WorldWideScience

Sample records for autonomous pathogen detection

  1. APDS: Autonomous Pathogen Detection System

    Energy Technology Data Exchange (ETDEWEB)

    Langlois, R G; Brown, S; Burris, L; Colston, B; Jones, L; Makarewicz, T; Mariella, R; Masquelier, D; McBride, M; Milanovich, F; Masarabadi, S; Venkateswaran, K; Marshall, G; Olson, D; Wolcott, D

    2002-02-14

    An early warning system to counter bioterrorism, the Autonomous Pathogen Detection System (APDS) continuously monitors the environment for the presence of biological pathogens (e.g., anthrax) and once detected, it sounds an alarm much like a smoke detector warns of a fire. Long before September 11, 2001, this system was being developed to protect domestic venues and events including performing arts centers, mass transit systems, major sporting and entertainment events, and other high profile situations in which the public is at risk of becoming a target of bioterrorist attacks. Customizing off-the-shelf components and developing new components, a multidisciplinary team developed APDS, a stand-alone system for rapid, continuous monitoring of multiple airborne biological threat agents in the environment. The completely automated APDS samples the air, prepares fluid samples in-line, and performs two orthogonal tests: immunoassay and nucleic acid detection. When compared to competing technologies, APDS is unprecedented in terms of flexibility and system performance.

  2. The Autonomous Pathogen Detection System

    Energy Technology Data Exchange (ETDEWEB)

    Dzenitis, J M; Makarewicz, A J

    2009-01-13

    We developed, tested, and now operate a civilian biological defense capability that continuously monitors the air for biological threat agents. The Autonomous Pathogen Detection System (APDS) collects, prepares, reads, analyzes, and reports results of multiplexed immunoassays and multiplexed PCR assays using Luminex{copyright} xMAP technology and flow cytometer. The mission we conduct is particularly demanding: continuous monitoring, multiple threat agents, high sensitivity, challenging environments, and ultimately extremely low false positive rates. Here, we introduce the mission requirements and metrics, show the system engineering and analysis framework, and describe the progress to date including early development and current status.

  3. APDS: The Autonomous Pathogen Detection System

    Energy Technology Data Exchange (ETDEWEB)

    Hindson, B; Makarewicz, A; Setlur, U; Henderer, B; McBride, M; Dzenitis, J

    2004-10-04

    We have developed and tested a fully autonomous pathogen detection system (APDS) capable of continuously monitoring the environment for airborne biological threat agents. The system was developed to provide early warning to civilians in the event of a bioterrorism incident and can be used at high profile events for short-term, intensive monitoring or in major public buildings or transportation nodes for long-term monitoring. The APDS is completely automated, offering continuous aerosol sampling, in-line sample preparation fluidics, multiplexed detection and identification immunoassays, and nucleic-acid based polymerase chain reaction (PCR) amplification and detection. Highly multiplexed antibody-based and duplex nucleic acid-based assays are combined to reduce false positives to a very low level, lower reagent costs, and significantly expand the detection capabilities of this biosensor. This article provides an overview of the current design and operation of the APDS. Certain sub-components of the ADPS are described in detail, including the aerosol collector, the automated sample preparation module that performs multiplexed immunoassays with confirmatory PCR, and the data monitoring and communications system. Data obtained from an APDS that operated continuously for seven days in a major U.S. transportation hub is reported.

  4. Autonomous system for pathogen detection and identification

    Energy Technology Data Exchange (ETDEWEB)

    Belgrader, P. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Benett, W. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Bergman, W. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Langlois, R. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Mariella, R. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Milanovich, F. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Miles, R. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Venkateswaran, K. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Long, G. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Nelson, W. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    1998-09-24

    This purpose of this project is to build a prototype instrument that will, running unattended, detect, identify, and quantify BW agents. In order to accomplish this, we have chosen to start with the world' s leading, proven, assays for pathogens: surface-molecular recognition assays, such as antibody-based assays, implemented on a high-performance, identification (ID)-capable flow cytometer, and the polymerase chain reaction (PCR) for nucleic-acid based assays. With these assays, we must integrate the capability to: l collect samples from aerosols, water, or surfaces; l perform sample preparation prior to the assays; l incubate the prepared samples, if necessary, for a period of time; l transport the prepared, incubated samples to the assays; l perform the assays; l interpret and report the results of the assays. Issues such as reliability, sensitivity and accuracy, quantity of consumables, maintenance schedule, etc. must be addressed satisfactorily to the end user. The highest possible sensitivity and specificity of the assay must be combined with no false alarms. Today, we have assays that can, in under 30 minutes, detect and identify simulants for BW agents at concentrations of a few hundred colony-forming units per ml of solution. If the bio-aerosol sampler of this system collects 1000 Ymin and concentrates the respirable particles into 1 ml of solution with 70% processing efficiency over a period of 5 minutes, then this translates to a detection/ID capability of under 0.1 agent-containing particle/liter of air.

  5. Autonomously Sensing Hydrogels for the Rapid and Selective Detection of Pathogenic Bacteria.

    Science.gov (United States)

    Ebrahimi, Mir-Morteza Sadat; Laabei, Maisem; Jenkins, A Tobias A; Schönherr, Holger

    2015-12-01

    The development of a versatile approach for the rapid and sensitive detection of relevant pathogenic bacteria and autonomous signaling of the detection events in reporter hydrogel film coatings is reported. Exploiting chitosan hydrogel films equipped with chromogenic or fluorogenic reporter moieties, the presence of the Gram-negative bacterium Pseudomonas aeruginosa and the Gram-positive bacterium Staphylococcus aureus is sensed within 1 h by detecting the characteristic enzymes α-glucosidase and elastase with limits of detection (LOD) hydrogels comprise an interesting platform for the rapid detection of bacteria.

  6. On-chip quantitative detection of pathogen genes by autonomous microfluidic PCR platform.

    Science.gov (United States)

    Tachibana, Hiroaki; Saito, Masato; Shibuya, Shogo; Tsuji, Koji; Miyagawa, Nobuyuki; Yamanaka, Keiichiro; Tamiya, Eiichi

    2015-12-15

    Polymerase chain reaction (PCR)-based genetic testing has become a routine part of clinical diagnoses and food testing. In these fields, rapid, easy-to-use, and cost-efficient PCR chips are expected to be appeared for providing such testing on-site. In this study, a new autonomous disposable plastic microfluidic PCR chip was created, and was utilized for quantitative detection of pathogenic microorganisms. To control the capillary flow of the following solution in the PCR microchannel, a driving microchannel was newly designed behind the PCR microchannel. This allowed the effective PCR by simply dropping the PCR solution onto the inlet without any external pumps. In order to achieve disposability, injection-molded cyclo-olefin polymer (COP) of a cost-competitive plastic was used for the PCR chip. We discovered that coating the microchannel walls with non-ionic surfactant produced a suitable hydrophilic surface for driving the capillary flow through the 1250-mm long microchannel. As a result, quantitative real-time PCR with the lowest initial concentration of human, Escherichia coli (E. coli), and pathogenic E. coli O157 genomic DNA of 4, 0.0019, 0.031 pg/μl, respectively, was successfully achieved in less than 18 min. Our results indicate that the platform presented in this study provided a rapid, easy-to-use, and low-cost real-time PCR system that could be potentially used for on-site gene testing.

  7. Semi autonomous mine detection system

    Energy Technology Data Exchange (ETDEWEB)

    Douglas Few; Roelof Versteeg; Herman Herman

    2010-04-01

    CMMAD is a risk reduction effort for the AMDS program. As part of CMMAD, multiple instances of semi autonomous robotic mine detection systems were created. Each instance consists of a robotic vehicle equipped with sensors required for navigation and marking, a countermine sensors and a number of integrated software packages which provide for real time processing of the countermine sensor data as well as integrated control of the robotic vehicle, the sensor actuator and the sensor. These systems were used to investigate critical interest functions (CIF) related to countermine robotic systems. To address the autonomy CIF, the INL developed RIK was extended to allow for interaction with a mine sensor processing code (MSPC). In limited field testing this system performed well in detecting, marking and avoiding both AT and AP mines. Based on the results of the CMMAD investigation we conclude that autonomous robotic mine detection is feasible. In addition, CMMAD contributed critical technical advances with regard to sensing, data processing and sensor manipulation, which will advance the performance of future fieldable systems. As a result, no substantial technical barriers exist which preclude – from an autonomous robotic perspective – the rapid development and deployment of fieldable systems.

  8. Rapid Detection of Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    David Perlin

    2005-08-14

    Pathogen identification is a crucial first defense against bioterrorism. A major emphasis of our national biodefense strategy is to establish fast, accurate and sensitive assays for diagnosis of infectious diseases agents. Such assays will ensure early and appropriate treatment of infected patients. Rapid diagnostics can also support infection control measures, which monitor and limit the spread of infectious diseases agents. Many select agents are highly transmissible in the early stages of disease, and it is critical to identify infected patients and limit the risk to the remainder of the population and to stem potential panic in the general population. Nucleic acid-based molecular approaches for identification overcome many of the deficiencies associated with conventional culture methods by exploiting both large- and small-scale genomic differences between organisms. PCR-based amplification of highly conserved ribosomal RNA (rRNA) genes, intergenic sequences, and specific toxin genes is currently the most reliable approach for bacterial, fungal and many viral pathogenic agents. When combined with fluorescence-based oligonucleotide detection systems, this approach provides real-time, quantitative, high fidelity analysis capable of single nucleotide allelic discrimination (4). These probe systems offer rapid turn around time (<2 h) and are suitable for high throughput, automated multiplex operations that are critical for clinical diagnostic laboratories. In this pilot program, we have used molecular beacon technology invented at the Public health Research Institute to develop a new generation of molecular probes to rapidly detect important agents of infectious diseases. We have also developed protocols to rapidly extract nucleic acids from a variety of clinical specimen including and blood and tissue to for detection in the molecular assays. This work represented a cooperative research development program between the Kramer-Tyagi/Perlin labs on probe development

  9. Multiplex detection of agricultural pathogens

    Energy Technology Data Exchange (ETDEWEB)

    McBride, Mary Teresa (Brentwood, CA); Slezak, Thomas Richard (Livermore, CA); Messenger, Sharon Lee (Kensington, CA)

    2010-09-14

    Described are kits and methods useful for detection of seven agricultural pathogens (BPSV; BHV; BVD; FMDV; BTV; SVD; and VESV) in a sample. Genomic sequence information from 7 agricultural pathogens was analyzed to identify signature sequences, e.g., polynucleotide sequences useful for confirming the presence or absence of a pathogen in a sample. Primer and probe sets were designed and optimized for use in a PCR based, multiplexed Luminex assay to successfully identify the presence or absence of pathogens in a sample.

  10. The Bering Autonomous Target Detection

    DEFF Research Database (Denmark)

    Jørgensen, John Leif; Denver, Troelz; Betto, Maurizio;

    2003-01-01

    autonomous star tracker the Advanced Stellar Compass (ASC). One feature of this instrument is that potential targets are registered directly in terms of date, right ascension, declination, and intensity, which greatly facilitates both tracking search and registering. Results from ground and inflight tests...... are encouraging, both with respect to robustness, speed and accuracy, and demonstrates the span and range of applications of this technology....

  11. Multiplex detection of respiratory pathogens

    Energy Technology Data Exchange (ETDEWEB)

    McBride, Mary (Brentwood, CA); Slezak, Thomas (Livermore, CA); Birch, James M. (Albany, CA)

    2012-07-31

    Described are kits and methods useful for detection of respiratory pathogens (influenza A (including subtyping capability for H1, H3, H5 and H7 subtypes) influenza B, parainfluenza (type 2), respiratory syncytial virus, and adenovirus) in a sample. Genomic sequence information from the respiratory pathogens was analyzed to identify signature sequences, e.g., polynucleotide sequences useful for confirming the presence or absence of a pathogen in a sample. Primer and probe sets were designed and optimized for use in a PCR based, multiplexed Luminex assay to successfully identify the presence or absence of pathogens in a sample.

  12. Pathogen detection using engineered bacteriophages.

    Science.gov (United States)

    Smartt, Abby E; Xu, Tingting; Jegier, Patricia; Carswell, Jessica J; Blount, Samuel A; Sayler, Gary S; Ripp, Steven

    2012-04-01

    Bacteriophages, or phages, are bacterial viruses that can infect a broad or narrow range of host organisms. Knowing the host range of a phage allows it to be exploited in targeting various pathogens. Applying phages for the identification of microorganisms related to food and waterborne pathogens and pathogens of clinical significance to humans and animals has a long history, and there has to some extent been a recent revival in these applications as phages have become more extensively integrated into novel detection, identification, and monitoring technologies. Biotechnological and genetic engineering strategies applied to phages are responsible for some of these new methods, but even natural unmodified phages are widely applicable when paired with appropriate innovative detector platforms. This review highlights the use of phages as pathogen detector interfaces to provide the reader with an up-to-date inventory of phage-based biodetection strategies.

  13. Autonomous valve for detection of biopolymer degradation

    DEFF Research Database (Denmark)

    Keller, Stephan Urs; Noeth, Nadine-Nicole; Fetz, Stefanie;

    2009-01-01

    We present a polymer microvalve that allows the detection of biopolymer degradation without the need of external energy. The valve is based on a polymer container filled with a colored marker solution and closed by a thin lid. This structure is covered by a film of poly(L-lactide) and degradation...... of the biopolymer triggers the release of the color which is detected visually. The autonomous valve has potential for the fast testing of biopolymer degradation under various environmental conditions or by specific enzymes....

  14. Adaptively detecting changes in Autonomic Grid Computing

    KAUST Repository

    Zhang, Xiangliang

    2010-10-01

    Detecting the changes is the common issue in many application fields due to the non-stationary distribution of the applicative data, e.g., sensor network signals, web logs and gridrunning logs. Toward Autonomic Grid Computing, adaptively detecting the changes in a grid system can help to alarm the anomalies, clean the noises, and report the new patterns. In this paper, we proposed an approach of self-adaptive change detection based on the Page-Hinkley statistic test. It handles the non-stationary distribution without the assumption of data distribution and the empirical setting of parameters. We validate the approach on the EGEE streaming jobs, and report its better performance on achieving higher accuracy comparing to the other change detection methods. Meanwhile this change detection process could help to discover the device fault which was not claimed in the system logs. © 2010 IEEE.

  15. Molecular detection of foodborne pathogens

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hartmann

    for detection and enumeration of Salmonella and Campylobacter are time-consuming and laborious. They lack specificity and do not enable detection of viable but non-culturable (VBNC) bacteria. The focus of the present thesis has been development and validation of PCR-based detection methods for Salmonella......Salmonella and Campylobacter are recognised as some of the most important foodborne pathogens worldwide. Human infections have wide health and socioeconomic consequences. Lots of effort has been devoted to increase the knowledge on the prevalence, transmission routes and persistence...... and Campylobacter. A conventional PCR-based method for detection of Campylobacter in chicken carcass rinse following 20 h of enrichment in Bolton broth was successfully compared to the ISO standard culture-based method (10272) on 68 naturally infected chickens. The method was subsequently validated on artificially...

  16. Autonomous Chemical Vapour Detection by Micro UAV

    Directory of Open Access Journals (Sweden)

    Kent Rosser

    2015-12-01

    Full Text Available The ability to remotely detect and map chemical vapour clouds in open air environments is a topic of significant interest to both defence and civilian communities. In this study, we integrate a prototype miniature colorimetric chemical sensor developed for methyl salicylate (MeS, as a model chemical vapour, into a micro unmanned aerial vehicle (UAV, and perform flights through a raised MeS vapour cloud. Our results show that that the system is capable of detecting MeS vapours at low ppm concentration in real-time flight and rapidly sending this information to users by on-board telemetry. Further, the results also indicate that the sensor is capable of distinguishing “clean” air from “dirty”, multiple times per flight, allowing us to look towards autonomous cloud mapping and source localization applications. Further development will focus on a broader range of integrated sensors, increased autonomy of detection and improved engineering of the system.

  17. Bacteriophage-Based Pathogen Detection

    Science.gov (United States)

    Ripp, Steven

    Considered the most abundant organism on Earth, at a population approaching 1031, bacteriophage, or phage for short, mediate interactions with myriad bacterial hosts that has for decades been exploited in phage typing schemes for signature identification of clinical, food-borne, and water-borne pathogens. With over 5,000 phage being morphologically characterized and grouped as to susceptible host, there exists an enormous cache of bacterial-specific sensors that has more recently been incorporated into novel bio-recognition assays with heightened sensitivity, specificity, and speed. These assays take many forms, ranging from straightforward visualization of labeled phage as they attach to their specific bacterial hosts to reporter phage that genetically deposit trackable signals within their bacterial hosts to the detection of progeny phage or other uniquely identifiable elements released from infected host cells. A comprehensive review of these and other phage-based detection assays, as directed towards the detection and monitoring of bacterial pathogens, will be provided in this chapter.

  18. Autonomous Rule Creation for Intrusion Detection

    Energy Technology Data Exchange (ETDEWEB)

    Todd Vollmer; Jim Alves-Foss; Milos Manic

    2011-04-01

    Many computational intelligence techniques for anomaly based network intrusion detection can be found in literature. Translating a newly discovered intrusion recognition criteria into a distributable rule can be a human intensive effort. This paper explores a multi-modal genetic algorithm solution for autonomous rule creation. This algorithm focuses on the process of creating rules once an intrusion has been identified, rather than the evolution of rules to provide a solution for intrusion detection. The algorithm was demonstrated on anomalous ICMP network packets (input) and Snort rules (output of the algorithm). Output rules were sorted according to a fitness value and any duplicates were removed. The experimental results on ten test cases demonstrated a 100 percent rule alert rate. Out of 33,804 test packets 3 produced false positives. Each test case produced a minimum of three rule variations that could be used as candidates for a production system.

  19. 新疆阿拉山口艾比湖湿地蜱种莱姆病病原体检测%Detection of Lyme disease pathogens in isolated ticks at Aibi Lake, Alataw Pass, Xinjiang Autonomous Region

    Institute of Scientific and Technical Information of China (English)

    王安东; 徐军; 王远志; 徐新龙; 戴莉; 杜景云; 王丽娜; 牟路萌; 肖云霞

    2015-01-01

    目的 了解新疆阿拉山口艾比湖湿地主要蜱种莱姆病螺旋体感染与基因型状况.方法 2014年4-8月,在新疆艾比湖湿地选取3个采集点,采用布旗法采集游离蜱,经形态学鉴定蜱种后,采用巢式PCR法扩增莱姆病病原5S-23S rRNA基因,将PCR产物测序并进行BLAST比对分析.结果 共检测游离蜱152只,其中血红扇头蜱12只、亚洲璃眼蜱59只、边缘革蜱81只.各蜱种莱姆病病原总体阳性率为34.87%(53/152),其中亚洲璃眼蜱阳性率为(57.63%,34/59),边缘革蜱阳性率为(22.22%,18/81),血红扇头蜱阳性率为(8.33%,1/12),亚洲璃眼蜱的阳性率高于边缘革蜱和血红扇头蜱(x2=18.328、9.694,P均<0.05);5S-23SrRNA基因测序比对显示艾比湖湿地莱姆病基因型为伯氏疏螺旋体.结论 首次在新疆阿拉山口艾比湖湿地硬蜱检测到伯氏疏螺旋体,提示新疆艾比湖为莱姆病病原自然疫源地.%Objective In order to understand the major tick species,Borrelia burgdorferi infection and genotype status at Aibi Lake,Alataw Pass,Xinjiang Autonomous Region.Methods Free-living ticks were collected by drag-flag method from April to August,2014,and the morphological identification was carried out.Borrelia spp.was detected by 5S-23S rRNA gene primers.The PCR products were sequenced and analyzed with BLAST.Results One hundred fifty-two isolated ticks were collected,including Rhipicephalus sanguineus (12),Hyalomma asiaticum (59) and Dermacentor Marginatus (81).The positive rate of Borrelia spp.was 34.87% (53/152).The positive rate of Hyalomma asiaticum (57.63%,34/59) was higher than that of Dermacentor Marginatus (22.22%,18/81,x2 =18.328,P < 0.05) and Rhipicephalus sanguineus (8.33%,1/12,x2 =9.694,P < 0.05).The analysis of 5S-23S rRNA sequencing indicated the pathogen was Borrelia burgdorferi sensu stricto.Conclusions Borrelia burgdorferi sensu stricto in ticks is firstly detected in Alataw region.The results conveyed us Aibi

  20. PathogenMip Assay: A Multiplex Pathogen Detection Assay

    OpenAIRE

    Akhras, Michael S.; Sreedevi Thiyagarajan; Villablanca, Andrea C.; Davis, Ronald W; Pål Nyrén; Nader Pourmand

    2007-01-01

    The Molecular Inversion Probe (MIP) assay has been previously applied to a large-scale human SNP detection. Here we describe the PathogenMip Assay, a complete protocol for probe production and applied approaches to pathogen detection. We have demonstrated the utility of this assay with an initial set of 24 probes targeting the most clinically relevant HPV genotypes associated with cervical cancer progression. Probe construction was based on a novel, cost-effective, ligase-based protocol. The ...

  1. Metagenomics for pathogen detection in public health

    OpenAIRE

    Miller, Ruth R.; Montoya, Vincent; Gardy, Jennifer L; Patrick, David M.; Tang, Patrick

    2013-01-01

    Traditional pathogen detection methods in public health infectious disease surveillance rely upon the identification of agents that are already known to be associated with a particular clinical syndrome. The emerging field of metagenomics has the potential to revolutionize pathogen detection in public health laboratories by allowing the simultaneous detection of all microorganisms in a clinical sample, without a priori knowledge of their identities, through the use of next-generation DNA sequ...

  2. Molecular detection of foodborne pathogens

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hartmann

    Salmonella and Campylobacter are recognised as some of the most important foodborne pathogens worldwide. Human infections have wide health and socioeconomic consequences. Lots of effort has been devoted to increase the knowledge on the prevalence, transmission routes and persistence of these...

  3. Digital PCR for detection of citrus pathogens

    Science.gov (United States)

    Citrus trees are often infected with multiple pathogens of economic importance, especially those with insect or mite vectors. Real-time/quantitative PCR (qPCR) has been used for high-throughput detection and relative quantification of pathogens; however, target reference or standards are required. I...

  4. Sensor Fault Detection and Diagnosis for autonomous vehicles

    Directory of Open Access Journals (Sweden)

    Realpe Miguel

    2015-01-01

    Full Text Available In recent years testing autonomous vehicles on public roads has become a reality. However, before having autonomous vehicles completely accepted on the roads, they have to demonstrate safe operation and reliable interaction with other traffic participants. Furthermore, in real situations and long term operation, there is always the possibility that diverse components may fail. This paper deals with possible sensor faults by defining a federated sensor data fusion architecture. The proposed architecture is designed to detect obstacles in an autonomous vehicle’s environment while detecting a faulty sensor using SVM models for fault detection and diagnosis. Experimental results using sensor information from the KITTI dataset confirm the feasibility of the proposed architecture to detect soft and hard faults from a particular sensor.

  5. Quantitative multiplex detection of pathogen biomarkers

    Energy Technology Data Exchange (ETDEWEB)

    Mukundan, Harshini; Xie, Hongzhi; Swanson, Basil I.; Martinez, Jennifer; Grace, Wynne K.

    2016-02-09

    The present invention addresses the simultaneous detection and quantitative measurement of multiple biomolecules, e.g., pathogen biomarkers through either a sandwich assay approach or a lipid insertion approach. The invention can further employ a multichannel, structure with multi-sensor elements per channel.

  6. Surrounding Moving Obstacle Detection for Autonomous Driving Using Stereo Vision

    OpenAIRE

    Hao Sun; Huanxin Zou; Shilin Zhou; Cheng Wang; Naser El-Sheimy

    2013-01-01

    Detection and tracking surrounding moving obstacles such as vehicles and pedestrians are crucial for the safety of mobile robotics and autonomous vehicles. This is especially the case in urban driving scenarios. This paper presents a novel framework for surrounding moving obstacles detection using binocular stereo vision. The contributions of our work are threefold. Firstly, a multiview feature matching scheme is presented for simultaneous stereo correspondence and motion correspondence searc...

  7. Autonomous Chemical Vapour Detection by Micro UAV

    OpenAIRE

    Kent Rosser; Karl Pavey; Nicholas FitzGerald; Anselm Fatiaki; Daniel Neumann; David Carr; Brian Hanlon; Javaan Chahl

    2015-01-01

    The ability to remotely detect and map chemical vapour clouds in open air environments is a topic of significant interest to both defence and civilian communities. In this study, we integrate a prototype miniature colorimetric chemical sensor developed for methyl salicylate (MeS), as a model chemical vapour, into a micro unmanned aerial vehicle (UAV), and perform flights through a raised MeS vapour cloud. Our results show that that the system is capable of detecting MeS vapours at low ppm con...

  8. Biosensors for the Detection of Food Pathogens

    OpenAIRE

    Palmiro Poltronieri; Valeria Mezzolla; Elisabetta Primiceri; Giuseppe Maruccio

    2014-01-01

    Food pathogens frequently cause foodborne diseases. There is a need to rapidly identify the source of the bacteria in order to contain their spread and epidemics. A pre-enrichment culture or a direct culture on agar plate are standard microbiological methods. In this review, we present an update on alternative molecular methods to nucleic acid-based detection for species identification. Biosensor-based methods rely on the recognition of antigen targets or receptors by antibodies, aptamers o...

  9. Rapid methods: the detection of foodborne pathogens

    OpenAIRE

    Beumer, R. R.; Hazeleger, W. C.

    2009-01-01

    Although bacteria are the first type of microorganisms that come to mind when discussing microbial food safety, they are by no means the only pathogenic foodborne microorganisms. Mycotoxin producing moulds, human enteric viruses, protozoan parasites and marine biotoxins are also of importance. However, since foods are only screened for bacteria routinely, in this article we will focus on the techniques used to detect bacterial contamination.

  10. Detection of pathogens from periodontal lesions

    Directory of Open Access Journals (Sweden)

    Malheiros Veruska de João

    2004-01-01

    Full Text Available OBJECTIVE: To comparatively detect A. actinomycetemcomitans and F. nucleatum from periodontal and healthy sites. METHODS: Subgingival clinical samples from 50 periodontitis adult patients and 50 healthy subjects were analyzed. Both organisms were isolated using a trypticase soy agar-bacitracin-vancomycin (TSBV medium and detected by PCR. Conventional biochemical tests were used for bacteria identification. RESULTS: A. actinomycetemcomitans and F. nucleatum were isolated in 18% and 20% of the patients, respectively, and in 2% and 24% of healthy subjects. Among A. actinomycetemcomitans isolates, biotype II was the most prevalent. Primer pair AA was 100% sensitive in the detection of A. actinomycetemcomitans from both subject groups. Primers ASH and FU were also 100% sensitive to detect this organism in healthy subject samples. Primer pair FN5047 was more sensitive to detect F. nucleatum in patients or in healthy samples than primer 5059S. Primers ASH and 5059S were more specific in the detection of A. actinomycetemcomitans and F. nucleatum, respectively, in patients and in healthy subject samples. CONCLUSIONS: PCR is an effective tool for detecting periodontal pathogens in subgingival samples, providing a faster and safer diagnostic tool of periodontal diseases. The method's sensitivity and specificity is conditioned by the choice of the set of primers used.

  11. Bacteriophage based probes for pathogen detection.

    Science.gov (United States)

    Singh, Amit; Arutyunov, Denis; Szymanski, Christine M; Evoy, Stephane

    2012-08-01

    Rapid and specific detection of pathogenic bacteria is important for the proper treatment, containment and prevention of human, animal and plant diseases. Identifying unique biological probes to achieve a high degree of specificity and minimize false positives has therefore garnered much interest in recent years. Bacteriophages are obligate intracellular parasites that subvert bacterial cell resources for their own multiplication and production of disseminative new virions, which repeat the cycle by binding specifically to the host surface receptors and injecting genetic material into the bacterial cells. The precision of host recognition in phages is imparted by the receptor binding proteins (RBPs) that are often located in the tail-spike or tail fiber protein assemblies of the virions. Phage host recognition specificity has been traditionally exploited for bacterial typing using laborious and time consuming bacterial growth assays. At the same time this feature makes phage virions or RBPs an excellent choice for the development of probes capable of selectively capturing bacteria on solid surfaces with subsequent quick and automatic detection of the binding event. This review focuses on the description of pathogen detection approaches based on immobilized phage virions as well as pure recombinant RBPs. Specific advantages of RBP-based molecular probes are also discussed.

  12. Biosensors: tool for food borne pathogen detection

    Directory of Open Access Journals (Sweden)

    Heena Sharma

    2013-12-01

    Full Text Available A paramount and alluring sphere of research, now-a-days, is food analysis, because of the breakneck augmentation of food enterprise and highly hightened maneuverability of today's populations. The management of food quality is very indispensable both for consumer safeguard as well as the food corporations. The biosensors' application in the field of food analysis is quite propitious for the revealing of food borne pathogens. Biosensor, an analytical device, transforms a biological response into an electrical signal. Bioreceptors and transducers are the two main components of a biosensor. Bioreceptor or biorecognition element is the one which leads to the recognition of target analyte and a transducer, for the conversion of recognized event into a measurable electrical signal. The development of biosensors improved the sensitivity and selectivity of detection techniques for food borne pathogens and is rapid, reliable, effective and highly suitable when used in in situ analysis. Since the security in the food supply becomes crucial because of increased perception among consumers and vying nature of food industries, the necessity for expeditious, low volume and sensitive biosensor devices has productively increased. Nevertheless, till date, a very few biosensor systems are available commercially such as Biacore, SpreetaTM, Reichert SR 7000, Analyte 2000, RAPTOR etc. Since, there is ever growing concern regarding safe food and water supply, it is very obvious that the demand for rapid detecting biosensors will also be increasing at par.

  13. Antibody conjugated graphene nanocomposites for pathogen detection

    Science.gov (United States)

    Sign, Chandan; Sumana, Gajjala

    2016-04-01

    Graphene oxide (GO), due to its excellent electrochemical properties and large surface area, known to be highly suitable material for biosensing application. Here, we report in situ synthesis of silver nanopaticles (AgNPs) onto the GO sheets for the electrochemical detection of Salmonella typhimurium (S.typhimurium). The GO-AgNPs composites have been deposited onto the indium tin oxide (ITO) coated glass substrate by the electrophoretic deposition technique. Carbodiimide coupling (EDC-NHS) has been used for the immobilization of antibodies of Salmonella typhimurium (anti-S.typhimurium) for detection of S.typhimurium. The electron microscopy and UV-visible studies reveal successful synthesis GO-AgNPs composites while FT-IR studies suggest the proper immobilization of anti-S.typhi. The cyclic voltammetry (CV) has been utilized for detection using anti-S.typhi/GOAgNPs/ITO based immunoelectrode as a function of S.typhimurium concentration. The fabricated immunosensor shows improved sensitivity of 33.04 μACFU-1mLcm-2 in a wide detection range of 101 to 106 CFUmL-1. This immunosensor may be utilized for the detection of other food borne pathogens like aflatoxin and E.coli also.

  14. Robust water hazard detection for autonomous off-road navigation

    Institute of Scientific and Technical Information of China (English)

    Tuo-zhong YAO; Zhi-yu XIANG; Ji-lin LIU

    2009-01-01

    Existing water hazard detection methods usually fail when the features of water surfaces are greatly changed by the surroundings, e.g., by a change in illumination. This paper proposes a novel algorithm to robustly detect different kinds of water hazards for autonomous navigation. Our algorithm combines traditional machine learning and image segmentation and uses only digital cameras, which are usually affordable, as the visual sensors. Active learning is used for automatically dealing with problems caused by the selection, labeling and classification of large numbers of training sets. Mean-shift based image segmentation is used to refine the final classification. Our experimental results show that our new algorithm can accurately detect not only 'common' water hazards, which usually have the features of both high brightness and low texture, but also 'special' water hazards that may have lots of ripples or low brightness.

  15. Surrounding Moving Obstacle Detection for Autonomous Driving Using Stereo Vision

    Directory of Open Access Journals (Sweden)

    Hao Sun

    2013-06-01

    Full Text Available Detection and tracking surrounding moving obstacles such as vehicles and pedestrians are crucial for the safety of mobile robotics and autonomous vehicles. This is especially the case in urban driving scenarios. This paper presents a novel framework for surrounding moving obstacles detection using binocular stereo vision. The contributions of our work are threefold. Firstly, a multiview feature matching scheme is presented for simultaneous stereo correspondence and motion correspondence searching. Secondly, the multiview geometry constraint derived from the relative camera positions in pairs of consecutive stereo views is exploited for surrounding moving obstacles detection. Thirdly, an adaptive particle filter is proposed for tracking of multiple moving obstacles in surrounding areas. Experimental results from real‐world driving sequences demonstrate the effectiveness and robustness of the proposed framework.

  16. Biosensors for the Detection of Food Pathogens

    Directory of Open Access Journals (Sweden)

    Palmiro Poltronieri

    2014-09-01

    Full Text Available Food pathogens frequently cause foodborne diseases. There is a need to rapidly identify the source of the bacteria in order to contain their spread and epidemics. A pre-enrichment culture or a direct culture on agar plate are standard microbiological methods. In this review, we present an update on alternative molecular methods to nucleic acid-based detection for species identification. Biosensor-based methods rely on the recognition of antigen targets or receptors by antibodies, aptamers or high-affinity ligands. The captured antigens may be then directly or indirectly detected through an antibody or high-affinity and high-specificity recognition molecule. Various different detection methods are discussed, from label-free sensors and immunosensors to fluorescence-based ones. Each method shows advantages and disadvantages in terms of equipment, sensitivity, simplicity and cost-effectiveness. Finally, lab-on-a-chip (LOC devices are introduced briefly, with the potential to be fast, sensitive and useful for on-site bacteria detection in food processing laboratories to check potential contamination by sample monitoring combined with a rapid pre-enrichment step.

  17. Obstacle detection for autonomous navigation : an LDRD final report.

    Energy Technology Data Exchange (ETDEWEB)

    Padilla, Denise D.

    2004-03-01

    This report summarizes the analytical and experimental efforts for the Laboratory Directed Research and Development (LDRD) project entitled 'Obstacle Detection for Autonomous Navigation'. The principal goal of this project was to develop a mathematical framework for obstacle detection. The framework provides a basis for solutions to many complex obstacle detection problems critical to successful autonomous navigation. Another goal of this project was to characterize sensing requirements in terms of physical characteristics of obstacles, vehicles, and terrain. For example, a specific vehicle traveling at a specific velocity over a specific terrain requires a sensor with a certain range of detection, resolution, field-of-view, and sufficient sensitivity to specific obstacle characteristics. In some cases, combinations of sensors were required to distinguish between different hazardous obstacles and benign terrain. In our framework, the problem was posed as a multidimensional, multiple-hypothesis, pattern recognition problem. Features were extracted from selected sensors that allow hazardous obstacles to be distinguished from benign terrain and other types of obstacles. Another unique thrust of this project was to characterize different terrain classes with respect to both positive (e.g., rocks, trees, fences) and negative (e.g., holes, ditches, drop-offs) obstacles. The density of various hazards per square kilometer was statistically quantified for different terrain categories (e.g., high desert, ponderosa forest, and prairie). This quantification reflects the scale, or size, and mobility of different types of vehicles. The tradeoffs between obstacle detection, position location, path planning, and vehicle mobility capabilities were also to be characterized.

  18. Improving the Lane Reference Detection for Autonomous Road Vehicle Control

    Directory of Open Access Journals (Sweden)

    Felipe Jiménez

    2016-01-01

    Full Text Available Autonomous road vehicles are increasingly becoming more important and there are several techniques and sensors that are being applied for vehicle control. This paper presents an alternative system for maintaining the position of autonomous vehicles without adding additional elements to the standard sensor architecture, by using a 3D laser scanner for continuously detecting a reference element in situations in which the GNSS receiver fails or provides accuracy below the required level. Considering that the guidance variables are more accurately estimated when dealing with reference points in front of and behind the vehicle, an algorithm based on vehicle dynamics mathematical model is proposed to extend the detected points in cases where the sensor is placed at the front of the vehicle. The algorithm has been tested when driving along a lane delimited by New Jersey barriers at both sides and the results show a correct behaviour. The system is capable of estimating the reference element behind the vehicle with sufficient accuracy when the laser scanner is placed at the front of it, so the robustness of the control input variables (lateral and angular errors estimation is improved making it unnecessary to place the sensor on the vehicle roof or to introduce additional sensors.

  19. Motor execution detection based on autonomic nervous system responses

    International Nuclear Information System (INIS)

    Triggered assistance has been shown to be a successful robotic strategy for provoking motor plasticity, probably because it requires neurologic patients’ active participation to initiate a movement involving their impaired limb. Triggered assistance, however, requires sufficient residual motor control to activate the trigger and, thus, is not applicable to individuals with severe neurologic injuries. In these situations, brain and body–computer interfaces have emerged as promising solutions to control robotic devices. In this paper, we investigate the feasibility of a body–machine interface to detect motion execution only monitoring the autonomic nervous system (ANS) response. Four physiological signals were measured (blood pressure, breathing rate, skin conductance response and heart rate) during an isometric pinching task and used to train a classifier based on hidden Markov models. We performed an experiment with six healthy subjects to test the effectiveness of the classifier to detect rest and active pinching periods. The results showed that the movement execution can be accurately classified based only on peripheral autonomic signals, with an accuracy level of 84.5%, sensitivity of 83.8% and specificity of 85.2%. These results are encouraging to perform further research on the use of the ANS response in body–machine interfaces. (paper)

  20. Field application of pathogen detection technologies

    Energy Technology Data Exchange (ETDEWEB)

    Straub, Tim M.; Call, Douglas R.; Bruckner-Lea, Cindy J.; Colburn, Heather A.; Baird, Cheryl L.; Bartholomew, Rachel A.; Ozanich, Richard M.; Jarman, Kristin H.

    2016-06-29

    Over the last 10 years there has been a significant increase in commercial products designed for field-based detection of microbial pathogens. This is due, in part, to the anthrax attacks in the United States in 2001, and the need for first responders to quickly identify the composition of suspected white powders and other potential biothreats. Demand for rapid detection is also driven by the need to ensure safe food, water, and environmental systems. From a technology perspective, rapid identification methods have largely capitalized on PCR and other molecular recognition techniques that can be deployed as robust field instrumentation. Examples of the relevant needs include the ability to: 1) declare a water distribution system free of microbial pathogens after a pipe/main break repair; 2) assess risks of contamination such as when produce production and processing plants are located near concentrated animal feeing operations; 3) evaluate the safety of ready-to-eat products; 4) determine the extent of potential serious disease outbreaks in remote and/or disaster stricken areas where access to clinical laboratories is not an immediate option; and 5) quickly assess credible biological terrorism events. Many of the principles underlying rapid detection methods are derived from methods for environmental microbiology, but there is a dearth of literature describing and evaluating field-based detection systems. Thus, the aims of this chapter are to: 1) summarize the different kinds of commercially available sampling kits and field-based biological detectors; 2) highlight some of the continued challenges of sample preparation to stimulate new research towards minimizing the impact of inhibitors on PCR-based detection systems; 3) describe our general rationale and statistically-based approach for instrument evaluation; 4) provide statistical and spatial guidelines for developing valid sampling plans; and 5) summarize some current needs and emerging technologies. This

  1. Autonomous Detection of Aerosolized Biological Agents by Multiplexed Immunoassay with PCR Confirmation

    Energy Technology Data Exchange (ETDEWEB)

    Hindson, B J; McBride, M T; Makarewicz, A J; Henderer, B D; Setlur, U S; Smith, S M; Gutierrez, D M; Metz, T R; Nasarabadi, S L; Venkateswaran, K S; Farrow, S W; Colston, Jr., B W; Dzenitis, J M

    2004-05-27

    The autonomous pathogen detection system (APDS) is an automated, podium-sized instrument that continuously monitors the air for biological threat agents (bacteria, viruses, and toxins). The system has been developed to warn of a biological attack in critical or high-traffic facilities and at special events. The APDS performs continuous aerosol collection, sample preparation, and detection using multiplexed immunoassay followed by confirmatory PCR using real-time TaqMan assays. We have integrated completely reusable flow-through devices that perform DNA extraction and PCR amplification. The fully integrated system was challenged with aerosolized Bacillus anthracis, Yersinia pestis, Bacillus globigii and botulinum toxoid. By coupling highly selective antibody and DNA based assays, the probability of an APDS reporting a false positive is extremely low.

  2. Foodborne pathogen detection using hyperspectral imaging

    Science.gov (United States)

    Foodborne pathogens can cause various diseases and even death when humans consume foods contaminated with microbial pathogens. Traditional culture-based direct plating methods are still the “gold standard” for presumptive-positive pathogen screening. Although considerable research has been devoted t...

  3. A Portable and Autonomous Magnetic Detection Platform for Biosensing

    Science.gov (United States)

    Germano, José; Martins, Verónica C.; Cardoso, Filipe A.; Almeida, Teresa M.; Sousa, Leonel; Freitas, Paulo P.; Piedade, Moisés S.

    2009-01-01

    This paper presents a prototype of a platform for biomolecular recognition detection. The system is based on a magnetoresistive biochip that performs biorecognition assays by detecting magnetically tagged targets. All the electronic circuitry for addressing, driving and reading out signals from spin-valve or magnetic tunnel junctions sensors is implemented using off-the-shelf components. Taking advantage of digital signal processing techniques, the acquired signals are processed in real time and transmitted to a digital analyzer that enables the user to control and follow the experiment through a graphical user interface. The developed platform is portable and capable of operating autonomously for nearly eight hours. Experimental results show that the noise level of the described platform is one order of magnitude lower than the one presented by the previously used measurement set-up. Experimental results also show that this device is able to detect magnetic nanoparticles with a diameter of 250 nm at a concentration of about 40 fM. Finally, the biomolecular recognition detection capabilities of the platform are demonstrated by performing a hybridization assay using complementary and non-complementary probes and a magnetically tagged 20mer single stranded DNA target. PMID:22408516

  4. Ultrasound and fluoroscopic images fusion by autonomous ultrasound probe detection.

    Science.gov (United States)

    Mountney, Peter; Ionasec, Razvan; Kaizer, Markus; Mamaghani, Sina; Wu, Wen; Chen, Terrence; John, Matthias; Boese, Jan; Comaniciu, Dorin

    2012-01-01

    New minimal-invasive interventions such as transcatheter valve procedures exploit multiple imaging modalities to guide tools (fluoroscopy) and visualize soft tissue (transesophageal echocardiography (TEE)). Currently, these complementary modalities are visualized in separate coordinate systems and on separate monitors creating a challenging clinical workflow. This paper proposes a novel framework for fusing TEE and fluoroscopy by detecting the pose of the TEE probe in the fluoroscopic image. Probe pose detection is challenging in fluoroscopy and conventional computer vision techniques are not well suited. Current research requires manual initialization or the addition of fiducials. The main contribution of this paper is autonomous six DoF pose detection by combining discriminative learning techniques with a fast binary template library. The pose estimation problem is reformulated to incrementally detect pose parameters by exploiting natural invariances in the image. The theoretical contribution of this paper is validated on synthetic, phantom and in vivo data. The practical application of this technique is supported by accurate results (< 5 mm in-plane error) and computation time of 0.5s.

  5. Autonomous mine detection system (AMDS) neutralization payload module

    Science.gov (United States)

    Majerus, M.; Vanaman, R.; Wright, N.

    2010-04-01

    The Autonomous Mine Detection System (AMDS) program is developing a landmine and explosive hazards standoff detection, marking, and neutralization system for dismounted soldiers. The AMDS Capabilities Development Document (CDD) has identified the requirement to deploy three payload modules for small robotic platforms: mine detection and marking, explosives detection and marking, and neutralization. This paper addresses the neutralization payload module. There are a number of challenges that must be overcome for the neutralization payload module to be successfully integrated into AMDS. The neutralizer must meet stringent size, weight, and power (SWaP) requirements to be compatible with a small robot. The neutralizer must be effective against a broad threat, to include metal and plastic-cased Anti-Personnel (AP) and Anti-Tank (AT) landmines, explosive devices, and Unexploded Explosive Ordnance (UXO.) It must adapt to a variety of threat concealments, overburdens, and emplacement methods, to include soil, gravel, asphalt, and concrete. A unique neutralization technology is being investigated for adaptation to the AMDS Neutralization Module. This paper will describe review this technology and how the other two payload modules influence its design for minimizing SWaP. Recent modeling and experimental efforts will be included.

  6. Aptamer-Based Technologies in Foodborne Pathogen Detection

    Science.gov (United States)

    Teng, Jun; Yuan, Fang; Ye, Yingwang; Zheng, Lei; Yao, Li; Xue, Feng; Chen, Wei; Li, Baoguang

    2016-01-01

    Aptamers are single stranded DNA or RNA ligands, which can be selected by a method called systematic evolution of ligands by exponential enrichment (SELEX); and they can specifically recognize and bind to their targets. These unique characteristics of aptamers offer great potentials in applications such as pathogen detection and biomolecular screening. Pathogen detection is the critical means in detecting and identifying the problems related to public health and food safety; and only the rapid, sensitive and efficient detection technologies can enable the users to make the accurate assessments on the risks of infections (humans and animals) or contaminations (foods and other commodities) caused by various pathogens. This article reviews the development in the field of the aptamer-based approaches for pathogen detection, including whole-cell SELEX and Genomic SELEX. Nowadays, a variety of aptamer-based biosensors have been developed for pathogen detection. Thus, in this review, we also cover the development in aptamer-based biosensors including optical biosensors for multiple pathogen detection by multiple-labeling or label-free models such as fluorescence detection and surface plasmon resonance, electrochemical biosensors and lateral chromatography test strips, and their applications in pathogen detection and biomolecular screening. While notable progress has been made in the field in the last decade, challenges or drawbacks in their applications such as pathogen detection and biomolecular screening remain to be overcome. PMID:27672383

  7. Towards autonomous radio detection of ultra high energy cosmic rays

    International Nuclear Information System (INIS)

    The radio-detection of extensive air showers, investigated for the first time in the 1960's, obtained promising results but plagued by the technical limitations. At that time, H.R. Allan summed up the state of the art in an extensive review article whose conclusions and predictions are still used today. Set up in 2001 at the Nancay Observatory, the CODALEMA experiment was built first as a demonstrator and successfully showed the feasibility of the radio-detection of extensive air showers. Radically modified in 2005, it allowed to obtain a clear energy correlation, and put in evidence an unambiguous signature of the geomagnetic origin of the electric field emission process associated to the air shower. The switch towards large areas is the next step of the technique's development. Therefore, the autonomy of the detectors becomes essential. After test prototypes installed in 2006 at the Pierre Auger Observatory, a generation of new autonomous detectors was developed. Their first results will be presented. This work is also dedicated to the issues related to the radio-detection technique: the antenna response, the sensitivity, the surrounding effects, the monitoring of a big array. The determination of the shower characteristics independently of other detectors such as the lateral distribution, the energy correlation and the frequency spectrum of the radio transient will be discussed. (author)

  8. Microarrays/DNA Chips for the Detection of Waterborne Pathogens.

    Science.gov (United States)

    Vale, Filipa F

    2016-01-01

    DNA microarrays are useful for the simultaneous detection of microorganisms in water samples. Specific probes targeting waterborne pathogens are selected with bioinformatics tools, synthesized and spotted onto a DNA array. Here, the construction of a DNA chip for waterborne pathogen detection is described, including the processes of probe in silico selection, synthesis, validation, and data analysis. PMID:27460375

  9. Towards Autonomous Agriculture: Automatic Ground Detection Using Trinocular Stereovision

    Directory of Open Access Journals (Sweden)

    Annalisa Milella

    2012-09-01

    Full Text Available Autonomous driving is a challenging problem, particularly when the domain is unstructured, as in an outdoor agricultural setting. Thus, advanced perception systems are primarily required to sense and understand the surrounding environment recognizing artificial and natural structures, topology, vegetation and paths. In this paper, a self-learning framework is proposed to automatically train a ground classifier for scene interpretation and autonomous navigation based on multi-baseline stereovision. The use of rich 3D data is emphasized where the sensor output includes range and color information of the surrounding environment. Two distinct classifiers are presented, one based on geometric data that can detect the broad class of ground and one based on color data that can further segment ground into subclasses. The geometry-based classifier features two main stages: an adaptive training stage and a classification stage. During the training stage, the system automatically learns to associate geometric appearance of 3D stereo-generated data with class labels. Then, it makes predictions based on past observations. It serves as well to provide training labels to the color-based classifier. Once trained, the color-based classifier is able to recognize similar terrain classes in stereo imagery. The system is continuously updated online using the latest stereo readings, thus making it feasible for long range and long duration navigation, over changing environments. Experimental results, obtained with a tractor test platform operating in a rural environment, are presented to validate this approach, showing an average classification precision and recall of 91.0% and 77.3%, respectively.

  10. Autonomic intrusion detection: Adaptively detecting anomalies over unlabeled audit data streams in computer networks

    KAUST Repository

    Wang, Wei

    2014-06-22

    In this work, we propose a novel framework of autonomic intrusion detection that fulfills online and adaptive intrusion detection over unlabeled HTTP traffic streams in computer networks. The framework holds potential for self-managing: self-labeling, self-updating and self-adapting. Our framework employs the Affinity Propagation (AP) algorithm to learn a subject’s behaviors through dynamical clustering of the streaming data. It automatically labels the data and adapts to normal behavior changes while identifies anomalies. Two large real HTTP traffic streams collected in our institute as well as a set of benchmark KDD’99 data are used to validate the framework and the method. The test results show that the autonomic model achieves better results in terms of effectiveness and efficiency compared to adaptive Sequential Karhunen–Loeve method and static AP as well as three other static anomaly detection methods, namely, k-NN, PCA and SVM.

  11. Recent developments in pathogen detection arrays: implications for fungal plant pathogens and use in practica

    NARCIS (Netherlands)

    Lievens, B.; Thomma, B.P.H.J.

    2005-01-01

    The failure to adequately identify plant pathogens from culture-based morphological techniques has led to the development of culture-independent molecular approaches. Increasingly, diagnostic laboratories are pursuing fast routine methods that provide reliable identification, sensitive detection, an

  12. Rapid methods: the detection of foodborne pathogens

    NARCIS (Netherlands)

    Beumer, R.R.; Hazeleger, W.C.

    2009-01-01

    Although bacteria are the first type of microorganisms that come to mind when discussing microbial food safety, they are by no means the only pathogenic foodborne microorganisms. Mycotoxin producing moulds, human enteric viruses, protozoan parasites and marine biotoxins are also of importance. Howev

  13. Sensor Fault Detection and Diagnosis for autonomous vehicles

    OpenAIRE

    Realpe Miguel; Vintimilla Boris; Vlacic Ljubo

    2015-01-01

    In recent years testing autonomous vehicles on public roads has become a reality. However, before having autonomous vehicles completely accepted on the roads, they have to demonstrate safe operation and reliable interaction with other traffic participants. Furthermore, in real situations and long term operation, there is always the possibility that diverse components may fail. This paper deals with possible sensor faults by defining a federated sensor data fusion architecture. The proposed ar...

  14. Bio-Functional Au/Si Nanorods for Pathogen Detection

    Science.gov (United States)

    Technical Abstract Nanotechnology applications for food safety and biosecurity, especially development of nanoscale sensors for foodborne pathogen measurement are emerging. A novel bio-functional nanosensor for Salmonella detection was developed using hetero-nanorods. The silica nanorods were fabr...

  15. Optical Biosensors for the Detection of Pathogenic Microorganisms.

    Science.gov (United States)

    Yoo, Seung Min; Lee, Sang Yup

    2016-01-01

    Pathogenic microorganisms are causative agents of various infectious diseases that are becoming increasingly serious worldwide. For the successful treatment of pathogenic infection, the rapid and accurate detection of multiple pathogenic microorganisms is of great importance in all areas related to health and safety. Among various sensor systems, optical biosensors allow easy-to-use, rapid, portable, multiplexed, and cost-effective diagnosis. Here, we review current trends and advances in pathogen-diagnostic optical biosensors. The technological and methodological approaches underlying diverse optical-sensing platforms and methods for detecting pathogenic microorganisms are reviewed, together with the strengths and drawbacks of each technique. Finally, challenges in developing efficient optical biosensor systems and future perspectives are discussed. PMID:26506111

  16. Large scale multiplex PCR improves pathogen detection by DNA microarrays

    Directory of Open Access Journals (Sweden)

    Krönke Martin

    2009-01-01

    Full Text Available Abstract Background Medium density DNA microchips that carry a collection of probes for a broad spectrum of pathogens, have the potential to be powerful tools for simultaneous species identification, detection of virulence factors and antimicrobial resistance determinants. However, their widespread use in microbiological diagnostics is limited by the problem of low pathogen numbers in clinical specimens revealing relatively low amounts of pathogen DNA. Results To increase the detection power of a fluorescence-based prototype-microarray designed to identify pathogenic microorganisms involved in sepsis, we propose a large scale multiplex PCR (LSplex PCR for amplification of several dozens of gene-segments of 9 pathogenic species. This protocol employs a large set of primer pairs, potentially able to amplify 800 different gene segments that correspond to the capture probes spotted on the microarray. The LSplex protocol is shown to selectively amplify only the gene segments corresponding to the specific pathogen present in the analyte. Application of LSplex increases the microarray detection of target templates by a factor of 100 to 1000. Conclusion Our data provide a proof of principle for the improvement of detection of pathogen DNA by microarray hybridization by using LSplex PCR.

  17. Resequencing Pathogen Microarray (RPM) for prospective detection and identification of emergent pathogen strains and variants

    Science.gov (United States)

    Tibbetts, Clark; Lichanska, Agnieszka M.; Borsuk, Lisa A.; Weslowski, Brian; Morris, Leah M.; Lorence, Matthew C.; Schafer, Klaus O.; Campos, Joseph; Sene, Mohamadou; Myers, Christopher A.; Faix, Dennis; Blair, Patrick J.; Brown, Jason; Metzgar, David

    2010-04-01

    High-density resequencing microarrays support simultaneous detection and identification of multiple viral and bacterial pathogens. Because detection and identification using RPM is based upon multiple specimen-specific target pathogen gene sequences generated in the individual test, the test results enable both a differential diagnostic analysis and epidemiological tracking of detected pathogen strains and variants from one specimen to the next. The RPM assay enables detection and identification of pathogen sequences that share as little as 80% sequence similarity to prototype target gene sequences represented as detector tiles on the array. This capability enables the RPM to detect and identify previously unknown strains and variants of a detected pathogen, as in sentinel cases associated with an infectious disease outbreak. We illustrate this capability using assay results from testing influenza A virus vaccines configured with strains that were first defined years after the design of the RPM microarray. Results are also presented from RPM-Flu testing of three specimens independently confirmed to the positive for the 2009 Novel H1N1 outbreak strain of influenza virus.

  18. PathogenMIPer: a tool for the design of molecular inversion probes to detect multiple pathogens

    Directory of Open Access Journals (Sweden)

    Akhras Michael

    2006-11-01

    Full Text Available Abstract Background Here we describe PathogenMIPer, a software program for designing molecular inversion probe (MIP oligonucleotides for use in pathogen identification and detection. The software designs unique and specific oligonucleotide probes targeting microbial or other genomes. The tool tailors all probe sequence components (including target-specific sequences, barcode sequences, universal primers and restriction sites and combines these components into ready-to-order probes for use in a MIP assay. The system can harness the genetic variability available in an entire genome in designing specific probes for the detection of multiple co-infections in a single tube using a MIP assay. Results PathogenMIPer can accept sequence data in FASTA file format, and other parameter inputs from the user through a graphical user interface. It can design MIPs not only for pathogens, but for any genome for use in parallel genomic analyses. The software was validated experimentally by applying it to the detection of human papilloma virus (HPV as a model system, which is associated with various human malignancies including cervical and skin cancers. Initial tests of laboratory samples using the MIPs developed by the PathogenMIPer to recognize 24 different types of HPVs gave very promising results, detecting even a small viral load of single as well as multiple infections (Akhras et al, personal communication. Conclusion PathogenMIPer is a software for designing molecular inversion probes for detection of multiple target DNAs in a sample using MIP assays. It enables broader use of MIP technology in the detection through genotyping of pathogens that are complex, difficult-to-amplify, or present in multiple subtypes in a sample.

  19. Online Detection of Mixed Layer Depth for Autonomous Underwater Vehicles

    Science.gov (United States)

    Chu, S.; Estlin, T.; Castano, R.; Woodward, G.; Gierach, M. M.; Thompson, A. F.; Schaffer, S.

    2015-12-01

    The accurate determination of the mixed layer depth (MLD) plays a crucial role in studying ocean dynamics and climate change. Various methods to estimate MLD have been proposed [1, 2]. However there is no current consensus on the best model, which leads to large uncertainty in the estimation. The variability, coupled with the complexity of physical, chemical and biological processes involved and the uncertainty and instabilities of the upper ocean surface, makes estimating MLD a challenging task. MLD varies significantly, even across a small spatial area (autonomous underwater vehicle (AUV). Using an online method permits a more adaptive approach to estimating MLD. Our proposed algorithm is based on an ensemble approach, which includes data mining techniques for real-time peak and change detection, learned seasonal variability profile, combined with MLD estimation criteria in [1]. In this study, we analyze measurements using glider data collected from the OSMOSIS (Ocean Surface Mixing, Ocean Submesoscale Interaction Study) project, concatenated into a year-long time series [3]. The glider data consists of nine full-depth moorings, which were deployed in a 15 km by 15 km box at the Porcupine Abyssal Plain in the northeast Atlantic, centered at 16.2°W, 48.7°N. Our algorithm utilizes direct measurements of salinity, temperature, depth and time and the design is based on the spatial and temporal variability of MLD learned. We will present our initial work on tracking the MLD based on real-time simulations using the OSMOSIS glider data and discussed for the case of deploying on a single AUV. Using an online algorithm for estimating MLD in-situ enables the system to rapidly adapt to the variability in a real-world environment and also allows for the intelligent operation of the limited sampling resources available on an AUV. We will discuss the autonomy architecture and algorithm design for implementing this methodology and present results from our initial

  20. Detection of Water Hazards for Autonomous Robotic Vehicles

    Science.gov (United States)

    Matthes, Larry; Belluta, Paolo; McHenry, Michael

    2006-01-01

    Four methods of detection of bodies of water are under development as means to enable autonomous robotic ground vehicles to avoid water hazards when traversing off-road terrain. The methods involve processing of digitized outputs of optoelectronic sensors aboard the vehicles. It is planned to implement these methods in hardware and software that would operate in conjunction with the hardware and software for navigation and for avoidance of solid terrain obstacles and hazards. The first method, intended for use during the day, is based on the observation that, under most off-road conditions, reflections of sky from water are easily discriminated from the adjacent terrain by their color and brightness, regardless of the weather and of the state of surface waves on the water. Accordingly, this method involves collection of color imagery by a video camera and processing of the image data by an algorithm that classifies each pixel as soil, water, or vegetation according to its color and brightness values (see figure). Among the issues that arise is the fact that in the presence of reflections of objects on the opposite shore, it is difficult to distinguish water by color and brightness alone. Another issue is that once a body of water has been identified by means of color and brightness, its boundary must be mapped for use in navigation. Techniques for addressing these issues are under investigation. The second method, which is not limited by time of day, is based on the observation that ladar returns from bodies of water are usually too weak to be detected. In this method, ladar scans of the terrain are analyzed for returns and the absence thereof. In appropriate regions, the presence of water can be inferred from the absence of returns. Under some conditions in which reflections from the bottom are detectable, ladar returns could, in principle, be used to determine depth. The third method involves the recognition of bodies of water as dark areas in short

  1. Rapid Detection, Characterization, and Enumeration of Foodborne Pathogens

    DEFF Research Database (Denmark)

    This book provides a new focus on the rapid detection of food–borne pathogens, employing food production chains as a starting point instead of a specific method or various detection technologies. This reference is organized by production chains or contamination scenarios, and offers a unique...

  2. Detection of bacterial pathogens in environmental samples using DNA microarrays.

    Science.gov (United States)

    Call, Douglas R; Borucki, Monica K; Loge, Frank J

    2003-05-01

    Polymerase chain reaction (PCR) is an important tool for pathogen detection, but historically, it has not been possible to accurately identify PCR products without sequencing, Southern blots, or dot-blots. Microarrays can be coupled with PCR where they serve as a set of parallel dot-blots to enhance product detection and identification. Microarrays are composed of many discretely located probes on a solid substrate such as glass. Each probe is composed of a sequence that is complimentary to a pathogen-specific gene sequence. PCR is used to amplify one or more genes and the products are then hybridized to the array to identify species-specific polymorphism within one or more genes. We illustrate this type of array using 16S rDNA probes suitable for distinguishing between several salmonid pathogens. We also describe the use of microarrays for direct detection of either RNA or DNA without the aid of PCR, although the sensitivity of these systems currently limits their application for pathogen detection. Finally, microarrays can also be used to "fingerprint" bacterial isolates and they can be used to identify diagnostic markers suitable for developing new PCR-based detection assays. We illustrate this type of array for subtyping an important food-borne pathogen, Listeria monocytogenes. PMID:12654494

  3. Innovative applications of bacteriophages in rapid detection and identification of foodborne pathogens

    Science.gov (United States)

    Relative to traditional microbiological approaches, biosensors are a rapid method for foodborne bacterial pathogen detection. Biosensors function by detecting the interaction of the target pathogen, or pathogen derived molecule, with a biological recognition component which must have sufficient aff...

  4. Waveguide-Based Biosensors for Pathogen Detection

    Directory of Open Access Journals (Sweden)

    Nile Hartman

    2009-07-01

    Full Text Available Optical phenomena such as fluorescence, phosphorescence, polarization, interference and non-linearity have been extensively used for biosensing applications. Optical waveguides (both planar and fiber-optic are comprised of a material with high permittivity/high refractive index surrounded on all sides by materials with lower refractive indices, such as a substrate and the media to be sensed. This arrangement allows coupled light to propagate through the high refractive index waveguide by total internal reflection and generates an electromagnetic wave—the evanescent field—whose amplitude decreases exponentially as the distance from the surface increases. Excitation of fluorophores within the evanescent wave allows for sensitive detection while minimizing background fluorescence from complex, “dirty” biological samples. In this review, we will describe the basic principles, advantages and disadvantages of planar optical waveguide-based biodetection technologies. This discussion will include already commercialized technologies (e.g., Corning’s EPIC® Ô, SRU Biosystems’ BIND™, Zeptosense®, etc. and new technologies that are under research and development. We will also review differing assay approaches for the detection of various biomolecules, as well as the thin-film coatings that are often required for waveguide functionalization and effective detection. Finally, we will discuss reverse-symmetry waveguides, resonant waveguide grating sensors and metal-clad leaky waveguides as alternative signal transducers in optical biosensing.

  5. Multimodal plasmonic nanosensor for the detection of pathogenic bacteria

    Science.gov (United States)

    Tay, Li-Lin; Hulse, John; Ryan, Shannon; Tanha, Jamshid; Fraser, Jeff; Wu, Xiaohua

    2009-08-01

    Multi-modal sensing scheme significantly improves the detection accuracy but can also introduce extra complexity in the overall design of the sensor. We overcome this difficulty by utilizing the plasmonic properties of metallic nanoparticles. In this study, we will present a simple dual optical sensing mechanism which harvests signals of the resonantly excited metallic nanostructure in the form of surface enhanced Raman scattering (SERS) and resonant Rayleigh scattering. Silver and gold nanoparticles labeled with appropriate antibodies act as signal transduction units and upon exposure to the targeted pathogen render the targeted species optically active. We demonstrate that detection of a single pathogen cell is easily attainable with the dual detection scheme. Furthermore, we explore the markedly different SERS intensity observed from the use of two very different antibody recognition units during the pathogen labeling process.

  6. Innovative hazard detection and avoidance strategy for autonomous safe planetary landing

    Science.gov (United States)

    Jiang, Xiuqiang; Li, Shuang; Tao, Ting

    2016-09-01

    Autonomous hazard detection and avoidance (AHDA) is one of the key technologies for future safe planetary landing missions. In this paper, we address the latest progress on planetary autonomous hazard detection and avoidance technologies. First, the innovative autonomous relay hazard detection and avoidance strategy adopted in Chang'e-3 lunar soft landing mission and its flight results are reported in detail. Second, two new conceptual candidate schemes of hazard detection and avoidance are presented based on the Chang'e-3 AHDA system and the latest developing technologies for the future planetary missions, and some preliminary testing results are also given. Finally, the related supporting technologies for the two candidate schemes above are analyzed.

  7. A new oligonucleotide microarray for detection of pathogenic and non-pathogenic Legionella spp.

    Directory of Open Access Journals (Sweden)

    Boyang Cao

    Full Text Available Legionella pneumophila has been recognized as the major cause of legionellosis since the discovery of the deadly disease. Legionella spp. other than L. pneumophila were later found to be responsible to many non-pneumophila infections. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this report, we have sequenced the 16S-23S rRNA gene internal transcribed spacer (ITS of 10 Legionella species and subspecies, including L. anisa, L. bozemanii, L. dumoffii, L. fairfieldensis, L. gormanii, L. jordanis, L. maceachernii, L. micdadei, L. pneumophila subspp. fraseri and L. pneumophila subspp. pasculleii, and developed a rapid oligonucleotide microarray detection technique accordingly to identify 12 most common Legionella spp., which consist of 11 pathogenic species of L. anisa, L. bozemanii, L. dumoffii, L. gormanii, L. jordanis, L. longbeachae, L. maceachernii, L. micdadei, and L. pneumophila (including subspp. pneumophila, subspp. fraseri, and subspp. pasculleii and one non-pathogenic species, L. fairfieldensis. Twenty-nine probes that reproducibly detected multiple Legionella species with high specificity were included in the array. A total of 52 strains, including 30 target pathogens and 22 non-target bacteria, were used to verify the oligonucleotide microarray assay. The sensitivity of the detection was at 1.0 ng with genomic DNA or 13 CFU/100 mL with Legionella cultures. The microarray detected seven samples of air conditioner-condensed water with 100% accuracy, validating the technique as a promising method for applications in basic microbiology, clinical diagnosis, food safety, and epidemiological surveillance. The phylogenetic study based on the ITS has also revealed that the non-pathogenic L. fairfieldensis is the closest to L. pneumophila than the nine other pathogenic Legionella spp.

  8. A new oligonucleotide microarray for detection of pathogenic and non-pathogenic Legionella spp.

    Science.gov (United States)

    Cao, Boyang; Liu, Xiangqian; Yu, Xiang; Chen, Min; Feng, Lu; Wang, Lei

    2014-01-01

    Legionella pneumophila has been recognized as the major cause of legionellosis since the discovery of the deadly disease. Legionella spp. other than L. pneumophila were later found to be responsible to many non-pneumophila infections. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this report, we have sequenced the 16S-23S rRNA gene internal transcribed spacer (ITS) of 10 Legionella species and subspecies, including L. anisa, L. bozemanii, L. dumoffii, L. fairfieldensis, L. gormanii, L. jordanis, L. maceachernii, L. micdadei, L. pneumophila subspp. fraseri and L. pneumophila subspp. pasculleii, and developed a rapid oligonucleotide microarray detection technique accordingly to identify 12 most common Legionella spp., which consist of 11 pathogenic species of L. anisa, L. bozemanii, L. dumoffii, L. gormanii, L. jordanis, L. longbeachae, L. maceachernii, L. micdadei, and L. pneumophila (including subspp. pneumophila, subspp. fraseri, and subspp. pasculleii) and one non-pathogenic species, L. fairfieldensis. Twenty-nine probes that reproducibly detected multiple Legionella species with high specificity were included in the array. A total of 52 strains, including 30 target pathogens and 22 non-target bacteria, were used to verify the oligonucleotide microarray assay. The sensitivity of the detection was at 1.0 ng with genomic DNA or 13 CFU/100 mL with Legionella cultures. The microarray detected seven samples of air conditioner-condensed water with 100% accuracy, validating the technique as a promising method for applications in basic microbiology, clinical diagnosis, food safety, and epidemiological surveillance. The phylogenetic study based on the ITS has also revealed that the non-pathogenic L. fairfieldensis is the closest to L. pneumophila than the nine other pathogenic Legionella spp. PMID:25469776

  9. Rapid detection, characterization, and enrumeration of food-borne pathogens

    Science.gov (United States)

    In recent years, there has been much research activity on the development of methodologies that are rapid, accurate, and ultrasensitive for detecting pathogenic microorganisms in food. Rapid methods include immunological systems such as the lateral flow assays and enzyme-linked immunosorbent assays...

  10. Bio-functional Au/Si Nanrods for Pathogen Detection

    Science.gov (United States)

    Nanotechnology applications for food safety and biosecurity, especially development of nanoscale sensors for foodborne pathogen measurement are emerging. A novel bio-functional nanosensor for Salmonella detection was developed using hetero-nanorods. The silica nanorods were fabricated by glancing a...

  11. Multiple Pathogen Detection Using Biosensors: Advancements and Challenges

    Science.gov (United States)

    Advancements in biosensor research have considerably impacted clinical diagnostics for human health. Efforts in capitalizing on the sensitivity of biosensors for food pathogen detection are evident in the food safety/security research community. For practical application with foods that normally h...

  12. Application of bacteriophages for detection of foodborne pathogens.

    Science.gov (United States)

    Schmelcher, Mathias; Loessner, Martin J

    2014-01-01

    Bacterial contamination of food products presents a challenge for the food industry and poses a high risk for the consumer. Despite increasing awareness and improved hygiene measures, foodborne pathogens remain a threat for public health, and novel methods for detection of these organisms are needed. Bacteriophages represent ideal tools for diagnostic assays because of their high target cell specificity, inherent signal-amplifying properties, easy and inexpensive production, and robustness. Every stage of the phage lytic multiplication cycle, from the initial recognition of the host cell to the final lysis event, may be harnessed in several ways for the purpose of bacterial detection. Besides intact phage particles, phage-derived affinity molecules such as cell wall binding domains and receptor binding proteins can serve for this purpose. This review provides an overview of existing phage-based technologies for detection of foodborne pathogens, and highlights the most recent developments in this field, with particular emphasis on phage-based biosensors.

  13. Application of bacteriophages for detection of foodborne pathogens.

    Science.gov (United States)

    Schmelcher, Mathias; Loessner, Martin J

    2014-01-01

    Bacterial contamination of food products presents a challenge for the food industry and poses a high risk for the consumer. Despite increasing awareness and improved hygiene measures, foodborne pathogens remain a threat for public health, and novel methods for detection of these organisms are needed. Bacteriophages represent ideal tools for diagnostic assays because of their high target cell specificity, inherent signal-amplifying properties, easy and inexpensive production, and robustness. Every stage of the phage lytic multiplication cycle, from the initial recognition of the host cell to the final lysis event, may be harnessed in several ways for the purpose of bacterial detection. Besides intact phage particles, phage-derived affinity molecules such as cell wall binding domains and receptor binding proteins can serve for this purpose. This review provides an overview of existing phage-based technologies for detection of foodborne pathogens, and highlights the most recent developments in this field, with particular emphasis on phage-based biosensors. PMID:24533229

  14. A Study on Detecting and Identifying Enteric Pathogens With PCR

    Institute of Scientific and Technical Information of China (English)

    JUN-WEN LI; XIU-QUAN SHI; FU-HUAN CHAO; XIN-WEI WANG; JIN-LAI ZHENG; NONG SONG

    2004-01-01

    Objective To develop a rapid and definite diagnostic test of bacterial enteritis caused by pathogenic enterobacteria, the most frequent etiologic agent of infectious enteritis in the world.Methods A set of conventional PCR assays were applied to detect and identify salmonella, shigella,and E. coli O157:H7 directly from pure culture and fecal samples. The general primers of pathogenic enterobacteria were located on the uidA gene, which were found not only in E. coli nuclear acid, but also in Shigella and salmonella genes. Shigella primer was from ipaH gene whose coded invasive plasmid relative antigen existed both in plasmid and in genome. The primers of salmonella were designed from the 16SrRNA sequence. The primer of E. coli O157:H7 was taken from eaeA gene.Five random primers were selected for RAPD. The detection system included common PCR,semi-nested PCR and RAPD. Results This method was more sensitive, specific and efficient and its processing was rapid and simple. For example, the method could be used to specifically detect and identify salmonella, shigella, and E. coli O157:H7, and its sensitivity ranged from 3 to 50 CFU, and its detection time was 4 hours. Conclusion This PCR method, therefore, can serve as a rourine and practical protocol for detecting and identifying pathogenic microorganisms from clinical samples.

  15. DNA microarray technique for detecting food-borne pathogens

    Directory of Open Access Journals (Sweden)

    Xing GAO

    2012-08-01

    Full Text Available Objective To study the application of DNA microarray technique for screening and identifying multiple food-borne pathogens. Methods The oligonucleotide probes were designed by Clustal X and Oligo 6.0 at the conserved regions of specific genes of multiple food-borne pathogens, and then were validated by bioinformatic analyses. The 5' end of each probe was modified by amino-group and 10 Poly-T, and the optimized probes were synthesized and spotted on aldehyde-coated slides. The bacteria DNA template incubated with Klenow enzyme was amplified by arbitrarily primed PCR, and PCR products incorporated into Aminoallyl-dUTP were coupled with fluorescent dye. After hybridization of the purified PCR products with DNA microarray, the hybridization image and fluorescence intensity analysis was acquired by ScanArray and GenePix Pro 5.1 software. A series of detection conditions such as arbitrarily primed PCR and microarray hybridization were optimized. The specificity of this approach was evaluated by 16 different bacteria DNA, and the sensitivity and reproducibility were verified by 4 food-borne pathogens DNA. The samples of multiple bacteria DNA and simulated water samples of Shigella dysenteriae were detected. Results Nine different food-borne bacteria were successfully discriminated under the same condition. The sensitivity of genomic DNA was 102 -103pg/ μl, and the coefficient of variation (CV of the reproducibility of assay was less than 15%. The corresponding specific hybridization maps of the multiple bacteria DNA samples were obtained, and the detection limit of simulated water sample of Shigella dysenteriae was 3.54×105cfu/ml. Conclusions The DNA microarray detection system based on arbitrarily primed PCR can be employed for effective detection of multiple food-borne pathogens, and this assay may offer a new method for high-throughput platform for detecting bacteria.

  16. Investigation of magnetic microdiscs for bacterial pathogen detection

    Science.gov (United States)

    Castillo-Torres, Keisha Y.; Garraud, Nicolas; Arnold, David P.; McLamore, Eric S.

    2016-05-01

    Despite strict regulations to control the presence of human pathogens in our food supply, recent foodborne outbreaks have heightened public concern about food safety and created urgency to improve methods for pathogen detection. Herein we explore a potentially portable, low-cost system that uses magnetic microdiscs for the detection of bacterial pathogens in liquid samples. The system operates by optically measuring the rotational dynamics of suspended magnetic microdiscs functionalized with pathogen-binding aptamers. The soft ferromagnetic (Ni80Fe20) microdiscs exhibit a closed magnetic spin arrangement (i.e. spin vortex) with zero magnetic stray field, leading to no disc agglomeration when in free suspension. With very high surface area for functionalization and volumes 10,000x larger than commonly used superparamagnetic nanoparticles, these 1.5-μm-diameter microdiscs are well suited for tagging, trapping, actuating, or interrogating bacterial targets. This work reports a wafer-level microfabrication process for fabrication of 600 million magnetic microdiscs per substrate and measurement of their rotational dynamics response. Additionally, the biofunctionalization of the microdiscs with DNA aptamers, subsequent binding to E. coli bacteria, and their magnetic manipulation is reported.

  17. Detection of periodontal pathogens in the patients with aortic aneurysm

    Institute of Scientific and Technical Information of China (English)

    Ding Fang; Lyu Yalin; Han Xiao; Zhang Hai; Liu Dongyu; Hei Wei; Liu Yinhua

    2014-01-01

    Background The occurrence and development of aortic aneurysm (AA) are associated with infection.Some researchers have detected the DNA of periodontal pathogens in AA samples in certain populations.However,it has not been done in Chinese population.The objective of this study was to evaluate the prevalence of periodontal pathogens in oral tissue samples and aneurysm samples of AA patients.Methods Eighty-nine subjects with AA and 59 subjects without AA were examined.Periodontal clinical parameters were evaluated.Unstimulated saliva and subgingival plaque somples were collected from all subjects.Twenty-six dissected AA samples were obtained.Evidence of eight periodontal pathogens including Porphyromonas gingivalis (Pg),Actinobacillus actinomycetemcomitans (Aa),Prevotella intermedia (Pi),Tannerella forsythensis (Tf),Treponema denticola (Td),Campylobacter rectus (Cr),Fusobacterium nucleatum (Fn),and Prevotella nigrescens (Pn) was ascertained in all samples by 16S rRNA-based polymerase chain reaction (PCR) assay.Results The periodontal indexes including plaque index (PLI),probing depth (PD),bleeding index (BI),and clinical attachment loss (CAL),of the six Ramfjord index teeth were significantly higher in the AA group than those in the control group (P <0.01).Eight periodontal pathogens in subgingival plaque samples were more frequently detected in the AA group than in control group.The difference in prevalence between the groups was significant for six (out of eight) periodontal pathogens assayed (Pg,Pi,Fn,Pn,Tf,and Td,P <0.01).Additionally,all eight periodontal pathogens were more frequently detected in saliva samples of the AA group than in those of the control group,again with six (out of eight) (Pg,Pi,Fn,Cr,Tf,and Td) displaying significant differences in prevalence between the two groups (P <0.01).Out of 26 aneurysm samples examined,Pg,Pi,Fn,Crand Tfwere detected in 6 (23.1%),2 (7.7%),3 (11.5%),1 (3.8%),2 (7.7%),respectively,and Aa,Pn,and Td were not

  18. Multi-modal target detection for autonomous wide area search and surveillance

    Science.gov (United States)

    Breckon, Toby P.; Gaszczak, Anna; Han, Jiwan; Eichner, Marcin L.; Barnes, Stuart E.

    2013-10-01

    Generalised wide are search and surveillance is a common-place tasking for multi-sensory equipped autonomous systems. Here we present on a key supporting topic to this task - the automatic interpretation, fusion and detected target reporting from multi-modal sensor information received from multiple autonomous platforms deployed for wide-area environment search. We detail the realization of a real-time methodology for the automated detection of people and vehicles using combined visible-band (EO), thermal-band (IR) and radar sensing from a deployed network of multiple autonomous platforms (ground and aerial). This facilities real-time target detection, reported with varying levels of confidence, using information from both multiple sensors and multiple sensor platforms to provide environment-wide situational awareness. A range of automatic classification approaches are proposed, driven by underlying machine learning techniques, that facilitate the automatic detection of either target type with cross-modal target confirmation. Extended results are presented that show both the detection of people and vehicles under varying conditions in both isolated rural and cluttered urban environments with minimal false positive detection. Performance evaluation is presented at an episodic level with individual classifiers optimized for maximal each object of interest (vehicle/person) detection over a given search path/pattern of the environment, across all sensors and modalities, rather than on a per sensor sample basis. Episodic target detection, evaluated over a number of wide-area environment search and reporting tasks, generally exceeds 90%+ for the targets considered here.

  19. Detection of pathogenic gram negative bacteria using infrared thermography

    Science.gov (United States)

    Lahiri, B. B.; Divya, M. P.; Bagavathiappan, S.; Thomas, Sabu; Philip, John

    2012-11-01

    Detection of viable bacteria is of prime importance in all fields of microbiology and biotechnology. Conventional methods of enumerating bacteria are often time consuming and labor-intensive. All living organisms generate heat due to metabolic activities and hence, measurement of heat energy is a viable tool for detection and quantification of bacteria. In this article, we employ a non-contact and real time method - infrared thermography (IRT) for measurement of temperature variations in four clinically significant gram negative pathogenic bacteria, viz. Vibrio cholerae, Vibrio mimicus, Proteus mirabilis and Pseudomonas aeruginosa. We observe that, the energy content, defined as the ratio of heat generated by bacterial metabolic activities to the heat lost from the liquid medium to the surrounding, vary linearly with the bacterial concentration in all the four pathogenic bacteria. The amount of energy content observed in different species is attributed to their metabolisms and morphologies that affect the convection velocity and hence heat transport in the medium.

  20. Multiplex detection of four pathogenic retroviruses using molecular beacons

    OpenAIRE

    Vet, Jacqueline A. M.; Majithia, Amit R.; Marras, Salvatore A. E.; Tyagi, Sanjay; DUBE, SYAMALIMA; Poiesz, Bernard J; Kramer, Fred Russell

    1999-01-01

    We describe a multiplex nucleic acid assay that identifies and determines the abundance of four different pathogenic retroviruses (HIV-1, HIV-2, and human T-lymphotrophic virus types I and II). Retroviral DNA sequences are amplified in a single, sealed tube by simultaneous PCR assays, and the resulting amplicons are detected in real time by the hybridization of four differently colored, amplicon-specific molecular beacons. The color of the fluorescence generated in the course of amplification...

  1. Dominant object detection for autonomous vision-based surveillance

    NARCIS (Netherlands)

    Celik, H.

    2010-01-01

    The deployment of visual surveillance and monitoring systems has reached massive proportions. Consequently, a need to automate the processes involved in retrieving useful information from surveillance videos, such as detecting and counting objects, and interpreting their individual and joint behavio

  2. Market Disease Pathogens Detection of Imported Fruits in Shanghai

    Institute of Scientific and Technical Information of China (English)

    MA Teng-fei; YANG Bo; YU Yue; WANG Yi-wen; LIU Yi; XU Zhen; LIU Yan; ZHU Pin-kuan; ZHANG Wei; ZHANG Zai-bao; Toyoda Hideyoshi; XU Ling

    2009-01-01

    A tremendous amount of imported fresh fruits has been delivered to Shanghai markets,increasing the risk of invasion by harmful plant pathogens.Therefore,it is important to establish an effective detection and supervision system to survey the outbreak of the market diseases of the imported fruits during marketing.The samples were regularly surveyed in different markets to examine varieties,prices,localities,selling conditions,and diseases of the imported fruits from 2004 to 2008.The survey showed that 58 species of 30 different fruits were imported to Shanghai from 16 countries with more expensive price.The larger products were bananas,grapes,apples,and oranges.During the investigation,we found that the imported fruits frequently brought about the relatively serious market diseases.On the basis of morphology and the nuclear internal transcribed spacer (ITS) of ribosomal DNA (rDNA) analysis,151 isolates of 15 fungi genera,which shown to be pathogenic afcer the inoculation assay.were finally identified.Among the identified fungi,Alternaria was the most frequent one with the highest detection rate (47.68%),followed by Penicillium (14.57%) and Fusarium (11.92%),respectively.Additionally,Pestalotiopsis microspora (detected in grapes Red-Globe coming from the USA) and Botrytis sp.(detected in black-plums coming from the USA)were first reported in China market.The present study summarized the selling situation of the imported fruits in Shanghai markets and constructed a library of the pathogens detected in the imported fruits during the selling period.The results obtained are useful to offer technical parameters for Chinese quarantine in order to prevent an invasion of the foreign harmful micro-organisms.

  3. Vehicle Detection for RCTA/ANS (Autonomous Navigation System)

    Science.gov (United States)

    Brennan, Shane; Bajracharya, Max; Matthies, Larry H.; Howard, Andrew B.

    2012-01-01

    Using a stereo camera pair, imagery is acquired and processed through the JPLV stereo processing pipeline. From this stereo data, large 3D blobs are found. These blobs are then described and classified by their shape to determine which are vehicles and which are not. Prior vehicle detection algorithms are either targeted to specific domains, such as following lead cars, or are intensity- based methods that involve learning typical vehicle appearances from a large corpus of training data. In order to detect vehicles, the JPL Vehicle Detection (JVD) algorithm goes through the following steps: 1. Take as input a left disparity image and left rectified image from JPLV stereo. 2. Project the disparity data onto a two-dimensional Cartesian map. 3. Perform some post-processing of the map built in the previous step in order to clean it up. 4. Take the processed map and find peaks. For each peak, grow it out into a map blob. These map blobs represent large, roughly vehicle-sized objects in the scene. 5. Take these map blobs and reject those that do not meet certain criteria. Build descriptors for the ones that remain. Pass these descriptors onto a classifier, which determines if the blob is a vehicle or not. The probability of detection is the probability that if a vehicle is present in the image, is visible, and un-occluded, then it will be detected by the JVD algorithm. In order to estimate this probability, eight sequences were ground-truthed from the RCTA (Robotics Collaborative Technology Alliances) program, totaling over 4,000 frames with 15 unique vehicles. Since these vehicles were observed at varying ranges, one is able to find the probability of detection as a function of range. At the time of this reporting, the JVD algorithm was tuned to perform best at cars seen from the front, rear, or either side, and perform poorly on vehicles seen from oblique angles.

  4. Magnetic Bead Based Immunoassay for Autonomous Detection of Toxins

    Energy Technology Data Exchange (ETDEWEB)

    Kwon, Y; Hara, C A; Knize, M G; Hwang, M H; Venkatesteswaran, K S; Wheeler, E K; Bell, P M; Renzi, R F; Fruetel, J A; Bailey, C G

    2008-05-01

    As a step towards toward the development of a rapid, reliable analyzer for bioagents in the environment, we are developing an automated system for the simultaneous detection of a group of select agents and toxins. To detect toxins, we modified and automated an antibody-based approach previously developed for manual medical diagnostics that uses fluorescent eTag{trademark} reporter molecules and is suitable for highly multiplexed assays. Detection is based on two antibodies binding simultaneously to a single antigen, one of which is labeled with biotin while the other is conjugated to a fluorescent eTag{trademark} through a cleavable linkage. Aqueous samples are incubated with the mixture of antibodies along with streptavidin-coated magnetic beads coupled to a photo-activatable porphyrin complex. In the presence of antigen, a molecular complex is formed where the cleavable linkage is held in proximity to the photoactivable group. Upon excitation at 680 nm, free radicals are generated, which diffuse and cleave the linkage, releasing the eTags{trademark}. Released eTags{trademark} are analyzed using capillary gel electrophoresis with laser-induced fluorescence detection. Limits of detection for ovalbumin and botulinum toxoid individually were 4 ng/mL (or 80 pg) and 16 ng/mL (or 320 pg), respectively, using the manual assay. In addition, we demonstrated the use of pairs of antibodies from different sources in a single assay to decrease the rate of false positives. Automation of the assay was demonstrated on a flow-through format with higher LODs of 125 ng/mL (or 2.5 ng) each of a mixture of ovalbumin and botulinum toxoid. This versatile assay can be easily modified with the appropriate antibodies to detect a wide range of toxins and other proteins.

  5. Maximizing the chances of detecting pathogenic leptospires in mammals

    DEFF Research Database (Denmark)

    Tulsiani, Suhella; Graham, G C; Dohnt, M F;

    2011-01-01

    of these studies have now been carefully analysed in attempts to see which method of detection and type of test sample were best. The effects of pentobarbitone sodium used to euthanize wild mammals before collection of necropsy samples, on the survival and detection of leptospires in vitro, were also explored....... In the earlier field investigation, serum, renal tissue and urine were collected from wild mammals, for the detection of pathogenic leptospires by culture, the microscopic agglutination test (MAT), real-time PCR and silver impregnation of smears. Although 27.6% of the rodents investigated were found leptospire....../ml, did not affect the viability or the detection of leptospires in culture, and is therefore unlikely to reduce the chances of isolating leptospires from an animal that has been euthanized with the compound. It appears that collecting multiple samples from each mammal being checked will improve...

  6. Actual Pathogen Detection: Sensors and Algorithms - a Review

    Directory of Open Access Journals (Sweden)

    Federico Hahn

    2009-03-01

    Full Text Available Pathogens feed on fruits and vegetables causing great food losses or at least reduction of their shelf life. These pathogens can cause losses of the final product or in the farms were the products are grown, attacking leaves, stems and trees. This review analyses disease detection sensors and algorithms for both the farm and postharvest management of fruit and vegetable quality. Mango, avocado, apple, tomato, potato, citrus and grapes were selected as the fruits and vegetables for study due to their world-wide consumption. Disease warning systems for predicting pathogens and insects on farms during fruit and vegetable production are commonly used for all the crops and are available where meteorological stations are present. It can be seen that these disease risk systems are being slowly replaced by remote sensing monitoring in developed countries. Satellite images have reduced their temporal resolution, but are expensive and must become cheaper for their use world-wide. In the last 30 years, a lot of research has been carried out in non-destructive sensors for food quality. Actually, non-destructive technology has been applied for sorting high quality fruit which is desired by the consumer. The sensors require algorithms to work properly; the most used being discriminant analysis and training neural networks. New algorithms will be required due to the high quantity of data acquired and its processing, and for disease warning strategies for disease detection.

  7. Integrated Detection of Pathogens and Host Biomarkers for Wounds

    Energy Technology Data Exchange (ETDEWEB)

    Jaing, C

    2012-03-19

    The increasing incidence and complications arising from combat wounds has necessitated a reassessment of methods for effective treatment. Infection, excessive inflammation, and incidence of drug-resistant organisms all contribute toward negative outcomes for afflicted individuals. The organisms and host processes involved in wound progression, however, are incompletely understood. We therefore set out, using our unique technical resources, to construct a profile of combat wounds which did or did not successfully resolve. We employed the Lawrence Livermore Microbial Detection Array and identified a number of nosocomial pathogens present in wound samples. Some of these identities corresponded with bacterial isolates previously cultured, while others were not obtained via standard microbiology. Further, we optimized proteomics protocols for the identification of host biomarkers indicative of various stages in wound progression. In combination with our pathogen data, our biomarker discovery efforts will provide a profile corresponding to wound complications, and will assist significantly in treatment of these complex cases.

  8. LABRADOR: a learning autonomous behavior-based robot for adaptive detection and object retrieval

    Science.gov (United States)

    Yamauchi, Brian; Moseley, Mark; Brookshire, Jonathan

    2013-01-01

    As part of the TARDEC-funded CANINE (Cooperative Autonomous Navigation in a Networked Environment) Program, iRobot developed LABRADOR (Learning Autonomous Behavior-based Robot for Adaptive Detection and Object Retrieval). LABRADOR was based on the rugged, man-portable, iRobot PackBot unmanned ground vehicle (UGV) equipped with an explosives ordnance disposal (EOD) manipulator arm and a custom gripper. For LABRADOR, we developed a vision-based object learning and recognition system that combined a TLD (track-learn-detect) filter based on object shape features with a color-histogram-based object detector. Our vision system was able to learn in real-time to recognize objects presented to the robot. We also implemented a waypoint navigation system based on fused GPS, IMU (inertial measurement unit), and odometry data. We used this navigation capability to implement autonomous behaviors capable of searching a specified area using a variety of robust coverage strategies - including outward spiral, random bounce, random waypoint, and perimeter following behaviors. While the full system was not integrated in time to compete in the CANINE competition event, we developed useful perception, navigation, and behavior capabilities that may be applied to future autonomous robot systems.

  9. Nanoparticles based DNA conjugates for detection of pathogenic microorganisms

    Science.gov (United States)

    Jamdagni, Pragati; Khatri, Poonam; Rana, J. S.

    2016-01-01

    Infectious diseases have been on rise in the recent past. Early diagnosis plays a role as important as proper treatment and prophylaxis. The current practices of detection are time consuming which may result in unnecessary delays in treatment. Advances in nanodiagnostic approaches have been in focus lately. The rising interest and better understanding of nanoparticles have led to opening up of new frontiers in the concerned area. Optical properties of nanoparticles are being exploited to design detection systems that can provide fast, one-step and reliable results. Based on conserved DNA sequences unique to the target organism, the results offer accuracy comparable to conventional tests. Further, visual or spectrophotometric analysis omits the need of costly apparatus for result interpretation. The present review aims at putting together the information on nanoparticles based DNA conjugate systems for detection of pathogenic microorganisms.

  10. The COMRADE System for Multirobot Autonomous Landmine Detection in Postconflict Regions

    Directory of Open Access Journals (Sweden)

    Prithviraj Dasgupta

    2015-01-01

    Full Text Available We consider the problem of autonomous landmine detection using a team of mobile robots. Previous research on robotic landmine detection mostly employs a single robot equipped with a landmine detection sensor to detect landmines. We envisage that the quality of landmine detection can be significantly improved if multiple robots are coordinated to detect landmines in a cooperative manner by incrementally fusing the landmine-related sensor information they collect and then use that information to visit locations of potential landmines. Towards this objective, we describe a multirobot system called COMRADES to address different aspects of the autonomous landmine detection problem including distributed area coverage to detect and locate landmines, information aggregation to fuse the sensor information obtained by different robots, and multirobot task allocation (MRTA to enable different robots to determine a suitable sequence to visit locations of potential landmines while reducing the time required and battery expended. We have used commercially available all-terrain robots called Coroware Explorer that are customized with a metal detector to detect metallic objects including landmines, as well as indoor Corobot robots, both in simulation and in physical experiments, to test the different techniques in COMRADES.

  11. Autonomous detection of ISO fade point with color laser printers

    Science.gov (United States)

    Yan, Ni; Maggard, Eric; Fothergill, Roberta; Jessome, Renee J.; Allebach, Jan P.

    2015-01-01

    Image quality assessment is a very important field in image processing. Human observation is slow and subjective, it also requires strict environment setup for the psychological test 1. Thus developing algorithms to match desired human experiments is always in need. Many studies have focused on detecting the fading phenomenon after the materials are printed, that is to monitor the persistence of the color ink 2-4. However, fading is also a common artifact produced by printing systems when the cartridges run low. We want to develop an automatic system to monitor cartridge life and report fading defects when they appear. In this paper, we first describe a psychological experiment that studies the human perspective on printed fading pages. Then we propose an algorithm based on Color Space Projection and K-means clustering to predict the visibility of fading defects. At last, we integrate the psychological experiment result with our algorithm to give a machine learning tool that monitors cartridge life.

  12. Detection of pathogenic clostridia in biogas plant wastes.

    Science.gov (United States)

    Neuhaus, Jürgen; Shehata, Awad A; Krüger, Monika

    2015-01-01

    As the number of biogas plants has grown rapidly in the last decade, the amount of potentially contaminated wastes with pathogenic Clostridium spp. has increased as well. This study reports the results from examining 203 biogas plant wastes (BGWs). The following Clostridium spp. with different frequencies could be isolated via a new enrichment medium (Krüne medium) and detected by matrix-assisted laser desorption/ionization-time-of-flight mass spectrometry (MALDI-TOF MS): Clostridium perfringens (58 %) then Clostridium bifermentans (27 %), Clostridium tertium (23 %) and Clostridium butyricum (19 %), Clostridium cadaveris (15 %), Clostridium parapurificum (6 %), Clostridium glycolicum (5 %), Clostridium baratii (4 %), Clostridium sporogenes (2 %), Clostridium sordellii (1 %) and Clostridium subterminale (0.5 %). The mean most probable number (MPN) count of sulfite reducing bacteria was between 10(3) and 10(4)/mL, and the higher the MPN, the more pathogenic Clostridium spp. were present. Also, real-time PCR was used to be compared with culture method for C. perfringens, C. bifermentans, C. butyricum, C. sporogenes/Clostridium botulinum and C. sordellii. Although real-time PCR was more sensitive than the culture method, both systems improve the recovery rate but in different ways and are useful to determine pathogenic clostridia in biogas plants. In conclusion, BGWs could present a biohazard risk of clostridia for humans and animals. PMID:24984829

  13. Humic substances interfere with detection of pathogenic prion protein

    Science.gov (United States)

    Smith, Christen B.; Booth, Clarissa J.; Wadzinski, Tyler J.; Legname, Giuseppe; Chappell, Rick; Johnson, Christopher J.; Pedersen, Joel A.

    2014-01-01

    Studies examining the persistence of prions (the etiological agent of transmissible spongiform encephalopathies) in soil require accurate quantification of pathogenic prion protein (PrPTSE) extracted from or in the presence of soil particles. Here, we demonstrate that natural organic matter (NOM) in soil impacts PrPTSE detection by immunoblotting. Methods commonly used to extract PrPTSE from soils release substantial amounts of NOM, and NOM inhibited PrPTSE immunoblot signal. The degree of immunoblot interference increased with increasing NOM concentration and decreasing NOM polarity. Humic substances affected immunoblot detection of prion protein from both deer and hamsters. We also establish that after interaction with humic acid, PrPTSE remains infectious to hamsters inoculated intracerebrally, and humic acid appeared to slow disease progression. These results provide evidence for interactions between PrPTSE and humic substances that influence both accurate measurement of PrPTSE in soil and disease transmission.

  14. A liquid-crystal-based DNA biosensor for pathogen detection

    Science.gov (United States)

    Khan, Mashooq; Khan, Abdur Rahim; Shin, Jae-Ho; Park, Soo-Young

    2016-03-01

    A liquid-crystal (LC)-filled transmission electron microscopy (TEM) grid cell coated with the cationic surfactant dodecyltrimethylammonium bromide (DTAB), to which a single-stranded deoxyribonucleic acid probe (ssDNAprobe) was adsorbed at the LC/aqueous interface (TEMDTAB/DNA), was applied for the highly specific detection of target DNA molecules. The DTAB-coated E7 (used LC mixture) in the TEM grid (TEMDTAB) exhibited a homeotropic orientation, and changed to a planar orientation upon adsorption of the ssDNAprobe. The TEMDTAB/DNA was then exposed to complementary (target) ssDNA, which resulted in a planar-to-homeotropic configurational change of E7 that could be observed through a polarized optical microscope under crossed polarizers. The optimum adsorption density (2 μM) of ssDNAprobe enabled the detection of ≥0.05 nM complementary ssDNA. This TEMDTAB/DNA biosensor could differentiate complementary ssDNA from mismatched ssDNA as well as double-stranded DNA. It also successfully detected the genomic DNAs of the bacterium Erwinia carotovora and the fungi Rhazictonia solani. Owe to the high specificity, sensitivity, and label-free detection, this biosensor may broaden the applications of LC-based biosensors to pathogen detection.

  15. Flood Detection and Monitoring by Autonomous Satellite Operations: the ASE Experience

    Science.gov (United States)

    Ip, F.; Dohm, J. M.; Baker, V. R.; Doggett, T.; Davies, A. G.; Castano, R.; Chien, S.; Cichy, B.; Greeley, R.; Sherwood, R.; Tran, D. Q.; Rabideau, G.

    2006-05-01

    We developed a satellite-based floodwater classification algorithm, ASE_FLOOD, to autonomously detect, monitor and respond to flooding events as they occur. It monitors selected river locations around the world for flood conditions in near real time through the Autonomous Sciencecraft Experiment (ASE). Normally, an ongoing flood might be missed because of the time required for the spacecraft to send its data to ground controllers for image processing and data analysis. The ASE approach cuts lengthy time lags inherent to taking an observation, transmitting it to the ground for study, and subsequently deciding to direct further satellite observations of an event. By introducing spaceborne data analysis and autonomous decision-making ability, ASE provides an innovative way for early detection, tracking and "rapid response" to dynamic transient flood events without any human intervention or prior knowledge. Tested and proven on NASA's EO-1 spacecraft, ASE's onboard data analysis detects flood/non-flood/cloudy conditions on the ground, and responds to the detected conditions accordingly using its ASE-facilitated autonomous decision making ability. Cloudy scenes and scenes with no significant flooding are dropped and not be transmitted, thereby saving downlink resources. When significant flooding is detected, ASE autonomously triggers the satellite to acquire additional images of the same target or adjacent flood-affected regions on the next orbital passes to track flood progress and map flood extent. This conditional change- based triggering allows the satellite to change its acquisition priorities and retarget its sensors to the emerging flood regions. The ASE approach greatly reduces the response time to floods from 2 weeks down to a possible 3 hours. It optimizes satellite downlink resources by eliminating useless scenes (e.g., cloudy) and preferentially transmitting onboard-derived data of high science value (e.g., time series of floodwater inundation maps). This

  16. Detection of Biological Pathogens Using Multiple Wireless Magnetoelastic Biosensors

    Science.gov (United States)

    Shen, Wen

    A number of recent, high-profile incidences of food-borne illness spreading through the food supply and the use of anthrax by terrorists after the September 11, 2001 attacks have demonstrated the need for new technologies that can rapidly detect the presence of biological pathogens. A bevy of biosensors show excellent detection sensitivity and specificity. However, false positive and false negative signals remain one of the primary reasons that many of these newly developed biosensors have not found application in the marketplace. The research described in this dissertation focuses on developing a free-standing magnetoelastic based bio-sensing system using a pulse method. This method allows fast detection, eliminates the bias magnetic field that is necessary in current methods, makes the system more simply and suitable for in-field detection. This system has two pairs of transformer coils, where a measurement sensor and a control sensor can be put in each pair of coils. The control sensor is used to compensate for environmental variables. The effect of pulse power on the performance of the magnetoelastic sensors in the pulse system is studied. The system is found to have excellent stability, good detection repeatability when used with multiple sensors. This research has investigated and demonstrated a multiple sensors approach. Because it will involve the simultaneous measurement of many sensors, it will significantly reduce problems encountered with false positive indications. The positioning and interference of sensors are investigated. By adding a multi-channel structure to the pulse detection system, the effect of sensor interference is minimized. The result of the repeatability test shows that the standard deviation when measuring three 1 mm magnetoelastic sensors is around 500 Hz, which is smaller than the minimum requirement for actual spores/bacteria detection. Magnetoelastic sensors immobilized with JRB7 phages and E2 phages have been used to specifically

  17. Detection of pathogenic organisms in food, water, and body fluids

    Science.gov (United States)

    Wallace, William H.; Henley, Michael V.; Sayler, Gary S.

    2002-06-01

    The construction of specific bioluminescent bacteriophage for detection of pathogenic organism can be developed to overcome interferences in complex matrices such as food, water and body fluids. Detection and identification of bacteria often require several days and frequently weeks by standard methods of isolation, growth and biochemical test. Immunoassay detection often requires the expression of the bacterial toxin, which can lead to non-detection of cells that may express the toxin under conditions different from testing protocols. Immunoassays require production of a specific antibody to the agent for detection and interference by contaminants frequently affects results. PCR based detection may be inhibited by substances in complex matrices. Modified methods of the PCR technique, such as magnetic capture-hybridization PCR (MCH-PCR), appear to improve the technique by removing the DNA products away from the inhibitors. However, the techniques required for PCR-based detection are slow and the procedures require skilled personnel working with labile reagents. Our approach is based on transferring bioluminescence (lux) genes into a selected bacteriophage. Bacteriophages are bacterial viruses that are widespread in nature and often are genus and species specific. This specificity eliminates or reduces false positives in a bacteriophage assay. The phage recognizes a specific receptor molecule on the surface of a susceptible bacterium, attaches and then injects the viral nucleic acid into the cell. The injected viral genome is expressed and then replicated, generating numerous exact copies of the viral genetic material including the lux genes, often resulting in an increase in bioluminescence by several hundred fold.

  18. Grid-Based Multi-Sensor Fusion for On-Road Obstacle Detection: Application to Autonomous Driving

    OpenAIRE

    Gálvez del Postigo Fernández, Carlos

    2015-01-01

    Self-driving cars have recently become a challenging research topic, with the aim of making transportation safer and more efficient. Current advanced driving assistance systems (ADAS) allow cars to drive autonomously by following lane markings, identifying road signs and detecting pedestrians and other vehicles. In this thesis work we improve the robustness of autonomous cars by designing an on-road obstacle detection system. The proposed solution consists on the low-level fusion of radar and...

  19. On the autonomous detection of coronal mass ejections in heliospheric imager data

    Science.gov (United States)

    Tappin, S. J.; Howard, T. A.; Hampson, M. M.; Thompson, R. N.; Burns, C. E.

    2012-05-01

    We report on the development of an Automatic Coronal Mass Ejection (CME) Detection tool (AICMED) for the Solar Mass Ejection Imager (SMEI). CMEs observed with heliospheric imagers are much more difficult to detect than those observed by coronagraphs as they have a lower contrast compared with the background light, have a larger range of intensity variation and are easily confused with other transient activity. CMEs appear in SMEI images as very faint often-fragmented arcs amongst a much brighter and often variable background. AICMED operates along the same lines as Computer Aided CME Tracking (CACTus), using the Hough Transform on elongation-time J-maps to extract straight lines from the data set. We compare AICMED results with manually measured CMEs on almost three years of data from early in SMEI operations. AICMED identified 83 verifiable events. Of these 46 could be matched with manually identified events, the majority of the non-detections can be explained. The remaining 37 AICMED events were newly discovered CMEs. The proportion of false identification was high, at 71% of the autonomously detected events. We find that AICMED is very effective as a region of interest highlighter, and is a promising first step in autonomous heliospheric imager CME detection, but the SMEI data are too noisy for the tool to be completely automated.

  20. A fractal analysis of pathogen detection by biosensors

    Science.gov (United States)

    Doke, Atul M.; Sadana, Ajit

    2006-05-01

    A fractal analysis is presented for the detection of pathogens such as Franscisela tularensis, and Yersinia pestis (the bacterium that causes plague) using a CANARY (cellular analysis and notification of antigens risks and yields) biosensor (Rider et al., 2003). In general, the binding and dissociation rate coefficients may be adequately described by either a single- or a dual-fractal analysis. An attempt is made to relate the binding rate coefficient to the degree of heterogeneity (fractal dimension value) present on the biosensor surface. Binding and dissociation rate coefficient values obtained are presented. The kinetics aspects along with the affinity values presented are of interest, and should along with the rate coefficients presented for the binding and the dissociation phase be of significant interest in help designing better biosensors for an application area that is bound to gain increasing importance in the future.

  1. Molecular Detection of Common Bacterial Pathogens Causing Meningitis

    Directory of Open Access Journals (Sweden)

    H Sadighian

    2009-03-01

    Full Text Available "nBackground: The clinical diagnosis of meningitis is crucial, particularly in children. The early diagnosis and empiric an­tibi­otic treatments have led to a reduction in morbidity and mortality rates. PCR and the enzymatic digestion of 16SrDNA frag­ment which is produced by universal primers led up fast and sensitive determination. The purpose of this study was to investi­gate a rapid method for detection of common bacterial pathogens causing meningitis."nMethods: According to the gene encoding 16SrDNA found in all bacteria, a pair of primers was designed. Then the univer­sal PCR was performed for bacterial agents of meningitis (Streptococcus pneumoniae, Neisseria meningitidis, Haemophilus influ­enzae, etc. by employing broad- range DNA extraction method. The ob­tained uni­versal PCR products were digested with restriction enzymes (HaeIII, AluI and MnlI to identify bacterial species. "nResults: By the enzymatic digestion of the universal products of each standard strain of the above bacteria, specific patterns were achieved. These specific patterns may be used for comparison in CSF examination. The analytical sensitivity of the as­say was approximately 1.5´102 CFU/ml of CSF even in samples with high amount of proteins. Conclusion: The universal PCR coupled with enzymatic digestion can be used to detect and identify bacterial pathogens in clini­cal specimens rapidly and accurately. Molecular diagnostic of bacterial meningitis, though expensive and labor-inten­sive, but is valuable and critical in patient management.

  2. Enzyme-free amplified detection of DNA by an autonomous ligation DNAzyme machinery.

    Science.gov (United States)

    Wang, Fuan; Elbaz, Johann; Willner, Itamar

    2012-03-28

    The Zn(2+)-dependent ligation DNAzyme is implemented as a biocatalyst for the amplified detection of a target DNA by the autonomous replication of a nucleic acid reporter unit that is generated by the catalyzed ligation process. The reporter units enhance the formation of active DNAzyme units, thus leading to the isothermal autocatalytic formation of the reporter elements. The system was further developed and applied for the amplified detection of Tay-Sachs genetic disorder mutant, with a detection limit of 1.0 × 10(-11) M. Besides providing a versatile paradigm for the amplified detection of DNA, the system reveals a new, enzyme-free, isothermal, autocatalytic mechanism that introduces means for effective programmed synthesis. PMID:22404383

  3. Bacteriophage functional genomics and its role in bacterial pathogen detection.

    Science.gov (United States)

    Klumpp, Jochen; Fouts, Derrick E; Sozhamannan, Shanmuga

    2013-07-01

    Emerging and reemerging bacterial infectious diseases are a major public health concern worldwide. The role of bacteriophages in the emergence of novel bacterial pathogens by horizontal gene transfer was highlighted by the May 2011 Escherichia coli O104:H4 outbreaks that originated in Germany and spread to other European countries. This outbreak also highlighted the pivotal role played by recent advances in functional genomics in rapidly deciphering the virulence mechanism elicited by this novel pathogen and developing rapid diagnostics and therapeutics. However, despite a steady increase in the number of phage sequences in the public databases, boosted by the next-generation sequencing technologies, few functional genomics studies of bacteriophages have been conducted. Our definition of 'functional genomics' encompasses a range of aspects: phage genome sequencing, annotation and ascribing functions to phage genes, prophage identification in bacterial sequences, elucidating the events in various stages of phage life cycle using genomic, transcriptomic and proteomic approaches, defining the mechanisms of host takeover including specific bacterial-phage protein interactions and identifying virulence and other adaptive features encoded by phages and finally, using prophage genomic information for bacterial detection/diagnostics. Given the breadth and depth of this definition and the fact that some of these aspects (especially phage-encoded virulence/adaptive features) have been treated extensively in other reviews, we restrict our focus only on certain aspects. These include phage genome sequencing and annotation, identification of prophages in bacterial sequences and genetic characterization of phages, functional genomics of the infection process and finally, bacterial identification using genomic information.

  4. Bacteriophage functional genomics and its role in bacterial pathogen detection.

    Science.gov (United States)

    Klumpp, Jochen; Fouts, Derrick E; Sozhamannan, Shanmuga

    2013-07-01

    Emerging and reemerging bacterial infectious diseases are a major public health concern worldwide. The role of bacteriophages in the emergence of novel bacterial pathogens by horizontal gene transfer was highlighted by the May 2011 Escherichia coli O104:H4 outbreaks that originated in Germany and spread to other European countries. This outbreak also highlighted the pivotal role played by recent advances in functional genomics in rapidly deciphering the virulence mechanism elicited by this novel pathogen and developing rapid diagnostics and therapeutics. However, despite a steady increase in the number of phage sequences in the public databases, boosted by the next-generation sequencing technologies, few functional genomics studies of bacteriophages have been conducted. Our definition of 'functional genomics' encompasses a range of aspects: phage genome sequencing, annotation and ascribing functions to phage genes, prophage identification in bacterial sequences, elucidating the events in various stages of phage life cycle using genomic, transcriptomic and proteomic approaches, defining the mechanisms of host takeover including specific bacterial-phage protein interactions and identifying virulence and other adaptive features encoded by phages and finally, using prophage genomic information for bacterial detection/diagnostics. Given the breadth and depth of this definition and the fact that some of these aspects (especially phage-encoded virulence/adaptive features) have been treated extensively in other reviews, we restrict our focus only on certain aspects. These include phage genome sequencing and annotation, identification of prophages in bacterial sequences and genetic characterization of phages, functional genomics of the infection process and finally, bacterial identification using genomic information. PMID:23520178

  5. An Autonomous Wearable System for Predicting and Detecting Localised Muscle Fatigue

    Directory of Open Access Journals (Sweden)

    Martin Colley

    2011-01-01

    Full Text Available Muscle fatigue is an established area of research and various types of muscle fatigue have been clinically investigated in order to fully understand the condition. This paper demonstrates a non-invasive technique used to automate the fatigue detection and prediction process. The system utilises the clinical aspects such as kinematics and surface electromyography (sEMG of an athlete during isometric contractions. Various signal analysis methods are used illustrating their applicability in real-time settings. This demonstrated system can be used in sports scenarios to promote muscle growth/performance or prevent injury. To date, research on localised muscle fatigue focuses on the clinical side and lacks the implementation for detecting/predicting localised muscle fatigue using an autonomous system. Results show that automating the process of localised muscle fatigue detection/prediction is promising. The autonomous fatigue system was tested on five individuals showing 90.37% accuracy on average of correct classification and an error of 4.35% in predicting the time to when fatigue will onset.

  6. Automatic detection and classification of obstacles with applications in autonomous mobile robots

    Science.gov (United States)

    Ponomaryov, Volodymyr I.; Rosas-Miranda, Dario I.

    2016-04-01

    Hardware implementation of an automatic detection and classification of objects that can represent an obstacle for an autonomous mobile robot using stereo vision algorithms is presented. We propose and evaluate a new method to detect and classify objects for a mobile robot in outdoor conditions. This method is divided in two parts, the first one is the object detection step based on the distance from the objects to the camera and a BLOB analysis. The second part is the classification step that is based on visuals primitives and a SVM classifier. The proposed method is performed in GPU in order to reduce the processing time values. This is performed with help of hardware based on multi-core processors and GPU platform, using a NVIDIA R GeForce R GT640 graphic card and Matlab over a PC with Windows 10.

  7. Identification of Pathogens Caused Eucalyptus spp. Die-back from Guangxi Zhuang Autonomous Region%广西桉树梢枯病病原菌鉴定

    Institute of Scientific and Technical Information of China (English)

    廖旺姣; 邹东霞; 黄乃秀; 薛振南; 吴耀军; 朱英芝

    2012-01-01

    The aim was to identify the pathogens caused Eucalyptus spp. die-back disease from Guangxi Zhuang Autonomous Region. [Method] After pathogen caused Eucalyptus spp. die-back disease in Hechi, Nanning, Chongzuo, Baise and Wuzhou in Guangxi Zhuang Autonomous Region was collected and isolated, pathogenicity test and species identification were performed. [ Result ] Lasiodiplodia theobromae, Neojusicoccumparvum and Cryptospotiopsis sp. were responsible for the disease. [Conclusion] The research provides reference for the effective control of Eucalyptus spp. die-back disease.%[目的]鉴定引起广西按树梢枯病的病原菌.[方法]对近年发生在广西河池、南宁、崇左、百色、梧州等地的桉树梢枯病进行了采样调查、病原菌分离、致病性测定及种类鉴定.[结果]可可毛色二孢[Lasiodiplodia theobromae(Pat) Griffon&Maubl]、新壳梭孢[Neofusicoccum parvum(Pennycook&Samuels) Crous,Slippers&A.J.L Phillips]和拟隐孢壳菌(Cryptospotiopsis sp.Bub.et Kabat)均可导致桉树梢枯病的发生.[结论]为桉树梢枯病的有效防治提供了依据.

  8. Detecting marine hazardous substances and organisms: sensors for pollutants, toxins, and pathogens

    Directory of Open Access Journals (Sweden)

    O. Zielinski

    2009-09-01

    Full Text Available Marine environments are influenced by a wide diversity of anthropogenic and natural substances and organisms that may have adverse effects on human health and ecosystems. Real-time measurements of pollutants, toxins, and pathogens across a range of spatial scales are required to adequately monitor these hazards, manage the consequences, and to understand the processes governing their magnitude and distribution. Significant technological advancements have been made in recent years for the detection and analysis of such marine hazards. In particular, sensors deployed on a variety of mobile and fixed-point observing platforms provide a valuable means to assess hazards. In this review, we present state-of-the-art of sensor technology for the detection of harmful substances and organisms in the ocean. Sensors are classified by their adaptability to various platforms, addressing large, intermediate, or small areal scales. Current gaps and future demands are identified with an indication of the urgent need for new sensors to detect marine hazards at all scales in autonomous real-time mode. Progress in sensor technology is expected to depend on the development of small-scale sensor technologies with a high sensitivity and specificity towards target analytes or organisms. However, deployable systems must comply with platform requirements as these interconnect the three areal scales. Future developments will include the integration of existing methods into complex and operational sensing systems for a comprehensive strategy for long-term monitoring. The combination of sensor techniques on all scales will remain crucial for the demand of large spatial and temporal coverage.

  9. Detecting marine hazardous substances and organisms: sensors for pollutants, toxins, and pathogens

    Directory of Open Access Journals (Sweden)

    O. Zielinski

    2009-05-01

    Full Text Available Marine environments are influenced by a wide diversity of anthropogenic and natural substances and organisms that may have adverse effects on human health and ecosystems. Real-time measurements of pollutants, toxins, and pathogens across a range of spatial scales are required to adequately monitor these hazards, manage the consequences, and to understand the processes governing their magnitude and distribution. Significant technological advancements have been made in recent years for the detection and analysis of such marine hazards. In particular, sensors deployed on a variety of mobile and fixed-point observing platforms provide a valuable means to assess hazards. In this review, we present state-of-the-art of sensor technology for the detection of harmful substances and organisms in the ocean. Sensors are classified by their adaptability to various platforms, addressing large, intermediate, or small areal scales. Current gaps and future demands are identified with an indication of the urgent need for new sensors to detect marine hazards at all scales in autonomous real-time mode. Progress in sensor technology is expected to depend on the development of small-scale sensor technologies with a high sensitivity and specificity towards target analytes or organisms. However, deployable systems must comply with platform requirements as these interconnect the three areal scales. Future developments will include the integration of existing methods into complex and operational sensing systems for a comprehensive strategy for long-term monitoring. The combination of sensor techniques on all scales will remain crucial for the demand of large spatial and temporal coverage.

  10. A Multiplexed Diagnostic Platform for Point-of-Care Pathogen Detection

    Energy Technology Data Exchange (ETDEWEB)

    Regan, J F; Letant, S E; Adams, K L; Mahnke, R C; Nguyen, N T; Dzenitis, J M; Hindson, B J; Hadley, D R; Makarewicz, T J; Henderer, B D; Breneman, J W; Tammero, L F; Ortiz, J I; Derlet, R W; Cohen, S; Colston, W W; McBride, M T; Birch, J M

    2008-02-04

    We developed an automated point-of-care diagnostic instrument that is capable of analyzing nasal swab samples for the presence of respiratory diseases. This robust instrument, called FluIDx, performs autonomous multiplexed RT-PCR reactions that are analyzed by microsphere xMAP technology. We evaluated the performance of FluIDx, in comparison rapid tests specific for influenza and respiratory syncytial virus, in a clinical study performed at the UC Davis Medical Center. The clinical study included samples positive for RSV (n = 71), influenza A (n = 16), influenza B (n = 4), adenovirus (n = 5), parainfluenza virus (n = 2), and 44 negative samples, according to a composite reference method. FluIDx and the rapid tests detected 85.9% and 62.0% of the RSV positive samples, respectively. Similar sensitivities were recorded for the influenza B samples; whereas the influenza A samples were poorly detected, likely due to the utilization of an influenza A signature that did not accurately match currently circulating influenza A strains. Data for all pathogens were compiled and indicate that FluIDx is more sensitive than the rapid tests, detecting 74.2% (95% C.I. of 64.7-81.9%) of the positive samples in comparison to 53.6% (95% C.I. of 43.7-63.2%) for the rapid tests. The higher sensitivity of FluIDx was partially offset by a lower specificity, 77.3% versus 100.0%. Overall, these data suggest automated flow-through PCR-based instruments that perform multiplexed assays can successfully screen clinical samples for infectious diseases.

  11. Detection and avoidance of simulated potholes in autonomous vehicle navigation in an unstructured environment

    Science.gov (United States)

    Karuppuswamy, Jaiganesh; Selvaraj, Vishnuvardhanaraj; Ganesh, Meyyappa M.; Hall, Ernest L.

    2000-10-01

    In the navigation of an autonomous vehicle, tracking and avoidance of the obstacles presents an interesting problem as this involves the integration of the vision and the motion systems. In an unstructured environment, the problem becomes much more severe as the obstacles have to be clearly recognized for any decisive action to be taken. In this paper, we discuss a solution to detection and avoidance of simulated potholes in the path of an autonomous vehicle operating in an unstructured environment. Pothole avoidance may be considered similar to other obstacle avoidance except that the potholes are depressions rather than extrusions form a surface. A non-contact vision approach has been taken since potholes usually are significantly different visually from a background surface. Large potholes more than 2 feet in diameter will be detected. Furthermore, only white potholes will be detected on a background of grass, asphalt, sand or green painted bridges. The signals from the environment are captured by the vehicle's vision systems and pre-processed appropriately. A histogram is used to determine a brightness threshold to determine if a pothole is within the field of view. Then, a binary image is formed. Regions are then detected in the binary image. Regions that have a diameter close to 2 feet and a ratio of circumference to diameter close to pi are considered potholes. The neuro-fuzzy logic controller where navigational strategies are evaluated uses these signals to decide a final course of navigation. The primary significance of the solution is that it is interfaced seamlessly into the existing central logic controller. The solution can also be easily extended to detect and avoid any two dimensional shape.

  12. Medium-resolution autonomous in situ gamma detection system for marine and coastal waters

    International Nuclear Information System (INIS)

    We are developing a medium-resolution autonomous in situ gamma detection system for marine and coastal waters. The system is designed to extract and preconcentrate isotopes of interest from natural waters prior to detection in order to eliminate signal attenuation of the gamma rays traveling through water and lower the overall background from the presence of naturally occurring radioactive isotopes (40K and U-Th series radionuclides). Filtration is used to preconcentrate target isotopes residing on suspended particles, while chemosorption is employed to preferentially extract truly dissolved components from the water column. Used filter and chemosorbent media will be counted autonomously using two LaBr3 detectors in a near 4-π configuration around the samples. A compact digital pulse processing system, developed in-house and capable of running in coincidence mode, is used to process the signal from the detectors to a small on-board computer. The entire system is extremely compact (9' dia. x 30' len.) and platform independent, but designed for initial deployment on a research buoy. A variety of commercial and in-house nano-porous chemosorbents have been selected, procured or produced, and these and filter and detector components have been tested. (author)

  13. Autonomous absolute calibration of an ICCD camera in single-photon detection regime

    CERN Document Server

    Qi, Luo; Leuchs, Gerd; Chekhova, Maria V

    2016-01-01

    Intensified charge coupled device (ICCD) cameras are widely used in various applications such as microscopy, astronomy, spectroscopy. Often they are used as single-photon detectors, with thresholding being an essential part of the readout. In this paper, we measure the quantum efficiency of an ICCD camera in the single-photon detection mode using the Klyshko absolute calibration technique. The quantum efficiency is obtained as a function of the threshold value and of the wavelength of the detected light. In addition, we study the homogeneity of the photon sensitivity over the camera chip area. The experiment is performed in the autonomous regime, without using any additional detectors. We therefore demonstrate the self-calibration of an ICCD camera.

  14. A microarray approach for simultaneous detection of multiple pathogens in food

    Science.gov (United States)

    A pathogen detection microarray was developed for simultaneous detection of the four most prominent foodborne pathogens including Escherichia coli O157:H7, Salmonella enterica, Listeria monocytogenes and Campylobacter jejuni. The approach utilized 14 species-specific gene targets to design a variety...

  15. Characterization of novel sufraces by FTIR spectroscopy and atomic force microscopy for food pathogen detection

    Science.gov (United States)

    Single molecular detection of pathogens and toxins of interest to food safety is within grasp using technology such as Atomic Force Microscopy. Using antibodies or specific aptamers connected to the AFM tip make it possible to detect a pathogen molecule on a surface. However, it also becomes necess...

  16. 9 CFR 113.37 - Detection of pathogens by the chicken embryo inoculation test.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Detection of pathogens by the chicken... VECTORS STANDARD REQUIREMENTS Standard Procedures § 113.37 Detection of pathogens by the chicken embryo...-serum mixture shall be inoculated into each of at least 20 fully susceptible chicken embryos. (1)...

  17. 9 CFR 113.36 - Detection of pathogens by the chicken inoculation test.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Detection of pathogens by the chicken... REQUIREMENTS Standard Procedures § 113.36 Detection of pathogens by the chicken inoculation test. The test for...,000 doses. (b) At least 25 healthy susceptible young chickens, properly identified and obtained...

  18. Robust and Real Time Detection of Curvy Lanes (Curves) with Desired Slopes for Driving Assistance and Autonomous Vehicles

    OpenAIRE

    Dubey, Amartansh; Bhurchandi, K. M.

    2015-01-01

    One of the biggest reasons for road accidents is curvy lanes and blind turns. Even one of the biggest hurdles for new autonomous vehicles is to detect curvy lanes, multiple lanes and lanes with a lot of discontinuity and noise. This paper presents very efficient and advanced algorithm for detecting curves having desired slopes (especially for detecting curvy lanes in real time) and detection of curves (lanes) with a lot of noise, discontinuity and disturbances. Overall aim is to develop robus...

  19. Hand-eye LRF-based Iterative Plane Detection Method for Autonomous Robotic Welding

    Directory of Open Access Journals (Sweden)

    Sungmin Lee

    2015-12-01

    Full Text Available This paper proposes a hand-eye LRF-based (laser range finder welding plane-detection method for autonomous robotic welding in the field of shipbuilding. The hand-eye LRF system consists of a 6 DOF manipulator and an LRF attached to the wrist of the manipulator. The welding plane is detected by the LRF with only the wrist’s rotation to minimize a mechanical error caused by the manipulator’s motion. A position on the plane is determined as an average position of the detected points on the plane, and a normal vector to the plane is determined by applying PCA (principal component analysis to the detected points. In this case, the accuracy of the detected plane is analysed by simulations with respect to the wrist’s angle interval and the plane angle. As a result of the analysis, an iterative plane-detection method with the manipulator’s alignment motion is proposed to improve the performance of plane detection. For verifying the feasibility and effectiveness of the proposed plane-detection method, experiments are carried out with a prototype of the hand-eye LRF-based system, which consists of a 1 DOF wrist’s joint, an LRF system and a rotatable plane. In addition, the experimental results of the PCA-based plane detection method are compared with those of the two representative plane-detection methods, based on RANSAC (RANdom SAmple Consensus and the 3D Hough transform in both accuracy and computation time’s points of view.

  20. Bio-Inspired Autonomous Communications Systems with Anomaly Detection Monitoring Project

    Data.gov (United States)

    National Aeronautics and Space Administration — We propose to develop and demonstrate BioComm, a bio-inspired autonomous communications system (ACS) aimed at dynamically reconfiguring and redeploying autonomous...

  1. 360-Degree Visual Detection and Target Tracking on an Autonomous Surface Vehicle

    Science.gov (United States)

    Wolf, Michael T; Assad, Christopher; Kuwata, Yoshiaki; Howard, Andrew; Aghazarian, Hrand; Zhu, David; Lu, Thomas; Trebi-Ollennu, Ashitey; Huntsberger, Terry

    2010-01-01

    This paper describes perception and planning systems of an autonomous sea surface vehicle (ASV) whose goal is to detect and track other vessels at medium to long ranges and execute responses to determine whether the vessel is adversarial. The Jet Propulsion Laboratory (JPL) has developed a tightly integrated system called CARACaS (Control Architecture for Robotic Agent Command and Sensing) that blends the sensing, planning, and behavior autonomy necessary for such missions. Two patrol scenarios are addressed here: one in which the ASV patrols a large harbor region and checks for vessels near a fixed asset on each pass and one in which the ASV circles a fixed asset and intercepts approaching vessels. This paper focuses on the ASV's central perception and situation awareness system, dubbed Surface Autonomous Visual Analysis and Tracking (SAVAnT), which receives images from an omnidirectional camera head, identifies objects of interest in these images, and probabilistically tracks the objects' presence over time, even as they may exist outside of the vehicle's sensor range. The integrated CARACaS/SAVAnT system has been implemented on U.S. Navy experimental ASVs and tested in on-water field demonstrations.

  2. Canine Detection of the Volatilome: A Review of Implications for Pathogen and Disease Detection

    Science.gov (United States)

    Angle, Craig; Waggoner, Lowell Paul; Ferrando, Arny; Haney, Pamela; Passler, Thomas

    2016-01-01

    The volatilome is the entire set of volatile organic compounds (VOC) produced by an organism. The accumulation of VOC inside and outside of the body reflects the unique metabolic state of an organism. Scientists are developing technologies to non-invasively detect VOC for the purposes of medical diagnosis, therapeutic monitoring, disease outbreak containment, and disease prevention. Detection dogs are proven to be a valuable real-time mobile detection technology for the detection of VOC related to explosives, narcotics, humans, and many other targets of interests. Little is known about what dogs are detecting when searching for biological targets. It is important to understand where biological VOC originates and how dogs might be able to detect biological targets. This review paper discusses the recent scientific literature involving VOC analysis and postulates potential biological targets for canine detection. Dogs have shown their ability to detect pathogen and disease-specific VOC. Future research will determine if dogs can be employed operationally in hospitals, on borders, in underserved areas, on farms, and in other operational environments to give real-time feedback on the presence of a biological target. PMID:27446935

  3. Autonomous detection and anticipation of jam fronts from messages propagated by inter-vehicle communication

    CERN Document Server

    Sch"onhof, M; Kesting, A; Helbing, D; Sch\\"onhof, Martin; Treiber, Martin; Kesting, Arne; Helbing, Dirk

    2006-01-01

    In this paper, a minimalist, completely distributed freeway traffic information system is introduced. It involves an autonomous, vehicle-based jam front detection, the information transmission via inter-vehicle communication, and the forecast of the spatial position of jam fronts by reconstructing the spatiotemporal traffic situation based on the transmitted information. The whole system is simulated with an integrated traffic simulator, that is based on a realistic microscopic traffic model for longitudinal movements and lane changes. The function of its communication module has been explicitly validated by comparing the simulation results with analytical calculations. By means of simulations, we show that the algorithms for a congestion-front recognition, message transmission, and processing predict reliably the existence and position of jam fronts for vehicle equipment rates as low as 3%. A reliable mode of operation already for small market penetrations is crucial for the successful introduction of inter-...

  4. Pathogen detection in milk samples by ligation detection reaction-mediated universal array method.

    Science.gov (United States)

    Cremonesi, P; Pisoni, G; Severgnini, M; Consolandi, C; Moroni, P; Raschetti, M; Castiglioni, B

    2009-07-01

    This paper describes a new DNA chip, based on the use of a ligation detection reaction coupled to a universal array, developed to detect and analyze, directly from milk samples, microbial pathogens known to cause bovine, ovine, and caprine mastitis or to be responsible for foodborne intoxication or infection, or both. Probes were designed for the identification of 15 different bacterial groups: Staphylococcus aureus, Streptococcus agalactiae, nonaureus staphylococci, Streptococcus bovis, Streptococcus equi, Streptococcus canis, Streptococcus dysgalactiae, Streptococcus parauberis, Streptococcus uberis, Streptococcus pyogenes, Mycoplasma spp., Salmonella spp., Bacillus spp., Campylobacter spp., and Escherichia coli and related species. These groups were identified based on the 16S rRNA gene. For microarray validation, 22 strains from the American Type Culture Collection or other culture collections and 50 milk samples were tested. The results demonstrated high specificity, with sensitivity as low as 6 fmol. Moreover, the ligation detection reaction-universal array assay allowed for the identification of Mycoplasma spp. in a few hours, avoiding the long incubation times of traditional microbiological identification methods. The universal array described here is a versatile tool able to identify milk pathogens efficiently and rapidly. PMID:19528580

  5. Robust and Real Time Detection of Curvy Lanes (Curves) Having Desired Slopes for Driving Assistance and Autonomous Vehicles

    OpenAIRE

    Amartansh Dubey; Bhurchandi, K. M.

    2015-01-01

    One of the biggest reasons for road accidents is cu rvy lanes and blind turns. Even one of the biggest hurdles for new autonomous vehicles is to d etect curvy lanes, multiple lanes and lanes with a lot of discontinuity and noise. This paper p resents very efficient and advanced algorithm for detecting curves having desired slopes (especia lly for detecting curvy lanes in real time) and detection of curves (lanes) with a lot of no...

  6. Engineered nanoconstructs for the multiplexed and sensitive detection of high-risk pathogens

    Science.gov (United States)

    Seo, Youngmin; Kim, Ji-Eun; Jeong, Yoon; Lee, Kwan Hong; Hwang, Jangsun; Hong, Jongwook; Park, Hansoo; Choi, Jonghoon

    2016-01-01

    Many countries categorize the causative agents of severe infectious diseases as high-risk pathogens. Given their extreme infectivity and potential to be used as biological weapons, a rapid and sensitive method for detection of high-risk pathogens (e.g., Bacillus anthracis, Francisella tularensis, Yersinia pestis, and Vaccinia virus) is highly desirable. Here, we report the construction of a novel detection platform comprising two units: (1) magnetic beads separately conjugated with multiple capturing antibodies against four different high-risk pathogens for simple and rapid isolation, and (2) genetically engineered apoferritin nanoparticles conjugated with multiple quantum dots and detection antibodies against four different high-risk pathogens for signal amplification. For each high-risk pathogen, we demonstrated at least 10-fold increase in sensitivity compared to traditional lateral flow devices that utilize enzyme-based detection methods. Multiplexed detection of high-risk pathogens in a sample was also successful by using the nanoconstructs harboring the dye molecules with fluorescence at different wavelengths. We ultimately envision the use of this novel nanoprobe detection platform in future applications that require highly sensitive on-site detection of high-risk pathogens.

  7. A Selective Chromogenic Plate, YECA, for the Detection of Pathogenic Yersinia enterocolitica: Specificity, Sensitivity, and Capacity to Detect Pathogenic Y. enterocolitica from Pig Tonsils

    Directory of Open Access Journals (Sweden)

    M. Denis

    2011-01-01

    Full Text Available A new selective chromogenic plate, YECA, was tested for its specificity, sensitivity, and accuracy to detect pathogenic Y. enterocolitica from pig tonsils. We tested a panel of 26 bacterial strains on YECA and compared it to PCA, CIN, and YeCM media. Detection of pathogenic Y. enterocolitica was carried out on 50 pig tonsils collected in one slaughter house. Enrichment was done in PSB and ITC broths. Streaking on YECA and CIN was done in direct, after 24H incubation of ITC, after 48H incubation of PSB and ITC. All the plates were incubated at 30∘C during 24 hours. Presence of typical colonies on CIN and YECA was checked, and isolates were biotyped. Pathogenic Y. enterocolitica strains showed an important growth on YECA with small and red fuchsia colonies while biotype 1A exhibited very few violet colonies. Enrichment in ITC during 48H gave the best performance for detecting positive samples in pathogenic Y. enterocolitica, and YECA could detect directly pathogenic Y. enterocolitica strains (2, 3, and 4. Use of YECA in combination with ITC generates a time-saver by giving a positive test in 72H.

  8. Fluorescence techniques to detect and to assess viability of plant pathogenic bacteria

    NARCIS (Netherlands)

    Chitarra, L.G.

    2001-01-01

    Plant pathogenic bacteria cause major economic losses in commercial crop production worldwide every year. The current methods used to detect and to assess the viability of bacterial pathogens and to test seed lots or plants for contamination are usually based on plate assays or on serological techni

  9. Hyperspectral imaging using a color camera and its application for pathogen detection

    Science.gov (United States)

    This paper reports the results of a feasibility study for the development of a hyperspectral image recovery (reconstruction) technique using a RGB color camera and regression analysis in order to detect and classify colonies of foodborne pathogens. The target bacterial pathogens were the six represe...

  10. Metagenomic analysis for detecting pathogens in culture-negative infective endocarditis.

    Science.gov (United States)

    Fukui, Yuto; Aoki, Kotaro; Okuma, Shinnosuke; Sato, Takahiro; Ishii, Yoshikazu; Tateda, Kazuhiro

    2015-12-01

    Pathogen identification is important for proper diagnosis and optimal treatment of infective endocarditis (IE). Blood and valve cultures are the gold standard for detecting pathogens responsible for IE. However, these tests only detect culturable pathogens, and have low sensitivity, especially in patients previously treated with antibiotics. Culture-negative IE is still a major clinical problem and a diagnostic challenge. Recently, metagenomic analysis using next generation sequencing has been used to detect pathogens directly from clinical samples. However, there are very few reports of the use of metagenomic analysis for pathogen identification in culture-negative IE cases and the usefulness of this new method is unknown. Here, we report a case of successful pathogen detection with metagenomic analysis in a patient of culture-negative IE. The patient underwent valve replacement surgery and received antibiotics for 5 weeks and survived. Using metagenomic analysis of resected vegetation, we detected Abiotrophia defectiva, which is often associated with culture-negative IE due to its fastidious growth. This method may be useful for pathogen identification in future cases of culture-negative IE.

  11. Molecular detection of bacterial pathogens using microparticle enhanced double-stranded DNA probes.

    Science.gov (United States)

    Riahi, Reza; Mach, Kathleen E; Mohan, Ruchika; Liao, Joseph C; Wong, Pak Kin

    2011-08-15

    Rapid, specific, and sensitive detection of bacterial pathogens is essential toward clinical management of infectious diseases. Traditional approaches for pathogen detection, however, often require time-intensive bacterial culture and amplification procedures. Herein, a microparticle enhanced double-stranded DNA probe is demonstrated for rapid species-specific detection of bacterial 16S rRNA. In this molecular assay, the binding of the target sequence to the fluorophore conjugated probe thermodynamically displaces the quencher probe and allows the fluorophore to fluoresce. By incorporation of streptavidin-coated microparticles to localize the biotinylated probes, the sensitivity of the assay can be improved by 3 orders of magnitude. The limit of detection of the assay is as few as eight bacteria without target amplification and is highly specific against other common pathogens. Its applicability toward clinical diagnostics is demonstrated by directly identifying bacterial pathogens in urine samples from patients with urinary tract infections.

  12. DETECTION AND IDENTIFICATION OF PATHOGENIC CANDIDA SPECIES IN WATER USING FLOW CYTOMETRY COUPLED WITH TAQMAN PCR

    Science.gov (United States)

    As the incidence of human fungal infection increases, the ability to detect and identify pathogenic fungi in potential environmental reservoirs becomes increasingly important for disease control. PCR based assays are widely used for diagnostic purposes, but may be inadequate for...

  13. Damage detection in composite structures using autonomous wireless systems: simulation and validation

    Energy Technology Data Exchange (ETDEWEB)

    Dumas, D; Lani, F [Cenaero, Centre de Recherche en Aeronautique, 29 Rue des freres Wright, B-6041 Gosselies (Belgium); Monnier, T [Universite de Lyon, INSA-Lyon, F-69621, Villeurbanne cedex (France); Smaili, R; Loyer, J, E-mail: david.dumas@cenaero.be [GOODRICH Actuation Systems, 106 Rue Fourny, F-78530, Buc (France)

    2011-07-19

    In the European FP6 project ADVICE, units that harvest energy from structural vibrations have been developed. These autonomous units are capable of wireless communication and are used as actuators of guided ultrasonic waves used to identify changes in structural behaviour. The growing use of composite structures in aeronautics brings new challenges to be able to predict and detect damage that may occur in these new materials. Part of the ADVICE project focused on studying the possibilities of damage detection in structures using Lamb waves. In order to do this, finite element simulations were performed and were compared with experimental data. This paper presents the finite element simulations performed to predict the behaviour of a structural health monitoring system. Using the technique and algorithms developed to quantify the amount of damage, we compare the numerical results to those that were obtained experimentally on a small representative composite structure. This allows evaluating how it is possible to design a monitoring system for composite structures and what needs to be addressed in the future.

  14. Fully Autonomous Multiplet Event Detection: Application to Local-Distance Monitoring of Blood Falls Seismicity

    Energy Technology Data Exchange (ETDEWEB)

    Carmichael, Joshua Daniel [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Carr, Christina [Univ. of Alaska, Fairbanks, AK (United States); Pettit, Erin C. [Univ. of Alaska, Fairbanks, AK (United States)

    2015-06-18

    We apply a fully autonomous icequake detection methodology to a single day of high-sample rate (200 Hz) seismic network data recorded from the terminus of Taylor Glacier, ANT that temporally coincided with a brine release episode near Blood Falls (May 13, 2014). We demonstrate a statistically validated procedure to assemble waveforms triggered by icequakes into populations of clusters linked by intra-event waveform similarity. Our processing methodology implements a noise-adaptive power detector coupled with a complete-linkage clustering algorithm and noise-adaptive correlation detector. This detector-chain reveals a population of 20 multiplet sequences that includes ~150 icequakes and produces zero false alarms on the concurrent, diurnally variable noise. Our results are very promising for identifying changes in background seismicity associated with the presence or absence of brine release episodes. We thereby suggest that our methodology could be applied to longer time periods to establish a brine-release monitoring program for Blood Falls that is based on icequake detections.

  15. A Monocular Vision Sensor-Based Obstacle Detection Algorithm for Autonomous Robots

    Science.gov (United States)

    Lee, Tae-Jae; Yi, Dong-Hoon; Cho, Dong-Il “Dan”

    2016-01-01

    This paper presents a monocular vision sensor-based obstacle detection algorithm for autonomous robots. Each individual image pixel at the bottom region of interest is labeled as belonging either to an obstacle or the floor. While conventional methods depend on point tracking for geometric cues for obstacle detection, the proposed algorithm uses the inverse perspective mapping (IPM) method. This method is much more advantageous when the camera is not high off the floor, which makes point tracking near the floor difficult. Markov random field-based obstacle segmentation is then performed using the IPM results and a floor appearance model. Next, the shortest distance between the robot and the obstacle is calculated. The algorithm is tested by applying it to 70 datasets, 20 of which include nonobstacle images where considerable changes in floor appearance occur. The obstacle segmentation accuracies and the distance estimation error are quantitatively analyzed. For obstacle datasets, the segmentation precision and the average distance estimation error of the proposed method are 81.4% and 1.6 cm, respectively, whereas those for a conventional method are 57.5% and 9.9 cm, respectively. For nonobstacle datasets, the proposed method gives 0.0% false positive rates, while the conventional method gives 17.6%. PMID:26938540

  16. Integrating disparity and edge detection algorithms to autonomously follow linear-shaped structures at low altitude

    NARCIS (Netherlands)

    C.R. Verschoor; A. Visser

    2013-01-01

    One of the main requirements in enabling autonomous flight of Micro Aerial Vehicles is the ability of autonomous navigation. One possible solution to solve this navigation problem is to use vision-based line-following algorithms. Such vision-based algorithm could rely on the various linear structure

  17. Phage-amplified bioluminescent bioreporters for the detection of foodborne pathogens

    Science.gov (United States)

    Ripp, Steven; Young, Jacque C.; Ozen, Aysu; Jegier, Patricia; Johnson, Courtney; Daumer, Kathleen; Garland, Jay; Sayler, Gary S.

    2004-06-01

    The objective of this investigation is to develop a bioluminescent bioreporter system for the detection and monitoring of pathogenic microbial species. Current detection methodologies typically rely on time-consuming sample pre-enrichment steps to elevate pathogen concentrations to detectable levels or DNA based polymerase chain reaction (PCR) techniques that require extensive user training and expensive instrumentation. Detection utilizing bioluminescent bioreporter organisms, however, can provide a simple and rapid means of monitoring foodborne pathogens. Bioluminescent bioreporters are engineered to produce light in response to specific environmental inducers. The light signal is then measured with photodetector devices to generate a quantitative assessment of inducer concentration. The immediate goal of this research effort is to integrate key quorum sensing signal transduction elements into pathogen specific bacteriophages. Upon infection of a unique pathogenic species by the bacteriophages, quorum sensing signals will be generated that will subsequently stimulate bioluminescence in neighboring bioluminescent bioreporter cells. Utilizing both bacteriophages and bioluminescent bioreporters, we realize exceptional pathogen specificity while attaining enhanced bioluminescence production. This integrative approach will lead to rapid pathogen identification without requisite sample pre-enrichment. Additionally, since the bioluminescent response is completely intrinsic to the bioreporter organism, no user interventions are required for generating light signals; the protocol requires only addition of the food sample with the bacteriophage/bioluminescent bioreporter system. Measurement of light responses can be achieved using high-throughput microtiter plate readers, hand-held photomultiplier units, or microchip luminometers.

  18. Evaluation of autonomous recording units for detecting 3 species of secretive marsh birds

    Science.gov (United States)

    Sidie-Slettehahl, Anna M.; Jensen, Kent C.; Johnson, Rex R.; Arnold, Todd W.; Austin, Jane; Stafford, Joshua D.

    2015-01-01

    Population status and habitat use of yellow rails (Coturnicops noveboracensis), Nelson's sparrows (Ammodramus nelsoni), and Le Conte's sparrows (A. leconteii) are poorly known, so standardized surveys of these species are needed to inform conservation planning and management. A protocol for monitoring secretive marsh birds exists; however, these species regularly call at night and may be missed during early morning surveys. We tested the effectiveness of autonomous recording units (hereafter, recording units) to survey these species by analyzing recorded vocalizations using bioacoustics software. We deployed 22 recording units at 54 sites in northern Minnesota and eastern North Dakota, USA, and conducted traditional broadcast surveys during May–June, 2010 and 2011. We compared detection probabilities between recording units and standard monitoring protocols using robust-design occupancy models. On average, recording units detected 0.59 (SE = 0.11) fewer Le Conte's sparrows, 0.76 (SE = 0.15) fewer Nelson's sparrows, and 1.01 (SE = 0.14) fewer yellow rails per survey than were detected using the standard protocol. Detection probabilities using the standard protocol averaged 0.95 (yellow rail; 95% CI = 0.86–0.98), 0.93 (Le Conte's sparrow; 95% CI = 0.78–0.98), and 0.89 (Nelson's sparrow; 95% CI = 0.56–0.98), but averaged 0.71 (yellow rail; 95% CI = 0.56–0.83), 0.61 (Le Conte's sparrow; 95% CI = 0.42–0.78), and 0.51 (Nelson's sparrow; 95% CI = 0.19–0.82) using recording units. Reduced detection by recording units was likely due to the ability of human listeners to identify birds calling at greater distances. Recording units may be effective for surveying nocturnal secretive marsh birds if investigators correct for differential detectability. Reduced detectability may be outweighed by the increased spatial and temporal coverage feasible with recording units.

  19. Rapid Methods for the Detection of Foodborne Bacterial Pathogens: Principles, Applications, Advantages and Limitations

    Directory of Open Access Journals (Sweden)

    Law eJodi Woan-Fei

    2015-01-01

    Full Text Available The incidence of foodborne diseases has increased over the years and resulted in major public health problem globally. Foodborne pathogens can be found in various foods and it is important to detect foodborne pathogens to provide safe food supply and to prevent foodborne diseases. The conventional methods used to detect foodborne pathogen are time consuming and laborious. Hence, a variety of methods have been developed for rapid detection of foodborne pathogens as it is required in many food analyses. Rapid detection methods can be categorized into nucleic acid-based, biosensor-based and immunological-based methods. This review emphasizes on the principles and application of recent rapid methods for the detection of foodborne bacterial pathogens. Detection methods included are simple polymerase chain reaction (PCR, multiplex PCR, real-time PCR, nucleic acid sequence-based amplification (NASBA, loop-mediated isothermal amplification (LAMP and oligonucleotide DNA microarray which classified as nucleic acid-based methods; optical, electrochemical and mass-based biosensors which classified as biosensor-based methods; enzyme-linked immunosorbent assay (ELISA and lateral flow immunoassay which classified as immunological-based methods. In general, rapid detection methods are generally time-efficient, sensitive, specific and labor-saving. The developments of rapid detection methods are vital in prevention and treatment of foodborne diseases.

  20. Sensor fusion: lane marking detection and autonomous intelligent cruise control system

    Science.gov (United States)

    Baret, Marc; Baillarin, S.; Calesse, C.; Martin, Lionel

    1995-12-01

    In the past few years MATRA and RENAULT have developed an Autonomous Intelligent Cruise Control (AICC) system based on a LIDAR sensor. This sensor incorporating a charge coupled device was designed to acquire pulsed laser diode emission reflected by standard car reflectors. The absence of moving mechanical parts, the large field of view, the high measurement rate and the very good accuracy for distance range and angular position of targets make this sensor very interesting. It provides the equipped car with the distance and the relative speed of other vehicles enabling the safety distance to be controlled by acting on the throttle and the automatic gear box. Experiments in various real traffic situations have shown the limitations of this kind of system especially on bends. All AICC sensors are unable to distinguish between a bend and a change of lane. This is easily understood if we consider a road without lane markings. This fact has led MATRA to improve its AICC system by providing the lane marking information. Also in the scope of the EUREKA PROMETHEUS project, MATRA and RENAULT have developed a lane keeping system in order to warn of the drivers lack of vigilance. Thus, MATRA have spread this system to far field lane marking detection and have coupled it with the AICC system. Experiments will be carried out on roads to estimate the gain in performance and comfort due to this fusion.

  1. Detection of Foodborne Pathogenic Bacteria using Bacteriophage Tail Spike Proteins

    Science.gov (United States)

    Poshtiban, Somayyeh

    Foodborne infections are worldwide health problem with tremendous social and financial impacts. Efforts are focused on developing accurate and reliable technologies for detection of food contaminations in early stages preferably on-site. This thesis focuses on interfacing engineering and biology by combining phage receptor binding proteins (RBPs) with engineered platforms including microresonator-based biosensors, magnetic particles and polymerase chain reaction (PCR) to develop bacterial detection sensors. We used phage RBPs as target specific bioreceptors to develop an enhanced microresonator array for bacterial detection. These resonator beams are optimized to feature a high natural frequency while offer large surface area for capture of bacteria. Theoretical analysis indicates a high mass sensitivity with a threshold for the detection of a single bacterial cell. We used phage RBPs as target specific bioreceptors, and successfully demonstrated the application of these phage RBB-immobilized arrays for specific detection of C. jejuni cells. We also developed a RBP-derivatized magnetic pre-enrichment method as an upstream sample preparation method to improve sensitivity and specificity of PCR for detection of bacterial cells in various food samples. The combination of RBP-based magnetic separation and real-time PCR allowed the detection of small number of bacteria in artificially contaminated food samples without any need for time consuming pre-enrichment step through culturing. We also looked into integration of the RBP-based magnetic separation with PCR onto a single microfluidic lab-on-a-chip to reduce the overall turnaround time.

  2. Rapid detection, characterization, and enumeration of foodborne pathogens

    DEFF Research Database (Denmark)

    Hoorfar, Jeffrey

    2011-01-01

    As food safety management further develops, microbiological testing will continue to play an important role in assessing whether Food Safety Objectives are achieved. However, traditional microbiological culture-based methods are limited, particularly in their ability to provide timely data....... The present review discusses the reasons for the increasing interest in rapid methods; current developments in the field, the research needs, and the future trends. The advent of biotechnology has introduced new technologies that led to the emergence of rapid diagnostic methods and altered food testing...... into focus with the 1990s outbreak of bovine spongiform encephalopathy that was linked to the human outbreak of Creutzfeldt Jakob's Disease. Serology is still an important tool in preventing foodborne pathogens to enter the human food supply through meat and milk from animals. One of the primary uses...

  3. Tandem Mass Spectrometry for the Detection of Plant Pathogenic Fungi and the Effects of Database Composition on Protein Inferences

    Science.gov (United States)

    Mass spectrometry has shown potential for identifying and detecting plant pathogens. Unlike antibody-based assays like ELISA, mass spectrometry does not require the use of pathogen-specific reagents for the detection of pathogen-specific proteins and peptides. However, the mass spectrometry appro...

  4. Detection of Multiple Waterborne Pathogens Using Microsequencing Arrays

    Science.gov (United States)

    Aims: A microarray was developed to simultaneously detect Cryptosporidium parvum, Cryptosporidium hominis, Enterococcus faecium, Bacillus anthracis and Francisella tularensis in water. Methods and Results: A DNA microarray was designed to contain probes that specifically dete...

  5. Bacteriophage Amplification-Coupled Detection and Identification of Bacterial Pathogens

    Science.gov (United States)

    Cox, Christopher R.; Voorhees, Kent J.

    Current methods of species-specific bacterial detection and identification are complex, time-consuming, and often require expensive specialized equipment and highly trained personnel. Numerous biochemical and genotypic identification methods have been applied to bacterial characterization, but all rely on tedious microbiological culturing practices and/or costly sequencing protocols which render them impractical for deployment as rapid, cost-effective point-of-care or field detection and identification methods. With a view towards addressing these shortcomings, we have exploited the evolutionarily conserved interactions between a bacteriophage (phage) and its bacterial host to develop species-specific detection methods. Phage amplification-coupled matrix assisted laser desorption time-of-flight mass spectrometry (MALDI-TOF-MS) was utilized to rapidly detect phage propagation resulting from species-specific in vitro bacterial infection. This novel signal amplification method allowed for bacterial detection and identification in as little as 2 h, and when combined with disulfide bond reduction methods developed in our laboratory to enhance MALDI-TOF-MS resolution, was observed to lower the limit of detection by several orders of magnitude over conventional spectroscopy and phage typing methods. Phage amplification has been combined with lateral flow immunochromatography (LFI) to develop rapid, easy-to-operate, portable, species-specific point-of-care (POC) detection devices. Prototype LFI detectors have been developed and characterized for Yersinia pestis and Bacillus anthracis, the etiologic agents of plague and anthrax, respectively. Comparable sensitivity and rapidity was observed when phage amplification was adapted to a species-specific handheld LFI detector, thus allowing for rapid, simple, POC bacterial detection and identification while eliminating the need for bacterial culturing or DNA isolation and amplification techniques.

  6. Detection of the emerging amphibian pathogens Batrachochytrium dendrobatidis and ranavirus in Russia

    Science.gov (United States)

    Reshetnikov, Andrey N.; Chestnut, Tara E.; Brunner, Jesse L.; Charles, Kaylene M.; Nebergall, Emily E.; Olson, Deanna H.

    2014-01-01

    In a population of the European common toad Bufo bufo from a rural pond in the region of Lake Glubokoe Regional Reserve in Moscow province, Russia, unexplained mass mortality events involving larvae and metamorphs have been observed over a monitoring period of >20 yr. We tested toads from this and a nearby site for the emerging amphibian pathogens Batrachochytrium dendrobatidis (Bd) and ranavirus (Rv). Both pathogens were detected, and at the rural pond site, with the above-noted losses and decline in toad breeding success, 40% of B. bufo metamorphs were Bd positive, 46% were Rv positive and 20% were co-infected with both pathogens. Toad metamorphs from a neighbouring water body were also Bd and Rv positive (25 and 55%, respectively). This is the first confirmation of these pathogens in Russia. Questions remain as to the origins of these pathogens in Russia and their roles in documented mass mortality events.

  7. Flash 3D Enhancements for Autonomous Precision Landing and Hazard Detection and Avoidance Project

    Data.gov (United States)

    National Aeronautics and Space Administration — With NASA's exploration initiative to return to Lunar Exploration and eventual human exploration of Mars, NASA has an increased need for advanced Autonomous...

  8. Surface plasmon resonance biosensors for detection of foodborne pathogens and toxins

    Science.gov (United States)

    Homola, Jiří; Hegnerová, Kateřina; Vala, Milan

    2009-02-01

    In the last decade surface plasmon resonance (SPR) biosensors have made great strides both in terms of technology and its applications. SPR biosensors have become a central tool for study of molecular interactions and have been widely used for detection of chemical and biological analytes. Food analysis belongs to major areas of potential applications of SPR biosensors. Therefore, numerous SPR biosensors for detection of analytes implicated in food safety (e.g. pathogens, toxins, drug residues, vitamins, hormones, chemical contaminants, and allergens) have been developed. This paper reviews recent developments in the field of SPR biosensors for food safety, in particular, for detection of foodborne pathogens and toxins.

  9. Recent Advancements in Nanobioassays and Nanobiosensors for Foodborne Pathogenic Bacteria Detection.

    Science.gov (United States)

    Chen, Jing; Park, Bosoon

    2016-06-01

    Bacterial pathogens are one of the leading causes of food safety incidents and product recalls worldwide. Timely detection and identification of microbial contamination in agricultural and food products is crucial for disease prevention and outbreak investigation. In efforts to improve and/or replace time-consuming and laborious "gold standards" for pathogen detection, numerous alternative rapid methods have been proposed in the past 15 years, with a trend toward incorporating nanotechnology and nanomaterials in food pathogen detection. This article is a review of the use of nanotechnology in various detection and sample preparation techniques and advancements in nanotechnology applications in food matrices. Some practical considerations in nanobioassay design are discussed, and the gaps between research status quo and market demands are identified.

  10. Real-time automated road, lane and car detection for autonomous driving

    OpenAIRE

    Birdal, Tolga; Erçil, Aytül; Ercil, Aytul

    2007-01-01

    In this paper, we discuss a vision based system for autonomous guidance of vehicles. An autonomous intelligent vehicle has to perform a number of functionalities. Segmentation of the road, determining the boundaries to drive in and recognizing the vehicles and obstacles around are the main tasks for vision guided vehicle navigation. In this article we propose a set of algorithms which lead to the solution of road and vehicle segmentation using data from a color camera. The algorithms descr...

  11. Biocontrol and Rapid Detection of Food-Borne Pathogens Using Bacteriophages and Endolysins.

    Science.gov (United States)

    Bai, Jaewoo; Kim, You-Tae; Ryu, Sangryeol; Lee, Ju-Hoon

    2016-01-01

    Bacteriophages have been suggested as natural food preservatives as well as rapid detection materials for food-borne pathogens in various foods. Since Listeria monocytogenes-targeting phage cocktail (ListShield) was approved for applications in foods, numerous phages have been screened and experimentally characterized for phage applications in foods. A single phage and phage cocktail treatments to various foods contaminated with food-borne pathogens including E. coli O157:H7, Salmonella enterica, Campylobacter jejuni, Listeria monocytogenes, Staphylococcus aureus, Cronobacter sakazakii, and Vibrio spp. revealed that they have great potential to control various food-borne pathogens and may be alternative for conventional food preservatives. In addition, phage-derived endolysins with high host specificity and host lysis activities may be preferred to food applications rather than phages. For rapid detection of food-borne pathogens, cell-wall binding domains (CBDs) from endolysins have been suggested due to their high host-specific binding. Fluorescence-tagged CBDs have been successfully evaluated and suggested to be alternative materials of expensive antibodies for various detection applications. Most recently, reporter phage systems have been developed and tested to confirm their usability and accuracy for specific detection. These systems revealed some advantages like rapid detection of only viable pathogenic cells without interference by food components in a very short reaction time, suggesting that these systems may be suitable for monitoring of pathogens in foods. Consequently, phage is the next-generation biocontrol agent as well as rapid detection tool to confirm and even identify the food-borne pathogens present in various foods.

  12. Biocontrol and Rapid Detection of Food-borne Pathogens Using Bacteriophages and Endolysins

    Directory of Open Access Journals (Sweden)

    Jaewoo eBai

    2016-04-01

    Full Text Available Bacteriophages have been suggested as natural food preservatives as well as rapid detection materials for food-borne pathogens in various foods. Since Listeria monocytogenes-targeting phage cocktail (ListShield was approved for applications in foods, numerous phages have been screened and experimentally characterized for phage applications in foods. A single phage and phage cocktail treatments to various foods contaminated with food-borne pathogens including E. coli O157:H7, Salmonella enterica, Campylobacter jejuni, Listeria monocytogenes, Staphylococcus aureus, Cronobacter sakazakii, and Vibrio spp. revealed that they have great potential to control various food-borne pathogens and may be alternative for conventional food preservatives. In addition, phage-derived endolysins with high host specificity and host lysis activities may be preferred to food applications rather than phages. For rapid detection of food-borne pathogens, cell-wall binding domains (CBDs from endolysins have been suggested due to their high host-specific binding. Fluorescence-tagged CBDs have been successfully evaluated and suggested to be alternative materials of expensive antibodies for various detection applications. Most recently, reporter phage systems have been developed and tested to confirm their usability and accuracy for specific detection. These systems revealed some advantages like rapid detection of only viable pathogenic cells without interference by food components in a very short reaction time, suggesting that these systems may be suitable for monitoring of pathogens in foods. Consequently, phage is the next-generation biocontrol agent as well as rapid detection tool to confirm and even identify the food-borne pathogens present in various foods.

  13. Molecular detection and characterization of tick-borne pathogens in dogs and ticks from Nigeria.

    Directory of Open Access Journals (Sweden)

    Joshua Kamani

    Full Text Available BACKGROUND: Only limited information is currently available on the prevalence of vector borne and zoonotic pathogens in dogs and ticks in Nigeria. The aim of this study was to use molecular techniques to detect and characterize vector borne pathogens in dogs and ticks from Nigeria. METHODOLOGY/PRINCIPAL FINDINGS: Blood samples and ticks (Rhipicephalus sanguineus, Rhipicephalus turanicus and Heamaphysalis leachi collected from 181 dogs from Nigeria were molecularly screened for human and animal vector-borne pathogens by PCR and sequencing. DNA of Hepatozoon canis (41.4%, Ehrlichia canis (12.7%, Rickettsia spp. (8.8%, Babesia rossi (6.6%, Anaplasma platys (6.6%, Babesia vogeli (0.6% and Theileria sp. (0.6% was detected in the blood samples. DNA of E. canis (23.7%, H. canis (21.1%, Rickettsia spp. (10.5%, Candidatus Neoehrlichia mikurensis (5.3% and A. platys (1.9% was detected in 258 ticks collected from 42 of the 181 dogs. Co- infections with two pathogens were present in 37% of the dogs examined and one dog was co-infected with 3 pathogens. DNA of Rickettsia conorii israelensis was detected in one dog and Rhipicephalus sanguineus tick. DNA of another human pathogen, Candidatus N. mikurensis was detected in Rhipicephalus sanguineus and Heamaphysalis leachi ticks, and is the first description of Candidatus N. mikurensis in Africa. The Theileria sp. DNA detected in a local dog in this study had 98% sequence identity to Theileria ovis from sheep. CONCLUSIONS/SIGNIFICANCE: The results of this study indicate that human and animal pathogens are abundant in dogs and their ticks in Nigeria and portray the potential high risk of human exposure to infection with these agents.

  14. Biocontrol and Rapid Detection of Food-Borne Pathogens Using Bacteriophages and Endolysins.

    Science.gov (United States)

    Bai, Jaewoo; Kim, You-Tae; Ryu, Sangryeol; Lee, Ju-Hoon

    2016-01-01

    Bacteriophages have been suggested as natural food preservatives as well as rapid detection materials for food-borne pathogens in various foods. Since Listeria monocytogenes-targeting phage cocktail (ListShield) was approved for applications in foods, numerous phages have been screened and experimentally characterized for phage applications in foods. A single phage and phage cocktail treatments to various foods contaminated with food-borne pathogens including E. coli O157:H7, Salmonella enterica, Campylobacter jejuni, Listeria monocytogenes, Staphylococcus aureus, Cronobacter sakazakii, and Vibrio spp. revealed that they have great potential to control various food-borne pathogens and may be alternative for conventional food preservatives. In addition, phage-derived endolysins with high host specificity and host lysis activities may be preferred to food applications rather than phages. For rapid detection of food-borne pathogens, cell-wall binding domains (CBDs) from endolysins have been suggested due to their high host-specific binding. Fluorescence-tagged CBDs have been successfully evaluated and suggested to be alternative materials of expensive antibodies for various detection applications. Most recently, reporter phage systems have been developed and tested to confirm their usability and accuracy for specific detection. These systems revealed some advantages like rapid detection of only viable pathogenic cells without interference by food components in a very short reaction time, suggesting that these systems may be suitable for monitoring of pathogens in foods. Consequently, phage is the next-generation biocontrol agent as well as rapid detection tool to confirm and even identify the food-borne pathogens present in various foods. PMID:27092128

  15. Application of bioinformatics on the detection of pathogens by Pcr

    International Nuclear Information System (INIS)

    Salmonellas are the main responsible agent for the frequent food-borne gastrointestinal diseases. Their detection using classical methods are laborious and their results take a lot of time to be revealed. In this context, we tried to set up a revealing technique of the invA virulence gene, found in the majority of Salmonella species. After amplification with PCR using specific primers created and verified by bioinformatics programs, two couples of primers were set up and they appeared to be very specific and sensitive for the detection of invA gene. (Author)

  16. Detection of hepatitis E virus and other livestock-related pathogens in Iowa streams.

    Science.gov (United States)

    Givens, Carrie E; Kolpin, Dana W; Borchardt, Mark A; Duris, Joseph W; Moorman, Thomas B; Spencer, Susan K

    2016-10-01

    Manure application is a source of pathogens to the environment. Through overland runoff and tile drainage, zoonotic pathogens can contaminate surface water and streambed sediment and could affect both wildlife and human health. This study examined the environmental occurrence of gene markers for livestock-related bacterial, protozoan, and viral pathogens and antibiotic resistance in surface waters within the South Fork Iowa River basin before and after periods of swine manure application on agricultural land. Increased concentrations of indicator bacteria after manure application exceeding Iowa's state bacteria water quality standards suggest that swine manure contributes to diminished water quality and may pose a risk to human health. Additionally, the occurrence of HEV and numerous bacterial pathogen genes for Escherichia coli, Enterococcus spp., Salmonella sp., and Staphylococcus aureus in both manure samples and in corresponding surface water following periods of manure application suggests a potential role for swine in the spreading of zoonotic pathogens to the surrounding environment. During this study, several zoonotic pathogens were detected including Shiga-toxin producing E. coli, Campylobacter jejuni, pathogenic enterococci, and S. aureus; all of which can pose mild to serious health risks to swine, humans, and other wildlife. This research provides the foundational understanding required for future assessment of the risk to environmental health from livestock-related zoonotic pathogen exposures in this region. This information could also be important for maintaining swine herd biosecurity and protecting the health of wildlife near swine facilities. PMID:27318519

  17. Centrifugal loop-mediated isothermal amplification microdevice for rapid, multiplex and colorimetric foodborne pathogen detection.

    Science.gov (United States)

    Oh, Seung Jun; Park, Byung Hyun; Jung, Jae Hwan; Choi, Goro; Lee, Doh C; Kim, Do Hyun; Seo, Tae Seok

    2016-01-15

    We present a centrifugal microfluidic device which enables multiplex foodborne pathogen identification by loop-mediated isothermal amplification (LAMP) and colorimetric detection using Eriochrome Black T (EBT). Five identical structures were designed in the centrifugal microfluidic system to perform the genetic analysis of 25 pathogen samples in a high-throughput manner. The sequential loading and aliquoting of the LAMP cocktail, the primer mixtures, and the DNA sample solutions were accomplished by the optimized zigzag-shaped microchannels and RPM control. We targeted three kinds of pathogenic bacteria (Escherichia coli O157:H7, Salmonella typhimurium and Vibrio parahaemolyticus) and detected the amplicons of the LAMP reaction by the EBT-mediated colorimetric method. For the limit-of-detection (LOD) test, we carried out the LAMP reaction on a chip with serially diluted DNA templates of E. coli O157:H7, and could observe the color change with 380 copies. The used primer sets in the LAMP reaction were specific only to the genomic DNA of E. coli O157:H7, enabling the on-chip selective, sensitive, and high-throughput pathogen identification with the naked eyes. The entire process was completed in 60min. Since the proposed microsystem does not require any bulky and expensive instrumentation for end-point detection, our microdevice would be adequate for point-of-care (POC) testing with high simplicity and high speed, providing an advanced genetic analysis microsystem for foodborne pathogen detection.

  18. DETECTION OF PATHOGENS CAUSING GENITAL ULCER DISEASE BY MULTIPLEX POLYMERASE CHAIN REACTION

    Institute of Scientific and Technical Information of China (English)

    Ai-ying Liu; Ming-jun Jiang; Yue-ping Yin; Jiang-fang Sun

    2005-01-01

    Objective To establish a multiplex polymerase chain reaction (M-PCR) assay for simultaneous detection of pathogens causing genital ulcer disease (GUD).Methods Based on the gene-specific region of the following pathogens: Chlamydia trachomatis ompl/ompb, herpes simplex virus (HSV) DNA polymerase, Treponema pallidum tpp47, Haemophilus ducreyi 16s rRNA, four sets of primers were designed and an M-PCR assay was developed to detect four pathogens in one test. The assay was evaluated with diagnostic result of golden standard for each pathogen.Results Of the 51 clinical samples, M-PCR showed slightly higher positive rate (47.1%) of HSV than cell culture (23.6%).Meanwhile, the positive rate of T. p allidum detected by M-PCR and dark-field microscopy was 19.6% ( 10/51) and 15.7% (8/51),respectively. Only one sample was positive for H. ducreyiand no sample was positive for C. trachomatis detected by both M-PCR assay and culture.Conclusion This primary study indicated that M-PCR assay can simultaneously and rapidly detect the four etiologic pathogens causing GUD.

  19. Recent advances in bacteriophage based biosensors for food-borne pathogen detection.

    Science.gov (United States)

    Singh, Amit; Poshtiban, Somayyeh; Evoy, Stephane

    2013-01-30

    Foodborne diseases are a major health concern that can have severe impact on society and can add tremendous financial burden to our health care systems. Rapid early detection of food contamination is therefore relevant for the containment of food-borne pathogens. Conventional pathogen detection methods, such as microbiological and biochemical identification are time-consuming and laborious, while immunological or nucleic acid-based techniques require extensive sample preparation and are not amenable to miniaturization for on-site detection. Biosensors have shown tremendous promise to overcome these limitations and are being aggressively studied to provide rapid, reliable and sensitive detection platforms for such applications. Novel biological recognition elements are studied to improve the selectivity and facilitate integration on the transduction platform for sensitive detection. Bacteriophages are one such unique biological entity that show excellent host selectivity and have been actively used as recognition probes for pathogen detection. This review summarizes the extensive literature search on the application of bacteriophages (and recently their receptor binding proteins) as probes for sensitive and selective detection of foodborne pathogens, and critically outlines their advantages and disadvantages over other recognition elements.

  20. Recent Advances in Bacteriophage Based Biosensors for Food-Borne Pathogen Detection

    Directory of Open Access Journals (Sweden)

    Somayyeh Poshtiban

    2013-01-01

    Full Text Available Foodborne diseases are a major health concern that can have severe impact on society and can add tremendous financial burden to our health care systems. Rapid early detection of food contamination is therefore relevant for the containment of food-borne pathogens. Conventional pathogen detection methods, such as microbiological and biochemical identification are time-consuming and laborious, while immunological or nucleic acid-based techniques require extensive sample preparation and are not amenable to miniaturization for on-site detection. Biosensors have shown tremendous promise to overcome these limitations and are being aggressively studied to provide rapid, reliable and sensitive detection platforms for such applications. Novel biological recognition elements are studied to improve the selectivity and facilitate integration on the transduction platform for sensitive detection. Bacteriophages are one such unique biological entity that show excellent host selectivity and have been actively used as recognition probes for pathogen detection. This review summarizes the extensive literature search on the application of bacteriophages (and recently their receptor binding proteins as probes for sensitive and selective detection of foodborne pathogens, and critically outlines their advantages and disadvantages over other recognition elements.

  1. Pathogen detection, testing, and control in fresh broccoli sprouts

    Directory of Open Access Journals (Sweden)

    Fahey Jed W

    2006-04-01

    Full Text Available Abstract Background The recent increased interest in consuming green vegetable sprouts has been tempered by the fact that fresh sprouts can in some cases be vehicles for food-borne illnesses. They must be grown according to proper conditions of sanitation and handled as a food product rather than as an agricultural commodity. When sprouts are grown in accordance with the criteria proposed from within the sprout industry, developed by regulatory agencies, and adhered to by many sprouters, green sprouts can be produced with very low risk. Contamination may occur when these guidelines are not followed. Methods A one year program of microbial hold-and-release testing, conducted in concert with strict seed and facility cleaning procedures by 13 U.S. broccoli sprout growers was evaluated. Microbial contamination tests were performed on 6839 drums of sprouts, equivalent to about 5 million consumer packages of fresh green sprouts. Results Only 24 (0.75% of the 3191 sprout samples gave an initial positive test for Escherichia coli O157:H7 or Salmonella spp., and when re-tested, 3 drums again tested positive. Composite testing (e.g., pooling up to 7 drums for pathogen testing was equally sensitive to single drum testing. Conclusion By using a "test-and-re-test" protocol, growers were able to minimize crop destruction. By pooling drums for testing, they were also able to reduce testing costs which now represent a substantial portion of the costs associated with sprout growing. The test-and-hold scheme described herein allowed those few batches of contaminated sprouts to be found prior to packaging and shipping. These events were isolated, and only safe sprouts entered the food supply.

  2. Detection of pathogens using on-chip electrochemical analysis of PCR amplified DNA molecules

    Science.gov (United States)

    Hodko, Dalibor; Raymer, Lindsay; Herbst, Stephanie M.; Magnuson, James W.; Gaskin, David

    2001-05-01

    The sensitivity and speed of methods for the detection of microorganisms and/or cells need to be constantly improved to provide timely and accurate analysis in large number of important applications. Such applications range from detection of pathogens in drinking water, biological warfare agents, biomedical diagnostics and food industry. The trends toward miniaturization of sensors using microfluidic and nanofluidic on-chip devices will push current detection limits to lower concentrations than what is offered by the present analytical equipment and/or detection kids. Microfluidic devices have been used to perform DNA analysis, polymerase chain reaction analysis, capillary electrophoresis and hybridization to oligonucleotide probes. This paper describes a new approach for the detection of pathogens on contaminated surfaces, which will integrated sampling, concentration and detection of targeted microorganisms.

  3. Molecular Detection of Bloodstream Pathogens in Critical Illness

    OpenAIRE

    Al_griw, Huda Hm

    2012-01-01

    Background: Critically ill patients are at particular risk of developing bloodstream infection. Such infections are associated with the development of sepsis, leading to a marked increase in mortality rate. Early detection of the causative organism and appropriate antibiotic treatment are therefore critical for optimum outcome of patients with nosocomial infection. Current infection diagnosis is based on standard blood culture techniques. However, microbiological culture has a number of limi...

  4. Magnetic Barcode Assay for Genetic Detection of Pathogens

    OpenAIRE

    Liong, Monty; Hoang, Anh N.; Chung, Jaehoon; Gural, Nil; Ford, Christopher B; Min, Changwook; Shah, Rupal R.; Ahmad, Rushdy; Fernandez-Suarez, Marta; Fortune, Sarah M.; Toner, Mehmet; Lee, Hakho; Weissleder, Ralph

    2013-01-01

    The task of rapidly identifying patients infected with Mycobacterium tuberculosis (MTB) in resource-constrained environments remains a challenge. A sensitive and robust platform that does not require bacterial isolation or culture is critical in making informed diagnostic and therapeutic decisions. Here we introduce a platform for the detection of nucleic acids based on a magnetic barcoding strategy. PCR-amplified mycobacterial genes are sequence-specifically captured on microspheres, labeled...

  5. Magnetic Barcode Assay for Genetic Detection of Pathogens

    Science.gov (United States)

    Liong, Monty; Hoang, Anh N.; Chung, Jaehoon; Gural, Nil; Ford, Christopher B.; Min, Changwook; Shah, Rupal R.; Ahmad, Rushdy; Fernandez-Suarez, Marta; Fortune, Sarah M.; Toner, Mehmet; Lee, Hakho; Weissleder, Ralph

    2013-01-01

    The task of rapidly identifying patients infected with Mycobacterium tuberculosis (MTB) in resource-constrained environments remains a challenge. A sensitive and robust platform that does not require bacterial isolation or culture is critical in making informed diagnostic and therapeutic decisions. Here we introduce a platform for the detection of nucleic acids based on a magnetic barcoding strategy. PCR-amplified mycobacterial genes are sequence-specifically captured on microspheres, labeled by magnetic nanoprobes, and detected by nuclear magnetic resonance. All components are integrated into a single, small fluidic cartridge for streamlined on-chip operation. We use this platform to detect MTB and identify drug-resistance strains from mechanically processed sputum samples within 2.5 hours. The specificity of the assay is confirmed by a panel of clinically relevant non-MTB bacteria, and the clinical utility is demonstrated by the measurements in MTB-positive patient specimens. Combined with portable systems, the magnetic barcode assay holds promise to become a sensitive, high-throughput, and low-cost platform for point-of-care diagnostics. PMID:23612293

  6. Molecular detection of plant pathogenic bacteria using polymerase chain reaction single-strand conformation polymorphism

    Institute of Scientific and Technical Information of China (English)

    Chandrashekar Srinivasa; Umesha Sharanaiah; Chandan Shivamallu

    2012-01-01

    The application of polymerase chain reaction (PCR) technology to molecular diagnostics holds great promise for the early identification of agriculturally important plant pathogens.Ralstonia solanacearum,Xanthomoans axonopodis pv.vesicatoria,and Xanthomonas oryzae pv.oryzae are phytopathogenic bacteria,which can infect vegetables,cause severe yield loss.PCR-single-strand conformation polymorphism (PCR-SSCP) is a simple and powerful technique for identifying sequence changes in amplified DNA.The technique of PCR-SSCP is being exploited so far,only to detect and diagnose human bacterial pathogens in addition to plant pathogenic fungi.Selective media and serology are the commonly used methods for the detection of plant pathogens in infected plant materials.In this study,we developed PCR-SSCP technique to identify phytopathogenic bacteria.The PCR product was denatured and separated on a non-denaturing polyacrylamide gel.SSCP banding patterns were detected by silver staining of nucleic acids.We tested over 56 isolates of R. solanacearum,44 isolates of X. axonopodis pv.vesicatoria,and 20 isolates of X.oryzae pv.oryzae.With the use of universal primer 16S rRNA,we could discriminate such species at the genus and species levels.Speciesspecific patterns were obtained for bacteria R.solanacearum,X.axonopodis pv.vesicatoria,and X.oryzae pv.oryzae.The potential use of PCR-SSCP technique for the detection and diagnosis of phytobacterial pathogens is discussed in the present paper.

  7. Comparing Luminex NxTAG-Respiratory Pathogen Panel and RespiFinder-22 for multiplex detection of respiratory pathogens.

    Science.gov (United States)

    Beckmann, Christiane; Hirsch, Hans H

    2016-08-01

    Respiratory tract infection (RTI) involves a variety of viruses and bacteria, which can be conveniently detected by multiplex nucleic acid amplification testing (NAT). To compare the novel Luminex-based NxTAG-Respiratory Pathogen Panel (NxTAG-RPP) with the routine multiplex-ligation-NAT based RespiFinder-22® (RF-22), 282 respiratory specimens including nasopharyngeal swabs (71%), broncho-alveolar lavage (27%), throat swabs, tracheal secretions, and sputum (2%) from 116 children and 155 adults were extracted using a Corbett CAS1200 (Qiagen), and analyzed in parallel by the routine RF-22 and NxTAG-RPP. Concordant results were obtained in 263 (93.3%) cases consisting of concordant positives in 167 (59.2%) and concordant negatives in 96 (34%). Results were discordant in 19 (6.7%) consisting of 15 positive:negative, and 4 negative:positive results by NxTAG-RPP versus RF-22, respectively. Co-infections were observed in 10.3% with NxTAG-RPP and in 5.9% with RF-22. Most additional viral pathogens identified by the NxTAG-RPP involved dual infections with rhinovirus and RSV. Discordant samples were mainly due to low genome signals of Ct less than 36, when retested by QNAT suggesting a higher sensitivity of the NxTAG-RPP, also when detecting multiple infections. Hands-on time after extraction for 24 and 96 samples was 0.25 and <0.5 hr for the NxTAG-RPP, and 2 and 4 hr for the RF-22, respectively. The median turn-around time was 6 hr (range 5-7 hr) for NxTAG-RPP and 12 hr (range 8-16 hr) for RF-22. The NxTAG-RPP showed comparable detection rates for most respiratory pathogens, while hands-on and turn-around time were considerably shorter. The clinical significance of detecting multiple viruses needs further clinical evaluation. J. Med. Virol. 88:1319-1324, 2016. © 2016 Wiley Periodicals, Inc. PMID:26856438

  8. A handheld real time thermal cycler for bacterial pathogen detection.

    Science.gov (United States)

    Higgins, James A; Nasarabadi, Shanavaz; Karns, Jeffrey S; Shelton, Daniel R; Cooper, Mary; Gbakima, Aiah; Koopman, Ronald P

    2003-08-15

    The handheld advanced nucleic acid analyzer (HANAA) is a portable real time thermal cycler unit that weighs under 1 kg and uses silicon and platinum-based thermalcycler units to conduct rapid heating and cooling of plastic reaction tubes. Two light emitting diodes (LED) provide greater than 1 mW of electrical power at wavelengths of 490 nm (blue) and 525 nm (green), allowing detection of the dyes FAM and JOE/TAMRA. Results are displayed in real time as bar graphs, and up to three, 4-sample assays can be run on the charge of the 12 V portable battery pack. The HANAA was evaluated for detection of defined Escherichia coli strains, and wild-type colonies isolated from stream water, using PCR for the lac Z and Tir genes. PCR reactions using SYBR Green dye allowed detection of E. coli ATCC 11775 and E. coli O157:H7 cells in under 30 min of assay time; however, background fluorescence associated with dye binding to nonspecific PCR products was present. DNA extracted from three isolates of Bacillus anthracis Ames, linked to a bioterrorism incident in Washington DC in October 2001, were also successfully tested on the HANAA using primers for the vrrA and capA genes. Positive results were observed at 32 and 22 min of assay time, respectively. A TaqMan probe specific to the aroQ gene of Erwinia herbicola was tested on the HANAA and when 500 cells were used as template, positive results were observed after only 7 min of assay time. Background fluorescence associated with the use of the probe was negligible. The HANAA is unique in offering real time PCR in a handheld format suitable for field use; a commercial version of the instrument, offering six reaction chambers, is available as of Fall 2002. PMID:12788554

  9. Bacterial contamination of platelet concentrates: pathogen detection and inactivation methods

    Directory of Open Access Journals (Sweden)

    Dana Védy

    2009-04-01

    Full Text Available Whereas the reduction of transfusion related viral transmission has been a priority during the last decade, bacterial infection transmitted by transfusion still remains associated to a high morbidity and mortality, and constitutes the most frequent infectious risk of transfusion. This problem especially concerns platelet concentrates because of their favorable bacterial growth conditions. This review gives an overview of platelet transfusion-related bacterial contamination as well as on the different strategies to reduce this problem by using either bacterial detection or inactivation methods.

  10. Strategies for the detection of food pathogens and contaminants

    DEFF Research Database (Denmark)

    Hearty, Stephen; Leonard, Paul; Sheehan, Alfredo Darmanin;

    that molecular contaminants such as microbial toxins and drug/pesticide residues translate well onto Biacore-based assay formats. However, larger and more complex entities such as spores and whole bacterial cells represent an altogether more difficult challenge. Here, we present an overview of our experiences...... to date with using Biacore for analysis of food contaminants and in particular the challenges associated with large analyte detection...... molecules and once suitably high affinity antibodies have been isolated, it is relatively straightforward to design and optimise concentration-based assays using SPR. Recently we have investigated the potential of applying Biacore technology to routine food analysis. Our experiences have shown...

  11. The development of a real-time PCR to detect pathogenic Leptospira species in kidney tissue.

    Science.gov (United States)

    Fearnley, C; Wakeley, P R; Gallego-Beltran, J; Dalley, C; Williamson, S; Gaudie, C; Woodward, M J

    2008-08-01

    A LightCycler real-time PCR hybridization probe-based assay that detects a conserved region of the16S rRNA gene of pathogenic but not saprophytic Leptospira species was developed for the rapid detection of pathogenic leptospires directly from processed tissue samples. In addition, a differential PCR specific for saprophytic leptospires and a control PCR targeting the porcine beta-actin gene were developed. To assess the suitability of these PCR methods for diagnosis, a trial was performed on kidneys taken from adult pigs with evidence of leptospiral infection, primarily a history of reproductive disease and serological evidence of exposure to pathogenic leptospires (n=180) and aborted pig foetuses (n=24). Leptospire DNA was detected by the 'pathogenic' specific PCR in 25 tissues (14%) and the control beta-actin PCR was positive in all 204 samples confirming DNA was extracted from all samples. No leptospires were isolated from these samples by culture and no positives were detected with the 'saprophytic' PCR. In a subsidiary experiment, the 'pathogenic' PCR was used to analyse kidney samples from rodents (n=7) collected as part of vermin control in a zoo, with show animals with high microagglutination titres to Leptospira species, and five were positive. Fifteen PCR amplicons from 1 mouse, 2 rat and 14 pig kidney samples, were selected at random from positive PCRs (n=30) and sequenced. Sequence data indicated L. interrogans DNA in the pig and rat samples and L. inadai DNA, which is considered of intermediate pathogenicity, in the mouse sample. The only successful culture was from this mouse kidney and the isolate was confirmed to be L. inadai by classical serology. These data suggest this suite of PCRs is suitable for testing for the presence of pathogenic leptospires in pig herds where abortions and infertility occur and potentially in other animals such as rodents.

  12. Strategies for the detection of food pathogens and contaminants

    DEFF Research Database (Denmark)

    Hearty, Stephen; Leonard, Paul; Sheehan, Alfredo Darmanin;

    We routinely use Biacore for affinity ranking and kinetic characterisation of diverse panels of hybridoma-derived and recombinant antibodies against a wide range of different clinically relevant antigens for diagnostic applications. Generally the analytes of interest are haptens or defined protei...... to date with using Biacore for analysis of food contaminants and in particular the challenges associated with large analyte detection......We routinely use Biacore for affinity ranking and kinetic characterisation of diverse panels of hybridoma-derived and recombinant antibodies against a wide range of different clinically relevant antigens for diagnostic applications. Generally the analytes of interest are haptens or defined protein...... molecules and once suitably high affinity antibodies have been isolated, it is relatively straightforward to design and optimise concentration-based assays using SPR. Recently we have investigated the potential of applying Biacore technology to routine food analysis. Our experiences have shown...

  13. Standardization of diagnostic PCR for the detection of foodborne pathogens

    DEFF Research Database (Denmark)

    Malorny, B.; Tassios, P.T.; Radstrom, P.;

    2003-01-01

    In vitro amplification of nucleic acids using the polymerase chain reaction (PCR) has become, since its discovery in the 1980s, a powerful diagnostic tool for the analysis of microbial infections as well as for the analysis of microorganisms in food samples. However, despite its potential, PCR has...... neither gained wide acceptance in routine diagnostics nor been widely incorporated in standardized methods. Lack of validation and standard protocols, as well as variable quality of reagents and equipment, influence the efficient dissemination of PCR methodology from expert research laboratories to end......-user laboratories. Moreover, the food industry understandably requires and expects officially approved standards. Recognizing this, in 1999, the European Commission approved the research project, FOOD-PCR (http://www.PCR.dk), which aims to validate and standardize the use of diagnostic PCR for the detection...

  14. RCA-Based Biosensor for Electrical and Colorimetric Detection of Pathogen DNA.

    Science.gov (United States)

    Jeong, Jaepil; Kim, Hyejin; Lee, Dong Jun; Jung, Byung Jun; Lee, Jong Bum

    2016-12-01

    For the diagnosis and prevention of diseases, a range of strategies for the detection of pathogens have been developed. In this study, we synthesized the rolling circle amplification (RCA)-based biosensor that enables detection of pathogen DNA in two analytical modes. Only in the presence of the target DNA, the template DNA can be continuously polymerized by simply carrying out RCA, which gives rise to a change of surface structure of Au electrodes and the gap between the electrodes. Electrical signal was generated after introducing hydrogen tetrachloroaurate (HAuCl4) to the DNA-coated biosensor for the improvement of the conductivity of DNA, which indicates that the presence of the pathogen DNA can be detected in an electrical approach. Furthermore, the existence of the target DNA was readily detected by the naked eyes through change in colors of the electrodes from bright yellow to orange-red after RCA reaction. The RCA-based biosensor offers a new platform for monitoring of pathogenic DNA with two different detection modes in one system. PMID:27142880

  15. Rapid detection of intestinal pathogens in fecal samples by an improved reverse dot blot method

    Institute of Scientific and Technical Information of China (English)

    Jian-Ming Xing; Su Zhang; Ying Du; Dan Bi; Li-Hui Yao

    2009-01-01

    AIM:To develop a new, rapid and accurate reverse dot blot (RDB) method for the detection of intestinal pathogens in fecal samples.METHODS:The 12 intestinal pathogens tested were Salmonella spp., Brucella spp., Escherichia coli O157:H7,Clostridium botulinum, Bacillus cereus,Clostridium perfringens, Vibrio parahaemolyticus,Shigella spp., Yersinia enterocolitica, Vibrio cholerae,Listeria monocytogenes and Staphylococcus aureus.The two universal primers were designed to amplify two variable regions of bacterial 16S and 23S rDNA genes from all of the 12 bacterial species tested. Five hundred and forty fecal samples from the diarrhea patients were detected using the improved RDB assay.RESULTS:The methods could identify the 12 intestinal pathogens specifically, and the detection limit was as low as 103 CFUs. The consistent detection rate of the improved RDB assay compared with the traditional culture method was up to 88.75%.CONCLUSION:The hybridization results indicated that the improved RDB assay developed was a reliable method for the detection of intestinal pathogen in fecal samples.

  16. RCA-Based Biosensor for Electrical and Colorimetric Detection of Pathogen DNA

    Science.gov (United States)

    Jeong, Jaepil; Kim, Hyejin; Lee, Dong Jun; Jung, Byung Jun; Lee, Jong Bum

    2016-05-01

    For the diagnosis and prevention of diseases, a range of strategies for the detection of pathogens have been developed. In this study, we synthesized the rolling circle amplification (RCA)-based biosensor that enables detection of pathogen DNA in two analytical modes. Only in the presence of the target DNA, the template DNA can be continuously polymerized by simply carrying out RCA, which gives rise to a change of surface structure of Au electrodes and the gap between the electrodes. Electrical signal was generated after introducing hydrogen tetrachloroaurate (HAuCl4) to the DNA-coated biosensor for the improvement of the conductivity of DNA, which indicates that the presence of the pathogen DNA can be detected in an electrical approach. Furthermore, the existence of the target DNA was readily detected by the naked eyes through change in colors of the electrodes from bright yellow to orange-red after RCA reaction. The RCA-based biosensor offers a new platform for monitoring of pathogenic DNA with two different detection modes in one system.

  17. Detection of pathogens in food using a SERS-based assay in just a few hours

    Science.gov (United States)

    Shende, Chetan; Sengupta, Atanu; Huang, Hermes; Farquharson, Stuart

    2014-05-01

    In 2011 Escherichia, Listeria, and Salmonella species infected over 1.2 million people in the United States, resulting in over 23,000 hospitalizations and 650 deaths. In January 2013 President Obama signed into law the Food and Drug Administration (FDA) Food Safety Modernization Act (FSMA), which requires constant microbial testing of food processing equipment and food to minimize contamination and distribution of food tainted with pathogens. The challenge to preventing distribution and consumption of contaminated foods lies in the fact that just a few bacterial cells can rapidly multiply to millions, reaching infectious doses within a few days. Unfortunately, current methods used to detect these few cells rely on similar growth steps to multiply the cells to the point of detection, which also takes a few days. Consequently, there is a critical need for an analyzer that can rapidly extract and detect foodborne pathogens at 1000 colony forming units per gram of food in 1-2 hours (not days), and with a specificity that differentiates from indigenous microflora, so that false alarms are eliminated. In an effort to meet this need, we have been developing an assay that extracts such pathogens from food, selectively binds these pathogens, and produces surface-enhanced Raman spectra (SERS) when read by a Raman analyzer. Here we present SERS measurements of these pathogens in actual food samples using this assay.

  18. Bacteriophages for detection and control of bacterial pathogens in food and food-processing environment.

    Science.gov (United States)

    Brovko, Lubov Y; Anany, Hany; Griffiths, Mansel W

    2012-01-01

    This chapter presents recent advances in bacteriophage research and their application in the area of food safety. Section 1 describes general facts on phage biology that are relevant to their application for control and detection of bacterial pathogens in food and environmental samples. Section 2 summarizes the recently acquired data on application of bacteriophages to control growth of bacterial pathogens and spoilage organisms in food and food-processing environment. Section 3 deals with application of bacteriophages for detection and identification of bacterial pathogens. Advantages of bacteriophage-based methods are presented and their shortcomings are discussed. The chapter is intended for food scientist and food product developers, and people in food inspection and health agencies with the ultimate goal to attract their attention to the new developing technology that has a tremendous potential in providing means for producing wholesome and safe food.

  19. Bacterial and viral pathogens detected in sea turtles stranded along the coast of Tuscany, Italy.

    Science.gov (United States)

    Fichi, G; Cardeti, G; Cersini, A; Mancusi, C; Guarducci, M; Di Guardo, G; Terracciano, G

    2016-03-15

    During 2014, six loggerhead turtles, Caretta caretta and one green turtle, Chelonia mydas, found stranded on the Tuscany coast of Italy, were examined for the presence of specific bacterial and viral agents, along with their role as carriers of fish and human pathogens. Thirteen different species of bacteria, 10 Gram negative and 3 Gram positive, were identified. Among them, two strains of Vibrio parahaemolyticus and one strain of Lactococcus garviae were recovered and confirmed by specific PCR protocols. No trh and tdh genes were detected in V. parahaemolyticus. The first isolation of L. garviae and the first detection of Betanodavirus in sea turtles indicate the possibility for sea turtles to act as carriers of fish pathogens. Furthermore, the isolation of two strains of V. parahaemolyticus highlights the possible role of these animals in human pathogens' diffusion.

  20. FY05 LDRD Final Report A Computational Design Tool for Microdevices and Components in Pathogen Detection Systems

    Energy Technology Data Exchange (ETDEWEB)

    Trebotich, D

    2006-02-07

    We have developed new algorithms to model complex biological flows in integrated biodetection microdevice components. The proposed work is important because the design strategy for the next-generation Autonomous Pathogen Detection System at LLNL is the microfluidic-based Biobriefcase, being developed under the Chemical and Biological Countermeasures Program in the Homeland Security Organization. This miniaturization strategy introduces a new flow regime to systems where biological flow is already complex and not well understood. Also, design and fabrication of MEMS devices is time-consuming and costly due to the current trial-and-error approach. Furthermore, existing devices, in general, are not optimized. There are several MEMS CAD capabilities currently available, but their computational fluid dynamics modeling capabilities are rudimentary at best. Therefore, we proposed a collaboration to develop computational tools at LLNL which will (1) provide critical understanding of the fundamental flow physics involved in bioMEMS devices, (2) shorten the design and fabrication process, and thus reduce costs, (3) optimize current prototypes and (4) provide a prediction capability for the design of new, more advanced microfluidic systems. Computational expertise was provided by Comp-CASC and UC Davis-DAS. The simulation work was supported by key experiments for guidance and validation at UC Berkeley-BioE.

  1. Development of an Automated Microfluidic System for DNA Collection, Amplification, and Detection of Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Hagan, Bethany S.; Bruckner-Lea, Cynthia J.

    2002-12-01

    This project was focused on developing and testing automated routines for a microfluidic Pathogen Detection System. The basic pathogen detection routine has three primary components; cell concentration, DNA amplification, and detection. In cell concentration, magnetic beads are held in a flow cell by an electromagnet. Sample liquid is passed through the flow cell and bacterial cells attach to the beads. These beads are then released into a small volume of fluid and delivered to the peltier device for cell lysis and DNA amplification. The cells are lysed during initial heating in the peltier device, and the released DNA is amplified using polymerase chain reaction (PCR) or strand displacement amplification (SDA). Once amplified, the DNA is then delivered to a laser induced fluorescence detection unit in which the sample is detected. These three components create a flexible platform that can be used for pathogen detection in liquid and sediment samples. Future developments of the system will include on-line DNA detection during DNA amplification and improved capture and release methods for the magnetic beads during cell concentration.

  2. Efficiency of Airborne Sample Analysis Platform (ASAP Bioaerosol Sampler for Pathogen Detection

    Directory of Open Access Journals (Sweden)

    Anurag eSharma

    2015-05-01

    Full Text Available The threat of bioterrorism and pandemics has highlighted the urgency for rapid and reliable bioaerosol detection in different environments. Safeguarding against such threats requires continuous sampling of the ambient air for pathogen detection. In this study we investigated the efficacy of the Airborne Sample Analysis Platform (ASAP 2800 bioaerosol sampler to collect representative samples of air and identify specific viruses suspended as bioaerosols. To test this concept, we aerosolized an innocuous replication-defective bovine adenovirus serotype 3 (BAdV3 in a controlled laboratory environment. The ASAP efficiently trapped the surrogate virus at 5×10E3 plaque-forming units (p.f.u. [2×10E5 genome copy equivalent] concentrations or more resulting in the successful detection of the virus using quantitative PCR. These results support the further development of ASAP for bioaerosol pathogen detection.

  3. Electroanalytical sensors and devices for multiplexed detection of foodborne pathogen microorganisms.

    Science.gov (United States)

    Pedrero, María; Campuzano, Susana; Pingarrón, José M

    2009-01-01

    The detection and identification of pathogen microorganisms still rely on conventional culturing techniques, which are not suitable for on-site monitoring. Therefore, a great research challenge in this field is focused on the need to develop rapid, reliable, specific, and sensitive methods to detect these bacteria at low cost. Moreover, the growing interest in biochip development for large scale screening analysis implies improved miniaturization, reduction of analysis time and cost, and multi-analyte detection, which has nowadays become a crucial challenge. This paper reviews multiplexed foodborne pathogen microorganisms detection methods based on electrochemical sensors incorporating microarrays and other platforms. These devices usually involve antibody-antigen and DNA hybridization specific interactions, although other approaches such as the monitoring of oxygen consumption are also considered.

  4. Electroanalytical biosensors and their potential for food pathogen and toxin detection.

    Science.gov (United States)

    Palchetti, Ilaria; Mascini, Marco

    2008-05-01

    The detection and identification of foodborne pathogens continue to rely on conventional culturing techniques. These are very elaborate, time-consuming, and have to be completed in a microbiology laboratory and are therefore not suitable for on-site monitoring. The need for a more rapid, reliable, specific, and sensitive method of detecting a target analyte, at low cost, is the focus of a great deal of research. Biosensor technology has the potential to speed up the detection, increase specificity and sensitivity, enable high-throughput analysis, and to be used for monitoring of critical control points in food production. This article reviews food pathogen detection methods based on electrochemical biosensors, specifically amperometric, potentiometric, and impedimetric biosensors. The underlying principles and application of these biosensors are discussed with special emphasis on new biorecognition elements, nanomaterials, and lab on a chip technology.

  5. Electroanalytical Sensors and Devices for Multiplexed Detection of Foodborne Pathogen Microorganisms

    Directory of Open Access Journals (Sweden)

    Susana Campuzano

    2009-07-01

    Full Text Available The detection and identification of pathogen microorganisms still rely on conventional culturing techniques, which are not suitable for on-site monitoring. Therefore, a great research challenge in this field is focused on the need to develop rapid, reliable, specific, and sensitive methods to detect these bacteria at low cost. Moreover, the growing interest in biochip development for large scale screening analysis implies improved miniaturization, reduction of analysis time and cost, and multi-analyte detection, which has nowadays become a crucial challenge. This paper reviews multiplexed foodborne pathogen microorganisms detection methods based on electrochemical sensors incorporating microarrays and other platforms. These devices usually involve antibody-antigen and DNA hybridization specific interactions, although other approaches such as the monitoring of oxygen consumption are also considered.

  6. Ultrasensitive detection and rapid identification of multiple foodborne pathogens with the naked eyes.

    Science.gov (United States)

    Zhang, Heng; Zhang, Yali; Lin, Yankui; Liang, Tongwen; Chen, Zhihua; Li, Jinfeng; Yue, Zhenfeng; Lv, Jingzhang; Jiang, Qing; Yi, Changqing

    2015-09-15

    In this study, a novel approach for ultrasensitive detection and rapid high-throughput identification of a panel of common foodborne pathogens with the naked eyes is presented. As a proof-of-concept application, a multiple pathogen analysis array is fabricated through immobilizing three specific polyT-capture probes which can respectively recognize rfbE gene (Escherichia coli O157:H7), invA gene (Salmonella enterica), inlA gene (Listeria monocytogenes) on the plastic substrates. PCR has been developed for amplification and labeling target genes of rfbE, invA, inlA with biotin. The biotinated target DNA is then captured onto the surface of plastic strips through specific DNA hybridization. The succeeding staining of biotinated DNA duplexes with avidin-horseradish peroxidise (AV-HRP) and biotinated anti-HRP antibody greatly amplifies the detectable signal through the multiple cycle signal amplification strategy, and thus realizing ultrasensitive and specific detection of the above three pathogens in food samples with the naked eyes. Results showed approximately 5 copies target pathogenic DNA could be detected with the naked eyes. This simple but very efficient colorimetric assay also show excellent anti-interference capability and good stability, and can be readily applied to point-of-care diagnosis.

  7. Improvement of methods for the detection of Gram-negative foodborne pathogens

    NARCIS (Netherlands)

    Margot, H.F.T.

    2016-01-01

    Foodborne diseases are a major source of morbidity and mortality worldwide. In most cases, these diseases are caused by contaminated food products, but transmission can also subsequently occur via person to person contact. The ability to detect the pathogens is an important aspect in the verificatio

  8. Validation of a multiplex reverse transcriptase PCR ELISA for the detection of 19 respiratory tract pathogens

    NARCIS (Netherlands)

    Puppe, W.; Weigl, J.; Groendahl, B.; Knuf, M.; Rockahr, S.; von Bismarck, P.; Aron, G.; Niesters, H. G. M.; Osterhaus, A. D. M. E.; Schmitt, H. -J.

    2013-01-01

    Introduction Since acute respiratory tract infections inflict a high burden of disease in children worldwide, a multiplex reverse transcription polymerase chain reaction combined with a microwell hybridization assay (m-RT-PCR ELISA) to detect 19 different respiratory pathogens was developed and vali

  9. Rapid detection of the most important pathogenic microorganisms in water and Food by (Chromogenic media)

    OpenAIRE

    H.R. Tavakoli; Manafi, M; Bayat, M.; A Mehrabi Tavana

    2009-01-01

    Background and Objectives: Chromogenic media are the newest methodsapplied for rapid detection of pathogenic microorganisms in drinking waterand food from 1998-2008. These Specific media contained the compoundsacting as a substrate for microbial enzymes and, according to the type ofenzyme, produce specific color. The aim of this study was to introduce thechromogenic media as a powerful tool in rapid detection of pathogenicagents in drinking water and food.Material and Methods: In this review ...

  10. Evolution of Drosophila resistance against different pathogens and infection routes entails no detectable maintenance costs.

    Science.gov (United States)

    Faria, Vítor G; Martins, Nelson E; Paulo, Tânia; Teixeira, Luís; Sucena, Élio; Magalhães, Sara

    2015-11-01

    Pathogens exert a strong selective pressure on hosts, entailing host adaptation to infection. This adaptation often affects negatively other fitness-related traits. Such trade-offs may underlie the maintenance of genetic diversity for pathogen resistance. Trade-offs can be tested with experimental evolution of host populations adapting to parasites, using two approaches: (1) measuring changes in immunocompetence in relaxed-selection lines and (2) comparing life-history traits of evolved and control lines in pathogen-free environments. Here, we used both approaches to examine trade-offs in Drosophila melanogaster populations evolving for over 30 generations under infection with Drosophila C Virus or the bacterium Pseudomonas entomophila, the latter through different routes. We find that resistance is maintained after up to 30 generations of relaxed selection. Moreover, no differences in several classical life-history traits between control and evolved populations were found in pathogen-free environments, even under stresses such as desiccation, nutrient limitation, and high densities. Hence, we did not detect any maintenance costs associated with resistance to pathogens. We hypothesize that extremely high selection pressures commonly used lead to the disproportionate expression of costs relative to their actual occurrence in natural systems. Still, the maintenance of genetic variation for pathogen resistance calls for an explanation.

  11. Development of a DNA-based microarray for the detection of zoonotic pathogens in rodent species.

    Science.gov (United States)

    Giles, Timothy; Yon, Lisa; Hannant, Duncan; Barrow, Paul; Abu-Median, Abu-Bakr

    2015-12-01

    The demand for diagnostic tools that allow simultaneous screening of samples for multiple pathogens is increasing because they overcome the limitations of other methods, which can only screen for a single or a few pathogens at a time. Microarrays offer the advantages of being capable to test a large number of samples simultaneously, screening for multiple pathogen types per sample and having comparable sensitivity to existing methods such as PCR. Array design is often considered the most important process in any microarray experiment and can be the deciding factor in the success of a study. There are currently no microarrays for simultaneous detection of rodent-borne pathogens. The aim of this report is to explicate the design, development and evaluation of a microarray platform for use as a screening tool that combines ease of use and rapid identification of a number of rodent-borne pathogens of zoonotic importance. Nucleic acid was amplified by multiplex biotinylation PCR prior to hybridisation onto microarrays. The array sensitivity was comparable to standard PCR, though less sensitive than real-time PCR. The array presented here is a prototype microarray identification system for zoonotic pathogens that can infect rodent species. PMID:26188129

  12. Simultaneous, specific and real-time detection of biothreat and frequently encountered food-borne pathogens

    Science.gov (United States)

    Woubit, Abdela Salah; Yehualaeshet, Teshome; Habtemariam, Tsegaye; Samuel, Temesgen

    2012-01-01

    The bacterial genera Escherichia, Salmonella, Shigella, Vibrio, Yersinia and Francisella include important food safety and biothreat agents causing food-related and other human illnesses worldwide. We aimed to develop rapid methods with the capability to simultaneously and differentially detect all six pathogens in one run. Our initial experiments to use previously reported sets of primers revealed non-specificity of some of the sequences when tested against a broader array of pathogens, or proved not optimal for simultaneous detection parameters. By extensive mining of the whole genome and protein databases of diverse closely and distantly related bacterial species and strains, we have identified unique genome regions, which we utilized to develop a detection platform. Twelve of the specific genomic targets we have identified to design the primers in F. tularensis ssp. tularensis, F. tularensis ssp. novicida, S. dysentriae, S. typhimurium, V. cholera, Y. pestis, and Y. pseudotuberculosis contained either hypothetical or putative proteins, the functions of which have not been clearly defined. Corresponding primer sets were designed from the target regions for use in real-time PCR assays to detect specific biothreat pathogens at species or strain levels. The primer sets were first tested by in-silico PCR against whole genome sequences of different species, sub-species, or strains and then by in vitro PCR against genomic DNA preparations from 23 strains representing six biothreat agents (E.coli O157:H7 strain EDL 933, Shigella dysentriae, Salmonella typhi, Francisella tularensis ssp. tularensis, Vibrio cholera, and Yersinia pestis) and six foodborne pathogens (Salmonella typhimurium, Salmonella saintpaul, Shigella sonnei, Francisella novicida, Vibrio parahemolytica and Yersinia pseudotuberculosis). Each pathogen was specifically identifiable at the genus and species levels. Sensitivity assays performed using purified DNA showed the lowest detection limit of 640 fg

  13. Rapid Detection and Identification of Infectious Pathogens Based on High-throughput Sequencing

    Institute of Scientific and Technical Information of China (English)

    Pei-Xiang Ni; Xin Ding; Yin-Xin Zhang; Xue Yao; Rui-Xue Sun; Peng Wang; Yan-Ping Gong

    2015-01-01

    Background:The dilemma of pathogens identification in patients with unidentified clinical symptoms such as fever of unknown origin exists,which not only poses a challenge to both the diagnostic and therapeutic process by itself,but also to expert physicians.Methods:In this report,we have attempted to increase the awareness of unidentified pathogens by developing a method to investigate hitherto unidentified infectious pathogens based on unbiased high-throughput sequencing.Results:Our observations show that this method supplements current diagnostic technology that predominantly relies on information derived five cases from the intensive care unit.This methodological approach detects viruses and corrects the incidence of false positive detection rates of pathogens in a much shorter period.Through our method is followed by polymerase chain reaction validation,we could identify infection with Epstein-Barr virus,and in another case,we could identify infection with Streptococcus viridians based on the culture,which was false positive.Conclusions:This technology is a promising approach to revolutionize rapid diagnosis of infectious pathogens and to guide therapy that might result in the improvement of personalized medicine.

  14. Bioelectronic DNA detection of human papillomaviruses using eSensor™: a model system for detection of multiple pathogens

    Directory of Open Access Journals (Sweden)

    Miller Donna L

    2003-06-01

    Full Text Available Abstract Background We used human papillomaviruses (HPV as a model system to evaluate the utility of a nucleic acid, hybridization-based bioelectronic DNA detection platform (eSensor™ in identifying multiple pathogens. Methods Two chips were spotted with capture probes consisting of DNA oligonucleotide sequences specific for HPV types. Electrically conductive signal probes were synthesized to be complementary to a distinct region of the amplified HPV target DNA. A portion of the HPV L1 region that was amplified by using consensus primers served as target DNA. The amplified target was mixed with a cocktail of signal probes and added to a cartridge containing a DNA chip to allow for hybridization with complementary capture probes. Results Two bioelectric chips were designed and successfully detected 86% of the HPV types contained in clinical samples. Conclusions This model system demonstrates the potential of the eSensor platform for rapid and integrated detection of multiple pathogens.

  15. Detection of hepatitis E virus and other livestock-related pathogens in Iowa streams

    Science.gov (United States)

    Givens, Carrie E.; Kolpin, Dana W.; Borchardt, Mark A.; Duris, Joseph; Moorman, Thomas B.; Spencer, Susan K.

    2016-01-01

    Manure application is a source of pathogens to the environment. Through overland runoff and tile drainage, zoonotic pathogens can contaminate surface water and streambed sediment and could affect both wildlife and human health. This study examined the environmental occurrence of gene markers for livestock-related bacterial, protozoan, and viral pathogens and antibiotic resistance in surface waters within the South Fork Iowa River basin before and after periods of swine manure application on agricultural land. Increased concentrations of indicator bacteria after manure application exceeding Iowa's state bacteria water quality standards suggest that swine manure contributes to diminished water quality and may pose a risk to human health. Additionally, the occurrence of HEV and numerous bacterial pathogen genes for Escherichia coli, Enterococcus spp., Salmonella sp., and Staphylococcus aureus in both manure samples and in corresponding surface water following periods of manure application suggests a potential role for swine in the spreading of zoonotic pathogens to the surrounding environment. During this study, several zoonotic pathogens were detected including Shiga-toxin producing E. coli, Campylobacter jejuni, pathogenic enterococci, and S. aureus; all of which can pose mild to serious health risks to swine, humans, and other wildlife. This research provides the foundational understanding required for future assessment of the risk to environmental health from livestock-related zoonotic pathogen exposures in this region. This information could also be important for maintaining swine herd biosecurity and protecting the health of wildlife near swine facilities.

  16. Detection of Emerging and Re-Emerging Pathogens in Surface Waters Close to an Urban Area

    Directory of Open Access Journals (Sweden)

    Stefania Marcheggiani

    2015-05-01

    Full Text Available Current knowledge about the spread of pathogens in aquatic environments is scarce probably because bacteria, viruses, algae and their toxins tend to occur at low concentrations in water, making them very difficult to measure directly. The purpose of this study was the development and validation of tools to detect pathogens in freshwater systems close to an urban area. In order to evaluate anthropogenic impacts on water microbiological quality, a phylogenetic microarray was developed in the context of the EU project µAQUA to detect simultaneously numerous pathogens and applied to samples from two different locations close to an urban area located upstream and downstream of Rome in the Tiber River. Furthermore, human enteric viruses were also detected. Fifty liters of water were collected and concentrated using a hollow-fiber ultrafiltration approach. The resultant concentrate was further size-fractionated through a series of decreasing pore size filters. RNA was extracted from pooled filters and hybridized to the newly designed microarray to detect pathogenic bacteria, protozoa and toxic cyanobacteria. Diatoms as indicators of the water quality status, were also included in the microarray to evaluate water quality. The microarray results gave positive signals for bacteria, diatoms, cyanobacteria and protozoa. Cross validation of the microarray was performed using standard microbiological methods for the bacteria. The presence of oral-fecal transmitted human enteric-viruses were detected using q-PCR. Significant concentrations of Salmonella, Clostridium, Campylobacter and Staphylococcus as well as Hepatitis E Virus (HEV, noroviruses GI (NoGGI and GII (NoGII and human adenovirus 41 (ADV 41 were found in the Mezzocammino site, whereas lower concentrations of other bacteria and only the ADV41 virus was recovered at the Castel Giubileo site. This study revealed that the pollution level in the Tiber River was considerably higher downstream rather than

  17. Detection of Pathogenic Vibrio spp. in Shellfish by Using Multiplex PCR and DNA Microarrays

    OpenAIRE

    Panicker, Gitika; Call, Douglas R.; Krug, Melissa J.; Bej, Asim K.

    2004-01-01

    This study describes the development of a gene-specific DNA microarray coupled with multiplex PCR for the comprehensive detection of pathogenic vibrios that are natural inhabitants of warm coastal waters and shellfish. Multiplex PCR with vvh and viuB for Vibrio vulnificus, with ompU, toxR, tcpI, and hlyA for V. cholerae, and with tlh, tdh, trh, and open reading frame 8 for V. parahaemolyticus helped to ensure that total and pathogenic strains, including subtypes of the three Vibrio spp., coul...

  18. Commercially Available Rapid Methods for Detection of Selected Food-borne Pathogens.

    Science.gov (United States)

    Valderrama, Wladir B; Dudley, Edward G; Doores, Stephanie; Cutter, Catherine N

    2016-07-01

    Generally, the enumeration and isolation of food-borne pathogens is performed using culture-dependent methods. These methods are sensitive, inexpensive, and provide both qualitative and quantitative assessment of the microorganisms present in a sample, but these are time-consuming. For this reason, researchers are developing new techniques that allow detection of food pathogens in shorter period of time. This review identifies commercially available methods for rapid detection and quantification of Listeria monocytogenes, Salmonella spp., Staphylococcus aureus, and Shiga toxin-producing Escherichia coli in food samples. Three categories are discussed: immunologically based methods, nucleic acid-based assays, and biosensors. This review describes the basic mechanism and capabilities of each method, discusses the difficulties of choosing the most convenient method, and provides an overview of the future challenges for the technology for rapid detection of microorganisms. PMID:25749054

  19. A new pentaplex-nested PCR to detect five pathogenic bacteria in free living amoebae.

    Science.gov (United States)

    Calvo, L; Gregorio, I; García, A; Fernández, M T; Goñi, P; Clavel, A; Peleato, M L; Fillat, M F

    2013-02-01

    Changes in water use and anthropogenic activity have major impacts on the quality of natural aquatic ecosystems, water distribution and wastewater plants. One of the main problems is the presence of some pathogenic microorganisms that are resistant to disinfection procedures when they are hosted by free living amoeba and that in many cases are hardly detectable by culture-based procedures. In this work we report a sensitive, low-cost procedure consisting of a pentaplex-nested PCR that allows simultaneous detection of Legionella pneumophila, Mycobacterium spp., Pseudomonas spp., Vibrio cholerae and the microcystin-producing cyanobacteria Microcystis aeruginosa. The method has been used to detect the presence of these pathogenic bacteria in water and inside free living amoeba. Its validation in 72 samples obtained from different water sources from Aragon (Spain) evidences that Mycobacterium and Pseudomonas spp are prevailing as amoeba-resistant bacteria.

  20. Rapid Detection and Identification of a Pathogen's DNA Using Phi29 DNA Polymerase

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Y.; Dunn, J.; Gao, S.; Bruno, J. F.; Luft, B. J.

    2008-10-31

    Zoonotic pathogens including those transmitted by insect vectors are some of the most deadly of all infectious diseases known to mankind. A number of these agents have been further weaponized and are widely recognized as being potentially significant biothreat agents. We describe a novel method based on multiply-primed rolling circle in vitro amplification for profiling genomic DNAs to permit rapid, cultivation-free differential detection and identification of circular plasmids in infectious agents. Using Phi29 DNA polymerase and a two-step priming reaction we could reproducibly detect and characterize by DNA sequencing circular DNA from Borrelia burgdorferi B31 in DNA samples containing as little as 25 pg of Borrelia DNA amongst a vast excess of human DNA. This simple technology can ultimately be adapted as a sensitive method to detect specific DNA from both known and unknown pathogens in a wide variety of complex environments.

  1. Progress in rapid detection and identification of unknown human and agricultural pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Barnes, T; Holzrichter, J F; Milanovich, F P

    1999-08-13

    The medical industry is driving pathogen detection technology from its present characteristics of $50/sample, 100 sample capability systems, with several day time responses, having several percent error rates in reported outcomes. The systems described above are capable of providing samples at < $5/test, managing several million samples, < 1-hour cycle times, (or just minutes in some cases) and < 0.1% error rates. Because of their importance to the medical and agricultural communities, all ''important'' pathogens will have detection kits available (within air transport times, anywhere in the world) by 2020, and the most well known pathogens will have kits available within a few years. Many are available now. Because of the importance of the food supply to modern nations, these technologies will be employed everywhere in this industry. For example, the United States imports 30 B tons of food a year, but inspects < 1%. Portable inspection systems will make it possible to test for dangerous pathogens in feed lots, food processing plants, markets, and points of use. Outbreaks of animal or plant disease will be immediately detectable using field instrumentation, and more complex samples can be sent to central testing laboratories where more sophisticated test systems will be available. Unusual pathogens either naturally or purposefully selected or developed, will require special attention because there is not a commercial economic driver for the development of detection systems and curative agents. Their development, and production for sufficient availability, will require significant investments by the world community. The strategy and costs for developing vaccines or curative drugs will be very expensive and will need special attention. However it is important that attention be directed to these problems because such attention has a strong deterrent effect on potential developers or users. The capacity to use the full information content contained

  2. An improved detection and quantification method for the coral pathogen Vibrio coralliilyticus.

    Directory of Open Access Journals (Sweden)

    Bryan Wilson

    Full Text Available DNA- and RNA-based PCR and reverse-transcription real-time PCR assays were developed for diagnostic detection of the vcpA zinc-metalloprotease implicated in the virulence of the coral pathogen Vibrio coralliilyticus. Both PCR methods were highly specific for V. coralliilyticus and failed to amplify strains of closely-related Vibrio species. The assays correctly detected all globally occurring V. coralliilyticus isolates including a newly-described isolate [TAV24] infecting gorgonians in the Mediterranean Sea and highlighted those isolates that had been potentially misidentified, in particular V. tubiashii strains ATCC 19105 and RE22, historically described as important oyster pathogens. The real-time assay is sensitive, detecting 10 gene copies and the relationships between gene copy number and cycle threshold (C T were highly linear (R(2≥ 99.7. The real-time assay was also not affected by interference from non-target DNA. These assays are useful for rapid detection of V. coralliilyticus and monitoring of virulence levels in environmental samples, allowing for implementation of timely management steps to limit and possibly prevent losses due to V. coralliilyticus infection, as well as furthering investigations of factors affecting pathogenesis of this important marine pathogen.

  3. Low-cost, real-time, continuous flow PCR system for pathogen detection.

    Science.gov (United States)

    Fernández-Carballo, B Leticia; McGuiness, Ian; McBeth, Christine; Kalashnikov, Maxim; Borrós, Salvador; Sharon, Andre; Sauer-Budge, Alexis F

    2016-04-01

    In this paper, we present a portable and low cost point-of-care (POC) PCR system for quantitative detection of pathogens. Our system is based on continuous flow PCR which maintains fixed temperatures zones and pushes the PCR solution between two heated areas allowing for faster heat transfer and as a result, a faster PCR. The PCR system is built around a 46.0 mm × 30.9 mm × 0.4 mm disposable thermoplastic chip. In order to make the single-use chip economically viable, it was manufactured by hot embossing and was designed to be compatible with roll-to-roll embossing for large scale production. The prototype instrumentation surrounding the chip includes two heaters, thermal sensors, and an optical system. The optical system allows for pathogen detection via real time fluorescence measurements. FAM probes were used as fluorescent reporters of the amplicons generated during the PCR. To demonstrate the function of the chip, two infectious bacteria targets were selected: Chlamydia trachomatis and Escherichia coli O157:H7. For both bacteria, the limit of detection of the system was determined, PCR efficiencies were calculated, and different flow velocities were tested. We have demonstrated successful detection for these two bacterial pathogens highlighting the versatility and broad utility of our portable, low-cost, and rapid PCR diagnostic device.

  4. In-situ detection of multiple pathogenic bacteria on food surfaces

    Science.gov (United States)

    Chai, Yating; Horikawa, Shin; Hu, Jiajia; Chen, I.-Hsuan; Hu, Jing; Barbaree, James M.; Chin, Bryan A.

    2015-05-01

    Real-time in-situ detection of pathogenic bacteria on fresh food surfaces was accomplished with phage-based magnetoelastic (ME) biosensors. The ME biosensor is constructed of a small rectangular strip of ME material that is coated with a biomolecular recognition element (phage, antibodies or proteins, etc.) that is specific to the target pathogen. This mass-sensitive ME biosensor is wirelessly actuated into mechanical resonance by an externally applied time-varying magnetic field. When the biosensor binds with target bacteria, the mass of the sensor increases, resulting in a decrease in the sensor's resonant frequency. In order to compensate for nonspecific binding, control biosensors without phage were used in this experiment. In previous research, the biosensors were measured one by one. However, the simultaneous measurement of multiple sensors was accomplished in this research, and promises to greatly shorten the analysis time for bacterial detection. Additionally, the use of multiple biosensors enables the possibility of simultaneous detection of different pathogenic bacteria. This paper presents results of experiments in which multiple phage-based ME biosensors were simultaneously monitored. The E2 phage and JRB7 phage from a landscape phage library served as the bio-recognition element that have the capability of binding specifically with Salmonella typhimurium and B. anthracis spores, respectively. Real-time in-situ detection of Salmonella typhimurium and B. anthracis spores on food surfaces are presented.

  5. Detection and enumeration of four foodborne pathogens in raw commingled silo milk in the United States.

    Science.gov (United States)

    Jackson, Emily E; Erten, Edibe S; Maddi, Neeraj; Graham, Thomas E; Larkin, John W; Blodgett, Robert J; Schlesser, Joseph E; Reddy, Ravinder M

    2012-08-01

    A nationwide survey was conducted to obtain qualitative and quantitative data on bacterial contamination of raw commingled silo milk intended for pasteurization. The levels of total aerobic bacteria, total coliforms, Enterobacteriaceae, Escherichia coli, and Staphylococcus aureus were determined using the TEMPO system. The prevalence rates and levels of presumptive Bacillus cereus, E. coli O157:H7, Listeria monocytogenes, and Salmonella spp. were determined in 214 samples. B. cereus was detected in 8.91% of samples, at 3.0 to 93 CFU/ml. E. coli O157:H7 was detected in 3.79 to 9.05% of samples, at bacteria were slightly lower in samples containing no pathogens. No correlation was observed between the levels of organisms detected with the TEMPO system and the presence or levels of any pathogen except E. coli O157:H7. A higher average log-transformed count of total viable bacteria was observed in samples positive for this organism. The high prevalence rates of target pathogens may be attributed to a variety of factors, including detection methods, sample size, and commingling of the milk in the silo. The effects of commingling likely contributed to the high prevalence rates and low levels of target pathogens because of the inclusion of milk from multiple bulk tanks. The high prevalence rates also may be the result of analysis of larger sample volumes using more sensitive detection methods. These quantitative data could be utilized to perform more accurate risk assessments and to better estimate the appropriate level of protection for dairy products and processing technologies.

  6. Phage-protease-peptide: a novel trifecta enabling multiplex detection of viable bacterial pathogens.

    Science.gov (United States)

    Alcaine, S D; Tilton, L; Serrano, M A C; Wang, M; Vachet, R W; Nugen, S R

    2015-10-01

    Bacteriophages represent rapid, readily targeted, and easily produced molecular probes for the detection of bacterial pathogens. Molecular biology techniques have allowed researchers to make significant advances in the bioengineering of bacteriophage to further improve speed and sensitivity of detection. Despite their host specificity, bacteriophages have not been meaningfully leveraged in multiplex detection of bacterial pathogens. We propose a proof-of-principal phage-based scheme to enable multiplex detection. Our scheme involves bioengineering bacteriophage to carry a gene for a specific protease, which is expressed during infection of the target cell. Upon lysis, the protease is released to cleave a reporter peptide, and the signal detected. Here we demonstrate the successful (i) modification of T7 bacteriophage to carry tobacco etch virus (TEV) protease; (ii) expression of TEV protease by Escherichia coli following infection by our modified T7, an average of 2000 units of protease per phage are produced during infection; and (iii) proof-of-principle detection of E. coli in 3 h after a primary enrichment via TEV protease activity using a fluorescent peptide and using a designed target peptide for matrix-assisted laser desorption/ionization time-of-flight mass spectrometry analysis (MALDI-TOF MS) analysis. This proof-of-principle can be translated to other phage-protease-peptide combinations to enable multiplex bacterial detection and readily adopted on multiple platforms, like MALDI-TOF MS or fluorescent readers, commonly found in labs.

  7. Robust and Real Time Detection of Curvy Lanes (Curves Having Desired Slopes for Driving Assistance and Autonomous Vehicles

    Directory of Open Access Journals (Sweden)

    Amartansh Dubey

    2015-01-01

    Full Text Available One of the biggest reasons for road accidents is cu rvy lanes and blind turns. Even one of the biggest hurdles for new autonomous vehicles is to d etect curvy lanes, multiple lanes and lanes with a lot of discontinuity and noise. This paper p resents very efficient and advanced algorithm for detecting curves having desired slopes (especia lly for detecting curvy lanes in real time and detection of curves (lanes with a lot of noise , discontinuity and disturbances. Overall aim is to develop robust method for this task which is applicable even in adverse conditions. Even in some of most famous and useful libraries like OpenC V and Matlab, there is no function available for detecting curves having desired slope s, shapes, discontinuities. Only few predefined shapes like circle, ellipse, etc, can be detected using presently available functions. Proposed algorithm can not only detect curves with discontinuity, noise, desired slope but also it can perform shadow and illumination correction a nd detect/ differentiate between different curves.

  8. Identification of upper respiratory tract pathogens using electrochemical detection on an oligonucleotide microarray.

    Directory of Open Access Journals (Sweden)

    Michael J Lodes

    Full Text Available Bacterial and viral upper respiratory infections (URI produce highly variable clinical symptoms that cannot be used to identify the etiologic agent. Proper treatment, however, depends on correct identification of the pathogen involved as antibiotics provide little or no benefit with viral infections. Here we describe a rapid and sensitive genotyping assay and microarray for URI identification using standard amplification and hybridization techniques, with electrochemical detection (ECD on a semiconductor-based oligonucleotide microarray. The assay was developed to detect four bacterial pathogens (Bordetella pertussis, Streptococcus pyogenes, Chlamydia pneumoniae and Mycoplasma pneumoniae and 9 viral pathogens (adenovirus 4, coronavirus OC43, 229E and HK, influenza A and B, parainfluenza types 1, 2, and 3 and respiratory syncytial virus. This new platform forms the basis for a fully automated diagnostics system that is very flexible and can be customized to suit different or additional pathogens. Multiple probes on a flexible platform allow one to test probes empirically and then select highly reactive probes for further iterative evaluation. Because ECD uses an enzymatic reaction to create electrical signals that can be read directly from the array, there is no need for image analysis or for expensive and delicate optical scanning equipment. We show assay sensitivity and specificity that are excellent for a multiplexed format.

  9. A novel microbial source tracking microarray for pathogen detection and fecal source identification in environmental systems.

    Science.gov (United States)

    Li, Xiang; Harwood, Valerie J; Nayak, Bina; Staley, Christopher; Sadowsky, Michael J; Weidhaas, Jennifer

    2015-06-16

    Pathogen detection and the identification of fecal contamination sources are challenging in environmental waters. Factors including pathogen diversity and ubiquity of fecal indicator bacteria hamper risk assessment and remediation of contamination sources. A custom microarray targeting pathogens (viruses, bacteria, protozoa), microbial source tracking (MST) markers, and antibiotic resistance genes was tested against DNA obtained from whole genome amplification (WGA) of RNA and DNA from sewage and animal (avian, cattle, poultry, and swine) feces. Perfect and mismatch probes established the specificity of the microarray in sewage, and fluorescence decrease of positive probes over a 1:10 dilution series demonstrated semiquantitative measurement. Pathogens, including norovirus, Campylobacter fetus, Helicobacter pylori, Salmonella enterica, and Giardia lamblia were detected in sewage, as well as MST markers and resistance genes to aminoglycosides, beta-lactams, and tetracycline. Sensitivity (percentage true positives) of MST results in sewage and animal waste samples (21-33%) was lower than specificity (83-90%, percentage of true negatives). Next generation DNA sequencing revealed two dominant bacterial families that were common to all sample types: Ruminococcaceae and Lachnospiraceae. Five dominant phyla and 15 dominant families comprised 97% and 74%, respectively, of sequences from all fecal sources. Phyla and families not represented on the microarray are possible candidates for inclusion in subsequent array designs. PMID:25970344

  10. Physics Based Model for Online Fault Detection in Autonomous Cryogenic Loading System

    Science.gov (United States)

    Kashani, Ali; Devine, Ekaterina Viktorovna P; Luchinsky, Dmitry Georgievich; Smelyanskiy, Vadim; Sass, Jared P.; Brown, Barbara L.; Patterson-Hine, Ann

    2013-01-01

    We report the progress in the development of the chilldown model for rapid cryogenic loading system developed at KSC. The nontrivial characteristic feature of the analyzed chilldown regime is its active control by dump valves. The two-phase flow model of the chilldown is approximated as one-dimensional homogeneous fluid flow with no slip condition for the interphase velocity. The model is built using commercial SINDAFLUINT software. The results of numerical predictions are in good agreement with the experimental time traces. The obtained results pave the way to the application of the SINDAFLUINT model as a verification tool for the design and algorithm development required for autonomous loading operation.

  11. Development of genetic methods for detection of pathogenic microorganisms in irradiated food

    International Nuclear Information System (INIS)

    The existence of injured microorganisms in food and their recovery during culturing procedures is critical. Injured microorganisms present a potential threat in food safety since they may repair themselves under suitable conditions. This study provides development of recovery methods for detection of injured foodborne microorganisms, after irradiation treatment at different doses. For this purpose, iniatially the methods of recovery were compared at different irradiation doses. At the second step, antibiotic resistance of foodborne pathogens was determined. After determination of antibiotic resistance, recovery methods were modified for reversibly injured foodborne pathogens at different doses after irradiation treatment . Finally, damages of DNA were detected by a spectrophotometric method after 1.0 kGy irradiation treatment

  12. Microbial Diagnostic Microarrays for the Detection and Typing of Food- and Water-Borne (Bacterial) Pathogens.

    Science.gov (United States)

    Kostić, Tanja; Sessitsch, Angela

    2011-10-14

    Reliable and sensitive pathogen detection in clinical and environmental (including food and water) samples is of greatest importance for public health. Standard microbiological methods have several limitations and improved alternatives are needed. Most important requirements for reliable analysis include: (i) specificity; (ii) sensitivity; (iii) multiplexing potential; (iv) robustness; (v) speed; (vi) automation potential; and (vii) low cost. Microarray technology can, through its very nature, fulfill many of these requirements directly and the remaining challenges have been tackled. In this review, we attempt to compare performance characteristics of the microbial diagnostic microarrays developed for the detection and typing of food and water pathogens, and discuss limitations, points still to be addressed and issues specific for the analysis of food, water and environmental samples.

  13. Microbial Diagnostic Microarrays for the Detection and Typing of Food- and Water-Borne (Bacterial Pathogens

    Directory of Open Access Journals (Sweden)

    Tanja Kostić

    2011-10-01

    Full Text Available Reliable and sensitive pathogen detection in clinical and environmental (including food and water samples is of greatest importance for public health. Standard microbiological methods have several limitations and improved alternatives are needed. Most important requirements for reliable analysis include: (i specificity; (ii sensitivity; (iii multiplexing potential; (iv robustness; (v speed; (vi automation potential; and (vii low cost. Microarray technology can, through its very nature, fulfill many of these requirements directly and the remaining challenges have been tackled. In this review, we attempt to compare performance characteristics of the microbial diagnostic microarrays developed for the detection and typing of food and water pathogens, and discuss limitations, points still to be addressed and issues specific for the analysis of food, water and environmental samples.

  14. Flow-enhanced detection of biological pathogens using piezoelectric microcantilever arrays

    Science.gov (United States)

    McGovern, John-Paul

    The piezoelectric microcantilever sensor (PEMS) is an all-electrical resonant oscillator biosensor system capable of in-situ and label-free detection. With various insulation and antibody immobilization schemes, it is well-suited for sensitive, specific pathogen detection applications with limits of detection on the order of relevant lethal infectious dosages. Initial PEMS implementation demonstrated biodetection of just 36 total Bacillus anthracis (BA) spores in 0.8 ml of liquid. However, concerns of cross reactivity between the antibody and closely related species of the target pathogens casts doubts on the usefulness of antibody-based assays in terms of the specificity of detection. The goal of this thesis is to develop the PEMS as a method for in-situ, label-free, pathogen detection with better limits of detection than current antibody-based methods as well as high sensitivity and specificity, by exploring PEMS array detection and engineered fluidics specificity augmentation. Experimentation in an 8 mm wide channel revealed that optimal discriminatory detection of BA spores among close cousins (B. cereus (BC), thuringiensis (BT) and subtilis (BS)) was achieved at 14 ml/min. At this flow rate, the detection signals of BC, BT, and BS all fell to within the noise level of the sensor, while that of BA was still nearly optimal. Thus, it was deduced that the interaction forces of BC, BT, and BS were 100 pN. Implementation of array sensing systems enabled real-time, redundant biosensor assays and concurrent background determination by a reference PEMS. Consequentially, successful real-time detection of 10 BA spores/ml was achieved, and single Cryptosporidium parvum (CP) oocyst detection at 0.1 oocysts/ml was accomplished with step-wise resonance frequency shifts of 290 Hz and signal to noise ratios (SNR) greater than 5. In a 19 mm wide flow channel, optimal single oocyst detection efficiency was achieved at 2 ml/min. Optimal discrimination of CP from C. muris (CM

  15. Ultrarapid Detection of Pathogenic Bacteria Using a 3D Immunomagnetic Flow Assay

    OpenAIRE

    Lee, Wonjae; Kwon, Donghoon; Chung, Boram; Jung, Gyoo Yeol; Au, Anthony; Folch, Albert; Jeon, Sangmin

    2014-01-01

    We developed a novel 3D immunomagnetic flow assay for the rapid detection of pathogenic bacteria in a large-volume food sample. Antibody-functionalized magnetic nanoparticle clusters (AbMNCs) were magnetically immobilized on the surfaces of a 3D-printed cylindrical microchannel. The injection of a Salmonella-spiked sample solution into the microchannel produced instant binding between the AbMNCs and the Salmonella bacteria due to their efficient collisions. Nearly perfect capture of the AbMNC...

  16. Fluorescence in situ hybridization for the tissue detection of bacterial pathogens associated with porcine infections

    DEFF Research Database (Denmark)

    Jensen, Henrik Elvang; Jensen, Louise Kruse; Barington, Kristiane;

    2015-01-01

    sequences within intact cells. FISH allows direct histological localization of the bacteria in the tissue and thereby a correlation between the infection and the histopathological changes present. This chapter presents protocols for FISH identification of bacterial pathogens in fixed deparaffinized tissue......Fluorescence in situ hybridization (FISH) is an efficient technique for the identification of specific bacteria in tissue of both experimental and spontaneous infections. The method detects specific sequences of nucleic acids by hybridization of fluorescently labeled probes to complementary target...

  17. HIGH SENSITIVE PCR METHOD FOR DETECTION OF PATHOGENIC Leptospira spp. IN PARAFFIN-EMBEDDED TISSUES

    OpenAIRE

    Angel Alberto Noda; Islay Rodríguez; Yaindrys Rodríguez; Anamays Govín; Carmen Fernández; Ana Margarita Obregón

    2014-01-01

    This study describes the development and application of a new PCR assay for the specific detection of pathogenic leptospires and its comparison with a previously reported PCR protocol. New primers were designed for PCR optimization and evaluation in artificially-infected paraffin-embedded tissues. PCR was then applied to post-mortem, paraffin-embedded samples, followed by amplicon sequencing. The PCR was more efficient than the reported protocol, allowing the amplification of expected DNA fra...

  18. Results from the Autonomous Triggering of in situ Sensors on Kilauea Volcano, HI, from Eruption Detection by Spacecraft

    Science.gov (United States)

    Doubleday, J.; Behar, A.; Davies, A.; Mora-Vargas, A.; Tran, D.; Abtahi, A.; Pieri, D. C.; Boudreau, K.; Cecava, J.

    2008-12-01

    Response time in acquiring sensor data in volcanic emergencies can be greatly improved through use of autonomous systems. For instance, ground-based observations and data processing applications of the JPL Volcano Sensor Web have promptly triggered spacecraft observations [e.g., 1]. The reverse command and information flow path can also be useful, using autonomous analysis of spacecraft data to trigger in situ sensors. In this demonstration project, SO2 sensors were incorporated into expendable "Volcano Monitor" capsules and placed downwind of the Pu'u 'O'o vent of Kilauea volcano, Hawai'i. In nominal (low) power conservation mode, data from these sensors were collected and transmitted every hour to the Volcano Sensor Web through the Iridium Satellite Network. When SO2 readings exceeded a predetermined threshold, the modem within the Volcano Monitor sent an alert to the Sensor Web, and triggered a request for prompt Earth Observing-1 (EO-1) spacecraft data acquisition. The Volcano Monitors were also triggered by the Sensor Web in response to an eruption detection by the MODIS instrument on Terra. During these pre- defined "critical events" the Sensor Web ordered the SO2 sensors within the Volcano Monitor to increase their sampling frequency to every 5 minutes (high power "burst mode"). Autonomous control of the sensors' sampling frequency enabled the Sensor Web to monitor and respond to rapidly evolving conditions, and allowed rapid compilation and dissemination of these data to the scientific community. Reference: [1] Davies et al., (2006) Eos, 87, (1), 1 and 5. This work was performed at the Jet Propulsion Laboratory-California Institute of Technology, under contract to NASA. Support was provided by the NASA AIST program, the Idaho Space Grant Consortium, and the New Mexico Space Grant Program. We also especially thank the personnel of the USGS Hawaiian Volcano Observatory for their invaluable scientific guidance and logistical assistance.

  19. SUSCEPTIBILITY AND DETECTION OF EXTENDED SPECTRUM β-LACTAMASE ENZYMES FROM OTITIS MEDIA PATHOGENS

    Directory of Open Access Journals (Sweden)

    Ejikeugwu Chika

    2013-01-01

    Full Text Available Otitis media is the bacterial infection of the middle ear usually accompanied with inflammation, effusions and pain. It can present clinically in two major forms: Acute Otitis Media (AOM and Otitis Media with Effusion (OME and it is one of the leading cause of hospital visits and antibiotic prescriptions amongst children and even adults. Antibiotic resistance is a global public health problem and Extended Spectrum β-Lactamase (ESBL enzymes is one of the new mechanisms of resistance in especially Gram negative bacteria including Escherichia coli, Klebsiella pneumoniae and Pseudomonas aeruginosa. ESBLs are plasmid-mediated β-lactamase enzymes that hydrolyze extended-spectrum oxyimino 3rd generation cephalosporins and monobactams. Organisms producing ESBLs have remained important nosocomial and community-acquired pathogens over the years. Ear swab specimens of children (aged 0-7 with suspected Otitis media infections and who attended a tertiary hospital in Enugu, Nigeria were cultured on growth media. E. coli, K. pneumoniae and P. aeruginosa were isolated and identified by standard microbiological techniques. Antibiogram was conducted on all isolated ear pathogens by Kirby-Bauer disk diffusion method and ESBL production was evaluated by the Double Disk Synergy Test (DDST method. Imipenem and meropenem were the most active antibiotics against the E. coli, K. pneumoniae and P. aeruginosa ear pathogens. Sulphamethoxazole-trimethoprim was the least active agent against the tested ear pathogens and this was followed by ofloxacin, ciprofloxacin, gentamicin, cefotaxime and ceftazidime. None of the E. coli, K. pneumoniae and P. aeruginosa ear pathogens produced ESBLs by the method used. ESBL production by pathogenic bacteria confers on organisms the ability to be multidrug resistant. Their prompt and accurate detection from clinical specimens, together with reporting them along with hospitals routine antibiogram results is vital as this will help to

  20. Detection of enteric pathogens in Turkey flocks affected with severe enteritis, in Brazil.

    Science.gov (United States)

    Moura-Alvarez, Joelma; Nuñez, Luis F N; Astolfi-Ferreira, Claudete S; Knöbl, Terezinha; Chacón, Jorge L; Moreno, Andrea M; Jones, Richard C; Ferreira, Antonio J Piantino

    2014-08-01

    Twenty-two flocks of turkeys affected by enteric problems, with ages between 10 and 104 days and located in the Southern region of Brazil, were surveyed for turkey by PCR for turkey astrovirus type 2 (TAstV-2), turkey coronavirus (TCoV), hemorrhagic enteritis virus (HEV), rotavirus, reovirus, Salmonella spp., and Lawsonia intracellularis (Li) infections. Eleven profiles of pathogen combination were observed. The most frequently encountered pathogen combinations were TCoV-Li, followed by TCoV-TAstV-2-Li, TCoV-TastV-2. Only TCoV was detected as the sole pathogen in three flocks. Eight and 19 flocks of the 22 were positive for TAstV-2 and TCoV, respectively. Six were positive for Salmonella spp. and L. intracellularis was detected in 12 turkey flocks. Reovirus and HEV were not detected in this survey. These results throw new light on the multiple etiology of enteritis in turkeys. The implications of these findings and their correlation with the clinical signs are comprehensively discussed, illustrating the complexity of the enteric diseases.

  1. Atypical sensors for direct and rapid neuronal detection of bacterial pathogens.

    Science.gov (United States)

    Lim, Ji Yeon; Choi, Seung-In; Choi, Geunyeol; Hwang, Sun Wook

    2016-03-09

    Bacterial infection can threaten the normal biological functions of a host, often leading to a disease. Hosts have developed complex immune systems to cope with the danger. Preceding the elimination of pathogens, selective recognition of the non-self invaders is necessary. At the forefront of the body's defenses are the innate immune cells, which are equipped with particular sensor molecules that can detect common exterior patterns of invading pathogens and their secreting toxins as well as with phagocytic machinery. Inflammatory mediators and cytokines released from these innate immune cells and infected tissues can boost the inflammatory cascade and further recruit adaptive immune cells to maximize the elimination and resolution. The nervous system also seems to interact with this process, mostly known to be affected by the inflammatory mediators through the binding of neuronal receptors, consequently activating neural circuits that tune the local and systemic inflammatory states. Recent research has suggested new contact points: direct interactions of sensory neurons with pathogens. Latest findings demonstrated that the sensory neurons not only share pattern recognition mechanisms with innate immune cells, but also utilize endogenous and exogenous electrogenic components for bacterial pathogen detection, by which the electrical firing prompts faster information flow than what could be achieved when the immune system is solely involved. As a result, rapid pain generation and active accommodation of the immune status occur. Here we introduced the sensory neuron-specific detector molecules for directly responding to bacterial pathogens and their signaling mechanisms. We also discussed extended issues that need to be explored in the future.

  2. Nano-particle enhanced impedimetric biosensor for detection of foodborne pathogens

    International Nuclear Information System (INIS)

    Recent outbreaks of foodborne illness have been increased the need for rapid and sensitive methods for detection of these pathogens. Conventional methods for pathogens detection and identification involve prolonged multiple enrichment steps. Even though some immunological rapid assays are available, these assays still need enrichment steps result in delayed detection. Biosensors have shown great potential for rapid detection of foodborne pathogens. They are capable of direct monitoring the antigen-antibody reactions in real time. Among the biosensors, impedimetric biosensors have been widely adapted as an analysis tool for the study of various biological binding reactions because of their high sensitivity and reagentless operation. In this study a nanoparticle-enhanced impedimetric biosensor for Salmonella enteritidis detection was developed which detected impedance changes caused by the attachment of the cells to the anti-Salmonella antibodies immobilized on interdigitated gold electrodes. Successive immobilization of neutravidin followed by anti-Salmonella antibodies was performed to the sensing area to create a biological detection surface. To enhance the impedance responses generated by antigen-antibody reactions, anti-Salmonella antibody conjugated nanoparticles were introduced on the sensing area. Using a portable impedance analyzer, the impedance across the interdigital electrodes was measured after the series of antigen-antibody bindings. Bacteria cells present in solution attached to capture antibodies and became tethered to the sensor surface. Attached bacteria cells changed the dielectric constant of the media between the electrodes thereby causing a change in measured impedance. Optimum input frequency was determined by analyzing frequency characteristics of the biosensor over ranges of applied frequencies from 10 Hz to 400 Hz. At 100 Hz of input frequency, the biosensor was most sensitive to the changes of the bacteria concentration and this frequency

  3. Towards On-site Pathogen Detection Using Antibody-based Sensors

    DEFF Research Database (Denmark)

    Skottrup, Peter Durand; Nicolaisen, Mogens; Justesen, Annemarie Fejer

    2008-01-01

    In this paper the recent progress within biosensors for plant pathogen detection will be reviewed. Bio-recognition layers on sensors can be designed in various ways, however the most popular approach is to immobilise antibodies for specific capture of analytes. Focus will be put on antibody surfa...... monocytogenes, Streptococcus mutans, Bacillus cereus, Bacillus anthracis, Campylobacter and Escherichia coli. We will touch upon optimal assay design and further discuss the strengths and limitations of current sensor technologies for detection of viruses, bacteria and fungi....

  4. Physics based model for online fault detection in autonomous cryogenic loading system

    International Nuclear Information System (INIS)

    We report the progress in the development of the chilldown model for a rapid cryogenic loading system developed at NASA-Kennedy Space Center. The nontrivial characteristic feature of the analyzed chilldown regime is its active control by dump valves. The two-phase flow model of the chilldown is approximated as one-dimensional homogeneous fluid flow with no slip condition for the interphase velocity. The model is built using commercial SINDA/FLUINT software. The results of numerical predictions are in good agreement with the experimental time traces. The obtained results pave the way to the application of the SINDA/FLUINT model as a verification tool for the design and algorithm development required for autonomous loading operation

  5. Detection of Bacterial Wilt Pathogen and Isolation of Its Bacteriophage from Banana in Lumajang Area, Indonesia

    Directory of Open Access Journals (Sweden)

    Hardian Susilo Addy

    2016-01-01

    Full Text Available Bacterial wilt disease on banana is an important disease in Lumajang District and causes severe yield loss. Utilizing bacteriophage as natural enemy of pathogenic bacteria has been widely known as one of the control strategies. This research was aimed at determining the causing agent of bacterial wilt on banana isolated from Lumajang area, to obtain wide-host range bacteriophages against bacterial wilt pathogen and to know the basic characteristic of bacteriophages, particularly its nucleic acid type. Causative agent of bacterial wilt was isolated from symptomatic banana trees from seven districts in Lumajang area on determinative CPG plates followed by rapid detection by PCR technique using specific pair-primer. Bacteriophages were also isolated from soil of infected banana crop in Sukodono District. Morphological observation showed that all bacterial isolates have similar characteristic as common bacterial wilt pathogen, Ralstonia solanacearum. In addition, detection of FliC region in all isolates confirmed that all isolates were R. solanacearum according to the presence of 400 bp of FliC DNA fragment. Moreover, two bacteriophages were obtained from this experiment (ϕRSSKD1 and ϕRSSKD2, which were able to infect all nine R. solanacearum isolates. Nucleic acid analysis showed that the nucleic acid of bacteriophages was DNA (deoxyribonucleic acid.

  6. Real-time PCR for detection and quantification of fungal and oomycete tomato pathogens in plant and soil samples

    NARCIS (Netherlands)

    Lievens, B.; Brouwer, M.; Vanachter, A.C.R.C.; Cammue, B.P.A.; Thomma, B.P.H.J.

    2006-01-01

    Although new, rapid detection and identification technologies are becoming available more and more for various plant pathogens, pathogen quantification remains one of the main challenges in the disease management of many crops. Currently, real-time polymerase chain reaction (PCR) is the most straigh

  7. Nucleic Acid-Based Detection and Identification of Bacterial and Fungal Plant Pathogens - Final Report

    Energy Technology Data Exchange (ETDEWEB)

    Kingsley, Mark T.

    2001-03-13

    The threat to American interests from terrorists is not limited to attacks against humans. Terrorists might seek to inflict damage to the U.S. economy by attacking our agricultural sector. Infection of commodity crops by bacterial or fungal crop pathogens could adversely impact U.S. agriculture, either directly from damage to crops or indirectly from damage to our ability to export crops suspected of contamination. Recognizing a terrorist attack against U.S. agriculture, to be able to prosecute the terrorists, is among the responsibilities of the members of Hazardous Material Response Unit (HMRU) of the Federal Bureau of Investigation (FBI). Nucleic acid analysis of plant pathogen strains by the use of polymerase chain reaction (PCR) amplification techniques is a powerful method for determining the exact identity of pathogens, as well as their possible region of origin. This type of analysis, however, requires that PCR assays be developed specific to each particular pathogen strain, and analysis protocols developed that are specific to the particular instrument used for detection. The objectives of the work described here were threefold: 1) to assess the potential terrorist threat to U.S. agricultural crops, 2) to determine whether suitable assays exist to monitor that threat, and 3) where assays are needed for priority plant pathogen threats, to modify or develop those assays for use by specialists at the HMRU. The assessment of potential threat to U.S. commodity crops and the availability of assays for those threats were described in detail in the Technical Requirements Document (9) and will be summarized in this report. This report addresses development of specific assays identified in the Technical Requirements Document, and offers recommendations for future development to ensure that HMRU specialists will be prepared with the PCR assays they need to protect against the threat of economic terrorism.

  8. Combining information of autonomic modulation and CGM measurements enables prediction and improves detection of spontaneous hypoglycemic events

    DEFF Research Database (Denmark)

    Cichosz, Simon Lebech; Frystyk, Jan; Tarnow, Lise;

    2015-01-01

    We have previously tested, in a laboratory setting, a novel algorithm that enables prediction of hypoglycemia. The algorithm integrates information of autonomic modulation, based on heart rate variability (HRV), and data based on a continuous glucose monitoring (CGM) device. Now, we investigate...... whether the algorithm is suitable for prediction of hypoglycemia and for improvement of hypoglycemic detection during normal daily activities. Twenty-one adults (13 men) with T1D prone to hypoglycemia were recruited and monitored with CGM and a Holter device while they performed normal daily activities......+HRV model-combining model (ii) with HRV data. A total of 12 hypoglycemic events (glucose levels < 3.9 mmol/L, 70 mg/dL) and 237 euglycemic measurements were included. For a 20-minute prediction, model (i) resulted in a ROC AUC of 0.69. If a high sensitivity of 100% was chosen, the corresponding specificity...

  9. Ultrarapid detection of pathogenic bacteria using a 3D immunomagnetic flow assay.

    Science.gov (United States)

    Lee, Wonjae; Kwon, Donghoon; Chung, Boram; Jung, Gyoo Yeol; Au, Anthony; Folch, Albert; Jeon, Sangmin

    2014-07-01

    We developed a novel 3D immunomagnetic flow assay for the rapid detection of pathogenic bacteria in a large-volume food sample. Antibody-functionalized magnetic nanoparticle clusters (AbMNCs) were magnetically immobilized on the surfaces of a 3D-printed cylindrical microchannel. The injection of a Salmonella-spiked sample solution into the microchannel produced instant binding between the AbMNCs and the Salmonella bacteria due to their efficient collisions. Nearly perfect capture of the AbMNCs and AbMNCs-Salmonella complexes was achieved under a high flow rate by stacking permanent magnets with spacers inside the cylindrical separator to maximize the magnetic force. The concentration of the bacteria in solution was determined using ATP luminescence measurements. The detection limit was better than 10 cfu/mL, and the overall assay time, including the binding, rinsing, and detection steps for a 10 mL sample took less than 3 min. To our knowledge, the 3D immunomagnetic flow assay described here provides the fastest high-sensitivity, high-capacity method for the detection of pathogenic bacteria. PMID:24856003

  10. New Trends in Impedimetric Biosensors for the Detection of Foodborne Pathogenic Bacteria

    Directory of Open Access Journals (Sweden)

    Yixian Wang

    2012-03-01

    Full Text Available The development of a rapid, sensitive, specific method for the foodborne pathogenic bacteria detection is of great importance to ensure food safety and security. In recent years impedimetric biosensors which integrate biological recognition technology and impedance have gained widespread application in the field of bacteria detection. This paper presents an overview on the progress and application of impedimetric biosensors for detection of foodborne pathogenic bacteria, particularly the new trends in the past few years, including the new specific bio-recognition elements such as bacteriophage and lectin, the use of nanomaterials and microfluidics techniques. The applications of these new materials or techniques have provided unprecedented opportunities for the development of high-performance impedance bacteria biosensors. The significant developments of impedimetric biosensors for bacteria detection in the last five years have been reviewed according to the classification of with or without specific bio-recognition element. In addition, some microfluidics systems, which were used in the construction of impedimetric biosensors to improve analytical performance, are introduced in this review.

  11. Using metagenomic analyses to estimate the consequences of enrichment bias for pathogen detection

    Directory of Open Access Journals (Sweden)

    Pettengill James B

    2012-07-01

    Full Text Available Abstract Background Enriching environmental samples to increase the probability of detection has been standard practice throughout the history of microbiology. However, by its very nature, the process of enrichment creates a biased sample that may have unintended consequences for surveillance or resolving a pathogenic outbreak. With the advent of next-generation sequencing and metagenomic approaches, the possibility now exists to quantify enrichment bias at an unprecedented taxonomic breadth. Findings We investigated differences in taxonomic profiles of three enriched and unenriched tomato phyllosphere samples taken from three different tomato fields (n = 18. 16S rRNA gene meteganomes were created for each of the 18 samples using 454/Roche’s pyrosequencing platform, resulting in a total of 165,259 sequences. Significantly different taxonomic profiles and abundances at a number of taxonomic levels were observed between the two treatments. Although as many as 28 putative Salmonella sequences were detected in enriched samples, there was no significant difference in the abundance of Salmonella between enriched and unenriched treatments. Conclusions Our results illustrate that the process of enriching greatly alters the taxonomic profile of an environmental sample beyond that of the target organism. We also found evidence suggesting that enrichment may not increase the probability of detecting a target. In conclusion, our results further emphasize the need to develop metagenomics as a validated culture independent method for pathogen detection.

  12. Electrochemical impedance immunosensor for rapid detection of stressed pathogenic Staphylococcus aureus bacteria.

    Science.gov (United States)

    Bekir, Karima; Barhoumi, Houcine; Braiek, Mohamed; Chrouda, Amani; Zine, Nadia; Abid, Nabil; Maaref, Abdelrazek; Bakhrouf, Amina; Ouada, Hafedh Ben; Jaffrezic-Renault, Nicole; Mansour, Hedi Ben

    2015-10-01

    In this work, we report the adaptation of bacteria to stress conditions that induce instability of their cultural, morphological, and enzymatic characters, on which the identification of pathogenic bacteria is based. These can raise serious issues during the characterization of bacteria. The timely detection of pathogens is also a subject of great importance. For this reason, our objective is oriented towards developing an immunosensing system for rapid detection and quantification of Staphylococcus aureus. Polyclonal anti-S. aureus are immobilized onto modified gold electrode by self-assembled molecular monolayer (SAM) method. The electrochemical performances of the developed immunosensor were evaluated by impedance spectroscopy through the monitoring of the charge transfer resistance at the modified solid/liquid interface using ferri-/ferrocyanide as redox probe. The developed immunosensor was applied to detect stressed and resuscitate bacteria. As a result, a stable and reproducible immunosensor with sensitivity of 15 kΩ/decade and a detection limit of 10 CFU/mL was obtained for the S. aureus concentrations ranging from 10(1) to 10(7) CFU/mL. A low deviation in the immunosensor response (±10 %) was signed when it is exposed to stressed and not stressed bacteria.

  13. Two Laboratory Activities Using Conventional or Real-Time PCR to Simulate Pathogenic E. coli Detection

    Directory of Open Access Journals (Sweden)

    Joanna R. Klein

    2014-02-01

    Full Text Available In these lab activities, students perform conventional PCR and real-time PCR to simulate pathogenic E. coli detection. The labs were designed to complement a previously published virtual PCR classroom activity in which students are asked to design a PCR-based diagnostic test for a pathogenic strain of E. coli. In the virtual PCR activity, students use bioinformatics to discover that the Shiga toxin genes (stx1 and stx2 are unique to the Enterohemorrhagic E. coli (EHEC strain O157:H7. Thus they come to the conclusion that doing PCR with primers designed for shiga toxin should be able to differentiate O157:H7 from other strains of E. coli. In the lab activity described here, students actually perform the PCR assay. Performing PCR enhanced student understanding of the technique beyond what was accomplished through the virtual PCR classroom activity and is recommended as an addition to the case study.

  14. Rapid and high-throughput detection of highly pathogenic bacteria by Ibis PLEX-ID technology.

    Directory of Open Access Journals (Sweden)

    Daniela Jacob

    Full Text Available In this manuscript, we describe the identification of highly pathogenic bacteria using an assay coupling biothreat group-specific PCR with electrospray ionization mass spectrometry (PCR/ESI-MS run on an Ibis PLEX-ID high-throughput platform. The biothreat cluster assay identifies most of the potential bioterrorism-relevant microorganisms including Bacillus anthracis, Francisella tularensis, Yersinia pestis, Burkholderia mallei and pseudomallei, Brucella species, and Coxiella burnetii. DNA from 45 different reference materials with different formulations and different concentrations were chosen and sent to a service screening laboratory that uses the PCR/ESI-MS platform to provide a microbial identification service. The standard reference materials were produced out of a repository built up in the framework of the EU funded project "Establishment of Quality Assurances for Detection of Highly Pathogenic Bacteria of Potential Bioterrorism Risk" (EQADeBa. All samples were correctly identified at least to the genus level.

  15. Simultaneous detection of multiple lower genital tract pathogens by an impedimetric immunochip.

    Science.gov (United States)

    Chiriacò, Maria Serena; Primiceri, Elisabetta; De Feo, Francesco; Montanaro, Alessandro; Monteduro, Anna Grazia; Tinelli, Andrea; Megha, Marcella; Carati, Davide; Maruccio, Giuseppe

    2016-05-15

    Lower genital tract infections caused by both sexually and not-sexually transmitted pathogens in women are a key public health priority worldwide, especially in developing countries. Since standard analyses are time-consuming, appropriate therapeutic intervention is often neglected or delayed. Lab-on-chips and biosensors open new perspectives and offer innovative tools to simplify the diagnosis by medical staff, especially in countries with inadequate resources. Here we report a biosensing platform based on Electrochemical Impedance Spectroscopy (EIS) that allows multiplexed detection of Candida albicans, Streptococcus agalactiae and Chlamydia trachomatis with a single biochip, enabling a quick screening thanks to the presence of different immobilized antibodies, each specific for one of the different target pathogens. PMID:26686917

  16. Coliform detection in cheese is associated with specific cheese characteristics, but no association was found with pathogen detection.

    Science.gov (United States)

    Trmčić, A; Chauhan, K; Kent, D J; Ralyea, R D; Martin, N H; Boor, K J; Wiedmann, M

    2016-08-01

    Coliform detection in finished products, including cheese, has traditionally been used to indicate whether a given product has been manufactured under unsanitary conditions. As our understanding of the diversity of coliforms has improved, it is necessary to assess whether coliforms are a good indicator organism and whether coliform detection in cheese is associated with the presence of pathogens. The objective of this study was (1) to evaluate cheese available on the market for presence of coliforms and key pathogens, and (2) to characterize the coliforms present to assess their likely sources and public health relevance. A total of 273 cheese samples were tested for presence of coliforms and for Salmonella, Staphylococcus aureus, Shiga toxin-producing Escherichia coli, Listeria monocytogenes, and other Listeria species. Among all tested cheese samples, 27% (75/273) tested positive for coliforms in concentrations >10cfu/g. Pasteurization, pH, water activity, milk type, and rind type were factors significantly associated with detection of coliforms in cheese; for example, a higher coliform prevalence was detected in raw milk cheeses (42% with >10cfu/g) compared with pasteurized milk cheese (21%). For cheese samples contaminated with coliforms, only water activity was significantly associated with coliform concentration. Coliforms isolated from cheese samples were classified into 13 different genera, including the environmental coliform genera Hafnia, Raoultella, and Serratia, which represent the 3 genera most frequently isolated across all cheeses. Escherichia, Hafnia, and Enterobacter were significantly more common among raw milk cheeses. Based on sequencing of the housekeeping gene clpX, most Escherichia isolates were confirmed as members of fecal commensal clades of E. coli. All cheese samples tested negative for Salmonella, Staph. aureus, and Shiga toxin-producing E. coli. Listeria spp. were found in 12 cheese samples, including 5 samples positive for L

  17. Multiplexed lateral flow microarray assay for detection of citrus pathogens Xylella fastidiosa and Xanthomonas axonopodis pv citri

    Energy Technology Data Exchange (ETDEWEB)

    Cary; R. Bruce (Santa Fe, NM); Stubben, Christopher J. (Los Alamos, NM)

    2011-03-22

    The invention provides highly sensitive and specific assays for the major citrus pathogens Xylella fastidiosa and Xanthomonas axonopodis, including a field deployable multiplexed assay capable of rapidly assaying for both pathogens simultaneously. The assays are directed at particular gene targets derived from pathogenic strains that specifically cause the major citrus diseases of citrus variegated chlorosis (Xylella fastidiosa 9a5c) and citrus canker (Xanthomonas axonopodis pv citri). The citrus pathogen assays of the invention offer femtomole sensitivity, excellent linear dynamic range, and rapid and specific detection.

  18. A Multiplex PCR Assay for the Detection of Pathogenic Genes of EPEC, ETEC and EIEC

    Institute of Scientific and Technical Information of China (English)

    ZHANG Tienan; LI Jichang; LU Chengwu; HUO Guicheng

    2006-01-01

    A multiplex polymerase chain reaction (PCR) was developed to detect three pathogenic genes of enteropathogenic, enterotocigenic and enteroinvasive Escherichia coli.. In this study three different sets of oligonucleotide primer were simultaneously used, and in this way, specific fragments of 880, 600, 150 bp for EPEC eaeA,EIEC ipaH and ETEC ST genes were amplified, respectively. The best condition of the multiplex PCR was: after an initial heat denaturation step at 95℃ for 5 min, followed by 30 cycles of denaturation at 94 ℃ for 40 s, primer annealing at 51.3 ℃ for 40 s and extension at 72 ℃ for 1 min, final extension at 72 ℃ for 10 min. The detection limit of tively. It may be a good way for the detection and identification of Diarrhea-causing E. coli..

  19. Colour-based Object Detection and Tracking for Autonomous Quadrotor UAV

    International Nuclear Information System (INIS)

    With robotics becoming a fundamental aspect of modern society, further research and consequent application is ever increasing. Aerial robotics, in particular, covers applications such as surveillance in hostile military zones or search and rescue operations in disaster stricken areas, where ground navigation is impossible. The increased visual capacity of UAV's (Unmanned Air Vehicles) is also applicable in the support of ground vehicles to provide supplies for emergency assistance, for scouting purposes or to extend communication beyond insurmountable land or water barriers. The Quadrotor, which is a small UAV has its lift generated by four rotors and can be controlled by altering the speeds of its motors relative to each other. The four rotors allow for a higher payload than single or dual rotor UAVs, which makes it safer and more suitable to carry camera and transmitter equipment. An onboard camera is used to capture and transmit images of the Quadrotor's First Person View (FPV) while in flight, in real time, wirelessly to a base station. The aim of this research is to develop an autonomous quadrotor platform capable of transmitting real time video signals to a base station for processing. The result from the image analysis will be used as a feedback in the quadrotor positioning control. To validate the system, the algorithm should have the capacity to make the quadrotor identify, track or hover above stationary or moving objects

  20. Colour-based Object Detection and Tracking for Autonomous Quadrotor UAV

    Science.gov (United States)

    Kadouf, Hani Hunud A.; Mohd Mustafah, Yasir

    2013-12-01

    With robotics becoming a fundamental aspect of modern society, further research and consequent application is ever increasing. Aerial robotics, in particular, covers applications such as surveillance in hostile military zones or search and rescue operations in disaster stricken areas, where ground navigation is impossible. The increased visual capacity of UAV's (Unmanned Air Vehicles) is also applicable in the support of ground vehicles to provide supplies for emergency assistance, for scouting purposes or to extend communication beyond insurmountable land or water barriers. The Quadrotor, which is a small UAV has its lift generated by four rotors and can be controlled by altering the speeds of its motors relative to each other. The four rotors allow for a higher payload than single or dual rotor UAVs, which makes it safer and more suitable to carry camera and transmitter equipment. An onboard camera is used to capture and transmit images of the Quadrotor's First Person View (FPV) while in flight, in real time, wirelessly to a base station. The aim of this research is to develop an autonomous quadrotor platform capable of transmitting real time video signals to a base station for processing. The result from the image analysis will be used as a feedback in the quadrotor positioning control. To validate the system, the algorithm should have the capacity to make the quadrotor identify, track or hover above stationary or moving objects.

  1. Rapid detection and identification of viral and bacterial fish pathogens using a DNA array‐based multiplex assay

    DEFF Research Database (Denmark)

    Lievens, B.; Frans, I.; Heusdens, C.;

    2011-01-01

    Fish diseases can be caused by a variety of diverse organisms, including bacteria, fungi, viruses and protozoa, and pose a universal threat to the ornamental fish industry and aquaculture. The lack of rapid, accurate and reliable means by which fish pathogens can be detected and identified has been...... for sensitive pathogen detection and identification in complex samples such as infected tissue is demonstrated in this study....

  2. PCR-based specific techniques used for detecting the most important pathogens on strawberry: a systematic review

    OpenAIRE

    Mirmajlessi, Seyed Mahyar; Destefanis, Marialaura; Gottsberger, Richard Alexander; Mänd, Marika; Loit, Evelin

    2015-01-01

    Background Strawberry diseases are a major limiting factor that severely impact plant agronomic performance. Regarding limitations of traditional techniques for detection of pathogens, researchers have developed specific DNA-based tests as sensitive and specific techniques. The aim of this review is to provide an overview of polymerase chain reaction (PCR)-based methods used for detection or quantification of the most widespread strawberry pathogens, such as Fusarium oxysporum f.sp. fragariae...

  3. Assessment of an extraction protocol to detect the major mastitis-causing pathogens in bovine milk.

    Science.gov (United States)

    Cressier, B; Bissonnette, N

    2011-05-01

    Despite all efforts to control its spread, mastitis remains the most costly disease for dairy farmers worldwide. One key component of better control of this disease is identification of the causative bacterial agent during udder infections in cows. Mastitis is complex, however, given the diversity of pathogens that must be identified. Development of a rapid and efficient bacterial species identification tool is thus necessary. This study was conducted to demonstrate the feasibility of bacterial DNA extraction for the automated molecular detection of major mastitis-causing pathogens directly in milk samples to complement traditional microbiological identification. Extraction and detection procedures were designed and optimized to achieve detection in a respectable time frame, at a reasonable cost, and with a high throughput capacity. The following species were identified: Staphylococcus aureus, Escherichia coli, Streptococcus uberis, Streptococcus agalactiae, Streptococcus dysgalactiae, and Klebsiella spp. (including Klebsiella oxytoca and Klebsiella pneumoniae). The detection procedure includes specific genomic DNA amplification by multiplex PCR for each species, separation by capillary electrophoresis, and laser-assisted automated detection. The specificity of the primers was assessed with a panel of bacteria representing mastitis-negative control species. The extraction protocol comprised multiple steps, starting with centrifugation for fat removal, followed by heating in the presence of a cation exchange resin to trap divalent ions. The analytical sensitivity was 100 cfu/mL for milk samples spiked with Staph. aureus, Strep. dysgalactiae, and E. coli, with a tendency for K. pneumoniae. The detection limit was 500 cfu/mL for Strep. uberis and Strep. agalactiae. The overall diagnostic sensitivity (95.4%) and specificity (97.3%) were determined in a double-blind randomized assay by processing 172 clinical milk samples with microbiological characterization as the

  4. Laser diagnostic technology for early detection of pathogen infestation in orange fruits

    International Nuclear Information System (INIS)

    Due to an increased expectation of food products that respect high quality and safety standards, there is a need for the growth of accurate, fast, objective and non-destructive technologies for quality determination of food and agricultural products. For this purpose, a diagnostic system based on laser photoacoustic spectroscopy (LPAS) was developed at ENEA Frascati Molecular Spectroscopy Laboratory (Italy). In the design of the photoacoustic detector, particular emphasis was placed in attaining a high sensitivity in detecting ethylene (ET) down to sub-parts per billion level (minimum detectable concentration 0.2 ppb). This was required due to the necessity to monitor and follow up ET production at a single fruit scale. ET is normally synthesised in very low amounts by healthy citrus fruits; however stress conditions such as pathogen attack may induce a substantial increase in the synthesised ET. In the present paper, the comparison between the ET emitted by healthy oranges (Citrus sinensis L. Osbeck) cv Navel and by Phytophthora citrophthora infested Navel orange fruits are reported. The obtained results show a well evident increase in ET emission from the infested fruit with respect to the healthy one, even 24 h after the inoculation with the pathogen; at that time the tissue necrosis was not yet visible, and the fruit was also not yet damaged. The possibility to perform a real time non-destructive detection of ET traces makes the LPAS a powerful tool for monitoring the healthy state of the citrus fruits.

  5. Establishment and Application of a Visual DNA Microarray for the Detection of Food-borne Pathogens.

    Science.gov (United States)

    Li, Yongjin

    2016-01-01

    The accurate detection and identification of food-borne pathogenic microorganisms is critical for food safety nowadays. In the present work, a visual DNA microarray was established and applied to detect pathogens commonly found in food, including Salmonella enterica, Shigella flexneri, E. coli O157:H7 and Listeria monocytogenes in food samples. Multiplex PCR (mPCR) was employed to simultaneously amplify specific gene fragments, fimY for Salmonella, ipaH for Shigella, iap for L. monocytogenes and ECs2841 for E. coli O157:H7, respectively. Biotinylated PCR amplicons annealed to the microarray probes were then reacted with a streptavidin-alkaline phosphatase conjugate and nitro blue tetrazolium/5-bromo-4-chloro-3'-indolylphosphate, p-toluidine salt (NBT/BCIP); the positive results were easily visualized as blue dots formatted on the microarray surface. The performance of a DNA microarray was tested against 14 representative collection strains and mock-contamination food samples. The combination of mPCR and a visual micro-plate chip specifically and sensitively detected Salmonella enterica, Shigella flexneri, E. coli O157:H7 and Listeria monocytogenes in standard strains and food matrices with a sensitivity of ∼10(2) CFU/mL of bacterial culture. Thus, the developed method is advantageous because of its high throughput, cost-effectiveness and ease of use. PMID:26860568

  6. Laser diagnostic technology for early detection of pathogen infestation in orange fruits

    Energy Technology Data Exchange (ETDEWEB)

    Giubileo, Gianfranco, E-mail: gianfranco.giubileo@frascati.enea.i [ENEA Frascati, Via E. Fermi 45, 00044 (Italy); Lai, Antonella; Piccinelli, Delinda [ENEA Frascati, Via E. Fermi 45, 00044 (Italy); Puiu, Adriana [Tor Vergata University of Rome, Faculty of Engineering, Via del Politecnico 1, 00133 Rome (Italy)

    2010-11-11

    Due to an increased expectation of food products that respect high quality and safety standards, there is a need for the growth of accurate, fast, objective and non-destructive technologies for quality determination of food and agricultural products. For this purpose, a diagnostic system based on laser photoacoustic spectroscopy (LPAS) was developed at ENEA Frascati Molecular Spectroscopy Laboratory (Italy). In the design of the photoacoustic detector, particular emphasis was placed in attaining a high sensitivity in detecting ethylene (ET) down to sub-parts per billion level (minimum detectable concentration 0.2 ppb). This was required due to the necessity to monitor and follow up ET production at a single fruit scale. ET is normally synthesised in very low amounts by healthy citrus fruits; however stress conditions such as pathogen attack may induce a substantial increase in the synthesised ET. In the present paper, the comparison between the ET emitted by healthy oranges (Citrus sinensis L. Osbeck) cv Navel and by Phytophthora citrophthora infested Navel orange fruits are reported. The obtained results show a well evident increase in ET emission from the infested fruit with respect to the healthy one, even 24 h after the inoculation with the pathogen; at that time the tissue necrosis was not yet visible, and the fruit was also not yet damaged. The possibility to perform a real time non-destructive detection of ET traces makes the LPAS a powerful tool for monitoring the healthy state of the citrus fruits.

  7. Exploration of Simple Analytical Approaches for Rapid Detection of Pathogenic Bacteria

    Energy Technology Data Exchange (ETDEWEB)

    Rahman, Salma [Iowa State Univ., Ames, IA (United States)

    2005-01-01

    Many of the current methods for pathogenic bacterial detection require long sample-preparation and analysis time, as well as complex instrumentation. This dissertation explores simple analytical approaches (e.g., flow cytometry and diffuse reflectance spectroscopy) that may be applied towards ideal requirements of a microbial detection system, through method and instrumentation development, and by the creation and characterization of immunosensing platforms. This dissertation is organized into six sections. In the general Introduction section a literature review on several of the key aspects of this work is presented. First, different approaches for detection of pathogenic bacteria will be reviewed, with a comparison of the relative strengths and weaknesses of each approach, A general overview regarding diffuse reflectance spectroscopy is then presented. Next, the structure and function of self-assembled monolayers (SAMs) formed from organosulfur molecules at gold and micrometer and sub-micrometer patterning of biomolecules using SAMs will be discussed. This section is followed by four research chapters, presented as separate manuscripts. Chapter 1 describes the efforts and challenges towards the creation of imunosensing platforms that exploit the flexibility and structural stability of SAMs of thiols at gold. 1H, 1H, 2H, 2H-perfluorodecyl-1-thiol SAM (PFDT) and dithio-bis(succinimidyl propionate)-(DSP)-derived SAMs were used to construct the platform. Chapter 2 describes the characterization of the PFDT- and DSP-derived SAMs, and the architectures formed when it is coupled to antibodies as well as target bacteria. These studies used infrared reflection spectroscopy (IRS), X-ray photoelectron spectroscopy (XPS), and electrochemical quartz crystal microbalance (EQCM), Chapter 3 presents a new sensitive, and portable diffuse reflection based technique for the rapid identification and quantification of pathogenic bacteria. Chapter 4 reports research efforts in the

  8. [Autonomic neuropathies].

    Science.gov (United States)

    Siepmann, T; Penzlin, A I; Illigens, B M W

    2013-07-01

    Autonomic neuropathies are a heterogeneous group of diseases that involve damage of small peripheral autonomic Aδ- and C-fibers. Causes of autonomic nerve fiber damage are disorders such as diabetes mellitus and HIV-infection. Predominant symptoms of autonomic neuropathy are orthostatic hypotension, gastro-intestinal problems, urogenital dysfunction, and cardiac arrhythmia, which can severely impair the quality of life in affected patients. Furthermore, autonomic neuropathies can be induced by autoimmune diseases such as acute inflammatory demyelinating polyneuropathy, hereditary disorders such as the lysosomal storage disorder Fabry disease and hereditary sensory and autonomic neuropathies, as well as certain toxins and drugs.

  9. Dual Enlargement of Gold Nanoparticles: From Mechanism to Scanometric Detection of Pathogenic Bacteria

    DEFF Research Database (Denmark)

    Cao, Cuong; Gontard, Lionel Cervera; Le Ly, Tram Thuy;

    2011-01-01

    the electron density of the nanostructures, leading to a stronger intensity for colorimetric discrimination as well as better sensitivity for quantitative measurement. Based on this, a simple scanometric assay for the on‐slide detection of the food‐born pathogen Campylobacter jejuni is developed. After...... capturing the target bacteria, gold‐tagged immunoprobes are added to create a signal on a solid substrate. The signal is then amplified by the dual enlargement process, resulting in a strong color intensity that can easily be recognized by the unaided eye, or measured by an inexpensive flatbed scanner...

  10. Fluorescence in situ hybridization rapidly detects three different pathogenic bacteria in urinary tract infection samples.

    Science.gov (United States)

    Wu, Qing; Li, Yan; Wang, Ming; Pan, Xiao P; Tang, Yong F

    2010-11-01

    The detection of pathogenic bacteria in urine is an important criterion for diagnosing urinary tract infections (UTIs). By using fluorescence in situ hybridization (FISH) with rRNA-targeted, fluorescently labeled oligonucleotide probes, bacterial pathogens present in urine samples were identified within 3-4 h. In this study, three probes that are specific for Escherichia coli, Enterococcus faecalis and Staphylococcus aureus were designed based on the conserved 16S RNA sequences, whereas probe Eub338 broadly recognizes all bacteria. We collected a total of 1000 urine samples, and 325 of these samples tested positive for a UTI via traditional culturing techniques; additionally, all 325 of these samples tested positive with the Eub338 probe in FISH analysis. FISH analyses with species-specific probes were performed in parallel to the test the ability to differentiate among several pathogenic bacteria. The samples for these experiments included 76 E. coli infected samples, 32 E. faecalis infected samples and 9 S. aureus infected samples. Compared to conventional methods of bacterial identification, the FISH method produced positive results for >90% of the samples tested. FISH has the potential to become an extremely useful diagnostic tool for UTIs because it has a quick turnaround time and high accuracy.

  11. Quantitative Molecular Detection of 19 Major Pathogens in the Interdental Biofilm of Periodontally Healthy Young Adults.

    Science.gov (United States)

    Carrouel, Florence; Viennot, Stéphane; Santamaria, Julie; Veber, Philippe; Bourgeois, Denis

    2016-01-01

    pathogen in adult periodontal disease, represents 8.08% of the 19 bacteria analyzed. P. gingivalis was detected in 19% of healthy subjects and represents 0.02% of the interdental biofilm. T. forsythensis and T. denticola (0.02 and 0.04% of the interdental biofilm) were detected in 93 and 49% of healthy subjects, respectively. The effective presence of periodontal pathogens is a strong indicator of the need to develop new methods for disrupting interdental biofilm in daily oral hygiene. PMID:27313576

  12. Quantitative molecular detection of 19 major pathogens in the interdental biofilm of periodontally healthy young adults

    Directory of Open Access Journals (Sweden)

    Florence eCarrouel

    2016-06-01

    Full Text Available In oral health, the interdental spaces are a real ecological niche for which the body has few or no alternative defenses and where the traditional daily methods for control by disrupting biofilm are not adequate. The interdental spaces are the source of many hypotheses regarding their potential associations with and/or causes of cardiovascular disease, diabetes, chronic kidney disease, degenerative disease, and depression. This PCR study is the first to describe the interdental microbiota in healthy adults aged 18-35 yrs old with reference to the Socransky complexes. The complexes tended to reflect microbial succession events in developing dental biofilms. Early colonizers included members of the yellow, green and purple complexes. The orange complex bacteria generally appear after the early colonizers and include many putative periodontal pathogens, such as F. nucleatum. The red complex (P. gingivalis, T. forsythia and T. denticola was considered the climax community and is on the list of putative periodontal pathogens. The 19 major periodontal pathogens tested were expressed at various levels. F. nucleatum was the most abundant species, and the least abundant were A. viscosus, P. gingivalis and A. actino. a. The genome counts for E. corrodens, C. concisus, C. rectus, T. denticola and T. forsythensis increased significantly with subject age. The study highlights the observation that bacteria from the yellow complex (Streptococcus spp., S. mitis, the green complex (E. corrodens, C. gracilis, C. ochracea, C. sputigena, A. actino a, the purple complex (V. parvula, A. ondotolitycus and the blue complex (A. viscosus are correlated. Concerning the orange complex, F. nucleatum is the most abundant species in interdental biofilm. The red complex, which is recognized as the most important pathogen in adult periodontal disease, represents 8.08% of the 19 bacteria analyzed. P. gingivalis was detected in 19% of healthy subjects and represents 0.02% of the

  13. Quantitative Molecular Detection of 19 Major Pathogens in the Interdental Biofilm of Periodontally Healthy Young Adults

    Science.gov (United States)

    Carrouel, Florence; Viennot, Stéphane; Santamaria, Julie; Veber, Philippe; Bourgeois, Denis

    2016-01-01

    pathogen in adult periodontal disease, represents 8.08% of the 19 bacteria analyzed. P. gingivalis was detected in 19% of healthy subjects and represents 0.02% of the interdental biofilm. T. forsythensis and T. denticola (0.02 and 0.04% of the interdental biofilm) were detected in 93 and 49% of healthy subjects, respectively. The effective presence of periodontal pathogens is a strong indicator of the need to develop new methods for disrupting interdental biofilm in daily oral hygiene. PMID:27313576

  14. Deception detection with behavioral, autonomic, and neural measures: Conceptual and methodological considerations that warrant modesty.

    Science.gov (United States)

    Meijer, Ewout H; Verschuere, Bruno; Gamer, Matthias; Merckelbach, Harald; Ben-Shakhar, Gershon

    2016-05-01

    The detection of deception has attracted increased attention among psychological researchers, legal scholars, and ethicists during the last decade. Much of this has been driven by the possibility of using neuroimaging techniques for lie detection. Yet, neuroimaging studies addressing deception detection are clouded by lack of conceptual clarity and a host of methodological problems that are not unique to neuroimaging. We review the various research paradigms and the dependent measures that have been adopted to study deception and its detection. In doing so, we differentiate between basic research designed to shed light on the neurocognitive mechanisms underlying deceptive behavior and applied research aimed at detecting lies. We also stress the distinction between paradigms attempting to detect deception directly and those attempting to establish involvement by detecting crime-related knowledge, and discuss the methodological difficulties and threats to validity associated with each paradigm. Our conclusion is that the main challenge of future research is to find paradigms that can isolate cognitive factors associated with deception, rather than the discovery of a unique (brain) correlate of lying. We argue that the Comparison Question Test currently applied in many countries has weak scientific validity, which cannot be remedied by using neuroimaging measures. Other paradigms are promising, but the absence of data from ecologically valid studies poses a challenge for legal admissibility of their outcomes. PMID:26787599

  15. Hyperspectral imaging using a color camera and its application for pathogen detection

    Science.gov (United States)

    Yoon, Seung-Chul; Shin, Tae-Sung; Heitschmidt, Gerald W.; Lawrence, Kurt C.; Park, Bosoon; Gamble, Gary

    2015-02-01

    This paper reports the results of a feasibility study for the development of a hyperspectral image recovery (reconstruction) technique using a RGB color camera and regression analysis in order to detect and classify colonies of foodborne pathogens. The target bacterial pathogens were the six representative non-O157 Shiga-toxin producing Escherichia coli (STEC) serogroups (O26, O45, O103, O111, O121, and O145) grown in Petri dishes of Rainbow agar. The purpose of the feasibility study was to evaluate whether a DSLR camera (Nikon D700) could be used to predict hyperspectral images in the wavelength range from 400 to 1,000 nm and even to predict the types of pathogens using a hyperspectral STEC classification algorithm that was previously developed. Unlike many other studies using color charts with known and noise-free spectra for training reconstruction models, this work used hyperspectral and color images, separately measured by a hyperspectral imaging spectrometer and the DSLR color camera. The color images were calibrated (i.e. normalized) to relative reflectance, subsampled and spatially registered to match with counterpart pixels in hyperspectral images that were also calibrated to relative reflectance. Polynomial multivariate least-squares regression (PMLR) was previously developed with simulated color images. In this study, partial least squares regression (PLSR) was also evaluated as a spectral recovery technique to minimize multicollinearity and overfitting. The two spectral recovery models (PMLR and PLSR) and their parameters were evaluated by cross-validation. The QR decomposition was used to find a numerically more stable solution of the regression equation. The preliminary results showed that PLSR was more effective especially with higher order polynomial regressions than PMLR. The best classification accuracy measured with an independent test set was about 90%. The results suggest the potential of cost-effective color imaging using hyperspectral image

  16. Pathogenic chytrid fungus Batrachochytrium dendrobatidis, but not B. salamandrivorans, detected on eastern hellbenders.

    Science.gov (United States)

    Bales, Emma K; Hyman, Oliver J; Loudon, Andrew H; Harris, Reid N; Lipps, Gregory; Chapman, Eric; Roblee, Kenneth; Kleopfer, John D; Terrell, Kimberly A

    2015-01-01

    Recent worldwide declines and extinctions of amphibian populations have been attributed to chytridiomycosis, a disease caused by the pathogenic fungus Batrachochytrium dendrobatidis (Bd). Until recently, Bd was thought to be the only Batrachochytrium species that infects amphibians; however a newly described species, Batrachochytrium salamandrivorans (Bs), is linked to die-offs in European fire salamanders (Salamandra salamandra). Little is known about the distribution, host range, or origin of Bs. In this study, we surveyed populations of an aquatic salamander that is declining in the United States, the eastern hellbender (Cryptobranchus alleganiensis alleganiensis), for the presence of Bs and Bd. Skin swabs were collected from a total of 91 individuals in New York, Pennsylvania, Ohio, and Virginia, and tested for both pathogens using duplex qPCR. Bs was not detected in any samples, suggesting it was not present in these hellbender populations (0% prevalence, 95% confidence intervals of 0.0-0.04). Bd was found on 22 hellbenders (24% prevalence, 95% confidence intervals of 0.16 ≤ 0.24 ≤ 0.34), representing all four states. All positive samples had low loads of Bd zoospores (12.7 ± 4.9 S.E.M. genome equivalents) compared to other Bd susceptible species. More research is needed to determine the impact of Batrachochytrium infection on hellbender fitness and population viability. In particular, understanding how hellbenders limit Bd infection intensity in an aquatic environment may yield important insights for amphibian conservation. This study is among the first to evaluate the distribution of Bs in the United States, and is consistent with another, which failed to detect Bs in the U.S. Knowledge about the distribution, host-range, and origin of Bs may help control the spread of this pathogen, especially to regions of high salamander diversity, such as the eastern United States.

  17. Pathogenic chytrid fungus Batrachochytrium dendrobatidis, but not B. salamandrivorans, detected on eastern hellbenders.

    Directory of Open Access Journals (Sweden)

    Emma K Bales

    Full Text Available Recent worldwide declines and extinctions of amphibian populations have been attributed to chytridiomycosis, a disease caused by the pathogenic fungus Batrachochytrium dendrobatidis (Bd. Until recently, Bd was thought to be the only Batrachochytrium species that infects amphibians; however a newly described species, Batrachochytrium salamandrivorans (Bs, is linked to die-offs in European fire salamanders (Salamandra salamandra. Little is known about the distribution, host range, or origin of Bs. In this study, we surveyed populations of an aquatic salamander that is declining in the United States, the eastern hellbender (Cryptobranchus alleganiensis alleganiensis, for the presence of Bs and Bd. Skin swabs were collected from a total of 91 individuals in New York, Pennsylvania, Ohio, and Virginia, and tested for both pathogens using duplex qPCR. Bs was not detected in any samples, suggesting it was not present in these hellbender populations (0% prevalence, 95% confidence intervals of 0.0-0.04. Bd was found on 22 hellbenders (24% prevalence, 95% confidence intervals of 0.16 ≤ 0.24 ≤ 0.34, representing all four states. All positive samples had low loads of Bd zoospores (12.7 ± 4.9 S.E.M. genome equivalents compared to other Bd susceptible species. More research is needed to determine the impact of Batrachochytrium infection on hellbender fitness and population viability. In particular, understanding how hellbenders limit Bd infection intensity in an aquatic environment may yield important insights for amphibian conservation. This study is among the first to evaluate the distribution of Bs in the United States, and is consistent with another, which failed to detect Bs in the U.S. Knowledge about the distribution, host-range, and origin of Bs may help control the spread of this pathogen, especially to regions of high salamander diversity, such as the eastern United States.

  18. Detection and identification of intestinal pathogenic bacteria by hybridization to oligonucleotide microarrays

    Institute of Scientific and Technical Information of China (English)

    Lian-Qun Jin; Jun-Wen Li; Sheng-Qi Wang; Fu-Huan Chao; Xin-Wei Wang; Zheng-Quan Yuan

    2005-01-01

    AIM: To detect the common intestinal pathogenic bacteria quickly and accurately.METHODS: A rapid (<3 h) experimental procedure was set up based upon the gene chip technology. Target genes were amplified and hybridized by oligonucleotide microarrays.RESULTS: One hundred and seventy strains of bacteria in pure culture belonging to 11 genera were successfully discriminated under comparatively same conditions, and a series of specific hybridization maps corresponding to each kind of bacteria were obtained. When this method was applied to 26 divided cultures, 25 (96.2%) were identified.CONCLUSION: Salmonella sp., Escherichia coli, Shigella sp., Listeria monocytogenes, Vibrio parahaemolyticus,Staphylococcus aureus, Proteus sp., Bacillus cereus,Vibrio cholerae, Enterococcus faecalis, Yersinia enterocolitica, and Campylobacter jejuni can be detected and identified by our microarrays. The accuracy, range,and discrimination power of this assay can be continually improved by adding further oligonucleotides to the arrays without any significant increase of complexity or cost.

  19. Modeling and simulation of DNA flow in a microfluidic-based pathogen detection system

    Energy Technology Data Exchange (ETDEWEB)

    Trebotich, D; Miller, G H

    2005-01-31

    We present simulation results from a new computational model of DNA flow in microfluidic devices. This work is important because computational models are needed to design miniaturized biomedical devices that are becoming the state-of-the-art in many significant applications including pathogen detection as well as continuous monitoring and drug delivery. Currently advanced algorithms in design tools are non-existent but necessary to understand the complex fluid and polymer dynamics involved in biological flow at small scales. Our model is based on a fully coupled fluid-particle numerical algorithm with both stochastic and deterministic components in a bead-rod polymer representation. We have applied this work to DNA extraction configurations in a microfluidic PCR chamber used in a pathogen detection system. We demonstrate our method on the test problem of flow of a single DNA molecule in a 2D packed array microchannel. We are also investigating mechanisms for molecular ''sticking'' using short range forces.

  20. Molecular detection of tick-borne pathogens in Ixodes ricinus from Moldova collected in 1960.

    Science.gov (United States)

    Movila, Alexandru; Toderas, Ion; Uspenskaia, Inga; Conovalov, Jurii

    2013-06-01

    This study is the first report about the prevalence of tick-borne pathogens, as well as their (co-)infection rates, in the museum-archived I. ricinus female ticks collected in Moldova in 1960. A total of 16.7% (21/126) ticks was mono-infected. Borrelia burgdorferi sensu stricto was revealed as the most abundant species (4.8%) followed by B. garinii (1.6%), B. afzelii (0.8%), B. valaisiana (0.8%), and B. lusitaniae (0.8%). DNA of Rickettsia helvetica (2.4%), R. monacensis (2.4%), Anaplasma phagocytophilum (2.4%), 'Candidatus Neoehrlichia mikurensis' (0.8%), and Babesia microti (0.8%) were also detected, indicating the occurrence of these emerging tick-borne microorganisms in Moldova since 1960 at least. In this study, we detected a co-infection (0.8%; 1/126 tested ticks) between B. microti and R. helvetica. Additional investigations are warranted to further characterize a historical snapshot of the distribution of tick-borne pathogens in Europe.

  1. Development of a nested PCR assay to detect the pathogenic free-living amoeba Naegleria fowleri.

    Science.gov (United States)

    Réveiller, Fabienne L; Cabanes, Pierre-André; Marciano-Cabral, Francine

    2002-05-01

    Naegleria fowleri is the causative agent of primary amoebic meningoencephalitis, a fatal disease of the central nervous system that is acquired while swimming or diving in freshwater. A cDNA clone designated Mp2C15 obtained from N. fowleri was used as a probe to distinguish N. fowleri from other free-living amoebae. The Mp2C15 probe hybridized to genomic DNA from pathogenic N. fowleri and antigenically related non-pathogenic N. lovaniensis. Mp2C15 was digested with the restriction enzyme XbaI, resulting in two fragments, Mp2C15.G and Mp2C15.P. Four species of Naegleria and four species of Acanthamoeba were examined for reactivity with Mp2C15.P. Mp2C15.P was specific for N. fowleri and was used in the development of a nested PCR assay which is capable of detecting as little as 5 pg of N. fowleri DNA or five intact N. fowleri amoebae. In summary, a rapid, sensitive, and specific assay for the detection of N. fowleri was developed.

  2. 16S rRNA-based detection of oral pathogens in coronary atherosclerotic plaque

    Directory of Open Access Journals (Sweden)

    Mahendra Jaideep

    2010-01-01

    Full Text Available Background: Atherosclerosis develops as a response of the vessel wall to injury. Chronic bacterial infections have been associated with an increased risk for atherosclerosis and coronary artery disease. The ability of oral pathogens to colonize in coronary atheromatous plaque is well known. Aim: The aim of this study was to detect the presence of Treponema denticola, Porphyromonas gingivalis and Campylobacter rectus in the subgingival and atherosclerotic plaques of patients with coronary artery disease. Materials and Methods: Fifty-one patients in the age group of 40-80 years with coronary artery disease were selected for the study. DNA was extracted from the plaque samples. The specific primers for T. denticola, C. rectus and P. gingivalis were used to amplify a part of the 16S rRNA gene by polymerase chain reaction. Statistical Analysis Used: Chi-square analysis, correlation coefficient and prevalence percentage of the microorganisms were carried out for the analysis. Results: Of the 51 patients, T. denticola, C. rectus and P. gingivalis were detected in 49.01%, 21.51% and 45.10% of the atherosclerotic plaque samples. Conclusions: Our study revealed the presence of bacterial DNA of the oral pathogenic microorganisms in coronary atherosclerotic plaques. The presence of the bacterial DNA in the coronary atherosclerotic plaques in significant proportion may suggest the possible relationship between periodontal bacterial infection and genesis of coronary atherosclerosis.

  3. Identification of pathogenic microbial cells and spores by electrochemical detection on a biochip

    Directory of Open Access Journals (Sweden)

    Andresen Heiko

    2004-04-01

    Full Text Available Abstract Background Bacillus cereus constitutes a significant cause of acute food poisoning in humans. Despite the recent development of different detection methods, new effective control measures and better diagnostic tools are required for quick and reliable detection of pathogenic micro-organisms. Thus, the objective of this study was to determine a simple method for rapid identification of enterotoxic Bacillus strains. Here, a special attention is given to an electrochemical biosensor since it meets the requirements of minimal size, lower costs and decreased power consumption. Results A bead-based sandwich hybridization system was employed in conjugation with electric chips for detection of vegetative cells and spores of Bacillus strains based on their toxin-encoding genes. The system consists of a silicon chip based potentiometric cell, and utilizes paramagnetic beads as solid carriers of the DNA probes. The specific signals from 20 amol of bacterial cell or spore DNA were achieved in less than 4 h. The method was also successful when applied directly to unpurified spore and cell extract samples. The assay for the haemolytic enterotoxin genes resulted in reproducible signals from B. cereus and B. thuringiensis while haemolysin-negative B. subtilis strain did not yield any signal. Conclusions The sensitivity, convenience and specificity of the system have shown its potential. In this respect an electrochemical detection on a chip enabling a fast characterization and monitoring of pathogens in food is of interest. This system can offer a contribution in the rapid identification of bacteria based on the presence of specific genes without preceding nucleic acid amplification.

  4. Differential efficiency among DNA extraction methods influences detection of the amphibian pathogen Batrachochytrium dendrobatidis.

    Science.gov (United States)

    Bletz, M C; Rebollar, E A; Harris, R N

    2015-02-10

    Chytridiomycosis, caused by the fungal pathogen Batrachochytrium dendrobatidis (Bd), is responsible for massive declines and extinctions of amphibians worldwide. The most common method for detecting Bd is quantitative polymerase chain reaction (qPCR). qPCR is a highly sensitive detection technique, but its ability to determine the presence and accurately quantify the amount of Bd is also contingent on the efficiency of the DNA extraction method used prior to PCR. Using qPCR, we compared the extraction efficiency of 3 different extraction methods commonly used for Bd detection across a range of zoospore quantities: PrepMan Ultra Reagent, Qiagen DNeasy Blood and Tissue Kit, and Mobio PowerSoil DNA Isolation Kit. We show that not all extraction methods led to successful detection of Bd for the low zoospore quantities and that there was variation in the estimated zoospore equivalents among the methods, which demonstrates that these methods have different extraction efficiencies. These results highlight the importance of considering the extraction method when comparing across studies. The Qiagen DNeasy kit had the highest efficiency. We also show that replicated estimates of less than 1 zoospore can result from known zoospore concentrations; therefore, such results should be considered when obtained from field data. Additionally, we discuss the implications of our findings for interpreting previous studies and for conducting future Bd surveys. It is imperative to use the most efficient DNA extraction method in tandem with the highly sensitive qPCR technique in order to accurately diagnose the presence of Bd as well as other pathogens.

  5. Method for detection of a few pathogenic bacteria and determination of live versus dead cells

    Science.gov (United States)

    Horikawa, Shin; Chen, I.-Hsuan; Du, Songtao; Liu, Yuzhe; Wikle, Howard C.; Suh, Sang-Jin; Barbaree, James M.; Chin, Bryan A.

    2016-05-01

    This paper presents a method for detection of a few pathogenic bacteria and determination of live versus dead cells. The method combines wireless phage-coated magnetoelastic (ME) biosensors and a surface-scanning dectector, enabling real-time monitoring of the growth of specific bacteria in a nutrient broth. The ME biosensor used in this investigation is composed of a strip-shaped ME resonator upon which an engineered bacteriophage is coated to capture a pathogen of interest. E2 phage with high binding affinity for Salmonella Typhimurium was used as a model study. The specificity of E2 phage has been reported to be 1 in 105 background bacteria. The phage-coated ME biosensors were first exposed to a low-concentration Salmonella suspension to capture roughly 300 cells on the sensor surface. When the growth of Salmonella in the broth occurs, the mass of the biosensor increases, which results in a decrease in the biosensor's resonant frequency. Monitoring of this mass- induced resonant frequency change allows for real-time detection of the presence of Salmonella. Detection of a few bacteria is also possible by growing them to a sufficient number. The surface-scanning detector was used to measure resonant frequency changes of 25 biosensors sequentially in an automated manner as a function of time. This methodology offers direct, real-time detection, quantification, and viability determination of specific bacteria. The rate of the sensor's resonant frequency change was found to be largely dependent on the number of initially bound cells and the efficiency of cell growth.

  6. Molecular detection of bacterial and parasitic pathogens in hard ticks from Portugal.

    Science.gov (United States)

    Maia, Carla; Ferreira, Andreia; Nunes, Mónica; Vieira, Maria Luísa; Campino, Lenea; Cardoso, Luís

    2014-06-01

    Ticks are important vector arthropods of human and animal pathogens. As information about agents of disease circulating in vectors in Portugal is limited, the aim of the present study was to detect bacteria and parasites with veterinary and zoonotic importance in ticks collected from dogs, cats, and field vegetation. A total of 925 ticks, comprising 888 (96.0%) adults, 8 (0.9%) nymphs, and 29 (3.1%) larvae, were collected in 4 geographic areas (districts) of Portugal. Among those, 620 (67.0%) were removed from naturally infested dogs, 42 (4.5%) from cats, and 263 (28.4%) were questing ticks obtained from field vegetation. Rhipicephalus sanguineus was the predominant tick species, and the only one collected from dogs and vegetation, while all Ixodes ricinus specimens (n=6) were recovered from cats. Rickettsia massiliae and Rickettsia conorii were identified in 35 ticks collected from cats and dogs and in 3 ticks collected from dogs. Among ticks collected from cats or dogs, 4 Rh. sanguineus specimens were detected with Hepatozoon felis, 3 with Anaplasma platys, 2 with Hepatozoon canis, one with Anaplasma phagocytophilum, one with Babesia vogeli, one with Borrelia burgdorferi sensu lato and one with Cercopithifilaria spp. Rickettsia helvetica was detected in one I. ricinus tick collected from a cat. To the best of our knowledge, this was the first time that Cercopithifilaria spp., Ba. vogeli, H. canis, and H. felis have been detected in ticks from Portugal. The wide range of tick-borne pathogens identified, some of zoonotic concern, suggests a risk for the emergence of tick-borne diseases in domestic animals and humans in Portugal. Further studies on these and other tick-borne agents should be performed to better understand their epidemiological and clinical importance, and to support the implementation of effective control measures.

  7. Agent, autonomous

    OpenAIRE

    Luciani, Annie

    2007-01-01

    The expression autonomous agents, widely used in virtual reality, computer graphics, artificial intelligence and artificial life, corresponds to the simulation of autonomous creatures, virtual (i.e. totally computed by a program), or embodied in a physical envelope, as done in autonomous robots.

  8. Rapid Detection of Pathogenic Bacteria from Fresh Produce by Filtration and Surface-Enhanced Raman Spectroscopy

    Science.gov (United States)

    Wu, Xiaomeng; Han, Caiqin; Chen, Jing; Huang, Yao-Wen; Zhao, Yiping

    2016-04-01

    The detection of Salmonella Poona from cantaloupe cubes and E. coli O157:H7 from lettuce has been explored by using a filtration method and surface-enhanced Raman spectroscopy (SERS) based on vancomycin-functionalized silver nanorod array substrates. It is found that with a two-step filtration process, the limit of detection (LOD) of Salmonella Poona from cantaloupe cubes can be as low as 100 CFU/mL in less than 4 h, whereas the chlorophyll in the lettuce causes severe SERS spectral interference. To improve the LOD of lettuce, a three-step filtration method with a hydrophobic filter is proposed. The hydrophobic filter can effectively eliminate the interferences from chlorophyll and achieve a LOD of 1000 CFU/mL detection of E. coli O157:H7 from lettuce samples within 5 h. With the low LODs and rapid detection time, the SERS biosensing platform has demonstrated its potential as a rapid, simple, and inexpensive means for pathogenic bacteria detection from fresh produce.

  9. Autonomous real-time detection of plumes and jets from moons and comets

    International Nuclear Information System (INIS)

    Dynamic activity on the surface of distant moons, asteroids, and comets can manifest as jets or plumes. These phenomena provide information about the interior of the bodies and the forces (gravitation, radiation, thermal) they experience. Fast detection and follow-up study is imperative since the phenomena may be time-varying and because the observing window may be limited (e.g., during a flyby). We have developed an advanced method for real-time detection of plumes and jets using onboard analysis of the data as it is collected. In contrast to prior work, our technique is not restricted to plume detection from spherical bodies, making it relevant for irregularly shaped bodies such as comets. Further, our study analyzes raw data, the form in which it is available on board the spacecraft, rather than fully processed image products. In summary, we contribute a vital assessment of a technique that can be used on board tomorrow's deep space missions to detect, and respond quickly to, new occurrences of plumes and jets.

  10. Autonomous real-time detection of plumes and jets from moons and comets

    Energy Technology Data Exchange (ETDEWEB)

    Wagstaff, Kiri L.; Thompson, David R.; Bue, Brian D.; Fuchs, Thomas J., E-mail: kiri.l.wagstaff@jpl.nasa.gov [Jet Propulsion Laboratory, California Institute of Technology, 4800 Oak Grove Drive, Pasadena, CA 91109 (United States)

    2014-10-10

    Dynamic activity on the surface of distant moons, asteroids, and comets can manifest as jets or plumes. These phenomena provide information about the interior of the bodies and the forces (gravitation, radiation, thermal) they experience. Fast detection and follow-up study is imperative since the phenomena may be time-varying and because the observing window may be limited (e.g., during a flyby). We have developed an advanced method for real-time detection of plumes and jets using onboard analysis of the data as it is collected. In contrast to prior work, our technique is not restricted to plume detection from spherical bodies, making it relevant for irregularly shaped bodies such as comets. Further, our study analyzes raw data, the form in which it is available on board the spacecraft, rather than fully processed image products. In summary, we contribute a vital assessment of a technique that can be used on board tomorrow's deep space missions to detect, and respond quickly to, new occurrences of plumes and jets.

  11. [Selective detection of viable pathogenic bacteria in water using reverse transcription quantitative PCR].

    Science.gov (United States)

    Lin, Yi-Wen; Li, Dan; Wu, Shu-Xu; He, Miao; Yang, Tian

    2012-11-01

    A reverse transcription q quantitative PCR (RT-qPCR) assay method was established, which can quantify the copy numbers of RNA in pathogenic bacteria of E. coli and Enterococcus faecium. The results showed that cDNA was generated with the RT-PCR reagents, target gene was quantified with the qPCR, the copy numbers of RNA were stable at about 1 copies x CFU(-1) for E. coli and 7.98 x 10(2) copies x CFU(-1) for Enterococcus faecium respectively during the stationary grow phase for the both indicator bacteria [E. coli (6-18 h) and Enterococcus faecium (10-38 h)]. The established RT-qPCR method can quantify the numbers of viable bacteria through detecting bacterial RNA targets. Through detecting the heat-treated E. coli and Enterococcus faecium by three methods (culture method, qPCR, RT-qPCR), we found that the qPCR and RT-qPCR can distinguish 1.43 lg copy non-viable E. coli and 2.5 lg copy non-viable Enterococcus faecium. These results indicated that the established methods could effectively distinguish viable bacteria from non-viable bacteria. Finally we used this method to evaluate the real effluents of the secondary sedimentation of wastewater treatment plant (WWTP), the results showed that the correlation coefficients (R2) between RT-qPCR and culture method were 0.930 (E. coli) and 0.948 (Enterococcus faecium), and this established RT-PCR method can rapidly detect viable pathogenic bacteria in genuine waters. PMID:23323443

  12. Dual-excitation upconverting nanoparticle and quantum dot aptasensor for multiplexed food pathogen detection.

    Science.gov (United States)

    Kurt, Hasan; Yüce, Meral; Hussain, Babar; Budak, Hikmet

    2016-07-15

    In this report, a dual-excitation sensing method was developed using aptamer-functionalized quantum dots and upconverting nanoparticles, exhibiting Stokes and anti-Stokes type excitation profiles, respectively. Conjugation of the aptamer-functionalized luminescent nanoparticles with the magnetic beads, comprising short DNA sequences that were partially complementary to the aptamer sequences, enabled facile separation of the analyte-free conjugates for fluorescent measurement. UV-Visible spectroscopy, Circular Dichroism spectroscopy, Dynamic Light Scattering and Polyacrylamide Gel Electrophoresis techniques were used to characterize the aptamer probes developed. The target-specific luminescent conjugates were applied for multiplex detection of model food pathogens, Salmonella typhimurium, and Staphylococcus aureus, in which the fluorescent emission spectra were obtained under UV excitation at 325nm for quantum dots and NIR excitation at 980nm for upconverting nanoparticles, respectively. The dual-excitation strategy was aimed to minimize cross-talk between the luminescent signals for multiplexed detection, and yielded limit of detection values of 16 and 28cfumL(-1) for Staphylococcus aureus, and Salmonella typhimurium, respectively. By employing a greater number of quantum dots and upconverting nanoparticles with non-overlapping fluorescent emissions, the proposed methodology might be exploited further to detect several analytes, simultaneously. PMID:26971274

  13. How to Calculate Renyi Entropy from Heart Rate Variability, and Why it Matters for Detecting Cardiac Autonomic Neuropathy

    Directory of Open Access Journals (Sweden)

    David eCornforth

    2014-09-01

    Full Text Available Cardiac Autonomic Neuropathy (CAN is a disease that involves nerve damage leading to an abnormal control of heart rate. An open question is to what extent this condition is detectable from Heart Rate Variability (HRV, which provides information only on successive intervals between heart beats, yet is non-invasive and easy to obtain from a 3-lead ECG recording. A variety of measures may be extracted from HRV, including time domain, frequency domain and more complex non-linear measures. Among the latter, Renyi Entropy has been proposed as a suitable measure that can be used to discriminate CAN from controls. However, all entropy methods require estimation of probabilities, and there are a number of ways in which this estimation can be made. In this work, we calculate Renyi entropy using several variations of the histogram method, and a density method based on sequences of RR intervals. In all, we calculate Renyi entropy using nine methods, and compare their effectiveness in separating the different classes of participants. We find that the histogram method using single RR intervals yields an entropy measure that is either incapable of discriminating CAN from controls, or that it provides little information that could not be gained from the standard deviation of the RR intervals. In contrast, probabilities calculated using a density method, based on sequences of RR intervals, yield an entropy measure that provides good separation between groups of participants, and provides information not available from the standard deviation. The main contribution of this work is that different approaches to calculating probability may affect the success of detecting disease. Our results bring new clarity to the methods used to calculate the Renyi entropy in general, and in particular, to the successful detection of CAN.

  14. Enteric bacterial pathogen detection in southern sea otters (Enhydra lutris nereis) is associated with coastal urbanization and freshwater runoff.

    Science.gov (United States)

    Miller, Melissa A; Byrne, Barbara A; Jang, Spencer S; Dodd, Erin M; Dorfmeier, Elene; Harris, Michael D; Ames, Jack; Paradies, David; Worcester, Karen; Jessup, David A; Miller, Woutrina A

    2010-01-01

    Although protected for nearly a century, California's sea otters have been slow to recover, in part due to exposure to fecally-associated protozoal pathogens like Toxoplasma gondii and Sarcocystis neurona. However, potential impacts from exposure to fecal bacteria have not been systematically explored. Using selective media, we examined feces from live and dead sea otters from California for specific enteric bacterial pathogens (Campylobacter, Salmonella, Clostridium perfringens, C. difficile and Escherichia coli O157:H7), and pathogens endemic to the marine environment (Vibrio cholerae, V. parahaemolyticus and Plesiomonas shigelloides). We evaluated statistical associations between detection of these pathogens in otter feces and demographic or environmental risk factors for otter exposure, and found that dead otters were more likely to test positive for C. perfringens, Campylobacter and V. parahaemolyticus than were live otters. Otters from more urbanized coastlines and areas with high freshwater runoff (near outflows of rivers or streams) were more likely to test positive for one or more of these bacterial pathogens. Other risk factors for bacterial detection in otters included male gender and fecal samples collected during the rainy season when surface runoff is maximal. Similar risk factors were reported in prior studies of pathogen exposure for California otters and their invertebrate prey, suggesting that land-sea transfer and/or facilitation of pathogen survival in degraded coastal marine habitat may be impacting sea otter recovery. Because otters and humans share many of the same foods, our findings may also have implications for human health. PMID:19720009

  15. A Comparison between Transcriptome Sequencing and 16S Metagenomics for Detection of Bacterial Pathogens in Wildlife.

    Directory of Open Access Journals (Sweden)

    Maria Razzauti

    Full Text Available Rodents are major reservoirs of pathogens responsible for numerous zoonotic diseases in humans and livestock. Assessing their microbial diversity at both the individual and population level is crucial for monitoring endemic infections and revealing microbial association patterns within reservoirs. Recently, NGS approaches have been employed to characterize microbial communities of different ecosystems. Yet, their relative efficacy has not been assessed. Here, we compared two NGS approaches, RNA-Sequencing (RNA-Seq and 16S-metagenomics, assessing their ability to survey neglected zoonotic bacteria in rodent populations.We first extracted nucleic acids from the spleens of 190 voles collected in France. RNA extracts were pooled, randomly retro-transcribed, then RNA-Seq was performed using HiSeq. Assembled bacterial sequences were assigned to the closest taxon registered in GenBank. DNA extracts were analyzed via a 16S-metagenomics approach using two sequencers: the 454 GS-FLX and the MiSeq. The V4 region of the gene coding for 16S rRNA was amplified for each sample using barcoded universal primers. Amplicons were multiplexed and processed on the distinct sequencers. The resulting datasets were de-multiplexed, and each read was processed through a pipeline to be taxonomically classified using the Ribosomal Database Project. Altogether, 45 pathogenic bacterial genera were detected. The bacteria identified by RNA-Seq were comparable to those detected by 16S-metagenomics approach processed with MiSeq (16S-MiSeq. In contrast, 21 of these pathogens went unnoticed when the 16S-metagenomics approach was processed via 454-pyrosequencing (16S-454. In addition, the 16S-metagenomics approaches revealed a high level of coinfection in bank voles.We concluded that RNA-Seq and 16S-MiSeq are equally sensitive in detecting bacteria. Although only the 16S-MiSeq method enabled identification of bacteria in each individual reservoir, with subsequent derivation of

  16. An autonomous image based approach for detecting glacial lake outburst floods

    Science.gov (United States)

    Koschitzki, R.; Schwalbe, E.; Maas, H.-G.

    2014-06-01

    The potential danger caused by glacier margin lakes and the related risk of glacier lake outburst floods (GLOF) increases constantly due to glaciers retreating in many parts of the world. Reasons for this development are on the one hand the new formation and enlargement of glacier margin lakes due to melt water. On the other hand, retreating and thinning glacier tongues lead to a decrease of the back pressure against the dammed glacier lakes. The paper describes the design of a photogrammetric GLOF monitoring system, based on monoscopic image sequence analysis for automatic detection of water level changes. The presented approach for measuring the water line in an image sequence is based on directional edge detection in LoG-filtered image data. After that, the water level is determined by a transformation of image measurements into object space based on orientation parameters of the camera and a geo-referenced lake basin model. The model can for instance be determined by photogrammetric methods after a GLOF; it may also be determined portion-wise by analysing shore lines at various water levels. Camera orientation parameters are determined by a local GPS-supported photogrammetric network. Comparing the determined water level changes with reference data provided by a water gauge, the precision is estimated in the order of one decimetre. A major challenge is the automatic detection of the water line in image sequences under varying light and visibility conditions. The paper will also discuss promising approaches such as multispectral images as well as a statistical analysis of grey value changes over short image sequences to eliminate disturbing reflections on the rough water surface.

  17. Development of an autonomous continuous monitoring system for mechanical damage detection.

    Energy Technology Data Exchange (ETDEWEB)

    Sohn, H. (Hoon); Allen, D. W. (David W.); Farrar, C. R. (Charles R.); Worden, K.

    2002-01-01

    The primary objective of damage identification is to ascertain the existence of damage within a mechanical system. This study applies the Sequential Probability Ratio Test (SPRT) to examine if damage is present or not. In the original formulation of the SPRT, the distribution of data is assumed Gaussian and thresholds for monitoring are set focusing on the center mass properties of the distribution. Decision-making for damage identification is, however, often sensitive to the tails of the distribution and the tails may not necessarily be governed by Gaussian characteristics. By modeling the tails using the technique of Extreme Value Statistics (EVS), the thresholds for the SPRT may be set more accurately avoiding the unnecessary normality assumption. The proposed combination of the SPRT and the EVS is demonstrated using experimental data collected from a three-story frame structure with bolted connections. The primary goal of structural health monitoring is simply to identify from measured data if a structure has deviated from a normal operational condition. Particularly, vibration-based damage detection techniques assume that changes of the structure's integrity affect characteristics of the measured vibration signals enabling one to detect damage. Many current approaches to this problem involve methods that leave much to the interpretation of analysts. These methods may enable a trained eye to discern and locate damage but are not easily automated or objective. In an attempt to automate the damage identification procedure, the SPRT is employed for the decision-making procedure. The original SPRT assumes that the extracted features have a Gaussian distribution. This normality assumption, however, may place misleading constraints on the tails of the distribution. As the problem of damage detection specifically focuses attention on the tails, the assumption of normality is likely to lead the analysis astray. To overcome this difficulty, the performance of the

  18. Report on the Workshop on DNA Isolation and Detection of Tsetse Pathogens and Symbionts using PCR

    International Nuclear Information System (INIS)

    The workshop on DNA isolation and detection of tsetse pathogens and symbionts using PCR was hosted by the Centre International de Recherche-Developpement Sur l'Elevage en Zone Subhumide (CIRDES) and was attended by eight participants and three lecturers from eleven countries. Several oral presentations were given that provided an overview on general principles of the PCR, on the factors that might affect the obtained results, on the different applications of the PCR for the Salivary Gland Hyperplasia Virus (SGHV) work, and on the current progress of the work on Wolbachia and Sodalis. Two sessions of tsetse dissections were organised, which focussed on the detection of hypertrophied salivary gland symptoms, on the separation of ovaries and testes, and on the collection of the haemolymph under aseptic conditions to initiate Sodalis cultures. Using the monitor connected to the microscope, all participants could view the dissection demonstrations, and were given later the opportunity to practice the dissections themselves. In addition, demonstrations were given on how to prepare slides to observe Sodalis bacteria under the compound microscope. In addition, several practical sessions were organised on DNA extraction for virus detection and demonstrations were given on extractions of the genomic DNA from the tsetse abdomen using the cetyltrimethylammo-niumbromide (CTAB) for Wolbachia diagnosis and using the DNeasy kit (Qiagen) method for Sodalis diagnosis. Finally, there were three sessions on the use of PCR and how to detect the virus in the samples extracted by the manual method using two sets of primers. Methods were likewise demonstrated on detecting Wolbachia and Sodalis in the DNA samples extracted by the CTAB and DNeasy methods, and a comparison was made of the three different methods to detect the SGHV, Wolbachia and Sodalis

  19. A method for the rapid detection and identification of halo blight pathogen on common bean

    Directory of Open Access Journals (Sweden)

    Popović Tatjana

    2014-01-01

    Full Text Available A diagnostic method based on nested-PCR, followed by ELISA and conventional bacteriology tests, for the rapid and reliable detection of halo blight pathogen Pseudomonas savastanoi pv. phaseolicola (Psp collected from infected bean leaves and seeds is described. Psp formed white, small and flat colonies on nutrient agar medium, creamy white, flat and circular on Milk-Tween agar medium and light yellow, convex and shiny on modified sucrose peptone agar medium. Eighteen Gram-negative, catalase-positive and oxidase-negative strains were subjected to nested PCR with primers P 5.1/P 3.1 and P 5.2/P 3.2, which directed the amplification of the 450 bp target DNA fragment in all tested strains. According to the results of DAS- and PTA-ELISA with respect to reactivity to specific antibodies, all analyzed strains belonged to Psp bacterium. Pathogenicity was tested on bean pods and cotyledon leaves, on which greasy spots were formed. Psp did not cause hypersensitive reaction on the leaves of tobacco and geranium. Strains produced levan, fluorescent pigment, oxidative metabolism of glucose, did not reduce nitrate, did not produce indole and H2S, did not hydrolyze starch, gelatin and esculin; they produced acid from glucose, mannose, sucrose and glycerol, and did not produce acid from maltose, starch, esculin, dulcite, sorbitol, inositol and erythritol.

  20. Auto Landing Process for Autonomous Flying Robot by Using Image Processing Based on Edge Detection

    Directory of Open Access Journals (Sweden)

    Bahram Lavi Sefidgari

    2014-01-01

    Full Text Available In today’s technological life, everyone is quite familiar with the importance of security measures in our lives. So in this regard, many attempts have been made by researchers and one of them is flying robots technology. One well-known usage of flying robot, perhaps, is its capability in security and care measurements which made this device extremely practical, not only for its unmanned movement, but also for the unique manoeuvre during flight over the arbitrary areas. In this research, the automatic landing of a flying robot is discussed. The system is based on the frequent interruptions that is sent from main microcontroller to camera module in order to take images; these images have been distinguished by image processing system based on edge detection, after analysing the image the system can tell whether or not to land on the ground. This method shows better performance in terms of precision as well as experimentally.

  1. Polymerase chain reaction detection of potentially pathogenic free-living amoebae in dental units.

    Science.gov (United States)

    Leduc, Annie; Gravel, Sabrina; Abikhzer, Jérémie; Roy, Stéphane; Barbeau, Jean

    2012-07-01

    Several genera of amoebae can be found in water from dental units and on the inner surface of waterlines. The presence of bacterial biofilms on these surfaces is thought to favor the proliferation of amoebae. Potentially pathogenic Acanthamoeba and Naegleria spp. may be an infection risk for patients through contact with open surgical sites or aerosolization. A polymerase chain reaction of DNA extracted from pelleted samples showed that Acanthamoeba spp. and Naegleria spp. were present in water from dental units, suction lines, and suction filters at the dental clinic of the Université de Montréal. Acanthamoeba spp. were detected in 24.2% of 66 samples and Naegleria spp. in 3.0%. We discuss the infection risk associated with these results.

  2. Quantitative polymerase chain reaction (PCR) for detection of aquatic animal pathogens in a diagnostic laboratory setting

    Science.gov (United States)

    Purcell, Maureen K.; Getchell, Rodman G.; McClure, Carol A.; Weber, S.E.; Garver, Kyle A.

    2011-01-01

    Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.

  3. Monoclonal antibody-based Surface Plasmon Resonance sensors for pathogen detection

    DEFF Research Database (Denmark)

    Skottrup, Peter Durand

    2007-01-01

    , that can detect and quantify specific plant pathogens and map these to defined positions within the field, would enable the farm manager to perform a precise and targeted application of pesticides and thereby reduce and optimise the use of agrochemicals. The ideal scenario for precision agriculture.......sp. tritici, the cause of wheat yellow rust and Phytophthora infestans, the cause of late blight disease in potato. As no antibody existed against urediniospores from P. striiformis, mouse monoclonal antibodies (mAbs) were produced and characterised. IgM-isotype mAbs from nine hybridoma cell lines were...... screened for cross-reactivity against representatives from common genera. Two specific mAbs were chosen for further characterisation and used to develop a competitive ELISA (using mAb4) and a subtractive inhibition ELISA (using mAb8). The subtractive inhibition ELISA was found to be more sensitive...

  4. Optimization of PMA-PCR Protocol for Viability Detection of Pathogens

    Science.gov (United States)

    Mikkelson, Brian J.; Lee, Christine M.; Ponce, Adrian

    2011-01-01

    This presented study demonstrates the need that PMA-PCR can be used to capture the loss of viability of a sample that is much more specific and time-efficient than alternative methods. This protocol is particularly useful in scenarios in which sterilization treatments may inactivate organisms but not degrade their DNA. The use of a PCR-based method of pathogen detection without first inactivating the DNA of nonviable cells will potentially lead to false positives. The loss of culturability, by heat-killing, did not prevent amplified PCR products, which supports the use of PMA to prevent amplification and differentiate between viable and dead cells. PMA was shown to inhibit the amplification of DNA by PCR in vegetative cells that had been heat-killed.

  5. Association of targeted multiplex PCR with resequencing microarray for the detection of multiple respiratory pathogens

    Directory of Open Access Journals (Sweden)

    Xuejun eMa

    2015-05-01

    Full Text Available A large number of viral and bacterial organisms are responsible for community-acquired pneumonia (CAP which contributes to substantial burden on health management. A new resequencing microarray (RPM-IVDC1 associated with targeted multiplex PCR was recently developed and validated for multiple respiratory viruses detection and discrimination. In this study, we evaluated the capability of RPM-IVDC1 for simultaneous identification of multiple viral and bacterial organisms. The nasopharyngeal aspirates (NPAs of 110 consecutive CAP patients, aged from 1 month to 96 years old, were collected from 5 distinct general hospitals in Beijing during 1-year period. The samples were subjected to the RPM-IVDC1 established protocol as compared to a real-time PCR (qRT-PCR, which was used as standard. The results of virus detection were consistent with those previously described. A total of 37 of Streptococcus pneumoniae, 14 of Haemophilus influenzae, 10 of Mycoplasma pneumoniae, 2 of Klebsiella pneumoniae and 1 of Moraxella catarrhalis were detected by RPM-IVDC1. The sensitivities and specificities were compared with those of qRT-PCR for S. pneumoniae (100%, 100%, respectively, H. influenzae (92.3%, 97.9%, respectively, M. pneumoniae (69.2%, 99.0%, respectively, K. pneumoniae (100%, 100%, respectively and M. catarrhalis (100%, 100%, respectively. Additional 22 of Streptococcus spp., 24 of Haemophilus spp. and 16 of Neisseria spp. were identified. In addition, methicillin-resistant and carbapenemases allele were also found in 9 of Staphylococcus spp. and 1 of K. pneumoniae, respectively. These results demonstrated the capability of RPM-IVDC1 for simultaneous detection of broad-spectrum respiratory pathogens in complex backgrounds and the advantage of accessing to the actual sequences, showing great potential use of epidemic outbreak investigation. The detection results should be carefully interpreted when introducing this technique in the clinical diagnostics.

  6. Fast and sensitive detection of foodborne pathogen using electrochemical impedance analysis, urease catalysis and microfluidics.

    Science.gov (United States)

    Chen, Qi; Wang, Dan; Cai, Gaozhe; Xiong, Yonghua; Li, Yuntao; Wang, Maohua; Huo, Huiling; Lin, Jianhan

    2016-12-15

    Early screening of pathogenic bacteria is a key to prevent and control of foodborne diseases. In this study, we developed a fast and sensitive bacteria detection method integrating electrochemical impedance analysis, urease catalysis with microfluidics and using Listeria as model. The Listeria cells, the anti-Listeria monoclonal antibodies modified magnetic nanoparticles (MNPs), and the anti-Listeria polyclonal antibodies and urease modified gold nanoparticles (AuNPs) were incubated in a fluidic separation chip with active mixing to form the MNP-Listeria-AuNP-urease sandwich complexes. The complexes were captured in the separation chip by applying a high gradient magnetic field, and the urea was injected to resuspend the complexes and hydrolyzed under the catalysis of the urease on the complexes into ammonium ions and carbonate ions, which were transported into a microfluidic detection chip with an interdigitated microelectrode for impedance measurement to determine the amount of the Listeria cells. The capture efficiency of the Listeria cells in the separation chip was ∼93% with a shorter time of 30min due to the faster immuno-reaction using the active magnetic mixing. The changes on both impedance magnitude and phase angle were demonstrated to be able to detect the Listeria cells as low as 1.6×10(2)CFU/mL. The detection time was reduced from original ∼2h to current ∼1h. The recoveries of the spiked lettuce samples ranged from 82.1% to 89.6%, indicating the applicability of this proposed biosensor. This microfluidic impedance biosensor has shown the potential for online, automatic and sensitive bacteria separation and detection.

  7. [The Advances in the Contamination and Detection of Foodborne Pathogen Noroviruses in Fresh Produce].

    Science.gov (United States)

    Xie, Yajing; Liu, Xianjin

    2015-11-01

    This article reviewed the researches proceeding on the contamination and detection of the foodborne pathogen noroviruses (NoVs) in fresh produce, which involved the NoVs contaminations in fresh produce, the special attachment of NoVs in fresh produce, the NoVs outbreaks associated with fresh produce and the NoVs detection in fresh produce. There had been an increase in reported infectious disease risks associated with the consumptions of fresh produce for recent 30 years. Because the NoVs, as a primary cause of viral gastroenteritis thoughout the world, were highly contagious, had a low infectious dose, and were persistent in the environment. And also the methods for NoVs detection in food had significantly developed over the last 15 years. Currently NoVs were the most common pathogen accounting for 40% of outbreaks associated with fresh produce (i. e., fruits and vegetables). Data from outbreaks investigations verified fresh produce as the high risk food products for NoVs. The fresh produce were typically eaten raw with no thermal processing, can be contaminated at any step during production and processing from faecally polluted water and fertilizers, the poor hygiene practices by food handlers and the cross-contamination. The attachment of NoVs to the fresh produce was due to the physio-chemical factors of virus protein coat, the special attachment to different fresh produce, and the possibility for internalization of NoVs. It might provide answers to why those high risk foods were more frequently implicated (i. e., lettuce and raspberries). According to the data of foodborne NoVs outbreaks which were associated with fresh produce from EU countries and the USA, the outbreaks in EU countries were mainly associated with NoVs contaminated raspberries and lettuce, while in USA which were associated with NoVs contaminated lettuce. Unfortunately, there were no NoVs detection methods for fresh produce or the data of foodborne NoVs outbreaks which were associated with

  8. A species independent universal bio-detection microarray for pathogen forensics and phylogenetic classification of unknown microorganisms

    Directory of Open Access Journals (Sweden)

    McCormick John

    2011-06-01

    Full Text Available Abstract Background The ability to differentiate a bioterrorist attack or an accidental release of a research pathogen from a naturally occurring pandemic or disease event is crucial to the safety and security of this nation by enabling an appropriate and rapid response. It is critical in samples from an infected patient, the environment, or a laboratory to quickly and accurately identify the precise pathogen including natural or engineered variants and to classify new pathogens in relation to those that are known. Current approaches for pathogen detection rely on prior genomic sequence information. Given the enormous spectrum of genetic possibilities, a field deployable, robust technology, such as a universal (any species microarray has near-term potential to address these needs. Results A new and comprehensive sequence-independent array (Universal Bio-Signature Detection Array was designed with approximately 373,000 probes. The main feature of this array is that the probes are computationally derived and sequence independent. There is one probe for each possible 9-mer sequence, thus 49 (262,144 probes. Each genome hybridized on this array has a unique pattern of signal intensities corresponding to each of these probes. These signal intensities were used to generate an un-biased cluster analysis of signal intensity hybridization patterns that can easily distinguish species into accepted and known phylogenomic relationships. Within limits, the array is highly sensitive and is able to detect synthetically mixed pathogens. Examples of unique hybridization signal intensity patterns are presented for different Brucella species as well as relevant host species and other pathogens. These results demonstrate the utility of the UBDA array as a diagnostic tool in pathogen forensics. Conclusions This pathogen detection system is fast, accurate and can be applied to any species. Hybridization patterns are unique to a specific genome and these can be used

  9. Efficacy of direct detection of pathogens in naturally infected mice by using a high-density PCR array.

    Science.gov (United States)

    Henderson, Kenneth S; Perkins, Cheryl L; Havens, Richard B; Kelly, Mee-Jin E; Francis, Brian C; Dole, Vandana S; Shek, William R

    2013-11-01

    We used a high-density array of real-time PCR assays for commonly reported rodent infectious agents (PRIA) to test naturally infected index mice and sentinel mice exposed by contact and soiled-bedding transfer. PRIA detected 14 pathogens--including viruses, bacteria, fur mites, pinworms, and enteric protozoa--in 97.2% of 28 pooled fecal samples, fur-perianal swabs, and oral swabs from 4 cages containing a total of 10 index mice. Among these pathogens, PRIA (like conventional health monitoring methods) failed to detect Mycoplasma pulmonis, Pasteurella pneumotropica, and Giardia spp. in all of the 9 contact and 9 soiled-bedding sentinels. PRIA demonstrated murine adenovirus and Cryptosporidium and Spironucleus spp. in contact but not soiled-bedding sentinels and detected Helicobacter and pinworms in fewer than half of the soiled-bedding sentinels. Of the 4 species of Helicobacter that species-specific PCR assays identified in index mice, only H. ganmani was found in soiled-bedding and contact sentinels. PRIA detected all of the pathogens in sentinels that were identified by conventional methods. Myobia musculi was detected by PCR in index and sentinel mice but missed by conventional parasitologic examinations. In summary, PRIA reproducibly detected diverse pathogens in heavily pooled specimens collected noninvasively from infected index mice antemortem. The inability of PRIA and conventional health monitoring methods (that is, parasitology, micro-biology, and serology) to demonstrate transmission of some pathogens to contact sentinels and the inefficient transmission of others to soiled-bedding sentinels underscores the importance of direct PCR testing to determine the pathogen status of rodents in quarantine and during routine colony surveillance. PMID:24351765

  10. A Modular Software and Hardware Framework with Application to Unmanned Autonomous Systems: Interacting Modules, Error Detection and Hardware Design

    OpenAIRE

    Skøien, Kristoffer Rist

    2011-01-01

    The Department of Engineering Cybernetics at the Norwegian University of Science andTechnology established the Unmanned Vehicle Laboratory fall 2010. The goal is to havestudents develop a fully functional autonomous aerial vehicle over time as part of projects and master’s theses. A range of projects were carried out fall 2010, among others the report General Platform for Unmanned Autonomous Systems was written on the topic of hardware, operating systems and peripheral interfacing.This m...

  11. Molecular-based detection of the gastrointestinal pathogen Campylobacter ureolyticus in unpasteurized milk samples from two cattle farms in Ireland

    Directory of Open Access Journals (Sweden)

    Koziel Monika

    2012-11-01

    Full Text Available Abstract Campylobacter jejuni and coli are collectively regarded as the most prevalent cause of bacterial foodborne illness worldwide. An emerging species, Campylobacter ureolyticus has recently been detected in patients with gastroenteritis, however, the source of this organism has, until now, remained unclear. Herein, we describe the molecular-based detection of this pathogen in bovine faeces (1/20 and unpasteurized milk (6/47 but not in poultry (chicken wings and caeca. This is, to the best of our knowledge, the first report of the presence of this potential gastrointestinal pathogen in an animal source, possibly suggesting a route for its transmission to humans.

  12. Impedance Biosensing to detect food allergens, endocrine disrupting chemicals, and food pathogens

    Science.gov (United States)

    Radhakrishnan, Rajeswaran

    Electrochemical impedance biosensors can be viewed as an AC electroanalytical method for the analyte detection in the fields of biomedicine, environmental monitoring, and food and agriculture, amongst others. The most common format for AC impedance biosensing involves surface immobilization of an antibody, receptor protein, DNA strand, or other species capable of bio-recognition, and AC impedance detection of the binding event. Technological application of AC impedance biosensors has been hindered by several obstacles, including the more complex circuitry required for AC relative to DC electrochemistry, chemical and physical interference arising from non-specific adsorption, and the stability and reproducibility of protein immobilization. One focus of these PhD studies is on methods to reduce or compensate for non-specific adsorption, including sample dilution, site blocking with BSA, and the use of control electrodes onto which reference antibodies are immobilized. Examples that will be presented include impedance detection of food pathogens, such as Listeria monocytogenes, using a mouse monoclonal antibody immobilized onto an Au electrode. This yields detection limits of 5 CFU/ml and 4 CFU/ml for ideal solutions and filtered tomato extract, respectively. Control experiments with an Au electrode onto which a mouse monoclonal antibody to GAPDH is immobilized demonstrate that non-specific adsorption is insignificant for the system and methodology studied here. Control experiments with Salmonella enterica demonstrate no cross-reactivity to this food pathogen. In addition, Detection of two endocrine-disrupting chemicals (EDC), norfluoxetine and BDE-47, is reported here by impedance biosensing, with a detection limit of 8.5 and 1.3 ng/ml for norfluoxetine and BDE-47, respectively. Additional research has focused on alternative substrates and linker chemistries for protein immobilization, including the use of degenerate (highly doped) Si and bidendate thiol monolayer

  13. Magnetic-optical nanohybrids for targeted detection, separation, and photothermal ablation of drug-resistant pathogens.

    Science.gov (United States)

    Ondera, Thomas J; Hamme, Ashton T

    2015-12-01

    A rapid, sensitive and quantitative immunoassay for the targeted detection and decontamination of E. coli based on Fe3O4 magnetic nanoparticles (MNPs) and plasmonic popcorn-shaped gold nanostructure attached single-walled carbon nanotubes (AuNP@SWCNT) is presented. The MNPs were synthesized as the support for a monoclonal antibody (mAb@MNP). E. coli (49979) was captured and rapidly preconcentrated from the sample with the mAb@MNP, followed by binding with Raman-tagged concanavalin A-AuNP@SWCNTs (Con A-AuNP@SWCNTs) as detector nanoprobes. A Raman tag 5,5'-dithiobis-(2-nitrobenzoic acid) (DTNB) generated a Raman signal upon 670 nm laser excitation enabling the detection and quantification of E. coli concentration with a limit of detection of 10(2) CFU mL(-1) and a linear logarithmic response range of 1.0 × 10(2) to 1.0 × 10(7) CFU mL(-1). The mAb@MNP could remove more than 98% of E. coli (initial concentration of 1.3 × 10(4) CFU mL(-1)) from water. The potential of the immunoassay to detect E. coli bacteria in real water samples was investigated and the results were compared with the experimental results from the classical count method. There was no statistically significant difference between the two methods (p > 0.05). Furthermore, the MNP/AuNP@SWCNT hybrid system exhibits an enhanced photothermal killing effect. The sandwich-like immunoassay possesses potential for rapid bioanalysis and the simultaneous biosensing of multiple pathogenic agents. PMID:26469636

  14. Comparison of the detection of periodontal pathogens in bacteraemia after tooth brushing by culture and molecular techniques

    Science.gov (United States)

    Figuero, Elena; González, Itziar; O´Connor, Ana; Diz, Pedro; Álvarez, Maximiliano; Herrera, David; Sanz, Mariano

    2016-01-01

    Background The prevalence and amounts of periodontal pathogens detected in bacteraemia samples after tooth brushing-induced by means of four diagnostic technique, three based on culture and one in a molecular-based technique, have been compared in this study. Material and Methods Blood samples were collected from thirty-six subjects with different periodontal status (17 were healthy, 10 with gingivitis and 9 with periodontitis) at baseline and 2 minutes after tooth brushing. Each sample was analyzed by three culture-based methods [direct anaerobic culturing (DAC), hemo-culture (BACTEC), and lysis-centrifugation (LC)] and one molecular-based technique [quantitative polymerase chain reaction (qPCR)]. With culture any bacterial isolate was detected and quantified, while with qPCR only Porphyromonas gingivalis and Aggregatibacter actinomycetemcomitans were detected and quantified. Descriptive analyses, ANOVA and Chi-squared tests, were performed. Results Neither BACTEC nor qPCR detected any type of bacteria in the blood samples. Only LC (2.7%) and DAC (8.3%) detected bacteraemia, although not in the same patients. Fusobacterium nucleatum was the most frequently detected bacterial species. Conclusions The disparity in the results when the same samples were analyzed with four different microbiological detection methods highlights the need for a proper validation of the methodology to detect periodontal pathogens in bacteraemia samples, mainly when the presence of periodontal pathogens in blood samples after tooth brushing was very seldom. Key words:Bacteraemia, periodontitis, culture, PCR, tooth brushing. PMID:26946197

  15. Vaginal microbicides: detecting toxicities in vivo that paradoxically increase pathogen transmission

    Directory of Open Access Journals (Sweden)

    Abusuwwa Raed

    2006-06-01

    Full Text Available Abstract Background Microbicides must protect against STD pathogens without causing unacceptable toxic effects. Microbicides based on nonoxynol-9 (N9 and other detergents disrupt sperm, HSV and HIV membranes, and these agents are effective contraceptives. But paradoxically N9 fails to protect women against HIV and other STD pathogens, most likely because it causes toxic effects that increase susceptibility. The mouse HSV-2 vaginal transmission model reported here: (a Directly tests for toxic effects that increase susceptibility to HSV-2, (b Determines in vivo whether a microbicide can protect against HSV-2 transmission without causing toxicities that increase susceptibility, and (c Identifies those toxic effects that best correlate with the increased HSV susceptibility. Methods Susceptibility was evaluated in progestin-treated mice by delivering a low-dose viral inoculum (0.1 ID50 at various times after delivering the candidate microbicide to detect whether the candidate increased the fraction of mice infected. Ten agents were tested – five detergents: nonionic (N9, cationic (benzalkonium chloride, BZK, anionic (sodium dodecylsulfate, SDS, the pair of detergents in C31G (C14AO and C16B; one surface active agent (chlorhexidine; two non-detergents (BufferGel®, and sulfonated polystyrene, SPS; and HEC placebo gel (hydroxyethylcellulose. Toxic effects were evaluated by histology, uptake of a 'dead cell' dye, colposcopy, enumeration of vaginal macrophages, and measurement of inflammatory cytokines. Results A single dose of N9 protected against HSV-2 for a few minutes but then rapidly increased susceptibility, which reached maximum at 12 hours. When applied at the minimal concentration needed for brief partial protection, all five detergents caused a subsequent increase in susceptibility at 12 hours of ~20–30-fold. Surprisingly, colposcopy failed to detect visible signs of the N9 toxic effect that increased susceptibility at 12 hours. Toxic

  16. Modular microfluidic system fabricated in thermoplastics for the strain-specific detection of bacterial pathogens.

    Science.gov (United States)

    Chen, Yi-Wen; Wang, Hong; Hupert, Mateusz; Witek, Makgorzata; Dharmasiri, Udara; Pingle, Maneesh R; Barany, Francis; Soper, Steven A

    2012-09-21

    The recent outbreaks of a lethal E. coli strain in Germany have aroused renewed interest in developing rapid, specific and accurate systems for detecting and characterizing bacterial pathogens in suspected contaminated food and/or water supplies. To address this need, we have designed, fabricated and tested an integrated modular-based microfluidic system and the accompanying assay for the strain-specific identification of bacterial pathogens. The system can carry out the entire molecular processing pipeline in a single disposable fluidic cartridge and detect single nucleotide variations in selected genes to allow for the identification of the bacterial species, even its strain with high specificity. The unique aspect of this fluidic cartridge is its modular format with task-specific modules interconnected to a fluidic motherboard to permit the selection of the target material. In addition, to minimize the amount of finishing steps for assembling the fluidic cartridge, many of the functional components were produced during the polymer molding step used to create the fluidic network. The operation of the cartridge was provided by electronic, mechanical, optical and hydraulic controls located off-chip and packaged into a small footprint instrument (1 ft(3)). The fluidic cartridge was capable of performing cell enrichment, cell lysis, solid-phase extraction (SPE) of genomic DNA, continuous flow (CF) PCR, CF ligase detection reaction (LDR) and universal DNA array readout. The cartridge was comprised of modules situated on a fluidic motherboard; the motherboard was made from polycarbonate, PC, and used for cell lysis, SPE, CF PCR and CF LDR. The modules were task-specific units and performed universal zip-code array readout or affinity enrichment of the target cells with both made from poly(methylmethacrylate), PMMA. Two genes, uidA and sipB/C, were used to discriminate between E. coli and Salmonella, and evaluated as a model system. Results showed that the fluidic

  17. Modular microfluidic system fabricated in thermoplastics for the strain-specific detection of bacterial pathogens.

    Science.gov (United States)

    Chen, Yi-Wen; Wang, Hong; Hupert, Mateusz; Witek, Makgorzata; Dharmasiri, Udara; Pingle, Maneesh R; Barany, Francis; Soper, Steven A

    2012-09-21

    The recent outbreaks of a lethal E. coli strain in Germany have aroused renewed interest in developing rapid, specific and accurate systems for detecting and characterizing bacterial pathogens in suspected contaminated food and/or water supplies. To address this need, we have designed, fabricated and tested an integrated modular-based microfluidic system and the accompanying assay for the strain-specific identification of bacterial pathogens. The system can carry out the entire molecular processing pipeline in a single disposable fluidic cartridge and detect single nucleotide variations in selected genes to allow for the identification of the bacterial species, even its strain with high specificity. The unique aspect of this fluidic cartridge is its modular format with task-specific modules interconnected to a fluidic motherboard to permit the selection of the target material. In addition, to minimize the amount of finishing steps for assembling the fluidic cartridge, many of the functional components were produced during the polymer molding step used to create the fluidic network. The operation of the cartridge was provided by electronic, mechanical, optical and hydraulic controls located off-chip and packaged into a small footprint instrument (1 ft(3)). The fluidic cartridge was capable of performing cell enrichment, cell lysis, solid-phase extraction (SPE) of genomic DNA, continuous flow (CF) PCR, CF ligase detection reaction (LDR) and universal DNA array readout. The cartridge was comprised of modules situated on a fluidic motherboard; the motherboard was made from polycarbonate, PC, and used for cell lysis, SPE, CF PCR and CF LDR. The modules were task-specific units and performed universal zip-code array readout or affinity enrichment of the target cells with both made from poly(methylmethacrylate), PMMA. Two genes, uidA and sipB/C, were used to discriminate between E. coli and Salmonella, and evaluated as a model system. Results showed that the fluidic

  18. Prevalence and Characteristics of Enteric Pathogens Detected in Diarrhoeic and Non-Diarrhoeic Foals in Trinidad

    Directory of Open Access Journals (Sweden)

    Robin Harris

    2012-01-01

    Full Text Available The study determined the relative importance of Escherichia coli, E. coli O157, Salmonella spp., Clostridium spp., rotavirus, Cryptosporidium spp., and Strongyloides westeri in foal (diarrhoeic and non-diarrhoeic available for sampling during the foaling season of 2010 and determined their sensitivity to antimicrobial agents. A cross-sectional study was conducted on 164 foals (9 diarrhoeic and 155 non-diarrhoeic from 15 farms in Trinidad. Isolation and detection of enteric pathogens followed standard methods, and the antibiograms of E. coli and Salmonella spp. were determined using the disc diffusion method. All organisms investigated were detected except E. coli O157. A high prevalence of E. coli (85.0%, Cryptosporidium spp. (64.8%, Strongyloides westeri (35.7% was seen, but the prevalence was comparatively low for Clostridium spp. (12.9%, Salmonella spp. (4.4% and rotavirus (2.1%. Only Salmonella spp. was isolated at a statistically significantly (<0.05; 2 higher frequency from diarrhoeic (25.0% than non-diarrhoeic (4.0% foals. Amongst E. coli isolates, the frequency of resistance was higher in isolates from diarrhoeic compared with non-diarrhoeic foals but the difference was only statistically significant (<0.05; 2 for tetracycline. All isolates of Salmonella spp. were sensitive to streptomycin and sulphamethoxazole/trimethoprim, a finding that may have therapeutic significance.

  19. Surface Generated Acoustic Wave Biosensors for the Detection of Pathogens: A Review

    Directory of Open Access Journals (Sweden)

    Antonio Arnau-Vives

    2009-07-01

    Full Text Available This review presents a deep insight into the Surface Generated Acoustic Wave (SGAW technology for biosensing applications, based on more than 40 years of technological and scientific developments. In the last 20 years, SGAWs have been attracting the attention of the biochemical scientific community, due to the fact that some of these devices - Shear Horizontal Surface Acoustic Wave (SH-SAW, Surface Transverse Wave (STW, Love Wave (LW, Flexural Plate Wave (FPW, Shear Horizontal Acoustic Plate Mode (SH-APM and Layered Guided Acoustic Plate Mode (LG-APM - have demonstrated a high sensitivity in the detection of biorelevant molecules in liquid media. In addition, complementary efforts to improve the sensing films have been done during these years. All these developments have been made with the aim of achieving, in a future, a highly sensitive, low cost, small size, multi-channel, portable, reliable and commercially established SGAW biosensor. A setup with these features could significantly contribute to future developments in the health, food and environmental industries. The second purpose of this work is to describe the state-of-the-art of SGAW biosensors for the detection of pathogens, being this topic an issue of extremely importance for the human health. Finally, the review discuses the commercial availability, trends and future challenges of the SGAW biosensors for such applications.

  20. Detection of Foodborne Pathogens and Mycotoxins in Eggs and Chicken Feeds from Farms to Retail Markets.

    Science.gov (United States)

    Lee, Minhwa; Seo, Dong Joo; Jeon, Su Been; Ok, Hyun Ee; Jung, Hyelee; Choi, Changsun; Chun, Hyang Sook

    2016-01-01

    Contamination by foodborne pathogens and mycotoxins was examined in 475 eggs and 20 feed samples collected from three egg layer farms, three egg-processing units, and five retail markets in Korea. Microbial contamination with Salmonella species, Escherichia coli, and Arcobacter species was examined by bacterial culture and multiplex polymerase chain reaction (PCR). The contamination levels of aflatoxins, ochratoxins, and zearalenone in eggs and chicken feeds were simultaneously analyzed with high-performance liquid chromatography coupled with fluorescence detection after the post-derivatization. While E. coli was isolated from 9.1% of eggs, Salmonella species were not isolated. Arcobacter species were detected in 0.8% of eggs collected from egg layers by PCR only. While aflatoxins, ochratoxins, and zearalenone were found in 100%, 100%, and 85% of chicken feeds, their contamination levels were below the maximum acceptable levels (1.86, 2.24, and 147.53 μg/kg, respectively). However, no eggs were contaminated with aflatoxins, ochratoxins, or zearalenone. Therefore, the risk of contamination by mycotoxins and microbes in eggs and chicken feeds is considered negligible and unlikely to pose a threat to human health. PMID:27621686

  1. Detection of Goss's Wilt Pathogen Clavibacter michiganensis subsp. nebraskensis in Maize by Loop-Mediated Amplification.

    Science.gov (United States)

    Yasuhara-Bell, Jarred; de Silva, Asoka; Heuchelin, Scott A; Chaky, Jennifer L; Alvarez, Anne M

    2016-03-01

    The Goss's wilt pathogen, Clavibacter michiganensis subsp. nebraskensis, can cause considerable losses in maize (Zea mays) production. Diagnosis of Goss's wilt currently is based on symptomology and identification of C. michiganensis subsp. nebraskensis, following isolation on a semiselective medium and/or serological testing. In an effort to provide a more efficient identification method, a loop-mediated amplification (LAMP) assay was developed to detect the tripartite ATP-independent periplasmic (TRAP)-type C4-dicarboxylate transport system large permease component and tested using strains of C. michiganensis subsp. nebraskensis, all other C. michiganensis subspecies and several genera of nontarget bacteria. Only strains of C. michiganensis subsp. nebraskensis reacted positively with the LAMP assay. The LAMP assay was then used to identify bacterial isolates from diseased maize. 16S rDNA and dnaA sequence analyses were used to confirm the identity of the maize isolates and validate assay specificity. The Cmm ImmunoStrip assay was included as a presumptive identification test of C. michiganensis subsp. nebraskensis at the species level. The Cmn-LAMP assay was further tested using symptomatic leaf tissue. The Cmn-LAMP assay was run in a hand-held real-time monitoring device (SMART-DART) and performed equally to in-lab quantitative polymerase chain reaction equipment. The Cmn-LAMP assay accurately identified C. michiganensis subsp. nebraskensis and has potential as a field test. The targeted sequence also has potential application in other molecular detection platforms. PMID:26595113

  2. Molecular detection of multiple emerging pathogens in sputa from cystic fibrosis patients.

    Directory of Open Access Journals (Sweden)

    Fadi Bittar

    Full Text Available BACKGROUND: There is strong evidence that culture-based methods detect only a small proportion of bacteria present in the respiratory tracts of cystic fibrosis (CF patients. METHODOLOGY/PRINCIPAL FINDINGS: Standard microbiological culture and phenotypic identification of bacteria in sputa from CF patients have been compared to molecular methods by the use of 16S rDNA amplification, cloning and sequencing. Twenty-five sputa from CF patients were cultured that yield 33 isolates (13 species known to be pathogens during CF. For molecular cloning, 760 clones were sequenced (7.2+/-3.9 species/sputum, and 53 different bacterial species were identified including 16 species of anaerobes (30%. Discrepancies between culture and molecular data were numerous and demonstrate that accurate identification remains challenging. New or emerging bacteria not or rarely reported in CF patients were detected including Dolosigranulum pigrum, Dialister pneumosintes, and Inquilinus limosus. CONCLUSIONS/SIGNIFICANCE: Our results demonstrate the complex microbial community in sputa from CF patients, especially anaerobic bacteria that are probably an underestimated cause of CF lung pathology. Metagenomic analysis is urgently needed to better understand those complex communities in CF pulmonary infections.

  3. Detection of Foodborne Pathogens and Mycotoxins in Eggs and Chicken Feeds from Farms to Retail Markets

    Science.gov (United States)

    Lee, Minhwa; Seo, Dong Joo; Jeon, Su Been; Ok, Hyun Ee; Jung, Hyelee; Choi, Changsun; Chun, Hyang Sook

    2016-01-01

    Contamination by foodborne pathogens and mycotoxins was examined in 475 eggs and 20 feed samples collected from three egg layer farms, three egg-processing units, and five retail markets in Korea. Microbial contamination with Salmonella species, Escherichia coli, and Arcobacter species was examined by bacterial culture and multiplex polymerase chain reaction (PCR). The contamination levels of aflatoxins, ochratoxins, and zearalenone in eggs and chicken feeds were simultaneously analyzed with high-performance liquid chromatography coupled with fluorescence detection after the post-derivatization. While E. coli was isolated from 9.1% of eggs, Salmonella species were not isolated. Arcobacter species were detected in 0.8% of eggs collected from egg layers by PCR only. While aflatoxins, ochratoxins, and zearalenone were found in 100%, 100%, and 85% of chicken feeds, their contamination levels were below the maximum acceptable levels (1.86, 2.24, and 147.53 μg/kg, respectively). However, no eggs were contaminated with aflatoxins, ochratoxins, or zearalenone. Therefore, the risk of contamination by mycotoxins and microbes in eggs and chicken feeds is considered negligible and unlikely to pose a threat to human health. PMID:27621686

  4. Validation of high-throughput real time polymerase chain reaction assays for simultaneous detection of invasive citrus pathogens.

    Science.gov (United States)

    Saponari, Maria; Loconsole, Giuliana; Liao, Hui-Hong; Jiang, Bo; Savino, Vito; Yokomi, Raymond K

    2013-11-01

    A number of important citrus pathogens are spread by graft propagation, arthropod vector transmission and inadvertent import and dissemination of infected plants. For these reasons, citrus disease management and clean stock programs require pathogen detection systems which are economical and sensitive to maintain a healthy industry. To this end, multiplex quantitative real-time PCR (qPCR) assays were developed allowing high-throughput and simultaneous detection of some major invasive citrus pathogens. Automated high-throughput extraction comparing several bead-based commercial extraction kits were tested and compared with tissue print and manual extraction to obtain nucleic acids from healthy and pathogen-infected citrus trees from greenhouse in planta collections and field. Total nucleic acids were used as templates for pathogen detection. Multiplex reverse transcription-qPCR (RT-qPCR) assays were developed for simultaneous detection of six targets including a virus, two viroids, a bacterium associated with huanglongbing and a citrus RNA internal control. Specifically, two one-step TaqMan-based multiplex RT-qPCR assays were developed and tested with target templates to determine sensitivity and detection efficiency. The first assay included primers and probes for 'Candidatus Liberibacter asiaticus' (CLas) and Citrus tristeza virus (CTV) broad spectrum detection and genotype differentiation (VT- and T3-like genotypes). The second assay contained primers and probes for Hop stunt viroid (HSVd), Citrus exocortis viroid (CEVd) and the mitochondrial NADH dehydrogenase (nad5) mRNA as an internal citrus host control. Primers and TaqMan probes for the viroids were designed in this work; whereas those for the other pathogens were from reports of others. Based on quantitation cycle values, automated high-throughput extraction of samples proved to be as suitable as manual extraction. The multiplex RT-qPCR assays detected both RNA and DNA pathogens in the same dilution series

  5. Detection, fate and inactivation of pathogenic norovirus employing settlement and UV treatment in wastewater treatment facilities.

    Science.gov (United States)

    Barrett, M; Fitzhenry, K; O'Flaherty, V; Dore, W; Keaveney, S; Cormican, M; Rowan, N; Clifford, E

    2016-10-15

    It is accepted that discharged wastewaters can be a significant source of pathogenic viruses in receiving water bodies contributing to pollution and may in turn enter the human food chain and pose a risk to human health, thus norovirus (NoV) is often a predominant cause of gastroenteritis globally. Working with NoV poses particular challenges as it cannot be readily identified and detection by molecular methods does not assess infectivity. It has been proposed that the infectivity of NoV may be modelled through the use of an alternative virus; F-specific RNA (FRNA) bacteriophages; GA genotype and other FRNA bacteriophages have been used as a surrogate in studies of NoV inactivation. This study investigated the efficiency of novel pulsed ultraviolet irradiation and low pressure ultraviolet irradiation as a potential pathogen inactivation system for NoV and FRNA bacteriophage (GA) in secondary treated wastewaters. The role of UV dose and the impact of suspended solids concentration on removal efficiency were also examined. The study also investigated the role of settlement processes in wastewater treatment plants in removing NoV. While NoV inactivation could not be determined it was found that at a maximum UV dose of 6.9J/cm(2) (6900mJ/cm(2)) an average 2.4 log removal of FRNA bacteriophage (GA) was observed; indicating the potential need for high UV doses to remove NoV if FRNA bacteriophage prove a suitable indicator for NoV. The study found that increasing concentrations of suspended solids impacted on PUV efficiency however, it appears the extent of the impact may be site specific. Furthermore, the study found that settlement processes can play a significant role in the removal of FRNA bacteriophage, thus potentially NoV.

  6. Host-Seeking Behavior and Arbovirus Detection in Mosquitoes of Habahe County, Xinjiang Uigur Autonomous Region, China.

    Science.gov (United States)

    Guo, Xiao-Xia; Zhang, Ying-Mei; Li, Chun-Xiao; Zhang, Gui-Lin; Zheng, Zhong; Dong, Yan-De; Xue, Rui-De; Xing, Dan; Zhao, Tong-Yan

    2015-12-01

    Mosquitoes in Habahe County of Xinjiang Uigur Autonomous Region in China are considered a serious nuisance problem to local residents, but little is known of their role in enzootic disease. Therefore, host-seeking behavior and virus detection in mosquitoes were investigated in this study. Adult host-seeking mosquitoes were sampled using the Centers for Disease Control and Prevention (CDC) light traps operated at three locations in June through August 2008. Nine traps were used at each location at 3 different heights (1 m, 3 m, and 5 m). Seven mosquito species from 4 genera were collected by CDC light traps in different habitats. In total, 90,055 mosquitoes were captured, of which Aedes vexans was the most abundant species, comprising 88.02% of all mosquitoes collected. The second most abundant species was Anopheles messese, which comprised about 5.86%. Other species caught were Culex modestus (2.89%), Aedes caspius (1.11%), Coquillettidia richiardii (0.61%), Ae. dorsalis (1.36%), and An. hyrcanus (0.14%). About 93.5% of Ae. vexans individuals were caught in CO2-baited CDC light traps at 1 m above the ground. The highest numbers of Cx. modestus were caught at the highest trap level, 5 m above ground. Overall, significantly more mosquitoes of all species were collected at dusk than at dawn. Based on blood-meal analyses, Ae. vexans and An. messese fed on various vertebrate hosts, whereas Cx. modestus fed on ducks only. From a total of 335 mosquito pools tested, 10 pools of Ae. vexans were found positive for alphavirus. Comparison with the gene database revealed that the alphavirus deoxyribonucleic acid fragment obtained (GenBank accession no. HM160530) was 100% homologous at the nucleotide level to chikungunya virus isolate LK (PB) chik3408, chikungunya virus isolate SGEHICHD122508, and chikungunya virus strain FD080231. The results of this study suggest that ongoing, integrated mosquito and arbovirus surveillance is necessary in this river wetland.

  7. Use of Metagenomic Shotgun Sequencing Technology To Detect Foodborne Pathogens within the Microbiome of the Beef Production Chain.

    Science.gov (United States)

    Yang, Xiang; Noyes, Noelle R; Doster, Enrique; Martin, Jennifer N; Linke, Lyndsey M; Magnuson, Roberta J; Yang, Hua; Geornaras, Ifigenia; Woerner, Dale R; Jones, Kenneth L; Ruiz, Jaime; Boucher, Christina; Morley, Paul S; Belk, Keith E

    2016-04-01

    Foodborne illnesses associated with pathogenic bacteria are a global public health and economic challenge. The diversity of microorganisms (pathogenic and nonpathogenic) that exists within the food and meat industries complicates efforts to understand pathogen ecology. Further, little is known about the interaction of pathogens within the microbiome throughout the meat production chain. Here, a metagenomic approach and shotgun sequencing technology were used as tools to detect pathogenic bacteria in environmental samples collected from the same groups of cattle at different longitudinal processing steps of the beef production chain: cattle entry to feedlot, exit from feedlot, cattle transport trucks, abattoir holding pens, and the end of the fabrication system. The log read counts classified as pathogens per million reads for Salmonella enterica,Listeria monocytogenes,Escherichia coli,Staphylococcus aureus, Clostridium spp. (C. botulinum and C. perfringens), and Campylobacter spp. (C. jejuni,C. coli, and C. fetus) decreased over subsequential processing steps. Furthermore, the normalized read counts for S. enterica,E. coli, and C. botulinumwere greater in the final product than at the feedlots, indicating that the proportion of these bacteria increased (the effect on absolute numbers was unknown) within the remaining microbiome. From an ecological perspective, data indicated that shotgun metagenomics can be used to evaluate not only the microbiome but also shifts in pathogen populations during beef production. Nonetheless, there were several challenges in this analysis approach, one of the main ones being the identification of the specific pathogen from which the sequence reads originated, which makes this approach impractical for use in pathogen identification for regulatory and confirmation purposes. PMID:26873315

  8. Use of Metagenomic Shotgun Sequencing Technology To Detect Foodborne Pathogens within the Microbiome of the Beef Production Chain

    Science.gov (United States)

    Yang, Xiang; Noyes, Noelle R.; Doster, Enrique; Martin, Jennifer N.; Linke, Lyndsey M.; Magnuson, Roberta J.; Yang, Hua; Geornaras, Ifigenia; Woerner, Dale R.; Jones, Kenneth L.; Ruiz, Jaime; Boucher, Christina; Morley, Paul S.

    2016-01-01

    Foodborne illnesses associated with pathogenic bacteria are a global public health and economic challenge. The diversity of microorganisms (pathogenic and nonpathogenic) that exists within the food and meat industries complicates efforts to understand pathogen ecology. Further, little is known about the interaction of pathogens within the microbiome throughout the meat production chain. Here, a metagenomic approach and shotgun sequencing technology were used as tools to detect pathogenic bacteria in environmental samples collected from the same groups of cattle at different longitudinal processing steps of the beef production chain: cattle entry to feedlot, exit from feedlot, cattle transport trucks, abattoir holding pens, and the end of the fabrication system. The log read counts classified as pathogens per million reads for Salmonella enterica, Listeria monocytogenes, Escherichia coli, Staphylococcus aureus, Clostridium spp. (C. botulinum and C. perfringens), and Campylobacter spp. (C. jejuni, C. coli, and C. fetus) decreased over subsequential processing steps. Furthermore, the normalized read counts for S. enterica, E. coli, and C. botulinum were greater in the final product than at the feedlots, indicating that the proportion of these bacteria increased (the effect on absolute numbers was unknown) within the remaining microbiome. From an ecological perspective, data indicated that shotgun metagenomics can be used to evaluate not only the microbiome but also shifts in pathogen populations during beef production. Nonetheless, there were several challenges in this analysis approach, one of the main ones being the identification of the specific pathogen from which the sequence reads originated, which makes this approach impractical for use in pathogen identification for regulatory and confirmation purposes. PMID:26873315

  9. Use of Metagenomic Shotgun Sequencing Technology To Detect Foodborne Pathogens within the Microbiome of the Beef Production Chain.

    Science.gov (United States)

    Yang, Xiang; Noyes, Noelle R; Doster, Enrique; Martin, Jennifer N; Linke, Lyndsey M; Magnuson, Roberta J; Yang, Hua; Geornaras, Ifigenia; Woerner, Dale R; Jones, Kenneth L; Ruiz, Jaime; Boucher, Christina; Morley, Paul S; Belk, Keith E

    2016-04-01

    Foodborne illnesses associated with pathogenic bacteria are a global public health and economic challenge. The diversity of microorganisms (pathogenic and nonpathogenic) that exists within the food and meat industries complicates efforts to understand pathogen ecology. Further, little is known about the interaction of pathogens within the microbiome throughout the meat production chain. Here, a metagenomic approach and shotgun sequencing technology were used as tools to detect pathogenic bacteria in environmental samples collected from the same groups of cattle at different longitudinal processing steps of the beef production chain: cattle entry to feedlot, exit from feedlot, cattle transport trucks, abattoir holding pens, and the end of the fabrication system. The log read counts classified as pathogens per million reads for Salmonella enterica,Listeria monocytogenes,Escherichia coli,Staphylococcus aureus, Clostridium spp. (C. botulinum and C. perfringens), and Campylobacter spp. (C. jejuni,C. coli, and C. fetus) decreased over subsequential processing steps. Furthermore, the normalized read counts for S. enterica,E. coli, and C. botulinumwere greater in the final product than at the feedlots, indicating that the proportion of these bacteria increased (the effect on absolute numbers was unknown) within the remaining microbiome. From an ecological perspective, data indicated that shotgun metagenomics can be used to evaluate not only the microbiome but also shifts in pathogen populations during beef production. Nonetheless, there were several challenges in this analysis approach, one of the main ones being the identification of the specific pathogen from which the sequence reads originated, which makes this approach impractical for use in pathogen identification for regulatory and confirmation purposes.

  10. Autonomic neuropathy

    DEFF Research Database (Denmark)

    Hilsted, J

    1983-01-01

    The diagnosis of autonomic neuropathy is often difficult to establish, since clinical symptoms generally appear late in the course of the disease, and may be non-specific. A number of recently developed quantifiable and reproducible autonomic nerve function tests are reviewed, with emphasis on th...

  11. Autonomic neuropathy

    DEFF Research Database (Denmark)

    Hilsted, J

    1980-01-01

    In order to elucidate the physiological significance of autonomic neuropathy in juvenile diabetics, cardiovascular, hormonal and metabolic functions have been investigated in three groups of juvenile diabetics: One group had no signs of neuropathy, one group had presumably slight autonomic...... neuropathy (reduced beat-to-beat variation in heart rate during hyperventilation) and one group had clinically severe autonomic neuropathy, defined by presence of orthostatic hypotension. In all three experimental situations we found sympathetic dysfunction causing cardiovascular and/or hormonal...... maladjustments in patients with autonomic neuropathy. Regarding metabolic functions we found normal responses to graded exercise and insulin-induced hypoglycemia in patients with autonomic neuropathy in spite of blunted catecholamine responses, suggesting increased sensitivity of glycogen stores and adipose...

  12. Phage-based surface plasmon resonance strategies for the detection of pathogens

    Science.gov (United States)

    Tawil, Nancy

    We start by reviewing the basic principles and recent advances in biosensing technologies using optical, electrochemical and acoustic platforms for phage-based diagnostics. Although much notable work has been done, a low cost, specific, sensitive optical method for detecting low concentrations of pathogens, in a few minutes, has not been established. We conclude from the limited body of work on the subject that improving immobilization strategies and finding more suitable phage recognition elements would allow for a more sensitive approach. Our aim was to better describe the attachment process of MRSA specific phages on gold surfaces, and the subsequent biodetection of their bacterial hosts by surface plasmon resonance (SPR). With the knowledge that the adsorption characteristics of thiol-containing molecules are necessary for applications involving the attachment of recognition elements to a functionalized surface, we start by providing comparative details on the kinetics of self-assembly of L-cysteine and 11-mercaptoundecanoic acid (MUA) monolayers on gold using SPR[1]. Our purpose, in carrying out these measurements was to establish each molecule's validity and applicability as a linker element for use in biosensing. We find that monolayer formation, for both L-cysteine and MUA, is described by the Langmuir isotherm at low concentrations only. For L-cysteine, both the amine and thiol groups contribute to the initial attachment of the molecule, followed by the replacement of the amine-gold complexes initially formed with more stable thiol-gold complexes. The reorganization of L-cysteine creates more space on the gold surface, and the zwitterionic form of the molecule permits the physisorption of a second layer through electrostatic interactions. On the other hand, MUA deposits randomly onto the surface of gold as a SAM and slowly reorganizes into a denser, vertical state. Surface plasmon resonance was then used for the real-time monitoring of the attachment of

  13. Direct detection and differentiation of pathogenic Leptospira species using a multi-gene targeted real time PCR approach.

    Directory of Open Access Journals (Sweden)

    Ana Sofia Ferreira

    Full Text Available Leptospirosis is a growing public and veterinary health concern caused by pathogenic species of Leptospira. Rapid and reliable laboratory tests for the direct detection of leptospiral infections in animals are in high demand not only to improve diagnosis but also for understanding the epidemiology of the disease. In this work we describe a novel and simple TaqMan-based multi-gene targeted real-time PCR approach able to detect and differentiate Leptospira interrogans, L. kirschneri, L. borgpeteresenii and L. noguchii, which constitute the veterinary most relevant pathogenic species of Leptospira. The method uses sets of species-specific probes, and respective flanking primers, designed from ompL1 and secY gene sequences. To monitor the presence of inhibitors, a duplex amplification assay targeting both the mammal β-actin and the leptospiral lipL32 genes was implemented. The analytical sensitivity of all primer and probe sets was estimated to be <10 genome equivalents (GE in the reaction mixture. Application of the amplification reactions on genomic DNA from a variety of pathogenic and non-pathogenic Leptospira strains and other non-related bacteria revealed a 100% analytical specificity. Additionally, pathogenic leptospires were successfully detected in five out of 29 tissue samples from animals (Mus spp., Rattus spp., Dolichotis patagonum and Sus domesticus. Two samples were infected with L. borgpetersenii, two with L. interrogans and one with L. kirschneri. The possibility to detect and identify these pathogenic agents to the species level in domestic and wildlife animals reinforces the diagnostic information and will enhance our understanding of the epidemiology of leptopirosis.

  14. The application of flow cytometry and fluorescent probe technology for detection and assessment of viability of plant pathogenic bacteria

    NARCIS (Netherlands)

    Chitarra, L.G.; Bulk, van den R.W.

    2003-01-01

    Conventional methods to detect and assess the viability of plant pathogenic bacteria are usually based on plating assays or serological techniques. Plating assays provide information about the number of viable cells, expressed as colony-forming units, but are time-consuming and laborious. Serologica

  15. Single walled carbon nanotube-based electrical biosensor for the label-free detection of pathogenic bacteria

    DEFF Research Database (Denmark)

    Yoo, S. M.; Baek, Y. K.; Shin, S.;

    2016-01-01

    We herein describe the development of a single-walled carbon nanotube (SWNT)-based electrical biosensor consisting of a two-terminal resistor, and report its use for the specific, label-free detection of pathogenic bacteria via changes in conductance. The ability of this biosensor to recognize di...

  16. Direct Detection and Differentiation of Pathogenic Leptospira Species Using a Multi-Gene Targeted Real Time PCR Approach

    OpenAIRE

    Ana Sofia Ferreira; Pedro Costa; Teresa Rocha; Ana Amaro; Maria Luísa Vieira; Ahmed Ahmed; Gertrude Thompson; Hartskeerl, Rudy A.; João Inácio

    2014-01-01

    Leptospirosis is a growing public and veterinary health concern caused by pathogenic species of Leptospira. Rapid and reliable laboratory tests for the direct detection of leptospiral infections in animals are in high demand not only to improve diagnosis but also for understanding the epidemiology of the disease. In this work we describe a novel and simple TaqMan-based multi-gene targeted real-time PCR approach able to detect and differentiate Leptospira interrogans, L. kirschneri, L. borgpet...

  17. Unbiased Parallel Detection of Viral Pathogens in Clinical Samples by Use of a Metagenomic Approach▿‡

    OpenAIRE

    Yang, Jian; Yang, Fan; Ren, Lili; Xiong, Zhaohui; Wu, Zhiqiang; Dong, Jie; Sun, Lilian; Zhang, Ting; Hu, Yongfeng; Du, Jiang; Wang, Jianwei; Jin, Qi

    2011-01-01

    Viral infectious diseases represent a major threat to public health and are among the greatest disease burdens worldwide. Rapid and accurate identification of viral agents is crucial for both outbreak control and estimating regional disease burdens. Recently developed metagenomic methods have proven to be powerful tools for simultaneous pathogen detection. Here, we performed a systematic study of the capability of the short-read-based metagenomic approach in the molecular detection of viral p...

  18. A model system for pathogen detection using a two-component bacteriophage/bioluminescent signal amplification assay

    Science.gov (United States)

    Bright, Nathan G.; Carroll, Richard J.; Applegate, Bruce M.

    2004-03-01

    Microbial contamination has become a mounting concern the last decade due to an increased emphasis of minimally processed food products specifically produce, and the recognition of foodborne pathogens such as Campylobacter jejuni, Escherichia coli O157:H7, and Listeria monocytogenes. This research investigates a detection approach utilizing bacteriophage pathogen specificity coupled with a bacterial bioluminescent bioreporter utilizing the quorum sensing molecule from Vibrio fischeri, N-(3-oxohexanoyl)-homoserine lactone (3-oxo-C6-HSL). The 3-oxo-C6-HSL molecules diffuse out of the target cell after infection and induce bioluminescence from a population of 3-oxo-C6-HSL bioreporters (ROLux). E. coli phage M13, a well-characterized bacteriophage, offers a model system testing the use of bacteriophage for pathogen detection through cell-to-cell communication via a LuxR/3-oxo-C6-HSL system. Simulated temperate phage assays tested functionality of the ROLux reporter and production of 3-oxo-C6-HSL by various test strains. These assays showed detection limits of 102cfu after 24 hours in a varietry of detection formats. Assays incorporating the bacteriophage M13-luxI with the ROLux reporter and a known population of target cells were subsequently developed and have shown consistent detection limits of 105cfu target organisms. Measurable light response from high concentrations of target cells was almost immediate, suggesting an enrichment step to further improve detection limits and reduce assay time.

  19. Development and evaluation of a panel of filovirus sequence capture probes for pathogen detection by next-generation sequencing.

    Directory of Open Access Journals (Sweden)

    Jeffrey W Koehler

    Full Text Available A detailed understanding of the circulating pathogens in a particular geographic location aids in effectively utilizing targeted, rapid diagnostic assays, thus allowing for appropriate therapeutic and containment procedures. This is especially important in regions prevalent for highly pathogenic viruses co-circulating with other endemic pathogens such as the malaria parasite. The importance of biosurveillance is highlighted by the ongoing Ebola virus disease outbreak in West Africa. For example, a more comprehensive assessment of the regional pathogens could have identified the risk of a filovirus disease outbreak earlier and led to an improved diagnostic and response capacity in the region. In this context, being able to rapidly screen a single sample for multiple pathogens in a single tube reaction could improve both diagnostics as well as pathogen surveillance. Here, probes were designed to capture identifying filovirus sequence for the ebolaviruses Sudan, Ebola, Reston, Taï Forest, and Bundibugyo and the Marburg virus variants Musoke, Ci67, and Angola. These probes were combined into a single probe panel, and the captured filovirus sequence was successfully identified using the MiSeq next-generation sequencing platform. This panel was then used to identify the specific filovirus from nonhuman primates experimentally infected with Ebola virus as well as Bundibugyo virus in human sera samples from the Democratic Republic of the Congo, thus demonstrating the utility for pathogen detection using clinical samples. While not as sensitive and rapid as real-time PCR, this panel, along with incorporating additional sequence capture probe panels, could be used for broad pathogen screening and biosurveillance.

  20. DNA Extraction Method Affects the Detection of a Fungal Pathogen in Formalin-Fixed Specimens Using qPCR.

    Directory of Open Access Journals (Sweden)

    Andrea J Adams

    Full Text Available Museum collections provide indispensable repositories for obtaining information about the historical presence of disease in wildlife populations. The pathogenic amphibian chytrid fungus Batrachochytrium dendrobatidis (Bd has played a significant role in global amphibian declines, and examining preserved specimens for Bd can improve our understanding of its emergence and spread. Quantitative PCR (qPCR enables Bd detection with minimal disturbance to amphibian skin and is significantly more sensitive to detecting Bd than histology; therefore, developing effective qPCR methodologies for detecting Bd DNA in formalin-fixed specimens can provide an efficient and effective approach to examining historical Bd emergence and prevalence. Techniques for detecting Bd in museum specimens have not been evaluated for their effectiveness in control specimens that mimic the conditions of animals most likely to be encountered in museums, including those with low pathogen loads. We used American bullfrogs (Lithobates catesbeianus of known infection status to evaluate the success of qPCR to detect Bd in formalin-fixed specimens after three years of ethanol storage. Our objectives were to compare the most commonly used DNA extraction method for Bd (PrepMan, PM to Macherey-Nagel DNA FFPE (MN, test optimizations for Bd detection with PM, and provide recommendations for maximizing Bd detection. We found that successful detection is relatively high (80-90% when Bd loads before formalin fixation are high, regardless of the extraction method used; however, at lower infection levels, detection probabilities were significantly reduced. The MN DNA extraction method increased Bd detection by as much as 50% at moderate infection levels. Our results indicate that, for animals characterized by lower pathogen loads (i.e., those most commonly encountered in museum collections, current methods may underestimate the proportion of Bd-infected amphibians. Those extracting DNA from

  1. DNA Extraction Method Affects the Detection of a Fungal Pathogen in Formalin-Fixed Specimens Using qPCR.

    Science.gov (United States)

    Adams, Andrea J; LaBonte, John P; Ball, Morgan L; Richards-Hrdlicka, Kathryn L; Toothman, Mary H; Briggs, Cheryl J

    2015-01-01

    Museum collections provide indispensable repositories for obtaining information about the historical presence of disease in wildlife populations. The pathogenic amphibian chytrid fungus Batrachochytrium dendrobatidis (Bd) has played a significant role in global amphibian declines, and examining preserved specimens for Bd can improve our understanding of its emergence and spread. Quantitative PCR (qPCR) enables Bd detection with minimal disturbance to amphibian skin and is significantly more sensitive to detecting Bd than histology; therefore, developing effective qPCR methodologies for detecting Bd DNA in formalin-fixed specimens can provide an efficient and effective approach to examining historical Bd emergence and prevalence. Techniques for detecting Bd in museum specimens have not been evaluated for their effectiveness in control specimens that mimic the conditions of animals most likely to be encountered in museums, including those with low pathogen loads. We used American bullfrogs (Lithobates catesbeianus) of known infection status to evaluate the success of qPCR to detect Bd in formalin-fixed specimens after three years of ethanol storage. Our objectives were to compare the most commonly used DNA extraction method for Bd (PrepMan, PM) to Macherey-Nagel DNA FFPE (MN), test optimizations for Bd detection with PM, and provide recommendations for maximizing Bd detection. We found that successful detection is relatively high (80-90%) when Bd loads before formalin fixation are high, regardless of the extraction method used; however, at lower infection levels, detection probabilities were significantly reduced. The MN DNA extraction method increased Bd detection by as much as 50% at moderate infection levels. Our results indicate that, for animals characterized by lower pathogen loads (i.e., those most commonly encountered in museum collections), current methods may underestimate the proportion of Bd-infected amphibians. Those extracting DNA from archived museum

  2. Molecular Detection of Tick-Borne Pathogens in Humans with Tick Bites and Erythema Migrans, in the Netherlands

    Science.gov (United States)

    Jahfari, Setareh; Hofhuis, Agnetha; Fonville, Manoj; van der Giessen, Joke; van Pelt, Wilfrid; Sprong, Hein

    2016-01-01

    Background Tick-borne diseases are the most prevalent vector-borne diseases in Europe. Knowledge on the incidence and clinical presentation of other tick-borne diseases than Lyme borreliosis and tick-borne encephalitis is minimal, despite the high human exposure to these pathogens through tick bites. Using molecular detection techniques, the frequency of tick-borne infections after exposure through tick bites was estimated. Methods Ticks, blood samples and questionnaires on health status were collected from patients that visited their general practitioner with a tick bite or erythema migrans in 2007 and 2008. The presence of several tick-borne pathogens in 314 ticks and 626 blood samples of this cohort were analyzed using PCR-based methods. Using multivariate logistic regression, associations were explored between pathogens detected in blood and self-reported symptoms at enrolment and during a three-month follow-up period. Results Half of the ticks removed from humans tested positive for Borrelia burgdorferi sensu lato, Anaplasma phagocytophilum, Candidatus Neoehrlichia mikurensis, Rickettsia helvetica, Rickettsia monacensis, Borrelia miyamotoi and several Babesia species. Among 92 Borrelia burgdorferi s. l. positive ticks, 33% carried another pathogen from a different genus. In blood of sixteen out of 626 persons with tick bites or erythema migrans, DNA was detected from Candidatus Neoehrlichia mikurensis (n = 7), Anaplasma phagocytophilum (n = 5), Babesia divergens (n = 3), Borrelia miyamotoi (n = 1) and Borrelia burgdorferi s. l. (n = 1). None of these sixteen individuals reported any overt symptoms that would indicate a corresponding illness during the three-month follow-up period. No associations were found between the presence of pathogen DNA in blood and; self-reported symptoms, with pathogen DNA in the corresponding ticks (n = 8), reported tick attachment duration, tick engorgement, or antibiotic treatment at enrolment. Conclusions Based on molecular

  3. Widespread detection of highly pathogenic H5 influenza viruses in wild birds from the Pacific Flyway of the United States.

    Science.gov (United States)

    Bevins, S N; Dusek, R J; White, C L; Gidlewski, T; Bodenstein, B; Mansfield, K G; DeBruyn, P; Kraege, D; Rowan, E; Gillin, C; Thomas, B; Chandler, S; Baroch, J; Schmit, B; Grady, M J; Miller, R S; Drew, M L; Stopak, S; Zscheile, B; Bennett, J; Sengl, J; Brady, Caroline; Ip, H S; Spackman, E; Killian, M L; Torchetti, M K; Sleeman, J M; Deliberto, T J

    2016-01-01

    A novel highly pathogenic avian influenza virus belonging to the H5 clade 2.3.4.4 variant viruses was detected in North America in late 2014. Motivated by the identification of these viruses in domestic poultry in Canada, an intensive study was initiated to conduct highly pathogenic avian influenza surveillance in wild birds in the Pacific Flyway of the United States. A total of 4,729 hunter-harvested wild birds were sampled and highly pathogenic avian influenza virus was detected in 1.3% (n = 63). Three H5 clade 2.3.4.4 subtypes were isolated from wild birds, H5N2, H5N8, and H5N1, representing the wholly Eurasian lineage H5N8 and two novel reassortant viruses. Testing of 150 additional wild birds during avian morbidity and mortality investigations in Washington yielded 10 (6.7%) additional highly pathogenic avian influenza isolates (H5N8 = 3 and H5N2 = 7). The geographically widespread detection of these viruses in apparently healthy wild waterfowl suggest that the H5 clade 2.3.4.4 variant viruses may behave similarly in this taxonomic group whereby many waterfowl species are susceptible to infection but do not demonstrate obvious clinical disease. Despite these findings in wild waterfowl, mortality has been documented for some wild bird species and losses in US domestic poultry during the first half of 2015 were unprecedented. PMID:27381241

  4. Development of a DNA Microarray-Based Assay for the Detection of Sugar Beet Root Rot Pathogens.

    Science.gov (United States)

    Liebe, Sebastian; Christ, Daniela S; Ehricht, Ralf; Varrelmann, Mark

    2016-01-01

    Sugar beet root rot diseases that occur during the cropping season or in storage are accompanied by high yield losses and a severe reduction of processing quality. The vast diversity of microorganism species involved in rot development requires molecular tools allowing simultaneous identification of many different targets. Therefore, a new microarray technology (ArrayTube) was applied in this study to improve diagnosis of sugar beet root rot diseases. Based on three marker genes (internal transcribed spacer, translation elongation factor 1 alpha, and 16S ribosomal DNA), 42 well-performing probes enabled the identification of prevalent field pathogens (e.g., Aphanomyces cochlioides), storage pathogens (e.g., Botrytis cinerea), and ubiquitous spoilage fungi (e.g., Penicillium expansum). All probes were proven for specificity with pure cultures from 73 microorganism species as well as for in planta detection of their target species using inoculated sugar beet tissue. Microarray-based identification of root rot pathogens in diseased field beets was successfully confirmed by classical detection methods. The high discriminatory potential was proven by Fusarium species differentiation based on a single nucleotide polymorphism. The results demonstrate that the ArrayTube constitute an innovative tool allowing a rapid and reliable detection of plant pathogens particularly when multiple microorganism species are present. PMID:26524545

  5. Widespread detection of highly pathogenic H5 influenza viruses in wild birds from the Pacific Flyway of the United States

    Science.gov (United States)

    Bevins, S.N.; Dusek, Robert J.; White, C. LeAnn; Gidlewski, Thomas; Bodenstein, B.; Mansfield, Kristin G.; DeBruyn, Paul; Kraege, Donald K.; Rowan, E.L.; Gillin, Colin; Thomas, B.; Chandler, S.; Baroch, J.; Schmit, B.; Grady, M. J.; Miller, R. S.; Drew, M.L.; Stopak, S.; Zscheile, B.; Bennett, J.; Sengl, J.; Brady, Caroline; Ip, Hon S.; Spackman, Erica; Killian, M. L.; Torchetti, Mia Kim; Sleeman, Jonathan M.; DeLiberto, T.J.

    2016-01-01

    A novel highly pathogenic avian influenza virus belonging to the H5 clade 2.3.4.4 variant viruses was detected in North America in late 2014. Motivated by the identification of these viruses in domestic poultry in Canada, an intensive study was initiated to conduct highly pathogenic avian influenza surveillance in wild birds in the Pacific Flyway of the United States. A total of 4,729 hunter-harvested wild birds were sampled and highly pathogenic avian influenza virus was detected in 1.3% (n = 63). Three H5 clade 2.3.4.4 subtypes were isolated from wild birds, H5N2, H5N8, and H5N1, representing the wholly Eurasian lineage H5N8 and two novel reassortant viruses. Testing of 150 additional wild birds during avian morbidity and mortality investigations in Washington yielded 10 (6.7%) additional highly pathogenic avian influenza isolates (H5N8 = 3 and H5N2 = 7). The geographically widespread detection of these viruses in apparently healthy wild waterfowl suggest that the H5 clade 2.3.4.4 variant viruses may behave similarly in this taxonomic group whereby many waterfowl species are susceptible to infection but do not demonstrate obvious clinical disease. Despite these findings in wild waterfowl, mortality has been documented for some wild bird species and losses in US domestic poultry during the first half of 2015 were unprecedented.

  6. Surveillance of low pathogenic avian influenza in layer chickens: risk factors, transmission and early detection

    NARCIS (Netherlands)

    Gonzales Rojas, J.L.

    2012-01-01

    Low pathogenic avian influenza virus (LPAIv) of H5 and H7 subtypes are able to mutate to highly pathogenic avian influenza virus (HPAIv), which are lethal for most poultry species, can cause large epidemics and are a serious threat to public health. Thus, circulation of these LPAIv in poultry is und

  7. A comparison of flocked swabs and traditional swabs, using multiplex real-time PCR for detection of common gastroenteritis pathogens in Botswana.

    Science.gov (United States)

    Mokomane, Margaret; Kasvosve, Ishmael; Gaseitsiwe, Simani; Steenhoff, Andrew P; Pernica, Jeffrey M; Lechiile, Kwana; Luinstra, Kathy; Smieja, Marek; Goldfarb, David M

    2016-10-01

    We compared the performance of flocked and matched traditional rectal swabs collected from 236 children admitted with gastroenteritis in Botswana. All samples were tested using real time multiplex-PCR assays for nine enteric pathogens. There was a 20% higher detection of Shigella from flocked swabs, but most other pathogens had similar detection rates. PMID:27460427

  8. Detection and Comparison of Pathogen of Virus Disease in Pumpkin by RT-PCR and IC-PCR

    Institute of Scientific and Technical Information of China (English)

    YANG Guohui; ZHANG Zhongkai; CUI Chongshi

    2006-01-01

    Two kinds of methods RT-PCR and IC-PCR were used to detect pathogen of virus disease of pumpkin and the sensitivity of the two methods was compared. The results showed that PRSV-W and CMV were detected in diseased samples gathered in Yunnan Province, while WMV and CMV were detected in diseased samples gathered in Heilongjiang Province. The sensitivity of RT-PCR is higher than that of IC-PCR, but the effect of IC-PCR in the specialization of bonding reaction and requisition for experiment material is better than that of RT-PCR.

  9. Simultaneous detection of LipL32 and LipL21 genes of pathogenic leptospira from serum samples of bovines by multiplex PCR

    Directory of Open Access Journals (Sweden)

    Timiri V. Meenambigai

    2011-12-01

    Full Text Available Leptospirosis is a worldwide zoonotic disease of cattle associated with pathogenic leptospiral infection. This study focuses in the use of a molecular tool to detect pathogenic leptospiral infection in bovines by targeting the outer membrane proteins LipL32 and LipL21 simultaneously in a multiplex PCR. Sixteen pathogenic reference strains and 10 bovine serum samples were analyzed for simultaneous detection of both genes at appropriate annealing conditions. These findings are suggestive of the fact that multiplex PCR can be used to detect major outer membrane proteins of pathogenic leptospira from serum samples. Further it aided in the differentiation of pathogenic and non-pathogenic species of leptospires too. This study will definitely serve as a valuable tool, as it suggests the importance of LipL32 genes as potential candidates for vaccine development to control animal Leptospirosis.

  10. One-day workflow scheme for bacterial pathogen detection and antimicrobial resistance testing from blood cultures.

    Science.gov (United States)

    Hansen, Wendy L J; Beuving, Judith; Verbon, Annelies; Wolffs, Petra F G

    2012-07-09

    Bloodstream infections are associated with high mortality rates because of the probable manifestation of sepsis, severe sepsis and septic shock(1). Therefore, rapid administration of adequate antibiotic therapy is of foremost importance in the treatment of bloodstream infections. The critical element in this process is timing, heavily dependent on the results of bacterial identification and antibiotic susceptibility testing. Both of these parameters are routinely obtained by culture-based testing, which is time-consuming and takes on average 24-48 hours(2, 4). The aim of the study was to develop DNA-based assays for rapid identification of bloodstream infections, as well as rapid antimicrobial susceptibility testing. The first assay is a eubacterial 16S rDNA-based real-time PCR assay complemented with species- or genus-specific probes(5). Using these probes, Gram-negative bacteria including Pseudomonas spp., Pseudomonas aeruginosa and Escherichia coli as well as Gram-positive bacteria including Staphylococcus spp., Staphylococcus aureus, Enterococcus spp., Streptococcus spp., and Streptococcus pneumoniae could be distinguished. Using this multiprobe assay, a first identification of the causative micro-organism was given after 2 h. Secondly, we developed a semi-molecular assay for antibiotic susceptibility testing of S. aureus, Enterococcus spp. and (facultative) aerobe Gram-negative rods(6). This assay was based on a study in which PCR was used to measure the growth of bacteria(7). Bacteria harvested directly from blood cultures are incubated for 6 h with a selection of antibiotics, and following a Sybr Green-based real-time PCR assay determines inhibition of growth. The combination of these two methods could direct the choice of a suitable antibiotic therapy on the same day (Figure 1). In conclusion, molecular analysis of both identification and antibiotic susceptibility offers a faster alternative for pathogen detection and could improve the diagnosis of

  11. Quantitative molecular detection of putative periodontal pathogens in clinically healthy and periodontally diseased subjects.

    Directory of Open Access Journals (Sweden)

    André Göhler

    Full Text Available Periodontitis is a multi-microbial oral infection with high prevalence among adults. Putative oral pathogens are commonly found in periodontally diseased individuals. However, these organisms can be also detected in the oral cavity of healthy subjects. This leads to the hypothesis, that alterations in the proportion of these organisms relative to the total amount of oral microorganisms, namely their abundance, rather than their simple presence might be important in the transition from health to disease. Therefore, we developed a quantitative molecular method to determine the abundance of various oral microorganisms and the portion of bacterial and archaeal nucleic acid relative to the total nucleic acid extracted from individual samples. We applied quantitative real-time PCRs targeting single-copy genes of periodontal bacteria and 16S-rRNA genes of Bacteria and Archaea. Testing tongue scrapings of 88 matched pairs of periodontally diseased and healthy subjects revealed a significantly higher abundance of P. gingivalis and a higher total bacterial abundance in diseased subjects. In fully adjusted models the risk of being periodontally diseased was significantly higher in subjects with high P. gingivalis and total bacterial abundance. Interestingly, we found that moderate abundances of A. actinomycetemcomitans were associated with reduced risk for periodontal disease compared to subjects with low abundances, whereas for high abundances, this protective effect leveled off. Moderate archaeal abundances were health associated compared to subjects with low abundances. In conclusion, our methodological approach unraveled associations of the oral flora with periodontal disease, which would have gone undetected if only qualitative data had been determined.

  12. Acceptance Criteria Framework for Autonomous Biological Detectors

    Energy Technology Data Exchange (ETDEWEB)

    Dzenitis, J M

    2006-12-12

    The purpose of this study was to examine a set of user acceptance criteria for autonomous biological detection systems for application in high-traffic, public facilities. The test case for the acceptance criteria was the Autonomous Pathogen Detection System (APDS) operating in high-traffic facilities in New York City (NYC). However, the acceptance criteria were designed to be generally applicable to other biological detection systems in other locations. For such detection systems, ''users'' will include local authorities (e.g., facility operators, public health officials, and law enforcement personnel) and national authorities [including personnel from the Department of Homeland Security (DHS), the BioWatch Program, the Centers for Disease Control and Prevention (CDC), and the Federal Bureau of Investigation (FBI)]. The panel members brought expertise from a broad range of backgrounds to complete this picture. The goals of this document are: (1) To serve as informal guidance for users in considering the benefits and costs of these systems. (2) To serve as informal guidance for developers in understanding the needs of users. In follow-up work, this framework will be used to systematically document the APDS for appropriateness and readiness for use in NYC.

  13. A simple and rapid immunochromatographic test strip for detection of pathogenic isolates of Vibrio harveyi.

    Science.gov (United States)

    Sithigorngul, Paisarn; Rukpratanporn, Sombat; Pecharaburanin, Nilawan; Suksawat, Pornthip; Longyant, Siwaporn; Chaivisuthangkura, Parin; Sithigorngul, Weerawan

    2007-12-01

    Mouse monoclonal antibodies (MAbs) and rabbit polyclonal antibody (PAb) against Vibrio harveyi were generated from immunization of mice and rabbits with highly virulent isolate of V. harveyi. Two MAbs specific to virulent isolates of V. harveyi were obtained and one of them (VH4) was selected to conjugate with colloidal gold as the detector antibody was laid on a sample pad. Rabbit polyclonal antibody was used as the capture antibody at the test line (T) and goat anti-mouse IgG antibody (GAM) was used as the capture antibody at the control line (C) of nitrocellulose strip. The ready-to-use strip was held in a plastic case and then stored in a desiccated plastic bag. A sample volume of 100 microl of bacterial suspension from various sources mixed with application buffer was applied to the sample chamber at one end of the strip and allowed to flow by chromatography through the nitrocellulose membrane to the other end. In test samples containing virulent isolates of V. harveyi, the bacteria would bind to the monoclonal antibody conjugated with colloidal gold and the resulting complex would be captured by the antibodies at the test line to give a reddish-purple band. Any unbound monoclonal antibody conjugated with colloidal gold moved across the test line would be captured by the GAM and form a band at the control line (C). In sample without V. harveyi or with V. harveyi below the limit (<10(6) CFU/ml) of detection for the kit, only the control line band was observed. If the test sample was pre-enriched in tryptic soy broth (TSB) for 6 h before application to the strip, the sensitivity would increase to 1-10 CFU/ml which is comparable to that of PCR. This method could be used to detect pathogenic isolates of V. harveyi in pond water or infected shrimp in order to monitor and to reduce the risk of V. harveyi outbreak in the shrimp culture. The beneficial features of this kit are that simple, convenient and quick results (within 15 min) can be obtained without the

  14. Vaginal microbicides: detecting toxicities in vivo that paradoxically increase pathogen transmission

    OpenAIRE

    Abusuwwa Raed; Wong XiXi; Hoen Timothy; Cone Richard A; Anderson Deborah J; Moench Thomas R

    2006-01-01

    Abstract Background Microbicides must protect against STD pathogens without causing unacceptable toxic effects. Microbicides based on nonoxynol-9 (N9) and other detergents disrupt sperm, HSV and HIV membranes, and these agents are effective contraceptives. But paradoxically N9 fails to protect women against HIV and other STD pathogens, most likely because it causes toxic effects that increase susceptibility. The mouse HSV-2 vaginal transmission model reported here: (a) Directly tests for toxi...

  15. Evaluation of Statens Serum Institut Enteric Medium for Detection of Enteric Pathogens

    OpenAIRE

    Blom, Marianne; Meyer, Aase; Gerner-Smidt, Peter; Gaarslev, Knud; Espersen, Frank

    1999-01-01

    The efficacy of the Statens Serum Institut (SSI) enteric medium for isolation and direct identification of enteric pathogens was evaluated. Six different biochemical reactions can be read by using the SSI enteric medium, allowing direct identification of a range of enteric pathogens. All 248 gram-negative bacterial species that were tested grew on the SSI enteric medium. Only 10 of 248 bacteria (4%) showed discrepant results in the biochemical reactions, and none of these were enteric pathoge...

  16. Impact of early detection and treatment of diabetes on the 6-year prevalence of cardiac autonomic neuropathy in people with screen-detected diabetes

    DEFF Research Database (Denmark)

    Charles, Morten; Fleischer, J; Witte, Daniel Rinse;

    2013-01-01

    Baggrund: Der er begrænset viden om hvordan tidlig multifaktoriel behandling forbedrer konsekvenser af diabetes. Kardiel autonom neuropati (KAN) hos personer med diabetes indikerer omfattende skade på det autonome nervesystem og er relateret til mortalitet og livskvalitet. I dette studie fra...... ADDITION Danmark undersøgte vi effekten af tidlig opsporing og efterfølgende intensive behandling af type 2 diabetes i almen praksis på hyppigheden af kardiel autonom neuropati 6 år efter diagnose. Resultater: Prævalensen af tidlig KAN var 15,1% i rutine behandlingsgruppen (RG) og 15.5% i intensive...... kardiovaskulære risikofaktorer er således ikke nok til at forebygge at mange diabetes patienter udvikler KAN....

  17. First detection of highly pathogenic avian influenza virus H5N1 in common kestrel falcon (Falco tinnunculus) in Egypt

    OpenAIRE

    ElBakrey, Reham M.; Mansour, Shimaa M. G.; Ali, Haytham; Knudsen, David E. B.; Eid, Amal A. M.

    2016-01-01

    Highly pathogenic avian influenza virus (HPAIV) poses threats to animal and human health worldwide. A common kestrel (Falco tinnunculus) was submitted to Avian and Rabbit Medicine Department, Zagazig University, Egypt. It exhibited torticollis, incoordination, and inability to stand. Conjunctivitis and crust formation were seen. Postmortem findings revealed congestion in internal organs and greenish content in gizzard. No avian pox virus was detected in cutaneous lesions neither in histopatho...

  18. Evaluation of the California mastitis test to detect an intramammary infection with a major pathogen in early lactation dairy cows.

    Science.gov (United States)

    Dingwell, Randy T; Leslie, Ken E; Schukken, Ynte H; Sargeant, Jan M; Timms, Leo L

    2003-05-01

    The purpose of this study was to evaluate the usefulness of the California mastitis test (CMT) to detect an intramammary infection caused by a major mastitis pathogen in early lactation cows. The gold standard used for comparison was bacteriological culture of single milk samples. The sensitivity (82.4%) and specificity (80.6%) of a positive CMT were highest on the 4th day of lactation. PMID:12757133

  19. Evaluation of the California mastitis test to detect an intramammary infection with a major pathogen in early lactation dairy cows

    OpenAIRE

    Dingwell, Randy T.; Leslie, Ken E.; Schukken, Ynte H.; Sargeant, Jan M; Leo L Timms

    2003-01-01

    The purpose of this study was to evaluate the usefulness of the California mastitis test (CMT) to detect an intramammary infection caused by a major mastitis pathogen in early lactation cows. The gold standard used for comparison was bacteriological culture of single milk samples. The sensitivity (82.4%) and specificity (80.6%) of a positive CMT were highest on the 4th day of lactation.

  20. Detection of Fusarium wilt pathogens of Psidium guajava L. in soil using culture independent PCR (ciPCR)

    OpenAIRE

    Mishra, Rupesh K.; Pandey, Brajesh K.; Muthukumar, M.; Pathak, Neelam; Zeeshan, Mohammad

    2012-01-01

    Traditional culturing methods take a long time for identification of pathogenic isolates. A protocol has been developed for the detection of Fusarium from soil samples in the early stage of infection. Seventeen soil samples from different locations were collected before the onset of rains to find out the presence of Fusarium spp. population present in the soil of guava orchards and to correlate its presence with incidence of wilt. A PCR based method was developed for the molecular characteriz...

  1. Sonication cultures of explanted components as an add-on test to routinely conducted microbiological diagnostics improve pathogen detection.

    Science.gov (United States)

    Holinka, Johannes; Bauer, Leonhard; Hirschl, Alexander M; Graninger, Wolfgang; Windhager, Reinhard; Presterl, Elisabeth

    2011-04-01

    The purpose of this study was to improve the pathogen detection in prosthetic joint infections, particularly to evaluate the feasibility of the sonication culture method in the clinical routine. Explanted components of all patients with presumptive prosthetic or implant infection were sonicated separately in sterile containers to dislodge the adherent bacteria from the surfaces and cultured. The results of sonication culture were compared to the conventional tissue culture. We investigated 60 consecutive patients with loosening of the prostheses or implants Forty patients had septic and 20 aseptic loosening (24 knee prostheses, 21 hip prostheses, 6 mega-prostheses, 2 shoulder prostheses, 6 osteosynthesis, 1 spinal instrumentation). The sensitivity of sonication fluid culture was 83.3%, of single positive tissue culture was 72.2% and 61.1% when two or more cultures yielded the same microorganism. In patients receiving antibiotic therapy the sensitivity was 65.9%, 57.5%, and 42.5%, respectively. Pathogens detected in a single tissue culture as well as in sonication culture yielded a significantly higher rate of prosthetic infection than conventional tissue culture alone (p = 0.008), even in patients receiving continuous antibiotic therapy before explantation (p = 0.016). The sonication method represents an essential add-on in pathogen detection compared to conventional tissue culture. PMID:21337398

  2. Direct detection and differentiation of pathogenic Leptospira species using a multi-gene targeted real time PCR approach.

    Science.gov (United States)

    Ferreira, Ana Sofia; Costa, Pedro; Rocha, Teresa; Amaro, Ana; Vieira, Maria Luísa; Ahmed, Ahmed; Thompson, Gertrude; Hartskeerl, Rudy A; Inácio, João

    2014-01-01

    Leptospirosis is a growing public and veterinary health concern caused by pathogenic species of Leptospira. Rapid and reliable laboratory tests for the direct detection of leptospiral infections in animals are in high demand not only to improve diagnosis but also for understanding the epidemiology of the disease. In this work we describe a novel and simple TaqMan-based multi-gene targeted real-time PCR approach able to detect and differentiate Leptospira interrogans, L. kirschneri, L. borgpeteresenii and L. noguchii, which constitute the veterinary most relevant pathogenic species of Leptospira. The method uses sets of species-specific probes, and respective flanking primers, designed from ompL1 and secY gene sequences. To monitor the presence of inhibitors, a duplex amplification assay targeting both the mammal β-actin and the leptospiral lipL32 genes was implemented. The analytical sensitivity of all primer and probe sets was estimated to be Dolichotis patagonum and Sus domesticus). Two samples were infected with L. borgpetersenii, two with L. interrogans and one with L. kirschneri. The possibility to detect and identify these pathogenic agents to the species level in domestic and wildlife animals reinforces the diagnostic information and will enhance our understanding of the epidemiology of leptopirosis. PMID:25398140

  3. A Comparison of In-House Real-Time LAMP Assays with a Commercial Assay for the Detection of Pathogenic Bacteria

    OpenAIRE

    Deguo Wang; Yongzhen Wang; Fugang Xiao; Weiyun Guo; Yongqing Zhang; Aiping Wang; Yanhong Liu

    2015-01-01

    Molecular detection of bacterial pathogens based on LAMP methods is a faster and simpler approach than conventional culture methods. Although different LAMP-based methods for pathogenic bacterial detection are available, a systematic comparison of these different LAMP assays has not been performed. In this paper, we compared 12 in-house real-time LAMP assays with a commercialized kit (Isothermal Master Mix) for the detection of Listeria monocytogenes, Salmonella spp, Staphylococcus aureus, E...

  4. Development and application of an eDNA method to detect and quantify a pathogenic parasite in aquatic ecosystems.

    Science.gov (United States)

    Huver, J R; Koprivnikar, J; Johnson, P T J; Whyard, S

    2015-06-01

    Approaches based on organismal DNA found in the environment (eDNA) have become increasingly utilized for ecological studies and biodiversity inventories as an alternative to traditional field survey methods. Such DNA-based techniques have largely been used to establish the presence of free-living organisms, but have much potential for detecting and quantifying infectious agents in the environment, which is necessary to evaluate disease risk. We developed an eDNA method to examine the distribution and abundance of the trematode Ribeiroia ondatrae, a pathogenic parasite known to cause malformations in North American amphibians. In addition to comparing this eDNA approach to classical host necropsy, we examined the detectability of R. ondatrae in water samples subject to different degradation conditions (time and temperature). Our test exhibited high specificity and sensitivity to R. ondatrae, capable of detecting as little as 14 fg (femtograms) of this parasite's DNA (1/2500th of a single infectious stage) from field water samples. Compared to our results from amphibian host necropsy, quantitative PCR was -90% concordant with respect to R. ondatrae detection from 15 field sites and was also a significant predictor of host infection abundance. DNA was still detectable in lab samples after 21 days at 25°C, indicating that our method is robust to field conditions. By comparing the advantages and disadvantages of eDNA vs. traditional survey methods for determining pathogen presence and abundance in the field, we found that the lower cost and effort associated with eDNA approaches provide many advantages. The development of alternative tools is critical for disease ecology, as wildlife management and conservation efforts require reliable establishment and monitoring of pathogens. PMID:26380540

  5. A reliable and inexpensive method of nucleic acid extraction for the PCR-based detection of diverse plant pathogens.

    Science.gov (United States)

    Li, R; Mock, R; Huang, Q; Abad, J; Hartung, J; Kinard, G

    2008-12-01

    A reliable extraction method is described for the preparation of total nucleic acids from at least ten plant genera for subsequent detection of plant pathogens by PCR-based techniques. The method combined a modified CTAB (cetyltrimethylammonium bromide) extraction protocol with a semi-automatic homogenizer (FastPrep) instrument) for rapid sample processing and low potential of cross contamination. The method was applied to sample preparation for PCR-based detection of 28 different RNA and DNA viruses, six viroids, two phytoplasmas and two bacterial pathogens from a range of infected host plants including sweet potato, small fruits and fruit trees. The procedure is cost-effective and the qualities of the nucleic acid preparations are comparable to those prepared by commonly used commercial kits. The efficiency of the procedure permits processing of numerous samples and the use of a single nucleic acid preparation for testing both RNA and DNA genomes by PCR, making this an appealing method for testing multiple pathogens in certification and quarantine programs.

  6. The development and application of the two real-time RT-PCR assays to detect the pathogen of HFMD.

    Directory of Open Access Journals (Sweden)

    Aili Cui

    Full Text Available Large-scale Hand, Foot, and Mouth Disease (HFMD outbreaks have frequently occurred in China since 2008, affecting more than one million children and causing several hundred children deaths every year. The pathogens of HFMD are mainly human enteroviruses (HEVs. Among them, human enterovirus 71 (HEV71 and coxsackievirus A16 (CVA16 are the most common pathogens of HFMD. However, other HEVs could also cause HFMD. To rapidly detect HEV71 and CVA16, and ensure detection of all HEVs causing HFMD, two real-time hybridization probe-based RT-PCR assays were developed in this study. One is a multiplex real-time RT-PCR assay, which was developed to detect and differentiate HEV71 specifically from CVA16 directly from clinical specimens within 1-2 h, and the other is a broad-spectrum real-time RT-PCR assay, which targeted almost all HEVs. The experiments confirmed that the two assays have high sensitivity and specificity, and the sensitivity was up to 0.1 TCID50/ml for detection of HEVs, HEV71, and CVA16, respectively. A total of 213 clinical specimens were simultaneously detected by three kinds of assays, including the two real-time RT-PCR assays, direct conventional RT-PCR assay, and virus isolation assay on human rhabdomyosarcoma cells (RD cells. The total positive rate of both HEV71 and CVA16 was 69.48% with real-time RT-PCR assay, 47.42% with RT-PCR assay, and 34.58% with virus isolation assay. One HFMD clinical specimen was positive for HEV, but negative for HEV71 or CVA16, which was identified as Echovirus 11 (Echo11 by virus isolation, RT-PCR, and sequencing for the VP1 gene. The two real-time RT-PCR assays had been applied in 31 provincial HFMD labs to detect the pathogens of HFMD, which has contributed to the rapid identification of the pathogens in the early stages of HFMD outbreaks, and helped to clarify the etiologic agents of HFMD in China.

  7. Efficient detection of pathogen virus in sand dabs,Paralichthys olivaceus using loop-mediated isothermal amplification (LAMP)

    Institute of Scientific and Technical Information of China (English)

    HWANG Jinik; PARK So Yun; SUH Sung-Suk; PARK Mirye; LEE Sukchan; LEE Taek-Kyun

    2016-01-01

    Viral hemorrhagic septicemia virus (VHSV) and marine birnavirus (MABV) are the causative pathogens for some of the most explosive epidemics of emerging viral diseases in many Asian countries, leading to huge economic losses in aquaculture. Rapid molecular detection for surveillance or diagnosis has been a critical component in reducing the prevalence of pathogen infection. The loop-mediated isothermal amplification (LAMP) of DNA is currently one of the most commonly used molecular diagnostic tools, as it is simple, quick, and easy to amplify target DNA under isothermal conditions. In the present study, a novel and highly specific LAMP assay for the sensitive and rapid detection of VHSV and MABV infection in fish was developed. Using a set of synthesized primers matching a specific region of the genome, the efficiency and specificity of the LAMP assay were optimized in terms of the reaction temperature and DNA polymerase concentration, as they are the main determinants of the sensitivity and specificity of the LAMP assay. In particular, we demonstrated that our assay could be applied to efficient detection of VHSV and MABV infection in the wild fish,Paralichthys olivaceus. Our results demonstrate the simplicity and convenience of this method for the detection of viral infection in aquatic organisms.

  8. Detection of HPV and co-infecting pathogens in healthy Italian women by multiplex real-time PCR.

    Science.gov (United States)

    Camporiondo, Maria Pia; Farchi, Francesca; Ciccozzi, Massimo; Denaro, Aurelia; Gallone, Domenica; Maracchioni, Fabio; Favalli, Cartesio; Ciotti, Marco

    2016-01-01

    Several pathogens can be transmitted sexually and are an important cause of morbidity among sexually active women. The aim of the study was to detect the presence of human papillomavirus (HPV), Chlamydia trachomatis (CT), Neisseria gonorrhoeae (NG), Trichomonas vaginalis (TV), Mycoplasma hominis (MH), Mycoplasma genitalium (MG), Ureaplasma urealyticum (UU), and Ureaplasma parvum (UP) in a group of 309 healthy women enrolled at the San Camillo - Forlanini hospital of Rome by using two multiplex real-time PCR assays based on TOCE® technology. The women's ages ranged from 34 to 60 years, median 49 [IQR 45-54]. Of the 309 women tested, HPV DNA was detected in 77/309 (24.9%) patients. Of these, 44 (14.2%) harboured a single infection while 33 (10.7%) were infected by multiple genotypes. Prevalence of HPV infection was highest among females aged 40-50 years (15.2%). Of the other pathogens sought, CT, MG and NG were not detected while positive results were found for MH (12/309, 3.9%), TV (4/309, 1.3%), UP (89/309, 28.8%) and UU (14/309, 4.5%). Co-infections were as follows: 5 MH/HPV, 4 TV/HPV, 34 UP/HPV and 9 UU/HPV. In HPV-positive women, the probability of being infected by UP and UU was 2.5 (p=0.00045) and 6 fold higher (p=0.0016) than in HPV-negative women. The study supports the use of multiplex real-time PCR assays in a routine diagnostic setting. The high sensitivity and specificity of these assays along with the simultaneous detection of the most common sexually transmitted pathogens confers an advantage with respect to more obsolete methods reducing costs and time to diagnosis. PMID:27031891

  9. Development of real-time PCR array for simultaneous detection of eight human blood-borne viral pathogens.

    Directory of Open Access Journals (Sweden)

    Natalia Pripuzova

    Full Text Available BACKGROUND: Real-time PCR array for rapid detection of multiple viral pathogens should be highly useful in cases where the sample volume and the time of testing are limited, i.e. in the eligibility testing of tissue and organ donors. FINDINGS: We developed a real-time PCR array capable of simultaneously detecting eight human viral pathogens: human immunodeficiency virus types 1 and 2 (HIV-1 and -2, hepatitis B virus (HBV, hepatitis C virus (HCV, human T-cell leukemia virus-1 and -2 (HTLV-1 and -2, vaccinia virus (VACV and West Nile virus (WNV. One hundred twenty (120 primers were designed using a combination of bioinformatics approaches, and, after experimental testing, 24 primer sets targeting eight viral pathogens were selected to set up the array with SYBR Green chemistry. The specificity and sensitivity of the virus-specific primer sets selected for the array were evaluated using analytical panels with known amounts of viruses spiked into human plasma. The array detected: 10 genome equivalents (geq/ml of HIV-2 and HCV, 50 geq of HIV-1 (subtype B, HBV (genotype A and WNV. It detected 100-1,000 geq/ml of plasma of HIV-1 subtypes (A - G, group N and CRF (AE and AG isolates. Further evaluation with a panel consisting of 28 HIV-1 and HIV-2 clinical isolates revealed no cross-reactivity of HIV-1 or HIV-2 specific primers with another type of HIV. All 28 viral isolates were identified with specific primer sets targeting the most conserved genome areas. The PCR array correctly identified viral infections in a panel of 17 previously quantified clinical plasma samples positive for HIV-1, HCV or HBV at as low as several geq per PCR reaction. CONCLUSIONS: The viral array described here demonstrated adequate performance in the testing of donors' clinical samples. Further improvement in its sensitivity for the broad spectrum of HIV-1 subtypes is under development.

  10. Determining the 95% limit of detection for waterborne pathogen analyses from primary concentration to qPCR

    Science.gov (United States)

    Stokdyk, Joel P.; Firnstahl, Aaron; Spencer, Susan K.; Burch, Tucker R; Borchardt, Mark A.

    2016-01-01

    The limit of detection (LOD) for qPCR-based analyses is not consistently defined or determined in studies on waterborne pathogens. Moreover, the LODs reported often reflect the qPCR assay alone rather than the entire sample process. Our objective was to develop an approach to determine the 95% LOD (lowest concentration at which 95% of positive samples are detected) for the entire process of waterborne pathogen detection. We began by spiking the lowest concentration that was consistently positive at the qPCR step (based on its standard curve) into each procedural step working backwards (i.e., extraction, secondary concentration, primary concentration), which established a concentration that was detectable following losses of the pathogen from processing. Using the fraction of positive replicates (n = 10) at this concentration, we selected and analyzed a second, and then third, concentration. If the fraction of positive replicates equaled 1 or 0 for two concentrations, we selected another. We calculated the LOD using probit analysis. To demonstrate our approach we determined the 95% LOD for Salmonella enterica serovar Typhimurium, adenovirus 41, and vaccine-derived poliovirus Sabin 3, which were 11, 12, and 6 genomic copies (gc) per reaction (rxn), respectively (equivalent to 1.3, 1.5, and 4.0 gc L−1 assuming the 1500 L tap-water sample volume prescribed in EPA Method 1615). This approach limited the number of analyses required and was amenable to testing multiple genetic targets simultaneously (i.e., spiking a single sample with multiple microorganisms). An LOD determined this way can facilitate study design, guide the number of required technical replicates, aid method evaluation, and inform data interpretation.

  11. Simultaneous Detection of Four Human Pathogenic Microsporidian Species from Clinical Samples by Oligonucleotide Microarray

    OpenAIRE

    Wang, Zheng; Orlandi, Palmer A.; David A Stenger

    2005-01-01

    Microsporidian species have been rapidly emerging as human enteric pathogens in immunocompromised and immunocompetent individuals in recent years. Routine diagnostic techniques for microsporidia in clinical laboratories are laborious and insensitive and tend to underestimate their presence. In most instances, they are unable to differentiate species of spores due to their small sizes and similar morphologies. In this study, we report the development of another protozoan oligonucleotide microa...

  12. A Modified Quantum Dot-Based Dot Blot Assay for Rapid Detection of Fish Pathogen Vibrio anguillarum.

    Science.gov (United States)

    Zhang, Yang; Xiao, Jingfan; Wang, Qiyao; Zhang, Yuanxing

    2016-08-28

    Vibrio anguillarum, a devastating pathogen causing vibriosis among marine fish, is prevailing in worldwide fishery industries and accounts for grievous economic losses. Therefore, a rapid on-site detection and diagnostic technique for this pathogen is in urgent need. In this study, two mouse monoclonal antibodies (MAbs) against V. anguillarum, 6B3-C5 and 8G3-B5, were generated by using hybridoma technology and their isotypes were characterized. MAb 6B3-C5 was chosen as the detector antibody and conjugated with quantum dots. Based on MAb 6B3- C5 labeled with quantum dots, a modified dot blot assay was developed for the on-site determination of V. anguillarum. It was found that the method had no cross-reactivity with other than V. anguillarum bacteria. The detection limit (LOD) for V. anguillarum was 1 × 10(3) CFU/ml in cultured bacterial suspension samples, which was a 100-fold higher sensitivity than the reported colloidal gold immunochromatographic test strip. When V. anguillarum was mixed with turbot tissue homogenates, the LOD was 1 × 10(3) CFU/ml, suggesting that tissue homogenates did not influence the detection capabilities. Preenrichment with the tissue homogenates for 12 h could raise the LOD up to 1 × 10(2) CFU/ml, confirming the reliability of the method. PMID:27116991

  13. Cybersecurity for aerospace autonomous systems

    Science.gov (United States)

    Straub, Jeremy

    2015-05-01

    High profile breaches have occurred across numerous information systems. One area where attacks are particularly problematic is autonomous control systems. This paper considers the aerospace information system, focusing on elements that interact with autonomous control systems (e.g., onboard UAVs). It discusses the trust placed in the autonomous systems and supporting systems (e.g., navigational aids) and how this trust can be validated. Approaches to remotely detect the UAV compromise, without relying on the onboard software (on a potentially compromised system) as part of the process are discussed. How different levels of autonomy (task-based, goal-based, mission-based) impact this remote characterization is considered.

  14. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

    Directory of Open Access Journals (Sweden)

    J.A. Khan

    2013-09-01

    Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

  15. Efficacy of Direct Detection of Pathogens in Naturally Infected Mice by Using a High-Density PCR Array

    OpenAIRE

    Kenneth S Henderson; Perkins, Cheryl L; Havens, Richard B; Kelly, Mee-Jin E; Francis, Brian C; Dole, Vandana S.; Shek, William R.

    2013-01-01

    We used a high-density array of real-time PCR assays for commonly reported rodent infectious agents (PRIA) to test naturally infected index mice and sentinel mice exposed by contact and soiled-bedding transfer. PRIA detected 14 pathogens—including viruses, bacteria, fur mites, pinworms, and enteric protozoa—in 97.2% of 28 pooled fecal samples, fur–perianal swabs, and oral swabs from 4 cages containing a total of 10 index mice. Among these pathogens, PRIA (like conventional health monitoring m...

  16. Detection of pathogenic bacteria in skin lesions of patients with chiclero's ulcer: reluctant response to antimonial treatment

    Directory of Open Access Journals (Sweden)

    Isaac-Márquez Angélica Patricia

    2003-01-01

    Full Text Available We investigated the bacterial flora present in skin lesions of patients with chiclero's ulcer from the Yucatan peninsula of Mexico using conventional culture methods (11 patients, and an immunocolorimetric detection of pathogenic Streptococcus pyogenes (15 patients. Prevalence of bacteria isolated by culture methods was 90.9% (10/11. We cultured, from chiclero's ulcers (60%, pathogenic bacterial such as Staphylococcus aureus (20%, S. pyogenes (1.6%, Pseudomonas aeruginosa (1.6%, Morganella morganii (1.6%, and opportunist pathogenic bacteria such as Klebsiella spp. (20.0%, Enterobacter spp. (20%, and Enterococcus spp. (20%. We also cultured coagulase-negative staphylococci in 40% (4/10 of the remaining patients. Micrococcus spp. and coagulase-negative staphylococci constituted the bacterial genuses more frequently isolated in the normal skin of patients with chiclero's ulcer and healthy individuals used as controls. We also undertook another study to find out the presence of S. pyogenes by an immunocolorimetric assay. This study indicated that 60% (9/15 of the ulcerated lesions, but not normal controls, were contaminated with S. pyogenes. Importantly, individuals with purulent secretion and holding concomitant infections with S. pyogenes, S. aureus, P. aeruginosa, M. morganii, and E. durans took longer to heal Leishmania (L. mexicana infections treated with antimonial drugs. Our results suggest the need to eliminate bacterial purulent infections, by antibiotic treatment, before starting antimonial administration to patients with chiclero's ulcer.

  17. Detection of Pathogenic Escherichia coli and Staphylococcus aureus from Cattle and Pigs Slaughtered in Abattoirs in Vhembe District, South Africa

    Directory of Open Access Journals (Sweden)

    Nicoline F. Tanih

    2015-01-01

    Full Text Available Pathogenic food-borne bacteria have been associated with severe morbidity and mortality in humans and animals. This study was aimed at determining the prevalence of Staphylococcus aureus, Salmonella spp., and Escherichia coli present in cattle and pigs slaughtered in selected abattoirs in Vhembe District and at determining the susceptibility of the isolates to antibiotics. A total of 176 swab samples (28 cattle and 16 pigs of the rump, flank, brisket, and neck of the animals were analyzed using standard microbiological methods. E. coli isolates were genotyped to detect pathogenic strains. Of the 176 samples, 104 (67.5% were positive for E. coli and 50 (32.5% for S. aureus. There was no statistically significant difference (P>0.05 in the isolation rate from the different animal parts or abattoirs. Overall, 14/104 (13.46% of the E. coli isolates were pathogenic strains which included enteropathogenic E. coli (EPEC (bfpA 1.9%, enterotoxigenic E. coli (ETEC (LT 3.8%, and enteroaggregative E. coli (EAEC (aaiC 7.6%. E. coli isolates were resistant (100% to vancomycin and bacitracin. S. aureus (100% were resistant to oxacillin and nalidixic acid. The presence of resistant strains of these bacteria in food of animal origin could serve as important vehicles transmitting these bacteria to humans. This finding is of epidemiological significance.

  18. Low-fouling surface plasmon resonance biosensor for multi-step detection of foodborne bacterial pathogens in complex food samples.

    Science.gov (United States)

    Vaisocherová-Lísalová, Hana; Víšová, Ivana; Ermini, Maria Laura; Špringer, Tomáš; Song, Xue Chadtová; Mrázek, Jan; Lamačová, Josefína; Scott Lynn, N; Šedivák, Petr; Homola, Jiří

    2016-06-15

    Recent outbreaks of foodborne illnesses have shown that foodborne bacterial pathogens present a significant threat to public health, resulting in an increased need for technologies capable of fast and reliable screening of food commodities. The optimal method of pathogen detection in foods should: (i) be rapid, specific, and sensitive; (ii) require minimum sample preparation; and (iii) be robust and cost-effective, thus enabling use in the field. Here we report the use of a SPR biosensor based on ultra-low fouling and functionalizable poly(carboxybetaine acrylamide) (pCBAA) brushes for the rapid and sensitive detection of bacterial pathogens in crude food samples utilizing a three-step detection assay. We studied both the surface resistance to fouling and the functional capabilities of these brushes with respect to each step of the assay, namely: (I) incubation of the sensor with crude food samples, resulting in the capture of bacteria by antibodies immobilized to the pCBAA coating, (II) binding of secondary biotinylated antibody (Ab2) to previously captured bacteria, and (III) binding of streptavidin-coated gold nanoparticles to the biotinylated Ab2 in order to enhance the sensor response. We also investigated the effects of the brush thickness on the biorecognition capabilities of the gold-grafted functionalized pCBAA coatings. We demonstrate that pCBAA-compared to standard low-fouling OEG-based alkanethiolate self-assemabled monolayers-exhibits superior surface resistance regarding both fouling from complex food samples as well as the non-specific binding of S-AuNPs. We further demonstrate that a SPR biosensor based on a pCBAA brush with a thickness as low as 20 nm was capable of detecting E. coli O157:H7 and Salmonella sp. in complex hamburger and cucumber samples with extraordinary sensitivity and specificity. The limits of detection for the two bacteria in cucumber and hamburger extracts were determined to be 57 CFU/mL and 17 CFU/mL for E. coli and 7.4 × 10

  19. Detection of respiratory viral and bacterial pathogens causing pediatric community-acquired pneumonia in Beijing using real-time PCR

    Institute of Scientific and Technical Information of China (English)

    Tie-Gang Zhang; Ai-Hua Li; Min Lyu; Meng Chen; Fang Huang; Jiang Wu

    2015-01-01

    Objective: The aim of this study was to determine the etiology and prevalence of pediatric CAP in Beijing using a real-time polymerase chain reaction (PCR) technique. Methods: Between February 15, 2011 and January 18, 2012, 371 pediatric patients with CAP were enrolled at Beijing Children's Hospital. Sixteen respiratory viruses and two bacteria were detected from tracheal aspirate specimens using commercially available multiplex real-time reverse transcription PCR (RT-PCR) kits. Results: A single viral pathogen was detected in 35.3%of enrolled patients, multiple viruses in 11.6%, and virus/bacteria co-infection in 17.8%. In contrast, only 6.5%of patients had a single bacterial pathogen and 2.2%were infected with multiple bacteria. The etiological agent was unknown for 26.7% of patients. The most common viruses were respiratory syncytial virus (RSV) (43.9%), rhinovirus (14.8%), parainfluenza virus (9.4%), and adenovirus (8.6%). In patients under three years of age, RSV (44.6%), rhinovirus (12.8%), and Streptococcus pneumoniae (9.9%) were the most frequent pathogens. In children aged 3e7 years, S. pneumoniae (38.9%), RSV (30.6%), Haemophilus influenzae (19.4%), and adenovirus (19.4%) were most prevalent. Finally in children over seven years, RSV (47.3%), S. pneumoniae (41.9%), and rhinovirus (21.5%) infections were most frequent. Conclusions: Viral pathogens, specifically RSV, were responsible for the majority of CAP in pediatric patients. However, both S. pneumoniae and H. influenzae contributed as major causes of disease. Commercially available multiplexing real-time PCR allowed for rapid detection of the etiological agent. Copyright © 2015, Chinese Medical Association Production. Production and hosting by Elsevier B.V. on behalf of KeAi Communications Co., Ltd. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

  20. Sampling and Homogenization Strategies Significantly Influence the Detection of Foodborne Pathogens in Meat

    Directory of Open Access Journals (Sweden)

    Alexander Rohde

    2015-01-01

    Full Text Available Efficient preparation of food samples, comprising sampling and homogenization, for microbiological testing is an essential, yet largely neglected, component of foodstuff control. Salmonella enterica spiked chicken breasts were used as a surface contamination model whereas salami and meat paste acted as models of inner-matrix contamination. A systematic comparison of different homogenization approaches, namely, stomaching, sonication, and milling by FastPrep-24 or SpeedMill, revealed that for surface contamination a broad range of sample pretreatment steps is applicable and loss of culturability due to the homogenization procedure is marginal. In contrast, for inner-matrix contamination long treatments up to 8 min are required and only FastPrep-24 as a large-volume milling device produced consistently good recovery rates. In addition, sampling of different regions of the spiked sausages showed that pathogens are not necessarily homogenously distributed throughout the entire matrix. Instead, in meat paste the core region contained considerably more pathogens compared to the rim, whereas in the salamis the distribution was more even with an increased concentration within the intermediate region of the sausages. Our results indicate that sampling and homogenization as integral parts of food microbiology and monitoring deserve more attention to further improve food safety.

  1. Detection, Identification, and Prevalence of Pathogenic Vibrio parahaemolyticus in Fish and Coastal Environment in Jordan.

    Science.gov (United States)

    Alaboudi, Akram R; Ababneh, Mustafa; Osaili, Tareq M; Al Shloul, Khalaf

    2016-01-01

    Vibrio parahaemolyticus is widely distributed in the marine environments and considered the leading cause of human gastroenteritis in Asian countries. A total of 150 marketed fish and 50 water and sediment samples from the Gulf of Aqaba were examined for the prevalence of pathogenic strains of V. parahaemolyticus. A total of 132 typical isolates obtained from the primary selective medium (thiosulfate-citrate bile salt sucrose agar) and showed positive biochemical properties were subjected to confirmation by polymerase chain reaction targeting the gyrB and toxR genes. These genes were confirmed at rates of 82% (108 isolates) and 72% (95 isolates), respectively. The toxR positive isolates were tested for the presence of thermolabile hemolysin (tlh), thermostable direct hemolysin (tdh), and tdh-related hemolysin (trh) virulence genes. Accordingly, the prevalence rates of pathogenic V. parahaemolyticus were 4%, 8%, and 12% in sediment, water, and fish samples, respectively. The 16S rRNA amplification and sequences were conducted for confirmation of the isolates and showing the relatedness among these isolates. The results showed that both 16S rRNA and toxR assays had same sensitivity and tested isolates had high nucleotide similarity irrespective of their sources.

  2. Interferometric biosensing platform for multiplexed digital detection of viral pathogens and biomarkers

    Science.gov (United States)

    Daaboul, George

    Label-free optical biosensors have been established as proven tools for monitoring specific biomolecular interactions. However, compact and robust embodiments of such instruments have yet to be introduced in order to provide sensitive, quantitative, and high-throughput biosensing for low-cost research and clinical applications. Here we present the interferometric reflectance-imaging sensor (IRIS). IRIS allows sensitive label free analysis using an inexpensive and durable multi-color LED illumination source on a silicon based surface. IRIS monitors biomolecular interaction through measurement of biomass addition to the sensor's surface. We demonstrate the capability of this system to dynamically monitor antigen---antibody interactions with a noise floor of 5.2 pg/mm 2 and DNA single mismatch detection under isothermal melting conditions in an array format. Ensemble detection of binding events using IRIS did not provide the sensitivity needed for detection of infectious disease and biomarkers at clinically relevant concentrations. Therefore, a new approach was adapted to the IRIS platform that allowed the detection and identification of individual nanoparticles on the sensor's surface. The new detection method was termed single-particle IRIS (SP-IRIS). We developed two detection modalities for SP-IRIS. The first modality is when the target is a nanoparticle such as a virus. We verified that SP-IRIS can accurately detect and size individual viral particles. Then we demonstrated that single nanoparticle counting and sizing methodology on SP-IRIS leads to a specific and sensitive virus sensor that can be multiplexed. Finally, we developed an assay for the detection of Ebola and Marburg. A detection limit of 3 x 103 PFU/ml was demonstrated for vesicular stomatitis virus (VSV) pseudotyped with Ebola or Marburg virus glycoprotein. We have demonstrated that virus detection can be done in human whole blood directly without the need for sample preparation. The second modality

  3. Cationic polyelectrolyte functionalized magnetic particles assisted highly sensitive pathogens detection in combination with polymerase chain reaction and capillary electrophoresis.

    Science.gov (United States)

    Chen, Jia; Lin, Yuexin; Wang, Yu; Jia, Li

    2015-06-01

    Pathogenic bacteria cause significant morbidity and mortality to humans. There is a pressing need to establish a simple and reliable method to detect them. Herein, we show that magnetic particles (MPs) can be functionalized by poly(diallyl dimethylammonium chloride) (PDDA), and the particles (PDDA-MPs) can be utilized as adsorbents for capture of pathogenic bacteria from aqueous solution based on electrostatic interaction. The as-prepared PDDA-MPs were characterized by Fourier-transform infrared spectroscopy, zeta potential, vibrating sample magnetometry, X-ray diffraction spectrometry, scanning electron microscopy, and transmission electron microscopy. The adsorption equilibrium time can be achieved in 3min. According to the Langmuir adsorption isotherm, the maximum adsorption capacities for E. coli O157:H7 (Gram-negative bacteria) and L. monocytogenes (Gram-positive bacteria) were calculated to be 1.8×10(9) and 3.1×10(9)cfumg(-1), respectively. The bacteria in spiked mineral water (1000mL) can be completely captured when applying 50mg of PDDA-MPs and an adsorption time of 5min. In addition, PDDA-MPs-based magnetic separation method in combination with polymerase chain reaction and capillary electrophoresis allows for rapid detection of 10(1)cfumL(-1) bacteria.

  4. Segmented continuous-flow multiplex polymerase chain reaction microfluidics for high-throughput and rapid foodborne pathogen detection.

    Science.gov (United States)

    Shu, Bowen; Zhang, Chunsun; Xing, Da

    2014-05-15

    High-throughput and rapid identification of multiple foodborne bacterial pathogens is vital in global public health and food industry. To fulfill this need, we propose a segmented continuous-flow multiplex polymerase chain reaction (SCF-MPCR) on a spiral-channel microfluidic device. The device consists of a disposable polytetrafluoroethylene (PTFE) capillary microchannel coiled on three isothermal blocks. Within the channel, n segmented flow regimes are sequentially generated, and m-plex PCR is individually performed in each regime when each mixture is driven to pass three temperature zones, thus providing a rapid analysis throughput of m×n. To characterize the performance of the microfluidic device, continuous-flow multiplex PCR in a single segmented flow has been evaluated by investigating the effect of key reaction parameters, including annealing temperatures, flow rates, polymerase concentration and amount of input DNA. With the optimized parameters, the genomic DNAs from Salmonella enterica, Listeria monocytogenes, Escherichia coli O157:H7 and Staphylococcus aureus could be amplified simultaneously in 19min, and the limit of detection was low, down to 10(2) copiesμL(-1). As proof of principle, the spiral-channel SCF-MPCR was applied to sequentially amplify four different bacterial pathogens from banana, milk, and sausage, displaying a throughput of 4×3 with no detectable cross-contamination.

  5. Loop-mediated isothermal amplification (LAMP) assays for detection and identification of aquaculture pathogens: current state and perspectives.

    Science.gov (United States)

    Biswas, Gouranga; Sakai, Masahiro

    2014-04-01

    Since its invention in 2000, loop-mediated isothermal amplification (LAMP) assay has been one of the most extensively used molecular diagnostic tools in bio-medical fields due to the rapidity, accuracy, and cost-effectiveness of the technique. This technique has also earned popularity in aquaculture disease diagnosis. Aquaculture, as a result of its rapid intensification and expansion, experiences increased infectious disease occurrences. For maintenance of economic viability, rapid, sensitive and efficient diagnosis of disease causing agents is an important step prior to undertaking effective prevention and control measures in aquaculture. Constraints on time and expertise required for conventional biochemical, serological and polymerase chain reaction (PCR)-based techniques offer avenues in adoption of the LAMP by the aquaculturists at field conditions. This assay has been successfully applied in detection of several bacterial, viral and parasitic pathogens causing serious diseases in aquaculture. In this review, we endeavored to accommodate the LAMP methodology with its different recent improvements and an overview of its application for the detection of aquaculture-associated pathogens.

  6. Cis phosphorylated tau as the earliest detectable pathogenic conformation in Alzheimer disease, offering novel diagnostic and therapeutic strategies.

    Science.gov (United States)

    Nakamura, Kazuhiro; Zhen Zhou, Xiao; Ping Lu, Kun

    2013-01-01

    After protein phosphorylation on certain serine or threonine residues preceding a proline (pSer/Thr-Pro), the function of certain phosphorylated protein is further regulated by cis-trans conformational change. Due to the lack of any tool to detect such two conformations in cells, however, it is not even known whether any cis or trans conformation exists in vivo, not to mention their conformation-specific functions or regulation. We developed a novel peptide chemistry technology to generate the first pair of antibodies that can distinguish cis from trans pThr231-Pro tau. Cis, but not trans, pThr231-tau appears early in mild cognitive impairment (MCI) neurons and further accumulates in only degenerating neurons as Alzheimer disease (AD) progresses, localizing to dystrophic neurites, which are known to correlate well with memory loss. Unlike trans p-tau, the cis cannot promote microtubule assembly, and is more resistant to dephosphorylation and degradation and more prone to aggregation. Pin1 accelerates cis to trans isomerization to prevent tau pathology in AD. Thus, during MCI and AD development, cis pThr231-Pro tau is the earliest detectable pathogenic tau conformation and antibodies and vaccines against the pathogenic cis p-tau may be used for the early diagnosis and treatment of AD. These findings offer in vivo approach to study conformational regulation of Pro-directed phosphorylation signaling.

  7. Detection of food-borne pathogens by nanoparticle technology coupled to a low-cost cell reader

    Science.gov (United States)

    Noiseux, Isabelle; Bouchard, Jean-Pierre; Gallant, Pascal; Bourqui, Pascal; Cao, Honghe; Vernon, Marci; Johnson, Roger; Chen, Shu; Mermut, Ozzy

    2010-02-01

    The detection, identification and quantification of pathogenic microorganisms at low cost are of great interest to the agro-food industry. We have developed a simple, rapid, sensitive, and specific method for detection of food-borne pathogens based on use of nanoparticles alongside a low cost fluorescence cell reader for the bioassay. The nanoparticles are coupled with antibodies that allow specific recognition of the targeted Listeria in either a liquid or food matrix. The bioconjugated nanoparticles (FNP) contain thousands of dye molecules enabling significant amplification of the fluorescent signal emitted from each bacterium. The developed fluorescence Cell Reader is an LED-based reader coupled with suitable optics and a camera that acquires high resolution images. The dedicated algorithm allowed the counting of each individual nanoparticles-fluorescent bacterial cells thus enabling highly sensitive reading. The system allows, within 1 hour, the recovery and counting of 104 to 108 cfu/mL of Listeria in pure culture. However, neither the Cell Reader nor the algorithm can differentiate between the FNPs specifically-bound to the target and the residual unbound FNPs limiting sensitivity of the system. Since FNPs are too small to be washed in the bioassay, a dual tagging approach was implemented to allow online optical separation of the fluorescent background caused by free FNPs.

  8. Oxidative stress and pathogenic attack in plants, studied by laser based photoacoustic trace gas detection

    NARCIS (Netherlands)

    Santosa, Ignatius Edi

    2002-01-01

    Photoacoustic detection has proven to be a sensitive method, which is suitable for trace gas measurement. In this thesis, we improved the photoacoustic detection system to measure new biologically interesting gases, ethane (C2H6) and nitric oxide (NO). A new design of grating holder is incorporated

  9. First detection of the larval chalkbrood disease pathogen Ascosphaera apis (Ascomycota: Eurotiomycetes: Ascosphaerales in adult bumble bees.

    Directory of Open Access Journals (Sweden)

    Sarah A Maxfield-Taylor

    Full Text Available Fungi in the genus Ascosphaera (Ascomycota: Eurotiomycetes: Ascosphaerales cause chalkbrood disease in larvae of bees. Here, we report the first-ever detection of the fungus in adult bumble bees that were raised in captivity for studies on colony development. Wild queens of Bombus griseocollis, B. nevadensis and B. vosnesenskii were collected and maintained for establishment of nests. Queens that died during rearing or that did not lay eggs within one month of capture were dissected, and tissues were examined microscopically for the presence of pathogens. Filamentous fungi that were detected were plated on artificial media containing broad spectrum antibiotics for isolation and identification. Based on morphological characters, the fungus was identified as Ascosphaera apis (Maasen ex Claussen Olive and Spiltoir, a species that has been reported earlier only from larvae of the European honey bee, Apis mellifera, the Asian honey bee, Apis cerana, and the carpenter bee Xylocopa californica arizonensis. The identity of the fungus was confirmed using molecular markers and phylogenetic analysis. Ascosphaera apis was detected in queens of all three bumble bee species examined. Of 150 queens dissected, 12 (8% contained vegetative and reproductive stages of the fungus. Both fungal stages were also detected in two workers collected from colonies with Ascosphaera-infected B. nevadensis queens. In this study, wild bees could have been infected prior to capture for rearing, or, the A. apis infection could have originated via contaminated European honey bee pollen fed to the bumble bees in captivity. Thus, the discovery of A. apis in adult bumble bees in the current study has important implications for commercial production of bumble bee colonies and highlights potential risks to native bees via pathogen spillover from infected bees and infected pollen.

  10. Autonomous Search

    CERN Document Server

    Hamadi, Youssef; Saubion, Frédéric

    2012-01-01

    Decades of innovations in combinatorial problem solving have produced better and more complex algorithms. These new methods are better since they can solve larger problems and address new application domains. They are also more complex which means that they are hard to reproduce and often harder to fine-tune to the peculiarities of a given problem. This last point has created a paradox where efficient tools are out of reach of practitioners. Autonomous search (AS) represents a new research field defined to precisely address the above challenge. Its major strength and originality consist in the

  11. Recovery Based Nanowire Field-Effect Transistor Detection of Pathogenic Avian Influenza DNA

    Science.gov (United States)

    Lin, Chih-Heng; Chu, Chia-Jung; Teng, Kang-Ning; Su, Yi-Jr; Chen, Chii-Dong; Tsai, Li-Chu; Yang, Yuh-Shyong

    2012-02-01

    Fast and accurate diagnosis is critical in infectious disease surveillance and management. We proposed a DNA recovery system that can easily be adapted to DNA chip or DNA biosensor for fast identification and confirmation of target DNA. This method was based on the re-hybridization of DNA target with a recovery DNA to free the DNA probe. Functionalized silicon nanowire field-effect transistor (SiNW FET) was demonstrated to monitor such specific DNA-DNA interaction using high pathogenic strain virus hemagglutinin 1 (H1) DNA of avian influenza (AI) as target. Specific electric changes were observed in real-time for AI virus DNA sensing and device recovery when nanowire surface of SiNW FET was modified with complementary captured DNA probe. The recovery based SiNW FET biosensor can be further developed for fast identification and further confirmation of a variety of influenza virus strains and other infectious diseases.

  12. Time-resolvable fluorescent conjugates for the detection of pathogens in environmental samples containing autofluorescent material

    Science.gov (United States)

    Connally, Russell; Veal, Duncan; Piper, James A.

    2003-07-01

    Water is routinely monitored for environmental pathogens such a Cryptosporidium and Giardia using immunofluorescence microscopy (IFM). Autofluorescence can greatly diminish an operators capacity to resolve labeled pathogens from non-specific background. Naturally fluorescing components (autofluorophores) encountered in biological samples typically have fluorescent lifetimes (τ) of less than 100 nanoseconds and their emissions may be excluded through use of time-resolved fluorescence microscopy (TRFM). TRFM relies on the large differences in τ between autofluorescent molecules and long-lived lanthanide chelates. In TRFM, targets labeled with a time-resolvable fluorescent immunoconjugate are excited by an intense (UV) light pulse. A short delay is imposed to permit the decay of autofluorescence before capture of luminescence from the excited chelate using an image intensified CCD camera. In our experience, autofluorescence can be reduced to insignificant levels with a consequent 30-fold increase in target visibility using TRFM techniques. We report conjugation of a novel europium chelate to a monoclonal antibody specific for Giardia lamblia and use of the immunoconjugate for TRFM studies. Initial attempts to conjugate the same chelate to a monoclonal antibody directed against Cryptosporidium parvum led to poorly fluorescent constructs that were prone to denature and precipitate. We successfully conjugated BHHCT to anti-mouse polyvalent immunoglobulin and used this construct to overcome the difficulties in direct labeling of the anti-Cryptosporidium antibody. Both Giardia and Cryptosporidium were labeled using the anti-mouse protocol with a subsequent 20-fold and 6.6-fold suppression of autofluorescence respectively. A rapid protocol for conjugating and purifying the immunoconjugate was found and methods of quantifying the fluorescence to protein ratio determined. Performance of our TRFM was dependent on the quality and brightness of the immunoconjugate and

  13. Fluorescence In Situ Hybridization for the Tissue Detection of Bacterial Pathogens Associated with Porcine Infections

    DEFF Research Database (Denmark)

    Elvang Jensen, Henrik; Jensen, Louise Kruse; Barington, Kristiane;

    2015-01-01

    Fluorescence in situ hybridization (FISH) is an efficient technique for the identification of specific bacteria in tissue of both experimental and spontaneous infections. The method detects specific sequences of nucleic acids by hybridization of fluorescently labeled probes to complementary targe...

  14. [Detection of viral infection pathogens in medicinal plants grown in Ukraine].

    Science.gov (United States)

    Mishchenko, L T; Korenieva, A A; Molchanets', O V; Boĭko, A L

    2009-01-01

    Monitoring of viral infection on medicinal plant plantations is carried out. Panax ginseng C.A. Meyer, Valeriana officinalis L., Plantago major L. with symptoms of viral infection were revealed. Viral nature of symptoms was proved with biotesting method. Morphology and sizes of virus particles, detected in Panax ginseng method. Morphology and sizes of virus particles, detected in Panax ginseng C.A. Meyer, Valeriana officinalis L., Plantago major L., were determined with electron microscopy method. The paper is presented in Ukrainian.

  15. Molecular techniques for pathogen identification and fungus detection in the environment

    OpenAIRE

    Tsui, C.K.M.; Woodhall, J.; Chen, W.; Lévesque, C.A.; Lau, A; Schoen, C.D.; Baschien, C.; Najafzadeh, M.J.; Hoog, de, G.S.

    2011-01-01

    Many species of fungi can cause disease in plants, animals and humans. Accurate and robust detection and quantification of fungi is essential for diagnosis, modeling and surveillance. Also direct detection of fungi enables a deeper understanding of natural microbial communities, particularly as a great many fungi are difficult or impossible to cultivate. In the last decade, effective amplification platforms, probe development and various quantitative PCR technologies have revolutionized resea...

  16. Studies on learning by detecting impasse and by resulting it for building large scale knowledge base for autonomous plant

    International Nuclear Information System (INIS)

    The acquisition of knowledge from human experts in an exhaustive way is extremely difficult, and even if it were possible, the maintenance of such a large knowledge base for realtime operation is not an easy task. The autonomous system having just incomplete knowledge would face with so many problems that contradicts with the system's current beliefs and/or are novel or unknown to the system. Experienced humans can manage to do with such novelty due to their generalizing ability and analogical inference based on the repertoire of precedents, even if they with new problems. Moreover, through experiencing such breakdowns and impasse, they can acquire some novel knowledge by their proactive attempts to interpret a provided problem as well as by updating their beliefs and contents and organization of their prior knowledge. We call such a style of learning as impasse-driven learning, meaning that learning dose occur being motivated by facing with contradiction and impasse. The related studies concerning with such a style of leaning have been studied within a field of machine learning of artificial intelligence so far as well as within a cognitive science field. In this paper, we at first summarize an outline of machine learning methodologies, and then, we detail about the impasse-driven learning. We discuss that from two different perspective of learning, one is from deductive and analogical learning and the other one is from inductive conceptual learning (i.e., concept formation or generalization-based memory). The former mainly discuss about how the learning system updates its prior beliefs and knowledge so that it can explain away the current contradiction using some meta-cognition heuristics. The latter attempts to assimilate a contradicting problem into its prior memory structure by dynamically reorganizing a collection of the precedents. We present those methodologies, and finally we introduce a case study of concept formation for plant anomalies and its usage for

  17. A novel electrochemical aptasensor for highly sensitive detection of thrombin based on the autonomous assembly of hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme nanowires

    International Nuclear Information System (INIS)

    Highlights: • This assay is label-free, the signal can be read out by measuring the electrochemical signal of hemin. • The hemin/G-quadruplex HRP-DNAzyme nanowires were formed via EXPAR reaction and HCR. • The prepared aptasensor exhibited low detection limit and wide linear range to TB. - Abstract: In this work, a new signal amplified strategy was constructed based on isothermal exponential amplification reaction (EXPAR) and hybridization chain reaction (HCR) generating the hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme (HRP-mimicking DNAzyme) nanowires as signal output component for the sensitive detection of thrombin (TB). We employed EXPAR’s ultra-high amplification efficiency to produce a large amount of two hairpin helper DNAs within a minutes. And then the resultant two hairpin helper DNAs could autonomously assemble the hemin/G-quadruplex HRP-mimicking DNAzymes nanowires as the redox-active reporter units on the electrode surface via hybridization chain reaction (HCR). The hemin/G-quadruplex structures simultaneously served as electron transfer medium and electrocatalyst to amplify the signal in the presence of H2O2. Specifically, only when the EXPAR reaction process has occurred, the HCR could be achieved and the hemin/G-quadruplex complexes could be formed on the surface of an electrode to give a detectable signal. The proposed strategy combines the amplification power of the EXPAR, HCR, and the inherent high sensitivity of the electrochemical detection. With such design, the proposed assay showed a good linear relationship within the range of 0.1 pM–50 nM with a detection limit of 33 fM (defined as S/N = 3) for TB

  18. A novel electrochemical aptasensor for highly sensitive detection of thrombin based on the autonomous assembly of hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme nanowires

    Energy Technology Data Exchange (ETDEWEB)

    Xie, Shunbi, E-mail: xieshunbi@163.com; Chai, Yaqin, E-mail: yaqinchai@swu.edu.cn; Yuan, Yali; Bai, Lijuan; Yuan, Ruo, E-mail: yuanruo@swu.edu.cn

    2014-06-01

    Highlights: • This assay is label-free, the signal can be read out by measuring the electrochemical signal of hemin. • The hemin/G-quadruplex HRP-DNAzyme nanowires were formed via EXPAR reaction and HCR. • The prepared aptasensor exhibited low detection limit and wide linear range to TB. - Abstract: In this work, a new signal amplified strategy was constructed based on isothermal exponential amplification reaction (EXPAR) and hybridization chain reaction (HCR) generating the hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme (HRP-mimicking DNAzyme) nanowires as signal output component for the sensitive detection of thrombin (TB). We employed EXPAR’s ultra-high amplification efficiency to produce a large amount of two hairpin helper DNAs within a minutes. And then the resultant two hairpin helper DNAs could autonomously assemble the hemin/G-quadruplex HRP-mimicking DNAzymes nanowires as the redox-active reporter units on the electrode surface via hybridization chain reaction (HCR). The hemin/G-quadruplex structures simultaneously served as electron transfer medium and electrocatalyst to amplify the signal in the presence of H{sub 2}O{sub 2}. Specifically, only when the EXPAR reaction process has occurred, the HCR could be achieved and the hemin/G-quadruplex complexes could be formed on the surface of an electrode to give a detectable signal. The proposed strategy combines the amplification power of the EXPAR, HCR, and the inherent high sensitivity of the electrochemical detection. With such design, the proposed assay showed a good linear relationship within the range of 0.1 pM–50 nM with a detection limit of 33 fM (defined as S/N = 3) for TB.

  19. Detection and typing of highly pathogenic porcine reproductive and respiratory syndrome virus by multiplex real-time rt-PCR.

    Directory of Open Access Journals (Sweden)

    Kerstin Wernike

    Full Text Available Porcine reproductive and respiratory syndrome (PRRS causes economic losses in the pig industry worldwide, and PRRS viruses (PRRSV are classified into the two distinct genotypes "North American (NA, type 2" and "European (EU, type 1". In 2006, a highly pathogenic NA strain of PRRSV (HP-PRRSV, characterized by high fever as well as high morbidity and mortality, emerged in swine farms in China. Therefore, a real-time reverse transcription polymerase chain reaction (RT-qPCR assay specific for HP-PRRSV was developed and combined with type 1- and type 2-specific RT-qPCR systems. Furthermore, an internal control, based on a heterologous RNA, was successfully introduced. This final multiplex PRRSV RT-qPCR, detecting and typing PRRSV, had an analytical sensitivity of less than 200 copies per µl for the type 1-assay and 20 copies per µl for the type 2- and HP assays and a high diagnostic sensitivity. A panel of reference strains and field isolates was reliably detected and samples from an animal trial with a Chinese HP-PRRS strain were used for test validation. The new multiplex PRRSV RT-qPCR system allows for the first time the highly sensitive detection and rapid differentiation of PRRSV of both genotypes as well as the direct detection of HP-PRRSV.

  20. Use of sensitive, broad-spectrum molecular assays and human airway epithelium cultures for detection of respiratory pathogens.

    Directory of Open Access Journals (Sweden)

    Krzysztof Pyrc

    Full Text Available Rapid and accurate detection and identification of viruses causing respiratory tract infections is important for patient care and disease control. Despite the fact that several assays are available, identification of an etiological agent is not possible in ~30% of patients suffering from respiratory tract diseases. Therefore, the aim of the current study was to develop a diagnostic set for the detection of respiratory viruses with sensitivity as low as 1-10 copies per reaction. Evaluation of the assay using a training clinical sample set showed that viral nucleic acids were identified in ~76% of cases. To improve assay performance and facilitate the identification of novel species or emerging strains, cultures of fully differentiated human airway epithelium were used to pre-amplify infectious viruses. This additional step resulted in the detection of pathogens in all samples tested. Based on these results it can be hypothesized that the lack of an etiological agent in some clinical samples, both reported previously and observed in the present study, may result not only from the presence of unknown viral species, but also from imperfections in the detection methods used.

  1. Pure Autonomic Failure

    Science.gov (United States)

    ... Drugs GARD Information Navigator FAQs About Rare Diseases Pure autonomic failure Title Other Names: Bradbury Eggleston syndrome; ... Categories: Nervous System Diseases ; RDCRN Summary Summary Listen Pure autonomic failure is characterized by generalized autonomic failure ...

  2. Multiplex detection of pathogen biomarkers in human blood, serum, and saliva using silicon photonic microring resonators

    Science.gov (United States)

    Estrada, I. A.; Burlingame, R. W.; Wang, A. P.; Chawla, K.; Grove, T.; Wang, J.; Southern, S. O.; Iqbal, M.; Gunn, L. C.; Gleeson, M. A.

    2015-05-01

    Genalyte has developed a multiplex silicon photonic chip diagnostics platform (MaverickTM) for rapid detection of up to 32 biological analytes from a drop of sample in just 10 to 20 minutes. The chips are manufactured with waveguides adjacent to ring resonators, and probed with a continuously variable wavelength laser. A shift in the resonant wavelength as mass binds above the ring resonators is measured and is directly proportional to the amount of bound macromolecules. We present here the ability to multiplex the detection of hemorrhagic fever antigens in whole blood, serum, and saliva in a 16 minute assay. Our proof of concept testing of a multiplex antigencapture chip has the ability to detect Zaire Ebola (ZEBOV) recombinant soluble glycoprotein (rsGP), Marburg virus (MARV) Angola recombinant glycoprotein (rGP) and dengue nonstructural protein I (NS1). In parallel, detection of 2 malaria antigens has proven successful, but has yet to be incorporated into multiplex with the others. Each assay performs with sensitivity ranging from 1.6 ng/ml to 39 ng/ml depending on the antigen detected, and with minimal cross-reactivity.

  3. Nanomaterial-based sensors for detection of foodborne bacterial pathogens and toxins as well as pork adulteration in meat products

    OpenAIRE

    Stephen Inbaraj, B; Chen, B H

    2016-01-01

    Food safety draws considerable attention in the modern pace of the world owing to rapid-changing food recipes and food habits. Foodborne illnesses associated with pathogens, toxins, and other contaminants pose serious threat to human health. Besides, a large amount of money is spent on both analyses and control measures, which causes significant loss to the food industry. Conventional detection methods for bacterial pathogens and toxins are time consuming and laborious, requiring certain soph...

  4. Widespread occurrence of diverse human pathogenic types of the fungus Fusarium detected in plumbing drains.

    Science.gov (United States)

    Short, Dylan P G; O'Donnell, Kerry; Zhang, Ning; Juba, Jean H; Geiser, David M

    2011-12-01

    It has been proposed that plumbing systems might serve as a significant environmental reservoir of human-pathogenic isolates of Fusarium. We tested this hypothesis by performing the first extensive multilocus sequence typing (MLST) survey of plumbing drain-associated Fusarium isolates and comparing the diversity observed to the known diversity of clinical Fusarium isolates. We sampled 471 drains, mostly in bathroom sinks, from 131 buildings in the United States using a swabbing method. We found that 66% of sinks and 80% of buildings surveyed yielded at least one Fusarium culture. A total of 297 isolates of Fusarium collected were subjected to MLST to identify the phylogenetic species and sequence types (STs) of these isolates. Our survey revealed that the six most common STs in sinks were identical to the six most frequently associated with human infections. We speculate that the most prevalent STs, by virtue of their ability to form and grow in biofilms, are well adapted to plumbing systems. Six major Fusarium STs were frequently isolated from plumbing drains within a broad geographic area and were identical to STs frequently associated with human infections. PMID:21976755

  5. Direct metagenomic detection of viral pathogens in nasal and fecal specimens using an unbiased high-throughput sequencing approach.

    Science.gov (United States)

    Nakamura, Shota; Yang, Cheng-Song; Sakon, Naomi; Ueda, Mayo; Tougan, Takahiro; Yamashita, Akifumi; Goto, Naohisa; Takahashi, Kazuo; Yasunaga, Teruo; Ikuta, Kazuyoshi; Mizutani, Tetsuya; Okamoto, Yoshiko; Tagami, Michihira; Morita, Ryoji; Maeda, Norihiro; Kawai, Jun; Hayashizaki, Yoshihide; Nagai, Yoshiyuki; Horii, Toshihiro; Iida, Tetsuya; Nakaya, Takaaki

    2009-01-01

    With the severe acute respiratory syndrome epidemic of 2003 and renewed attention on avian influenza viral pandemics, new surveillance systems are needed for the earlier detection of emerging infectious diseases. We applied a "next-generation" parallel sequencing platform for viral detection in nasopharyngeal and fecal samples collected during seasonal influenza virus (Flu) infections and norovirus outbreaks from 2005 to 2007 in Osaka, Japan. Random RT-PCR was performed to amplify RNA extracted from 0.1-0.25 ml of nasopharyngeal aspirates (N = 3) and fecal specimens (N = 5), and more than 10 microg of cDNA was synthesized. Unbiased high-throughput sequencing of these 8 samples yielded 15,298-32,335 (average 24,738) reads in a single 7.5 h run. In nasopharyngeal samples, although whole genome analysis was not available because the majority (>90%) of reads were host genome-derived, 20-460 Flu-reads were detected, which was sufficient for subtype identification. In fecal samples, bacteria and host cells were removed by centrifugation, resulting in gain of 484-15,260 reads of norovirus sequence (78-98% of the whole genome was covered), except for one specimen that was under-detectable by RT-PCR. These results suggest that our unbiased high-throughput sequencing approach is useful for directly detecting pathogenic viruses without advance genetic information. Although its cost and technological availability make it unlikely that this system will very soon be the diagnostic standard worldwide, this system could be useful for the earlier discovery of novel emerging viruses and bioterrorism, which are difficult to detect with conventional procedures. PMID:19156205

  6. Direct metagenomic detection of viral pathogens in nasal and fecal specimens using an unbiased high-throughput sequencing approach.

    Directory of Open Access Journals (Sweden)

    Shota Nakamura

    Full Text Available With the severe acute respiratory syndrome epidemic of 2003 and renewed attention on avian influenza viral pandemics, new surveillance systems are needed for the earlier detection of emerging infectious diseases. We applied a "next-generation" parallel sequencing platform for viral detection in nasopharyngeal and fecal samples collected during seasonal influenza virus (Flu infections and norovirus outbreaks from 2005 to 2007 in Osaka, Japan. Random RT-PCR was performed to amplify RNA extracted from 0.1-0.25 ml of nasopharyngeal aspirates (N = 3 and fecal specimens (N = 5, and more than 10 microg of cDNA was synthesized. Unbiased high-throughput sequencing of these 8 samples yielded 15,298-32,335 (average 24,738 reads in a single 7.5 h run. In nasopharyngeal samples, although whole genome analysis was not available because the majority (>90% of reads were host genome-derived, 20-460 Flu-reads were detected, which was sufficient for subtype identification. In fecal samples, bacteria and host cells were removed by centrifugation, resulting in gain of 484-15,260 reads of norovirus sequence (78-98% of the whole genome was covered, except for one specimen that was under-detectable by RT-PCR. These results suggest that our unbiased high-throughput sequencing approach is useful for directly detecting pathogenic viruses without advance genetic information. Although its cost and technological availability make it unlikely that this system will very soon be the diagnostic standard worldwide, this system could be useful for the earlier discovery of novel emerging viruses and bioterrorism, which are difficult to detect with conventional procedures.

  7. Experiment on Synchronous Timing Signal Detection from ISDB-T Terrestrial Digital TV Signal with Application to Autonomous Distributed ITS-IVC Network

    Science.gov (United States)

    Karasawa, Yoshio; Kumagai, Taichi; Takemoto, Atsushi; Fujii, Takeo; Ito, Kenji; Suzuki, Noriyoshi

    A novel timing synchronizing scheme is proposed for use in inter-vehicle communication (IVC) with an autonomous distributed intelligent transport system (ITS). The scheme determines the timing of packet signal transmission in the IVC network and employs the guard interval (GI) timing in the orthogonal frequency divisional multiplexing (OFDM) signal currently used for terrestrial broadcasts in the Japanese digital television system (ISDB-T). This signal is used because it is expected that the automotive market will demand the capability for cars to receive terrestrial digital TV broadcasts in the near future. The use of broadcasts by automobiles presupposes that the on-board receivers are capable of accurately detecting the GI timing data in an extremely low carrier-to-noise ratio (CNR) condition regardless of a severe multipath environment which will introduce broad scatter in signal arrival times. Therefore, we analyzed actual broadcast signals received in a moving vehicle in a field experiment and showed that the GI timing signal is detected with the desired accuracy even in the case of extremely low-CNR environments. Some considerations were also given about how to use these findings.

  8. Detection of pathogenic Campylobacter, E. coli O157:H7 and Salmonella spp. in wastewater by PCR assay.

    Science.gov (United States)

    Bonetta, Si; Pignata, C; Lorenzi, E; De Ceglia, M; Meucci, L; Bonetta, Sa; Gilli, G; Carraro, E

    2016-08-01

    The aim of this study was the evaluation of the occurrence of pathogenic Campylobacter, Escherichia coli O157:H7, E. coli virulence genes and Salmonella spp. in different wastewater treatment plants (WWTPs) using a method based on an enrichment step and PCR. This method was sensitive enough to detect low levels (∼2 CFU100 ml(-1) of raw sewage) of all the investigated pathogens. In the WWTP samples, E. coli O157:H7 DNA and the eae gene were never found, but 33 % of influents and effluents exhibited amplicons corresponding to Shiga-like toxin I. Twenty-five percent of the influent and 8 % of the effluent exhibited the presence of Shiga-like toxin II. Campylobacter jejuni and C. coli DNA were identified in 50 and 25 % of the influents and in 8 and 25 % of the effluents, respectively. Salmonella spp. DNA was present in all the samples. Considering the results obtained, the method tested here offers a reliable and expeditious tool for evaluating the efficiency of the effluent treatment in order to mitigate contamination risk. Influent contamination by Salmonella spp. and Campylobacter spp. provides indirect information about their circulation; moreover, their presence in effluents underlines the role of WWTPs in the contamination of the receiving surface waters, which affects public health directly or indirectly. PMID:27106076

  9. Diabetic autonomic neuropathy.

    Science.gov (United States)

    Freeman, Roy

    2014-01-01

    Diabetes mellitus is the commonest cause of an autonomic neuropathy in the developed world. Diabetic autonomic neuropathy causes a constellation of symptoms and signs affecting cardiovascular, urogenital, gastrointestinal, pupillomotor, thermoregulatory, and sudomotor systems. Several discrete syndromes associated with diabetes cause autonomic dysfunction. The most prevalent of these are: generalized diabetic autonomic neuropathy, autonomic neuropathy associated with the prediabetic state, treatment-induced painful and autonomic neuropathy, and transient hypoglycemia-associated autonomic neuropathy. These autonomic manifestations of diabetes are responsible for the most troublesome and disabling features of diabetic peripheral neuropathy and result in a significant proportion of the mortality and morbidity associated with the disease.

  10. Target-specific capture enhances sensitivity of electrochemical detection of bacterial pathogens.

    Science.gov (United States)

    Patel, Mayank; Gonzalez, Rodrigo; Halford, Colin; Lewinski, Michael A; Landaw, Elliot M; Churchill, Bernard M; Haake, David A

    2011-12-01

    We report the concentration and purification of bacterial 16S rRNA by the use of a biotinylated DNA target-specific capture (TSC) probe. For both cultivated bacterial and urine specimens from urinary tract infection patients, TSC resulted in a 5- to 8-fold improvement in the sensitivity of bacterial detection in a 16S rRNA electrochemical sensor assay.

  11. Au/Si nanorod-based biosensor for food pathogen detection

    Science.gov (United States)

    Technical Abstract Among several potentials of nanotechnology applications for food industry, development of nanoscale sensors for food safety and quality measurement are emerging. A novel biosensor for Salmonella detection was developed using Au/Si nanorods. The Si nanorods were fabricated by gla...

  12. International Standardisation of a Method for Detection of Human Pathogenic Viruses in Molluscan Shellfish

    DEFF Research Database (Denmark)

    Lees, David; Schultz, Anna Charlotte

    2010-01-01

    The viruses primarily associated with shellfish-borne illness are norovirus, causing gastroenteritis and hepatitis A virus (HAV). Recent years have seen a proliferation of publications on methods for detection of these viruses in shellfish using polymerase chain reaction (PCR). However, currently...

  13. Rapid colorimetric sensing platform for the detection of Listeria monocytogenes foodborne pathogen.

    Science.gov (United States)

    Alhogail, Sahar; Suaifan, Ghadeer A R Y; Zourob, Mohammed

    2016-12-15

    Listeria monocytogenes is a serious cause of human foodborne infections worldwide, which needs spending billions of dollars for inspection of bacterial contamination in food every year. Therefore, there is an urgent need for rapid, in-field and cost effective detection techniques. In this study, rapid, low-cost and simple colorimetric assay was developed using magnetic nanoparticles for the detection of listeria bacteria. The protease from the listeria bacteria was detected using D-amino acid substrate. D-amino acid substrate was linked to the carboxylic acid on the magnetic nanoparticles using EDC/NHS chemistry. The cysteine residue at the C-terminal of the substrate was used for the self-assembled monolayer formation on the gold sensor surface, which in turn the black magnetic nanobeads will mask the golden color. The color will change from black to golden color upon the cleavage of the specific peptide sequence by the Listeria protease. The sensor was tested with serial dilutions of Listeria bacteria. It was found that the appearance of the gold surface area is proportional to the bacterial concentrations in CFU/ml. The lowest detection limit of the developed sensor for Listeria was found to be 2.17×10(2) colony forming unit/ml (CFU/ml). The specificity of the biosensor was tested against four different foodborne associated bacteria (Escherichia coli, Salmonella, Shigella flexnerii and Staphylococcus aureus). Finally, the sensor was tested with artificially spiked whole milk and ground meat spiked with listeria. PMID:27543841

  14. An Immunofluorescence Assay to Detect Urediniospores of the Soybean Rust Pathogen, Phakopsora pachyrhizi

    Science.gov (United States)

    An indirect immunofluorescence spore assay (IFSA) was developed to detect urediniospores of Phakopsora pachyrhizi, utilizing rabbit polyclonal antisera produced in response to intact non-germinated (SBR1A) or germinated (SBR2) urediniospores of P. pachyrhizi. Both antisera were specific to Phakopso...

  15. Real-time PCR Detection of Food-borne Pathogenic Salmonella spp

    DEFF Research Database (Denmark)

    Malorny, B.; Mäde, D.; Löfström, Charlotta

    2013-01-01

    -limiting gastrointestinal disease in a wide range of mammalian hosts. Within the last decade, numerous real-time PCR assays have been developed for rapid detection of salmonellae in potentially contaminated food or feed. Some of them were extensively validated and are useful for diagnostic laboratories. Furthermore......, effective sample preparation prior to the analytical real-time PCR assay avoids inhibitory substances disturbing the PCR and contributes to a high sensitivity. We discuss appropriate sample preparation methods including enrichment procedures for various food items and analytical real-time PCR assays...... for the detection of Salmonella and give a state-of-the-art summary what targets are used and how valid the assays are to apply as diagnostic tool. Furthermore, recommendations for selection of an appropriate real-time PCR method are presented....

  16. Ultra-Fast Low Concentration Detection of Candida Pathogens Utilizing High Resolution Micropore Chips

    Directory of Open Access Journals (Sweden)

    2009-03-01

    Full Text Available Although Candida species are the fourth most common cause of nosocomial blood stream infections in the United States, early diagnostic tools for invasive candidemia are lacking. Due to an increasing rate of candidemia, a new screening system is needed to detect the Candida species in a timely manner. Here we describe a novel method of detection using a solid-state micro-scale pore similar to the operational principles of a Coulter counter. With a steady electrolyte current flowing through the pore, measurements are taken of changes in the current corresponding to the shape of individual yeasts as they translocate or travel through the pore. The direct ultra-fast low concentration electrical addressing of C. albicans has established criteria for distinguishing individual yeast based on their structural properties, which may reduce the currently used methods’ complexity for both identification and quantification capabilities in mixed blood samples

  17. Molecular Detection of Multiple Emerging Pathogens in Sputa from Cystic Fibrosis Patients

    OpenAIRE

    Fadi Bittar; Hervé Richet; Jean-Christophe Dubus; Martine Reynaud-Gaubert; Nathalie Stremler; Jacques Sarles; Didier Raoult; Jean-Marc Rolain

    2008-01-01

    Background: There is strong evidence that culture-based methods detect only a small proportion of bacteria present in the respiratory tracts of cystic fibrosis (CF) patients. Methodology/Principal Findings: Standard microbiological culture and phenotypic identification of bacteria in sputa from CF patients have been compared to molecular methods by the use of 16S rDNA amplification, cloning and sequencing. Twenty-five sputa from CF patients were cultured that yield 33 isolates (13 species) kn...

  18. DNA-based detection of the fungal pathogen Geomyces destructans in soil from bat hibernacula

    Science.gov (United States)

    Lindner, Daniel L.; Gargas, Andrea; Lorch, Jeffrey M.; Banik, Mark T.; Glaeser, Jessie; Kunz, Thomas H.; Blehert, David S.

    2011-01-01

    White-nose syndrome (WNS) is an emerging disease causing unprecedented morbidity and mortality among bats in eastern North America. The disease is characterized by cutaneous infection of hibernating bats by the psychrophilic fungus Geomyces destructans. Detection of G. destructans in environments occupied by bats will be critical for WNS surveillance, management and characterization of the fungal lifecycle. We initiated an rRNA gene region-based molecular survey to characterize the distribution of G. destructans in soil samples collected from bat hibernacula in the eastern United States with an existing PCR test. Although this test did not specifically detect G. destructans in soil samples based on a presence/absence metric, it did favor amplification of DNA from putative Geomyces species. Cloning and sequencing of PCR products amplified from 24 soil samples revealed 74 unique sequence variants representing 12 clades. Clones with exact sequence matches to G. destructans were identified in three of 19 soil samples from hibernacula in states where WNS is known to occur. Geomyces destructans was not identified in an additional five samples collected outside the region where WNS has been documented. This study highlights the diversity of putative Geomyces spp. in soil from bat hibernacula and indicates that further research is needed to better define the taxonomy of this genus and to develop enhanced diagnostic tests for rapid and specific detection of G. destructans in environmental samples.

  19. Synthesis and electrochemical detection of a thiazolyl-indole natural product isolated from the nosocomial pathogen Pseudomonas aeruginosa.

    Science.gov (United States)

    Buzid, Alyah; Muimhneacháin, Eoin Ó; Reen, F Jerry; Hayes, Phyllis E; Pardo, Leticia M; Shang, Fengjun; O'Gara, Fergal; Sperry, Jonathan; Luong, John H T; Glennon, Jeremy D; McGlacken, Gerard P

    2016-09-01

    Pseudomonas aeruginosa is a Gram-negative opportunistic pathogen, capable of surviving in a broad range of natural environments and quickly acquiring resistance. It is associated with hospital-acquired infections, particularly in patients with compromised immunity, and is the primary cause of morbidity and mortality in cystic fibrosis (CF) patients. P. aeruginosa is also of nosocomial importance on dairy farms and veterinary hospitals, where it is a key morbidity factor in bovine mastitis. P. aeruginosa uses a cell-cell communication system consisting of signalling molecules to coordinate bacterial secondary metabolites, biofilm formation, and virulence. Simple and sensitive methods for the detection of biomolecules as indicators of P. aeruginosa infection would be of great clinical importance. Here, we report the synthesis of the P. aeruginosa natural product, barakacin, which was recently isolated from the bovine ruminal strain ZIO. A simple and sensitive electrochemical method was used for barakacin detection using a boron-doped diamond (BDD) and glassy carbon (GC) electrodes, based on cyclic voltammetry (CV) and differential pulse voltammetry (DPV). The influence of electrolyte pH on the peak potential and peak currents was also investigated. At pH 2.0, the peak current was linearly dependent on barakacin concentration (in the range used, 1-10 μM), with correlation coefficients greater than 0.98 on both electrodes. The detection limit (S/N = 3) on the BDD electrode was 100-fold lower than that obtained on the GC electrode. The optimized method using the BDD electrode was extended to bovine (cow feces) and human (sputum of a CF patient) samples. Spiked barakacin was easily detected in these matrices at a limit of 0.5 and 0.05 μM, respectively. Graphical abstract Electrochemical detection of barakacin. PMID:27473426

  20. Comparison of the EntericBio multiplex PCR system with routine culture for detection of bacterial enteric pathogens.

    LENUS (Irish Health Repository)

    O'Leary, James

    2009-11-01

    The EntericBio system uses a multiplex PCR assay for the simultaneous detection of Campylobacter spp., Salmonella enterica, Shigella spp., and Escherichia coli O157 from feces. It combines overnight broth enrichment with PCR amplification and detection by hybridization. An evaluation of this system was conducted by comparing the results obtained with the system with those obtained by routine culture, supplemented with alternative PCR detection methods. In a study of 773 samples, routine culture and the EntericBio system yielded 94.6 and 92.4% negative results, respectively. Forty-two samples had positive results by culture, and all of these were positive with the EntericBio system. This system detected an additional 17 positive samples (Campylobacter spp., n = 12; Shigella spp., n = 1; E. coli O157, n = 4), but the results for 5 samples (Campylobacter spp., n = 2; Shigella spp., n = 1; E. coli O157, n = 2) could not be confirmed. The target for Shigella spp. detected by the EntericBio system is the ipaH gene, and the molecular indication of the presence of Shigella spp. was investigated by sequence analysis, which confirmed that the ipaH gene was present in a Klebsiella pneumoniae isolate from the patient. The sensitivity, specificity, positive predictive value, and negative predictive value were 100%, 99.3%, 91.5%, and 100%, respectively. Turnaround times were significantly reduced with the EntericBio system, and a result was available between 24 and 32 h after receipt of the sample in the laboratory. In addition, the amount of laboratory waste was significantly reduced by use of this system. In summary, the EntericBio system proved convenient to use, more sensitive than the conventional culture used in this study, and highly specific; and it generated results significantly faster than routine culture for the pathogens tested.

  1. Behavior-Based Approach for the Detection of Land Mines Utilizing off the Shelf Low Cost Autonomous Robot

    Directory of Open Access Journals (Sweden)

    Abdel Ilah Nour Alshbatat

    2013-03-01

    Full Text Available Several countries all of the world are affected by landmines. The presence of mines represents a major threat to lives and causes economic problems. Currently, detecting and clearing mines demand specific expertise with special equipment. In this context, this paper offers the design and development of an intelligent controller which can control and enable the robot to detect mines by means of sensors and of processing the fused information to guide soldiers when passing landmines.  This is accomplished by broken down the overall system into two subsystems: sensor technologies and robotic device. Sensors devices include infrared distance sensor, metal detector, ultrasonic range finder, accelerometer sensor, while the structure of the robot in our case consists mainly  of a commercial  off-the-shelf  parts which  are  available  at  low  costs. The proposed controller is mainly based on creating fuzzy rules that reflect the behaviors of soldier beings in controlling a robot in a well known landmine. Simulation and experimental results are presented her to prove the efficiency of the proposed approach. The results show that the system is able to detect landmines and guide soldiers while crossing mines area.

  2. Fluorescence detection of telomerase activity in cancer cell extracts based on autonomous exonuclease III-assisted isothermal cycling signal amplification.

    Science.gov (United States)

    Ding, Caifeng; Li, Xiaoqian; Wang, Wei; Chen, Yaoyao

    2016-09-15

    Based on the extension reaction of a telomerase substrate (TS) primer in the presence of the telomerase, strand-displacement process to perform more stable longer duplex chain, and stepwise hydrolysis of mononucleotides from the blunt or the recessed 3'-hydroxyl termini of duplex DNA in the presence of Exonuclease III (Exo III), an amplified fluorescence detection of telomerase activity in the cancer cells was described in this manuscript. A fluorescence probe DNA, a quencher DNA, and a TS primer were mixed to construct a three-chain DNA structure and a two-chain DNA structure because the amount of the TS primer was less than the other two DNA. In the presence of the telomerase, the quencher DNA was replaced from the probe DNA and the telomerase activity could be determined with the fluorescence enhancement. The telomerase activity in HeLa extracts equivalent to 6-2000 cells was detected by this method. Moreover, the strategy was further proved by using telomerase extracted from Romas cells. With the multiple rounds of isothermal strand displacement and the hydrolysis process, constituted consecutive of signal amplification for the novel detection paradigm that allowed measuring of telomerase activity in crude cancer cell extracts confirmed the reliability and practicality of the protocol, which reveal this platform holds great promise in the biochemical assay for the telomerase activity in early diagnosis for cancers. PMID:27108253

  3. DNA-Directed Antibody Immobilization for Enhanced Detection of Single Viral Pathogens.

    Science.gov (United States)

    Seymour, Elif; Daaboul, George G; Zhang, Xirui; Scherr, Steven M; Ünlü, Nese Lortlar; Connor, John H; Ünlü, M Selim

    2015-10-20

    Here, we describe the use of DNA-conjugated antibodies for rapid and sensitive detection of whole viruses using a single-particle interferometric reflectance imaging sensor (SP-IRIS), a simple, label-free biosensor capable of imaging individual nanoparticles. First, we characterize the elevation of the antibodies conjugated to a DNA sequence on a three-dimensional (3-D) polymeric surface using a fluorescence axial localization technique, spectral self-interference fluorescence microscopy (SSFM). Our results indicate that using DNA linkers results in significant elevation of the antibodies on the 3-D polymeric surface. We subsequently show the specific detection of pseudotyped vesicular stomatitis virus (VSV) as a model virus on SP-IRIS platform. We demonstrate that DNA-conjugated antibodies improve the capture efficiency by achieving the maximal virus capture for an antibody density as low as 0.72 ng/mm(2), whereas for unmodified antibody, the optimal virus capture requires six times greater antibody density on the sensor surface. We also show that using DNA conjugated anti-EBOV GP (Ebola virus glycoprotein) improves the sensitivity of EBOV-GP carrying VSV detection compared to directly immobilized antibodies. Furthermore, utilizing a DNA surface for conversion to an antibody array offers an easier manufacturing process by replacing the antibody printing step with DNA printing. The DNA-directed immobilization technique also has the added advantages of programmable sensor surface generation based on the need and resistance to high temperatures required for microfluidic device fabrication. These capabilities improve the existing SP-IRIS technology, resulting in a more robust and versatile platform, ideal for point-of-care diagnostics applications. PMID:26378807

  4. Detection of Food Spoilage and Pathogenic Bacteria Based on Ligation Detection Reaction Coupled to Flow-Through Hybridization on Membranes

    Directory of Open Access Journals (Sweden)

    K. Böhme

    2014-01-01

    Full Text Available Traditional culturing methods are still commonly applied for bacterial identification in the food control sector, despite being time and labor intensive. Microarray technologies represent an interesting alternative. However, they require higher costs and technical expertise, making them still inappropriate for microbial routine analysis. The present study describes the development of an efficient method for bacterial identification based on flow-through reverse dot-blot (FT-RDB hybridization on membranes, coupled to the high specific ligation detection reaction (LDR. First, the methodology was optimized by testing different types of ligase enzymes, labeling, and membranes. Furthermore, specific oligonucleotide probes were designed based on the 16S rRNA gene, using the bioinformatic tool Oligonucleotide Retrieving for Molecular Applications (ORMA. Four probes were selected and synthesized, being specific for Aeromonas spp., Pseudomonas spp., Shewanella spp., and Morganella morganii, respectively. For the validation of the probes, 16 reference strains from type culture collections were tested by LDR and FT-RDB hybridization using universal arrays spotted onto membranes. In conclusion, the described methodology could be applied for the rapid, accurate, and cost-effective identification of bacterial species, exhibiting special relevance in food safety and quality.

  5. Detection of biomarkers of pathogenic Naegleria fowleri through mass spectrometry and proteomics.

    Science.gov (United States)

    Moura, Hercules; Izquierdo, Fernando; Woolfitt, Adrian R; Wagner, Glauber; Pinto, Tatiana; del Aguila, Carmen; Barr, John R

    2015-01-01

    Emerging methods based on mass spectrometry (MS) can be used in the rapid identification of microorganisms. Thus far, these practical and rapidly evolving methods have mainly been applied to characterize prokaryotes. We applied matrix-assisted laser-desorption-ionization-time-of-flight mass spectrometry MALDI-TOF MS in the analysis of whole cells of 18 N. fowleri isolates belonging to three genotypes. Fourteen originated from the cerebrospinal fluid or brain tissue of primary amoebic meningoencephalitis patients and four originated from water samples of hot springs, rivers, lakes or municipal water supplies. Whole Naegleria trophozoites grown in axenic cultures were washed and mixed with MALDI matrix. Mass spectra were acquired with a 4700 TOF-TOF instrument. MALDI-TOF MS yielded consistent patterns for all isolates examined. Using a combination of novel data processing methods for visual peak comparison, statistical analysis and proteomics database searching we were able to detect several biomarkers that can differentiate all species and isolates studied, along with common biomarkers for all N. fowleri isolates. Naegleria fowleri could be easily separated from other species within the genus Naegleria. A number of peaks detected were tentatively identified. MALDI-TOF MS fingerprinting is a rapid, reproducible, high-throughput alternative method for identifying Naegleria isolates. This method has potential for studying eukaryotic agents.

  6. A molecular assay for sensitive detection of pathogen-specific T-cells.

    Directory of Open Access Journals (Sweden)

    Victoria O Kasprowicz

    Full Text Available Here we describe the development and validation of a highly sensitive assay of antigen-specific IFN-γ production using real time quantitative PCR (qPCR for two reporters--monokine-induced by IFN-γ (MIG and the IFN-γ inducible protein-10 (IP10. We developed and validated the assay and applied it to the detection of CMV, HIV and Mycobacterium tuberculosis (MTB specific responses, in a cohort of HIV co-infected patients. We compared the sensitivity of this assay to that of the ex vivo RD1 (ESAT-6 and CFP-10-specific IFN-γ Elispot assay. We observed a clear quantitative correlation between the two assays (P<0.001. Our assay proved to be a sensitive assay for the detection of MTB-specific T cells, could be performed on whole blood samples of fingerprick (50 uL volumes, and was not affected by HIV-mediated immunosuppression. This assay platform is potentially of utility in diagnosis of infection in this and other clinical settings.

  7. Autonomous underwater riser inspection tool

    Energy Technology Data Exchange (ETDEWEB)

    Camerini, Claudio; Marnet, Robson [Petrobras SA, (Brazil); Freitas, Miguel; Von der Weid, Jean Pierre [CPTI/PUC-Rio, Rio de Janeiro, (Brazil); Artigas Lander, Ricardo [EngeMOVI, Curitiba, (Brazil)

    2010-07-01

    The detection of damage on the riser is a serious concern for pipeline companies. Visual examinations by remotely operated vehicle (ROV) are presently carried out to detect the defects but this process has limitations and is expensive. This paper presents the development of a new tool to ensure autonomous underwater riser inspection (AURI) that uses the riser itself for guidance. The AURI, which is autonomous in terms of control and power supply, is equipped with several cameras that perform a complete visual inspection of the riser with 100 % coverage of the external surface of the riser. The paper presents the detailed characteristics of the first AURI prototype, describes its launching procedure and provides the preliminary test results from pool testing. The results showed that the AURI is a viable system for autonomous riser inspection. Offshore tests on riser pipelines are scheduled to be performed shortly.

  8. Comparison of PCR,DIA and Pathogenicity Assay for Detection of Xanthomonas axonopodis pv.citri,the Causal Agent of Citrus Bacterial Canker Disease

    Institute of Scientific and Technical Information of China (English)

    WANG Zhong-kang; SUN Xian-yun; YIN You-ping; ZHOU Chang-yong; XIA Yu-xian

    2004-01-01

    Polymerase chain reaction (PCR) approach based on newly designed primers, JYF5/JYR5, was applied for specific detection of Xanthomonas axonopodis pv.citri(Xac). The efficiency and reliability of PCR method were compared with dot immunobinding assay (DIA) and classical pathogenicity test techniques for detecting suspensions of pure cells of Xac and soaking sap of citrus tissues. Detection sensitivity of PCR was about 4.5 cells or 1.56 pg target DNA per reaction which was higher than that of DIA (ca. 450 cells per dot).These three techniques (PCR assay, DIA and Pathogenecity test) could always detect Xac from symptomatic citrus samples. Different performances were obtained from citrus materials without symptoms, and the positive detection frequency was PCR, DIA and pathogenicity test.

  9. Detection and Molecular Characterization of Potentially Pathogenic Free-living Amoebae from Water Sources in Kish Island, Southern Iran.

    Science.gov (United States)

    Niyyati, Maryam; Lasgerdi, Zohreh; Lorenzo-Morales, Jacob

    2015-01-01

    Amoebic keratitis, a sight-threatening corneal infection, mainly occurs in contact lens wearers who wash their eyes with tap water. The present research was conducted to identify the occurrence of potentially pathogenic free-living amoebae (FLA) in tap water sources on Kish Island, a tourist region in Iran. Amoebae were detected using a culture-enriched method and by polymerase chain reaction (PCR)/sequencing of the diagnostic fragment 3 region of the 18S rRNA gene of Acanthamoeba. In the case of other free-living amoebae species, PCR/sequencing analysis of the 18S rDNA was conducted. Results of this study showed the presence of Acanthamoeba belonging to T3, T4, T5, and T11 genotypes in tap water sources. Additionally, Vermamoebae vermiformis was detected in three water samples. This is the first report of the Acanthamoeba genotypes T3, T4, T5, and T11 and V. vermiformis species in tap water sources in a tourist region in Iran.

  10. Sensitive and direct detection of receptor binding specificity of highly pathogenic avian influenza A virus in clinical samples.

    Directory of Open Access Journals (Sweden)

    Tadanobu Takahashi

    Full Text Available Influenza A virus (IAV recognizes two types of N-acetylneuraminic acid (Neu5Ac by galactose (Gal linkages, Neu5Acα2,3Gal and Neu5Acα2,6Gal. Avian IAV preferentially binds to Neu5Acα2,3Gal linkage, while human IAV preferentially binds to Neu5Acα2,6Gal linkage, as a virus receptor. Shift in receptor binding specificity of avian IAV from Neu5Acα2,3Gal linkage to Neu5Acα2,6Gal linkage is generally believed to be a critical factor for its transmission ability among humans. Surveillance of this shift of highly pathogenic H5N1 avian IAV (HPAI is thought to be a very important for prediction and prevention of a catastrophic pandemic of HPAI among humans. In this study, we demonstrated that receptor binding specificity of IAV bound to sialo-glycoconjugates was sensitively detected by quantifying the HA gene with real-time reverse-transcription-PCR. The new assay enabled direct detection of receptor binding specificity of HPAIs in chicken clinical samples including trachea and cloaca swabs in only less than 4 h.

  11. Assessment of molecular methods as a tool for detecting pathogenic protozoa isolated from water bodies.

    Science.gov (United States)

    Adamska, M; Sawczuk, M; Kolodziejczyk, L; Skotarczak, B

    2015-12-01

    Several species belong to the Cryptosporidium and Giardia genus, the main parasitic protozoa occurring in water, but only some of them are infectious to humans. We investigated the occurrence of Cryptosporidium and Giardia and identified their species in the water samples collected from natural water bodies in north-western Poland. A total of 600 samples from water bodies used for bathing, sewage discharge, as drinking water sources and watering places for animals were screened. The samples were collected during a 3-year period in each of the four seasons and filtered using Filta-Max (IDEXX Laboratories, USA). Genomic DNA was extracted from all samples and used as a target sequence for polymerase chain reaction (PCR) and TaqMan real-time PCR, as well as for reverse line blotting (RLB) methods. PCR methods seem to be more sensitive to detect Giardia and Cryptosporidium DNA in water samples than RLB methods. All PCR products were sequenced and three were identified as C. parvum and four as G. intestinalis. The overall prevalence of C. parvum (0.5%) and G. intestinalis (0.6%) in the samples suggests that the risk of Cryptosporidium and Giardia infections in north-western Poland is minimal.

  12. Pathogen Sensors

    Directory of Open Access Journals (Sweden)

    Joseph Irudayaraj

    2009-10-01

    Full Text Available The development of sensors for detecting foodborne pathogens has been motivated by the need to produce safe foods and to provide better healthcare. However, in the more recent times, these needs have been expanded to encompass issues relating to biosecurity, detection of plant and soil pathogens, microbial communities, and the environment. The range of technologies that currently flood the sensor market encompass PCR and microarray-based methods, an assortment of optical sensors (including bioluminescence and fluorescence, in addition to biosensor-based approaches that include piezoelectric, potentiometric, amperometric, and conductometric sensors to name a few. More recently, nanosensors have come into limelight, as a more sensitive and portable alternative, with some commercial success. However, key issues affecting the sensor community is the lack of standardization of the testing protocols and portability, among other desirable elements, which include timeliness, cost-effectiveness, user-friendliness, sensitivity and specificity. [...

  13. Multiplex PCR system for rapid detection of pathogens in patients with presumed sepsis - a systemic review and meta-analysis.

    Directory of Open Access Journals (Sweden)

    Shy-Shin Chang

    Full Text Available BACKGROUND: Blood culture is viewed as the golden standard for the diagnosis of sepsis but suffers from low sensitivity and long turnaround time. LightCycler SeptiFast (LC-SF is a real-time multiplex polymerase chain reaction test able to detect 25 common pathogens responsible for bloodstream infections within hours. We aim to assess the accuracy of LC-SF by systematically reviewing the published studies. METHOD: Related literature on Medline, Embase, and Cochrane databases was searched up to October 2012 for studies utilizing LC-SF to diagnose suspected sepsis and that provided sufficient data to construct two-by-two tables. RESULTS: A total of 34 studies enrolling 6012 patients of suspected sepsis were included. The overall sensitivity and specificity for LC-SF to detect bacteremia or fungemia was 0·75 (95% CI: 0·65-0·83 and 0·92 (95%CI:0·90-0·95, respectively. LC-SF had a high positive likelihood ratio (10·10 and a moderate negative likelihood ratio (0·27. Specifically, LC-SF had a sensitivity of 0·80 (95%CI: 0·70-0·88 and a specificity of 0·95(95%CI: 0·93-0·97 for the bacteremia outcome, and a sensitivity of 0·61 (95%CI: 0·48-0·72 and a specificity of 0·99 (95%CI: 0·99-0·99 for the fungemia outcome. High heterogeneity was found in the bacteremia outcome subgroup but not in the fungemia outcome subgroup. CONCLUSION: LC-SF is of high rule-in value for early detection of septic patients. In a population with low pretest probability, LC-SF test can still provide valuable information for ruling out bacteremia or fungemia.

  14. Development of Real-Time PCR Methods for the Detection of Bacterial Meningitis Pathogens without DNA Extraction.

    Directory of Open Access Journals (Sweden)

    Jeni Vuong

    Full Text Available Neisseria meningitidis (Nm, Haemophilus influenzae (Hi, and Streptococcus pneumoniae (Sp are the lead causes of bacterial meningitis. Detection of these pathogens from clinical specimens using traditional real-time PCR (rt-PCR requires DNA extraction to remove the PCR inhibitors prior to testing, which is time consuming and labor intensive. In this study, five species-specific (Nm-sodC and -ctrA, Hi-hpd#1 and -hpd#3 and Sp-lytA and six serogroup-specific rt-PCR tests (A, B, C, W, X, Y targeting Nm capsular genes were evaluated in the two direct rt-PCR methods using PerfeCTa and 5x Omni that do not require DNA extraction. The sensitivity and specify of the two direct rt-PCR methods were compared to TaqMan traditional rt-PCR, the current standard rt-PCR method for the detection of meningitis pathogens. The LLD for all 11 rt-PCR tests ranged from 6,227 to 272,229 CFU/ml for TaqMan, 1,824-135,982 for 5x Omni, and 168-6,836 CFU/ml for PerfeCTa. The diagnostic sensitivity using TaqMan ranged from 89.2%-99.6%, except for NmB-csb, which was 69.7%. For 5x Omni, the sensitivity varied from 67.1% to 99.8%, with three tests below 90%. The sensitivity of these tests using PerfeCTa varied from 89.4% to 99.8%. The specificity ranges of the 11 tests were 98.0-99.9%, 97.5-99.9%, and 92.9-99.9% for TaqMan, 5x Omni, and PerfeCTa, respectively. PerfeCTa direct rt-PCR demonstrated similar or better sensitivity compared to 5x Omni direct rt-PCR or TaqMan traditional rt-PCR. Since the direct rt-PCR method does not require DNA extraction, it reduces the time and cost for processing CSF specimens, increases testing throughput, decreases the risk of cross-contamination, and conserves precious CSF. The direct rt-PCR method will be beneficial to laboratories with high testing volume.

  15. Evaluation of yield of currently available diagnostics by sample type to optimize detection of respiratory pathogens in patients with a community-acquired pneumonia

    NARCIS (Netherlands)

    E. Huijskens (Elisabeth); J.W. Rossen (John); J.A.J.W. Kluytmans (Jan); A.G.M. van der Zanden (Adri); M.P.G. Koopmans D.V.M. (Marion)

    2014-01-01

    textabstractBackground: For the detection of respiratory pathogens, the sampling strategy may influence the diagnostic yield. Ideally, samples from the lower respiratory tract are collected, but they are difficult to obtain. Objectives: In this study, we compared the diagnostic yield in sputum and o

  16. Evaluation of yield of currently available diagnostics by sample type to optimize detection of respiratory pathogens in patients with a community-acquired pneumonia

    NARCIS (Netherlands)

    Huijskens, Elisabeth G. W.; Rossen, John W. A.; Kluytmans, Jan A. J. W.; van der Zanden, Adri G. M.; Koopmans, Marion

    2014-01-01

    BACKGROUND: For the detection of respiratory pathogens, the sampling strategy may influence the diagnostic yield. Ideally, samples from the lower respiratory tract are collected, but they are difficult to obtain. OBJECTIVES: In this study, we compared the diagnostic yield in sputum and oropharyngeal

  17. Bioinspired Synthesis of All-in-One Organic-Inorganic Hybrid Nanoflowers Combined with a Handheld pH Meter for On-Site Detection of Food Pathogen.

    Science.gov (United States)

    Ye, Ranfeng; Zhu, Chengzhou; Song, Yang; Lu, Qian; Ge, Xiaoxiao; Yang, Xu; Zhu, Mei-Jun; Du, Dan; Li, He; Lin, Yuehe

    2016-06-01

    With a mild elaborately bioinspired one-pot process, Con A-GOx-CaHPO4 nanoflowers are prepared. Employing the as-prepared all-in-one hybrid nanoflowers as signal tags, a simple but potentially powerful amplification biosensing technology for the detection of food pathogen with excellent simplicity, portability, sensitivity, and adaptability is achieved.

  18. Correlation between Detection of a Plasmid and High-Level Virulence of Vibrio nigripulchritudo, a Pathogen of the Shrimp Litopenaeus stylirostris▿

    Science.gov (United States)

    Reynaud, Yann; Saulnier, Denis; Mazel, Didier; Goarant, Cyrille; Le Roux, Frédérique

    2008-01-01

    Vibrio nigripulchritudo, the etiological agent of Litopenaeus stylirostris summer syndrome, is responsible for mass mortalities of shrimp in New Caledonia. Epidemiological studies led to the suggestion that this disease is caused by an emergent group of pathogenic strains. Genomic subtractive hybridization was carried out between two isolates exhibiting low and high virulence. Our subtraction library was constituted of 521 specific fragments; 55 of these were detected in all virulent isolates from our collection (n = 32), and 13 were detected only in the isolates demonstrating the highest pathogenicity (n = 19), suggesting that they could be used as genetic markers for high virulence capacity. Interestingly, 10 of these markers are carried by a replicon of 11.2 kbp that contains sequences highly similar to those of a plasmid detected in Vibrio shilonii, a coral pathogen. The detection of this plasmid was correlated with the highest pathogenicity status of the isolates from our collection. The origin and consequence of this plasmid acquisition are discussed. PMID:18359828

  19. Correlation between detection of a plasmid and high-level virulence of Vibrio nigripulchritudo, a pathogen of the shrimp Litopenaeus stylirostris.

    Science.gov (United States)

    Reynaud, Yann; Saulnier, Denis; Mazel, Didier; Goarant, Cyrille; Le Roux, Frédérique

    2008-05-01

    Vibrio nigripulchritudo, the etiological agent of Litopenaeus stylirostris summer syndrome, is responsible for mass mortalities of shrimp in New Caledonia. Epidemiological studies led to the suggestion that this disease is caused by an emergent group of pathogenic strains. Genomic subtractive hybridization was carried out between two isolates exhibiting low and high virulence. Our subtraction library was constituted of 521 specific fragments; 55 of these were detected in all virulent isolates from our collection (n = 32), and 13 were detected only in the isolates demonstrating the highest pathogenicity (n = 19), suggesting that they could be used as genetic markers for high virulence capacity. Interestingly, 10 of these markers are carried by a replicon of 11.2 kbp that contains sequences highly similar to those of a plasmid detected in Vibrio shilonii, a coral pathogen. The detection of this plasmid was correlated with the highest pathogenicity status of the isolates from our collection. The origin and consequence of this plasmid acquisition are discussed. PMID:18359828

  20. Evaluation of a triplex real-time PCR system to detect the plant-pathogenic molds Alternaria spp., Fusarium spp. and C. purpurea.

    Science.gov (United States)

    Grube, Sabrina; Schönling, Jutta; Prange, Alexander

    2015-12-01

    This article describes the development of a triplex real-time PCR system for the simultaneous detection of three major plant-pathogenic mold genera (Alternaria spp., Fusarium spp. and the species Claviceps purpurea). The designed genus-specific primer-probe systems were validated for sensitivity, specificity and amplification in the presence of background DNA. PMID:26545945

  1. Application of DNA Aptamers and Quantum Dots to Lateral Flow Test Strips for Detection of Foodborne Pathogens with Improved Sensitivity versus Colloidal Gold

    OpenAIRE

    John G. Bruno

    2014-01-01

    Preliminary studies aimed at improving the sensitivity of foodborne pathogen detection via lateral flow (LF) test strips by use of high affinity DNA aptamers for capture and reporter functions when coupled to red-emitting quantum dots (Qdot 655) are reported. A variety of DNA aptamers developed against Escherichia coli, Listeria monocytogenes, and Salmonella enterica were paired in capture and reporter combinations to determine which yielded the strongest detection of their cognate bacteria u...

  2. Gas House Autonomous System Monitoring

    Science.gov (United States)

    Miller, Luke; Edsall, Ashley

    2015-01-01

    Gas House Autonomous System Monitoring (GHASM) will employ Integrated System Health Monitoring (ISHM) of cryogenic fluids in the High Pressure Gas Facility at Stennis Space Center. The preliminary focus of development incorporates the passive monitoring and eventual commanding of the Nitrogen System. ISHM offers generic system awareness, adept at using concepts rather than specific error cases. As an enabler for autonomy, ISHM provides capabilities inclusive of anomaly detection, diagnosis, and abnormality prediction. Advancing ISHM and Autonomous Operation functional capabilities enhances quality of data, optimizes safety, improves cost effectiveness, and has direct benefits to a wide spectrum of aerospace applications.

  3. Skin lesion-associated pathogens from Octopus vulgaris: first detection of Photobacterium swingsii, Lactococcus garvieae and betanodavirus.

    Science.gov (United States)

    Fichi, G; Cardeti, G; Perrucci, S; Vanni, A; Cersini, A; Lenzi, C; De Wolf, T; Fronte, B; Guarducci, M; Susini, F

    2015-07-23

    The common octopus Octopus vulgaris Cuvier, 1798 is extremely important in fisheries and is a useful protein source in most Mediterranean countries. Here we investigated pathogens associated with skin lesions in 9 naturally deceased specimens that included both cultured and wild common octopus. Within 30 min after death, each octopus was stored at 4°C and microbiologically examined within 24 h. Bacterial colonies, cultured from swabs taken from the lesions, were examined using taxonomical and biochemical analyses. Vibrio alginolyticus and V. parahaemolyticus were only isolated from cultured animals. A conventional PCR targeting the 16S ribosomal RNA (rRNA) gene and sequencing were performed on 2 bacterial isolates that remained unidentified after taxonomical and biochemical analysis. The sequence results indicated that the bacteria had a 99% identity with Lactococcus garvieae and Photobacterium swingsii. L. garvieae was confirmed using a specific PCR based on the 16S-23S rRNA internal transcribed spacer region, while P. swingsii was confirmed by phylogenetic analyses. Although all animals examined were found to be infected by the protozoan species Aggregata octopiana localised in the intestines, it was also present in skin lesions of 2 of the animals. Betanodavirus was detected in both cultured and wild individuals by cell culture, PCR and electron microscopy. These findings are the first report of L. garvieae and betanodavirus from skin lesions of common octopus and the first identification of P. swingsii both in octopus skin lesions and in marine invertebrates in Italy.

  4. [A Case of Leptospirosis in which the Causative Pathogen was Detected Using Cerebrospinal Fluid PCR Eight Days after Onset].

    Science.gov (United States)

    Arita, Yuki; Tono, Toshihiro; Hosoda, Tomohiro; Taguchi, Hiroaki; Sakamoto, Mitsuo; Osone, Yasuo; Nozaki, Hiroyuki

    2016-05-01

    We report a patient with leptospirosis caused by infection with Leptospira interrogans serovar Rachmati. A 30-year-old Japanese man took part in a survival camp on Iriomote Island, Okinawa, from July 9 to July 15, 2014. During the camp, he swam in the river and kayaked. He developed a high fever and fatigue 7 days after completing his trip and was admitted to our hospital on July 22. On admission, he complained of a posterior cervical pain and a loss of appetite. Laboratory findings revealed granulocytosis, mildly elevated AST and ALT levels, elevated BUN and Cr levels, and a significantly elevated CRP level. No pathogenic bacteria were isolated from blood, urine, or cerebrospinal fluid cultures. We included leptospirosis in the differential diagnosis because of the patient's history of participating in a survival camp on Iriomote Island. Minocycline 200 mg, p.o. showed an excellent efficacy. The Leptospira flagellar gene FlaB was detected using a cerebrospinal fluid PCR. A microscopic agglutination test (MAT) during the convalescent stage demonstrated significant increases in antibodies against L. interrogans serovar Rachmati, confirming the diagnosis of leptospirosis. A medical history including occupation and recent travel history, and an adequate specimen sampling are crucial for the accurate and early diagnosis of leptospirosis. PMID:27529969

  5. The melioidosis agent Burkholderia pseudomallei and related opportunistic pathogens detected in faecal matter of wildlife and livestock in northern Australia.

    Science.gov (United States)

    Höger, A C R; Mayo, M; Price, E P; Theobald, V; Harrington, G; Machunter, B; Choy, J Low; Currie, B J; Kaestli, M

    2016-07-01

    The Darwin region in northern Australia has experienced rapid population growth in recent years, and with it, an increased incidence of melioidosis. Previous studies in Darwin have associated the environmental presence of Burkholderia pseudomallei, the causative agent of melioidosis, with anthropogenic land usage and proximity to animals. In our study, we estimated the occurrence of B. pseudomallei and Burkholderia spp. relatives in faecal matter of wildlife, livestock and domestic animals in the Darwin region. A total of 357 faecal samples were collected and bacteria isolated through culture and direct DNA extraction after enrichment in selective media. Identification of B. pseudomallei, B. ubonensis, and other Burkholderia spp. was carried out using TTS1, Bu550, and recA BUR3-BUR4 quantitative PCR assays, respectively. B. pseudomallei was detected in seven faecal samples from wallabies and a chicken. B. cepacia complex spp. and Pandoraea spp. were cultured from wallaby faecal samples, and B. cenocepacia and B. cepacia were also isolated from livestock animals. Various bacteria isolated in this study represent opportunistic human pathogens, raising the possibility that faecal shedding contributes to the expanding geographical distribution of not just B. pseudomallei but other Burkholderiaceae that can cause human disease. PMID:26935879

  6. Loop-mediated isothermal amplification of specific endoglucanase gene sequence for detection of the bacterial wilt pathogen Ralstonia solanacearum.

    Directory of Open Access Journals (Sweden)

    Rok Lenarčič

    Full Text Available The increased globalization of crops production and processing industries also promotes the side-effects of more rapid and efficient spread of plant pathogens. To prevent the associated economic losses, and particularly those related to bacterial diseases where their management relies on removal of the infected material from production, simple, easy-to-perform, rapid and cost-effective tests are needed. Loop-mediated isothermal amplification (LAMP assays that target 16S rRNA, fliC and egl genes were compared and evaluated as on-site applications. The assay with the best performance was that targeted to the egl gene, which shows high analytical specificity for diverse strains of the betaproteobacterium Ralstonia solanacearum, including its non-European and non-race 3 biovar 2 strains. The additional melting curve analysis provides confirmation of the test results. According to our extensive assessment, the egl LAMP assay requires minimum sample preparation (a few minutes of boiling for the identification of pure cultures and ooze from symptomatic material, and it can also be used in a high-throughput format in the laboratory. This provides sensitive and reliable detection of R. solanacearum strains of different phylotypes.

  7. [A Case of Leptospirosis in which the Causative Pathogen was Detected Using Cerebrospinal Fluid PCR Eight Days after Onset].

    Science.gov (United States)

    Arita, Yuki; Tono, Toshihiro; Hosoda, Tomohiro; Taguchi, Hiroaki; Sakamoto, Mitsuo; Osone, Yasuo; Nozaki, Hiroyuki

    2016-05-01

    We report a patient with leptospirosis caused by infection with Leptospira interrogans serovar Rachmati. A 30-year-old Japanese man took part in a survival camp on Iriomote Island, Okinawa, from July 9 to July 15, 2014. During the camp, he swam in the river and kayaked. He developed a high fever and fatigue 7 days after completing his trip and was admitted to our hospital on July 22. On admission, he complained of a posterior cervical pain and a loss of appetite. Laboratory findings revealed granulocytosis, mildly elevated AST and ALT levels, elevated BUN and Cr levels, and a significantly elevated CRP level. No pathogenic bacteria were isolated from blood, urine, or cerebrospinal fluid cultures. We included leptospirosis in the differential diagnosis because of the patient's history of participating in a survival camp on Iriomote Island. Minocycline 200 mg, p.o. showed an excellent efficacy. The Leptospira flagellar gene FlaB was detected using a cerebrospinal fluid PCR. A microscopic agglutination test (MAT) during the convalescent stage demonstrated significant increases in antibodies against L. interrogans serovar Rachmati, confirming the diagnosis of leptospirosis. A medical history including occupation and recent travel history, and an adequate specimen sampling are crucial for the accurate and early diagnosis of leptospirosis.

  8. Heteropolymeric triplex-based genomic assay to detect pathogens or single-nucleotide polymorphisms in human genomic samples.

    Directory of Open Access Journals (Sweden)

    Jasmine I Daksis

    Full Text Available Human genomic samples are complex and are considered difficult to assay directly without denaturation or PCR amplification. We report the use of a base-specific heteropolymeric triplex, formed by native duplex genomic target and an oligonucleotide third strand probe, to assay for low copy pathogen genomes present in a sample also containing human genomic duplex DNA, or to assay human genomic duplex DNA for Single Nucleotide Polymorphisms (SNP, without PCR amplification. Wild-type and mutant probes are used to identify triplexes containing FVL G1691A, MTHFR C677T and CFTR mutations. The specific triplex structure forms rapidly at room temperature in solution and may be detected without a separation step. YOYO-1, a fluorescent bis-intercalator, promotes and signals the formation of the specific triplex. Genomic duplexes may be assayed homogeneously with single base pair resolution. The specific triple-stranded structures of the assay may approximate homologous recombination intermediates, which various models suggest may form in either the major or minor groove of the duplex. The bases of the stable duplex target are rendered specifically reactive to the bases of the probe because of the activity of intercalated YOYO-1, which is known to decondense duplex locally 1.3 fold. This may approximate the local decondensation effected by recombination proteins such as RecA in vivo. Our assay, while involving triplex formation, is sui generis, as it is not homopurine sequence-dependent, as are "canonical triplexes". Rather, the base pair-specific heteropolymeric triplex of the assay is conformation-dependent. The highly sensitive diagnostic assay we present allows for the direct detection of base sequence in genomic duplex samples, including those containing human genomic duplex DNA, thereby bypassing the inherent problems and cost associated with conventional PCR based diagnostic assays.

  9. Prevalence of pathogenic Yersinia enterocolitica in minced meat, pig tongues and hearts at the retail level in the Czech Republic detected by real time PCR

    Directory of Open Access Journals (Sweden)

    Alena Lorencova

    2016-06-01

    Full Text Available Yersiniosis is the third most frequently reported zoonosis in the European Union and Yersinia enterocolitica is the most common species causing human infections. Pigs are assumed to be the main reservoir of human pathogenic Y. enterocolitica with the presence of bacteria mainly in the tonsils and intestinal content. Undercooked pork and pork products have been suggested as the primary source of human yersiniosis. Nevertheless, data on the prevalence of pathogenic Y. enterocolitica in foodstuffs including pork products are very limited. A molecular based method (real time PCR targeting the ompF gene (detection of Yersinia genus and the ail gene (a chromosomally located virulence marker of Y. enterocolitica was used to determine the prevalence of pathogenic Y. enterocolitica in minced meat and edible pork offal at the retail level in the Czech Republic. A total of 50 pig tongues, 50 pig hearts, and 93 samples of minced meat containing pork were purchased at nine retail outlets in Brno. High detection rates of Yersinia spp. were found in all types of samples (pig tongues, 80.0%; pig hearts, 40.0%; and minced meat, 55.9%. The highest prevalence of pathogenic Y. enterocolitica was found in pig tongues (40.0%, followed by pig hearts (18.0% and minced meat samples (17.2%. Although from the point of view of food safety the merely molecular detection of DNA of the pathogenic bacteria could represent a false positive result, our results indicate the presence of pathogenic Y. enterocolitica in raw pork products at the retail level in the Czech Republic, which may pose a risk of consumer infection. Sufficient heat treatment and prevention of cross-contamination during preparation of food in the kitchen should be recommended.

  10. Development of a visual loop-mediated isothermal amplification method for rapid detection of the bacterial pathogen Pseudomonas putida of the large yellow croaker (Pseudosciaena crocea).

    Science.gov (United States)

    Mao, Zhijuan; Qiu, Yangyu; Zheng, Lei; Chen, Jigang; Yang, Jifang

    2012-06-01

    In recent years, the large yellow croaker (Pseudosciaena crocea), an important marine fish farmed in the coastal areas of Zhejiang province, east China, has become severely endangered as a result of the bacterial pathogen Pseudomonas putida. This paper reports the development of a visual loop-mediated isothermal amplification (LAMP) assay for rapid detection of the pathogen. Four primers, F3, B3, FIP and BIP, were designed on the basis of DNA sequence of the rpoN gene of P. putida. After optimization of the reaction conditions, the detection limit of LAMP assay was 4.8cfu per reaction, 10-fold higher than that of conventional PCR. The assay showed high specificity to discriminate all P. putida isolates from nine other Gram-negative bacteria. The assay also successfully detected the pathogen DNA in the tissues of infected fish. For visual LAMP without cross-contamination, SYBR Green I was embedded in a microcrystalline wax capsule and preset in the reaction tubes; after the reaction the wax was melted at 85°C to release the dye and allow intercalation with the amplicons. The simple, highly sensitive, highly specific and cost-effective characteristics of visual LAMP may encourage its application in the rapid diagnosis of this pathogen.

  11. Rapid detection of virulence-associated genes in avian pathogenic Escherichia coli by multiplex polymerase chain reaction.

    Science.gov (United States)

    Ewers, Christa; Janssen, Traute; Kiessling, Sabine; Philipp, Hans-C; Wieler, Lothar H

    2005-06-01

    the protocol was concluded to be a useful, sensitive, and rapid assay system to detect avian pathogenic E. coli and differentiate them from nonpathogenic strains and those belonging to other pathotypes.

  12. Molecular detection of the human pathogenic Rickettsia sp. strain Atlantic rainforest in Amblyomma dubitatum ticks from Argentina.

    Science.gov (United States)

    Monje, Lucas D; Nava, Santiago; Eberhardt, Ayelen T; Correa, Ana I; Guglielmone, Alberto A; Beldomenico, Pablo M

    2015-02-01

    To date, three tick-borne pathogenic Rickettsia species have been reported in different regions of Argentina, namely, R. rickettsii, R. parkeri, and R. massiliae. However, there are no reports available for the presence of tick-borne pathogens from the northeastern region of Argentina. This study evaluated the infection with Rickettsia species of Amblyomma dubitatum ticks collected from vegetation and feeding from capybaras (Hydrochoerus hydrochaeris) in northeastern Argentina. From a total of 374 A. dubitatum ticks collected and evaluated by PCR for the presence of rickettsial DNA, 19 were positive for the presence of Rickettsia bellii DNA, two were positive for Rickettsia sp. strain COOPERI, and one was positive for the pathogenic Rickettsia sp. strain Atlantic rainforest. To our knowledge, this study is the first report of the presence of the human pathogen Rickettsia sp. strain Atlantic rainforest and Rickettsia sp. strain COOPERI in Argentina. Moreover, our findings posit A. dubitatum as a potential vector for this pathogenic strain of Rickettsia.

  13. Autonomic Nervous System Disorders

    Science.gov (United States)

    Your autonomic nervous system is the part of your nervous system that controls involuntary actions, such as the beating of your heart ... breathing and swallowing Erectile dysfunction in men Autonomic nervous system disorders can occur alone or as the result ...

  14. Autoimmune Autonomic Ganglionopathy

    Science.gov (United States)

    ... Accessed 9/2/2015. Autoimmune Autonomic Ganglionopathy Summary. Dysautonomia International . http://www.dysautonomiainternational.org/page.php?ID= ... page Basic Information In Depth Information Basic Information Dysautonomia International offers an information page on Autoimmune autonomic ...

  15. Novel technologies for foodborne pathogenic microorganism detection%食源性致病微生物的检测新技术

    Institute of Scientific and Technical Information of China (English)

    陈玉婷; 程楠; 许文涛

    2015-01-01

    It is very important to establish an effective detection method of foodborne pathogenic microorganism for food safety risk control and people's health. Based on a brief introduction to traditional microbial detection technology, some novel methods to detect foodborne pathogenic microorganism were introduced in this paper, including microbial test paper detection technology, microbial metabolites detection technology, microbial immunological detection technology, microbial DNA detection technology, microbial sensor detection technology, etc. Then the basic principle, advantages and disadvantages and application were analyzed, respectively. Finally, the trends of novel detection technologies for foodborne pathogenic microorganism were proposed.%研究和建立食源性致病微生物的有效检测方法对于食品安全风险控制及人们的身体健康具有重要意义。本文在简要介绍微生物传统检测技术的基础上,系统地介绍了各类食源性致病微生物检测新方法,包括微生物试纸片检测技术、微生物代谢物检测技术、微生物免疫学检测技术、微生物DNA检测技术、微生物传感器检测技术等,分析了各类食源性微生物检测方法的基本原理、优缺点和应用,并对食源性致病微生物的检测新技术的发展提出了设想。

  16. Novel technologies for foodborne pathogenic microorganism detection%食源性致病微生物的检测新技术

    Institute of Scientific and Technical Information of China (English)

    陈玉婷; 程楠; 许文涛

    2015-01-01

    研究和建立食源性致病微生物的有效检测方法对于食品安全风险控制及人们的身体健康具有重要意义。本文在简要介绍微生物传统检测技术的基础上,系统地介绍了各类食源性致病微生物检测新方法,包括微生物试纸片检测技术、微生物代谢物检测技术、微生物免疫学检测技术、微生物DNA检测技术、微生物传感器检测技术等,分析了各类食源性微生物检测方法的基本原理、优缺点和应用,并对食源性致病微生物的检测新技术的发展提出了设想。%It is very important to establish an effective detection method of foodborne pathogenic microorganism for food safety risk control and people's health. Based on a brief introduction to traditional microbial detection technology, some novel methods to detect foodborne pathogenic microorganism were introduced in this paper, including microbial test paper detection technology, microbial metabolites detection technology, microbial immunological detection technology, microbial DNA detection technology, microbial sensor detection technology, etc. Then the basic principle, advantages and disadvantages and application were analyzed, respectively. Finally, the trends of novel detection technologies for foodborne pathogenic microorganism were proposed.

  17. A Detailed Protocol to Enable Safe-Handling, Preemptive Detection, and Systematic Surveillance of Rat-Vectored Pathogens in the Urban Environment

    Science.gov (United States)

    Parsons, Michael H.; Sarno, Ronald J.; Deutsch, Michael A.

    2016-01-01

    We detail a five-stage protocol to address physical barriers and experimental limitations that have hindered routine pathogen monitoring of wild rats in urban settings. New York City potentially harbors from 2 to 32 million rats among its 8-million people. However, at a time, when people are most vulnerable to disease from over-crowdedness brought on by increased urbanization of society, the difficulty of studying wild rats has led to a paucity of ecological and epidemiological research. Challenges of safely handling animals and the difficulties of identifying individual animals and the emergence of their respective pathogen loads (timing of infection) have impeded progress. We previously reported a method using radio frequency identification paired with load cell and camera traps to enable the identification of individual animals and subsequent monitoring of the animals’ weights (an indicator of health). However, efficient pathogen surveillance requires repeated captures of the same individual in order to isolate and document the emergence of new pathogens, or variations in pathogen load, over time. Most of these barriers are now addressed in our protocol, which is aided by the use of a mobile, outdoor laboratory, followed by incorporation of pheromone-based lures to attract individuals back to active sensors, within a camera trap. This approach allows for the assessment of individual animal health, behaviors under camera, and changing pathogen loads and weights in most urban environments (e.g., financial district, docks, sewers, and residential). Five phases are described and presented: (1) site selection and urban trapping, (2) anesthetization, (3) serological and ectoparasite collection, (4) microchip implantation, and (5) retrapping and luring animals back to active remote sensors. In order to fulfill the unmet call for preemptive pathogen surveillance, public health officials and researchers may wish to adapt, or modify, similar protocols to ensure early

  18. A Detailed Protocol to Enable Safe-Handling, Preemptive Detection, and Systematic Surveillance of Rat-Vectored Pathogens in the Urban Environment.

    Science.gov (United States)

    Parsons, Michael H; Sarno, Ronald J; Deutsch, Michael A

    2016-01-01

    We detail a five-stage protocol to address physical barriers and experimental limitations that have hindered routine pathogen monitoring of wild rats in urban settings. New York City potentially harbors from 2 to 32 million rats among its 8-million people. However, at a time, when people are most vulnerable to disease from over-crowdedness brought on by increased urbanization of society, the difficulty of studying wild rats has led to a paucity of ecological and epidemiological research. Challenges of safely handling animals and the difficulties of identifying individual animals and the emergence of their respective pathogen loads (timing of infection) have impeded progress. We previously reported a method using radio frequency identification paired with load cell and camera traps to enable the identification of individual animals and subsequent monitoring of the animals' weights (an indicator of health). However, efficient pathogen surveillance requires repeated captures of the same individual in order to isolate and document the emergence of new pathogens, or variations in pathogen load, over time. Most of these barriers are now addressed in our protocol, which is aided by the use of a mobile, outdoor laboratory, followed by incorporation of pheromone-based lures to attract individuals back to active sensors, within a camera trap. This approach allows for the assessment of individual animal health, behaviors under camera, and changing pathogen loads and weights in most urban environments (e.g., financial district, docks, sewers, and residential). Five phases are described and presented: (1) site selection and urban trapping, (2) anesthetization, (3) serological and ectoparasite collection, (4) microchip implantation, and (5) retrapping and luring animals back to active remote sensors. In order to fulfill the unmet call for preemptive pathogen surveillance, public health officials and researchers may wish to adapt, or modify, similar protocols to ensure early

  19. [Trigeminal autonomic cephalgias].

    Science.gov (United States)

    Maximova, M Yu; Piradov, M A; Suanova, E T; Sineva, N A

    2015-01-01

    Review of literature on the trigeminal autonomic cephalgias are presented. Trigeminal autonomic cephalgias are primary headaches with phenotype consisting of trigeminal pain with autonomic sign including lacrimation, rhinorrhea and miosis. Discussed are issues of classification, pathogenesis, clinical picture, diagnosis, differential diagnosis and treatment of this headache. Special attention is paid to cluster headache, paroxysmal hemicrania, SUNCT syndrome, hemicrania continua.

  20. Nanomaterial-based sensors for detection of foodborne bacterial pathogens and toxins as well as pork adulteration in meat products

    Directory of Open Access Journals (Sweden)

    B. Stephen Inbaraj

    2016-01-01

    Full Text Available Food safety draws considerable attention in the modern pace of the world owing to rapid-changing food recipes and food habits. Foodborne illnesses associated with pathogens, toxins, and other contaminants pose serious threat to human health. Besides, a large amount of money is spent on both analyses and control measures, which causes significant loss to the food industry. Conventional detection methods for bacterial pathogens and toxins are time consuming and laborious, requiring certain sophisticated instruments and trained personnel. In recent years, nanotechnology has emerged as a promising field for solving food safety issues in terms of detecting contaminants, enabling controlled release of preservatives to extend the shelf life of foods, and improving food-packaging strategies. Nanomaterials including metal oxide and metal nanoparticles, carbon nanotubes, and quantum dots are gaining a prominent role in the design of sensors and biosensors for food analysis. In this review, various nanomaterial-based sensors reported in the literature for detection of several foodborne bacterial pathogens and toxins are summarized highlighting their principles, advantages, and limitations in terms of simplicity, sensitivity, and multiplexing capability. In addition, the application through a noncross-linking method without the need for any surface modification is also presented for detection of pork adulteration in meat products.

  1. Human GBP1 does not localize to pathogen vacuoles but restricts Toxoplasma gondii.

    Science.gov (United States)

    Johnston, Ashleigh C; Piro, Anthony; Clough, Barbara; Siew, Malvin; Virreira Winter, Sebastian; Coers, Jörn; Frickel, Eva-Maria

    2016-08-01

    Guanylate binding proteins (GBPs) are a family of large interferon-inducible GTPases that are transcriptionally upregulated upon infection with intracellular pathogens. Murine GBPs (mGBPs) including mGBP1 and 2 localize to and disrupt pathogen-containing vacuoles (PVs) resulting in the cell-autonomous clearing or innate immune detection of PV-resident pathogens. Human GBPs (hGBPs) are known to exert antiviral host defense and activate the NLRP3 inflammasome, but it is unclear whether hGBPs can directly recognize and control intravacuolar pathogens. Here, we report that endogenous or ectopically expressed hGBP1 fails to associate with PVs formed in human cells by the bacterial pathogens Chlamydia trachomatis or Salmonella typhimurium or the protozoan pathogen Toxoplasma gondii. While we find that hGBP1 expression has no discernible effect on intracellular replication of C. trachomatis and S. typhimurium, we observed enhanced early Toxoplasma replication in CRISPR hGBP1-deleted human epithelial cells. We thus identified a novel role for hGBP1 in cell-autonomous immunity that is independent of PV translocation, as observed for mGBPs. This study highlights fundamental differences between human and murine GBPs and underlines the need to study the functions of GBPs at cellular locations away from PVs. PMID:26874079

  2. Correlation between Detection of a Plasmid and High-Level Virulence of Vibrio nigripulchritudo, a Pathogen of the Shrimp Litopenaeus stylirostris▿

    OpenAIRE

    Reynaud, Yann; Saulnier, Denis; Mazel, Didier; Goarant, Cyrille; Le Roux, Frédérique

    2008-01-01

    Vibrio nigripulchritudo, the etiological agent of Litopenaeus stylirostris summer syndrome, is responsible for mass mortalities of shrimp in New Caledonia. Epidemiological studies led to the suggestion that this disease is caused by an emergent group of pathogenic strains. Genomic subtractive hybridization was carried out between two isolates exhibiting low and high virulence. Our subtraction library was constituted of 521 specific fragments; 55 of these were detected in all virulent isolates...

  3. DNA Detection and Genotypic Identification of Potentially Human-Pathogenic Microsporidia from Asymptomatic Pet Parrots in South Korea as a Risk Factor for Zoonotic Emergence ▿

    OpenAIRE

    Lee, So-Young; Lee, Sung-Seok; Lyoo, Young S.; Park, Hee-Myung

    2011-01-01

    We detected and identified genotypes of human-pathogenic microsporidia in fecal samples from 51 asymptomatic captive-bred pet parrots in South Korea. Microsporidia were identified in 8 samples (15.7%); 7 parrots tested positive for Encephalitozoon hellem, and 1 parrot tested positive for both E. hellem and Encephalitozoon cuniculi. In genotypic identifications, E. hellem was present in genotypes 1A and 2B and E. cuniculi was present in genotype II. Pet parrots might be a source of human micro...

  4. What makes pathogens pathogenic

    OpenAIRE

    Ehrlich, Garth D.; Hiller, N.Luisa; Hu, Fen Ze

    2008-01-01

    Metazoans contain multiple complex microbial ecosystems in which the balance between host and microbe can be tipped from commensalism to pathogenicity. This transition is likely to depend both on the prevailing environmental conditions and on specific gene-gene interactions placed within the context of the entire ecosystem.

  5. LEO AUTONOMOUS NAVIGATION BASED ON IMAGE MOTION

    Institute of Scientific and Technical Information of China (English)

    DUANFang; LIUJian-ye; YUFeng

    2005-01-01

    A method of LEO autonomous navigation is presented based on the nonlinear satellite velocity relative to the earth. The velocity is detected by a high-speed camera, with the attitude information detected by a star sensor. Compared with traditional autonomous navigation by landmark identification, the satellite velocity relarive to the earth is obtained by correlativity analysis of images. It does not need to recognize ground objects or views. Since it is not necessary to pre-store the database of ground marks, lots of memory space can be saved.The state and observation equations are constructed, and the filtering is processed by the Kalman filter. Simulation results show that the system has high autonomous navigation precision in LEO autonomous navigation.

  6. Multiplex detection of nine food-borne pathogens by mPCR and capillary electrophoresis after using a universal pre-enrichment medium

    Directory of Open Access Journals (Sweden)

    Germán eVillamizar-Rodríguez

    2015-11-01

    Full Text Available Routine microbiological quality analyses in food samples require, in some cases, an initial incubation in pre-enrichment medium. This is necessary in order to assure that small amounts of pathogenic strains are going to be detected. In this work, a universal pre-enrichment medium has been developed for simultaneous growth of Bacillus cereus, Campylobacter jejuni, Clostridium perfringens, Cronobacter sakazakii, Escherichia coli, Enterobacteriaceae family (thirty eight species, twenty seven genera, Listeria monocytogenes, Staphylococcus aureus, Salmonella spp. (two species, thirteen strains. Growth confirmation for all these species was achieved in all cases, with excellent enrichments. This was confirmed by plating on the corresponding selective agar media for each bacterium. This GVUM universal pre-enrichment medium could be useful in food microbiological analyses, where different pathogenic bacteria must be detected after a pre-enrichment step. Following, a mPCR reaction for detection of all these pathogens was developed, after designing a set of nine oligonucleotide pairs from specific genetic targets on gDNA from each of these bacteria, covering all available strains already sequenced in GenBank for them. The detection limits have been 1 Genome Equivalent, with the exception of Fam. Enterobacteriaceae (5 GEs. We obtained amplification for all targets (from 70 to 251 bp, depending on the bacteria type, showing the capability of this method to detect the most important industrial and sanitary food-borne pathogens from a universal pre-enrichment medium. This method includes an initial pre-enrichment step (18 h, followed by a mPCR (2 h and a capillary electrophoresis (30 min; avoiding the tedious and long lasting growing on solid media required in traditional analysis (1 to 4 days, depending on the specific pathogen and verification procedure. An external testing of this method was conducted in order to compare classical and mPCR methods. This

  7. Serological detection of 'Candidatus Liberibacter asiaticus' in citrus, and identification by GeLC-MS/MS of a chaperone protein responding to cellular pathogens.

    Science.gov (United States)

    Ding, Fang; Duan, Yongping; Yuan, Qing; Shao, Jonathan; Hartung, John S

    2016-01-01

    We describe experiments with antibodies against 'Candidatus Liberibacter asiaticus used to detect the pathogen in infected plants. We used scFv selected to bind epitopes exposed on the surface of the bacterium in tissue prints, with secondary monoclonal antibodies directed at a FLAG epitope included at the carboxyl end of the scFv. Unexpectedly, the anti-FLAG secondary antibody produced positive results with CaLas diseased samples when the primary scFv were not used. The anti-FLAG monoclonal antibody (Mab) also identified plants infected with other vascular pathogens. We then identified a paralogous group of secreted chaperone proteins in the HSP-90 family that contained the amino acid sequence DDDDK identical to the carboxy-terminal sequence of the FLAG epitope. A rabbit polyclonal antibody against one of the same epitopes combined with a goat anti-rabbit secondary antibody produced very strong purple color in individual phloem cells, as expected for this pathogen. These results were entirely specific for CaLas-infected citrus. The simplicity, cost and ability to scale the tissue print assay makes this an attractive assay to complement PCR-based assays currently in use. The partial FLAG epitope may itself be useful as a molecular marker for the rapid screening of citrus plants for the presence of vascular pathogens. PMID:27381064

  8. Breath analysis for in vivo detection of pathogens related to ventilator-associated pneumonia in intensive care patients: a prospective pilot study.

    Science.gov (United States)

    Filipiak, Wojciech; Beer, Ronny; Sponring, Andreas; Filipiak, Anna; Ager, Clemens; Schiefecker, Alois; Lanthaler, Simon; Helbok, Raimund; Nagl, Markus; Troppmair, Jakob; Amann, Anton

    2015-03-01

    Existing methods for the early detection of infections in mechanically ventilated (MV) patients at intensive care units (ICUs) are unsatisfactory. Here we present an exploratory study assessing the feasibility of breath VOC analyses for the non-invasive detection of pathogens in the lower respiratory tract of ventilated patients. An open uncontrolled clinical pilot study was performed by enrolling 28 mechanically ventilated (MV) patients with severe intracranial disease, being at risk for the development of or already with confirmed ventilation-associated pneumonia (VAP). The recently developed sampling technique enabled the collection of breath gas with a maximized contribution of alveolar air directly from the respiratory circuit under continuous capnography control, adsorptive preconcentration and final analysis by means of gas chromatography-mass spectrometry (GC-MS).VAP was confirmed in 22/28 preselected patients (78%). The most common microorganisms were Staphylococcus aureus (5/22 VAP patients), Escherichia coli (5/22 VAP patients) and Candida spp. (5/22 VAP patients). 12/32 metabolites released by S. aureus in our previous in vitro studies were also detected in the end-tidal air of VAP patients infected with this pathogen. A similar overlap was seen in Candida albicans infections (8/29 VOCs). Moreover, the concentration profile of selected compounds correlated with the course of the infection.This prospective pilot study provides proof of the concept that the appearance and the concentration profile of pathogen-derived metabolites (elucidated from in vitro experiments) in the breath of ventilated patients during clinically confirmed VAP correlates with the presence of a particular pathogen. PMID:25557917

  9. Simultaneous detection of eight swine reproductive and respiratory pathogens using a novel GeXP analyser-based multiplex PCR assay.

    Science.gov (United States)

    Zhang, Minxiu; Xie, Zhixun; Xie, Liji; Deng, Xianwen; Xie, Zhiqin; Luo, Sisi; Liu, Jiabo; Pang, Yaoshan; Khan, Mazhar I

    2015-11-01

    A new high-throughput GenomeLab Gene Expression Profiler (GeXP) analyser-based multiplex PCR assay was developed for the detection of eight reproductive and respiratory pathogens in swine. The reproductive and respiratory pathogens include North American porcine reproductive and respiratory syndrome virus (PRRSV-NA), classical swine fever virus (CSFV), porcine circovirus 2 (PCV-2), swine influenza virus (SIV) (including H1 and H3 subtypes), porcine parvovirus (PPV), pseudorabies virus (PRV) and Japanese encephalitis virus (JEV). Nine pairs of specific chimeric primers were designed and used to initiate PCRs, and one pair of universal primers was used for subsequent PCR cycles. The specificity of the GeXP assay was examined using positive controls for each virus. The sensitivity was evaluated using serial ten-fold dilutions of in vitro-transcribed RNA from all of the RNA viruses and plasmids from DNA viruses. The GeXP assay was further evaluated using 114 clinical specimens and was compared with real-time PCR/single RT-PCR methods. The specificity of the GeXP assay for each pathogen was examined using single cDNA/DNA template. Specific amplification peaks of the reproductive and respiratory pathogens were observed on the GeXP analyser. The minimum copies per reaction detected for each virus by the GeXP assay were as follows: 1000 copies/μl for PRV; 100 copies/μl for CSFV, JEV, PCV-2 and PPV; and 10 copies/μl for SIV-H1, SIV-H3 and PRRSV-NA. Analysis of 114 clinical samples using the GeXP assay demonstrated that the GeXP assay had comparable detection to real-time PCR/single RT-PCR. This study demonstrated that the GeXP assay is a new method with high sensitivity and specificity for the identification of these swine reproductive and respiratory pathogens. The GeXP assay may be adopted for molecular epidemiological surveys of these reproductive and respiratory pathogens in swine populations. PMID:26259690

  10. Target-catalyzed autonomous assembly of dendrimer-like DNA nanostructures for enzyme-free and signal amplified colorimetric nucleic acids detection.

    Science.gov (United States)

    He, Hongfei; Dai, Jianyuan; Duan, Zhijuan; Meng, Yan; Zhou, Cuisong; Long, Yuyin; Zheng, Baozhan; Du, Juan; Guo, Yong; Xiao, Dan

    2016-12-15

    Self-assembly of DNA nanostructures is of great importance in nanomedicine, nanotechnology and biosensing. Herein, a novel target-catalyzed autonomous assembly pathway for the formation of dendrimer-like DNA nanostructures that only employing target DNA and three hairpin DNA probes was proposed. We use the sticky-ended Y shape DNA (Y-DNA) as the assembly monomer and it was synthesized by the catalyzed hairpin assembly (CHA) instead of the DNA strand annealing method. The formed Y-DNA was equipped with three ssDNA sticky ends and two of them were predesigned to be complementary to the third one, then the dendrimer-like DNA nanostructures can be obtained via an autonomous assembly among these sticky-ended Y-DNAs. The resulting nanostructure has been successfully applied to develop an enzyme-free and signal amplified gold nanoparticle (AuNP)-based colorimetric nucleic acids assay. PMID:27498325

  11. Research project RoboGas{sup Inspector}. Gas leak detection with autonomous mobile robots; Forschungsprojekt RoboGas{sup Inspector}. Gaslecksuche mit autonomen mobilen Robotern

    Energy Technology Data Exchange (ETDEWEB)

    Habib, Abdelkarim [BAM Bundesanstalt fuer Materialforschung und -pruefung, Berlin (Germany); Bonow, Gero; Kroll, Andreas [Fachgebiet Mess- und Regelungstechnik, Universitaet Kassel, Kassel (Germany); Hegenberg, Jens; Schmidt, Ludger [Fachgebiet Mensch-Maschine-Systemtechnik, Universitaet Kassel, Kassel (Germany); Barz, Thomas; Schulz, Dirk [Fraunhofer FKIE, Unbemannte Systeme, Wachtberg (Germany)

    2013-05-15

    As part of the promotional program AUTONOMIK of the Federal Ministry of Economics and Technology (Berlin, Federal Republic of Germany) a consortium of nine project partners developed a prototype of an autonomous mobile robot looking for gas leaks in extended industrial equipment. The autonomous mobility of the system for any systems was implemented using different types of sensors for self-localization and navigation. The tele-operation enables a manual intervention in the process. The robot performs inspection tasks in industrial plants by means of video technology and remote gas measurement technology without driving into the possible risk areas and without the presence of humans. The robot can be used for routine inspections of facilities or for the targeted inspection of specific plant components. Thanks to the remote sensing technique also plant components can be inspected which are difficult to be inspected due to their limited accessibility by conventional measurement techniques.

  12. Research progress in detection techniques for foodborne pathogen%食源性致病细菌检测技术研究进展

    Institute of Scientific and Technical Information of China (English)

    侯进慧; 蔡侃; 樊继强

    2012-01-01

    对几种常见的食源性致病细菌检测技术进行了综述,对以聚合酶链式反应(PCR)方法为基础的检测技术进行了分析,将PCR检测食源性致病菌所需要用到的靶基因及其引物等进行了归纳,并对食源性致病菌检测技术的发展提出了建议。%Several kinds of detection techniques for common foodborne pathegens were reviewed.Detection methods based on PCR were analyzed especially,and target genes and their primers of some foodborne pathogens involved in PCR detection were summarized.Furthermore,some suggestions were given to the development of detection techniques for foodborne pathegens.

  13. Detection of respiratory pathogens in pediatric acute otitis media by PCR and comparison of findings in the middle ear and nasopharynx.

    Science.gov (United States)

    Yatsyshina, Svetlana; Mayanskiy, Nikolay; Shipulina, Olga; Kulichenko, Tatiana; Alyabieva, Natalia; Katosova, Lyubovj; Lazareva, Anna; Skachkova, Tatyana; Elkina, Maria; Matosova, Svetlana; Shipulin, German

    2016-05-01

    We conducted a series of polymerase chain reactions (PCRs) in order to detect bacteria (7 species) and viruses (17 species) in middle ear fluid (MEF) and nasopharynx (Nph) of children with acute otitis media (AOM; n=179). Bacterial and viral nucleic acids were detected in MEF of 78.8% and 14.5% patients, respectively. The prevalence was as follows: Streptococcus pneumoniae, 70.4%; Haemophilus influenzae, 17.9%; Staphylococcus aureus, 16.8%; Streptococcus pyogenes, 12.3%; Moraxella catarrhalis, 9.5%; rhinovirus, 9.5%; and adenovirus, 3.4%. The overall rate of PCR-positive specimens for bacterial pathogens was 2.6 times higher, compared to culture results. The rate of PCR-positive results and the distribution of pathogens in the Nph were similar to those in the MEF. Nph PCR results had variable positive predictive values and high negative predictive values in predicting MEF findings. Our results indicate that Nph PCR could be a practical tool for examining respiratory pathogens in children with acute infections.

  14. A method to detect metal-drug complexes and their interactions with pathogenic bacteria via graphene nanosheet assist laser desorption/ionization mass spectrometry and biosensors

    Energy Technology Data Exchange (ETDEWEB)

    Abdelhamid, Hani Nasser [Department of Chemistry, National Sun Yat-Sen University, Kaohsiung, 804, Taiwan (China); Wu, Hui-Fen, E-mail: hwu@faculty.nsysu.edu.tw [Department of Chemistry, National Sun Yat-Sen University, Kaohsiung, 804, Taiwan (China); School of Pharmacy, College of Pharmacy, Kaohsiung Medical University, Kaohsiung, 800, Taiwan (China); Center for Nanoscience and Nanotechnology, National Sun Yat-Sen University, Kaohsiung, 804, Taiwan (China); Doctoral Degree Program in Marine Biotechnology, National Sun Yat-Sen University, Kaohsiung, 804, Taiwan (China)

    2012-11-02

    Highlights: Black-Right-Pointing-Pointer Probe transition metals-complexes based on noncovalent functionalized graphene for MALDI-MS. Black-Right-Pointing-Pointer Study interaction of transition metals complexes with pathogenic bacteria. Black-Right-Pointing-Pointer Propose a new biosensor for two pathogenic bacteria. - Abstract: A new method was proposed to probe the interactions between transition metals of Fe(II), Fe(III), Cu(II) with a non steroidal anti-inflammatory drug (NSAID), flufenamic acid (FF) using graphene as a matrix for Graphene assisted laser desorption ionization mass spectrometry (GALDI-MS). Metal-drug complexation was confirmed via UV absorption spectroscopy, fluorescence spectroscopy, pH meter, and change in solution conductivity. The optimal molar ratios for these complexation interactions are stoichiometry 1:2 in both Cu(II) and Fe(II) complexes, and 1:3 in Fe(III) complexes at physiological pH (7.4). Metal complexation of the drug could enhance fluorescence for 20 fold which is due to the charge transfer reaction or increase rigidity of the drug. The main interaction between graphene and flufenamic acid is the {Pi}-{Pi} interaction which allows us to probe the metal-drug complexation. The GALDI-MS could sensitively detect the drug at m/z 281.0 Da (protonated molecule) with detection limit 2.5 pmol (1.0 {mu}M) and complexation at m/z 661.0, 654.0 and 933.0 Da corresponding to [Cu(II)(FF){sub 2}(H{sub 2}O){sub 2} + H]{sup +}, [Fe(II)(FF){sub 2}(H{sub 2}O){sub 2} + H]{sup +} and [Fe(III) (FF){sub 3}(H{sub 2}O){sub 2} + H]{sup +}, respectively (with limit of detection (LOD) 2.0 pmol (10.0 {mu}M). Matrix assisted laser desorption ionization mass spectrometry (MALDI-MS) spectra show change in the protein profile of intact pathogenic bacteria (Pseudomonas aeroginosa, Staphylococcus aureus). The change in the ionization ability (mainly proton affinity) of pathogenic bacteria may be due to the interactions between the bacteria with the drug (or its

  15. A phage-displayed chicken single-chain antibody fused to alkaline phosphatase detects Fusarium pathogens and their presence in cereal grains

    International Nuclear Information System (INIS)

    Graphical abstract: A phage-displayed chicken scFv antibody, FvSG7, binds on the surface antigen of conidiospores and the mycelia of F. verticillioides. Its fusion with alkaline phosphatase (AP) through a 218 linker displayed a 4-fold higher affinity compared with the parent scFv antibody and efficiently detected toxigenic Fusarium pathogens in cereal grains. Highlights: ► Generation of a highly reactive scFv antibody against F. verticillioides. ► Localization of the antibody binding to the surface target of F. verticillioides. ► Expression of the antibody–alkaline phosphatase (AP) fusion linked by a 218 linker. ► The antibody–AP fusion has a higher affinity than the parental antibody. ► The antibody–AP fusion detects toxigenic Fusarium pathogens in cereal grains. -- Abstract: Fusarium and its poisonous mycotoxins are distributed worldwide and are of particular interest in agriculture and food safety. A simple analytical method to detect pathogens is essential for forecasting diseases and controlling mycotoxins. This article describes a proposed method for convenient and sensitive detection of Fusarium pathogens that uses the fusion of single-chain variable fragment (scFv) and alkaline phosphatase (AP). A highly reactive scFv antibody specific to soluble cell wall-bound proteins (SCWPs) of F. verticillioides was selected from an immunized chicken phagemid library by phage display. The antibody was verified to bind on the surface of ungerminated conidiospores and mycelia of F. verticillioides. The scFv–AP fusion was constructed, and soluble expression in bacteria was confirmed. Both the antibody properties and enzymatic activity were retained, and the antigen-binding capacity of the fusion was enhanced by the addition of a linker. Surface plasmon resonance measurements confirmed that the fusion displayed 4-fold higher affinity compared with the fusion's parental scFv antibody. Immunoblot analyses showed that the fusion had good binding capacity to

  16. A phage-displayed chicken single-chain antibody fused to alkaline phosphatase detects Fusarium pathogens and their presence in cereal grains

    Energy Technology Data Exchange (ETDEWEB)

    Hu, Zu-Quan [Molecular Biotechnology Laboratory of Triticeae Crops, Huazhong Agricultural University, Wuhan 430070 (China); Li, He-Ping [Molecular Biotechnology Laboratory of Triticeae Crops, Huazhong Agricultural University, Wuhan 430070 (China); College of Life Science and Technology, Huazhong Agricultural University, Wuhan 430070 (China); Zhang, Jing-Bo [Molecular Biotechnology Laboratory of Triticeae Crops, Huazhong Agricultural University, Wuhan 430070 (China); College of Plant Science and Technology, Huazhong Agricultural University, Wuhan 430070 (China); Huang, Tao [Molecular Biotechnology Laboratory of Triticeae Crops, Huazhong Agricultural University, Wuhan 430070 (China); College of Life Science and Technology, Huazhong Agricultural University, Wuhan 430070 (China); Liu, Jin-Long; Xue, Sheng [Molecular Biotechnology Laboratory of Triticeae Crops, Huazhong Agricultural University, Wuhan 430070 (China); Wu, Ai-Bo [Institute for Agri-food Standards and Testing Technology, Laboratory of Quality and Safety Risk Assessment for Agro-products, Ministry of Agriculture, Shanghai Academy of Agricultural Sciences, 1000 Jinqi Road, Shanghai 201403 (China); Liao, Yu-Cai, E-mail: ycliao06@yahoo.com.cn [Molecular Biotechnology Laboratory of Triticeae Crops, Huazhong Agricultural University, Wuhan 430070 (China); College of Plant Science and Technology, Huazhong Agricultural University, Wuhan 430070 (China); National Center of Plant Gene Research, Wuhan 430070 (China)

    2013-02-18

    Graphical abstract: A phage-displayed chicken scFv antibody, FvSG7, binds on the surface antigen of conidiospores and the mycelia of F. verticillioides. Its fusion with alkaline phosphatase (AP) through a 218 linker displayed a 4-fold higher affinity compared with the parent scFv antibody and efficiently detected toxigenic Fusarium pathogens in cereal grains. Highlights: ► Generation of a highly reactive scFv antibody against F. verticillioides. ► Localization of the antibody binding to the surface target of F. verticillioides. ► Expression of the antibody–alkaline phosphatase (AP) fusion linked by a 218 linker. ► The antibody–AP fusion has a higher affinity than the parental antibody. ► The antibody–AP fusion detects toxigenic Fusarium pathogens in cereal grains. -- Abstract: Fusarium and its poisonous mycotoxins are distributed worldwide and are of particular interest in agriculture and food safety. A simple analytical method to detect pathogens is essential for forecasting diseases and controlling mycotoxins. This article describes a proposed method for convenient and sensitive detection of Fusarium pathogens that uses the fusion of single-chain variable fragment (scFv) and alkaline phosphatase (AP). A highly reactive scFv antibody specific to soluble cell wall-bound proteins (SCWPs) of F. verticillioides was selected from an immunized chicken phagemid library by phage display. The antibody was verified to bind on the surface of ungerminated conidiospores and mycelia of F. verticillioides. The scFv–AP fusion was constructed, and soluble expression in bacteria was confirmed. Both the antibody properties and enzymatic activity were retained, and the antigen-binding capacity of the fusion was enhanced by the addition of a linker. Surface plasmon resonance measurements confirmed that the fusion displayed 4-fold higher affinity compared with the fusion's parental scFv antibody. Immunoblot analyses showed that the fusion had good binding

  17. Molecular analysis of bacterial communities and detection of potential pathogens in a recirculating aquaculture system for Scophthalmus maximus and Solea senegalensis.

    Directory of Open Access Journals (Sweden)

    Patrícia Martins

    Full Text Available The present study combined a DGGE and barcoded 16S rRNA pyrosequencing approach to assess bacterial composition in the water of a recirculating aquaculture system (RAS with a shallow raceway system (SRS for turbot (Scophthalmus maximus and sole (Solea senegalensis. Barcoded pyrosequencing results were also used to determine the potential pathogen load in the RAS studied. Samples were collected from the water supply pipeline (Sup, fish production tanks (Pro, sedimentation filter (Sed, biofilter tank (Bio, and protein skimmer (Ozo; also used as an ozone reaction chamber of twin RAS operating in parallel (one for each fish species. Our results revealed pronounced differences in bacterial community composition between turbot and sole RAS, suggesting that in the systems studied there is a strong species-specific effect on water bacterial communities. Proteobacteria was the most abundant phylum in the water supply and all RAS compartments. Other important taxonomic groups included the phylum Bacteriodetes. The saltwater supplied displayed a markedly lower richness and appeared to have very little influence on bacterial composition. The following potentially pathogenic species were detected: Photobacterium damselae in turbot (all compartments, Tenacibaculum discolor in turbot and sole (all compartments, Tenacibaculum soleae in turbot (all compartments and sole (Pro, Sed and Bio, and Serratia marcescens in turbot (Sup, Sed, Bio and Ozo and sole (only Sed RAS. Despite the presence of these pathogens, no symptomatic fish were observed. Although we were able to identify potential pathogens, this approach should be employed with caution when monitoring aquaculture systems, as the required phylogenetic resolution for reliable identification of pathogens may not always be possible to achieve when employing 16S rRNA gene fragments.

  18. Molecular analysis of bacterial communities and detection of potential pathogens in a recirculating aquaculture system for Scophthalmus maximus and Solea senegalensis.

    Science.gov (United States)

    Martins, Patrícia; Cleary, Daniel F R; Pires, Ana C C; Rodrigues, Ana Maria; Quintino, Victor; Calado, Ricardo; Gomes, Newton C M

    2013-01-01

    The present study combined a DGGE and barcoded 16S rRNA pyrosequencing approach to assess bacterial composition in the water of a recirculating aquaculture system (RAS) with a shallow raceway system (SRS) for turbot (Scophthalmus maximus) and sole (Solea senegalensis). Barcoded pyrosequencing results were also used to determine the potential pathogen load in the RAS studied. Samples were collected from the water supply pipeline (Sup), fish production tanks (Pro), sedimentation filter (Sed), biofilter tank (Bio), and protein skimmer (Ozo; also used as an ozone reaction chamber) of twin RAS operating in parallel (one for each fish species). Our results revealed pronounced differences in bacterial community composition between turbot and sole RAS, suggesting that in the systems studied there is a strong species-specific effect on water bacterial communities. Proteobacteria was the most abundant phylum in the water supply and all RAS compartments. Other important taxonomic groups included the phylum Bacteriodetes. The saltwater supplied displayed a markedly lower richness and appeared to have very little influence on bacterial composition. The following potentially pathogenic species were detected: Photobacterium damselae in turbot (all compartments), Tenacibaculum discolor in turbot and sole (all compartments), Tenacibaculum soleae in turbot (all compartments) and sole (Pro, Sed and Bio), and Serratia marcescens in turbot (Sup, Sed, Bio and Ozo) and sole (only Sed) RAS. Despite the presence of these pathogens, no symptomatic fish were observed. Although we were able to identify potential pathogens, this approach should be employed with caution when monitoring aquaculture systems, as the required phylogenetic resolution for reliable identification of pathogens may not always be possible to achieve when employing 16S rRNA gene fragments. PMID:24278329

  19. Application of DNA Aptamers and Quantum Dots to Lateral Flow Test Strips for Detection of Foodborne Pathogens with Improved Sensitivity versus Colloidal Gold.

    Science.gov (United States)

    Bruno, John G

    2014-01-01

    Preliminary studies aimed at improving the sensitivity of foodborne pathogen detection via lateral flow (LF) test strips by use of high affinity DNA aptamers for capture and reporter functions when coupled to red-emitting quantum dots (Qdot 655) are reported. A variety of DNA aptamers developed against Escherichia coli, Listeria monocytogenes, and Salmonella enterica were paired in capture and reporter combinations to determine which yielded the strongest detection of their cognate bacteria using a colloidal gold screening system. Several promising sandwich combinations were identified for each of the three bacterial LF strip systems. The best E. coli aptamer-LF system was further studied and yielded a visible limit of detection (LOD) of ~3,000 E. coli 8739 and ~6,000 E. coli O157:H7 in buffer. These LODs were reduced to ~300-600 bacterial cells per test respectively by switching to a Qdot 655 aptamer-LF system. Novel aspects of these assays such as the use of high levels of detergents to avoid quantum dot agglutination and enhance migration in analytical membranes, identification of optimal analytical membrane types, UV-immobilization of capture aptamers, and novel dual biotin/digoxigenin-end labeled aptamer streptavidin-colloidal gold or -Qdot 655 conjugates plus anti-digoxigenin antibody control lines are also discussed. In general, this work provides proof-of-principle for highly sensitive aptamer-Qdot LF strip assays for rapid foodborne pathogen detection. PMID:25437803

  20. Application of DNA Aptamers and Quantum Dots to Lateral Flow Test Strips for Detection of Foodborne Pathogens with Improved Sensitivity versus Colloidal Gold

    Directory of Open Access Journals (Sweden)

    John G. Bruno

    2014-04-01

    Full Text Available Preliminary studies aimed at improving the sensitivity of foodborne pathogen detection via lateral flow (LF test strips by use of high affinity DNA aptamers for capture and reporter functions when coupled to red-emitting quantum dots (Qdot 655 are reported. A variety of DNA aptamers developed against Escherichia coli, Listeria monocytogenes, and Salmonella enterica were paired in capture and reporter combinations to determine which yielded the strongest detection of their cognate bacteria using a colloidal gold screening system. Several promising sandwich combinations were identified for each of the three bacterial LF strip systems. The best E. coli aptamer-LF system was further studied and yielded a visible limit of detection (LOD of ~3,000 E. coli 8739 and ~6,000 E. coli O157:H7 in buffer. These LODs were reduced to ~300–600 bacterial cells per test respectively by switching to a Qdot 655 aptamer-LF system. Novel aspects of these assays such as the use of high levels of detergents to avoid quantum dot agglutination and enhance migration in analytical membranes, identification of optimal analytical membrane types, UV-immobilization of capture aptamers, and novel dual biotin/digoxigenin-end labeled aptamer streptavidin-colloidal gold or -Qdot 655 conjugates plus anti-digoxigenin antibody control lines are also discussed. In general, this work provides proof-of-principle for highly sensitive aptamer-Qdot LF strip assays for rapid foodborne pathogen detection.

  1. Integrated lab-on-a-chip: a combined sample preparation and PCR system as an ultrafast analytical tool for pathogen detection

    Science.gov (United States)

    Becker, Holger; Hlawatsch, Nadine; Klemm, Richard; Gärtner, Claudia

    2011-02-01

    Lab-on-a-chip systems are seen as a very promising approach for a decentralized continuous pathogen monitoring technology. In this paper, we present the development of a fully integrated device for the multiplexed nucleic-acid based identification of pathogens. Due to the complexity of such a fully integrated device, in a first development step, functional modules for the various process steps like lysis, DNA extraction and purification, continuous-flow PCR and detection have been developed and evaluated, allowing a functional verification prior to integration. All the modules as well as the final integrated device have been manufactured using scaleable industrial manufacturing methods, namely injection molding in order to facilitate commercialization.

  2. A CCD-based fluorescence imaging system for real-time loop-mediated isothermal amplification-based rapid and sensitive detection of waterborne pathogens on microchips.

    Science.gov (United States)

    Ahmad, Farhan; Seyrig, Gregoire; Tourlousse, Dieter M; Stedtfeld, Robert D; Tiedje, James M; Hashsham, Syed A

    2011-10-01

    Rapid, sensitive, and low-cost pathogen diagnostic systems are needed for early disease diagnosis and treatment, especially in resource-limited settings. This study reports a low-cost charge-coupled device (CCD)-based fluorescence imaging system for rapid detection of waterborne pathogens by isothermal gene amplification in disposable microchips. Fluorescence imaging capability of this monochromatic CCD camera is evaluated by optimizing the gain, offset, and exposure time. This imaging system is validated for 12 virulence genes of major waterborne pathogens on cyclic olefin polymer (COP) microchips, using SYTO-82 dye and real time fluorescence loop-mediated isothermal amplification referred here as microRT(f)-LAMP. Signal-to-noise ratio (SNR) and threshold time (Tt) of microRT(f)-LAMP assays are compared with those from a commercial real-time polymerase chain reaction (PCR) instrument. Applying a CCD exposure of 5 s to 10(5) starting DNA copies of microRT(f)-LAMP assays increases the SNR by 8-fold and reduces the Tt by 9.8 min in comparison to a commercial real-time PCR instrument. Additionally, single copy level sensitivity for Campylobacter jejuni 0414 gene is obtained for microRT(f)-LAMP with a Tt of 19 min, which is half the time of the commercial real-time PCR instrument. Due to the control over the exposure time and the wide field imaging capability of CCD, this low-cost fluorescence imaging system has the potential for rapid and parallel detection of pathogenic microorganisms in high throughput microfluidic chips.

  3. A remote and autonomous continuous monitoring ultrasonic system for flood detection in sub-sea members of offshore steel oil rigs

    Energy Technology Data Exchange (ETDEWEB)

    Mijarez-Castro, Rito

    2006-07-01

    This thesis presents a novel and autonomous continuous monitoring system for flood detection in the hollow sub-sea members of offshore steel oil rigs. The technique offers an alternative to underwater nondestructive testing methods based on ultrasound and x-rays, which have been used to detect the presence of seawater in these applications, often with divers or remote operating vehicles. The research consists of theoretical and experimental work necessary for the development of an integral system that can be used in new fixed offshore oil rig designs. The system employs a single piezoelectric transducer which can be permanently attached to the inner wall of every sub-sea structure and which is powered by a normally inert seawater battery. Upon activation, the sensor transmits ultrasonic chirp or tone encoded pulses in the range of 21 k Hz to 42 k Hz, to a monitoring system at deck level for decoding and identifying flooded members. Two approaches to the system were considered during the investigation, depending on the communication channel exploited. These were based on either using the seawater as a propagation medium or using the steel structure as a wave-guide. A system based on theoretical models was built and field experiments were conducted using a purpose built jointed steel pipe structure, 7 m in length, 0.5 m in diameter and 16 mm in thickness. This structure was flooded by complete immersion in seawater. Results obtained using water as communication medium and a frequency in the order of 38 k Hz yielded an attenuation figure of 0.4 d B m{sub -}1 over 100 m, since losses were predominantly geometric. In contrast, using the tubular structure as a wave-guide and axis symmetric guided waves as the excitation, a gross attenuation figure of 1.3 d B m{sub -}1 was attained. In the straight parts of the structure, the attenuation ranged from 0.3 d B m{sub -} 1 to 0.6 d B m{sub -}1. The modes most likely to have been excited within the structure were L(0,5) - L(0

  4. An alternative chemical redox method for the production of bispecific antibodies: implication in rapid detection of food borne pathogens.

    Directory of Open Access Journals (Sweden)

    Mohammad Owais

    Full Text Available Bi-functional antibodies with the ability to bind two unrelated epitopes have remarkable potential in diagnostic and bio-sensing applications. In the present study, bispecific antibodies that recognize human red blood cell (RBC and the food borne pathogen Listeria monocytogenes (L. monocytogenes were engineered. The procedure involves initial reduction of a mixture of anti-RBC and anti-Listeria antibodies followed by gradual re-oxidation of the reduced disulphides. This facilitates association of the separated antibody chains and formation of hybrid immunoglobulins with affinity for the L. monocytogenes and human RBC. The bispecific antibodies caused the agglutination of the RBCs only in the presence of L. monocytogenes cells. The agglutination process necessitated the specific presence of L. monocytogenes and the red colored clumps formed were readily visible with naked eyes. The RBC agglutination assay described here provides a remarkably simple approach for the rapid and highly specific screening of various pathogens in their biological niches.

  5. Genetic characterization of porcine kobuvirus and detection of coinfecting pathogens in diarrheic pigs in Jiangsu Province, China.

    Science.gov (United States)

    Yang, Zhen; Jin, Wenjie; Zhao, Zhenpeng; Lin, Weidong; Zhang, Di; Yu, Enqi; Qin, Aijian; Yang, Hanchun

    2014-12-01

    In this study, 396 samples from diarrheic pigs on 46 pig farms in Jiangsu Province, China, were analyzed by RT-PCR. One-hundred eighty-one pigs from 37 farms tested positive for porcine kobuvirus (PKV). Phylogenetic analysis of the 3D gene from 19 isolates showed sequence homology of 88.0 %-100 % and 69.4 %-100 % for nucleotides and amino acids, respectively, while similarity to isolates of other kobuviruses was 69.6 %-78.8 % and 27.8 %-56.9 %, respectively. One-hundred eighty-five samples contained two or more pathogens, and 31/68 PKV-positive samples tested positive for other diarrheic pathogens, confirming the existence of PKV infection and coinfection. PMID:25119679

  6. Door Detection Algorithm for Autonomous Navigation Robot Based on Computer Vision%基于计算机视觉的自主导航机器人门检测算法

    Institute of Scientific and Technical Information of China (English)

    陈祥

    2012-01-01

    Door detection problem in Autonomous navigation robot was studied. For robot autonomous navigation area, no - visual sensor is not suitable for closed door detection, so the major work is how to effectively improve the indoor door detection's location. According to indoor door shape characteristic, this paper put forward a computer vision based autonomous navigation robot door detection algorithm. Algorithm only needs monocular vision image collection. According to the height, width and the characteristics of the shape of the door, the door detection can be realized. In the detecting process of, of the door features, the improved linear detection algorithm was used with high detection speed and high efficiency. The experimental results show that this method can be applied in not only a single background of doors, but also the more complex background. The door detection is effective and more robust. Therefore, it has great application value for robot autonomous navigation of home intelligence service.%研究了自主导航机器人中如何有效提高室内房门检测定位的问题.针对导航中非视觉传感器通过探测距离来判断门的位置,而关闭状态的门和周边的墙几乎处于同一平面无法定位,导致检测不准.可根据室内房门的形状特点,提出了一种计算机视觉的自主导航机器人门检测算法,能在单且视觉下进行图像采集,并根据房门的高度、宽度比以及门的形状特征,进而实现图像中门的检测.由于在检测门特征过程中使用了改进了的直线检测算法,因此具有检测速度快、效率高的特点.实验结果表明,与传统非视觉距离探测方法相比,改进方案不仅适用于单一背景下开状态的门检测,更对关闭状态门的检测具有有效性,完成导航平均处理时间约为2.2s,速度较高,对于家庭智能服务机器人的自主导航具有很大的应用价值.

  7. Detection of DOPA-Melanin in the Dimorphic Fungal Pathogen Penicillium marneffei and Its Effect on Macrophage Phagocytosis In Vitro

    OpenAIRE

    Donghua Liu; Lili Wei; Ting Guo; Weifen Tan

    2014-01-01

    The fungal pathogen Penicillium marneffei produces melanin-like pigment in vitro. The synthetic pathway of melanin and its possible influence in the protective yeast cells surviving within macrophage cells are not known. In this work, P. marneffei produced brown black pigment in the presence of L-DOPA and black particles were extracted from yeast cells treated with proteolytic enzymes, denaturant and concentrated hot acid. Kojic acid inhibited the brown-black pigment production of P. marneffe...

  8. Detection of Melanin-Like Pigments in the Dimorphic Fungal Pathogen Paracoccidioides brasiliensis In Vitro and during Infection

    OpenAIRE

    Gómez, Beatriz L.; Nosanchuk, Joshua D.; Díez, Soraya; Youngchim, Sirida; Aisen, Philip; Cano, Luz E.; Restrepo, Angela; Casadevall, Arturo; Hamilton, Andrew J.

    2001-01-01

    Melanins are implicated in the pathogenesis of several human diseases, including some microbial infections. In this study, we analyzed whether the conidia and the yeasts of the thermally dimorphic fungal pathogen Paracoccidioides brasiliensis produce melanin or melanin-like compounds in vitro and during infection. Growth of P. brasiliensis mycelia on water agar alone produced pigmented conidia, and growth of yeasts in minimal medium with l-3,4-dihydroxyphenylalanine (l-DOPA) produced pigmente...

  9. Rapid detection of fungal pathogens in bronchoalveolar lavage samples using panfungal PCR combined with high resolution melting analysis.

    Science.gov (United States)

    Bezdicek, Matej; Lengerova, Martina; Ricna, Dita; Weinbergerova, Barbora; Kocmanova, Iva; Volfova, Pavlina; Drgona, Lubos; Poczova, Miroslava; Mayer, Jiri; Racil, Zdenek

    2016-10-01

    Despite advances in the treatment of invasive fungal diseases (IFD), mortality rates remain high. Moreover, due to the expanding spectrum of causative agents, fast and accurate pathogen identification is necessary. We designed a panfungal polymerase chain reaction (PCR), which targets the highly variable ITS2 region of rDNA genes and uses high resolution melting analysis (HRM) for subsequent species identification. The sensitivity and specificity of this method was tested on a broad spectrum of the most clinically important fungal pathogens including Aspergillus spp., Candida spp. and mucormycetes. Despite the fact that fluid from bronchoalveolar lavage (BAL) is one of the most frequently tested materials there is a lack of literature sources aimed at panfungal PCR as an IFD diagnostic tool from BAL samples. The applicability of this method in routine practice was evaluated on 104 BAL samples from immunocompromised patients. Due to high ITS region variability, we obtained divergent melting peaks for different fungal species. Thirteen out of 18 patients with proven or probable IFD were positive. Therefore, the sensitivity, specificity, positive predictive value and negative predictive value of our method were 67%, 100%, 100%, and 94%, respectively. In our assay, fungal pathogens identification is based on HRM, therefore omitting the expensive and time consuming sequencing step. With the high specificity, positive and negative predictive values, short time needed to obtain a result, and low price, the presented assay is intended to be used as a quick screening method for patients at risk of IFD. PMID:27161789

  10. Trigeminal autonomic cephalgias

    OpenAIRE

    Benoliel, Rafael

    2012-01-01

    1. Trigeminal autonomic cephalgias (TACs) are headaches/facial pains classified together based on:a suspected common pathophysiology involving the trigeminovascular system, the trigeminoparasympathetic reflex and centres controlling circadian rhythms;a similar clinical presentation of trigeminal pain, and autonomic activation.

  11. Testing for autonomic neuropathy

    DEFF Research Database (Denmark)

    Hilsted, J

    1984-01-01

    Autonomic neuropathy is a common complication in long-term diabetes, about 30% of the patients showing measurable signs of autonomic dysfunction after 10 years duration of disease. The diagnosis is often difficult to establish because clinical symptoms generally occur late in the course...

  12. Comparative Analysis of Two Broad-Range PCR Assays for Pathogen Detection in Positive-Blood-Culture Bottles: PCR–High-Resolution Melting Analysis versus PCR-Mass Spectrometry

    OpenAIRE

    Jeng, Kevin; Gaydos, Charlotte A; Blyn, Lawrence B.; Yang, Samuel; Won, Helen; Matthews, Heather; Toleno, Donna; Hsieh, Yu-Hsiang; Carroll, Karen C.; Hardick, Justin; Masek, Billy; Kecojevic, Alexander; Sampath, Rangarajan; Peterson, Stephen; Rothman, Richard E.

    2012-01-01

    Detection of pathogens in bloodstream infections is important for directing antimicrobial treatment, but current culture-based approaches can be problematic. Broad-range PCR assays which target conserved genomic motifs for postamplification amplicon analysis permit detection of sepsis-causing pathogens. Comparison of different broad-range assays is important for informing future implementation strategies. In this study, we compared positive-blood-culture bottles processed by PCR coupled to hi...

  13. 食源性致病菌快速检测技术研究进展%Rapid Detection Technique of Foodborne Pathogen

    Institute of Scientific and Technical Information of China (English)

    王大勇; 方振东; 谢朝新; 张春秀

    2009-01-01

    Foodborne pathogen is one the most primary factors affected food safety. Traditional methods to detect foodborne pathogens are complex and time-consuming, especially some of the bacteria are difficult to cultivate that make the needs of the control and prevention of the foodborne diseases difficult, and therefore, a rapid, simple, and specific detection has become a research hot spot. The application research of electrical impedance, radiation meas-urement, micro-heat, ELISA, PCR, gene chip, and bio-sensor technology to rapidly detect foodborne pathogenic bac-teria such as Staphylococcus aureus, Salmonella, enterohemorrhagie E. coli were summarized in this paper.%食源性致病菌是影响食品安全的主要因素之一,传统的细菌分离、培养与鉴定由于需时较长,特剐是有的细菌难以培养,难以适应食源性疾病预防控制的需要,因而快速、简便、特异的检测方法成为研究的热点.对电阻抗、放射测量、微热量、ELISA、PCR、基因芯片和生物传感器技术在金黄色葡萄球菌、沙门菌、肠出血性大肠埃希菌等食源性致病菌快速检测中的应用研究进行综述.

  14. DNA detection and genotypic identification of potentially human-pathogenic microsporidia from asymptomatic pet parrots in South Korea as a risk factor for zoonotic emergence.

    Science.gov (United States)

    Lee, So-Young; Lee, Sung-Seok; Lyoo, Young S; Park, Hee-Myung

    2011-12-01

    We detected and identified genotypes of human-pathogenic microsporidia in fecal samples from 51 asymptomatic captive-bred pet parrots in South Korea. Microsporidia were identified in 8 samples (15.7%); 7 parrots tested positive for Encephalitozoon hellem, and 1 parrot tested positive for both E. hellem and Encephalitozoon cuniculi. In genotypic identifications, E. hellem was present in genotypes 1A and 2B and E. cuniculi was present in genotype II. Pet parrots might be a source of human microsporidian infection.

  15. Detection and investigation of foodborne bacterial pathogens in Ningbo%宁波地区食品中致病菌污染物检测与调查

    Institute of Scientific and Technical Information of China (English)

    盛冬萍; 谢益君; 陈米娜; 徐景野

    2013-01-01

    Objective objective To understand the presence,contamination and cross contamination of foodborne bacterial pathogens in Ningbo city,provide basis for foodborne disease control,and trace the source of foodborne disease.Methods Strains were detected directly or after enrichment with biochemistry and API method,and subtyped with serum agglutination method.Antibiotic resistance and relative genes were detected with K-B method and PCR method respectively.Results 2 331 (7 species and 12 types) strains were detected from 6 812 food samples and the detection rate is 34.22% (2 331/6 812).The prevalent pathogens were Vibrio parahaemolyticus,and the detection rate was significantly different from the other types (P < 0.005).Vibrio parahaemolyticus could be classified into 10 sero-groups,and O6 and O5 were proved as the prevalent sero-groups.Most of the pathogens were sensitive to antibiotics.Three strains of Aeromonas were found multi-resistant with aacc resistance gene.Conclusion Various distribution was proved in foodborne bacteria in Ningbo.Contamination of foodborne pathogens was a major factor of foodborne diseases.Vibrio parahaemolyticus was the prevalent pathogenic bacteria.Most of the pathogens were sensitive to antibiotics.Bacteria with aacc resistance gene were found,which should raise concerns to control the spread of the resistant strains through rational administration of antibiotics and resistance surveillance.%目的 了解宁波地区食品中携带或污染的致病菌,为控制食源性疾病提供依据.方法 致病菌检测采用直接分离与增菌分离相结合的方法;细菌鉴定采用生化筛检和API等方法;血清分型采用诊断血清凝集法;药敏试验采用K-B法;采用PCR检测耐药基因.结果 从6 812份食品标本中检出致病菌7类12种,共2 331株,检出率为34.22%,以副溶血性弧菌检出率最高,与其他病原菌检出率比较差异有统计学意义(P<0.005).主要流行株

  16. Detection of Pathogens Causing Citrus Black Spot of Guanxi Honey Pomelo by Nested PCR%巢式PCR检测琯溪蜜柚黑斑病病原菌

    Institute of Scientific and Technical Information of China (English)

    郑域茹; 罗金水; 张汉荣; 卢松茂; 林智明; 王宏毅; 李美桂

    2013-01-01

    Citrus black spot is a fungal disease in most Guanxi honey pomelo. By using the specific primers, a unique 487 bp band was obtained by PCR amplification from genomic DNA of the pathogen causing citrus black spot of Guanxi honey pomelo and the method could accurately distinguish the honey pomelo black spot pathogen from the other disease pathogens of Sphaceloma fawcetti Jenk, Colletotrichum gleosporioides Penz and Mycosphaerella cirri White-Side in Guanxi honey pomelo. The sensitivity was determined by nested PCR. For the genomic DNA of honey pomelo black spot pathogen, the sensibility of nested PCR reached 100 fg/μL, 100 times higher than that of routine PCR. For the DNA of diseased tissues, the sensibility of nested PCR reached 100μg of DNA sample. Through nested PCR assay, the pathogen of honey pomelo black spot could be specifically detected form diseased and symptom latent infection honey pomelo tissues with the detection rate of 96.67% and 90%, respectively.%利用特异性引物从琯溪蜜柚黑斑病菌基因组DNA中扩增出一条分子量为487 bp的特异性条带,准确地与疮痂病、炭疽病和黄斑病菌等蜜柚常发性真菌病害区分开.采用巢式PCR对该引物的检测灵敏度进行测定,结果显示,对于黑斑病菌基因组DNA,巢式PCR的检测灵敏度为100 fg/μL,灵敏度比常规PCR至少提高100倍;对于发病组织,巢式PCR可从病斑组织含量为100 μg的DNA样品中检测到黑斑病菌.采用巢式PCR检测技术,可从蜜柚的黑斑病显症组织和未显症组织特异性地检测到病原菌,且检出率分别为96.67%和90%.

  17. Conventional and real-time PCRs for detection of Erwinia piriflorinigrans allow its distinction from the fire blight pathogen, Erwinia amylovora.

    Science.gov (United States)

    Barbé, Silvia; Bertolini, Edson; Roselló, Montserrat; Llop, Pablo; López, María M

    2014-04-01

    Erwinia piriflorinigrans is a new pathogenic species of the bacterial genus Erwinia that has been described recently in Spain. Accurate detection and identification of E. piriflorinigrans are challenging because its symptoms on pear blossoms are similar to those caused by Erwinia amylovora, the causal agent of fire blight. Moreover, these two species share phenotypic and molecular characteristics. Two specific and sensitive conventional and real-time PCR protocols were developed to identify and detect E. piriflorinigrans and to differentiate it from E. amylovora and other species of this genus. These protocols were based on sequences from plasmid pEPIR37, which is present in all strains of E. piriflorinigrans analyzed. After the stability of the plasmid was demonstrated, the specificities of the protocols were confirmed by the amplification of all E. piriflorinigrans strains tested, whereas 304 closely related pathogenic and nonpathogenic Erwinia strains and microbiota from pear trees were not amplified. In sensitivity assays, 10(3) cells/ml extract were detected in spiked plant material by conventional or real-time PCR, and 10(2) cells/ml were detected in DNA extracted from spiked plant material by real-time PCR. The protocols developed here succeeded in detecting E. piriflorinigrans in 102 out of 564 symptomatic and asymptomatic naturally infected pear samples (flowers, cortex stem tissue, leaves, shoots, and fruitlets), in necrotic Pyracantha sp. blossoms, and in necrotic pear and apple tissues infected with both E. amylovora and E. piriflorinigrans. Therefore, these new tools can be used in epidemiological studies that will enhance our understanding of the life cycle of E. piriflorinigrans in different hosts and plant tissues and its interaction with E. amylovora.

  18. Research advances for fast detection of food borne pathogenic bacteria%食品病原微生物快速检测技术研究进展

    Institute of Scientific and Technical Information of China (English)

    杨春光; 王宏伟; 彭心婷; 苏明明; 徐静; 李莉; 孙兴权; 曹际娟

    2015-01-01

    Now with the rapid development of food industry, food safety is concerned all over the world. Many factors affect the food safety, among which pathogenic microbe is one of the most primary factor. In order to effectively and efficiently monitor the food safety, it is more and more important for food quality control and supervision to control the pathogenic microorganism in food processing, and establish the method for rapid detection of food pathogen. Traditional methods for detection of food borne pathogens are quite complex, and cost much time, so more researches focus on the quick, convenient and differential methods. The scope of application of rapid detection method is very extensive, and more sensitive than the traditional detection method. This article introduced several advanced fast detection technology of food pathogenic bacteria, including molecular biology technology, immunity technology, metabolism technology and biosensor technology, and the rapid detection technology of those more advanced analysis and summarize the current mainstream, aiming to provide a reference for the further study.%随着现在食品工业的快速发展,食品安全越来越受到各国的重视。影响食品安全的因素很多,其中食品中的病原微生物是影响食品安全的主要因素之一。为了对食品安全进行有效、快速的监测,控制食品加工中的病原微生物,研究和建立食品病原快速检测方法对于食品质量控制和监管及人们健康也就越来越重要。食源性致病菌的传统检测方法繁琐复杂、周期较长,因而快速、简便、特异的检测方法成为研究的热点。快速检测方法的应用范围非常广泛,并且比传统的检测方法更加敏感。本文主要从分子生物学技术、免疫技术、代谢技术、生物传感器技术等方面介绍了目前国内外用于食品微生物检测的先进技术,并对这些在当前较为先进的主流的快速检测技术

  19. 食品病原微生物快速检测技术研究进展%Research advances for fast detection of food borne pathogenic bacteria

    Institute of Scientific and Technical Information of China (English)

    杨春光; 王宏伟; 彭心婷; 苏明明; 徐静; 李莉; 孙兴权; 曹际娟

    2015-01-01

    随着现在食品工业的快速发展,食品安全越来越受到各国的重视。影响食品安全的因素很多,其中食品中的病原微生物是影响食品安全的主要因素之一。为了对食品安全进行有效、快速的监测,控制食品加工中的病原微生物,研究和建立食品病原快速检测方法对于食品质量控制和监管及人们健康也就越来越重要。食源性致病菌的传统检测方法繁琐复杂、周期较长,因而快速、简便、特异的检测方法成为研究的热点。快速检测方法的应用范围非常广泛,并且比传统的检测方法更加敏感。本文主要从分子生物学技术、免疫技术、代谢技术、生物传感器技术等方面介绍了目前国内外用于食品微生物检测的先进技术,并对这些在当前较为先进的主流的快速检测技术进行总结分析,为今后进一步研究和开发新检测技术提供一些参考。%Now with the rapid development of food industry, food safety is concerned all over the world. Many factors affect the food safety, among which pathogenic microbe is one of the most primary factor. In order to effectively and efficiently monitor the food safety, it is more and more important for food quality control and supervision to control the pathogenic microorganism in food processing, and establish the method for rapid detection of food pathogen. Traditional methods for detection of food borne pathogens are quite complex, and cost much time, so more researches focus on the quick, convenient and differential methods. The scope of application of rapid detection method is very extensive, and more sensitive than the traditional detection method. This article introduced several advanced fast detection technology of food pathogenic bacteria, including molecular biology technology, immunity technology, metabolism technology and biosensor technology, and the rapid detection technology of those more advanced analysis and

  20. A rapid method for the detection of foodborne pathogens by extraction of a trace amount of DNA from raw milk based on amino-modified silica-coated magnetic nanoparticles and polymerase chain reaction.

    Science.gov (United States)

    Bai, Yalong; Song, Minghui; Cui, Yan; Shi, Chunlei; Wang, Dapeng; Paoli, George C; Shi, Xianming

    2013-07-17

    A method based on amino-modified silica-coated magnetic nanoparticles (ASMNPs) and polymerase chain reaction (PCR) was developed to rapidly and sensitively detect foodborne pathogens in raw milk. After optimizing parameters such as pH, temperature, and time, a trace amount of genomic DNA of pathogens could be extracted directly from complex matrices such as raw milk using ASMNPs. The magnetically separated complexes of genomic DNA and ASMNPs were directly subjected to single PCR (S-PCR) or multiplex PCR (M-PCR) to detect single or multiple pathogens from raw milk samples. Salmonella Enteritidis (Gram-negative) and Listeria monocytogenes (Gram-positive) were used as model organisms to artificially contaminate raw milk samples. After magnetic separation and S-PCR, the detection sensitivities were 8 CFU mL(-1) and 13 CFU mL(-1) respectively for these two types of pathogens. Furthermore, this method was successfully used to detect multiple pathogens (S. Enteritidis and L. monocytogenes) from artificially contaminated raw milk using M-PCR at sensitivities of 15 CFU mL(-1) and 25 CFU mL(-1), respectively. This method has great potential to rapidly and sensitively detect pathogens in raw milk or other complex food matrices.

  1. 不同方法检测食源性致病菌的对比研究%Comparative study of different methods for detecting foodborne pathogens

    Institute of Scientific and Technical Information of China (English)

    罗宇鹏

    2015-01-01

    Objective To investigate the feasibility of the gene chip technique and multiplex PCR technique for detecting and screening foodborne pathogens .Methods The primer sequences were designed to target cells ,the biotin was adopted to label the re‐verse primer 5′end and the amino group was adopted to label oligonucleotide probe 5′end .The probe spotted on a solid support for preparing microarray ,PCR product was hybridized with microarray probe region ,PCR and hybridization reaction system was opti‐mized .Results The microarray technique could simultaneously detect multiple pathogens of Shigella ,Salmonella ,Klebsiella pneu‐moniae ,Brucella ,Proteus mirabilis ,Staphylococcus aureus ,Campylobacter jejuni ,etc .,which was easy to operate and had strong specificity .The sensitivity of bacterial pure cultures was 5 .0 × 102 CFU/mL ,the sensitivity of DNA detection was 0 .1 pg ,the coin‐cidence rate for detecting isolated bacteria was 100 % .The PCR detection system was established and optimized by using primers , the concentration of Mg2+ and the annealing temperature Tm value of 1 .5 mmol/L and 56 ℃ were determined ,the detection sensi‐tivity reached to 10 pg ,all the specific primers amplified bands could be amplified under this sensitivity .Conclusion The gene chip technique and multiplex PCR technique can effectively detect foodborne pathogens ,which provide a new idea for detecting pathogens with the high‐throughput screening and are worth popularization and application in the field of food safety .%目的:探讨基因芯片技术和多重PCR技术用于检测和筛查食源性致病菌的可行性。方法通过设计靶细胞引物序列,采用生物素标记反向引物5′端,氨基基团标记寡核苷酸探针5′端。将探针在固相载体上点样,制备基因芯片,PCR产物与芯片点制探针区域进行杂交,并对PCR杂交反应的体系进行优化。结果基因芯片技术可以同时检测志贺氏菌、沙门氏

  2. Extraction and sensitive detection of toxins A and B from the human pathogen Clostridium difficile in 40 seconds using microwave-accelerated metal-enhanced fluorescence.

    Directory of Open Access Journals (Sweden)

    Lovleen Tina Joshi

    Full Text Available Clostridium difficile is the primary cause of antibiotic associated diarrhea in humans and is a significant cause of morbidity and mortality. Thus the rapid and accurate identification of this pathogen in clinical samples, such as feces, is a key step in reducing the devastating impact of this disease. The bacterium produces two toxins, A and B, which are thought to be responsible for the majority of the pathology associated with the disease, although the relative contribution of each is currently a subject of debate. For this reason we have developed a rapid detection assay based on microwave-accelerated metal-enhanced fluorescence which is capable of detecting the presence of 10 bacteria in unprocessed human feces within 40 seconds. These promising results suggest that this prototype biosensor has the potential to be developed into a rapid, point of care, real time diagnostic assay for C. difficile.

  3. 3D-printed microfluidic device for the detection of pathogenic bacteria using size-based separation in helical channel with trapezoid cross-section.

    Science.gov (United States)

    Lee, Wonjae; Kwon, Donghoon; Choi, Woong; Jung, Gyoo Yeol; Jeon, Sangmin

    2015-01-01

    A facile method has been developed to detect pathogenic bacteria using magnetic nanoparticle clusters (MNCs) and a 3D-printed helical microchannel. Antibody-functionalized MNCs were used to capture E. coli (EC) bacteria in milk, and the free MNCs and MNC-EC complexes were separated from the milk using a permanent magnet. The free MNCs and MNC-EC complexes were dispersed in a buffer solution, then the solution was injected into a helical microchannel device with or without a sheath flow. The MNC-EC complexes were separated from the free MNCs via the Dean drag force and lift force, and the separation was facilitated in the presence of a sheath flow. The concentration of the E. coli bacteria was determined using a light absorption spectrometer, and the limit of detection was found to be 10 cfu/mL in buffer solution and 100 cfu/mL in milk. PMID:25578942

  4. Autonomous linear lossless systems

    OpenAIRE

    Rao, Shodhan; Rapisarda, Paolo

    2008-01-01

    We define a lossless autonomous system as one having a quadratic differential form associated with it called an energy function, which is positive and which is conserved. We define an oscillatory system as one which has all its trajectories bounded on the entire time axis. In this paper, we show that an autonomous system is lossless if and only if it is oscillatory. Next we discuss a few properties of energy functions of autonomous lossless systems and a suitable way of splitting a given ener...

  5. Autonomous surveillance for biosecurity.

    Science.gov (United States)

    Jurdak, Raja; Elfes, Alberto; Kusy, Branislav; Tews, Ashley; Hu, Wen; Hernandez, Emili; Kottege, Navinda; Sikka, Pavan

    2015-04-01

    The global movement of people and goods has increased the risk of biosecurity threats and their potential to incur large economic, social, and environmental costs. Conventional manual biosecurity surveillance methods are limited by their scalability in space and time. This article focuses on autonomous surveillance systems, comprising sensor networks, robots, and intelligent algorithms, and their applicability to biosecurity threats. We discuss the spatial and temporal attributes of autonomous surveillance technologies and map them to three broad categories of biosecurity threat: (i) vector-borne diseases; (ii) plant pests; and (iii) aquatic pests. Our discussion reveals a broad range of opportunities to serve biosecurity needs through autonomous surveillance. PMID:25744760

  6. Autonomous control systems - Architecture and fundamental issues

    Science.gov (United States)

    Antsaklis, P. J.; Passino, K. M.; Wang, S. J.

    1988-01-01

    A hierarchical functional autonomous controller architecture is introduced. In particular, the architecture for the control of future space vehicles is described in detail; it is designed to ensure the autonomous operation of the control system and it allows interaction with the pilot and crew/ground station, and the systems on board the autonomous vehicle. The fundamental issues in autonomous control system modeling and analysis are discussed. It is proposed to utilize a hybrid approach to modeling and analysis of autonomous systems. This will incorporate conventional control methods based on differential equations and techniques for the analysis of systems described with a symbolic formalism. In this way, the theory of conventional control can be fully utilized. It is stressed that autonomy is the design requirement and intelligent control methods appear at present, to offer some of the necessary tools to achieve autonomy. A conventional approach may evolve and replace some or all of the `intelligent' functions. It is shown that in addition to conventional controllers, the autonomous control system incorporates planning, learning, and FDI (fault detection and identification).

  7. Advancing Autonomous Operations for Deep Space Vehicles

    Science.gov (United States)

    Haddock, Angie T.; Stetson, Howard K.

    2014-01-01

    Starting in Jan 2012, the Advanced Exploration Systems (AES) Autonomous Mission Operations (AMO) Project began to investigate the ability to create and execute "single button" crew initiated autonomous activities [1]. NASA Marshall Space Flight Center (MSFC) designed and built a fluid transfer hardware test-bed to use as a sub-system target for the investigations of intelligent procedures that would command and control a fluid transfer test-bed, would perform self-monitoring during fluid transfers, detect anomalies and faults, isolate the fault and recover the procedures function that was being executed, all without operator intervention. In addition to the development of intelligent procedures, the team is also exploring various methods for autonomous activity execution where a planned timeline of activities are executed autonomously and also the initial analysis of crew procedure development. This paper will detail the development of intelligent procedures for the NASA MSFC Autonomous Fluid Transfer System (AFTS) as well as the autonomous plan execution capabilities being investigated. Manned deep space missions, with extreme communication delays with Earth based assets, presents significant challenges for what the on-board procedure content will encompass as well as the planned execution of the procedures.

  8. Detection of five potentially periodontal pathogenic bacteria in peri-implant disease: A comparison of PCR and real-time PCR.

    Science.gov (United States)

    Schmalz, Gerhard; Tsigaras, Sandra; Rinke, Sven; Kottmann, Tanja; Haak, Rainer; Ziebolz, Dirk

    2016-07-01

    The aim of this study was to compare the microbial analysis methods of polymerase chain reaction (PCR) and real-time PCR (RT-PCR) in terms of detection of five selected potentially periodontal pathogenic bacteria in peri-implant disease. Therefore 45 samples of healthy, mucositis and peri-implantitis (n = 15 each) were assessed according to presence of the following bacteria using PCR (DNA-strip technology) and RT-PCR (fluorescent dye SYBR green-system): Aggregatibacter actinomycetemcomitans (Aa), Porphyromonas gingivalis (Pg), Treponema denticola (Td), Tanerella forsythia (Tf), and Fusobacterium nucleatum (Fn). There were no significant correlations between the bacterial and disease patterns, so the benefit of using microbiological tests for the diagnosis of peri-implant diseases is questionable. Correlations between the methods were highest for Tf (Kendall's Tau: 0.65, Spearman: 0.78), Fn (0.49, 0.61) and Td (0.49, 0.59). For Aa (0.38, 0.42) and Pg (0.04, 0.04), lower correlation values were detected. Accordingly, conventional semi-quantitative PCR seems to be sufficient for analyzing potentially periodontal pathogenic bacterial species.

  9. Application of LAMP in detection of pathogenic microbe%环介导等温扩增技术在致病菌检测中的应用

    Institute of Scientific and Technical Information of China (English)

    贺尔娜; 蔡挺; 张顺

    2012-01-01

    Loop-mediated isothermal amplification (LAMP) is a novel method of nucleic acid amplification developed in the last 10 years, with the advantages such as simplicity, rapidity, high sensitivity and high specificity. It is always applied in the detection of pathogenic microbe. This method employs a DNA polymerase with strand displacement activity and a set of 4 different primers specifically designed to recognize 6 distinct regions on the target DNA, with fewer steps and simpler equipment compared to PCR assays. This paper summarized the applications of LAMP method in the detection of pathogenic microbe.%环介导等温扩增(loop-mediated isothermal amplification,LAMP)技术是近10年来发展起来的具有简便、快速、灵敏度高、特异性强等优点的新的恒温核酸扩增技术,已被应用于致病菌检测的研究.LAMP技术需针对靶基因的6个区域设计4种特异性引物,并采用链置换型DNA聚合酶,操作步骤少,不需要聚合酶链反应(polymerase chain reaction,PCR)技术复杂的设备.本文就LAMP技术在致病菌检测中的应用作一综述.

  10. 核酸扩增技术在病原体检测中的应用%Application of nucleic acid amplification in pathogen detection

    Institute of Scientific and Technical Information of China (English)

    范吉云; 郭晓奎; 李擎天

    2009-01-01

    传统的病原体检测方法在检测敏感性、特异性、应用范围等方面存在许多不足.PCR技术已被用于感染早期的病原体检测,但在应用过程中也面临不少问题.近年来出现的新的核酸扩增技术可弥补普通PCR技术的缺点.此文就其中依赖核酸序列的扩增技术、PCR-胶体金免疫层析技术和多重荧光实时PcR技术进行综述.%The traditional pathogen detection mathods have many disadvantages in the sensitivity, specificity and application range. There are still some problems in PCB, which has been used for pathogen detection in the early stage of infection. New nucleic acid amplification technologies may make up the deficiency of PCR. In this review, three methods including nucleic acid sequence-based amplification (NASBA), PCR-immunochromatography test and multiplex fluorescent real-time PCR technology are described.

  11. Chemiluminescent labels released from long spacer arm-functionalized magnetic particles: a novel strategy for ultrasensitive and highly selective detection of pathogen infections.

    Science.gov (United States)

    Yang, Haowen; Liang, Wenbiao; He, Nongyue; Deng, Yan; Li, Zhiyang

    2015-01-14

    Previously, the unique advantages provided by chemiluminescence (CL) and magnetic particles (MPs) have resulted in the development of many useful nucleic acid detection methods. CL is highly sensitive, but when applied to MPs, its intensity is limited by the inner filter-like effect arising from excess dark MPs. Herein, we describe a modified strategy whereby CL labels are released from MPs to eliminate this negative effect. This approach relies on (1) the magnetic capture of target molecules on long spacer arm-functionalized magnetic particles (LSA-MPs), (2) the conjugation of streptavidin-alkaline phosphatase (SA-AP) to biotinylated amplicons of target pathogens, (3) the release of CL labels (specifically, AP tags), and (4) the detection of the released labels. CL labels were released from LSA-MPs through LSA ultrasonication or DNA enzymolysis, which proved to be the superior method. In contrast to conventional MPs, LSA-MPs exhibited significantly improved CL detection, because of the introduction of LSA, which was made of water-soluble carboxymethylated β-1,3-glucan. Detection of hepatitis B virus with this technique revealed a low detection limit of 50 fM, high selectivity, and excellent reproducibility. Thus, this approach may hold great potential for early stage clinical diagnosis of infectious diseases.

  12. The nicotine paradox: effect of smoking on autonomic discrimination.

    Science.gov (United States)

    Lombardo, T W; Epstein, L H

    1986-01-01

    Smoking reduces negative affect while it increases sympathetic nervous system activity. However, theories of emotion predict that increased autonomic arousal should increase rather than reduce negative affect. One explanation for this paradox is that nicotine interferes with perception of autonomic activity. We evaluated the effect of smoking on autonomic activity perception by measuring performance on a heartbeat detection task after a high or low dose of nicotine or not smoking. A group of nonsmokers also completed the task. Results failed to support the hypothesis. In light of previous research, the results suggest EMG perception may be more important to the negative affect reduction phenomenon than perception of autonomic activity. PMID:3739820

  13. Highly Autonomous Systems Workshop

    Science.gov (United States)

    Doyle, R.; Rasmussen, R.; Man, G.; Patel, K.

    1998-01-01

    It is our aim by launching a series of workshops on the topic of highly autonomous systems to reach out to the larger community interested in technology development for remotely deployed systems, particularly those for exploration.

  14. Autonomic Nervous System Disorders

    Science.gov (United States)

    ... with breathing and swallowing Erectile dysfunction in men Autonomic nervous system disorders can occur alone or as the result of another disease, such as Parkinson's disease, alcoholism and diabetes. Problems can affect either part ...

  15. Autonomous immunity in mucosal epithelial cells: fortifying the barrier against infection.

    Science.gov (United States)

    Ross, Karen F; Herzberg, Mark C

    2016-06-01

    Mucosal epithelial cells express an autonomous innate immune response that controls the overgrowth of invaded bacteria, mitigates the harmful effects of the bacteria carried within, and does not rely on other external arms of the immune response. Epithelial cell autonomous innate immunity "respects" the social biology of invading bacteria to achieve symbiosis, and is the primary protective mechanism against pathogens. PMID:27005450

  16. The Detection of a Low Pathogenicity Avian Influenza Virus Subtype H9 Infection in a Turkey Breeder Flock in the United Kingdom.

    Science.gov (United States)

    Reid, Scott M; Banks, Jill; Ceeraz, Vanessa; Seekings, Amanda; Howard, Wendy A; Puranik, Anita; Collins, Susan; Manvell, Ruth; Irvine, Richard M; Brown, Ian H

    2016-05-01

    In April 2013, an H9N2 low pathogenicity avian influenza (LPAI) virus was isolated in a turkey breeder farm in Eastern England comprising 4966 birds. Point-of-lay turkey breeding birds had been moved from a rearing site and within 5 days had shown rapid onset of clinical signs of dullness, coughing, and anorexia. Three houses were involved, two contained a total of 4727 turkey hens, and the third housed 239 male turkeys. Around 50% of the hens were affected, whereas the male turkeys demonstrated milder clinical signs. Bird morbidity rose from 10% to 90%, with an increase in mortality in both houses of turkey hens to 17 dead birds in one house and 27 birds in the second house by day 6. The birds were treated with an antibiotic but were not responsive. Postmortem investigation revealed air sacculitis but no infraorbital sinus swellings or sinusitis. Standard samples were collected, and influenza A was detected. H9 virus infection was confirmed in all three houses by detection and subtyping of hemagglutinating agents in embryonated specific-pathogen-free fowls' eggs, which were shown to be viruses of H9N2 subtype using neuraminidase inhibition tests and a suite of real-time reverse transcription PCR assays. LPAI virus pathotype was suggested by cleavage site sequencing, and an intravenous pathogenicity index of 0.00 confirmed that the virus was of low pathogenicity. Therefore, no official disease control measures were required, and despite the high morbidity, birds recovered and were kept in production. Neuraminidase sequence analysis revealed a deletion of 78 nucleotides in the stalk region, suggesting an adaptation of the virus to poultry. Hemagglutinin gene sequences of two of the isolates clustered with a group of H9 viruses containing other contemporary European H9 strains in the Y439/Korean-like group. The closest matches to the two isolates were A/turkey/Netherlands/11015452/11 (H9N2; 97.9-98% nucleotide identity) and A/mallard/Finland/Li13384/10 (H9N2; 97

  17. Autonomous Star Tracker Algorithms

    DEFF Research Database (Denmark)

    Betto, Maurizio; Jørgensen, John Leif; Kilsgaard, Søren;

    1998-01-01

    Proposal, in response to an ESA R.f.P., to design algorithms for autonomous star tracker operations.The proposal also included the development of a star tracker breadboard to test the algorithms performances.......Proposal, in response to an ESA R.f.P., to design algorithms for autonomous star tracker operations.The proposal also included the development of a star tracker breadboard to test the algorithms performances....

  18. Development of innovative PCR and fluorescence activated cell sorting methodologies for the detection of a range of foodborne pathogens.

    OpenAIRE

    Martinon, Alice Marie Amelie

    2011-01-01

    peer-reviewed The early and rapid detection of the Enterobacteriaceae, Staphylococcus aureus and Listeria monocytogenes is desirable to prevent foodborne outbreaks. In this thesis, novel molecular and flow cytometric based methods were developed for their qualitative and quantitative detection. For S. aureus and L. monocytogenes, two highly specific primer sets were selected for application in simplex and duplex SYBR Green-based real-time PCR assays. Melting curve analysis confirm...

  19. HIV感染者口腔牙周致病菌检出情况分析%Analysis for Detection of Oral Periodontal Pathogens in HIV Infected Patients

    Institute of Scientific and Technical Information of China (English)

    温龑; 裴峻浩翔; 段开文

    2015-01-01

    Objective To understand the detection of oral periodontal pathogens in part of HIV infected patients in Yunnan region.Methods The col ection of clinic specimens were took to obtain the 66 cases of HIV infected patients,saliva and gingival crevicular fluid (GCF)samples which were come from the Third People,s of Kunming.The six kinds of periodontal pathogens were detected by extraction of DNA and PCR testing and analyzed by using statistical methods.Results The dif erent bacteria have been detected in dif erent specimens and the discrepancy of detection rate of these bacteria was significant.However,the dif erence of same bacterial in dif erent samples was minimal.In addition,there was no manifest function on the detection rate of periodontal pathogens in aspects of smoking,drinking,dif erent CD4 cel counts and highly active antiretroviral therapy(HAART).Conclusion It is vital to strengthen the research and detection of oral periodontal pathogens in HIV infected patients through combine with domestic and international research and report to treat targeted periodontal disease that occur ed in HIV infected patients.%目的了解云南地区部分HIV感染患者口腔内牙周致病菌检出情况。方法采用临床标本收集的方法,获得昆明市第三人民医院感染一科66例HIV感染者的唾液标本和龈沟液标本,通过DNA的提取和PCR检测,对标本中的6种牙周致病菌进行检测并运用统计学方法分析。结果不同细菌在不同取材标本都有检出,且各种细菌的检出率差异很大,但同一细菌在不同样本中检出率差异却极小。另外,吸烟饮酒、不同CD4细胞计数和高效抗逆转录病毒治疗(highly active anti retrovial therapy,HAART)HAART对可疑牙周致病菌的检出均无明显影响。结论应结合国内外的研究与报道,加强对HIV感染者口腔牙周致病菌的研究与检测,从而有针对性的治疗发生在HIV感染者口腔中的牙周疾病。

  20. Cutaneous autonomic denervation in Parkinson's disease.

    Science.gov (United States)

    Navarro-Otano, Judith; Casanova-Mollà, Jordi; Morales, Merche; Valls-Solé, Josep; Tolosa, Eduard

    2015-08-01

    Numerous studies have detailed involvement of the peripheral autonomic nervous system (PANS) in Parkinson's disease (PD). We assessed autonomic innervation of dermal annexes through quantitative fluorescence measurement from skin obtained via punch biopsies at distal leg region in PD and control subjects. We defined a ratio between the area corresponding to protein gen product (PGP) immunoreactivity and the area corresponding to blood vessel or sweat gland as a quantitative measure of autonomic innervation. Presence of alpha-synuclein (AS) deposits in dermis and hypodermis was also assessed by immunohistochemistry. Skin biopsies form six PD patients and six healthy controls were studied. Autonomic innervation scores were lower in PD than in controls in both blood vessels and sweat glands. No AS or phosphorylated AS (pAS) immunoreactivity was detected in dermis or hypodermis in any of the studied subjects. The results of this investigation suggest that autonomic innervation of dermal annexes in living patients with PD is reduced compared to controls. AS or pAS deposits were not found in dermis or hypodermis suggesting that distal leg skin study is not useful for in vivo detection of AS in PD.