Digital PCR for detection of citrus pathogens

Science.gov (United States)

Citrus trees are often infected with multiple pathogens of economic importance, especially those with insect or mite vectors. Real-time/quantitative PCR (qPCR) has been used for high-throughput detection and relative quantification of pathogens; however, target reference or standards are required. I...

Advances and Challenges in Viability Detection of Foodborne Pathogens

Directory of Open Access Journals (Sweden)

Dexin Zeng

2016-11-01

Full Text Available Foodborne outbreaks are a serious public health and food safety concern worldwide. There is a great demand for rapid, sensitive, specific, and accurate methods to detect microbial pathogens in foods. Conventional methods based on cultivation of pathogens have been the gold standard protocols; however, they take up to a week to complete. Molecular assays such as polymerase chain reaction (PCR, sequencing, microarray technologies have been widely used in detection of foodborne pathogens. Among molecular assays, PCR technology conventional and real-time PCR (qPCR is most commonly used in the foodborne pathogen detection because of its high sensitivity and specificity. However, a major drawback of PCR is its inability to differentiate the DNA from dead and viable cells, and this is a critical factor for the food industry, regulatory agencies and the consumer. To remedy this shortcoming, researchers have used biological dyes such as ethidium monoazide (EMA and propidium monoazide (PMA to pretreat samples before DNA extraction to intercalate the DNA of dead cells in food samples, and then proceed with regular DNA preparation and qPCR. By combining PMA treatment with qPCR (PMA-qPCR, scientists have applied this technology to detect viable cells of various bacterial pathogens in foods. The incorporation of PMA into PCR-based assays for viability detection of pathogens in foods has increased significantly in the last decade. On the other hand, some downsides with this approach have been noted, particularly to achieve complete suppression of signal of DNA from the dead cells present in some particular food matrix. Nowadays, there is a tendency of more and more researchers adapting this approach for viability detection; and a few commercial kits based on PMA are available in the market. As time goes on, more scientists apply this approach to a broader range of pathogen detections, this viability approach (PMA or other chemicals such as platinum compound

A new oligonucleotide microarray for detection of pathogenic and non-pathogenic Legionella spp.

Directory of Open Access Journals (Sweden)

Boyang Cao

Full Text Available Legionella pneumophila has been recognized as the major cause of legionellosis since the discovery of the deadly disease. Legionella spp. other than L. pneumophila were later found to be responsible to many non-pneumophila infections. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this report, we have sequenced the 16S-23S rRNA gene internal transcribed spacer (ITS of 10 Legionella species and subspecies, including L. anisa, L. bozemanii, L. dumoffii, L. fairfieldensis, L. gormanii, L. jordanis, L. maceachernii, L. micdadei, L. pneumophila subspp. fraseri and L. pneumophila subspp. pasculleii, and developed a rapid oligonucleotide microarray detection technique accordingly to identify 12 most common Legionella spp., which consist of 11 pathogenic species of L. anisa, L. bozemanii, L. dumoffii, L. gormanii, L. jordanis, L. longbeachae, L. maceachernii, L. micdadei, and L. pneumophila (including subspp. pneumophila, subspp. fraseri, and subspp. pasculleii and one non-pathogenic species, L. fairfieldensis. Twenty-nine probes that reproducibly detected multiple Legionella species with high specificity were included in the array. A total of 52 strains, including 30 target pathogens and 22 non-target bacteria, were used to verify the oligonucleotide microarray assay. The sensitivity of the detection was at 1.0 ng with genomic DNA or 13 CFU/100 mL with Legionella cultures. The microarray detected seven samples of air conditioner-condensed water with 100% accuracy, validating the technique as a promising method for applications in basic microbiology, clinical diagnosis, food safety, and epidemiological surveillance. The phylogenetic study based on the ITS has also revealed that the non-pathogenic L. fairfieldensis is the closest to L. pneumophila than the nine other pathogenic Legionella spp.

A New Oligonucleotide Microarray for Detection of Pathogenic and Non-Pathogenic Legionella spp.

Science.gov (United States)

Cao, Boyang; Liu, Xiangqian; Yu, Xiang; Chen, Min; Feng, Lu; Wang, Lei

2014-01-01

Legionella pneumophila has been recognized as the major cause of legionellosis since the discovery of the deadly disease. Legionella spp. other than L. pneumophila were later found to be responsible to many non-pneumophila infections. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this report, we have sequenced the 16S-23S rRNA gene internal transcribed spacer (ITS) of 10 Legionella species and subspecies, including L. anisa, L. bozemanii, L. dumoffii, L. fairfieldensis, L. gormanii, L. jordanis, L. maceachernii, L. micdadei, L. pneumophila subspp. fraseri and L. pneumophila subspp. pasculleii, and developed a rapid oligonucleotide microarray detection technique accordingly to identify 12 most common Legionella spp., which consist of 11 pathogenic species of L. anisa, L. bozemanii, L. dumoffii, L. gormanii, L. jordanis, L. longbeachae, L. maceachernii, L. micdadei, and L. pneumophila (including subspp. pneumophila, subspp. fraseri, and subspp. pasculleii) and one non-pathogenic species, L. fairfieldensis. Twenty-nine probes that reproducibly detected multiple Legionella species with high specificity were included in the array. A total of 52 strains, including 30 target pathogens and 22 non-target bacteria, were used to verify the oligonucleotide microarray assay. The sensitivity of the detection was at 1.0 ng with genomic DNA or 13 CFU/100 mL with Legionella cultures. The microarray detected seven samples of air conditioner-condensed water with 100% accuracy, validating the technique as a promising method for applications in basic microbiology, clinical diagnosis, food safety, and epidemiological surveillance. The phylogenetic study based on the ITS has also revealed that the non-pathogenic L. fairfieldensis is the closest to L. pneumophila than the nine other pathogenic Legionella spp. PMID:25469776

Electrochemical Methodologies for the Detection of Pathogens.

Science.gov (United States)

Amiri, Mandana; Bezaatpour, Abolfazl; Jafari, Hamed; Boukherroub, Rabah; Szunerits, Sabine

2018-05-25

Bacterial infections remain one of the principal causes of morbidity and mortality worldwide. The number of deaths due to infections is declining every year by only 1% with a forecast of 13 million deaths in 2050. Among the 1400 recognized human pathogens, the majority of infectious diseases is caused by just a few, about 20 pathogens only. While the development of vaccinations and novel antibacterial drugs and treatments are at the forefront of research, and strongly financially supported by policy makers, another manner to limit and control infectious outbreaks is targeting the development and implementation of early warning systems, which indicate qualitatively and quantitatively the presence of a pathogen. As toxin contaminated food and drink are a potential threat to human health and consequently have a significant socioeconomic impact worldwide, the detection of pathogenic bacteria remains not only a big scientific challenge but also a practical problem of enormous significance. Numerous analytical methods, including conventional culturing and staining techniques as well as molecular methods based on polymerase chain reaction amplification and immunological assays, have emerged over the years and are used to identify and quantify pathogenic agents. While being highly sensitive in most cases, these approaches are highly time, labor, and cost consuming, requiring trained personnel to perform the frequently complex assays. A great challenge in this field is therefore to develop rapid, sensitive, specific, and if possible miniaturized devices to validate the presence of pathogens in cost and time efficient manners. Electrochemical sensors are well accepted powerful tools for the detection of disease-related biomarkers and environmental and organic hazards. They have also found widespread interest in the last years for the detection of waterborne and foodborne pathogens due to their label free character and high sensitivity. This Review is focused on the current

Autonomous unobtrusive detection of mild cognitive impairment in older adults.

Science.gov (United States)

Akl, Ahmad; Taati, Babak; Mihailidis, Alex

2015-05-01

The current diagnosis process of dementia is resulting in a high percentage of cases with delayed detection. To address this problem, in this paper, we explore the feasibility of autonomously detecting mild cognitive impairment (MCI) in the older adult population. We implement a signal processing approach equipped with a machine learning paradigm to process and analyze real-world data acquired using home-based unobtrusive sensing technologies. Using the sensor and clinical data pertaining to 97 subjects, acquired over an average period of three years, a number of measures associated with the subjects' walking speed and general activity in the home were calculated. Different time spans of these measures were used to generate feature vectors to train and test two machine learning algorithms namely support vector machines and random forests. We were able to autonomously detect MCI in older adults with an area under the ROC curve of 0.97 and an area under the precision-recall curve of 0.93 using a time window of 24 weeks. This study is of great significance since it can potentially assist in the early detection of cognitive impairment in older adults.

Human detection for underground autonomous mine vehicles using thermal imaging

CSIR Research Space (South Africa)

Dickens, JS

2011-07-01

Full Text Available Underground mine automation has the potential to increase safety, productivity and allow the mining of lower-grade resources. In a mining environment with both autonomous robots and humans, it is essential that the robots are able to detect...

Microfluidic devices for sample preparation and rapid detection of foodborne pathogens.

Science.gov (United States)

Kant, Krishna; Shahbazi, Mohammad-Ali; Dave, Vivek Priy; Ngo, Tien Anh; Chidambara, Vinayaka Aaydha; Than, Linh Quyen; Bang, Dang Duong; Wolff, Anders

2018-03-10

Rapid detection of foodborne pathogens at an early stage is imperative for preventing the outbreak of foodborne diseases, known as serious threats to human health. Conventional bacterial culturing methods for foodborne pathogen detection are time consuming, laborious, and with poor pathogen diagnosis competences. This has prompted researchers to call the current status of detection approaches into question and leverage new technologies for superior pathogen sensing outcomes. Novel strategies mainly rely on incorporating all the steps from sample preparation to detection in miniaturized devices for online monitoring of pathogens with high accuracy and sensitivity in a time-saving and cost effective manner. Lab on chip is a blooming area in diagnosis, which exploits different mechanical and biological techniques to detect very low concentrations of pathogens in food samples. This is achieved through streamlining the sample handling and concentrating procedures, which will subsequently reduce human errors and enhance the accuracy of the sensing methods. Integration of sample preparation techniques into these devices can effectively minimize the impact of complex food matrix on pathogen diagnosis and improve the limit of detections. Integration of pathogen capturing bio-receptors on microfluidic devices is a crucial step, which can facilitate recognition abilities in harsh chemical and physical conditions, offering a great commercial benefit to the food-manufacturing sector. This article reviews recent advances in current state-of-the-art of sample preparation and concentration from food matrices with focus on bacterial capturing methods and sensing technologies, along with their advantages and limitations when integrated into microfluidic devices for online rapid detection of pathogens in foods and food production line. Copyright © 2018. Published by Elsevier Inc.

An Autonomous Wearable System for Predicting and Detecting Localised Muscle Fatigue

Science.gov (United States)

Al-Mulla, Mohamed R.; Sepulveda, Francisco; Colley, Martin

2011-01-01

Muscle fatigue is an established area of research and various types of muscle fatigue have been clinically investigated in order to fully understand the condition. This paper demonstrates a non-invasive technique used to automate the fatigue detection and prediction process. The system utilises the clinical aspects such as kinematics and surface electromyography (sEMG) of an athlete during isometric contractions. Various signal analysis methods are used illustrating their applicability in real-time settings. This demonstrated system can be used in sports scenarios to promote muscle growth/performance or prevent injury. To date, research on localised muscle fatigue focuses on the clinical side and lacks the implementation for detecting/predicting localised muscle fatigue using an autonomous system. Results show that automating the process of localised muscle fatigue detection/prediction is promising. The autonomous fatigue system was tested on five individuals showing 90.37% accuracy on average of correct classification and an error of 4.35% in predicting the time to when fatigue will onset. PMID:22319367

An Autonomous Wearable System for Predicting and Detecting Localised Muscle Fatigue

Directory of Open Access Journals (Sweden)

Martin Colley

2011-01-01

Full Text Available Muscle fatigue is an established area of research and various types of muscle fatigue have been clinically investigated in order to fully understand the condition. This paper demonstrates a non-invasive technique used to automate the fatigue detection and prediction process. The system utilises the clinical aspects such as kinematics and surface electromyography (sEMG of an athlete during isometric contractions. Various signal analysis methods are used illustrating their applicability in real-time settings. This demonstrated system can be used in sports scenarios to promote muscle growth/performance or prevent injury. To date, research on localised muscle fatigue focuses on the clinical side and lacks the implementation for detecting/predicting localised muscle fatigue using an autonomous system. Results show that automating the process of localised muscle fatigue detection/prediction is promising. The autonomous fatigue system was tested on five individuals showing 90.37% accuracy on average of correct classification and an error of 4.35% in predicting the time to when fatigue will onset.

Autonomous Rule Creation for Intrusion Detection

Energy Technology Data Exchange (ETDEWEB)

Todd Vollmer; Jim Alves-Foss; Milos Manic

2011-04-01

Many computational intelligence techniques for anomaly based network intrusion detection can be found in literature. Translating a newly discovered intrusion recognition criteria into a distributable rule can be a human intensive effort. This paper explores a multi-modal genetic algorithm solution for autonomous rule creation. This algorithm focuses on the process of creating rules once an intrusion has been identified, rather than the evolution of rules to provide a solution for intrusion detection. The algorithm was demonstrated on anomalous ICMP network packets (input) and Snort rules (output of the algorithm). Output rules were sorted according to a fitness value and any duplicates were removed. The experimental results on ten test cases demonstrated a 100 percent rule alert rate. Out of 33,804 test packets 3 produced false positives. Each test case produced a minimum of three rule variations that could be used as candidates for a production system.

Vision based speed breaker detection for autonomous vehicle

Science.gov (United States)

C. S., Arvind; Mishra, Ritesh; Vishal, Kumar; Gundimeda, Venugopal

2018-04-01

In this paper, we are presenting a robust and real-time, vision-based approach to detect speed breaker in urban environments for autonomous vehicle. Our method is designed to detect the speed breaker using visual inputs obtained from a camera mounted on top of a vehicle. The method performs inverse perspective mapping to generate top view of the road and segment out region of interest based on difference of Gaussian and median filter images. Furthermore, the algorithm performs RANSAC line fitting to identify the possible speed breaker candidate region. This initial guessed region via RANSAC, is validated using support vector machine. Our algorithm can detect different categories of speed breakers on cement, asphalt and interlock roads at various conditions and have achieved a recall of 0.98.

Rapid identification and detection of pathogenic Fungi by padlock probes

NARCIS (Netherlands)

Tsui, C.K.M.; Wang, B.; Schoen, C.D.; Hamelin, R.C.

2013-01-01

Fungi are important pathogens of human diseases, as well as to agricultural crop and trees. Molecular diagnostics can detect diseases early, and improve identification accuracy and follow-up disease management. The use of padlock probe is effective to facilitate these detections and pathogen

Autonomous Chemical Vapour Detection by Micro UAV

Directory of Open Access Journals (Sweden)

Kent Rosser

2015-12-01

Full Text Available The ability to remotely detect and map chemical vapour clouds in open air environments is a topic of significant interest to both defence and civilian communities. In this study, we integrate a prototype miniature colorimetric chemical sensor developed for methyl salicylate (MeS, as a model chemical vapour, into a micro unmanned aerial vehicle (UAV, and perform flights through a raised MeS vapour cloud. Our results show that that the system is capable of detecting MeS vapours at low ppm concentration in real-time flight and rapidly sending this information to users by on-board telemetry. Further, the results also indicate that the sensor is capable of distinguishing “clean” air from “dirty”, multiple times per flight, allowing us to look towards autonomous cloud mapping and source localization applications. Further development will focus on a broader range of integrated sensors, increased autonomy of detection and improved engineering of the system.

Early Seizure Detection Based on Cardiac Autonomic Regulation Dynamics

Directory of Open Access Journals (Sweden)

Jonatas Pavei

2017-10-01

Full Text Available Epilepsy is a neurological disorder that causes changes in the autonomic nervous system. Heart rate variability (HRV reflects the regulation of cardiac activity and autonomic nervous system tone. The early detection of epileptic seizures could foster the use of new treatment approaches. This study presents a new methodology for the prediction of epileptic seizures using HRV signals. Eigendecomposition of HRV parameter covariance matrices was used to create an input for a support vector machine (SVM-based classifier. We analyzed clinical data from 12 patients (9 female; 3 male; age 34.5 ± 7.5 years, involving 34 seizures and a total of 55.2 h of interictal electrocardiogram (ECG recordings. Data from 123.6 h of ECG recordings from healthy subjects were used to test false positive rate per hour (FP/h in a completely independent data set. Our methodological approach allowed the detection of impending seizures from 5 min to just before the onset of a clinical/electrical seizure with a sensitivity of 94.1%. The FP rate was 0.49 h−1 in the recordings from patients with epilepsy and 0.19 h−1 in the recordings from healthy subjects. Our results suggest that it is feasible to use the dynamics of HRV parameters for the early detection and, potentially, the prediction of epileptic seizures.

DNA microarray technique for detecting food-borne pathogens

Directory of Open Access Journals (Sweden)

Xing GAO

2012-08-01

Full Text Available Objective To study the application of DNA microarray technique for screening and identifying multiple food-borne pathogens. Methods The oligonucleotide probes were designed by Clustal X and Oligo 6.0 at the conserved regions of specific genes of multiple food-borne pathogens, and then were validated by bioinformatic analyses. The 5' end of each probe was modified by amino-group and 10 Poly-T, and the optimized probes were synthesized and spotted on aldehyde-coated slides. The bacteria DNA template incubated with Klenow enzyme was amplified by arbitrarily primed PCR, and PCR products incorporated into Aminoallyl-dUTP were coupled with fluorescent dye. After hybridization of the purified PCR products with DNA microarray, the hybridization image and fluorescence intensity analysis was acquired by ScanArray and GenePix Pro 5.1 software. A series of detection conditions such as arbitrarily primed PCR and microarray hybridization were optimized. The specificity of this approach was evaluated by 16 different bacteria DNA, and the sensitivity and reproducibility were verified by 4 food-borne pathogens DNA. The samples of multiple bacteria DNA and simulated water samples of Shigella dysenteriae were detected. Results Nine different food-borne bacteria were successfully discriminated under the same condition. The sensitivity of genomic DNA was 102 －103pg/ μl, and the coefficient of variation (CV of the reproducibility of assay was less than 15%. The corresponding specific hybridization maps of the multiple bacteria DNA samples were obtained, and the detection limit of simulated water sample of Shigella dysenteriae was 3.54×105cfu/ml. Conclusions The DNA microarray detection system based on arbitrarily primed PCR can be employed for effective detection of multiple food-borne pathogens, and this assay may offer a new method for high-throughput platform for detecting bacteria.

Detection and treatment of chemical weapons and/or biological pathogens

Science.gov (United States)

Mariella Jr., Raymond P.

2004-09-07

A system for detection and treatment of chemical weapons and/or biological pathogens uses a detector system, an electrostatic precipitator or scrubber, a circulation system, and a control. The precipitator or scrubber is activated in response to a signal from the detector upon the detection of chemical weapons and/or biological pathogens.

Quantitative multiplex detection of pathogen biomarkers

Energy Technology Data Exchange (ETDEWEB)

Mukundan, Harshini; Xie, Hongzhi; Swanson, Basil I.; Martinez, Jennifer; Grace, Wynne K.

2016-02-09

The present invention addresses the simultaneous detection and quantitative measurement of multiple biomolecules, e.g., pathogen biomarkers through either a sandwich assay approach or a lipid insertion approach. The invention can further employ a multichannel, structure with multi-sensor elements per channel.

Quantitative multiplex detection of pathogen biomarkers

Science.gov (United States)

Mukundan, Harshini; Xie, Hongzhi; Swanson, Basil I; Martinez, Jennifer; Grace, Wynne K

2014-10-14

The present invention addresses the simultaneous detection and quantitative measurement of multiple biomolecules, e.g., pathogen biomarkers through either a sandwich assay approach or a lipid insertion approach. The invention can further employ a multichannel, structure with multi-sensor elements per channel.

Rapid detection, characterization, and enumeration of foodborne pathogens.

Science.gov (United States)

Hoorfar, J

2011-11-01

As food safety management further develops, microbiological testing will continue to play an important role in assessing whether Food Safety Objectives are achieved. However, traditional microbiological culture-based methods are limited, particularly in their ability to provide timely data. The present review discusses the reasons for the increasing interest in rapid methods, current developments in the field, the research needs, and the future trends. The advent of biotechnology has introduced new technologies that led to the emergence of rapid diagnostic methods and altered food testing practices. Rapid methods are comprised of many different detection technologies, including specialized enzyme substrates, antibodies and DNA, ranging from simple differential plating media to the use of sophisticated instruments. The use of non-invasive sampling techniques for live animals especially came into focus with the 1990s outbreak of bovine spongiform encephalopathy that was linked to the human outbreak of Creutzfeldt Jakob's Disease. Serology is still an important tool in preventing foodborne pathogens to enter the human food supply through meat and milk from animals. One of the primary uses of rapid methods is for fast screening of large number of samples, where most of them are expected to be test-negative, leading to faster product release for sale. This has been the main strength of rapid methods such as real-time Polymerase Chain Reaction (PCR). Enrichment PCR, where a primary culture broth is tested in PCR, is the most common approach in rapid testing. Recent reports show that it is possible both to enrich a sample and enumerate by pathogen-specific real-time PCR, if the enrichment time is short. This can be especially useful in situations where food producers ask for the level of pathogen in a contaminated product. Another key issue is automation, where the key drivers are miniaturization and multiple testing, which mean that not only one instrument is flexible

Real-time door detection for indoor autonomous vehicle

Science.gov (United States)

He, Zhihao; Zhu, Ming

2017-07-01

Indoor Autonomous Vehicle(IAV) is used in many indoor scenes. Such as hotels and hospitals. Door detection is a key issue to guide the IAV into rooms. In this paper, we consider door detection in the use of indoor navigation of IAV. Since real-time properties are important for real-world IAV, the detection algorithm must be fast enough. Most monocular-camera based door detection model need a perfect detection of the four line segments of the door or the four corners. But in many situations, line segments could be extended or cut off. And there could be many false detected corners. And few of them can distinguish doors from door-like objects with door-like shape effectively. We proposed a 2-D vision model of the door that is made up of line segments. The number of parts detected is used to determine the possibility of a door. Our algorithm is tested on a database of doors.1 The robustness and real-time are verified. The precision is 89.4%. Average time consumed for processing a 640x320 figure is 44.73ms.

Motor execution detection based on autonomic nervous system responses

International Nuclear Information System (INIS)

Marchal-Crespo, Laura; Riener, Robert; Zimmermann, Raphael; Lambercy, Olivier; Edelmann, Janis; Fluet, Marie-Christine; Gassert, Roger; Wolf, Martin

2013-01-01

Triggered assistance has been shown to be a successful robotic strategy for provoking motor plasticity, probably because it requires neurologic patients’ active participation to initiate a movement involving their impaired limb. Triggered assistance, however, requires sufficient residual motor control to activate the trigger and, thus, is not applicable to individuals with severe neurologic injuries. In these situations, brain and body–computer interfaces have emerged as promising solutions to control robotic devices. In this paper, we investigate the feasibility of a body–machine interface to detect motion execution only monitoring the autonomic nervous system (ANS) response. Four physiological signals were measured (blood pressure, breathing rate, skin conductance response and heart rate) during an isometric pinching task and used to train a classifier based on hidden Markov models. We performed an experiment with six healthy subjects to test the effectiveness of the classifier to detect rest and active pinching periods. The results showed that the movement execution can be accurately classified based only on peripheral autonomic signals, with an accuracy level of 84.5%, sensitivity of 83.8% and specificity of 85.2%. These results are encouraging to perform further research on the use of the ANS response in body–machine interfaces. (paper)

Biocontrol and Rapid Detection of Food-borne Pathogens Using Bacteriophages and Endolysins

Directory of Open Access Journals (Sweden)

Jaewoo eBai

2016-04-01

Full Text Available Bacteriophages have been suggested as natural food preservatives as well as rapid detection materials for food-borne pathogens in various foods. Since Listeria monocytogenes-targeting phage cocktail (ListShield was approved for applications in foods, numerous phages have been screened and experimentally characterized for phage applications in foods. A single phage and phage cocktail treatments to various foods contaminated with food-borne pathogens including E. coli O157:H7, Salmonella enterica, Campylobacter jejuni, Listeria monocytogenes, Staphylococcus aureus, Cronobacter sakazakii, and Vibrio spp. revealed that they have great potential to control various food-borne pathogens and may be alternative for conventional food preservatives. In addition, phage-derived endolysins with high host specificity and host lysis activities may be preferred to food applications rather than phages. For rapid detection of food-borne pathogens, cell-wall binding domains (CBDs from endolysins have been suggested due to their high host-specific binding. Fluorescence-tagged CBDs have been successfully evaluated and suggested to be alternative materials of expensive antibodies for various detection applications. Most recently, reporter phage systems have been developed and tested to confirm their usability and accuracy for specific detection. These systems revealed some advantages like rapid detection of only viable pathogenic cells without interference by food components in a very short reaction time, suggesting that these systems may be suitable for monitoring of pathogens in foods. Consequently, phage is the next-generation biocontrol agent as well as rapid detection tool to confirm and even identify the food-borne pathogens present in various foods.

Microfluidic devices for sample preparation and rapid detection of foodborne pathogens

DEFF Research Database (Denmark)

Kant, Krishna; Shahbazi, Mohammad-Ali; Dave, Vivek Priy

2018-01-01

and improve the limit of detections. Integration of pathogen capturing bio-receptors on microfluidic devices is a crucial step, which can facilitate recognition abilities in harsh chemical and physical conditions, offering a great commercial benefit to the food-manufacturing sector. This article reviews...... diagnosis competences. This has prompted researchers to call the current status of detection approaches into question and leverage new technologies for superior pathogen sensing outcomes. Novel strategies mainly rely on incorporating all the steps from sample preparation to detection in miniaturized devices...... recent advances in current state-of-the-art of sample preparation and concentration from food matrices with focus on bacterial capturing methods and sensing technologies, along with their advantages and limitations when integrated into microfluidic devices for online rapid detection of pathogens in foods...

Real-time object detection and semantic segmentation for autonomous driving

Science.gov (United States)

Li, Baojun; Liu, Shun; Xu, Weichao; Qiu, Wei

2018-02-01

In this paper, we proposed a Highly Coupled Network (HCNet) for joint objection detection and semantic segmentation. It follows that our method is faster and performs better than the previous approaches whose decoder networks of different tasks are independent. Besides, we present multi-scale loss architecture to learn better representation for different scale objects, but without extra time in the inference phase. Experiment results show that our method achieves state-of-the-art results on the KITTI datasets. Moreover, it can run at 35 FPS on a GPU and thus is a practical solution to object detection and semantic segmentation for autonomous driving.

Detecting marine hazardous substances and organisms: sensors for pollutants, toxins, and pathogens

Directory of Open Access Journals (Sweden)

O. Zielinski

2009-09-01

Full Text Available Marine environments are influenced by a wide diversity of anthropogenic and natural substances and organisms that may have adverse effects on human health and ecosystems. Real-time measurements of pollutants, toxins, and pathogens across a range of spatial scales are required to adequately monitor these hazards, manage the consequences, and to understand the processes governing their magnitude and distribution. Significant technological advancements have been made in recent years for the detection and analysis of such marine hazards. In particular, sensors deployed on a variety of mobile and fixed-point observing platforms provide a valuable means to assess hazards. In this review, we present state-of-the-art of sensor technology for the detection of harmful substances and organisms in the ocean. Sensors are classified by their adaptability to various platforms, addressing large, intermediate, or small areal scales. Current gaps and future demands are identified with an indication of the urgent need for new sensors to detect marine hazards at all scales in autonomous real-time mode. Progress in sensor technology is expected to depend on the development of small-scale sensor technologies with a high sensitivity and specificity towards target analytes or organisms. However, deployable systems must comply with platform requirements as these interconnect the three areal scales. Future developments will include the integration of existing methods into complex and operational sensing systems for a comprehensive strategy for long-term monitoring. The combination of sensor techniques on all scales will remain crucial for the demand of large spatial and temporal coverage.

Improving the Lane Reference Detection for Autonomous Road Vehicle Control

Directory of Open Access Journals (Sweden)

Felipe Jiménez

2016-01-01

Full Text Available Autonomous road vehicles are increasingly becoming more important and there are several techniques and sensors that are being applied for vehicle control. This paper presents an alternative system for maintaining the position of autonomous vehicles without adding additional elements to the standard sensor architecture, by using a 3D laser scanner for continuously detecting a reference element in situations in which the GNSS receiver fails or provides accuracy below the required level. Considering that the guidance variables are more accurately estimated when dealing with reference points in front of and behind the vehicle, an algorithm based on vehicle dynamics mathematical model is proposed to extend the detected points in cases where the sensor is placed at the front of the vehicle. The algorithm has been tested when driving along a lane delimited by New Jersey barriers at both sides and the results show a correct behaviour. The system is capable of estimating the reference element behind the vehicle with sufficient accuracy when the laser scanner is placed at the front of it, so the robustness of the control input variables (lateral and angular errors estimation is improved making it unnecessary to place the sensor on the vehicle roof or to introduce additional sensors.

9 CFR 113.36 - Detection of pathogens by the chicken inoculation test.

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Detection of pathogens by the chicken... REQUIREMENTS Standard Procedures § 113.36 Detection of pathogens by the chicken inoculation test. The test for...,000 doses. (b) At least 25 healthy susceptible young chickens, properly identified and obtained from...

Detection and characterization of foodborne pathogenic bacteria with hyperspectral microscope imaging

Science.gov (United States)

Rapid detection and identification of pathogenic microorganisms naturally occurring during food processing are important in developing intervention and verification strategies. In the poultry industry, contamination of poultry meat with foodborne pathogens (especially, Salmonella and Campylobacter) ...

Surrounding Moving Obstacle Detection for Autonomous Driving Using Stereo Vision

Directory of Open Access Journals (Sweden)

Hao Sun

2013-06-01

Full Text Available Detection and tracking surrounding moving obstacles such as vehicles and pedestrians are crucial for the safety of mobile robotics and autonomous vehicles. This is especially the case in urban driving scenarios. This paper presents a novel framework for surrounding moving obstacles detection using binocular stereo vision. The contributions of our work are threefold. Firstly, a multiview feature matching scheme is presented for simultaneous stereo correspondence and motion correspondence searching. Secondly, the multiview geometry constraint derived from the relative camera positions in pairs of consecutive stereo views is exploited for surrounding moving obstacles detection. Thirdly, an adaptive particle filter is proposed for tracking of multiple moving obstacles in surrounding areas. Experimental results from real-world driving sequences demonstrate the effectiveness and robustness of the proposed framework.

Rapid Methods for the Detection of Foodborne Bacterial Pathogens: Principles, Applications, Advantages and Limitations

Directory of Open Access Journals (Sweden)

Law eJodi Woan-Fei

2015-01-01

Full Text Available The incidence of foodborne diseases has increased over the years and resulted in major public health problem globally. Foodborne pathogens can be found in various foods and it is important to detect foodborne pathogens to provide safe food supply and to prevent foodborne diseases. The conventional methods used to detect foodborne pathogen are time consuming and laborious. Hence, a variety of methods have been developed for rapid detection of foodborne pathogens as it is required in many food analyses. Rapid detection methods can be categorized into nucleic acid-based, biosensor-based and immunological-based methods. This review emphasizes on the principles and application of recent rapid methods for the detection of foodborne bacterial pathogens. Detection methods included are simple polymerase chain reaction (PCR, multiplex PCR, real-time PCR, nucleic acid sequence-based amplification (NASBA, loop-mediated isothermal amplification (LAMP and oligonucleotide DNA microarray which classified as nucleic acid-based methods; optical, electrochemical and mass-based biosensors which classified as biosensor-based methods; enzyme-linked immunosorbent assay (ELISA and lateral flow immunoassay which classified as immunological-based methods. In general, rapid detection methods are generally time-efficient, sensitive, specific and labor-saving. The developments of rapid detection methods are vital in prevention and treatment of foodborne diseases.

Deoxyribonucleic Acid Probes Analyses for the Detection of Periodontal Pathogens.

Science.gov (United States)

Al Yahfoufi, Zoubeida; Hadchiti, Wahib; Berberi, Antoine

2015-09-01

In clinical microbiology several techniques have been used to identify bacteria. Recently, Deoxyribonucleic acid (DNA)-based techniques have been introduced to detect human microbial pathogens in periodontal diseases. Deoxyribonucleic acid probes can detect bacteria at a very low level if we compared with the culture methods. These probes have shown rapid and cost-effective microbial diagnosis, good sensitivity and specificity for some periodontal pathogens in cases of severe periodontitis. Eighty-five patients were recruited for the study. Twenty-one subjects ranging between 22 and 48 years of age fulfilled the inclusion and exclusion criteria. Seventy-eight samples became available for DNA probe analysis from the deepest pockets in each quadrant. All 21 patients showed positive results for Prevotella intermedia; also, Prevotella gingivalis was identified in 19 subjects, Aggregatibacter actinomycetemcomitans in 6 subjects. P. intermedia was diagnosed positive in 82% of the subgingival samples taken, 79% for P. gingivalis, and 23% for A. actinomycetemcomitans. This study shows a high frequency of putative periodontal pathogens by using DNA probe technology, which is semi-quantitative in this study. Deoxyribonucleic acid probes can detect bacteria at very low level about 10(3) which is below the detection level of culture methods. The detection threshold of cultural methods. The three types of bacteria can be detected rapidly with high sensitivity by using the DNA probe by general practitioners, and thus can help in the diagnosis process and the treatment.

Label and label-free based surface-enhanced Raman scattering for pathogen bacteria detection: A review.

Science.gov (United States)

Liu, Yu; Zhou, Haibo; Hu, Ziwei; Yu, Guangxia; Yang, Danting; Zhao, Jinshun

2017-08-15

Rapid, accurate detection of pathogen bacteria is a highly topical research area for the sake of food safety and public health. Surface-enhanced Raman scattering (SERS) is being considered as a powerful and attractive technique for pathogen bacteria detection, due to its sensitivity, high speed, comparatively low cost, multiplexing ability and portability. This contribution aims to give a comprehensive overview of SERS as a technique for rapid detection of pathogen bacteria based on label and label-free strategies. A brief tutorial on SERS is given first of all. Then we summarize the recent trends and developments of label and label-free based SERS applied to detection of pathogen bacteria, including the relatively complete interpretation of SERS spectra. In addition, multifunctional SERS platforms for pathogen bacteria in matrix are discussed as well. Furthermore, an outlook of the work done and a perspective on the future directions of SERS as a reliable tool for real-time pathogen bacteria detection are given. Copyright © 2017 Elsevier B.V. All rights reserved.

Bacteriophages for detection of bacterial pathogens

International Nuclear Information System (INIS)

Kutateladze, M.

2009-01-01

The G. Eliava Institute of Bacteriophages, Microbiology and Virology (Tbilisi, Georgia) is one of the most famous institutions focused on bacteriophage research for the elaboration of appropriate phage methodologies for human and animal protection. The main direction of the institute is the study and production of bacteriophages against intestinal disorders (dysentery, typhoid, intesti) and purulent-septic infections (staphylococcus, streptococcus, pyophage, etc.). These preparations were successfully introduced during the Soviet era, and for decades were used throughout the former Soviet Union and in other Socialist countries for the treatment, prophylaxis, and diagnosis of various infectious diseases, including those caused by antibiotic-resistant bacterial strains. Bacteriophages were widely used for identifying and detecting infections caused by the most dangerous pathogens and causative agents of epidemiological outbreaks. The specific topic of this presentation is the phage typing of bacterial species, which can be an important method for epidemiological diagnostics. Together with different genetic methodologies - such as PCR-based methods, PFGE, plasmid fingerprinting, and ribosomal typing - phage typing is one method for identifying bacterial pathogens. The method has a high percentage of determination of phage types, high specificity of reaction, and is easy for interpretation and use by health workers. Phage typing was applied for inter-species differentiation of different species of Salmonella, S. typhi, Brucella spp, Staphylococcus aureus, E. col,i Clostridium deficile, Vibrio cholerae, Yersinia pestis, Yersinia enterocolitica, Lysteria monocytogenes, Clostridium perfringens, Clostridium tetani, plant pathogens, and other bacterial pathogens. In addition to addressing the utility and efficacy of phage typing, the paper will discuss the isolation and selection of diagnostic typing phages for interspecies differentiation of pathogens that is necessary

9 CFR 113.37 - Detection of pathogens by the chicken embryo inoculation test.

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Detection of pathogens by the chicken... VECTORS STANDARD REQUIREMENTS Standard Procedures § 113.37 Detection of pathogens by the chicken embryo...-serum mixture shall be inoculated into each of at least 20 fully susceptible chicken embryos. (1) Twenty...

Recent developments in pathogen detection arrays: implications for fungal plant pathogens and use in practica

NARCIS (Netherlands)

Lievens, B.; Thomma, B.P.H.J.

2005-01-01

The failure to adequately identify plant pathogens from culture-based morphological techniques has led to the development of culture-independent molecular approaches. Increasingly, diagnostic laboratories are pursuing fast routine methods that provide reliable identification, sensitive detection,

Molecular Detection and Characterization of Tick-borne Pathogens in Dogs and Ticks from Nigeria

Science.gov (United States)

Kamani, Joshua; Baneth, Gad; Mumcuoglu, Kosta Y.; Waziri, Ndadilnasiya E.; Eyal, Osnat; Guthmann, Yifat; Harrus, Shimon

2013-01-01

Background Only limited information is currently available on the prevalence of vector borne and zoonotic pathogens in dogs and ticks in Nigeria. The aim of this study was to use molecular techniques to detect and characterize vector borne pathogens in dogs and ticks from Nigeria. Methodology/Principal Findings Blood samples and ticks (Rhipicephalus sanguineus, Rhipicephalus turanicus and Heamaphysalis leachi) collected from 181 dogs from Nigeria were molecularly screened for human and animal vector-borne pathogens by PCR and sequencing. DNA of Hepatozoon canis (41.4%), Ehrlichia canis (12.7%), Rickettsia spp. (8.8%), Babesia rossi (6.6%), Anaplasma platys (6.6%), Babesia vogeli (0.6%) and Theileria sp. (0.6%) was detected in the blood samples. DNA of E. canis (23.7%), H. canis (21.1%), Rickettsia spp. (10.5%), Candidatus Neoehrlichia mikurensis (5.3%) and A. platys (1.9%) was detected in 258 ticks collected from 42 of the 181 dogs. Co- infections with two pathogens were present in 37% of the dogs examined and one dog was co-infected with 3 pathogens. DNA of Rickettsia conorii israelensis was detected in one dog and Rhipicephalus sanguineus tick. DNA of another human pathogen, Candidatus N. mikurensis was detected in Rhipicephalus sanguineus and Heamaphysalis leachi ticks, and is the first description of Candidatus N. mikurensis in Africa. The Theileria sp. DNA detected in a local dog in this study had 98% sequence identity to Theileria ovis from sheep. Conclusions/Significance The results of this study indicate that human and animal pathogens are abundant in dogs and their ticks in Nigeria and portray the potential high risk of human exposure to infection with these agents. PMID:23505591

Molecular detection and characterization of tick-borne pathogens in dogs and ticks from Nigeria.

Directory of Open Access Journals (Sweden)

Joshua Kamani

Full Text Available BACKGROUND: Only limited information is currently available on the prevalence of vector borne and zoonotic pathogens in dogs and ticks in Nigeria. The aim of this study was to use molecular techniques to detect and characterize vector borne pathogens in dogs and ticks from Nigeria. METHODOLOGY/PRINCIPAL FINDINGS: Blood samples and ticks (Rhipicephalus sanguineus, Rhipicephalus turanicus and Heamaphysalis leachi collected from 181 dogs from Nigeria were molecularly screened for human and animal vector-borne pathogens by PCR and sequencing. DNA of Hepatozoon canis (41.4%, Ehrlichia canis (12.7%, Rickettsia spp. (8.8%, Babesia rossi (6.6%, Anaplasma platys (6.6%, Babesia vogeli (0.6% and Theileria sp. (0.6% was detected in the blood samples. DNA of E. canis (23.7%, H. canis (21.1%, Rickettsia spp. (10.5%, Candidatus Neoehrlichia mikurensis (5.3% and A. platys (1.9% was detected in 258 ticks collected from 42 of the 181 dogs. Co- infections with two pathogens were present in 37% of the dogs examined and one dog was co-infected with 3 pathogens. DNA of Rickettsia conorii israelensis was detected in one dog and Rhipicephalus sanguineus tick. DNA of another human pathogen, Candidatus N. mikurensis was detected in Rhipicephalus sanguineus and Heamaphysalis leachi ticks, and is the first description of Candidatus N. mikurensis in Africa. The Theileria sp. DNA detected in a local dog in this study had 98% sequence identity to Theileria ovis from sheep. CONCLUSIONS/SIGNIFICANCE: The results of this study indicate that human and animal pathogens are abundant in dogs and their ticks in Nigeria and portray the potential high risk of human exposure to infection with these agents.

A feature matching and fusion-based positive obstacle detection algorithm for field autonomous land vehicles

Directory of Open Access Journals (Sweden)

Tao Wu

2017-03-01

Full Text Available Positive obstacles will cause damage to field robotics during traveling in field. Field autonomous land vehicle is a typical field robotic. This article presents a feature matching and fusion-based algorithm to detect obstacles using LiDARs for field autonomous land vehicles. There are three main contributions: (1 A novel setup method of compact LiDAR is introduced. This method improved the LiDAR data density and reduced the blind region of the LiDAR sensor. (2 A mathematical model is deduced under this new setup method. The ideal scan line is generated by using the deduced mathematical model. (3 Based on the proposed mathematical model, a feature matching and fusion (FMAF-based algorithm is presented in this article, which is employed to detect obstacles. Experimental results show that the performance of the proposed algorithm is robust and stable, and the computing time is reduced by an order of two magnitudes by comparing with other exited algorithms. This algorithm has been perfectly applied to our autonomous land vehicle, which has won the champion in the challenge of Chinese “Overcome Danger 2014” ground unmanned vehicle.

Autonomous nutrient detection for water quality monitoring

OpenAIRE

Maher, Damien; Cleary, John; Cogan, Deirdre; Diamond, Dermot

2012-01-01

The ever increasing demand for real time environmental monitoring is currently being driven by strong legislative and societal drivers. Low cost autonomous environmental monitoring systems are required to meet this demand as current monitoring solutions are insufficient. This poster presents an autonomous nutrient analyser platform for water quality monitoring. Results from a field trial of the nutrient analyser are reported along with current work to expand the range of water quality targ...

Detection of pathogens from periodontal lesions

Directory of Open Access Journals (Sweden)

Malheiros Veruska de João

2004-01-01

Full Text Available OBJECTIVE: To comparatively detect A. actinomycetemcomitans and F. nucleatum from periodontal and healthy sites. METHODS: Subgingival clinical samples from 50 periodontitis adult patients and 50 healthy subjects were analyzed. Both organisms were isolated using a trypticase soy agar-bacitracin-vancomycin (TSBV medium and detected by PCR. Conventional biochemical tests were used for bacteria identification. RESULTS: A. actinomycetemcomitans and F. nucleatum were isolated in 18% and 20% of the patients, respectively, and in 2% and 24% of healthy subjects. Among A. actinomycetemcomitans isolates, biotype II was the most prevalent. Primer pair AA was 100% sensitive in the detection of A. actinomycetemcomitans from both subject groups. Primers ASH and FU were also 100% sensitive to detect this organism in healthy subject samples. Primer pair FN5047 was more sensitive to detect F. nucleatum in patients or in healthy samples than primer 5059S. Primers ASH and 5059S were more specific in the detection of A. actinomycetemcomitans and F. nucleatum, respectively, in patients and in healthy subject samples. CONCLUSIONS: PCR is an effective tool for detecting periodontal pathogens in subgingival samples, providing a faster and safer diagnostic tool of periodontal diseases. The method's sensitivity and specificity is conditioned by the choice of the set of primers used.

Nucleic Acid-based Detection of Bacterial Pathogens Using Integrated Microfluidic Platform Systems

Directory of Open Access Journals (Sweden)

Carl A. Batt

2009-05-01

Full Text Available The advent of nucleic acid-based pathogen detection methods offers increased sensitivity and specificity over traditional microbiological techniques, driving the development of portable, integrated biosensors. The miniaturization and automation of integrated detection systems presents a significant advantage for rapid, portable field-based testing. In this review, we highlight current developments and directions in nucleic acid-based micro total analysis systems for the detection of bacterial pathogens. Recent progress in the miniaturization of microfluidic processing steps for cell capture, DNA extraction and purification, polymerase chain reaction, and product detection are detailed. Discussions include strategies and challenges for implementation of an integrated portable platform.

Rapid detection, characterization, and enumeration of foodborne pathogens

DEFF Research Database (Denmark)

Hoorfar, Jeffrey

2011-01-01

. The present review discusses the reasons for the increasing interest in rapid methods; current developments in the field, the research needs, and the future trends. The advent of biotechnology has introduced new technologies that led to the emergence of rapid diagnostic methods and altered food testing...... of rapid methods is for fast screening of large number of samples, where most of them are expected to be test-negative, leading to faster product release for sale. This has been the main strength of rapid methods such as real-time Polymerase Chain Reaction (PCR). Enrichment PCR, where a primary culture...... of pathogen in a contaminated product. Another key issue is automation, where the key drivers are miniaturization and multiple testing, which mean that not only one instrument is flexible enough to test for many pathogens but also many pathogens can be detected with one test. The review is mainly based...

Pathogen detection by the polymerase chain reaction

Energy Technology Data Exchange (ETDEWEB)

Chitpatima, S T; Settachan, D; Pornsilpatip, J; Visawapoka, U [Pramongkutklao College of Medicine, Bangkok (Thailand). Molecular Biology Lab.; Dvorak, D R [Amersham International Ltd., Singapore (Singapore)

1994-05-01

In recent years, significant advances in the knowledge of DNA and its make up have led to the development of a powerful technique called polymerase chain reaction (PCR). Since the advent of PCR, laboratories around the globe have been exploiting this technology to bridge limitations or to overcome common problems encountered in molecular biology techniques. In addition, this technology has been employed successfully in diagnostic and basic scientific research and development. The true potentials of this technology is realized in early detection of pathogens and genetic abnormalities. In this paper two PCR protocols are described. The first is for detection of HIV-1 DNA in blood, the other for detection of rabies virus RNA in brain cells. 6 refs, 3 figs, 1 tab.

Multiplex PCR assay for simultaneous detection of six major bacterial pathogens of rice.

Science.gov (United States)

Cui, Z; Ojaghian, M R; Tao, Z; Kakar, K U; Zeng, J; Zhao, W; Duan, Y; Vera Cruz, C M; Li, B; Zhu, B; Xie, G

2016-05-01

The aim of this study was to develop a multiplex PCR (mPCR) assay for rapid, sensitive and simultaneous detection of six important rice pathogens: Xanthomonas oryzae pv. oryzae, X. oryzae pv. oryzicola, Pseudomonas fuscovaginae, Burkholderia glumae, Burkholderia gladioli and Acidovorax avenae subsp. avenae. Specific primers were designed through a bioinformatics pipeline. Sensitivity of detection was established using both traditional PCR and quantitative real-time PCR on isolated DNA and on bacterial cells both in vitro and in simulated diseased seeds and the parameters were optimized for an mPCR assay. A total of 150 bacterial strains were tested for specificity. The mPCR assay accurately predicted the presence of pathogens among 44 symptomatic and asymptomatic rice seed, sheath and leaf samples. This study confirmed that this mPCR assay is a rapid, reliable and simple tool for the simultaneous detection of six important rice bacterial pathogens. This study is the first report of a method allowing simultaneous detection of six major rice pathogens. The ability to use crude extracts from plants without bacterial isolation or DNA extraction enhances the value of this mPCR technology for rapid detection and aetiological/epidemiological studies. © 2016 The Society for Applied Microbiology.

Advanced biosensors for detection of pathogens related to livestock and poultry.

Science.gov (United States)

Vidic, Jasmina; Manzano, Marisa; Chang, Chung-Ming; Jaffrezic-Renault, Nicole

2017-02-21

Infectious animal diseases caused by pathogenic microorganisms such as bacteria and viruses threaten the health and well-being of wildlife, livestock, and human populations, limit productivity and increase significantly economic losses to each sector. The pathogen detection is an important step for the diagnostics, successful treatment of animal infection diseases and control management in farms and field conditions. Current techniques employed to diagnose pathogens in livestock and poultry include classical plate-based methods and conventional biochemical methods as enzyme-linked immunosorbent assays (ELISA). These methods are time-consuming and frequently incapable to distinguish between low and highly pathogenic strains. Molecular techniques such as polymerase chain reaction (PCR) and real time PCR (RT-PCR) have also been proposed to be used to diagnose and identify relevant infectious disease in animals. However these DNA-based methodologies need isolated genetic materials and sophisticated instruments, being not suitable for in field analysis. Consequently, there is strong interest for developing new swift point-of-care biosensing systems for early detection of animal diseases with high sensitivity and specificity. In this review, we provide an overview of the innovative biosensing systems that can be applied for livestock pathogen detection. Different sensing strategies based on DNA receptors, glycan, aptamers and antibodies are presented. Besides devices still at development level some are validated according to standards of the World Organization for Animal Health and are commercially available. Especially, paper-based platforms proposed as an affordable, rapid and easy to perform sensing systems for implementation in field condition are included in this review.

Rapid detection of pathogenic bacteria by volatile organic compound (VOC) analysis

Science.gov (United States)

Senecal, Andre G.; Magnone, Joshua; Yeomans, Walter; Powers, Edmund M.

2002-02-01

Developments in rapid detection technologies have made countless improvements over the years. However, because of the limited sample that these technologies can process in a single run, the chance of capturing and identifying a small amount of pathogens is difficult. The problem is further magnified by the natural random distribution of pathogens in foods. Methods to simplify pathogenic detection through the identification of bacteria specific VOC were studied. E. coli O157:H7 and Salmonella typhimurium were grown on selected agar medium to model protein, and carbohydrate based foods. Pathogenic and common spoilage bacteria (Pseudomonas and Morexella) were screened for unique VOC production. Bacteria were grown on agar slants in closed vials. Headspace sampling was performed at intervals up to 24 hours using Solid Phase Micro-Extraction (SPME) techniques followed by GC/MS analysis. Development of unique volatiles was followed to establish sensitivity of detection. E. coli produced VOC not found in either Trypticase Soy Yeast (TSY) agar blanks or spoilage organism samples were - indole, 1-decanol, and 2-nonanone. Salmonella specific VOC grown on TSY were 3-methyl-1-butanol, dimethyl sulfide, 2-undecanol, 2-pentadecanol and 1-octanol. Trials on potato dextrose agar (PDA) slants indicated VOC specific for E. coli and Salmonella when compared to PDA blanks and Pseudomonas samples. However, these VOC peaks were similar for both pathogens. Morexella did not grow on PDA slants. Work will continue with model growth mediums at various temperatures, and mixed flora inoculums. As well as, VOC production based on the dynamics of bacterial growth.

Methods for detecting pathogens in the beef food chain: detecting particular pathogens

Science.gov (United States)

The main food-borne pathogens of concern in the beef food chain are Shiga toxin-producing Escherichia coli (STEC) and Salmonella spp.; however, the presence of other pathogens, including Listeria monocytogenes, Campylobacter spp., Clostridium spp., Bacillus cereus, and Mycobacterium avium subsp. par...

Nano-particle enhanced impedimetric biosensor for detection of foodborne pathogens

International Nuclear Information System (INIS)

Kim, G; Om, A S; Mun, J H

2007-01-01

Recent outbreaks of foodborne illness have been increased the need for rapid and sensitive methods for detection of these pathogens. Conventional methods for pathogens detection and identification involve prolonged multiple enrichment steps. Even though some immunological rapid assays are available, these assays still need enrichment steps result in delayed detection. Biosensors have shown great potential for rapid detection of foodborne pathogens. They are capable of direct monitoring the antigen-antibody reactions in real time. Among the biosensors, impedimetric biosensors have been widely adapted as an analysis tool for the study of various biological binding reactions because of their high sensitivity and reagentless operation. In this study a nanoparticle-enhanced impedimetric biosensor for Salmonella enteritidis detection was developed which detected impedance changes caused by the attachment of the cells to the anti-Salmonella antibodies immobilized on interdigitated gold electrodes. Successive immobilization of neutravidin followed by anti-Salmonella antibodies was performed to the sensing area to create a biological detection surface. To enhance the impedance responses generated by antigen-antibody reactions, anti-Salmonella antibody conjugated nanoparticles were introduced on the sensing area. Using a portable impedance analyzer, the impedance across the interdigital electrodes was measured after the series of antigen-antibody bindings. Bacteria cells present in solution attached to capture antibodies and became tethered to the sensor surface. Attached bacteria cells changed the dielectric constant of the media between the electrodes thereby causing a change in measured impedance. Optimum input frequency was determined by analyzing frequency characteristics of the biosensor over ranges of applied frequencies from 10 Hz to 400 Hz. At 100 Hz of input frequency, the biosensor was most sensitive to the changes of the bacteria concentration and this frequency

SERS based point-of-care detection of food-borne pathogens

International Nuclear Information System (INIS)

Mungroo, Nawfal Adam; Oliveira, Gustavo; Neethirajan, Suresh

2016-01-01

The authors have developed a microfluidic platform for improved detection of pathogenic bacteria by using silver nanoparticles and new platforms for chemometric data analysis, viz. a combination of principle component analysis and linear discriminant analysis. The method can distinguish eight key food borne pathogens (E. coli, S. typhimirium, S. enteritis, Pseudomonas aeruginosa, L. monocytogenes, L. innocua, MRSA 35 and MRSA 86) and, hence, holds good promise for use in the food industry. (author)

Luciferase-Zinc-Finger System for the Rapid Detection of Pathogenic Bacteria.

Science.gov (United States)

Shi, Chu; Xu, Qing; Ge, Yue; Jiang, Ling; Huang, He

2017-08-09

Rapid and reliable detection of pathogenic bacteria is crucial for food safety control. Here, we present a novel luciferase-zinc finger system for the detection of pathogens that offers rapid and specific profiling. The system, which uses a zinc-finger protein domain to probe zinc finger recognition sites, was designed to bind the amplified conserved regions of 16S rDNA, and the obtained products were detected using a modified luciferase. The luciferase-zinc finger system not only maintained luciferase activity but also allowed the specific detection of different bacterial species, with a sensitivity as low as 10 copies and a linear range from 10 to 10 4 copies per microliter of the specific PCR product. Moreover, the system is robust and rapid, enabling the simultaneous detection of 6 species of bacteria in artificially contaminated samples with excellent accuracy. Thus, we envision that our luciferase-zinc finger system will have far-reaching applications.

Increased detection of mastitis pathogens by real-time PCR compared to bacterial culture.

Science.gov (United States)

Keane, O M; Budd, K E; Flynn, J; McCoy, F

2013-09-21

Rapid and accurate identification of mastitis pathogens is important for disease control. Bacterial culture and isolate identification is considered the gold standard in mastitis diagnosis but is time consuming and results in many culture-negative samples. Identification of mastitis pathogens by PCR has been proposed as a fast and sensitive alternative to bacterial culture. The results of bacterial culture and PCR for the identification of the aetiological agent of clinical mastitis were compared. The pathogen identified by traditional culture methods was also detected by PCR in 98 per cent of cases indicating good agreement between the positive results of bacterial culture and PCR. A mastitis pathogen could not be recovered from approximately 30 per cent of samples by bacterial culture, however, an aetiological agent was identified by PCR in 79 per cent of these samples. Therefore, a mastitis pathogen was detected in significantly more milk samples by PCR than by bacterial culture (92 per cent and 70 per cent, respectively) although the clinical relevance of PCR-positive culture-negative results remains controversial. A mixed infection of two or more mastitis pathogens was also detected more commonly by PCR. Culture-negative samples due to undetected Staphylococcus aureus infections were rare. The use of PCR technology may assist in rapid mastitis diagnosis, however, accurate interpretation of PCR results in the absence of bacterial culture remains problematic.

Fluorescence techniques to detect and to assess viability of plant pathogenic bacteria

NARCIS (Netherlands)

Chitarra, L.G.

2001-01-01

Plant pathogenic bacteria cause major economic losses in commercial crop production worldwide every year. The current methods used to detect and to assess the viability of bacterial pathogens and to test seed lots or plants for contamination are usually based on plate assays or on

Detection of foodborne pathogens by qPCR: A practical approach for food industry applications

Directory of Open Access Journals (Sweden)

María-José Chapela

2015-12-01

Full Text Available Microbiological analysis of food is an integrated part of microbial safety management in the food chain. Monitoring and controlling foodborne pathogens are traditionally carried out by conventional microbiological methods based on culture-dependent approaches in control laboratories and private companies. However, polymerase chain reaction (PCR has revolutionized microbiological analysis allowing detection of pathogenic microorganisms in food, without the necessity of classical isolation and identification. However, at present, PCR and quantitative polymerase chain reaction (qPCR are essential analytical tools for researchers working in the field of foodborne pathogens. This manuscript reviews recently described qPCR methods applied for foodborne bacteria detection, serving as economical, safe, and reliable alternatives for application in the food industry and control laboratories. Multiplex qPCR, which allows the simultaneous detection of more than one pathogen in one single reaction, saving considerable effort, time, and money, is emphasized in the article.

Development of an Automated Microfluidic System for DNA Collection, Amplification, and Detection of Pathogens

Energy Technology Data Exchange (ETDEWEB)

Hagan, Bethany S.; Bruckner-Lea, Cynthia J.

2002-12-01

This project was focused on developing and testing automated routines for a microfluidic Pathogen Detection System. The basic pathogen detection routine has three primary components; cell concentration, DNA amplification, and detection. In cell concentration, magnetic beads are held in a flow cell by an electromagnet. Sample liquid is passed through the flow cell and bacterial cells attach to the beads. These beads are then released into a small volume of fluid and delivered to the peltier device for cell lysis and DNA amplification. The cells are lysed during initial heating in the peltier device, and the released DNA is amplified using polymerase chain reaction (PCR) or strand displacement amplification (SDA). Once amplified, the DNA is then delivered to a laser induced fluorescence detection unit in which the sample is detected. These three components create a flexible platform that can be used for pathogen detection in liquid and sediment samples. Future developments of the system will include on-line DNA detection during DNA amplification and improved capture and release methods for the magnetic beads during cell concentration.

Genome-Enhanced Detection and Identification (GEDI of plant pathogens

Directory of Open Access Journals (Sweden)

Nicolas Feau

2018-02-01

Full Text Available Plant diseases caused by fungi and Oomycetes represent worldwide threats to crops and forest ecosystems. Effective prevention and appropriate management of emerging diseases rely on rapid detection and identification of the causal pathogens. The increase in genomic resources makes it possible to generate novel genome-enhanced DNA detection assays that can exploit whole genomes to discover candidate genes for pathogen detection. A pipeline was developed to identify genome regions that discriminate taxa or groups of taxa and can be converted into PCR assays. The modular pipeline is comprised of four components: (1 selection and genome sequencing of phylogenetically related taxa, (2 identification of clusters of orthologous genes, (3 elimination of false positives by filtering, and (4 assay design. This pipeline was applied to some of the most important plant pathogens across three broad taxonomic groups: Phytophthoras (Stramenopiles, Oomycota, Dothideomycetes (Fungi, Ascomycota and Pucciniales (Fungi, Basidiomycota. Comparison of 73 fungal and Oomycete genomes led the discovery of 5,939 gene clusters that were unique to the targeted taxa and an additional 535 that were common at higher taxonomic levels. Approximately 28% of the 299 tested were converted into qPCR assays that met our set of specificity criteria. This work demonstrates that a genome-wide approach can efficiently identify multiple taxon-specific genome regions that can be converted into highly specific PCR assays. The possibility to easily obtain multiple alternative regions to design highly specific qPCR assays should be of great help in tackling challenging cases for which higher taxon-resolution is needed.

Progress in rapid detection and identification of unknown human and agricultural pathogens

International Nuclear Information System (INIS)

Barnes, T; Holzrichter, J F; Milanovich, F P

1999-01-01

The medical industry is driving pathogen detection technology from its present characteristics of$50/sample, 100 sample capability systems, with several day time responses, having several percent error rates in reported outcomes. The systems described above are capable of providing samples at and lt;$5/test, managing several million samples, and lt; 1-hour cycle times, (or just minutes in some cases) and and lt; 0.1% error rates. Because of their importance to the medical and agricultural communities, all ''important'' pathogens will have detection kits available (within air transport times, anywhere in the world) by 2020, and the most well known pathogens will have kits available within a few years. Many are available now. Because of the importance of the food supply to modern nations, these technologies will be employed everywhere in this industry. For example, the United States imports 30 B tons of food a year, but inspects and lt; 1%. Portable inspection systems will make it possible to test for dangerous pathogens in feed lots, food processing plants, markets, and points of use. Outbreaks of animal or plant disease will be immediately detectable using field instrumentation, and more complex samples can be sent to central testing laboratories where more sophisticated test systems will be available. Unusual pathogens either naturally or purposefully selected or developed, will require special attention because there is not a commercial economic driver for the development of detection systems and curative agents. Their development, and production for sufficient availability, will require significant investments by the world community. The strategy and costs for developing vaccines or curative drugs will be very expensive and will need special attention. However it is important that attention be directed to these problems because such attention has a strong deterrent effect on potential developers or users. The capacity to use the full information content

Imperfect pathogen detection from non-invasive skin swabs biases disease inference

Science.gov (United States)

DiRenzo, Graziella V.; Grant, Evan H. Campbell; Longo, Ana; Che-Castaldo, Christian; Zamudio, Kelly R.; Lips, Karen

2018-01-01

1. Conservation managers rely on accurate estimates of disease parameters, such as pathogen prevalence and infection intensity, to assess disease status of a host population. However, these disease metrics may be biased if low-level infection intensities are missed by sampling methods or laboratory diagnostic tests. These false negatives underestimate pathogen prevalence and overestimate mean infection intensity of infected individuals. 2. Our objectives were two-fold. First, we quantified false negative error rates of Batrachochytrium dendrobatidis on non-invasive skin swabs collected from an amphibian community in El Copé, Panama. We swabbed amphibians twice in sequence, and we used a recently developed hierarchical Bayesian estimator to assess disease status of the population. Second, we developed a novel hierarchical Bayesian model to simultaneously account for imperfect pathogen detection from field sampling and laboratory diagnostic testing. We evaluated the performance of the model using simulations and varying sampling design to quantify the magnitude of bias in estimates of pathogen prevalence and infection intensity. 3. We show that Bd detection probability from skin swabs was related to host infection intensity, where Bd infections information in advance, we advocate that the most cautious approach is to assume all errors are possible and to accommodate them by adjusting sampling designs. The modeling framework presented here improves the accuracy in estimating pathogen prevalence and infection intensity.

CT-Guided Biopsy in Suspected Spondylodiscitis--The Association of Paravertebral Inflammation with Microbial Pathogen Detection.

Directory of Open Access Journals (Sweden)

Daniel Spira

Full Text Available To search for imaging characteristics distinguishing patients with successful from those with futile microbiological pathogen detection by CT-guided biopsy in suspected spondylodiscitis.34 consecutive patients with suspected spondylodiscitis underwent CT-guided biopsy for pathogen detection. MR-images were assessed for inflammatory infiltration of disks, adjacent vertebrae, epidural and paravertebral space. CT-images were reviewed for arrosion of adjacent end plates and reduced disk height. Biopsy samples were sent for microbiological examination in 34/34 patients, and for additional histological analysis in 28/34 patients.Paravertebral infiltration was present in all 10/10 patients with positive microbiology and occurred in only 12/24 patients with negative microbiology, resulting in a sensitivity of 100% and a specificity of 50% for pathogen detection. Despite its limited sensitivities, epidural infiltration and paravertebral abscesses showed considerably higher specificities of 83.3% and 90.9%, respectively. Paravertebral infiltration was more extensive in patients with positive as compared to negative microbiology (p = 0.002. Even though sensitivities for pathogen detection were also high in case of vertebral and disk infiltration, or end plate arrosion, specificities remained below 10%.Inflammatory infiltration of the paravertebral space indicated successful pathogen detection by CT-guided biopsy. Specificity was increased by the additional occurrence of epidural infiltration or paravertebral abscesses.

Medium-resolution autonomous in situ gamma detection system for marine and coastal waters

International Nuclear Information System (INIS)

Schwantes, J.M.; Addleman, R.S.; Davidson, J.D.; Douglas, M.; Meier, D.; Mullen, O.D.; Myjak, M.; Jones, M.E.; Woodring, M.L.; Johnson, B.; Santschi, P.H.

2009-01-01

We are developing a medium-resolution autonomous in situ gamma detection system for marine and coastal waters. The system is designed to extract and preconcentrate isotopes of interest from natural waters prior to detection in order to eliminate signal attenuation of the gamma rays traveling through water and lower the overall background from the presence of naturally occurring radioactive isotopes ( 40 K and U-Th series radionuclides). Filtration is used to preconcentrate target isotopes residing on suspended particles, while chemosorption is employed to preferentially extract truly dissolved components from the water column. Used filter and chemosorbent media will be counted autonomously using two LaBr 3 detectors in a near 4-π configuration around the samples. A compact digital pulse processing system, developed in-house and capable of running in coincidence mode, is used to process the signal from the detectors to a small on-board computer. The entire system is extremely compact (9' dia. x 30' len.) and platform independent, but designed for initial deployment on a research buoy. A variety of commercial and in-house nano-porous chemosorbents have been selected, procured or produced, and these and filter and detector components have been tested. (author)

Development of a real-time PCR for the detection of pathogenic Leptospira spp. in California sea lions.

Science.gov (United States)

Wu, Qingzhong; Prager, Katherine C; Goldstein, Tracey; Alt, David P; Galloway, Renee L; Zuerner, Richard L; Lloyd-Smith, James O; Schwacke, Lori

2014-08-11

Several real-time PCR assays are currently used for detection of pathogenic Leptospira spp.; however, few methods have been described for the successful evaluation of clinical urine samples. This study reports a rapid assay for the detection of pathogenic Leptospira spp. in California sea lions Zalophus californianus using real-time PCR with primers and a probe targeting the lipL32 gene. The PCR assay had high analytic sensitivity-the limit of detection was 3 genome copies per PCR volume using L. interrogans serovar Pomona DNA and 100% analytic specificity; it detected all pathogenic leptospiral serovars tested and none of the non-pathogenic Leptospira species (L. biflexa and L. meyeri serovar Semaranga), the intermediate species L. inadai, or the non-Leptospira pathogens tested. Our assay had an amplification efficiency of 1.00. Comparisons between the real-time PCR assay and culture isolation for detection of pathogenic Leptospira spp. in urine and kidney tissue samples from California sea lions showed that samples were more often positive by real-time PCR than by culture methods. Inclusion of an internal amplification control in the real-time PCR assay showed no inhibitory effects in PCR negative samples. These studies indicated that our real-time PCR assay has high analytic sensitivity and specificity for the rapid detection of pathogenic Leptospira species in urine and kidney tissue samples.

Detection of multiple potentially pathogenic bacteria in Matang mangrove estuaries, Malaysia.

Science.gov (United States)

Ghaderpour, Aziz; Mohd Nasori, Khairul Nazrin; Chew, Li Lee; Chong, Ving Ching; Thong, Kwai Lin; Chai, Lay Ching

2014-06-15

The deltaic estuarine system of the Matang Mangrove Forest Reserve of Malaysia is a site where several human settlements and brackish water aquaculture have been established. Here, we evaluated the level of fecal indicator bacteria (FIB) and the presence of potentially pathogenic bacteria in the surface water and sediments. Higher levels of FIB were detected at downstream sampling sites from the fishing village, indicating it as a possible source of anthropogenic pollution to the estuary. Enterococci levels in the estuarine sediments were higher than in the surface water, while total coliforms and E. coli in the estuarine sediments were not detected in all samples. Also, various types of potentially pathogenic bacteria, including Klebsiella pneumoniae, Serratia marcescens and Enterobacter cloacae were isolated. The results indicate that the Matang estuarine system is contaminated with various types of potential human bacterial pathogens which might pose a health risk to the public. Copyright © 2014 Elsevier Ltd. All rights reserved.

Novel aptamer-linked nanoconjugate approach for detection of waterborne bacterial pathogens: an update

Science.gov (United States)

Singh, Gulshan; Manohar, Murli; Adegoke, Anthony Ayodeji; Stenström, Thor Axel; Shanker, Rishi

2017-01-01

The lack of microbiologically safe water in underdeveloped nations is the prime cause of infectious disease outbreaks. The need for the specific identification and detection of microorganisms encourages the development of advanced, rapid, sensitive and highly specific methods for the monitoring of pathogens and management of potential risk to human health. The rapid molecular assays based on detection of specific molecular signatures offer advantages over conventional methods in terms of specificity and sensitivity but require complex instrumentation and skilled personnel. Nanotechnology is an emerging area and provides a robust approach for the identification of pathogenic microorganism utilizing the peculiar properties of nanomaterials, i.e. small size (1-100 nm) and large surface area. This emerging technology promises to fulfill the urgent need of a novel strategy to enhance the bacterial identification and quantitation in the environment. In this context, the peculiar properties of gold nanoparticles, their plasmonic shifts, and changes in magnetic properties have been utilized for the simple and cost-effective detection of bacterial nucleic acids, antigens and toxins with quite improved sensitivity. One of the promising leads to develop an advance detection method might be the coupling of nucleic acid aptamers (capable of interacting specifically with bacteria, protozoa, and viruses) with nanomaterials. Such aptamer-nano conjugate can be used for the specific recognition of infectious agents in different environmental matrices. This review summarizes the application of nanotechnology in the area of pathogen detection and discusses the prospects of coupling nucleic acid aptamers with nanoparticles for the specific detection of targeted pathogens.

Novel aptamer-linked nanoconjugate approach for detection of waterborne bacterial pathogens: an update

International Nuclear Information System (INIS)

Singh, Gulshan; Manohar, Murli; Adegoke, Anthony Ayodeji; Stenström, Thor Axel; Shanker, Rishi

2017-01-01

The lack of microbiologically safe water in underdeveloped nations is the prime cause of infectious disease outbreaks. The need for the specific identification and detection of microorganisms encourages the development of advanced, rapid, sensitive and highly specific methods for the monitoring of pathogens and management of potential risk to human health. The rapid molecular assays based on detection of specific molecular signatures offer advantages over conventional methods in terms of specificity and sensitivity but require complex instrumentation and skilled personnel. Nanotechnology is an emerging area and provides a robust approach for the identification of pathogenic microorganism utilizing the peculiar properties of nanomaterials, i.e. small size (1–100 nm) and large surface area. This emerging technology promises to fulfill the urgent need of a novel strategy to enhance the bacterial identification and quantitation in the environment. In this context, the peculiar properties of gold nanoparticles, their plasmonic shifts, and changes in magnetic properties have been utilized for the simple and cost-effective detection of bacterial nucleic acids, antigens and toxins with quite improved sensitivity. One of the promising leads to develop an advance detection method might be the coupling of nucleic acid aptamers (capable of interacting specifically with bacteria, protozoa, and viruses) with nanomaterials. Such aptamer-nano conjugate can be used for the specific recognition of infectious agents in different environmental matrices. This review summarizes the application of nanotechnology in the area of pathogen detection and discusses the prospects of coupling nucleic acid aptamers with nanoparticles for the specific detection of targeted pathogens.

Novel aptamer-linked nanoconjugate approach for detection of waterborne bacterial pathogens: an update

Energy Technology Data Exchange (ETDEWEB)

Singh, Gulshan, E-mail: gsingh.gulshan@gmail.com [Durban University of Technology, Institute for Water and Wastewater Technology (IWWT) (South Africa); Manohar, Murli [Jamia Hamdard (Hamdard University), Department of Biochemistry (India); Adegoke, Anthony Ayodeji; Stenström, Thor Axel [Durban University of Technology, Institute for Water and Wastewater Technology (IWWT) (South Africa); Shanker, Rishi [Ahmedabad University, Division of Biological & Life Sciences, School of Arts & Sciences (India)

2017-01-15

The lack of microbiologically safe water in underdeveloped nations is the prime cause of infectious disease outbreaks. The need for the specific identification and detection of microorganisms encourages the development of advanced, rapid, sensitive and highly specific methods for the monitoring of pathogens and management of potential risk to human health. The rapid molecular assays based on detection of specific molecular signatures offer advantages over conventional methods in terms of specificity and sensitivity but require complex instrumentation and skilled personnel. Nanotechnology is an emerging area and provides a robust approach for the identification of pathogenic microorganism utilizing the peculiar properties of nanomaterials, i.e. small size (1–100 nm) and large surface area. This emerging technology promises to fulfill the urgent need of a novel strategy to enhance the bacterial identification and quantitation in the environment. In this context, the peculiar properties of gold nanoparticles, their plasmonic shifts, and changes in magnetic properties have been utilized for the simple and cost-effective detection of bacterial nucleic acids, antigens and toxins with quite improved sensitivity. One of the promising leads to develop an advance detection method might be the coupling of nucleic acid aptamers (capable of interacting specifically with bacteria, protozoa, and viruses) with nanomaterials. Such aptamer-nano conjugate can be used for the specific recognition of infectious agents in different environmental matrices. This review summarizes the application of nanotechnology in the area of pathogen detection and discusses the prospects of coupling nucleic acid aptamers with nanoparticles for the specific detection of targeted pathogens.

Towards On-site Pathogen Detection Using Antibody-based Sensors

DEFF Research Database (Denmark)

Skottrup, Peter Durand; Nicolaisen, Mogens; Justesen, Annemarie Fejer

2008-01-01

In this paper the recent progress within biosensors for plant pathogen detection will be reviewed. Bio-recognition layers on sensors can be designed in various ways, however the most popular approach is to immobilise antibodies for specific capture of analytes. Focus will be put on antibody surfa...

Single walled carbon nanotube-based electrical biosensor for the label-free detection of pathogenic bacteria

DEFF Research Database (Denmark)

Yoo, S. M.; Baek, Y. K.; Shin, S.

2016-01-01

We herein describe the development of a single-walled carbon nanotube (SWNT)-based electrical biosensor consisting of a two-terminal resistor, and report its use for the specific, label-free detection of pathogenic bacteria via changes in conductance. The ability of this biosensor to recognize...... different pathogenic bacteria was analyzed, and conditions were optimized with different probe concentrations. Using this system, the reference strains and clinical isolates of Staphylococcus aureus and Escherichia coli were successfully detected; in both cases, the sensor showed a detection limit of 10 CFU....... This SWNT-based electrical biosensor will prove useful for the development of highly sensitive and specific handheld pathogen detectors....

Efficiency of Airborne Sample Analysis Platform (ASAP Bioaerosol Sampler for Pathogen Detection

Directory of Open Access Journals (Sweden)

Anurag eSharma

2015-05-01

Full Text Available The threat of bioterrorism and pandemics has highlighted the urgency for rapid and reliable bioaerosol detection in different environments. Safeguarding against such threats requires continuous sampling of the ambient air for pathogen detection. In this study we investigated the efficacy of the Airborne Sample Analysis Platform (ASAP 2800 bioaerosol sampler to collect representative samples of air and identify specific viruses suspended as bioaerosols. To test this concept, we aerosolized an innocuous replication-defective bovine adenovirus serotype 3 (BAdV3 in a controlled laboratory environment. The ASAP efficiently trapped the surrogate virus at 5×10E3 plaque-forming units (p.f.u. [2×10E5 genome copy equivalent] concentrations or more resulting in the successful detection of the virus using quantitative PCR. These results support the further development of ASAP for bioaerosol pathogen detection.

Detection of mastitis pathogens by analysis of volatile bacterial metabolites

NARCIS (Netherlands)

Hettinga, K.A.; Valenberg, van H.J.F.; Lam, T.J.G.M.; Hooijdonk, van A.C.M.

2008-01-01

The ability to detect mastitis pathogens based on their volatile metabolites was studied. Milk samples from cows with clinical mastitis, caused by Staphylococcus aureus, coagulase-negative staphylococci, Streptococcus uberis, Streptococcus dysgalactiae, and Escherichia coli were collected. In

Automatic detection and classification of obstacles with applications in autonomous mobile robots

Science.gov (United States)

Ponomaryov, Volodymyr I.; Rosas-Miranda, Dario I.

2016-04-01

Hardware implementation of an automatic detection and classification of objects that can represent an obstacle for an autonomous mobile robot using stereo vision algorithms is presented. We propose and evaluate a new method to detect and classify objects for a mobile robot in outdoor conditions. This method is divided in two parts, the first one is the object detection step based on the distance from the objects to the camera and a BLOB analysis. The second part is the classification step that is based on visuals primitives and a SVM classifier. The proposed method is performed in GPU in order to reduce the processing time values. This is performed with help of hardware based on multi-core processors and GPU platform, using a NVIDIA R GeForce R GT640 graphic card and Matlab over a PC with Windows 10.

TEST KIT FOR THE DETECTION AND GENOTYPING OF HIGHLY PATHOGENIC INFLUENZA VIRUS A H5N1 BY REAL-TIME POLYMERASE CHAIN REACTION

Directory of Open Access Journals (Sweden)

S. V. Stepaniuk

2014-06-01

Full Text Available Results of the annual monitoring of epizooties indicate that highly pathogenic HPAI/H5N1 avian influenza widely circulated in Eurasian region. Over a period of 2010–2013 years more than 165 cases of outbreaks in 14 countries were found out. Ukraine became one of the first countries in Europe where in Autonomous Republic of Crimea in October 2005 outbreak of avian epizootic with HPAI/H5N1 was documented and until February 2008 more than 236,000 poultry were killed. Since then the question of monitoring of infected both migrating birds and poultry in places of cross contact in Ukraine remains of high priority. The test system is developed for identification and genotyping A H5N1 on three genes (M, H5 and N1 HPAI/H5N1 in real-time mode for polymerase chain reaction. Test kit capacity to detect HPAI/h5n1avian influenza virus and differentiate it from the other viral infection agents of birds and animals were studied by testing of HPAI/H5N1 virus isolated during mass infection outbreak in Crimea in 2005 and cultural specimens of other viral pathogens. It was established that the «DIA Real Avian Influenza» test kit was capable to detect RNA influenza A virus of high pathogenic H5N1 strains having high sensitivity (100% while RNA of the Crimean HPAI/H5N1 isolate studying and specificity (100% while RNA viruses of Newcastle birds disease, fowl powershift, syndrome of drop in egg production and horse influenza studying.

Antibody array in a multiwell plate format for the sensitive and multiplexed detection of important plant pathogens.

Science.gov (United States)

Charlermroj, Ratthaphol; Himananto, Orawan; Seepiban, Channarong; Kumpoosiri, Mallika; Warin, Nuchnard; Gajanandana, Oraprapai; Elliott, Christopher T; Karoonuthaisiri, Nitsara

2014-07-15

The global seed market is considered to be an important industry with a total value of $10,543 million US dollars in 2012. Because plant pathogens such as bacteria and viruses cause a significant economic loss to both producers and exporters, the seed export industry urgently requires rapid, sensitive, and inexpensive testing for the pathogens to prevent disease spreading worldwide. This study developed an antibody array in a multiwell plate format to simultaneously detect four crucial plant pathogens, namely, a bacterial fruit blotch bacterium Acidovorax avenae subsp. citrulli (Aac), Chilli veinal mottle virus (ChiVMV, potyvirus), Watermelon silver mottle virus (WSMoV, tospovirus serogroup IV), and Melon yellow spot virus (MYSV, tospovirus). The capture antibodies specific to the pathogens were immobilized on each well at preassigned positions by an automatic microarrayer. The antibodies on the arrays specifically captured the corresponding pathogens present in the sample extracts. The presence of pathogens bound on the capture antibodies was subsequently detected by a cocktail of fluorescently conjugated secondary antibodies. The limits of detection of the developed antibody array for the detection of Aac, ChiVMV, WSMoV, and MYSV were 5 × 10(5) CFU/mL, 30 ng/mL, 1000 ng/mL, and 160 ng/mL, respectively, which were very similar to those of the conventional ELISA method. The antibody array in a multiwell plate format accurately detected plant pathogens in single and multiple detections. Moreover, this format enables easy handling of the assay at a higher speed of operation.

Molecular detection of pathogens in water--the pros and cons of molecular techniques.

Science.gov (United States)

Girones, Rosina; Ferrús, Maria Antonia; Alonso, José Luis; Rodriguez-Manzano, Jesus; Calgua, Byron; Corrêa, Adriana de Abreu; Hundesa, Ayalkibet; Carratala, Anna; Bofill-Mas, Sílvia

2010-08-01

Pollution of water by sewage and run-off from farms produces a serious public health problem in many countries. Viruses, along with bacteria and protozoa in the intestine or in urine are shed and transported through the sewer system. Even in highly industrialized countries, pathogens, including viruses, are prevalent throughout the environment. Molecular methods are used to monitor viral, bacterial, and protozoan pathogens, and to track pathogen- and source-specific markers in the environment. Molecular techniques, specifically polymerase chain reaction-based methods, provide sensitive, rapid, and quantitative analytical tools with which to study such pathogens, including new or emerging strains. These techniques are used to evaluate the microbiological quality of food and water, and to assess the efficiency of virus removal in drinking and wastewater treatment plants. The range of methods available for the application of molecular techniques has increased, and the costs involved have fallen. These developments have allowed the potential standardization and automation of certain techniques. In some cases they facilitate the identification, genotyping, enumeration, viability assessment, and source-tracking of human and animal contamination. Additionally, recent improvements in detection technologies have allowed the simultaneous detection of multiple targets in a single assay. However, the molecular techniques available today and those under development require further refinement in order to be standardized and applicable to a diversity of matrices. Water disinfection treatments may have an effect on the viability of pathogens and the numbers obtained by molecular techniques may overestimate the quantification of infectious microorganisms. The pros and cons of molecular techniques for the detection and quantification of pathogens in water are discussed. (c) 2010 Elsevier Ltd. All rights reserved.

Maximizing the chances of detecting pathogenic leptospires in mammals

DEFF Research Database (Denmark)

Tulsiani, Suhella; Graham, G C; Dohnt, M F

2011-01-01

. In the earlier field investigation, serum, renal tissue and urine were collected from wild mammals, for the detection of pathogenic leptospires by culture, the microscopic agglutination test (MAT), real-time PCR and silver impregnation of smears. Although 27.6% of the rodents investigated were found leptospire....../ml, did not affect the viability or the detection of leptospires in culture, and is therefore unlikely to reduce the chances of isolating leptospires from an animal that has been euthanized with the compound. It appears that collecting multiple samples from each mammal being checked will improve...

Concurrent Detection of Human Norovirus and Bacterial Pathogens in Water Samples from an Agricultural Region in Central California Coast

Directory of Open Access Journals (Sweden)

Peng Tian

2017-08-01

Full Text Available Bacterial pathogens and human norovirus (HuNoV are major cause for acute gastroenteritis caused by contaminated food and water. Public waterways can become contaminated from a variety of sources and flood after heavy rain events, leading to pathogen contamination of produce fields. We initiated a survey of several public watersheds in a major leafy green produce production region of the Central California Coast to determine the prevalence of HuNoV as well as bacterial pathogens. Moore swabs were used to collect environmental samples bi-monthly at over 30 sampling sites in the region. High prevalence of HuNoV and bacterial pathogens were detected in environmental water samples in the region. The overall detection rates of HuNoV, O157 Shiga toxin-producing Escherichia coli (STEC, non-O157 STEC, Salmonella, and Listeria were 25.58, 7.91, 9.42, 59.65, and 44.30%, respectively. The detection rates of Salmonella and L. monocytogenes were significantly higher in the spring. Fall and spring had elevated detection rates of O157 STEC. The overall detection rates of non-O157 STEC in the fall were lower than the other seasons but not significant. The overall detection rates of HuNoV were highest in fall, followed by spring and winter, with summer being lowest and significantly lower than other seasons. This study presented the first study of evaluating the correlation between the detection rate of HuNoV and the detection rates of four bacterial pathogens from environmental water. Overall, there was no significant difference in HuNoV detection rates between samples testing positive or negative for the four bacterial pathogens tested. Pathogens in animal-impacted and human-impacted areas were investigated. There were significant higher detection rates in animal-impacted areas than that of human-impacted areas for bacterial pathogens. However, there was no difference in HuNoV detection rates between these two areas. The overall detection levels of generic E

Development and application of an oligonucleotide microarray and real-time quantitative PCR for detection of wastewater bacterial pathogens

Energy Technology Data Exchange (ETDEWEB)

Lee, Dae-Young [National Water Research Institute, Environment Canada, 867 Lakeshore Road, Burlington, Ontario, L7R 4A6 (Canada)], E-mail: daeyoung.lee@ec.gc.ca; Lauder, Heather; Cruwys, Heather; Falletta, Patricia [National Water Research Institute, Environment Canada, 867 Lakeshore Road, Burlington, Ontario, L7R 4A6 (Canada); Beaudette, Lee A. [Environmental Science and Technology Centre, Environment Canada, 335 River Road South, Ottawa, Ontario, K1A 0H3 (Canada)], E-mail: lee.beaudette@ec.gc.ca

2008-07-15

Conventional microbial water quality test methods are well known for their technical limitations, such as lack of direct pathogen detection capacity and low throughput capability. The microarray assay has recently emerged as a promising alternative for environmental pathogen monitoring. In this study, bacterial pathogens were detected in municipal wastewater using a microarray equipped with short oligonucleotide probes targeting 16S rRNA sequences. To date, 62 probes have been designed against 38 species, 4 genera, and 1 family of pathogens. The detection sensitivity of the microarray for a waterborne pathogen Aeromonas hydrophila was determined to be approximately 1.0% of the total DNA, or approximately 10{sup 3}A. hydrophila cells per sample. The efficacy of the DNA microarray was verified in a parallel study where pathogen genes and E. coli cells were enumerated using real-time quantitative PCR (qPCR) and standard membrane filter techniques, respectively. The microarray and qPCR successfully detected multiple wastewater pathogen species at different stages of the disinfection process (i.e. secondary effluents vs. disinfected final effluents) and at two treatment plants employing different disinfection methods (i.e. chlorination vs. UV irradiation). This result demonstrates the effectiveness of the DNA microarray as a semi-quantitative, high throughput pathogen monitoring tool for municipal wastewater.

Detection of mastitis pathogens by analysis of volatile bacterial metabolites.

Science.gov (United States)

Hettinga, K A; van Valenberg, H J F; Lam, T J G M; van Hooijdonk, A C M

2008-10-01

The ability to detect mastitis pathogens based on their volatile metabolites was studied. Milk samples from cows with clinical mastitis, caused by Staphylococcus aureus, coagulase-negative staphylococci, Streptococcus uberis, Streptococcus dysgalactiae, and Escherichia coli were collected. In addition, samples from cows without clinical mastitis and with low somatic cell count (SCC) were collected for comparison. All mastitis samples were examined by using classical microbiological methods, followed by headspace analysis for volatile metabolites. Milk from culture-negative samples contained a lower number and amount of volatile components compared with cows with clinical mastitis. Because of variability between samples within a group, comparisons between pathogens were not sufficient for classification of the samples by univariate statistics. Therefore, an artificial neural network was trained to classify the pathogen in the milk samples based on the bacterial metabolites. The trained network differentiated milk from uninfected and infected quarters very well. When comparing pathogens, Staph. aureus produced a very different pattern of volatile metabolites compared with the other samples. Samples with coagulase-negative staphylococci and E. coli had enough dissimilarity with the other pathogens, making it possible to separate these 2 pathogens from each other and from the other samples. The 2 streptococcus species did not show significant differences between each other but could be identified as a different group from the other pathogens. Five groups can thus be identified based on the volatile bacterial metabolites: Staph. aureus, coagulase-negative staphylococci, streptococci (Strep. uberis and Strep. dysgalactiae as one group), E. coli, and uninfected quarters.

Towards Autonomous Agriculture: Automatic Ground Detection Using Trinocular Stereovision

Directory of Open Access Journals (Sweden)

Annalisa Milella

2012-09-01

Full Text Available Autonomous driving is a challenging problem, particularly when the domain is unstructured, as in an outdoor agricultural setting. Thus, advanced perception systems are primarily required to sense and understand the surrounding environment recognizing artificial and natural structures, topology, vegetation and paths. In this paper, a self-learning framework is proposed to automatically train a ground classifier for scene interpretation and autonomous navigation based on multi-baseline stereovision. The use of rich 3D data is emphasized where the sensor output includes range and color information of the surrounding environment. Two distinct classifiers are presented, one based on geometric data that can detect the broad class of ground and one based on color data that can further segment ground into subclasses. The geometry-based classifier features two main stages: an adaptive training stage and a classification stage. During the training stage, the system automatically learns to associate geometric appearance of 3D stereo-generated data with class labels. Then, it makes predictions based on past observations. It serves as well to provide training labels to the color-based classifier. Once trained, the color-based classifier is able to recognize similar terrain classes in stereo imagery. The system is continuously updated online using the latest stereo readings, thus making it feasible for long range and long duration navigation, over changing environments. Experimental results, obtained with a tractor test platform operating in a rural environment, are presented to validate this approach, showing an average classification precision and recall of 91.0% and 77.3%, respectively.

Development of genetic methods for detection of pathogenic microorganisms in irradiated food

International Nuclear Information System (INIS)

2010-01-01

The existence of injured microorganisms in food and their recovery during culturing procedures is critical. Injured microorganisms present a potential threat in food safety since they may repair themselves under suitable conditions. This study provides development of recovery methods for detection of injured foodborne microorganisms, after irradiation treatment at different doses. For this purpose, iniatially the methods of recovery were compared at different irradiation doses. At the second step, antibiotic resistance of foodborne pathogens was determined. After determination of antibiotic resistance, recovery methods were modified for reversibly injured foodborne pathogens at different doses after irradiation treatment . Finally, damages of DNA were detected by a spectrophotometric method after 1.0 kGy irradiation treatment

A Bacterial Pathogen Targets a Host Rab-Family GTPase Defense Pathway with a GAP.

Science.gov (United States)

Spanò, Stefania; Gao, Xiang; Hannemann, Sebastian; Lara-Tejero, María; Galán, Jorge E

2016-02-10

Cell-autonomous defense mechanisms are potent strategies that protect individual cells against intracellular pathogens. The Rab-family GTPase Rab32 was previously shown to restrict the intracellular human pathogen Salmonella Typhi, but its potential broader role in antimicrobial defense remains unknown. We show that Rab32 represents a general cell-autonomous, antimicrobial defense that is counteracted by two Salmonella effectors. Mice lacking Rab-32 or its nucleotide exchange factor BLOC-3 are permissive to S. Typhi infection and exhibit increased susceptibility to S. Typhimurium. S. Typhimurium counters this defense pathway by delivering two type III secretion effectors, SopD2, a Rab32 GAP, and GtgE, a specific Rab32 protease. An S. Typhimurium mutant strain lacking these two effectors exhibits markedly reduced virulence, which is fully restored in BLOC-3-deficient mice. These results demonstrate that a cell-autonomous, Rab32-dependent host defense pathway plays a central role in the defense against vacuolar pathogens and describe a mechanism evolved by a bacterial pathogen to counter it. Copyright © 2016 Elsevier Inc. All rights reserved.

Human pathogens in plant biofilms: Formation, physiology, and detection.

Science.gov (United States)

Ximenes, Eduardo; Hoagland, Lori; Ku, Seockmo; Li, Xuan; Ladisch, Michael

2017-07-01

Fresh produce, viewed as an essential part of a healthy life style is usually consumed in the form of raw or minimally processed fruits and vegetables, and is a potentially important source of food-borne human pathogenic bacteria and viruses. These are passed on to the consumer since the bacteria can form biofilms or otherwise populate plant tissues, thereby using plants as vectors to infect animal hosts. The life cycle of the bacteria in plants differs from those in animals or humans and results in altered physiochemical and biological properties (e.g., physiology, immunity, native microflora, physical barriers, mobility, and temperature). Mechanisms by which healthy plants may become contaminated by microorganisms, develop biofilms, and then pass on their pathogenic burden to people are explored in the context of hollow fiber microfiltration by which plant-derived microorganisms may be recovered and rapidly concentrated to facilitate study of their properties. Enzymes, when added to macerated plant tissues, hydrolyze or alter macromolecules that would otherwise foul hollow-fiber microfiltration membranes. Hence, microfiltration may be used to quickly increase the concentration of microorganisms to detectable levels. This review discusses microbial colonization of vegetables, formation and properties of biofilms, and how hollow fiber microfiltration may be used to concentrate microbial targets to detectable levels. The use of added enzymes helps to disintegrate biofilms and minimize hollow fiber membrane fouling, thereby providing a new tool for more time effectively elucidating mechanisms by which biofilms develop and plant tissue becomes contaminated with human pathogens. Biotechnol. Bioeng. 2017;114: 1403-1418. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Detection of bovine mastitis pathogens by loop-mediated isothermal amplification and an electrochemical DNA chip.

Science.gov (United States)

Kawai, Kazuhiro; Inada, Mika; Ito, Keiko; Hashimoto, Koji; Nikaido, Masaru; Hata, Eiji; Katsuda, Ken; Kiku, Yoshio; Tagawa, Yuichi; Hayashi, Tomohito

2017-12-22

Bovine mastitis causes significant economic losses in the dairy industry. Effective prevention of bovine mastitis requires an understanding of the infection status of a pathogenic microorganism in a herd that has not yet shown clinical signs of mastitis and appropriate treatment specific for the pathogenic microorganism. However, bacterial identification by culture has drawbacks in that the sensitivity may be low and the procedure can be complex. In this study, we developed a genetic detection method to identify mastitis pathogens using a simple and highly sensitive electrochemical DNA chip which can specifically detect bacterial DNA in milk specimens. First, we selected microorganisms belonging to 12 families and/or genera associated with mastitis for which testing should be performed. Next, we optimized the conditions for amplifying microorganism DNA by loop-mediated isothermal amplification (LAMP) using 32 primers and the use of a DNA chip capable of measuring all pathogens simultaneously. Sample detection could be completed in just a few hours using this method. Comparison of the results obtained with our DNA chip method and those obtained by bacterial culture verified that when the culture method was set to 100%, the total positive concordance rate of the DNA chip was 85.0% and the total negative concordance rate was 86.9%. Furthermore, the proposed method allows both rapid and highly sensitive detection of mastitis pathogens. We believe that this method will contribute to the development of an effective mastitis control program.

Detection of Pathogen Exposure in African Buffalo Using Non-Specific Markers of Inflammation

Directory of Open Access Journals (Sweden)

Caroline K. Glidden

2018-01-01

Full Text Available Detecting exposure to new or emerging pathogens is a critical challenge to protecting human, domestic animal, and wildlife health. Yet, current techniques to detect infections typically target known pathogens of humans or economically important animals. In the face of the current surge in infectious disease emergence, non-specific disease surveillance tools are urgently needed. Tracking common host immune responses indicative of recent infection may have potential as a non-specific diagnostic approach for disease surveillance. The challenge to immunologists is to identify the most promising markers, which ideally should be highly conserved across pathogens and host species, become upregulated rapidly and consistently in response to pathogen invasion, and remain elevated beyond clearance of infection. This study combined an infection experiment and a longitudinal observational study to evaluate the utility of non-specific markers of inflammation [NSMI; two acute phase proteins (haptoglobin and serum amyloid A, two pro-inflammatory cytokines (IFNγ and TNF-α] as indicators of pathogen exposure in a wild mammalian species, African buffalo (Syncerus caffer. Specifically, in the experimental study, we asked (1 How quickly do buffalo mount NSMI responses upon challenge with an endemic pathogen, foot-and-mouth disease virus; (2 for how long do NSMI remain elevated after viral clearance and; (3 how pronounced is the difference between peak NSMI concentration and baseline NSMI concentration? In the longitudinal study, we asked (4 Are elevated NSMI associated with recent exposure to a suite of bacterial and viral respiratory pathogens in a wild population? Among the four NSMI that we tested, haptoglobin showed the strongest potential as a surveillance marker in African buffalo: concentrations quickly and consistently reached high levels in response to experimental infection, remaining elevated for almost a month. Moreover, elevated haptoglobin was

Detection of the emerging amphibian pathogens Batrachochytrium dendrobatidis and ranavirus in Russia

Science.gov (United States)

Reshetnikov, Andrey N.; Chestnut, Tara E.; Brunner, Jesse L.; Charles, Kaylene M.; Nebergall, Emily E.; Olson, Deanna H.

2014-01-01

In a population of the European common toad Bufo bufo from a rural pond in the region of Lake Glubokoe Regional Reserve in Moscow province, Russia, unexplained mass mortality events involving larvae and metamorphs have been observed over a monitoring period of >20 yr. We tested toads from this and a nearby site for the emerging amphibian pathogens Batrachochytrium dendrobatidis (Bd) and ranavirus (Rv). Both pathogens were detected, and at the rural pond site, with the above-noted losses and decline in toad breeding success, 40% of B. bufo metamorphs were Bd positive, 46% were Rv positive and 20% were co-infected with both pathogens. Toad metamorphs from a neighbouring water body were also Bd and Rv positive (25 and 55%, respectively). This is the first confirmation of these pathogens in Russia. Questions remain as to the origins of these pathogens in Russia and their roles in documented mass mortality events.

Bio-Inspired Autonomous Communications Systems with Anomaly Detection Monitoring, Phase I

Data.gov (United States)

National Aeronautics and Space Administration — We propose to develop and demonstrate BioComm, a bio-inspired autonomous communications system (ACS) aimed at dynamically reconfiguring and redeploying autonomous...

Detection and Tracking Strategies for Autonomous Aerial Refuelling Tasks Based on Monocular Vision

Directory of Open Access Journals (Sweden)

Yingjie Yin

2014-07-01

Full Text Available Detection and tracking strategies based on monocular vision are proposed for autonomous aerial refuelling tasks. The drogue attached to the fuel tanker aircraft has two important features. The grey values of the drogue's inner part are different from the external umbrella ribs, as shown in the image. The shape of the drogue's inner dark part is nearly circular. According to crucial prior knowledge, the rough and fine positioning algorithms are designed to detect the drogue. Particle filter based on the drogue's shape is proposed to track the drogue. A strategy to switch between detection and tracking is proposed to improve the robustness of the algorithms. The inner dark part of the drogue is segmented precisely in the detecting and tracking process and the segmented circular part can be used to measure its spatial position. The experimental results show that the proposed method has good performance in real-time and satisfied robustness and positioning accuracy.

Shuttlecock detection system for fully-autonomous badminton robot with two high-speed video cameras

Science.gov (United States)

Masunari, T.; Yamagami, K.; Mizuno, M.; Une, S.; Uotani, M.; Kanematsu, T.; Demachi, K.; Sano, S.; Nakamura, Y.; Suzuki, S.

2017-02-01

Two high-speed video cameras are successfully used to detect the motion of a flying shuttlecock of badminton. The shuttlecock detection system is applied to badminton robots that play badminton fully autonomously. The detection system measures the three dimensional position and velocity of a flying shuttlecock, and predicts the position where the shuttlecock falls to the ground. The badminton robot moves quickly to the position where the shuttle-cock falls to, and hits the shuttlecock back into the opponent's side of the court. In the game of badminton, there is a large audience, and some of them move behind a flying shuttlecock, which are a kind of background noise and makes it difficult to detect the motion of the shuttlecock. The present study demonstrates that such noises can be eliminated by the method of stereo imaging with two high-speed cameras.

New Trends in Impedimetric Biosensors for the Detection of Foodborne Pathogenic Bacteria

Science.gov (United States)

Wang, Yixian; Ye, Zunzhong; Ying, Yibin

2012-01-01

The development of a rapid, sensitive, specific method for the foodborne pathogenic bacteria detection is of great importance to ensure food safety and security. In recent years impedimetric biosensors which integrate biological recognition technology and impedance have gained widespread application in the field of bacteria detection. This paper presents an overview on the progress and application of impedimetric biosensors for detection of foodborne pathogenic bacteria, particularly the new trends in the past few years, including the new specific bio-recognition elements such as bacteriophage and lectin, the use of nanomaterials and microfluidics techniques. The applications of these new materials or techniques have provided unprecedented opportunities for the development of high-performance impedance bacteria biosensors. The significant developments of impedimetric biosensors for bacteria detection in the last five years have been reviewed according to the classification of with or without specific bio-recognition element. In addition, some microfluidics systems, which were used in the construction of impedimetric biosensors to improve analytical performance, are introduced in this review. PMID:22737018

Microbial Biosensor for the Detection of Protease-Virulent Factors from Pathogens

Science.gov (United States)

2017-04-28

pathogen signalling molecules. With that goal in mind , researchers have developed various types of biosensors that detect infectious determinants...life to boost their capability for rapid determination of clean water sources during field deployment. Despite the promising results of these studies

An improved specimens handling procedure for pathogen detection of the cerebrospinal fluid by microscope

Directory of Open Access Journals (Sweden)

WANG Hua-cheng

2013-02-01

Full Text Available Background The diagnosis of encephalitis depends on the finding of pathogens in the brain parenchyma or cerebrospinal fluid (CSF. But the success rates of finding pathogens by microscope are low by the traditional specimens handling procedure in which pathogens are detected by direct centrifugation of CSF getting from lumbar puncture. The process of pathogen collection from the CSF such as centrifugation and washing would cause the destruction and loss of pathogens, resulting in a lower rate of pathogen discovery. Therefore, in order to increase the detection rate of pathogenic microorganisms in CSF, these traditional steps need to be improved. Methods CSF samples of 23 patients with suspected viral encephalitis and 10 control patients with fracture were prepared by two methods: traditional specimens handling procedure (TSHP and improved specimens handling procedure (ISHP. In the ISHP, a final concentration of 2.5% glutaraldehyde was added to CSF in a glass tube, mixed and kept not moving in 4 ℃ for 2 to 4 h or in 37 ℃for 1 h. Then a smear was made from the sediment formed in the tube to check pathogens by microscope. As for the TSHP, pathogens were collected by direct centrifugation of CSF which had not been treated after lumbar puncture, and checked through Gimenze staining. Results There was no statistically significant difference between the two dealing procedures in the control group ( P = 1.000. As for the case group, there were 10 cases showing positive in Pandy test after TSHP, and visible sediments were seen in all the 23 cases after ISHP. There was statistically significant difference between two kinds of CSF treatment for the finding of pathogens (P = 0.000. Seven cases presented pathogen growth in CSF and were diagosed as rickettsial infections by Gimenze staining, immunofluorescence assay (IFA and polymerase chain reaction (PCR. Conclusion Improved specimens handling procedures of CSF contribute to the seperation of cells

Detection of respiratory bacterial pathogens causing atypical pneumonia by multiplex Lightmix® RT-PCR.

Science.gov (United States)

Wagner, Karoline; Springer, Burkard; Imkamp, Frank; Opota, Onya; Greub, Gilbert; Keller, Peter M

2018-04-01

Pneumonia is a severe infectious disease. In addition to common viruses and bacterial pathogens (e.g. Streptococcus pneumoniae), fastidious respiratory pathogens like Chlamydia pneumoniae, Mycoplasma pneumoniae and Legionella spp. can cause severe atypical pneumonia. They do not respond to penicillin derivatives, which may cause failure of antibiotic empirical therapy. The same applies for infections with B. pertussis and B. parapertussis, the cause of pertussis disease, that may present atypically and need to be treated with macrolides. Moreover, these fastidious bacteria are difficult to identify by culture or serology, and therefore often remain undetected. Thus, rapid and accurate identification of bacterial pathogens causing atypical pneumonia is crucial. We performed a retrospective method evaluation study to evaluate the diagnostic performance of the new, commercially available Lightmix ® multiplex RT-PCR assay that detects these fastidious bacterial pathogens causing atypical pneumonia. In this retrospective study, 368 clinical respiratory specimens, obtained from patients suffering from atypical pneumonia that have been tested negative for the presence of common agents of pneumonia by culture and viral PCR, were investigated. These clinical specimens have been previously characterized by singleplex RT-PCR assays in our diagnostic laboratory and were used to evaluate the diagnostic performance of the respiratory multiplex Lightmix ® RT-PCR. The multiplex RT-PCR displayed a limit of detection between 5 and 10 DNA copies for different in-panel organisms and showed identical performance characteristics with respect to specificity and sensitivity as in-house singleplex RT-PCRs for pathogen detection. The Lightmix ® multiplex RT-PCR assay represents a low-cost, time-saving and accurate diagnostic tool with high throughput potential. The time-to-result using an automated DNA extraction device for respiratory specimens followed by multiplex RT-PCR detection was

Equivalence of self- and staff-collected nasal swabs for the detection of viral respiratory pathogens.

Directory of Open Access Journals (Sweden)

Manas K Akmatov

Full Text Available BACKGROUND: The need for the timely collection of diagnostic biosamples during symptomatic episodes represents a major obstacle to large-scale studies on acute respiratory infection (ARI epidemiology. This may be circumvented by having the participants collect their own nasal swabs. We compared self- and staff-collected swabs in terms of swabbing quality and detection of viral respiratory pathogens. METHODOLOGY/PRINCIPAL FINDINGS: We conducted a prospective study among employees of our institution during the ARI season 2010/2011 (December-March. Weekly emails were sent to the participants (n = 84, reminding them to come to the study center in case of new symptoms. The participants self-collected an anterior nasal swab from one nostril, and trained study personnel collected one from the other nostril. The participants self-collected another two swabs (one from each nostril on a subsequent day. Human β-actin DNA concentration was determined in the swabs as a quality control. Viral respiratory pathogens were detected by multiplex RT-PCR (Seeplex RV15 kit, Seegene, Eschborn, Germany. Of 84 participants, 56 (67% reported at least one ARI episode, 18 participants two, and one participant three. Self-swabbing was highly accepted by the participants. The amount of β-actin DNA per swab was higher in the self- than in the staff-collected swabs (p = 0.008. β-actin concentration was lower in the self-swabs collected on day 1 than in those collected on a subsequent day (p<0.0001. A respiratory viral pathogen was detected in 31% (23/75 of staff- and in 35% (26/75 of self-collected swabs (p = 0.36. With both approaches, the most frequently identified pathogens were human rhinoviruses A/B/C (12/75 swabs, 16% and human coronavirus OC43 (4/75 swabs, 5%. There was almost perfect agreement between self- and staff-collected swabs in terms of pathogen detection (agreement = 93%, kappa = 0.85, p<0.0001. CONCLUSIONS/SIGNIFICANCE: Nasal self

Rapid Detection and Characterization of Emerging Foreign Animal Disease Pathogens

Energy Technology Data Exchange (ETDEWEB)

Jaing, C. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

2016-11-18

To best safeguard human and animal health requires early detection and characterization of disease events. This must include effective surveillance for emerging infectious diseases. Both deliberate and natural outbreaks have enormous economic and public health impacts, and can present serious threats to national security. In this project, we developed novel next generation detection technologies to protect the agricultural economy and biosecurity. The first technology is a multiplexed assay to simultaneously detection 10 swine viral and bacterial pathogens. The second one is the Lawrence Livermore Microbial Detection Array (LLMDA) which can detect more than 10,000 microbial species including 4219 viruses, 5367 bacteria, 265 fungi, 117 protozoa and 293 archaea. We analyzed a series of swine clinical samples from past disease events to demonstrate the utility of the assays for faster and cheaper detection of emerging and foreign animal disease pathogens, and their utility as s routine diagnosis and surveillance tool. A second goal of the study is to better understand mechanisms of African swine fever virus (ASFV) infection in pigs to aid the development of countermeasures and diagnostics. There is no vaccine available for ASF. ASF outbreak is on the rise on several European countries. Though ASF is not currently in the U.S., a potential outbreak in the U.S. would be detrimental to the swine industry and the US agricultural economy. We pursued a genome-wide approach to characterize the pig immune responses after ASFV infection. We used RNA sequencing and bioinformatics methods to identify genes and pathways that are affected during ASF infection. We have identified a list of most differentially expressed genes that are in the immune response pathways.

High throughput screening strategies and technology platforms for detection of pathogens: An Introduction

Science.gov (United States)

Globally, foodborne pathogens are a major public health concern. In this chapter, we provide a broad description of the problem of food-borne diseases and current and future detection technologies for food safety assurance and prevention of foodborne illnesses. Current detection approaches include s...

360-Degree Visual Detection and Target Tracking on an Autonomous Surface Vehicle

Science.gov (United States)

Wolf, Michael T; Assad, Christopher; Kuwata, Yoshiaki; Howard, Andrew; Aghazarian, Hrand; Zhu, David; Lu, Thomas; Trebi-Ollennu, Ashitey; Huntsberger, Terry

2010-01-01

This paper describes perception and planning systems of an autonomous sea surface vehicle (ASV) whose goal is to detect and track other vessels at medium to long ranges and execute responses to determine whether the vessel is adversarial. The Jet Propulsion Laboratory (JPL) has developed a tightly integrated system called CARACaS (Control Architecture for Robotic Agent Command and Sensing) that blends the sensing, planning, and behavior autonomy necessary for such missions. Two patrol scenarios are addressed here: one in which the ASV patrols a large harbor region and checks for vessels near a fixed asset on each pass and one in which the ASV circles a fixed asset and intercepts approaching vessels. This paper focuses on the ASV's central perception and situation awareness system, dubbed Surface Autonomous Visual Analysis and Tracking (SAVAnT), which receives images from an omnidirectional camera head, identifies objects of interest in these images, and probabilistically tracks the objects' presence over time, even as they may exist outside of the vehicle's sensor range. The integrated CARACaS/SAVAnT system has been implemented on U.S. Navy experimental ASVs and tested in on-water field demonstrations.

Monoclonal antibody-based Surface Plasmon Resonance sensors for pathogen detection

DEFF Research Database (Denmark)

Skottrup, Peter Durand

2007-01-01

essentially transforms molecular interactions into a digital signal, thereby making detection of analytes label-free. Biosensors are used for detection of analytes ranging from small drug molecules to food- and waterborne microorganisms as well as biowarfare pathogens. In future farming, plant production......A biosensor is an analytical device, which incorporates a biological sensing element integrated within a physicochemical transducer. The aim of a biosensor is to produce an electronic signal, which is proportional to the interaction of analytes with the sensing element. This means that the sensor...

Hand-Eye LRF-Based Iterative Plane Detection Method for Autonomous Robotic Welding

Directory of Open Access Journals (Sweden)

Sungmin Lee

2015-12-01

Full Text Available This paper proposes a hand-eye LRF-based (laser range finder welding plane-detection method for autonomous robotic welding in the field of shipbuilding. The hand-eye LRF system consists of a 6 DOF manipulator and an LRF attached to the wrist of the manipulator. The welding plane is detected by the LRF with only the wrist's rotation to minimize a mechanical error caused by the manipulator's motion. A position on the plane is determined as an average position of the detected points on the plane, and a normal vector to the plane is determined by applying PCA (principal component analysis to the detected points. In this case, the accuracy of the detected plane is analysed by simulations with respect to the wrist's angle interval and the plane angle. As a result of the analysis, an iterative plane-detection method with the manipulator's alignment motion is proposed to improve the performance of plane detection. For verifying the feasibility and effectiveness of the proposed plane-detection method, experiments are carried out with a prototype of the hand-eye LRF-based system, which consists of a 1 DOF wrist's joint, an LRF system and a rotatable plane. In addition, the experimental results of the PCA-based plane detection method are compared with those of the two representative plane-detection methods, based on RANSAC (RANdom SAmple Consensus and the 3D Hough transform in both accuracy and computation time's points of view.

Rapid multiplex detection of 10 foodborne pathogens with an up-converting phosphor technology-based 10-channel lateral flow assay

Science.gov (United States)

Zhao, Yong; Wang, Haoran; Zhang, Pingping; Sun, Chongyun; Wang, Xiaochen; Wang, Xinrui; Yang, Ruifu; Wang, Chengbin; Zhou, Lei

2016-01-01

The rapid high-throughput detection of foodborne pathogens is essential in controlling food safety. In this study, a 10-channel up-converting phosphor technology-based lateral flow (TC-UPT-LF) assay was established for the rapid and simultaneous detection of 10 epidemic foodborne pathogens. Ten different single-target UPT-LF strips were developed and integrated into one TC-UPT-LF disc with optimization. Without enrichment the TC-UPT-LF assay had a detection sensitivity of 104 CFU mL−1 or 105 CFU mL−1 for each pathogen, and after sample enrichment it was 10 CFU/0.6 mg. The assay also showed good linearity, allowing quantitative detection, with a linear fitting coefficient of determination (R2) of 0.916–0.998. The 10 detection channels did not cross-react, so multiple targets could be specifically detected. When 279 real food samples were tested, the assay was highly consistent (100%) with culture-based methods. The results for 110 food samples artificially contaminated with single or multiple targets showed a high detection rate (≥80%) for most target bacteria. Overall, the TC-UPT-LF assay allows the rapid, quantitative, and simultaneous detection of 10 kinds of foodborne pathogens within 20 min, and is especially suitable for the rapid detection and surveillance of foodborne pathogens in food and water. PMID:26884128

Multiplex detection of plant pathogens through the luminex magplex bead system

NARCIS (Netherlands)

Vlugt, van der R.A.A.; Raaij, van H.M.G.; Weerdt, de M.; Bergervoet, J.H.W.

2015-01-01

Here we describe a versatile multiplex method for both the serological and molecular detection of plant pathogens. The Luminex MagPlex bead system uses small paramagnetic microspheres (“beads”), either coated with specific antibodies or oligonucleotides, which capture respectively viruses and/or

Multirobot autonomous landmine detection using distributed multisensor information aggregation

Science.gov (United States)

Jumadinova, Janyl; Dasgupta, Prithviraj

2012-06-01

We consider the problem of distributed sensor information fusion by multiple autonomous robots within the context of landmine detection. We assume that different landmines can be composed of different types of material and robots are equipped with different types of sensors, while each robot has only one type of landmine detection sensor on it. We introduce a novel technique that uses a market-based information aggregation mechanism called a prediction market. Each robot is provided with a software agent that uses sensory input of the robot and performs calculations of the prediction market technique. The result of the agent's calculations is a 'belief' representing the confidence of the agent in identifying the object as a landmine. The beliefs from different robots are aggregated by the market mechanism and passed on to a decision maker agent. The decision maker agent uses this aggregate belief information about a potential landmine and makes decisions about which other robots should be deployed to its location, so that the landmine can be confirmed rapidly and accurately. Our experimental results show that, for identical data distributions and settings, using our prediction market-based information aggregation technique increases the accuracy of object classification favorably as compared to two other commonly used techniques.

Simultaneous Detection of Five Pathogens from Cerebrospinal Fluid Specimens Using Luminex Technology

Directory of Open Access Journals (Sweden)

Linfu Zhou

2016-02-01

Full Text Available Early diagnosis and treatment are crucial for the outcome of central nervous system (CNS infections. In this study, we developed a multiplex PCR-Luminex assay for the simultaneous detection of five major pathogens, including Mycobacterium tuberculosis, Cryptococcus neoformans, Streptococcus pneumoniae, and herpes simplex virus types 1 and 2, which frequently cause CNS infections. Through the hybridization reaction between multiplex PCR-amplified targets and oligonucleotide “anti-TAG” sequences, we found that the PCR-Luminex assay could detect as low as 101–102 copies of synthetic pathogen DNAs. Furthermore, 163 cerebrospinal fluid (CSF specimens from patients with suspected CNS infections were used to evaluate the efficiency of this multiplex PCR-Luminex method. Compared with Ziehl-Neelsen stain, this assay showed a high diagnostic accuracy for tuberculosis meningitis (sensitivity, 90.7% and specificity, 99.1%. For cryptococcal meningitis, the sensitivity and specificity were 92% and 97.1%, respectively, compared with the May Grunwald Giemsa (MGG stain. For herpes simplex virus types 1 and 2 encephalitis, the sensitivities were 80.8% and 100%, and the specificities were 94.2% and 99%, respectively, compared with Enzyme Linked Immunosorbent Assay (ELISA assays. Taken together, this multiplex PCR-Luminex assay showed potential efficiency for the simultaneous detection of five pathogens and may be a promising supplement to conventional methods for diagnosing CNS infections.

Fluorescent Silica Nanoparticles in the Detection and Control of the Growth of Pathogen

International Nuclear Information System (INIS)

Chitra, K.; Annadurai, G.

2013-01-01

In this present study the bio conjugated fluorescent silica nanoparticles give an efficient fluorescent-based immunoassay for the detection of pathogen. The synthesized silica nanoparticles were poly dispersed and the size of the silica nanoparticles was in the range of 114-164 nm. The energy dispersive X-ray spectrophotometer showed the presence of silica at 1.8 keV and the selected area diffractometer showed amorphous nature of silica nanoparticles. The FTIR spectrum confirmed the attachment of dye and carboxyl group onto the silica nanoparticles surface. The fluorescent silica nanoparticles showed highly efficient fluorescence and the fluorescent emission of silica nanoparticles occurred at 536 nm. The SEM image showed the aggregation of nanoparticles and bacteria. The growth of the pathogenic E. coli was controlled using silica nanoparticles; therefore silica nanoparticles could be used in food packaging material, biomedical material, and so forth. This work provides a rapid, simple, and accurate method for the detection of pathogen using fluorescent-based immunoassay.

An Expert System for Autonomous Spacecraft Control

Science.gov (United States)

Sherwood, Rob; Chien, Steve; Tran, Daniel; Cichy, Benjamin; Castano, Rebecca; Davies, Ashley; Rabideau, Gregg

2005-01-01

The Autonomous Sciencecraft Experiment (ASE), part of the New Millennium Space Technology 6 Project, is flying onboard the Earth Orbiter 1 (EO-1) mission. The ASE software enables EO-1 to autonomously detect and respond to science events such as: volcanic activity, flooding, and water freeze/thaw. ASE uses classification algorithms to analyze imagery onboard to detect chang-e and science events. Detection of these events is then used to trigger follow-up imagery. Onboard mission planning software then develops a response plan that accounts for target visibility and operations constraints. This plan is then executed using a task execution system that can deal with run-time anomalies. In this paper we describe the autonomy flight software and how it enables a new paradigm of autonomous science and mission operations. We will also describe the current experiment status and future plans.

Impact of Aerosol Dust on xMAP Multiplex Detection of Different Class Pathogens

Directory of Open Access Journals (Sweden)

Denis A. Kleymenov

2017-11-01

Full Text Available Environmental or city-scale bioaerosol surveillance can provide additional value for biodefense and public health. Efficient bioaerosol monitoring should rely on multiplex systems capable of detecting a wide range of biologically hazardous components potentially present in air (bacteria, viruses, toxins and allergens. xMAP technology from LuminexTM allows multiplex bead-based detection of antigens or nucleic acids, but its use for simultaneous detection of different classes of pathogens (bacteria, virus, toxin is questionable. Another problem is the detection of pathogens in complex matrices, e.g., in the presence of dust. In the this research, we developed the model xMAP multiplex test-system aiRDeTeX 1.0, which enables detection of influenza A virus, Adenovirus type 6 Salmonella typhimurium, and cholera toxin B subunit representing RNA virus, DNA virus, gram-negative bacteria and toxin respectively as model organisms of biologically hazardous components potentially present in or spreadable through the air. We have extensively studied the effect of matrix solution (PBS, distilled water, environmental dust and ultrasound treatment for monoplex and multiplex detection efficiency of individual targets. All targets were efficiently detectable in PBS and in the presence of dust. Ultrasound does not improve the detection except for bacterial LPS.

Comparison between nasopharyngeal swab and nasal wash, using culture and PCR, in the detection of potential respiratory pathogens.

Science.gov (United States)

Gritzfeld, Jenna F; Roberts, Paul; Roche, Lorna; El Batrawy, Sherouk; Gordon, Stephen B

2011-04-13

Nasopharyngeal carriage of potential pathogens is important as it is both the major source of transmission and the prerequisite of invasive disease. New methods for detecting carriage could improve comfort, accuracy and laboratory utility. The aims of this study were to compare the sensitivities of a nasopharyngeal swab (NPS) and a nasal wash (NW) in detecting potential respiratory pathogens in healthy adults using microbiological culture and PCR. Healthy volunteers attended for nasal washing and brushing of the posterior nasopharynx. Conventional and real-time PCR were used to detect pneumococcus and meningococcus. Statistical differences between the two nasal sampling methods were determined using a nonparametric Mann-Whitney U test; differences between culture and PCR methods were determined using the McNemar test.Nasal washing was more comfortable for volunteers than swabbing (n = 24). In detection by culture, the NW was significantly more likely to detect pathogens than the NPS (p < 0.00001). Overall, there was a low carriage rate of pathogens in this sample; no significant difference was seen in the detection of bacteria between culture and PCR methods. Nasal washing and PCR may provide effective alternatives to nasopharyngeal swabbing and classical microbiology, respectively.

Sensitive real-time PCR detection of pathogenic Leptospira spp. and a comparison of nucleic acid amplification methods for the diagnosis of leptospirosis.

Science.gov (United States)

Waggoner, Jesse J; Balassiano, Ilana; Abeynayake, Janaki; Sahoo, Malaya K; Mohamed-Hadley, Alisha; Liu, Yuanyuan; Vital-Brazil, Juliana Magalhães; Pinsky, Benjamin A

2014-01-01

Bacteria of the genus Leptospira, the causative agents of leptospirosis, are categorized into pathogenic and non-pathogenic species. However, the benefit of using a clinical diagnostic that is specific for pathogenic species remains unclear. In this study, we present the development of a real-time PCR (rtPCR) for the detection of pathogenic Leptospira (the pathogenic rtPCR), and we perform a comparison of the pathogenic rtPCR with a published assay that detects all Leptospira species [the undifferentiated febrile illness (UFI) assay] and a reference 16S Leptospira rtPCR, which was originally designed to detect pathogenic species. For the pathogenic rtPCR, a new hydrolysis probe was designed for use with primers from the UFI assay, which targets the 16S gene. The pathogenic rtPCR detected Leptospira DNA in 37/37 cultured isolates from 5 pathogenic and one intermediate species. Two strains of the non-pathogenic L. biflexa produced no signal. Clinical samples from 65 patients with suspected leptospirosis were then tested using the pathogenic rtPCR and a reference Leptospira 16S rtPCR. All 65 samples had tested positive for Leptospira using the UFI assay; 62 (95.4%) samples tested positive using the pathogenic rtPCR (p = 0.24). Only 24 (36.9%) samples tested positive in the reference 16S rtPCR (pLeptospira species in 49/50 cases, including 3 cases that were only detected using the UFI assay. The pathogenic rtPCR displayed similar sensitivity to the UFI assay when testing clinical specimens with no difference in specificity. Both assays proved significantly more sensitive than a real-time molecular test used for comparison. Future studies are needed to investigate the clinical and epidemiologic significance of more sensitive Leptospira detection using these tests.

Towards autonomous radio detection of ultra high energy cosmic rays

International Nuclear Information System (INIS)

Garcon, Th.

2010-01-01

The radio-detection of extensive air showers, investigated for the first time in the 1960's, obtained promising results but plagued by the technical limitations. At that time, H.R. Allan summed up the state of the art in an extensive review article whose conclusions and predictions are still used today. Set up in 2001 at the Nancay Observatory, the CODALEMA experiment was built first as a demonstrator and successfully showed the feasibility of the radio-detection of extensive air showers. Radically modified in 2005, it allowed to obtain a clear energy correlation, and put in evidence an unambiguous signature of the geomagnetic origin of the electric field emission process associated to the air shower. The switch towards large areas is the next step of the technique's development. Therefore, the autonomy of the detectors becomes essential. After test prototypes installed in 2006 at the Pierre Auger Observatory, a generation of new autonomous detectors was developed. Their first results will be presented. This work is also dedicated to the issues related to the radio-detection technique: the antenna response, the sensitivity, the surrounding effects, the monitoring of a big array. The determination of the shower characteristics independently of other detectors such as the lateral distribution, the energy correlation and the frequency spectrum of the radio transient will be discussed. (author)

Canine Detection of the Volatilome: A Review of Implications for Pathogen and Disease Detection.

Science.gov (United States)

Angle, Craig; Waggoner, Lowell Paul; Ferrando, Arny; Haney, Pamela; Passler, Thomas

2016-01-01

The volatilome is the entire set of volatile organic compounds (VOC) produced by an organism. The accumulation of VOC inside and outside of the body reflects the unique metabolic state of an organism. Scientists are developing technologies to non-invasively detect VOC for the purposes of medical diagnosis, therapeutic monitoring, disease outbreak containment, and disease prevention. Detection dogs are proven to be a valuable real-time mobile detection technology for the detection of VOC related to explosives, narcotics, humans, and many other targets of interests. Little is known about what dogs are detecting when searching for biological targets. It is important to understand where biological VOC originates and how dogs might be able to detect biological targets. This review paper discusses the recent scientific literature involving VOC analysis and postulates potential biological targets for canine detection. Dogs have shown their ability to detect pathogen and disease-specific VOC. Future research will determine if dogs can be employed operationally in hospitals, on borders, in underserved areas, on farms, and in other operational environments to give real-time feedback on the presence of a biological target.

Molecular techniques for detection and identification of pathogens in food: advantages and limitations

OpenAIRE

Palomino-Camargo, Carolina; Instituto de Ciencia y Tecnología de Alimentos, Facultad de Ciencias, Universidad Central de Venezuela. Caracas, Venezuela. Magíster en Ciencia y Tecnología de los Alimentos licenciada en Biología; González-Muñoz, Yuniesky; Instituto de Ciencia y Tecnología de Alimentos, Facultad de Ciencias, Universidad Central de Venezuela. Caracas, Venezuela. Ministerio del Poder Popular para la Alimentación. Caracas, Venezuela. licenciado en Ciencias de los Alimentos.

2014-01-01

Foodborne diseases, caused by pathogenic microorganisms, are a major public health problem worldwide. Microbiological methods commonly used in the detection of these foodborne pathogens are laborious and time consuming. This situation, coupled with the demand for immediate results and with technological advances, has led to the development of a wide range of rapid methods in recent decades. On this basis, this review describes the advantages and limitations of the main molecular methods used ...

Autonomous long-range open area fire detection and reporting

Science.gov (United States)

Engelhaupt, Darell E.; Reardon, Patrick J.; Blackwell, Lisa; Warden, Lance; Ramsey, Brian D.

2005-03-01

Approximately 5 billion dollars in US revenue was lost in 2003 due to open area fires. In addition many lives are lost annually. Early detection of open area fires is typically performed by manned observatories, random reporting and aerial surveillance. Optical IR flame detectors have been developed previously. They typically have experienced high false alarms and low flame detection sensitivity due to interference from solar and other causes. Recently a combination of IR detectors has been used in a two or three color mode to reduce false alarms from solar, or background sources. A combination of ultra-violet C (UVC) and near infra-red (NIR) detectors has also been developed recently for flame discrimination. Relatively solar-blind basic detectors are now available but typically detect at only a few tens of meters at ~ 1 square meter fuel flame. We quantify the range and solar issues for IR and visible detectors and qualitatively define UV sensor requirements in terms of the mode of operation, collection area issues and flame signal output by combustion photochemistry. We describe innovative flame signal collection optics for multiple wavelengths using UV and IR as low false alarm detection of open area fires at long range (8-10 km/m2) in daylight (or darkness). A circular array detector and UV-IR reflective and refractive devices including cylindrical or toroidal lens elements for the IR are described. The dispersion in a refractive cylindrical IR lens characterizes the fire and allows a stationary line or circle generator to locate the direction and different flame IR "colors" from a wide FOV. The line generator will produce spots along the line corresponding to the fire which can be discriminated with a linear detector. We demonstrate prototype autonomous sensors with RF digital reporting from various sites.

Cybersecurity for aerospace autonomous systems

Science.gov (United States)

Straub, Jeremy

2015-05-01

High profile breaches have occurred across numerous information systems. One area where attacks are particularly problematic is autonomous control systems. This paper considers the aerospace information system, focusing on elements that interact with autonomous control systems (e.g., onboard UAVs). It discusses the trust placed in the autonomous systems and supporting systems (e.g., navigational aids) and how this trust can be validated. Approaches to remotely detect the UAV compromise, without relying on the onboard software (on a potentially compromised system) as part of the process are discussed. How different levels of autonomy (task-based, goal-based, mission-based) impact this remote characterization is considered.

Transmutation of Personal Glucose Meters into Portable and Highly Sensitive Microbial Pathogen Detection Platform.

Science.gov (United States)

Wang, Zhenzhen; Chen, Zhaowei; Gao, Nan; Ren, Jinsong; Qu, Xiaogang

2015-10-07

Herein, for the first time, we presented a simple and general approach by using personal glucose meters (PGM) for portable and ultrasensitive detection of microbial pathogens. Upon addition of pathogenic bacteria, glucoamylase-quaternized magnetic nanoparticles (GA-QMNPS) conjugates were disrupted by the competitive multivalent interactions between bacteria and QMNPS, resulting in the release of GA. After magnetic separation, the free GA could catalyze the hydrolysis of amylose into glucose for quantitative readout by PGM. In such way, PGM was transmuted into a bacterial detection device and extremely low detection limits down to 20 cells mL(-1) was achieved. More importantly, QMNPS could inhibit the growth of the bacteria and destroy its cellular structure, which enabled bacteria detection and inhibition simultaneously. The simplicity, portability, sensitivity and low cost of presented work make it attractive for clinical applications. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Direct Detection and Differentiation of Pathogenic Leptospira Species Using a Multi-Gene Targeted Real Time PCR Approach

Science.gov (United States)

Ferreira, Ana Sofia; Costa, Pedro; Rocha, Teresa; Amaro, Ana; Vieira, Maria Luísa; Ahmed, Ahmed; Thompson, Gertrude; Hartskeerl, Rudy A.; Inácio, João

2014-01-01

Leptospirosis is a growing public and veterinary health concern caused by pathogenic species of Leptospira. Rapid and reliable laboratory tests for the direct detection of leptospiral infections in animals are in high demand not only to improve diagnosis but also for understanding the epidemiology of the disease. In this work we describe a novel and simple TaqMan-based multi-gene targeted real-time PCR approach able to detect and differentiate Leptospira interrogans, L. kirschneri, L. borgpeteresenii and L. noguchii, which constitute the veterinary most relevant pathogenic species of Leptospira. The method uses sets of species-specific probes, and respective flanking primers, designed from ompL1 and secY gene sequences. To monitor the presence of inhibitors, a duplex amplification assay targeting both the mammal β-actin and the leptospiral lipL32 genes was implemented. The analytical sensitivity of all primer and probe sets was estimated to be <10 genome equivalents (GE) in the reaction mixture. Application of the amplification reactions on genomic DNA from a variety of pathogenic and non-pathogenic Leptospira strains and other non-related bacteria revealed a 100% analytical specificity. Additionally, pathogenic leptospires were successfully detected in five out of 29 tissue samples from animals (Mus spp., Rattus spp., Dolichotis patagonum and Sus domesticus). Two samples were infected with L. borgpetersenii, two with L. interrogans and one with L. kirschneri. The possibility to detect and identify these pathogenic agents to the species level in domestic and wildlife animals reinforces the diagnostic information and will enhance our understanding of the epidemiology of leptopirosis. PMID:25398140

Automatic, ECG-based detection of autonomic arousals and their association with cortical arousals, leg movements, and respiratory events in sleep

DEFF Research Database (Denmark)

Olsen, Mads; Schneider, Logan Douglas; Cheung, Joseph

2018-01-01

The current definition of sleep arousals neglects to address the diversity of arousals and their systemic cohesion. Autonomic arousals (AA) are autonomic activations often associated with cortical arousals (CA), but they may also occur in isolation in relation to a respiratory event, a leg movement...... event or spontaneously, without any other physiological associations. AA should be acknowledged as essential events to understand and explore the systemic implications of arousals. We developed an automatic AA detection algorithm based on intelligent feature selection and advanced machine learning using...... or respiratory events. This indicates that most FP constitute autonomic activations that are indistinguishable from those with cortical cohesion. The proposed algorithm provides an automatic system trained in a clinical environment, which can be utilized to analyse the systemic and clinical impacts of arousals....

Use of Metagenomic Shotgun Sequencing Technology To Detect Foodborne Pathogens within the Microbiome of the Beef Production Chain

OpenAIRE

Yang, Xiang; Noyes, Noelle R.; Doster, Enrique; Martin, Jennifer N.; Linke, Lyndsey M.; Magnuson, Roberta J.; Yang, Hua; Geornaras, Ifigenia; Woerner, Dale R.; Jones, Kenneth L.; Ruiz, Jaime; Boucher, Christina; Morley, Paul S.; Belk, Keith E.

2016-01-01

Foodborne illnesses associated with pathogenic bacteria are a global public health and economic challenge. The diversity of microorganisms (pathogenic and nonpathogenic) that exists within the food and meat industries complicates efforts to understand pathogen ecology. Further, little is known about the interaction of pathogens within the microbiome throughout the meat production chain. Here, a metagenomic approach and shotgun sequencing technology were used as tools to detect pathogenic bact...

Evaluation of different enrichment methods for pathogenic Yersinia species detection by real time PCR

Science.gov (United States)

2014-01-01

Background Yersiniosis is a zoonotic disease reported worldwide. Culture and PCR based protocols are the most common used methods for detection of pathogenic Yersinia species in animal samples. PCR sensitivity could be increased by an initial enrichment step. This step is particularly useful in surveillance programs, where PCR is applied to samples from asymptomatic animals. The aim of this study was to evaluate the improvement in pathogenic Yersinia species detection using a suitable enrichment method prior to the real time PCR (rtPCR). Nine different enrichment protocols were evaluated including six different broth mediums (CASO, ITC, PSB, PBS, PBSMSB and PBSSSB). Results The analysis of variance showed significant differences in Yersinia detection by rtPCR according to the enrichment protocol used. These differences were higher for Y. pseudotuberculosis than for Y. enterocolitica. In general, samples incubated at lower temperatures yielded the highest detection rates. The best results were obtained with PBSMSB and PBS2. Application of PBSMSB protocol to free-ranging wild board samples improved the detection of Y. enterocolitica by 21.2% when compared with direct rtPCR. Y. pseudotuberculosis detection was improved by 10.6% when results obtained by direct rtPCR and by PBSMSB enrichment before rtPCR were analyzed in combination. Conclusions The data obtained in the present study indicate a difference in Yersinia detection by rtPCR related to the enrichment protocol used, being PBSMSB enrichment during 15 days at 4°C and PBS during 7 days at 4°C the most efficient. The use of direct rtPCR in combination with PBSMSB enrichment prior to rtPCR resulted in an improvement in the detection rates of pathogenic Yersinia in wild boar and could be useful for application in other animal samples. PMID:25168886

Detection of Emerging and Re-Emerging Pathogens in Surface Waters Close to an Urban Area

Directory of Open Access Journals (Sweden)

Stefania Marcheggiani

2015-05-01

Full Text Available Current knowledge about the spread of pathogens in aquatic environments is scarce probably because bacteria, viruses, algae and their toxins tend to occur at low concentrations in water, making them very difficult to measure directly. The purpose of this study was the development and validation of tools to detect pathogens in freshwater systems close to an urban area. In order to evaluate anthropogenic impacts on water microbiological quality, a phylogenetic microarray was developed in the context of the EU project µAQUA to detect simultaneously numerous pathogens and applied to samples from two different locations close to an urban area located upstream and downstream of Rome in the Tiber River. Furthermore, human enteric viruses were also detected. Fifty liters of water were collected and concentrated using a hollow-fiber ultrafiltration approach. The resultant concentrate was further size-fractionated through a series of decreasing pore size filters. RNA was extracted from pooled filters and hybridized to the newly designed microarray to detect pathogenic bacteria, protozoa and toxic cyanobacteria. Diatoms as indicators of the water quality status, were also included in the microarray to evaluate water quality. The microarray results gave positive signals for bacteria, diatoms, cyanobacteria and protozoa. Cross validation of the microarray was performed using standard microbiological methods for the bacteria. The presence of oral-fecal transmitted human enteric-viruses were detected using q-PCR. Significant concentrations of Salmonella, Clostridium, Campylobacter and Staphylococcus as well as Hepatitis E Virus (HEV, noroviruses GI (NoGGI and GII (NoGII and human adenovirus 41 (ADV 41 were found in the Mezzocammino site, whereas lower concentrations of other bacteria and only the ADV41 virus was recovered at the Castel Giubileo site. This study revealed that the pollution level in the Tiber River was considerably higher downstream rather than

FY05 LDRD Final Report A Computational Design Tool for Microdevices and Components in Pathogen Detection Systems

Energy Technology Data Exchange (ETDEWEB)

Trebotich, D

2006-02-07

We have developed new algorithms to model complex biological flows in integrated biodetection microdevice components. The proposed work is important because the design strategy for the next-generation Autonomous Pathogen Detection System at LLNL is the microfluidic-based Biobriefcase, being developed under the Chemical and Biological Countermeasures Program in the Homeland Security Organization. This miniaturization strategy introduces a new flow regime to systems where biological flow is already complex and not well understood. Also, design and fabrication of MEMS devices is time-consuming and costly due to the current trial-and-error approach. Furthermore, existing devices, in general, are not optimized. There are several MEMS CAD capabilities currently available, but their computational fluid dynamics modeling capabilities are rudimentary at best. Therefore, we proposed a collaboration to develop computational tools at LLNL which will (1) provide critical understanding of the fundamental flow physics involved in bioMEMS devices, (2) shorten the design and fabrication process, and thus reduce costs, (3) optimize current prototypes and (4) provide a prediction capability for the design of new, more advanced microfluidic systems. Computational expertise was provided by Comp-CASC and UC Davis-DAS. The simulation work was supported by key experiments for guidance and validation at UC Berkeley-BioE.

High-throughput DNA microarray detection of pathogenic bacteria in shallow well groundwater in the Kathmandu Valley, Nepal.

Science.gov (United States)

Inoue, Daisuke; Hinoura, Takuji; Suzuki, Noriko; Pang, Junqin; Malla, Rabin; Shrestha, Sadhana; Chapagain, Saroj Kumar; Matsuzawa, Hiroaki; Nakamura, Takashi; Tanaka, Yasuhiro; Ike, Michihiko; Nishida, Kei; Sei, Kazunari

2015-01-01

Because of heavy dependence on groundwater for drinking water and other domestic use, microbial contamination of groundwater is a serious problem in the Kathmandu Valley, Nepal. This study investigated comprehensively the occurrence of pathogenic bacteria in shallow well groundwater in the Kathmandu Valley by applying DNA microarray analysis targeting 941 pathogenic bacterial species/groups. Water quality measurements found significant coliform (fecal) contamination in 10 of the 11 investigated groundwater samples and significant nitrogen contamination in some samples. The results of DNA microarray analysis revealed the presence of 1-37 pathogen species/groups, including 1-27 biosafety level 2 ones, in 9 of the 11 groundwater samples. While the detected pathogens included several feces- and animal-related ones, those belonging to Legionella and Arthrobacter, which were considered not to be directly associated with feces, were detected prevalently. This study could provide a rough picture of overall pathogenic bacterial contamination in the Kathmandu Valley, and demonstrated the usefulness of DNA microarray analysis as a comprehensive screening tool of a wide variety of pathogenic bacteria.

The detection and differentiation of canine respiratory pathogens using oligonucleotide microarrays.

Science.gov (United States)

Wang, Lih-Chiann; Kuo, Ya-Ting; Chueh, Ling-Ling; Huang, Dean; Lin, Jiunn-Horng

2017-05-01

Canine respiratory diseases are commonly seen in dogs along with co-infections with multiple respiratory pathogens, including viruses and bacteria. Virus infections in even vaccinated dogs were also reported. The clinical signs caused by different respiratory etiological agents are similar, which makes differential diagnosis imperative. An oligonucleotide microarray system was developed in this study. The wild type and vaccine strains of canine distemper virus (CDV), influenza virus, canine herpesvirus (CHV), Bordetella bronchiseptica and Mycoplasma cynos were detected and differentiated simultaneously on a microarray chip. The detection limit is 10, 10, 100, 50 and 50 copy numbers for CDV, influenza virus, CHV, B. bronchiseptica and M. cynos, respectively. The clinical test results of nasal swab samples showed that the microarray had remarkably better efficacy than the multiplex PCR-agarose gel method. The positive detection rate of microarray and agarose gel was 59.0% (n=33) and 41.1% (n=23) among the 56 samples, respectively. CDV vaccine strain and pathogen co-infections were further demonstrated by the microarray but not by the multiplex PCR-agarose gel. The oligonucleotide microarray provides a highly efficient diagnosis alternative that could be applied to clinical usage, greatly assisting in disease therapy and control. Copyright © 2017 Elsevier B.V. All rights reserved.

A PDMS/paper/glass hybrid microfluidic biochip integrated with aptamer-functionalized graphene oxide nano-biosensors for one-step multiplexed pathogen detection.

Science.gov (United States)

Zuo, Peng; Li, XiuJun; Dominguez, Delfina C; Ye, Bang-Ce

2013-10-07

Infectious pathogens often cause serious public health concerns throughout the world. There is an increasing demand for simple, rapid and sensitive approaches for multiplexed pathogen detection. In this paper we have developed a polydimethylsiloxane (PDMS)/paper/glass hybrid microfluidic system integrated with aptamer-functionalized graphene oxide (GO) nano-biosensors for simple, one-step, multiplexed pathogen detection. The paper substrate used in this hybrid microfluidic system facilitated the integration of aptamer biosensors on the microfluidic biochip, and avoided complicated surface treatment and aptamer probe immobilization in a PDMS or glass-only microfluidic system. Lactobacillus acidophilus was used as a bacterium model to develop the microfluidic platform with a detection limit of 11.0 cfu mL(-1). We have also successfully extended this method to the simultaneous detection of two infectious pathogens - Staphylococcus aureus and Salmonella enterica. This method is simple and fast. The one-step 'turn on' pathogen assay in a ready-to-use microfluidic device only takes ~10 min to complete on the biochip. Furthermore, this microfluidic device has great potential in rapid detection of a wide variety of different other bacterial and viral pathogens.

Current Technical Approaches for the Early Detection of Foodborne Pathogens: Challenges and Opportunities

Directory of Open Access Journals (Sweden)

Il-Hoon Cho

2017-09-01

Full Text Available The development of novel and high-tech solutions for rapid, accurate, and non-laborious microbial detection methods is imperative to improve the global food supply. Such solutions have begun to address the need for microbial detection that is faster and more sensitive than existing methodologies (e.g., classic culture enrichment methods. Multiple reviews report the technical functions and structures of conventional microbial detection tools. These tools, used to detect pathogens in food and food homogenates, were designed via qualitative analysis methods. The inherent disadvantage of these analytical methods is the necessity for specimen preparation, which is a time-consuming process. While some literature describes the challenges and opportunities to overcome the technical issues related to food industry legal guidelines, there is a lack of reviews of the current trials to overcome technological limitations related to sample preparation and microbial detection via nano and micro technologies. In this review, we primarily explore current analytical technologies, including metallic and magnetic nanomaterials, optics, electrochemistry, and spectroscopy. These techniques rely on the early detection of pathogens via enhanced analytical sensitivity and specificity. In order to introduce the potential combination and comparative analysis of various advanced methods, we also reference a novel sample preparation protocol that uses microbial concentration and recovery technologies. This technology has the potential to expedite the pre-enrichment step that precedes the detection process.

Current Technical Approaches for the Early Detection of Foodborne Pathogens: Challenges and Opportunities.

Science.gov (United States)

Cho, Il-Hoon; Ku, Seockmo

2017-09-30

The development of novel and high-tech solutions for rapid, accurate, and non-laborious microbial detection methods is imperative to improve the global food supply. Such solutions have begun to address the need for microbial detection that is faster and more sensitive than existing methodologies (e.g., classic culture enrichment methods). Multiple reviews report the technical functions and structures of conventional microbial detection tools. These tools, used to detect pathogens in food and food homogenates, were designed via qualitative analysis methods. The inherent disadvantage of these analytical methods is the necessity for specimen preparation, which is a time-consuming process. While some literature describes the challenges and opportunities to overcome the technical issues related to food industry legal guidelines, there is a lack of reviews of the current trials to overcome technological limitations related to sample preparation and microbial detection via nano and micro technologies. In this review, we primarily explore current analytical technologies, including metallic and magnetic nanomaterials, optics, electrochemistry, and spectroscopy. These techniques rely on the early detection of pathogens via enhanced analytical sensitivity and specificity. In order to introduce the potential combination and comparative analysis of various advanced methods, we also reference a novel sample preparation protocol that uses microbial concentration and recovery technologies. This technology has the potential to expedite the pre-enrichment step that precedes the detection process.

Analysis of bacterial metagenomes from the Southwestern Gulf of Mexico for pathogens detection.

Science.gov (United States)

Escobedo-Hinojosa, Wendy; Pardo-López, Liliana

2017-07-31

Little is known about the diversity of bacteria in the Southwestern Gulf of Mexico. The aim of the study illustrated in this perspective was to search for the presence of bacterial pathogens in this ecosystem, using metagenomic data recently generated by the Mexican research group known as the Gulf of Mexico Research Consortium. Several genera of bacteria annotated as pathogens were detected in water and sediment marine samples. As expected, native and ubiquitous pathogenic bacteria genera such as Burkolderia, Halomonas, Pseudomonas, Shewanella and Vibrio were highly represented. Surprisingly, non-native genera of public health concern were also detected, including Borrelia, Ehrlichia, Leptospira, Mycobacterium, Mycoplasma, Salmonella, Staphylococcus, Streptococcus and Treponema. While there are no previous metagenomics studies of this environment, the potential influences of natural, anthropogenic and ecological factors on the diversity of putative pathogenic bacteria found in it are reviewed. The taxonomic annotation herein reported provides a starting point for an improved understanding of bacterial biodiversity in the Southwestern Gulf of Mexico. It also represents a useful tool in public health as it may help identify infectious diseases associated with exposure to marine water and ingestion of fish or shellfish, and thus may be useful in predicting and preventing waterborne disease outbreaks. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Prevalence and pattern of cardiac autonomic dysfunction in newly detected type 2 diabetes mellitus.

Science.gov (United States)

Jyotsna, Viveka P; Sahoo, Abhay; Sreenivas, V; Deepak, K K

2009-01-01

Cardiac autonomic functions were assessed in 145 consecutive recently detected type 2 diabetics. Ninety-nine healthy persons served as controls. Criteria for normalcy were, heart rate variation during deep breathing >or=15 beats/min, deep breathing expiratory to inspiratory R-R ratio >or=1.21, Valsalva ratio >or=1.21, sustained handgrip test >or=16 mm of mercury, cold pressor test >or=10, BP response to standing or=1.04. An abnormal test was defined as the above parameters being or=30 mm of mercury and autonomic function was normal in 7.8% patients and 32.5% healthy controls.

Integrated Detection of Pathogens and Host Biomarkers for Wounds

Energy Technology Data Exchange (ETDEWEB)

Jaing, C

2012-03-19

The increasing incidence and complications arising from combat wounds has necessitated a reassessment of methods for effective treatment. Infection, excessive inflammation, and incidence of drug-resistant organisms all contribute toward negative outcomes for afflicted individuals. The organisms and host processes involved in wound progression, however, are incompletely understood. We therefore set out, using our unique technical resources, to construct a profile of combat wounds which did or did not successfully resolve. We employed the Lawrence Livermore Microbial Detection Array and identified a number of nosocomial pathogens present in wound samples. Some of these identities corresponded with bacterial isolates previously cultured, while others were not obtained via standard microbiology. Further, we optimized proteomics protocols for the identification of host biomarkers indicative of various stages in wound progression. In combination with our pathogen data, our biomarker discovery efforts will provide a profile corresponding to wound complications, and will assist significantly in treatment of these complex cases.

Influence of Rack Design and Disease Prevalence on Detection of Rodent Pathogens in Exhaust Debris Samples from Individually Ventilated Caging Systems.

Science.gov (United States)

Bauer, Beth A; Besch-Williford, Cynthia; Livingston, Robert S; Crim, Marcus J; Riley, Lela K; Myles, Matthew H

2016-11-01

Sampling of bedding debris within the exhaust systems of ventilated racks may be a mechanism for detecting murine pathogens in colony animals. This study examined the effectiveness of detecting pathogens by PCR analysis of exhaust debris samples collected from ventilated racks of 2 different rack designs, one with unfiltered air flow from within the cage to the air-exhaust pathway, and the other had a filter between the cage and the air-exhaust pathway. For 12 wk, racks were populated with either 1 or 5 cages of mice (3 mice per cage) infected with one of the following pathogens: mouse norovirus (MNV), mouse parvovirus (MPV), mouse hepatitis virus (MHV), Helicobacter spp., Pasteurella pneumotropica, pinworms, Entamoeba muris, Tritrichomonas muris, and fur mites. Pathogen shedding by infected mice was monitored throughout the study. In the filter-containing rack, PCR testing of exhaust plenums yielded negative results for all pathogens at all time points of the study. In the rack with open air flow, pathogens detected by PCR analysis of exhaust debris included MHV, Helicobacter spp., P. pneumotropica, pinworms, enteric protozoa, and fur mites; these pathogens were detected in racks housing either 1 or 5 cages of infected mice. Neither MPV nor MNV was detected in exhaust debris, even though prolonged viral shedding was confirmed. These results demonstrate that testing rack exhaust debris from racks with unfiltered air flow detected MHV, enteric bacteria and parasites, and fur mites. However, this method failed to reliably detect MNV or MPV infection of colony animals.

Surveillance of vector-borne pathogens under imperfect detection: lessons from Chagas disease risk (mis)measurement.

Science.gov (United States)

Minuzzi-Souza, Thaís Tâmara Castro; Nitz, Nadjar; Cuba, César Augusto Cuba; Hagström, Luciana; Hecht, Mariana Machado; Santana, Camila; Ribeiro, Marcelle; Vital, Tamires Emanuele; Santalucia, Marcelo; Knox, Monique; Obara, Marcos Takashi; Abad-Franch, Fernando; Gurgel-Gonçalves, Rodrigo

2018-01-09

Vector-borne pathogens threaten human health worldwide. Despite their critical role in disease prevention, routine surveillance systems often rely on low-complexity pathogen detection tests of uncertain accuracy. In Chagas disease surveillance, optical microscopy (OM) is routinely used for detecting Trypanosoma cruzi in its vectors. Here, we use replicate T. cruzi detection data and hierarchical site-occupancy models to assess the reliability of OM-based T. cruzi surveillance while explicitly accounting for false-negative and false-positive results. We investigated 841 triatomines with OM slides (1194 fresh, 1192 Giemsa-stained) plus conventional (cPCR, 841 assays) and quantitative PCR (qPCR, 1682 assays). Detections were considered unambiguous only when parasitologists unmistakably identified T. cruzi in Giemsa-stained slides. qPCR was >99% sensitive and specific, whereas cPCR was ~100% specific but only ~55% sensitive. In routine surveillance, examination of a single OM slide per vector missed ~50-75% of infections and wrongly scored as infected ~7% of the bugs. qPCR-based and model-based infection frequency estimates were nearly three times higher, on average, than OM-based indices. We conclude that the risk of vector-borne Chagas disease may be substantially higher than routine surveillance data suggest. The hierarchical modelling approach we illustrate can help enhance vector-borne disease surveillance systems when pathogen detection is imperfect.

Simultaneous Detection of Brown Rot- and Soft Rot-Causing Bacterial Pathogens from Potato Tubers Through Multiplex PCR.

Science.gov (United States)

Ranjan, R K; Singh, Dinesh; Baranwal, V K

2016-11-01

Ralstonia solanacearum (Smith) Yabuuchi et al. and Erwinia carotovora subsp. carotovora (Jones) Bergey et al. (Pectobacterium carotovorum subsp. carotovorum) are the two major bacterial pathogens of potato causing brown rot (wilt) and soft rot diseases, respectively, in the field and during storage. Reliable and early detection of these pathogens are keys to avoid occurrence of these diseases in potato crops and reduce yield loss. In the present study, multiplex polymerase chain reaction (PCR) protocol was developed for simultaneous detection of R. solanacearum and E. carotovora subsp. carotovora from potato tubers. A set of oligos targeting the pectatelyase (pel) gene of E. carotovora subsp. carotovora and the universal primers based on 16S r RNA gene of R. solanacearum were used. The standardized multiplex PCR protocol could detect R. solanacearum and E. carotovora subsp. carotovora up to 0.01 and 1.0 ng of genomic DNA, respectively. The protocol was further validated on 96 stored potato tuber samples, collected from different potato-growing states of India, viz. Uttarakhand, Odisha, Meghalaya and Delhi. 53.1 % tuber samples were positive for R. solanacearum, and 15.1 % of samples were positive for E. carotovora subsp. carotovora, and both the pathogens were positive in 26.0 % samples when BIO-PCR was used. This method offers sensitive, specific, reliable and fast detection of two major bacterial pathogens from potato tubers simultaneously, particularly pathogen-free seed certification in large scale.

Simultaneous Detection of 13 Key Bacterial Respiratory Pathogens by Combination of Multiplex PCR and Capillary Electrophoresis.

Science.gov (United States)

Jiang, Lu Xi; Ren, Hong Yu; Zhou, Hai Jian; Zhao, Si Hong; Hou, Bo Yan; Yan, Jian Ping; Qin, Tian; Chen, Yu

2017-08-01

Lower respiratory tract infections continue to pose a significant threat to human health. It is important to accurately and rapidly detect respiratory bacteria. To compensate for the limits of current respiratory bacteria detection methods, we developed a combination of multiplex polymerase chain reaction (PCR) and capillary electrophoresis (MPCE) assay to detect thirteen bacterial pathogens responsible for lower respiratory tract infections, including Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, Pseudomonas aeruginosa, Klebsiella pneumoniae, Escherichia coli, Staphylococcus aureus, Mycoplasma pneumoniae, Legionella spp., Bordetella pertussis, Mycobacterium tuberculosis complex, Corynebacterium diphtheriae, and Streptococcus pyogenes. Three multiplex PCR reactions were built, and the products were analyzed by capillary electrophoresis using the high-throughput DNA analyzer. The specificity of the MPCE assay was examined and the detection limit was evaluated using DNA samples from each bacterial strain and the simulative samples of each strain. This assay was further evaluated using 152 clinical specimens and compared with real-time PCR reactions. For this assay, three nested-multiplex-PCRs were used to detect these clinical specimens. The detection limits of the MPCE assay for the 13 pathogens were very low and ranged from 10-7 to 10-2 ng/μL. Furthermore, analysis of the 152 clinical specimens yielded a specificity ranging from 96.5%-100.0%, and a sensitivity of 100.0% for the 13 pathogens. This study revealed that the MPCE assay is a rapid, reliable, and high-throughput method with high specificity and sensitivity. This assay has great potential in the molecular epidemiological survey of respiratory pathogens. Copyright © 2017 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

Rapid fluorescence detection of pathogenic bacteria using magnetic enrichment technique combined with magnetophoretic chromatography.

Science.gov (United States)

Che, Yulan; Xu, Yi; Wang, Renjie; Chen, Li

2017-08-01

A rapid and sensitive analytical method was developed to detect pathogenic bacteria which combined magnetic enrichment, fluorescence labeling with polyethylene glycol (PEG) magnetophoretic chromatography. As pathogenic bacteria usually exist in complex matrixes at low concentration, an efficient enrichment is essential for diagnosis. In order to capture series types of pathogenic bacteria in samples, amino-modified magnetic nanoparticles (Fe 3 O 4 @SiO 2 -NH 2 ) were prepared for efficient enrichment by the electrostatic interaction with pathogenic bacteria. It was shown that the capture efficiency reached up to 95.4% for Escherichia coli (E. coli). Furthermore, quantitative analysis of the bacteria was achieved by using acridine orange (AO) as a fluorescence probe for the captured E. coli due to its ability of staining series types of bacteria and rapid labeling. In order to remove the free magnetic nanoparticles and redundant fluorescent reagent, the labeled suspension was poured into a PEG separation column and was separated by applying an external magnetic field. The presence of 100 cfu mL -1 E. coli could be detected for semi-quantitative analysis by observing the separation column with the naked eye, and the concentration could be further evaluated by fluorescence detection. All the above processes were finished within 80 min. It was demonstrated that a good linear relationship existed between the fluorescence intensity and the concentration of E. coli ranging from 10 2 to 10 6  cfu mL -1 , with a detection limit of 100 cfu mL -1 when E. coli acted as target bacteria. The recovery rate of E. coli was 93.6∼102.0% in tap water and cooked meat samples, and the RSD was lower than 7% (n = 6); the result coincided with the conventional plate count method. Graphical abstract ᅟ.

Meta-analysis diagnostic accuracy of SNP-based pathogenicity detection tools: a case of UTG1A1 gene mutations.

Science.gov (United States)

Galehdari, Hamid; Saki, Najmaldin; Mohammadi-Asl, Javad; Rahim, Fakher

2013-01-01

Crigler-Najjar syndrome (CNS) type I and type II are usually inherited as autosomal recessive conditions that result from mutations in the UGT1A1 gene. The main objective of the present review is to summarize results of all available evidence on the accuracy of SNP-based pathogenicity detection tools compared to published clinical result for the prediction of in nsSNPs that leads to disease using prediction performance method. A comprehensive search was performed to find all mutations related to CNS. Database searches included dbSNP, SNPdbe, HGMD, Swissvar, ensemble, and OMIM. All the mutation related to CNS was extracted. The pathogenicity prediction was done using SNP-based pathogenicity detection tools include SIFT, PHD-SNP, PolyPhen2, fathmm, Provean, and Mutpred. Overall, 59 different SNPs related to missense mutations in the UGT1A1 gene, were reviewed. Comparing the diagnostic OR, PolyPhen2 and Mutpred have the highest detection 4.983 (95% CI: 1.24 - 20.02) in both, following by SIFT (diagnostic OR: 3.25, 95% CI: 1.07 - 9.83). The highest MCC of SNP-based pathogenicity detection tools, was belong to SIFT (34.19%) followed by Provean, PolyPhen2, and Mutpred (29.99%, 29.89%, and 29.89%, respectively). Hence the highest SNP-based pathogenicity detection tools ACC, was fit to SIFT (62.71%) followed by PolyPhen2, and Mutpred (61.02%, in both). Our results suggest that some of the well-established SNP-based pathogenicity detection tools can appropriately reflect the role of a disease-associated SNP in both local and global structures.

Microbial Quality, Safety, and Pathogen Detection by Using Quantitative PCR of Raw Salad Vegetables Sold in Dhanbad City, India.

Science.gov (United States)

Mritunjay, Sujeet K; Kumar, Vipin

2017-01-01

Consumption of ready-to-eat fresh vegetables has increased worldwide, with a consequent increase in outbreaks caused by foodborne pathogens. In the Indian subcontinent, raw fresh vegetables are usually consumed without washing or other decontamination procedures, thereby leading to new food safety threats. In this study, the microbiological quality and pathogenic profile of raw salad vegetables was evaluated through standard protocols. In total, 480 samples (60 each of eight different salad vegetables) of cucumber, tomato, carrot, coriander, cabbage, beetroot, radish, and spinach were collected from different locations in Dhanbad, a city famous for its coal fields and often called the "Coal Capital of India." The samples were analyzed for total plate count, total coliforms, Escherichia coli , E. coli O157:H7, Listeria monocytogenes , and Salmonella spp. Incidences of pathogens were detected through quantitative PCR subsequent to isolation. Results showed that 46.7% (for total plate counts) and 30% (for total coliforms) of samples were unacceptable for consumption per the Food Safety and Standards Authority of India. Pathogenic microorganisms were detected in 3.7% of total samples. E. coli O157:H7 was detected in three samples of spinach (2) and beetroot ( 1 ); L. monocytogenes was detected in 14 samples of spinach ( 8 ), tomato ( 3 ), cucumber ( 2 ), and radish ( 1 ); and Salmonella spp. were detected in 16 samples of spinach ( 7 ), tomato ( 3 ), beetroot ( 2 ), cucumber ( 2 ), carrot ( 1 ), and radish ( 1 ). Pathogens were not detected in any of the cabbage and coriander samples.

Matrix approach to the simultaneous detection of multiple potato pathogens by real-time PCR.

Science.gov (United States)

Nikitin, M M; Statsyuk, N V; Frantsuzov, P A; Dzhavakhiya, V G; Golikov, A G

2018-03-01

Create a method for highly sensitive, selective, rapid and easy-to-use detection and identification of economically significant potato pathogens, including viruses, bacteria and oomycetes, be it single pathogen, or a range of various pathogens occurring simultaneously. Test-systems for real-time PCR, operating in the unified amplification regime, have been developed for Phytophthora infestans, Pectobacterium atrosepticum, Dickeya dianthicola, Dickeya solani, Ralstonia solanacearum, Pectobacterium carotovorum, Clavibacter michiganensis subsp. sepedonicus, potato viruses Y (ordinary and necrotic forms as well as indiscriminative test system, detecting all forms), A, X, S, M, potato leaf roll virus, potato mop top virus and potato spindle tuber viroid. The test-systems (including polymerase and revertase) were immobilized and lyophilized in miniature microreactors (1·2 μl) on silicon DNA/RNA microarrays (micromatrices) to be used with a mobile AriaDNA ® amplifier. Preloaded 30-reaction micromatrices having shelf life of 3 and 6 months (for RNA- and DNA-based pathogens, respectively) at room temperature with no special conditions were successfully tested on both reference and field samples in comparison with traditional ELISA and microbiological methods, showing perfect performance and sensitivity (1 pg). The accurate, rapid and user-friendly diagnostic system in a micromatrix format may significantly contribute to pathogen screening and phytopathological studies. © 2018 The Authors. Journal of Applied Microbiology published by John Wiley & Sons Ltd on behalf of The Society for Applied Microbiology.

GPS/DR Error Estimation for Autonomous Vehicle Localization.

Science.gov (United States)

Lee, Byung-Hyun; Song, Jong-Hwa; Im, Jun-Hyuck; Im, Sung-Hyuck; Heo, Moon-Beom; Jee, Gyu-In

2015-08-21

Autonomous vehicles require highly reliable navigation capabilities. For example, a lane-following method cannot be applied in an intersection without lanes, and since typical lane detection is performed using a straight-line model, errors can occur when the lateral distance is estimated in curved sections due to a model mismatch. Therefore, this paper proposes a localization method that uses GPS/DR error estimation based on a lane detection method with curved lane models, stop line detection, and curve matching in order to improve the performance during waypoint following procedures. The advantage of using the proposed method is that position information can be provided for autonomous driving through intersections, in sections with sharp curves, and in curved sections following a straight section. The proposed method was applied in autonomous vehicles at an experimental site to evaluate its performance, and the results indicate that the positioning achieved accuracy at the sub-meter level.

Bacterial and viral pathogens detected in sea turtles stranded along the coast of Tuscany, Italy.

Science.gov (United States)

Fichi, G; Cardeti, G; Cersini, A; Mancusi, C; Guarducci, M; Di Guardo, G; Terracciano, G

2016-03-15

During 2014, six loggerhead turtles, Caretta caretta and one green turtle, Chelonia mydas, found stranded on the Tuscany coast of Italy, were examined for the presence of specific bacterial and viral agents, along with their role as carriers of fish and human pathogens. Thirteen different species of bacteria, 10 Gram negative and 3 Gram positive, were identified. Among them, two strains of Vibrio parahaemolyticus and one strain of Lactococcus garviae were recovered and confirmed by specific PCR protocols. No trh and tdh genes were detected in V. parahaemolyticus. The first isolation of L. garviae and the first detection of Betanodavirus in sea turtles indicate the possibility for sea turtles to act as carriers of fish pathogens. Furthermore, the isolation of two strains of V. parahaemolyticus highlights the possible role of these animals in human pathogens' diffusion. Copyright © 2016 Elsevier B.V. All rights reserved.

Recent Advances in Molecular Technologies and Their Application in Pathogen Detection in Foods with Particular Reference to Yersinia

Directory of Open Access Journals (Sweden)

Jin Gui

2011-01-01

Full Text Available Yersinia enterocolitica is an important zoonotic pathogen that can cause yersiniosis in humans and animals. Food has been suggested to be the main source of yersiniosis. It is critical for the researchers to be able to detect Yersinia or any other foodborne pathogen with increased sensitivity and specificity, as well as in real-time, in the case of a foodborne disease outbreak. Conventional detection methods are known to be labor intensive, time consuming, or expensive. On the other hand, more sensitive molecular-based detection methods like next generation sequencing, microarray, and many others are capable of providing faster results. DNA testing is now possible on a single molecule, and high-throughput analysis allows multiple detection reactions to be performed at once, thus allowing a range of characteristics to be rapidly and simultaneously determined. Despite better detection efficiencies, results derived using molecular biology methods can be affected by the various food matrixes. With the improvements in sample preparation, data analysis, and testing procedures, molecular detection techniques will likely continue to simplify and increase the speed of detection while simultaneously improving the sensitivity and specificity for tracking pathogens in food matrices.

Detection of pneumonia associated pathogens using a prototype multiplexed pneumonia test in hospitalized patients with severe pneumonia.

Directory of Open Access Journals (Sweden)

Berit Schulte

Full Text Available Severe pneumonia remains an important cause of morbidity and mortality. Polymerase chain reaction (PCR has been shown to be more sensitive than current standard microbiological methods--particularly in patients with prior antibiotic treatment--and therefore, may improve the accuracy of microbiological diagnosis for hospitalized patients with pneumonia. Conventional detection techniques and multiplex PCR for 14 typical bacterial pneumonia-associated pathogens were performed on respiratory samples collected from adult hospitalized patients enrolled in a prospective multi-center study. Patients were enrolled from March until September 2012. A total of 739 fresh, native samples were eligible for analysis, of which 75 were sputa, 421 aspirates, and 234 bronchial lavages. 276 pathogens were detected by microbiology for which a valid PCR result was generated (positive or negative detection result by Curetis prototype system. Among these, 120 were identified by the prototype assay, 50 pathogens were not detected. Overall performance of the prototype for pathogen identification was 70.6% sensitivity (95% confidence interval (CI lower bound: 63.3%, upper bound: 76.9% and 95.2% specificity (95% CI lower bound: 94.6%, upper bound: 95.7%. Based on the study results, device cut-off settings were adjusted for future series production. The overall performance with the settings of the CE series production devices was 78.7% sensitivity (95% CI lower bound: 72.1% and 96.6% specificity (95% CI lower bound: 96.1%. Time to result was 5.2 hours (median for the prototype test and 43.5 h for standard-of-care. The Pneumonia Application provides a rapid and moderately sensitive assay for the detection of pneumonia-causing pathogens with minimal hands-on time.Deutsches Register Klinischer Studien (DRKS DRKS00005684.

Multiplexed lateral flow microarray assay for detection of citrus pathogens Xylella fastidiosa and Xanthomonas axonopodis pv citri

Energy Technology Data Exchange (ETDEWEB)

Cary,; Bruce, R [Santa Fe, NM; Stubben, Christopher J [Los Alamos, NM

2011-03-22

The invention provides highly sensitive and specific assays for the major citrus pathogens Xylella fastidiosa and Xanthomonas axonopodis, including a field deployable multiplexed assay capable of rapidly assaying for both pathogens simultaneously. The assays are directed at particular gene targets derived from pathogenic strains that specifically cause the major citrus diseases of citrus variegated chlorosis (Xylella fastidiosa 9a5c) and citrus canker (Xanthomonas axonopodis pv citri). The citrus pathogen assays of the invention offer femtomole sensitivity, excellent linear dynamic range, and rapid and specific detection.

GPS/DR Error Estimation for Autonomous Vehicle Localization

Directory of Open Access Journals (Sweden)

Byung-Hyun Lee

2015-08-01

Full Text Available Autonomous vehicles require highly reliable navigation capabilities. For example, a lane-following method cannot be applied in an intersection without lanes, and since typical lane detection is performed using a straight-line model, errors can occur when the lateral distance is estimated in curved sections due to a model mismatch. Therefore, this paper proposes a localization method that uses GPS/DR error estimation based on a lane detection method with curved lane models, stop line detection, and curve matching in order to improve the performance during waypoint following procedures. The advantage of using the proposed method is that position information can be provided for autonomous driving through intersections, in sections with sharp curves, and in curved sections following a straight section. The proposed method was applied in autonomous vehicles at an experimental site to evaluate its performance, and the results indicate that the positioning achieved accuracy at the sub-meter level.

A PDMS/paper/glass hybrid microfluidic biochip integrated with aptamer-functionalized graphene oxide nano-biosensors for one-step multiplexed pathogen detection

OpenAIRE

Zuo, Peng; Li, XiuJun; Dominguez, Delfina C.; Ye, Bang-Ce

2013-01-01

Infectious pathogens often cause serious public health concerns throughout the world. There is an increasing demand for simple, rapid and sensitive approaches for multiplexed pathogen detection. In this paper we have developed a polydimethylsiloxane (PDMS)/paper/glass hybrid microfluidic system integrated with aptamer-functionalized graphene oxide (GO) nano-biosensors for simple, one-step, multiplexed pathogen detection. The paper substrate used in this hybrid microfluidic system facilitated ...

Detection of hepatitis E virus and other livestock-related pathogens in Iowa streams

Science.gov (United States)

Givens, Carrie E.; Kolpin, Dana W.; Borchardt, Mark A.; Duris, Joseph W.; Moorman, Thomas B.; Spencer, Susan K.

2016-01-01

Manure application is a source of pathogens to the environment. Through overland runoff and tile drainage, zoonotic pathogens can contaminate surface water and streambed sediment and could affect both wildlife and human health. This study examined the environmental occurrence of gene markers for livestock-related bacterial, protozoan, and viral pathogens and antibiotic resistance in surface waters within the South Fork Iowa River basin before and after periods of swine manure application on agricultural land. Increased concentrations of indicator bacteria after manure application exceeding Iowa's state bacteria water quality standards suggest that swine manure contributes to diminished water quality and may pose a risk to human health. Additionally, the occurrence of HEV and numerous bacterial pathogen genes for Escherichia coli, Enterococcus spp., Salmonella sp., and Staphylococcus aureus in both manure samples and in corresponding surface water following periods of manure application suggests a potential role for swine in the spreading of zoonotic pathogens to the surrounding environment. During this study, several zoonotic pathogens were detected including Shiga-toxin producing E. coli, Campylobacter jejuni, pathogenic enterococci, and S. aureus; all of which can pose mild to serious health risks to swine, humans, and other wildlife. This research provides the foundational understanding required for future assessment of the risk to environmental health from livestock-related zoonotic pathogen exposures in this region. This information could also be important for maintaining swine herd biosecurity and protecting the health of wildlife near swine facilities.

Comparison between nasopharyngeal swab and nasal wash, using culture and PCR, in the detection of potential respiratory pathogens

Directory of Open Access Journals (Sweden)

El Batrawy Sherouk

2011-04-01

Full Text Available Abstract Background Nasopharyngeal carriage of potential pathogens is important as it is both the major source of transmission and the prerequisite of invasive disease. New methods for detecting carriage could improve comfort, accuracy and laboratory utility. The aims of this study were to compare the sensitivities of a nasopharyngeal swab (NPS and a nasal wash (NW in detecting potential respiratory pathogens in healthy adults using microbiological culture and PCR. Results Healthy volunteers attended for nasal washing and brushing of the posterior nasopharynx. Conventional and real-time PCR were used to detect pneumococcus and meningococcus. Statistical differences between the two nasal sampling methods were determined using a nonparametric Mann-Whitney U test; differences between culture and PCR methods were determined using the McNemar test. Nasal washing was more comfortable for volunteers than swabbing (n = 24. In detection by culture, the NW was significantly more likely to detect pathogens than the NPS (p Conclusions Nasal washing and PCR may provide effective alternatives to nasopharyngeal swabbing and classical microbiology, respectively.

FISHing for bacteria in food--a promising tool for the reliable detection of pathogenic bacteria?

Science.gov (United States)

Rohde, Alexander; Hammerl, Jens Andre; Appel, Bernd; Dieckmann, Ralf; Al Dahouk, Sascha

2015-04-01

Foodborne pathogens cause millions of infections every year and are responsible for considerable economic losses worldwide. The current gold standard for the detection of bacterial pathogens in food is still the conventional cultivation following standardized and generally accepted protocols. However, these methods are time-consuming and do not provide fast information about food contaminations and thus are limited in their ability to protect consumers in time from potential microbial hazards. Fluorescence in situ hybridization (FISH) represents a rapid and highly specific technique for whole-cell detection. This review aims to summarize the current data on FISH-testing for the detection of pathogenic bacteria in different food matrices and to evaluate its suitability for the implementation in routine testing. In this context, the use of FISH in different matrices and their pretreatment will be presented, the sensitivity and specificity of FISH tests will be considered and the need for automation shall be discussed as well as the use of technological improvements to overcome current hurdles for a broad application in monitoring food safety. In addition, the overall economical feasibility will be assessed in a rough calculation of costs, and strengths and weaknesses of FISH are considered in comparison with traditional and well-established detection methods. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

A quantum-dot-based fluoroassay for detection of food-borne pathogens.

Science.gov (United States)

Mohamadi, Elaheh; Moghaddasi, Mohammadali; Farahbakhsh, Afshin; Kazemi, Abbass

2017-09-01

Evaluation of the distribution capability of food-borne pathogens existing in food products by taking the advantage of quantum dots (QDs) for their photoluminescence properties was carried out. Bacteria namely Escherichia coli (E. coli) labelled with CdSe-QDs were examined both on an Agar nutrient and ground fish substrates in order to observe their growth rate in different environments in the Lab. A sample with an appropriate concentration ratio 10 7 CFU/mL of bacteria/CdSe-QDs was empirically selected from the samples which were grown on the Agar containing plates. The selected sample was also tested on a ground fish substrate as a real food sample. The bacterial growth was observed under the irradiation of UV light and the growth patterns were investigated for 3 successive days. The growth patterns indicated that E. coli can stay alive and can be distributed on food products so that the growth can be easily monitored. This approach makes bacterial growth on food products detectable so that it can be used as a bacteria-QD assay for an easy detection of food borne pathogens grown on a food sample. Copyright © 2017 Elsevier B.V. All rights reserved.

Validation of Metagenomic Next-Generation Sequencing Tests for Universal Pathogen Detection.

Science.gov (United States)

Schlaberg, Robert; Chiu, Charles Y; Miller, Steve; Procop, Gary W; Weinstock, George

2017-06-01

- Metagenomic sequencing can be used for detection of any pathogens using unbiased, shotgun next-generation sequencing (NGS), without the need for sequence-specific amplification. Proof-of-concept has been demonstrated in infectious disease outbreaks of unknown causes and in patients with suspected infections but negative results for conventional tests. Metagenomic NGS tests hold great promise to improve infectious disease diagnostics, especially in immunocompromised and critically ill patients. - To discuss challenges and provide example solutions for validating metagenomic pathogen detection tests in clinical laboratories. A summary of current regulatory requirements, largely based on prior guidance for NGS testing in constitutional genetics and oncology, is provided. - Examples from 2 separate validation studies are provided for steps from assay design, and validation of wet bench and bioinformatics protocols, to quality control and assurance. - Although laboratory and data analysis workflows are still complex, metagenomic NGS tests for infectious diseases are increasingly being validated in clinical laboratories. Many parallels exist to NGS tests in other fields. Nevertheless, specimen preparation, rapidly evolving data analysis algorithms, and incomplete reference sequence databases are idiosyncratic to the field of microbiology and often overlooked.

Autonomous Science Analysis with the New Millennium Program-Autonomous Sciencecraft Experiment

Science.gov (United States)

Doggett, T.; Davies, A. G.; Castano, R. A.; Baker, V. R.; Dohm, J. M.; Greeley, R.; Williams, K. K.; Chien, S.; Sherwood, R.

2002-12-01

The NASA New Millennium Program (NMP) is a testbed for new, high-risk technologies, including new software and hardware. The Autonomous Sciencecraft Experiment (ASE) will fly on the Air Force Research Laboratory TechSat-21 mission in 2006 is such a NMP mission, and is managed by the Jet Propulsion Laboratory, California Institute of Technology. TechSat-21 consists of three satellites, each equipped with X-band Synthetic Aperture Radar (SAR) that will occupy a 13-day repeat track Earth orbit. The main science objectives of ASE are to demonstrate that process-related change detection and feature identification can be conducted autonomously during space flight, leading to autonomous onboard retargeting of the spacecraft. This mission will observe transient geological and environmental processes using SAR. Examples of geologic processes that may be observed and investigated include active volcanism, the movement of sand dunes and transient features in desert environments, water flooding, and the formation and break-up of lake ice. Science software onboard the spacecraft will allow autonomous processing and formation of SAR images and extraction of scientific information. The subsequent analyses, performed on images formed onboard from the SAR data, will include feature identification using scalable feature "templates" for each target, change detection through comparison of current and archived images, and science discovery, a search for other features of interest in each image. This approach results in obtaining the same science return for a reduced amount of resource use (such as downlink) when compared to that from a mission operating without ASE technology. Redundant data is discarded. The science-driven goals of ASE will evolve during the ASE mission through onboard replanning software that can re-task satellite operations. If necessary, as a result of a discovery made autonomously by onboard science processing, existing observation sequences will be pre-empted to

A Rapid and Simple Real-Time PCR Assay for Detecting Foodborne Pathogenic Bacteria in Human Feces.

Science.gov (United States)

Hanabara, Yutaro; Ueda, Yutaka

2016-11-22

A rapid, simple method for detecting foodborne pathogenic bacteria in human feces is greatly needed. Here, we examined the efficacy of a method that employs a combination of a commercial PCR master mix, which is insensitive to PCR inhibitors, and a DNA extraction method which used sodium dodecyl benzene sulfonate (SDBS), and Tween 20 to counteract the inhibitory effects of SDBS on the PCR assay. This method could detect the target genes (stx1 and stx2 of enterohemorrhagic Escherichia coli, invA of Salmonella Enteritidis, tdh of Vibrio parahaemolyticus, gyrA of Campylobacter jejuni, ceuE of Campylobacter coli, SEA of Staphylococcus aureus, ces of Bacillus cereus, and cpe of Clostridium perfringens) in a fecal suspension containing 1.0 × 10 1 to 1.0 × 10 3 CFU/ml. Furthermore, the assay was neither inhibited nor influenced by individual differences among the fecal samples of 10 subjects or fecal concentration (40-160 mg/ml in the fecal suspension). When we attempted to detect the genes of pathogenic bacteria in 4 actual clinical cases, we found that this method was more sensitive than standard culture method. These results showed that this assay is a rapid, simple detection method for foodborne pathogenic bacteria in human feces.

Exploration of Simple Analytical Approaches for Rapid Detection of Pathogenic Bacteria

Energy Technology Data Exchange (ETDEWEB)

Rahman, Salma [Iowa State Univ., Ames, IA (United States)

2005-01-01

Many of the current methods for pathogenic bacterial detection require long sample-preparation and analysis time, as well as complex instrumentation. This dissertation explores simple analytical approaches (e.g., flow cytometry and diffuse reflectance spectroscopy) that may be applied towards ideal requirements of a microbial detection system, through method and instrumentation development, and by the creation and characterization of immunosensing platforms. This dissertation is organized into six sections. In the general Introduction section a literature review on several of the key aspects of this work is presented. First, different approaches for detection of pathogenic bacteria will be reviewed, with a comparison of the relative strengths and weaknesses of each approach, A general overview regarding diffuse reflectance spectroscopy is then presented. Next, the structure and function of self-assembled monolayers (SAMs) formed from organosulfur molecules at gold and micrometer and sub-micrometer patterning of biomolecules using SAMs will be discussed. This section is followed by four research chapters, presented as separate manuscripts. Chapter 1 describes the efforts and challenges towards the creation of imunosensing platforms that exploit the flexibility and structural stability of SAMs of thiols at gold. 1H, 1H, 2H, 2H-perfluorodecyl-1-thiol SAM (PFDT) and dithio-bis(succinimidyl propionate)-(DSP)-derived SAMs were used to construct the platform. Chapter 2 describes the characterization of the PFDT- and DSP-derived SAMs, and the architectures formed when it is coupled to antibodies as well as target bacteria. These studies used infrared reflection spectroscopy (IRS), X-ray photoelectron spectroscopy (XPS), and electrochemical quartz crystal microbalance (EQCM), Chapter 3 presents a new sensitive, and portable diffuse reflection based technique for the rapid identification and quantification of pathogenic bacteria. Chapter 4 reports research efforts in the

A Plant Immune Receptor Detects Pathogen Effectors that Target WRKY Transcription Factors.

Science.gov (United States)

Sarris, Panagiotis F; Duxbury, Zane; Huh, Sung Un; Ma, Yan; Segonzac, Cécile; Sklenar, Jan; Derbyshire, Paul; Cevik, Volkan; Rallapalli, Ghanasyam; Saucet, Simon B; Wirthmueller, Lennart; Menke, Frank L H; Sohn, Kee Hoon; Jones, Jonathan D G

2015-05-21

Defense against pathogens in multicellular eukaryotes depends on intracellular immune receptors, yet surveillance by these receptors is poorly understood. Several plant nucleotide-binding, leucine-rich repeat (NB-LRR) immune receptors carry fusions with other protein domains. The Arabidopsis RRS1-R NB-LRR protein carries a C-terminal WRKY DNA binding domain and forms a receptor complex with RPS4, another NB-LRR protein. This complex detects the bacterial effectors AvrRps4 or PopP2 and then activates defense. Both bacterial proteins interact with the RRS1 WRKY domain, and PopP2 acetylates lysines to block DNA binding. PopP2 and AvrRps4 interact with other WRKY domain-containing proteins, suggesting these effectors interfere with WRKY transcription factor-dependent defense, and RPS4/RRS1 has integrated a "decoy" domain that enables detection of effectors that target WRKY proteins. We propose that NB-LRR receptor pairs, one member of which carries an additional protein domain, enable perception of pathogen effectors whose function is to target that domain. Copyright © 2015 Elsevier Inc. All rights reserved.

Graphene-interfaced electrical biosensor for label-free and sensitive detection of foodborne pathogenic E. coli O157:H7.

Science.gov (United States)

Pandey, Ashish; Gurbuz, Yasar; Ozguz, Volkan; Niazi, Javed H; Qureshi, Anjum

2017-05-15

E. coli O157:H7 is an enterohemorrhagic bacteria responsible for serious foodborne outbreaks that causes diarrhoea, fever and vomiting in humans. Recent foodborne E. coli outbreaks has left a serious concern to public health. Therefore, there is an increasing demand for a simple, rapid and sensitive method for pathogen detection in contaminated foods. In this study, we developed a label-free electrical biosensor interfaced with graphene for sensitive detection of pathogenic bacteria. This biosensor was fabricated by interfacing graphene with interdigitated microelectrodes of capacitors that were biofunctionalized with E. coli O157:H7 specific antibodies for sensitive pathogenic bacteria detection. Here, graphene nanostructures on the sensor surface provided superior chemical properties such as high carrier mobility and biocompatibility with antibodies and bacteria. The sensors transduced the signal based on changes in dielectric properties (capacitance) through (i) polarization of captured cell-surface charges, (ii) cells' internal bioactivity, (iii) cell-wall's electronegativity or dipole moment and their relaxation and (iv) charge carrier mobility of graphene that modulated the electrical properties once the pathogenic E. coli O157:H7 captured on the sensor surface. Sensitive capacitance changes thus observed with graphene based capacitors were specific to E. coli O157:H7 strain with a sensitivity as low as 10-100 cells/ml. The proposed graphene based electrical biosensor provided advantages of speed, sensitivity, specificity and in-situ bacterial detection with no chemical mediators, represents a versatile approach for detection of a wide variety of other pathogens. Copyright © 2016 Elsevier B.V. All rights reserved.

A Path Tracking Algorithm Using Future Prediction Control with Spike Detection for an Autonomous Vehicle Robot

Directory of Open Access Journals (Sweden)

Muhammad Aizzat Zakaria

2013-08-01

Full Text Available Trajectory tracking is an important aspect of autonomous vehicles. The idea behind trajectory tracking is the ability of the vehicle to follow a predefined path with zero steady state error. The difficulty arises due to the nonlinearity of vehicle dynamics. Therefore, this paper proposes a stable tracking control for an autonomous vehicle. An approach that consists of steering wheel control and lateral control is introduced. This control algorithm is used for a non-holonomic navigation problem, namely tracking a reference trajectory in a closed loop form. A proposed future prediction point control algorithm is used to calculate the vehicle's lateral error in order to improve the performance of the trajectory tracking. A feedback sensor signal from the steering wheel angle and yaw rate sensor is used as feedback information for the controller. The controller consists of a relationship between the future point lateral error, the linear velocity, the heading error and the reference yaw rate. This paper also introduces a spike detection algorithm to track the spike error that occurs during GPS reading. The proposed idea is to take the advantage of the derivative of the steering rate. This paper aims to tackle the lateral error problem by applying the steering control law to the vehicle, and proposes a new path tracking control method by considering the future coordinate of the vehicle and the future estimated lateral error. The effectiveness of the proposed controller is demonstrated by a simulation and a GPS experiment with noisy data. The approach used in this paper is not limited to autonomous vehicles alone since the concept of autonomous vehicle tracking can be used in mobile robot platforms, as the kinematic model of these two platforms is similar.

Humic substances interfere with detection of pathogenic prion protein

Science.gov (United States)

Smith, Christen B.; Booth, Clarissa J.; Wadzinski, Tyler J.; Legname, Giuseppe; Chappell, Rick; Johnson, Christopher J.; Pedersen, Joel A.

2014-01-01

Studies examining the persistence of prions (the etiological agent of transmissible spongiform encephalopathies) in soil require accurate quantification of pathogenic prion protein (PrPTSE) extracted from or in the presence of soil particles. Here, we demonstrate that natural organic matter (NOM) in soil impacts PrPTSE detection by immunoblotting. Methods commonly used to extract PrPTSE from soils release substantial amounts of NOM, and NOM inhibited PrPTSE immunoblot signal. The degree of immunoblot interference increased with increasing NOM concentration and decreasing NOM polarity. Humic substances affected immunoblot detection of prion protein from both deer and hamsters. We also establish that after interaction with humic acid, PrPTSE remains infectious to hamsters inoculated intracerebrally, and humic acid appeared to slow disease progression. These results provide evidence for interactions between PrPTSE and humic substances that influence both accurate measurement of PrPTSE in soil and disease transmission.

Multiplex TaqMan® detection of pathogenic and multi-drug resistant Salmonella.

Science.gov (United States)

Singh, Prashant; Mustapha, Azlin

2013-09-02

Overuse of antibiotics in the medical and animal industries is one of the major causes for the development of multi-drug-resistant (MDR) food pathogens that are often difficult to treat. In the past few years, higher incidences of outbreaks caused by MDR Salmonella have been increasingly documented. The objective of this study was to develop a rapid multiplex real-time polymerase chain reaction (PCR) assay for simultaneous detection of pathogenic and MDR Salmonella spp. A multiplex TaqMan®real-time PCR was designed by targeting the invasin virulence gene (invA), and four commonly found antibiotic resistance genes, viz. ampicillin, chloramphenicol, streptomycin and tetracycline. To avoid false negative results and to increase the reliability of the assay, an internal amplification control (IAC) was added which was detected using a locked nucleic acid (LNA) probe. In serially diluted (5 ng-50 fg) DNA samples, the assay was able to detect 100 genomic equivalents of Salmonella, while in a multiplex format, the sensitivity was 1000 genomic equivalents. The assay performed equally well on artificially contaminated samples of beef trim, ground beef of different fat contents (73:27, 80:20, 85:15 and 93:7), chicken rinse, ground chicken, ground turkey, egg, spinach and tomato. While the detection limit for un-enriched inoculated food samples was 10(4) CFU/g, this was improved to 10 CFU/g after a 12-h enrichment in buffered peptone water, with 100% reproducibility. The multiplex real-time assay developed in this study can be used as a valuable tool to detect MDR virulent Salmonella, thus enhancing the safety of food. © 2013.

Detection of human bacterial pathogens in ticks collected from Louisiana black bears (Ursus americanus luteolus).

Science.gov (United States)

Leydet, Brian F; Liang, Fang-Ting

2013-04-01

There are 4 major human-biting tick species in the northeastern United States, which include: Amblyomma americanum, Amblyomma maculatum, Dermacentor variabilis, and Ixodes scapularis. The black bear is a large mammal that has been shown to be parasitized by all the aforementioned ticks. We investigated the bacterial infections in ticks collected from Louisiana black bears (Ursus americanus subspecies luteolus). Eighty-six ticks were collected from 17 black bears in Louisiana from June 2010 to March 2011. All 4 common human-biting tick species were represented. Each tick was subjected to polymerase chain reaction (PCR) targeting select bacterial pathogens and symbionts. Bacterial DNA was detected in 62% of ticks (n=53). Rickettsia parkeri, the causative agent of an emerging spotted fever group rickettsiosis, was identified in 66% of A. maculatum, 28% of D. variabilis, and 11% of I. scapularis. The Lyme disease bacterium, Borrelia burgdorferi, was detected in 2 I. scapularis, while one A. americanum was positive for Borrelia bissettii, a putative human pathogen. The rickettsial endosymbionts Candidatus Rickettsia andeanae, rickettsial endosymbiont of I. scapularis, and Rickettsia amblyommii were detected in their common tick hosts at 21%, 39%, and 60%, respectively. All ticks were PCR-negative for Anaplasma phagocytophilum, Ehrlichia spp., and Babesia microti. This is the first reported detection of R. parkeri in vector ticks in Louisiana; we also report the novel association of R. parkeri with I. scapularis. Detection of both R. parkeri and B. burgdorferi in their respective vectors in Louisiana demands further investigation to determine potential for human exposure to these pathogens. Copyright © 2013 Elsevier GmbH. All rights reserved.

Direct colorimetric detection of unamplified pathogen DNA by dextrin-capped gold nanoparticles.

Science.gov (United States)

Baetsen-Young, Amy M; Vasher, Matthew; Matta, Leann L; Colgan, Phil; Alocilja, Evangelyn C; Day, Brad

2018-03-15

The interaction between gold nanoparticles (AuNPs) and nucleic acids has facilitated a variety of diagnostic applications, with further diversification of synthesis match bio-applications while reducing biotoxicity. However, DNA interactions with unique surface capping agents have not been fully defined. Using dextrin-capped AuNPs (d-AuNPs), we have developed a novel unamplified genomic DNA (gDNA) nanosensor, exploiting dispersion and aggregation characteristics of d-AuNPs, in the presence of gDNA, for sequence-specific detection. We demonstrate that d-AuNPs are stable in a five-fold greater salt concentration than citrate-capped AuNPs and the d-AuNPs were stabilized by single stranded DNA probe (ssDNAp). However, in the elevated salt concentrations of the DNA detection assay, the target reactions were surprisingly further stabilized by the formation of a ssDNAp-target gDNA complex. The results presented herein lead us to propose a mechanism whereby genomic ssDNA secondary structure formation during ssDNAp-to-target gDNA binding enables d-AuNP stabilization in elevated ionic environments. Using the assay described herein, we were successful in detecting as little as 2.94 fM of pathogen DNA, and using crude extractions of a pathogen matrix, as few as 18 spores/µL. Copyright © 2017 Elsevier B.V. All rights reserved.

Gas House Autonomous System Monitoring

Science.gov (United States)

Miller, Luke; Edsall, Ashley

2015-01-01

Gas House Autonomous System Monitoring (GHASM) will employ Integrated System Health Monitoring (ISHM) of cryogenic fluids in the High Pressure Gas Facility at Stennis Space Center. The preliminary focus of development incorporates the passive monitoring and eventual commanding of the Nitrogen System. ISHM offers generic system awareness, adept at using concepts rather than specific error cases. As an enabler for autonomy, ISHM provides capabilities inclusive of anomaly detection, diagnosis, and abnormality prediction. Advancing ISHM and Autonomous Operation functional capabilities enhances quality of data, optimizes safety, improves cost effectiveness, and has direct benefits to a wide spectrum of aerospace applications.

Advancing Autonomous Operations for Deep Space Vehicles

Science.gov (United States)

Haddock, Angie T.; Stetson, Howard K.

2014-01-01

Starting in Jan 2012, the Advanced Exploration Systems (AES) Autonomous Mission Operations (AMO) Project began to investigate the ability to create and execute "single button" crew initiated autonomous activities [1]. NASA Marshall Space Flight Center (MSFC) designed and built a fluid transfer hardware test-bed to use as a sub-system target for the investigations of intelligent procedures that would command and control a fluid transfer test-bed, would perform self-monitoring during fluid transfers, detect anomalies and faults, isolate the fault and recover the procedures function that was being executed, all without operator intervention. In addition to the development of intelligent procedures, the team is also exploring various methods for autonomous activity execution where a planned timeline of activities are executed autonomously and also the initial analysis of crew procedure development. This paper will detail the development of intelligent procedures for the NASA MSFC Autonomous Fluid Transfer System (AFTS) as well as the autonomous plan execution capabilities being investigated. Manned deep space missions, with extreme communication delays with Earth based assets, presents significant challenges for what the on-board procedure content will encompass as well as the planned execution of the procedures.

[Detection of biofilm formation by selected pathogens relevant to the food industry].

Science.gov (United States)

Šilhová-Hrušková, L; Moťková, P; Šilha, D; Vytřasová, J

2015-09-01

Detection of biofilm formation by microbial pathogens relevant to the food industry and comparison of biofilm formation under different conditions of culture. The following microorganisms were selected for the study: Staphylococcus aureus, Listeria innocua, Listeria ivanovii, Cronobacter sakazakii, Cronobacter muytjensii, Arcobacter butzleri, Arcobacter cryaerophilus, Campylobacter jejuni, and Campylobacter coli. To detect biofilm formation the microtiter plate assay, as described by Christensen and culture on stainless steel coupons were used. The biofilm forming capacity was confirmed in all microorganisms tested, both on the microtiter plates and stainless steel coupons. Biofilm formation was influenced by the culture medium, material used, and culture duration as well as by the test microorganism. It was found that different species and strains of the same genus differ in biofilm formation. Differences were also found between the collection strains and isolates from the environment. Some bacteria tended to form biofilm more readily on the surface of the polyethylene microtiter plates and less readily on stainless steel coupons while others appeared to have an opposite tendency. Some pathogens were able to increase the planktonic cell density in the initial suspension even by three orders of magnitude within 72 hours while producing plenty of biofilm. The study of biofilm formation by high risk pathogens is of utmost importance, not only to the food industry. From the obtained results, it is evident that bacterial biofilms form rapidly (within 24 hours in the present study). Due to their architecture, these biofilms are difficult to eradicate, and therefore, it is crucial to prevent biofilm formation.

Multifunctional Nanotechnology-Enabled Sensors for Rapid Capture and Detection of Pathogens.

Science.gov (United States)

Mustafa, Fatima; Hassan, Rabeay Y A; Andreescu, Silvana

2017-09-15

Nanomaterial-based sensing approaches that incorporate different types of nanoparticles (NPs) and nanostructures in conjunction with natural or synthetic receptors as molecular recognition elements provide opportunities for the design of sensitive and selective assays for rapid detection of contaminants. This review summarizes recent advancements over the past ten years in the development of nanotechnology-enabled sensors and systems for capture and detection of pathogens. The most common types of nanostructures and NPs, their modification with receptor molecules and integration to produce viable sensing systems with biorecognition, amplification and signal readout are discussed. Examples of all-in-one systems that combine multifunctional properties for capture, separation, inactivation and detection are also provided. Current trends in the development of low-cost instrumentation for rapid assessment of food contamination are discussed as well as challenges for practical implementation and directions for future research.

Compact autonomous navigation system (CANS)

Science.gov (United States)

Hao, Y. C.; Ying, L.; Xiong, K.; Cheng, H. Y.; Qiao, G. D.

2017-11-01

Autonomous navigation of Satellite and constellation has series of benefits, such as to reduce operation cost and ground station workload, to avoid the event of crises of war and natural disaster, to increase spacecraft autonomy, and so on. Autonomous navigation satellite is independent of ground station support. Many systems are developed for autonomous navigation of satellite in the past 20 years. Along them American MANS (Microcosm Autonomous Navigation System) [1] of Microcosm Inc. and ERADS [2] [3] (Earth Reference Attitude Determination System) of Honeywell Inc. are well known. The systems anticipate a series of good features of autonomous navigation and aim low cost, integrated structure, low power consumption and compact layout. The ERADS is an integrated small 3-axis attitude sensor system with low cost and small volume. It has the Earth center measurement accuracy higher than the common IR sensor because the detected ultraviolet radiation zone of the atmosphere has a brightness gradient larger than that of the IR zone. But the ERADS is still a complex system because it has to eliminate many problems such as making of the sapphire sphere lens, birefringence effect of sapphire, high precision image transfer optical fiber flattener, ultraviolet intensifier noise, and so on. The marginal sphere FOV of the sphere lens of the ERADS is used to star imaging that may be bring some disadvantages., i.e. , the image energy and attitude measurements accuracy may be reduced due to the tilt image acceptance end of the fiber flattener in the FOV. Besides Japan, Germany and Russia developed visible earth sensor for GEO [4] [5]. Do we have a way to develop a cheaper/easier and more accurate autonomous navigation system that can be used to all LEO spacecraft, especially, to LEO small and micro satellites? To return this problem we provide a new type of the system—CANS (Compact Autonomous Navigation System) [6].

Development of a multiplex PCR assay for rapid and simultaneous detection of four genera of fish pathogenic bacteria.

Science.gov (United States)

Zhang, D F; Zhang, Q Q; Li, A H

2014-11-01

Species of genus Aeromonas, Vibrio, Edwardsiella and Streptococcus are the most common fish pathogenic bacteria that cause economically devastating losses in aquaculture. A multiplex polymerase chain reaction (mPCR) was developed for the simultaneous detection and differentiation of the four genera of fish pathogenic bacteria. Through the use of genus-specific primers instead of species-specific ones, the current mPCR covered much more target bacterial species compared with previously reported species-specific mPCR methods. The specificity of the four putative genus-specific primers was validated experimentally while used exclusively (uniplex PCR) or combined (mPCR) against bacterial genomic DNA templates of the target bacteria and nontarget bacteria. The PCR amplicons for the following genera were obtained as expected: Aeromonas (875 bp), Vibrio (524 bp), Edwardsiella (302 bp) and Streptococcus (197 bp), and the fragments could be separated clearly on the agarose gel electrophoresis. The mPCR did not produce nonspecific amplification products when used to amplify 21 nontarget species of bacteria. The mPCR detection limits for each target bacterial genera were 50 colony-forming units (CFU) in pure culture and 100 CFU in fish tissue samples. In conclusion, the mPCR assay was proven to be a powerful alternative to the conventional culture-based method, given its rapid, specific, sensitive and reliable detection of target pathogens. The fish pathogenic bacteria of genus Aeromonas, Vibrio, Edwardsiella and Streptococcus frequently cause severe outbreaks of diseases in cultured fish, and the genus-specific multiplex PCR assay developed in this study can detect the bacteria of the four genera when present in the samples either alone or mixed. The mPCR assay is expected to identify the causative agents more efficiently than uniplex PCR or species-specific multiplex PCR for clinical diagnosis, resulting in the earlier implementation of control measures. This m

Evaluating surveillance strategies for the early detection of low pathogenicity avian influenza infections.

Science.gov (United States)

Comin, Arianna; Stegeman, Arjan; Marangon, Stefano; Klinkenberg, Don

2012-01-01

In recent years, the early detection of low pathogenicity avian influenza (LPAI) viruses in poultry has become increasingly important, given their potential to mutate into highly pathogenic viruses. However, evaluations of LPAI surveillance have mainly focused on prevalence and not on the ability to act as an early warning system. We used a simulation model based on data from Italian LPAI epidemics in turkeys to evaluate different surveillance strategies in terms of their performance as early warning systems. The strategies differed in terms of sample size, sampling frequency, diagnostic tests, and whether or not active surveillance (i.e., routine laboratory testing of farms) was performed, and were also tested under different epidemiological scenarios. We compared surveillance strategies by simulating within-farm outbreaks. The output measures were the proportion of infected farms that are detected and the farm reproduction number (R(h)). The first one provides an indication of the sensitivity of the surveillance system to detect within-farm infections, whereas R(h) reflects the effectiveness of outbreak detection (i.e., if detection occurs soon enough to bring an epidemic under control). Increasing the sampling frequency was the most effective means of improving the timeliness of detection (i.e., it occurs earlier), whereas increasing the sample size increased the likelihood of detection. Surveillance was only effective in preventing an epidemic if actions were taken within two days of sampling. The strategies were not affected by the quality of the diagnostic test, although performing both serological and virological assays increased the sensitivity of active surveillance. Early detection of LPAI outbreaks in turkeys can be achieved by increasing the sampling frequency for active surveillance, though very frequent sampling may not be sustainable in the long term. We suggest that, when no LPAI virus is circulating yet and there is a low risk of virus introduction

Evaluating surveillance strategies for the early detection of low pathogenicity avian influenza infections.

Directory of Open Access Journals (Sweden)

Arianna Comin

Full Text Available In recent years, the early detection of low pathogenicity avian influenza (LPAI viruses in poultry has become increasingly important, given their potential to mutate into highly pathogenic viruses. However, evaluations of LPAI surveillance have mainly focused on prevalence and not on the ability to act as an early warning system. We used a simulation model based on data from Italian LPAI epidemics in turkeys to evaluate different surveillance strategies in terms of their performance as early warning systems. The strategies differed in terms of sample size, sampling frequency, diagnostic tests, and whether or not active surveillance (i.e., routine laboratory testing of farms was performed, and were also tested under different epidemiological scenarios. We compared surveillance strategies by simulating within-farm outbreaks. The output measures were the proportion of infected farms that are detected and the farm reproduction number (R(h. The first one provides an indication of the sensitivity of the surveillance system to detect within-farm infections, whereas R(h reflects the effectiveness of outbreak detection (i.e., if detection occurs soon enough to bring an epidemic under control. Increasing the sampling frequency was the most effective means of improving the timeliness of detection (i.e., it occurs earlier, whereas increasing the sample size increased the likelihood of detection. Surveillance was only effective in preventing an epidemic if actions were taken within two days of sampling. The strategies were not affected by the quality of the diagnostic test, although performing both serological and virological assays increased the sensitivity of active surveillance. Early detection of LPAI outbreaks in turkeys can be achieved by increasing the sampling frequency for active surveillance, though very frequent sampling may not be sustainable in the long term. We suggest that, when no LPAI virus is circulating yet and there is a low risk of virus

Laser diagnostic technology for early detection of pathogen infestation in orange fruits

International Nuclear Information System (INIS)

Giubileo, Gianfranco; Lai, Antonella; Piccinelli, Delinda; Puiu, Adriana

2010-01-01

Due to an increased expectation of food products that respect high quality and safety standards, there is a need for the growth of accurate, fast, objective and non-destructive technologies for quality determination of food and agricultural products. For this purpose, a diagnostic system based on laser photoacoustic spectroscopy (LPAS) was developed at ENEA Frascati Molecular Spectroscopy Laboratory (Italy). In the design of the photoacoustic detector, particular emphasis was placed in attaining a high sensitivity in detecting ethylene (ET) down to sub-parts per billion level (minimum detectable concentration 0.2 ppb). This was required due to the necessity to monitor and follow up ET production at a single fruit scale. ET is normally synthesised in very low amounts by healthy citrus fruits; however stress conditions such as pathogen attack may induce a substantial increase in the synthesised ET. In the present paper, the comparison between the ET emitted by healthy oranges (Citrus sinensis L. Osbeck) cv Navel and by Phytophthora citrophthora infested Navel orange fruits are reported. The obtained results show a well evident increase in ET emission from the infested fruit with respect to the healthy one, even 24 h after the inoculation with the pathogen; at that time the tissue necrosis was not yet visible, and the fruit was also not yet damaged. The possibility to perform a real time non-destructive detection of ET traces makes the LPAS a powerful tool for monitoring the healthy state of the citrus fruits.

Laser diagnostic technology for early detection of pathogen infestation in orange fruits

Science.gov (United States)

Giubileo, Gianfranco; Lai, Antonella; Piccinelli, Delinda; Puiu, Adriana

2010-11-01

Due to an increased expectation of food products that respect high quality and safety standards, there is a need for the growth of accurate, fast, objective and non-destructive technologies for quality determination of food and agricultural products. For this purpose, a diagnostic system based on laser photoacoustic spectroscopy (LPAS) was developed at ENEA Frascati Molecular Spectroscopy Laboratory (Italy). In the design of the photoacoustic detector, particular emphasis was placed in attaining a high sensitivity in detecting ethylene (ET) down to sub-parts per billion level (minimum detectable concentration 0.2 ppb). This was required due to the necessity to monitor and follow up ET production at a single fruit scale. ET is normally synthesised in very low amounts by healthy citrus fruits; however stress conditions such as pathogen attack may induce a substantial increase in the synthesised ET. In the present paper, the comparison between the ET emitted by healthy oranges ( Citrus sinensis L. Osbeck) cv Navel and by Phytophthora citrophthora infested Navel orange fruits are reported. The obtained results show a well evident increase in ET emission from the infested fruit with respect to the healthy one, even 24 h after the inoculation with the pathogen; at that time the tissue necrosis was not yet visible, and the fruit was also not yet damaged. The possibility to perform a real time non-destructive detection of ET traces makes the LPAS a powerful tool for monitoring the healthy state of the citrus fruits.

Laser diagnostic technology for early detection of pathogen infestation in orange fruits

Energy Technology Data Exchange (ETDEWEB)

Giubileo, Gianfranco, E-mail: gianfranco.giubileo@frascati.enea.i [ENEA Frascati, Via E. Fermi 45, 00044 (Italy); Lai, Antonella; Piccinelli, Delinda [ENEA Frascati, Via E. Fermi 45, 00044 (Italy); Puiu, Adriana [Tor Vergata University of Rome, Faculty of Engineering, Via del Politecnico 1, 00133 Rome (Italy)

2010-11-11

Due to an increased expectation of food products that respect high quality and safety standards, there is a need for the growth of accurate, fast, objective and non-destructive technologies for quality determination of food and agricultural products. For this purpose, a diagnostic system based on laser photoacoustic spectroscopy (LPAS) was developed at ENEA Frascati Molecular Spectroscopy Laboratory (Italy). In the design of the photoacoustic detector, particular emphasis was placed in attaining a high sensitivity in detecting ethylene (ET) down to sub-parts per billion level (minimum detectable concentration 0.2 ppb). This was required due to the necessity to monitor and follow up ET production at a single fruit scale. ET is normally synthesised in very low amounts by healthy citrus fruits; however stress conditions such as pathogen attack may induce a substantial increase in the synthesised ET. In the present paper, the comparison between the ET emitted by healthy oranges (Citrus sinensis L. Osbeck) cv Navel and by Phytophthora citrophthora infested Navel orange fruits are reported. The obtained results show a well evident increase in ET emission from the infested fruit with respect to the healthy one, even 24 h after the inoculation with the pathogen; at that time the tissue necrosis was not yet visible, and the fruit was also not yet damaged. The possibility to perform a real time non-destructive detection of ET traces makes the LPAS a powerful tool for monitoring the healthy state of the citrus fruits.

A Multifunctional Coating for Autonomous Corrosion Control

Science.gov (United States)

Calle, Luz M.; Li, Wenyan; Buhrow, Jerry W.; Jolley, Scott t.

2011-01-01

Nearly all metals and their alloys are subject to corrosion that causes them to lose their structural integrity or other critical functionality. Protective coatings are the most commonly used method of corrosion control. However, progressively stricter environmental regulations have resulted in the ban of many commercially available corrosion protective coatings due to the harmful effects of their solvents or corrosion inhibitors. This work concerns the development of a multifunctional smart coating for the autonomous control of corrosion. This coating is being developed to have the inherent ability to detect the chemical changes associated with the onset of corrosion and respond autonomously to indicate it and control it. The multi-functionality of the coating is based on microencapsulation technology specifically designed for corrosion control applications. This design has, in addition to all the advantages of existing microcapsulation designs, the corrosion controlled release function that triggers the delivery of corrosion indicators and inhibitors on demand, only when and where needed. Microencapsulation of self-healing agents for autonomous repair of mechanical damage to the coating is also being pursued. Corrosion indicators, corrosion inhibitors, as well as self-healing agents, have been encapsulated and dispersed into several paint systems to test the corrosion detection, inhibition, and self-healing properties of the coating. Key words: Corrosion, coating, autonomous corrosion control, corrosion indication, corrosion inhibition, self-healing coating, smart coating, multifunctional coating, microencapsulation.

Evaluation of three 5' exonuclease-based real-time polymerase chain reaction assays for detection of pathogenic Leptospira species in canine urine.

Science.gov (United States)

Fink, Jamie M; Moore, George E; Landau, Ruth; Vemulapalli, Ramesh

2015-03-01

Leptospirosis is caused by several pathogenic Leptospira species, and is an important infectious disease of dogs. Early detection of infection is crucial for an effective antibiotic treatment of the disease. Though different polymerase chain reaction (PCR) assays have been developed for detection of pathogenic Leptospira spp., thorough evaluation of the performance of these assays using dog urine samples has not been carried out. In the current study, the performance of 3 real-time PCR (qPCR) assays was assessed, 1 targeting the 16S ribosomal RNA (rRNA) gene and the other 2 targeting the lipL32 gene, a gene for the LipL32 outer membrane protein. With DNA extracted from laboratory-cultured pathogenic Leptospira spp., all 3 qPCR assays showed 100% specificity and had identical lower limits of detection. Compared to a conventional, gel-based PCR assay, all 3 qPCR assays were 100-fold more sensitive. There was a 100% agreement in the results of the 3 assays when tested on urine samples collected aseptically from 30 dogs suspected for leptospirosis. However, when tested on 30 urine samples that were collected by the free-catch method, the 16S rRNA-based assay falsely detected 13.3% of the samples as positive for pathogenic Leptospira spp. Nucleotide sequence analysis of the amplified DNA fragments showed that the assay resulted in false positives because of unrelated bacteria. All urine samples collected from 100 apparently healthy dogs at a local animal shelter tested negative for pathogenic Leptospira spp. These results highlight the importance of sample-specific validation of PCR-based diagnostic assays and the application of appropriately validated assays for more reliable pathogen detection. © 2015 The Author(s).

Autonomous Cryogenic Load Operations: KSC Autonomous Test Engineer

Science.gov (United States)

Shrading, Nicholas J.

2012-01-01

The KSC Autonomous Test Engineer (KATE) program has a long history at KSC. Now a part of the Autonomous Cryogenic Load Operations (ACLO) mission, this software system has been sporadically developed over the past 20+ years. Originally designed to provide health and status monitoring for a simple water-based fluid system, it was proven to be a capable autonomous test engineer for determining sources of failure in. the system, As part.of a new goal to provide this same anomaly-detection capability for a complicated cryogenic fluid system, software engineers, physicists, interns and KATE experts are working to upgrade the software capabilities and graphical user interface. Much progress was made during this effort to improve KATE. A display ofthe entire cryogenic system's graph, with nodes for components and edges for their connections, was added to the KATE software. A searching functionality was added to the new graph display, so that users could easily center their screen on specific components. The GUI was also modified so that it displayed information relevant to the new project goals. In addition, work began on adding new pneumatic and electronic subsystems into the KATE knowledgebase, so that it could provide health and status monitoring for those systems. Finally, many fixes for bugs, memory leaks, and memory errors were implemented and the system was moved into a state in which it could be presented to stakeholders. Overall, the KATE system was improved and necessary additional features were added so that a presentation of the program and its functionality in the next few months would be a success.

The cytoskeleton in cell-autonomous immunity: structural determinants of host defence

Science.gov (United States)

Mostowy, Serge; Shenoy, Avinash R.

2016-01-01

Host cells use antimicrobial proteins, pathogen-restrictive compartmentalization and cell death in their defence against intracellular pathogens. Recent work has revealed that four components of the cytoskeleton — actin, microtubules, intermediate filaments and septins, which are well known for their roles in cell division, shape and movement — have important functions in innate immunity and cellular self-defence. Investigations using cellular and animal models have shown that these cytoskeletal proteins are crucial for sensing bacteria and for mobilizing effector mechanisms to eliminate them. In this Review, we highlight the emerging roles of the cytoskeleton as a structural determinant of cell-autonomous host defence. PMID:26292640

System for rapid detection of antibiotic resistance of airborne pathogens

Science.gov (United States)

Fortin, M.; Noiseux, I.; Mouslinkina, L.; Vernon, M. L.; Laflamme, C.; Filion, G.; Duchaine, C.; Ho, J.

2009-05-01

This project uses function-based detection via a fundamental understanding of the genetic markers of AR to distinguish harmful organisms from innocuous ones. This approach circumvents complex analyses to unravel the taxonomic details of 1399 pathogen species, enormously simplifying detection requirements. Laval Hospital's fast permeabilization strategy enables AR revelation in <1hr. Packaging the AR protocols in liquid-processing cartridges and coupling these to our in-house miniature fiber optic flow cell (FOFC) provides first responders with timely information on-site. INO's FOFC platform consists of a specialty optical fiber through which a hole is transversally bored by laser micromachining. The analyte solution is injected into the hole of the fiber and the particles are detected and counted. The advantage with respect to classic free space FC is that alignment occurs in the fabrication process only and complex excitation and collection optics are replaced by optical fibers. Moreover, we use a sheathless configuration which has the advantage of increase the portability of the system, to reduce excess biohazard material and the need for weekly maintenance. In this paper we present the principle of our FOFC along with a, demonstration of the basic capability of the platform for detection of bacillus cereus spores using permeabilized staining.

Autonomous Intersection Management

Science.gov (United States)

2009-12-01

detects that the driver is not slowing sufficiently fast. Jaguar, Honda, and BMW offer similar systems. Nissan and Toyota have recently begun offering...that the driver is not braking hard enough. Both Toyota and BMW are currently selling vehicles that can parallel park completely autonomously, even...other vehicles. The system was tested both in simulation and with a robotic vehicle. This work is sponsored by Toyota , who have also currently have an

Enteric bacterial pathogen detection in southern sea otters (Enhydra lutris nereis) is associated with coastal urbanization and freshwater runoff.

Science.gov (United States)

Miller, Melissa A; Byrne, Barbara A; Jang, Spencer S; Dodd, Erin M; Dorfmeier, Elene; Harris, Michael D; Ames, Jack; Paradies, David; Worcester, Karen; Jessup, David A; Miller, Woutrina A

2010-01-01

Although protected for nearly a century, California's sea otters have been slow to recover, in part due to exposure to fecally-associated protozoal pathogens like Toxoplasma gondii and Sarcocystis neurona. However, potential impacts from exposure to fecal bacteria have not been systematically explored. Using selective media, we examined feces from live and dead sea otters from California for specific enteric bacterial pathogens (Campylobacter, Salmonella, Clostridium perfringens, C. difficile and Escherichia coli O157:H7), and pathogens endemic to the marine environment (Vibrio cholerae, V. parahaemolyticus and Plesiomonas shigelloides). We evaluated statistical associations between detection of these pathogens in otter feces and demographic or environmental risk factors for otter exposure, and found that dead otters were more likely to test positive for C. perfringens, Campylobacter and V. parahaemolyticus than were live otters. Otters from more urbanized coastlines and areas with high freshwater runoff (near outflows of rivers or streams) were more likely to test positive for one or more of these bacterial pathogens. Other risk factors for bacterial detection in otters included male gender and fecal samples collected during the rainy season when surface runoff is maximal. Similar risk factors were reported in prior studies of pathogen exposure for California otters and their invertebrate prey, suggesting that land-sea transfer and/or facilitation of pathogen survival in degraded coastal marine habitat may be impacting sea otter recovery. Because otters and humans share many of the same foods, our findings may also have implications for human health.

Evolution of Drosophila resistance against different pathogens and infection routes entails no detectable maintenance costs.

Science.gov (United States)

Faria, Vítor G; Martins, Nelson E; Paulo, Tânia; Teixeira, Luís; Sucena, Élio; Magalhães, Sara

2015-11-01

Pathogens exert a strong selective pressure on hosts, entailing host adaptation to infection. This adaptation often affects negatively other fitness-related traits. Such trade-offs may underlie the maintenance of genetic diversity for pathogen resistance. Trade-offs can be tested with experimental evolution of host populations adapting to parasites, using two approaches: (1) measuring changes in immunocompetence in relaxed-selection lines and (2) comparing life-history traits of evolved and control lines in pathogen-free environments. Here, we used both approaches to examine trade-offs in Drosophila melanogaster populations evolving for over 30 generations under infection with Drosophila C Virus or the bacterium Pseudomonas entomophila, the latter through different routes. We find that resistance is maintained after up to 30 generations of relaxed selection. Moreover, no differences in several classical life-history traits between control and evolved populations were found in pathogen-free environments, even under stresses such as desiccation, nutrient limitation, and high densities. Hence, we did not detect any maintenance costs associated with resistance to pathogens. We hypothesize that extremely high selection pressures commonly used lead to the disproportionate expression of costs relative to their actual occurrence in natural systems. Still, the maintenance of genetic variation for pathogen resistance calls for an explanation. © 2015 The Author(s). Evolution © 2015 The Society for the Study of Evolution.

High throughput, multiplexed pathogen detection authenticates plague waves in medieval Venice, Italy.

Science.gov (United States)

Tran, Thi-Nguyen-Ny; Signoli, Michel; Fozzati, Luigi; Aboudharam, Gérard; Raoult, Didier; Drancourt, Michel

2011-03-10

Historical records suggest that multiple burial sites from the 14th-16th centuries in Venice, Italy, were used during the Black Death and subsequent plague epidemics. High throughput, multiplexed real-time PCR detected DNA of seven highly transmissible pathogens in 173 dental pulp specimens collected from 46 graves. Bartonella quintana DNA was identified in five (2.9%) samples, including three from the 16th century and two from the 15th century, and Yersinia pestis DNA was detected in three (1.7%) samples, including two from the 14th century and one from the 16th century. Partial glpD gene sequencing indicated that the detected Y. pestis was the Orientalis biotype. These data document for the first time successive plague epidemics in the medieval European city where quarantine was first instituted in the 14th century.

The development and application of the two real-time RT-PCR assays to detect the pathogen of HFMD.

Directory of Open Access Journals (Sweden)

Aili Cui

Full Text Available Large-scale Hand, Foot, and Mouth Disease (HFMD outbreaks have frequently occurred in China since 2008, affecting more than one million children and causing several hundred children deaths every year. The pathogens of HFMD are mainly human enteroviruses (HEVs. Among them, human enterovirus 71 (HEV71 and coxsackievirus A16 (CVA16 are the most common pathogens of HFMD. However, other HEVs could also cause HFMD. To rapidly detect HEV71 and CVA16, and ensure detection of all HEVs causing HFMD, two real-time hybridization probe-based RT-PCR assays were developed in this study. One is a multiplex real-time RT-PCR assay, which was developed to detect and differentiate HEV71 specifically from CVA16 directly from clinical specimens within 1-2 h, and the other is a broad-spectrum real-time RT-PCR assay, which targeted almost all HEVs. The experiments confirmed that the two assays have high sensitivity and specificity, and the sensitivity was up to 0.1 TCID50/ml for detection of HEVs, HEV71, and CVA16, respectively. A total of 213 clinical specimens were simultaneously detected by three kinds of assays, including the two real-time RT-PCR assays, direct conventional RT-PCR assay, and virus isolation assay on human rhabdomyosarcoma cells (RD cells. The total positive rate of both HEV71 and CVA16 was 69.48% with real-time RT-PCR assay, 47.42% with RT-PCR assay, and 34.58% with virus isolation assay. One HFMD clinical specimen was positive for HEV, but negative for HEV71 or CVA16, which was identified as Echovirus 11 (Echo11 by virus isolation, RT-PCR, and sequencing for the VP1 gene. The two real-time RT-PCR assays had been applied in 31 provincial HFMD labs to detect the pathogens of HFMD, which has contributed to the rapid identification of the pathogens in the early stages of HFMD outbreaks, and helped to clarify the etiologic agents of HFMD in China.

Autonomous Aeromagnetic Surveys Using a Fluxgate Magnetometer.

Science.gov (United States)

Macharet, Douglas G; Perez-Imaz, Héctor I A; Rezeck, Paulo A F; Potje, Guilherme A; Benyosef, Luiz C C; Wiermann, André; Freitas, Gustavo M; Garcia, Luis G U; Campos, Mario F M

2016-12-17

Recent advances in the research of autonomous vehicles have showed a vast range of applications, such as exploration, surveillance and environmental monitoring. Considering the mining industry, it is possible to use such vehicles in the prospection of minerals of commercial interest beneath the ground. However, tasks such as geophysical surveys are highly dependent on specific sensors, which mostly are not designed to be used in these new range of autonomous vehicles. In this work, we propose a novel magnetic survey pipeline that aims to increase versatility, speed and robustness by using autonomous rotary-wing Unmanned Aerial Vehicles (UAVs). We also discuss the development of a state-of-the-art three-axis fluxgate, where our goal in this work was to refine and adjust the sensor topology and coupled electronics specifically for this type of vehicle and application. The sensor was built with two ring-cores using a specially developed stress-annealed CoFeSiB amorphous ribbon, in order to get sufficient resolution to detect concentrations of small ferrous minerals. Finally, we report on the results of experiments performed with a real UAV in an outdoor environment, showing the efficacy of the methodology in detecting an artificial ferrous anomaly.

Landmark navigation and autonomous landing approach with obstacle detection for aircraft

Science.gov (United States)

Fuerst, Simon; Werner, Stefan; Dickmanns, Dirk; Dickmanns, Ernst D.

1997-06-01

A machine perception system for aircraft and helicopters using multiple sensor data for state estimation is presented. By combining conventional aircraft sensor like gyros, accelerometers, artificial horizon, aerodynamic measuring devices and GPS with vision data taken by conventional CCD-cameras mounted on a pan and tilt platform, the position of the craft can be determined as well as the relative position to runways and natural landmarks. The vision data of natural landmarks are used to improve position estimates during autonomous missions. A built-in landmark management module decides which landmark should be focused on by the vision system, depending on the distance to the landmark and the aspect conditions. More complex landmarks like runways are modeled with different levels of detail that are activated dependent on range. A supervisor process compares vision data and GPS data to detect mistracking of the vision system e.g. due to poor visibility and tries to reinitialize the vision system or to set focus on another landmark available. During landing approach obstacles like trucks and airplanes can be detected on the runway. The system has been tested in real-time within a hardware-in-the-loop simulation. Simulated aircraft measurements corrupted by noise and other characteristic sensor errors have been fed into the machine perception system; the image processing module for relative state estimation was driven by computer generated imagery. Results from real-time simulation runs are given.

Using infrared HOG-based pedestrian detection for outdoor autonomous searching UAV with embedded system

Science.gov (United States)

Shao, Yanhua; Mei, Yanying; Chu, Hongyu; Chang, Zhiyuan; He, Yuxuan; Zhan, Huayi

2018-04-01

Pedestrian detection (PD) is an important application domain in computer vision and pattern recognition. Unmanned Aerial Vehicles (UAVs) have become a major field of research in recent years. In this paper, an algorithm for a robust pedestrian detection method based on the combination of the infrared HOG (IR-HOG) feature and SVM is proposed for highly complex outdoor scenarios on the basis of airborne IR image sequences from UAV. The basic flow of our application operation is as follows. Firstly, the thermal infrared imager (TAU2-336), which was installed on our Outdoor Autonomous Searching (OAS) UAV, is used for taking pictures of the designated outdoor area. Secondly, image sequences collecting and processing were accomplished by using high-performance embedded system with Samsung ODROID-XU4 and Ubuntu as the core and operating system respectively, and IR-HOG features were extracted. Finally, the SVM is used to train the pedestrian classifier. Experiment show that, our method shows promising results under complex conditions including strong noise corruption, partial occlusion etc.

Fluorescence-Free Biosensor Methods in Detection of Food Pathogens with a Special Focus on Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Rajeswaran Radhakrishnan

2017-12-01

Full Text Available Food pathogens contaminate food products that allow their growth on the shelf and also under refrigerated conditions. Therefore, it is of utmost importance to lower the limit of detection (LOD of the method used and to obtain the results within hours to few days. Biosensor methods exploit the available technologies to individuate and provide an approximate quantification of the bacteria present in a sample. The main bottleneck of these methods depends on the aspecific binding to the surfaces and on a change in sensitivity when bacteria are in a complex food matrix with respect to bacteria in a liquid food sample. In this review, we introduce surface plasmon resonance (SPR, new advancements in SPR techniques, and electrochemical impedance spectroscopy (EIS, as fluorescence-free biosensing technologies for detection of L. monocytogenes in foods. The application of the two methods has facilitated L. monocytogenes detection with LOD of 1 log CFU/mL. Further advancements are envisaged through the combination of biosensor methods with immunoseparation of bacteria from larger volumes, application of lab-on-chip technologies, and EIS sensing methods for multiplex pathogen detection. Validation efforts are being conducted to demonstrate the robustness of detection, reproducibility and variability in multi-site installations.

A Broad-Spectrum Infection Diagnostic that Detects Pathogen-Associated Molecular Patterns (PAMPs) in Whole Blood.

Science.gov (United States)

Cartwright, Mark; Rottman, Martin; Shapiro, Nathan I; Seiler, Benjamin; Lombardo, Patrick; Gamini, Nazita; Tomolonis, Julie; Watters, Alexander L; Waterhouse, Anna; Leslie, Dan; Bolgen, Dana; Graveline, Amanda; Kang, Joo H; Didar, Tohid; Dimitrakakis, Nikolaos; Cartwright, David; Super, Michael; Ingber, Donald E

2016-07-01

Blood cultures, and molecular diagnostic tests that directly detect pathogen DNA in blood, fail to detect bloodstream infections in most infected patients. Thus, there is a need for a rapid test that can diagnose the presence of infection to triage patients, guide therapy, and decrease the incidence of sepsis. An Enzyme-Linked Lectin-Sorbent Assay (ELLecSA) that uses magnetic microbeads coated with an engineered version of the human opsonin, Mannose Binding Lectin, containing the Fc immunoglobulin domain linked to its carbohydrate recognition domain (FcMBL) was developed to quantify pathogen-associated molecular patterns (PAMPs) in whole blood. This assay was tested in rats and pigs to explore whether it can detect infections and monitor disease progression, and in prospectively enrolled, emergency room patients with suspected sepsis. These results were also compared with data obtained from non-infected patients with or without traumatic injuries. The FcMBL ELLecSA was able to detect PAMPS present on, or released by, 85% of clinical isolates representing 47 of 55 different pathogen species, including the most common causes of sepsis. The PAMP assay rapidly (animals, even when blood cultures were negative and bacteriocidal antibiotics were administered. In patients with suspected sepsis, the FcMBL ELLecSA detected infection in 55 of 67 patients with high sensitivity (>81%), specificity (>89%), and diagnostic accuracy of 0·87. It also distinguished infection from trauma-related inflammation in the same patient cohorts with a higher specificity than the clinical sepsis biomarker, C-reactive Protein. The FcMBL ELLecSA-based PAMP assay offers a rapid, simple, sensitive and specific method for diagnosing infections, even when blood cultures are negative and antibiotic therapy has been initiated. It may help to triage patients with suspected systemic infections, and serve as a companion diagnostic to guide administration of emerging dialysis-like sepsis therapies

Systematic detection of positive selection in the human-pathogen interactome and lasting effects on infectious disease susceptibility.

Directory of Open Access Journals (Sweden)

Erik Corona

Full Text Available Infectious disease has shaped the natural genetic diversity of humans throughout the world. A new approach to capture positive selection driven by pathogens would provide information regarding pathogen exposure in distinct human populations and the constantly evolving arms race between host and disease-causing agents. We created a human pathogen interaction database and used the integrated haplotype score (iHS to detect recent positive selection in genes that interact with proteins from 26 different pathogens. We used the Human Genome Diversity Panel to identify specific populations harboring pathogen-interacting genes that have undergone positive selection. We found that human genes that interact with 9 pathogen species show evidence of recent positive selection. These pathogens are Yersenia pestis, human immunodeficiency virus (HIV 1, Zaire ebolavirus, Francisella tularensis, dengue virus, human respiratory syncytial virus, measles virus, Rubella virus, and Bacillus anthracis. For HIV-1, GWAS demonstrate that some naturally selected variants in the host-pathogen protein interaction networks continue to have functional consequences for susceptibility to these pathogens. We show that selected human genes were enriched for HIV susceptibility variants (identified through GWAS, providing further support for the hypothesis that ancient humans were exposed to lentivirus pandemics. Human genes in the Italian, Miao, and Biaka Pygmy populations that interact with Y. pestis show significant signs of selection. These results reveal some of the genetic footprints created by pathogens in the human genome that may have left lasting marks on susceptibility to infectious disease.

Determining the 95% limit of detection for waterborne pathogen analyses from primary concentration to qPCR

Science.gov (United States)

Stokdyk, Joel P.; Firnstahl, Aaron; Spencer, Susan K.; Burch, Tucker R; Borchardt, Mark A.

2016-01-01

The limit of detection (LOD) for qPCR-based analyses is not consistently defined or determined in studies on waterborne pathogens. Moreover, the LODs reported often reflect the qPCR assay alone rather than the entire sample process. Our objective was to develop an approach to determine the 95% LOD (lowest concentration at which 95% of positive samples are detected) for the entire process of waterborne pathogen detection. We began by spiking the lowest concentration that was consistently positive at the qPCR step (based on its standard curve) into each procedural step working backwards (i.e., extraction, secondary concentration, primary concentration), which established a concentration that was detectable following losses of the pathogen from processing. Using the fraction of positive replicates (n = 10) at this concentration, we selected and analyzed a second, and then third, concentration. If the fraction of positive replicates equaled 1 or 0 for two concentrations, we selected another. We calculated the LOD using probit analysis. To demonstrate our approach we determined the 95% LOD for Salmonella enterica serovar Typhimurium, adenovirus 41, and vaccine-derived poliovirus Sabin 3, which were 11, 12, and 6 genomic copies (gc) per reaction (rxn), respectively (equivalent to 1.3, 1.5, and 4.0 gc L−1 assuming the 1500 L tap-water sample volume prescribed in EPA Method 1615). This approach limited the number of analyses required and was amenable to testing multiple genetic targets simultaneously (i.e., spiking a single sample with multiple microorganisms). An LOD determined this way can facilitate study design, guide the number of required technical replicates, aid method evaluation, and inform data interpretation.

Enteric bacterial pathogen detection in southern sea otters (Enhydra lutris nereis) is associated with coastal urbanization and freshwater runoff

Science.gov (United States)

Miller, Melissa A.; Byrne, Barbara A.; Jang, Spencer S.; Dodd, Erin M.; Dorfmeier, Elene; Harris, Michael D.; Ames, Jack; Paradies, David; Worcester, Karen; Jessup, David A.; Miller, Woutrina A.

2009-01-01

Although protected for nearly a century, California’s sea otters have been slow to recover, in part due to exposure to fecally-associated protozoal pathogens like Toxoplasma gondii and Sarcocystis neurona. However, potential impacts from exposure to fecal bacteria have not been systematically explored. Using selective media, we examined feces from live and dead sea otters from California for specific enteric bacterial pathogens (Campylobacter, Salmonella, Clostridium perfringens, C. difficile and Escherichia coli O157:H7), and pathogens endemic to the marine environment (Vibrio cholerae, V. parahaemolyticus and Plesiomonas shigelloides). We evaluated statistical associations between detection of these pathogens in otter feces and demographic or environmental risk factors for otter exposure, and found that dead otters were more likely to test positive for C. perfringens, Campylobacter and V. parahaemolyticus than were live otters. Otters from more urbanized coastlines and areas with high freshwater runoff (near outflows of rivers or streams) were more likely to test positive for one or more of these bacterial pathogens. Other risk factors for bacterial detection in otters included male gender and fecal samples collected during the rainy season when surface runoff is maximal. Similar risk factors were reported in prior studies of pathogen exposure for California otters and their invertebrate prey, suggesting that land-sea transfer and/or facilitation of pathogen survival in degraded coastal marine habitat may be impacting sea otter recovery. Because otters and humans share many of the same foods, our findings may also have implications for human health. PMID:19720009

Simultaneous aptasensor for multiplex pathogenic bacteria detection based on multicolor upconversion nanoparticles labels.

Science.gov (United States)

Wu, Shijia; Duan, Nuo; Shi, Zhao; Fang, Congcong; Wang, Zhouping

2014-03-18

A highly sensitive and specific multiplex method for the simultaneous detection of three pathogenic bacteria was fabricated using multicolor upconversion nanoparticles (UCNPs) as luminescence labels coupled with aptamers as the molecular recognition elements. Multicolor UCNPs were synthesized via doping with various rare-earth ions to obtain well-separated emission peaks. The aptamer sequences were selected using the systematic evolution of ligands by exponential enrichment (SELEX) strategy for Staphylococcus aureus, Vibrio parahemolyticus, and Salmonella typhimurium. When applied in this method, aptamers can be used for the specific recognition of the bacteria from complex mixtures, including those found in real food matrixes. Aptamers and multicolor UCNPs were employed to selectively capture and simultaneously quantify the three target bacteria on the basis of the independent peaks. Under optimal conditions, the correlation between the concentration of three bacteria and the luminescence signal was found to be linear from 50-10(6) cfu mL(-1). Improved by the magnetic separation and concentration effect of Fe3O4 magnetic nanoparticles, the limits of detection of the developed method were found to be 25, 10, and 15 cfu mL(-1) for S. aureus, V. parahemolyticus, and S. typhimurium, respectively. The capability of the bioassay in real food samples was also investigated, and the results were consistent with experimental results obtained from plate-counting methods. This proposed method for the detection of various pathogenic bacteria based on multicolor UCNPs has great potential in the application of food safety and multiplex nanosensors.

A Broad-Spectrum Infection Diagnostic that Detects Pathogen-Associated Molecular Patterns (PAMPs) in Whole Blood

OpenAIRE

Cartwright, Mark; Rottman, Martin; Shapiro, Nathan I.; Seiler, Benjamin; Lombardo, Patrick; Gamini, Nazita; Tomolonis, Julie; Watters, Alexander L.; Waterhouse, Anna; Leslie, Dan; Bolgen, Dana; Graveline, Amanda; Kang, Joo H.; Didar, Tohid; Dimitrakakis, Nikolaos

2016-01-01

Background: Blood cultures, and molecular diagnostic tests that directly detect pathogen DNA in blood, fail to detect bloodstream infections in most infected patients. Thus, there is a need for a rapid test that can diagnose the presence of infection to triage patients, guide therapy, and decrease the incidence of sepsis. Methods: An Enzyme-Linked Lectin-Sorbent Assay (ELLecSA) that uses magnetic microbeads coated with an engineered version of the human opsonin, Mannose Binding Lectin, contai...

High Throughput, Multiplexed Pathogen Detection Authenticates Plague Waves in Medieval Venice, Italy

Science.gov (United States)

Tran, Thi-Nguyen-Ny; Signoli, Michel; Fozzati, Luigi; Aboudharam, Gérard; Raoult, Didier; Drancourt, Michel

2011-01-01

Background Historical records suggest that multiple burial sites from the 14th–16th centuries in Venice, Italy, were used during the Black Death and subsequent plague epidemics. Methodology/Principal Findings High throughput, multiplexed real-time PCR detected DNA of seven highly transmissible pathogens in 173 dental pulp specimens collected from 46 graves. Bartonella quintana DNA was identified in five (2.9%) samples, including three from the 16th century and two from the 15th century, and Yersinia pestis DNA was detected in three (1.7%) samples, including two from the 14th century and one from the 16th century. Partial glpD gene sequencing indicated that the detected Y. pestis was the Orientalis biotype. Conclusions These data document for the first time successive plague epidemics in the medieval European city where quarantine was first instituted in the 14th century. PMID:21423736

Learning Objects and Grasp Affordances through Autonomous Exploration

DEFF Research Database (Denmark)

Kraft, Dirk; Detry, Renaud; Pugeault, Nicolas

2009-01-01

We describe a system for autonomous learning of visual object representations and their grasp affordances on a robot-vision system. It segments objects by grasping and moving 3D scene features, and creates probabilistic visual representations for object detection, recognition and pose estimation...... image sequences as well as (3) a number of built-in behavioral modules on the one hand, and autonomous exploration on the other hand, the system is able to generate object and grasping knowledge through interaction with its environment....

Design and Elementary Evaluation of a Highly-Automated Fluorescence-Based Instrument System for On-Site Detection of Food-Borne Pathogens

Directory of Open Access Journals (Sweden)

Zhan Lu

2017-02-01

Full Text Available A simple, highly-automated instrument system used for on-site detection of foodborne pathogens based on fluorescence was designed, fabricated, and preliminarily tested in this paper. A corresponding method has been proved effective in our previous studies. This system utilizes a light-emitting diode (LED to excite fluorescent labels and a spectrometer to record the fluorescence signal from samples. A rotation stage for positioning and switching samples was innovatively designed for high-throughput detection, ten at most in one single run. We also developed software based on LabVIEW for data receiving, processing, and the control of the whole system. In the test of using a pure quantum dot (QD solution as a standard sample, detection results from this home-made system were highly-relevant with that from a well-commercialized product and even slightly better reproducibility was found. And in the test of three typical kinds of food-borne pathogens, fluorescence signals recorded by this system are highly proportional to the variation of the sample concentration, with a satisfied limit of detection (LOD (nearly 102–103 CFU·mL−1 in food samples. Additionally, this instrument system is low-cost and easy-to-use, showing a promising potential for on-site rapid detection of food-borne pathogens.

Mechatronics Design of an Autonomous Pipe-Inspection Robot

Directory of Open Access Journals (Sweden)

Abdellatif Mohamed

2018-01-01

Full Text Available Pipelines require periodical inspection to detect corrosion, deformation and congestion with obstacles in the network. Autonomous mobile robots are good solutions for this task. Visual information from the pipe interior associated with a location stamp is needed for inspection. In this paper, the previous designs of autonomous robots are reviewed and a new robot is developed to ensure simple design and smooth motion. Images are processed online to detect irregularity in pipe and then start capturing high resolution pictures to conserve the limited memory size. The new robot moves in pipes and provides video stream of pipe interior with location stamp. The visual information can later be processed offline to extract more information of pipeline condition to make maintenance decisions.

Detection of Antibodies to Seven Priority Pathogens in Backyard Poultry in Trinidad, West Indies

Directory of Open Access Journals (Sweden)

Arianne Brown Jordan

2018-01-01

Full Text Available Backyard poultry farms in Trinidad and Tobago (T&T play a vital role in providing food and income for rural communities. There is currently no information on the presence and circulation of pathogens in backyard poultry farms in T&T, and little is known in relation to the potential risks of spread of these pathogens to the commercial poultry sector. In order to address this, serum samples were collected from 41 chickens on five backyard farms taken from selected locations in Trinidad. Samples were tested for antibodies to seven priority pathogens of poultry by enzyme-linked immunosorbent assay (ELISA. Antibodies were detected in 65% (CI 95%: 50–78% of the sampled birds for Infectious bronchitis virus (IBV, 67.5% (CI 95%: 52–80% for Infectious bursal disease virus (IBDV, 10% (CI 95%: 4–23% for Newcastle disease virus (NDV, 0% (CI 95%: 0–0% for Avian influenza virus (AIV, 0% (CI 95%: 0–0% for West Nile virus (WNV, 31.7% (CI 95%: 20–47% for Mycoplasm gallisepticum/synoviae and 0% (CI 95%: 0–0% for Salmonella enterica serotype Enteritidis. These results reveal the presence and circulation of important pathogens of poultry in selected backyard farms in Trinidad. The results provide important information which should be taken into consideration when assessing the risks of pathogen transmission between commercial and backyard poultry farms, as well as between poultry and wild birds.

Approaches for Reverse Line Blot-Based Detection of Microbial Pathogens in Ixodes ricinus Ticks Collected in Austria and Impact of the Chosen Method.

Science.gov (United States)

Schötta, Anna-Margarita; Wijnveld, Michiel; Stockinger, Hannes; Stanek, Gerold

2017-07-01

Ticks transmit a large number of pathogens capable of causing human disease. In this study, the PCR-reverse line blot (RLB) method was used to screen for pathogens in a total of 554 Ixodes ricinus ticks collected from all provinces of Austria. These pathogens belong to the genera Borrelia , Rickettsiae , Anaplasma / Ehrlichia (including " Candidatus Neoehrlichia"), Babesia , and Coxiella The pathogens with the highest detected prevalence were spirochetes of the Borrelia burgdorferi sensu lato complex, in 142 ticks (25.6%). Borrelia afzelii (80/142) was the most frequently detected species, followed by Borrelia burgdorferi sensu stricto (38/142) and Borrelia valaisiana (36/142). Borrelia garinii/Borrelia bavariensis , Borrelia lusitaniae , and Borrelia spielmanii were found in 28 ticks, 5 ticks, and 1 tick, respectively. Rickettsia spp. were detected in 93 ticks (16.8%): R. helvetica (39/93), R. raoultii (38/93), R. monacensis (2/93), and R. slovaca (1/93). Thirteen Rickettsia samples remain uncharacterized. " Candidatus Neoehrlichia mikurensis," Babesia spp. ( B. venatorum , B. divergens , B. microti ), and Anaplasma phagocytophilum were found in 4.5%, 2.7%, and 0.7%, respectively. Coxiella burnetii was not detected. Multiple microorganisms were detected in 40 ticks (7.2%), and the cooccurrence of Babesia spp. and " Candidatus Neoehrlichia mikurensis" showed a significant positive correlation. We also compared different PCR-RLBs for detection of Borrelia burgdorferi sensu lato and Rickettsia spp. and showed that different detection approaches provide highly diverse results, indicating that analysis of environmental samples remains challenging. IMPORTANCE This study determined the wide spectrum of tick-borne bacterial and protozoal pathogens that can be encountered in Austria. Surveillance of (putative) pathogenic microorganisms occurring in the environment is of medical importance, especially when those agents can be transmitted by ticks and cause disease. The

Multiplex detection of nine food-borne pathogens by mPCR and capillary electrophoresis after using a universal pre-enrichment medium.

Science.gov (United States)

Villamizar-Rodríguez, Germán; Fernández, Javier; Marín, Laura; Muñiz, Juan; González, Isabel; Lombó, Felipe

2015-01-01

Routine microbiological quality analyses in food samples require, in some cases, an initial incubation in pre-enrichment medium. This is necessary in order to ensure that small amounts of pathogenic strains are going to be detected. In this work, a universal pre-enrichment medium has been developed for the simultaneous growth of Bacillus cereus, Campylobacter jejuni, Clostridium perfringens, Cronobacter sakazakii, Escherichia coli, Enterobacteriaceae family (38 species, 27 genera), Listeria monocytogenes, Staphylococcus aureus, Salmonella spp. (two species, 13 strains). Growth confirmation for all these species was achieved in all cases, with excellent enrichments. This was confirmed by plating on the corresponding selective agar media for each bacterium. This GVUM universal pre-enrichment medium could be useful in food microbiological analyses, where different pathogenic bacteria must be detected after a pre-enrichment step. Following, a mPCR reaction for detection of all these pathogens was developed, after designing a set of nine oligonucleotide pairs from specific genetic targets on gDNA from each of these bacteria, covering all available strains already sequenced in GenBank for each pathogen type. The detection limits have been 1 Genome Equivalent (GE), with the exception of the Fam. Enterobacteriaceae (5 GEs). We obtained amplification for all targets (from 70 to 251 bp, depending on the bacteria type), showing the capability of this method to detect the most important industrial and sanitary food-borne pathogens from a universal pre-enrichment medium. This method includes an initial pre-enrichment step (18 h), followed by a mPCR (2 h) and a capillary electrophoresis (30 min); avoiding the tedious and long lasting growing on solid media required in traditional analysis (1-4 days, depending on the specific pathogen and verification procedure). An external testing of this method was conducted in order to compare classical and mPCR methods. This evaluation was

Multiplex detection of nine food-borne pathogens by mPCR and capillary electrophoresis after using a universal pre-enrichment medium

Science.gov (United States)

Villamizar-Rodríguez, Germán; Fernández, Javier; Marín, Laura; Muñiz, Juan; González, Isabel; Lombó, Felipe

2015-01-01

Routine microbiological quality analyses in food samples require, in some cases, an initial incubation in pre-enrichment medium. This is necessary in order to ensure that small amounts of pathogenic strains are going to be detected. In this work, a universal pre-enrichment medium has been developed for the simultaneous growth of Bacillus cereus, Campylobacter jejuni, Clostridium perfringens, Cronobacter sakazakii, Escherichia coli, Enterobacteriaceae family (38 species, 27 genera), Listeria monocytogenes, Staphylococcus aureus, Salmonella spp. (two species, 13 strains). Growth confirmation for all these species was achieved in all cases, with excellent enrichments. This was confirmed by plating on the corresponding selective agar media for each bacterium. This GVUM universal pre-enrichment medium could be useful in food microbiological analyses, where different pathogenic bacteria must be detected after a pre-enrichment step. Following, a mPCR reaction for detection of all these pathogens was developed, after designing a set of nine oligonucleotide pairs from specific genetic targets on gDNA from each of these bacteria, covering all available strains already sequenced in GenBank for each pathogen type. The detection limits have been 1 Genome Equivalent (GE), with the exception of the Fam. Enterobacteriaceae (5 GEs). We obtained amplification for all targets (from 70 to 251 bp, depending on the bacteria type), showing the capability of this method to detect the most important industrial and sanitary food-borne pathogens from a universal pre-enrichment medium. This method includes an initial pre-enrichment step (18 h), followed by a mPCR (2 h) and a capillary electrophoresis (30 min); avoiding the tedious and long lasting growing on solid media required in traditional analysis (1–4 days, depending on the specific pathogen and verification procedure). An external testing of this method was conducted in order to compare classical and mPCR methods. This evaluation was

Cardiovascular autonomic neuropathy in diabetes

DEFF Research Database (Denmark)

Spallone, Vincenza; Ziegler, Dan; Freeman, Roy

2011-01-01

Cardiovascular Autonomic Neuropathy (CAN) Subcommittee of Toronto Consensus Panel on Diabetic Neuropathy worked to update CAN guidelines, with regard to epidemiology, clinical impact, diagnosis, usefulness of CAN testing, and management. CAN is the impairment of cardiovascular autonomic control...... in type 2 diabetes. CAN is a risk marker of mortality and cardiovascular morbidity, and possibly a progression promoter of diabetic nephropathy. Criteria for CAN diagnosis and staging are: 1. one abnormal cardio-vagal test identifies possible or early CAN; 2. at least two abnormal cardio-vagal tests....... diagnosis of CAN clinical forms, 2. detection and tailored treatment of CAN clinical correlates (e.g. tachycardia, OH, nondipping, QT interval prolongation), 3. risk stratification for diabetic complications and cardiovascular morbidity and mortality, and 4. modulation of targets of diabetes therapy...

Detection of cardiovascular autonomic neuropathy using exercise testing in patients with type 2 diabetes mellitus.

Science.gov (United States)

Banthia, Smriti; Bergner, Daniel W; Chicos, Alexandru B; Ng, Jason; Pelchovitz, Daniel J; Subacius, Haris; Kadish, Alan H; Goldberger, Jeffrey J

2013-01-01

This study investigated autonomic nervous system function in subjects with diabetes during exercise and recovery. Eighteen type 2 diabetics (age 55±2 years) and twenty healthy controls (age 51±1 years) underwent two 16-min bicycle submaximal ECG stress tests followed by 45 min of recovery. During session #2, atropine (0.04 mg/kg) was administered at peak exercise, and the final two minutes of exercise and entire recovery occurred under parasympathetic blockade. Plasma catecholamines were measured throughout. Parasympathetic effect was defined as the difference between a measured parameter at baseline and after parasympathetic blockade. The parasympathetic effect on the RR interval was blunted (P=.004) in diabetic subjects during recovery. Parasympathetic effect on QT-RR slope during early recovery was diminished in the diabetes group (diabetes 0.13±0.02, control 0.21±0.02, P=.03). Subjects with diabetes had a lower heart rate recovery at 1 min (diabetes 18.5±1.9 bpm, control 27.6±1.5 bpm, Pdiabetes, even with minimal evidence of CAN using current methodology, altered cardiac autonomic balance is present and can be detected through an exercise-based assessment for CAN. The early post-exercise recovery period in diabetes was characterized by enhanced sympathoexcitation, diminished parasympathetic reactivation and delay in heart rate recovery. Copyright © 2013 Elsevier Inc. All rights reserved.

Detection of Pathogenic Biofilms with Bacterial Amyloid Targeting Fluorescent Probe, CDy11

DEFF Research Database (Denmark)

Kim, Jun Young; Sahu, Srikanta; Yau, Yin Hoe

2016-01-01

Bacterial biofilms are responsible for a wide range of persistent infections. In the clinic, diagnosis of biofilm-associated infections relies heavily on culturing methods, which fail to detect nonculturable bacteria. Identification of novel fluorescent probes for biofilm imaging will greatly...... facilitate diagnosis of pathogenic bacterial infection. Herein, we report a novel fluorescent probe, CDy11 (compound of designation yellow 11), which targets amyloid in the Pseudomonas aeruginosa biofilm matrix through a diversity oriented fluorescent library approach (DOFLA). CDy11 was further demonstrated...

Detection and prevalence of pathogenic Yersinia enterocolitica in refrigerated and frozen dairy products by duplex PCR and dot hybridization targeting the virF and ail genes.

Science.gov (United States)

Ye, Y W; Ling, N; Han, Y J; Wu, Q P

2014-11-01

Pathogenic Yersinia enterocolitica is involved in yersiniosis through expression of chromosome-borne or plasmid-borne virulence factors. Yersinia enterocolitica is a cold-tolerant pathogen frequently isolated from refrigerated or frozen foods. However, little attention has been focused on the prevalence of pathogenic Y. enterocolitica in refrigerated or frozen dairy samples in China. In this study, we developed a new duplex PCR targeting the plasmid-borne virF gene and chromosome-borne ail gene for detection of pathogenic Y. enterocolitica isolates. We established a detection limit for the duplex PCR of 6.5 × 10(2)cfu/mL in artificially contaminated dairy samples. In addition, the duplex PCR could detect directly 4.5 to 5.7 cfu of Y. enterocolitica in 5 mL of brain heart infusion broth after 6 h of enrichment at 28 °C. A newly developed dot hybridization assay further confirmed specificity of the duplex PCR for detection of virulent Y. enterocolitica. Furthermore, 13 Y. enterocolitica and 5 pathogenic strains, from 88 commercial frozen or refrigerated dairy products, were detected successfully by the China National Standard method (GB/T4789.8-2008) and the duplex PCR, respectively. Finally, biotypes and serotypes of pathogenic Y. enterocolitica strains were further characterized. The duplex PCR developed here is reliable for large-scale screening, routine monitoring, and risk assessment of pathogenic Y. enterocolitica in refrigerated or frozen dairy products. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Diagnostic accuracy of the ROCHE Septifast PCR system for the rapid detection of blood pathogens in neonatal sepsis-A prospective clinical trial.

Science.gov (United States)

Straub, Julia; Paula, Helga; Mayr, Michaela; Kasper, David; Assadian, Ojan; Berger, Angelika; Rittenschober-Böhm, Judith

2017-01-01

Diagnosis of neonatal sepsis remains a major challenge in neonatology. Most molecular-based methods are not customized for neonatal requirements. The aim of the present study was to assess the diagnostic accuracy of a modified multiplex PCR protocol for the detection of neonatal sepsis using small blood volumes. 212 episodes of suspected neonatal late onset sepsis were analyzed prospectively using the Roche SeptiFast® MGRADE PCR with a modified DNA extraction protocol and software-handling tool. Results were compared to blood culture, laboratory biomarkers and clinical signs of sepsis. Of 212 episodes, 85 (40.1%) were categorized as "not infected". Among these episodes, 1 was false positive by blood culture (1.2%) and 23 were false positive by PCR (27.1%). Of 51 (24.1%) episodes diagnosed as "culture proven sepsis", the same pathogen was detected by blood culture and PCR in 39 episodes (76.5%). In 8 episodes, more pathogens were detected by PCR compared to blood culture, and in 4 episodes the pathogen detected by blood culture was not found by PCR. One of these episodes was caused by Bacillus cereus, a pathogen not included in the PCR panel. In 76/212 (35.8%) episodes, clinical sepsis was diagnosed. Among these, PCR yielded positive results in 39.5% of episodes (30/76 episodes). For culture-positive sepsis, PCR showed a sensitivity of 90.2% (95%CI 86.2-94.2%) and a specificity of 72.9% (95%CI 67.0-79.0%). The Roche SeptiFast® MGRADE PCR using a modified DNA extraction protocol showed acceptable results for rapid detection of neonatal sepsis in addition to conventional blood culture. The benefit of rapid pathogen detection has to be balanced against the considerable risk of contamination, loss of information on antibiotic sensitivity pattern and increased costs.

DETECTION AND IDENTIFICATION OF PATHOGENIC CANDIDA SPECIES IN WATER USING FLOW CYTOMETRY COUPLED WITH TAQMAN PCR

Science.gov (United States)

As the incidence of human fungal infection increases, the ability to detect and identify pathogenic fungi in potential environmental reservoirs becomes increasingly important for disease control. PCR based assays are widely used for diagnostic purposes, but may be inadequate for...

Development of multiplex loop mediated isothermal amplification (m-LAMP) label-based gold nanoparticles lateral flow dipstick biosensor for detection of pathogenic Leptospira

International Nuclear Information System (INIS)

Nurul Najian, A.B.; Engku Nur Syafirah, E.A.R.; Ismail, Nabilah; Mohamed, Maizan; Yean, Chan Yean

2016-01-01

In recent years extensive numbers of molecular diagnostic methods have been developed to meet the need of point-of-care devices. Efforts have been made towards producing rapid, simple and inexpensive DNA tests, especially in the diagnostics field. We report on the development of a label-based lateral flow dipstick for the rapid and simple detection of multiplex loop-mediated isothermal amplification (m-LAMP) amplicons. A label-based m-LAMP lateral flow dipstick assay was developed for the simultaneous detection of target DNA template and a LAMP internal control. This biosensor operates through a label based system, in which probe-hybridization and the additional incubation step are eliminated. We demonstrated this m-LAMP assay by detecting pathogenic Leptospira, which causes the re-emerging disease Leptospirosis. The lateral flow dipstick was developed to detect of three targets, the LAMP target amplicon, the LAMP internal control amplicon and a chromatography control. Three lines appeared on the dipstick, indicating positive results for all representative pathogenic Leptospira species, whereas two lines appeared, indicating negative results, for other bacterial species. The specificity of this biosensor assay was 100% when it was tested with 13 representative pathogenic Leptospira species, 2 intermediate Leptospira species, 1 non-pathogenic Leptospira species and 28 other bacteria species. This study found that this DNA biosensor was able to detect DNA at concentrations as low as 3.95 × 10 −1 genomic equivalent ml −1 . An integrated m-LAMP and label-based lateral flow dipstick was successfully developed, promising simple and rapid visual detection in clinical diagnostics and serving as a point-of-care device. - Highlights: • We develop multiplex LAMP label-based lateral flow dipstick biosensor for detection of pathogenic Leptospira. • We design primers for multiplex LAMP targeting the conserved LipL32 gene of pathogenic Leptospira and LAMP internal

Development of multiplex loop mediated isothermal amplification (m-LAMP) label-based gold nanoparticles lateral flow dipstick biosensor for detection of pathogenic Leptospira

Energy Technology Data Exchange (ETDEWEB)

Nurul Najian, A.B.; Engku Nur Syafirah, E.A.R.; Ismail, Nabilah [Department of Medical Microbiology & Parasitology, School of Medical Sciences, Health Campus, Universiti Sains Malaysia, 16150 Kubang Kerian, Kelantan (Malaysia); Mohamed, Maizan [Faculty of Veterinary Medicine, Universiti Malaysia Kelantan, City Campus, Pengkalan Chepa, Locked Bag 36, 16100 Kota Bharu, Kelantan (Malaysia); Yean, Chan Yean, E-mail: yeancyn@yahoo.com [Department of Medical Microbiology & Parasitology, School of Medical Sciences, Health Campus, Universiti Sains Malaysia, 16150 Kubang Kerian, Kelantan (Malaysia); Institute for Research in Molecular Medicine (INFORMM), Health Campus, Universiti Sains Malaysia, 16150 Kubang Kerian, Kelantan (Malaysia)

2016-01-15

In recent years extensive numbers of molecular diagnostic methods have been developed to meet the need of point-of-care devices. Efforts have been made towards producing rapid, simple and inexpensive DNA tests, especially in the diagnostics field. We report on the development of a label-based lateral flow dipstick for the rapid and simple detection of multiplex loop-mediated isothermal amplification (m-LAMP) amplicons. A label-based m-LAMP lateral flow dipstick assay was developed for the simultaneous detection of target DNA template and a LAMP internal control. This biosensor operates through a label based system, in which probe-hybridization and the additional incubation step are eliminated. We demonstrated this m-LAMP assay by detecting pathogenic Leptospira, which causes the re-emerging disease Leptospirosis. The lateral flow dipstick was developed to detect of three targets, the LAMP target amplicon, the LAMP internal control amplicon and a chromatography control. Three lines appeared on the dipstick, indicating positive results for all representative pathogenic Leptospira species, whereas two lines appeared, indicating negative results, for other bacterial species. The specificity of this biosensor assay was 100% when it was tested with 13 representative pathogenic Leptospira species, 2 intermediate Leptospira species, 1 non-pathogenic Leptospira species and 28 other bacteria species. This study found that this DNA biosensor was able to detect DNA at concentrations as low as 3.95 × 10{sup −1} genomic equivalent ml{sup −1}. An integrated m-LAMP and label-based lateral flow dipstick was successfully developed, promising simple and rapid visual detection in clinical diagnostics and serving as a point-of-care device. - Highlights: • We develop multiplex LAMP label-based lateral flow dipstick biosensor for detection of pathogenic Leptospira. • We design primers for multiplex LAMP targeting the conserved LipL32 gene of pathogenic Leptospira and LAMP

Using an autonomous Wave Glider to detect seawater anomalies related to submarine groundwater discharge - engineering challenge

Science.gov (United States)

Leibold, P.; Brueckmann, W.; Schmidt, M.; Balushi, H. A.; Abri, O. A.

2017-12-01

Coastal aquifer systems are amongst the most precious and vulnerable water resources worldwide. While differing in lateral and vertical extent they commonly show a complex interaction with the marine realm. Excessive groundwater extraction can cause saltwater intrusion from the sea into the aquifers, having a strongly negative impact on the groundwater quality. While the reverse pathway, the discharge of groundwater into the sea is well understood in principle, it's mechanisms and quantities not well constrained. We will present a project that combines onshore monitoring and modeling of groundwater in the coastal plain of Salalah, Oman with an offshore autonomous robotic monitoring system, the Liquid Robotics Wave Glider. Eventually, fluxes detected by the Wave Glider system and the onshore monitoring of groundwater will be combined into a 3-D flow model of the coastal and deeper aquifers. The main tool for offshore SGD investigation project is a Wave Glider, an autonomous vehicle based on a new propulsion technology. The Wave Glider is a low-cost satellite-connected marine craft, consisting of a combination of a sea-surface and an underwater component which is propelled by the conversion of ocean wave energy into forward thrust. While the wave energy propulsion system is purely mechanical, electrical energy for onboard computers, communication and sensors is provided by photovoltaic cells. For the project the SGD Wave Glider is being equipped with dedicated sensors to measure temperature, conductivity, Radon isotope (222Rn, 220Rn) activity concentration as well as other tracers of groundwater discharge. Dedicated software using this data input will eventually allow the Wave Glider to autonomously collect information and actively adapt its search pattern to hunt for spatial and temporal anomalies. Our presentation will focus on the engineering and operational challenges ofdetecting submarine groundwater discharges with the Wave Glider system in the Bay of Salalah

Detection of bacteriocins produced by plant pathogenic bacteria from the general Erwinia, Pseudomonas and Xanthomonas

International Nuclear Information System (INIS)

Biagi, C.M.R. de

1992-01-01

Detection of bacteriocin production was studied under distinct conditions using strains of plant pathogenic bacteria from the genera Erwinia, Pseudomonas and Xanthomonas. 58.06%, 79.31% and 40.00% of producing strains were found respectively in the three groups of bacteria using the 523 medium which was the best for the detection of bacteriocin production. Increasing agar concentrations added to the medium up to 1,5% improved the detection. The amount of medium added to the Petri dishes did not affect bacteriocin production. The longest incubation time (72 h.) improved the detection of haloes production. Ultra-violet irradiation in low dosages seems to improve the visualization of haloes production but this is dependent on the tested strains. (author)

In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

Directory of Open Access Journals (Sweden)

J.A. Khan

2013-09-01

Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

Purification and proteomics of pathogen-modified vacuoles and membranes

Directory of Open Access Journals (Sweden)

Jo-Ana eHerweg

2015-06-01

Full Text Available Certain pathogenic bacteria adopt an intracellular lifestyle and proliferate in eukaryotic host cells. The intracellular niche protects the bacteria from cellular and humoral components of the mammalian immune system, and at the same time, allows the bacteria to gain access to otherwise restricted nutrient sources. Yet, intracellular protection and access to nutrients comes with a price, i.e. the bacteria need to overcome cell-autonomous defense mechanisms, such as the bactericidal endocytic pathway. While a few bacteria rupture the early phagosome and escape into the host cytoplasm, most intracellular pathogens form a distinct, degradation-resistant and replication-permissive membranous compartment. Intracellular bacteria that form unique pathogen vacuoles include Legionella, Mycobacterium, Chlamydia, Simkania and Salmonella species. In order to understand the formation of these pathogen niches on a global scale and in a comprehensive and quantitative manner, an inventory of compartment-associated host factors is required. To this end, the intact pathogen compartments need to be isolated, purified and biochemically characterized. Here, we review recent progress on the isolation and purification of pathogen-modified vacuoles and membranes, as well as their proteomic characterization by mass spectrometry and different validation approaches. These studies provide the basis for further investigations on the specific mechanisms of pathogen-driven compartment formation.

Fault detection and isolation in GPS receiver autonomous integrity monitoring based on chaos particle swarm optimization-particle filter algorithm

Science.gov (United States)

Wang, Ershen; Jia, Chaoying; Tong, Gang; Qu, Pingping; Lan, Xiaoyu; Pang, Tao

2018-03-01

The receiver autonomous integrity monitoring (RAIM) is one of the most important parts in an avionic navigation system. Two problems need to be addressed to improve this system, namely, the degeneracy phenomenon and lack of samples for the standard particle filter (PF). However, the number of samples cannot adequately express the real distribution of the probability density function (i.e., sample impoverishment). This study presents a GPS receiver autonomous integrity monitoring (RAIM) method based on a chaos particle swarm optimization particle filter (CPSO-PF) algorithm with a log likelihood ratio. The chaos sequence generates a set of chaotic variables, which are mapped to the interval of optimization variables to improve particle quality. This chaos perturbation overcomes the potential for the search to become trapped in a local optimum in the particle swarm optimization (PSO) algorithm. Test statistics are configured based on a likelihood ratio, and satellite fault detection is then conducted by checking the consistency between the state estimate of the main PF and those of the auxiliary PFs. Based on GPS data, the experimental results demonstrate that the proposed algorithm can effectively detect and isolate satellite faults under conditions of non-Gaussian measurement noise. Moreover, the performance of the proposed novel method is better than that of RAIM based on the PF or PSO-PF algorithm.

Autonomous Aeromagnetic Surveys Using a Fluxgate Magnetometer

Directory of Open Access Journals (Sweden)

Douglas G. Macharet

2016-12-01

Full Text Available Recent advances in the research of autonomous vehicles have showed a vast range of applications, such as exploration, surveillance and environmental monitoring. Considering the mining industry, it is possible to use such vehicles in the prospection of minerals of commercial interest beneath the ground. However, tasks such as geophysical surveys are highly dependent on specific sensors, which mostly are not designed to be used in these new range of autonomous vehicles. In this work, we propose a novel magnetic survey pipeline that aims to increase versatility, speed and robustness by using autonomous rotary-wing Unmanned Aerial Vehicles (UAVs. We also discuss the development of a state-of-the-art three-axis fluxgate, where our goal in this work was to refine and adjust the sensor topology and coupled electronics specifically for this type of vehicle and application. The sensor was built with two ring-cores using a specially developed stress-annealed CoFeSiB amorphous ribbon, in order to get sufficient resolution to detect concentrations of small ferrous minerals. Finally, we report on the results of experiments performed with a real UAV in an outdoor environment, showing the efficacy of the methodology in detecting an artificial ferrous anomaly.

The role of serum methylglyoxal on diabetic peripheral and cardiovascular autonomic neuropathy

DEFF Research Database (Denmark)

Hansen, C.S.; Jensen, T.M.; Jensen, J.S.

2015-01-01

AIMS: Cardiovascular autonomic neuropathy and diabetic peripheral neuropathy are common diabetic complications and independent predictors of cardiovascular disease. The glucose metabolite methylglyoxal has been suggested to play a causal role in the pathogeneses of diabetic peripheral neuropathy...... and possibly diabetic cardiovascular autonomic neuropathy. The aim of this study was to investigate the cross-sectional association between serum methylglyoxal and diabetic peripheral neuropathy and cardiovascular autonomic neuropathy in a subset of patients in the ADDITION-Denmark study with short-term screen......-detected Type 2 diabetes (duration ~ 5.8 years). METHODS: The patients were well controlled with regard to HbA(1c), lipids and blood pressure. Cardiovascular autonomic neuropathy was assessed by measures of resting heart rate variability and cardiovascular autonomic reflex tests. Diabetic peripheral neuropathy...

Integrated optical detection of autonomous capillary microfluidic immunoassays:a hand-held point-of-care prototype.

Science.gov (United States)

Novo, P; Chu, V; Conde, J P

2014-07-15

The miniaturization of biosensors using microfluidics has potential in enabling the development of point-of-care devices, with the added advantages of reduced time and cost of analysis with limits-of-detection comparable to those obtained through traditional laboratory techniques. Interfacing microfluidic devices with the external world can be difficult especially in aspects involving fluid handling and the need for simple sample insertion that avoids special equipment or trained personnel. In this work we present a point-of-care prototype system by integrating capillary microfluidics with a microfabricated photodiode array and electronic instrumentation into a hand-held unit. The capillary microfluidic device is capable of autonomous and sequential fluid flow, including control of the average fluid velocity at any given point of the analysis. To demonstrate the functionality of the prototype, a model chemiluminescence ELISA was performed. The performance of the integrated optical detection in the point-of-care prototype is equal to that obtained with traditional bench-top instrumentation. The photodiode signals were acquired, displayed and processed by a simple graphical user interface using a computer connected to the microcontroller through USB. The prototype performed integrated chemiluminescence ELISA detection in about 15 min with a limit-of-detection of ≈2 nM with an antibody-antigen affinity constant of ≈2×10(7) M(-1). Copyright © 2014 Elsevier B.V. All rights reserved.

Detection of pathogenic micro-organisms on children's hands and toys during play.

Science.gov (United States)

Martínez-Bastidas, T; Castro-del Campo, N; Mena, K D; Castro-del Campo, N; León-Félix, J; Gerba, C P; Chaidez, C

2014-06-01

This study aimed to determine if the children's leisure activities impact the presence of pathogens on their hands and toys. To assess the microbiological hazard in playground areas, a pilot study that included 12 children was conducted. We then conducted an intervention study; children's hands and toys were washed before playing. Faecal coliforms, pathogenic bacteria and Giardia lamblia were quantified by membrane filtration, selective media and flotation techniques, respectively; rotavirus, hepatitis A and rhinovirus by RT-PCR. Pilot study results revealed faecal contamination on children's hands and toys after playing on sidewalks and in public parks. Pathogenic bacteria, hepatitis A and G. lamblia on children's hands were also found. In the intervention study, Staphylococcus aureus and Klebsiella pneumoniae were found on children's hands at concentrations up to 2·5 × 10(4) and 1 × 10(4) CFU hands(-1), respectively. E. coli and Kl. pneumoniae were detected on toys (2·4 × 10(3) and 2·7 × 10(4) CFU toy(-1), respectively). Salmonella spp, Serratia spp and G. lamblia cysts were also present on toys. Children's play activities influence microbial presence on hands and toys; the transfer seems to occur in both ways. Control strategy needs to be implemented to protect children from infectious diseases. © 2014 The Society for Applied Microbiology.

Detection of Pathogenic Viruses in Sewage Provided Early Warnings of Hepatitis A Virus and Norovirus Outbreaks

Science.gov (United States)

Hellmér, Maria; Paxéus, Nicklas; Magnius, Lars; Enache, Lucica; Arnholm, Birgitta; Johansson, Annette; Bergström, Tomas

2014-01-01

Most persons infected with enterically transmitted viruses shed large amounts of virus in feces for days or weeks, both before and after onset of symptoms. Therefore, viruses causing gastroenteritis may be detected in wastewater, even if only a few persons are infected. In this study, the presence of eight pathogenic viruses (norovirus, astrovirus, rotavirus, adenovirus, Aichi virus, parechovirus, hepatitis A virus [HAV], and hepatitis E virus) was investigated in sewage to explore whether their identification could be used as an early warning of outbreaks. Samples of the untreated sewage were collected in proportion to flow at Ryaverket, Gothenburg, Sweden. Daily samples collected during every second week between January and May 2013 were pooled and analyzed for detection of viruses by concentration through adsorption to milk proteins and PCR. The largest amount of noroviruses was detected in sewage 2 to 3 weeks before most patients were diagnosed with this infection in Gothenburg. The other viruses were detected at lower levels. HAV was detected between weeks 5 and 13, and partial sequencing of the structural VP1protein identified three different strains. Two strains were involved in an ongoing outbreak in Scandinavia and were also identified in samples from patients with acute hepatitis A in Gothenburg during spring of 2013. The third strain was unique and was not detected in any patient sample. The method used may thus be a tool to detect incipient outbreaks of these viruses and provide early warning before the causative pathogens have been recognized in health care. PMID:25172863

Detection of HPV and co-infecting pathogens in healthy Italian women by multiplex real-time PCR.

Science.gov (United States)

Camporiondo, Maria Pia; Farchi, Francesca; Ciccozzi, Massimo; Denaro, Aurelia; Gallone, Domenica; Maracchioni, Fabio; Favalli, Cartesio; Ciotti, Marco

2016-01-01

Several pathogens can be transmitted sexually and are an important cause of morbidity among sexually active women. The aim of the study was to detect the presence of human papillomavirus (HPV), Chlamydia trachomatis (CT), Neisseria gonorrhoeae (NG), Trichomonas vaginalis (TV), Mycoplasma hominis (MH), Mycoplasma genitalium (MG), Ureaplasma urealyticum (UU), and Ureaplasma parvum (UP) in a group of 309 healthy women enrolled at the San Camillo - Forlanini hospital of Rome by using two multiplex real-time PCR assays based on TOCE® technology. The women's ages ranged from 34 to 60 years, median 49 [IQR 45-54]. Of the 309 women tested, HPV DNA was detected in 77/309 (24.9%) patients. Of these, 44 (14.2%) harboured a single infection while 33 (10.7%) were infected by multiple genotypes. Prevalence of HPV infection was highest among females aged 40-50 years (15.2%). Of the other pathogens sought, CT, MG and NG were not detected while positive results were found for MH (12/309, 3.9%), TV (4/309, 1.3%), UP (89/309, 28.8%) and UU (14/309, 4.5%). Co-infections were as follows: 5 MH/HPV, 4 TV/HPV, 34 UP/HPV and 9 UU/HPV. In HPV-positive women, the probability of being infected by UP and UU was 2.5 (p=0.00045) and 6 fold higher (p=0.0016) than in HPV-negative women. The study supports the use of multiplex real-time PCR assays in a routine diagnostic setting. The high sensitivity and specificity of these assays along with the simultaneous detection of the most common sexually transmitted pathogens confers an advantage with respect to more obsolete methods reducing costs and time to diagnosis.

Autonomic headache with autonomic seizures: a case report.

Science.gov (United States)

Ozge, Aynur; Kaleagasi, Hakan; Yalçin Tasmertek, Fazilet

2006-10-01

The aim of the report is to present a case of an autonomic headache associated with autonomic seizures. A 19-year-old male who had had complex partial seizures for 15 years was admitted with autonomic complaints and left hemicranial headache, independent from seizures, that he had had for 2 years and were provoked by watching television. Brain magnetic resonance imaging showed right hippocampal sclerosis and electroencephalography revealed epileptic activity in right hemispheric areas. Treatment with valproic acid decreased the complaints. The headache did not fulfil the criteria for the diagnosis of trigeminal autonomic cephalalgias, and was different from epileptic headache, which was defined as a pressing type pain felt over the forehead for several minutes to a few hours. Although epileptic headache responds to anti-epileptics and the complaints of the present case decreased with antiepileptics, it has been suggested that the headache could be a non-trigeminal autonomic headache instead of an epileptic headache.

Environmentally Friendly Coating Technology for Autonomous Corrosion Control

Science.gov (United States)

Calle, Luz M.; Li, Wenyan; Buhrow, Jerry W.; Johnsey, Marissa N.; Jolley, Scott T.; Pearman, Benjamin P.; Zhang, Xuejun; Fitzpatrick, Lilliana; Gillis, Mathew; Blanton, Michael;

Molecular-based detection of the gastrointestinal pathogen Campylobacter ureolyticus in unpasteurized milk samples from two cattle farms in Ireland

Directory of Open Access Journals (Sweden)

Koziel Monika

2012-11-01

Full Text Available Abstract Campylobacter jejuni and coli are collectively regarded as the most prevalent cause of bacterial foodborne illness worldwide. An emerging species, Campylobacter ureolyticus has recently been detected in patients with gastroenteritis, however, the source of this organism has, until now, remained unclear. Herein, we describe the molecular-based detection of this pathogen in bovine faeces (1/20 and unpasteurized milk (6/47 but not in poultry (chicken wings and caeca. This is, to the best of our knowledge, the first report of the presence of this potential gastrointestinal pathogen in an animal source, possibly suggesting a route for its transmission to humans.

Molecular Biosensors for Electrochemical Detection of Infectious Pathogens in Liquid Biopsies: Current Trends and Challenges.

Science.gov (United States)

Campuzano, Susana; Yáñez-Sedeño, Paloma; Pingarrón, José Manuel

2017-11-03

Rapid and reliable diagnosis of infectious diseases caused by pathogens, and timely initiation of appropriate treatment are critical determinants to promote optimal clinical outcomes and general public health. Conventional in vitro diagnostics for infectious diseases are time-consuming and require centralized laboratories, experienced personnel and bulky equipment. Recent advances in electrochemical affinity biosensors have demonstrated to surpass conventional standards in regards to time, simplicity, accuracy and cost in this field. The tremendous potential offered by electrochemical affinity biosensors to detect on-site infectious pathogens at clinically relevant levels in scarcely treated body fluids is clearly stated in this review. The development and application of selected examples using different specific receptors, assay formats and electrochemical approaches focusing on the determination of specific circulating biomarkers of different molecular (genetic, regulatory and functional) levels associated with bacterial and viral pathogens are critically discussed. Existing challenges still to be addressed and future directions in this rapidly advancing and highly interesting field are also briefly pointed out.

Direct immobilization of antibodies on Zn-doped Fe_3O_4 nanoclusters for detection of pathogenic bacteria

International Nuclear Information System (INIS)

Pal, Monalisa; Lee, Sanghee; Kwon, Donghoon; Hwang, Jeongin; Lee, Hyeonjeong; Hwang, Seokyung; Jeon, Sangmin

2017-01-01

Zinc-doped magnetic nanoclusters (Zn-MNCs) were synthesized and used to detect pathogenic bacteria in milk. Hydrothermally synthesized Zn-MNCs exhibited stronger magnetic properties than pure MNCs, which facilitated the magnetic separation from the sample using a permanent magnet. The presence of accessible Zn sites allows the direct immobilization of half-fragmented antibodies over Zn-MNCs through strong Zn−S bonds and prevents the tedious multiple steps of molecular functionalization or coating with costly noble metals prior to conjugation with an antibody. After the capture and magnetic separation of Salmonella in milk using the antibody-functionalized Zn-MNCs, the concentration of bacteria was determined with a portable ATP luminometer and the detection limit was found to be 10 CFU/mL. - Highlights: • Zn-doped Fe_3O_4 nanoclusters (Zn-MNCs) were synthesized by hydrothermal method. • Antibodies were directly immobilized over Zn-MNCs through strong Zn–S_t_h_i_o_l bonds. • Higher magnetization of Zn-MNCs than pure MNCs facilitates the magnetic separation. • Detection limit of pathogenic bacteria in milk was found to be 10 cfu/mL. • Cost effective, sensitive and selective detection of bacteria.

Establishment and Application of a Visual DNA Microarray for the Detection of Food-borne Pathogens.

Science.gov (United States)

Li, Yongjin

2016-01-01

The accurate detection and identification of food-borne pathogenic microorganisms is critical for food safety nowadays. In the present work, a visual DNA microarray was established and applied to detect pathogens commonly found in food, including Salmonella enterica, Shigella flexneri, E. coli O157:H7 and Listeria monocytogenes in food samples. Multiplex PCR (mPCR) was employed to simultaneously amplify specific gene fragments, fimY for Salmonella, ipaH for Shigella, iap for L. monocytogenes and ECs2841 for E. coli O157:H7, respectively. Biotinylated PCR amplicons annealed to the microarray probes were then reacted with a streptavidin-alkaline phosphatase conjugate and nitro blue tetrazolium/5-bromo-4-chloro-3'-indolylphosphate, p-toluidine salt (NBT/BCIP); the positive results were easily visualized as blue dots formatted on the microarray surface. The performance of a DNA microarray was tested against 14 representative collection strains and mock-contamination food samples. The combination of mPCR and a visual micro-plate chip specifically and sensitively detected Salmonella enterica, Shigella flexneri, E. coli O157:H7 and Listeria monocytogenes in standard strains and food matrices with a sensitivity of ∼10(2) CFU/mL of bacterial culture. Thus, the developed method is advantageous because of its high throughput, cost-effectiveness and ease of use.

Molecular detection of tick-borne pathogens in cattle from Southwestern Ethiopia.

Directory of Open Access Journals (Sweden)

Zerihun Hailemariam

Full Text Available Tick-borne diseases (TBDs cause significant losses among livestock and impact the livelihoods of resource-poor farming communities worldwide. In Ethiopia, detailed studies on the epidemiology of tick-borne pathogens (TBPs in cattle using sensitive molecular detection methods are scarce. The objective of this study was to determine the prevalence and species composition of bovine TBPs of veterinary significance in local cattle populations. A comprehensive cross-sectional epidemiological study was conducted in cattle populations of Illubabor zone in Southwestern Ethiopia from June to August 2013. For this purpose, blood samples were collected from 392 cattle. A combination of polymerase chain reaction (PCR and a Reverse Line Blot (RLB hybridization assay was employed for the detection of TBPs in these samples. The PCR/RLB results of the 392 blood samples indicated a high overall prevalence of 96.9% for TBPs, including Theileria mutans (66.1%, Theileria orientalis (51.8%, Anaplasma sp. Omatjenne (25.5%, Anaplasma marginale (14.5%, Babesia bigemina (14.0% and Theileria velifera (13.0% and minor occurrences of Ehrlichia ruminantium (0.5% and Ehrlichia minasensis (0.26%. Moreover, three novel Anaplasma genotypes were detected in bovine blood samples. A phylogenetic analysis revealed that they most likely represent three, but at least two, new species. The prevalence of the three novel Anaplasma species, preliminary designated as Anaplasma sp. Hadesa, Anaplasma sp. Saso and Anaplasma sp. Dedessa, was 12.5%, 14.3% and 5.6%, respectively. Overall, a total of 227 cattle (57.9% were found to be co-infected with two or more TBPs simultaneously and 86 different species combinations were observed. The findings show a very high burden of infection of cattle with TBPs in Ethiopia. The high frequency of co-infections suggests that clinical manifestations might be complex. Further research is required to determine the pathogenicity, host cell types and vector of

Autonomous Cryogenic Load Operations: Knowledge-Based Autonomous Test Engineer

Science.gov (United States)

Schrading, J. Nicolas

2013-01-01

The Knowledge-Based Autonomous Test Engineer (KATE) program has a long history at KSC. Now a part of the Autonomous Cryogenic Load Operations (ACLO) mission, this software system has been sporadically developed over the past 20 years. Originally designed to provide health and status monitoring for a simple water-based fluid system, it was proven to be a capable autonomous test engineer for determining sources of failure in the system. As part of a new goal to provide this same anomaly-detection capability for a complicated cryogenic fluid system, software engineers, physicists, interns and KATE experts are working to upgrade the software capabilities and graphical user interface. Much progress was made during this effort to improve KATE. A display of the entire cryogenic system's graph, with nodes for components and edges for their connections, was added to the KATE software. A searching functionality was added to the new graph display, so that users could easily center their screen on specific components. The GUI was also modified so that it displayed information relevant to the new project goals. In addition, work began on adding new pneumatic and electronic subsystems into the KATE knowledge base, so that it could provide health and status monitoring for those systems. Finally, many fixes for bugs, memory leaks, and memory errors were implemented and the system was moved into a state in which it could be presented to stakeholders. Overall, the KATE system was improved and necessary additional features were added so that a presentation of the program and its functionality in the next few months would be a success.

Vision-Aided Autonomous Landing and Ingress of Micro Aerial Vehicles

Science.gov (United States)

Brockers, Roland; Ma, Jeremy C.; Matthies, Larry H.; Bouffard, Patrick

2012-01-01

Micro aerial vehicles have limited sensor suites and computational power. For reconnaissance tasks and to conserve energy, these systems need the ability to autonomously land at vantage points or enter buildings (ingress). But for autonomous navigation, information is needed to identify and guide the vehicle to the target. Vision algorithms can provide egomotion estimation and target detection using input from cameras that are easy to include in miniature systems.

Multiplex real-time PCR (TaqMan) assay for the simultaneous detection and discrimination of potato powdery and common scab diseases and pathogens.

Science.gov (United States)

Qu, X S; Wanner, L A; Christ, B J

2011-03-01

To develop a multiplex real-time PCR assay using TaqMan probes for the simultaneous detection and discrimination of potato powdery scab and common scab, two potato tuber diseases with similar symptoms, and the causal pathogens Spongospora subterranea and plant pathogenic Streptomyces spp. Real-time PCR primers and a probe for S. subterranea were designed based on the DNA sequence of the ribosomal RNA ITS2 region. Primers and a probe for pathogenic Streptomyces were designed based on the DNA sequence of the txtAB genes. The two sets of primer pairs and probes were used in a single real-time PCR assay. The multiplex real-time PCR assay was confirmed to be specific for S. subterranea and pathogenic Streptomyces. The assay detected DNA quantities of 100 fg for each of the two pathogens and linear responses and high correlation coefficients between the amount of DNA and C(t) values for each pathogen were achieved. The presence of two sets of primer pairs and probes and of plant extracts did not alter the sensitivity and efficiency of multiplex PCR amplification. Using the PCR assay, we could discriminate between powdery scab and common scab tubers with similar symptoms. Common scab and powdery scab were detected in some tubers with no visible symptoms. Mixed infections of common scab and powdery scab on single tubers were also revealed. This multiplex real-time PCR assay is a rapid, cost efficient, specific and sensitive tool for the simultaneous detection and discrimination of the two pathogens on infected potato tubers when visual symptoms are inconclusive or not present. Accurate and quick identification and discrimination of the cause of scab diseases on potatoes will provide critical information to potato growers and researchers for disease management. This is important because management strategies for common and powdery scab diseases are very different. © 2011 The Authors. Journal of Applied Microbiology © 2011 The Society for Applied Microbiology.

An autonomous surface discontinuity detection and quantification method by digital image correlation and phase congruency

Science.gov (United States)

Cinar, A. F.; Barhli, S. M.; Hollis, D.; Flansbjer, M.; Tomlinson, R. A.; Marrow, T. J.; Mostafavi, M.

2017-09-01

Digital image correlation has been routinely used to measure full-field displacements in many areas of solid mechanics, including fracture mechanics. Accurate segmentation of the crack path is needed to study its interaction with the microstructure and stress fields, and studies of crack behaviour, such as the effect of closure or residual stress in fatigue, require data on its opening displacement. Such information can be obtained from any digital image correlation analysis of cracked components, but it collection by manual methods is quite onerous, particularly for massive amounts of data. We introduce the novel application of Phase Congruency to detect and quantify cracks and their opening. Unlike other crack detection techniques, Phase Congruency does not rely on adjustable threshold values that require user interaction, and so allows large datasets to be treated autonomously. The accuracy of the Phase Congruency based algorithm in detecting cracks is evaluated and compared with conventional methods such as Heaviside function fitting. As Phase Congruency is a displacement-based method, it does not suffer from the noise intensification to which gradient-based methods (e.g. strain thresholding) are susceptible. Its application is demonstrated to experimental data for cracks in quasi-brittle (Granitic rock) and ductile (Aluminium alloy) materials.

Development and application of an eDNA method to detect and quantify a pathogenic parasite in aquatic ecosystems.

Science.gov (United States)

Huver, J R; Koprivnikar, J; Johnson, P T J; Whyard, S

2015-06-01

Approaches based on organismal DNA found in the environment (eDNA) have become increasingly utilized for ecological studies and biodiversity inventories as an alternative to traditional field survey methods. Such DNA-based techniques have largely been used to establish the presence of free-living organisms, but have much potential for detecting and quantifying infectious agents in the environment, which is necessary to evaluate disease risk. We developed an eDNA method to examine the distribution and abundance of the trematode Ribeiroia ondatrae, a pathogenic parasite known to cause malformations in North American amphibians. In addition to comparing this eDNA approach to classical host necropsy, we examined the detectability of R. ondatrae in water samples subject to different degradation conditions (time and temperature). Our test exhibited high specificity and sensitivity to R. ondatrae, capable of detecting as little as 14 fg (femtograms) of this parasite's DNA (1/2500th of a single infectious stage) from field water samples. Compared to our results from amphibian host necropsy, quantitative PCR was -90% concordant with respect to R. ondatrae detection from 15 field sites and was also a significant predictor of host infection abundance. DNA was still detectable in lab samples after 21 days at 25°C, indicating that our method is robust to field conditions. By comparing the advantages and disadvantages of eDNA vs. traditional survey methods for determining pathogen presence and abundance in the field, we found that the lower cost and effort associated with eDNA approaches provide many advantages. The development of alternative tools is critical for disease ecology, as wildlife management and conservation efforts require reliable establishment and monitoring of pathogens.

Comparative genome analysis of pathogenic and non-pathogenic Clavibacter strains reveals adaptations to their lifestyle

OpenAIRE

Załuga, Joanna; Stragier, Pieter; Baeyen, Steve; Haegeman, Annelies; Van Vaerenbergh, Johan; Maes, Martine; De Vos, Paul

2014-01-01

Background The genus Clavibacter harbors economically important plant pathogens infecting agricultural crops such as potato and tomato. Although the vast majority of Clavibacter strains are pathogenic, there is an increasing number of non-pathogenic isolates reported. Non-pathogenic Clavibacter strains isolated from tomato seeds are particularly problematic because they affect the current detection and identification tests for Clavibacter michiganensis subsp. michiganensis (Cmm), which is reg...

Nanomaterial-based sensors for detection of foodborne bacterial pathogens and toxins as well as pork adulteration in meat products

Directory of Open Access Journals (Sweden)

B. Stephen Inbaraj

2016-01-01

Full Text Available Food safety draws considerable attention in the modern pace of the world owing to rapid-changing food recipes and food habits. Foodborne illnesses associated with pathogens, toxins, and other contaminants pose serious threat to human health. Besides, a large amount of money is spent on both analyses and control measures, which causes significant loss to the food industry. Conventional detection methods for bacterial pathogens and toxins are time consuming and laborious, requiring certain sophisticated instruments and trained personnel. In recent years, nanotechnology has emerged as a promising field for solving food safety issues in terms of detecting contaminants, enabling controlled release of preservatives to extend the shelf life of foods, and improving food-packaging strategies. Nanomaterials including metal oxide and metal nanoparticles, carbon nanotubes, and quantum dots are gaining a prominent role in the design of sensors and biosensors for food analysis. In this review, various nanomaterial-based sensors reported in the literature for detection of several foodborne bacterial pathogens and toxins are summarized highlighting their principles, advantages, and limitations in terms of simplicity, sensitivity, and multiplexing capability. In addition, the application through a noncross-linking method without the need for any surface modification is also presented for detection of pork adulteration in meat products.

Autonomous navigation - The ARMMS concept. [Autonomous Redundancy and Maintenance Management Subsystem

Science.gov (United States)

Wood, L. J.; Jones, J. B.; Mease, K. D.; Kwok, J. H.; Goltz, G. L.; Kechichian, J. A.

1984-01-01

A conceptual design is outlined for the navigation subsystem of the Autonomous Redundancy and Maintenance Management Subsystem (ARMMS). The principal function of this navigation subsystem is to maintain the spacecraft over a specified equatorial longitude to within + or - 3 deg. In addition, the navigation subsystem must detect and correct internal faults. It comprises elements for a navigation executive and for orbit determination, trajectory, maneuver planning, and maneuver command. Each of these elements is described. The navigation subsystem is to be used in the DSCS III spacecraft.

Improving vector-borne pathogen surveillance: A laboratory-based study exploring the potential to detect dengue virus and malaria parasites in mosquito saliva.

Science.gov (United States)

Melanson, Vanessa R; Jochim, Ryan; Yarnell, Michael; Ferlez, Karen Bingham; Shashikumar, Soumya; Richardson, Jason H

2017-01-01

Vector-borne pathogen surveillance programmes typically rely on the collection of large numbers of potential vectors followed by screening protocols focused on detecting pathogens in the arthropods. These processes are laborious, time consuming, expensive, and require screening of large numbers of samples. To streamline the surveillance process, increase sample throughput, and improve cost-effectiveness, a method to detect dengue virus and malaria parasites (Plasmodium falciparum) by leveraging the sugar-feeding behaviour of mosquitoes and their habit of expectorating infectious agents in their saliva during feeding was investigated in this study. Dengue virus 2 (DENV-2) infected female Aedes aegypti mosquitoes and P. falciparum infected female Anopheles stephensi mosquitoes were allowed to feed on honey coated Flinders Technical Associates -FTA® cards dyed with blue food colouring. The feeding resulted in deposition of saliva containing either DENV-2 particles or P. falciparum sporozoites onto the FTA card. Nucleic acid was extracted from each card and the appropriate real-time PCR (qPCR) assay was run to detect the pathogen of interest. As little as one plaque forming unit (PFU) of DENV-2 and as few as 60 P. falciparum parasites deposited on FTA cards from infected mosquitoes were detected via qPCR. Hence, their use to collect mosquito saliva for pathogen detection is a relevant technique for vector surveillance. This study provides laboratory confirmation that FTA cards can be used to capture and stabilize expectorated DENV-2 particles and P. falciparum sporozoites from infectious, sugar-feeding mosquitoes in very low numbers. Thus, the FTA card-based mosquito saliva capture method offers promise to overcome current limitations and revolutionize traditional mosquito-based pathogen surveillance programmes. Field testing and further method development are required to optimize this strategy.

Hyperspectral imaging using a color camera and its application for pathogen detection

Science.gov (United States)

Yoon, Seung-Chul; Shin, Tae-Sung; Heitschmidt, Gerald W.; Lawrence, Kurt C.; Park, Bosoon; Gamble, Gary

2015-02-01

This paper reports the results of a feasibility study for the development of a hyperspectral image recovery (reconstruction) technique using a RGB color camera and regression analysis in order to detect and classify colonies of foodborne pathogens. The target bacterial pathogens were the six representative non-O157 Shiga-toxin producing Escherichia coli (STEC) serogroups (O26, O45, O103, O111, O121, and O145) grown in Petri dishes of Rainbow agar. The purpose of the feasibility study was to evaluate whether a DSLR camera (Nikon D700) could be used to predict hyperspectral images in the wavelength range from 400 to 1,000 nm and even to predict the types of pathogens using a hyperspectral STEC classification algorithm that was previously developed. Unlike many other studies using color charts with known and noise-free spectra for training reconstruction models, this work used hyperspectral and color images, separately measured by a hyperspectral imaging spectrometer and the DSLR color camera. The color images were calibrated (i.e. normalized) to relative reflectance, subsampled and spatially registered to match with counterpart pixels in hyperspectral images that were also calibrated to relative reflectance. Polynomial multivariate least-squares regression (PMLR) was previously developed with simulated color images. In this study, partial least squares regression (PLSR) was also evaluated as a spectral recovery technique to minimize multicollinearity and overfitting. The two spectral recovery models (PMLR and PLSR) and their parameters were evaluated by cross-validation. The QR decomposition was used to find a numerically more stable solution of the regression equation. The preliminary results showed that PLSR was more effective especially with higher order polynomial regressions than PMLR. The best classification accuracy measured with an independent test set was about 90%. The results suggest the potential of cost-effective color imaging using hyperspectral image

A novel multiplex PCR assay for simultaneous detection of nine clinically significant bacterial pathogens associated with bovine mastitis.

Science.gov (United States)

Ashraf, Aqeela; Imran, Muhammad; Yaqub, Tahir; Tayyab, Muhammad; Shehzad, Wasim; Thomson, Peter C

2017-06-01

For rapid and simultaneous detection of nine bovine mastitic pathogens, a sensitive and specific multiplex PCR assay was developed. The assay was standardized using reference strains and validated on mastitic milk cultures which were identified to species level based on 16S rRNA sequencing. Multiplex PCR assay also efficiently detected the target bacterial strains directly from milk. The detection limit of the assay was up to 50 pg for DNA isolated from pure cultures and 10 4  CFU/ml for spiked milk samples. As estimated by latent class analysis, the assay was sensitive up to 88% and specific up to 98% for targeted mastitic pathogens, compared with the bacterial culture method and the 16S rRNA sequence analysis. This novel molecular assay could be useful for monitoring and maintaining the bovine udder health, ensuring the bacteriological safety of milk, and conducting epidemiological studies. Copyright © 2017 Elsevier Ltd. All rights reserved.

Improved Object Proposals with Geometrical Features for Autonomous Driving

Directory of Open Access Journals (Sweden)

Yiliu Feng

2017-01-01

Full Text Available This paper aims at generating high-quality object proposals for object detection in autonomous driving. Most existing proposal generation methods are designed for the general object detection, which may not perform well in a particular scene. We propose several geometrical features suited for autonomous driving and integrate them into state-of-the-art general proposal generation methods. In particular, we formulate the integration as a feature fusion problem by fusing the geometrical features with existing proposal generation methods in a Bayesian framework. Experiments on the challenging KITTI benchmark demonstrate that our approach improves the existing methods significantly. Combined with a convolutional neural net detector, our approach achieves state-of-the-art performance on all three KITTI object classes.

Autonomous Collision-Free Navigation of Microvehicles in Complex and Dynamically Changing Environments.

Science.gov (United States)

Li, Tianlong; Chang, Xiaocong; Wu, Zhiguang; Li, Jinxing; Shao, Guangbin; Deng, Xinghong; Qiu, Jianbin; Guo, Bin; Zhang, Guangyu; He, Qiang; Li, Longqiu; Wang, Joseph

2017-09-26

Self-propelled micro- and nanoscale robots represent a rapidly emerging and fascinating robotics research area. However, designing autonomous and adaptive control systems for operating micro/nanorobotics in complex and dynamically changing environments, which is a highly demanding feature, is still an unmet challenge. Here we describe a smart microvehicle for precise autonomous navigation in complicated environments and traffic scenarios. The fully autonomous navigation system of the smart microvehicle is composed of a microscope-coupled CCD camera, an artificial intelligence planner, and a magnetic field generator. The microscope-coupled CCD camera provides real-time localization of the chemically powered Janus microsphere vehicle and environmental detection for path planning to generate optimal collision-free routes, while the moving direction of the microrobot toward a reference position is determined by the external electromagnetic torque. Real-time object detection offers adaptive path planning in response to dynamically changing environments. We demonstrate that the autonomous navigation system can guide the vehicle movement in complex patterns, in the presence of dynamically changing obstacles, and in complex biological environments. Such a navigation system for micro/nanoscale vehicles, relying on vision-based close-loop control and path planning, is highly promising for their autonomous operation in complex dynamic settings and unpredictable scenarios expected in a variety of realistic nanoscale scenarios.

A Low Cost Sensors Approach for Accurate Vehicle Localization and Autonomous Driving Application.

Science.gov (United States)

Vivacqua, Rafael; Vassallo, Raquel; Martins, Felipe

2017-10-16

Autonomous driving in public roads requires precise localization within the range of few centimeters. Even the best current precise localization system based on the Global Navigation Satellite System (GNSS) can not always reach this level of precision, especially in an urban environment, where the signal is disturbed by surrounding buildings and artifacts. Laser range finder and stereo vision have been successfully used for obstacle detection, mapping and localization to solve the autonomous driving problem. Unfortunately, Light Detection and Ranging (LIDARs) are very expensive sensors and stereo vision requires powerful dedicated hardware to process the cameras information. In this context, this article presents a low-cost architecture of sensors and data fusion algorithm capable of autonomous driving in narrow two-way roads. Our approach exploits a combination of a short-range visual lane marking detector and a dead reckoning system to build a long and precise perception of the lane markings in the vehicle's backwards. This information is used to localize the vehicle in a map, that also contains the reference trajectory for autonomous driving. Experimental results show the successful application of the proposed system on a real autonomous driving situation.

Detection of pathogenic Leptospira from selected environment in Kelantan and Terengganu, Malaysia.

Science.gov (United States)

Ridzlan, F R; Bahaman, A R; Khairani-Bejo, S; Mutalib, A R

2010-12-01

Leptospirosis is recognized as one of the important zoonotic diseases in the world including Malaysia. A total of 145 soil and water samples were collected from selected National Service Training Centres (NSTC) in Kelantan and Terengganu. The samples were inoculated into modified semisolid Ellinghausen McCullough Johnson Harris (EMJH) medium, incubated at room temperature for 1 month and examined under the dark-field microscope. Positive growth of the leptospiral isolates were then confirmed with 8-Azaguanine Test, Polymerase Chain Reaction (PCR) assay and Microscopic Agglutination Test (MAT). Fifteen cultures (10.34%) exhibited positive growths which were seen under dark field microscope whilst only 20% (3/15) were confirmed as pathogenic species. based on 8-Azaguanine Test and PCR. Serological identification of the isolates with MAT showed that hebdomadis was the dominant serovar in Terengganu. Pathogenic leptospires can be detected in Malaysian environment and this has the potential to cause an outbreak. Therefore, precautionary steps against leptospirosis should be taken by camp authorities to ensure the safety of trainees.

Molecular and serological detection of tick-borne pathogens in donkeys (Equus asinus) in Italy.

Science.gov (United States)

Veronesi, Fabrizia; Morganti, Giulia; Ravagnan, Silvia; Laus, Fulvio; Spaterna, Andrea; Diaferia, Manuela; Moretti, Annabella; Fioretti, Daniela Piergili; Capelli, Gioia

2014-10-10

Donkeys, owing to the frequent outdoor activity, are exposed to a high risk of infection with tick-borne pathogens. This work aimed to detect exposure to Theileria equi, Babesia caballi, Anaplasma phagocytophilum and Borrelia burgdorferi s.l. of donkeys reared in Central Italy. For this purpose 122 adult donkeys were selected within 11 herds and submitted to blood collection. IgG antibodies to T. equi, B. caballi, A. phagocytophilum and B. burgdorferi s.l. were detected by IFAT. Conventional PCRs targeting the genes MSP2 and the flagellin were used for the detection of A. phagocytophilum and B. burgdorferi s.l. respectively and a Real Time PCR Sybr Green was used to detect Babesia/Theileria spp…. The species identity was determined by amplicons sequencing. Forty eight (39.3%) and 58 (47.5%) animals tested positive for T. equi and B. caballi antibodies, respectively; nine animals (7.4%) were found positive for antibodies against A. phagocytophilum whereas negative results were obtained for B. burgdorferi s.l. Twenty-six (21.3%) animals showed antibodies for both T. equi and B. caballi. Twenty-three (18.8%) donkeys were positive to Babesia/Theileria spp. PCR assay. Out of 21 sequenced amplicons, 20 were identified as T. equi, belonging to three main groups designated A, B and D and one as B. caballi group A. Neither A. phagocytophilum nor B. burgdorferi PCR results were positive. The study showed a high exposure of donkeys to tick-borne pathogens and provides information on the genetic identity of the T. equi strains circulating in Central Italy. Copyright © 2014 Elsevier B.V. All rights reserved.

Autonomic Neuropathy

Science.gov (United States)

... risk of autonomic neuropathy. Other diseases. Amyloidosis, porphyria, hypothyroidism and cancer (usually due to side effects from treatment) may also increase the risk of autonomic neuropathy. ...

Development of multiplex loop mediated isothermal amplification (m-LAMP) label-based gold nanoparticles lateral flow dipstick biosensor for detection of pathogenic Leptospira.

Science.gov (United States)

Nurul Najian, A B; Engku Nur Syafirah, E A R; Ismail, Nabilah; Mohamed, Maizan; Yean, Chan Yean

2016-01-15

In recent years extensive numbers of molecular diagnostic methods have been developed to meet the need of point-of-care devices. Efforts have been made towards producing rapid, simple and inexpensive DNA tests, especially in the diagnostics field. We report on the development of a label-based lateral flow dipstick for the rapid and simple detection of multiplex loop-mediated isothermal amplification (m-LAMP) amplicons. A label-based m-LAMP lateral flow dipstick assay was developed for the simultaneous detection of target DNA template and a LAMP internal control. This biosensor operates through a label based system, in which probe-hybridization and the additional incubation step are eliminated. We demonstrated this m-LAMP assay by detecting pathogenic Leptospira, which causes the re-emerging disease Leptospirosis. The lateral flow dipstick was developed to detect of three targets, the LAMP target amplicon, the LAMP internal control amplicon and a chromatography control. Three lines appeared on the dipstick, indicating positive results for all representative pathogenic Leptospira species, whereas two lines appeared, indicating negative results, for other bacterial species. The specificity of this biosensor assay was 100% when it was tested with 13 representative pathogenic Leptospira species, 2 intermediate Leptospira species, 1 non-pathogenic Leptospira species and 28 other bacteria species. This study found that this DNA biosensor was able to detect DNA at concentrations as low as 3.95 × 10(-1) genomic equivalent ml(-1). An integrated m-LAMP and label-based lateral flow dipstick was successfully developed, promising simple and rapid visual detection in clinical diagnostics and serving as a point-of-care device. Copyright © 2015 Elsevier B.V. All rights reserved.

Comparative proteomic analysis of pathogenic and non-pathogenic strains from the swine pathogen Mycoplasma hyopneumoniae

Directory of Open Access Journals (Sweden)

Klein Cátia S

2009-12-01

Full Text Available Abstract Background Mycoplasma hyopneumoniae is a highly infectious swine pathogen and is the causative agent of enzootic pneumonia (EP. Following the previous report of a proteomic survey of the pathogenic 7448 strain of swine pathogen, Mycoplasma hyopneumoniae, we performed comparative protein profiling of three M. hyopneumoniae strains, namely the non-pathogenic J strain and the two pathogenic strains 7448 and 7422. Results In 2DE comparisons, we were able to identify differences in expression levels for 67 proteins, including the overexpression of some cytoadherence-related proteins only in the pathogenic strains. 2DE immunoblot analyses allowed the identification of differential proteolytic cleavage patterns of the P97 adhesin in the three strains. For more comprehensive protein profiling, an LC-MS/MS strategy was used. Overall, 35% of the M. hyopneumoniae genome coding capacity was covered. Partially overlapping profiles of identified proteins were observed in the strains with 81 proteins identified only in one strain and 54 proteins identified in two strains. Abundance analysis of proteins detected in more than one strain demonstrates the relative overexpression of 64 proteins, including the P97 adhesin in the pathogenic strains. Conclusions Our results indicate the physiological differences between the non-pathogenic strain, with its non-infective proliferate lifestyle, and the pathogenic strains, with its constitutive expression of adhesins, which would render the bacterium competent for adhesion and infection prior to host contact.

16S rRNA-based detection of oral pathogens in coronary atherosclerotic plaque

Directory of Open Access Journals (Sweden)

Mahendra Jaideep

2010-01-01

Full Text Available Background: Atherosclerosis develops as a response of the vessel wall to injury. Chronic bacterial infections have been associated with an increased risk for atherosclerosis and coronary artery disease. The ability of oral pathogens to colonize in coronary atheromatous plaque is well known. Aim: The aim of this study was to detect the presence of Treponema denticola, Porphyromonas gingivalis and Campylobacter rectus in the subgingival and atherosclerotic plaques of patients with coronary artery disease. Materials and Methods: Fifty-one patients in the age group of 40-80 years with coronary artery disease were selected for the study. DNA was extracted from the plaque samples. The specific primers for T. denticola, C. rectus and P. gingivalis were used to amplify a part of the 16S rRNA gene by polymerase chain reaction. Statistical Analysis Used: Chi-square analysis, correlation coefficient and prevalence percentage of the microorganisms were carried out for the analysis. Results: Of the 51 patients, T. denticola, C. rectus and P. gingivalis were detected in 49.01%, 21.51% and 45.10% of the atherosclerotic plaque samples. Conclusions: Our study revealed the presence of bacterial DNA of the oral pathogenic microorganisms in coronary atherosclerotic plaques. The presence of the bacterial DNA in the coronary atherosclerotic plaques in significant proportion may suggest the possible relationship between periodontal bacterial infection and genesis of coronary atherosclerosis.

Programmable autonomous synthesis of single-stranded DNA

Science.gov (United States)

Kishi, Jocelyn Y.; Schaus, Thomas E.; Gopalkrishnan, Nikhil; Xuan, Feng; Yin, Peng

2018-02-01

DNA performs diverse functional roles in biology, nanotechnology and biotechnology, but current methods for autonomously synthesizing arbitrary single-stranded DNA are limited. Here, we introduce the concept of primer exchange reaction (PER) cascades, which grow nascent single-stranded DNA with user-specified sequences following prescribed reaction pathways. PER synthesis happens in a programmable, autonomous, in situ and environmentally responsive fashion, providing a platform for engineering molecular circuits and devices with a wide range of sensing, monitoring, recording, signal-processing and actuation capabilities. We experimentally demonstrate a nanodevice that transduces the detection of a trigger RNA into the production of a DNAzyme that degrades an independent RNA substrate, a signal amplifier that conditionally synthesizes long fluorescent strands only in the presence of a particular RNA signal, molecular computing circuits that evaluate logic (AND, OR, NOT) combinations of RNA inputs, and a temporal molecular event recorder that records in the PER transcript the order in which distinct RNA inputs are sequentially detected.

Multi-state autonomous drilling for lunar exploration

Directory of Open Access Journals (Sweden)

Chen Chongbin

2016-10-01

Full Text Available Due to the lack of information of subsurface lunar regolith stratification which varies along depth, the drilling device may encounter lunar soil and lunar rock randomly in the drilling process. To meet the load safety requirements of unmanned sampling mission under limited orbital resources, the control strategy of autonomous drilling should adapt to the indeterminable lunar environments. Based on the analysis of two types of typical drilling media (i.e., lunar soil and lunar rock, this paper proposes a multi-state control strategy for autonomous lunar drilling. To represent the working circumstances in the lunar subsurface and reduce the complexity of the control algorithm, lunar drilling process was categorized into three drilling states: the interface detection, initiation of drilling parameters for recognition and drilling medium recognition. Support vector machine (SVM and continuous wavelet transform were employed for the online recognition of drilling media and interface, respectively. Finite state machine was utilized to control the transition among different drilling states. To verify the effectiveness of the multi-state control strategy, drilling experiments were implemented with multi-layered drilling media constructed by lunar soil simulant and lunar rock simulant. The results reveal that the multi-state control method is capable of detecting drilling state variation and adjusting drilling parameters timely under vibration interferences. The multi-state control method provides a feasible reference for the control of extraterrestrial autonomous drilling.

Multiplex detection of nine food-borne pathogens by mPCR and capillary electrophoresis after using a universal pre-enrichment medium

Directory of Open Access Journals (Sweden)

Germán eVillamizar-Rodríguez

2015-11-01

Full Text Available Routine microbiological quality analyses in food samples require, in some cases, an initial incubation in pre-enrichment medium. This is necessary in order to assure that small amounts of pathogenic strains are going to be detected. In this work, a universal pre-enrichment medium has been developed for simultaneous growth of Bacillus cereus, Campylobacter jejuni, Clostridium perfringens, Cronobacter sakazakii, Escherichia coli, Enterobacteriaceae family (thirty eight species, twenty seven genera, Listeria monocytogenes, Staphylococcus aureus, Salmonella spp. (two species, thirteen strains. Growth confirmation for all these species was achieved in all cases, with excellent enrichments. This was confirmed by plating on the corresponding selective agar media for each bacterium. This GVUM universal pre-enrichment medium could be useful in food microbiological analyses, where different pathogenic bacteria must be detected after a pre-enrichment step. Following, a mPCR reaction for detection of all these pathogens was developed, after designing a set of nine oligonucleotide pairs from specific genetic targets on gDNA from each of these bacteria, covering all available strains already sequenced in GenBank for them. The detection limits have been 1 Genome Equivalent, with the exception of Fam. Enterobacteriaceae (5 GEs. We obtained amplification for all targets (from 70 to 251 bp, depending on the bacteria type, showing the capability of this method to detect the most important industrial and sanitary food-borne pathogens from a universal pre-enrichment medium. This method includes an initial pre-enrichment step (18 h, followed by a mPCR (2 h and a capillary electrophoresis (30 min; avoiding the tedious and long lasting growing on solid media required in traditional analysis (1 to 4 days, depending on the specific pathogen and verification procedure. An external testing of this method was conducted in order to compare classical and mPCR methods. This

Widespread detection of highly pathogenic H5 influenza viruses in wild birds from the Pacific Flyway of the United States.

Science.gov (United States)

Bevins, S N; Dusek, R J; White, C L; Gidlewski, T; Bodenstein, B; Mansfield, K G; DeBruyn, P; Kraege, D; Rowan, E; Gillin, C; Thomas, B; Chandler, S; Baroch, J; Schmit, B; Grady, M J; Miller, R S; Drew, M L; Stopak, S; Zscheile, B; Bennett, J; Sengl, J; Brady, Caroline; Ip, H S; Spackman, E; Killian, M L; Torchetti, M K; Sleeman, J M; Deliberto, T J

2016-07-06

A novel highly pathogenic avian influenza virus belonging to the H5 clade 2.3.4.4 variant viruses was detected in North America in late 2014. Motivated by the identification of these viruses in domestic poultry in Canada, an intensive study was initiated to conduct highly pathogenic avian influenza surveillance in wild birds in the Pacific Flyway of the United States. A total of 4,729 hunter-harvested wild birds were sampled and highly pathogenic avian influenza virus was detected in 1.3% (n = 63). Three H5 clade 2.3.4.4 subtypes were isolated from wild birds, H5N2, H5N8, and H5N1, representing the wholly Eurasian lineage H5N8 and two novel reassortant viruses. Testing of 150 additional wild birds during avian morbidity and mortality investigations in Washington yielded 10 (6.7%) additional highly pathogenic avian influenza isolates (H5N8 = 3 and H5N2 = 7). The geographically widespread detection of these viruses in apparently healthy wild waterfowl suggest that the H5 clade 2.3.4.4 variant viruses may behave similarly in this taxonomic group whereby many waterfowl species are susceptible to infection but do not demonstrate obvious clinical disease. Despite these findings in wild waterfowl, mortality has been documented for some wild bird species and losses in US domestic poultry during the first half of 2015 were unprecedented.

Autonomous Robot Navigation In Public Nature Park

DEFF Research Database (Denmark)

Andersen, Jens Christian; Andersen, Nils Axel; Ravn, Ole

2005-01-01

This extended abstract describes a project to make a robot travel autonomously across a public nature park. The challenge is to detect and follow the right path across junctions and open squares avoiding people and obstacles. The robot is equipped with a laser scanner, a (low accuracy) GPS, wheel...

Genetic autonomic disorders.

Science.gov (United States)

Axelrod, Felicia B

2013-03-01

Genetic disorders affecting the autonomic nervous system can result in abnormal development of the nervous system or they can be caused by neurotransmitter imbalance, an ion-channel disturbance or by storage of deleterious material. The symptoms indicating autonomic dysfunction, however, will depend upon whether the genetic lesion has disrupted peripheral or central autonomic centers or both. Because the autonomic nervous system is pervasive and affects every organ system in the body, autonomic dysfunction will result in impaired homeostasis and symptoms will vary. The possibility of genetic confirmation by molecular testing for specific diagnosis is increasing but treatments tend to remain only supportive and directed toward particular symptoms. Copyright © 2013 Elsevier Inc. All rights reserved.

A multiplex PCR/LDR assay for simultaneous detection and identification of the NIAID category B bacterial food and water-borne pathogens.

Science.gov (United States)

Rundell, Mark S; Pingle, Maneesh; Das, Sanchita; Hussain, Aashiq; Ocheretina, Oksana; Charles, Macarthur; Larone, Davise H; Spitzer, Eric D; Golightly, Linnie; Barany, Francis

2014-06-01

Enteric pathogens that cause gastroenteritis remain a major global health concern. The goal of this study was to develop a multiplex PCR/ligation detection reaction (LDR) assay for the detection of all NIAID category B bacterial food and water-borne pathogens directly from stool specimens. To validate the PCR/LDR assay, clinical isolates of Campylobacter spp., Vibrio spp., Shigella spp., Salmonella spp., Listeria monocytogenes, Yersinia enterocolitica, and diarrheagenic Escherichia coli were tested. The sensitivity and specificity of the assay were assessed using a large number of seeded culture-negative stool specimens and a smaller set of clinical specimens from Haiti. The overall sensitivity ranged from 91% to 100% (median 100%) depending on the species. For the majority of organisms, the sensitivity was 100%. The overall specificity based on initial testing ranged from 98% to 100% depending on the species. After additional testing of discordant samples, the lowest specificity was 99.4%. PCR/LDR detected additional category B agents (particularly diarrheagenic E. coli) in 11/40 specimens from Haiti that were culture-positive for V. cholerae and in approximately 1% of routine culture-negative stool specimens from a hospital in New York. This study demonstrated the ability of the PCR/LDR assay to detect a large comprehensive panel of category B enteric bacterial pathogens as well as mixed infections. This type of assay has the potential to provide earlier warnings of possible public health threats and more accurate surveillance of food and water-borne pathogens. Copyright © 2014 Elsevier Inc. All rights reserved.

Aptamer-based hydrogel barcodes for the capture and detection of multiple types of pathogenic bacteria.

Science.gov (United States)

Xu, Yueshuang; Wang, Huan; Luan, Chengxin; Liu, Yuxiao; Chen, Baoan; Zhao, Yuanjin

2018-02-15

Rapid and sensitive diagnosing hematological infections based on the separation and detection of pathogenic bacteria in the patient's blood is a significant challenge. To address this, we herein present a new barcodes technology that can simultaneously capture and detect multiple types of pathogenic bacteria from a complex sample. The barcodes are poly (ethylene glycol) (PEG) hydrogel inverse opal particles with characteristic reflection peak codes that remain stable during bacteria capture on their surfaces. As the spherical surface of the particles has ordered porous nanostructure, the barcodes can provide not only more surface area for probe immobilization and reaction, but also a nanopatterned platform for highly efficient bioreactions. In addition, the PEG hydrogel scaffold could decrease the non-specificity adsorption by its anti-adhesive effect, and the decorated aptamer probes in the scaffolds could increase the sensitivity, reliability, and specificity of the bacteria capture and detection. Moreover, the tagged magnetic nanoparticles in the PEG scaffold could impart the barcodes with controllable movement under magnetic fields, which can be used to significantly increase the reaction speed and simplify the processing of the bioassays. Based on the describe barcodes, it was demonstrated that the bacteria could be captured and identified even at low bacterial concentrations (100 CFU mL -1 ) within 2.5h, which is effectively shortened in comparison with the "gold standard" in clinic. These features make the barcodes ideal for capturing and detecting multiple bacteria from clinical samples for hematological infection diagnostics. Copyright © 2017 Elsevier B.V. All rights reserved.

Implementation of microfluidic sandwich ELISA for superior detection of plant pathogens.

Science.gov (United States)

Thaitrong, Numrin; Charlermroj, Ratthaphol; Himananto, Orawan; Seepiban, Channarong; Karoonuthaisiri, Nitsara

2013-01-01

Rapid and economical screening of plant pathogens is a high-priority need in the seed industry. Crop quality control and disease surveillance demand early and accurate detection in addition to robustness, scalability, and cost efficiency typically required for selective breeding and certification programs. Compared to conventional bench-top detection techniques routinely employed, a microfluidic-based approach offers unique benefits to address these needs simultaneously. To our knowledge, this work reports the first attempt to perform microfluidic sandwich ELISA for Acidovorax citrulli (Ac), watermelon silver mottle virus (WSMoV), and melon yellow spot virus (MYSV) screening. The immunoassay occurs on the surface of a reaction chamber represented by a microfluidic channel. The capillary force within the microchannel draws a reagent into the reaction chamber as well as facilitates assay incubation. Because the underlying pad automatically absorbs excess fluid, the only operation required is sequential loading of buffers/reagents. Buffer selection, antibody concentrations, and sample loading scheme were optimized for each pathogen. Assay optimization reveals that the 20-folds lower sample volume demanded by the microchannel structure outweighs the 2- to 4-folds higher antibody concentrations required, resulting in overall 5-10 folds of reagent savings. In addition to cutting the assay time by more than 50%, the new platform offers 65% cost savings from less reagent consumption and labor cost. Our study also shows 12.5-, 2-, and 4-fold improvement in assay sensitivity for Ac, WSMoV, and MYSV, respectively. Practical feasibility is demonstrated using 19 real plant samples. Given a standard 96-well plate format, the developed assay is compatible with commercial fluorescent plate readers and readily amendable to robotic liquid handling systems for completely hand-free assay automation.

Implementation of microfluidic sandwich ELISA for superior detection of plant pathogens.

Directory of Open Access Journals (Sweden)

Numrin Thaitrong

Full Text Available Rapid and economical screening of plant pathogens is a high-priority need in the seed industry. Crop quality control and disease surveillance demand early and accurate detection in addition to robustness, scalability, and cost efficiency typically required for selective breeding and certification programs. Compared to conventional bench-top detection techniques routinely employed, a microfluidic-based approach offers unique benefits to address these needs simultaneously. To our knowledge, this work reports the first attempt to perform microfluidic sandwich ELISA for Acidovorax citrulli (Ac, watermelon silver mottle virus (WSMoV, and melon yellow spot virus (MYSV screening. The immunoassay occurs on the surface of a reaction chamber represented by a microfluidic channel. The capillary force within the microchannel draws a reagent into the reaction chamber as well as facilitates assay incubation. Because the underlying pad automatically absorbs excess fluid, the only operation required is sequential loading of buffers/reagents. Buffer selection, antibody concentrations, and sample loading scheme were optimized for each pathogen. Assay optimization reveals that the 20-folds lower sample volume demanded by the microchannel structure outweighs the 2- to 4-folds higher antibody concentrations required, resulting in overall 5-10 folds of reagent savings. In addition to cutting the assay time by more than 50%, the new platform offers 65% cost savings from less reagent consumption and labor cost. Our study also shows 12.5-, 2-, and 4-fold improvement in assay sensitivity for Ac, WSMoV, and MYSV, respectively. Practical feasibility is demonstrated using 19 real plant samples. Given a standard 96-well plate format, the developed assay is compatible with commercial fluorescent plate readers and readily amendable to robotic liquid handling systems for completely hand-free assay automation.

Helicase-dependent isothermal amplification: a novel tool in the development of molecular-based analytical systems for rapid pathogen detection.

Science.gov (United States)

Barreda-García, Susana; Miranda-Castro, Rebeca; de-Los-Santos-Álvarez, Noemí; Miranda-Ordieres, Arturo J; Lobo-Castañón, María Jesús

2018-01-01

Highly sensitive testing of nucleic acids is essential to improve the detection of pathogens, which pose a major threat for public health worldwide. Currently available molecular assays, mainly based on PCR, have a limited utility in point-of-need control or resource-limited settings. Consequently, there is a strong interest in developing cost-effective, robust, and portable platforms for early detection of these harmful microorganisms. Since its description in 2004, isothermal helicase-dependent amplification (HDA) has been successfully applied in the development of novel molecular-based technologies for rapid, sensitive, and selective detection of viruses and bacteria. In this review, we highlight relevant analytical systems using this simple nucleic acid amplification methodology that takes place at a constant temperature and that is readily compatible with microfluidic technologies. Different strategies for monitoring HDA amplification products are described. In addition, we present technological advances for integrating sample preparation, HDA amplification, and detection. Future perspectives and challenges toward point-of-need use not only for clinical diagnosis but also in food safety testing and environmental monitoring are also discussed. Graphical Abstract Expanding the analytical toolbox for the detection of DNA sequences specific of pathogens with isothermal helicase dependent amplification (HDA).

Future research needs involving pathogens in groundwater

Science.gov (United States)

Bradford, Scott A.; Harvey, Ronald W.

2017-01-01

Contamination of groundwater by enteric pathogens has commonly been associated with disease outbreaks. Proper management and treatment of pathogen sources are important prerequisites for preventing groundwater contamination. However, non-point sources of pathogen contamination are frequently difficult to identify, and existing approaches for pathogen detection are costly and only provide semi-quantitative information. Microbial indicators that are readily quantified often do not correlate with the presence of pathogens. Pathogens of emerging concern and increasing detections of antibiotic resistance among bacterial pathogens in groundwater are topics of growing concern. Adequate removal of pathogens during soil passage is therefore critical for safe groundwater extraction. Processes that enhance pathogen transport (e.g., high velocity zones and preferential flow) and diminish pathogen removal (e.g., reversible retention and enhanced survival) are of special concern because they increase the risk of groundwater contamination, but are still incompletely understood. Improved theory and modeling tools are needed to analyze experimental data, test hypotheses, understand coupled processes and controlling mechanisms, predict spatial and/or temporal variability in model parameters and uncertainty in pathogen concentrations, assess risk, and develop mitigation and best management approaches to protect groundwater.

Future research needs involving pathogens in groundwater

Science.gov (United States)

Bradford, Scott A.; Harvey, Ronald W.

2017-06-01

Contamination of groundwater by enteric pathogens has commonly been associated with disease outbreaks. Proper management and treatment of pathogen sources are important prerequisites for preventing groundwater contamination. However, non-point sources of pathogen contamination are frequently difficult to identify, and existing approaches for pathogen detection are costly and only provide semi-quantitative information. Microbial indicators that are readily quantified often do not correlate with the presence of pathogens. Pathogens of emerging concern and increasing detections of antibiotic resistance among bacterial pathogens in groundwater are topics of growing concern. Adequate removal of pathogens during soil passage is therefore critical for safe groundwater extraction. Processes that enhance pathogen transport (e.g., high velocity zones and preferential flow) and diminish pathogen removal (e.g., reversible retention and enhanced survival) are of special concern because they increase the risk of groundwater contamination, but are still incompletely understood. Improved theory and modeling tools are needed to analyze experimental data, test hypotheses, understand coupled processes and controlling mechanisms, predict spatial and/or temporal variability in model parameters and uncertainty in pathogen concentrations, assess risk, and develop mitigation and best management approaches to protect groundwater.

Comparative genome analysis of pathogenic and non-pathogenic Clavibacter strains reveals adaptations to their lifestyle.

Science.gov (United States)

Załuga, Joanna; Stragier, Pieter; Baeyen, Steve; Haegeman, Annelies; Van Vaerenbergh, Johan; Maes, Martine; De Vos, Paul

2014-05-22

The genus Clavibacter harbors economically important plant pathogens infecting agricultural crops such as potato and tomato. Although the vast majority of Clavibacter strains are pathogenic, there is an increasing number of non-pathogenic isolates reported. Non-pathogenic Clavibacter strains isolated from tomato seeds are particularly problematic because they affect the current detection and identification tests for Clavibacter michiganensis subsp. michiganensis (Cmm), which is regulated with a zero tolerance in tomato seed. Their misidentification as pathogenic Cmm hampers a clear judgment on the seed quality and health. To get more insight in the genetic features linked to the lifestyle of these bacteria, a whole-genome sequence of the tomato seed-borne non-pathogenic Clavibacter LMG 26808 was determined. To gain a better understanding of the molecular determinants of pathogenicity, the genome sequence of LMG 26808 was compared with that of the pathogenic Cmm strain (NCPPB 382). The comparative analysis revealed that LMG 26808 does not contain plasmids pCM1 and pCM2 and also lacks the majority of important virulence factors described so far for pathogenic Cmm. This explains its apparent non-pathogenic nature in tomato plants. Moreover, the genome analysis of LMG 26808 detected sequences from a plasmid originating from a member of Enterobacteriaceae/Klebsiella relative. Genes received that way and coding for antibiotic resistance may provide a competitive advantage for survival of LMG 26808 in its ecological niche. Genetically, LMG 26808 was the most similar to the pathogenic Cmm NCPPB 382 but contained more mobile genetic elements. The genome of this non-pathogenic Clavibacter strain contained also a high number of transporters and regulatory genes. The genome sequence of the non-pathogenic Clavibacter strain LMG 26808 and the comparative analyses with other pathogenic Clavibacter strains provided a better understanding of the genetic bases of virulence and

Autonomous Navigation and Obstacle Avoidance of a Micro-Bus

Directory of Open Access Journals (Sweden)

Carlos Fernández

2013-04-01

Full Text Available At present, the topic of automated vehicles is one of the most promising research areas in the field of Intelligent Transportation Systems (ITS. The use of automated vehicles for public transportation also contributes to reductions in congestion levels and to improvements in traffic flow. Moreover, electrical public autonomous vehicles are environmentally friendly, provide better air quality and contribute to energy conservation. The driverless public transportation systems, which are at present operating in some airports and train stations, are restricted to dedicated roads and exhibit serious trouble dynamically avoiding obstacles in the trajectory. In this paper, an electric autonomous mini-bus is presented. All datasets used in this article were collected during the experiments carried out in the demonstration event of the 2012 IEEE Intelligent Vehicles Symposium that took place in Alcalá de Henares (Spain. The demonstration consisted of a route 725 metres long containing a list of latitude-longitude points (waypoints. The mini-bus was capable of driving autonomously from one waypoint to another using a GPS sensor. Furthermore, the vehicle is provided with a multi-beam Laser Imaging Detection and Ranging (LIDAR sensor for surrounding reconstruction and obstacle detection. When an obstacle is detected in the planned path, the planned route is modified in order to avoid the obstacle and continue its way to the end of the mission. On the demonstration day, a total of 196 attendees had the opportunity to get a ride on the vehicles. A total of 28 laps were successfully completed in full autonomous mode in a private circuit located in the National Institute for Aerospace Research (INTA, Spain. In other words, the system completed 20.3 km of driverless navigation and obstacle avoidance.

Patients With Fibromyalgia Have Significant Autonomic Symptoms But Modest Autonomic Dysfunction.

Science.gov (United States)

Vincent, Ann; Whipple, Mary O; Low, Phillip A; Joyner, Michael; Hoskin, Tanya L

2016-05-01

Research suggests that disordered autonomic function may be one contributor to deconditioning reported in fibromyalgia; however, no study to date has assessed these variables simultaneously with comprehensive measures. To characterize physical fitness and autonomic function with the use of clinically validated measures and subjective questionnaires between patients with fibromyalgia and healthy controls. Cross-sectional, observational, controlled study. Community sample of patients with fibromyalgia and healthy controls. Thirty patients with fibromyalgia and 30 pain and fatigue-free controls. Participants completed a battery of self-report questionnaires and physiological measures, including clinically validated measures of physical fitness and autonomic function. Six-Minute Walk Test total distance, maximal oxygen consumption as assessed by cardiopulmonary exercise testing, total steps using activity monitor, Composite Autonomic Scoring Scale as assessed by Autonomic Reflex Screen, total metabolic equivalents per week using the International Physical Activity Questionnaire, and self-reported autonomic symptoms via the 31-item Composite Autonomic Symptom Score questionnaire. Autonomic function, as assessed by self-report, was significantly different between patients and controls (P physical activity was not significantly different between patients and controls (P = .99), but levels of moderate and vigorous physical activity as measured by actigraphy were significantly lower in patients (P = .012 and P = .047, respectively). Exercise capacity (6-Minute Walk) was poorer in patients (P = .0006), but there was no significant difference in maximal volume of oxygen consumption (P = .07). Patients with fibromyalgia report more severe symptoms across all domains, including physical activity and autonomic symptoms, compared with controls, but the objective assessments only showed modest differences. Our results suggest that patients with widespread subjective impairment of

A novel gold nanoparticle-DNA aptamer-based plasmonic chip for rapid and sensitive detection of bacterial pathogens

DEFF Research Database (Denmark)

Sun, Yi; Phuoc Long, Truong; Wolff, Anders

2016-01-01

Gold nanoparticles (AuNPs)-based biosensors are emerging technologies for rapid detection of pathogens. However, it is very challenging to develop chip-based AuNP-biosensors for whole cells. This paper describes a novel AuNPs-DNA aptamer-based plasmonic assay which allows DNA aptamers...

A Machine Learning Approach to Pedestrian Detection for Autonomous Vehicles Using High-Definition 3D Range Data

Directory of Open Access Journals (Sweden)

Pedro J. Navarro

2016-12-01

Full Text Available This article describes an automated sensor-based system to detect pedestrians in an autonomous vehicle application. Although the vehicle is equipped with a broad set of sensors, the article focuses on the processing of the information generated by a Velodyne HDL-64E LIDAR sensor. The cloud of points generated by the sensor (more than 1 million points per revolution is processed to detect pedestrians, by selecting cubic shapes and applying machine vision and machine learning algorithms to the XY, XZ, and YZ projections of the points contained in the cube. The work relates an exhaustive analysis of the performance of three different machine learning algorithms: k-Nearest Neighbours (kNN, Naïve Bayes classifier (NBC, and Support Vector Machine (SVM. These algorithms have been trained with 1931 samples. The final performance of the method, measured a real traffic scenery, which contained 16 pedestrians and 469 samples of non-pedestrians, shows sensitivity (81.2%, accuracy (96.2% and specificity (96.8%.

A Machine Learning Approach to Pedestrian Detection for Autonomous Vehicles Using High-Definition 3D Range Data.

Science.gov (United States)

Navarro, Pedro J; Fernández, Carlos; Borraz, Raúl; Alonso, Diego

2016-12-23

This article describes an automated sensor-based system to detect pedestrians in an autonomous vehicle application. Although the vehicle is equipped with a broad set of sensors, the article focuses on the processing of the information generated by a Velodyne HDL-64E LIDAR sensor. The cloud of points generated by the sensor (more than 1 million points per revolution) is processed to detect pedestrians, by selecting cubic shapes and applying machine vision and machine learning algorithms to the XY, XZ, and YZ projections of the points contained in the cube. The work relates an exhaustive analysis of the performance of three different machine learning algorithms: k-Nearest Neighbours (kNN), Naïve Bayes classifier (NBC), and Support Vector Machine (SVM). These algorithms have been trained with 1931 samples. The final performance of the method, measured a real traffic scenery, which contained 16 pedestrians and 469 samples of non-pedestrians, shows sensitivity (81.2%), accuracy (96.2%) and specificity (96.8%).

Depletion of Human DNA in Spiked Clinical Specimens for Improvement of Sensitivity of Pathogen Detection by Next-Generation Sequencing

OpenAIRE

Hasan, Mohammad R.; Rawat, Arun; Tang, Patrick; Jithesh, Puthen V.; Thomas, Eva; Tan, Rusung; Tilley, Peter

2016-01-01

Next-generation sequencing (NGS) technology has shown promise for the detection of human pathogens from clinical samples. However, one of the major obstacles to the use of NGS in diagnostic microbiology is the low ratio of pathogen DNA to human DNA in most clinical specimens. In this study, we aimed to develop a specimen-processing protocol to remove human DNA and enrich specimens for bacterial and viral DNA for shotgun metagenomic sequencing. Cerebrospinal fluid (CSF) and nasopharyngeal aspi...

Nucleic Acid-Based Detection and Identification of Bacterial and Fungal Plant Pathogens - Final Report

Energy Technology Data Exchange (ETDEWEB)

Kingsley, Mark T.

2001-03-13

The threat to American interests from terrorists is not limited to attacks against humans. Terrorists might seek to inflict damage to the U.S. economy by attacking our agricultural sector. Infection of commodity crops by bacterial or fungal crop pathogens could adversely impact U.S. agriculture, either directly from damage to crops or indirectly from damage to our ability to export crops suspected of contamination. Recognizing a terrorist attack against U.S. agriculture, to be able to prosecute the terrorists, is among the responsibilities of the members of Hazardous Material Response Unit (HMRU) of the Federal Bureau of Investigation (FBI). Nucleic acid analysis of plant pathogen strains by the use of polymerase chain reaction (PCR) amplification techniques is a powerful method for determining the exact identity of pathogens, as well as their possible region of origin. This type of analysis, however, requires that PCR assays be developed specific to each particular pathogen strain, and analysis protocols developed that are specific to the particular instrument used for detection. The objectives of the work described here were threefold: 1) to assess the potential terrorist threat to U.S. agricultural crops, 2) to determine whether suitable assays exist to monitor that threat, and 3) where assays are needed for priority plant pathogen threats, to modify or develop those assays for use by specialists at the HMRU. The assessment of potential threat to U.S. commodity crops and the availability of assays for those threats were described in detail in the Technical Requirements Document (9) and will be summarized in this report. This report addresses development of specific assays identified in the Technical Requirements Document, and offers recommendations for future development to ensure that HMRU specialists will be prepared with the PCR assays they need to protect against the threat of economic terrorism.

Synovial fluid multiplex PCR is superior to culture for detection of low-virulent pathogens causing periprosthetic joint infection.

Science.gov (United States)

Morgenstern, Christian; Cabric, Sabrina; Perka, Carsten; Trampuz, Andrej; Renz, Nora

2018-02-01

Analysis of joint aspirate is the standard preoperative investigation for diagnosis of periprosthetic joint infection (PJI). We compared the diagnostic performance of culture and multiplex polymerase chain reaction (PCR) of synovial fluid for diagnosis of PJI. Patients in whom aspiration of the prosthetic hip or knee joint was performed before revision arthroplasty were prospectively included. The performance of synovial fluid culture and multiplex PCR was compared by McNemar's chi-squared test. A total of 142 patients were included, 82 with knee and 60 with hip prosthesis. PJI was diagnosed in 77 patients (54%) and aseptic failure in 65 patients (46%). The sensitivity of synovial fluid culture and PCR was 52% and 60%, respectively, showing concordant results in 116 patients (82%). In patients with PJI, PCR missed 6 high-virulent pathogens (S. aureus, streptococci, E. faecalis, E. coli) which grew in synovial fluid culture, whereas synovial fluid culture missed 12 pathogens detected by multiplex PCR, predominantly low-virulent pathogens (Cutibacterium acnes and coagulase-negative staphylococci). In patients with aseptic failure, PCR detected 6 low-virulent organisms (predominantly C. acnes). While the overall performance of synovial fluid PCR was comparable to culture, PCR was superior for detection of low-virulent bacteria such as Cutibacterium spp. and coagulase-negative staphylococci. In addition, synovial fluid culture required several days for growth, whereas multiplex PCR provided results within 5hours in an automated manner. Copyright © 2017 Elsevier Inc. All rights reserved.

Detection and identification of intestinal pathogenic bacteria by hybridization to oligonucleotide microarrays

Science.gov (United States)

Jin, Lian-Qun; Li, Jun-Wen; Wang, Sheng-Qi; Chao, Fu-Huan; Wang, Xin-Wei; Yuan, Zheng-Quan

2005-01-01

AIM: To detect the common intestinal pathogenic bacteria quickly and accurately. METHODS: A rapid (<3 h) experimental procedure was set up based upon the gene chip technology. Target genes were amplified and hybridized by oligonucleotide microarrays. RESULTS: One hundred and seventy strains of bacteria in pure culture belonging to 11 genera were successfully discriminated under comparatively same conditions, and a series of specific hybridization maps corresponding to each kind of bacteria were obtained. When this method was applied to 26 divided cultures, 25 (96.2%) were identified. CONCLUSION: Salmonella sp., Escherichia coli, Shigella sp., Listeria monocytogenes, Vibrio parahaemolyticus, Staphylococcus aureus, Proteus sp., Bacillus cereus, Vibrio cholerae, Enterococcus faecalis, Yersinia enterocolitica, and Campylobacter jejuni can be detected and identified by our microarrays. The accuracy, range, and discrimination power of this assay can be continually improved by adding further oligonucleotides to the arrays without any significant increase of complexity or cost. PMID:16437687

Lawrence Livermore National Laboratory Workshop Characterization of Pathogenicity, Virulence and Host-Pathogen Interactions

Energy Technology Data Exchange (ETDEWEB)

Krishnan, A

2006-08-30

The threats of bio-terrorism and newly emerging infectious diseases pose serious challenges to the national security infrastructure. Rapid detection and diagnosis of infectious disease in human populations, as well as characterizing pathogen biology, are critical for reducing the morbidity and mortality associated with such threats. One of the key challenges in managing an infectious disease outbreak, whether through natural causes or acts of overt terrorism, is detection early enough to initiate effective countermeasures. Much recent attention has been directed towards the utility of biomarkers or molecular signatures that result from the interaction of the pathogen with the host for improving our ability to diagnose and mitigate the impact of a developing infection during the time window when effective countermeasures can be instituted. Host responses may provide early signals in blood even from localized infections. Multiple innate and adaptive immune molecules, in combination with other biochemical markers, may provide disease-specific information and new targets for countermeasures. The presence of pathogen specific markers and an understanding of the molecular capabilities and adaptations of the pathogen when it interacts with its host may likewise assist in early detection and provide opportunities for targeting countermeasures. An important question that needs to be addressed is whether these molecular-based approaches will prove useful for early diagnosis, complement current methods of direct agent detection, and aid development and use of countermeasures. Lawrence Livermore National Laboratory (LLNL) will host a workshop to explore the utility of host- and pathogen-based molecular diagnostics, prioritize key research issues, and determine the critical steps needed to transition host-pathogen research to tools that can be applied towards a more effective national bio-defense strategy. The workshop will bring together leading researchers/scientists in the

Rapid and high-throughput detection of highly pathogenic bacteria by Ibis PLEX-ID technology.

Directory of Open Access Journals (Sweden)

Daniela Jacob

Full Text Available In this manuscript, we describe the identification of highly pathogenic bacteria using an assay coupling biothreat group-specific PCR with electrospray ionization mass spectrometry (PCR/ESI-MS run on an Ibis PLEX-ID high-throughput platform. The biothreat cluster assay identifies most of the potential bioterrorism-relevant microorganisms including Bacillus anthracis, Francisella tularensis, Yersinia pestis, Burkholderia mallei and pseudomallei, Brucella species, and Coxiella burnetii. DNA from 45 different reference materials with different formulations and different concentrations were chosen and sent to a service screening laboratory that uses the PCR/ESI-MS platform to provide a microbial identification service. The standard reference materials were produced out of a repository built up in the framework of the EU funded project "Establishment of Quality Assurances for Detection of Highly Pathogenic Bacteria of Potential Bioterrorism Risk" (EQADeBa. All samples were correctly identified at least to the genus level.

Autonomous physics-based color learning under daylight

Science.gov (United States)

Berube Lauziere, Yves; Gingras, Denis J.; Ferrie, Frank P.

1999-09-01

An autonomous approach for learning the colors of specific objects assumed to have known body spectral reflectances is developed for daylight illumination conditions. The main issue is to be able to find these objects autonomously in a set of training images captured under a wide variety of daylight illumination conditions, and to extract their colors to determine color space regions that are representative of the objects' colors and their variations. The work begins by modeling color formation under daylight using the color formation equations and the semi-empirical model of Judd, MacAdam and Wyszecki (CIE daylight model) for representing the typical spectral distributions of daylight. This results in color space regions that serve as prior information in the initial phase of learning which consists in detecting small reliable clusters of pixels having the appropriate colors. These clusters are then expanded by a region growing technique using broader color space regions than those predicted by the model. This is to detect objects in a way that is able to account for color variations which the model cannot due to its limitations. Validation on the detected objects is performed to filter out those that are not of interest and to eliminate unreliable pixel color values extracted from the remaining ones. Detection results using the color space regions determined from color values obtained by this procedure are discussed.

Use of Metagenomic Shotgun Sequencing Technology To Detect Foodborne Pathogens within the Microbiome of the Beef Production Chain.

Science.gov (United States)

Yang, Xiang; Noyes, Noelle R; Doster, Enrique; Martin, Jennifer N; Linke, Lyndsey M; Magnuson, Roberta J; Yang, Hua; Geornaras, Ifigenia; Woerner, Dale R; Jones, Kenneth L; Ruiz, Jaime; Boucher, Christina; Morley, Paul S; Belk, Keith E

2016-04-01

Foodborne illnesses associated with pathogenic bacteria are a global public health and economic challenge. The diversity of microorganisms (pathogenic and nonpathogenic) that exists within the food and meat industries complicates efforts to understand pathogen ecology. Further, little is known about the interaction of pathogens within the microbiome throughout the meat production chain. Here, a metagenomic approach and shotgun sequencing technology were used as tools to detect pathogenic bacteria in environmental samples collected from the same groups of cattle at different longitudinal processing steps of the beef production chain: cattle entry to feedlot, exit from feedlot, cattle transport trucks, abattoir holding pens, and the end of the fabrication system. The log read counts classified as pathogens per million reads for Salmonella enterica,Listeria monocytogenes,Escherichia coli,Staphylococcus aureus, Clostridium spp. (C. botulinum and C. perfringens), and Campylobacter spp. (C. jejuni,C. coli, and C. fetus) decreased over subsequential processing steps. Furthermore, the normalized read counts for S. enterica,E. coli, and C. botulinumwere greater in the final product than at the feedlots, indicating that the proportion of these bacteria increased (the effect on absolute numbers was unknown) within the remaining microbiome. From an ecological perspective, data indicated that shotgun metagenomics can be used to evaluate not only the microbiome but also shifts in pathogen populations during beef production. Nonetheless, there were several challenges in this analysis approach, one of the main ones being the identification of the specific pathogen from which the sequence reads originated, which makes this approach impractical for use in pathogen identification for regulatory and confirmation purposes. Copyright © 2016 Yang et al.

Towards Autonomous Modular UAV Missions: The Detection, Geo-Location and Landing Paradigm

Science.gov (United States)

Kyristsis, Sarantis; Antonopoulos, Angelos; Chanialakis, Theofilos; Stefanakis, Emmanouel; Linardos, Christos; Tripolitsiotis, Achilles; Partsinevelos, Panagiotis

2016-01-01

Nowadays, various unmanned aerial vehicle (UAV) applications become increasingly demanding since they require real-time, autonomous and intelligent functions. Towards this end, in the present study, a fully autonomous UAV scenario is implemented, including the tasks of area scanning, target recognition, geo-location, monitoring, following and finally landing on a high speed moving platform. The underlying methodology includes AprilTag target identification through Graphics Processing Unit (GPU) parallelized processing, image processing and several optimized locations and approach algorithms employing gimbal movement, Global Navigation Satellite System (GNSS) readings and UAV navigation. For the experimentation, a commercial and a custom made quad-copter prototype were used, portraying a high and a low-computational embedded platform alternative. Among the successful targeting and follow procedures, it is shown that the landing approach can be successfully performed even under high platform speeds. PMID:27827883

Semi-Autonomous Systems Laboratory

Data.gov (United States)

Federal Laboratory Consortium — VisionThe Semi-Autonomous Systems Lab focuses on developing a comprehensive framework for semi-autonomous coordination of networked robotic systems. Semi-autonomous...

Performance evaluation of 3D vision-based semi-autonomous control method for assistive robotic manipulator.

Science.gov (United States)

Ka, Hyun W; Chung, Cheng-Shiu; Ding, Dan; James, Khara; Cooper, Rory

2018-02-01

We developed a 3D vision-based semi-autonomous control interface for assistive robotic manipulators. It was implemented based on one of the most popular commercially available assistive robotic manipulator combined with a low-cost depth-sensing camera mounted on the robot base. To perform a manipulation task with the 3D vision-based semi-autonomous control interface, a user starts operating with a manual control method available to him/her. When detecting objects within a set range, the control interface automatically stops the robot, and provides the user with possible manipulation options through audible text output, based on the detected object characteristics. Then, the system waits until the user states a voice command. Once the user command is given, the control interface drives the robot autonomously until the given command is completed. In the empirical evaluations conducted with human subjects from two different groups, it was shown that the semi-autonomous control can be used as an alternative control method to enable individuals with impaired motor control to more efficiently operate the robot arms by facilitating their fine motion control. The advantage of semi-autonomous control was not so obvious for the simple tasks. But, for the relatively complex real-life tasks, the 3D vision-based semi-autonomous control showed significantly faster performance. Implications for Rehabilitation A 3D vision-based semi-autonomous control interface will improve clinical practice by providing an alternative control method that is less demanding physically as well cognitively. A 3D vision-based semi-autonomous control provides the user with task specific intelligent semiautonomous manipulation assistances. A 3D vision-based semi-autonomous control gives the user the feeling that he or she is still in control at any moment. A 3D vision-based semi-autonomous control is compatible with different types of new and existing manual control methods for ARMs.

Development and evaluation of a panel of filovirus sequence capture probes for pathogen detection by next-generation sequencing.

Directory of Open Access Journals (Sweden)

Jeffrey W Koehler

Full Text Available A detailed understanding of the circulating pathogens in a particular geographic location aids in effectively utilizing targeted, rapid diagnostic assays, thus allowing for appropriate therapeutic and containment procedures. This is especially important in regions prevalent for highly pathogenic viruses co-circulating with other endemic pathogens such as the malaria parasite. The importance of biosurveillance is highlighted by the ongoing Ebola virus disease outbreak in West Africa. For example, a more comprehensive assessment of the regional pathogens could have identified the risk of a filovirus disease outbreak earlier and led to an improved diagnostic and response capacity in the region. In this context, being able to rapidly screen a single sample for multiple pathogens in a single tube reaction could improve both diagnostics as well as pathogen surveillance. Here, probes were designed to capture identifying filovirus sequence for the ebolaviruses Sudan, Ebola, Reston, Taï Forest, and Bundibugyo and the Marburg virus variants Musoke, Ci67, and Angola. These probes were combined into a single probe panel, and the captured filovirus sequence was successfully identified using the MiSeq next-generation sequencing platform. This panel was then used to identify the specific filovirus from nonhuman primates experimentally infected with Ebola virus as well as Bundibugyo virus in human sera samples from the Democratic Republic of the Congo, thus demonstrating the utility for pathogen detection using clinical samples. While not as sensitive and rapid as real-time PCR, this panel, along with incorporating additional sequence capture probe panels, could be used for broad pathogen screening and biosurveillance.

Rapid detection and identification of viral and bacterial fish pathogens using a DNA array‐based multiplex assay

DEFF Research Database (Denmark)

Lievens, B.; Frans, I.; Heusdens, C.

2011-01-01

for the simultaneous detection and identification of all cyprinid herpesviruses (CyHV‐1, CyHV‐2 and CyHV‐3) and some of the most important fish pathogenic Flavobacterium species, including F. branchiophilum, F. columnare and F. psychrophilum. For virus identification, the DNA polymerase and helicase genes were...

Dual Enlargement of Gold Nanoparticles: From Mechanism to Scanometric Detection of Pathogenic Bacteria

DEFF Research Database (Denmark)

Cao, Cuong; Gontard, Lionel Cervera; Le Ly, Tram Thuy

2011-01-01

the electron density of the nanostructures, leading to a stronger intensity for colorimetric discrimination as well as better sensitivity for quantitative measurement. Based on this, a simple scanometric assay for the on‐slide detection of the food‐born pathogen Campylobacter jejuni is developed. After...... capturing the target bacteria, gold‐tagged immunoprobes are added to create a signal on a solid substrate. The signal is then amplified by the dual enlargement process, resulting in a strong color intensity that can easily be recognized by the unaided eye, or measured by an inexpensive flatbed scanner...

Diagnosis of Fault Modes Masked by Control Loops with an Application to Autonomous Hovercraft Systems

Directory of Open Access Journals (Sweden)

Ioannis A. Raptis

2013-01-01

Full Text Available This paper introduces a methodology for the design, testing and assessment of incipient failure detection techniques for failing components/systems of an autonomous vehicle masked or hidden by feedback control loops. It is recognized that the optimum operation of critical assets (aircraft, autonomous systems, etc. may be compromised by feedback control loops by masking severe fault modes while compensating for typical disturbances. Detrimental consequences of such occurrences include the inability to detect expeditiously and accurately incipient failures, loss of control and inefficient operation of assets in the form of fuel overconsumption and adverse environmental impact. We pursue a systems engineering process to design, construct and test an autonomous hovercraft instrumented appropriately for improved autonomy. Hidden fault modes are detected with performance guarantees by invoking a Bayesian estimation approach called particle filtering. Simulation and experimental studies are employed to demonstrate the efficacy of the proposed methods.

Results from the Autonomous Triggering of in situ Sensors on Kilauea Volcano, HI, from Eruption Detection by Spacecraft

Science.gov (United States)

Doubleday, J.; Behar, A.; Davies, A.; Mora-Vargas, A.; Tran, D.; Abtahi, A.; Pieri, D. C.; Boudreau, K.; Cecava, J.

2008-12-01

Response time in acquiring sensor data in volcanic emergencies can be greatly improved through use of autonomous systems. For instance, ground-based observations and data processing applications of the JPL Volcano Sensor Web have promptly triggered spacecraft observations [e.g., 1]. The reverse command and information flow path can also be useful, using autonomous analysis of spacecraft data to trigger in situ sensors. In this demonstration project, SO2 sensors were incorporated into expendable "Volcano Monitor" capsules and placed downwind of the Pu'u 'O'o vent of Kilauea volcano, Hawai'i. In nominal (low) power conservation mode, data from these sensors were collected and transmitted every hour to the Volcano Sensor Web through the Iridium Satellite Network. When SO2 readings exceeded a predetermined threshold, the modem within the Volcano Monitor sent an alert to the Sensor Web, and triggered a request for prompt Earth Observing-1 (EO-1) spacecraft data acquisition. The Volcano Monitors were also triggered by the Sensor Web in response to an eruption detection by the MODIS instrument on Terra. During these pre- defined "critical events" the Sensor Web ordered the SO2 sensors within the Volcano Monitor to increase their sampling frequency to every 5 minutes (high power "burst mode"). Autonomous control of the sensors' sampling frequency enabled the Sensor Web to monitor and respond to rapidly evolving conditions, and allowed rapid compilation and dissemination of these data to the scientific community. Reference: [1] Davies et al., (2006) Eos, 87, (1), 1 and 5. This work was performed at the Jet Propulsion Laboratory-California Institute of Technology, under contract to NASA. Support was provided by the NASA AIST program, the Idaho Space Grant Consortium, and the New Mexico Space Grant Program. We also especially thank the personnel of the USGS Hawaiian Volcano Observatory for their invaluable scientific guidance and logistical assistance.

Assessing respiratory pathogen communities in bighorn sheep populations: Sampling realities, challenges, and improvements.

Directory of Open Access Journals (Sweden)

Carson J Butler

Full Text Available Respiratory disease has been a persistent problem for the recovery of bighorn sheep (Ovis canadensis, but has uncertain etiology. The disease has been attributed to several bacterial pathogens including Mycoplasma ovipneumoniae and Pasteurellaceae pathogens belonging to the Mannheimia, Bibersteinia, and Pasteurella genera. We estimated detection probability for these pathogens using protocols with diagnostic tests offered by a fee-for-service laboratory and not offered by a fee-for-service laboratory. We conducted 2861 diagnostic tests on swab samples collected from 476 bighorn sheep captured across Montana and Wyoming to gain inferences regarding detection probability, pathogen prevalence, and the power of different sampling methodologies to detect pathogens in bighorn sheep populations. Estimated detection probability using fee-for-service protocols was less than 0.50 for all Pasteurellaceae and 0.73 for Mycoplasma ovipneumoniae. Non-fee-for-service Pasteurellaceae protocols had higher detection probabilities, but no single protocol increased detection probability of all Pasteurellaceae pathogens to greater than 0.50. At least one protocol resulted in an estimated detection probability of 0.80 for each pathogen except Mannheimia haemolytica, for which the highest detection probability was 0.45. In general, the power to detect Pasteurellaceae pathogens at low prevalence in populations was low unless many animals were sampled or replicate samples were collected per animal. Imperfect detection also resulted in low precision when estimating prevalence for any pathogen. Low and variable detection probabilities for respiratory pathogens using live-sampling protocols may lead to inaccurate conclusions regarding pathogen community dynamics and causes of bighorn sheep respiratory disease epizootics. We recommend that agencies collect multiples samples per animal for Pasteurellaceae detection, and one sample for Mycoplasma ovipneumoniae detection from

Machine Visual Guidance For An Autonomous Undersea Submersible

Science.gov (United States)

Nguyen, Hoa G.; Kaomea, Peter K.; Heckman, Paul J.

1988-12-01

Optical imaging is the preferred sensory modality for underwater robotic activities requiring high resolution at close range, such as station keeping, docking, control of manipulator, and object retrieval. Machine vision will play a vital part in the design of next generation autonomous underwater submersibles. This paper describes an effort to demonstrate that real-time vision-based guidance and control of autonomous underwater submersibles is possible with compact, low-power, and vehicle-imbeddable hardware. The Naval Ocean Systems Center's EAVE-WEST (Experimental Autonomous Vehicle-West) submersible is being used as the testbed. The vision hardware consists of a PC-bus video frame grabber and an IBM-PC/AT compatible single-board computer, both residing in the artificial intelligence/vision electronics bottle of the submersible. The specific application chosen involves the tracking of underwater buoy cables. Image recognition is performed in two steps. Feature points are identified in the underwater video images using a technique which detects one-dimensional local brightness minima and maxima. Hough transformation is then used to detect the straight line among these feature points. A hierarchical coarse-to-fine processing method is employed which terminates when enough feature points have been identified to allow a reliable fit. The location of the cable identified is then reported to the vehicle controller computer for automatic steering control. The process currently operates successfully with a throughput of approximately 2 frames per second.

Autonomous learning of robust visual object detection and identification on a humanoid

NARCIS (Netherlands)

Leitner, J.; Chandrashekhariah, P.; Harding, S.; Frank, M.; Spina, G.; Förster, A.; Triesch, J.; Schmidhuber, J.

2012-01-01

In this work we introduce a technique for a humanoid robot to autonomously learn the representations of objects within its visual environment. Our approach involves an attention mechanism in association with feature based segmentation that explores the environment and provides object samples for

Impact of early detection and treatment of diabetes on the 6-year prevalence of cardiac autonomic neuropathy in people with screen-detected diabetes

DEFF Research Database (Denmark)

Charles, Morten; Fleischer, J; Witte, Daniel Rinse

2013-01-01

Baggrund: Der er begrænset viden om hvordan tidlig multifaktoriel behandling forbedrer konsekvenser af diabetes. Kardiel autonom neuropati (KAN) hos personer med diabetes indikerer omfattende skade på det autonome nervesystem og er relateret til mortalitet og livskvalitet. I dette studie fra...... ADDITION Danmark undersøgte vi effekten af tidlig opsporing og efterfølgende intensive behandling af type 2 diabetes i almen praksis på hyppigheden af kardiel autonom neuropati 6 år efter diagnose. Resultater: Prævalensen af tidlig KAN var 15,1% i rutine behandlingsgruppen (RG) og 15.5% i intensive...... kardiovaskulære risikofaktorer er således ikke nok til at forebygge at mange diabetes patienter udvikler KAN....

Detection of Water Hazards for Autonomous Robotic Vehicles

Science.gov (United States)

Matthes, Larry; Belluta, Paolo; McHenry, Michael

2006-01-01

Four methods of detection of bodies of water are under development as means to enable autonomous robotic ground vehicles to avoid water hazards when traversing off-road terrain. The methods involve processing of digitized outputs of optoelectronic sensors aboard the vehicles. It is planned to implement these methods in hardware and software that would operate in conjunction with the hardware and software for navigation and for avoidance of solid terrain obstacles and hazards. The first method, intended for use during the day, is based on the observation that, under most off-road conditions, reflections of sky from water are easily discriminated from the adjacent terrain by their color and brightness, regardless of the weather and of the state of surface waves on the water. Accordingly, this method involves collection of color imagery by a video camera and processing of the image data by an algorithm that classifies each pixel as soil, water, or vegetation according to its color and brightness values (see figure). Among the issues that arise is the fact that in the presence of reflections of objects on the opposite shore, it is difficult to distinguish water by color and brightness alone. Another issue is that once a body of water has been identified by means of color and brightness, its boundary must be mapped for use in navigation. Techniques for addressing these issues are under investigation. The second method, which is not limited by time of day, is based on the observation that ladar returns from bodies of water are usually too weak to be detected. In this method, ladar scans of the terrain are analyzed for returns and the absence thereof. In appropriate regions, the presence of water can be inferred from the absence of returns. Under some conditions in which reflections from the bottom are detectable, ladar returns could, in principle, be used to determine depth. The third method involves the recognition of bodies of water as dark areas in short

Comparison of direct-plating and broth-enrichment culture methods for detection of potential bacterial pathogens in respiratory secretions.

Science.gov (United States)

Kaur, Ravinder; Wischmeyer, Jareth; Morris, Matthew; Pichichero, Michael E

2017-11-01

We compared the recovery of potential respiratory bacterial pathogens and normal flora from nasopharyngeal specimens collected from children during health and at the onset of acute otitis media (AOM) by selective direct-plating and overnight broth-enrichment. Overall, 3442 nasal wash (NW) samples collected from young children were analysed from a 10-year prospective study. NWs were cultured by (1) direct-plating to TSAII/5 % sheep blood agar and chocolate agar plates and (2) overnight broth-enrichment in BacT/ALERT SA-broth followed by plating. Standard microbiology techniques were applied to identify three dominant respiratory bacterial pathogens: Streptococcus pneumoniae (Spn), Haemophilus influenzae (Hflu) and Moraxella catarrhalis (Mcat) as well as two common nasal flora, Staphylococcus aureus (SA) and alpha-haemolytic Streptococci (AHS).Results/Key findings. Direct-plating of NW resulted in isolation of Spn from 37.8 %, Hflu from 13.6 % and Mcat from 33.2 % of samples. In comparison, overnight broth-enrichment isolated fewer Spn (30.1 %), Hflu (6.2 %) and Mcat (16.2 %) (Penrichment resulted in significant increased isolation of SA (6.0 %) and AHS (30.1 %) (Penrichment when samples were collected from healthy children but not during AOM. In middle ear fluids (MEF) at the onset of AOM, broth-enrichment resulted in higher recovery of Spn (+10.4 %, Penrichment significantly reduces the accurate detection of bacterial respiratory pathogens and increases identification of SA and AHS in NW. Broth-enrichment improves detection of bacterial respiratory pathogens in MEF samples.

Direct immobilization of antibodies on Zn-doped Fe{sub 3}O{sub 4} nanoclusters for detection of pathogenic bacteria

Energy Technology Data Exchange (ETDEWEB)

Pal, Monalisa; Lee, Sanghee; Kwon, Donghoon; Hwang, Jeongin; Lee, Hyeonjeong; Hwang, Seokyung; Jeon, Sangmin, E-mail: jeons@postech.ac.kr

2017-02-01

Zinc-doped magnetic nanoclusters (Zn-MNCs) were synthesized and used to detect pathogenic bacteria in milk. Hydrothermally synthesized Zn-MNCs exhibited stronger magnetic properties than pure MNCs, which facilitated the magnetic separation from the sample using a permanent magnet. The presence of accessible Zn sites allows the direct immobilization of half-fragmented antibodies over Zn-MNCs through strong Zn−S bonds and prevents the tedious multiple steps of molecular functionalization or coating with costly noble metals prior to conjugation with an antibody. After the capture and magnetic separation of Salmonella in milk using the antibody-functionalized Zn-MNCs, the concentration of bacteria was determined with a portable ATP luminometer and the detection limit was found to be 10 CFU/mL. - Highlights: • Zn-doped Fe{sub 3}O{sub 4} nanoclusters (Zn-MNCs) were synthesized by hydrothermal method. • Antibodies were directly immobilized over Zn-MNCs through strong Zn–S{sub thiol} bonds. • Higher magnetization of Zn-MNCs than pure MNCs facilitates the magnetic separation. • Detection limit of pathogenic bacteria in milk was found to be 10 cfu/mL. • Cost effective, sensitive and selective detection of bacteria.

Design and Implementation of Autonomous Stair Climbing with Nao Humanoid Robot

OpenAIRE

Lu, Wei

2015-01-01

With the development of humanoid robots, autonomous stair climbing is an important capability. Humanoid robots will play an important role in helping people tackle some basic problems in the future. The main contribution of this thesis is that the NAO humanoid robot can climb the spiral staircase autonomously. In the vision module, the algorithm of image filtering and detecting the contours of the stair contributes to calculating the location of the stairs accurately. Additionally, the st...

Automated surface-scanning detection of pathogenic bacteria on fresh produce

Science.gov (United States)

Horikawa, Shin; Du, Songtao; Liu, Yuzhe; Chen, I.-Hsuan; Xi, Jianguo; Crumpler, Michael S.; Sirois, Donald L.; Best, Steve R.; Wikle, Howard C.; Chin, Bryan A.

2017-05-01

This paper investigates the effects of surface-scanning detector position on the resonant frequency and signal amplitude of a wireless magnetoelastic (ME) biosensor for direct pathogen detection on solid surfaces. The experiments were conducted on the surface of a flat polyethylene (PE) plate as a model study. An ME biosensor (1 mm × 0.2 mm × 30 μm) was placed on the PE surface, and a surface-scanning detector was brought close and aligned to the sensor for wireless resonant frequency measurement. The position of the detector was accurately controlled by using a motorized three-axis translation system (i.e., controlled X, Y, and Z positions). The results showed that the resonant frequency variations of the sensor were -125 to +150 Hz for X and Y detector displacements of +/-600 μm and Z displacements of +100 to +500 μm. These resonant frequency variations were small compared to the sensor's initial resonant frequency (< 0.007% of 2.2 MHz initial resonant frequency) measured at the detector home position, indicating high accuracy of the measurement. In addition, the signal amplitude was, as anticipated, found to decrease exponentially with increasing detection distance (i.e., Z distance). Finally, additional experiments were conducted on the surface of cucumbers. Similar results were obtained.

INS integrated motion analysis for autonomous vehicle navigation

Science.gov (United States)

Roberts, Barry; Bazakos, Mike

1991-01-01

The use of inertial navigation system (INS) measurements to enhance the quality and robustness of motion analysis techniques used for obstacle detection is discussed with particular reference to autonomous vehicle navigation. The approach to obstacle detection used here employs motion analysis of imagery generated by a passive sensor. Motion analysis of imagery obtained during vehicle travel is used to generate range measurements to points within the field of view of the sensor, which can then be used to provide obstacle detection. Results obtained with an INS integrated motion analysis approach are reviewed.

Detection of virulence factors and molecular typing of pathogenic Leptospira from capybara (Hydrochaeris hydrochaeris).

Science.gov (United States)

Jorge, Sérgio; Monte, Leonardo G; Coimbra, Marco Antonio; Albano, Ana Paula; Hartwig, Daiane D; Lucas, Caroline; Seixas, Fabiana K; Dellagostin, Odir A; Hartleben, Cláudia P

2012-10-01

Leptospirosis is a globally prevalent zoonosis caused by pathogenic Leptospira spp.; several serologic variants have reservoirs in synanthropic rodents. The capybara is the largest living rodent in the world, and it has a wide geographical distribution in Central and South America. This rodent is a significant source of Leptospira since the agent is shed via urine into the environment and is a potential public health threat. In this study, we isolated and identified by molecular techniques a pathogenic Leptospira from capybara in southern Brazil. The isolated strain was characterized by partial rpoB gene sequencing and variable-number tandem-repeats analysis as L. interrogans, serogroup Icterohaemorrhagiae. In addition, to confirm the expression of virulence factors, the bacterial immunoglobulin-like proteins A and B expression was detected by indirect immunofluorescence using leptospiral specific monoclonal antibodies. This report identifies capybaras as an important source of infection and provides insight into the epidemiology of leptospirosis.

Direct bacterial loop-mediated isothermal amplification detection on the pathogenic features of the nosocomial pathogen - Methicillin resistant Staphylococcus aureus strains with respiratory origins.

Science.gov (United States)

Lin, Qun; Xu, Pusheng; Li, Jiaowu; Chen, Yin; Feng, Jieyi

2017-08-01

Loop-mediated isothermal amplification based detection assays using bacterial culture or colony for direct detection of methicillin resistant Staphylococcus aureus(MRSA) had been developed and evaluated, followed by its extensive application on a large scale of clinical MRSA isolated from respiratory origins, including nasal swabs and sputums. Six primers, including outer primers, inner primers and loop primers, were specifically designed for recognizing eight distinct sequences on four targets: 16SrRNA, femA, mecA and orfX. Twenty-seven reference strains were used to develop, evaluate and optimize this assay. Then, a total of 532 clinical MRSA isolates were employed for each detected targets. And the results were determined through both visual observation of the color change by naked eye and electrophoresis. The specific of each primer had been confirmed, and the optimal amplification was obtained under 65 °C for 40 min. The limit of detections (LOD) of bacteria culture LAMP assays were determined to be 10 4  CFU/ml for 16S rRNA, femA, as well as orfX and 10 5  CFU/ml for mecA, respectively. The established novel assays on MRSA detection may provide new strategies for rapid detection of foodborne pathogens. Copyright © 2017. Published by Elsevier Ltd.

An Autonomous Mobile Robotic System for Surveillance of Indoor Environments

Directory of Open Access Journals (Sweden)

Donato Di Paola

2010-02-01

Full Text Available The development of intelligent surveillance systems is an active research area. In this context, mobile and multi-functional robots are generally adopted as means to reduce the environment structuring and the number of devices needed to cover a given area. Nevertheless, the number of different sensors mounted on the robot, and the number of complex tasks related to exploration, monitoring, and surveillance make the design of the overall system extremely challenging. In this paper, we present our autonomous mobile robot for surveillance of indoor environments. We propose a system able to handle autonomously general-purpose tasks and complex surveillance issues simultaneously. It is shown that the proposed robotic surveillance scheme successfully addresses a number of basic problems related to environment mapping, localization and autonomous navigation, as well as surveillance tasks, like scene processing to detect abandoned or removed objects and people detection and following. The feasibility of the approach is demonstrated through experimental tests using a multisensor platform equipped with a monocular camera, a laser scanner, and an RFID device. Real world applications of the proposed system include surveillance of wide areas (e.g. airports and museums and buildings, and monitoring of safety equipment.

An Autonomous Mobile Robotic System for Surveillance of Indoor Environments

Directory of Open Access Journals (Sweden)

Donato Di Paola

2010-03-01

Full Text Available The development of intelligent surveillance systems is an active research area. In this context, mobile and multi-functional robots are generally adopted as means to reduce the environment structuring and the number of devices needed to cover a given area. Nevertheless, the number of different sensors mounted on the robot, and the number of complex tasks related to exploration, monitoring, and surveillance make the design of the overall system extremely challenging. In this paper, we present our autonomous mobile robot for surveillance of indoor environments. We propose a system able to handle autonomously general-purpose tasks and complex surveillance issues simultaneously. It is shown that the proposed robotic surveillance scheme successfully addresses a number of basic problems related to environment mapping, localization and autonomous navigation, as well as surveillance tasks, like scene processing to detect abandoned or removed objects and people detection and following. The feasibility of the approach is demonstrated through experimental tests using a multisensor platform equipped with a monocular camera, a laser scanner, and an RFID device. Real world applications of the proposed system include surveillance of wide areas (e.g. airports and museums and buildings, and monitoring of safety equipment.

A rapid and specific detection of pathogenic serovar Salmonella typhimurium by loop-mediated isothermal amplification method (LAMP

Directory of Open Access Journals (Sweden)

Hadi Ravan

2017-09-01

Discussion and conclusion: As a result of a high sensitivity and specificity of the method as well as its low cost per assay, it could be concluded that the present LAMP assay is a powerful, accurate, and efficient method for detecting pathogenic serovar Salmonella typhimurium in food-processing industries and diagnostic laboratories.

[Development of molecular detection of food-borne pathogenic bacteria using miniaturized microfluidic devices].

Science.gov (United States)

Iván, Kristóf; Maráz, Anna

2015-12-20

Detection and identification of food-borne pathogenic bacteria are key points for the assurance of microbiological food safety. Traditional culture-based methods are more and more replaced by or supplemented with nucleic acid based molecular techniques, targeting specific (preferably virulence) genes in the genomes. Internationally validated DNA amplification - most frequently real-time polymerase chain reaction - methods are applied by the food microbiological testing laboratories for routine analysis, which will result not only in shortening the time for results but they also improve the performance characteristics (e.g. sensitivity, specificity) of the methods. Beside numerous advantages of the polymerase chain reaction based techniques for routine microbiological analysis certain drawbacks have to be mentioned, such as the high cost of the equipment and reagents, as well as the risk of contamination of the laboratory environment by the polymerase chain reaction amplicons, which require construction of an isolated laboratory system. Lab-on-a-chip systems can integrate most of these laboratory processes within a miniaturized device that delivers the same specificity and reliability as the standard protocols. The benefits of miniaturized devices are: simple - often automated - use, small overall size, portability, sterility due to single use possibility. These miniaturized rapid diagnostic tests are being researched and developed at the best research centers around the globe implementing various sample preparation and molecular DNA amplification methods on-chip. In parallel, the aim of the authors' research is to develop microfluidic Lab-on-a-chip devices for the detection and identification of food-borne pathogenic bacteria.

Molecular diagnostics for the detection and characterization of microbial pathogens.

Science.gov (United States)

Procop, Gary W

2007-09-01

New and advanced methods of molecular diagnostics are changing the way we practice clinical microbiology, which affects the practice of medicine. Signal amplification and real-time nucleic acid amplification technologies offer a sensitive and specific result with a more rapid turnaround time than has ever before been possible. Numerous methods of postamplification analysis afford the simultaneous detection and differentiation of numerous microbial pathogens, their mechanisms of resistance, and the construction of disease-specific assays. The technical feasibility of these assays has already been demonstrated. How these new, often more expensive tests will be incorporated into routine practice and the impact they will have on patient care remain to be determined. One of the most attractive uses for such techniques is to achieve a more rapid characterization of the infectious agent so that a narrower-spectrum antimicrobial agent may be used, which should have an impact on resistance patterns.

Validating a UAV artificial intelligence control system using an autonomous test case generator

Science.gov (United States)

Straub, Jeremy; Huber, Justin

2013-05-01

The validation of safety-critical applications, such as autonomous UAV operations in an environment which may include human actors, is an ill posed problem. To confidence in the autonomous control technology, numerous scenarios must be considered. This paper expands upon previous work, related to autonomous testing of robotic control algorithms in a two dimensional plane, to evaluate the suitability of similar techniques for validating artificial intelligence control in three dimensions, where a minimum level of airspeed must be maintained. The results of human-conducted testing are compared to this automated testing, in terms of error detection, speed and testing cost.

Rapid methods: the detection of foodborne pathogens

NARCIS (Netherlands)

Beumer, R.R.; Hazeleger, W.C.

2009-01-01

Although bacteria are the first type of microorganisms that come to mind when discussing microbial food safety, they are by no means the only pathogenic foodborne microorganisms. Mycotoxin producing moulds, human enteric viruses, protozoan parasites and marine biotoxins are also of importance.

Vision Analysis System for Autonomous Landing of Micro Drone

Directory of Open Access Journals (Sweden)

Skoczylas Marcin

2014-12-01

Full Text Available This article describes a concept of an autonomous landing system of UAV (Unmanned Aerial Vehicle. This type of device is equipped with the functionality of FPV observation (First Person View and radio broadcasting of video or image data. The problem is performance of a system of autonomous drone landing in an area with dimensions of 1m × 1m, based on CCD camera coupled with an image transmission system connected to a base station. Captured images are scanned and landing marker is detected. For this purpose, image features detectors (such as SIFT, SURF or BRISK are utilized to create a database of keypoints of the landing marker and in a new image keypoints are found using the same feature detector. In this paper results of a framework that allows detection of defined marker for the purpose of drone landing field positioning will be presented.

Prediction of molecular mimicry candidates in human pathogenic bacteria.

Science.gov (United States)

Doxey, Andrew C; McConkey, Brendan J

2013-08-15

Molecular mimicry of host proteins is a common strategy adopted by bacterial pathogens to interfere with and exploit host processes. Despite the availability of pathogen genomes, few studies have attempted to predict virulence-associated mimicry relationships directly from genomic sequences. Here, we analyzed the proteomes of 62 pathogenic and 66 non-pathogenic bacterial species, and screened for the top pathogen-specific or pathogen-enriched sequence similarities to human proteins. The screen identified approximately 100 potential mimicry relationships including well-characterized examples among the top-scoring hits (e.g., RalF, internalin, yopH, and others), with about 1/3 of predicted relationships supported by existing literature. Examination of homology to virulence factors, statistically enriched functions, and comparison with literature indicated that the detected mimics target key host structures (e.g., extracellular matrix, ECM) and pathways (e.g., cell adhesion, lipid metabolism, and immune signaling). The top-scoring and most widespread mimicry pattern detected among pathogens consisted of elevated sequence similarities to ECM proteins including collagens and leucine-rich repeat proteins. Unexpectedly, analysis of the pathogen counterparts of these proteins revealed that they have evolved independently in different species of bacterial pathogens from separate repeat amplifications. Thus, our analysis provides evidence for two classes of mimics: complex proteins such as enzymes that have been acquired by eukaryote-to-pathogen horizontal transfer, and simpler repeat proteins that have independently evolved to mimic the host ECM. Ultimately, computational detection of pathogen-specific and pathogen-enriched similarities to host proteins provides insights into potentially novel mimicry-mediated virulence mechanisms of pathogenic bacteria.

Vaginal microbicides: detecting toxicities in vivo that paradoxically increase pathogen transmission

Directory of Open Access Journals (Sweden)

Abusuwwa Raed

2006-06-01

Full Text Available Abstract Background Microbicides must protect against STD pathogens without causing unacceptable toxic effects. Microbicides based on nonoxynol-9 (N9 and other detergents disrupt sperm, HSV and HIV membranes, and these agents are effective contraceptives. But paradoxically N9 fails to protect women against HIV and other STD pathogens, most likely because it causes toxic effects that increase susceptibility. The mouse HSV-2 vaginal transmission model reported here: (a Directly tests for toxic effects that increase susceptibility to HSV-2, (b Determines in vivo whether a microbicide can protect against HSV-2 transmission without causing toxicities that increase susceptibility, and (c Identifies those toxic effects that best correlate with the increased HSV susceptibility. Methods Susceptibility was evaluated in progestin-treated mice by delivering a low-dose viral inoculum (0.1 ID50 at various times after delivering the candidate microbicide to detect whether the candidate increased the fraction of mice infected. Ten agents were tested – five detergents: nonionic (N9, cationic (benzalkonium chloride, BZK, anionic (sodium dodecylsulfate, SDS, the pair of detergents in C31G (C14AO and C16B; one surface active agent (chlorhexidine; two non-detergents (BufferGel®, and sulfonated polystyrene, SPS; and HEC placebo gel (hydroxyethylcellulose. Toxic effects were evaluated by histology, uptake of a 'dead cell' dye, colposcopy, enumeration of vaginal macrophages, and measurement of inflammatory cytokines. Results A single dose of N9 protected against HSV-2 for a few minutes but then rapidly increased susceptibility, which reached maximum at 12 hours. When applied at the minimal concentration needed for brief partial protection, all five detergents caused a subsequent increase in susceptibility at 12 hours of ~20–30-fold. Surprisingly, colposcopy failed to detect visible signs of the N9 toxic effect that increased susceptibility at 12 hours. Toxic

Autonomous Soil Assessment System: A Data-Driven Approach to Planetary Mobility Hazard Detection

Science.gov (United States)

Raimalwala, K.; Faragalli, M.; Reid, E.

2018-04-01

The Autonomous Soil Assessment System predicts mobility hazards for rovers. Its development and performance are presented, with focus on its data-driven models, machine learning algorithms, and real-time sensor data fusion for predictive analytics.

Phage-based surface plasmon resonance strategies for the detection of pathogens

Science.gov (United States)

Tawil, Nancy

We start by reviewing the basic principles and recent advances in biosensing technologies using optical, electrochemical and acoustic platforms for phage-based diagnostics. Although much notable work has been done, a low cost, specific, sensitive optical method for detecting low concentrations of pathogens, in a few minutes, has not been established. We conclude from the limited body of work on the subject that improving immobilization strategies and finding more suitable phage recognition elements would allow for a more sensitive approach. Our aim was to better describe the attachment process of MRSA specific phages on gold surfaces, and the subsequent biodetection of their bacterial hosts by surface plasmon resonance (SPR). With the knowledge that the adsorption characteristics of thiol-containing molecules are necessary for applications involving the attachment of recognition elements to a functionalized surface, we start by providing comparative details on the kinetics of self-assembly of L-cysteine and 11-mercaptoundecanoic acid (MUA) monolayers on gold using SPR[1]. Our purpose, in carrying out these measurements was to establish each molecule's validity and applicability as a linker element for use in biosensing. We find that monolayer formation, for both L-cysteine and MUA, is described by the Langmuir isotherm at low concentrations only. For L-cysteine, both the amine and thiol groups contribute to the initial attachment of the molecule, followed by the replacement of the amine-gold complexes initially formed with more stable thiol-gold complexes. The reorganization of L-cysteine creates more space on the gold surface, and the zwitterionic form of the molecule permits the physisorption of a second layer through electrostatic interactions. On the other hand, MUA deposits randomly onto the surface of gold as a SAM and slowly reorganizes into a denser, vertical state. Surface plasmon resonance was then used for the real-time monitoring of the attachment of

A phage-displayed chicken single-chain antibody fused to alkaline phosphatase detects Fusarium pathogens and their presence in cereal grains

International Nuclear Information System (INIS)

Hu, Zu-Quan; Li, He-Ping; Zhang, Jing-Bo; Huang, Tao; Liu, Jin-Long; Xue, Sheng; Wu, Ai-Bo; Liao, Yu-Cai

2013-01-01

Graphical abstract: A phage-displayed chicken scFv antibody, FvSG7, binds on the surface antigen of conidiospores and the mycelia of F. verticillioides. Its fusion with alkaline phosphatase (AP) through a 218 linker displayed a 4-fold higher affinity compared with the parent scFv antibody and efficiently detected toxigenic Fusarium pathogens in cereal grains. Highlights: ► Generation of a highly reactive scFv antibody against F. verticillioides. ► Localization of the antibody binding to the surface target of F. verticillioides. ► Expression of the antibody–alkaline phosphatase (AP) fusion linked by a 218 linker. ► The antibody–AP fusion has a higher affinity than the parental antibody. ► The antibody–AP fusion detects toxigenic Fusarium pathogens in cereal grains. -- Abstract: Fusarium and its poisonous mycotoxins are distributed worldwide and are of particular interest in agriculture and food safety. A simple analytical method to detect pathogens is essential for forecasting diseases and controlling mycotoxins. This article describes a proposed method for convenient and sensitive detection of Fusarium pathogens that uses the fusion of single-chain variable fragment (scFv) and alkaline phosphatase (AP). A highly reactive scFv antibody specific to soluble cell wall-bound proteins (SCWPs) of F. verticillioides was selected from an immunized chicken phagemid library by phage display. The antibody was verified to bind on the surface of ungerminated conidiospores and mycelia of F. verticillioides. The scFv–AP fusion was constructed, and soluble expression in bacteria was confirmed. Both the antibody properties and enzymatic activity were retained, and the antigen-binding capacity of the fusion was enhanced by the addition of a linker. Surface plasmon resonance measurements confirmed that the fusion displayed 4-fold higher affinity compared with the fusion's parental scFv antibody. Immunoblot analyses showed that the fusion had good binding capacity to

A phage-displayed chicken single-chain antibody fused to alkaline phosphatase detects Fusarium pathogens and their presence in cereal grains

Energy Technology Data Exchange (ETDEWEB)

Hu, Zu-Quan [Molecular Biotechnology Laboratory of Triticeae Crops, Huazhong Agricultural University, Wuhan 430070 (China); Li, He-Ping [Molecular Biotechnology Laboratory of Triticeae Crops, Huazhong Agricultural University, Wuhan 430070 (China); College of Life Science and Technology, Huazhong Agricultural University, Wuhan 430070 (China); Zhang, Jing-Bo [Molecular Biotechnology Laboratory of Triticeae Crops, Huazhong Agricultural University, Wuhan 430070 (China); College of Plant Science and Technology, Huazhong Agricultural University, Wuhan 430070 (China); Huang, Tao [Molecular Biotechnology Laboratory of Triticeae Crops, Huazhong Agricultural University, Wuhan 430070 (China); College of Life Science and Technology, Huazhong Agricultural University, Wuhan 430070 (China); Liu, Jin-Long; Xue, Sheng [Molecular Biotechnology Laboratory of Triticeae Crops, Huazhong Agricultural University, Wuhan 430070 (China); Wu, Ai-Bo [Institute for Agri-food Standards and Testing Technology, Laboratory of Quality and Safety Risk Assessment for Agro-products, Ministry of Agriculture, Shanghai Academy of Agricultural Sciences, 1000 Jinqi Road, Shanghai 201403 (China); Liao, Yu-Cai, E-mail: ycliao06@yahoo.com.cn [Molecular Biotechnology Laboratory of Triticeae Crops, Huazhong Agricultural University, Wuhan 430070 (China); College of Plant Science and Technology, Huazhong Agricultural University, Wuhan 430070 (China); National Center of Plant Gene Research, Wuhan 430070 (China)

2013-02-18

Graphical abstract: A phage-displayed chicken scFv antibody, FvSG7, binds on the surface antigen of conidiospores and the mycelia of F. verticillioides. Its fusion with alkaline phosphatase (AP) through a 218 linker displayed a 4-fold higher affinity compared with the parent scFv antibody and efficiently detected toxigenic Fusarium pathogens in cereal grains. Highlights: ► Generation of a highly reactive scFv antibody against F. verticillioides. ► Localization of the antibody binding to the surface target of F. verticillioides. ► Expression of the antibody–alkaline phosphatase (AP) fusion linked by a 218 linker. ► The antibody–AP fusion has a higher affinity than the parental antibody. ► The antibody–AP fusion detects toxigenic Fusarium pathogens in cereal grains. -- Abstract: Fusarium and its poisonous mycotoxins are distributed worldwide and are of particular interest in agriculture and food safety. A simple analytical method to detect pathogens is essential for forecasting diseases and controlling mycotoxins. This article describes a proposed method for convenient and sensitive detection of Fusarium pathogens that uses the fusion of single-chain variable fragment (scFv) and alkaline phosphatase (AP). A highly reactive scFv antibody specific to soluble cell wall-bound proteins (SCWPs) of F. verticillioides was selected from an immunized chicken phagemid library by phage display. The antibody was verified to bind on the surface of ungerminated conidiospores and mycelia of F. verticillioides. The scFv–AP fusion was constructed, and soluble expression in bacteria was confirmed. Both the antibody properties and enzymatic activity were retained, and the antigen-binding capacity of the fusion was enhanced by the addition of a linker. Surface plasmon resonance measurements confirmed that the fusion displayed 4-fold higher affinity compared with the fusion's parental scFv antibody. Immunoblot analyses showed that the fusion had good binding

Limits of clinical tests to screen autonomic function in diabetes type 1.

Science.gov (United States)

Ducher, M; Bertram, D; Sagnol, I; Cerutti, C; Thivolet, C; Fauvel, J P

2001-11-01

A precocious detection of cardiac autonomic dysfunction is of major clinical interest that could lead to a more intensive supervision of diabetic patients. However, classical clinical exploration of cardiac autonomic function is not easy to undertake in a reproducible way. Thus, respective interests of autonomic nervous parameters provided by both clinical tests and computerized analysis of resting blood pressure were checked in type 1 diabetic patients without orthostatic hypotension and microalbuminuria. Thirteen diabetic subjects matched for age and gender to thirteen healthy subjects volunteered to participate to the study. From clinical tests (standing up, deep breathing, Valsalva maneuver, handgrip test), autonomic function was scored according to Ewing's methodology. Analysis of resting beat to beat blood pressure provided autonomic indices of the cardiac function (spectral analysis or Z analysis). 5 of the 13 diabetic patients exhibited a pathological score (more than one pathological response) suggesting the presence of cardiovascular autonomic dysfunction. The most discriminative test was the deep breathing test. However, spectral indices of BP recordings and baro-reflex sensitivity (BRS) of these 5 subjects were similar to those of healthy subjects and of remaining diabetic subjects. Alteration in Ewing's score given by clinical tests may not reflect an alteration of cardiac autonomic function in asymptomatic type 1 diabetic patients, because spectral indices of sympathetic and parasympathetic (including BRS) function were within normal range. Our results strongly suggest to confront results provided by both methodologies before concluding to an autonomic cardiac impairment in asymptomatic diabetic patients.

Dual-excitation upconverting nanoparticle and quantum dot aptasensor for multiplexed food pathogen detection.

Science.gov (United States)

Kurt, Hasan; Yüce, Meral; Hussain, Babar; Budak, Hikmet

2016-07-15

In this report, a dual-excitation sensing method was developed using aptamer-functionalized quantum dots and upconverting nanoparticles, exhibiting Stokes and anti-Stokes type excitation profiles, respectively. Conjugation of the aptamer-functionalized luminescent nanoparticles with the magnetic beads, comprising short DNA sequences that were partially complementary to the aptamer sequences, enabled facile separation of the analyte-free conjugates for fluorescent measurement. UV-Visible spectroscopy, Circular Dichroism spectroscopy, Dynamic Light Scattering and Polyacrylamide Gel Electrophoresis techniques were used to characterize the aptamer probes developed. The target-specific luminescent conjugates were applied for multiplex detection of model food pathogens, Salmonella typhimurium, and Staphylococcus aureus, in which the fluorescent emission spectra were obtained under UV excitation at 325nm for quantum dots and NIR excitation at 980nm for upconverting nanoparticles, respectively. The dual-excitation strategy was aimed to minimize cross-talk between the luminescent signals for multiplexed detection, and yielded limit of detection values of 16 and 28cfumL(-1) for Staphylococcus aureus, and Salmonella typhimurium, respectively. By employing a greater number of quantum dots and upconverting nanoparticles with non-overlapping fluorescent emissions, the proposed methodology might be exploited further to detect several analytes, simultaneously. Copyright © 2016 Elsevier B.V. All rights reserved.

The application of flow cytometry and fluorescent probe technology for detection and assessment of viability of plant pathogenic bacteria

NARCIS (Netherlands)

Chitarra, L.G.; Bulk, van den R.W.

2003-01-01

Conventional methods to detect and assess the viability of plant pathogenic bacteria are usually based on plating assays or serological techniques. Plating assays provide information about the number of viable cells, expressed as colony-forming units, but are time-consuming and laborious.

Tracing pathogens in the food chain

NARCIS (Netherlands)

Brul, S.; Fratamico, P.M.; McMeekin, T.A.

2010-01-01

Successful methods for the detection and investigation of outbreaks of foodborne disease are essential for ensuring consumer safety. Increased understanding of the transmission of pathogens in food chains will also assist efforts to safeguard public health. Tracing pathogens in the food chain

Sensor fusion: lane marking detection and autonomous intelligent cruise control system

Science.gov (United States)

Baret, Marc; Baillarin, S.; Calesse, C.; Martin, Lionel

1995-12-01

In the past few years MATRA and RENAULT have developed an Autonomous Intelligent Cruise Control (AICC) system based on a LIDAR sensor. This sensor incorporating a charge coupled device was designed to acquire pulsed laser diode emission reflected by standard car reflectors. The absence of moving mechanical parts, the large field of view, the high measurement rate and the very good accuracy for distance range and angular position of targets make this sensor very interesting. It provides the equipped car with the distance and the relative speed of other vehicles enabling the safety distance to be controlled by acting on the throttle and the automatic gear box. Experiments in various real traffic situations have shown the limitations of this kind of system especially on bends. All AICC sensors are unable to distinguish between a bend and a change of lane. This is easily understood if we consider a road without lane markings. This fact has led MATRA to improve its AICC system by providing the lane marking information. Also in the scope of the EUREKA PROMETHEUS project, MATRA and RENAULT have developed a lane keeping system in order to warn of the drivers lack of vigilance. Thus, MATRA have spread this system to far field lane marking detection and have coupled it with the AICC system. Experiments will be carried out on roads to estimate the gain in performance and comfort due to this fusion.

Hyperspectral Imagery Target Detection Using Improved Anomaly Detection and Signature Matching Methods

National Research Council Canada - National Science Library

Smetek, Timothy E

2007-01-01

This research extends the field of hyperspectral target detection by developing autonomous anomaly detection and signature matching methodologies that reduce false alarms relative to existing benchmark detectors...

Comparison of supervised machine learning algorithms for waterborne pathogen detection using mobile phone fluorescence microscopy

Science.gov (United States)

Ceylan Koydemir, Hatice; Feng, Steve; Liang, Kyle; Nadkarni, Rohan; Benien, Parul; Ozcan, Aydogan

2017-06-01

Giardia lamblia is a waterborne parasite that affects millions of people every year worldwide, causing a diarrheal illness known as giardiasis. Timely detection of the presence of the cysts of this parasite in drinking water is important to prevent the spread of the disease, especially in resource-limited settings. Here we provide extended experimental testing and evaluation of the performance and repeatability of a field-portable and cost-effective microscopy platform for automated detection and counting of Giardia cysts in water samples, including tap water, non-potable water, and pond water. This compact platform is based on our previous work, and is composed of a smartphone-based fluorescence microscope, a disposable sample processing cassette, and a custom-developed smartphone application. Our mobile phone microscope has a large field of view of 0.8 cm2 and weighs only 180 g, excluding the phone. A custom-developed smartphone application provides a user-friendly graphical interface, guiding the users to capture a fluorescence image of the sample filter membrane and analyze it automatically at our servers using an image processing algorithm and training data, consisting of >30,000 images of cysts and >100,000 images of other fluorescent particles that are captured, including, e.g. dust. The total time that it takes from sample preparation to automated cyst counting is less than an hour for each 10 ml of water sample that is tested. We compared the sensitivity and the specificity of our platform using multiple supervised classification models, including support vector machines and nearest neighbors, and demonstrated that a bootstrap aggregating (i.e. bagging) approach using raw image file format provides the best performance for automated detection of Giardia cysts. We evaluated the performance of this machine learning enabled pathogen detection device with water samples taken from different sources (e.g. tap water, non-potable water, pond water) and achieved a

Comparison of supervised machine learning algorithms for waterborne pathogen detection using mobile phone fluorescence microscopy

KAUST Repository

Ceylan Koydemir, Hatice

2017-06-14

Giardia lamblia is a waterborne parasite that affects millions of people every year worldwide, causing a diarrheal illness known as giardiasis. Timely detection of the presence of the cysts of this parasite in drinking water is important to prevent the spread of the disease, especially in resource-limited settings. Here we provide extended experimental testing and evaluation of the performance and repeatability of a field-portable and cost-effective microscopy platform for automated detection and counting of Giardia cysts in water samples, including tap water, non-potable water, and pond water. This compact platform is based on our previous work, and is composed of a smartphone-based fluorescence microscope, a disposable sample processing cassette, and a custom-developed smartphone application. Our mobile phone microscope has a large field of view of ~0.8 cm2 and weighs only ~180 g, excluding the phone. A custom-developed smartphone application provides a user-friendly graphical interface, guiding the users to capture a fluorescence image of the sample filter membrane and analyze it automatically at our servers using an image processing algorithm and training data, consisting of >30,000 images of cysts and >100,000 images of other fluorescent particles that are captured, including, e.g. dust. The total time that it takes from sample preparation to automated cyst counting is less than an hour for each 10 ml of water sample that is tested. We compared the sensitivity and the specificity of our platform using multiple supervised classification models, including support vector machines and nearest neighbors, and demonstrated that a bootstrap aggregating (i.e. bagging) approach using raw image file format provides the best performance for automated detection of Giardia cysts. We evaluated the performance of this machine learning enabled pathogen detection device with water samples taken from different sources (e.g. tap water, non-potable water, pond water) and achieved

Comparison of supervised machine learning algorithms for waterborne pathogen detection using mobile phone fluorescence microscopy

KAUST Repository

Ceylan Koydemir, Hatice; Feng, Steve; Liang, Kyle; Nadkarni, Rohan; Benien, Parul; Ozcan, Aydogan

2017-01-01

Giardia lamblia is a waterborne parasite that affects millions of people every year worldwide, causing a diarrheal illness known as giardiasis. Timely detection of the presence of the cysts of this parasite in drinking water is important to prevent the spread of the disease, especially in resource-limited settings. Here we provide extended experimental testing and evaluation of the performance and repeatability of a field-portable and cost-effective microscopy platform for automated detection and counting of Giardia cysts in water samples, including tap water, non-potable water, and pond water. This compact platform is based on our previous work, and is composed of a smartphone-based fluorescence microscope, a disposable sample processing cassette, and a custom-developed smartphone application. Our mobile phone microscope has a large field of view of ~0.8 cm2 and weighs only ~180 g, excluding the phone. A custom-developed smartphone application provides a user-friendly graphical interface, guiding the users to capture a fluorescence image of the sample filter membrane and analyze it automatically at our servers using an image processing algorithm and training data, consisting of >30,000 images of cysts and >100,000 images of other fluorescent particles that are captured, including, e.g. dust. The total time that it takes from sample preparation to automated cyst counting is less than an hour for each 10 ml of water sample that is tested. We compared the sensitivity and the specificity of our platform using multiple supervised classification models, including support vector machines and nearest neighbors, and demonstrated that a bootstrap aggregating (i.e. bagging) approach using raw image file format provides the best performance for automated detection of Giardia cysts. We evaluated the performance of this machine learning enabled pathogen detection device with water samples taken from different sources (e.g. tap water, non-potable water, pond water) and achieved

Comparison of supervised machine learning algorithms for waterborne pathogen detection using mobile phone fluorescence microscopy

Directory of Open Access Journals (Sweden)

Ceylan Koydemir Hatice

2017-06-01

Full Text Available Giardia lamblia is a waterborne parasite that affects millions of people every year worldwide, causing a diarrheal illness known as giardiasis. Timely detection of the presence of the cysts of this parasite in drinking water is important to prevent the spread of the disease, especially in resource-limited settings. Here we provide extended experimental testing and evaluation of the performance and repeatability of a field-portable and cost-effective microscopy platform for automated detection and counting of Giardia cysts in water samples, including tap water, non-potable water, and pond water. This compact platform is based on our previous work, and is composed of a smartphone-based fluorescence microscope, a disposable sample processing cassette, and a custom-developed smartphone application. Our mobile phone microscope has a large field of view of ~0.8 cm2 and weighs only ~180 g, excluding the phone. A custom-developed smartphone application provides a user-friendly graphical interface, guiding the users to capture a fluorescence image of the sample filter membrane and analyze it automatically at our servers using an image processing algorithm and training data, consisting of >30,000 images of cysts and >100,000 images of other fluorescent particles that are captured, including, e.g. dust. The total time that it takes from sample preparation to automated cyst counting is less than an hour for each 10 ml of water sample that is tested. We compared the sensitivity and the specificity of our platform using multiple supervised classification models, including support vector machines and nearest neighbors, and demonstrated that a bootstrap aggregating (i.e. bagging approach using raw image file format provides the best performance for automated detection of Giardia cysts. We evaluated the performance of this machine learning enabled pathogen detection device with water samples taken from different sources (e.g. tap water, non-potable water, pond

Nodeomics: pathogen detection in vertebrate lymph nodes using meta-transcriptomics.

Directory of Open Access Journals (Sweden)

Nicola E Wittekindt

Full Text Available The ongoing emergence of human infections originating from wildlife highlights the need for better knowledge of the microbial community in wildlife species where traditional diagnostic approaches are limited. Here we evaluate the microbial biota in healthy mule deer (Odocoileus hemionus by analyses of lymph node meta-transcriptomes. cDNA libraries from five individuals and two pools of samples were prepared from retropharyngeal lymph node RNA enriched for polyadenylated RNA and sequenced using Roche-454 Life Sciences technology. Protein-coding and 16S ribosomal RNA (rRNA sequences were taxonomically profiled using protein and rRNA specific databases. Representatives of all bacterial phyla were detected in the seven libraries based on protein-coding transcripts indicating that viable microbiota were present in lymph nodes. Residents of skin and rumen, and those ubiquitous in mule deer habitat dominated classifiable bacterial species. Based on detection of both rRNA and protein-coding transcripts, we identified two new proteobacterial species; a Helicobacter closely related to Helicobacter cetorum in the Helicobacter pylori/Helicobacter acinonychis complex and an Acinetobacter related to Acinetobacter schindleri. Among viruses, a novel gamma retrovirus and other members of the Poxviridae and Retroviridae were identified. We additionally evaluated bacterial diversity by amplicon sequencing the hypervariable V6 region of 16S rRNA and demonstrate that overall taxonomic diversity is higher with the meta-transcriptomic approach. These data provide the most complete picture to date of the microbial diversity within a wildlife host. Our research advances the use of meta-transcriptomics to study microbiota in wildlife tissues, which will facilitate detection of novel organisms with pathogenic potential to human and animals.

Testing for autonomic neuropathy

DEFF Research Database (Denmark)

Hilsted, J

1984-01-01

Autonomic neuropathy is a common complication in long-term diabetes, about 30% of the patients showing measurable signs of autonomic dysfunction after 10 years duration of disease. The diagnosis is often difficult to establish because clinical symptoms generally occur late in the course of the di......Autonomic neuropathy is a common complication in long-term diabetes, about 30% of the patients showing measurable signs of autonomic dysfunction after 10 years duration of disease. The diagnosis is often difficult to establish because clinical symptoms generally occur late in the course...

A Multifunctional Smart Coating for Autonomous Corrosion Control

Science.gov (United States)

Calle, Luz Marina; Buhrow, Jerry W.; Jolley, Scott T.

2012-01-01

Corrosion is a destructive process that often causes failure in metallic components and structures. Protective coatings are the most commonly used method of corrosion control. However, progressively stricter environmental regulations have resulted in the ban of many commercially available corrosion protective coatings due to the harmful effects of their solvents or corrosion inhibitors. This work concerns the development of a multifunctional, smart coating for the autonomous control of corrosion. This coating is being developed to have the inherent ability to detect the chemical changes associated with the onset of corrosion and respond autonomously to control it. The multi-functionality of the coating is based on micro-encapsulation technology specifically designed for corrosion control applications. This design has, in addition to all the advantages of other existing microcapsules designs, the corrosion controlled release function that allows the delivery of corrosion indicators and inhibitors on demand only when and where needed. Corrosion indicators as well as corrosion inhibitors have been incorporated into microcapsules, blended into several paint systems, and tested for corrosion detection and protection efficacy. This

Molecular techniques for characterisation of pathogens

DEFF Research Database (Denmark)

Kampmann, Marie-Louise

Pathogens have always had a major interest to humans due to their central role in sickness and death. Influenza A annually kills at least 250,000 humans, and has been the cause of millions of further deaths during pandemic years in the past. Plague (Yersinia pestis) has been the cause of the Black...... capture for the detection of Y. pestis in samples from the Justinian plague (600 AD) as an attempt to detect this pathogen as a cause of death in the victims....

A novel approach for differentiating pathogenic and non-pathogenic Leptospira based on molecular fingerprinting.

Science.gov (United States)

Xiao, Di; Zhang, Cuicai; Zhang, Huifang; Li, Xiuwen; Jiang, Xiugao; Zhang, Jianzhong

2015-04-24

disease that has become an important public health problem. Traditional serological methods are the gold standard for the detection of pathogenic strains of Leptospira. However, serological procedures are cumbersome, require more complex experimental techniques, and are based on a large number of international and domestic reference strains. Additionally, these experiments involve the immunization of animals with antigens from different serotypes to produce immune serum, and improper techniques may result in a rapid decrease in antibody titer, which would affect the final results. It is difficult to perform cumbersome detection procedures in a basic laboratory. Therefore, the use of conventional serological methods is limited, which significantly impacts daily leptospirosis epidemic surveillance, prevention, and control. Molecular biology methods, such as 16S rRNA and PCR-based methods, can be used to identify the pathogenic Leptospira. However, DNA extraction and gene sequencing methods are laborious and time consuming. Therefore, more rapid and reliable high-throughput identification methods are urgently needed for the clinical diagnosis of leptospirosis to improve epidemic control. Here, molecular fingerprinting technique was use to identify the pathogenicity. We constructed the reference spectra database and the super reference spectra of pathogenic and non-pathogenic Leptospira, which can rapidly identified Leptospira at the species level and the pathogenicity of these isolates can be simultaneously confirmed. Furthermore, the protein components of Leptospira pathogenicity were revealed. These findings thus provide a new way for Leptospira pathogenicity identification. Copyright © 2014. Published by Elsevier B.V.

Comparison of pathogenic domains of rabies and African rabies-related lyssaviruses and pathogenicity observed in mice

Directory of Open Access Journals (Sweden)

Joe Kgaladi

2013-03-01

Full Text Available Several lyssavirus species occur in Africa (Rabies virus, Lagos bat virus, Mokola virus, Duvenhage virus, Shimoni bat virus and Ikoma lyssavirus, displaying a high sequence diversity between isolates belonging to the same species. There is limited information about comparative pathogenesis of these African lyssaviruses and this precludes authoritative opinion on the potential public and veterinary health impact. In this study, an analysis of representative African lyssaviruses attempted to correlate viral genomic sequence similarities and differences with the corresponding pathogenic profiles observed in mice. The study demonstrated that the virus isolates evaluated could be lethal to mice when introduced intramuscularly and that different isolates of the same lyssavirus species differ in their virulence. Using real-time polymerase chain reaction (PCR, viral RNA was detected in brain tissue, but no viral RNA was detected in the salivary glands or blood of mice that succumbed to infection. Comparison of known pathogenic domains indicated that pathogenicity is likely to be dependent on multiple domains. Cumulatively, our results re-emphasised the realisation that the pathogenicity of a lyssavirus species cannot be deduced based on studies of only a single isolate of the species or a single pathogenic domain.

Automated processing integrated with a microflow cytometer for pathogen detection in clinical matrices.

Science.gov (United States)

Golden, J P; Verbarg, J; Howell, P B; Shriver-Lake, L C; Ligler, F S

2013-02-15

A spinning magnetic trap (MagTrap) for automated sample processing was integrated with a microflow cytometer capable of simultaneously detecting multiple targets to provide an automated sample-to-answer diagnosis in 40 min. After target capture on fluorescently coded magnetic microspheres, the magnetic trap automatically concentrated the fluorescently coded microspheres, separated the captured target from the sample matrix, and exposed the bound target sequentially to biotinylated tracer molecules and streptavidin-labeled phycoerythrin. The concentrated microspheres were then hydrodynamically focused in a microflow cytometer capable of 4-color analysis (two wavelengths for microsphere identification, one for light scatter to discriminate single microspheres and one for phycoerythrin bound to the target). A three-fold decrease in sample preparation time and an improved detection limit, independent of target preconcentration, was demonstrated for detection of Escherichia coli 0157:H7 using the MagTrap as compared to manual processing. Simultaneous analysis of positive and negative controls, along with the assay reagents specific for the target, was used to obtain dose-response curves, demonstrating the potential for quantification of pathogen load in buffer and serum. Published by Elsevier B.V.

Microbiome analysis and detection of pathogenic bacteria of Penaeus monodon from Jakarta Bay and Bali.

Science.gov (United States)

Oetama, Vincensius S P; Hennersdorf, Philipp; Abdul-Aziz, Muslihudeen A; Mrotzek, Grit; Haryanti, Haryanti; Saluz, Hans Peter

2016-09-30

Penaeus monodon, the Asian black tiger shrimp is one of the most widely consumed marine crustaceans worldwide. In this study, we examine and compare the fecal microbiota of P. monodon from highly polluted waters around Jakarta Bay, with those of less polluted waters of Bali. Using next generation sequencing techniques, we identified potential bacterial pathogens and common viral diseases of shrimp. Proteobacteria (96.08%) was found to be the most predominant phylum, followed by Bacteriodetes (2.32%), Fusobacteria (0.96%), and Firmicutes (0.53%). On the order level, Vibrionales (66.20%) and Pseudoaltermonadales (24.81%) were detected as predominant taxa. qPCR profiling was used as a confirmatory step and further revealed Vibrio alginolyticus and Photobacterium damselae as two potential pathogenic species present in most of the samples. In addition, viral diseases for shrimp were discovered among the samples, WSSV in Jakarta free-living samples, YHV in Bali free-living samples and IHHNV in both. Copyright © 2016 Elsevier Ltd. All rights reserved.

Identification of periodontal pathogens in atherosclerotic vessels

DEFF Research Database (Denmark)

Fiehn, Nils-Erik; Larsen, Tove; Christiansen, Natalia

2005-01-01

Epidemiological studies have shown that periodontitis may be associated with presence of atherosclerosis. DNA from periodontal pathogens has been detected in atherosclerotic lesions, but viable oral bacteria have not yet been isolated from atherosclerotic plaques. The purpose of the present study...... was to determine if viable oral bacteria could be isolated from atherosclerotic lesions and if DNA from periodontal pathogens could be detected by use of polymerase chain reaction (PCR) techniques....

An autonomic security monitor for distributed operating systems

OpenAIRE

Arenas, A.; Aziz, Benjamin; Maj, S.; Matthews, B.

2011-01-01

This paper presents an autonomic system for the monitoring of security-relevant information in a Grid-based operating system. The system implements rule-based policies using Java Drools. Policies are capable of controlling the system environment based on changes in levels of CPU/memory usage, accesses to system resources, detection of abnormal behaviour such as DDos attacks.

Methods to classify bacterial pathogens in cystic fibrosis

DEFF Research Database (Denmark)

Bjarnsholt, Thomas; Nielsen, Xiaohui Chen; Johansen, Ulla

2011-01-01

for identification of isolates from the Burkholderia complex to the species level. DNA typing by PFGE, which can be used for any bacterial pathogen, is described as it is employed for Pseudomonas aeruginosa. A commercially available ELISA method is described for measuring IgG antibodies against P. aeruginosa in CF......Many bacteria can be detected in CF sputum, pathogenic and commensal. Modified Koch's criteria for identification of established and emerging CF pathogens are therefore described. Methods are described to isolate bacteria and to detect bacterial biofilms in sputum or lung tissue from CF patients...

Intent-Estimation- and Motion-Model-Based Collision Avoidance Method for Autonomous Vehicles in Urban Environments

Directory of Open Access Journals (Sweden)

Rulin Huang

2017-04-01

Full Text Available Existing collision avoidance methods for autonomous vehicles, which ignore the driving intent of detected vehicles, thus, cannot satisfy the requirements for autonomous driving in urban environments because of their high false detection rates of collisions with vehicles on winding roads and the missed detection rate of collisions with maneuvering vehicles. This study introduces an intent-estimation- and motion-model-based (IEMMB method to address these disadvantages. First, a state vector is constructed by combining the road structure and the moving state of detected vehicles. A Gaussian mixture model is used to learn the maneuvering patterns of vehicles from collected data, and the patterns are used to estimate the driving intent of the detected vehicles. Then, a desirable long-term trajectory is obtained by weighting time and comfort. The long-term trajectory and the short-term trajectory, which are predicted using a constant yaw rate motion model, are fused to achieve an accurate trajectory. Finally, considering the moving state of the autonomous vehicle, collisions can be detected and avoided. Experiments have shown that the intent estimation method performed well, achieving an accuracy of 91.7% on straight roads and an accuracy of 90.5% on winding roads, which is much higher than that achieved by the method that ignores the road structure. The average collision detection distance is increased by more than 8 m. In addition, the maximum yaw rate and acceleration during an evasive maneuver are decreased, indicating an improvement in the driving comfort.

High Throughput Sequencing for Detection of Foodborne Pathogens

Directory of Open Access Journals (Sweden)

Camilla Sekse

2017-10-01

Full Text Available High-throughput sequencing (HTS is becoming the state-of-the-art technology for typing of microbial isolates, especially in clinical samples. Yet, its application is still in its infancy for monitoring and outbreak investigations of foods. Here we review the published literature, covering not only bacterial but also viral and Eukaryote food pathogens, to assess the status and potential of HTS implementation to inform stakeholders, improve food safety and reduce outbreak impacts. The developments in sequencing technology and bioinformatics have outpaced the capacity to analyze and interpret the sequence data. The influence of sample processing, nucleic acid extraction and purification, harmonized protocols for generation and interpretation of data, and properly annotated and curated reference databases including non-pathogenic “natural” strains are other major obstacles to the realization of the full potential of HTS in analytical food surveillance, epidemiological and outbreak investigations, and in complementing preventive approaches for the control and management of foodborne pathogens. Despite significant obstacles, the achieved progress in capacity and broadening of the application range over the last decade is impressive and unprecedented, as illustrated with the chosen examples from the literature. Large consortia, often with broad international participation, are making coordinated efforts to cope with many of the mentioned obstacles. Further rapid progress can therefore be prospected for the next decade.

Simultaneous Detection of Key Bacterial Pathogens Related to Pneumonia and Meningitis Using Multiplex PCR Coupled With Mass Spectrometry

Directory of Open Access Journals (Sweden)

Chi Zhang

2018-04-01

Full Text Available Pneumonia and meningitis continue to present an enormous public health burden and pose a major threat to young children. Among the causative organisms of pneumonia and meningitis, bacteria are the most common causes of serious disease and deaths. It is challenging to accurately and rapidly identify these agents. To solve this problem, we developed and validated a 12-plex PCR coupled with matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS method (bacterial pathogen-mass spectrometry, BP-MS that can be used to simultaneously screen for 11 key bacterial pathogens related to pneumonia and meningitis. Forty-six nasopharyngeal swabs and 12 isolates were used to determine the specificity of the method. The results showed that, using the BP-MS method, we could accurately identify the expected bacteria without cross-reactivity with other pathogens. For the 11 target bacterial pathogens, the analytical sensitivity of the BP-MS method was as low as 10 copies/reaction. To further evaluate the clinical effectiveness of this method, 204 nasopharyngeal swabs from hospitalized children with suspected pneumonia were tested using this method. In total, 81.9% (167/204 of the samples were positive for at least one of the 11 target pathogens. Among the 167 bacteria-positive samples, the rate of multiple infections was 55.7% (93/167, and the most frequent combination was Streptococcus pneumoniae with Haemophilus influenzae, representing 46.2% (43/93 two-pathogen mixed infections. We used real-time PCR and nested PCR to confirm positive results, with identical results obtained for 81.4% (136/167 of the samples. The BP-MS method is a sensitive and specific molecular detection technique in a multiplex format and with high sample throughput. Therefore, it will be a powerful tool for pathogen screening and antibiotic selection at an early stage of disease.

Mobile autonomous robot for radiological surveys

International Nuclear Information System (INIS)

Dudar, A.M.; Wagner, D.G.; Teese, G.D.

1992-01-01

The robotics development group at the Savannah River Laboratory (SRL) is developing a mobile autonomous robot that performs radiological surveys of potentially contaminated floors. The robot is called SIMON, which stands for Semi-Intelligent Mobile Observing Navigator. Certain areas of SRL are classified as radiologically controlled areas (RCAs). In an RCA, radioactive materials are frequently handled by workers, and thus, the potential for contamination is ever present. Current methods used for floor radiological surveying includes labor-intensive manual scanning or random smearing of certain floor locations. An autonomous robot such as SIMON performs the surveying task in a much more efficient manner and will track down contamination before it is contacted by humans. SIMON scans floors at a speed of 1 in./s and stops and alarms upon encountering contamination. Its environment is well defined, consisting of smooth building floors with wide corridors. The kind of contaminations that SIMON is capable of detecting are alpha and beta-gamma. The contamination levels of interest are low to moderate

The clinical presentation and diagnosis of epileptic autonomic auras

Directory of Open Access Journals (Sweden)

Marina Revditovna Kremenchugskaya

2012-01-01

Full Text Available Objective: to refine the pattern of clinical manifestations of epileptic autonomic auras (EAA and to reveal clinical, electroencephalographic, and neuroimaging ratios. Patients and methods. Eighteen patients (8, 41% men and 10, 59% women aged 9 to 27years (mean 18±5years were examined. The examination encompassed analysis of history data, clinical and neurological studies, long-term video-assisted electroencephalographic monitoring, and magnetic resonance imaging (MRI of the brain. Results. In most patients (n = 12, 67%, the symptoms of EAA corresponded to the criteria for abdominal one. In the other patients, the clinical manifestations resembled autonomic paroxysms as attacks of panic. Interictal pathological changes on an electroencephalogram (EEG were present in the frontal, temporal, and frontotemporal regions in 4 (22%, 6 (33%, and 7 (39% patients, respectively, as well as in both the left and right hemispheres without significant differences. Pathological EEG changes were not found in one case. MRI detected that 13 (72% patients had structural changes that were potentially eliptogenic. Conclusion. The clinical symptoms of EAA give information on the site of a primary pathological focus. It is necessary to differentiate EAA from non-epileptic paroxysmal states. The autonomic phenomena of epileptic genesis help study the functional organizations of the autonomic nervous system.

Estimation and Control for Autonomous Coring from a Rover Manipulator

Science.gov (United States)

Hudson, Nicolas; Backes, Paul; DiCicco, Matt; Bajracharya, Max

2010-01-01

A system consisting of a set of estimators and autonomous behaviors has been developed which allows robust coring from a low-mass rover platform, while accommodating for moderate rover slip. A redundant set of sensors, including a force-torque sensor, visual odometry, and accelerometers are used to monitor discrete critical and operational modes, as well as to estimate continuous drill parameters during the coring process. A set of critical failure modes pertinent to shallow coring from a mobile platform is defined, and autonomous behaviors associated with each critical mode are used to maintain nominal coring conditions. Autonomous shallow coring is demonstrated from a low-mass rover using a rotary-percussive coring tool mounted on a 5 degree-of-freedom (DOF) arm. A new architecture of using an arm-stabilized, rotary percussive tool with the robotic arm used to provide the drill z-axis linear feed is validated. Particular attention to hole start using this architecture is addressed. An end-to-end coring sequence is demonstrated, where the rover autonomously detects and then recovers from a series of slip events that exceeded 9 cm total displacement.

Overview of the Autonomic Nervous System

Science.gov (United States)

... be reversible or progressive. Anatomy of the autonomic nervous system The autonomic nervous system is the part of ... organs they connect with. Function of the autonomic nervous system The autonomic nervous system controls internal body processes ...

Development of Loop-Mediated Isothermal Amplification (LAMP) assay for rapid detection of Fusarium oxysporum f. sp. ciceris - wilt pathogen of chickpea.

Science.gov (United States)

Ghosh, Raju; Nagavardhini, Avuthu; Sengupta, Anindita; Sharma, Mamta

2015-02-11

Fusarium oxysporum f. sp. ciceris (Foc), the causal agent of Fusarium wilt is a devastating pathogen of chickpea. In chickpea, various soil borne pathogens produce (s) similar symptoms, therefore cannot be distinguished easily at field level. There is real need for a rapid, inexpensive, and easy to operate and maintain genotyping tool to facilitate accurate disease diagnosis and surveillance for better management of Fusarium wilt outbreaks. In this study, we developed a loop-mediated isothermal amplification (LAMP) assay targeting the elongation factor 1 alpha gene sequence for visual detection of Foc. The LAMP reaction was optimal at 63°C for 60 min. When hydroxynaphthol blue (HNB) was added before amplification, samples with Foc DNA developed a characteristic sky blue colour but those without DNA or with the DNA of six other plant pathogenic fungi did not. Results obtained with LAMP and HNB were confirmed when LAMP products were subjected to gel electrophoresis. The detection limit of this LAMP assay for Foc was 10 fg of genomic DNA per reaction, while that of conventional PCR was 100 pg. In conclusion, it was found that a LAMP assay combined with HNB is simple, rapid, sensitive, and specific. The LAMP assay does not require specialized equipment, hence can be used in the field for the rapid detection of Foc. This is the first report of the use of LAMP assay for the detection of Foc. The presented LAMP method provides a specific, sensitive and rapid diagnostic tool for the distinction of Foc, with the potential to be standardized as a detection method for Foc in endemic areas and will be very useful for monitoring the disease complex in the field further suggesting the management strategies.

Accessing Autonomic Function Can Early Screen Metabolic Syndrome

Science.gov (United States)

Dai, Meng; Li, Mian; Yang, Zhi; Xu, Min; Xu, Yu; Lu, Jieli; Chen, Yuhong; Liu, Jianmin; Ning, Guang; Bi, Yufang

2012-01-01

Background Clinical diagnosis of the metabolic syndrome is time-consuming and invasive. Convenient instruments that do not require laboratory or physical investigation would be useful in early screening individuals at high risk of metabolic syndrome. Examination of the autonomic function can be taken as a directly reference and screening indicator for predicting metabolic syndrome. Methodology and Principal Findings The EZSCAN test, as an efficient and noninvasive technology, can access autonomic function through measuring electrochemical skin conductance. In this study, we used EZSCAN value to evaluate autonomic function and to detect metabolic syndrome in 5,887 participants aged 40 years or older. The EZSCAN test diagnostic accuracy was analyzed by receiver operating characteristic curves. Among the 5,815 participants in the final analysis, 2,541 were diagnosed as metabolic syndrome and the overall prevalence was 43.7%. Prevalence of the metabolic syndrome increased with the elevated EZSCAN risk level (p for trend metabolic syndrome components (p for trend metabolic syndrome after the multiple adjustments. The area under the curve of the EZSCAN test was 0.62 (95% confidence interval [CI], 0.61–0.64) for predicting metabolic syndrome. The optimal operating point for the EZSCAN value to detect a high risk of prevalent metabolic syndrome was 30 in this study, while the sensitivity and specificity were 71.2% and 46.7%, respectively. Conclusions and Significance In conclusion, although less sensitive and accurate when compared with the clinical definition of metabolic syndrome, we found that the EZSCAN test is a good and simple screening technique for early predicting metabolic syndrome. PMID:22916265

Biological Inspiration for Agile Autonomous Air Vehicles

Science.gov (United States)

2007-11-01

half of one wing, bees with legs packed with pollen , butterflies or moths with torn and frayed wings likewise are capable of apparently normal flight...technologies. To appreciate this, consider a not unreasonable extension of a wide area autonomous search (WAAS) munition operational scenario. Here...detect and destroy missile launchers that are operating in the back alleys of an urban areas or search Evers, J.H. (2007) Biological Inspiration for Agile

Catecholamines and diabetic autonomic neuropathy

DEFF Research Database (Denmark)

Hilsted, J

1995-01-01

In diabetic patients with autonomic neuropathy plasma noradrenaline concentration, used as an index of sympathetic nervous activity, is low. This decrease is, however, only found in patients with a long duration of diabetes with clinically severe autonomic neuropathy. This apparent insensitivity...... of plasma catecholamine measurements is not due to changes in the clearance of catecholamines in diabetic autonomic neuropathy. The physiological responses to infused adrenaline and to noradrenaline are enhanced, for noradrenaline mainly cardiovascular responses. Adrenoceptors (alpha and beta adrenoceptors......) are not altered in circulating blood cells in diabetic autonomic neuropathy. Thus, a generalized up-regulation of adrenoceptors does not occur in diabetic autonomic neuropathy....

Epigenetic control of effectors in plant pathogens

Directory of Open Access Journals (Sweden)

Mark eGijzen

2014-11-01

Full Text Available Plant pathogens display impressive versatility in adapting to host immune systems. Pathogen effector proteins facilitate disease but can become avirulence (Avr factors when the host acquires discrete recognition capabilities that trigger immunity. The mechanisms that lead to changes to pathogen Avr factors that enable escape from host immunity are diverse, and include epigenetic switches that allow for reuse or recycling of effectors. This perspective outlines possibilities of how epigenetic control of Avr effector gene expression may have arisen and persisted in plant pathogens, and how it presents special problems for diagnosis and detection of specific pathogen strains or pathotypes.

Prevalence of pathogenic Yersinia enterocolitica in minced meat, pig tongues and hearts at the retail level in the Czech Republic detected by real time PCR

Directory of Open Access Journals (Sweden)

Alena Lorencova

2016-06-01

Full Text Available Yersiniosis is the third most frequently reported zoonosis in the European Union and Yersinia enterocolitica is the most common species causing human infections. Pigs are assumed to be the main reservoir of human pathogenic Y. enterocolitica with the presence of bacteria mainly in the tonsils and intestinal content. Undercooked pork and pork products have been suggested as the primary source of human yersiniosis. Nevertheless, data on the prevalence of pathogenic Y. enterocolitica in foodstuffs including pork products are very limited. A molecular based method (real time PCR targeting the ompF gene (detection of Yersinia genus and the ail gene (a chromosomally located virulence marker of Y. enterocolitica was used to determine the prevalence of pathogenic Y. enterocolitica in minced meat and edible pork offal at the retail level in the Czech Republic. A total of 50 pig tongues, 50 pig hearts, and 93 samples of minced meat containing pork were purchased at nine retail outlets in Brno. High detection rates of Yersinia spp. were found in all types of samples (pig tongues, 80.0%; pig hearts, 40.0%; and minced meat, 55.9%. The highest prevalence of pathogenic Y. enterocolitica was found in pig tongues (40.0%, followed by pig hearts (18.0% and minced meat samples (17.2%. Although from the point of view of food safety the merely molecular detection of DNA of the pathogenic bacteria could represent a false positive result, our results indicate the presence of pathogenic Y. enterocolitica in raw pork products at the retail level in the Czech Republic, which may pose a risk of consumer infection. Sufficient heat treatment and prevention of cross-contamination during preparation of food in the kitchen should be recommended.

Efferocytosis of Pathogen-Infected Cells

Directory of Open Access Journals (Sweden)

Niloofar Karaji

2017-12-01

Full Text Available The prompt and efficient clearance of unwanted and abnormal cells by phagocytes is termed efferocytosis and is crucial for organism development, maintenance of tissue homeostasis, and regulation of the immune system. Dying cells are recognized by phagocytes through pathways initiated via “find me” signals, recognition via “eat me” signals and down-modulation of regulatory “don’t eat me” signals. Pathogen infection may trigger cell death that drives phagocytic clearance in an immunologically silent, or pro-inflammatory manner, depending on the mode of cell death. In many cases, efferocytosis is a mechanism for eliminating pathogens and pathogen-infected cells; however, some pathogens have subverted this process and use efferocytic mechanisms to avoid innate immune detection and assist phagocyte infection. In parallel, phagocytes can integrate signals received from infected dying cells to elicit the most appropriate effector response against the infecting pathogen. This review focuses on pathogen-induced cell death signals that drive infected cell recognition and uptake by phagocytes, and the outcomes for the infected target cell, the phagocyte, the pathogen and the host.

Molecular Diagnostics for Soilborne Fungal Pathogens

Directory of Open Access Journals (Sweden)

E.J. Paplomatas

2004-08-01

Full Text Available Several classical approaches have been developed to detect and identify soil fungal inhabitants through the years. Selective media have been devised to exclude the large number of soil organisms and allow growth of target fungi. However the advent of molecular biology has offered a number of revolutionary insights into the detection and enumeration of soilborne fungal pathogens and also has started to provide information on the identification of unknown species from DNA sequences. This review paper focuses on the application of various molecular techniques in the detection, identification, characterization and quantification of soilborne fungal plant pathogens. This is based on information from the literature and is combined with personal research findings of the author.

Autonomic cardiac innervation

Science.gov (United States)

Hasan, Wohaib

2013-01-01

Autonomic cardiac neurons have a common origin in the neural crest but undergo distinct developmental differentiation as they mature toward their adult phenotype. Progenitor cells respond to repulsive cues during migration, followed by differentiation cues from paracrine sources that promote neurochemistry and differentiation. When autonomic axons start to innervate cardiac tissue, neurotrophic factors from vascular tissue are essential for maintenance of neurons before they reach their targets, upon which target-derived trophic factors take over final maturation, synaptic strength and postnatal survival. Although target-derived neurotrophins have a central role to play in development, alternative sources of neurotrophins may also modulate innervation. Both developing and adult sympathetic neurons express proNGF, and adult parasympathetic cardiac ganglion neurons also synthesize and release NGF. The physiological function of these “non-classical” cardiac sources of neurotrophins remains to be determined, especially in relation to autocrine/paracrine sustenance during development.   Cardiac autonomic nerves are closely spatially associated in cardiac plexuses, ganglia and pacemaker regions and so are sensitive to release of neurotransmitter, neuropeptides and trophic factors from adjacent nerves. As such, in many cardiac pathologies, it is an imbalance within the two arms of the autonomic system that is critical for disease progression. Although this crosstalk between sympathetic and parasympathetic nerves has been well established for adult nerves, it is unclear whether a degree of paracrine regulation occurs across the autonomic limbs during development. Aberrant nerve remodeling is a common occurrence in many adult cardiovascular pathologies, and the mechanisms regulating outgrowth or denervation are disparate. However, autonomic neurons display considerable plasticity in this regard with neurotrophins and inflammatory cytokines having a central regulatory

Medical Devices; Immunology and Microbiology Devices; Classification of the Device To Detect and Identify Microbial Pathogen Nucleic Acids in Cerebrospinal Fluid. Final order.

Science.gov (United States)

2017-10-20

The Food and Drug Administration (FDA or we) is classifying the device to detect and identify microbial pathogen nucleic acids in cerebrospinal fluid into class II (special controls). The special controls that will apply to the device type are identified in this order and will be part of the codified language for the device to detect and identify microbial pathogen nucleic acids in cerebrospinal fluid’s classification. We are taking this action because we have determined that classifying the device into class II (special controls) will provide a reasonable assurance of safety and effectiveness of the device. We believe this action will also enhance patients' access to beneficial innovative devices, in part by reducing regulatory burdens.

Indicators for waterborne pathogens

National Research Council Canada - National Science Library

Committee on Indicators for Waterborne Pathogens, National Research Council

2004-01-01

... not practical or feasible to monitor for the complete spectrum of microorganisms that may occur in water, and many known pathogens are difficult to detect directly and reliably in water samples.Â...

Methods for detecting pathogens in the beef food chain: an overview

Science.gov (United States)

The main food-borne pathogens of concern in the beef chain are Shiga toxin-producing Escherichia coli (STEC) and Salmonella. Other pathogens, including Listeria monocytogenes and Campylobacter spp. may also be present and pose contamination concerns in both the cattle production environment and bee...

Molecular biology of Ganoderma pathogenicity and diagnosis in coconut seedlings.

Science.gov (United States)

Kandan, A; Radjacommare, R; Ramanathan, A; Raguchander, T; Balasubramanian, P; Samiyappan, R

2009-01-01

The pathogenicity of Ganoderma boninense was tested on coconut seedlings under greenhouse conditions and infection confirmed by using immunological and molecular diagnostic tools. Desiccation of older leaves and the emergence of sporophores were observed from pathogen-inoculated seedlings, whereas a control seedling does not show any pathogenic symptoms. Mature sporophores were formed within 10-13 weeks after inoculation. Polyclonal antibodies raised against mycelial proteins of Ganoderma were used for detection of Ganoderma in infected field palm and seedlings through indirect enzyme-linked immunosorbent assay technique. We adopted dot-immunobinding assay for the detection of Ganoderma from greenhouse and field samples. Under nucleic-acid-based diagnosis, G. boninense (167 bp) was detected from artificially inoculated seedlings and infected field palms by polymerase chain reaction. Apart from these, histopathological studies also support the Ganoderma pathogenicity in coconut seedlings. The pathogenicity test and combination of all the three diagnostic methods for Ganoderma could be highly reliable, rapid, sensitive and effective screening of resistance in planting material in the future.

Space imaging infrared optical guidance for autonomous ground vehicle

Science.gov (United States)

Akiyama, Akira; Kobayashi, Nobuaki; Mutoh, Eiichiro; Kumagai, Hideo; Yamada, Hirofumi; Ishii, Hiromitsu

2008-08-01

We have developed the Space Imaging Infrared Optical Guidance for Autonomous Ground Vehicle based on the uncooled infrared camera and focusing technique to detect the objects to be evaded and to set the drive path. For this purpose we made servomotor drive system to control the focus function of the infrared camera lens. To determine the best focus position we use the auto focus image processing of Daubechies wavelet transform technique with 4 terms. From the determined best focus position we transformed it to the distance of the object. We made the aluminum frame ground vehicle to mount the auto focus infrared unit. Its size is 900mm long and 800mm wide. This vehicle mounted Ackerman front steering system and the rear motor drive system. To confirm the guidance ability of the Space Imaging Infrared Optical Guidance for Autonomous Ground Vehicle we had the experiments for the detection ability of the infrared auto focus unit to the actual car on the road and the roadside wall. As a result the auto focus image processing based on the Daubechies wavelet transform technique detects the best focus image clearly and give the depth of the object from the infrared camera unit.

A Secure, Scalable and Elastic Autonomic Computing Systems Paradigm: Supporting Dynamic Adaptation of Self-* Services from an Autonomic Cloud

Directory of Open Access Journals (Sweden)

Abdul Jaleel

2018-05-01

Full Text Available Autonomic computing embeds self-management features in software systems using external feedback control loops, i.e., autonomic managers. In existing models of autonomic computing, adaptive behaviors are defined at the design time, autonomic managers are statically configured, and the running system has a fixed set of self-* capabilities. An autonomic computing design should accommodate autonomic capability growth by allowing the dynamic configuration of self-* services, but this causes security and integrity issues. A secure, scalable and elastic autonomic computing system (SSE-ACS paradigm is proposed to address the runtime inclusion of autonomic managers, ensuring secure communication between autonomic managers and managed resources. Applying the SSE-ACS concept, a layered approach for the dynamic adaptation of self-* services is presented with an online ‘Autonomic_Cloud’ working as the middleware between Autonomic Managers (offering the self-* services and Autonomic Computing System (requiring the self-* services. A stock trading and forecasting system is used for simulation purposes. The security impact of the SSE-ACS paradigm is verified by testing possible attack cases over the autonomic computing system with single and multiple autonomic managers running on the same and different machines. The common vulnerability scoring system (CVSS metric shows a decrease in the vulnerability severity score from high (8.8 for existing ACS to low (3.9 for SSE-ACS. Autonomic managers are introduced into the system at runtime from the Autonomic_Cloud to test the scalability and elasticity. With elastic AMs, the system optimizes the Central Processing Unit (CPU share resulting in an improved execution time for business logic. For computing systems requiring the continuous support of self-management services, the proposed system achieves a significant improvement in security, scalability, elasticity, autonomic efficiency, and issue resolving time

The Rise of the Autonomous Cyber Criminal

OpenAIRE

Rogers, Marcus

2015-01-01

Are we on the threshold of a new evolution of cyber crime? There has been numerous discussions and SciFi themes that have centered around truly autonomous online criminal behavior. This talk will look at the myths and realities surrounding the potential for automated systems to turn to the "dark side" and become uber cyber criminals, and what if anything we can do to prevent or at least detect this type of criminal behavior.

Pyrosequencing detects human and animal pathogenic taxa in the grapevine endosphere.

Science.gov (United States)

Yousaf, Sohail; Bulgari, Daniela; Bergna, Alessandro; Pancher, Michael; Quaglino, Fabio; Casati, Paola; Campisano, Andrea

2014-01-01

Generally, plants are not considered as hosts for human and animal pathogens (HAP). The recent produce-associated outbreaks of food-borne diseases have drawn attention toward significant deficiencies in our understanding of the ecology of HAP, and their potential for interkingdom transfer. To examine the association of microorganisms classified as HAP with plants, we surveyed the presence and distribution of HAP bacterial taxa (henceforth HAPT, for brevity's sake) in the endosphere of grapevine (Vitis vinifera L.) both in the plant stems and leaves. An enrichment protocol was used on leaves to detect taxa with very low abundance in undisturbed tissues. We used pyrosequencing and phylogenetic analyses of the 16S rDNA gene. We identified several HAPT, and focused on four genera (Propionibacterium, Staphylococcus, Clostridium, and Burkholderia). The majority of the bacterial sequences in the genus Propionibacterium, from grapevine leaf and stem, were identified as P. acnes. Clostridia were detected in leaves and stems, but their number was much higher in leaves after enrichment. HAPT were indentified both in leaves and wood of grapevines. This depicts the ability of these taxa to be internalized within plant tissues and maintain their population levels in a variety of environments. Our analysis highlighted the presence of HAPT in the grapevine endosphere and unexpected occurrence of these bacterial taxa in this atypical environment.

Test characteristics of milk amyloid A ELISA, somatic cell count, and bacteriological culture for detection of intramammary pathogens that cause subclinical mastitis.

Science.gov (United States)

Jaeger, S; Virchow, F; Torgerson, P R; Bischoff, M; Biner, B; Hartnack, S; Rüegg, S R

2017-09-01

Bovine mastitis is an important disease in the dairy industry, causing economic losses as a result of withheld milk and treatment costs. Several studies have suggested milk amyloid A (MAA) as a promising biomarker in the diagnosis of mastitis. In the absence of a gold standard for diagnosis of subclinical mastitis, we estimated the diagnostic test accuracy of a commercial MAA-ELISA, somatic cell count (SCC), and bacteriological culture using Bayesian latent class modeling. We divided intramammary infections into 2 classes: those caused by major pathogens (e.g., Escherichia coli, Staphylococcus aureus, streptococci, and lacto-/enterococci) and those caused by all pathogens (major pathogens plus Corynebacterium bovis, coagulase-negative staphylococci, Bacillus spp., Streptomyces spp.). We applied the 3 diagnostic tests to all samples. Of 433 composite milk samples included in this study, 275 (63.5%) contained at least 1 colony of any bacterial species; of those, 56 contained major pathogens and 219 contained minor pathogens. The remaining 158 samples (36.5%) were sterile. We determined 2 different thresholds for the MAA-ELISA using Bayesian latent class modeling: 3.9 µg/mL to detect mastitis caused by major pathogens and 1.6 µg/mL to detect mastitis caused by all pathogens. The optimal SCC threshold for identification of subclinical mastitis was 150,000 cells/mL; this threshold led to higher specificity (Sp) than 100,000 cells/mL. Test accuracy for major-pathogen intramammary infections was as follows: SCC, sensitivity (Se) 92.6% and Sp 72.9%; MAA-ELISA, Se 81.4% and Sp 93.4%; bacteriological culture, Se 23.8% and Sp 95.2%. Test accuracy for all-pathogen intramammary infections was as follows: SCC, sensitivity 90.3% and Sp 71.8%; MAA-ELISA, Se 88.0% and Sp 65.2%; bacteriological culture, Se 83.8% and Sp 54.8%. We suggest the use of SCC and MAA-ELISA as a combined screening procedure for situations such as a Staphylococcus aureus control program. With Bayesian

Autonomic computing enabled cooperative networked design

CERN Document Server

Wodczak, Michal

2014-01-01

This book introduces the concept of autonomic computing driven cooperative networked system design from an architectural perspective. As such it leverages and capitalises on the relevant advancements in both the realms of autonomic computing and networking by welding them closely together. In particular, a multi-faceted Autonomic Cooperative System Architectural Model is defined which incorporates the notion of Autonomic Cooperative Behaviour being orchestrated by the Autonomic Cooperative Networking Protocol of a cross-layer nature. The overall proposed solution not only advocates for the inc

Detection of five potentially periodontal pathogenic bacteria in peri-implant disease: A comparison of PCR and real-time PCR.

Science.gov (United States)

Schmalz, Gerhard; Tsigaras, Sandra; Rinke, Sven; Kottmann, Tanja; Haak, Rainer; Ziebolz, Dirk

2016-07-01

The aim of this study was to compare the microbial analysis methods of polymerase chain reaction (PCR) and real-time PCR (RT-PCR) in terms of detection of five selected potentially periodontal pathogenic bacteria in peri-implant disease. Therefore 45 samples of healthy, mucositis and peri-implantitis (n = 15 each) were assessed according to presence of the following bacteria using PCR (DNA-strip technology) and RT-PCR (fluorescent dye SYBR green-system): Aggregatibacter actinomycetemcomitans (Aa), Porphyromonas gingivalis (Pg), Treponema denticola (Td), Tanerella forsythia (Tf), and Fusobacterium nucleatum (Fn). There were no significant correlations between the bacterial and disease patterns, so the benefit of using microbiological tests for the diagnosis of peri-implant diseases is questionable. Correlations between the methods were highest for Tf (Kendall's Tau: 0.65, Spearman: 0.78), Fn (0.49, 0.61) and Td (0.49, 0.59). For Aa (0.38, 0.42) and Pg (0.04, 0.04), lower correlation values were detected. Accordingly, conventional semi-quantitative PCR seems to be sufficient for analyzing potentially periodontal pathogenic bacterial species. Copyright © 2016 Elsevier Inc. All rights reserved.

Surveillance for early detection of low pathogenicity avian influenza in poultry

NARCIS (Netherlands)

Comin, A.

2012-01-01

Infection with low pathogenicity avian influenza (LPAI) virus is widespread and has led to outbreaks in domestic birds in many countries. Although infection does not pose a serious concern for animal heath, LPAI virus subtypes H5 and H7 can mutate into the highly pathogenic form (HPAI), which can

Algae as reservoirs for coral pathogens.

Directory of Open Access Journals (Sweden)

Michael J Sweet

Full Text Available Benthic algae are associated with coral death in the form of stress and disease. It's been proposed that they release exudates, which facilitate invasion of potentially pathogenic microbes at the coral-algal interface, resulting in coral disease. However, the original source of these pathogens remains unknown. This study examined the ability of benthic algae to act as reservoirs of coral pathogens by characterizing surface associated microbes associated with major Caribbean and Indo-Pacific algal species/types and by comparing them to potential pathogens of two dominant coral diseases: White Syndrome (WS in the Indo-Pacific and Yellow Band Disease (YBD in the Caribbean. Coral and algal sampling was conducted simultaneously at the same sites to avoid spatial effects. Potential pathogens were defined as those absent or rare in healthy corals, increasing in abundance in healthy tissues adjacent to a disease lesion, and dominant in disease lesions. Potentially pathogenic bacteria were detected in both WS and YBD and were also present within the majority of algal species/types (54 and 100% for WS and YBD respectively. Pathogenic ciliates were associated only with WS and not YBD lesions and these were also present in 36% of the Indo-Pacific algal species. Although potential pathogens were associated with many algal species, their presence was inconsistent among replicate algal samples and detection rates were relatively low, suggestive of low density and occurrence. At the community level, coral-associated microbes irrespective of the health of their host differed from algal-associated microbes, supporting that algae and corals have distinctive microbial communities associated with their tissue. We conclude that benthic algae are common reservoirs for a variety of different potential coral pathogens. However, algal-associated microbes alone are unlikely to cause coral death. Initial damage or stress to the coral via other competitive mechanisms is

New insights in the interpretation of array-CGH: autism spectrum disorder and positive family history for intellectual disability predict the detection of pathogenic variants.

Science.gov (United States)

Cappuccio, Gerarda; Vitiello, Francesco; Casertano, Alberto; Fontana, Paolo; Genesio, Rita; Bruzzese, Dario; Ginocchio, Virginia Maria; Mormile, Angela; Nitsch, Lucio; Andria, Generoso; Melis, Daniela

2016-04-12

Array-CGH (aCGH) is presently used into routine clinical practice for diagnosis of patients with intellectual disability (ID), multiple congenital anomalies (MCA), and autism spectrum disorder (ASD). ACGH could detect small chromosomal imbalances, copy number variations (CNVs), and closely define their size and gene content. ACGH detects pathogenic imbalances in 14-20 % of patients with ID. The aims of this study were: to establish clinical clues potentially associated with pathogenic CNVs and to identify cytogenetic indicators to predict the pathogenicity of the variants of uncertain significance (VOUS) in a large cohort of paediatric patients. We enrolled 214 patients referred for either: ID, and/or ASD and/or MCA to genetic services at the Federico II University of Naples, Department of Translational Medicine. For each patient we collected clinical and imaging data. All the patients were tested with aCGH or as first-tier test or as part of a wider diagnostic work-up. Pathologic data were detected in 65 individuals (30 %) and 46 CNVs revealed a known syndrome. The pathological CNVs were usually deletions showing the highest gene-dosage content. The positive family history for ID/ASD/MCA and ASD were good indicators for detecting pathological chromosomal rearrangements. Other clinical features as eyes anomalies, hearing loss, neurological signs, cutaneous dyscromia and endocrinological problems seem to be potential predictors of pathological CNVs. Among patients carrying VOUS we analyzed genetic features including CNVs size, presence of deletion or duplication, genic density, multiple CNVs, to clinical features. Higher gene density was found in patients affected by ID. This result suggest that higher gene content has more chances to include pathogenic gene involved and causing ID in these patients. Our study suggest the use of aCGH as first-tier test in patients with neurdevelopmental phenotypes. The inferred results have been used for building a flow-chart to be

[The Advances in the Contamination and Detection of Foodborne Pathogen Noroviruses in Fresh Produce].

Science.gov (United States)

Xie, Yajing; Liu, Xianjin

2015-11-01

This article reviewed the researches proceeding on the contamination and detection of the foodborne pathogen noroviruses (NoVs) in fresh produce, which involved the NoVs contaminations in fresh produce, the special attachment of NoVs in fresh produce, the NoVs outbreaks associated with fresh produce and the NoVs detection in fresh produce. There had been an increase in reported infectious disease risks associated with the consumptions of fresh produce for recent 30 years. Because the NoVs, as a primary cause of viral gastroenteritis thoughout the world, were highly contagious, had a low infectious dose, and were persistent in the environment. And also the methods for NoVs detection in food had significantly developed over the last 15 years. Currently NoVs were the most common pathogen accounting for 40% of outbreaks associated with fresh produce (i. e., fruits and vegetables). Data from outbreaks investigations verified fresh produce as the high risk food products for NoVs. The fresh produce were typically eaten raw with no thermal processing, can be contaminated at any step during production and processing from faecally polluted water and fertilizers, the poor hygiene practices by food handlers and the cross-contamination. The attachment of NoVs to the fresh produce was due to the physio-chemical factors of virus protein coat, the special attachment to different fresh produce, and the possibility for internalization of NoVs. It might provide answers to why those high risk foods were more frequently implicated (i. e., lettuce and raspberries). According to the data of foodborne NoVs outbreaks which were associated with fresh produce from EU countries and the USA, the outbreaks in EU countries were mainly associated with NoVs contaminated raspberries and lettuce, while in USA which were associated with NoVs contaminated lettuce. Unfortunately, there were no NoVs detection methods for fresh produce or the data of foodborne NoVs outbreaks which were associated with

First detection of the larval chalkbrood disease pathogen Ascosphaera apis (Ascomycota: Eurotiomycetes: Ascosphaerales in adult bumble bees.

Directory of Open Access Journals (Sweden)

Sarah A Maxfield-Taylor

Full Text Available Fungi in the genus Ascosphaera (Ascomycota: Eurotiomycetes: Ascosphaerales cause chalkbrood disease in larvae of bees. Here, we report the first-ever detection of the fungus in adult bumble bees that were raised in captivity for studies on colony development. Wild queens of Bombus griseocollis, B. nevadensis and B. vosnesenskii were collected and maintained for establishment of nests. Queens that died during rearing or that did not lay eggs within one month of capture were dissected, and tissues were examined microscopically for the presence of pathogens. Filamentous fungi that were detected were plated on artificial media containing broad spectrum antibiotics for isolation and identification. Based on morphological characters, the fungus was identified as Ascosphaera apis (Maasen ex Claussen Olive and Spiltoir, a species that has been reported earlier only from larvae of the European honey bee, Apis mellifera, the Asian honey bee, Apis cerana, and the carpenter bee Xylocopa californica arizonensis. The identity of the fungus was confirmed using molecular markers and phylogenetic analysis. Ascosphaera apis was detected in queens of all three bumble bee species examined. Of 150 queens dissected, 12 (8% contained vegetative and reproductive stages of the fungus. Both fungal stages were also detected in two workers collected from colonies with Ascosphaera-infected B. nevadensis queens. In this study, wild bees could have been infected prior to capture for rearing, or, the A. apis infection could have originated via contaminated European honey bee pollen fed to the bumble bees in captivity. Thus, the discovery of A. apis in adult bumble bees in the current study has important implications for commercial production of bumble bee colonies and highlights potential risks to native bees via pathogen spillover from infected bees and infected pollen.

First detection of the larval chalkbrood disease pathogen Ascosphaera apis (Ascomycota: Eurotiomycetes: Ascosphaerales) in adult bumble bees.

Science.gov (United States)

Maxfield-Taylor, Sarah A; Mujic, Alija B; Rao, Sujaya

2015-01-01

Fungi in the genus Ascosphaera (Ascomycota: Eurotiomycetes: Ascosphaerales) cause chalkbrood disease in larvae of bees. Here, we report the first-ever detection of the fungus in adult bumble bees that were raised in captivity for studies on colony development. Wild queens of Bombus griseocollis, B. nevadensis and B. vosnesenskii were collected and maintained for establishment of nests. Queens that died during rearing or that did not lay eggs within one month of capture were dissected, and tissues were examined microscopically for the presence of pathogens. Filamentous fungi that were detected were plated on artificial media containing broad spectrum antibiotics for isolation and identification. Based on morphological characters, the fungus was identified as Ascosphaera apis (Maasen ex Claussen) Olive and Spiltoir, a species that has been reported earlier only from larvae of the European honey bee, Apis mellifera, the Asian honey bee, Apis cerana, and the carpenter bee Xylocopa californica arizonensis. The identity of the fungus was confirmed using molecular markers and phylogenetic analysis. Ascosphaera apis was detected in queens of all three bumble bee species examined. Of 150 queens dissected, 12 (8%) contained vegetative and reproductive stages of the fungus. Both fungal stages were also detected in two workers collected from colonies with Ascosphaera-infected B. nevadensis queens. In this study, wild bees could have been infected prior to capture for rearing, or, the A. apis infection could have originated via contaminated European honey bee pollen fed to the bumble bees in captivity. Thus, the discovery of A. apis in adult bumble bees in the current study has important implications for commercial production of bumble bee colonies and highlights potential risks to native bees via pathogen spillover from infected bees and infected pollen.

Dual-Recognition Förster Resonance Energy Transfer Based Platform for One-Step Sensitive Detection of Pathogenic Bacteria Using Fluorescent Vancomycin-Gold Nanoclusters and Aptamer-Gold Nanoparticles.

Science.gov (United States)

Yu, Mengqun; Wang, Hong; Fu, Fei; Li, Linyao; Li, Jing; Li, Gan; Song, Yang; Swihart, Mark T; Song, Erqun

2017-04-04

The effective monitoring, identification, and quantification of pathogenic bacteria is essential for addressing serious public health issues. In this study, we present a universal and facile one-step strategy for sensitive and selective detection of pathogenic bacteria using a dual-molecular affinity-based Förster (fluorescence) resonance energy transfer (FRET) platform based on the recognition of bacterial cell walls by antibiotic and aptamer molecules, respectively. As a proof of concept, Vancomycin (Van) and a nucleic acid aptamer were employed in a model dual-recognition scheme for detecting Staphylococcus aureus (Staph. aureus). Within 30 min, by using Van-functionalized gold nanoclusters and aptamer-modified gold nanoparticles as the energy donor and acceptor, respectively, the FRET signal shows a linear variation with the concentration of Staph. aureus in the range from 20 to 10 8 cfu/mL with a detection limit of 10 cfu/mL. Other nontarget bacteria showed negative results, demonstrating the good specificity of the approach. When employed to assay Staph. aureus in real samples, the dual-recognition FRET strategy showed recoveries from 99.00% to the 109.75% with relative standard derivations (RSDs) less than 4%. This establishes a universal detection platform for sensitive, specific, and simple pathogenic bacteria detection, which could have great impact in the fields of food/public safety monitoring and infectious disease diagnosis.

Lab-on-a-Chip Pathogen Sensors for Food Safety

Directory of Open Access Journals (Sweden)

Bumsang Kim

2012-08-01

Full Text Available There have been a number of cases of foodborne illness among humans that are caused by pathogens such as Escherichia coli O157:H7, Salmonella typhimurium, etc. The current practices to detect such pathogenic agents are cell culturing, immunoassays, or polymerase chain reactions (PCRs. These methods are essentially laboratory-based methods that are not at all real-time and thus unavailable for early-monitoring of such pathogens. They are also very difficult to implement in the field. Lab-on-a-chip biosensors, however, have a strong potential to be used in the field since they can be miniaturized and automated; they are also potentially fast and very sensitive. These lab-on-a-chip biosensors can detect pathogens in farms, packaging/processing facilities, delivery/distribution systems, and at the consumer level. There are still several issues to be resolved before applying these lab-on-a-chip sensors to field applications, including the pre-treatment of a sample, proper storage of reagents, full integration into a battery-powered system, and demonstration of very high sensitivity, which are addressed in this review article. Several different types of lab-on-a-chip biosensors, including immunoassay- and PCR-based, have been developed and tested for detecting foodborne pathogens. Their assay performance, including detection limit and assay time, are also summarized. Finally, the use of optical fibers or optical waveguide is discussed as a means to improve the portability and sensitivity of lab-on-a-chip pathogen sensors.

Pathogen avoidance by insect predators

OpenAIRE

Meyling, Nicolai V.; Ormond, Emma; Roy, Helen E.; Pell, Judith K.

2008-01-01

Insects can detect cues related to the risk of attack by their natural enemies. Pathogens are among the natural enemies of insects and entomopathogenic fungi attack a wide array of host species. Evidence documents that social insects in particular have adapted behavioural mechanisms to avoid infection by fungal pathogens. These mechanisms are referred to as 'behavioural resistance'. However, there is little evidence for similar adaptations in non-social insects. We have conducted experime...

Pathogens in drinking water: Are there any new ones

Energy Technology Data Exchange (ETDEWEB)

Reasoner, D.J.

1993-01-01

Since 1976 three newly recognized human pathogens have become familiar to the drinking water industry as waterborne disease agents. These are: the legionnaires disease agent, Legionella pneumophila and related species; and two protozoan pathogens, Giardia lamblia and Cryptosporidium parvum, both of which form highly disinfectant resistant cysts that are shed in the feces of infected individuals. The question frequently arises - are there other emerging waterborne pathogens that may pose a human health problem that the drinking water industry will have to deal with. The paper will review the current state of knowledge of the occurrence and incidence of pathogens and opportunistic pathogens other than Legionella, Giardia and Cryptosporidium in treated and untreated drinking water. Bacterial agents that will be reviewed include Aeromonas, Pseudomonas, Campylobacter, Mycobacterium, Yersinia and Plesiomonas. Aspects of detection of these agents including detection methods and feasibility of monitoring will be addressed.

Pseudomnas syringae – a Pathogen of Fruit Trees in Serbia

Directory of Open Access Journals (Sweden)

Veljko Gavrilović

2009-01-01

Full Text Available Data about symptomatology, pathogenicity and bacteriological characteristics of Pseudomonas syringae, and PCR methods for fast and reliable detection of the pathogen are given in this paper. P. syringae has been experimentaly proved as a pathogen of pear, apple, apricot, plum cherry, and raspberry, and pathogen strains have also been isolated from necrotic peach buds. Two pathogen varieties, syringae and morsprunorum, were found in our research in Serbia, the former being dominant on fruit trees.The most reliable method for detection of this bacteria is PCR, using BOX and REP primers. This method has also revealed significant differences among the strains originating from fruit trees in Serbia. Thus, it was proved that the population of P. syringae in Serbia is heterogeneous, which is very important for future epidemiologocal studies. Control of this pathogen includes mechanical, cultural and chemical measures, but integrated approach is very important for sustainable control.

Insights into the background of autonomic medicine.

Science.gov (United States)

Laranjo, Sérgio; Geraldes, Vera; Oliveira, Mário; Rocha, Isabel

2017-10-01

Knowledge of the physiology underlying the autonomic nervous system is pivotal for understanding autonomic dysfunction in clinical practice. Autonomic dysfunction may result from primary modifications of the autonomic nervous system or be secondary to a wide range of diseases that cause severe morbidity and mortality. Together with a detailed history and physical examination, laboratory assessment of autonomic function is essential for the analysis of various clinical conditions and the establishment of effective, personalized and precise therapeutic schemes. This review summarizes the main aspects of autonomic medicine that constitute the background of cardiovascular autonomic dysfunction. Copyright © 2017 Sociedade Portuguesa de Cardiologia. Publicado por Elsevier España, S.L.U. All rights reserved.

An Autonomous Sensor System Architecture for Active Flow and Noise Control Feedback

Science.gov (United States)

Humphreys, William M, Jr.; Culliton, William G.

2008-01-01

Multi-channel sensor fusion represents a powerful technique to simply and efficiently extract information from complex phenomena. While the technique has traditionally been used for military target tracking and situational awareness, a study has been successfully completed that demonstrates that sensor fusion can be applied equally well to aerodynamic applications. A prototype autonomous hardware processor was successfully designed and used to detect in real-time the two-dimensional flow reattachment location generated by a simple separated-flow wind tunnel model. The success of this demonstration illustrates the feasibility of using autonomous sensor processing architectures to enhance flow control feedback signal generation.

Autonomic Nervous System Disorders

Science.gov (United States)

Your autonomic nervous system is the part of your nervous system that controls involuntary actions, such as the beating of your heart ... breathing and swallowing Erectile dysfunction in men Autonomic nervous system disorders can occur alone or as the result ...

Stereo Vision Guiding for the Autonomous Landing of Fixed-Wing UAVs: A Saliency-Inspired Approach

Directory of Open Access Journals (Sweden)

Zhaowei Ma

2016-03-01

Full Text Available It is an important criterion for unmanned aerial vehicles (UAVs to land on the runway safely. This paper concentrates on stereo vision localization of a fixed-wing UAV's autonomous landing within global navigation satellite system (GNSS denied environments. A ground stereo vision guidance system imitating the human visual system (HVS is presented for the autonomous landing of fixed-wing UAVs. A saliency-inspired algorithm is presented and developed to detect flying UAV targets in captured sequential images. Furthermore, an extended Kalman filter (EKF based state estimation is employed to reduce localization errors caused by measurement errors of object detection and pan-tilt unit (PTU attitudes. Finally, stereo-vision-dataset-based experiments are conducted to verify the effectiveness of the proposed visual detection method and error correction algorithm. The compared results between the visual guidance approach and differential GPS-based approach indicate that the stereo vision system and detection method can achieve the better guiding effect.

Detection of pathogenic Leptospira species associated with phyllostomid bats (Mammalia: Chiroptera) from Veracruz, Mexico.

Science.gov (United States)

Ballados-González, G G; Sánchez-Montes, S; Romero-Salas, D; Colunga Salas, P; Gutiérrez-Molina, R; León-Paniagua, L; Becker, I; Méndez-Ojeda, M L; Barrientos-Salcedo, C; Serna-Lagunes, R; Cruz-Romero, A

2018-06-01

The genus Leptospira encompass 22 species of spirochaetes, with ten pathogenic species that have been recorded in more than 160 mammals worldwide. In the last two decades, the numbers of records of these agents associated with bats have increased exponentially, particularly in America. Although order Chiroptera represents the second most diverse order of mammals in Mexico, and leptospirosis represents a human and veterinary problem in the country, few studies have been conducted to identify potential wildlife reservoirs. The aim of this study was to detect the presence and diversity of Leptospira sp. in communities of bats in an endemic state of leptospirosis in Mexico. During January to September 2016, 81 bats of ten species from three localities of Veracruz, Mexico, were collected with mist nets. Kidney samples were obtained from all specimens. For the detection of Leptospira sp., we amplified several genes using specific primers. Amplicons of the expected size were submitted to sequencing, and sequences recovered were compared with those of reference deposited in GenBank using the BLAST tool. To identify their phylogenetic position, we realized a reconstruction using maximum-likelihood (ML) method. Twenty-five samples from three bat species (Artibeus lituratus, Choeroniscus godmani and Desmodus rotundus) showed the presence of Leptospira DNA. Sequences recovered were close to Leptospira noguchii, Leptospira weilii and Leptospira interrogans. Our results include the first record of Leptospira in bats from Mexico and exhibit a high diversity of these pathogens circulating in the state. Due to the finding of a large number of positive wild animals, it is necessary to implement a surveillance system in populations of the positive bats as well as in related species, in order to understand their role as carriers of this bacterial genus. © 2018 Blackwell Verlag GmbH.

Rapid detection of food pathogens using RNA aptamers-immobilized slide.

Science.gov (United States)

Maeng, Jin-Soo; Kim, Namsoo; Kim, Chong-Tai; Han, Seung Ryul; Lee, Young Ju; Lee, Seong-Wook; Lee, Myung-Hyun; Cho, Yong-Jin

2012-07-01

The purpose of this study was to develop a simple and rapid detection system for foodborne bacteria, which consisted of an optical microscope and its slide chip with artificial antibodies, or RNA aptamers. From an RNA pool, three each RNA aptamers were built by the method of SELEX (systematic evolution of ligands by exponential enrichment) for components of cell wall, LPS (lipopolysaccharide) from E. coli O157:H7, teichoic acid from Staphylococcus aureus and a cell membrane protein of OmpC from Salmonella typhimurium, respectively. These aptamers were hybridized with thiol-conjugated 16 dT-linker molecules in order to be immobilized on silver surface which was, in advance, fabricated on glass slide, using a spin-coating method. To confirm that each aptamers retained its specific binding activities to their antigenic live bacteria, microscopic view of bound cells immobilized on silver film were observed. Furthermore, we observed the fluorescence-emitting bacteria-aptamer complex immobilized on silver film after adding RNA aptamers hybridized with fluorophore, FAM-conjugated 16 dT-linker molecules. As a result, the RNA aptamers-immobilized slide system developed in this study was a useful new tool to rapidly monitor individual food pathogens.

A method to detect metal–drug complexes and their interactions with pathogenic bacteria via graphene nanosheet assist laser desorption/ionization mass spectrometry and biosensors

International Nuclear Information System (INIS)

Abdelhamid, Hani Nasser; Wu, Hui-Fen

2012-01-01

Highlights: ► Probe transition metals-complexes based on noncovalent functionalized graphene for MALDI-MS. ► Study interaction of transition metals complexes with pathogenic bacteria. ► Propose a new biosensor for two pathogenic bacteria. - Abstract: A new method was proposed to probe the interactions between transition metals of Fe(II), Fe(III), Cu(II) with a non steroidal anti-inflammatory drug (NSAID), flufenamic acid (FF) using graphene as a matrix for Graphene assisted laser desorption ionization mass spectrometry (GALDI-MS). Metal–drug complexation was confirmed via UV absorption spectroscopy, fluorescence spectroscopy, pH meter, and change in solution conductivity. The optimal molar ratios for these complexation interactions are stoichiometry 1:2 in both Cu(II) and Fe(II) complexes, and 1:3 in Fe(III) complexes at physiological pH (7.4). Metal complexation of the drug could enhance fluorescence for 20 fold which is due to the charge transfer reaction or increase rigidity of the drug. The main interaction between graphene and flufenamic acid is the Π–Π interaction which allows us to probe the metal–drug complexation. The GALDI-MS could sensitively detect the drug at m/z 281.0 Da (protonated molecule) with detection limit 2.5 pmol (1.0 μM) and complexation at m/z 661.0, 654.0 and 933.0 Da corresponding to [Cu(II)(FF) 2 (H 2 O) 2 + H] + , [Fe(II)(FF) 2 (H 2 O) 2 + H] + and [Fe(III) (FF) 3 (H 2 O) 2 + H] + , respectively (with limit of detection (LOD) 2.0 pmol (10.0 μM). Matrix assisted laser desorption ionization mass spectrometry (MALDI-MS) spectra show change in the protein profile of intact pathogenic bacteria (Pseudomonas aeroginosa, Staphylococcus aureus). The change in the ionization ability (mainly proton affinity) of pathogenic bacteria may be due to the interactions between the bacteria with the drug (or its complexes). Shielding carboxylic group by metals and increase the hydrophilicity could enhance the biocompatibility of complexes

Mycosphaerella fijiensis, the black leaf streak pathogen of banana: progress towards understanding pathogen biology and detection, disease development, and the challenges of control.

Science.gov (United States)

Churchill, Alice C L

2011-05-01

primary hosts of M. fijiensis, the ornamental plant Heliconia psittacorum has been reported as an alternative host. Several valuable tools and resources have been developed to overcome some of the challenges of studying this host-pathogen system. These include a DNA-mediated fungal transformation system and the ability to conduct targeted gene disruptions, reliable quantitative plant bioassays, diagnostic probes to detect and differentiate M. fijiensis from related pathogens and to distinguish strains of different mating types, and a genome sequence that has revealed a wealth of gene sequences and molecular markers to be utilized in functional and population biology studies. http://bananas.bioversityinternational.org/, http://genome.jgi-psf.org/Mycfi2/Mycfi2.home.html, http://www.isppweb.org/names_banana_pathogen.asp#fun, http://www.promusa.org/. © 2010 THE AUTHOR. MOLECULAR PLANT PATHOLOGY © 2010 BSPP AND BLACKWELL PUBLISHING LTD.

Cardiac autonomic modulation impairments in advanced breast cancer patients.

Science.gov (United States)

Arab, Claudia; Vanderlei, Luiz Carlos Marques; da Silva Paiva, Laércio; Fulghum, Kyle Levi; Fristachi, Carlos Elias; Nazario, Afonso Celso Pinto; Elias, Simone; Gebrim, Luiz Henrique; Ferreira Filho, Celso; Gidron, Yori; Ferreira, Celso

2018-05-02

To compare cardiac autonomic modulation in early- versus advanced-stage breast cancer patients before any type of cancer treatment and investigate associated factors. This cross-sectional study included women (30-69 years old) with primary diagnosis of breast cancer and women with benign breast tumors. We evaluated cardiac modulation by heart rate variability and assessed factors of anxiety, depression, physical activity, and other relevant medical variables. Patients were divided into three groups based on TNM staging of cancer severity: early-stage cancer (n = 42), advanced-stage cancer (n = 37), or benign breast tumors to serve as a control (n = 37). We analyzed heart rate variability in time and frequency domains. The advanced-stage cancer group had lower vagal modulation than early-stage and benign groups; also, the advance-stage group had lower overall heart rate variability when compared to benign conditions. Heart rate variability was influenced by age, menopausal status, and BMI. Heart rate variability seems to be a promising, non-invasive tool for early diagnosis of autonomic dysfunction in breast cancer and detection of cardiovascular impairments at cancer diagnosis. Cardiac autonomic modulation is inversely associated with breast cancer staging.

Autonomous authority in relation to the staff regulations of autonomous parliaments

Directory of Open Access Journals (Sweden)

Rafael Cano Silva

2018-04-01

Full Text Available The statutes of Autonomous Parliaments are parliamentary administrative norms approved by each legislative chamber by virtue of their parliamentary autonomy. However, the parliamentary autonomy of each autonomous parliament does not have the same normative aspect for these purposes. It is studied in this article as despite having the Constitution as a common element, it is essential the special attribution that each autonomous chamber has and that the jurisprudence, both of the Constitutional Court, and that of the Supreme Court, has put in value, question that is included in the section related to the jurisprudence. In conclusion, the bureaucratic organization, in what refers to personal media, may be substantially different in each one of the legislative assemblies, as analyzed in the conclusions of this study.

Detection of Seed-Borne Fungal pathogens on Soya beans

International Nuclear Information System (INIS)

Wanyera, R

2002-01-01

Soya beans (Glycine max max L.) are propagated by seed and are vulnerable to devastating seed-borne diseases where the importance of each disease varies greatly. Seed-borne diseases cause significant losses in seed, food production and quality of seed and grain. Studies on seed borne diseases in Kenya have not been given emphasis on very important seed crops among the soya beans. The identification and rejection of the seed crop is mainly based on visual appraisal in the field with little or no laboratory work undertaken. Three methods were used to analyse the health status of fifty two soyabean seed samples collected from the National Plant Breeding Research Centre-Njoro and farmers' fields in Bahati division of Nakuru district. The analysis was carried out in the laboratory. The objective of the analysis was to identify and inventory seed-borne fungal pathogens of soya beans grown in Kenya. The normal blotter, herbicide and germination test methods were used. The tests revealed the presence of several important fungal pathogens on soyabean seed samples. Among the pathogens recorded Phoma sp, phomopsis sp, fusarium sp, Hainesia lyhri and Cercospora kikuchii were frequently recorded on the seed samples. Results of the germination test between paper method showed low germination (0-6.7%) on the normal sedlings in all the test samples. Hainesia lyhri was a new record on the soyabean seeds

Accessing autonomic function can early screen metabolic syndrome.

Directory of Open Access Journals (Sweden)

Kan Sun

Full Text Available BACKGROUND: Clinical diagnosis of the metabolic syndrome is time-consuming and invasive. Convenient instruments that do not require laboratory or physical investigation would be useful in early screening individuals at high risk of metabolic syndrome. Examination of the autonomic function can be taken as a directly reference and screening indicator for predicting metabolic syndrome. METHODOLOGY AND PRINCIPAL FINDINGS: The EZSCAN test, as an efficient and noninvasive technology, can access autonomic function through measuring electrochemical skin conductance. In this study, we used EZSCAN value to evaluate autonomic function and to detect metabolic syndrome in 5,887 participants aged 40 years or older. The EZSCAN test diagnostic accuracy was analyzed by receiver operating characteristic curves. Among the 5,815 participants in the final analysis, 2,541 were diagnosed as metabolic syndrome and the overall prevalence was 43.7%. Prevalence of the metabolic syndrome increased with the elevated EZSCAN risk level (p for trend <0.0001. Moreover, EZSCAN value was associated with an increase in the number of metabolic syndrome components (p for trend <0.0001. Compared with the no risk group (EZSCAN value 0-24, participants at the high risk group (EZSCAN value: 50-100 had a 2.35 fold increased risk of prevalent metabolic syndrome after the multiple adjustments. The area under the curve of the EZSCAN test was 0.62 (95% confidence interval [CI], 0.61-0.64 for predicting metabolic syndrome. The optimal operating point for the EZSCAN value to detect a high risk of prevalent metabolic syndrome was 30 in this study, while the sensitivity and specificity were 71.2% and 46.7%, respectively. CONCLUSIONS AND SIGNIFICANCE: In conclusion, although less sensitive and accurate when compared with the clinical definition of metabolic syndrome, we found that the EZSCAN test is a good and simple screening technique for early predicting metabolic syndrome.

Autonomic test by EZSCAN in the screening for prediabetes and diabetes.

Directory of Open Access Journals (Sweden)

Zhi Yang

Full Text Available BACKGROUND: Autonomic neuropathy is common in diabetics and may occur in prediabetes. A new and noninvasive autonomic test-EZSCAN evaluates sudomotor function precisely. No generally accepted EZSCAN thresholds to screen for prediabetes and diabetes have been defined. METHODOLOGY AND PRINCIPAL FINDINGS: Cross-sectional study of 5, 824 Chinese adults aged 40 and older was conducted in Shanghai, China. We used EZSCAN to evaluate autonomic function in different glucose status and screen for prediabetes and diabetes. The prevalence of prediabetes and diabetes were 21.9% and 17.5% respectively. Compared with the lowest quintile, the highest quintile of EZSCAN value had odds ratios for having dysglycemia (prediabetes or diabetes of 2.08 (95% CI 1.67-2.58 in total population, 2.89 (95% CI 2.06-4.05 in men and 1.70 (95% CI 1.28-2.25 in women after adjustment for confounding factors. EZSCAN value improved the areas under ROC curve for detection of dysglycemia or diabetes beyond the contribution of conventional risk factors by 0.8% and 12.9%. The cut-off point of EZSCAN value higher than 30% provided reasonable sensitivities (70.3-83.7% to detect dysglycemia not only in total population regardless of sex but also in individuals with high risk of developing diabetes. CONCLUSIONS AND SIGNIFICANCE: EZSCAN value higher than 30% indicate an increased risk of prevalent prediabetes and diabetes, suggesting that subjects with EZSCAN ≥30% should be further evaluated by oral glucose tolerance test. The improvement of EZSCAN for diabetes detection was still of limited clinical relevance. Thus the clinical application value of EZSCAN is needed to be explored in future studies.

Formal Verification of Autonomous Vehicle Platooning

OpenAIRE

Kamali, Maryam; Dennis, Louise A.; McAree, Owen; Fisher, Michael; Veres, Sandor M.

2016-01-01

The coordination of multiple autonomous vehicles into convoys or platoons is expected on our highways in the near future. However, before such platoons can be deployed, the new autonomous behaviors of the vehicles in these platoons must be certified. An appropriate representation for vehicle platooning is as a multi-agent system in which each agent captures the "autonomous decisions" carried out by each vehicle. In order to ensure that these autonomous decision-making agents in vehicle platoo...

Development of highly sensitive electrochemical genosensor based on multiwalled carbon nanotubes-chitosan-bismuth and lead sulfide nanoparticles for the detection of pathogenic Aeromonas.

Science.gov (United States)

Fernandes, António Maximiano; Abdalhai, Mandour H; Ji, Jian; Xi, Bing-Wen; Xie, Jun; Sun, Jiadi; Noeline, Rasoamandrary; Lee, Byong H; Sun, Xiulan

2015-01-15

In this paper, we reported the construction of new high sensitive electrochemical genosensor based on multiwalled carbon nanotubes-chitosan-bismuth complex (MWCNT-Chi-Bi) and lead sulfide nanoparticles for the detection of pathogenic Aeromonas. Lead sulfide nanoparticles capped with 5'-(NH2) oligonucleotides thought amide bond was used as signalizing probe DNA (sz-DNA) and thiol-modified oligonucleotides sequence was used as fixing probe DNA (fDNA). The two probes hybridize with target Aeromonas DNA (tDNA) sequence (fDNA-tDNA-szDNA). The signal of hybridization is detected by differential pulse voltammetry (DPV) after electrodeposition of released lead nanoparticles (PbS) from sz-DNA on the surface of glass carbon electrode decorated with MWCNT-Chi-Bi, which improves the deposition and traducing electrical signal. The optimization of incubation time, hybridization temperature, deposition potential, deposition time and the specificity of the probes were investigated. Our results showed the highest sensibility to detect the target gene when compared with related biosensors and polymerase chain reaction (PCR). The detection limit for this biosensor was 1.0×10(-14) M. We could detect lower than 10(2) CFU mL(-1) of Aeromonas in spiked tap water. This method is rapid and sensitive for the detection of pathogenic bacteria and would become a potential application in biomedical diagnosis, food safety and environmental monitoring. Copyright © 2014 Elsevier B.V. All rights reserved.

Autonomous Landing on Moving Platforms

KAUST Repository

Mendoza Chavez, Gilberto

2016-08-01

This thesis investigates autonomous landing of a micro air vehicle (MAV) on a nonstationary ground platform. Unmanned aerial vehicles (UAVs) and micro air vehicles (MAVs) are becoming every day more ubiquitous. Nonetheless, many applications still require specialized human pilots or supervisors. Current research is focusing on augmenting the scope of tasks that these vehicles are able to accomplish autonomously. Precise autonomous landing on moving platforms is essential for self-deployment and recovery of MAVs, but it remains a challenging task for both autonomous and piloted vehicles. Model Predictive Control (MPC) is a widely used and effective scheme to control constrained systems. One of its variants, output-feedback tube-based MPC, ensures robust stability for systems with bounded disturbances under system state reconstruction. This thesis proposes a MAV control strategy based on this variant of MPC to perform rapid and precise autonomous landing on moving targets whose nominal (uncommitted) trajectory and velocity are slowly varying. The proposed approach is demonstrated on an experimental setup.

Developing operation algorithms for vision subsystems in autonomous mobile robots

Science.gov (United States)

Shikhman, M. V.; Shidlovskiy, S. V.

2018-05-01

The paper analyzes algorithms for selecting keypoints on the image for the subsequent automatic detection of people and obstacles. The algorithm is based on the histogram of oriented gradients and the support vector method. The combination of these methods allows successful selection of dynamic and static objects. The algorithm can be applied in various autonomous mobile robots.

System safety analysis of an autonomous mobile robot

International Nuclear Information System (INIS)

Bartos, R.J.

1994-01-01

Analysis of the safety of operating and maintaining the Stored Waste Autonomous Mobile Inspector (SWAMI) II in a hazardous environment at the Fernald Environmental Management Project (FEMP) was completed. The SWAMI II is a version of a commercial robot, the HelpMate trademark robot produced by the Transitions Research Corporation, which is being updated to incorporate the systems required for inspecting mixed toxic chemical and radioactive waste drums at the FEMP. It also has modified obstacle detection and collision avoidance subsystems. The robot will autonomously travel down the aisles in storage warehouses to record images of containers and collect other data which are transmitted to an inspector at a remote computer terminal. A previous study showed the SWAMI II has economic feasibility. The SWAMI II will more accurately locate radioactive contamination than human inspectors. This thesis includes a System Safety Hazard Analysis and a quantitative Fault Tree Analysis (FTA). The objectives of the analyses are to prevent potentially serious events and to derive a comprehensive set of safety requirements from which the safety of the SWAMI II and other autonomous mobile robots can be evaluated. The Computer-Aided Fault Tree Analysis (CAFTA copyright) software is utilized for the FTA. The FTA shows that more than 99% of the safety risk occurs during maintenance, and that when the derived safety requirements are implemented the rate of serious events is reduced to below one event per million operating hours. Training and procedures in SWAMI II operation and maintenance provide an added safety margin. This study will promote the safe use of the SWAMI II and other autonomous mobile robots in the emerging technology of mobile robotic inspection

Autonomic Neuropathy in Diabetes Mellitus

OpenAIRE

Verrotti, Alberto; Prezioso, Giovanni; Scattoni, Raffaella; Chiarelli, Francesco

2014-01-01

Diabetic autonomic neuropathy (DAN) is a serious and common complication of diabetes, often overlooked and misdiagnosed. It is a systemic-wide disorder that may be asymptomatic in the early stages. The most studied and clinically important form of DAN is cardiovascular autonomic neuropathy defined as the impairment of autonomic control of the cardiovascular system in patients with diabetes after exclusion of other causes. The reported prevalence of DAN varies widely depending on inconsistent ...

Ground plane detection for autonomous robots in complex environments inclined with flexed far-field terrains

CSIR Research Space (South Africa)

Osunmakind, IO

2009-11-01

Full Text Available In this paper, collective intelligence of the Emergent Situation Awareness (ESA) technology is proposed as a supportive strategy for autonomous robotic navigation. The ability to reveal uncertainties over time on flexed far-field is a ground plane...

Recent advances in the use of laser-induced breakdown spectroscopy (LIBS) as a rapid point-of-care pathogen diagnostic

Science.gov (United States)

Rehse, Steven; Trojand, Daniel; Putnam, Russell; Gillies, Derek; Woodman, Ryan; Sheikh, Khadija; Daabous, Andrew

2013-05-01

There is a well-known and urgent need in the fields of medicine, environmental health and safety, food-processing, and defense/security to develop new 21st Century technologies for the rapid and sensitive identification of bacterial pathogens. In only the last five years, the use of a real-time elemental (atomic) analysis performed with laser-induced breakdown spectroscopy (LIBS) has made tremendous progress in becoming a viable technology for rapid bacterial pathogen detection and identification. In this talk we will show how this laser-based optical emission spectroscopic technique is able to sensitively assay the elemental composition of bacterial cells in situ. We will also present the latest achievements of our lab to fully develop LIBS-based bacterial sensing including simulation of a rapid urinary tract infection diagnosis and investigation of a variety of autonomous multivariate analysis algorithms. Lastly, we will show how this technology is now ready to be transitioned from the laboratory to field-portable and potentially man-portable instrumentation. The introduction of such a technology into popular use could very well transform the field of bacterial biosensing - a market valued at approximately 10 billion/year world-wide. Funding for this project was provided in part by a Natural Sciences and Engineering Research Council of Canada Discovery Grant.

Hyperspectral image reconstruction using RGB color for foodborne pathogen detection on agar plates

Science.gov (United States)

Yoon, Seung-Chul; Shin, Tae-Sung; Park, Bosoon; Lawrence, Kurt C.; Heitschmidt, Gerald W.

2014-03-01

This paper reports the latest development of a color vision technique for detecting colonies of foodborne pathogens grown on agar plates with a hyperspectral image classification model that was developed using full hyperspectral data. The hyperspectral classification model depended on reflectance spectra measured in the visible and near-infrared spectral range from 400 and 1,000 nm (473 narrow spectral bands). Multivariate regression methods were used to estimate and predict hyperspectral data from RGB color values. The six representative non-O157 Shiga-toxin producing Eschetichia coli (STEC) serogroups (O26, O45, O103, O111, O121, and O145) were grown on Rainbow agar plates. A line-scan pushbroom hyperspectral image sensor was used to scan 36 agar plates grown with pure STEC colonies at each plate. The 36 hyperspectral images of the agar plates were divided in half to create training and test sets. The mean Rsquared value for hyperspectral image estimation was about 0.98 in the spectral range between 400 and 700 nm for linear, quadratic and cubic polynomial regression models and the detection accuracy of the hyperspectral image classification model with the principal component analysis and k-nearest neighbors for the test set was up to 92% (99% with the original hyperspectral images). Thus, the results of the study suggested that color-based detection may be viable as a multispectral imaging solution without much loss of prediction accuracy compared to hyperspectral imaging.

Discerning non-autonomous dynamics

Energy Technology Data Exchange (ETDEWEB)

Clemson, Philip T.; Stefanovska, Aneta, E-mail: aneta@lancaster.ac.uk

2014-09-30

Structure and function go hand in hand. However, while a complex structure can be relatively safely broken down into the minutest parts, and technology is now delving into nanoscales, the function of complex systems requires a completely different approach. Here the complexity clearly arises from nonlinear interactions, which prevents us from obtaining a realistic description of a system by dissecting it into its structural component parts. At best, the result of such investigations does not substantially add to our understanding or at worst it can even be misleading. Not surprisingly, the dynamics of complex systems, facilitated by increasing computational efficiency, is now readily tackled in the case of measured time series. Moreover, time series can now be collected in practically every branch of science and in any structural scale—from protein dynamics in a living cell to data collected in astrophysics or even via social networks. In searching for deterministic patterns in such data we are limited by the fact that no complex system in the real world is autonomous. Hence, as an alternative to the stochastic approach that is predominantly applied to data from inherently non-autonomous complex systems, theory and methods specifically tailored to non-autonomous systems are needed. Indeed, in the last decade we have faced a huge advance in mathematical methods, including the introduction of pullback attractors, as well as time series methods that cope with the most important characteristic of non-autonomous systems—their time-dependent behaviour. Here we review current methods for the analysis of non-autonomous dynamics including those for extracting properties of interactions and the direction of couplings. We illustrate each method by applying it to three sets of systems typical for chaotic, stochastic and non-autonomous behaviour. For the chaotic class we select the Lorenz system, for the stochastic the noise-forced Duffing system and for the non-autonomous

Discerning non-autonomous dynamics

International Nuclear Information System (INIS)

Clemson, Philip T.; Stefanovska, Aneta

2014-01-01

Structure and function go hand in hand. However, while a complex structure can be relatively safely broken down into the minutest parts, and technology is now delving into nanoscales, the function of complex systems requires a completely different approach. Here the complexity clearly arises from nonlinear interactions, which prevents us from obtaining a realistic description of a system by dissecting it into its structural component parts. At best, the result of such investigations does not substantially add to our understanding or at worst it can even be misleading. Not surprisingly, the dynamics of complex systems, facilitated by increasing computational efficiency, is now readily tackled in the case of measured time series. Moreover, time series can now be collected in practically every branch of science and in any structural scale—from protein dynamics in a living cell to data collected in astrophysics or even via social networks. In searching for deterministic patterns in such data we are limited by the fact that no complex system in the real world is autonomous. Hence, as an alternative to the stochastic approach that is predominantly applied to data from inherently non-autonomous complex systems, theory and methods specifically tailored to non-autonomous systems are needed. Indeed, in the last decade we have faced a huge advance in mathematical methods, including the introduction of pullback attractors, as well as time series methods that cope with the most important characteristic of non-autonomous systems—their time-dependent behaviour. Here we review current methods for the analysis of non-autonomous dynamics including those for extracting properties of interactions and the direction of couplings. We illustrate each method by applying it to three sets of systems typical for chaotic, stochastic and non-autonomous behaviour. For the chaotic class we select the Lorenz system, for the stochastic the noise-forced Duffing system and for the non-autonomous

Detection of pathogenic bacteria in skin lesions of patients with chiclero's ulcer: reluctant response to antimonial treatment

Directory of Open Access Journals (Sweden)

Isaac-Márquez Angélica Patricia

2003-01-01

Full Text Available We investigated the bacterial flora present in skin lesions of patients with chiclero's ulcer from the Yucatan peninsula of Mexico using conventional culture methods (11 patients, and an immunocolorimetric detection of pathogenic Streptococcus pyogenes (15 patients. Prevalence of bacteria isolated by culture methods was 90.9% (10/11. We cultured, from chiclero's ulcers (60%, pathogenic bacterial such as Staphylococcus aureus (20%, S. pyogenes (1.6%, Pseudomonas aeruginosa (1.6%, Morganella morganii (1.6%, and opportunist pathogenic bacteria such as Klebsiella spp. (20.0%, Enterobacter spp. (20%, and Enterococcus spp. (20%. We also cultured coagulase-negative staphylococci in 40% (4/10 of the remaining patients. Micrococcus spp. and coagulase-negative staphylococci constituted the bacterial genuses more frequently isolated in the normal skin of patients with chiclero's ulcer and healthy individuals used as controls. We also undertook another study to find out the presence of S. pyogenes by an immunocolorimetric assay. This study indicated that 60% (9/15 of the ulcerated lesions, but not normal controls, were contaminated with S. pyogenes. Importantly, individuals with purulent secretion and holding concomitant infections with S. pyogenes, S. aureus, P. aeruginosa, M. morganii, and E. durans took longer to heal Leishmania (L. mexicana infections treated with antimonial drugs. Our results suggest the need to eliminate bacterial purulent infections, by antibiotic treatment, before starting antimonial administration to patients with chiclero's ulcer.

Structural Discrimination and Autonomous Vehicles

DEFF Research Database (Denmark)

Liu, Hin-Yan

2016-01-01

This paper examines the potential for structural discrimination to be woven into the fabric of autonomous vehicle developments, which remain underexplored and undiscussed. The prospect for structural discrimination arises as a result of the coordinated modes of autonomous vehicle behaviour...... individual identity, and potentially relative worth, to autonomous vehicles engaging in a crash damage calculus. At the risk of introducing these ideas into the development of autonomous vehicles, this paper hopes to spark a debate to foreclose these eventualities....... that is prescribed by its code. This leads to the potential for individuated outcomes to be networked and thereby multiplied consistently to any number of vehicles implementing such a code. The aggregated effects of such algorithmic policy preferences will thus cumulate in the reallocation of benefits and burdens...

System and Method for Automated Rendezvous, Docking and Capture of Autonomous Underwater Vehicles

Science.gov (United States)

Stone, William C. (Inventor); Clark, Evan (Inventor); Richmond, Kristof (Inventor); Paulus, Jeremy (Inventor); Kapit, Jason (Inventor); Scully, Mark (Inventor); Kimball, Peter (Inventor)

2018-01-01

A system for automated rendezvous, docking, and capture of autonomous underwater vehicles at the conclusion of a mission comprising of comprised of a docking rod having lighted, pulsating (in both frequency and light intensity) series of LED light strips thereon, with the LEDs at a known spacing, and the autonomous underwater vehicle specially designed to detect and capture the docking rod and then be lifted structurally by a spherical end strop about which the vehicle can be pivoted and hoisted up (e.g., onto a ship). The method of recovery allows for very routine and reliable automated recovery of an unmanned underwater asset.

Decentralized Control of Autonomous Vehicles

Science.gov (United States)

2003-01-01

Autonomous Vehicles by John S. Baras, Xiaobo Tan, Pedram Hovareshti CSHCN TR 2003-8 (ISR TR 2003-14) Report Documentation Page Form ApprovedOMB No. 0704...AND SUBTITLE Decentralized Control of Autonomous Vehicles 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d. PROJECT...Standard Form 298 (Rev. 8-98) Prescribed by ANSI Std Z39-18 Decentralized Control of Autonomous Vehicles ∗ John S. Baras, Xiaobo Tan, and Pedram

Molecular Detection and Characterization of Zoonotic and Veterinary Pathogens in Ticks from Northeastern China

Science.gov (United States)

Wei, Feng; Song, Mingxin; Liu, Huanhuan; Wang, Bo; Wang, Shuchao; Wang, Zedong; Ma, Hongyu; Li, Zhongyu; Zeng, Zheng; Qian, Jun; Liu, Quan

2016-01-01

Tick-borne diseases are considered as emerging infectious diseases in humans and animals in China. In this study, Ixodes persulcatus (n = 1699), Haemaphysalis concinna (n = 412), Haemaphysalis longicornis (n = 390), Dermacentor nuttalli (n = 253), and Dermacentor silvarum (n = 204) ticks were collected by flagging from northeastern China, and detected for infection with Anaplasma, Ehrlichia, Babesia, and Hepatozoon spp. by using nested polymerase chain reaction assays and sequencing analysis. Anaplasma phagocytophilum was detected in all tick species, i.e., I. persulcatus (9.4%), H. longicornis (1.9%), H. concinna (6.5%), D. nuttalli (1.7%), and D. silvarum (2.3%); Anaplasma bovis was detected in H. longicornis (0.3%) and H. concinna (0.2%); Ehrlichia muris was detected in I. persulcatus (2.5%) and H. concinna (0.2%); Candidatus Neoehrlichia mikurensis was only detected in I. persulcatus (0.4%). The Ehrlichia variant (GenBank access number KU921424), closely related to Ehrlichia ewingii, was found in H. longicornis (0.8%) and H. concinna (0.2%). I. persulcatus was infected with Babesia venatorum (1.2%), Babesia microti (0.6%), and Babesia divergens (0.6%). Additionally, four Babesia sequence variants (GenBank access numbers 862303–862306) were detected in I. persulcatus, H. longicornis, and H. concinna, which belonged to the clusters formed by the parasites of dogs, sheep, and cattle (B. gibsoni, B. motasi, and B. crassa). Two Hepatozoon spp. (GenBank access numbers KX016028 and KX016029) associated with hepatozoonosis in Japanese martens were found in the collected ticks (0.1–3.1%). These findings showed the genetic variability of Anaplasma, Ehrlichia, Babesia, and Hepatozoon spp. circulating in ticks in northeastern China, highlighting the necessity for further research of these tick-associated pathogens and their role in human and animal diseases. PMID:27965644

Molecular detection and characterization of zoonotic and veterinary pathogens in ticks from northeastern China

Directory of Open Access Journals (Sweden)

Feng Wei

2016-11-01

Full Text Available Tick-borne diseases are considered as emerging infectious diseases in humans and animals in China. In this study, Ixodes persulcatus (n=1699, Haemaphysalis concinna (n=412, Haemaphysalis longicornis (n=390, Dermacentor nuttalli (n=253, and Dermacentor silvarum (n=204 ticks were collected by flagging from northeastern China, and detected for infection with Anaplasma, Ehrlichia, Babesia, and Hepatozoon spp. by using nested polymerase chain reaction assays and sequencing analysis. A. phagocytophilum was detected in all tick species, i.e., I. persulcatus (9.4%, H. longicornis (1.9%, H. concinna (6.5%, D. nuttalli (1.7%, and D. silvarum (2.3%; A. bovis was detected in H. longicornis (0.3% and H. concinna (0.2%; E. muris was detected in I. persulcatus (2.5% and H. concinna (0.2%; Candidatus Neoehrlichia mikurensis was only detected in I. persulcatus (0.4%. The Ehrlichia variant (GenBank access number KU921424, closely related to E. ewingii, was found in H. longicornis (0.8% and H. concinna (0.2%. I. persulcatus was infected with B. venatorum (1.2%, B. microti (0.6%, and B. divergens (0.6%. Additionally, four Babesia sequence variants (GenBank access numbers 862303–862306 were detected in I. persulcatus, H. longicornis, and H. concinna, which belonged to the clusters formed by the parasites of dogs, sheep and cattle (B. gibsoni, B. motasi, and B. crassa. Two Hepatozoon spp. (GenBank access numbers KX016028 and KX016029 associated with hepatozoonosis in Japanese martens were found in the collected ticks (0.1–3.1%. These findings showed the genetic variability of Anaplasma, Ehrlichia, Babesia, and Hepatozoon spp. circulating in ticks in northeastern China, highlighting the necessity for further research of these tick-associated pathogens and their role in human and animal diseases.

Micro-nano-bio acoustic system for the detection of foodborne pathogens in real samples.

Science.gov (United States)

Papadakis, George; Murasova, Pavla; Hamiot, Audrey; Tsougeni, Katerina; Kaprou, Georgia; Eck, Michael; Rabus, David; Bilkova, Zuzana; Dupuy, Bruno; Jobst, Gerhard; Tserepi, Angeliki; Gogolides, Evangelos; Gizeli, Electra

2018-07-15

The fast and efficient detection of foodborne pathogens is a societal priority, given the large number of food-poisoning outbreaks, and a scientific and technological challenge, given the need to detect as little as 1 viable cell in 25 gr of food. Here, we present the first approach that achieves the above goal, thanks to the use of a micro/nano-technology and the detection capability of acoustic wave sensors. Starting from 1 Salmonella cell in 25 ml of milk, we employ immuno-magnetic beads to capture cells after only 3 h of pre-enrichment and subsequently demonstrate efficient DNA amplification using the Loop Mediated Isothermal Amplification method (LAMP) and acoustic detection in an integrated platform, within an additional ½ h. The demonstrated 4 h sample-to-analysis time comes as a huge improvement to the current need of few days to obtain the same result. In addition, the work presents the first reported Lab-on-Chip platform that comprises an acoustic device as the sensing element, exhibiting impressive analytical features, namely, an acoustic limit of detection of 2 cells/μl or 3 aM of the DNA target and ability to detect in a label-free manner dsDNA amplicons in impure samples. The use of food samples together with the incorporation of the necessary pre-enrichment step and ability for multiple analysis with an internal control, make the proposed methodology highly relevant to real-world applications. Moreover, the work suggests that acoustic wave devices can be used as an attractive alternative to electrochemical sensors in integrated platforms for applications in food safety and the point-of-care diagnostics. Copyright © 2018. Published by Elsevier B.V.

Public Health, Ethics, and Autonomous Vehicles.

Science.gov (United States)

Fleetwood, Janet

2017-04-01

With the potential to save nearly 30 000 lives per year in the United States, autonomous vehicles portend the most significant advance in auto safety history by shifting the focus from minimization of postcrash injury to collision prevention. I have delineated the important public health implications of autonomous vehicles and provided a brief analysis of a critically important ethical issue inherent in autonomous vehicle design. The broad expertise, ethical principles, and values of public health should be brought to bear on a wide range of issues pertaining to autonomous vehicles.

Unsupervised feature learning for autonomous rock image classification

Science.gov (United States)

Shu, Lei; McIsaac, Kenneth; Osinski, Gordon R.; Francis, Raymond

2017-09-01

Autonomous rock image classification can enhance the capability of robots for geological detection and enlarge the scientific returns, both in investigation on Earth and planetary surface exploration on Mars. Since rock textural images are usually inhomogeneous and manually hand-crafting features is not always reliable, we propose an unsupervised feature learning method to autonomously learn the feature representation for rock images. In our tests, rock image classification using the learned features shows that the learned features can outperform manually selected features. Self-taught learning is also proposed to learn the feature representation from a large database of unlabelled rock images of mixed class. The learned features can then be used repeatedly for classification of any subclass. This takes advantage of the large dataset of unlabelled rock images and learns a general feature representation for many kinds of rocks. We show experimental results supporting the feasibility of self-taught learning on rock images.

Pathogenic agents in freshwater resources

Science.gov (United States)

Geldreich, Edwin E.

1996-02-01

Numerous pathogenic agents have been found in freshwaters used as sources for water supplies, recreational bathing and irrigation. These agents include bacterial pathogens, enteric viruses, several protozoans and parasitic worms more common to tropical waters. Although infected humans are a major source of pathogens, farm animals (cattle, sheep, pigs), animal pets (dogs, cats) and wildlife serve as significant reservoirs and should not be ignored. The range of infected individuals within a given warm-blooded animal group (humans included) may range from 1 to 25%. Survival times for pathogens in the water environment may range from a few days to as much as a year (Ascaris, Taenia eggs), with infective dose levels varying from one viable cell for several primary pathogenic agents to many thousands of cells for a given opportunistic pathogen.As pathogen detection in water is complex and not readily incorporated into routine monitoring, a surrogate is necessary. In general, indicators of faecal contamination provide a positive correlation with intestinal pathogen occurrences only when appropriate sample volumes are examined by sensitive methodology.Pathways by which pathogens reach susceptible water users include ingestion of contaminated water, body contact with polluted recreational waters and consumption of salad crops irrigated by polluted freshwaters. Major contributors to the spread of various water-borne pathogens are sewage, polluted surface waters and stormwater runoff. All of these contributions are intensified during periods of major floods. Several water-borne case histories are cited as examples of breakdowns in public health protection related to water supply, recreational waters and the consumption of contaminated salad crops. In the long term, water resource management must focus on pollution prevention from point sources of waste discharges and the spread of pathogens in watershed stormwater runoff.

Electrokinetically-controlled RNA-DNA hybridization assay for foodborne pathogens

International Nuclear Information System (INIS)

Weng, X.; Jiang, H.; Li, D.

2012-01-01

We have developed a microfluidic chip for use in an RNA-DNA hybridization assay for foodborne pathogens. Automatic sequential reagent dispensing and washing was realized with a programmable DC voltage sequencer. Signal detection was achieved with a miniaturized optical detection module. Salmonella and Listeria monocytogenes bacteria in different concentrations were quantitatively determined by this RNA-DNA hybridization assay in the microfluidic chip. The detection limit for the Salmonella and Listeria monocytogenes bacteria is 10 3 to 10 4 CFU mL -1 . The method excels by a significant reduction in the consumption of sample and reagent, and a short assay time. This automatic-operating microfluidic RNA-DNA hybridization assay is promising for on-site pathogen detection. (author)

Surveillance programs for detection and characterization of emergent pathogens and antimicrobial resistance: results from the Division of Infectious Diseases, UNIFESP.

Science.gov (United States)

Colombo, Arnaldo L; Janini, Mario; Salomão, Reinaldo; Medeiros, Eduardo A S; Wey, Sergio B; Pignatari, Antonio C C

2009-09-01

Several epidemiological changes have occurred in the pattern of nosocomial and community acquired infectious diseases during the past 25 years. Social and demographic changes possibly related to this phenomenon include a rapid population growth, the increase in urban migration and movement across international borders by tourists and immigrants, alterations in the habitats of animals and arthropods that transmit disease, as well as the raise of patients with impaired host defense abilities. Continuous surveillance programs of emergent pathogens and antimicrobial resistance are warranted for detecting in real time new pathogens, as well as to characterize molecular mechanisms of resistance. In order to become more effective, surveillance programs of emergent pathogens should be organized as a multicenter laboratory network connected to the main public and private infection control centers. Microbiological data should be integrated to guide therapy, adapting therapy to local ecology and resistance patterns. This paper presents an overview of data generated by the Division of Infectious Diseases, Federal University of São Paulo, along with its participation in different surveillance programs of nosocomial and community acquired infectious diseases.

Distributed Data Logging and Intelligent Control Strategies for a Scaled Autonomous Vehicle

OpenAIRE

Tilman Happek; Uwe Lang; Torben Bockmeier; Dimitrji Neubauer; Alexander Kuznietsov

2016-01-01

In this paper we present an autonomous car with distributed data processing. The car is controlled by a multitude of independent sensors. For the lane detection, a camera is used, which detects the lane marks with a Hough transformation. Once the camera detects these, one of them is calculated to be followed by the car. This lane is verified by the other sensors of the car. These sensors check the route for obstructions or allow the car to scan a parking space and to park on the roadside if t...

Abnormal autonomic cardiac response to transient hypoxia in sickle cell anemia

International Nuclear Information System (INIS)

Sangkatumvong, S; Khoo, M C K; Coates, T D

2008-01-01

The objective of this study was to non-invasively assess cardiac autonomic control in subjects with sickle cell anemia (SCA) by tracking the changes in heart rate variability (HRV) that occur following brief exposure to a hypoxic stimulus. Five African–American SCA patients and seven healthy control subjects were recruited to participate in this study. Each subject was exposed to a controlled hypoxic stimulus consisting of five breaths of nitrogen. Time-varying spectral analysis of HRV was applied to estimate the cardiac autonomic response to the transient episode of hypoxia. The confounding effects of changes in respiration on the HRV spectral indices were reduced by using a computational model. A significant decrease in the parameters related to parasympathetic control was detected in the post-hypoxic responses of the SCA subjects relative to normal controls. The spectral index related to sympathetic activity, on the other hand, showed a tendency to increase the following hypoxic stimulation, but the change was not significant. This study suggests that there is some degree of cardiovascular autonomic dysfunction in SCA that is revealed by the response to transient hypoxia

Comparative analysis of lipopolysaccharides of pathogenic and intermediately pathogenic Leptospira species.

Science.gov (United States)

Patra, Kailash P; Choudhury, Biswa; Matthias, Michael M; Baga, Sheyenne; Bandyopadhya, Keya; Vinetz, Joseph M

2015-10-30

Lipopolysaccharides (LPS) are complex, amphipathic biomolecules that constitute the major surface component of Gram-negative bacteria. Leptospira, unlike other human-pathogenic spirochetes, produce LPS, which is fundamental to the taxonomy of the genus, involved in host-adaption and also the target of diagnostic antibodies. Despite its significance, little is known of Leptospira LPS composition and carbohydrate structure among different serovars. LPS from Leptospira interrogans serovar Copenhageni strain L1-130, a pathogenic species, and L. licerasiae serovar Varillal strain VAR 010, an intermediately pathogenic species, were studied. LPS prepared from aqueous and phenol phases were analyzed separately. L. interrogans serovar Copenhageni has additional sugars not found in L. licerasiae serovar Varillal, including fucose (2.7%), a high amount of GlcNAc (12.3%), and two different types of dideoxy HexNAc. SDS-PAGE indicated that L. interrogans serovar Copenhageni LPS had a far higher molecular weight and complexity than that of L. licerasiae serovar Varillal. Chemical composition showed that L. interrogans serovar Copenhageni LPS has an extended O-antigenic polysaccharide consisting of sugars, not present in L. licerasiae serovar Varillal. Arabinose, xylose, mannose, galactose and L-glycero-D-mannoheptose were detected in both the species. Fatty acid analysis by gas chromatography-mass spectrometry (GC-MS) showed the presence of hydroxypalmitate (3-OH-C16:0) only in L. interrogans serovar Copenhageni. Negative staining electron microscopic examination of LPS showed different filamentous morphologies in L. interrogans serovar Copenhageni vs. L. licerasiae serovar Varillal. This comparative biochemical analysis of pathogenic and intermediately pathogenic Leptospira LPS reveals important carbohydrate and lipid differences that underlie future work in understanding the mechanisms of host-adaptation, pathogenicity and vaccine development in leptospirosis.

A method to detect metal-drug complexes and their interactions with pathogenic bacteria via graphene nanosheet assist laser desorption/ionization mass spectrometry and biosensors