WorldWideScience

Sample records for autonomous pathogen detection

  1. The Autonomous Pathogen Detection System

    Energy Technology Data Exchange (ETDEWEB)

    Dzenitis, J M; Makarewicz, A J

    2009-01-13

    We developed, tested, and now operate a civilian biological defense capability that continuously monitors the air for biological threat agents. The Autonomous Pathogen Detection System (APDS) collects, prepares, reads, analyzes, and reports results of multiplexed immunoassays and multiplexed PCR assays using Luminex{copyright} xMAP technology and flow cytometer. The mission we conduct is particularly demanding: continuous monitoring, multiple threat agents, high sensitivity, challenging environments, and ultimately extremely low false positive rates. Here, we introduce the mission requirements and metrics, show the system engineering and analysis framework, and describe the progress to date including early development and current status.

  2. On-chip quantitative detection of pathogen genes by autonomous microfluidic PCR platform.

    Science.gov (United States)

    Tachibana, Hiroaki; Saito, Masato; Shibuya, Shogo; Tsuji, Koji; Miyagawa, Nobuyuki; Yamanaka, Keiichiro; Tamiya, Eiichi

    2015-12-15

    Polymerase chain reaction (PCR)-based genetic testing has become a routine part of clinical diagnoses and food testing. In these fields, rapid, easy-to-use, and cost-efficient PCR chips are expected to be appeared for providing such testing on-site. In this study, a new autonomous disposable plastic microfluidic PCR chip was created, and was utilized for quantitative detection of pathogenic microorganisms. To control the capillary flow of the following solution in the PCR microchannel, a driving microchannel was newly designed behind the PCR microchannel. This allowed the effective PCR by simply dropping the PCR solution onto the inlet without any external pumps. In order to achieve disposability, injection-molded cyclo-olefin polymer (COP) of a cost-competitive plastic was used for the PCR chip. We discovered that coating the microchannel walls with non-ionic surfactant produced a suitable hydrophilic surface for driving the capillary flow through the 1250-mm long microchannel. As a result, quantitative real-time PCR with the lowest initial concentration of human, Escherichia coli (E. coli), and pathogenic E. coli O157 genomic DNA of 4, 0.0019, 0.031 pg/μl, respectively, was successfully achieved in less than 18 min. Our results indicate that the platform presented in this study provided a rapid, easy-to-use, and low-cost real-time PCR system that could be potentially used for on-site gene testing. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Development of a Commercial Prototype of the Autonomous Pathogen Detection System Final Report CRADA No. TC-02077-04

    Energy Technology Data Exchange (ETDEWEB)

    Dzenitis, J. M. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Haigh, P. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2017-09-27

    This was a collaborative effort between The Regents of the University of California, Lawrence Livermore National Laboratory (LLNL), and GE Ion Track, Inc. (GEIT) to develop a commercial prototype of the Autonomous Pathogen Detection System (APDS), an instrument that monitors the air for all three biological threat agents (bacteria, viruses and toxins). This was originally a one year CRADA project, with the cost of the work at LLNL being funded by the Department of Homeland Security's Office of National Laboratories. The original project consisted of five major tasks and deliverables. The CRADA was then amended, converting the CRADA from a programmatically funded CRADA to a funds-in CRADA, extending the project for an additional 14 months, and adding four new tasks and deliverable to the project.

  4. Autonomous Forest Fire Detection

    NARCIS (Netherlands)

    Breejen, E. den; Breuers, M.; Cremer, F.; Kemp, R.A.W.; Roos, M.; Schutte, K.; Vries, J.S. de

    1998-01-01

    Forest fire detection is a very important issue in the pre-suppression process. Timely detection allows the suppression units to reach the fire in its initial stages and this will reduce the suppression costs considerably. The autonomous forest fire detection principle is based on temporal contrast

  5. The Bering Autonomous Target Detection

    DEFF Research Database (Denmark)

    Jørgensen, John Leif; Denver, Troelz; Betto, Maurizio

    2003-01-01

    An autonomous asteroid target detection and tracking method has been developed. The method features near omnidirectionality and focus on high speed operations and completeness of search of the near space rather than the traditional faint object search methods, employed presently at the larger...... telescopes. The method has proven robust in operation and is well suited for use onboard spacecraft. As development target for the method and the associated instrumentation the asteroid research mission Bering has been used. Onboard a spacecraft, the autonomous detection is centered around the fully...

  6. Semi autonomous mine detection system

    Energy Technology Data Exchange (ETDEWEB)

    Douglas Few; Roelof Versteeg; Herman Herman

    2010-04-01

    CMMAD is a risk reduction effort for the AMDS program. As part of CMMAD, multiple instances of semi autonomous robotic mine detection systems were created. Each instance consists of a robotic vehicle equipped with sensors required for navigation and marking, a countermine sensors and a number of integrated software packages which provide for real time processing of the countermine sensor data as well as integrated control of the robotic vehicle, the sensor actuator and the sensor. These systems were used to investigate critical interest functions (CIF) related to countermine robotic systems. To address the autonomy CIF, the INL developed RIK was extended to allow for interaction with a mine sensor processing code (MSPC). In limited field testing this system performed well in detecting, marking and avoiding both AT and AP mines. Based on the results of the CMMAD investigation we conclude that autonomous robotic mine detection is feasible. In addition, CMMAD contributed critical technical advances with regard to sensing, data processing and sensor manipulation, which will advance the performance of future fieldable systems. As a result, no substantial technical barriers exist which preclude – from an autonomous robotic perspective – the rapid development and deployment of fieldable systems.

  7. Multiplex detection of agricultural pathogens

    Science.gov (United States)

    Siezak, Thomas R.; Gardner, Shea; Torres, Clinton; Vitalis, Elizabeth; Lenhoff, Raymond J.

    2013-01-15

    Described are kits and methods useful for detection of agricultural pathogens in a sample. Genomic sequence information from agricultural pathogens was analyzed to identify signature sequences, e.g., polynucleotide sequences useful for confirming the presence or absence of a pathogen in a sample. Primer and probe sets were designed and optimized for use in a PCR based, multiplexed Luminex assay and/or an array assay to successfully identify the presence or absence of pathogens in a sample.

  8. Multiplex detection of respiratory pathogens

    Science.gov (United States)

    McBride, Mary [Brentwood, CA; Slezak, Thomas [Livermore, CA; Birch, James M [Albany, CA

    2012-07-31

    Described are kits and methods useful for detection of respiratory pathogens (influenza A (including subtyping capability for H1, H3, H5 and H7 subtypes) influenza B, parainfluenza (type 2), respiratory syncytial virus, and adenovirus) in a sample. Genomic sequence information from the respiratory pathogens was analyzed to identify signature sequences, e.g., polynucleotide sequences useful for confirming the presence or absence of a pathogen in a sample. Primer and probe sets were designed and optimized for use in a PCR based, multiplexed Luminex assay to successfully identify the presence or absence of pathogens in a sample.

  9. Biosensors for plant pathogen detection.

    Science.gov (United States)

    Khater, Mohga; de la Escosura-Muñiz, Alfredo; Merkoçi, Arben

    2017-07-15

    Infectious plant diseases are caused by pathogenic microorganisms such as fungi, bacteria, viruses, viroids, phytoplasma and nematodes. Worldwide, plant pathogen infections are among main factors limiting crop productivity and increasing economic losses. Plant pathogen detection is important as first step to manage a plant disease in greenhouses, field conditions and at the country boarders. Current immunological techniques used to detect pathogens in plant include enzyme-linked immunosorbent assays (ELISA) and direct tissue blot immunoassays (DTBIA). DNA-based techniques such as polymerase chain reaction (PCR), real time PCR (RT-PCR) and dot blot hybridization have also been proposed for pathogen identification and detection. However these methodologies are time-consuming and require complex instruments, being not suitable for in-situ analysis. Consequently, there is strong interest for developing new biosensing systems for early detection of plant diseases with high sensitivity and specificity at the point-of-care. In this context, we revise here the recent advancement in the development of advantageous biosensing systems for plant pathogen detection based on both antibody and DNA receptors. The use of different nanomaterials such as nanochannels and metallic nanoparticles for the development of innovative and sensitive biosensing systems for the detection of pathogens (i.e. bacteria and viruses) at the point-of-care is also shown. Plastic and paper-based platforms have been used for this purpose, offering cheap and easy-to-use really integrated sensing systems for rapid on-site detection. Beside devices developed at research and development level a brief revision of commercially available kits is also included in this review. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Molecular detection of human bacterial pathogens

    National Research Council Canada - National Science Library

    Liu, Dongyou

    2011-01-01

    .... Molecular Detection of Human Bacterial Pathogens addresses this issue, with international scientists in respective bacterial pathogen research and diagnosis providing expert summaries on current...

  11. Autonomous valve for detection of biopolymer degradation

    DEFF Research Database (Denmark)

    Keller, Stephan Urs; Noeth, Nadine-Nicole; Fetz, Stefanie

    2009-01-01

    We present a polymer microvalve that allows the detection of biopolymer degradation without the need of external energy. The valve is based on a polymer container filled with a colored marker solution and closed by a thin lid. This structure is covered by a film of poly(L-lactide) and degradation...... of the biopolymer triggers the release of the color which is detected visually. The autonomous valve has potential for the fast testing of biopolymer degradation under various environmental conditions or by specific enzymes....

  12. Adaptively detecting changes in Autonomic Grid Computing

    KAUST Repository

    Zhang, Xiangliang

    2010-10-01

    Detecting the changes is the common issue in many application fields due to the non-stationary distribution of the applicative data, e.g., sensor network signals, web logs and gridrunning logs. Toward Autonomic Grid Computing, adaptively detecting the changes in a grid system can help to alarm the anomalies, clean the noises, and report the new patterns. In this paper, we proposed an approach of self-adaptive change detection based on the Page-Hinkley statistic test. It handles the non-stationary distribution without the assumption of data distribution and the empirical setting of parameters. We validate the approach on the EGEE streaming jobs, and report its better performance on achieving higher accuracy comparing to the other change detection methods. Meanwhile this change detection process could help to discover the device fault which was not claimed in the system logs. © 2010 IEEE.

  13. Molecular detection of foodborne pathogens

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hartmann

    of the VBNC state, and would thus be able to assess the outcome and impact of increasingly applied post-slaughter reduction strategies. A real-time PCR-based method for detection of Salmonella was optimized following a diversified approach to enable the shortest time of analysis possible. Positive effects...... of these pathogens in the food chain, in order to improve intervention strategies and make more effective the control of production lines and single food items. To serve this purpose, rapid and reliable detection and quantification methods are imperative. The culture-based standard methods currently applied...... for detection and enumeration of Salmonella and Campylobacter are time-consuming and laborious. They lack specificity and do not enable detection of viable but non-culturable (VBNC) bacteria. The focus of the present thesis has been development and validation of PCR-based detection methods for Salmonella...

  14. Molecular detection of foodborne pathogens

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hartmann

    .84) was obtained between the Campylobacter counts obtained by PMA-PCR and culture, indicating that the method presents as a reliable tool for producing accurate quantitative data on viable Campylobacter. DNA from dead cells was not detected by the proposed method, however, it recognized the infectious potential...... of these pathogens in the food chain, in order to improve intervention strategies and make more effective the control of production lines and single food items. To serve this purpose, rapid and reliable detection and quantification methods are imperative. The culture-based standard methods currently applied...... for detection and enumeration of Salmonella and Campylobacter are time-consuming and laborious. They lack specificity and do not enable detection of viable but non-culturable (VBNC) bacteria. The focus of the present thesis has been development and validation of PCR-based detection methods for Salmonella...

  15. Autonomous Chemical Vapour Detection by Micro UAV

    Directory of Open Access Journals (Sweden)

    Kent Rosser

    2015-12-01

    Full Text Available The ability to remotely detect and map chemical vapour clouds in open air environments is a topic of significant interest to both defence and civilian communities. In this study, we integrate a prototype miniature colorimetric chemical sensor developed for methyl salicylate (MeS, as a model chemical vapour, into a micro unmanned aerial vehicle (UAV, and perform flights through a raised MeS vapour cloud. Our results show that that the system is capable of detecting MeS vapours at low ppm concentration in real-time flight and rapidly sending this information to users by on-board telemetry. Further, the results also indicate that the sensor is capable of distinguishing “clean” air from “dirty”, multiple times per flight, allowing us to look towards autonomous cloud mapping and source localization applications. Further development will focus on a broader range of integrated sensors, increased autonomy of detection and improved engineering of the system.

  16. Autonomous Rule Creation for Intrusion Detection

    Energy Technology Data Exchange (ETDEWEB)

    Todd Vollmer; Jim Alves-Foss; Milos Manic

    2011-04-01

    Many computational intelligence techniques for anomaly based network intrusion detection can be found in literature. Translating a newly discovered intrusion recognition criteria into a distributable rule can be a human intensive effort. This paper explores a multi-modal genetic algorithm solution for autonomous rule creation. This algorithm focuses on the process of creating rules once an intrusion has been identified, rather than the evolution of rules to provide a solution for intrusion detection. The algorithm was demonstrated on anomalous ICMP network packets (input) and Snort rules (output of the algorithm). Output rules were sorted according to a fitness value and any duplicates were removed. The experimental results on ten test cases demonstrated a 100 percent rule alert rate. Out of 33,804 test packets 3 produced false positives. Each test case produced a minimum of three rule variations that could be used as candidates for a production system.

  17. Autonomous detection of indoor and outdoor signs

    Science.gov (United States)

    Holden, Steven; Snorrason, Magnus; Goodsell, Thomas; Stevens, Mark R.

    2005-05-01

    Most goal-oriented mobile robot tasks involve navigation to one or more known locations. This is generally done using GPS coordinates and landmarks outdoors, or wall-following and fiducial marks indoors. Such approaches ignore the rich source of navigation information that is already in place for human navigation in all man-made environments: signs. A mobile robot capable of detecting and reading arbitrary signs could be tasked using directions that are intuitive to hu-mans, and it could report its location relative to intuitive landmarks (a street corner, a person's office, etc.). Such ability would not require active marking of the environment and would be functional in the absence of GPS. In this paper we present an updated version of a system we call Sign Understanding in Support of Autonomous Navigation (SUSAN). This system relies on cues common to most signs, the presence of text, vivid color, and compact shape. By not relying on templates, SUSAN can detect a wide variety of signs: traffic signs, street signs, store-name signs, building directories, room signs, etc. In this paper we focus on the text detection capability. We present results summarizing probability of detection and false alarm rate across many scenes containing signs of very different designs and in a variety of lighting conditions.

  18. Autonomous nutrient detection for water quality monitoring

    OpenAIRE

    Maher, Damien; Cleary, John; Cogan, Deirdre; Diamond, Dermot

    2012-01-01

    The ever increasing demand for real time environmental monitoring is currently being driven by strong legislative and societal drivers. Low cost autonomous environmental monitoring systems are required to meet this demand as current monitoring solutions are insufficient. This poster presents an autonomous nutrient analyser platform for water quality monitoring. Results from a field trial of the nutrient analyser are reported along with current work to expand the range of water quality targ...

  19. Malicious Hubs: Detecting Abnormally Malicious Autonomous Systems

    Energy Technology Data Exchange (ETDEWEB)

    Kalafut, Andrew J. [Indiana University; Shue, Craig A [ORNL; Gupta, Prof. Minaxi [Indiana University

    2010-01-01

    While many attacks are distributed across botnets, investigators and network operators have recently targeted malicious networks through high profile autonomous system (AS) de-peerings and network shut-downs. In this paper, we explore whether some ASes indeed are safe havens for malicious activity. We look for ISPs and ASes that exhibit disproportionately high malicious behavior using 12 popular blacklists. We find that some ASes have over 80% of their routable IP address space blacklisted and others account for large fractions of blacklisted IPs. Overall, we conclude that examining malicious activity at the AS granularity can unearth networks with lax security or those that harbor cybercrime.

  20. Quantitative multiplex detection of pathogen biomarkers

    Science.gov (United States)

    Mukundan, Harshini; Xie, Hongzhi; Swanson, Basil I; Martinez, Jennifer; Grace, Wynne K

    2014-10-14

    The present invention addresses the simultaneous detection and quantitative measurement of multiple biomolecules, e.g., pathogen biomarkers through either a sandwich assay approach or a lipid insertion approach. The invention can further employ a multichannel, structure with multi-sensor elements per channel.

  1. Microretroreflector-sedimentation immunoassays for pathogen detection.

    Science.gov (United States)

    Garvey, Gavin; Shakarisaz, David; Ruiz-Ruiz, Federico; Hagström, Anna E V; Raja, Balakrishnan; Pascente, Carmen; Kar, Archana; Kourentzi, Katerina; Rito-Palomares, Marco; Ruchhoeft, Paul; Willson, Richard C

    2014-09-16

    Point-of-care detection of pathogens is medically valuable but poses challenging trade-offs between instrument complexity and clinical and analytical sensitivity. Here we introduce a diagnostic platform utilizing lithographically fabricated micron-scale forms of cubic retroreflectors, arguably one of the most optically detectable human artifacts, as reporter labels for use in sensitive immunoassays. We demonstrate the applicability of this novel optical label in a simple assay format in which retroreflector cubes are first mixed with the sample. The cubes are then allowed to settle onto an immuno-capture surface, followed by inversion for gravity-driven removal of nonspecifically bound cubes. Cubes bridged to the capture surface by the analyte are detected using inexpensive, low-numerical aperture optics. For model bacterial and viral pathogens, sensitivity in 10% human serum was found to be 10(4) bacterial cells/mL and 10(4) virus particles/mL, consistent with clinical utility.

  2. Integrating Pavement Crack Detection and Analysis Using Autonomous Unmanned Aerial Vehicle Imagery

    Science.gov (United States)

    2015-03-27

    INTEGRATING PAVEMENT CRACK DETECTION AND ANALYSIS USING AUTONOMOUS UNMANNED AERIAL VEHICLE...protection in the United States. AFIT-ENV-MS-15-M-195 INTEGRATING PAVEMENT CRACK DETECTION AND ANALYSIS USING AUTONOMOUS UNMANNED AERIAL...APPROVED FOR PUBLIC RELEASE; DISTRIBUTION UNLIMITED. AFIT-ENV-MS-15-M-195 INTEGRATING PAVEMENT CRACK DETECTION AND ANALYSIS USING AUTONOMOUS

  3. Human detection for underground autonomous mine vehicles using thermal imaging

    CSIR Research Space (South Africa)

    Dickens, JS

    2011-07-01

    Full Text Available Page 1 of 12 26th International Conference on CAD/CAM, Robotics & Factories of the Future, 26-28 July 2011, Kuala Lumpur, Malaysia HUMAN DETECTION FOR UNDERGROUND AUTONOMOUS MINE VEHICLES USING THERMAL IMAGING J. S. Dickens1, J. J. Green2.... Dickens Page 2 of 12 26th International Conference on CAD/CAM, Robotics & Factories of the Future, 26-28 July 2011, Kuala Lumpur...

  4. AUTONOMOUS DETECTION AND TRACKING OF AN OBJECT AUTONOMOUSLY USING AR.DRONE QUADCOPTER

    Directory of Open Access Journals (Sweden)

    Futuhal Arifin

    2014-08-01

    Full Text Available Abstract Nowadays, there are many robotic applications being developed to do tasks autonomously without any interactions or commands from human. Therefore, developing a system which enables a robot to do surveillance such as detection and tracking of a moving object will lead us to more advanced tasks carried out by robots in the future. AR.Drone is a flying robot platform that is able to take role as UAV (Unmanned Aerial Vehicle. Usage of computer vision algorithm such as Hough Transform makes it possible for such system to be implemented on AR.Drone. In this research, the developed algorithm is able to detect and track an object with certain shape and color. Then the algorithm is successfully implemented on AR.Drone quadcopter for detection and tracking.

  5. Bacteriophages for detection of bacterial pathogens

    International Nuclear Information System (INIS)

    Kutateladze, M.

    2009-01-01

    The G. Eliava Institute of Bacteriophages, Microbiology and Virology (Tbilisi, Georgia) is one of the most famous institutions focused on bacteriophage research for the elaboration of appropriate phage methodologies for human and animal protection. The main direction of the institute is the study and production of bacteriophages against intestinal disorders (dysentery, typhoid, intesti) and purulent-septic infections (staphylococcus, streptococcus, pyophage, etc.). These preparations were successfully introduced during the Soviet era, and for decades were used throughout the former Soviet Union and in other Socialist countries for the treatment, prophylaxis, and diagnosis of various infectious diseases, including those caused by antibiotic-resistant bacterial strains. Bacteriophages were widely used for identifying and detecting infections caused by the most dangerous pathogens and causative agents of epidemiological outbreaks. The specific topic of this presentation is the phage typing of bacterial species, which can be an important method for epidemiological diagnostics. Together with different genetic methodologies - such as PCR-based methods, PFGE, plasmid fingerprinting, and ribosomal typing - phage typing is one method for identifying bacterial pathogens. The method has a high percentage of determination of phage types, high specificity of reaction, and is easy for interpretation and use by health workers. Phage typing was applied for inter-species differentiation of different species of Salmonella, S. typhi, Brucella spp, Staphylococcus aureus, E. col,i Clostridium deficile, Vibrio cholerae, Yersinia pestis, Yersinia enterocolitica, Lysteria monocytogenes, Clostridium perfringens, Clostridium tetani, plant pathogens, and other bacterial pathogens. In addition to addressing the utility and efficacy of phage typing, the paper will discuss the isolation and selection of diagnostic typing phages for interspecies differentiation of pathogens that is necessary

  6. Detection of pathogens from periodontal lesions

    Directory of Open Access Journals (Sweden)

    Malheiros Veruska de João

    2004-01-01

    Full Text Available OBJECTIVE: To comparatively detect A. actinomycetemcomitans and F. nucleatum from periodontal and healthy sites. METHODS: Subgingival clinical samples from 50 periodontitis adult patients and 50 healthy subjects were analyzed. Both organisms were isolated using a trypticase soy agar-bacitracin-vancomycin (TSBV medium and detected by PCR. Conventional biochemical tests were used for bacteria identification. RESULTS: A. actinomycetemcomitans and F. nucleatum were isolated in 18% and 20% of the patients, respectively, and in 2% and 24% of healthy subjects. Among A. actinomycetemcomitans isolates, biotype II was the most prevalent. Primer pair AA was 100% sensitive in the detection of A. actinomycetemcomitans from both subject groups. Primers ASH and FU were also 100% sensitive to detect this organism in healthy subject samples. Primer pair FN5047 was more sensitive to detect F. nucleatum in patients or in healthy samples than primer 5059S. Primers ASH and 5059S were more specific in the detection of A. actinomycetemcomitans and F. nucleatum, respectively, in patients and in healthy subject samples. CONCLUSIONS: PCR is an effective tool for detecting periodontal pathogens in subgingival samples, providing a faster and safer diagnostic tool of periodontal diseases. The method's sensitivity and specificity is conditioned by the choice of the set of primers used.

  7. Acanthamoeba: ecology, pathogenicity and laboratory detection.

    Science.gov (United States)

    Walker, C W

    1996-06-01

    Acanthamoeba spp. are ubiquitous free-living protozoa found in a wide range of environmental niches. They are resistant to disinfectants, temperature variation and desiccation and are responsible for two recognised diseases in humans, granulomatous amoebic encephalitis and keratitis. Both infections are rare, although the latter is currently receiving more attention following the association between Acanthamoeba and the wearing of contact lenses. Laboratory diagnosis is unusual but not beyond the bounds of most routine clinical microbiology departments. In this review the various aspects surrounding the ecology, pathogenicity and laboratory detection of Acanthamoeba spp. are considered.

  8. Surrounding Moving Obstacle Detection for Autonomous Driving Using Stereo Vision

    Directory of Open Access Journals (Sweden)

    Hao Sun

    2013-06-01

    Full Text Available Detection and tracking surrounding moving obstacles such as vehicles and pedestrians are crucial for the safety of mobile robotics and autonomous vehicles. This is especially the case in urban driving scenarios. This paper presents a novel framework for surrounding moving obstacles detection using binocular stereo vision. The contributions of our work are threefold. Firstly, a multiview feature matching scheme is presented for simultaneous stereo correspondence and motion correspondence searching. Secondly, the multiview geometry constraint derived from the relative camera positions in pairs of consecutive stereo views is exploited for surrounding moving obstacles detection. Thirdly, an adaptive particle filter is proposed for tracking of multiple moving obstacles in surrounding areas. Experimental results from real-world driving sequences demonstrate the effectiveness and robustness of the proposed framework.

  9. Improving the Lane Reference Detection for Autonomous Road Vehicle Control

    Directory of Open Access Journals (Sweden)

    Felipe Jiménez

    2016-01-01

    Full Text Available Autonomous road vehicles are increasingly becoming more important and there are several techniques and sensors that are being applied for vehicle control. This paper presents an alternative system for maintaining the position of autonomous vehicles without adding additional elements to the standard sensor architecture, by using a 3D laser scanner for continuously detecting a reference element in situations in which the GNSS receiver fails or provides accuracy below the required level. Considering that the guidance variables are more accurately estimated when dealing with reference points in front of and behind the vehicle, an algorithm based on vehicle dynamics mathematical model is proposed to extend the detected points in cases where the sensor is placed at the front of the vehicle. The algorithm has been tested when driving along a lane delimited by New Jersey barriers at both sides and the results show a correct behaviour. The system is capable of estimating the reference element behind the vehicle with sufficient accuracy when the laser scanner is placed at the front of it, so the robustness of the control input variables (lateral and angular errors estimation is improved making it unnecessary to place the sensor on the vehicle roof or to introduce additional sensors.

  10. Motor execution detection based on autonomic nervous system responses

    International Nuclear Information System (INIS)

    Marchal-Crespo, Laura; Riener, Robert; Zimmermann, Raphael; Lambercy, Olivier; Edelmann, Janis; Fluet, Marie-Christine; Gassert, Roger; Wolf, Martin

    2013-01-01

    Triggered assistance has been shown to be a successful robotic strategy for provoking motor plasticity, probably because it requires neurologic patients’ active participation to initiate a movement involving their impaired limb. Triggered assistance, however, requires sufficient residual motor control to activate the trigger and, thus, is not applicable to individuals with severe neurologic injuries. In these situations, brain and body–computer interfaces have emerged as promising solutions to control robotic devices. In this paper, we investigate the feasibility of a body–machine interface to detect motion execution only monitoring the autonomic nervous system (ANS) response. Four physiological signals were measured (blood pressure, breathing rate, skin conductance response and heart rate) during an isometric pinching task and used to train a classifier based on hidden Markov models. We performed an experiment with six healthy subjects to test the effectiveness of the classifier to detect rest and active pinching periods. The results showed that the movement execution can be accurately classified based only on peripheral autonomic signals, with an accuracy level of 84.5%, sensitivity of 83.8% and specificity of 85.2%. These results are encouraging to perform further research on the use of the ANS response in body–machine interfaces. (paper)

  11. Field application of pathogen detection technologies

    Energy Technology Data Exchange (ETDEWEB)

    Straub, Tim M.; Call, Douglas R.; Bruckner-Lea, Cindy J.; Colburn, Heather A.; Baird, Cheryl L.; Bartholomew, Rachel A.; Ozanich, Richard M.; Jarman, Kristin H.

    2016-06-29

    Over the last 10 years there has been a significant increase in commercial products designed for field-based detection of microbial pathogens. This is due, in part, to the anthrax attacks in the United States in 2001, and the need for first responders to quickly identify the composition of suspected white powders and other potential biothreats. Demand for rapid detection is also driven by the need to ensure safe food, water, and environmental systems. From a technology perspective, rapid identification methods have largely capitalized on PCR and other molecular recognition techniques that can be deployed as robust field instrumentation. Examples of the relevant needs include the ability to: 1) declare a water distribution system free of microbial pathogens after a pipe/main break repair; 2) assess risks of contamination such as when produce production and processing plants are located near concentrated animal feeing operations; 3) evaluate the safety of ready-to-eat products; 4) determine the extent of potential serious disease outbreaks in remote and/or disaster stricken areas where access to clinical laboratories is not an immediate option; and 5) quickly assess credible biological terrorism events. Many of the principles underlying rapid detection methods are derived from methods for environmental microbiology, but there is a dearth of literature describing and evaluating field-based detection systems. Thus, the aims of this chapter are to: 1) summarize the different kinds of commercially available sampling kits and field-based biological detectors; 2) highlight some of the continued challenges of sample preparation to stimulate new research towards minimizing the impact of inhibitors on PCR-based detection systems; 3) describe our general rationale and statistically-based approach for instrument evaluation; 4) provide statistical and spatial guidelines for developing valid sampling plans; and 5) summarize some current needs and emerging technologies. This

  12. Aptamer-Based Technologies in Foodborne Pathogen Detection

    Directory of Open Access Journals (Sweden)

    Jun Teng

    2016-09-01

    Full Text Available Aptamers are single stranded DNA or RNA ligands, which can be selected by a method called systematic evolution of ligands by exponential enrichment (SELEX; and they can specifically recognize and bind to their targets. These unique characteristics of aptamers offer great potentials in applications such as pathogen detection and biomolecular screening. Pathogen detection is the first and critical means in detecting and identifying the problems related to public health and food safety; and only the rapid, sensitive and efficient detection technologies can enable the users to make to accurate assessments on the risk of infections (humans and animals or contaminations (foods and other commodities caused by various pathogens. This article reviews the developments in the field of the aptamer-based approaches for pathogen detection, including whole-cell SELEX and Genomic SELEX. Nowadays, a variety of aptamer-based biosensors have been developed for pathogen detection. Thus, in this review, we also cover the development of aptamer-based biosensors including optical biosensors for multiple pathogen detection in multiple-labeling or label-free models such as fluorescence detection and surface plasmon resonance, electrochemical biosensors, and lateral chromatography test strips, and their applications in the pathogen detection and biomolecular screening. While notable progress has been made in the field in the last decade, challenges or drawbacks in their applications such as pathogen detection and biomolecular screening, remain to be overcome.

  13. Aptamer-Based Technologies in Foodborne Pathogen Detection.

    Science.gov (United States)

    Teng, Jun; Yuan, Fang; Ye, Yingwang; Zheng, Lei; Yao, Li; Xue, Feng; Chen, Wei; Li, Baoguang

    2016-01-01

    Aptamers are single stranded DNA or RNA ligands, which can be selected by a method called systematic evolution of ligands by exponential enrichment (SELEX); and they can specifically recognize and bind to their targets. These unique characteristics of aptamers offer great potentials in applications such as pathogen detection and biomolecular screening. Pathogen detection is the critical means in detecting and identifying the problems related to public health and food safety; and only the rapid, sensitive and efficient detection technologies can enable the users to make the accurate assessments on the risks of infections (humans and animals) or contaminations (foods and other commodities) caused by various pathogens. This article reviews the development in the field of the aptamer-based approaches for pathogen detection, including whole-cell SELEX and Genomic SELEX. Nowadays, a variety of aptamer-based biosensors have been developed for pathogen detection. Thus, in this review, we also cover the development in aptamer-based biosensors including optical biosensors for multiple pathogen detection by multiple-labeling or label-free models such as fluorescence detection and surface plasmon resonance, electrochemical biosensors and lateral chromatography test strips, and their applications in pathogen detection and biomolecular screening. While notable progress has been made in the field in the last decade, challenges or drawbacks in their applications such as pathogen detection and biomolecular screening remain to be overcome.

  14. Towards autonomous radio detection of ultra high energy cosmic rays

    International Nuclear Information System (INIS)

    Garcon, Th.

    2010-01-01

    The radio-detection of extensive air showers, investigated for the first time in the 1960's, obtained promising results but plagued by the technical limitations. At that time, H.R. Allan summed up the state of the art in an extensive review article whose conclusions and predictions are still used today. Set up in 2001 at the Nancay Observatory, the CODALEMA experiment was built first as a demonstrator and successfully showed the feasibility of the radio-detection of extensive air showers. Radically modified in 2005, it allowed to obtain a clear energy correlation, and put in evidence an unambiguous signature of the geomagnetic origin of the electric field emission process associated to the air shower. The switch towards large areas is the next step of the technique's development. Therefore, the autonomy of the detectors becomes essential. After test prototypes installed in 2006 at the Pierre Auger Observatory, a generation of new autonomous detectors was developed. Their first results will be presented. This work is also dedicated to the issues related to the radio-detection technique: the antenna response, the sensitivity, the surrounding effects, the monitoring of a big array. The determination of the shower characteristics independently of other detectors such as the lateral distribution, the energy correlation and the frequency spectrum of the radio transient will be discussed. (author)

  15. Towards Autonomous Agriculture: Automatic Ground Detection Using Trinocular Stereovision

    Directory of Open Access Journals (Sweden)

    Annalisa Milella

    2012-09-01

    Full Text Available Autonomous driving is a challenging problem, particularly when the domain is unstructured, as in an outdoor agricultural setting. Thus, advanced perception systems are primarily required to sense and understand the surrounding environment recognizing artificial and natural structures, topology, vegetation and paths. In this paper, a self-learning framework is proposed to automatically train a ground classifier for scene interpretation and autonomous navigation based on multi-baseline stereovision. The use of rich 3D data is emphasized where the sensor output includes range and color information of the surrounding environment. Two distinct classifiers are presented, one based on geometric data that can detect the broad class of ground and one based on color data that can further segment ground into subclasses. The geometry-based classifier features two main stages: an adaptive training stage and a classification stage. During the training stage, the system automatically learns to associate geometric appearance of 3D stereo-generated data with class labels. Then, it makes predictions based on past observations. It serves as well to provide training labels to the color-based classifier. Once trained, the color-based classifier is able to recognize similar terrain classes in stereo imagery. The system is continuously updated online using the latest stereo readings, thus making it feasible for long range and long duration navigation, over changing environments. Experimental results, obtained with a tractor test platform operating in a rural environment, are presented to validate this approach, showing an average classification precision and recall of 91.0% and 77.3%, respectively.

  16. Autonomous Contingency Detection and Reaction for Unmanned Aircraft, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — Unmanned aircraft systems (UAS) and, in particular, intelligent, autonomous aircraft operating in the national airspace system (NAS) have the potential to...

  17. Autonomic intrusion detection: Adaptively detecting anomalies over unlabeled audit data streams in computer networks

    KAUST Repository

    Wang, Wei

    2014-06-22

    In this work, we propose a novel framework of autonomic intrusion detection that fulfills online and adaptive intrusion detection over unlabeled HTTP traffic streams in computer networks. The framework holds potential for self-managing: self-labeling, self-updating and self-adapting. Our framework employs the Affinity Propagation (AP) algorithm to learn a subject’s behaviors through dynamical clustering of the streaming data. It automatically labels the data and adapts to normal behavior changes while identifies anomalies. Two large real HTTP traffic streams collected in our institute as well as a set of benchmark KDD’99 data are used to validate the framework and the method. The test results show that the autonomic model achieves better results in terms of effectiveness and efficiency compared to adaptive Sequential Karhunen–Loeve method and static AP as well as three other static anomaly detection methods, namely, k-NN, PCA and SVM.

  18. Multiplex detection of plant pathogens using a microsphere immunoassay technology.

    Directory of Open Access Journals (Sweden)

    Ratthaphol Charlermroj

    Full Text Available Plant pathogens are a serious problem for seed export, plant disease control and plant quarantine. Rapid and accurate screening tests are urgently required to protect and prevent plant diseases spreading worldwide. A novel multiplex detection method was developed based on microsphere immunoassays to simultaneously detect four important plant pathogens: a fruit blotch bacterium Acidovorax avenae subsp. citrulli (Aac, chilli vein-banding mottle virus (CVbMV, potyvirus, watermelon silver mottle virus (WSMoV, tospovirus serogroup IV and melon yellow spot virus (MYSV, tospovirus. An antibody for each plant pathogen was linked on a fluorescence-coded magnetic microsphere set which was used to capture corresponding pathogen. The presence of pathogens was detected by R-phycoerythrin (RPE-labeled antibodies specific to the pathogens. The assay conditions were optimized by identifying appropriate antibody pairs, blocking buffer, concentration of RPE-labeled antibodies and assay time. Once conditions were optimized, the assay was able to detect all four plant pathogens precisely and accurately with substantially higher sensitivity than enzyme-linked immunosorbent assay (ELISA when spiked in buffer and in healthy watermelon leaf extract. The assay time of the microsphere immunoassay (1 hour was much shorter than that of ELISA (4 hours. This system was also shown to be capable of detecting the pathogens in naturally infected plant samples and is a major advancement in plant pathogen detection.

  19. Multiplex detection of plant pathogens using a microsphere immunoassay technology.

    Science.gov (United States)

    Charlermroj, Ratthaphol; Himananto, Orawan; Seepiban, Channarong; Kumpoosiri, Mallika; Warin, Nuchnard; Oplatowska, Michalina; Gajanandana, Oraprapai; Grant, Irene R; Karoonuthaisiri, Nitsara; Elliott, Christopher T

    2013-01-01

    Plant pathogens are a serious problem for seed export, plant disease control and plant quarantine. Rapid and accurate screening tests are urgently required to protect and prevent plant diseases spreading worldwide. A novel multiplex detection method was developed based on microsphere immunoassays to simultaneously detect four important plant pathogens: a fruit blotch bacterium Acidovorax avenae subsp. citrulli (Aac), chilli vein-banding mottle virus (CVbMV, potyvirus), watermelon silver mottle virus (WSMoV, tospovirus serogroup IV) and melon yellow spot virus (MYSV, tospovirus). An antibody for each plant pathogen was linked on a fluorescence-coded magnetic microsphere set which was used to capture corresponding pathogen. The presence of pathogens was detected by R-phycoerythrin (RPE)-labeled antibodies specific to the pathogens. The assay conditions were optimized by identifying appropriate antibody pairs, blocking buffer, concentration of RPE-labeled antibodies and assay time. Once conditions were optimized, the assay was able to detect all four plant pathogens precisely and accurately with substantially higher sensitivity than enzyme-linked immunosorbent assay (ELISA) when spiked in buffer and in healthy watermelon leaf extract. The assay time of the microsphere immunoassay (1 hour) was much shorter than that of ELISA (4 hours). This system was also shown to be capable of detecting the pathogens in naturally infected plant samples and is a major advancement in plant pathogen detection.

  20. Autonomous rock detection on mars through region contrast

    Science.gov (United States)

    Xiao, Xueming; Cui, Hutao; Yao, Meibao; Tian, Yang

    2017-08-01

    In this paper, we present a new autonomous rock detection approach through region contrast. Unlike current state-of-art pixel-level rock segmenting methods, new method deals with this issue in region level, which will significantly reduce the computational cost. Image is firstly splitted into homogeneous regions based on intensity information and spatial layout. Considering the high-water memory constraints of onboard flight processor, only low-level features, average intensity and variation of superpixel, are measured. Region contrast is derived as the integration of intensity contrast and smoothness measurement. Rocks are then segmented from the resulting contrast map by an adaptive threshold. Since the merely intensity-based method may cause false detection in background areas with different illuminations from surroundings, a more reliable method is further proposed by introducing spatial factor and background similarity to the region contrast. Spatial factor demonstrates the locality of contrast, while background similarity calculates the probability of each subregion belonging to background. Our method is efficient in dealing with large images and only few parameters are needed. Preliminary experimental results show that our algorithm outperforms edge-based methods in various grayscale rover images.

  1. Evaluation of stereo vision obstacle detection algorithms for off-road autonomous navigation

    Science.gov (United States)

    Rankin, Arturo; Huertas, Andres; Matthies, Larry

    2005-01-01

    Reliable detection of non-traversable hazards is a key requirement for off-road autonomous navigation. A detailed description of each obstacle detection algorithm and their performance on the surveyed obstacle course is presented in this paper.

  2. Towards a demonstrator for autonomous object detection on board Gaia

    Science.gov (United States)

    Mignot, Shan

    2010-07-01

    ESA's cornerstone mission Gaia aims at autonomously building a billion-star catalogue by detecting them on board. The scientific and technical requirements make this an engineering challenge. We have devised a prototype to assess achievable performances and assist in sizing the on-board electronics. It is based on a sequence of four tasks: calibrating the CCD data, estimating the sky background, identifying the objects and, finally, characterising them. Although inspired by previous similar studies (APM, Sextractor), this approach has been thoroughly revisited and finely adapted to Gaia. A mixed implementation is proposed which deals with the important data flow and the hard real-time constraints in hardware (FPGA) and entrusts more complex or variable processing to software. This segmentation also corresponds to subdividing the previous operations in pixel-based and object-based domains. Our hardware and software demonstrators show that the scientific specifications can be met, as regards completeness, precision and robustness while, technically speaking, our pipeline, optimised for area and power consumption, allows for selecting target components. Gaia's prime contractor, inspired by these developments, has also elected a mixed architecture, so that our R&D has proven relevant for the forthcoming generation of satellites.

  3. Rapid methods: the detection of foodborne pathogens

    NARCIS (Netherlands)

    Beumer, R.R.; Hazeleger, W.C.

    2009-01-01

    Although bacteria are the first type of microorganisms that come to mind when discussing microbial food safety, they are by no means the only pathogenic foodborne microorganisms. Mycotoxin producing moulds, human enteric viruses, protozoan parasites and marine biotoxins are also of importance.

  4. Recent developments in pathogen detection arrays: implications for fungal plant pathogens and use in practica

    NARCIS (Netherlands)

    Lievens, B.; Thomma, B.P.H.J.

    2005-01-01

    The failure to adequately identify plant pathogens from culture-based morphological techniques has led to the development of culture-independent molecular approaches. Increasingly, diagnostic laboratories are pursuing fast routine methods that provide reliable identification, sensitive detection,

  5. Detection of mastitis pathogens by analysis of volatile bacterial metabolites

    NARCIS (Netherlands)

    Hettinga, K.A.; Valenberg, van H.J.F.; Lam, T.J.G.M.; Hooijdonk, van A.C.M.

    2008-01-01

    The ability to detect mastitis pathogens based on their volatile metabolites was studied. Milk samples from cows with clinical mastitis, caused by Staphylococcus aureus, coagulase-negative staphylococci, Streptococcus uberis, Streptococcus dysgalactiae, and Escherichia coli were collected. In

  6. A Review of Membrane-Based Biosensors for Pathogen Detection.

    Science.gov (United States)

    van den Hurk, Remko; Evoy, Stephane

    2015-06-15

    Biosensors are of increasing interest for the detection of bacterial pathogens in many applications such as human, animal and plant health, as well as food and water safety. Membranes and membrane-like structures have been integral part of several pathogen detection platforms. Such structures may serve as simple mechanical support, function as a part of the transduction mechanism, may be used to filter out or concentrate pathogens, and may be engineered to specifically house active proteins. This review focuses on membrane materials, their associated biosensing applications, chemical linking procedures, and transduction mechanisms. The sensitivity of membrane biosensors is discussed, and the state of the field is evaluated and summarized.

  7. Resequencing Pathogen Microarray (RPM) for prospective detection and identification of emergent pathogen strains and variants

    Science.gov (United States)

    Tibbetts, Clark; Lichanska, Agnieszka M.; Borsuk, Lisa A.; Weslowski, Brian; Morris, Leah M.; Lorence, Matthew C.; Schafer, Klaus O.; Campos, Joseph; Sene, Mohamadou; Myers, Christopher A.; Faix, Dennis; Blair, Patrick J.; Brown, Jason; Metzgar, David

    2010-04-01

    High-density resequencing microarrays support simultaneous detection and identification of multiple viral and bacterial pathogens. Because detection and identification using RPM is based upon multiple specimen-specific target pathogen gene sequences generated in the individual test, the test results enable both a differential diagnostic analysis and epidemiological tracking of detected pathogen strains and variants from one specimen to the next. The RPM assay enables detection and identification of pathogen sequences that share as little as 80% sequence similarity to prototype target gene sequences represented as detector tiles on the array. This capability enables the RPM to detect and identify previously unknown strains and variants of a detected pathogen, as in sentinel cases associated with an infectious disease outbreak. We illustrate this capability using assay results from testing influenza A virus vaccines configured with strains that were first defined years after the design of the RPM microarray. Results are also presented from RPM-Flu testing of three specimens independently confirmed to the positive for the 2009 Novel H1N1 outbreak strain of influenza virus.

  8. PathogenMIPer: a tool for the design of molecular inversion probes to detect multiple pathogens

    Directory of Open Access Journals (Sweden)

    Akhras Michael

    2006-11-01

    Full Text Available Abstract Background Here we describe PathogenMIPer, a software program for designing molecular inversion probe (MIP oligonucleotides for use in pathogen identification and detection. The software designs unique and specific oligonucleotide probes targeting microbial or other genomes. The tool tailors all probe sequence components (including target-specific sequences, barcode sequences, universal primers and restriction sites and combines these components into ready-to-order probes for use in a MIP assay. The system can harness the genetic variability available in an entire genome in designing specific probes for the detection of multiple co-infections in a single tube using a MIP assay. Results PathogenMIPer can accept sequence data in FASTA file format, and other parameter inputs from the user through a graphical user interface. It can design MIPs not only for pathogens, but for any genome for use in parallel genomic analyses. The software was validated experimentally by applying it to the detection of human papilloma virus (HPV as a model system, which is associated with various human malignancies including cervical and skin cancers. Initial tests of laboratory samples using the MIPs developed by the PathogenMIPer to recognize 24 different types of HPVs gave very promising results, detecting even a small viral load of single as well as multiple infections (Akhras et al, personal communication. Conclusion PathogenMIPer is a software for designing molecular inversion probes for detection of multiple target DNAs in a sample using MIP assays. It enables broader use of MIP technology in the detection through genotyping of pathogens that are complex, difficult-to-amplify, or present in multiple subtypes in a sample.

  9. Nano/Micro and Spectroscopic Approaches to Food Pathogen Detection

    Science.gov (United States)

    Cho, Il-Hoon; Radadia, Adarsh D.; Farrokhzad, Khashayar; Ximenes, Eduardo; Bae, Euiwon; Singh, Atul K.; Oliver, Haley; Ladisch, Michael; Bhunia, Arun; Applegate, Bruce; Mauer, Lisa; Bashir, Rashid; Irudayaraj, Joseph

    2014-06-01

    Despite continuing research efforts, timely and simple pathogen detection with a high degree of sensitivity and specificity remains an elusive goal. Given the recent explosion of sensor technologies, significant strides have been made in addressing the various nuances of this important global challenge that affects not only the food industry but also human health. In this review, we provide a summary of the various ongoing efforts in pathogen detection and sample preparation in areas related to Fourier transform infrared and Raman spectroscopy, light scattering, phage display, micro/nanodevices, and nanoparticle biosensors. We also discuss the advantages and potential limitations of the detection methods and suggest next steps for further consideration.

  10. Rapid Detection, Characterization, and Enumeration of Foodborne Pathogens

    DEFF Research Database (Denmark)

    This book provides a new focus on the rapid detection of food–borne pathogens, employing food production chains as a starting point instead of a specific method or various detection technologies. This reference is organized by production chains or contamination scenarios, and offers a unique...

  11. Waveguide-Based Biosensors for Pathogen Detection

    Directory of Open Access Journals (Sweden)

    Nile Hartman

    2009-07-01

    Full Text Available Optical phenomena such as fluorescence, phosphorescence, polarization, interference and non-linearity have been extensively used for biosensing applications. Optical waveguides (both planar and fiber-optic are comprised of a material with high permittivity/high refractive index surrounded on all sides by materials with lower refractive indices, such as a substrate and the media to be sensed. This arrangement allows coupled light to propagate through the high refractive index waveguide by total internal reflection and generates an electromagnetic wave—the evanescent field—whose amplitude decreases exponentially as the distance from the surface increases. Excitation of fluorophores within the evanescent wave allows for sensitive detection while minimizing background fluorescence from complex, “dirty” biological samples. In this review, we will describe the basic principles, advantages and disadvantages of planar optical waveguide-based biodetection technologies. This discussion will include already commercialized technologies (e.g., Corning’s EPIC® Ô, SRU Biosystems’ BIND™, Zeptosense®, etc. and new technologies that are under research and development. We will also review differing assay approaches for the detection of various biomolecules, as well as the thin-film coatings that are often required for waveguide functionalization and effective detection. Finally, we will discuss reverse-symmetry waveguides, resonant waveguide grating sensors and metal-clad leaky waveguides as alternative signal transducers in optical biosensing.

  12. Methods for detecting pathogens in the beef food chain: detecting particular pathogens

    Science.gov (United States)

    The main food-borne pathogens of concern in the beef food chain are Shiga toxin-producing Escherichia coli (STEC) and Salmonella spp.; however, the presence of other pathogens, including Listeria monocytogenes, Campylobacter spp., Clostridium spp., Bacillus cereus, and Mycobacterium avium subsp. par...

  13. Advances and Challenges in Viability Detection of Foodborne Pathogens

    Directory of Open Access Journals (Sweden)

    Dexin Zeng

    2016-11-01

    Full Text Available Foodborne outbreaks are a serious public health and food safety concern worldwide. There is a great demand for rapid, sensitive, specific, and accurate methods to detect microbial pathogens in foods. Conventional methods based on cultivation of pathogens have been the gold standard protocols; however, they take up to a week to complete. Molecular assays such as polymerase chain reaction (PCR, sequencing, microarray technologies have been widely used in detection of foodborne pathogens. Among molecular assays, PCR technology conventional and real-time PCR (qPCR is most commonly used in the foodborne pathogen detection because of its high sensitivity and specificity. However, a major drawback of PCR is its inability to differentiate the DNA from dead and viable cells, and this is a critical factor for the food industry, regulatory agencies and the consumer. To remedy this shortcoming, researchers have used biological dyes such as ethidium monoazide (EMA and propidium monoazide (PMA to pretreat samples before DNA extraction to intercalate the DNA of dead cells in food samples, and then proceed with regular DNA preparation and qPCR. By combining PMA treatment with qPCR (PMA-qPCR, scientists have applied this technology to detect viable cells of various bacterial pathogens in foods. The incorporation of PMA into PCR-based assays for viability detection of pathogens in foods has increased significantly in the last decade. On the other hand, some downsides with this approach have been noted, particularly to achieve complete suppression of signal of DNA from the dead cells present in some particular food matrix. Nowadays, there is a tendency of more and more researchers adapting this approach for viability detection; and a few commercial kits based on PMA are available in the market. As time goes on, more scientists apply this approach to a broader range of pathogen detections, this viability approach (PMA or other chemicals such as platinum compound

  14. Advances and Challenges in Viability Detection of Foodborne Pathogens.

    Science.gov (United States)

    Zeng, Dexin; Chen, Zi; Jiang, Yuan; Xue, Feng; Li, Baoguang

    2016-01-01

    Foodborne outbreaks are a serious public health and food safety concern worldwide. There is a great demand for rapid, sensitive, specific, and accurate methods to detect microbial pathogens in foods. Conventional methods based on cultivation of pathogens have been the gold standard protocols; however, they take up to a week to complete. Molecular assays such as polymerase chain reaction (PCR), sequencing, microarray technologies have been widely used in detection of foodborne pathogens. Among molecular assays, PCR technology [conventional and real-time PCR (qPCR)] is most commonly used in the foodborne pathogen detection because of its high sensitivity and specificity. However, a major drawback of PCR is its inability to differentiate the DNA from dead and viable cells, and this is a critical factor for the food industry, regulatory agencies and the consumer. To remedy this shortcoming, researchers have used biological dyes such as ethidium monoazide and propidium monoazide (PMA) to pretreat samples before DNA extraction to intercalate the DNA of dead cells in food samples, and then proceed with regular DNA preparation and qPCR. By combining PMA treatment with qPCR (PMA-qPCR), scientists have applied this technology to detect viable cells of various bacterial pathogens in foods. The incorporation of PMA into PCR-based assays for viability detection of pathogens in foods has increased significantly in the last decade. On the other hand, some downsides with this approach have been noted, particularly to achieve complete suppression of signal of DNA from the dead cells present in some particular food matrix. Nowadays, there is a tendency of more and more researchers adapting this approach for viability detection; and a few commercial kits based on PMA are available in the market. As time goes on, more scientists apply this approach to a broader range of pathogen detections, this viability approach (PMA or other chemicals such as platinum compound) may eventually

  15. Recent progress in developing proximity ligation assays for pathogen detection.

    Science.gov (United States)

    Greenwood, Christina; Johnson, Gemma; Dhillon, Harvinder S; Bustin, Stephen

    2015-01-01

    The effective management of infectious diseases depends on the early detection of the microbes responsible, since pathogens are most effectively eliminated in the initial stages of infection. Current immunodiagnostic methods lack the sensitivity for earliest possible diagnosis. Nucleic acid-based tests (NATs) are more sensitive, but the detection of microbial DNA does not definitively prove the presence of a viable microorganism capable of causing a given infection. Proximity assays combine the specificity of antibody-based detection of proteins with the sensitivity and dynamic range of NATs, and their use may allow earlier as well as more clinically relevant detection than is possible with current NATs or immunoassays. However, the full potential of proximity assays for pathogen detection remains to be fulfilled, mainly due to the challenges associated with identifying suitable antibodies and antibody combinations, sensitivity issues arising from non-specific interactions of proximity probes and the longer incubation times required to carry out the assays.

  16. More Pathogenicity or Just More Pathogens?—On the Interpretation Problem of Multiple Pathogen Detections with Diagnostic Multiplex Assays

    Directory of Open Access Journals (Sweden)

    Andreas E. Zautner

    2017-06-01

    Full Text Available Modern molecular diagnostic approaches in the diagnostic microbiological laboratory like real-time quantitative polymerase chain reaction (qPCR have led to a considerable increase of diagnostic sensitivity. They usually outperform the diagnostic sensitivity of culture-based approaches. Culture-based diagnostics were found to be insufficiently sensitive for the assessment of the composition of biofilms in chronic wounds and poorly standardized for screenings for enteric colonization with multi-drug resistant bacteria. However, the increased sensitivity of qPCR causes interpretative challenges regarding the attribution of etiological relevance to individual pathogen species in case of multiple detections of facultative pathogenic microorganisms in primarily non-sterile sample materials. This is particularly the case in high-endemicity settings, where continuous exposition to respective microorganisms leads to immunological adaptation and semi-resistance while considerable disease would result in case of exposition of a non-adapted population. While biofilms in chronic wounds show higher pathogenic potential in case of multi-species composition, detection of multiple pathogens in respiratory samples is much more difficult to interpret and asymptomatic enteric colonization with facultative pathogenic microorganisms is frequently observed in high endemicity settings. For respiratory samples and stool samples, cycle-threshold-value-based semi-quantitative interpretation of qPCR results has been suggested. Etiological relevance is assumed if cycle-threshold values are low, suggesting high pathogen loads. Although the procedure is challenged by lacking standardization and methodical issues, first evaluations have led to promising results. Future studies should aim at generally acceptable quantitative cut-off values to allow discrimination of asymptomatic colonization from clinically relevant infection.

  17. A new oligonucleotide microarray for detection of pathogenic and non-pathogenic Legionella spp.

    Directory of Open Access Journals (Sweden)

    Boyang Cao

    Full Text Available Legionella pneumophila has been recognized as the major cause of legionellosis since the discovery of the deadly disease. Legionella spp. other than L. pneumophila were later found to be responsible to many non-pneumophila infections. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this report, we have sequenced the 16S-23S rRNA gene internal transcribed spacer (ITS of 10 Legionella species and subspecies, including L. anisa, L. bozemanii, L. dumoffii, L. fairfieldensis, L. gormanii, L. jordanis, L. maceachernii, L. micdadei, L. pneumophila subspp. fraseri and L. pneumophila subspp. pasculleii, and developed a rapid oligonucleotide microarray detection technique accordingly to identify 12 most common Legionella spp., which consist of 11 pathogenic species of L. anisa, L. bozemanii, L. dumoffii, L. gormanii, L. jordanis, L. longbeachae, L. maceachernii, L. micdadei, and L. pneumophila (including subspp. pneumophila, subspp. fraseri, and subspp. pasculleii and one non-pathogenic species, L. fairfieldensis. Twenty-nine probes that reproducibly detected multiple Legionella species with high specificity were included in the array. A total of 52 strains, including 30 target pathogens and 22 non-target bacteria, were used to verify the oligonucleotide microarray assay. The sensitivity of the detection was at 1.0 ng with genomic DNA or 13 CFU/100 mL with Legionella cultures. The microarray detected seven samples of air conditioner-condensed water with 100% accuracy, validating the technique as a promising method for applications in basic microbiology, clinical diagnosis, food safety, and epidemiological surveillance. The phylogenetic study based on the ITS has also revealed that the non-pathogenic L. fairfieldensis is the closest to L. pneumophila than the nine other pathogenic Legionella spp.

  18. DNA microarray technique for detecting food-borne pathogens

    Directory of Open Access Journals (Sweden)

    Xing GAO

    2012-08-01

    Full Text Available Objective To study the application of DNA microarray technique for screening and identifying multiple food-borne pathogens. Methods The oligonucleotide probes were designed by Clustal X and Oligo 6.0 at the conserved regions of specific genes of multiple food-borne pathogens, and then were validated by bioinformatic analyses. The 5' end of each probe was modified by amino-group and 10 Poly-T, and the optimized probes were synthesized and spotted on aldehyde-coated slides. The bacteria DNA template incubated with Klenow enzyme was amplified by arbitrarily primed PCR, and PCR products incorporated into Aminoallyl-dUTP were coupled with fluorescent dye. After hybridization of the purified PCR products with DNA microarray, the hybridization image and fluorescence intensity analysis was acquired by ScanArray and GenePix Pro 5.1 software. A series of detection conditions such as arbitrarily primed PCR and microarray hybridization were optimized. The specificity of this approach was evaluated by 16 different bacteria DNA, and the sensitivity and reproducibility were verified by 4 food-borne pathogens DNA. The samples of multiple bacteria DNA and simulated water samples of Shigella dysenteriae were detected. Results Nine different food-borne bacteria were successfully discriminated under the same condition. The sensitivity of genomic DNA was 102 -103pg/ μl, and the coefficient of variation (CV of the reproducibility of assay was less than 15%. The corresponding specific hybridization maps of the multiple bacteria DNA samples were obtained, and the detection limit of simulated water sample of Shigella dysenteriae was 3.54×105cfu/ml. Conclusions The DNA microarray detection system based on arbitrarily primed PCR can be employed for effective detection of multiple food-borne pathogens, and this assay may offer a new method for high-throughput platform for detecting bacteria.

  19. Autonomous Gait Event Detection with Portable Single-Camera Gait Kinematics Analysis System

    Directory of Open Access Journals (Sweden)

    Cheng Yang

    2016-01-01

    Full Text Available Laboratory-based nonwearable motion analysis systems have significantly advanced with robust objective measurement of the limb motion, resulting in quantified, standardized, and reliable outcome measures compared with traditional, semisubjective, observational gait analysis. However, the requirement for large laboratory space and operational expertise makes these systems impractical for gait analysis at local clinics and homes. In this paper, we focus on autonomous gait event detection with our bespoke, relatively inexpensive, and portable, single-camera gait kinematics analysis system. Our proposed system includes video acquisition with camera calibration, Kalman filter + Structural-Similarity-based marker tracking, autonomous knee angle calculation, video-frame-identification-based autonomous gait event detection, and result visualization. The only operational effort required is the marker-template selection for tracking initialization, aided by an easy-to-use graphic user interface. The knee angle validation on 10 stroke patients and 5 healthy volunteers against a gold standard optical motion analysis system indicates very good agreement. The autonomous gait event detection shows high detection rates for all gait events. Experimental results demonstrate that the proposed system can automatically measure the knee angle and detect gait events with good accuracy and thus offer an alternative, cost-effective, and convenient solution for clinical gait kinematics analysis.

  20. Conventional and molecular methods to detect bacterial pathogens in mussels.

    Science.gov (United States)

    Gugliandolo, C; Lentini, V; Spanò, A; Maugeri, T L

    2011-01-01

    To detect Aeromonas spp., Salmonella spp., Vibrio cholerae, Vibrio parahaemolyticus and Vibrio vulnificus in mussels and water samples from a farming area, conventional and molecular methods were applied to enrichment cultures. The aerolysin gene (aero) of Aeromonas spp., the invasion plasmid antigen B (ipaB) gene of Salmonella spp., the enterotoxin secretion protein (epsM) gene of V. cholerae, the species-specific region of 16S rRNA gene of V. vulnificus, the 16S-23S rDNA (IGS) gene of V. parahaemolyticus and the pR72H fragment of V. parahaemolyticus were amplified by multiplex polymerase chain reaction (PCR) assays on DNA extracted from enrichment cultures. The haemolysin gene (tdh) of pathogenic V. parahaemolyticus was also amplified. Conventional culture method allowed the isolation of V. parahaemolyticus and V. vulnificus from water and mussels. The genes aero, epsM and 16S rRNA of V. vulnificus were occasionally detected in the enrichment cultures. In mussels, the ipaB and IGS genes were detected from June to September and from April to November, respectively. All genes, except aero, were amplified from mussels collected in September, when pathogenic V. parahaemolyticus (tdh+) strains were also isolated. Multiplex-PCR assays were more sensitive and faster than conventional procedures. The results emphasize the need of an accurate and rapid detection of bacterial pathogens in mussels to protect human health. © 2010 The Authors. Letters in Applied Microbiology © 2010 The Society for Applied Microbiology.

  1. Dominant object detection for autonomous vision-based surveillance

    NARCIS (Netherlands)

    Celik, H.

    2010-01-01

    The deployment of visual surveillance and monitoring systems has reached massive proportions. Consequently, a need to automate the processes involved in retrieving useful information from surveillance videos, such as detecting and counting objects, and interpreting their individual and joint

  2. Sample preparation and assay refinements for pathogen detection platforms

    Science.gov (United States)

    Lim, Daniel V.; Kearns, Elizabeth A.; Leskinen, Stephaney D.; Magaña, Sonia; Stroot, Joyce M.; Hunter, Dawn M.; Schlemmer, Sarah M.

    2009-02-01

    Food-borne and waterborne microbial pathogens are a potential problem in biowarfare and public health. Such pathogens can affect the health, combat readiness, and effectiveness of the warfighter in a battlefield environment and present potential threats to the civilian population through intentional or natural contamination of food and water. Conventional procedures to detect and identify microbial pathogens in food, water, and other materials can take days to perform and may provide inconclusive information. Research at the University of South Florida's Advanced Biosensors Laboratory (ABL) focuses on development of sample processing procedures and biosensor-based assays for rapid detection of biothreat agents. Rapid processing methods, including use of an automated concentrator of microorganisms in water, have been developed for complex matrix samples including ground beef, apple juice, produce, potable water and recreational water, enabling such samples to be directly tested by biosensor assays for target analytes. Bacillus atrophaeus spores and other bacteria can be concentrated from potable and recreational water at low levels with a dead-end hollow-fiber ultrafiltration concentration system. Target bacteria recovered by these processing procedures can be identified by evanescent wave, fiber optic biosensors or other detection platforms. Fiber optic biosensor assays have been improved to include subsequent PCR analysis and viability determination of captured target bacteria using broth enrichment and/or ATP luminescence.

  3. Autonomous acoustic/seismic networks for intrusion detection and assessment

    International Nuclear Information System (INIS)

    Swanson, D.C.; Kurtz, P.H.

    1995-01-01

    Passive acoustic and seismic sensors have the unique capability for inexpensive non-line-of-sight (NLOS) detection and identification of vehicle movements as well as human and machine activity. By networking multiple sensor sites, one can use on-site processing to minimize internode communications for data fusion to localize the target of interest. Since all acoustic and seismic sources have characteristic directivity responses to their respective noise signatures, the network also offers the ability to observe and identify these characteristics. However, in many perimeter defense situations, a simple detection is all that's really needed. Therefore, the intelligent sensor processing goal is to reduce the false alarm rate in the presence of significant changes in background noise and the environment. The authors have developed a generic hardware platform for acoustic/seismic detection and environmental characterization. They have also developed adaptive models for predicting target detectability in a dynamic environment for performance prediction of the sensor networks. Initial performance tests of the hardware are very encouraging and the authors expect acoustic/seismic sensor networks and the environmental models to have a wide variety uses in surveillance and intrusion detection

  4. MODNet: Moving Object Detection Network with Motion and Appearance for Autonomous Driving

    OpenAIRE

    Siam, Mennatullah; Mahgoub, Heba; Zahran, Mohamed; Yogamani, Senthil; Jagersand, Martin; El-Sallab, Ahmad

    2017-01-01

    We propose a novel multi-task learning system that combines appearance and motion cues for a better semantic reasoning of the environment. A unified architecture for joint vehicle detection and motion segmentation is introduced. In this architecture, a two-stream encoder is shared among both tasks. In order to evaluate our method in autonomous driving setting, KITTI annotated sequences with detection and odometry ground truth are used to automatically generate static/dynamic annotations on th...

  5. Vehicle Detection for RCTA/ANS (Autonomous Navigation System)

    Science.gov (United States)

    Brennan, Shane; Bajracharya, Max; Matthies, Larry H.; Howard, Andrew B.

    2012-01-01

    Using a stereo camera pair, imagery is acquired and processed through the JPLV stereo processing pipeline. From this stereo data, large 3D blobs are found. These blobs are then described and classified by their shape to determine which are vehicles and which are not. Prior vehicle detection algorithms are either targeted to specific domains, such as following lead cars, or are intensity- based methods that involve learning typical vehicle appearances from a large corpus of training data. In order to detect vehicles, the JPL Vehicle Detection (JVD) algorithm goes through the following steps: 1. Take as input a left disparity image and left rectified image from JPLV stereo. 2. Project the disparity data onto a two-dimensional Cartesian map. 3. Perform some post-processing of the map built in the previous step in order to clean it up. 4. Take the processed map and find peaks. For each peak, grow it out into a map blob. These map blobs represent large, roughly vehicle-sized objects in the scene. 5. Take these map blobs and reject those that do not meet certain criteria. Build descriptors for the ones that remain. Pass these descriptors onto a classifier, which determines if the blob is a vehicle or not. The probability of detection is the probability that if a vehicle is present in the image, is visible, and un-occluded, then it will be detected by the JVD algorithm. In order to estimate this probability, eight sequences were ground-truthed from the RCTA (Robotics Collaborative Technology Alliances) program, totaling over 4,000 frames with 15 unique vehicles. Since these vehicles were observed at varying ranges, one is able to find the probability of detection as a function of range. At the time of this reporting, the JVD algorithm was tuned to perform best at cars seen from the front, rear, or either side, and perform poorly on vehicles seen from oblique angles.

  6. Magnetic Bead Based Immunoassay for Autonomous Detection of Toxins

    Energy Technology Data Exchange (ETDEWEB)

    Kwon, Y; Hara, C A; Knize, M G; Hwang, M H; Venkatesteswaran, K S; Wheeler, E K; Bell, P M; Renzi, R F; Fruetel, J A; Bailey, C G

    2008-05-01

    As a step towards toward the development of a rapid, reliable analyzer for bioagents in the environment, we are developing an automated system for the simultaneous detection of a group of select agents and toxins. To detect toxins, we modified and automated an antibody-based approach previously developed for manual medical diagnostics that uses fluorescent eTag{trademark} reporter molecules and is suitable for highly multiplexed assays. Detection is based on two antibodies binding simultaneously to a single antigen, one of which is labeled with biotin while the other is conjugated to a fluorescent eTag{trademark} through a cleavable linkage. Aqueous samples are incubated with the mixture of antibodies along with streptavidin-coated magnetic beads coupled to a photo-activatable porphyrin complex. In the presence of antigen, a molecular complex is formed where the cleavable linkage is held in proximity to the photoactivable group. Upon excitation at 680 nm, free radicals are generated, which diffuse and cleave the linkage, releasing the eTags{trademark}. Released eTags{trademark} are analyzed using capillary gel electrophoresis with laser-induced fluorescence detection. Limits of detection for ovalbumin and botulinum toxoid individually were 4 ng/mL (or 80 pg) and 16 ng/mL (or 320 pg), respectively, using the manual assay. In addition, we demonstrated the use of pairs of antibodies from different sources in a single assay to decrease the rate of false positives. Automation of the assay was demonstrated on a flow-through format with higher LODs of 125 ng/mL (or 2.5 ng) each of a mixture of ovalbumin and botulinum toxoid. This versatile assay can be easily modified with the appropriate antibodies to detect a wide range of toxins and other proteins.

  7. Rapid detection, characterization, and enumeration of foodborne pathogens.

    Science.gov (United States)

    Hoorfar, J

    2011-11-01

    As food safety management further develops, microbiological testing will continue to play an important role in assessing whether Food Safety Objectives are achieved. However, traditional microbiological culture-based methods are limited, particularly in their ability to provide timely data. The present review discusses the reasons for the increasing interest in rapid methods, current developments in the field, the research needs, and the future trends. The advent of biotechnology has introduced new technologies that led to the emergence of rapid diagnostic methods and altered food testing practices. Rapid methods are comprised of many different detection technologies, including specialized enzyme substrates, antibodies and DNA, ranging from simple differential plating media to the use of sophisticated instruments. The use of non-invasive sampling techniques for live animals especially came into focus with the 1990s outbreak of bovine spongiform encephalopathy that was linked to the human outbreak of Creutzfeldt Jakob's Disease. Serology is still an important tool in preventing foodborne pathogens to enter the human food supply through meat and milk from animals. One of the primary uses of rapid methods is for fast screening of large number of samples, where most of them are expected to be test-negative, leading to faster product release for sale. This has been the main strength of rapid methods such as real-time Polymerase Chain Reaction (PCR). Enrichment PCR, where a primary culture broth is tested in PCR, is the most common approach in rapid testing. Recent reports show that it is possible both to enrich a sample and enumerate by pathogen-specific real-time PCR, if the enrichment time is short. This can be especially useful in situations where food producers ask for the level of pathogen in a contaminated product. Another key issue is automation, where the key drivers are miniaturization and multiple testing, which mean that not only one instrument is flexible

  8. Daytime Water Detection by Fusing Multiple Cues for Autonomous Off-Road Navigation

    Science.gov (United States)

    Rankin, A. L.; Matthies, L. H.; Huertas, A.

    2004-01-01

    Detecting water hazards is a significant challenge to unmanned ground vehicle autonomous off-road navigation. This paper focuses on detecting the presence of water during the daytime using color cameras. A multi-cue approach is taken. Evidence of the presence of water is generated from color, texture, and the detection of reflections in stereo range data. A rule base for fusing water cues was developed by evaluating detection results from an extensive archive of data collection imagery containing water. This software has been implemented into a run-time passive perception subsystem and tested thus far under Linux on a Pentium based processor.

  9. Actual Pathogen Detection: Sensors and Algorithms - a Review

    Directory of Open Access Journals (Sweden)

    Federico Hahn

    2009-03-01

    Full Text Available Pathogens feed on fruits and vegetables causing great food losses or at least reduction of their shelf life. These pathogens can cause losses of the final product or in the farms were the products are grown, attacking leaves, stems and trees. This review analyses disease detection sensors and algorithms for both the farm and postharvest management of fruit and vegetable quality. Mango, avocado, apple, tomato, potato, citrus and grapes were selected as the fruits and vegetables for study due to their world-wide consumption. Disease warning systems for predicting pathogens and insects on farms during fruit and vegetable production are commonly used for all the crops and are available where meteorological stations are present. It can be seen that these disease risk systems are being slowly replaced by remote sensing monitoring in developed countries. Satellite images have reduced their temporal resolution, but are expensive and must become cheaper for their use world-wide. In the last 30 years, a lot of research has been carried out in non-destructive sensors for food quality. Actually, non-destructive technology has been applied for sorting high quality fruit which is desired by the consumer. The sensors require algorithms to work properly; the most used being discriminant analysis and training neural networks. New algorithms will be required due to the high quantity of data acquired and its processing, and for disease warning strategies for disease detection.

  10. LABRADOR: a learning autonomous behavior-based robot for adaptive detection and object retrieval

    Science.gov (United States)

    Yamauchi, Brian; Moseley, Mark; Brookshire, Jonathan

    2013-01-01

    As part of the TARDEC-funded CANINE (Cooperative Autonomous Navigation in a Networked Environment) Program, iRobot developed LABRADOR (Learning Autonomous Behavior-based Robot for Adaptive Detection and Object Retrieval). LABRADOR was based on the rugged, man-portable, iRobot PackBot unmanned ground vehicle (UGV) equipped with an explosives ordnance disposal (EOD) manipulator arm and a custom gripper. For LABRADOR, we developed a vision-based object learning and recognition system that combined a TLD (track-learn-detect) filter based on object shape features with a color-histogram-based object detector. Our vision system was able to learn in real-time to recognize objects presented to the robot. We also implemented a waypoint navigation system based on fused GPS, IMU (inertial measurement unit), and odometry data. We used this navigation capability to implement autonomous behaviors capable of searching a specified area using a variety of robust coverage strategies - including outward spiral, random bounce, random waypoint, and perimeter following behaviors. While the full system was not integrated in time to compete in the CANINE competition event, we developed useful perception, navigation, and behavior capabilities that may be applied to future autonomous robot systems.

  11. Integrated Detection of Pathogens and Host Biomarkers for Wounds

    Energy Technology Data Exchange (ETDEWEB)

    Jaing, C

    2012-03-19

    The increasing incidence and complications arising from combat wounds has necessitated a reassessment of methods for effective treatment. Infection, excessive inflammation, and incidence of drug-resistant organisms all contribute toward negative outcomes for afflicted individuals. The organisms and host processes involved in wound progression, however, are incompletely understood. We therefore set out, using our unique technical resources, to construct a profile of combat wounds which did or did not successfully resolve. We employed the Lawrence Livermore Microbial Detection Array and identified a number of nosocomial pathogens present in wound samples. Some of these identities corresponded with bacterial isolates previously cultured, while others were not obtained via standard microbiology. Further, we optimized proteomics protocols for the identification of host biomarkers indicative of various stages in wound progression. In combination with our pathogen data, our biomarker discovery efforts will provide a profile corresponding to wound complications, and will assist significantly in treatment of these complex cases.

  12. Autonomous detection of ISO fade point with color laser printers

    Science.gov (United States)

    Yan, Ni; Maggard, Eric; Fothergill, Roberta; Jessome, Renee J.; Allebach, Jan P.

    2015-01-01

    Image quality assessment is a very important field in image processing. Human observation is slow and subjective, it also requires strict environment setup for the psychological test 1. Thus developing algorithms to match desired human experiments is always in need. Many studies have focused on detecting the fading phenomenon after the materials are printed, that is to monitor the persistence of the color ink 2-4. However, fading is also a common artifact produced by printing systems when the cartridges run low. We want to develop an automatic system to monitor cartridge life and report fading defects when they appear. In this paper, we first describe a psychological experiment that studies the human perspective on printed fading pages. Then we propose an algorithm based on Color Space Projection and K-means clustering to predict the visibility of fading defects. At last, we integrate the psychological experiment result with our algorithm to give a machine learning tool that monitors cartridge life.

  13. The COMRADE System for Multirobot Autonomous Landmine Detection in Postconflict Regions

    Directory of Open Access Journals (Sweden)

    Prithviraj Dasgupta

    2015-01-01

    Full Text Available We consider the problem of autonomous landmine detection using a team of mobile robots. Previous research on robotic landmine detection mostly employs a single robot equipped with a landmine detection sensor to detect landmines. We envisage that the quality of landmine detection can be significantly improved if multiple robots are coordinated to detect landmines in a cooperative manner by incrementally fusing the landmine-related sensor information they collect and then use that information to visit locations of potential landmines. Towards this objective, we describe a multirobot system called COMRADES to address different aspects of the autonomous landmine detection problem including distributed area coverage to detect and locate landmines, information aggregation to fuse the sensor information obtained by different robots, and multirobot task allocation (MRTA to enable different robots to determine a suitable sequence to visit locations of potential landmines while reducing the time required and battery expended. We have used commercially available all-terrain robots called Coroware Explorer that are customized with a metal detector to detect metallic objects including landmines, as well as indoor Corobot robots, both in simulation and in physical experiments, to test the different techniques in COMRADES.

  14. Comparison of Different Methods of Detection of Enteric Pathogenic Protozoa

    Directory of Open Access Journals (Sweden)

    N H Ahmed

    2013-01-01

    Full Text Available Purpose: The study was conducted to compare different methods of detection of pathogenic protozoan parasites in stool specimens of People Living with HIV/AIDS (PLHA. Materials and Methods: Stool specimens of 242 HIV sero-positive patients were examined using the wet mount technique, modified Ziehl-Neelsen′s (ZN staining, auto-fluorescence and auramine fluorescence staining. Patient specimens, 94 and 40 out of 242, were also subjected to Giardia antigen detection using an enzyme immunoassay and Cryptosporidium antigen detection by immuno-chromatography, respectively. For calculation of sensitivity, specificity, positive and negative predictive values, light microscopy of wet mounts and modified ZN stained smears for Giardia and Coccidia, respectively, were considered as gold standards. Results: Sensitivity of auto-fluorescence, auramine-O staining and antigen detection techniques was found to be 100% as compared to the routine standards. The specificity of auto-fluorescence was 90.6% and 100% for Cyclospora and Isospora, respectively; that of auramine-O staining was 98.9% for Cryptosporidium, 99.30% for Cyclospora and 100% for Isospora; and that of antigen detection was 90.6% and 97.7% for Cryptosporidium and Giardia, respectively. Conclusion: In laboratories requiring screening of large number of stool specimens for detection of protozoan parasites, fluorescence microscopy and antigen detection can be useful techniques. Confirmation of positive results, however, needs to be done with the standard techniques.

  15. Rapid Detection and Characterization of Emerging Foreign Animal Disease Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Jaing, C. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2016-11-18

    To best safeguard human and animal health requires early detection and characterization of disease events. This must include effective surveillance for emerging infectious diseases. Both deliberate and natural outbreaks have enormous economic and public health impacts, and can present serious threats to national security. In this project, we developed novel next generation detection technologies to protect the agricultural economy and biosecurity. The first technology is a multiplexed assay to simultaneously detection 10 swine viral and bacterial pathogens. The second one is the Lawrence Livermore Microbial Detection Array (LLMDA) which can detect more than 10,000 microbial species including 4219 viruses, 5367 bacteria, 265 fungi, 117 protozoa and 293 archaea. We analyzed a series of swine clinical samples from past disease events to demonstrate the utility of the assays for faster and cheaper detection of emerging and foreign animal disease pathogens, and their utility as s routine diagnosis and surveillance tool. A second goal of the study is to better understand mechanisms of African swine fever virus (ASFV) infection in pigs to aid the development of countermeasures and diagnostics. There is no vaccine available for ASF. ASF outbreak is on the rise on several European countries. Though ASF is not currently in the U.S., a potential outbreak in the U.S. would be detrimental to the swine industry and the US agricultural economy. We pursued a genome-wide approach to characterize the pig immune responses after ASFV infection. We used RNA sequencing and bioinformatics methods to identify genes and pathways that are affected during ASF infection. We have identified a list of most differentially expressed genes that are in the immune response pathways.

  16. Developments in Micro- and Nanotechnology for Foodborne Pathogen Detection.

    Science.gov (United States)

    Carlson, Krista; Misra, Manoranjan; Mohanty, Swomitra

    2018-01-01

    In response to the potential hazards associated with the globalization of the food industry, research has been focused on the development of new sensing techniques to provide the means of contamination detection at any stage in the food supply chain. The demand for on-site detection is growing as pre-emptive sensing of pathogens could eliminate foodborne-related outbreaks and associated healthcare costs. Reduction in food waste is also a driver for point-of-use (POU) sensing, from both an economic and environmental standpoint. The following review discusses the latest advancements in platforms that have the greatest potential for inexpensive, real-time detection, and identification of foodborne pathogens. Specific focus has been placed on the development techniques, which utilize micro- and nanoscale technology. Sample preparation-free techniques are also discussed, as the growing demand to enable POU sensing at any stage in the food supply chain will be a major driver toward the advancements of these nondestructive methods.

  17. Autonomous robot for detecting subsurface voids and tunnels using microgravity

    Science.gov (United States)

    Wilson, Stacy S.; Crawford, Nicholas C.; Croft, Leigh Ann; Howard, Michael; Miller, Stephen; Rippy, Thomas

    2006-05-01

    Tunnels have been used to evade security of defensive positions both during times of war and peace for hundreds of years. Tunnels are presently being built under the Mexican Border by drug smugglers and possibly terrorists. Several have been discovered at the border crossing at Nogales near Tucson, Arizona, along with others at other border towns. During this war on terror, tunnels under the Mexican Border pose a significant threat for the security of the United States. It is also possible that terrorists will attempt to tunnel under strategic buildings and possibly discharge explosives. The Center for Cave and Karst Study (CCKS) at Western Kentucky University has a long and successful history of determining the location of caves and subsurface voids using microgravity technology. Currently, the CCKS is developing a remotely controlled robot which will be used to locate voids underground. The robot will be a remotely controlled vehicle that will use microgravity and GPS to accurately detect and measure voids below the surface. It is hoped that this robot will also be used in military applications to locate other types of voids underground such as tunnels and bunkers. It is anticipated that the robot will be able to function up to a mile from the operator. This paper will describe the construction of the robot and the use of microgravity technology to locate subsurface voids with the robot.

  18. Genome-Enhanced Detection and Identification (GEDI of plant pathogens

    Directory of Open Access Journals (Sweden)

    Nicolas Feau

    2018-02-01

    Full Text Available Plant diseases caused by fungi and Oomycetes represent worldwide threats to crops and forest ecosystems. Effective prevention and appropriate management of emerging diseases rely on rapid detection and identification of the causal pathogens. The increase in genomic resources makes it possible to generate novel genome-enhanced DNA detection assays that can exploit whole genomes to discover candidate genes for pathogen detection. A pipeline was developed to identify genome regions that discriminate taxa or groups of taxa and can be converted into PCR assays. The modular pipeline is comprised of four components: (1 selection and genome sequencing of phylogenetically related taxa, (2 identification of clusters of orthologous genes, (3 elimination of false positives by filtering, and (4 assay design. This pipeline was applied to some of the most important plant pathogens across three broad taxonomic groups: Phytophthoras (Stramenopiles, Oomycota, Dothideomycetes (Fungi, Ascomycota and Pucciniales (Fungi, Basidiomycota. Comparison of 73 fungal and Oomycete genomes led the discovery of 5,939 gene clusters that were unique to the targeted taxa and an additional 535 that were common at higher taxonomic levels. Approximately 28% of the 299 tested were converted into qPCR assays that met our set of specificity criteria. This work demonstrates that a genome-wide approach can efficiently identify multiple taxon-specific genome regions that can be converted into highly specific PCR assays. The possibility to easily obtain multiple alternative regions to design highly specific qPCR assays should be of great help in tackling challenging cases for which higher taxon-resolution is needed.

  19. Autonomous Gait Event Detection with Portable Single-Camera Gait Kinematics Analysis System

    OpenAIRE

    Yang, Cheng.; Ugbolue, Ukadike C..; Kerr, Andrew.; Stankovic, Vladimir.; Stankovic, Lina.; Carse, Bruce.; Kaliarntas, Konstantinos T..; Rowe, Philip J..

    2016-01-01

    Laboratory-based nonwearable motion analysis systems have significantly advanced with robust objective measurement of the limb motion, resulting in quantified, standardized, and reliable outcome measures compared with traditional, semisubjective, observational gait analysis. However, the requirement for large laboratory space and operational expertise makes these systems impractical for gait analysis at local clinics and homes. In this paper, we focus on autonomous gait event detection with o...

  20. Novel detection techniques for human pathogens that contaminate poultry.

    Science.gov (United States)

    Mandrell, R E; Wachtel, M R

    1999-06-01

    Poultry products are presumed to be a major contributor to human foodborne illness due to their high frequency of contamination with pathogens Salmonella spp. and Campylobacter spp. This has stimulated the development of more sensitive and rapid methods for identifying pathogens present in poultry. These new methods include immunomagnetic separation of pathogen, PCR amplification of pathogen-specific sequences, pathogen-specific DNA and RNA probes, and identification of pathogen-specific ions by mass spectrometry.

  1. Human pathogens in plant biofilms: Formation, physiology, and detection.

    Science.gov (United States)

    Ximenes, Eduardo; Hoagland, Lori; Ku, Seockmo; Li, Xuan; Ladisch, Michael

    2017-07-01

    Fresh produce, viewed as an essential part of a healthy life style is usually consumed in the form of raw or minimally processed fruits and vegetables, and is a potentially important source of food-borne human pathogenic bacteria and viruses. These are passed on to the consumer since the bacteria can form biofilms or otherwise populate plant tissues, thereby using plants as vectors to infect animal hosts. The life cycle of the bacteria in plants differs from those in animals or humans and results in altered physiochemical and biological properties (e.g., physiology, immunity, native microflora, physical barriers, mobility, and temperature). Mechanisms by which healthy plants may become contaminated by microorganisms, develop biofilms, and then pass on their pathogenic burden to people are explored in the context of hollow fiber microfiltration by which plant-derived microorganisms may be recovered and rapidly concentrated to facilitate study of their properties. Enzymes, when added to macerated plant tissues, hydrolyze or alter macromolecules that would otherwise foul hollow-fiber microfiltration membranes. Hence, microfiltration may be used to quickly increase the concentration of microorganisms to detectable levels. This review discusses microbial colonization of vegetables, formation and properties of biofilms, and how hollow fiber microfiltration may be used to concentrate microbial targets to detectable levels. The use of added enzymes helps to disintegrate biofilms and minimize hollow fiber membrane fouling, thereby providing a new tool for more time effectively elucidating mechanisms by which biofilms develop and plant tissue becomes contaminated with human pathogens. Biotechnol. Bioeng. 2017;114: 1403-1418. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  2. New quantitative detection of pathogens in heterogeneous environmental samples

    Science.gov (United States)

    Lee, Eun-Hee; Wang, Xiaofang; Mitchell, Kristi; Chae, Seon-Ha; Son, Ahjeong

    2015-04-01

    Quantum dots and magnetic beads based genomic assay (NanoGene assay) has been developed for sensitive and inhibition resistant gene quantification to achieve in-situ bacteria monitoring in environmental samples. In this study, eaeA gene of pathogenic E. coli O157:H7 was quantified. The result demonstrated the excellent sensitivity (i.e., limit of detection: 87 gene copies for dsDNA and 890 zeptomolar for ssDNA) in the presence of nonspecific microbial populations (Kim et al., 2010; 2011a). The feasibility of the developed gene quantification for non-laboratory environment usage (in-situ use) was investigated. Therefore, DNA hybridization was achieved at ambient temperature and minimum agitation, and the analysis was completed within hours. Most importantly, the NanoGene assay demonstrated the resistance to the presence of naturally occurring inhibitors (humic acids, cations) and residual reagents (surfactants, alcohols) from DNA extraction (Kim et al., 2011b). The assay was also applied to humic acids laden soils (7 types of soils with various amount of organic matters) and successfully quantified 105 to 108 CFU of E. coli O157:H7 per gram soil (R2 = 0.99). The results indicate that the presented NanoGene assay is suitable for further development as an in-situ bacteria monitoring method for working with heterogeneous environmental samples (Wang et al., 2013). Another aspect of the method is to transform the NanoGene assay into a portable device that can be used as a pathogenic bacteria detector in environment. The project consisted of the first inline fluidic components development and characterization as well as the first integration effort on a briefcase platform for the in-situ pathogen detection system (IPDS) (Mitchell et al., 2014). Our long term vision is to further miniaturize the briefcase platform implementation of the IPDS and to commercialize the handheld version of the IPDS.

  3. A review on detection methods used for foodborne pathogens

    Directory of Open Access Journals (Sweden)

    B Priyanka

    2016-01-01

    Full Text Available Foodborne pathogens have been a cause of a large number of diseases worldwide and more so in developing countries. This has a major economic impact. It is important to contain them, and to do so, early detection is very crucial. Detection and diagnostics relied on culture-based methods to begin with and have developed in the recent past parallel to the developments towards immunological methods such as enzyme-linked immunosorbent assays (ELISA and molecular biology-based methods such as polymerase chain reaction (PCR. The aim has always been to find a rapid, sensitive, specific and cost-effective method. Ranging from culturing of microbes to the futuristic biosensor technology, the methods have had this common goal. This review summarizes the recent trends and brings together methods that have been developed over the years.

  4. Real-time object detection and semantic segmentation for autonomous driving

    Science.gov (United States)

    Li, Baojun; Liu, Shun; Xu, Weichao; Qiu, Wei

    2018-02-01

    In this paper, we proposed a Highly Coupled Network (HCNet) for joint objection detection and semantic segmentation. It follows that our method is faster and performs better than the previous approaches whose decoder networks of different tasks are independent. Besides, we present multi-scale loss architecture to learn better representation for different scale objects, but without extra time in the inference phase. Experiment results show that our method achieves state-of-the-art results on the KITTI datasets. Moreover, it can run at 35 FPS on a GPU and thus is a practical solution to object detection and semantic segmentation for autonomous driving.

  5. A feature matching and fusion-based positive obstacle detection algorithm for field autonomous land vehicles

    Directory of Open Access Journals (Sweden)

    Tao Wu

    2017-03-01

    Full Text Available Positive obstacles will cause damage to field robotics during traveling in field. Field autonomous land vehicle is a typical field robotic. This article presents a feature matching and fusion-based algorithm to detect obstacles using LiDARs for field autonomous land vehicles. There are three main contributions: (1 A novel setup method of compact LiDAR is introduced. This method improved the LiDAR data density and reduced the blind region of the LiDAR sensor. (2 A mathematical model is deduced under this new setup method. The ideal scan line is generated by using the deduced mathematical model. (3 Based on the proposed mathematical model, a feature matching and fusion (FMAF-based algorithm is presented in this article, which is employed to detect obstacles. Experimental results show that the performance of the proposed algorithm is robust and stable, and the computing time is reduced by an order of two magnitudes by comparing with other exited algorithms. This algorithm has been perfectly applied to our autonomous land vehicle, which has won the champion in the challenge of Chinese “Overcome Danger 2014” ground unmanned vehicle.

  6. System for rapid detection of antibiotic resistance of airborne pathogens

    Science.gov (United States)

    Fortin, M.; Noiseux, I.; Mouslinkina, L.; Vernon, M. L.; Laflamme, C.; Filion, G.; Duchaine, C.; Ho, J.

    2009-05-01

    This project uses function-based detection via a fundamental understanding of the genetic markers of AR to distinguish harmful organisms from innocuous ones. This approach circumvents complex analyses to unravel the taxonomic details of 1399 pathogen species, enormously simplifying detection requirements. Laval Hospital's fast permeabilization strategy enables AR revelation in <1hr. Packaging the AR protocols in liquid-processing cartridges and coupling these to our in-house miniature fiber optic flow cell (FOFC) provides first responders with timely information on-site. INO's FOFC platform consists of a specialty optical fiber through which a hole is transversally bored by laser micromachining. The analyte solution is injected into the hole of the fiber and the particles are detected and counted. The advantage with respect to classic free space FC is that alignment occurs in the fabrication process only and complex excitation and collection optics are replaced by optical fibers. Moreover, we use a sheathless configuration which has the advantage of increase the portability of the system, to reduce excess biohazard material and the need for weekly maintenance. In this paper we present the principle of our FOFC along with a, demonstration of the basic capability of the platform for detection of bacillus cereus spores using permeabilized staining.

  7. TractorEYE: Vision-based Real-time Detection for Autonomous Vehicles in Agriculture

    DEFF Research Database (Denmark)

    Christiansen, Peter

    ) using a smaller memory footprint and 7.3-times faster processing. Low memory footprint and fast processing makes DeepAnomaly suitable for real-time applications running on an embedded GPU. FieldSAFE is a multi-modal dataset for detection of static and moving obstacles in agriculture. The dataset...... the safety of vehicle and especially surroundings such as humans and animals. To get fully autonomous vehicles certified for farming, computer vision algorithms and sensor technologies must detect obstacles with equivalent or better than human-level performance. Furthermore, detections must run in real-time...... algorithm is proposed DeepAnomaly to perform real-time anomaly detection of distant, heavy occluded and unknown obstacles in agriculture. DeepAnomaly is - compared to a state-of-the-art object detector Faster R-CNN - for an agricultural use-case able to detect humans better and at longer ranges (45-90m...

  8. Detection and characterization of foodborne pathogenic bacteria with hyperspectral microscope imaging

    Science.gov (United States)

    Rapid detection and identification of pathogenic microorganisms naturally occurring during food processing are important in developing intervention and verification strategies. In the poultry industry, contamination of poultry meat with foodborne pathogens (especially, Salmonella and Campylobacter) ...

  9. Using dynamic pupillometry as a simple screening tool to detect autonomic neuropathy in patients with diabetes: a pilot study.

    Science.gov (United States)

    Ferrari, Giselle L; Marques, Jefferson L B; Gandhi, Rajiv A; Heller, Simon R; Schneider, Fábio K; Tesfaye, Solomon; Gamba, Humberto R

    2010-06-17

    Autonomic neuropathy is a common and serious complication of diabetes. Early detection is essential to enable appropriate interventional therapy and management. Dynamic pupillometry has been proposed as a simpler and more sensitive tool to detect subclinical autonomic dysfunction. The aim of this study was to investigate pupil responsiveness in diabetic subjects with and without cardiovascular autonomic neuropathy (CAN) using dynamic pupillometry in two sets of experiments. During the first experiment, one flash was administered and the pupil response was recorded for 3 s. In the second experiment, 25 flashes at 1-s interval were administered and the pupil response was recorded for 30 s. Several time and pupil-iris radius-related parameters were computed from the acquired data. A total of 24 diabetic subjects (16 without and 8 with CAN) and 16 healthy volunteers took part in the study. Our results show that diabetic subjects with and without CAN have sympathetic and parasympathetic dysfunction, evidenced by diminished amplitude reflexes and significant smaller pupil radius. It suggests that pupillary autonomic dysfunction occurs before a more generalized involvement of the autonomic nervous system, and this could be used to detect early autonomic dysfunction. Dynamic pupillometry provides a simple, inexpensive, and noninvasive tool to screen high-risk diabetic patients for diabetic autonomic neuropathy.

  10. Using dynamic pupillometry as a simple screening tool to detect autonomic neuropathy in patients with diabetes: a pilot study

    Directory of Open Access Journals (Sweden)

    Schneider Fábio K

    2010-06-01

    Full Text Available Abstract Background Autonomic neuropathy is a common and serious complication of diabetes. Early detection is essential to enable appropriate interventional therapy and management. Dynamic pupillometry has been proposed as a simpler and more sensitive tool to detect subclinical autonomic dysfunction. The aim of this study was to investigate pupil responsiveness in diabetic subjects with and without cardiovascular autonomic neuropathy (CAN using dynamic pupillometry in two sets of experiments. Methods During the first experiment, one flash was administered and the pupil response was recorded for 3 s. In the second experiment, 25 flashes at 1-s interval were administered and the pupil response was recorded for 30 s. Several time and pupil-iris radius-related parameters were computed from the acquired data. A total of 24 diabetic subjects (16 without and 8 with CAN and 16 healthy volunteers took part in the study. Results Our results show that diabetic subjects with and without CAN have sympathetic and parasympathetic dysfunction, evidenced by diminished amplitude reflexes and significant smaller pupil radius. It suggests that pupillary autonomic dysfunction occurs before a more generalized involvement of the autonomic nervous system, and this could be used to detect early autonomic dysfunction. Conclusions Dynamic pupillometry provides a simple, inexpensive, and noninvasive tool to screen high-risk diabetic patients for diabetic autonomic neuropathy.

  11. Application of nanotechnology in biosensors for enhancing pathogen detection.

    Science.gov (United States)

    Sposito, Alex J; Kurdekar, Aditya; Zhao, Jiangqin; Hewlett, Indira

    2018-03-12

    Rapid detection and identification of pathogenic microorganisms is fundamental to minimizing the spread of infectious disease, and informing clinicians on patient treatment strategies. This need has led to the development of enhanced biosensors that utilize state of the art nanomaterials and nanotechnology, and represent the next generation of diagnostics. A primer on nanoscale biorecognition elements such as, nucleic acids, antibodies, and their synthetic analogs (molecular imprinted polymers), will be presented first. Next the application of various nanotechnologies for biosensor transduction will be discussed, along with the inherent nanoscale phenomenon that leads to their improved performance and capabilities in biosensor systems. A future outlook on characterization and quality assurance, nanotoxicity, and nanomaterial integration into lab-on-a-chip systems will provide the closing thoughts. This article is categorized under: Diagnostic Tools > Diagnostic Nanodevices Diagnostic Tools > Biosensing. © 2018 Wiley Periodicals, Inc.

  12. Real-time quantitative PCR, pathogen detection and MIQE.

    Science.gov (United States)

    Johnson, Gemma; Nolan, Tania; Bustin, Stephen A

    2013-01-01

    Nucleic acids are the ultimate biomarker and real-time PCR (qPCR) is firmly established as the method of choice for nucleic acid detection. Together, they allow the accurate, sensitive and specific identification of pathogens, and the use of qPCR has become routine in diagnostic laboratories. The reliability of qPCR-based assays relies on a combination of optimal sample selection, assay design and validation as well as appropriate data analysis and the "Minimal Information for the Publication of real-time PCR" (MIQE) guidelines aim to improve both the reliability of assay design as well as the transparency of reporting, essential conditions if qPCR is to remain the benchmark technology for molecular diagnosis.

  13. Hand-Eye LRF-Based Iterative Plane Detection Method for Autonomous Robotic Welding

    Directory of Open Access Journals (Sweden)

    Sungmin Lee

    2015-12-01

    Full Text Available This paper proposes a hand-eye LRF-based (laser range finder welding plane-detection method for autonomous robotic welding in the field of shipbuilding. The hand-eye LRF system consists of a 6 DOF manipulator and an LRF attached to the wrist of the manipulator. The welding plane is detected by the LRF with only the wrist's rotation to minimize a mechanical error caused by the manipulator's motion. A position on the plane is determined as an average position of the detected points on the plane, and a normal vector to the plane is determined by applying PCA (principal component analysis to the detected points. In this case, the accuracy of the detected plane is analysed by simulations with respect to the wrist's angle interval and the plane angle. As a result of the analysis, an iterative plane-detection method with the manipulator's alignment motion is proposed to improve the performance of plane detection. For verifying the feasibility and effectiveness of the proposed plane-detection method, experiments are carried out with a prototype of the hand-eye LRF-based system, which consists of a 1 DOF wrist's joint, an LRF system and a rotatable plane. In addition, the experimental results of the PCA-based plane detection method are compared with those of the two representative plane-detection methods, based on RANSAC (RANdom SAmple Consensus and the 3D Hough transform in both accuracy and computation time's points of view.

  14. A Path Tracking Algorithm Using Future Prediction Control with Spike Detection for an Autonomous Vehicle Robot

    Directory of Open Access Journals (Sweden)

    Muhammad Aizzat Zakaria

    2013-08-01

    Full Text Available Trajectory tracking is an important aspect of autonomous vehicles. The idea behind trajectory tracking is the ability of the vehicle to follow a predefined path with zero steady state error. The difficulty arises due to the nonlinearity of vehicle dynamics. Therefore, this paper proposes a stable tracking control for an autonomous vehicle. An approach that consists of steering wheel control and lateral control is introduced. This control algorithm is used for a non-holonomic navigation problem, namely tracking a reference trajectory in a closed loop form. A proposed future prediction point control algorithm is used to calculate the vehicle's lateral error in order to improve the performance of the trajectory tracking. A feedback sensor signal from the steering wheel angle and yaw rate sensor is used as feedback information for the controller. The controller consists of a relationship between the future point lateral error, the linear velocity, the heading error and the reference yaw rate. This paper also introduces a spike detection algorithm to track the spike error that occurs during GPS reading. The proposed idea is to take the advantage of the derivative of the steering rate. This paper aims to tackle the lateral error problem by applying the steering control law to the vehicle, and proposes a new path tracking control method by considering the future coordinate of the vehicle and the future estimated lateral error. The effectiveness of the proposed controller is demonstrated by a simulation and a GPS experiment with noisy data. The approach used in this paper is not limited to autonomous vehicles alone since the concept of autonomous vehicle tracking can be used in mobile robot platforms, as the kinematic model of these two platforms is similar.

  15. An Autonomous Wearable System for Predicting and Detecting Localised Muscle Fatigue

    Science.gov (United States)

    Al-Mulla, Mohamed R.; Sepulveda, Francisco; Colley, Martin

    2011-01-01

    Muscle fatigue is an established area of research and various types of muscle fatigue have been clinically investigated in order to fully understand the condition. This paper demonstrates a non-invasive technique used to automate the fatigue detection and prediction process. The system utilises the clinical aspects such as kinematics and surface electromyography (sEMG) of an athlete during isometric contractions. Various signal analysis methods are used illustrating their applicability in real-time settings. This demonstrated system can be used in sports scenarios to promote muscle growth/performance or prevent injury. To date, research on localised muscle fatigue focuses on the clinical side and lacks the implementation for detecting/predicting localised muscle fatigue using an autonomous system. Results show that automating the process of localised muscle fatigue detection/prediction is promising. The autonomous fatigue system was tested on five individuals showing 90.37% accuracy on average of correct classification and an error of 4.35% in predicting the time to when fatigue will onset. PMID:22319367

  16. A real-time method for autonomous passive acoustic detection-classification of humpback whales.

    Science.gov (United States)

    Abbot, Ted A; Premus, Vincent E; Abbot, Philip A

    2010-05-01

    This paper describes a method for real-time, autonomous, joint detection-classification of humpback whale vocalizations. The approach adapts the spectrogram correlation method used by Mellinger and Clark [J. Acoust. Soc. Am. 107, 3518-3529 (2000)] for bowhead whale endnote detection to the humpback whale problem. The objective is the implementation of a system to determine the presence or absence of humpback whales with passive acoustic methods and to perform this classification with low false alarm rate in real time. Multiple correlation kernels are used due to the diversity of humpback song. The approach also takes advantage of the fact that humpbacks tend to vocalize repeatedly for extended periods of time, and identification is declared only when multiple song units are detected within a fixed time interval. Humpback whale vocalizations from Alaska, Hawaii, and Stellwagen Bank were used to train the algorithm. It was then tested on independent data obtained off Kaena Point, Hawaii in February and March of 2009. Results show that the algorithm successfully classified humpback whales autonomously in real time, with a measured probability of correct classification in excess of 74% and a measured probability of false alarm below 1%.

  17. An Autonomous Wearable System for Predicting and Detecting Localised Muscle Fatigue

    Directory of Open Access Journals (Sweden)

    Martin Colley

    2011-01-01

    Full Text Available Muscle fatigue is an established area of research and various types of muscle fatigue have been clinically investigated in order to fully understand the condition. This paper demonstrates a non-invasive technique used to automate the fatigue detection and prediction process. The system utilises the clinical aspects such as kinematics and surface electromyography (sEMG of an athlete during isometric contractions. Various signal analysis methods are used illustrating their applicability in real-time settings. This demonstrated system can be used in sports scenarios to promote muscle growth/performance or prevent injury. To date, research on localised muscle fatigue focuses on the clinical side and lacks the implementation for detecting/predicting localised muscle fatigue using an autonomous system. Results show that automating the process of localised muscle fatigue detection/prediction is promising. The autonomous fatigue system was tested on five individuals showing 90.37% accuracy on average of correct classification and an error of 4.35% in predicting the time to when fatigue will onset.

  18. Autonomous real-time all-sky cloud detection over Mauna Kea

    Science.gov (United States)

    Mahoney, William; Morrison, Glenn; Matsushige, Grant

    2012-09-01

    Canada-France-Hawaii-Telescope (CFHT) Corporation operates and maintains under automation an all-sky mid-infrared (IR) camera providing the Mauna Kea community with real-time cloud detection and sky monitoring solutions. From the cloud's mid-IR black body emission detected in a medium bandwidth filter (10-12μm), time-based differentials are obtained permitting clouds to be detected for global and specific sky regions above Mauna Kea. The instrument interfaces with CFHT environmental monitors for autonomous operations and weather-induced shutdowns. Development efforts are continuing to eventually provide the following new data products: cloud cover determination, photometric quality assessment, sky and cloud brightness and color-based temperatures. The initial dataset provided by the instrument has shown to be invaluable for all modes of ground-based astronomical observing.

  19. Drogue detection for autonomous aerial refueling based on convolutional neural networks

    Directory of Open Access Journals (Sweden)

    Xufeng Wang

    2017-02-01

    Full Text Available Drogue detection is a fundamental issue during the close docking phase of autonomous aerial refueling (AAR. To cope with this issue, a novel and effective method based on deep learning with convolutional neural networks (CNNs is proposed. In order to ensure its robustness and wide application, a deep learning dataset of images was prepared by utilizing real data of “Probe and Drogue” aerial refueling, which contains diverse drogues in various environmental conditions without artificial features placed on the drogues. By employing deep learning ideas and graphics processing units (GPUs, a model for drogue detection using a Caffe deep learning framework with CNNs was designed to ensure the method’s accuracy and real-time performance. Experiments were conducted to demonstrate the effectiveness of the proposed method, and results based on real AAR data compare its performance to other methods, validating the accuracy, speed, and robustness of its drogue detection ability.

  20. Multi-robot terrain coverage and task allocation for autonomous detection of landmines

    Science.gov (United States)

    Dasgupta, Prithviraj; Muñoz-Meléndez, Angélica; Guruprasad, K. R.

    2012-06-01

    Multi-robot systems comprising of heterogeneous autonomous vehicles on land, air, water are being increasingly used to assist or replace humans in different hazardous missions. Two crucial aspects in such multi-robot systems are to: a) explore an initially unknown region of interest to discover tasks, and, b) allocate and share the discovered tasks between the robots in a coordinated manner using a multi-robot task allocation (MRTA) algorithm. In this paper, we describe results from our research on multi-robot terrain coverage and MRTA algorithms within an autonomous landmine detection scenario, done as part of the COMRADES project. Each robot is equipped with a different type of landmine detection sensor and different sensors, even of the same type, can have different degrees of accuracy. The landmine detection-related operations performed by each robot are abstracted as tasks and multiple robots are required to complete a single task. First, we describe a distributed and robust terrain coverage algorithm that employs Voronoi partitions to divide the area of interest among the robots and then uses a single-robot coverage algorithm to explore each partition for potential landmines. Then, we describe MRTA algorithms that use the location information of discovered potential landmines and employ either a greedy strategy, or, an opportunistic strategy to allocate tasks among the robots while attempting to minimize the time (energy) expended by the robots to perform the tasks. We report experimental results of our algorithms using accurately-simulated Corobot robots within the Webots simulator performing a multi-robot, landmine detection operation.

  1. Using an autonomous Wave Glider to detect seawater anomalies related to submarine groundwater discharge - engineering challenge

    Science.gov (United States)

    Leibold, P.; Brueckmann, W.; Schmidt, M.; Balushi, H. A.; Abri, O. A.

    2017-12-01

    Coastal aquifer systems are amongst the most precious and vulnerable water resources worldwide. While differing in lateral and vertical extent they commonly show a complex interaction with the marine realm. Excessive groundwater extraction can cause saltwater intrusion from the sea into the aquifers, having a strongly negative impact on the groundwater quality. While the reverse pathway, the discharge of groundwater into the sea is well understood in principle, it's mechanisms and quantities not well constrained. We will present a project that combines onshore monitoring and modeling of groundwater in the coastal plain of Salalah, Oman with an offshore autonomous robotic monitoring system, the Liquid Robotics Wave Glider. Eventually, fluxes detected by the Wave Glider system and the onshore monitoring of groundwater will be combined into a 3-D flow model of the coastal and deeper aquifers. The main tool for offshore SGD investigation project is a Wave Glider, an autonomous vehicle based on a new propulsion technology. The Wave Glider is a low-cost satellite-connected marine craft, consisting of a combination of a sea-surface and an underwater component which is propelled by the conversion of ocean wave energy into forward thrust. While the wave energy propulsion system is purely mechanical, electrical energy for onboard computers, communication and sensors is provided by photovoltaic cells. For the project the SGD Wave Glider is being equipped with dedicated sensors to measure temperature, conductivity, Radon isotope (222Rn, 220Rn) activity concentration as well as other tracers of groundwater discharge. Dedicated software using this data input will eventually allow the Wave Glider to autonomously collect information and actively adapt its search pattern to hunt for spatial and temporal anomalies. Our presentation will focus on the engineering and operational challenges ofdetecting submarine groundwater discharges with the Wave Glider system in the Bay of Salalah

  2. 9 CFR 113.37 - Detection of pathogens by the chicken embryo inoculation test.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Detection of pathogens by the chicken... VECTORS STANDARD REQUIREMENTS Standard Procedures § 113.37 Detection of pathogens by the chicken embryo...-serum mixture shall be inoculated into each of at least 20 fully susceptible chicken embryos. (1) Twenty...

  3. 9 CFR 113.36 - Detection of pathogens by the chicken inoculation test.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Detection of pathogens by the chicken... REQUIREMENTS Standard Procedures § 113.36 Detection of pathogens by the chicken inoculation test. The test for...,000 doses. (b) At least 25 healthy susceptible young chickens, properly identified and obtained from...

  4. LITERATURE REVIEW OF MOLECULAR METHODS FOR SIMULTANEOUS DETECTION OF PATHOGENS IN WATER

    Science.gov (United States)

    This literature search is a review of molecular technologies (qPCR, microarray, microfluidics and lab-on-a-chip) for simultaneous detection of multiple waterborne pathogens in order to understand the state of the technology. The search content focuses on: pathogen detection witho...

  5. Bio-Inspired Autonomous Communications Systems with Anomaly Detection Monitoring, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — We propose to develop and demonstrate BioComm, a bio-inspired autonomous communications system (ACS) aimed at dynamically reconfiguring and redeploying autonomous...

  6. 360-Degree Visual Detection and Target Tracking on an Autonomous Surface Vehicle

    Science.gov (United States)

    Wolf, Michael T; Assad, Christopher; Kuwata, Yoshiaki; Howard, Andrew; Aghazarian, Hrand; Zhu, David; Lu, Thomas; Trebi-Ollennu, Ashitey; Huntsberger, Terry

    2010-01-01

    This paper describes perception and planning systems of an autonomous sea surface vehicle (ASV) whose goal is to detect and track other vessels at medium to long ranges and execute responses to determine whether the vessel is adversarial. The Jet Propulsion Laboratory (JPL) has developed a tightly integrated system called CARACaS (Control Architecture for Robotic Agent Command and Sensing) that blends the sensing, planning, and behavior autonomy necessary for such missions. Two patrol scenarios are addressed here: one in which the ASV patrols a large harbor region and checks for vessels near a fixed asset on each pass and one in which the ASV circles a fixed asset and intercepts approaching vessels. This paper focuses on the ASV's central perception and situation awareness system, dubbed Surface Autonomous Visual Analysis and Tracking (SAVAnT), which receives images from an omnidirectional camera head, identifies objects of interest in these images, and probabilistically tracks the objects' presence over time, even as they may exist outside of the vehicle's sensor range. The integrated CARACaS/SAVAnT system has been implemented on U.S. Navy experimental ASVs and tested in on-water field demonstrations.

  7. Detection of cardiovascular autonomic neuropathy using exercise testing in patients with type 2 diabetes mellitus.

    Science.gov (United States)

    Banthia, Smriti; Bergner, Daniel W; Chicos, Alexandru B; Ng, Jason; Pelchovitz, Daniel J; Subacius, Haris; Kadish, Alan H; Goldberger, Jeffrey J

    2013-01-01

    This study investigated autonomic nervous system function in subjects with diabetes during exercise and recovery. Eighteen type 2 diabetics (age 55±2 years) and twenty healthy controls (age 51±1 years) underwent two 16-min bicycle submaximal ECG stress tests followed by 45 min of recovery. During session #2, atropine (0.04 mg/kg) was administered at peak exercise, and the final two minutes of exercise and entire recovery occurred under parasympathetic blockade. Plasma catecholamines were measured throughout. Parasympathetic effect was defined as the difference between a measured parameter at baseline and after parasympathetic blockade. The parasympathetic effect on the RR interval was blunted (P=.004) in diabetic subjects during recovery. Parasympathetic effect on QT-RR slope during early recovery was diminished in the diabetes group (diabetes 0.13±0.02, control 0.21±0.02, P=.03). Subjects with diabetes had a lower heart rate recovery at 1 min (diabetes 18.5±1.9 bpm, control 27.6±1.5 bpm, Pdiabetes, even with minimal evidence of CAN using current methodology, altered cardiac autonomic balance is present and can be detected through an exercise-based assessment for CAN. The early post-exercise recovery period in diabetes was characterized by enhanced sympathoexcitation, diminished parasympathetic reactivation and delay in heart rate recovery. Copyright © 2013 Elsevier Inc. All rights reserved.

  8. Sepsis biomarkers and pathogen detection methods: State of the art

    Directory of Open Access Journals (Sweden)

    Schmitz Roland P.H.

    2014-01-01

    Full Text Available Evidence-based blood culture testing is of utmost importance for ICU patients with suspected sepsis or organ infection. Knowledge of the etiologic agent (bacteria or fungi and their susceptibility against antimicrobials enables the clinician to initiate an appropriate antimicrobial therapy and guides diagnostic procedures. This has been shown to reduce mortality, ICU-stay and antibiotic overuse. Whereas microbiological laboratory practice has been highly standardized, short­falls in the preanalytic procedures in the ICU (indication, timing, volume, numbers, collection of blood cultures have a significant effect on the diagnostic yield. Due to system-related drawbacks of molecular diagnostics, i.e. PCR-based pathogen detection, which are arguable sensitivities, the failing of the 'fast time-to-result argument', no solution to establish a comprising antibiogram, still ongoing discussions on the coverage of the tar­get panel, high overall costs, and the lacking of resilient data on clinical utility, non-culture-based NATs do currently not represent an alternative to blood culture testing. Inflammatory markers are recognized to play an increasingly important role in the diagnosis and monitoring of sepsis. This is partly due to low specificity of clinical symptoms and conventional inflammatory signs for the diagnosis of sepsis but also to a lack of correlation with the severity of the inflammatory response. Elevated serum PCT levels indicate systemic inflammation reliably. PCT is the only sepsis marker that is helpful in the differentiation between infectious and non-infectious causes of organ dysfunction and shock and might support antibiotic therapy.

  9. Development of an oligonucleotide-based microarray to detect multiple foodborne pathogens.

    Science.gov (United States)

    Suo, Biao; He, Yiping; Paoli, George; Gehring, Andrew; Tu, Shu-I; Shi, Xianming

    2010-04-01

    Escherichia coli O157:H7, Salmonella enterica, Listeria monocytogenes and Campylobacter jejuni are considered important pathogens causing the most food-related human illnesses worldwide. Current methods for pathogen detection have limitations in the effectiveness of identifying multiple foodborne pathogens. In this study, a pathogen detection microarray was developed using various 70-mer oligonucleotides specifically targeting the above pathogens. To reduce the cost of detection, each microarray chip was designed and fabricated to accommodate 12 identical arrays which could be used for screening up to 12 different samples. To achieve high detection sensitivity and specificity, target-specific DNA amplification instead of whole genome random amplification was used prior to microarray analysis. Combined with 14-plex PCR amplification of target sequences, the microarray unambiguously distinguished all 4 pathogens with a detection sensitivity of 1 x 10(-4) ng (approximately 20 copies) of each genomic DNA. Applied the assay to 39 fresh meat samples, 16 samples were found to be contaminated by either 1 or 2 of these pathogens. The co-occurrences of Salmonella and E. coli O157:H7, Salmonella and L. monocytogenes in the same meat samples were also observed. Overall, the microarray combined with multiplex PCR method was able to effectively screen single or multiple pathogens in food samples and to provide important genotypic information related to pathogen virulence.

  10. An Autonomous Divisive Algorithm for Community Detection Based on Weak Link and Link-Break Strategy

    Directory of Open Access Journals (Sweden)

    Xiaoyu Ding

    2018-01-01

    Full Text Available Divisive algorithms are widely used for community detection. A common strategy of divisive algorithms is to remove the external links which connect different communities so that communities get disconnected from each other. Divisive algorithms have been investigated for several decades but some challenges remain unsolved: (1 how to efficiently identify external links, (2 how to efficiently remove external links, and (3 how to end a divisive algorithm with no help of predefined parameters or community definitions. To overcome these challenges, we introduced a concept of the weak link and autonomous division. The implementation of the proposed divisive algorithm adopts a new link-break strategy similar to a tug-of-war contest, where communities act as contestants and weak links act as breakable ropes. Empirical evaluations on artificial and real-world networks show that the proposed algorithm achieves a better accuracy-efficiency trade-off than some of the latest divisive algorithms.

  11. Novel strategies to enhance lateral flow immunoassay sensitivity for detecting foodborne pathogens.

    Science.gov (United States)

    Shan, Shan; Lai, Weihua; Xiong, Yonghua; Wei, Hua; Xu, Hengyi

    2015-01-28

    Food contaminated by foodborne pathogens causes diseases, affects individuals, and even kills those affected individuals. As such, rapid and sensitive detection methods should be developed to screen pathogens in food. One current detection method is lateral flow immunoassay, an efficient technique because of several advantages, including rapidity, simplicity, stability, portability, and sensitivity. This review presents the format and principle of lateral flow immunoassay strip and the development of conventional lateral flow immunoassay for detecting foodborne pathogens. Furthermore, novel strategies that can be applied to enhance the sensitivity of lateral flow immunoassay to detect foodborne pathogens are presented; these strategies include innovating new label application, designing new formats of lateral flow immunoassay, combining with other methods, and developing signal amplification systems. With these advancements, detection sensitivity and detection time can be greatly improved.

  12. Molecular inversion probe: a new tool for highly specific detection of plant pathogens.

    Science.gov (United States)

    Lau, Han Yih; Palanisamy, Ramkumar; Trau, Matt; Botella, Jose R

    2014-01-01

    Highly specific detection methods, capable of reliably identifying plant pathogens are crucial in plant disease management strategies to reduce losses in agriculture by preventing the spread of diseases. We describe a novel molecular inversion probe (MIP) assay that can be potentially developed into a robust multiplex platform to detect and identify plant pathogens. A MIP has been designed for the plant pathogenic fungus Fusarium oxysporum f.sp. conglutinans and the proof of concept for the efficiency of this technology is provided. We demonstrate that this methodology can detect as little as 2.5 ng of pathogen DNA and is highly specific, being able to accurately differentiate Fusarium oxysporum f.sp. conglutinans from other fungal pathogens such as Botrytis cinerea and even pathogens of the same species such as Fusarium oxysporum f.sp. lycopersici. The MIP assay was able to detect the presence of the pathogen in infected Arabidopsis thaliana plants as soon as the tissues contained minimal amounts of pathogen. MIP methods are intrinsically highly multiplexable and future development of specific MIPs could lead to the establishment of a diagnostic method that could potentially screen infected plants for hundreds of pathogens in a single assay.

  13. Highly Sensitive and Miniaturized Fluorescence Detection System with an Autonomous Capillary Fluid Manipulation Chip

    Directory of Open Access Journals (Sweden)

    Ji Fang

    2012-05-01

    Full Text Available This paper presents a novel, highly sensitive and ultra-small fluorescent detection system, including an autonomous capillary fluid manipulation chip. The optical detector integrates a LED light source, all necessary optical components, and a photodiode with preamplifier into one package of about 2 cm × 2 cm × 2 cm. Also, the low-cost and simple pumpless microfluidic device works well in sample preparation and manipulation. This chip consists of capillary stop valves and trigger valves which are fabricated by lithography and then bonded with a polydimethylsiloxane-ethylene oxide polymer polydimethylsiloxane (PEO-PDMS cover. The contact angle of the PEO-PDMS can be adjusted by changing the concentration of the PEO. Hence, the fluidic chip can achieve functionalities such as timing features and basic logical functions. The prototype has been tested by fluorescence dye 5-Carboxyfluorescein (5-FAM dissolved into the solvent DMSO (Dimethyl Sulfoxide. The results prove a remarkable sensitivity at a pico-scale molar, around 1.08 pM. The low-cost and miniaturized optical detection system, with a self-control capillary-driven microfluidic chip developed in this work, can be used as the crucial parts in portable biochemical detection applications and point of care testing.

  14. An autonomous surface discontinuity detection and quantification method by digital image correlation and phase congruency

    Science.gov (United States)

    Cinar, A. F.; Barhli, S. M.; Hollis, D.; Flansbjer, M.; Tomlinson, R. A.; Marrow, T. J.; Mostafavi, M.

    2017-09-01

    Digital image correlation has been routinely used to measure full-field displacements in many areas of solid mechanics, including fracture mechanics. Accurate segmentation of the crack path is needed to study its interaction with the microstructure and stress fields, and studies of crack behaviour, such as the effect of closure or residual stress in fatigue, require data on its opening displacement. Such information can be obtained from any digital image correlation analysis of cracked components, but it collection by manual methods is quite onerous, particularly for massive amounts of data. We introduce the novel application of Phase Congruency to detect and quantify cracks and their opening. Unlike other crack detection techniques, Phase Congruency does not rely on adjustable threshold values that require user interaction, and so allows large datasets to be treated autonomously. The accuracy of the Phase Congruency based algorithm in detecting cracks is evaluated and compared with conventional methods such as Heaviside function fitting. As Phase Congruency is a displacement-based method, it does not suffer from the noise intensification to which gradient-based methods (e.g. strain thresholding) are susceptible. Its application is demonstrated to experimental data for cracks in quasi-brittle (Granitic rock) and ductile (Aluminium alloy) materials.

  15. Detection of TORCH pathogens in children with congenital cataracts.

    Science.gov (United States)

    Lu, Bin; Yang, Yabo

    2016-08-01

    The aim of the present study was to investigate the correlation between infection rates with TORCH pathogens including toxoplasma, rubella virus, cytomegalovirus, and herpes simplex virus (HSV) I and II and congenital cataracts. In total, the data from 69 children with congenital cataract treated at the Children's Hospital of the Zhejiang University School of Medicine between May 2006 and September 2013 were examined, including the complete serum test results for immunoglobulin (Ig)G and IgM that target TORCH pathogenic antibodies. These results were compared with the antibody levels of 5,914 children in a control group. Using SPSS 19.0 software, variance equation Levene tests, mean equation t tests, and completely randomized design of four tables χ 2 tests were applied. The HSV II IgG positivity rates significantly differed between the cataract and control groups. These results suggested that HSV may be one of the pathogenic viruses that leads to congenital cataracts.

  16. Real-time passive acoustic detection of marine mammals from a variety of autonomous platforms

    Science.gov (United States)

    Baumgartner, M.; Van Parijs, S. M.; Hotchkin, C. F.; Gurnee, J.; Stafford, K.; Winsor, P.; Davies, K. T. A.; Taggart, C. T.

    2016-02-01

    Over the past two decades, passive acoustic monitoring has proven to be an effective means of estimating the occurrence of marine mammals. The vast majority of applications involve archival recordings from bottom-mounted instruments or towed hydrophones from moving ships; however, there is growing interest in assessing marine mammal occurrence from autonomous platforms, particularly in real time. The Woods Hole Oceanographic Institution has developed the capability to detect, classify, and remotely report in near real time the calls of marine mammals via passive acoustics from a variety of autonomous platforms, including Slocum gliders, wave gliders, and moored buoys. The mobile Slocum glider can simultaneously measure marine mammal occurrence and oceanographic conditions throughout the water column, making it well suited for studying both marine mammal distribution and habitat. Wave gliders and moored buoys provide complementary observations over much larger spatial scales and longer temporal scales, respectively. The near real-time reporting capability of these platforms enables follow-up visual observations, on-water research, or responsive management action. We have recently begun to use this technology to regularly monitor baleen whales off the coast of New England, USA and Nova Scotia, Canada, as well as baleen whales, beluga whales, and bearded seals in the Chukchi Sea off the northwest coast of Alaska, USA. Our long-range goal is to monitor occurrence over wide spatial and temporal extents as part of the regional and global ocean observatory initiatives to improve marine mammal conservation and management and to study changes in marine mammal distribution over multi-annual time scales in response to climate change.

  17. [DNA microarrays and their application in detecting and identifying intestinal pathogens].

    Science.gov (United States)

    Jin, Da-Zhi; Wen, Si-Yuan; Wang, Sheng-Qi

    2006-06-01

    DNA microarrays offer many advantages of high throughout, automation, rapid detection, and so on. Therefore, this technology had been used in many fields such as molecular epidemiology of bacteria, microbial gene identification, disease mechanism, gene mutation, gene expression identification, DNA sequencing and medicine screening etc. The assays for identifying pathogens using DNA microarrays reported aboard recently are introduced. The application of DNA microarrays in detecting and identifying intestinal pathogens mainly includes three aspects: the identification of toxin and characteristic genes of pathogens, the identification of bacterial DNA or RNA directly, the simultaneous detection of a large number of intestinal pathogens with the target - gene of ribosomal RNA. Because of its high efficiency, DNA microarrays is superior to other biological method. Obviously DNA microarrays technology may be useful in identifying intestinal pathogens and have a wide prospect.

  18. Rapid detection, characterization, and enumeration of foodborne pathogens

    DEFF Research Database (Denmark)

    Hoorfar, Jeffrey

    2011-01-01

    into focus with the 1990s outbreak of bovine spongiform encephalopathy that was linked to the human outbreak of Creutzfeldt Jakob's Disease. Serology is still an important tool in preventing foodborne pathogens to enter the human food supply through meat and milk from animals. One of the primary uses...

  19. DETECTION OF HIGHLY PATHOGENIC AVIAN INFLUENZA (H5N1 ...

    African Journals Online (AJOL)

    kamani

    domestic poultry in Hong Kong. Different reassortant of this virus however continued to emerge from goose and duck containing the same H5 haemagglutinins glycoprotein but had various internal genes and spread to different regions (Guan et al., 2002). Highly Pathogenic Avian Influenza also caused respiratory disease ...

  20. The role of chitin detection in plant-pathogen interactions

    NARCIS (Netherlands)

    Kombrink, A.; Sánchez-Vallet, A.; Thomma, B.P.H.J.

    2011-01-01

    Despite the deployment of antifungal defence strategies, fungal diseases occur in all types of multicellular organisms. In plants, the role of fungal chitin as pathogen-associated molecular pattern that activates host defence is well established. Interestingly, plants employ homologs of the chitin

  1. Human pathogens in plant biofilms: Formation, physiology, and detection

    Science.gov (United States)

    Fresh produce, viewed as an essential part of a healthy life style is usually consumed in the form of raw or minimally processed fruits and vegetables, and is a potentially important source of food-borne human pathogenic bacteria and viruses. These are passed on to the consumer since the bacteria ca...

  2. Pathogen detection and gut bacteria identification in Apis cerana ...

    African Journals Online (AJOL)

    acer

    other lactic acid bacteria, were isolated from larvae and adult workers, but gave conflicting preliminary identities based on their biochemistry-morphology versus sequence analysis of a partial fragment (1.4 kb) of their 16S rRNA. Key words: Apis cerana indica, bee pathogens, gut bacteria, multiplex polymerase chain ...

  3. Pathogen detection in produce using applications of immunomagnetic beads and biosensors

    Science.gov (United States)

    The presence of pathogenic bacteria is of increasing public health concerns. Rapid and sensitive tests to detect pathogens are required to keep the safety of food supply. In this chapter we summarized our previous investigations where we applied immunomagnetic-bead (IMB) capture and various biosen...

  4. Fluorescence techniques to detect and to assess viability of plant pathogenic bacteria

    NARCIS (Netherlands)

    Chitarra, L.G.

    2001-01-01

    Plant pathogenic bacteria cause major economic losses in commercial crop production worldwide every year. The current methods used to detect and to assess the viability of bacterial pathogens and to test seed lots or plants for contamination are usually based on plate assays or on

  5. Fully Autonomous Multiplet Event Detection: Application to Local-Distance Monitoring of Blood Falls Seismicity

    Energy Technology Data Exchange (ETDEWEB)

    Carmichael, Joshua Daniel [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Carr, Christina [Univ. of Alaska, Fairbanks, AK (United States); Pettit, Erin C. [Univ. of Alaska, Fairbanks, AK (United States)

    2015-06-18

    We apply a fully autonomous icequake detection methodology to a single day of high-sample rate (200 Hz) seismic network data recorded from the terminus of Taylor Glacier, ANT that temporally coincided with a brine release episode near Blood Falls (May 13, 2014). We demonstrate a statistically validated procedure to assemble waveforms triggered by icequakes into populations of clusters linked by intra-event waveform similarity. Our processing methodology implements a noise-adaptive power detector coupled with a complete-linkage clustering algorithm and noise-adaptive correlation detector. This detector-chain reveals a population of 20 multiplet sequences that includes ~150 icequakes and produces zero false alarms on the concurrent, diurnally variable noise. Our results are very promising for identifying changes in background seismicity associated with the presence or absence of brine release episodes. We thereby suggest that our methodology could be applied to longer time periods to establish a brine-release monitoring program for Blood Falls that is based on icequake detections.

  6. Microfluidic devices for sample preparation and rapid detection of foodborne pathogens.

    Science.gov (United States)

    Kant, Krishna; Shahbazi, Mohammad-Ali; Dave, Vivek Priy; Ngo, Tien Anh; Chidambara, Vinayaka Aaydha; Than, Linh Quyen; Bang, Dang Duong; Wolff, Anders

    2018-03-10

    Rapid detection of foodborne pathogens at an early stage is imperative for preventing the outbreak of foodborne diseases, known as serious threats to human health. Conventional bacterial culturing methods for foodborne pathogen detection are time consuming, laborious, and with poor pathogen diagnosis competences. This has prompted researchers to call the current status of detection approaches into question and leverage new technologies for superior pathogen sensing outcomes. Novel strategies mainly rely on incorporating all the steps from sample preparation to detection in miniaturized devices for online monitoring of pathogens with high accuracy and sensitivity in a time-saving and cost effective manner. Lab on chip is a blooming area in diagnosis, which exploits different mechanical and biological techniques to detect very low concentrations of pathogens in food samples. This is achieved through streamlining the sample handling and concentrating procedures, which will subsequently reduce human errors and enhance the accuracy of the sensing methods. Integration of sample preparation techniques into these devices can effectively minimize the impact of complex food matrix on pathogen diagnosis and improve the limit of detections. Integration of pathogen capturing bio-receptors on microfluidic devices is a crucial step, which can facilitate recognition abilities in harsh chemical and physical conditions, offering a great commercial benefit to the food-manufacturing sector. This article reviews recent advances in current state-of-the-art of sample preparation and concentration from food matrices with focus on bacterial capturing methods and sensing technologies, along with their advantages and limitations when integrated into microfluidic devices for online rapid detection of pathogens in foods and food production line. Copyright © 2018. Published by Elsevier Inc.

  7. Microfluidic Label-Free Sensing for Rapid Multiplexed Pathogen Detection in Space Missions

    Data.gov (United States)

    National Aeronautics and Space Administration — For the success of most space programs involving environmental control and waste water management, the rapid detection and identification of pathogens under resource...

  8. DETECTION AND IDENTIFICATION OF PATHOGENIC CANDIDA SPECIES IN WATER USING FLOW CYTOMETRY COUPLED WITH TAQMAN PCR

    Science.gov (United States)

    As the incidence of human fungal infection increases, the ability to detect and identify pathogenic fungi in potential environmental reservoirs becomes increasingly important for disease control. PCR based assays are widely used for diagnostic purposes, but may be inadequate for...

  9. Neuropad for the detection of cardiovascular autonomic neuropathy in patients with type 2 diabetes.

    Science.gov (United States)

    Mendivil, Carlos O; Kattah, William; Orduz, Arturo; Tique, Claudia; Cárdenas, José L; Patiño, Jorge E

    2016-01-01

    Cardiovascular autonomic neuropathy (CAN) is a prevalent and neglected chronic complication of diabetes, with a large impact on morbidity and mortality. Part of the reason why it is not detected and treated opportunely is because of the complexity of the tests required for its diagnosis. We evaluated the Neuropad®, a test based on sudomotor function, as a screening tool for CAN in adult patients with type 2 diabetes in Bogotá, Colombia. This was a cross-sectional evaluation of Neuropad® for the detection of CAN. Patients were 20-75years of age and did not suffer from any other type of neuropathy. CAN was diagnosed using the Ewing battery of tests for R-R variability during deep breathing, Valsalva and lying-to-standing maneuvers. Additionally, distal symmetric polyneuropathy (DSP) was diagnosed using a sign-based scale (Michigan Neuropathy Disability Score - NDS) and a symptom-based score (Total Symptom Score - TSS). The primary outcome was the sensitivity and specificity of the Neuropad® for the diagnosis of CAN, and secondary outcomes were the sensitivity and specificity of Neuropad® for DSP. We studied 154 patients (74 men and 80 women). Prevalence of CAN was extremely high (68.0% of study participants), but also DSP was prevalent, particularly according to the signs-based definition (45%). The sensitivity of the Neuropad® for any degree of CAN was 70.1%, being slightly higher for the deep breathing and Valsalva tests than for lying-to-standing. The specificity of the Neuropad® for any type of CAN was only 37.0%, as expected for a screening exam. The negative predictive value was higher for the deep breathing and Valsalva tests (69.4 and 81.6%, respectively). Neuropad showed also a good sensitivity and negative predictive value for DSP. The sensitivity and specificity of Neuropad were better among men, and among patients with diabetes duration above the group median. The Neuropad is a simple and inexpensive device that demonstrated an adequate performance

  10. An improved specimens handling procedure for pathogen detection of the cerebrospinal fluid by microscope

    Directory of Open Access Journals (Sweden)

    WANG Hua-cheng

    2013-02-01

    Full Text Available Background The diagnosis of encephalitis depends on the finding of pathogens in the brain parenchyma or cerebrospinal fluid (CSF. But the success rates of finding pathogens by microscope are low by the traditional specimens handling procedure in which pathogens are detected by direct centrifugation of CSF getting from lumbar puncture. The process of pathogen collection from the CSF such as centrifugation and washing would cause the destruction and loss of pathogens, resulting in a lower rate of pathogen discovery. Therefore, in order to increase the detection rate of pathogenic microorganisms in CSF, these traditional steps need to be improved. Methods CSF samples of 23 patients with suspected viral encephalitis and 10 control patients with fracture were prepared by two methods: traditional specimens handling procedure (TSHP and improved specimens handling procedure (ISHP. In the ISHP, a final concentration of 2.5% glutaraldehyde was added to CSF in a glass tube, mixed and kept not moving in 4 ℃ for 2 to 4 h or in 37 ℃for 1 h. Then a smear was made from the sediment formed in the tube to check pathogens by microscope. As for the TSHP, pathogens were collected by direct centrifugation of CSF which had not been treated after lumbar puncture, and checked through Gimenze staining. Results There was no statistically significant difference between the two dealing procedures in the control group ( P = 1.000. As for the case group, there were 10 cases showing positive in Pandy test after TSHP, and visible sediments were seen in all the 23 cases after ISHP. There was statistically significant difference between two kinds of CSF treatment for the finding of pathogens (P = 0.000. Seven cases presented pathogen growth in CSF and were diagosed as rickettsial infections by Gimenze staining, immunofluorescence assay (IFA and polymerase chain reaction (PCR. Conclusion Improved specimens handling procedures of CSF contribute to the seperation of cells

  11. Rapid methods for the detection of foodborne bacterial pathogens: principles, applications, advantages and limitations

    Science.gov (United States)

    Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han

    2015-01-01

    The incidence of foodborne diseases has increased over the years and resulted in major public health problem globally. Foodborne pathogens can be found in various foods and it is important to detect foodborne pathogens to provide safe food supply and to prevent foodborne diseases. The conventional methods used to detect foodborne pathogen are time consuming and laborious. Hence, a variety of methods have been developed for rapid detection of foodborne pathogens as it is required in many food analyses. Rapid detection methods can be categorized into nucleic acid-based, biosensor-based and immunological-based methods. This review emphasizes on the principles and application of recent rapid methods for the detection of foodborne bacterial pathogens. Detection methods included are simple polymerase chain reaction (PCR), multiplex PCR, real-time PCR, nucleic acid sequence-based amplification (NASBA), loop-mediated isothermal amplification (LAMP) and oligonucleotide DNA microarray which classified as nucleic acid-based methods; optical, electrochemical and mass-based biosensors which classified as biosensor-based methods; enzyme-linked immunosorbent assay (ELISA) and lateral flow immunoassay which classified as immunological-based methods. In general, rapid detection methods are generally time-efficient, sensitive, specific and labor-saving. The developments of rapid detection methods are vital in prevention and treatment of foodborne diseases. PMID:25628612

  12. Rapid Methods for the Detection of Foodborne Bacterial Pathogens: Principles, Applications, Advantages and Limitations

    Directory of Open Access Journals (Sweden)

    Law eJodi Woan-Fei

    2015-01-01

    Full Text Available The incidence of foodborne diseases has increased over the years and resulted in major public health problem globally. Foodborne pathogens can be found in various foods and it is important to detect foodborne pathogens to provide safe food supply and to prevent foodborne diseases. The conventional methods used to detect foodborne pathogen are time consuming and laborious. Hence, a variety of methods have been developed for rapid detection of foodborne pathogens as it is required in many food analyses. Rapid detection methods can be categorized into nucleic acid-based, biosensor-based and immunological-based methods. This review emphasizes on the principles and application of recent rapid methods for the detection of foodborne bacterial pathogens. Detection methods included are simple polymerase chain reaction (PCR, multiplex PCR, real-time PCR, nucleic acid sequence-based amplification (NASBA, loop-mediated isothermal amplification (LAMP and oligonucleotide DNA microarray which classified as nucleic acid-based methods; optical, electrochemical and mass-based biosensors which classified as biosensor-based methods; enzyme-linked immunosorbent assay (ELISA and lateral flow immunoassay which classified as immunological-based methods. In general, rapid detection methods are generally time-efficient, sensitive, specific and labor-saving. The developments of rapid detection methods are vital in prevention and treatment of foodborne diseases.

  13. Sensor fusion: lane marking detection and autonomous intelligent cruise control system

    Science.gov (United States)

    Baret, Marc; Baillarin, S.; Calesse, C.; Martin, Lionel

    1995-12-01

    In the past few years MATRA and RENAULT have developed an Autonomous Intelligent Cruise Control (AICC) system based on a LIDAR sensor. This sensor incorporating a charge coupled device was designed to acquire pulsed laser diode emission reflected by standard car reflectors. The absence of moving mechanical parts, the large field of view, the high measurement rate and the very good accuracy for distance range and angular position of targets make this sensor very interesting. It provides the equipped car with the distance and the relative speed of other vehicles enabling the safety distance to be controlled by acting on the throttle and the automatic gear box. Experiments in various real traffic situations have shown the limitations of this kind of system especially on bends. All AICC sensors are unable to distinguish between a bend and a change of lane. This is easily understood if we consider a road without lane markings. This fact has led MATRA to improve its AICC system by providing the lane marking information. Also in the scope of the EUREKA PROMETHEUS project, MATRA and RENAULT have developed a lane keeping system in order to warn of the drivers lack of vigilance. Thus, MATRA have spread this system to far field lane marking detection and have coupled it with the AICC system. Experiments will be carried out on roads to estimate the gain in performance and comfort due to this fusion.

  14. Detection of foodborne pathogens by qPCR: A practical approach for food industry applications

    Directory of Open Access Journals (Sweden)

    María-José Chapela

    2015-12-01

    Full Text Available Microbiological analysis of food is an integrated part of microbial safety management in the food chain. Monitoring and controlling foodborne pathogens are traditionally carried out by conventional microbiological methods based on culture-dependent approaches in control laboratories and private companies. However, polymerase chain reaction (PCR has revolutionized microbiological analysis allowing detection of pathogenic microorganisms in food, without the necessity of classical isolation and identification. However, at present, PCR and quantitative polymerase chain reaction (qPCR are essential analytical tools for researchers working in the field of foodborne pathogens. This manuscript reviews recently described qPCR methods applied for foodborne bacteria detection, serving as economical, safe, and reliable alternatives for application in the food industry and control laboratories. Multiplex qPCR, which allows the simultaneous detection of more than one pathogen in one single reaction, saving considerable effort, time, and money, is emphasized in the article.

  15. Detection of Multiple Waterborne Pathogens Using Microsequencing Arrays

    Science.gov (United States)

    Aims: A microarray was developed to simultaneously detect Cryptosporidium parvum, Cryptosporidium hominis, Enterococcus faecium, Bacillus anthracis and Francisella tularensis in water. Methods and Results: A DNA microarray was designed to contain probes that specifically dete...

  16. Flash 3D Enhancements for Autonomous Precision Landing and Hazard Detection and Avoidance, Phase II

    Data.gov (United States)

    National Aeronautics and Space Administration — With NASA's exploration initiative to return to Lunar Exploration and eventual human exploration of Mars, NASA has an increased need for advanced Autonomous...

  17. Detection of subclinical autonomic neuropathy in constipated patients using a sweat test.

    OpenAIRE

    Altomare, D; Pilot, M A; Scott, M; Williams, N; Rubino, M; Ilincic, L; Waldron, D

    1992-01-01

    Chronic idiopathic constipation may be the result of an autonomic neuropathy. This hypothesis was tested in 23 constipated patients and 17 age matched controls, using the acetylcholine sweat spot test devised to test autonomic integrity in diabetes. Acetylcholine (0.01%) was injected in the dorsum of the foot painted with a mixture of starch and iodine. Active sweat glands appeared on the surface of the skin as small black dots which were photographed and counted, using a grid with 60 subarea...

  18. Towards Autonomous Modular UAV Missions: The Detection, Geo-Location and Landing Paradigm

    OpenAIRE

    Kyristsis, Sarantis; Antonopoulos, Angelos; Chanialakis, Theofilos; Stefanakis, Emmanouel; Linardos, Christos; Tripolitsiotis, Achilles; Partsinevelos, Panagiotis

    2016-01-01

    Nowadays, various unmanned aerial vehicle (UAV) applications become increasingly demanding since they require real-time, autonomous and intelligent functions. Towards this end, in the present study, a fully autonomous UAV scenario is implemented, including the tasks of area scanning, target recognition, geo-location, monitoring, following and finally landing on a high speed moving platform. The underlying methodology includes AprilTag target identification through Graphics Processing Unit (GP...

  19. Detection of 23 Gastrointestinal Pathogens Among Children Who Present With Diarrhea.

    Science.gov (United States)

    Stockmann, Chris; Pavia, Andrew T; Graham, Brad; Vaughn, Mike; Crisp, Rob; Poritz, Mark A; Thatcher, Stephanie; Korgenski, E Kent; Barney, Trenda; Daly, Judy; Rogatcheva, Margarita

    2017-09-01

    Diarrheal diseases are a major cause of ambulatory care visits and hospitalizations among children. Because of overlapping signs and symptoms and expensive and inefficient testing methods, the etiology of pediatric diarrhea is rarely established. We identified children diarrhea at Primary Children's Hospital in Salt Lake City, Utah, between October 2010 and September 2012. Stool specimens submitted for testing were evaluated by using the FilmArray gastrointestinal diagnostic system, which is a rapid multiplex polymerase chain reaction platform that can simultaneously detect 23 bacterial, viral, and protozoal agents. A pathogen was detected in 561 (52%) of 1089 diarrheal episodes. The most commonly detected pathogens included toxigenic Clostridium difficile (16%), diarrheagenic Escherichia coli (15%), norovirus GI/GII (11%), and adenovirus F 40/41 (7%). Shiga toxin-producing E coli were detected in 43 (4%) specimens. Multiple pathogens were identified in 160 (15%) specimens. Viral pathogens (norovirus, adenovirus, rotavirus, and sapovirus) were more common among children children 2 to 4 years of age. Children with 1 or more underlying chronic medical conditions were less likely to have a pathogen identified than those without a chronic medical condition (45% vs 60%, respectively; P children with diarrhea. Viral pathogens are identified frequently among young children with acute gastroenteritis. © The Author 2016. Published by Oxford University Press on behalf of the Pediatric Infectious Diseases Society. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  20. Advanced molecular diagnostic techniques for detection of food-borne pathogens: Current applications and future challenges.

    Science.gov (United States)

    Umesha, S; Manukumar, H M

    2018-01-02

    The elimination of disease-causing microbes from the food supply is a primary goal and this review deals with the overall techniques available for detection of food-borne pathogens. Now-a-days conventional methods are replaced by advanced methods like Biosensors, Nucleic Acid-based Tests (NAT), and different PCR-based techniques used in molecular biology to identify specific pathogens. Bacillus cereus, Staphylococcus aureus, Proteus vulgaris, Escherichia coli, Campylobacter, Listeria monocytogenes, Salmonella spp., Aspergillus spp., Fusarium spp., Penicillium spp., and pathogens are detected in contaminated food items that cause always diseases in human in any one or the other way. Identification of food-borne pathogens in a short period of time is still a challenge to the scientific field in general and food technology in particular. The low level of food contamination by major pathogens requires specific sensitive detection platforms and the present area of hot research looking forward to new nanomolecular techniques for nanomaterials, make them suitable for the development of assays with high sensitivity, response time, and portability. With the sound of these, we attempt to highlight a comprehensive overview about food-borne pathogen detection by rapid, sensitive, accurate, and cost affordable in situ analytical methods from conventional methods to recent molecular approaches for advanced food and microbiology research.

  1. Monoclonal antibody-based Surface Plasmon Resonance sensors for pathogen detection

    DEFF Research Database (Denmark)

    Skottrup, Peter Durand

    2007-01-01

    essentially transforms molecular interactions into a digital signal, thereby making detection of analytes label-free. Biosensors are used for detection of analytes ranging from small drug molecules to food- and waterborne microorganisms as well as biowarfare pathogens. In future farming, plant production......, that can detect and quantify specific plant pathogens and map these to defined positions within the field, would enable the farm manager to perform a precise and targeted application of pesticides and thereby reduce and optimise the use of agrochemicals. The ideal scenario for precision agriculture...... is to have real-time, robust and low-cost sensors, for both soil and air, which can be operated by personnel with limited or no training in plant pathology. In the present thesis focus is put on the development of immunological sensors for detection of two model plant pathogens, Puccinia striiformis f...

  2. Towards On-site Pathogen Detection Using Antibody-based Sensors

    DEFF Research Database (Denmark)

    Skottrup, Peter Durand; Nicolaisen, Mogens; Justesen, Annemarie Fejer

    2008-01-01

    In this paper the recent progress within biosensors for plant pathogen detection will be reviewed. Bio-recognition layers on sensors can be designed in various ways, however the most popular approach is to immobilise antibodies for specific capture of analytes. Focus will be put on antibody surface......-immobilisation strategies as well as the use of antibodies in the widely used sensors, quartz crystal microbalance, surface plasmon resonance and cantilevers. We will describe the available data on antibody-based plant pathogen detection and furthermore use examples from detection of the pathogens Salmonella, Listeria...... monocytogenes, Streptococcus mutans, Bacillus cereus, Bacillus anthracis, Campylobacter and Escherichia coli. We will touch upon optimal assay design and further discuss the strengths and limitations of current sensor technologies for detection of viruses, bacteria and fungi....

  3. Detection of American lineage low pathogenic avian influenza viruses in Uria lomvia in Greenland

    DEFF Research Database (Denmark)

    Hjulsager, Charlotte Kristiane; Hartby, Christina Marie; Krog, Jesper Schak

    screened for AIV in oropharyngeal and cloacal swab specimens from each bird by RT-PCR. American lineage H11N2 AIV was detected in both oropharyngeal and cloacal swabs from one bird, and American lineage low pathogenic AIV with subtype H5N1 was detected in the cloacal swab from another bird. The sparse...

  4. Detection of Pathogens with Impedance Analysis in a Lab on a Chip

    NARCIS (Netherlands)

    van der Wouden, E.J.; Super, M.; Ingber, D.E.; van den Berg, Albert

    2011-01-01

    In this work, we demonstrate an impedance approach to detect pathogens bound to magnetic beads. The approach was demonstrated with C-Albicans. We show that when an appropriate frequency is applied to two electrodes present in a microfluidic channel the impedance change in the detection volume can be

  5. Application of bioinformatics on the detection of pathogens by Pcr

    International Nuclear Information System (INIS)

    Rezig, Slim; Sakhri, Saber

    2007-01-01

    Salmonellas are the main responsible agent for the frequent food-borne gastrointestinal diseases. Their detection using classical methods are laborious and their results take a lot of time to be revealed. In this context, we tried to set up a revealing technique of the invA virulence gene, found in the majority of Salmonella species. After amplification with PCR using specific primers created and verified by bioinformatics programs, two couples of primers were set up and they appeared to be very specific and sensitive for the detection of invA gene. (Author)

  6. Molecular detection and characterization of tick-borne pathogens in dogs and ticks from Nigeria.

    Directory of Open Access Journals (Sweden)

    Joshua Kamani

    Full Text Available BACKGROUND: Only limited information is currently available on the prevalence of vector borne and zoonotic pathogens in dogs and ticks in Nigeria. The aim of this study was to use molecular techniques to detect and characterize vector borne pathogens in dogs and ticks from Nigeria. METHODOLOGY/PRINCIPAL FINDINGS: Blood samples and ticks (Rhipicephalus sanguineus, Rhipicephalus turanicus and Heamaphysalis leachi collected from 181 dogs from Nigeria were molecularly screened for human and animal vector-borne pathogens by PCR and sequencing. DNA of Hepatozoon canis (41.4%, Ehrlichia canis (12.7%, Rickettsia spp. (8.8%, Babesia rossi (6.6%, Anaplasma platys (6.6%, Babesia vogeli (0.6% and Theileria sp. (0.6% was detected in the blood samples. DNA of E. canis (23.7%, H. canis (21.1%, Rickettsia spp. (10.5%, Candidatus Neoehrlichia mikurensis (5.3% and A. platys (1.9% was detected in 258 ticks collected from 42 of the 181 dogs. Co- infections with two pathogens were present in 37% of the dogs examined and one dog was co-infected with 3 pathogens. DNA of Rickettsia conorii israelensis was detected in one dog and Rhipicephalus sanguineus tick. DNA of another human pathogen, Candidatus N. mikurensis was detected in Rhipicephalus sanguineus and Heamaphysalis leachi ticks, and is the first description of Candidatus N. mikurensis in Africa. The Theileria sp. DNA detected in a local dog in this study had 98% sequence identity to Theileria ovis from sheep. CONCLUSIONS/SIGNIFICANCE: The results of this study indicate that human and animal pathogens are abundant in dogs and their ticks in Nigeria and portray the potential high risk of human exposure to infection with these agents.

  7. Biocontrol and Rapid Detection of Food-Borne Pathogens Using Bacteriophages and Endolysins

    Science.gov (United States)

    Bai, Jaewoo; Kim, You-Tae; Ryu, Sangryeol; Lee, Ju-Hoon

    2016-01-01

    Bacteriophages have been suggested as natural food preservatives as well as rapid detection materials for food-borne pathogens in various foods. Since Listeria monocytogenes-targeting phage cocktail (ListShield) was approved for applications in foods, numerous phages have been screened and experimentally characterized for phage applications in foods. A single phage and phage cocktail treatments to various foods contaminated with food-borne pathogens including E. coli O157:H7, Salmonella enterica, Campylobacter jejuni, Listeria monocytogenes, Staphylococcus aureus, Cronobacter sakazakii, and Vibrio spp. revealed that they have great potential to control various food-borne pathogens and may be alternative for conventional food preservatives. In addition, phage-derived endolysins with high host specificity and host lysis activities may be preferred to food applications rather than phages. For rapid detection of food-borne pathogens, cell-wall binding domains (CBDs) from endolysins have been suggested due to their high host-specific binding. Fluorescence-tagged CBDs have been successfully evaluated and suggested to be alternative materials of expensive antibodies for various detection applications. Most recently, reporter phage systems have been developed and tested to confirm their usability and accuracy for specific detection. These systems revealed some advantages like rapid detection of only viable pathogenic cells without interference by food components in a very short reaction time, suggesting that these systems may be suitable for monitoring of pathogens in foods. Consequently, phage is the next-generation biocontrol agent as well as rapid detection tool to confirm and even identify the food-borne pathogens present in various foods. PMID:27092128

  8. Biocontrol and Rapid Detection of Food-borne Pathogens Using Bacteriophages and Endolysins

    Directory of Open Access Journals (Sweden)

    Jaewoo eBai

    2016-04-01

    Full Text Available Bacteriophages have been suggested as natural food preservatives as well as rapid detection materials for food-borne pathogens in various foods. Since Listeria monocytogenes-targeting phage cocktail (ListShield was approved for applications in foods, numerous phages have been screened and experimentally characterized for phage applications in foods. A single phage and phage cocktail treatments to various foods contaminated with food-borne pathogens including E. coli O157:H7, Salmonella enterica, Campylobacter jejuni, Listeria monocytogenes, Staphylococcus aureus, Cronobacter sakazakii, and Vibrio spp. revealed that they have great potential to control various food-borne pathogens and may be alternative for conventional food preservatives. In addition, phage-derived endolysins with high host specificity and host lysis activities may be preferred to food applications rather than phages. For rapid detection of food-borne pathogens, cell-wall binding domains (CBDs from endolysins have been suggested due to their high host-specific binding. Fluorescence-tagged CBDs have been successfully evaluated and suggested to be alternative materials of expensive antibodies for various detection applications. Most recently, reporter phage systems have been developed and tested to confirm their usability and accuracy for specific detection. These systems revealed some advantages like rapid detection of only viable pathogenic cells without interference by food components in a very short reaction time, suggesting that these systems may be suitable for monitoring of pathogens in foods. Consequently, phage is the next-generation biocontrol agent as well as rapid detection tool to confirm and even identify the food-borne pathogens present in various foods.

  9. Clinical differences between respiratory viral and bacterial mono- and dual pathogen detected among Singapore military servicemen with febrile respiratory illness.

    Science.gov (United States)

    Ho, Zheng Jie Marc; Zhao, Xiahong; Cook, Alex R; Loh, Jin Phang; Ng, Sock Hoon; Tan, Boon Huan; Lee, Vernon J

    2015-07-01

    Although it is known that febrile respiratory illnesses (FRI) may be caused by multiple respiratory pathogens, there are no population-level studies describing its impact on clinical disease. Between May 2009 and October 2012, 7733 FRI patients and controls in the Singapore military had clinical data and nasal wash samples collected prospectively and sent for PCR testing. Patients with one pathogen detected (mono-pathogen) were compared with those with two pathogens (dual pathogen) for differences in basic demographics and clinical presentation. In total, 45.8% had one pathogen detected, 20.2% had two pathogens detected, 30.9% had no pathogens detected, and 3.1% had more than two pathogens. Multiple pathogens were associated with recruits, those with asthma and non-smokers. Influenza A (80.0%), influenza B (73.0%) and mycoplasma (70.6%) were most commonly associated with mono-infections, while adenovirus was most commonly associated with dual infections (62.9%). Influenza A paired with S. pneumoniae had higher proportions of chills and rigors than their respective mono-pathogens (P = 0.03, P = 0.009). H. influenzae paired with either enterovirus or parainfluenzae had higher proportions of cough with phlegm than their respective mono-pathogens. Although there were observed differences in mean proportions of body temperature, nasal symptoms, sore throat, body aches and joint pains between viral and bacterial mono-pathogens, there were few differences between distinct dual-pathogen pairs and their respective mono-pathogen counterparts. A substantial number of FRI patients have multiple pathogens detected. Observed clinical differences between patients of dual pathogen and mono-pathogen indicate the likely presence of complex microbial interactions between the various pathogens. © 2015 The Authors. Influenza and Other Respiratory Viruses Published by John Wiley & Sons Ltd.

  10. Pathogen detection, testing, and control in fresh broccoli sprouts

    Directory of Open Access Journals (Sweden)

    Fahey Jed W

    2006-04-01

    Full Text Available Abstract Background The recent increased interest in consuming green vegetable sprouts has been tempered by the fact that fresh sprouts can in some cases be vehicles for food-borne illnesses. They must be grown according to proper conditions of sanitation and handled as a food product rather than as an agricultural commodity. When sprouts are grown in accordance with the criteria proposed from within the sprout industry, developed by regulatory agencies, and adhered to by many sprouters, green sprouts can be produced with very low risk. Contamination may occur when these guidelines are not followed. Methods A one year program of microbial hold-and-release testing, conducted in concert with strict seed and facility cleaning procedures by 13 U.S. broccoli sprout growers was evaluated. Microbial contamination tests were performed on 6839 drums of sprouts, equivalent to about 5 million consumer packages of fresh green sprouts. Results Only 24 (0.75% of the 3191 sprout samples gave an initial positive test for Escherichia coli O157:H7 or Salmonella spp., and when re-tested, 3 drums again tested positive. Composite testing (e.g., pooling up to 7 drums for pathogen testing was equally sensitive to single drum testing. Conclusion By using a "test-and-re-test" protocol, growers were able to minimize crop destruction. By pooling drums for testing, they were also able to reduce testing costs which now represent a substantial portion of the costs associated with sprout growing. The test-and-hold scheme described herein allowed those few batches of contaminated sprouts to be found prior to packaging and shipping. These events were isolated, and only safe sprouts entered the food supply.

  11. Detection and identification of previously unrecognized microbial pathogens.

    OpenAIRE

    Relman, D. A.

    1998-01-01

    Features of a number of important but poorly explained human clinical syndromes strongly indicate a microbial etiology. In these syndromes, the failure of cultivation-dependent microbial detection methods reveals our ignorance of microbial growth requirements. Sequence-based molecular methods, however, offer alternative approaches for microbial identification directly from host specimens found in the setting of unexplained acute illnesses, chronic inflammatory disease, and from anatomic sites...

  12. Detection of Tick-Borne Pathogens in the Korean Water Deer (Hydropotes inermis argyropus) from Jeonbuk Province, Korea

    OpenAIRE

    Seong, Giyong; Han, Yu-Jung; Oh, Sung-Suck; Chae, Joon-Seok; Yu, Do-Hyeon; Park, Jinho; Park, Bae-Keun; Yoo, Jae-Gyu; Choi, Kyoung-Seong

    2015-01-01

    The objective of this study was to investigate the prevalence of tick-borne pathogens in the Korean water deer (Hydropotes inermis argyropus). Pathogens were identified using PCR which included Anaplasma, Ehrlichia, Rickettsia, and Theileria. Rickettsia was not detected, whereas Anaplasma, Ehrlichia, and Theileria infections were detected in 4, 2, and 8 animals, respectively. The most prevalent pathogen was Theileria. Of the 8 Theileria-positive animals, 2 were mixed-infected with 3 pathogens...

  13. Strategies for the detection of food pathogens and contaminants

    DEFF Research Database (Denmark)

    We routinely use Biacore for affinity ranking and kinetic characterisation of diverse panels of hybridoma-derived and recombinant antibodies against a wide range of different clinically relevant antigens for diagnostic applications. Generally the analytes of interest are haptens or defined protein...... molecules and once suitably high affinity antibodies have been isolated, it is relatively straightforward to design and optimise concentration-based assays using SPR. Recently we have investigated the potential of applying Biacore technology to routine food analysis. Our experiences have shown...... to date with using Biacore for analysis of food contaminants and in particular the challenges associated with large analyte detection...

  14. Strategies for the detection of food pathogens and contaminants

    DEFF Research Database (Denmark)

    Hearty, Stephen; Leonard, Paul; Sheehan, Alfredo Darmanin

    2006-01-01

    We routinely use Biacore for affinity ranking and kinetic characterisation of diverse panels of hybridoma-derived and recombinant antibodies against a wide range of different clinically relevant antigens for diagnostic applications. Generally the analytes of interest are haptens or defined protein...... molecules and once suitably high affinity antibodies have been isolated, it is relatively straightforward to design and optimise concentration-based assays using SPR. Recently we have investigated the potential of applying Biacore technology to routine food analysis. Our experiences have shown...... to date with using Biacore for analysis of food contaminants and in particular the challenges associated with large analyte detection...

  15. Bacterial contamination of platelet concentrates: pathogen detection and inactivation methods

    Directory of Open Access Journals (Sweden)

    Dana Védy

    2009-04-01

    Full Text Available Whereas the reduction of transfusion related viral transmission has been a priority during the last decade, bacterial infection transmitted by transfusion still remains associated to a high morbidity and mortality, and constitutes the most frequent infectious risk of transfusion. This problem especially concerns platelet concentrates because of their favorable bacterial growth conditions. This review gives an overview of platelet transfusion-related bacterial contamination as well as on the different strategies to reduce this problem by using either bacterial detection or inactivation methods.

  16. Standardization of diagnostic PCR for the detection of foodborne pathogens

    DEFF Research Database (Denmark)

    Malorny, B.; Tassios, P.T.; Radstrom, P.

    2003-01-01

    neither gained wide acceptance in routine diagnostics nor been widely incorporated in standardized methods. Lack of validation and standard protocols, as well as variable quality of reagents and equipment, influence the efficient dissemination of PCR methodology from expert research laboratories to end......-user laboratories. Moreover, the food industry understandably requires and expects officially approved standards. Recognizing this, in 1999, the European Commission approved the research project, FOOD-PCR (http://www.PCR.dk), which aims to validate and standardize the use of diagnostic PCR for the detection...

  17. Microfluidic devices for sample preparation and rapid detection of foodborne pathogens

    DEFF Research Database (Denmark)

    Kant, Krishna; Shahbazi, Mohammad-Ali; Dave, Vivek Priy

    2018-01-01

    diagnosis competences. This has prompted researchers to call the current status of detection approaches into question and leverage new technologies for superior pathogen sensing outcomes. Novel strategies mainly rely on incorporating all the steps from sample preparation to detection in miniaturized devices...... streamlining the sample handling and concentrating procedures, which will subsequently reduce human errors and enhance the accuracy of the sensing methods. Integration of sample preparation techniques into these devices can effectively minimize the impact of complex food matrix on pathogen diagnosis...... recent advances in current state-of-the-art of sample preparation and concentration from food matrices with focus on bacterial capturing methods and sensing technologies, along with their advantages and limitations when integrated into microfluidic devices for online rapid detection of pathogens in foods...

  18. Evaluation of detection methods for screening meat and poultry products for the presence of foodborne pathogens.

    Science.gov (United States)

    Bohaychuk, Valerie M; Gensler, Gary E; King, Robin K; Wu, John T; McMullen, Lynn M

    2005-12-01

    Rapid and molecular technologies such as enzyme-linked immunosorbent assay (ELISA), PCR, and lateral flow immunoprecipitation can reduce the time and labor involved in screening food products for the presence of pathogens. These technologies were compared with conventional culture methodology for the detection of Salmonella, Campylobacter, Listeria, and Escherichia coli O157:H7 inoculated in raw and processed meat and poultry products. Recommended protocols were modified so that the same enrichment broths used in the culture methods were also used in the ELISA, PCR, and lateral flow immunoprecipitation assays. The percent agreement between the rapid technologies and culture methods ranged from 80 to 100% depending on the pathogen detected and the method used. ELISA, PCR, and lateral flow immunoprecipitation all performed well, with no statistical difference, compared with the culture method for the detection of E. coli O157:H7. ELISA performed better for the detection of Salmonella, with sensitivity and specificity rates of 100%. PCR performed better for the detection of Campylobacter jejuni, with 100% agreement to the culture method. PCR was highly sensitive for the detection of all the foodborne pathogens tested except Listeria monocytogenes. Although the lateral flow immunoprecipitation tests were statistically different from the culture methods for Salmonella and Listeria because of false-positive results, the tests did not produce any false negatives, indicating that this method would be suitable for screening meat and poultry products for these pathogens.

  19. Multiplex PCR assay for simultaneous detection of six major bacterial pathogens of rice.

    Science.gov (United States)

    Cui, Z; Ojaghian, M R; Tao, Z; Kakar, K U; Zeng, J; Zhao, W; Duan, Y; Vera Cruz, C M; Li, B; Zhu, B; Xie, G

    2016-05-01

    The aim of this study was to develop a multiplex PCR (mPCR) assay for rapid, sensitive and simultaneous detection of six important rice pathogens: Xanthomonas oryzae pv. oryzae, X. oryzae pv. oryzicola, Pseudomonas fuscovaginae, Burkholderia glumae, Burkholderia gladioli and Acidovorax avenae subsp. avenae. Specific primers were designed through a bioinformatics pipeline. Sensitivity of detection was established using both traditional PCR and quantitative real-time PCR on isolated DNA and on bacterial cells both in vitro and in simulated diseased seeds and the parameters were optimized for an mPCR assay. A total of 150 bacterial strains were tested for specificity. The mPCR assay accurately predicted the presence of pathogens among 44 symptomatic and asymptomatic rice seed, sheath and leaf samples. This study confirmed that this mPCR assay is a rapid, reliable and simple tool for the simultaneous detection of six important rice bacterial pathogens. This study is the first report of a method allowing simultaneous detection of six major rice pathogens. The ability to use crude extracts from plants without bacterial isolation or DNA extraction enhances the value of this mPCR technology for rapid detection and aetiological/epidemiological studies. © 2016 The Society for Applied Microbiology.

  20. A rapid, highly sensitive and culture-free detection of pathogens from blood by positive enrichment.

    Science.gov (United States)

    Vutukuru, Manjula Ramya; Sharma, Divya Khandige; Ragavendar, M S; Schmolke, Susanne; Huang, Yiwei; Gumbrecht, Walter; Mitra, Nivedita

    2016-12-01

    Molecular diagnostics is a promising alternative to culture based methods for the detection of bloodstream infections, notably due to its overall lower turnaround time when starting directly from patient samples. Whole blood is usually the starting diagnostic sample in suspected bloodstream infections. The detection of low concentrations of pathogens in blood using a molecular assay necessitates a fairly high starting volume of blood sample in the range of 5-10mL. This large volume of blood sample has a substantial accompanying human genomic content that interferes with pathogen detection. In this study, we have established a workflow using magnetic beads coated with Apolipoprotein H that makes it possible to concentrate pathogens from a 5.0mL whole blood sample, thereby enriching pathogens from whole blood background and also reducing the sample volume to ~200μL or less. We have also demonstrated that this method of enrichment allows detection of 1CFU/mL of Escherichia coli, Enterococcus gallinarum and Candida tropicalis from 5mL blood using quantitative PCR; a detection limit that is not possible in unenriched samples. The enrichment method demonstrated here took 30min to complete and can be easily integrated with various downstream molecular and microbiological techniques. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Simultaneous Detection of Multiple Fish Pathogens Using a Naked-Eye Readable DNA Microarray

    Directory of Open Access Journals (Sweden)

    King-Jung Lin

    2012-02-01

    Full Text Available We coupled 16S rDNA PCR and DNA hybridization technology to construct a microarray for simultaneous detection and discrimination of eight fish pathogens (Aeromonas hydrophila, Edwardsiella tarda, Flavobacterium columnare, Lactococcus garvieae, Photobacterium damselae, Pseudomonas anguilliseptica, Streptococcus iniae and Vibrio anguillarum commonly encountered in aquaculture. The array comprised short oligonucleotide probes (30 mer complementary to the polymorphic regions of 16S rRNA genes for the target pathogens. Targets annealed to the microarray probes were reacted with streptavidin-conjugated alkaline phosphatase and nitro blue tetrazolium/5-bromo-4-chloro-3′-indolylphosphate, p-toluidine salt (NBT/BCIP, resulting in blue spots that are easily visualized by the naked eye. Testing was performed against a total of 168 bacterial strains, i.e., 26 representative collection strains, 81 isolates of target fish pathogens, and 61 ecologically or phylogenetically related strains. The results showed that each probe consistently identified its corresponding target strain with 100% specificity. The detection limit of the microarray was estimated to be in the range of 1 pg for genomic DNA and 103 CFU/mL for pure pathogen cultures. These high specificity and sensitivity results demonstrate the feasibility of using DNA microarrays in the diagnostic detection of fish pathogens.

  2. Ground plane detection for autonomous robots in complex environments inclined with flexed far-field terrains

    CSIR Research Space (South Africa)

    Osunmakind, IO

    2009-11-01

    Full Text Available In this paper, collective intelligence of the Emergent Situation Awareness (ESA) technology is proposed as a supportive strategy for autonomous robotic navigation. The ability to reveal uncertainties over time on flexed far-field is a ground plane...

  3. A Genoproteomic Approach to Detect Peptide Markers of Bacterial Respiratory Pathogens.

    Science.gov (United States)

    Wang, Honghui; Drake, Steven K; Yong, Chen; Gucek, Marjan; Lyes, Matthew A; Rosenberg, Avi Z; Soderblom, Erik; Arthur Moseley, M; Dekker, John P; Suffredini, Anthony F

    2017-08-01

    Rapid identification of respiratory pathogens may facilitate targeted antimicrobial therapy. Direct identification of bacteria in bronchoalveolar lavage (BAL) by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry is confounded by interfering substances. We describe a method to identify unique peptide markers of 5 gram-negative bacteria by liquid chromatography-tandem mass spectrometry (LC-MS/MS) for direct pathogen identification in BAL. In silico translation and digestion were performed on 14-25 whole genomes representing strains of Acinetobacter baumannii , Moraxella catarrhalis , Pseudomonas aeruginosa , Stenotrophomonas maltophilia , and Klebsiella pneumoniae . Peptides constituting theoretical core peptidomes in each were identified. Rapid tryptic digestion was performed; peptides were analyzed by LC-MS/MS and compared with the theoretical core peptidomes. High-confidence core peptides (false discovery rate identified and analyzed with the lowest common ancestor search to yield potential species-specific peptide markers. The species specificity of each peptide was verified with protein BLAST. Further, 1 or 2 pathogens were serially diluted into pooled inflamed BAL, and a targeted LC-MS/MS assay was used to detect 25 peptides simultaneously. Five unique peptides with the highest abundance for each pathogen distinguished these pathogens with varied detection sensitivities. Peptide markers for A. baumannii and P. aeruginosa , when spiked simultaneously into inflamed BAL, were detected with as few as 3.6 (0.2) × 10 3 and 2.2 (0.6) × 10 3 colony-forming units, respectively, by targeted LC-MS/MS. This proof-of-concept study shows the feasibility of identifying unique peptides in BAL for 5 gram-negative bacterial pathogens, and it may provide a novel approach for rapid direct identification of bacterial pathogens in BAL. © 2017 American Association for Clinical Chemistry.

  4. Development of an Automated Microfluidic System for DNA Collection, Amplification, and Detection of Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Hagan, Bethany S.; Bruckner-Lea, Cynthia J.

    2002-12-01

    This project was focused on developing and testing automated routines for a microfluidic Pathogen Detection System. The basic pathogen detection routine has three primary components; cell concentration, DNA amplification, and detection. In cell concentration, magnetic beads are held in a flow cell by an electromagnet. Sample liquid is passed through the flow cell and bacterial cells attach to the beads. These beads are then released into a small volume of fluid and delivered to the peltier device for cell lysis and DNA amplification. The cells are lysed during initial heating in the peltier device, and the released DNA is amplified using polymerase chain reaction (PCR) or strand displacement amplification (SDA). Once amplified, the DNA is then delivered to a laser induced fluorescence detection unit in which the sample is detected. These three components create a flexible platform that can be used for pathogen detection in liquid and sediment samples. Future developments of the system will include on-line DNA detection during DNA amplification and improved capture and release methods for the magnetic beads during cell concentration.

  5. Detection of multiple potentially pathogenic bacteria in Matang mangrove estuaries, Malaysia.

    Science.gov (United States)

    Ghaderpour, Aziz; Mohd Nasori, Khairul Nazrin; Chew, Li Lee; Chong, Ving Ching; Thong, Kwai Lin; Chai, Lay Ching

    2014-06-15

    The deltaic estuarine system of the Matang Mangrove Forest Reserve of Malaysia is a site where several human settlements and brackish water aquaculture have been established. Here, we evaluated the level of fecal indicator bacteria (FIB) and the presence of potentially pathogenic bacteria in the surface water and sediments. Higher levels of FIB were detected at downstream sampling sites from the fishing village, indicating it as a possible source of anthropogenic pollution to the estuary. Enterococci levels in the estuarine sediments were higher than in the surface water, while total coliforms and E. coli in the estuarine sediments were not detected in all samples. Also, various types of potentially pathogenic bacteria, including Klebsiella pneumoniae, Serratia marcescens and Enterobacter cloacae were isolated. The results indicate that the Matang estuarine system is contaminated with various types of potential human bacterial pathogens which might pose a health risk to the public. Copyright © 2014 Elsevier Ltd. All rights reserved.

  6. Bacterial and viral pathogens detected in sea turtles stranded along the coast of Tuscany, Italy.

    Science.gov (United States)

    Fichi, G; Cardeti, G; Cersini, A; Mancusi, C; Guarducci, M; Di Guardo, G; Terracciano, G

    2016-03-15

    During 2014, six loggerhead turtles, Caretta caretta and one green turtle, Chelonia mydas, found stranded on the Tuscany coast of Italy, were examined for the presence of specific bacterial and viral agents, along with their role as carriers of fish and human pathogens. Thirteen different species of bacteria, 10 Gram negative and 3 Gram positive, were identified. Among them, two strains of Vibrio parahaemolyticus and one strain of Lactococcus garviae were recovered and confirmed by specific PCR protocols. No trh and tdh genes were detected in V. parahaemolyticus. The first isolation of L. garviae and the first detection of Betanodavirus in sea turtles indicate the possibility for sea turtles to act as carriers of fish pathogens. Furthermore, the isolation of two strains of V. parahaemolyticus highlights the possible role of these animals in human pathogens' diffusion. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Detection of respiratory bacterial pathogens causing atypical pneumonia by multiplex Lightmix®RT-PCR.

    Science.gov (United States)

    Wagner, Karoline; Springer, Burkard; Imkamp, Frank; Opota, Onya; Greub, Gilbert; Keller, Peter M

    2018-04-01

    Pneumonia is a severe infectious disease. In addition to common viruses and bacterial pathogens (e.g. Streptococcus pneumoniae), fastidious respiratory pathogens like Chlamydia pneumoniae, Mycoplasma pneumoniae and Legionella spp. can cause severe atypical pneumonia. They do not respond to penicillin derivatives, which may cause failure of antibiotic empirical therapy. The same applies for infections with B. pertussis and B. parapertussis, the cause of pertussis disease, that may present atypically and need to be treated with macrolides. Moreover, these fastidious bacteria are difficult to identify by culture or serology, and therefore often remain undetected. Thus, rapid and accurate identification of bacterial pathogens causing atypical pneumonia is crucial. We performed a retrospective method evaluation study to evaluate the diagnostic performance of the new, commercially available Lightmix ® multiplex RT-PCR assay that detects these fastidious bacterial pathogens causing atypical pneumonia. In this retrospective study, 368 clinical respiratory specimens, obtained from patients suffering from atypical pneumonia that have been tested negative for the presence of common agents of pneumonia by culture and viral PCR, were investigated. These clinical specimens have been previously characterized by singleplex RT-PCR assays in our diagnostic laboratory and were used to evaluate the diagnostic performance of the respiratory multiplex Lightmix ® RT-PCR. The multiplex RT-PCR displayed a limit of detection between 5 and 10 DNA copies for different in-panel organisms and showed identical performance characteristics with respect to specificity and sensitivity as in-house singleplex RT-PCRs for pathogen detection. The Lightmix ® multiplex RT-PCR assay represents a low-cost, time-saving and accurate diagnostic tool with high throughput potential. The time-to-result using an automated DNA extraction device for respiratory specimens followed by multiplex RT-PCR detection was

  8. Efficiency of Airborne Sample Analysis Platform (ASAP) bioaerosol sampler for pathogen detection.

    Science.gov (United States)

    Sharma, Anurag; Clark, Elizabeth; McGlothlin, James D; Mittal, Suresh K

    2015-01-01

    The threat of bioterrorism and pandemics has highlighted the urgency for rapid and reliable bioaerosol detection in different environments. Safeguarding against such threats requires continuous sampling of the ambient air for pathogen detection. In this study we investigated the efficacy of the Airborne Sample Analysis Platform (ASAP) 2800 bioaerosol sampler to collect representative samples of air and identify specific viruses suspended as bioaerosols. To test this concept, we aerosolized an innocuous replication-defective bovine adenovirus serotype 3 (BAdV3) in a controlled laboratory environment. The ASAP efficiently trapped the surrogate virus at 5 × 10(3) plaque-forming units (p.f.u.) [2 × 10(5) genome copy equivalent] concentrations or more resulting in the successful detection of the virus using quantitative PCR. These results support the further development of ASAP for bioaerosol pathogen detection.

  9. Efficiency of Airborne Sample Analysis Platform (ASAP Bioaerosol Sampler for Pathogen Detection

    Directory of Open Access Journals (Sweden)

    Anurag eSharma

    2015-05-01

    Full Text Available The threat of bioterrorism and pandemics has highlighted the urgency for rapid and reliable bioaerosol detection in different environments. Safeguarding against such threats requires continuous sampling of the ambient air for pathogen detection. In this study we investigated the efficacy of the Airborne Sample Analysis Platform (ASAP 2800 bioaerosol sampler to collect representative samples of air and identify specific viruses suspended as bioaerosols. To test this concept, we aerosolized an innocuous replication-defective bovine adenovirus serotype 3 (BAdV3 in a controlled laboratory environment. The ASAP efficiently trapped the surrogate virus at 5×10E3 plaque-forming units (p.f.u. [2×10E5 genome copy equivalent] concentrations or more resulting in the successful detection of the virus using quantitative PCR. These results support the further development of ASAP for bioaerosol pathogen detection.

  10. Surface plasmon resonance imaging for label-free detection of foodborne pathogens and toxins

    Science.gov (United States)

    More rapid and efficient detection methods for foodborne pathogenic bacteria and toxins are needed to address the long assay time and limitations in multiplex capacity. Surface plasmon resonance imaging (SPRi) is an emerging optical technique, which allows for rapid and label-free screening of multi...

  11. Improvement of methods for the detection of Gram-negative foodborne pathogens

    NARCIS (Netherlands)

    Margot, H.F.T.

    2016-01-01

    Foodborne diseases are a major source of morbidity and mortality worldwide. In most cases, these diseases are caused by contaminated food products, but transmission can also subsequently occur via person to person contact. The ability to detect the pathogens is an important aspect in the

  12. Bioelectronic DNA detection of human papillomaviruses using eSensor™: a model system for detection of multiple pathogens

    Directory of Open Access Journals (Sweden)

    Miller Donna L

    2003-06-01

    Full Text Available Abstract Background We used human papillomaviruses (HPV as a model system to evaluate the utility of a nucleic acid, hybridization-based bioelectronic DNA detection platform (eSensor™ in identifying multiple pathogens. Methods Two chips were spotted with capture probes consisting of DNA oligonucleotide sequences specific for HPV types. Electrically conductive signal probes were synthesized to be complementary to a distinct region of the amplified HPV target DNA. A portion of the HPV L1 region that was amplified by using consensus primers served as target DNA. The amplified target was mixed with a cocktail of signal probes and added to a cartridge containing a DNA chip to allow for hybridization with complementary capture probes. Results Two bioelectric chips were designed and successfully detected 86% of the HPV types contained in clinical samples. Conclusions This model system demonstrates the potential of the eSensor platform for rapid and integrated detection of multiple pathogens.

  13. Efficiency of Airborne Sample Analysis Platform (ASAP) bioaerosol sampler for pathogen detection

    OpenAIRE

    Sharma, Anurag; Clark, Elizabeth; McGlothlin, James D.; Mittal, Suresh K.

    2015-01-01

    The threat of bioterrorism and pandemics has highlighted the urgency for rapid and reliable bioaerosol detection in different environments. Safeguarding against such threats requires continuous sampling of the ambient air for pathogen detection. In this study we investigated the efficacy of the Airborne Sample Analysis Platform (ASAP) 2800 bioaerosol sampler to collect representative samples of air and identify specific viruses suspended as bioaerosols. To test this concept, we aerosolized an...

  14. Comparison of primers for the detection of pathogenic Escherichia coli using real-time PCR.

    Science.gov (United States)

    Barak, J D; Sananikone, K; Delwiche, M J

    2005-01-01

    To evaluate PCR primers for the detection of pathogenic Escherichia coli in a real-time PCR assay and determine their utility in produce irrigation water testing. Three previously published PCR primer sets and one set designed for this study were tested for their ability to produce amplification products for several pathogenic E. coli serotypes from whole cells as template. Two of the previously published primer sets were chosen for real-time PCR detection limit determination. The coneaeA and PEH detection limit of E. coli O157:H7 was 10(0) and 10(1) CFU rxn(-1) in sterile water respectively. To detect E. coli O157:H7 in sprout irrigation water, the water required dilution due to PCR inhibitors. The detection limit of the coneaeA and PEH was 10(1) and between 10(2) and 10(3) CFU rxn(-1) in diluted sprout irrigation water respectively. The primer set coneaeA was able to produce an amplification product from each E. coli serotype, except O128:H7 and most sensitive for real-time PCR detection of pathogenic E. coli in diluted sprout irrigation water. The necessity of a dissociation analysis to distinguish positive samples from those with fluorescence of random dsDNA generation for real-time PCR in a complex background was established.

  15. Development of a magnetic nanoparticles microarray for simultaneous and simple detection of foodborne pathogens.

    Science.gov (United States)

    Li, Song; Liu, Hongna; Deng, Yan; Lin, Lin; He, Nongyue

    2013-07-01

    Foodborne diseases are a widespread and growing public health problem affecting both developed and developing countries, microbiologically contaminated food and water are the major causes of diarrhoeal diseases. Methods based on polymerase chain reaction (PCR) and microarrays are rapid and sensitive enough to detect very small quantities of microorganisms, however, the requirement for expensive equipments limits their application. In the present paper, we describe a method based on multiplex PCR and magnetic nanoparticles labelling for simultaneous detection of four major foodborne pathogens, including Escherichia coli O157:H7, Salmonella enterica, Vibrio cholera and Campylobacter jejuni. The process utilizes an oligonucleotide array onto which 5' biotinylated single strand PCR products were hybridized and visualized with streptavidin-coated magnetic nanoparticles (SA-MNPs), the signal from which could be detected by the naked eye, microscope or CCD camera. By employing SA-MNPs as visible labels, the microarray unambiguously distinguished all 4 pathogens with detection sensitivity up to 316 CFU/mL. Due to its high sensitivity, specificity and simple detection procedure, the magnetic bead assay provides a powerful tool for the detection and identification of foodborne pathogens in a modestly equipped laboratory.

  16. Evolution of Drosophila resistance against different pathogens and infection routes entails no detectable maintenance costs.

    Science.gov (United States)

    Faria, Vítor G; Martins, Nelson E; Paulo, Tânia; Teixeira, Luís; Sucena, Élio; Magalhães, Sara

    2015-11-01

    Pathogens exert a strong selective pressure on hosts, entailing host adaptation to infection. This adaptation often affects negatively other fitness-related traits. Such trade-offs may underlie the maintenance of genetic diversity for pathogen resistance. Trade-offs can be tested with experimental evolution of host populations adapting to parasites, using two approaches: (1) measuring changes in immunocompetence in relaxed-selection lines and (2) comparing life-history traits of evolved and control lines in pathogen-free environments. Here, we used both approaches to examine trade-offs in Drosophila melanogaster populations evolving for over 30 generations under infection with Drosophila C Virus or the bacterium Pseudomonas entomophila, the latter through different routes. We find that resistance is maintained after up to 30 generations of relaxed selection. Moreover, no differences in several classical life-history traits between control and evolved populations were found in pathogen-free environments, even under stresses such as desiccation, nutrient limitation, and high densities. Hence, we did not detect any maintenance costs associated with resistance to pathogens. We hypothesize that extremely high selection pressures commonly used lead to the disproportionate expression of costs relative to their actual occurrence in natural systems. Still, the maintenance of genetic variation for pathogen resistance calls for an explanation. © 2015 The Author(s). Evolution © 2015 The Society for the Study of Evolution.

  17. An autonomous fault detection, isolation, and recovery system for a 20-kHz electric power distribution test bed

    Science.gov (United States)

    Quinn, Todd M.; Walters, Jerry L.

    1991-01-01

    Future space explorations will require long term human presence in space. Space environments that provide working and living quarters for manned missions are becoming increasingly larger and more sophisticated. Monitor and control of the space environment subsystems by expert system software, which emulate human reasoning processes, could maintain the health of the subsystems and help reduce the human workload. The autonomous power expert (APEX) system was developed to emulate a human expert's reasoning processes used to diagnose fault conditions in the domain of space power distribution. APEX is a fault detection, isolation, and recovery (FDIR) system, capable of autonomous monitoring and control of the power distribution system. APEX consists of a knowledge base, a data base, an inference engine, and various support and interface software. APEX provides the user with an easy-to-use interactive interface. When a fault is detected, APEX will inform the user of the detection. The user can direct APEX to isolate the probable cause of the fault. Once a fault has been isolated, the user can ask APEX to justify its fault isolation and to recommend actions to correct the fault. APEX implementation and capabilities are discussed.

  18. Detection of Emerging and Re-Emerging Pathogens in Surface Waters Close to an Urban Area

    Directory of Open Access Journals (Sweden)

    Stefania Marcheggiani

    2015-05-01

    Full Text Available Current knowledge about the spread of pathogens in aquatic environments is scarce probably because bacteria, viruses, algae and their toxins tend to occur at low concentrations in water, making them very difficult to measure directly. The purpose of this study was the development and validation of tools to detect pathogens in freshwater systems close to an urban area. In order to evaluate anthropogenic impacts on water microbiological quality, a phylogenetic microarray was developed in the context of the EU project µAQUA to detect simultaneously numerous pathogens and applied to samples from two different locations close to an urban area located upstream and downstream of Rome in the Tiber River. Furthermore, human enteric viruses were also detected. Fifty liters of water were collected and concentrated using a hollow-fiber ultrafiltration approach. The resultant concentrate was further size-fractionated through a series of decreasing pore size filters. RNA was extracted from pooled filters and hybridized to the newly designed microarray to detect pathogenic bacteria, protozoa and toxic cyanobacteria. Diatoms as indicators of the water quality status, were also included in the microarray to evaluate water quality. The microarray results gave positive signals for bacteria, diatoms, cyanobacteria and protozoa. Cross validation of the microarray was performed using standard microbiological methods for the bacteria. The presence of oral-fecal transmitted human enteric-viruses were detected using q-PCR. Significant concentrations of Salmonella, Clostridium, Campylobacter and Staphylococcus as well as Hepatitis E Virus (HEV, noroviruses GI (NoGGI and GII (NoGII and human adenovirus 41 (ADV 41 were found in the Mezzocammino site, whereas lower concentrations of other bacteria and only the ADV41 virus was recovered at the Castel Giubileo site. This study revealed that the pollution level in the Tiber River was considerably higher downstream rather than

  19. Detection of Emerging and Re-Emerging Pathogens in Surface Waters Close to an Urban Area

    Science.gov (United States)

    Marcheggiani, Stefania; D’Ugo, Emilo; Puccinelli, Camilla; Giuseppetti, Roberto; D’Angelo, Anna Maria; Gualerzi, Claudio Orlando; Spurio, Roberto; Medlin, Linda K.; Guillebault, Delphine; Weigel, Wilfried; Helmi, Karim; Mancini, Laura

    2015-01-01

    Current knowledge about the spread of pathogens in aquatic environments is scarce probably because bacteria, viruses, algae and their toxins tend to occur at low concentrations in water, making them very difficult to measure directly. The purpose of this study was the development and validation of tools to detect pathogens in freshwater systems close to an urban area. In order to evaluate anthropogenic impacts on water microbiological quality, a phylogenetic microarray was developed in the context of the EU project µAQUA to detect simultaneously numerous pathogens and applied to samples from two different locations close to an urban area located upstream and downstream of Rome in the Tiber River. Furthermore, human enteric viruses were also detected. Fifty liters of water were collected and concentrated using a hollow-fiber ultrafiltration approach. The resultant concentrate was further size-fractionated through a series of decreasing pore size filters. RNA was extracted from pooled filters and hybridized to the newly designed microarray to detect pathogenic bacteria, protozoa and toxic cyanobacteria. Diatoms as indicators of the water quality status, were also included in the microarray to evaluate water quality. The microarray results gave positive signals for bacteria, diatoms, cyanobacteria and protozoa. Cross validation of the microarray was performed using standard microbiological methods for the bacteria. The presence of oral-fecal transmitted human enteric-viruses were detected using q-PCR. Significant concentrations of Salmonella, Clostridium, Campylobacter and Staphylococcus as well as Hepatitis E Virus (HEV), noroviruses GI (NoGGI) and GII (NoGII) and human adenovirus 41 (ADV 41) were found in the Mezzocammino site, whereas lower concentrations of other bacteria and only the ADV41 virus was recovered at the Castel Giubileo site. This study revealed that the pollution level in the Tiber River was considerably higher downstream rather than upstream of

  20. Towards Autonomous Modular UAV Missions: The Detection, Geo-Location and Landing Paradigm

    Science.gov (United States)

    Kyristsis, Sarantis; Antonopoulos, Angelos; Chanialakis, Theofilos; Stefanakis, Emmanouel; Linardos, Christos; Tripolitsiotis, Achilles; Partsinevelos, Panagiotis

    2016-01-01

    Nowadays, various unmanned aerial vehicle (UAV) applications become increasingly demanding since they require real-time, autonomous and intelligent functions. Towards this end, in the present study, a fully autonomous UAV scenario is implemented, including the tasks of area scanning, target recognition, geo-location, monitoring, following and finally landing on a high speed moving platform. The underlying methodology includes AprilTag target identification through Graphics Processing Unit (GPU) parallelized processing, image processing and several optimized locations and approach algorithms employing gimbal movement, Global Navigation Satellite System (GNSS) readings and UAV navigation. For the experimentation, a commercial and a custom made quad-copter prototype were used, portraying a high and a low-computational embedded platform alternative. Among the successful targeting and follow procedures, it is shown that the landing approach can be successfully performed even under high platform speeds. PMID:27827883

  1. Towards Autonomous Modular UAV Missions: The Detection, Geo-Location and Landing Paradigm.

    Science.gov (United States)

    Kyristsis, Sarantis; Antonopoulos, Angelos; Chanialakis, Theofilos; Stefanakis, Emmanouel; Linardos, Christos; Tripolitsiotis, Achilles; Partsinevelos, Panagiotis

    2016-11-03

    Nowadays, various unmanned aerial vehicle (UAV) applications become increasingly demanding since they require real-time, autonomous and intelligent functions. Towards this end, in the present study, a fully autonomous UAV scenario is implemented, including the tasks of area scanning, target recognition, geo-location, monitoring, following and finally landing on a high speed moving platform. The underlying methodology includes AprilTag target identification through Graphics Processing Unit (GPU) parallelized processing, image processing and several optimized locations and approach algorithms employing gimbal movement, Global Navigation Satellite System (GNSS) readings and UAV navigation. For the experimentation, a commercial and a custom made quad-copter prototype were used, portraying a high and a low-computational embedded platform alternative. Among the successful targeting and follow procedures, it is shown that the landing approach can be successfully performed even under high platform speeds.

  2. Towards Autonomous Modular UAV Missions: The Detection, Geo-Location and Landing Paradigm

    Directory of Open Access Journals (Sweden)

    Sarantis Kyristsis

    2016-11-01

    Full Text Available Nowadays, various unmanned aerial vehicle (UAV applications become increasingly demanding since they require real-time, autonomous and intelligent functions. Towards this end, in the present study, a fully autonomous UAV scenario is implemented, including the tasks of area scanning, target recognition, geo-location, monitoring, following and finally landing on a high speed moving platform. The underlying methodology includes AprilTag target identification through Graphics Processing Unit (GPU parallelized processing, image processing and several optimized locations and approach algorithms employing gimbal movement, Global Navigation Satellite System (GNSS readings and UAV navigation. For the experimentation, a commercial and a custom made quad-copter prototype were used, portraying a high and a low-computational embedded platform alternative. Among the successful targeting and follow procedures, it is shown that the landing approach can be successfully performed even under high platform speeds.

  3. Detection of hepatitis E virus and other livestock-related pathogens in Iowa streams

    Science.gov (United States)

    Givens, Carrie E.; Kolpin, Dana W.; Borchardt, Mark A.; Duris, Joseph W.; Moorman, Thomas B.; Spencer, Susan K.

    2016-01-01

    Manure application is a source of pathogens to the environment. Through overland runoff and tile drainage, zoonotic pathogens can contaminate surface water and streambed sediment and could affect both wildlife and human health. This study examined the environmental occurrence of gene markers for livestock-related bacterial, protozoan, and viral pathogens and antibiotic resistance in surface waters within the South Fork Iowa River basin before and after periods of swine manure application on agricultural land. Increased concentrations of indicator bacteria after manure application exceeding Iowa's state bacteria water quality standards suggest that swine manure contributes to diminished water quality and may pose a risk to human health. Additionally, the occurrence of HEV and numerous bacterial pathogen genes for Escherichia coli, Enterococcus spp., Salmonella sp., and Staphylococcus aureus in both manure samples and in corresponding surface water following periods of manure application suggests a potential role for swine in the spreading of zoonotic pathogens to the surrounding environment. During this study, several zoonotic pathogens were detected including Shiga-toxin producing E. coli, Campylobacter jejuni, pathogenic enterococci, and S. aureus; all of which can pose mild to serious health risks to swine, humans, and other wildlife. This research provides the foundational understanding required for future assessment of the risk to environmental health from livestock-related zoonotic pathogen exposures in this region. This information could also be important for maintaining swine herd biosecurity and protecting the health of wildlife near swine facilities.

  4. Imperfect pathogen detection from non-invasive skin swabs biases disease inference

    Science.gov (United States)

    DiRenzo, Graziella V.; Grant, Evan H. Campbell; Longo, Ana; Che-Castaldo, Christian; Zamudio, Kelly R.; Lips, Karen

    2018-01-01

    1. Conservation managers rely on accurate estimates of disease parameters, such as pathogen prevalence and infection intensity, to assess disease status of a host population. However, these disease metrics may be biased if low-level infection intensities are missed by sampling methods or laboratory diagnostic tests. These false negatives underestimate pathogen prevalence and overestimate mean infection intensity of infected individuals. 2. Our objectives were two-fold. First, we quantified false negative error rates of Batrachochytrium dendrobatidis on non-invasive skin swabs collected from an amphibian community in El Copé, Panama. We swabbed amphibians twice in sequence, and we used a recently developed hierarchical Bayesian estimator to assess disease status of the population. Second, we developed a novel hierarchical Bayesian model to simultaneously account for imperfect pathogen detection from field sampling and laboratory diagnostic testing. We evaluated the performance of the model using simulations and varying sampling design to quantify the magnitude of bias in estimates of pathogen prevalence and infection intensity. 3. We show that Bd detection probability from skin swabs was related to host infection intensity, where Bd infections < 10 zoospores have < 95% probability of being detected. If imperfect Bd detection was not considered, then Bd prevalence was underestimated by as much as 16%. In the Bd-amphibian system, this indicates a need to correct for imperfect pathogen detection caused by skin swabs in persisting host communities with low-level infections. More generally, our results have implications for study designs in other disease systems, particularly those with similar objectives, biology, and sampling decisions. 4. Uncertainty in pathogen detection is an inherent property of most sampling protocols and diagnostic tests, where the magnitude of bias depends on the study system, type of infection, and false negative error rates. Given that it may

  5. Detection of Pathogen Exposure in African Buffalo Using Non-Specific Markers of Inflammation

    Directory of Open Access Journals (Sweden)

    Caroline K. Glidden

    2018-01-01

    Full Text Available Detecting exposure to new or emerging pathogens is a critical challenge to protecting human, domestic animal, and wildlife health. Yet, current techniques to detect infections typically target known pathogens of humans or economically important animals. In the face of the current surge in infectious disease emergence, non-specific disease surveillance tools are urgently needed. Tracking common host immune responses indicative of recent infection may have potential as a non-specific diagnostic approach for disease surveillance. The challenge to immunologists is to identify the most promising markers, which ideally should be highly conserved across pathogens and host species, become upregulated rapidly and consistently in response to pathogen invasion, and remain elevated beyond clearance of infection. This study combined an infection experiment and a longitudinal observational study to evaluate the utility of non-specific markers of inflammation [NSMI; two acute phase proteins (haptoglobin and serum amyloid A, two pro-inflammatory cytokines (IFNγ and TNF-α] as indicators of pathogen exposure in a wild mammalian species, African buffalo (Syncerus caffer. Specifically, in the experimental study, we asked (1 How quickly do buffalo mount NSMI responses upon challenge with an endemic pathogen, foot-and-mouth disease virus; (2 for how long do NSMI remain elevated after viral clearance and; (3 how pronounced is the difference between peak NSMI concentration and baseline NSMI concentration? In the longitudinal study, we asked (4 Are elevated NSMI associated with recent exposure to a suite of bacterial and viral respiratory pathogens in a wild population? Among the four NSMI that we tested, haptoglobin showed the strongest potential as a surveillance marker in African buffalo: concentrations quickly and consistently reached high levels in response to experimental infection, remaining elevated for almost a month. Moreover, elevated haptoglobin was

  6. Imperfect pathogen detection from non-invasive skin swabs biases disease inference

    Science.gov (United States)

    DiRenzo, Graziella V.; Grant, Evan H. Campbell; Longo, Ana; Che-Castaldo, Christian; Zamudio, Kelly R.; Lips, Karen

    2018-01-01

    1. Conservation managers rely on accurate estimates of disease parameters, such as pathogen prevalence and infection intensity, to assess disease status of a host population. However, these disease metrics may be biased if low-level infection intensities are missed by sampling methods or laboratory diagnostic tests. These false negatives underestimate pathogen prevalence and overestimate mean infection intensity of infected individuals. 2. Our objectives were two-fold. First, we quantified false negative error rates of Batrachochytrium dendrobatidis on non-invasive skin swabs collected from an amphibian community in El Copé, Panama. We swabbed amphibians twice in sequence, and we used a recently developed hierarchical Bayesian estimator to assess disease status of the population. Second, we developed a novel hierarchical Bayesian model to simultaneously account for imperfect pathogen detection from field sampling and laboratory diagnostic testing. We evaluated the performance of the model using simulations and varying sampling design to quantify the magnitude of bias in estimates of pathogen prevalence and infection intensity. 3. We show that Bd detection probability from skin swabs was related to host infection intensity, where Bd infections disease systems, particularly those with similar objectives, biology, and sampling decisions. 4. Uncertainty in pathogen detection is an inherent property of most sampling protocols and diagnostic tests, where the magnitude of bias depends on the study system, type of infection, and false negative error rates. Given that it may be difficult to know this information in advance, we advocate that the most cautious approach is to assume all errors are possible and to accommodate them by adjusting sampling designs. The modeling framework presented here improves the accuracy in estimating pathogen prevalence and infection intensity.

  7. Rapid Detection and Identification of a Pathogen's DNA Using Phi29 DNA Polymerase

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Y.; Dunn, J.; Gao, S.; Bruno, J. F.; Luft, B. J.

    2008-10-31

    Zoonotic pathogens including those transmitted by insect vectors are some of the most deadly of all infectious diseases known to mankind. A number of these agents have been further weaponized and are widely recognized as being potentially significant biothreat agents. We describe a novel method based on multiply-primed rolling circle in vitro amplification for profiling genomic DNAs to permit rapid, cultivation-free differential detection and identification of circular plasmids in infectious agents. Using Phi29 DNA polymerase and a two-step priming reaction we could reproducibly detect and characterize by DNA sequencing circular DNA from Borrelia burgdorferi B31 in DNA samples containing as little as 25 pg of Borrelia DNA amongst a vast excess of human DNA. This simple technology can ultimately be adapted as a sensitive method to detect specific DNA from both known and unknown pathogens in a wide variety of complex environments.

  8. Real-time nucleic acid-based detection methods for pathogenic bacteria in food.

    Science.gov (United States)

    McKillip, John L; Drake, Maryanne

    2004-04-01

    Quality assurance in the food industry in recent years has involved the acceptance and implementation of a variety of nucleic acid-based methods for rapid and sensitive detection of food-associated pathogenic bacteria. Techniques such as polymerase chain reaction have greatly expedited the process of pathogen detection and have in some cases replaced traditional methods for bacterial enumeration in food. Conventional PCR, albeit sensitive and specific under optimized conditions, obligates the user to employ agarose gel electrophoresis as the means for endpoint analysis following sample processing. For the last few years, a variety of real-time PCR chemistries and detection instruments have appeared on the market, and many of these lend themselves to applications in food microbiology. These approaches afford a user the ability to amplify DNA or RNA, as well as detect and confirm target sequence identity in a closed-tube format with the use of a variety of fluorophores, labeled probes, or both, without the need to run gels. Such real-time chemistries also offer greater sensitivity than traditional gel visualization and can be semiquantitative and multiplexed depending on the specific experimental objectives. This review emphasizes the current systems available for real-time PCR-based pathogen detection, the basic mechanisms and requirements for each, and the prospects for development over the next few years in the food industry.

  9. Impact of Aerosol Dust on xMAP Multiplex Detection of Different Class Pathogens

    Directory of Open Access Journals (Sweden)

    Denis A. Kleymenov

    2017-11-01

    Full Text Available Environmental or city-scale bioaerosol surveillance can provide additional value for biodefense and public health. Efficient bioaerosol monitoring should rely on multiplex systems capable of detecting a wide range of biologically hazardous components potentially present in air (bacteria, viruses, toxins and allergens. xMAP technology from LuminexTM allows multiplex bead-based detection of antigens or nucleic acids, but its use for simultaneous detection of different classes of pathogens (bacteria, virus, toxin is questionable. Another problem is the detection of pathogens in complex matrices, e.g., in the presence of dust. In the this research, we developed the model xMAP multiplex test-system aiRDeTeX 1.0, which enables detection of influenza A virus, Adenovirus type 6 Salmonella typhimurium, and cholera toxin B subunit representing RNA virus, DNA virus, gram-negative bacteria and toxin respectively as model organisms of biologically hazardous components potentially present in or spreadable through the air. We have extensively studied the effect of matrix solution (PBS, distilled water, environmental dust and ultrasound treatment for monoplex and multiplex detection efficiency of individual targets. All targets were efficiently detectable in PBS and in the presence of dust. Ultrasound does not improve the detection except for bacterial LPS.

  10. Equivalence of self- and staff-collected nasal swabs for the detection of viral respiratory pathogens.

    Directory of Open Access Journals (Sweden)

    Manas K Akmatov

    Full Text Available BACKGROUND: The need for the timely collection of diagnostic biosamples during symptomatic episodes represents a major obstacle to large-scale studies on acute respiratory infection (ARI epidemiology. This may be circumvented by having the participants collect their own nasal swabs. We compared self- and staff-collected swabs in terms of swabbing quality and detection of viral respiratory pathogens. METHODOLOGY/PRINCIPAL FINDINGS: We conducted a prospective study among employees of our institution during the ARI season 2010/2011 (December-March. Weekly emails were sent to the participants (n = 84, reminding them to come to the study center in case of new symptoms. The participants self-collected an anterior nasal swab from one nostril, and trained study personnel collected one from the other nostril. The participants self-collected another two swabs (one from each nostril on a subsequent day. Human β-actin DNA concentration was determined in the swabs as a quality control. Viral respiratory pathogens were detected by multiplex RT-PCR (Seeplex RV15 kit, Seegene, Eschborn, Germany. Of 84 participants, 56 (67% reported at least one ARI episode, 18 participants two, and one participant three. Self-swabbing was highly accepted by the participants. The amount of β-actin DNA per swab was higher in the self- than in the staff-collected swabs (p = 0.008. β-actin concentration was lower in the self-swabs collected on day 1 than in those collected on a subsequent day (p<0.0001. A respiratory viral pathogen was detected in 31% (23/75 of staff- and in 35% (26/75 of self-collected swabs (p = 0.36. With both approaches, the most frequently identified pathogens were human rhinoviruses A/B/C (12/75 swabs, 16% and human coronavirus OC43 (4/75 swabs, 5%. There was almost perfect agreement between self- and staff-collected swabs in terms of pathogen detection (agreement = 93%, kappa = 0.85, p<0.0001. CONCLUSIONS/SIGNIFICANCE: Nasal self

  11. Simultaneous Detection of 13 Key Bacterial Respiratory Pathogens by Combination of Multiplex PCR and Capillary Electrophoresis.

    Science.gov (United States)

    Jiang, Lu Xi; Ren, Hong Yu; Zhou, Hai Jian; Zhao, Si Hong; Hou, Bo Yan; Yan, Jian Ping; Qin, Tian; Chen, Yu

    2017-08-01

    Lower respiratory tract infections continue to pose a significant threat to human health. It is important to accurately and rapidly detect respiratory bacteria. To compensate for the limits of current respiratory bacteria detection methods, we developed a combination of multiplex polymerase chain reaction (PCR) and capillary electrophoresis (MPCE) assay to detect thirteen bacterial pathogens responsible for lower respiratory tract infections, including Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, Pseudomonas aeruginosa, Klebsiella pneumoniae, Escherichia coli, Staphylococcus aureus, Mycoplasma pneumoniae, Legionella spp., Bordetella pertussis, Mycobacterium tuberculosis complex, Corynebacterium diphtheriae, and Streptococcus pyogenes. Three multiplex PCR reactions were built, and the products were analyzed by capillary electrophoresis using the high-throughput DNA analyzer. The specificity of the MPCE assay was examined and the detection limit was evaluated using DNA samples from each bacterial strain and the simulative samples of each strain. This assay was further evaluated using 152 clinical specimens and compared with real-time PCR reactions. For this assay, three nested-multiplex-PCRs were used to detect these clinical specimens. The detection limits of the MPCE assay for the 13 pathogens were very low and ranged from 10-7 to 10-2 ng/μL. Furthermore, analysis of the 152 clinical specimens yielded a specificity ranging from 96.5%-100.0%, and a sensitivity of 100.0% for the 13 pathogens. This study revealed that the MPCE assay is a rapid, reliable, and high-throughput method with high specificity and sensitivity. This assay has great potential in the molecular epidemiological survey of respiratory pathogens. Copyright © 2017 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

  12. Novel aptamer-linked nanoconjugate approach for detection of waterborne bacterial pathogens: an update

    Science.gov (United States)

    Singh, Gulshan; Manohar, Murli; Adegoke, Anthony Ayodeji; Stenström, Thor Axel; Shanker, Rishi

    2017-01-01

    The lack of microbiologically safe water in underdeveloped nations is the prime cause of infectious disease outbreaks. The need for the specific identification and detection of microorganisms encourages the development of advanced, rapid, sensitive and highly specific methods for the monitoring of pathogens and management of potential risk to human health. The rapid molecular assays based on detection of specific molecular signatures offer advantages over conventional methods in terms of specificity and sensitivity but require complex instrumentation and skilled personnel. Nanotechnology is an emerging area and provides a robust approach for the identification of pathogenic microorganism utilizing the peculiar properties of nanomaterials, i.e. small size (1-100 nm) and large surface area. This emerging technology promises to fulfill the urgent need of a novel strategy to enhance the bacterial identification and quantitation in the environment. In this context, the peculiar properties of gold nanoparticles, their plasmonic shifts, and changes in magnetic properties have been utilized for the simple and cost-effective detection of bacterial nucleic acids, antigens and toxins with quite improved sensitivity. One of the promising leads to develop an advance detection method might be the coupling of nucleic acid aptamers (capable of interacting specifically with bacteria, protozoa, and viruses) with nanomaterials. Such aptamer-nano conjugate can be used for the specific recognition of infectious agents in different environmental matrices. This review summarizes the application of nanotechnology in the area of pathogen detection and discusses the prospects of coupling nucleic acid aptamers with nanoparticles for the specific detection of targeted pathogens.

  13. Novel aptamer-linked nanoconjugate approach for detection of waterborne bacterial pathogens: an update

    Energy Technology Data Exchange (ETDEWEB)

    Singh, Gulshan, E-mail: gsingh.gulshan@gmail.com [Durban University of Technology, Institute for Water and Wastewater Technology (IWWT) (South Africa); Manohar, Murli [Jamia Hamdard (Hamdard University), Department of Biochemistry (India); Adegoke, Anthony Ayodeji; Stenström, Thor Axel [Durban University of Technology, Institute for Water and Wastewater Technology (IWWT) (South Africa); Shanker, Rishi [Ahmedabad University, Division of Biological & Life Sciences, School of Arts & Sciences (India)

    2017-01-15

    The lack of microbiologically safe water in underdeveloped nations is the prime cause of infectious disease outbreaks. The need for the specific identification and detection of microorganisms encourages the development of advanced, rapid, sensitive and highly specific methods for the monitoring of pathogens and management of potential risk to human health. The rapid molecular assays based on detection of specific molecular signatures offer advantages over conventional methods in terms of specificity and sensitivity but require complex instrumentation and skilled personnel. Nanotechnology is an emerging area and provides a robust approach for the identification of pathogenic microorganism utilizing the peculiar properties of nanomaterials, i.e. small size (1–100 nm) and large surface area. This emerging technology promises to fulfill the urgent need of a novel strategy to enhance the bacterial identification and quantitation in the environment. In this context, the peculiar properties of gold nanoparticles, their plasmonic shifts, and changes in magnetic properties have been utilized for the simple and cost-effective detection of bacterial nucleic acids, antigens and toxins with quite improved sensitivity. One of the promising leads to develop an advance detection method might be the coupling of nucleic acid aptamers (capable of interacting specifically with bacteria, protozoa, and viruses) with nanomaterials. Such aptamer-nano conjugate can be used for the specific recognition of infectious agents in different environmental matrices. This review summarizes the application of nanotechnology in the area of pathogen detection and discusses the prospects of coupling nucleic acid aptamers with nanoparticles for the specific detection of targeted pathogens.

  14. Fault detection and isolation in GPS receiver autonomous integrity monitoring based on chaos particle swarm optimization-particle filter algorithm

    Science.gov (United States)

    Wang, Ershen; Jia, Chaoying; Tong, Gang; Qu, Pingping; Lan, Xiaoyu; Pang, Tao

    2018-03-01

    The receiver autonomous integrity monitoring (RAIM) is one of the most important parts in an avionic navigation system. Two problems need to be addressed to improve this system, namely, the degeneracy phenomenon and lack of samples for the standard particle filter (PF). However, the number of samples cannot adequately express the real distribution of the probability density function (i.e., sample impoverishment). This study presents a GPS receiver autonomous integrity monitoring (RAIM) method based on a chaos particle swarm optimization particle filter (CPSO-PF) algorithm with a log likelihood ratio. The chaos sequence generates a set of chaotic variables, which are mapped to the interval of optimization variables to improve particle quality. This chaos perturbation overcomes the potential for the search to become trapped in a local optimum in the particle swarm optimization (PSO) algorithm. Test statistics are configured based on a likelihood ratio, and satellite fault detection is then conducted by checking the consistency between the state estimate of the main PF and those of the auxiliary PFs. Based on GPS data, the experimental results demonstrate that the proposed algorithm can effectively detect and isolate satellite faults under conditions of non-Gaussian measurement noise. Moreover, the performance of the proposed novel method is better than that of RAIM based on the PF or PSO-PF algorithm.

  15. Evaluation of different enrichment methods for pathogenic Yersinia species detection by real time PCR

    Science.gov (United States)

    2014-01-01

    Background Yersiniosis is a zoonotic disease reported worldwide. Culture and PCR based protocols are the most common used methods for detection of pathogenic Yersinia species in animal samples. PCR sensitivity could be increased by an initial enrichment step. This step is particularly useful in surveillance programs, where PCR is applied to samples from asymptomatic animals. The aim of this study was to evaluate the improvement in pathogenic Yersinia species detection using a suitable enrichment method prior to the real time PCR (rtPCR). Nine different enrichment protocols were evaluated including six different broth mediums (CASO, ITC, PSB, PBS, PBSMSB and PBSSSB). Results The analysis of variance showed significant differences in Yersinia detection by rtPCR according to the enrichment protocol used. These differences were higher for Y. pseudotuberculosis than for Y. enterocolitica. In general, samples incubated at lower temperatures yielded the highest detection rates. The best results were obtained with PBSMSB and PBS2. Application of PBSMSB protocol to free-ranging wild board samples improved the detection of Y. enterocolitica by 21.2% when compared with direct rtPCR. Y. pseudotuberculosis detection was improved by 10.6% when results obtained by direct rtPCR and by PBSMSB enrichment before rtPCR were analyzed in combination. Conclusions The data obtained in the present study indicate a difference in Yersinia detection by rtPCR related to the enrichment protocol used, being PBSMSB enrichment during 15 days at 4°C and PBS during 7 days at 4°C the most efficient. The use of direct rtPCR in combination with PBSMSB enrichment prior to rtPCR resulted in an improvement in the detection rates of pathogenic Yersinia in wild boar and could be useful for application in other animal samples. PMID:25168886

  16. Detection of Antibodies to Seven Priority Pathogens in Backyard Poultry in Trinidad, West Indies

    Directory of Open Access Journals (Sweden)

    Arianne Brown Jordan

    2018-01-01

    Full Text Available Backyard poultry farms in Trinidad and Tobago (T&T play a vital role in providing food and income for rural communities. There is currently no information on the presence and circulation of pathogens in backyard poultry farms in T&T, and little is known in relation to the potential risks of spread of these pathogens to the commercial poultry sector. In order to address this, serum samples were collected from 41 chickens on five backyard farms taken from selected locations in Trinidad. Samples were tested for antibodies to seven priority pathogens of poultry by enzyme-linked immunosorbent assay (ELISA. Antibodies were detected in 65% (CI 95%: 50–78% of the sampled birds for Infectious bronchitis virus (IBV, 67.5% (CI 95%: 52–80% for Infectious bursal disease virus (IBDV, 10% (CI 95%: 4–23% for Newcastle disease virus (NDV, 0% (CI 95%: 0–0% for Avian influenza virus (AIV, 0% (CI 95%: 0–0% for West Nile virus (WNV, 31.7% (CI 95%: 20–47% for Mycoplasm gallisepticum/synoviae and 0% (CI 95%: 0–0% for Salmonella enterica serotype Enteritidis. These results reveal the presence and circulation of important pathogens of poultry in selected backyard farms in Trinidad. The results provide important information which should be taken into consideration when assessing the risks of pathogen transmission between commercial and backyard poultry farms, as well as between poultry and wild birds.

  17. Detection of Antibodies to Seven Priority Pathogens in Backyard Poultry in Trinidad, West Indies.

    Science.gov (United States)

    Brown Jordan, Arianne; Bolfa, Pompei; Marchi, Silvia; Hemmings, Shakera; Major, Tashard; Suepaul, Rod; Blake, Lemar; Oura, Christopher

    2018-01-20

    Backyard poultry farms in Trinidad and Tobago (T&T) play a vital role in providing food and income for rural communities. There is currently no information on the presence and circulation of pathogens in backyard poultry farms in T&T, and little is known in relation to the potential risks of spread of these pathogens to the commercial poultry sector. In order to address this, serum samples were collected from 41 chickens on five backyard farms taken from selected locations in Trinidad. Samples were tested for antibodies to seven priority pathogens of poultry by enzyme-linked immunosorbent assay (ELISA). Antibodies were detected in 65% (CI 95%: 50-78%) of the sampled birds for Infectious bronchitis virus (IBV), 67.5% (CI 95%: 52-80%) for Infectious bursal disease virus (IBDV), 10% (CI 95%: 4-23%) for Newcastle disease virus (NDV), 0% (CI 95%: 0-0%) for Avian influenza virus (AIV), 0% (CI 95%: 0-0%) for West Nile virus (WNV), 31.7% (CI 95%: 20-47%) for Mycoplasm gallisepticum/synoviae and 0% (CI 95%: 0-0%) for Salmonella enterica serotype Enteritidis. These results reveal the presence and circulation of important pathogens of poultry in selected backyard farms in Trinidad. The results provide important information which should be taken into consideration when assessing the risks of pathogen transmission between commercial and backyard poultry farms, as well as between poultry and wild birds.

  18. Detection of the emerging amphibian pathogens Batrachochytrium dendrobatidis and ranavirus in Russia

    Science.gov (United States)

    Reshetnikov, Andrey N.; Chestnut, Tara E.; Brunner, Jesse L.; Charles, Kaylene M.; Nebergall, Emily E.; Olson, Deanna H.

    2014-01-01

    In a population of the European common toad Bufo bufo from a rural pond in the region of Lake Glubokoe Regional Reserve in Moscow province, Russia, unexplained mass mortality events involving larvae and metamorphs have been observed over a monitoring period of >20 yr. We tested toads from this and a nearby site for the emerging amphibian pathogens Batrachochytrium dendrobatidis (Bd) and ranavirus (Rv). Both pathogens were detected, and at the rural pond site, with the above-noted losses and decline in toad breeding success, 40% of B. bufo metamorphs were Bd positive, 46% were Rv positive and 20% were co-infected with both pathogens. Toad metamorphs from a neighbouring water body were also Bd and Rv positive (25 and 55%, respectively). This is the first confirmation of these pathogens in Russia. Questions remain as to the origins of these pathogens in Russia and their roles in documented mass mortality events.

  19. Detection of Pathogenic Viruses in Sewage Provided Early Warnings of Hepatitis A Virus and Norovirus Outbreaks

    Science.gov (United States)

    Hellmér, Maria; Paxéus, Nicklas; Magnius, Lars; Enache, Lucica; Arnholm, Birgitta; Johansson, Annette; Bergström, Tomas

    2014-01-01

    Most persons infected with enterically transmitted viruses shed large amounts of virus in feces for days or weeks, both before and after onset of symptoms. Therefore, viruses causing gastroenteritis may be detected in wastewater, even if only a few persons are infected. In this study, the presence of eight pathogenic viruses (norovirus, astrovirus, rotavirus, adenovirus, Aichi virus, parechovirus, hepatitis A virus [HAV], and hepatitis E virus) was investigated in sewage to explore whether their identification could be used as an early warning of outbreaks. Samples of the untreated sewage were collected in proportion to flow at Ryaverket, Gothenburg, Sweden. Daily samples collected during every second week between January and May 2013 were pooled and analyzed for detection of viruses by concentration through adsorption to milk proteins and PCR. The largest amount of noroviruses was detected in sewage 2 to 3 weeks before most patients were diagnosed with this infection in Gothenburg. The other viruses were detected at lower levels. HAV was detected between weeks 5 and 13, and partial sequencing of the structural VP1protein identified three different strains. Two strains were involved in an ongoing outbreak in Scandinavia and were also identified in samples from patients with acute hepatitis A in Gothenburg during spring of 2013. The third strain was unique and was not detected in any patient sample. The method used may thus be a tool to detect incipient outbreaks of these viruses and provide early warning before the causative pathogens have been recognized in health care. PMID:25172863

  20. Current Technical Approaches for the Early Detection of Foodborne Pathogens: Challenges and Opportunities

    Directory of Open Access Journals (Sweden)

    Il-Hoon Cho

    2017-09-01

    Full Text Available The development of novel and high-tech solutions for rapid, accurate, and non-laborious microbial detection methods is imperative to improve the global food supply. Such solutions have begun to address the need for microbial detection that is faster and more sensitive than existing methodologies (e.g., classic culture enrichment methods. Multiple reviews report the technical functions and structures of conventional microbial detection tools. These tools, used to detect pathogens in food and food homogenates, were designed via qualitative analysis methods. The inherent disadvantage of these analytical methods is the necessity for specimen preparation, which is a time-consuming process. While some literature describes the challenges and opportunities to overcome the technical issues related to food industry legal guidelines, there is a lack of reviews of the current trials to overcome technological limitations related to sample preparation and microbial detection via nano and micro technologies. In this review, we primarily explore current analytical technologies, including metallic and magnetic nanomaterials, optics, electrochemistry, and spectroscopy. These techniques rely on the early detection of pathogens via enhanced analytical sensitivity and specificity. In order to introduce the potential combination and comparative analysis of various advanced methods, we also reference a novel sample preparation protocol that uses microbial concentration and recovery technologies. This technology has the potential to expedite the pre-enrichment step that precedes the detection process.

  1. Progress in rapid detection and identification of unknown human and agricultural pathogens

    International Nuclear Information System (INIS)

    Barnes, T; Holzrichter, J F; Milanovich, F P

    1999-01-01

    The medical industry is driving pathogen detection technology from its present characteristics of$50/sample, 100 sample capability systems, with several day time responses, having several percent error rates in reported outcomes. The systems described above are capable of providing samples at and lt;$5/test, managing several million samples, and lt; 1-hour cycle times, (or just minutes in some cases) and and lt; 0.1% error rates. Because of their importance to the medical and agricultural communities, all ''important'' pathogens will have detection kits available (within air transport times, anywhere in the world) by 2020, and the most well known pathogens will have kits available within a few years. Many are available now. Because of the importance of the food supply to modern nations, these technologies will be employed everywhere in this industry. For example, the United States imports 30 B tons of food a year, but inspects and lt; 1%. Portable inspection systems will make it possible to test for dangerous pathogens in feed lots, food processing plants, markets, and points of use. Outbreaks of animal or plant disease will be immediately detectable using field instrumentation, and more complex samples can be sent to central testing laboratories where more sophisticated test systems will be available. Unusual pathogens either naturally or purposefully selected or developed, will require special attention because there is not a commercial economic driver for the development of detection systems and curative agents. Their development, and production for sufficient availability, will require significant investments by the world community. The strategy and costs for developing vaccines or curative drugs will be very expensive and will need special attention. However it is important that attention be directed to these problems because such attention has a strong deterrent effect on potential developers or users. The capacity to use the full information content

  2. Low-cost, real-time, continuous flow PCR system for pathogen detection.

    Science.gov (United States)

    Fernández-Carballo, B Leticia; McGuiness, Ian; McBeth, Christine; Kalashnikov, Maxim; Borrós, Salvador; Sharon, Andre; Sauer-Budge, Alexis F

    2016-04-01

    In this paper, we present a portable and low cost point-of-care (POC) PCR system for quantitative detection of pathogens. Our system is based on continuous flow PCR which maintains fixed temperatures zones and pushes the PCR solution between two heated areas allowing for faster heat transfer and as a result, a faster PCR. The PCR system is built around a 46.0 mm × 30.9 mm × 0.4 mm disposable thermoplastic chip. In order to make the single-use chip economically viable, it was manufactured by hot embossing and was designed to be compatible with roll-to-roll embossing for large scale production. The prototype instrumentation surrounding the chip includes two heaters, thermal sensors, and an optical system. The optical system allows for pathogen detection via real time fluorescence measurements. FAM probes were used as fluorescent reporters of the amplicons generated during the PCR. To demonstrate the function of the chip, two infectious bacteria targets were selected: Chlamydia trachomatis and Escherichia coli O157:H7. For both bacteria, the limit of detection of the system was determined, PCR efficiencies were calculated, and different flow velocities were tested. We have demonstrated successful detection for these two bacterial pathogens highlighting the versatility and broad utility of our portable, low-cost, and rapid PCR diagnostic device.

  3. Physics Based Model for Online Fault Detection in Autonomous Cryogenic Loading System

    Science.gov (United States)

    Kashani, Ali; Devine, Ekaterina Viktorovna P; Luchinsky, Dmitry Georgievich; Smelyanskiy, Vadim; Sass, Jared P.; Brown, Barbara L.; Patterson-Hine, Ann

    2013-01-01

    We report the progress in the development of the chilldown model for rapid cryogenic loading system developed at KSC. The nontrivial characteristic feature of the analyzed chilldown regime is its active control by dump valves. The two-phase flow model of the chilldown is approximated as one-dimensional homogeneous fluid flow with no slip condition for the interphase velocity. The model is built using commercial SINDAFLUINT software. The results of numerical predictions are in good agreement with the experimental time traces. The obtained results pave the way to the application of the SINDAFLUINT model as a verification tool for the design and algorithm development required for autonomous loading operation.

  4. Next generation sequencing-based multigene panel for high throughput detection of food-borne pathogens.

    Science.gov (United States)

    Ferrario, Chiara; Lugli, Gabriele Andrea; Ossiprandi, Maria Cristina; Turroni, Francesca; Milani, Christian; Duranti, Sabrina; Mancabelli, Leonardo; Mangifesta, Marta; Alessandri, Giulia; van Sinderen, Douwe; Ventura, Marco

    2017-09-01

    Contamination of food by chemicals or pathogenic bacteria may cause particular illnesses that are linked to food consumption, commonly referred to as foodborne diseases. Bacteria are present in/on various foods products, such as fruits, vegetables and ready-to-eat products. Bacteria that cause foodborne diseases are known as foodborne pathogens (FBPs). Accurate detection methods that are able to reveal the presence of FBPs in food matrices are in constant demand, in order to ensure safe foods with a minimal risk of causing foodborne diseases. Here, a multiplex PCR-based Illumina sequencing method for FBP detection in food matrices was developed. Starting from 25 bacterial targets and 49 selected PCR primer pairs, a primer collection called foodborne pathogen - panel (FPP) consisting of 12 oligonucleotide pairs was developed. The FPP allows a more rapid and reliable identification of FBPs compared to classical cultivation methods. Furthermore, FPP permits sensitive and specific FBP detection in about two days from food sample acquisition to bioinformatics-based identification. The FPP is able to simultaneously identify eight different bacterial pathogens, i.e. Listeria monocytogenes, Campylobacter jejuni, Campylobacter coli, Salmonella enterica subsp. enterica serovar enteritidis, Escherichia coli, Shigella sonnei, Staphylococcus aureus and Yersinia enterocolitica, in a given food matrix at a threshold contamination level of 10 1 cell/g. Moreover, this novel detection method may represent an alternative and/or a complementary approach to PCR-based techniques, which are routinely used for FBP detection, and could be implemented in (parts of) the food chain as a quality check. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Rapid detection of pathogenic bacteria by volatile organic compound (VOC) analysis

    Science.gov (United States)

    Senecal, Andre G.; Magnone, Joshua; Yeomans, Walter; Powers, Edmund M.

    2002-02-01

    Developments in rapid detection technologies have made countless improvements over the years. However, because of the limited sample that these technologies can process in a single run, the chance of capturing and identifying a small amount of pathogens is difficult. The problem is further magnified by the natural random distribution of pathogens in foods. Methods to simplify pathogenic detection through the identification of bacteria specific VOC were studied. E. coli O157:H7 and Salmonella typhimurium were grown on selected agar medium to model protein, and carbohydrate based foods. Pathogenic and common spoilage bacteria (Pseudomonas and Morexella) were screened for unique VOC production. Bacteria were grown on agar slants in closed vials. Headspace sampling was performed at intervals up to 24 hours using Solid Phase Micro-Extraction (SPME) techniques followed by GC/MS analysis. Development of unique volatiles was followed to establish sensitivity of detection. E. coli produced VOC not found in either Trypticase Soy Yeast (TSY) agar blanks or spoilage organism samples were - indole, 1-decanol, and 2-nonanone. Salmonella specific VOC grown on TSY were 3-methyl-1-butanol, dimethyl sulfide, 2-undecanol, 2-pentadecanol and 1-octanol. Trials on potato dextrose agar (PDA) slants indicated VOC specific for E. coli and Salmonella when compared to PDA blanks and Pseudomonas samples. However, these VOC peaks were similar for both pathogens. Morexella did not grow on PDA slants. Work will continue with model growth mediums at various temperatures, and mixed flora inoculums. As well as, VOC production based on the dynamics of bacterial growth.

  6. Advanced biosensors for detection of pathogens related to livestock and poultry.

    Science.gov (United States)

    Vidic, Jasmina; Manzano, Marisa; Chang, Chung-Ming; Jaffrezic-Renault, Nicole

    2017-02-21

    Infectious animal diseases caused by pathogenic microorganisms such as bacteria and viruses threaten the health and well-being of wildlife, livestock, and human populations, limit productivity and increase significantly economic losses to each sector. The pathogen detection is an important step for the diagnostics, successful treatment of animal infection diseases and control management in farms and field conditions. Current techniques employed to diagnose pathogens in livestock and poultry include classical plate-based methods and conventional biochemical methods as enzyme-linked immunosorbent assays (ELISA). These methods are time-consuming and frequently incapable to distinguish between low and highly pathogenic strains. Molecular techniques such as polymerase chain reaction (PCR) and real time PCR (RT-PCR) have also been proposed to be used to diagnose and identify relevant infectious disease in animals. However these DNA-based methodologies need isolated genetic materials and sophisticated instruments, being not suitable for in field analysis. Consequently, there is strong interest for developing new swift point-of-care biosensing systems for early detection of animal diseases with high sensitivity and specificity. In this review, we provide an overview of the innovative biosensing systems that can be applied for livestock pathogen detection. Different sensing strategies based on DNA receptors, glycan, aptamers and antibodies are presented. Besides devices still at development level some are validated according to standards of the World Organization for Animal Health and are commercially available. Especially, paper-based platforms proposed as an affordable, rapid and easy to perform sensing systems for implementation in field condition are included in this review.

  7. Detection of Gastrointestinal Pathogens from Stool Samples on Hemoccult Cards by Multiplex PCR

    Directory of Open Access Journals (Sweden)

    Martin Alberer

    2017-01-01

    Full Text Available Purpose. Up to 30% of international travelers are affected by travelers’ diarrhea (TD. Reliable data on the etiology of TD is lacking. Sufficient laboratory capacity at travel destinations is often unavailable and transporting conventional stool samples to the home country is inconvenient. We evaluated the use of Hemoccult cards for stool sampling combined with a multiplex PCR for the detection of model viral, bacterial, and protozoal TD pathogens. Methods. Following the creation of serial dilutions for each model pathogen, last positive dilution steps (LPDs and thereof calculated last positive sample concentrations (LPCs were compared between conventional stool samples and card samples. Furthermore, card samples were tested after a prolonged time interval simulating storage during a travel duration of up to 6 weeks. Results. The LPDs/LPCs were comparable to testing of conventional stool samples. After storage on Hemoccult cards, the recovery rate was 97.6% for C. jejuni, 100% for E. histolytica, 97.6% for norovirus GI, and 100% for GII. Detection of expected pathogens was possible at weekly intervals up to 42 days. Conclusion. Stool samples on Hemoccult cards stored at room temperature can be used in combination with a multiplex PCR as a reliable tool for testing of TD pathogens.

  8. Analysis of bacterial metagenomes from the Southwestern Gulf of Mexico for pathogens detection.

    Science.gov (United States)

    Escobedo-Hinojosa, Wendy; Pardo-López, Liliana

    2017-07-31

    Little is known about the diversity of bacteria in the Southwestern Gulf of Mexico. The aim of the study illustrated in this perspective was to search for the presence of bacterial pathogens in this ecosystem, using metagenomic data recently generated by the Mexican research group known as the Gulf of Mexico Research Consortium. Several genera of bacteria annotated as pathogens were detected in water and sediment marine samples. As expected, native and ubiquitous pathogenic bacteria genera such as Burkolderia, Halomonas, Pseudomonas, Shewanella and Vibrio were highly represented. Surprisingly, non-native genera of public health concern were also detected, including Borrelia, Ehrlichia, Leptospira, Mycobacterium, Mycoplasma, Salmonella, Staphylococcus, Streptococcus and Treponema. While there are no previous metagenomics studies of this environment, the potential influences of natural, anthropogenic and ecological factors on the diversity of putative pathogenic bacteria found in it are reviewed. The taxonomic annotation herein reported provides a starting point for an improved understanding of bacterial biodiversity in the Southwestern Gulf of Mexico. It also represents a useful tool in public health as it may help identify infectious diseases associated with exposure to marine water and ingestion of fish or shellfish, and thus may be useful in predicting and preventing waterborne disease outbreaks. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  9. Microbial Diagnostic Microarrays for the Detection and Typing of Food- and Water-Borne (Bacterial Pathogens

    Directory of Open Access Journals (Sweden)

    Tanja Kostić

    2011-10-01

    Full Text Available Reliable and sensitive pathogen detection in clinical and environmental (including food and water samples is of greatest importance for public health. Standard microbiological methods have several limitations and improved alternatives are needed. Most important requirements for reliable analysis include: (i specificity; (ii sensitivity; (iii multiplexing potential; (iv robustness; (v speed; (vi automation potential; and (vii low cost. Microarray technology can, through its very nature, fulfill many of these requirements directly and the remaining challenges have been tackled. In this review, we attempt to compare performance characteristics of the microbial diagnostic microarrays developed for the detection and typing of food and water pathogens, and discuss limitations, points still to be addressed and issues specific for the analysis of food, water and environmental samples.

  10. Development of genetic methods for detection of pathogenic microorganisms in irradiated food

    International Nuclear Information System (INIS)

    2010-01-01

    The existence of injured microorganisms in food and their recovery during culturing procedures is critical. Injured microorganisms present a potential threat in food safety since they may repair themselves under suitable conditions. This study provides development of recovery methods for detection of injured foodborne microorganisms, after irradiation treatment at different doses. For this purpose, iniatially the methods of recovery were compared at different irradiation doses. At the second step, antibiotic resistance of foodborne pathogens was determined. After determination of antibiotic resistance, recovery methods were modified for reversibly injured foodborne pathogens at different doses after irradiation treatment . Finally, damages of DNA were detected by a spectrophotometric method after 1.0 kGy irradiation treatment

  11. Monoclonal antibody-based Surface Plasmon Resonance sensors for pathogen detection

    DEFF Research Database (Denmark)

    Skottrup, Peter Durand

    2007-01-01

    A biosensor is an analytical device, which incorporates a biological sensing element integrated within a physicochemical transducer. The aim of a biosensor is to produce an electronic signal, which is proportional to the interaction of analytes with the sensing element. This means that the sensor......, that can detect and quantify specific plant pathogens and map these to defined positions within the field, would enable the farm manager to perform a precise and targeted application of pesticides and thereby reduce and optimise the use of agrochemicals. The ideal scenario for precision agriculture...... is to have real-time, robust and low-cost sensors, for both soil and air, which can be operated by personnel with limited or no training in plant pathology. In the present thesis focus is put on the development of immunological sensors for detection of two model plant pathogens, Puccinia striiformis f...

  12. From Bits and Pieces to Whole Phage to Nanomachines: Pathogen Detection Using Bacteriophages.

    Science.gov (United States)

    Anany, H; Chou, Y; Cucic, S; Derda, R; Evoy, S; Griffiths, M W

    2017-02-28

    The innate specificity of bacteriophages toward their hosts makes them excellent candidates for the development of detection assays. They can be used in many ways to detect pathogens, and each has its own advantages and disadvantages. Whole bacteriophages can carry reporter genes to alter the phenotype of the target. Bacteriophages can act as staining agents or the progeny of the infection process can be detected, which further increases the sensitivity of the detection assay. Compared with whole-phage particles, use of phage components as probes offers other advantages: for example, smaller probe size to enhance binding activity, phage structures that can be engineered for better affinity, as well as specificity, binding properties, and robustness. When no natural binding with the target exists, phages can be used as vehicles to identify new protein-ligand interactions necessary for diagnostics. This review comprehensively summarizes many uses of phages as detection tools and points the way toward how phage-based technologies may be improved.

  13. Multiplexed Detection of Foodborne Pathogens from Contaminated Lettuces Using a Handheld Multistep Lateral Flow Assay Device.

    Science.gov (United States)

    Shin, Joong Ho; Hong, Jisoo; Go, Hyeyun; Park, Juhwan; Kong, Minsuk; Ryu, Sangryeol; Kim, Kwang-Pyo; Roh, Eunjung; Park, Je-Kyun

    2018-01-10

    This paper presents a handheld device that is capable of simplifying multistep assays to perform sensitive detection of foodborne pathogens. The device is capable of multiplexed detection of Escherichia coli (E. coli) O157:H7, Salmonella Typhimurium (S. Typhimurium), Staphylococcus aureus, and Bacillus cereus. The limit of detection for each bacterium was characterized, and then, the detection of bacteria from contaminated fresh lettuces was demonstrated for two representative foodborne pathogens. We employed a sample pretreatment protocol to recover and concentrate target bacteria from contaminated lettuces, which can detect 1.87 × 10 4 CFU of E. coli O157:H7 and 1.47 × 10 4 CFU of S. Typhimurium/1 g of lettuce without an enrichment process. Lastly, we demonstrated that the limit of detection can be reduced to 1 CFU of E. coli O157:H7 and 1 CFU of S. Typhimurium/1 g of lettuce by including a 6 h enrichment of contaminated lettuces in growth media before pretreatment.

  14. Rapid fluorescence detection of pathogenic bacteria using magnetic enrichment technique combined with magnetophoretic chromatography.

    Science.gov (United States)

    Che, Yulan; Xu, Yi; Wang, Renjie; Chen, Li

    2017-08-01

    A rapid and sensitive analytical method was developed to detect pathogenic bacteria which combined magnetic enrichment, fluorescence labeling with polyethylene glycol (PEG) magnetophoretic chromatography. As pathogenic bacteria usually exist in complex matrixes at low concentration, an efficient enrichment is essential for diagnosis. In order to capture series types of pathogenic bacteria in samples, amino-modified magnetic nanoparticles (Fe 3 O 4 @SiO 2 -NH 2 ) were prepared for efficient enrichment by the electrostatic interaction with pathogenic bacteria. It was shown that the capture efficiency reached up to 95.4% for Escherichia coli (E. coli). Furthermore, quantitative analysis of the bacteria was achieved by using acridine orange (AO) as a fluorescence probe for the captured E. coli due to its ability of staining series types of bacteria and rapid labeling. In order to remove the free magnetic nanoparticles and redundant fluorescent reagent, the labeled suspension was poured into a PEG separation column and was separated by applying an external magnetic field. The presence of 100 cfu mL -1 E. coli could be detected for semi-quantitative analysis by observing the separation column with the naked eye, and the concentration could be further evaluated by fluorescence detection. All the above processes were finished within 80 min. It was demonstrated that a good linear relationship existed between the fluorescence intensity and the concentration of E. coli ranging from 10 2 to 10 6  cfu mL -1 , with a detection limit of 100 cfu mL -1 when E. coli acted as target bacteria. The recovery rate of E. coli was 93.6∼102.0% in tap water and cooked meat samples, and the RSD was lower than 7% (n = 6); the result coincided with the conventional plate count method. Graphical abstract ᅟ.

  15. A microfluidic platform with integrated arrays for immunologic assays for biological pathogen detection

    Science.gov (United States)

    Klemm, Richard; Becker, Holger; Hlawatsch, Nadine; Julich, Sandra; Miethe, Peter; Moche, Christian; Schattschneider, Sebastian; Tomaso, Herbert; Gärtner, Claudia

    2014-05-01

    The ability to integrate complete assays on a microfluidic chip helps to greatly simplify instrument requirements and allows the use of lab-on-a-chip technology in the field. A core application for such field-portable systems is the detection of pathogens in a CBRN scenario such as permanent monitoring of airborne pathogens, e.g. in subway stations or hospitals etc. An immunological assay was chosen as method for the pathogen identification. The conceptual approach was its realization as a lab-on-a-chip system, enabling an easy handling of the sample in an automated manner. The immunological detection takes place on an antibody array directly implemented in the microfluidic network. Different immobilization strategies will be presented showing the performance of the system. Central elements of the disposable microfluidic device like fluidic interface, turning valves, liquid introduction and waste storage, as well as the architecture of measurement and control fluidic network, will be introduced. Overall process times of about 30 minutes were achieved and assays for the detection of Francisella tularensis and Yersinia pestis are presented. An important feature of the integrated lab-on-a-chip approach is that all waste liquids remain on-chip and contamination risks can be avoided.

  16. Simultaneous Detection of Five Pathogens from Cerebrospinal Fluid Specimens Using Luminex Technology

    Directory of Open Access Journals (Sweden)

    Linfu Zhou

    2016-02-01

    Full Text Available Early diagnosis and treatment are crucial for the outcome of central nervous system (CNS infections. In this study, we developed a multiplex PCR-Luminex assay for the simultaneous detection of five major pathogens, including Mycobacterium tuberculosis, Cryptococcus neoformans, Streptococcus pneumoniae, and herpes simplex virus types 1 and 2, which frequently cause CNS infections. Through the hybridization reaction between multiplex PCR-amplified targets and oligonucleotide “anti-TAG” sequences, we found that the PCR-Luminex assay could detect as low as 101–102 copies of synthetic pathogen DNAs. Furthermore, 163 cerebrospinal fluid (CSF specimens from patients with suspected CNS infections were used to evaluate the efficiency of this multiplex PCR-Luminex method. Compared with Ziehl-Neelsen stain, this assay showed a high diagnostic accuracy for tuberculosis meningitis (sensitivity, 90.7% and specificity, 99.1%. For cryptococcal meningitis, the sensitivity and specificity were 92% and 97.1%, respectively, compared with the May Grunwald Giemsa (MGG stain. For herpes simplex virus types 1 and 2 encephalitis, the sensitivities were 80.8% and 100%, and the specificities were 94.2% and 99%, respectively, compared with Enzyme Linked Immunosorbent Assay (ELISA assays. Taken together, this multiplex PCR-Luminex assay showed potential efficiency for the simultaneous detection of five pathogens and may be a promising supplement to conventional methods for diagnosing CNS infections.

  17. Detection of diarrhoeal pathogens in human faeces using an automated, robotic platform.

    Science.gov (United States)

    Jex, Aaron R; Stanley, Keith K; Lo, William; Littman, Rachael; Verweij, Jaco J; Campbell, Bronwyn E; Nolan, Matthew J; Pangasa, Aradhana; Stevens, Melita A; Haydon, Shane; Gasser, Robin B

    2012-02-01

    Infectious diarrhoeal diseases represent a major socio-economic burden to humans, and are linked to a range of pathogens, including viruses, bacteria and protists. The accurate detection of such pathogens is central to control. However, detection often relies on methods that have limited diagnostic sensitivity and specificity. Here, we assessed an automated, robotic platform for the simultaneous detection of eight major pathogens associated with infectious diarrhoea. Genomic DNA samples (n = 167) from faeces from humans with diarrhoea and diagnosed as cryptosporidiosis, and 100 uninfected control subjects, were tested for adenovirus 40/41, norovirus, Clostridium difficile, Campylobacter, Salmonella, Shigella, Cryptosporidium and Giardia by multiplexed-tandem PCR, and also characterized by single-strand conformation polymorphism analysis (SSCP) and selective sequencing. All 167 samples tested positive for Cryptosporidium, five for adenovirus 40/41, four for Campylobacter, three for C. difficile and seven for Shigella spp., with no false positive results for any assay. The automated PCR exhibited a high sensitivity, with humans. This platform requires little molecular biological expertise and is well suited to various diagnostic facilities and settings. Copyright © 2011 Elsevier Ltd. All rights reserved.

  18. Application of oligonucleotide array technology for the rapid detection of pathogenic bacteria of foodborne infections.

    Science.gov (United States)

    Hong, Bang-Xing; Jiang, Li-Fang; Hu, Yu-Shan; Fang, Dan-Yun; Guo, Hui-Yu

    2004-09-01

    A rapid and accurate method for detection for common pathogenic bacteria in foodborne infections was established by using oligonucleotide array technology. Nylon membrane was used as the array support. A mutation region of the 23S rRNA gene was selected as the discrimination target from 14 species (genera) of bacteria causing foodborne infections and two unrelated bacterial species. A pair of universal primers was designed for PCR amplification of the 23S rRNA gene. Twenty-one species (genera)-specific oligonucleotide detection probes were synthesized and spotted onto the nylon membranes. The 23S rRNA gene amplification products of 14 species of pathogenic bacteria were hybridized to the oligonucleotide array. Hybridization results were analyzed with digoxigenin-linked enzyme reaction. Results indicated that nine species of pathogenic bacteria (Escherichia coli, Campylobacter jejuni, Shigella dysenteriae, Vibrio cholerae, Vibrio parahaemolyticus, Proteus vulgaris, Bacillus cereus, Listeria monocytogenes and Clostridium botulinum) showed high sensitivity and specificity for the oligonucleotide array. Two other species (Salmonella enterica and Yersinia enterocolitica) gave weak cross-reaction with E. coli, but the reaction did not affect their detection. After redesigning the probes, positive hybridization results were obtained with Staphylococcus aureus, but not with Clostridium perfringens and Streptococcus pyogenes. The oligonucleotide array can also be applied to samples collected in clinical settings of foodborne infections. The superiority of oligonucleotide array over other tests lies on its rapidity, accuracy and efficiency in the diagnosis, treatment and control of foodborne infections.

  19. Nano-particle enhanced impedimetric biosensor for detection of foodborne pathogens

    International Nuclear Information System (INIS)

    Kim, G; Om, A S; Mun, J H

    2007-01-01

    Recent outbreaks of foodborne illness have been increased the need for rapid and sensitive methods for detection of these pathogens. Conventional methods for pathogens detection and identification involve prolonged multiple enrichment steps. Even though some immunological rapid assays are available, these assays still need enrichment steps result in delayed detection. Biosensors have shown great potential for rapid detection of foodborne pathogens. They are capable of direct monitoring the antigen-antibody reactions in real time. Among the biosensors, impedimetric biosensors have been widely adapted as an analysis tool for the study of various biological binding reactions because of their high sensitivity and reagentless operation. In this study a nanoparticle-enhanced impedimetric biosensor for Salmonella enteritidis detection was developed which detected impedance changes caused by the attachment of the cells to the anti-Salmonella antibodies immobilized on interdigitated gold electrodes. Successive immobilization of neutravidin followed by anti-Salmonella antibodies was performed to the sensing area to create a biological detection surface. To enhance the impedance responses generated by antigen-antibody reactions, anti-Salmonella antibody conjugated nanoparticles were introduced on the sensing area. Using a portable impedance analyzer, the impedance across the interdigital electrodes was measured after the series of antigen-antibody bindings. Bacteria cells present in solution attached to capture antibodies and became tethered to the sensor surface. Attached bacteria cells changed the dielectric constant of the media between the electrodes thereby causing a change in measured impedance. Optimum input frequency was determined by analyzing frequency characteristics of the biosensor over ranges of applied frequencies from 10 Hz to 400 Hz. At 100 Hz of input frequency, the biosensor was most sensitive to the changes of the bacteria concentration and this frequency

  20. Possible use of ail and foxA polymorphisms for detecting pathogenic Yersinia enterocolitica.

    Science.gov (United States)

    Huang, Ying; Wang, Xin; Cui, Zhigang; Yang, Yuhuan; Xiao, Yuchun; Tang, Liuying; Kan, Biao; Xu, Jianguo; Jing, Huaiqi

    2010-08-07

    Yersinia enterocolitica is an enteric pathogen that invades the intestinal mucosa and proliferates within the lymphoid follicles (Peyer's patches). The attachment invasion locus (ail) mediates invasion by Y. enterocolitica and confers an invasive phenotype upon non-invasive E. coli; ail is the primary virulence factor of Y. enterocolitica. The ferrioxamine receptor (foxA) located on the Y. enterocolitica chromosome, together with its transport protein, transports a siderophore specific for ferric ion. Currently, ail is the primary target gene for nucleic acid detection of pathogenic Y. enterocolitica. The genes ail and foxA in 271 pathogenic and 27 non-pathogenic Y. enterocolitica strains isolated from China and 10 reference strains were sequenced, aligned, compared to the ail and foxA sequences of Yersinia enterocolitica subsp. enterocolitica 8081 (Genbank: NC_008800), and analyzed for sequence polymorphism. The ail from the 282 strains showed 3 sequence patterns: 277 strains of serotypes O:3, O:9 and O:5, 27 with identical nucleic acid sequences formed pattern A1; 4 strains of serotype 1B/O:8 with identical nucleic acid sequences formed pattern A2; and one Chinese isolate 2/O:9 formed pattern A3. In the primary coding region of the foxA ORF (Genebank: X60447 nt 433-1866; nt 28 to 1,461 in the ORF), the sequences formed 3 groups and were further divided into 8 sequence patterns. The ail and foxA loci of pathogenic Y. enterocolitica have been analyzed. The ail sequence was highly conserved among the same serotype strains from different sources; and foxA was highly conserved among the pathogenic strains, although there was some sequence diversity. Fewer strains were used from outside China, which is a limitation of the study.

  1. Possible use of ail and foxA polymorphisms for detecting pathogenic Yersinia enterocolitica

    Directory of Open Access Journals (Sweden)

    Huang Ying

    2010-08-01

    Full Text Available Abstract Background Yersinia enterocolitica is an enteric pathogen that invades the intestinal mucosa and proliferates within the lymphoid follicles (Peyer's patches. The attachment invasion locus (ail mediates invasion by Y. enterocolitica and confers an invasive phenotype upon non-invasive E. coli; ail is the primary virulence factor of Y. enterocolitica. The ferrioxamine receptor (foxA located on the Y. enterocolitica chromosome, together with its transport protein, transports a siderophore specific for ferric ion. Currently, ail is the primary target gene for nucleic acid detection of pathogenic Y. enterocolitica. Results The genes ail and foxA in 271 pathogenic and 27 non-pathogenic Y. enterocolitica strains isolated from China and 10 reference strains were sequenced, aligned, compared to the ail and foxA sequences of Yersinia enterocolitica subsp. enterocolitica 8081 (Genbank: NC_008800, and analyzed for sequence polymorphism. The ail from the 282 strains showed 3 sequence patterns: 277 strains of serotypes O:3, O:9 and O:5, 27 with identical nucleic acid sequences formed pattern A1; 4 strains of serotype 1B/O:8 with identical nucleic acid sequences formed pattern A2; and one Chinese isolate 2/O:9 formed pattern A3. In the primary coding region of the foxA ORF (Genebank: X60447 nt 433-1866; nt 28 to 1,461 in the ORF, the sequences formed 3 groups and were further divided into 8 sequence patterns. Conclusion The ail and foxA loci of pathogenic Y. enterocolitica have been analyzed. The ail sequence was highly conserved among the same serotype strains from different sources; and foxA was highly conserved among the pathogenic strains, although there was some sequence diversity. Fewer strains were used from outside China, which is a limitation of the study.

  2. Rapidly evolving genes in pathogens: methods for detecting positive selection and examples among fungi, bacteria, viruses and protists.

    Science.gov (United States)

    Aguileta, Gabriela; Refrégier, Guislaine; Yockteng, Roxana; Fournier, Elisabeth; Giraud, Tatiana

    2009-07-01

    The ongoing coevolutionary struggle between hosts and pathogens, with hosts evolving to escape pathogen infection and pathogens evolving to escape host defences, can generate an 'arms race', i.e., the occurrence of recurrent selective sweeps that each favours a novel resistance or virulence allele that goes to fixation. Host-pathogen coevolution can alternatively lead to a 'trench warfare', i.e., balancing selection, maintaining certain alleles at loci involved in host-pathogen recognition over long time scales. Recently, technological and methodological progress has enabled detection of footprints of selection directly on genes, which can provide useful insights into the processes of coevolution. This knowledge can also have practical applications, for instance development of vaccines or drugs. Here we review the methods for detecting genes under positive selection using divergence data (i.e., the ratio of nonsynonymous to synonymous substitution rates, d(N)/d(S)). We also review methods for detecting selection using polymorphisms, such as methods based on F(ST) measures, frequency spectrum, linkage disequilibrium and haplotype structure. In the second part, we review examples where targets of selection have been identified in pathogens using these tests. Genes under positive selection in pathogens have mostly been sought among viruses, bacteria and protists, because of their paramount importance for human health. Another focus is on fungal pathogens owing to their agronomic importance. We finally discuss promising directions in pathogen studies, such as detecting selection in non-coding regions.

  3. Evaluating surveillance strategies for the early detection of low pathogenicity avian influenza infections.

    Science.gov (United States)

    Comin, Arianna; Stegeman, Arjan; Marangon, Stefano; Klinkenberg, Don

    2012-01-01

    In recent years, the early detection of low pathogenicity avian influenza (LPAI) viruses in poultry has become increasingly important, given their potential to mutate into highly pathogenic viruses. However, evaluations of LPAI surveillance have mainly focused on prevalence and not on the ability to act as an early warning system. We used a simulation model based on data from Italian LPAI epidemics in turkeys to evaluate different surveillance strategies in terms of their performance as early warning systems. The strategies differed in terms of sample size, sampling frequency, diagnostic tests, and whether or not active surveillance (i.e., routine laboratory testing of farms) was performed, and were also tested under different epidemiological scenarios. We compared surveillance strategies by simulating within-farm outbreaks. The output measures were the proportion of infected farms that are detected and the farm reproduction number (R(h)). The first one provides an indication of the sensitivity of the surveillance system to detect within-farm infections, whereas R(h) reflects the effectiveness of outbreak detection (i.e., if detection occurs soon enough to bring an epidemic under control). Increasing the sampling frequency was the most effective means of improving the timeliness of detection (i.e., it occurs earlier), whereas increasing the sample size increased the likelihood of detection. Surveillance was only effective in preventing an epidemic if actions were taken within two days of sampling. The strategies were not affected by the quality of the diagnostic test, although performing both serological and virological assays increased the sensitivity of active surveillance. Early detection of LPAI outbreaks in turkeys can be achieved by increasing the sampling frequency for active surveillance, though very frequent sampling may not be sustainable in the long term. We suggest that, when no LPAI virus is circulating yet and there is a low risk of virus introduction

  4. Evaluating surveillance strategies for the early detection of low pathogenicity avian influenza infections.

    Directory of Open Access Journals (Sweden)

    Arianna Comin

    Full Text Available In recent years, the early detection of low pathogenicity avian influenza (LPAI viruses in poultry has become increasingly important, given their potential to mutate into highly pathogenic viruses. However, evaluations of LPAI surveillance have mainly focused on prevalence and not on the ability to act as an early warning system. We used a simulation model based on data from Italian LPAI epidemics in turkeys to evaluate different surveillance strategies in terms of their performance as early warning systems. The strategies differed in terms of sample size, sampling frequency, diagnostic tests, and whether or not active surveillance (i.e., routine laboratory testing of farms was performed, and were also tested under different epidemiological scenarios. We compared surveillance strategies by simulating within-farm outbreaks. The output measures were the proportion of infected farms that are detected and the farm reproduction number (R(h. The first one provides an indication of the sensitivity of the surveillance system to detect within-farm infections, whereas R(h reflects the effectiveness of outbreak detection (i.e., if detection occurs soon enough to bring an epidemic under control. Increasing the sampling frequency was the most effective means of improving the timeliness of detection (i.e., it occurs earlier, whereas increasing the sample size increased the likelihood of detection. Surveillance was only effective in preventing an epidemic if actions were taken within two days of sampling. The strategies were not affected by the quality of the diagnostic test, although performing both serological and virological assays increased the sensitivity of active surveillance. Early detection of LPAI outbreaks in turkeys can be achieved by increasing the sampling frequency for active surveillance, though very frequent sampling may not be sustainable in the long term. We suggest that, when no LPAI virus is circulating yet and there is a low risk of virus

  5. Development of saliva-based exposure assays for detecting exposure to waterborne pathogens

    Science.gov (United States)

    Identifying which pathogens we are exposed to can be challenging because many types of pathogens can be found in water and many pathogens have similar symptoms. EPA scientists have developed a simple way to measure human exposure to waterborne pathogens.

  6. Detection of bacteriocins produced by plant pathogenic bacteria from the general Erwinia, Pseudomonas and Xanthomonas

    International Nuclear Information System (INIS)

    Biagi, C.M.R. de

    1992-01-01

    Detection of bacteriocin production was studied under distinct conditions using strains of plant pathogenic bacteria from the genera Erwinia, Pseudomonas and Xanthomonas. 58.06%, 79.31% and 40.00% of producing strains were found respectively in the three groups of bacteria using the 523 medium which was the best for the detection of bacteriocin production. Increasing agar concentrations added to the medium up to 1,5% improved the detection. The amount of medium added to the Petri dishes did not affect bacteriocin production. The longest incubation time (72 h.) improved the detection of haloes production. Ultra-violet irradiation in low dosages seems to improve the visualization of haloes production but this is dependent on the tested strains. (author)

  7. Detection of human bacterial pathogens in ticks collected from Louisiana black bears (Ursus americanus luteolus).

    Science.gov (United States)

    Leydet, Brian F; Liang, Fang-Ting

    2013-04-01

    There are 4 major human-biting tick species in the northeastern United States, which include: Amblyomma americanum, Amblyomma maculatum, Dermacentor variabilis, and Ixodes scapularis. The black bear is a large mammal that has been shown to be parasitized by all the aforementioned ticks. We investigated the bacterial infections in ticks collected from Louisiana black bears (Ursus americanus subspecies luteolus). Eighty-six ticks were collected from 17 black bears in Louisiana from June 2010 to March 2011. All 4 common human-biting tick species were represented. Each tick was subjected to polymerase chain reaction (PCR) targeting select bacterial pathogens and symbionts. Bacterial DNA was detected in 62% of ticks (n=53). Rickettsia parkeri, the causative agent of an emerging spotted fever group rickettsiosis, was identified in 66% of A. maculatum, 28% of D. variabilis, and 11% of I. scapularis. The Lyme disease bacterium, Borrelia burgdorferi, was detected in 2 I. scapularis, while one A. americanum was positive for Borrelia bissettii, a putative human pathogen. The rickettsial endosymbionts Candidatus Rickettsia andeanae, rickettsial endosymbiont of I. scapularis, and Rickettsia amblyommii were detected in their common tick hosts at 21%, 39%, and 60%, respectively. All ticks were PCR-negative for Anaplasma phagocytophilum, Ehrlichia spp., and Babesia microti. This is the first reported detection of R. parkeri in vector ticks in Louisiana; we also report the novel association of R. parkeri with I. scapularis. Detection of both R. parkeri and B. burgdorferi in their respective vectors in Louisiana demands further investigation to determine potential for human exposure to these pathogens. Copyright © 2013 Elsevier GmbH. All rights reserved.

  8. Detection of Respiratory Pathogens in Parapneumonic Effusions by Hypothesis-free, Next-Generation Sequencing (NGS)

    Science.gov (United States)

    Ampofo, Krow; Pavia, Andrew; Blaschke, Anne J; Schlaberg, Robert

    2017-01-01

    Abstract Background Species-specific polymerase chain reaction (PCR) testing of pleural fluid (PF) from children with parapneumonic effusion (PPE) has increased pathogen identification in pediatric PPE. However, a pathogen is not detected in 25–35% of cases. Hypothesis-free, next-generation sequencing (NGS) provides a more comprehensive alternative and has led to pathogen detection in PCR-negative samples. However, the utility of NGS in the evaluation of PF from children with PPE is unknown. Methods Archived PF (n = 20) from children younger than 18 years with PPE and hospitalized at Primary Children’s Hospital, Utah, in 2015 and previously tested by PCR were evaluated. Ten PCR-negative and 10 PCR-positive PF specimens were tested using RNA-seq at an average depth of 7.7×106 sequencing reads per sample. NGS data were analyzed with Taxonomer. We compared pathogens detected by blood and PF culture, PCR, and NGS. Results Overall, compared with blood/PF culture, PF PCR and PF NGS testing of PF increased bacterial identification from 15% to 50% (P < 0.05) and 65% (P = 0.003), respectively. Pathogen detection in PF by PCR and NGS were comparable (50 vs. 65%, p = NS) (Table). However, compared with PF PCR, NGS significantly increased detection of S. pyogenes (20% vs. 55%; P < 0.05), with 100% concordance when detected by PCR and culture. Detection of Fusobacterium spp. (10 vs. 10%) by PF NGS and PF PCR were comparable. In contrast, there was no detection of S. pneumoniae (15 vs. 0%) by PF NGS compared with PF PCR. Conclusion PF NGS testing significantly improves bacterial identification and comparable to PF PCR testing, which can help inform antimicrobial selection. However there were differences in detection of S. pneumoniae and S. pyogenes. Further studies of NGS testing of PF of children with PPE are needed to assess its potential in the evaluation of PPE in children. Positive by culturea and PCR (n = 10) Negative by culturea and PCR (n = 10

  9. Combining information of autonomic modulation and CGM measurements enables prediction and improves detection of spontaneous hypoglycemic events

    DEFF Research Database (Denmark)

    Cichosz, Simon Lebech; Frystyk, Jan; Tarnow, Lise

    2015-01-01

    We have previously tested, in a laboratory setting, a novel algorithm that enables prediction of hypoglycemia. The algorithm integrates information of autonomic modulation, based on heart rate variability (HRV), and data based on a continuous glucose monitoring (CGM) device. Now, we investigate...... whether the algorithm is suitable for prediction of hypoglycemia and for improvement of hypoglycemic detection during normal daily activities. Twenty-one adults (13 men) with T1D prone to hypoglycemia were recruited and monitored with CGM and a Holter device while they performed normal daily activities....... We used our developed algorithm (a pattern classification method) to predict spontaneous hypoglycemia based on CGM and HRV. We compared 3 different models; (i) a model containing raw data from the CGM device; (ii) a CGM* model containing data derived from the CGM device signal; and (iii) a CGM...

  10. Molecular detection of tick-borne pathogens in wild red foxes (Vulpes vulpes) from Central Italy.

    Science.gov (United States)

    Ebani, Valentina Virginia; Rocchigiani, Guido; Nardoni, Simona; Bertelloni, Fabrizio; Vasta, Violetta; Papini, Roberto Amerigo; Verin, Ranieri; Poli, Alessandro; Mancianti, Francesca

    2017-08-01

    Spleen samples from 153 red foxes, shot during regular hunting season in the province of Pisa (Central Italy), were examined to detect DNA of Anaplasma phagocytophilum, Ehrlichia canis, Coxiella burnetii, Francisella tularensis, Hepatozoon canis and Babesia sp./Theileria sp. DNA of vector-borne pathogens was detected in 120 (78.43%; 95% CI: 71.06-84.66%) foxes. Specifically, 75 (49%; 95% CI: 40.86-57.22%) animals scored PCR-positive per H. canis, 68 (44.44%; 95% CI: 36.42-52.69%) for E. canis, 35 (22.88%; 95% CI: 16.48-30.35%) for piroplasms (Theileria annae), 3 (1.96%; 95% CI: 0.41-5.62%) for C. burnetii and 1 (0.65%; 95% CI: 0.02-3.59%) for A. phagocytophilum. No positive reaction was observed for F. tularensis. Fifty-six animals (36.6%; 95% CI: 28.97-44.76%) were positive for two or three pathogens. Red foxes result to be involved in the cycle of vector-borne pathogens that are associated to disease in dogs and humans. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. [Detection of biofilm formation by selected pathogens relevant to the food industry].

    Science.gov (United States)

    Šilhová-Hrušková, L; Moťková, P; Šilha, D; Vytřasová, J

    2015-09-01

    Detection of biofilm formation by microbial pathogens relevant to the food industry and comparison of biofilm formation under different conditions of culture. The following microorganisms were selected for the study: Staphylococcus aureus, Listeria innocua, Listeria ivanovii, Cronobacter sakazakii, Cronobacter muytjensii, Arcobacter butzleri, Arcobacter cryaerophilus, Campylobacter jejuni, and Campylobacter coli. To detect biofilm formation the microtiter plate assay, as described by Christensen and culture on stainless steel coupons were used. The biofilm forming capacity was confirmed in all microorganisms tested, both on the microtiter plates and stainless steel coupons. Biofilm formation was influenced by the culture medium, material used, and culture duration as well as by the test microorganism. It was found that different species and strains of the same genus differ in biofilm formation. Differences were also found between the collection strains and isolates from the environment. Some bacteria tended to form biofilm more readily on the surface of the polyethylene microtiter plates and less readily on stainless steel coupons while others appeared to have an opposite tendency. Some pathogens were able to increase the planktonic cell density in the initial suspension even by three orders of magnitude within 72 hours while producing plenty of biofilm. The study of biofilm formation by high risk pathogens is of utmost importance, not only to the food industry. From the obtained results, it is evident that bacterial biofilms form rapidly (within 24 hours in the present study). Due to their architecture, these biofilms are difficult to eradicate, and therefore, it is crucial to prevent biofilm formation.

  12. Fluorescent Silica Nanoparticles in the Detection and Control of the Growth of Pathogen

    International Nuclear Information System (INIS)

    Chitra, K.; Annadurai, G.

    2013-01-01

    In this present study the bio conjugated fluorescent silica nanoparticles give an efficient fluorescent-based immunoassay for the detection of pathogen. The synthesized silica nanoparticles were poly dispersed and the size of the silica nanoparticles was in the range of 114-164 nm. The energy dispersive X-ray spectrophotometer showed the presence of silica at 1.8 keV and the selected area diffractometer showed amorphous nature of silica nanoparticles. The FTIR spectrum confirmed the attachment of dye and carboxyl group onto the silica nanoparticles surface. The fluorescent silica nanoparticles showed highly efficient fluorescence and the fluorescent emission of silica nanoparticles occurred at 536 nm. The SEM image showed the aggregation of nanoparticles and bacteria. The growth of the pathogenic E. coli was controlled using silica nanoparticles; therefore silica nanoparticles could be used in food packaging material, biomedical material, and so forth. This work provides a rapid, simple, and accurate method for the detection of pathogen using fluorescent-based immunoassay.

  13. Development of a real-time PCR for the detection of pathogenic Leptospira spp. in California sea lions.

    Science.gov (United States)

    Wu, Qingzhong; Prager, Katherine C; Goldstein, Tracey; Alt, David P; Galloway, Renee L; Zuerner, Richard L; Lloyd-Smith, James O; Schwacke, Lori

    2014-08-11

    Several real-time PCR assays are currently used for detection of pathogenic Leptospira spp.; however, few methods have been described for the successful evaluation of clinical urine samples. This study reports a rapid assay for the detection of pathogenic Leptospira spp. in California sea lions Zalophus californianus using real-time PCR with primers and a probe targeting the lipL32 gene. The PCR assay had high analytic sensitivity-the limit of detection was 3 genome copies per PCR volume using L. interrogans serovar Pomona DNA and 100% analytic specificity; it detected all pathogenic leptospiral serovars tested and none of the non-pathogenic Leptospira species (L. biflexa and L. meyeri serovar Semaranga), the intermediate species L. inadai, or the non-Leptospira pathogens tested. Our assay had an amplification efficiency of 1.00. Comparisons between the real-time PCR assay and culture isolation for detection of pathogenic Leptospira spp. in urine and kidney tissue samples from California sea lions showed that samples were more often positive by real-time PCR than by culture methods. Inclusion of an internal amplification control in the real-time PCR assay showed no inhibitory effects in PCR negative samples. These studies indicated that our real-time PCR assay has high analytic sensitivity and specificity for the rapid detection of pathogenic Leptospira species in urine and kidney tissue samples.

  14. Loop-mediated isothermal amplification: an emerging technology for detection of fish and shellfish pathogens.

    Science.gov (United States)

    Savan, R; Kono, T; Itami, T; Sakai, M

    2005-10-01

    Fish and shellfish diseases are a constant threat to the sustainability and economic viability of aquaculture. Early diagnosis plays a vital role in management of fish and shellfish diseases. Traditionally, various biochemical and serological tests have been used for fish disease diagnosis. However, the time and expertise required for such diagnoses makes it difficult for aquaculturists to easily adopt them under production conditions. Polymerase chain reaction and probe-based nucleic acid detection have become increasingly popular in fish and shellfish diagnostics. Recently, a novel technique called loop-mediated isothermal amplification (LAMP) has been developed, which is highly sensitive and rapid. LAMP has been used for the detection of bacterial, viral, fungal and parasitic diseases in both animal and plants. In aquaculture, LAMP-based detection of pathogens like Edwardsiella tarda, E. ictaluri, Nocardia seriolae, Tetracapsuloides bryosalmonae, white spot syndrome virus and infectious haematopoietic necrosis virus have been reported. In this review, the application of LAMP for the detection of aquaculture-associated pathogens is discussed.

  15. New Trends in Impedimetric Biosensors for the Detection of Foodborne Pathogenic Bacteria

    Directory of Open Access Journals (Sweden)

    Yixian Wang

    2012-03-01

    Full Text Available The development of a rapid, sensitive, specific method for the foodborne pathogenic bacteria detection is of great importance to ensure food safety and security. In recent years impedimetric biosensors which integrate biological recognition technology and impedance have gained widespread application in the field of bacteria detection. This paper presents an overview on the progress and application of impedimetric biosensors for detection of foodborne pathogenic bacteria, particularly the new trends in the past few years, including the new specific bio-recognition elements such as bacteriophage and lectin, the use of nanomaterials and microfluidics techniques. The applications of these new materials or techniques have provided unprecedented opportunities for the development of high-performance impedance bacteria biosensors. The significant developments of impedimetric biosensors for bacteria detection in the last five years have been reviewed according to the classification of with or without specific bio-recognition element. In addition, some microfluidics systems, which were used in the construction of impedimetric biosensors to improve analytical performance, are introduced in this review.

  16. Nucleic Acid-Based Detection and Identification of Bacterial and Fungal Plant Pathogens - Final Report

    Energy Technology Data Exchange (ETDEWEB)

    Kingsley, Mark T.

    2001-03-13

    The threat to American interests from terrorists is not limited to attacks against humans. Terrorists might seek to inflict damage to the U.S. economy by attacking our agricultural sector. Infection of commodity crops by bacterial or fungal crop pathogens could adversely impact U.S. agriculture, either directly from damage to crops or indirectly from damage to our ability to export crops suspected of contamination. Recognizing a terrorist attack against U.S. agriculture, to be able to prosecute the terrorists, is among the responsibilities of the members of Hazardous Material Response Unit (HMRU) of the Federal Bureau of Investigation (FBI). Nucleic acid analysis of plant pathogen strains by the use of polymerase chain reaction (PCR) amplification techniques is a powerful method for determining the exact identity of pathogens, as well as their possible region of origin. This type of analysis, however, requires that PCR assays be developed specific to each particular pathogen strain, and analysis protocols developed that are specific to the particular instrument used for detection. The objectives of the work described here were threefold: 1) to assess the potential terrorist threat to U.S. agricultural crops, 2) to determine whether suitable assays exist to monitor that threat, and 3) where assays are needed for priority plant pathogen threats, to modify or develop those assays for use by specialists at the HMRU. The assessment of potential threat to U.S. commodity crops and the availability of assays for those threats were described in detail in the Technical Requirements Document (9) and will be summarized in this report. This report addresses development of specific assays identified in the Technical Requirements Document, and offers recommendations for future development to ensure that HMRU specialists will be prepared with the PCR assays they need to protect against the threat of economic terrorism.

  17. Detection of pathogenic viruses in sewage provided early warnings of hepatitis A virus and norovirus outbreaks.

    Science.gov (United States)

    Hellmér, Maria; Paxéus, Nicklas; Magnius, Lars; Enache, Lucica; Arnholm, Birgitta; Johansson, Annette; Bergström, Tomas; Norder, Heléne

    2014-11-01

    Most persons infected with enterically transmitted viruses shed large amounts of virus in feces for days or weeks, both before and after onset of symptoms. Therefore, viruses causing gastroenteritis may be detected in wastewater, even if only a few persons are infected. In this study, the presence of eight pathogenic viruses (norovirus, astrovirus, rotavirus, adenovirus, Aichi virus, parechovirus, hepatitis A virus [HAV], and hepatitis E virus) was investigated in sewage to explore whether their identification could be used as an early warning of outbreaks. Samples of the untreated sewage were collected in proportion to flow at Ryaverket, Gothenburg, Sweden. Daily samples collected during every second week between January and May 2013 were pooled and analyzed for detection of viruses by concentration through adsorption to milk proteins and PCR. The largest amount of noroviruses was detected in sewage 2 to 3 weeks before most patients were diagnosed with this infection in Gothenburg. The other viruses were detected at lower levels. HAV was detected between weeks 5 and 13, and partial sequencing of the structural VP1protein identified three different strains. Two strains were involved in an ongoing outbreak in Scandinavia and were also identified in samples from patients with acute hepatitis A in Gothenburg during spring of 2013. The third strain was unique and was not detected in any patient sample. The method used may thus be a tool to detect incipient outbreaks of these viruses and provide early warning before the causative pathogens have been recognized in health care. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  18. Rapid and high-throughput detection of highly pathogenic bacteria by Ibis PLEX-ID technology.

    Directory of Open Access Journals (Sweden)

    Daniela Jacob

    Full Text Available In this manuscript, we describe the identification of highly pathogenic bacteria using an assay coupling biothreat group-specific PCR with electrospray ionization mass spectrometry (PCR/ESI-MS run on an Ibis PLEX-ID high-throughput platform. The biothreat cluster assay identifies most of the potential bioterrorism-relevant microorganisms including Bacillus anthracis, Francisella tularensis, Yersinia pestis, Burkholderia mallei and pseudomallei, Brucella species, and Coxiella burnetii. DNA from 45 different reference materials with different formulations and different concentrations were chosen and sent to a service screening laboratory that uses the PCR/ESI-MS platform to provide a microbial identification service. The standard reference materials were produced out of a repository built up in the framework of the EU funded project "Establishment of Quality Assurances for Detection of Highly Pathogenic Bacteria of Potential Bioterrorism Risk" (EQADeBa. All samples were correctly identified at least to the genus level.

  19. Development and application of an oligonucleotide microarray and real-time quantitative PCR for detection of wastewater bacterial pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Dae-Young [National Water Research Institute, Environment Canada, 867 Lakeshore Road, Burlington, Ontario, L7R 4A6 (Canada)], E-mail: daeyoung.lee@ec.gc.ca; Lauder, Heather; Cruwys, Heather; Falletta, Patricia [National Water Research Institute, Environment Canada, 867 Lakeshore Road, Burlington, Ontario, L7R 4A6 (Canada); Beaudette, Lee A. [Environmental Science and Technology Centre, Environment Canada, 335 River Road South, Ottawa, Ontario, K1A 0H3 (Canada)], E-mail: lee.beaudette@ec.gc.ca

    2008-07-15

    Conventional microbial water quality test methods are well known for their technical limitations, such as lack of direct pathogen detection capacity and low throughput capability. The microarray assay has recently emerged as a promising alternative for environmental pathogen monitoring. In this study, bacterial pathogens were detected in municipal wastewater using a microarray equipped with short oligonucleotide probes targeting 16S rRNA sequences. To date, 62 probes have been designed against 38 species, 4 genera, and 1 family of pathogens. The detection sensitivity of the microarray for a waterborne pathogen Aeromonas hydrophila was determined to be approximately 1.0% of the total DNA, or approximately 10{sup 3}A. hydrophila cells per sample. The efficacy of the DNA microarray was verified in a parallel study where pathogen genes and E. coli cells were enumerated using real-time quantitative PCR (qPCR) and standard membrane filter techniques, respectively. The microarray and qPCR successfully detected multiple wastewater pathogen species at different stages of the disinfection process (i.e. secondary effluents vs. disinfected final effluents) and at two treatment plants employing different disinfection methods (i.e. chlorination vs. UV irradiation). This result demonstrates the effectiveness of the DNA microarray as a semi-quantitative, high throughput pathogen monitoring tool for municipal wastewater.

  20. Development and application of an oligonucleotide microarray and real-time quantitative PCR for detection of wastewater bacterial pathogens

    International Nuclear Information System (INIS)

    Lee, Dae-Young; Lauder, Heather; Cruwys, Heather; Falletta, Patricia; Beaudette, Lee A.

    2008-01-01

    Conventional microbial water quality test methods are well known for their technical limitations, such as lack of direct pathogen detection capacity and low throughput capability. The microarray assay has recently emerged as a promising alternative for environmental pathogen monitoring. In this study, bacterial pathogens were detected in municipal wastewater using a microarray equipped with short oligonucleotide probes targeting 16S rRNA sequences. To date, 62 probes have been designed against 38 species, 4 genera, and 1 family of pathogens. The detection sensitivity of the microarray for a waterborne pathogen Aeromonas hydrophila was determined to be approximately 1.0% of the total DNA, or approximately 10 3 A. hydrophila cells per sample. The efficacy of the DNA microarray was verified in a parallel study where pathogen genes and E. coli cells were enumerated using real-time quantitative PCR (qPCR) and standard membrane filter techniques, respectively. The microarray and qPCR successfully detected multiple wastewater pathogen species at different stages of the disinfection process (i.e. secondary effluents vs. disinfected final effluents) and at two treatment plants employing different disinfection methods (i.e. chlorination vs. UV irradiation). This result demonstrates the effectiveness of the DNA microarray as a semi-quantitative, high throughput pathogen monitoring tool for municipal wastewater

  1. Real-time PCR for detection and quantification of fungal and oomycete tomato pathogens in plant and soil samples

    NARCIS (Netherlands)

    Lievens, B.; Brouwer, M.; Vanachter, A.C.R.C.; Cammue, B.P.A.; Thomma, B.P.H.J.

    2006-01-01

    Although new, rapid detection and identification technologies are becoming available more and more for various plant pathogens, pathogen quantification remains one of the main challenges in the disease management of many crops. Currently, real-time polymerase chain reaction (PCR) is the most

  2. Colour-based Object Detection and Tracking for Autonomous Quadrotor UAV

    Science.gov (United States)

    Kadouf, Hani Hunud A.; Mohd Mustafah, Yasir

    2013-12-01

    With robotics becoming a fundamental aspect of modern society, further research and consequent application is ever increasing. Aerial robotics, in particular, covers applications such as surveillance in hostile military zones or search and rescue operations in disaster stricken areas, where ground navigation is impossible. The increased visual capacity of UAV's (Unmanned Air Vehicles) is also applicable in the support of ground vehicles to provide supplies for emergency assistance, for scouting purposes or to extend communication beyond insurmountable land or water barriers. The Quadrotor, which is a small UAV has its lift generated by four rotors and can be controlled by altering the speeds of its motors relative to each other. The four rotors allow for a higher payload than single or dual rotor UAVs, which makes it safer and more suitable to carry camera and transmitter equipment. An onboard camera is used to capture and transmit images of the Quadrotor's First Person View (FPV) while in flight, in real time, wirelessly to a base station. The aim of this research is to develop an autonomous quadrotor platform capable of transmitting real time video signals to a base station for processing. The result from the image analysis will be used as a feedback in the quadrotor positioning control. To validate the system, the algorithm should have the capacity to make the quadrotor identify, track or hover above stationary or moving objects.

  3. Colour-based Object Detection and Tracking for Autonomous Quadrotor UAV

    International Nuclear Information System (INIS)

    Kadouf, Hani Hunud A; Mustafah, Yasir Mohd

    2013-01-01

    With robotics becoming a fundamental aspect of modern society, further research and consequent application is ever increasing. Aerial robotics, in particular, covers applications such as surveillance in hostile military zones or search and rescue operations in disaster stricken areas, where ground navigation is impossible. The increased visual capacity of UAV's (Unmanned Air Vehicles) is also applicable in the support of ground vehicles to provide supplies for emergency assistance, for scouting purposes or to extend communication beyond insurmountable land or water barriers. The Quadrotor, which is a small UAV has its lift generated by four rotors and can be controlled by altering the speeds of its motors relative to each other. The four rotors allow for a higher payload than single or dual rotor UAVs, which makes it safer and more suitable to carry camera and transmitter equipment. An onboard camera is used to capture and transmit images of the Quadrotor's First Person View (FPV) while in flight, in real time, wirelessly to a base station. The aim of this research is to develop an autonomous quadrotor platform capable of transmitting real time video signals to a base station for processing. The result from the image analysis will be used as a feedback in the quadrotor positioning control. To validate the system, the algorithm should have the capacity to make the quadrotor identify, track or hover above stationary or moving objects

  4. Detection of pathogens by real-time PCR in adult patients with acute exacerbation of bronchial asthma.

    Science.gov (United States)

    Yoshii, Yutaka; Shimizu, Kenichiro; Morozumi, Miyuki; Chiba, Naoko; Ubukata, Kimiko; Uruga, Hironori; Hanada, Shigeo; Wakui, Hiroshi; Minagawa, Shunsuke; Hara, Hiromichi; Numata, Takanori; Saito, Keisuke; Araya, Jun; Nakayama, Katsutoshi; Kishi, Kazuma; Kuwano, Kazuyoshi

    2017-11-22

    Respiratory tract infection is a major cause of acute exacerbation of bronchial asthma (AEBA). Although recent findings suggest that common bacteria are causally associated with AEBA, a comprehensive epidemiologic analysis of infectious pathogens including common/atypical bacteria and viruses in AEBA has not been performed. Accordingly, we attempted to detect pathogens during AEBA by using real-time polymerase chain reaction (PCR) in comparison to conventional methods. We prospectively enroled adult patients with AEBA from August 2012 to March 2014. Infectious pathogens collected in nasopharyngeal swab and sputum samples were examined in each patient by conventional methods and real-time PCR, which can detect 6 bacterial and 11 viral pathogens. The causal association of these pathogens with AEBA severity and their frequency of monthly distribution were also examined. Among the 64 enroled patients, infectious pathogens were detected in 49 patients (76.6%) using real-time PCR and in 14 patients (21.9%) using conventional methods (p Real-time PCR detected bacteria in 29 patients (45.3%) and respiratory viruses in 28 patients (43.8%). Haemophilus influenzae was the most frequently detected microorganism (26.6%), followed by rhinovirus (15.6%). Influenza virus was the significant pathogen associated with severe AEBA. Moreover, AEBA occurred most frequently during November to January. Real-time PCR was more useful than conventional methods to detect infectious pathogens in patients with AEBA. Accurate detection of pathogens with real-time PCR may enable the selection of appropriate anti-bacterial/viral agents as a part of the treatment for AEBA.

  5. High Throughput, Multiplexed Pathogen Detection Authenticates Plague Waves in Medieval Venice, Italy

    Science.gov (United States)

    Tran, Thi-Nguyen-Ny; Signoli, Michel; Fozzati, Luigi; Aboudharam, Gérard; Raoult, Didier; Drancourt, Michel

    2011-01-01

    Background Historical records suggest that multiple burial sites from the 14th–16th centuries in Venice, Italy, were used during the Black Death and subsequent plague epidemics. Methodology/Principal Findings High throughput, multiplexed real-time PCR detected DNA of seven highly transmissible pathogens in 173 dental pulp specimens collected from 46 graves. Bartonella quintana DNA was identified in five (2.9%) samples, including three from the 16th century and two from the 15th century, and Yersinia pestis DNA was detected in three (1.7%) samples, including two from the 14th century and one from the 16th century. Partial glpD gene sequencing indicated that the detected Y. pestis was the Orientalis biotype. Conclusions These data document for the first time successive plague epidemics in the medieval European city where quarantine was first instituted in the 14th century. PMID:21423736

  6. High throughput, multiplexed pathogen detection authenticates plague waves in medieval Venice, Italy.

    Science.gov (United States)

    Tran, Thi-Nguyen-Ny; Signoli, Michel; Fozzati, Luigi; Aboudharam, Gérard; Raoult, Didier; Drancourt, Michel

    2011-03-10

    Historical records suggest that multiple burial sites from the 14th-16th centuries in Venice, Italy, were used during the Black Death and subsequent plague epidemics. High throughput, multiplexed real-time PCR detected DNA of seven highly transmissible pathogens in 173 dental pulp specimens collected from 46 graves. Bartonella quintana DNA was identified in five (2.9%) samples, including three from the 16th century and two from the 15th century, and Yersinia pestis DNA was detected in three (1.7%) samples, including two from the 14th century and one from the 16th century. Partial glpD gene sequencing indicated that the detected Y. pestis was the Orientalis biotype. These data document for the first time successive plague epidemics in the medieval European city where quarantine was first instituted in the 14th century.

  7. High throughput, multiplexed pathogen detection authenticates plague waves in medieval Venice, Italy.

    Directory of Open Access Journals (Sweden)

    Thi-Nguyen-Ny Tran

    Full Text Available BACKGROUND: Historical records suggest that multiple burial sites from the 14th-16th centuries in Venice, Italy, were used during the Black Death and subsequent plague epidemics. METHODOLOGY/PRINCIPAL FINDINGS: High throughput, multiplexed real-time PCR detected DNA of seven highly transmissible pathogens in 173 dental pulp specimens collected from 46 graves. Bartonella quintana DNA was identified in five (2.9% samples, including three from the 16th century and two from the 15th century, and Yersinia pestis DNA was detected in three (1.7% samples, including two from the 14th century and one from the 16th century. Partial glpD gene sequencing indicated that the detected Y. pestis was the Orientalis biotype. CONCLUSIONS: These data document for the first time successive plague epidemics in the medieval European city where quarantine was first instituted in the 14th century.

  8. Multiplexed lateral flow microarray assay for detection of citrus pathogens Xylella fastidiosa and Xanthomonas axonopodis pv citri

    Energy Technology Data Exchange (ETDEWEB)

    Cary,; Bruce, R [Santa Fe, NM; Stubben, Christopher J [Los Alamos, NM

    2011-03-22

    The invention provides highly sensitive and specific assays for the major citrus pathogens Xylella fastidiosa and Xanthomonas axonopodis, including a field deployable multiplexed assay capable of rapidly assaying for both pathogens simultaneously. The assays are directed at particular gene targets derived from pathogenic strains that specifically cause the major citrus diseases of citrus variegated chlorosis (Xylella fastidiosa 9a5c) and citrus canker (Xanthomonas axonopodis pv citri). The citrus pathogen assays of the invention offer femtomole sensitivity, excellent linear dynamic range, and rapid and specific detection.

  9. Simultaneous aptasensor for multiplex pathogenic bacteria detection based on multicolor upconversion nanoparticles labels.

    Science.gov (United States)

    Wu, Shijia; Duan, Nuo; Shi, Zhao; Fang, Congcong; Wang, Zhouping

    2014-03-18

    A highly sensitive and specific multiplex method for the simultaneous detection of three pathogenic bacteria was fabricated using multicolor upconversion nanoparticles (UCNPs) as luminescence labels coupled with aptamers as the molecular recognition elements. Multicolor UCNPs were synthesized via doping with various rare-earth ions to obtain well-separated emission peaks. The aptamer sequences were selected using the systematic evolution of ligands by exponential enrichment (SELEX) strategy for Staphylococcus aureus, Vibrio parahemolyticus, and Salmonella typhimurium. When applied in this method, aptamers can be used for the specific recognition of the bacteria from complex mixtures, including those found in real food matrixes. Aptamers and multicolor UCNPs were employed to selectively capture and simultaneously quantify the three target bacteria on the basis of the independent peaks. Under optimal conditions, the correlation between the concentration of three bacteria and the luminescence signal was found to be linear from 50-10(6) cfu mL(-1). Improved by the magnetic separation and concentration effect of Fe3O4 magnetic nanoparticles, the limits of detection of the developed method were found to be 25, 10, and 15 cfu mL(-1) for S. aureus, V. parahemolyticus, and S. typhimurium, respectively. The capability of the bioassay in real food samples was also investigated, and the results were consistent with experimental results obtained from plate-counting methods. This proposed method for the detection of various pathogenic bacteria based on multicolor UCNPs has great potential in the application of food safety and multiplex nanosensors.

  10. Laser diagnostic technology for early detection of pathogen infestation in orange fruits

    Science.gov (United States)

    Giubileo, Gianfranco; Lai, Antonella; Piccinelli, Delinda; Puiu, Adriana

    2010-11-01

    Due to an increased expectation of food products that respect high quality and safety standards, there is a need for the growth of accurate, fast, objective and non-destructive technologies for quality determination of food and agricultural products. For this purpose, a diagnostic system based on laser photoacoustic spectroscopy (LPAS) was developed at ENEA Frascati Molecular Spectroscopy Laboratory (Italy). In the design of the photoacoustic detector, particular emphasis was placed in attaining a high sensitivity in detecting ethylene (ET) down to sub-parts per billion level (minimum detectable concentration 0.2 ppb). This was required due to the necessity to monitor and follow up ET production at a single fruit scale. ET is normally synthesised in very low amounts by healthy citrus fruits; however stress conditions such as pathogen attack may induce a substantial increase in the synthesised ET. In the present paper, the comparison between the ET emitted by healthy oranges ( Citrus sinensis L. Osbeck) cv Navel and by Phytophthora citrophthora infested Navel orange fruits are reported. The obtained results show a well evident increase in ET emission from the infested fruit with respect to the healthy one, even 24 h after the inoculation with the pathogen; at that time the tissue necrosis was not yet visible, and the fruit was also not yet damaged. The possibility to perform a real time non-destructive detection of ET traces makes the LPAS a powerful tool for monitoring the healthy state of the citrus fruits.

  11. Laser diagnostic technology for early detection of pathogen infestation in orange fruits

    International Nuclear Information System (INIS)

    Giubileo, Gianfranco; Lai, Antonella; Piccinelli, Delinda; Puiu, Adriana

    2010-01-01

    Due to an increased expectation of food products that respect high quality and safety standards, there is a need for the growth of accurate, fast, objective and non-destructive technologies for quality determination of food and agricultural products. For this purpose, a diagnostic system based on laser photoacoustic spectroscopy (LPAS) was developed at ENEA Frascati Molecular Spectroscopy Laboratory (Italy). In the design of the photoacoustic detector, particular emphasis was placed in attaining a high sensitivity in detecting ethylene (ET) down to sub-parts per billion level (minimum detectable concentration 0.2 ppb). This was required due to the necessity to monitor and follow up ET production at a single fruit scale. ET is normally synthesised in very low amounts by healthy citrus fruits; however stress conditions such as pathogen attack may induce a substantial increase in the synthesised ET. In the present paper, the comparison between the ET emitted by healthy oranges (Citrus sinensis L. Osbeck) cv Navel and by Phytophthora citrophthora infested Navel orange fruits are reported. The obtained results show a well evident increase in ET emission from the infested fruit with respect to the healthy one, even 24 h after the inoculation with the pathogen; at that time the tissue necrosis was not yet visible, and the fruit was also not yet damaged. The possibility to perform a real time non-destructive detection of ET traces makes the LPAS a powerful tool for monitoring the healthy state of the citrus fruits.

  12. Laser diagnostic technology for early detection of pathogen infestation in orange fruits

    Energy Technology Data Exchange (ETDEWEB)

    Giubileo, Gianfranco, E-mail: gianfranco.giubileo@frascati.enea.i [ENEA Frascati, Via E. Fermi 45, 00044 (Italy); Lai, Antonella; Piccinelli, Delinda [ENEA Frascati, Via E. Fermi 45, 00044 (Italy); Puiu, Adriana [Tor Vergata University of Rome, Faculty of Engineering, Via del Politecnico 1, 00133 Rome (Italy)

    2010-11-11

    Due to an increased expectation of food products that respect high quality and safety standards, there is a need for the growth of accurate, fast, objective and non-destructive technologies for quality determination of food and agricultural products. For this purpose, a diagnostic system based on laser photoacoustic spectroscopy (LPAS) was developed at ENEA Frascati Molecular Spectroscopy Laboratory (Italy). In the design of the photoacoustic detector, particular emphasis was placed in attaining a high sensitivity in detecting ethylene (ET) down to sub-parts per billion level (minimum detectable concentration 0.2 ppb). This was required due to the necessity to monitor and follow up ET production at a single fruit scale. ET is normally synthesised in very low amounts by healthy citrus fruits; however stress conditions such as pathogen attack may induce a substantial increase in the synthesised ET. In the present paper, the comparison between the ET emitted by healthy oranges (Citrus sinensis L. Osbeck) cv Navel and by Phytophthora citrophthora infested Navel orange fruits are reported. The obtained results show a well evident increase in ET emission from the infested fruit with respect to the healthy one, even 24 h after the inoculation with the pathogen; at that time the tissue necrosis was not yet visible, and the fruit was also not yet damaged. The possibility to perform a real time non-destructive detection of ET traces makes the LPAS a powerful tool for monitoring the healthy state of the citrus fruits.

  13. Comparison of ePlex Respiratory Pathogen Panel with Laboratory-Developed Real-Time PCR Assays for Detection of Respiratory Pathogens.

    Science.gov (United States)

    Nijhuis, R H T; Guerendiain, D; Claas, E C J; Templeton, K E

    2017-06-01

    Infections of the respiratory tract can be caused by a diversity of pathogens, both viral and bacterial. Rapid microbiological diagnosis ensures appropriate antimicrobial therapy as well as effective implementation of isolation precautions. The ePlex respiratory pathogen panel (RP panel) is a novel molecular biology-based assay, developed by GenMark Diagnostics, Inc. (Carlsbad, CA), to be performed within a single cartridge for the diagnosis of 25 respiratory pathogens (viral and bacterial). The objective of this study was to compare the performance of the RP panel with those of laboratory-developed real-time PCR assays, using a variety of previously collected clinical respiratory specimens. A total of 343 clinical specimens as well as 29 external quality assessment (EQA) specimens and 2 different Middle East respiratory syndrome coronavirus isolates have been assessed in this study. The RP panel showed an agreement of 97.4% with the real-time PCR assay regarding 464 pathogens found in the clinical specimens. All pathogens present in clinical samples and EQA samples with a threshold cycle ( C T ) value of panel. The RP panel detected 17 additional pathogens, 7 of which could be confirmed by discrepant testing. In conclusion, this study shows excellent performance of the RP panel in comparison to real-time PCR assays for the detection of respiratory pathogens. The ePlex system provided a large amount of useful diagnostic data within a short time frame, with minimal hands-on time, and can therefore potentially be used for rapid diagnostic sample-to-answer testing, in either a laboratory or a decentralized setting. Copyright © 2017 Nijhuis et al.

  14. Exploration of Simple Analytical Approaches for Rapid Detection of Pathogenic Bacteria

    Energy Technology Data Exchange (ETDEWEB)

    Rahman, Salma [Iowa State Univ., Ames, IA (United States)

    2005-01-01

    Many of the current methods for pathogenic bacterial detection require long sample-preparation and analysis time, as well as complex instrumentation. This dissertation explores simple analytical approaches (e.g., flow cytometry and diffuse reflectance spectroscopy) that may be applied towards ideal requirements of a microbial detection system, through method and instrumentation development, and by the creation and characterization of immunosensing platforms. This dissertation is organized into six sections. In the general Introduction section a literature review on several of the key aspects of this work is presented. First, different approaches for detection of pathogenic bacteria will be reviewed, with a comparison of the relative strengths and weaknesses of each approach, A general overview regarding diffuse reflectance spectroscopy is then presented. Next, the structure and function of self-assembled monolayers (SAMs) formed from organosulfur molecules at gold and micrometer and sub-micrometer patterning of biomolecules using SAMs will be discussed. This section is followed by four research chapters, presented as separate manuscripts. Chapter 1 describes the efforts and challenges towards the creation of imunosensing platforms that exploit the flexibility and structural stability of SAMs of thiols at gold. 1H, 1H, 2H, 2H-perfluorodecyl-1-thiol SAM (PFDT) and dithio-bis(succinimidyl propionate)-(DSP)-derived SAMs were used to construct the platform. Chapter 2 describes the characterization of the PFDT- and DSP-derived SAMs, and the architectures formed when it is coupled to antibodies as well as target bacteria. These studies used infrared reflection spectroscopy (IRS), X-ray photoelectron spectroscopy (XPS), and electrochemical quartz crystal microbalance (EQCM), Chapter 3 presents a new sensitive, and portable diffuse reflection based technique for the rapid identification and quantification of pathogenic bacteria. Chapter 4 reports research efforts in the

  15. Evaluation of Luminex xTAG Gastrointestinal Pathogen Panel Assay for Detection of Multiple Diarrheal Pathogens in Fecal Samples in Vietnam.

    Science.gov (United States)

    Duong, Vu Thuy; Phat, Voong Vinh; Tuyen, Ha Thanh; Dung, Tran Thi Ngoc; Trung, Pham Duc; Minh, Pham Van; Tu, Le Thi Phuong; Campbell, James I; Le Phuc, Hoang; Ha, Ton Thi Thanh; Ngoc, Nguyen Minh; Huong, Nguyen Thi Thanh; Tam, Pham Thi Thanh; Huong, Dang Thao; Xang, Nguyen Van; Dong, Nguyen; Phuong, Le Thi; Hung, Nguyen Van; Phu, Bui Duc; Phuc, Tran My; Thwaites, Guy E; Vi, Lu Lan; Rabaa, Maia A; Thompson, Corinne N; Baker, Stephen

    2016-04-01

    Diarrheal disease is a complex syndrome that remains a leading cause of global childhood morbidity and mortality. The diagnosis of enteric pathogens in a timely and precise manner is important for making treatment decisions and informing public health policy, but accurate diagnosis is a major challenge in industrializing countries. Multiplex molecular diagnostic techniques may represent a significant improvement over classical approaches. We evaluated the Luminex xTAG gastrointestinal pathogen panel (GPP) assay for the detection of common enteric bacterial and viral pathogens in Vietnam. Microbiological culture and real-time PCR were used as gold standards. The tests were performed on 479 stool samples collected from people admitted to the hospital for diarrheal disease throughout Vietnam. Sensitivity and specificity were calculated for the xTAG GPP for the seven principal diarrheal etiologies. The sensitivity and specificity for the xTAG GPP were >88% for Shigellaspp.,Campylobacterspp., rotavirus, norovirus genotype 1/2 (GI/GII), and adenovirus compared to those of microbiological culture and/or real-time PCR. However, the specificity was low (∼60%) for Salmonella species. Additionally, a number of important pathogens that are not identified in routine hospital procedures in this setting, such as Cryptosporidiumspp. and Clostridium difficile, were detected with the GPP. The use of the Luminex xTAG GPP for the detection of enteric pathogens in settings, like Vietnam, would dramatically improve the diagnostic accuracy and capacity of hospital laboratories, allowing for timely and appropriate therapy decisions and a wider understanding of the epidemiology of pathogens associated with severe diarrheal disease in low-resource settings. Copyright © 2016 Duong et al.

  16. Pathogens of Food Animals: Sources, Characteristics, Human Risk, and Methods of Detection.

    Science.gov (United States)

    Logue, Catherine M; Barbieri, Nicolle L; Nielsen, Daniel W

    Pathogens associated with food production (livestock) animals come in many forms causing a multitude of disease for humans. For the purpose of this review, these infectious agents can be divided into three broad categories: those that are associated with bacterial disease, those that are associated with viruses, and those that are parasitic in nature. The goal of this chapter is to provide the reader with an overview of the most common pathogens that cause disease in humans through exposure via the food chain and the consequence of this exposure as well as risk and detection methods. We have also included a collection of unusual pathogens that although rare have still caused disease, and their recognition is warranted in light of emerging and reemerging diseases. These provide the reader an understanding of where the next big outbreak could occur. The influence of the global economy, the movement of people, and food makes understanding production animal-associated disease paramount to being able to address new diseases as they arise. © 2017 Elsevier Inc. All rights reserved.

  17. Prevalence of respiratory pathogens detected in dogs with kennel cough in Poland

    Directory of Open Access Journals (Sweden)

    Edyta Kaczorek

    2016-01-01

    Full Text Available Kennel cough is a multifactorial disease occurring all over the world; however, its epidemiology is still not fully understood. To the authors’ knowledge, no studies monitoring the occurrence of infectious agents responsible for kennel cough have been carried out in Poland. Therefore, the objective of our study was to determine which of the four pathogens most frequently isolated in other countries are predominant in north-eastern Poland. Swabs from the upper respiratory tract and tracheal lavage fluids from dogs (n = 40 exhibiting symptoms of this disease were analysed. Canine herpesvirus, canine parainfluenza virus, canine adenovirus type 2 and Bordetella bronchiseptica were identified by polymerase chain reaction. At least one of the above-listed infectious agents was found in all dogs. The predominant pathogen within the area under our study, both in mono- and co-infections, was canine herpesvirus (32/40, whereas canine adenovirus type 2 occurred least frequently (4/40. The effectiveness of detection of selected pathogens from both types of study material was also compared. Tracheal lavage fluid was more suitable for the isolation of canine herpes virus, canine parainfluenza virus, and Bordetella bronchiseptica. Swabs from the upper respiratory tract were more suitable for the isolation of canine adenovirus type 2.

  18. Molecular Biosensors for Electrochemical Detection of Infectious Pathogens in Liquid Biopsies: Current Trends and Challenges

    Science.gov (United States)

    Yáñez-Sedeño, Paloma

    2017-01-01

    Rapid and reliable diagnosis of infectious diseases caused by pathogens, and timely initiation of appropriate treatment are critical determinants to promote optimal clinical outcomes and general public health. Conventional in vitro diagnostics for infectious diseases are time-consuming and require centralized laboratories, experienced personnel and bulky equipment. Recent advances in electrochemical affinity biosensors have demonstrated to surpass conventional standards in regards to time, simplicity, accuracy and cost in this field. The tremendous potential offered by electrochemical affinity biosensors to detect on-site infectious pathogens at clinically relevant levels in scarcely treated body fluids is clearly stated in this review. The development and application of selected examples using different specific receptors, assay formats and electrochemical approaches focusing on the determination of specific circulating biomarkers of different molecular (genetic, regulatory and functional) levels associated with bacterial and viral pathogens are critically discussed. Existing challenges still to be addressed and future directions in this rapidly advancing and highly interesting field are also briefly pointed out. PMID:29099764

  19. Multiplex TaqMan® detection of pathogenic and multi-drug resistant Salmonella.

    Science.gov (United States)

    Singh, Prashant; Mustapha, Azlin

    2013-09-02

    Overuse of antibiotics in the medical and animal industries is one of the major causes for the development of multi-drug-resistant (MDR) food pathogens that are often difficult to treat. In the past few years, higher incidences of outbreaks caused by MDR Salmonella have been increasingly documented. The objective of this study was to develop a rapid multiplex real-time polymerase chain reaction (PCR) assay for simultaneous detection of pathogenic and MDR Salmonella spp. A multiplex TaqMan®real-time PCR was designed by targeting the invasin virulence gene (invA), and four commonly found antibiotic resistance genes, viz. ampicillin, chloramphenicol, streptomycin and tetracycline. To avoid false negative results and to increase the reliability of the assay, an internal amplification control (IAC) was added which was detected using a locked nucleic acid (LNA) probe. In serially diluted (5 ng-50 fg) DNA samples, the assay was able to detect 100 genomic equivalents of Salmonella, while in a multiplex format, the sensitivity was 1000 genomic equivalents. The assay performed equally well on artificially contaminated samples of beef trim, ground beef of different fat contents (73:27, 80:20, 85:15 and 93:7), chicken rinse, ground chicken, ground turkey, egg, spinach and tomato. While the detection limit for un-enriched inoculated food samples was 10(4) CFU/g, this was improved to 10 CFU/g after a 12-h enrichment in buffered peptone water, with 100% reproducibility. The multiplex real-time assay developed in this study can be used as a valuable tool to detect MDR virulent Salmonella, thus enhancing the safety of food. © 2013.

  20. A Machine Learning Approach to Pedestrian Detection for Autonomous Vehicles Using High-Definition 3D Range Data.

    Science.gov (United States)

    Navarro, Pedro J; Fernández, Carlos; Borraz, Raúl; Alonso, Diego

    2016-12-23

    This article describes an automated sensor-based system to detect pedestrians in an autonomous vehicle application. Although the vehicle is equipped with a broad set of sensors, the article focuses on the processing of the information generated by a Velodyne HDL-64E LIDAR sensor. The cloud of points generated by the sensor (more than 1 million points per revolution) is processed to detect pedestrians, by selecting cubic shapes and applying machine vision and machine learning algorithms to the XY, XZ, and YZ projections of the points contained in the cube. The work relates an exhaustive analysis of the performance of three different machine learning algorithms: k-Nearest Neighbours (kNN), Naïve Bayes classifier (NBC), and Support Vector Machine (SVM). These algorithms have been trained with 1931 samples. The final performance of the method, measured a real traffic scenery, which contained 16 pedestrians and 469 samples of non-pedestrians, shows sensitivity (81.2%), accuracy (96.2%) and specificity (96.8%).

  1. A Machine Learning Approach to Pedestrian Detection for Autonomous Vehicles Using High-Definition 3D Range Data

    Directory of Open Access Journals (Sweden)

    Pedro J. Navarro

    2016-12-01

    Full Text Available This article describes an automated sensor-based system to detect pedestrians in an autonomous vehicle application. Although the vehicle is equipped with a broad set of sensors, the article focuses on the processing of the information generated by a Velodyne HDL-64E LIDAR sensor. The cloud of points generated by the sensor (more than 1 million points per revolution is processed to detect pedestrians, by selecting cubic shapes and applying machine vision and machine learning algorithms to the XY, XZ, and YZ projections of the points contained in the cube. The work relates an exhaustive analysis of the performance of three different machine learning algorithms: k-Nearest Neighbours (kNN, Naïve Bayes classifier (NBC, and Support Vector Machine (SVM. These algorithms have been trained with 1931 samples. The final performance of the method, measured a real traffic scenery, which contained 16 pedestrians and 469 samples of non-pedestrians, shows sensitivity (81.2%, accuracy (96.2% and specificity (96.8%.

  2. Automatic, ECG-based detection of autonomic arousals and their association with cortical arousals, leg movements, and respiratory events in sleep

    DEFF Research Database (Denmark)

    Olsen, Mads; Schneider, Logan Douglas; Cheung, Joseph

    2018-01-01

    The current definition of sleep arousals neglects to address the diversity of arousals and their systemic cohesion. Autonomic arousals (AA) are autonomic activations often associated with cortical arousals (CA), but they may also occur in isolation in relation to a respiratory event, a leg movement...... or respiratory events. This indicates that most FP constitute autonomic activations that are indistinguishable from those with cortical cohesion. The proposed algorithm provides an automatic system trained in a clinical environment, which can be utilized to analyse the systemic and clinical impacts of arousals....... event or spontaneously, without any other physiological associations. AA should be acknowledged as essential events to understand and explore the systemic implications of arousals. We developed an automatic AA detection algorithm based on intelligent feature selection and advanced machine learning using...

  3. Pathogenic chytrid fungus Batrachochytrium dendrobatidis, but not B. salamandrivorans, detected on eastern hellbenders.

    Directory of Open Access Journals (Sweden)

    Emma K Bales

    Full Text Available Recent worldwide declines and extinctions of amphibian populations have been attributed to chytridiomycosis, a disease caused by the pathogenic fungus Batrachochytrium dendrobatidis (Bd. Until recently, Bd was thought to be the only Batrachochytrium species that infects amphibians; however a newly described species, Batrachochytrium salamandrivorans (Bs, is linked to die-offs in European fire salamanders (Salamandra salamandra. Little is known about the distribution, host range, or origin of Bs. In this study, we surveyed populations of an aquatic salamander that is declining in the United States, the eastern hellbender (Cryptobranchus alleganiensis alleganiensis, for the presence of Bs and Bd. Skin swabs were collected from a total of 91 individuals in New York, Pennsylvania, Ohio, and Virginia, and tested for both pathogens using duplex qPCR. Bs was not detected in any samples, suggesting it was not present in these hellbender populations (0% prevalence, 95% confidence intervals of 0.0-0.04. Bd was found on 22 hellbenders (24% prevalence, 95% confidence intervals of 0.16 ≤ 0.24 ≤ 0.34, representing all four states. All positive samples had low loads of Bd zoospores (12.7 ± 4.9 S.E.M. genome equivalents compared to other Bd susceptible species. More research is needed to determine the impact of Batrachochytrium infection on hellbender fitness and population viability. In particular, understanding how hellbenders limit Bd infection intensity in an aquatic environment may yield important insights for amphibian conservation. This study is among the first to evaluate the distribution of Bs in the United States, and is consistent with another, which failed to detect Bs in the U.S. Knowledge about the distribution, host-range, and origin of Bs may help control the spread of this pathogen, especially to regions of high salamander diversity, such as the eastern United States.

  4. Pathogenic chytrid fungus Batrachochytrium dendrobatidis, but not B. salamandrivorans, detected on eastern hellbenders.

    Science.gov (United States)

    Bales, Emma K; Hyman, Oliver J; Loudon, Andrew H; Harris, Reid N; Lipps, Gregory; Chapman, Eric; Roblee, Kenneth; Kleopfer, John D; Terrell, Kimberly A

    2015-01-01

    Recent worldwide declines and extinctions of amphibian populations have been attributed to chytridiomycosis, a disease caused by the pathogenic fungus Batrachochytrium dendrobatidis (Bd). Until recently, Bd was thought to be the only Batrachochytrium species that infects amphibians; however a newly described species, Batrachochytrium salamandrivorans (Bs), is linked to die-offs in European fire salamanders (Salamandra salamandra). Little is known about the distribution, host range, or origin of Bs. In this study, we surveyed populations of an aquatic salamander that is declining in the United States, the eastern hellbender (Cryptobranchus alleganiensis alleganiensis), for the presence of Bs and Bd. Skin swabs were collected from a total of 91 individuals in New York, Pennsylvania, Ohio, and Virginia, and tested for both pathogens using duplex qPCR. Bs was not detected in any samples, suggesting it was not present in these hellbender populations (0% prevalence, 95% confidence intervals of 0.0-0.04). Bd was found on 22 hellbenders (24% prevalence, 95% confidence intervals of 0.16 ≤ 0.24 ≤ 0.34), representing all four states. All positive samples had low loads of Bd zoospores (12.7 ± 4.9 S.E.M. genome equivalents) compared to other Bd susceptible species. More research is needed to determine the impact of Batrachochytrium infection on hellbender fitness and population viability. In particular, understanding how hellbenders limit Bd infection intensity in an aquatic environment may yield important insights for amphibian conservation. This study is among the first to evaluate the distribution of Bs in the United States, and is consistent with another, which failed to detect Bs in the U.S. Knowledge about the distribution, host-range, and origin of Bs may help control the spread of this pathogen, especially to regions of high salamander diversity, such as the eastern United States.

  5. Performance of a multiplexed serological microarray for the detection of antibodies against central nervous system pathogens.

    Science.gov (United States)

    Jääskeläinen, Anne J; Viitala, Sari M; Kurkela, Satu; Hepojoki, Satu; Sillanpää, Heidi; Kallio-Kokko, Hannimari; Bergström, Tomas; Suni, Jukka; Närvänen, Ale; Vapalahti, Olli; Vaheri, Antti

    2014-05-01

    Central nervous system (CNS) infections have multiple potential causative agents for which simultaneous pathogen screening can provide a useful tool. This study evaluated a multiplexed microarray for the simultaneous detection of antibodies against CNS pathogens. The performance of selected microarray antigens for the detection of IgG antibodies against herpes simplex virus 1 and 2 (HSV-1 and HSV-2), varicella-zoster virus (VZV), adenovirus, Mycoplasma pneumoniae and Borrelia burgdorferi sensu lato, was evaluated using serum sample panels tested with reference assays used in a routine diagnostic laboratory. The microarray sensitivity for HSV-1, HSV-2, VZV, adenovirus and M. pneumonia ranged from 77% to 100%, and the specificity ranged from 74% to 97%. Very variable sensitivities and specificities were found for borrelial antigens of three different VlsE protein IR(6) peptide variants (IR6p1, IR6p2, IR6p4) and three recombinant decorin binding proteins A (DbpA; DbpAIa, DbpA91, DbpAG40). For single antigens, good specificity was shown for antigens of IR6p4 and DbpAIa (96%), while DbpA91, IR6p1 and IR6p2 were moderately specific (88-92%). The analytical sensitivity of the microarray was dependent on the borrelial IgG concentration of the specimen. The overall performance and technical features of the platform showed that the platform supports both recombinant proteins, whole viruses and peptides as antigens. This study showed diagnostic potential for all six CNS pathogens, including Borrelia burgdorferi sensu lato, using glutaraldehyde based microarray, and further highlighted the importance of careful antigen selection and the requirement for the use of multiple borrelial antigens in order to increase specificity without a major lack of sensitivity. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Monoclonal antibody-based Surface Plasmon Resonance sensors for pathogen detection

    DEFF Research Database (Denmark)

    Skottrup, Peter Durand

    2007-01-01

    essentially transforms molecular interactions into a digital signal, thereby making detection of analytes label-free. Biosensors are used for detection of analytes ranging from small drug molecules to food- and waterborne microorganisms as well as biowarfare pathogens. In future farming, plant production......A biosensor is an analytical device, which incorporates a biological sensing element integrated within a physicochemical transducer. The aim of a biosensor is to produce an electronic signal, which is proportional to the interaction of analytes with the sensing element. This means that the sensor.......sp. tritici, the cause of wheat yellow rust and Phytophthora infestans, the cause of late blight disease in potato. As no antibody existed against urediniospores from P. striiformis, mouse monoclonal antibodies (mAbs) were produced and characterised. IgM-isotype mAbs from nine hybridoma cell lines were...

  7. Label and label-free based surface-enhanced Raman scattering for pathogen bacteria detection: A review.

    Science.gov (United States)

    Liu, Yu; Zhou, Haibo; Hu, Ziwei; Yu, Guangxia; Yang, Danting; Zhao, Jinshun

    2017-08-15

    Rapid, accurate detection of pathogen bacteria is a highly topical research area for the sake of food safety and public health. Surface-enhanced Raman scattering (SERS) is being considered as a powerful and attractive technique for pathogen bacteria detection, due to its sensitivity, high speed, comparatively low cost, multiplexing ability and portability. This contribution aims to give a comprehensive overview of SERS as a technique for rapid detection of pathogen bacteria based on label and label-free strategies. A brief tutorial on SERS is given first of all. Then we summarize the recent trends and developments of label and label-free based SERS applied to detection of pathogen bacteria, including the relatively complete interpretation of SERS spectra. In addition, multifunctional SERS platforms for pathogen bacteria in matrix are discussed as well. Furthermore, an outlook of the work done and a perspective on the future directions of SERS as a reliable tool for real-time pathogen bacteria detection are given. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. 16S rRNA-based detection of oral pathogens in coronary atherosclerotic plaque

    Directory of Open Access Journals (Sweden)

    Mahendra Jaideep

    2010-01-01

    Full Text Available Background: Atherosclerosis develops as a response of the vessel wall to injury. Chronic bacterial infections have been associated with an increased risk for atherosclerosis and coronary artery disease. The ability of oral pathogens to colonize in coronary atheromatous plaque is well known. Aim: The aim of this study was to detect the presence of Treponema denticola, Porphyromonas gingivalis and Campylobacter rectus in the subgingival and atherosclerotic plaques of patients with coronary artery disease. Materials and Methods: Fifty-one patients in the age group of 40-80 years with coronary artery disease were selected for the study. DNA was extracted from the plaque samples. The specific primers for T. denticola, C. rectus and P. gingivalis were used to amplify a part of the 16S rRNA gene by polymerase chain reaction. Statistical Analysis Used: Chi-square analysis, correlation coefficient and prevalence percentage of the microorganisms were carried out for the analysis. Results: Of the 51 patients, T. denticola, C. rectus and P. gingivalis were detected in 49.01%, 21.51% and 45.10% of the atherosclerotic plaque samples. Conclusions: Our study revealed the presence of bacterial DNA of the oral pathogenic microorganisms in coronary atherosclerotic plaques. The presence of the bacterial DNA in the coronary atherosclerotic plaques in significant proportion may suggest the possible relationship between periodontal bacterial infection and genesis of coronary atherosclerosis.

  9. Molecular detection of tick-borne pathogens in Ixodes ricinus from Moldova collected in 1960.

    Science.gov (United States)

    Movila, Alexandru; Toderas, Ion; Uspenskaia, Inga; Conovalov, Jurii

    2013-06-01

    This study is the first report about the prevalence of tick-borne pathogens, as well as their (co-)infection rates, in the museum-archived I. ricinus female ticks collected in Moldova in 1960. A total of 16.7% (21/126) ticks was mono-infected. Borrelia burgdorferi sensu stricto was revealed as the most abundant species (4.8%) followed by B. garinii (1.6%), B. afzelii (0.8%), B. valaisiana (0.8%), and B. lusitaniae (0.8%). DNA of Rickettsia helvetica (2.4%), R. monacensis (2.4%), Anaplasma phagocytophilum (2.4%), 'Candidatus Neoehrlichia mikurensis' (0.8%), and Babesia microti (0.8%) were also detected, indicating the occurrence of these emerging tick-borne microorganisms in Moldova since 1960 at least. In this study, we detected a co-infection (0.8%; 1/126 tested ticks) between B. microti and R. helvetica. Additional investigations are warranted to further characterize a historical snapshot of the distribution of tick-borne pathogens in Europe. Copyright © 2013 Elsevier GmbH. All rights reserved.

  10. Development of a nested PCR assay to detect the pathogenic free-living amoeba Naegleria fowleri.

    Science.gov (United States)

    Réveiller, Fabienne L; Cabanes, Pierre-André; Marciano-Cabral, Francine

    2002-05-01

    Naegleria fowleri is the causative agent of primary amoebic meningoencephalitis, a fatal disease of the central nervous system that is acquired while swimming or diving in freshwater. A cDNA clone designated Mp2C15 obtained from N. fowleri was used as a probe to distinguish N. fowleri from other free-living amoebae. The Mp2C15 probe hybridized to genomic DNA from pathogenic N. fowleri and antigenically related non-pathogenic N. lovaniensis. Mp2C15 was digested with the restriction enzyme XbaI, resulting in two fragments, Mp2C15.G and Mp2C15.P. Four species of Naegleria and four species of Acanthamoeba were examined for reactivity with Mp2C15.P. Mp2C15.P was specific for N. fowleri and was used in the development of a nested PCR assay which is capable of detecting as little as 5 pg of N. fowleri DNA or five intact N. fowleri amoebae. In summary, a rapid, sensitive, and specific assay for the detection of N. fowleri was developed.

  11. Challenges in Laboratory Detection of Fungal Pathogens in the Airways of Cystic Fibrosis Patients.

    Science.gov (United States)

    Chen, Sharon C-A; Meyer, Wieland; Pashley, Catherine H

    2018-02-01

    Study of the clinical significance of fungal colonization/infection in the airways of cystic fibrosis (CF) patients, especially by filamentous fungi, is challenged by the absence of standardized methodology for the detection and identification of an ever-broadening range of fungal pathogens. Culture-based methods remain the cornerstone diagnostic approaches, but current methods used in many clinical laboratories are insensitive and unstandardized, rendering comparative studies unfeasible. Guidelines for standardized processing of respiratory specimens and for their culture are urgently needed and should include recommendations for specific processing procedures, inoculum density, culture media, incubation temperature and duration of culture. Molecular techniques to detect fungi directly from clinical specimens include panfungal PCR assays, multiplex or pathogen-directed assays, real-time PCR, isothermal methods and probe-based assays. In general, these are used to complement culture. Fungal identification by DNA sequencing methods is often required to identify cultured isolates, but matrix-assisted laser desorption/ionization time-of-flight mass spectrometry is increasingly used as an alternative to DNA sequencing. Genotyping of isolates is undertaken to investigate relatedness between isolates, to pinpoint the infection source and to study the population structure. Methods range from PCR fingerprinting and amplified fragment length polymorphism analysis, to short tandem repeat typing, multilocus sequencing typing (MLST) and whole genome sequencing (WGS). MLST is the current preferred method, whilst WGS offers best case resolution but currently is understudied.

  12. Comparison of individual and pooled sampling methods for detecting bacterial pathogens of fish

    Science.gov (United States)

    Mumford, Sonia; Patterson, Chris; Evered, J.; Brunson, Ray; Levine, J.; Winton, J.

    2005-01-01

    Examination of finfish populations for viral and bacterial pathogens is an important component of fish disease control programs worldwide. Two methods are commonly used for collecting tissue samples for bacteriological culture, the currently accepted standards for detection of bacterial fish pathogens. The method specified in the Office International des Epizooties Manual of Diagnostic Tests for Aquatic Animals permits combining renal and splenic tissues from as many as 5 fish into pooled samples. The American Fisheries Society (AFS) Blue Book/US Fish and Wildlife Service (USFWS) Inspection Manual specifies the use of a bacteriological loop for collecting samples from the kidney of individual fish. An alternative would be to more fully utilize the pooled samples taken for virology. If implemented, this approach would provide substantial savings in labor and materials. To compare the relative performance of the AFS/USFWS method and this alternative approach, cultures of Yersinia ruckeri were used to establish low-level infections in groups of rainbow trout (Oncorhynchus mykiss) that were sampled by both methods. Yersinia ruckeri was cultured from 22 of 37 groups by at least 1 method. The loop method yielded 18 positive groups, with 1 group positive in the loop samples but negative in the pooled samples. The pooled samples produced 21 positive groups, with 4 groups positive in the pooled samples but negative in the loop samples. There was statistically significant agreement (Spearman coefficient 0.80, P methods to permit detection of low-level bacterial infections of rainbow trout.

  13. Autonomous real-time detection of plumes and jets from moons and comets

    Energy Technology Data Exchange (ETDEWEB)

    Wagstaff, Kiri L.; Thompson, David R.; Bue, Brian D.; Fuchs, Thomas J., E-mail: kiri.l.wagstaff@jpl.nasa.gov [Jet Propulsion Laboratory, California Institute of Technology, 4800 Oak Grove Drive, Pasadena, CA 91109 (United States)

    2014-10-10

    Dynamic activity on the surface of distant moons, asteroids, and comets can manifest as jets or plumes. These phenomena provide information about the interior of the bodies and the forces (gravitation, radiation, thermal) they experience. Fast detection and follow-up study is imperative since the phenomena may be time-varying and because the observing window may be limited (e.g., during a flyby). We have developed an advanced method for real-time detection of plumes and jets using onboard analysis of the data as it is collected. In contrast to prior work, our technique is not restricted to plume detection from spherical bodies, making it relevant for irregularly shaped bodies such as comets. Further, our study analyzes raw data, the form in which it is available on board the spacecraft, rather than fully processed image products. In summary, we contribute a vital assessment of a technique that can be used on board tomorrow's deep space missions to detect, and respond quickly to, new occurrences of plumes and jets.

  14. Autonomous real-time detection of plumes and jets from moons and comets

    International Nuclear Information System (INIS)

    Wagstaff, Kiri L.; Thompson, David R.; Bue, Brian D.; Fuchs, Thomas J.

    2014-01-01

    Dynamic activity on the surface of distant moons, asteroids, and comets can manifest as jets or plumes. These phenomena provide information about the interior of the bodies and the forces (gravitation, radiation, thermal) they experience. Fast detection and follow-up study is imperative since the phenomena may be time-varying and because the observing window may be limited (e.g., during a flyby). We have developed an advanced method for real-time detection of plumes and jets using onboard analysis of the data as it is collected. In contrast to prior work, our technique is not restricted to plume detection from spherical bodies, making it relevant for irregularly shaped bodies such as comets. Further, our study analyzes raw data, the form in which it is available on board the spacecraft, rather than fully processed image products. In summary, we contribute a vital assessment of a technique that can be used on board tomorrow's deep space missions to detect, and respond quickly to, new occurrences of plumes and jets.

  15. Biosensors based on modularly designed synthetic peptides for recognition, detection and live/dead differentiation of pathogenic bacteria.

    Science.gov (United States)

    Liu, Xiaobo; Marrakchi, Mouna; Xu, Dawei; Dong, He; Andreescu, Silvana

    2016-06-15

    Rapid and sensitive detection of bacterial pathogens is critical for assessing public health, food and environmental safety. We report the use of modularly designed and site-specifically oriented synthetic antimicrobial peptides (sAMPs) as novel recognition agents enabling detection and quantification of bacterial pathogens. The oriented assembly of the synthetic peptides on electrode surfaces through an engineered cysteine residue coupled with impedimetric detection facilitated rapid and sensitive detection of bacterial pathogens with a detection limit of 10(2)CFU/mL for four bacterial strains including Escherichia coli (E. coli), Pseudomonas aeruginosa (P. aeruginosa), Staphylococcus aureus (S. aureus) and Staphylococcus epidermidis (S. epidermidis). The approach enabled differentiation between live and dead bacteria. The fabrication of the sAMPs functionalized surface and the importance of the sAMPs orientation for providing optimum recognition and detection ability against pathogens are discussed. The proposed methodology provides a universal platform for the detection of bacterial pathogens based on engineered peptides, as alternative to the most commonly used immunological and gene based assays. The method can also be used to fabricate antimicrobial coatings and surfaces for inactivation and screening of viable bacteria. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Nanozyme-Mediated Dual Immunoassay Integrated with Smartphone for Use in Simultaneous Detection of Pathogens.

    Science.gov (United States)

    Cheng, Nan; Song, Yang; Zeinhom, Mohamed M A; Chang, Yu-Chung; Sheng, Lina; Li, Haolin; Du, Dan; Li, Lei; Zhu, Mei-Jun; Luo, Yunbo; Xu, Wentao; Lin, Yuehe

    2017-11-22

    Nanozymes are an excellent class of optical reporters for the development of sensitive biosensors for widespread applications. In this study, mesoporous core-shell palladium@platinum (Pd@Pt) nanoparticles were synthesized and then applied as signal amplifier in a dual lateral flow immunoassay (LFIA) and integrated with a smartphone-based device for use in simultaneous detection of Salmonella Enteritidis and Escherichia coli O157:H7. After optimization, the limit of detections were calculated to be ∼20 cfu/mL for S. Enteritidis and ∼34 cfu/mL for E. coli O157:H7, respectively. The greatly improved sensitivity was contributed by the peroxidase-like catalytic activity of the Pd@Pt nanoparticles for signal enhancement and the parallel design of dual detection for eliminating the cross-interference. The estimated recoveries of the dual LFIA range from 91.44 to 117.00%, which indicated that the developed method is capable of detecting live bacteria in food samples. This approach provides an attractive platform for S. Enteritidis and E. coli O157:H7 detection using a smartphone-based device as the sole piece of equipment, indicating great promise for foodborne pathogen analysis or in-field food safety tracking.

  17. Molecular detection of bacterial and parasitic pathogens in hard ticks from Portugal.

    Science.gov (United States)

    Maia, Carla; Ferreira, Andreia; Nunes, Mónica; Vieira, Maria Luísa; Campino, Lenea; Cardoso, Luís

    2014-06-01

    Ticks are important vector arthropods of human and animal pathogens. As information about agents of disease circulating in vectors in Portugal is limited, the aim of the present study was to detect bacteria and parasites with veterinary and zoonotic importance in ticks collected from dogs, cats, and field vegetation. A total of 925 ticks, comprising 888 (96.0%) adults, 8 (0.9%) nymphs, and 29 (3.1%) larvae, were collected in 4 geographic areas (districts) of Portugal. Among those, 620 (67.0%) were removed from naturally infested dogs, 42 (4.5%) from cats, and 263 (28.4%) were questing ticks obtained from field vegetation. Rhipicephalus sanguineus was the predominant tick species, and the only one collected from dogs and vegetation, while all Ixodes ricinus specimens (n=6) were recovered from cats. Rickettsia massiliae and Rickettsia conorii were identified in 35 ticks collected from cats and dogs and in 3 ticks collected from dogs. Among ticks collected from cats or dogs, 4 Rh. sanguineus specimens were detected with Hepatozoon felis, 3 with Anaplasma platys, 2 with Hepatozoon canis, one with Anaplasma phagocytophilum, one with Babesia vogeli, one with Borrelia burgdorferi sensu lato and one with Cercopithifilaria spp. Rickettsia helvetica was detected in one I. ricinus tick collected from a cat. To the best of our knowledge, this was the first time that Cercopithifilaria spp., Ba. vogeli, H. canis, and H. felis have been detected in ticks from Portugal. The wide range of tick-borne pathogens identified, some of zoonotic concern, suggests a risk for the emergence of tick-borne diseases in domestic animals and humans in Portugal. Further studies on these and other tick-borne agents should be performed to better understand their epidemiological and clinical importance, and to support the implementation of effective control measures. Copyright © 2014 Elsevier GmbH. All rights reserved.

  18. Molecular and serological detection of tick-borne pathogens in donkeys (Equus asinus) in Italy.

    Science.gov (United States)

    Veronesi, Fabrizia; Morganti, Giulia; Ravagnan, Silvia; Laus, Fulvio; Spaterna, Andrea; Diaferia, Manuela; Moretti, Annabella; Fioretti, Daniela Piergili; Capelli, Gioia

    2014-10-10

    Donkeys, owing to the frequent outdoor activity, are exposed to a high risk of infection with tick-borne pathogens. This work aimed to detect exposure to Theileria equi, Babesia caballi, Anaplasma phagocytophilum and Borrelia burgdorferi s.l. of donkeys reared in Central Italy. For this purpose 122 adult donkeys were selected within 11 herds and submitted to blood collection. IgG antibodies to T. equi, B. caballi, A. phagocytophilum and B. burgdorferi s.l. were detected by IFAT. Conventional PCRs targeting the genes MSP2 and the flagellin were used for the detection of A. phagocytophilum and B. burgdorferi s.l. respectively and a Real Time PCR Sybr Green was used to detect Babesia/Theileria spp…. The species identity was determined by amplicons sequencing. Forty eight (39.3%) and 58 (47.5%) animals tested positive for T. equi and B. caballi antibodies, respectively; nine animals (7.4%) were found positive for antibodies against A. phagocytophilum whereas negative results were obtained for B. burgdorferi s.l. Twenty-six (21.3%) animals showed antibodies for both T. equi and B. caballi. Twenty-three (18.8%) donkeys were positive to Babesia/Theileria spp. PCR assay. Out of 21 sequenced amplicons, 20 were identified as T. equi, belonging to three main groups designated A, B and D and one as B. caballi group A. Neither A. phagocytophilum nor B. burgdorferi PCR results were positive. The study showed a high exposure of donkeys to tick-borne pathogens and provides information on the genetic identity of the T. equi strains circulating in Central Italy. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Detection of Tick-Borne Pathogens in the Korean Water Deer (Hydropotes inermis argyropus) from Jeonbuk Province, Korea.

    Science.gov (United States)

    Seong, Giyong; Han, Yu-Jung; Oh, Sung-Suck; Chae, Joon-Seok; Yu, Do-Hyeon; Park, Jinho; Park, Bae-Keun; Yoo, Jae-Gyu; Choi, Kyoung-Seong

    2015-10-01

    The objective of this study was to investigate the prevalence of tick-borne pathogens in the Korean water deer (Hydropotes inermis argyropus). Pathogens were identified using PCR which included Anaplasma, Ehrlichia, Rickettsia, and Theileria. Rickettsia was not detected, whereas Anaplasma, Ehrlichia, and Theileria infections were detected in 4, 2, and 8 animals, respectively. The most prevalent pathogen was Theileria. Of the 8 Theileria-positive animals, 2 were mixed-infected with 3 pathogens (Anaplasma, Ehrlichia, and Theileria) and another 2 animals showed mixed-infection with 2 pathogens (Anaplasma and Theileria). Sequencing analysis was used to verify the PCR results. The pathogens found in this study were identified as Anaplasma phagocytophilum, Ehrlichia canis, and Theileria sp. To the best of our knowledge, this is the first report identifying these 3 pathogens in the Korean water deer. Our results suggest that the Korean water deer may serve as a major reservoir for these tick-borne pathogens, leading to spread of tick-borne diseases to domestic animals, livestock, and humans. Further studies are needed to investigate their roles in this respect.

  20. Concurrent Detection of Human Norovirus and Bacterial Pathogens in Water Samples from an Agricultural Region in Central California Coast

    Directory of Open Access Journals (Sweden)

    Peng Tian

    2017-08-01

    Full Text Available Bacterial pathogens and human norovirus (HuNoV are major cause for acute gastroenteritis caused by contaminated food and water. Public waterways can become contaminated from a variety of sources and flood after heavy rain events, leading to pathogen contamination of produce fields. We initiated a survey of several public watersheds in a major leafy green produce production region of the Central California Coast to determine the prevalence of HuNoV as well as bacterial pathogens. Moore swabs were used to collect environmental samples bi-monthly at over 30 sampling sites in the region. High prevalence of HuNoV and bacterial pathogens were detected in environmental water samples in the region. The overall detection rates of HuNoV, O157 Shiga toxin-producing Escherichia coli (STEC, non-O157 STEC, Salmonella, and Listeria were 25.58, 7.91, 9.42, 59.65, and 44.30%, respectively. The detection rates of Salmonella and L. monocytogenes were significantly higher in the spring. Fall and spring had elevated detection rates of O157 STEC. The overall detection rates of non-O157 STEC in the fall were lower than the other seasons but not significant. The overall detection rates of HuNoV were highest in fall, followed by spring and winter, with summer being lowest and significantly lower than other seasons. This study presented the first study of evaluating the correlation between the detection rate of HuNoV and the detection rates of four bacterial pathogens from environmental water. Overall, there was no significant difference in HuNoV detection rates between samples testing positive or negative for the four bacterial pathogens tested. Pathogens in animal-impacted and human-impacted areas were investigated. There were significant higher detection rates in animal-impacted areas than that of human-impacted areas for bacterial pathogens. However, there was no difference in HuNoV detection rates between these two areas. The overall detection levels of generic E

  1. How to Calculate Renyi Entropy from Heart Rate Variability, and Why it Matters for Detecting Cardiac Autonomic Neuropathy

    Directory of Open Access Journals (Sweden)

    David eCornforth

    2014-09-01

    Full Text Available Cardiac Autonomic Neuropathy (CAN is a disease that involves nerve damage leading to an abnormal control of heart rate. An open question is to what extent this condition is detectable from Heart Rate Variability (HRV, which provides information only on successive intervals between heart beats, yet is non-invasive and easy to obtain from a 3-lead ECG recording. A variety of measures may be extracted from HRV, including time domain, frequency domain and more complex non-linear measures. Among the latter, Renyi Entropy has been proposed as a suitable measure that can be used to discriminate CAN from controls. However, all entropy methods require estimation of probabilities, and there are a number of ways in which this estimation can be made. In this work, we calculate Renyi entropy using several variations of the histogram method, and a density method based on sequences of RR intervals. In all, we calculate Renyi entropy using nine methods, and compare their effectiveness in separating the different classes of participants. We find that the histogram method using single RR intervals yields an entropy measure that is either incapable of discriminating CAN from controls, or that it provides little information that could not be gained from the standard deviation of the RR intervals. In contrast, probabilities calculated using a density method, based on sequences of RR intervals, yield an entropy measure that provides good separation between groups of participants, and provides information not available from the standard deviation. The main contribution of this work is that different approaches to calculating probability may affect the success of detecting disease. Our results bring new clarity to the methods used to calculate the Renyi entropy in general, and in particular, to the successful detection of CAN.

  2. An autonomous image based approach for detecting glacial lake outburst floods

    Science.gov (United States)

    Koschitzki, R.; Schwalbe, E.; Maas, H.-G.

    2014-06-01

    The potential danger caused by glacier margin lakes and the related risk of glacier lake outburst floods (GLOF) increases constantly due to glaciers retreating in many parts of the world. Reasons for this development are on the one hand the new formation and enlargement of glacier margin lakes due to melt water. On the other hand, retreating and thinning glacier tongues lead to a decrease of the back pressure against the dammed glacier lakes. The paper describes the design of a photogrammetric GLOF monitoring system, based on monoscopic image sequence analysis for automatic detection of water level changes. The presented approach for measuring the water line in an image sequence is based on directional edge detection in LoG-filtered image data. After that, the water level is determined by a transformation of image measurements into object space based on orientation parameters of the camera and a geo-referenced lake basin model. The model can for instance be determined by photogrammetric methods after a GLOF; it may also be determined portion-wise by analysing shore lines at various water levels. Camera orientation parameters are determined by a local GPS-supported photogrammetric network. Comparing the determined water level changes with reference data provided by a water gauge, the precision is estimated in the order of one decimetre. A major challenge is the automatic detection of the water line in image sequences under varying light and visibility conditions. The paper will also discuss promising approaches such as multispectral images as well as a statistical analysis of grey value changes over short image sequences to eliminate disturbing reflections on the rough water surface.

  3. An autonomous image based approach for detecting glacial lake outburst floods

    Directory of Open Access Journals (Sweden)

    R. Koschitzki

    2014-06-01

    Full Text Available The potential danger caused by glacier margin lakes and the related risk of glacier lake outburst floods (GLOF increases constantly due to glaciers retreating in many parts of the world. Reasons for this development are on the one hand the new formation and enlargement of glacier margin lakes due to melt water. On the other hand, retreating and thinning glacier tongues lead to a decrease of the back pressure against the dammed glacier lakes. The paper describes the design of a photogrammetric GLOF monitoring system, based on monoscopic image sequence analysis for automatic detection of water level changes. The presented approach for measuring the water line in an image sequence is based on directional edge detection in LoG-filtered image data. After that, the water level is determined by a transformation of image measurements into object space based on orientation parameters of the camera and a geo-referenced lake basin model. The model can for instance be determined by photogrammetric methods after a GLOF; it may also be determined portion-wise by analysing shore lines at various water levels. Camera orientation parameters are determined by a local GPS-supported photogrammetric network. Comparing the determined water level changes with reference data provided by a water gauge, the precision is estimated in the order of one decimetre. A major challenge is the automatic detection of the water line in image sequences under varying light and visibility conditions. The paper will also discuss promising approaches such as multispectral images as well as a statistical analysis of grey value changes over short image sequences to eliminate disturbing reflections on the rough water surface.

  4. Comparison of supervised machine learning algorithms for waterborne pathogen detection using mobile phone fluorescence microscopy

    KAUST Repository

    Ceylan Koydemir, Hatice

    2017-06-14

    Giardia lamblia is a waterborne parasite that affects millions of people every year worldwide, causing a diarrheal illness known as giardiasis. Timely detection of the presence of the cysts of this parasite in drinking water is important to prevent the spread of the disease, especially in resource-limited settings. Here we provide extended experimental testing and evaluation of the performance and repeatability of a field-portable and cost-effective microscopy platform for automated detection and counting of Giardia cysts in water samples, including tap water, non-potable water, and pond water. This compact platform is based on our previous work, and is composed of a smartphone-based fluorescence microscope, a disposable sample processing cassette, and a custom-developed smartphone application. Our mobile phone microscope has a large field of view of ~0.8 cm2 and weighs only ~180 g, excluding the phone. A custom-developed smartphone application provides a user-friendly graphical interface, guiding the users to capture a fluorescence image of the sample filter membrane and analyze it automatically at our servers using an image processing algorithm and training data, consisting of >30,000 images of cysts and >100,000 images of other fluorescent particles that are captured, including, e.g. dust. The total time that it takes from sample preparation to automated cyst counting is less than an hour for each 10 ml of water sample that is tested. We compared the sensitivity and the specificity of our platform using multiple supervised classification models, including support vector machines and nearest neighbors, and demonstrated that a bootstrap aggregating (i.e. bagging) approach using raw image file format provides the best performance for automated detection of Giardia cysts. We evaluated the performance of this machine learning enabled pathogen detection device with water samples taken from different sources (e.g. tap water, non-potable water, pond water) and achieved

  5. Comparison of supervised machine learning algorithms for waterborne pathogen detection using mobile phone fluorescence microscopy

    Directory of Open Access Journals (Sweden)

    Ceylan Koydemir Hatice

    2017-06-01

    Full Text Available Giardia lamblia is a waterborne parasite that affects millions of people every year worldwide, causing a diarrheal illness known as giardiasis. Timely detection of the presence of the cysts of this parasite in drinking water is important to prevent the spread of the disease, especially in resource-limited settings. Here we provide extended experimental testing and evaluation of the performance and repeatability of a field-portable and cost-effective microscopy platform for automated detection and counting of Giardia cysts in water samples, including tap water, non-potable water, and pond water. This compact platform is based on our previous work, and is composed of a smartphone-based fluorescence microscope, a disposable sample processing cassette, and a custom-developed smartphone application. Our mobile phone microscope has a large field of view of ~0.8 cm2 and weighs only ~180 g, excluding the phone. A custom-developed smartphone application provides a user-friendly graphical interface, guiding the users to capture a fluorescence image of the sample filter membrane and analyze it automatically at our servers using an image processing algorithm and training data, consisting of >30,000 images of cysts and >100,000 images of other fluorescent particles that are captured, including, e.g. dust. The total time that it takes from sample preparation to automated cyst counting is less than an hour for each 10 ml of water sample that is tested. We compared the sensitivity and the specificity of our platform using multiple supervised classification models, including support vector machines and nearest neighbors, and demonstrated that a bootstrap aggregating (i.e. bagging approach using raw image file format provides the best performance for automated detection of Giardia cysts. We evaluated the performance of this machine learning enabled pathogen detection device with water samples taken from different sources (e.g. tap water, non-potable water, pond

  6. Comparison of supervised machine learning algorithms for waterborne pathogen detection using mobile phone fluorescence microscopy

    Science.gov (United States)

    Ceylan Koydemir, Hatice; Feng, Steve; Liang, Kyle; Nadkarni, Rohan; Benien, Parul; Ozcan, Aydogan

    2017-06-01

    Giardia lamblia is a waterborne parasite that affects millions of people every year worldwide, causing a diarrheal illness known as giardiasis. Timely detection of the presence of the cysts of this parasite in drinking water is important to prevent the spread of the disease, especially in resource-limited settings. Here we provide extended experimental testing and evaluation of the performance and repeatability of a field-portable and cost-effective microscopy platform for automated detection and counting of Giardia cysts in water samples, including tap water, non-potable water, and pond water. This compact platform is based on our previous work, and is composed of a smartphone-based fluorescence microscope, a disposable sample processing cassette, and a custom-developed smartphone application. Our mobile phone microscope has a large field of view of 0.8 cm2 and weighs only 180 g, excluding the phone. A custom-developed smartphone application provides a user-friendly graphical interface, guiding the users to capture a fluorescence image of the sample filter membrane and analyze it automatically at our servers using an image processing algorithm and training data, consisting of >30,000 images of cysts and >100,000 images of other fluorescent particles that are captured, including, e.g. dust. The total time that it takes from sample preparation to automated cyst counting is less than an hour for each 10 ml of water sample that is tested. We compared the sensitivity and the specificity of our platform using multiple supervised classification models, including support vector machines and nearest neighbors, and demonstrated that a bootstrap aggregating (i.e. bagging) approach using raw image file format provides the best performance for automated detection of Giardia cysts. We evaluated the performance of this machine learning enabled pathogen detection device with water samples taken from different sources (e.g. tap water, non-potable water, pond water) and achieved a

  7. 'Bioluminescent' reporter phage for the detection of Category A bacterial pathogens.

    Science.gov (United States)

    Schofield, David A; Molineux, Ian J; Westwater, Caroline

    2011-07-08

    Yersinia pestis and Bacillus anthracis are Category A bacterial pathogens that are the causative agents of the plague and anthrax, respectively. Although the natural occurrence of both diseases' is now relatively rare, the possibility of terrorist groups using these pathogens as a bioweapon is real. Because of the disease's inherent communicability, rapid clinical course, and high mortality rate, it is critical that an outbreak be detected quickly. Therefore methodologies that provide rapid detection and diagnosis are essential to ensure immediate implementation of public health measures and activation of crisis management. Recombinant reporter phage may provide a rapid and specific approach for the detection of Y. pestis and B. anthracis. The Centers for Disease Control and Prevention currently use the classical phage lysis assays for the confirmed identification of these bacterial pathogens. These assays take advantage of naturally occurring phage which are specific and lytic for their bacterial hosts. After overnight growth of the cultivated bacterium in the presence of the specific phage, the formation of plaques (bacterial lysis) provides a positive identification of the bacterial target. Although these assays are robust, they suffer from three shortcomings: 1) they are laboratory based; 2) they require bacterial isolation and cultivation from the suspected sample, and 3) they take 24-36 h to complete. To address these issues, recombinant "light-tagged" reporter phage were genetically engineered by integrating the Vibrio harveyi luxAB genes into the genome of Y. pestis and B. anthracis specific phage. The resulting luxAB reporter phage were able to detect their specific target by rapidly (within minutes) and sensitively conferring a bioluminescent phenotype to recipient cells. Importantly, detection was obtained either with cultivated recipient cells or with mock-infected clinical specimens. For demonstration purposes, here we describe the method for the phage

  8. Antibody array in a multiwell plate format for the sensitive and multiplexed detection of important plant pathogens.

    Science.gov (United States)

    Charlermroj, Ratthaphol; Himananto, Orawan; Seepiban, Channarong; Kumpoosiri, Mallika; Warin, Nuchnard; Gajanandana, Oraprapai; Elliott, Christopher T; Karoonuthaisiri, Nitsara

    2014-07-15

    The global seed market is considered to be an important industry with a total value of $10,543 million US dollars in 2012. Because plant pathogens such as bacteria and viruses cause a significant economic loss to both producers and exporters, the seed export industry urgently requires rapid, sensitive, and inexpensive testing for the pathogens to prevent disease spreading worldwide. This study developed an antibody array in a multiwell plate format to simultaneously detect four crucial plant pathogens, namely, a bacterial fruit blotch bacterium Acidovorax avenae subsp. citrulli (Aac), Chilli veinal mottle virus (ChiVMV, potyvirus), Watermelon silver mottle virus (WSMoV, tospovirus serogroup IV), and Melon yellow spot virus (MYSV, tospovirus). The capture antibodies specific to the pathogens were immobilized on each well at preassigned positions by an automatic microarrayer. The antibodies on the arrays specifically captured the corresponding pathogens present in the sample extracts. The presence of pathogens bound on the capture antibodies was subsequently detected by a cocktail of fluorescently conjugated secondary antibodies. The limits of detection of the developed antibody array for the detection of Aac, ChiVMV, WSMoV, and MYSV were 5 × 10(5) CFU/mL, 30 ng/mL, 1000 ng/mL, and 160 ng/mL, respectively, which were very similar to those of the conventional ELISA method. The antibody array in a multiwell plate format accurately detected plant pathogens in single and multiple detections. Moreover, this format enables easy handling of the assay at a higher speed of operation.

  9. Pathosphere.org: pathogen detection and characterization through a web-based, open source informatics platform.

    Science.gov (United States)

    Kilianski, Andy; Carcel, Patrick; Yao, Shijie; Roth, Pierce; Schulte, Josh; Donarum, Greg B; Fochler, Ed T; Hill, Jessica M; Liem, Alvin T; Wiley, Michael R; Ladner, Jason T; Pfeffer, Bradley P; Elliot, Oliver; Petrosov, Alexandra; Jima, Dereje D; Vallard, Tyghe G; Melendrez, Melanie C; Skowronski, Evan; Quan, Phenix-Lan; Lipkin, W Ian; Gibbons, Henry S; Hirschberg, David L; Palacios, Gustavo F; Rosenzweig, C Nicole

    2015-12-29

    The detection of pathogens in complex sample backgrounds has been revolutionized by wide access to next-generation sequencing (NGS) platforms. However, analytical methods to support NGS platforms are not as uniformly available. Pathosphere (found at Pathosphere.org) is a cloud - based open - sourced community tool that allows for communication, collaboration and sharing of NGS analytical tools and data amongst scientists working in academia, industry and government. The architecture allows for users to upload data and run available bioinformatics pipelines without the need for onsite processing hardware or technical support. The pathogen detection capabilities hosted on Pathosphere were tested by analyzing pathogen-containing samples sequenced by NGS with both spiked human samples as well as human and zoonotic host backgrounds. Pathosphere analytical pipelines developed by Edgewood Chemical Biological Center (ECBC) identified spiked pathogens within a common sample analyzed by 454, Ion Torrent, and Illumina sequencing platforms. ECBC pipelines also correctly identified pathogens in human samples containing arenavirus in addition to animal samples containing flavivirus and coronavirus. These analytical methods were limited in the detection of sequences with limited homology to previous annotations within NCBI databases, such as parvovirus. Utilizing the pipeline-hosting adaptability of Pathosphere, the analytical suite was supplemented by analytical pipelines designed by the United States Army Medical Research Insititute of Infectious Diseases and Walter Reed Army Institute of Research (USAMRIID-WRAIR). These pipelines were implemented and detected parvovirus sequence in the sample that the ECBC iterative analysis previously failed to identify. By accurately detecting pathogens in a variety of samples, this work demonstrates the utility of Pathosphere and provides a platform for utilizing, modifying and creating pipelines for a variety of NGS technologies developed

  10. Molecular detection and characterization of zoonotic and veterinary pathogens in ticks from northeastern China

    Directory of Open Access Journals (Sweden)

    Feng Wei

    2016-11-01

    Full Text Available Tick-borne diseases are considered as emerging infectious diseases in humans and animals in China. In this study, Ixodes persulcatus (n=1699, Haemaphysalis concinna (n=412, Haemaphysalis longicornis (n=390, Dermacentor nuttalli (n=253, and Dermacentor silvarum (n=204 ticks were collected by flagging from northeastern China, and detected for infection with Anaplasma, Ehrlichia, Babesia, and Hepatozoon spp. by using nested polymerase chain reaction assays and sequencing analysis. A. phagocytophilum was detected in all tick species, i.e., I. persulcatus (9.4%, H. longicornis (1.9%, H. concinna (6.5%, D. nuttalli (1.7%, and D. silvarum (2.3%; A. bovis was detected in H. longicornis (0.3% and H. concinna (0.2%; E. muris was detected in I. persulcatus (2.5% and H. concinna (0.2%; Candidatus Neoehrlichia mikurensis was only detected in I. persulcatus (0.4%. The Ehrlichia variant (GenBank access number KU921424, closely related to E. ewingii, was found in H. longicornis (0.8% and H. concinna (0.2%. I. persulcatus was infected with B. venatorum (1.2%, B. microti (0.6%, and B. divergens (0.6%. Additionally, four Babesia sequence variants (GenBank access numbers 862303–862306 were detected in I. persulcatus, H. longicornis, and H. concinna, which belonged to the clusters formed by the parasites of dogs, sheep and cattle (B. gibsoni, B. motasi, and B. crassa. Two Hepatozoon spp. (GenBank access numbers KX016028 and KX016029 associated with hepatozoonosis in Japanese martens were found in the collected ticks (0.1–3.1%. These findings showed the genetic variability of Anaplasma, Ehrlichia, Babesia, and Hepatozoon spp. circulating in ticks in northeastern China, highlighting the necessity for further research of these tick-associated pathogens and their role in human and animal diseases.

  11. CT-Guided Biopsy in Suspected Spondylodiscitis--The Association of Paravertebral Inflammation with Microbial Pathogen Detection.

    Directory of Open Access Journals (Sweden)

    Daniel Spira

    Full Text Available To search for imaging characteristics distinguishing patients with successful from those with futile microbiological pathogen detection by CT-guided biopsy in suspected spondylodiscitis.34 consecutive patients with suspected spondylodiscitis underwent CT-guided biopsy for pathogen detection. MR-images were assessed for inflammatory infiltration of disks, adjacent vertebrae, epidural and paravertebral space. CT-images were reviewed for arrosion of adjacent end plates and reduced disk height. Biopsy samples were sent for microbiological examination in 34/34 patients, and for additional histological analysis in 28/34 patients.Paravertebral infiltration was present in all 10/10 patients with positive microbiology and occurred in only 12/24 patients with negative microbiology, resulting in a sensitivity of 100% and a specificity of 50% for pathogen detection. Despite its limited sensitivities, epidural infiltration and paravertebral abscesses showed considerably higher specificities of 83.3% and 90.9%, respectively. Paravertebral infiltration was more extensive in patients with positive as compared to negative microbiology (p = 0.002. Even though sensitivities for pathogen detection were also high in case of vertebral and disk infiltration, or end plate arrosion, specificities remained below 10%.Inflammatory infiltration of the paravertebral space indicated successful pathogen detection by CT-guided biopsy. Specificity was increased by the additional occurrence of epidural infiltration or paravertebral abscesses.

  12. CT-Guided Biopsy in Suspected Spondylodiscitis – The Association of Paravertebral Inflammation with Microbial Pathogen Detection

    Science.gov (United States)

    Spira, Daniel; Germann, Thomas; Lehner, Burkhard; Hemmer, Stefan; Akbar, Michael; Jesser, Jessica; Weber, Marc-André; Rehnitz, Christoph

    2016-01-01

    Objectives To search for imaging characteristics distinguishing patients with successful from those with futile microbiological pathogen detection by CT-guided biopsy in suspected spondylodiscitis. Methods 34 consecutive patients with suspected spondylodiscitis underwent CT-guided biopsy for pathogen detection. MR-images were assessed for inflammatory infiltration of disks, adjacent vertebrae, epidural and paravertebral space. CT-images were reviewed for arrosion of adjacent end plates and reduced disk height. Biopsy samples were sent for microbiological examination in 34/34 patients, and for additional histological analysis in 28/34 patients. Results Paravertebral infiltration was present in all 10/10 patients with positive microbiology and occurred in only 12/24 patients with negative microbiology, resulting in a sensitivity of 100% and a specificity of 50% for pathogen detection. Despite its limited sensitivities, epidural infiltration and paravertebral abscesses showed considerably higher specificities of 83.3% and 90.9%, respectively. Paravertebral infiltration was more extensive in patients with positive as compared to negative microbiology (p = 0.002). Even though sensitivities for pathogen detection were also high in case of vertebral and disk infiltration, or end plate arrosion, specificities remained below 10%. Conclusions Inflammatory infiltration of the paravertebral space indicated successful pathogen detection by CT-guided biopsy. Specificity was increased by the additional occurrence of epidural infiltration or paravertebral abscesses. PMID:26727377

  13. A method for the rapid detection and identification of halo blight pathogen on common bean

    Directory of Open Access Journals (Sweden)

    Popović Tatjana

    2014-01-01

    Full Text Available A diagnostic method based on nested-PCR, followed by ELISA and conventional bacteriology tests, for the rapid and reliable detection of halo blight pathogen Pseudomonas savastanoi pv. phaseolicola (Psp collected from infected bean leaves and seeds is described. Psp formed white, small and flat colonies on nutrient agar medium, creamy white, flat and circular on Milk-Tween agar medium and light yellow, convex and shiny on modified sucrose peptone agar medium. Eighteen Gram-negative, catalase-positive and oxidase-negative strains were subjected to nested PCR with primers P 5.1/P 3.1 and P 5.2/P 3.2, which directed the amplification of the 450 bp target DNA fragment in all tested strains. According to the results of DAS- and PTA-ELISA with respect to reactivity to specific antibodies, all analyzed strains belonged to Psp bacterium. Pathogenicity was tested on bean pods and cotyledon leaves, on which greasy spots were formed. Psp did not cause hypersensitive reaction on the leaves of tobacco and geranium. Strains produced levan, fluorescent pigment, oxidative metabolism of glucose, did not reduce nitrate, did not produce indole and H2S, did not hydrolyze starch, gelatin and esculin; they produced acid from glucose, mannose, sucrose and glycerol, and did not produce acid from maltose, starch, esculin, dulcite, sorbitol, inositol and erythritol.

  14. Antibody-based magneto-elastic biosensors: potential devices for detection of pathogens and associated toxins.

    Science.gov (United States)

    Menti, C; Henriques, J A P; Missell, F P; Roesch-Ely, M

    2016-07-01

    This work describes the design and development process of an immunosensor. The creation of such devices goes through various steps, which complement each other, and choosing an efficient immobilization method that binds to a specific target is essential to achieve satisfactory diagnostic results. In this perspective, the emphasis here is on developing biosensors based on binding antigens/antibodies on particular surfaces of magneto-elastic sensors. Different aspects leading to the improvement of these sensors, such as the antibody structure, the chemical functionalization of the surface, and cross-linking antibody reticulation were summarized and discussed. This paper deals with the progress of magneto-elastic immunosensors to detect bacterial pathogens and associated toxins. Biologically modified surface characterization methods are further considered. Thus, research opportunities and trends of future development in these areas are finally discussed.

  15. Quantitative polymerase chain reaction (PCR) for detection of aquatic animal pathogens in a diagnostic laboratory setting

    Science.gov (United States)

    Purcell, Maureen K.; Getchell, Rodman G.; McClure, Carol A.; Weber, S.E.; Garver, Kyle A.

    2011-01-01

    Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.

  16. Nanostructured Electrochemical Biosensors for Label-Free Detection of Water- and Food-Borne Pathogens.

    Science.gov (United States)

    Reta, Nekane; Saint, Christopher P; Michelmore, Andrew; Prieto-Simon, Beatriz; Voelcker, Nicolas H

    2018-02-21

    The emergence of nanostructured materials has opened new horizons in the development of next generation biosensors. Being able to control the design of the electrode interface at the nanoscale combined with the intrinsic characteristics of the nanomaterials engenders novel biosensing platforms with improved capabilities. The purpose of this review is to provide a comprehensive and critical overview of the latest trends in emerging nanostructured electrochemical biosensors. A detailed description and discussion of recent approaches to construct label-free electrochemical nanostructured electrodes is given with special focus on pathogen detection for environmental monitoring and food safety. This includes the use of nanoscale materials such as nanotubes, nanowires, nanoparticles, and nanosheets as well as porous nanostructured materials including nanoporous anodic alumina, mesoporous silica, porous silicon, and polystyrene nanochannels. These platforms may pave the way toward the development of point-of-care portable electronic devices for applications ranging from environmental analysis to biomedical diagnostics.

  17. Hyperspectral image reconstruction using RGB color for foodborne pathogen detection on agar plates

    Science.gov (United States)

    Yoon, Seung-Chul; Shin, Tae-Sung; Park, Bosoon; Lawrence, Kurt C.; Heitschmidt, Gerald W.

    2014-03-01

    This paper reports the latest development of a color vision technique for detecting colonies of foodborne pathogens grown on agar plates with a hyperspectral image classification model that was developed using full hyperspectral data. The hyperspectral classification model depended on reflectance spectra measured in the visible and near-infrared spectral range from 400 and 1,000 nm (473 narrow spectral bands). Multivariate regression methods were used to estimate and predict hyperspectral data from RGB color values. The six representative non-O157 Shiga-toxin producing Eschetichia coli (STEC) serogroups (O26, O45, O103, O111, O121, and O145) were grown on Rainbow agar plates. A line-scan pushbroom hyperspectral image sensor was used to scan 36 agar plates grown with pure STEC colonies at each plate. The 36 hyperspectral images of the agar plates were divided in half to create training and test sets. The mean Rsquared value for hyperspectral image estimation was about 0.98 in the spectral range between 400 and 700 nm for linear, quadratic and cubic polynomial regression models and the detection accuracy of the hyperspectral image classification model with the principal component analysis and k-nearest neighbors for the test set was up to 92% (99% with the original hyperspectral images). Thus, the results of the study suggested that color-based detection may be viable as a multispectral imaging solution without much loss of prediction accuracy compared to hyperspectral imaging.

  18. Detection of pathogenic Leptospira species associated with phyllostomid bats (Mammalia: Chiroptera) from Veracruz, Mexico.

    Science.gov (United States)

    Ballados-González, G G; Sánchez-Montes, S; Romero-Salas, D; Colunga Salas, P; Gutiérrez-Molina, R; León-Paniagua, L; Becker, I; Méndez-Ojeda, M L; Barrientos-Salcedo, C; Serna-Lagunes, R; Cruz-Romero, A

    2018-06-01

    The genus Leptospira encompass 22 species of spirochaetes, with ten pathogenic species that have been recorded in more than 160 mammals worldwide. In the last two decades, the numbers of records of these agents associated with bats have increased exponentially, particularly in America. Although order Chiroptera represents the second most diverse order of mammals in Mexico, and leptospirosis represents a human and veterinary problem in the country, few studies have been conducted to identify potential wildlife reservoirs. The aim of this study was to detect the presence and diversity of Leptospira sp. in communities of bats in an endemic state of leptospirosis in Mexico. During January to September 2016, 81 bats of ten species from three localities of Veracruz, Mexico, were collected with mist nets. Kidney samples were obtained from all specimens. For the detection of Leptospira sp., we amplified several genes using specific primers. Amplicons of the expected size were submitted to sequencing, and sequences recovered were compared with those of reference deposited in GenBank using the BLAST tool. To identify their phylogenetic position, we realized a reconstruction using maximum-likelihood (ML) method. Twenty-five samples from three bat species (Artibeus lituratus, Choeroniscus godmani and Desmodus rotundus) showed the presence of Leptospira DNA. Sequences recovered were close to Leptospira noguchii, Leptospira weilii and Leptospira interrogans. Our results include the first record of Leptospira in bats from Mexico and exhibit a high diversity of these pathogens circulating in the state. Due to the finding of a large number of positive wild animals, it is necessary to implement a surveillance system in populations of the positive bats as well as in related species, in order to understand their role as carriers of this bacterial genus. © 2018 Blackwell Verlag GmbH.

  19. Surface enhanced Raman scattering (SERS) with biopolymer encapsulated silver nanosubstrates for rapid detection of foodborne pathogens.

    Science.gov (United States)

    Sundaram, Jaya; Park, Bosoon; Kwon, Yongkuk; Lawrence, Kurt C

    2013-10-01

    A biopolymer encapsulated with silver nanoparticles was prepared using silver nitrate, polyvinyl alcohol (PVA) solution, and trisodium citrate. It was deposited on a mica sheet to use as SERS substrate. Fresh cultures of Salmonella Typhimurium, Escherichia coli, Staphylococcus aureus and Listeria innocua were washed from chicken rinse and suspended in 10 ml of sterile deionized water. Approximately 5 μl of the bacterial suspensions was placed on the substrate individually and exposed to 785 nm HeNe laser excitation. SERS spectral data were recorded over the Raman shift between 400 and 1800 cm(-1) from 15 different spots on the substrate for each sample; and three replicates were done on each bacteria type. Principal component analysis (PCA) model was developed to classify foodborne bacteria types. PC1 identified 96% of the variation among the given bacteria specimen, and PC2 identified 3%, resulted in a total of 99% classification accuracy. Soft Independent Modeling of Class Analogies (SIMCA) of validation set gave an overall correct classification of 97%. Comparison of the SERS spectra of different types of gram-negative and gram-positive bacteria indicated that all of them have similar cell walls and cell membrane structures. Conversely, major differences were noted around the nucleic acid and amino acid structure information between 1200 cm(-1) and 1700 cm(-1) and at the finger print region between 400 cm(-1) and 700 cm(-1). Silver biopolymer nanoparticle substrate could be a promising SERS tool for pathogen detection. Also this study indicates that SERS technology could be used for reliable and rapid detection and classification of food borne pathogens. Published by Elsevier B.V.

  20. [The Advances in the Contamination and Detection of Foodborne Pathogen Noroviruses in Fresh Produce].

    Science.gov (United States)

    Xie, Yajing; Liu, Xianjin

    2015-11-01

    This article reviewed the researches proceeding on the contamination and detection of the foodborne pathogen noroviruses (NoVs) in fresh produce, which involved the NoVs contaminations in fresh produce, the special attachment of NoVs in fresh produce, the NoVs outbreaks associated with fresh produce and the NoVs detection in fresh produce. There had been an increase in reported infectious disease risks associated with the consumptions of fresh produce for recent 30 years. Because the NoVs, as a primary cause of viral gastroenteritis thoughout the world, were highly contagious, had a low infectious dose, and were persistent in the environment. And also the methods for NoVs detection in food had significantly developed over the last 15 years. Currently NoVs were the most common pathogen accounting for 40% of outbreaks associated with fresh produce (i. e., fruits and vegetables). Data from outbreaks investigations verified fresh produce as the high risk food products for NoVs. The fresh produce were typically eaten raw with no thermal processing, can be contaminated at any step during production and processing from faecally polluted water and fertilizers, the poor hygiene practices by food handlers and the cross-contamination. The attachment of NoVs to the fresh produce was due to the physio-chemical factors of virus protein coat, the special attachment to different fresh produce, and the possibility for internalization of NoVs. It might provide answers to why those high risk foods were more frequently implicated (i. e., lettuce and raspberries). According to the data of foodborne NoVs outbreaks which were associated with fresh produce from EU countries and the USA, the outbreaks in EU countries were mainly associated with NoVs contaminated raspberries and lettuce, while in USA which were associated with NoVs contaminated lettuce. Unfortunately, there were no NoVs detection methods for fresh produce or the data of foodborne NoVs outbreaks which were associated with

  1. Simultaneous Detection of Brown Rot- and Soft Rot-Causing Bacterial Pathogens from Potato Tubers Through Multiplex PCR.

    Science.gov (United States)

    Ranjan, R K; Singh, Dinesh; Baranwal, V K

    2016-11-01

    Ralstonia solanacearum (Smith) Yabuuchi et al. and Erwinia carotovora subsp. carotovora (Jones) Bergey et al. (Pectobacterium carotovorum subsp. carotovorum) are the two major bacterial pathogens of potato causing brown rot (wilt) and soft rot diseases, respectively, in the field and during storage. Reliable and early detection of these pathogens are keys to avoid occurrence of these diseases in potato crops and reduce yield loss. In the present study, multiplex polymerase chain reaction (PCR) protocol was developed for simultaneous detection of R. solanacearum and E. carotovora subsp. carotovora from potato tubers. A set of oligos targeting the pectatelyase (pel) gene of E. carotovora subsp. carotovora and the universal primers based on 16S r RNA gene of R. solanacearum were used. The standardized multiplex PCR protocol could detect R. solanacearum and E. carotovora subsp. carotovora up to 0.01 and 1.0 ng of genomic DNA, respectively. The protocol was further validated on 96 stored potato tuber samples, collected from different potato-growing states of India, viz. Uttarakhand, Odisha, Meghalaya and Delhi. 53.1 % tuber samples were positive for R. solanacearum, and 15.1 % of samples were positive for E. carotovora subsp. carotovora, and both the pathogens were positive in 26.0 % samples when BIO-PCR was used. This method offers sensitive, specific, reliable and fast detection of two major bacterial pathogens from potato tubers simultaneously, particularly pathogen-free seed certification in large scale.

  2. Molecular-based detection of the gastrointestinal pathogen Campylobacter ureolyticus in unpasteurized milk samples from two cattle farms in Ireland

    Directory of Open Access Journals (Sweden)

    Koziel Monika

    2012-11-01

    Full Text Available Abstract Campylobacter jejuni and coli are collectively regarded as the most prevalent cause of bacterial foodborne illness worldwide. An emerging species, Campylobacter ureolyticus has recently been detected in patients with gastroenteritis, however, the source of this organism has, until now, remained unclear. Herein, we describe the molecular-based detection of this pathogen in bovine faeces (1/20 and unpasteurized milk (6/47 but not in poultry (chicken wings and caeca. This is, to the best of our knowledge, the first report of the presence of this potential gastrointestinal pathogen in an animal source, possibly suggesting a route for its transmission to humans.

  3. Vaginal microbicides: detecting toxicities in vivo that paradoxically increase pathogen transmission

    Directory of Open Access Journals (Sweden)

    Abusuwwa Raed

    2006-06-01

    Full Text Available Abstract Background Microbicides must protect against STD pathogens without causing unacceptable toxic effects. Microbicides based on nonoxynol-9 (N9 and other detergents disrupt sperm, HSV and HIV membranes, and these agents are effective contraceptives. But paradoxically N9 fails to protect women against HIV and other STD pathogens, most likely because it causes toxic effects that increase susceptibility. The mouse HSV-2 vaginal transmission model reported here: (a Directly tests for toxic effects that increase susceptibility to HSV-2, (b Determines in vivo whether a microbicide can protect against HSV-2 transmission without causing toxicities that increase susceptibility, and (c Identifies those toxic effects that best correlate with the increased HSV susceptibility. Methods Susceptibility was evaluated in progestin-treated mice by delivering a low-dose viral inoculum (0.1 ID50 at various times after delivering the candidate microbicide to detect whether the candidate increased the fraction of mice infected. Ten agents were tested – five detergents: nonionic (N9, cationic (benzalkonium chloride, BZK, anionic (sodium dodecylsulfate, SDS, the pair of detergents in C31G (C14AO and C16B; one surface active agent (chlorhexidine; two non-detergents (BufferGel®, and sulfonated polystyrene, SPS; and HEC placebo gel (hydroxyethylcellulose. Toxic effects were evaluated by histology, uptake of a 'dead cell' dye, colposcopy, enumeration of vaginal macrophages, and measurement of inflammatory cytokines. Results A single dose of N9 protected against HSV-2 for a few minutes but then rapidly increased susceptibility, which reached maximum at 12 hours. When applied at the minimal concentration needed for brief partial protection, all five detergents caused a subsequent increase in susceptibility at 12 hours of ~20–30-fold. Surprisingly, colposcopy failed to detect visible signs of the N9 toxic effect that increased susceptibility at 12 hours. Toxic

  4. Molecular detection of tick-borne pathogens in cattle from Southwestern Ethiopia.

    Directory of Open Access Journals (Sweden)

    Zerihun Hailemariam

    Full Text Available Tick-borne diseases (TBDs cause significant losses among livestock and impact the livelihoods of resource-poor farming communities worldwide. In Ethiopia, detailed studies on the epidemiology of tick-borne pathogens (TBPs in cattle using sensitive molecular detection methods are scarce. The objective of this study was to determine the prevalence and species composition of bovine TBPs of veterinary significance in local cattle populations. A comprehensive cross-sectional epidemiological study was conducted in cattle populations of Illubabor zone in Southwestern Ethiopia from June to August 2013. For this purpose, blood samples were collected from 392 cattle. A combination of polymerase chain reaction (PCR and a Reverse Line Blot (RLB hybridization assay was employed for the detection of TBPs in these samples. The PCR/RLB results of the 392 blood samples indicated a high overall prevalence of 96.9% for TBPs, including Theileria mutans (66.1%, Theileria orientalis (51.8%, Anaplasma sp. Omatjenne (25.5%, Anaplasma marginale (14.5%, Babesia bigemina (14.0% and Theileria velifera (13.0% and minor occurrences of Ehrlichia ruminantium (0.5% and Ehrlichia minasensis (0.26%. Moreover, three novel Anaplasma genotypes were detected in bovine blood samples. A phylogenetic analysis revealed that they most likely represent three, but at least two, new species. The prevalence of the three novel Anaplasma species, preliminary designated as Anaplasma sp. Hadesa, Anaplasma sp. Saso and Anaplasma sp. Dedessa, was 12.5%, 14.3% and 5.6%, respectively. Overall, a total of 227 cattle (57.9% were found to be co-infected with two or more TBPs simultaneously and 86 different species combinations were observed. The findings show a very high burden of infection of cattle with TBPs in Ethiopia. The high frequency of co-infections suggests that clinical manifestations might be complex. Further research is required to determine the pathogenicity, host cell types and vector of

  5. Comparison of the detection of periodontal pathogens in bacteraemia after tooth brushing by culture and molecular techniques.

    Science.gov (United States)

    Marín, M-J; Figuero, E; González, I; O'Connor, A; Diz, P; Álvarez, M; Herrera, D; Sanz, M

    2016-05-01

    The prevalence and amounts of periodontal pathogens detected in bacteraemia samples after tooth brushing-induced by means of four diagnostic technique, three based on culture and one in a molecular-based technique, have been compared in this study. Blood samples were collected from thirty-six subjects with different periodontal status (17 were healthy, 10 with gingivitis and 9 with periodontitis) at baseline and 2 minutes after tooth brushing. Each sample was analyzed by three culture-based methods [direct anaerobic culturing (DAC), hemo-culture (BACTEC), and lysis-centrifugation (LC)] and one molecular-based technique [quantitative polymerase chain reaction (qPCR)]. With culture any bacterial isolate was detected and quantified, while with qPCR only Porphyromonas gingivalis and Aggregatibacter actinomycetemcomitans were detected and quantified. Descriptive analyses, ANOVA and Chi-squared tests, were performed. Neither BACTEC nor qPCR detected any type of bacteria in the blood samples. Only LC (2.7%) and DAC (8.3%) detected bacteraemia, although not in the same patients. Fusobacterium nucleatum was the most frequently detected bacterial species. The disparity in the results when the same samples were analyzed with four different microbiological detection methods highlights the need for a proper validation of the methodology to detect periodontal pathogens in bacteraemia samples, mainly when the presence of periodontal pathogens in blood samples after tooth brushing was very seldom.

  6. Comparison of the detection of periodontal pathogens in bacteraemia after tooth brushing by culture and molecular techniques

    Science.gov (United States)

    Figuero, Elena; González, Itziar; O´Connor, Ana; Diz, Pedro; Álvarez, Maximiliano; Herrera, David; Sanz, Mariano

    2016-01-01

    Background The prevalence and amounts of periodontal pathogens detected in bacteraemia samples after tooth brushing-induced by means of four diagnostic technique, three based on culture and one in a molecular-based technique, have been compared in this study. Material and Methods Blood samples were collected from thirty-six subjects with different periodontal status (17 were healthy, 10 with gingivitis and 9 with periodontitis) at baseline and 2 minutes after tooth brushing. Each sample was analyzed by three culture-based methods [direct anaerobic culturing (DAC), hemo-culture (BACTEC), and lysis-centrifugation (LC)] and one molecular-based technique [quantitative polymerase chain reaction (qPCR)]. With culture any bacterial isolate was detected and quantified, while with qPCR only Porphyromonas gingivalis and Aggregatibacter actinomycetemcomitans were detected and quantified. Descriptive analyses, ANOVA and Chi-squared tests, were performed. Results Neither BACTEC nor qPCR detected any type of bacteria in the blood samples. Only LC (2.7%) and DAC (8.3%) detected bacteraemia, although not in the same patients. Fusobacterium nucleatum was the most frequently detected bacterial species. Conclusions The disparity in the results when the same samples were analyzed with four different microbiological detection methods highlights the need for a proper validation of the methodology to detect periodontal pathogens in bacteraemia samples, mainly when the presence of periodontal pathogens in blood samples after tooth brushing was very seldom. Key words:Bacteraemia, periodontitis, culture, PCR, tooth brushing. PMID:26946197

  7. Prevalence and Characteristics of Enteric Pathogens Detected in Diarrhoeic and Non-Diarrhoeic Foals in Trinidad

    Directory of Open Access Journals (Sweden)

    Robin Harris

    2012-01-01

    Full Text Available The study determined the relative importance of Escherichia coli, E. coli O157, Salmonella spp., Clostridium spp., rotavirus, Cryptosporidium spp., and Strongyloides westeri in foal (diarrhoeic and non-diarrhoeic available for sampling during the foaling season of 2010 and determined their sensitivity to antimicrobial agents. A cross-sectional study was conducted on 164 foals (9 diarrhoeic and 155 non-diarrhoeic from 15 farms in Trinidad. Isolation and detection of enteric pathogens followed standard methods, and the antibiograms of E. coli and Salmonella spp. were determined using the disc diffusion method. All organisms investigated were detected except E. coli O157. A high prevalence of E. coli (85.0%, Cryptosporidium spp. (64.8%, Strongyloides westeri (35.7% was seen, but the prevalence was comparatively low for Clostridium spp. (12.9%, Salmonella spp. (4.4% and rotavirus (2.1%. Only Salmonella spp. was isolated at a statistically significantly (<0.05; 2 higher frequency from diarrhoeic (25.0% than non-diarrhoeic (4.0% foals. Amongst E. coli isolates, the frequency of resistance was higher in isolates from diarrhoeic compared with non-diarrhoeic foals but the difference was only statistically significant (<0.05; 2 for tetracycline. All isolates of Salmonella spp. were sensitive to streptomycin and sulphamethoxazole/trimethoprim, a finding that may have therapeutic significance.

  8. Molecular Detection of Multiple Emerging Pathogens in Sputa from Cystic Fibrosis Patients

    Science.gov (United States)

    Bittar, Fadi; Richet, Hervé; Dubus, Jean-Christophe; Reynaud-Gaubert, Martine; Stremler, Nathalie; Sarles, Jacques; Raoult, Didier; Rolain, Jean-Marc

    2008-01-01

    Background There is strong evidence that culture-based methods detect only a small proportion of bacteria present in the respiratory tracts of cystic fibrosis (CF) patients. Methodology/Principal Findings Standard microbiological culture and phenotypic identification of bacteria in sputa from CF patients have been compared to molecular methods by the use of 16S rDNA amplification, cloning and sequencing. Twenty-five sputa from CF patients were cultured that yield 33 isolates (13 species) known to be pathogens during CF. For molecular cloning, 760 clones were sequenced (7.2±3.9 species/sputum), and 53 different bacterial species were identified including 16 species of anaerobes (30%). Discrepancies between culture and molecular data were numerous and demonstrate that accurate identification remains challenging. New or emerging bacteria not or rarely reported in CF patients were detected including Dolosigranulum pigrum, Dialister pneumosintes, and Inquilinus limosus. Conclusions/Significance Our results demonstrate the complex microbial community in sputa from CF patients, especially anaerobic bacteria that are probably an underestimated cause of CF lung pathology. Metagenomic analysis is urgently needed to better understand those complex communities in CF pulmonary infections. PMID:18682840

  9. Specific and sensitive detection of the conifer pathogen Gremmeniella abietina by nested PCR

    Directory of Open Access Journals (Sweden)

    Hansson Per

    2005-11-01

    Full Text Available Abstract Background Gremmeniella abietina (Lagerb. Morelet is an ascomycete fungus that causes stem canker and shoot dieback in many conifer species. The fungus is widespread and causes severe damage to forest plantations in Europe, North America and Asia. To facilitate early diagnosis and improve measures to control the spread of the disease, rapid, specific and sensitive detection methods for G. abietina in conifer hosts are needed. Results We designed two pairs of specific primers for G. abietina based on the 18S rDNA sequence variation pattern. These primers were validated against a wide range of fungi and 14 potential conifer hosts. Based on these specific primers, two nested PCR systems were developed. The first system employed universal fungal primers to enrich the fungal DNA targets in the first round, followed by a second round selective amplification of the pathogen. The other system employed G. abietina-specific primers in both PCR steps. Both approaches can detect the presence of G. abietina in composite samples with high sensitivity, as little as 7.5 fg G. abietina DNA in the host genomic background. Conclusion The methods described here are rapid and can be applied directly to a wide range of conifer species, without the need for fungal isolation and cultivation. Therefore, it represents a promising alternative to disease inspection in forest nurseries, plantations and quarantine control facilities.

  10. Surface Generated Acoustic Wave Biosensors for the Detection of Pathogens: A Review

    Directory of Open Access Journals (Sweden)

    Antonio Arnau-Vives

    2009-07-01

    Full Text Available This review presents a deep insight into the Surface Generated Acoustic Wave (SGAW technology for biosensing applications, based on more than 40 years of technological and scientific developments. In the last 20 years, SGAWs have been attracting the attention of the biochemical scientific community, due to the fact that some of these devices - Shear Horizontal Surface Acoustic Wave (SH-SAW, Surface Transverse Wave (STW, Love Wave (LW, Flexural Plate Wave (FPW, Shear Horizontal Acoustic Plate Mode (SH-APM and Layered Guided Acoustic Plate Mode (LG-APM - have demonstrated a high sensitivity in the detection of biorelevant molecules in liquid media. In addition, complementary efforts to improve the sensing films have been done during these years. All these developments have been made with the aim of achieving, in a future, a highly sensitive, low cost, small size, multi-channel, portable, reliable and commercially established SGAW biosensor. A setup with these features could significantly contribute to future developments in the health, food and environmental industries. The second purpose of this work is to describe the state-of-the-art of SGAW biosensors for the detection of pathogens, being this topic an issue of extremely importance for the human health. Finally, the review discuses the commercial availability, trends and future challenges of the SGAW biosensors for such applications.

  11. Comparing nucleic acid lateral flow and electrochemical genosensing for the simultaneous detection of foodborne pathogens.

    Science.gov (United States)

    Ben Aissa, A; Jara, J J; Sebastián, R M; Vallribera, A; Campoy, S; Pividori, M I

    2017-02-15

    Due to the increasing need of rapid tests for application in low resource settings, WHO summarized their ideal features under the acronym ASSURED (Affordable, Sensitive, Specific, User-friendly, Rapid and Robust, Equipment-free, Delivered to those who need it). In this work, two different platforms for the rapid and simultaneous testing of the foodborne pathogens E. coli O157:H7 and Salmonella enterica, in detail a nucleic acid lateral flow and an electrochemical magneto-genosensor are presented and compared in terms of their analytical performance. The DNA of the bacteria was amplified by polymerase chain reaction using a quadruple-tagging set of primers specific for E. coli eaeA (151bp) and Salmonella enterica yfiR (375bp) genes. During the amplification, the amplicons were labelled at the same time with biotin/digoxigenin or biotin/fluorescein tags, respectively. The nucleic acid lateral flow assay was based on the use of streptavidin gold nanoparticles for the labelling of the tagged amplicon from E. coli and Salmonella. The visual readout was achieved when the gold-modified amplicons were captured by the specific antibodies. The features of this approach are discussed and compared with an electrochemical magneto-genosensor. Although nucleic acid lateral flow showed higher limit of detection, this strategy was able to clearly distinguish positive and negative samples of both bacteria being considered as a rapid and promising detection tool for bacteria screening. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Development of simple multiplex real-time PCR assays for foodborne pathogens detection and identification on LightCycler

    Directory of Open Access Journals (Sweden)

    Avo Karus1

    2017-03-01

    Full Text Available Most acute intestinal diseases are caused by food-borne pathogens. A fast and simple real-time PCR-based procedure for simultaneous detection of food contamination by any of the five food-borne pathogens: Campylobacter jejuni, Mycobacterium bovis, Enterobacter sakazaki, Shigella boydii, Clostridium perfrigens using multiplex EvaGreen real-time PCR for LightCycler was developed and evaluated. Real-time qPCR showed excellent sensitivity. Tm calling and Melting Curve Genotyping (MCG were used for analysis of PCR product melting curves. The Melting Curve Genotyping option showed good performance for discrimination of positive samples containing DNA of single pathogen or pathogen mixtures from negative samples.

  13. Can coefficient of variation of time-domain analysis be valuable for detecting cardiovascular autonomic neuropathy in young patients with type 1 diabetes: a case control study.

    Science.gov (United States)

    Razanskaite-Virbickiene, Dovile; Danyte, Evalda; Mockeviciene, Giedre; Dobrovolskiene, Rimante; Verkauskiene, Rasa; Zalinkevicius, Rimantas

    2017-01-19

    Cardiovascular autonomic neuropathy (CAN) increases morbidity and mortality in diabetes through association with a high risk of cardiac arrhythmias and sudden death, possibly related to silent myocardial ischemia. During the sub-clinical stage, CAN can be detected through reduction in heart rate variability (HRV). The aim of our study was to estimate if the time and frequency-domain analysis can be valuable for detecting CAN in young patients with type 1 diabetes mellitus (T1DM). For this case control study of evaluation of cardiovascular autonomic function the 15-25 years age group of patients with duration of T1DM more than 9 years (n = 208, 89 males and 119 females) were selected. 67 patients with confirmed CAN were assigned to the "case group" and 141 patients without CAN served as a control group, the duration of T1DM was similar (15.07 ± 4.89 years vs.13.66 ± 4.02 years; p = 0.06) in both groups. Cardiovascular autonomic reflex tests and time and frequency domains analysis of HRV were performed for all subjects. Time domain measures were significantly lower in CAN group compared with control (p patients with CAN. Receivers operating characteristic (ROC) curves were constructed to compare the accuracies of the parameters of time-domain analysis for diagnosing CAN. We estimated a more reliable cut-off value of parameters of time-domain. The CV values in supine position cardiovascular autonomic function, providing more information about sympathetic and parasympathetic activity. The coefficient of variation (time-domain analysis) especially during deep breathing could be valuable for detecting CAN.

  14. Detection of virulence-associated genes in pathogenic and commensal avian Escherichia coli isolates.

    Science.gov (United States)

    Paixão, A C; Ferreira, A C; Fontes, M; Themudo, P; Albuquerque, T; Soares, M C; Fevereiro, M; Martins, L; Corrêa de Sá, M I

    2016-07-01

    Poultry colibacillosis due to Avian Pathogenic Escherichia coli (APEC) is responsible for several extra-intestinal pathological conditions, leading to serious economic damage in poultry production. The most commonly associated pathologies are airsacculitis, colisepticemia, and cellulitis in broiler chickens, and salpingitis and peritonitis in broiler breeders. In this work a total of 66 strains isolated from dead broiler breeders affected with colibacillosis and 61 strains from healthy broilers were studied. Strains from broiler breeders were typified with serogroups O2, O18, and O78, which are mainly associated with disease. The serogroup O78 was the most prevalent (58%). All the strains were checked for the presence of 11 virulence genes: 1) arginine succinyltransferase A (astA); ii) E.coli hemeutilization protein A (chuA); iii) colicin V A/B (cvaA/B); iv) fimbriae mannose-binding type 1 (fimC); v) ferric yersiniabactin uptake A (fyuA); vi) iron-repressible high-molecular-weight proteins 2 (irp2); vii) increased serum survival (iss); viii) iron-uptake systems of E.coli D (iucD); ix) pielonefritis associated to pili C (papC); x) temperature sensitive haemaglutinin (tsh), and xi) vacuolating autotransporter toxin (vat), by Multiplex-PCR. The results showed that all genes are present in both commensal and pathogenic E. coli strains. The iron uptake-related genes and the serum survival gene were more prevalent among APEC. The adhesin genes, except tsh, and the toxin genes, except astA, were also more prevalent among APEC isolates. Except for astA and tsh, APEC strains harbored the majority of the virulence-associated genes studied and fimC was the most prevalent gene, detected in 96.97 and 88.52% of APEC and AFEC strains, respectively. Possession of more than one iron transport system seems to play an important role on APEC survival. © 2016 Poultry Science Association Inc.

  15. Validation of high-throughput real time polymerase chain reaction assays for simultaneous detection of invasive citrus pathogens.

    Science.gov (United States)

    Saponari, Maria; Loconsole, Giuliana; Liao, Hui-Hong; Jiang, Bo; Savino, Vito; Yokomi, Raymond K

    2013-11-01

    A number of important citrus pathogens are spread by graft propagation, arthropod vector transmission and inadvertent import and dissemination of infected plants. For these reasons, citrus disease management and clean stock programs require pathogen detection systems which are economical and sensitive to maintain a healthy industry. To this end, multiplex quantitative real-time PCR (qPCR) assays were developed allowing high-throughput and simultaneous detection of some major invasive citrus pathogens. Automated high-throughput extraction comparing several bead-based commercial extraction kits were tested and compared with tissue print and manual extraction to obtain nucleic acids from healthy and pathogen-infected citrus trees from greenhouse in planta collections and field. Total nucleic acids were used as templates for pathogen detection. Multiplex reverse transcription-qPCR (RT-qPCR) assays were developed for simultaneous detection of six targets including a virus, two viroids, a bacterium associated with huanglongbing and a citrus RNA internal control. Specifically, two one-step TaqMan-based multiplex RT-qPCR assays were developed and tested with target templates to determine sensitivity and detection efficiency. The first assay included primers and probes for 'Candidatus Liberibacter asiaticus' (CLas) and Citrus tristeza virus (CTV) broad spectrum detection and genotype differentiation (VT- and T3-like genotypes). The second assay contained primers and probes for Hop stunt viroid (HSVd), Citrus exocortis viroid (CEVd) and the mitochondrial NADH dehydrogenase (nad5) mRNA as an internal citrus host control. Primers and TaqMan probes for the viroids were designed in this work; whereas those for the other pathogens were from reports of others. Based on quantitation cycle values, automated high-throughput extraction of samples proved to be as suitable as manual extraction. The multiplex RT-qPCR assays detected both RNA and DNA pathogens in the same dilution series

  16. Autonomic neuropathies

    Science.gov (United States)

    Low, P. A.

    1998-01-01

    A limited autonomic neuropathy may underlie some unusual clinical syndromes, including the postural tachycardia syndrome, pseudo-obstruction syndrome, heat intolerance, and perhaps chronic fatigue syndrome. Antibodies to autonomic structures are common in diabetes, but their specificity is unknown. The presence of autonomic failure worsens prognosis in the diabetic state. Some autonomic neuropathies are treatable. Familial amyloid polyneuropathy may respond to liver transplantation. There are anecdotal reports of acute panautonomic neuropathy responding to intravenous gamma globulin. Orthostatic hypotension may respond to erythropoietin or midodrine.

  17. Development and application of a multiplex PCR assay for rapid detection of 4 major bacterial pathogens in ducks.

    Science.gov (United States)

    Wei, B; Cha, S-Y; Kang, M; Park, I-J; Moon, O-K; Park, C-K; Jang, H-K

    2013-05-01

    Infections with Pasteurella multocida, Salmonella enterica, Riemerella anatipestifer, and Escherichia coli result in high morbidity and mortality, which cause significant economic loss in the poultry industry. It can be difficult to distinguish these pathogens based on clinical signs because these pathogens can cause similar clinical signs and coinfections can occur. Thus, rapid and sensitive detection of these 4 major bacterial pathogens are important in ducks. The aim of this study was to develop a multiplex PCR (mPCR) assay for simultaneously detecting and identifying these 4 pathogenic bacteria in a single tube reaction. The target genes used were KMT1 of P. multocida, the invasion protein gene of S. enterica, 16S rDNA of R. anatipestifer, and the alkaline phosphatase gene of E. coli. The detection limit of the assay for all bacterial DNA was 10 pg. The mPCR did not produce any nonspecific amplification products when tested against other related pathogens, including Staphylococcus aureus, Streptococcus pyogenes, Clostridium perfringens, Mycoplasma gallinarum, Mycoplasma synoviae, and Mycoplasma gallisepticum, which can also infect ducks. We applied mPCR to field samples, and the results were the same as the single PCR results. These results suggest that mPCR for the 4 bacteria is a useful and rapid technique to apply to field samples.

  18. 16SPIP: a comprehensive analysis pipeline for rapid pathogen detection in clinical samples based on 16S metagenomic sequencing.

    Science.gov (United States)

    Miao, Jiaojiao; Han, Na; Qiang, Yujun; Zhang, Tingting; Li, Xiuwen; Zhang, Wen

    2017-12-28

    Pathogen detection in clinical samples based on 16S metagenomic sequencing technology in microbiology laboratories is an important strategy for clinical diagnosis, public health surveillance, and investigations of outbreaks. However, the implementation of the technology is limited by its accuracy and the time required for bioinformatics analysis. Therefore, a simple, standardized, and rapid analysis pipeline from the receipt of clinical samples to the generation of a test report is needed to increase the use of metagenomic analyses in clinical settings. We developed a comprehensive bioinformatics analysis pipeline for the identification of pathogens in clinical samples based on 16S metagenomic sequencing data, named 16SPIP. This pipeline offers two analysis modes (fast and sensitive mode) for the rapid conversion of clinical 16S metagenomic data to test reports for pathogen detection. The pipeline includes tools for data conversion, quality control, merging of paired-end reads, alignment, and pathogen identification. We validated the feasibility and accuracy of the pipeline using a combination of culture and whole-genome shotgun (WGS) metagenomic analyses. 16SPIP may be effective for the analysis of 16S metagenomic sequencing data for real-time, rapid, and unbiased pathogen detection in clinical samples.

  19. Autonomous houses. Autonomous house

    Energy Technology Data Exchange (ETDEWEB)

    Tanaka, S. (Tokai University, Tokyo (Japan). Faculty of Engineering)

    1991-09-30

    Self-sufficiency type houses are outlined. On condition that people gain a certain amount of income in relation with the society, they self-suffice under the given environment, allowing themselves to accept a minimum of industrial products with small environmental load. Ordinary supply from outside of fossil energy and materials which depend on it is minimized. Types are classified into three: energy, energy materials and perfect self-sufficiency. A study project for environment symbiotic houses is progressing which is planned by the Ministry of Construction and Institute of Building Energy Conservation and is invested by a private company. Its target is making a house for halving an environmental load by CO{sub 2}, for the purpose of creating the environment symbiotic house which is nice to and in harmony with the global environment and human beings. As a part of the studies on energy-saving and resource conservation on houses, introduced is a plan of an autonomous house at Izu-Atagawa. The passive method and high thermal-insulation are used for air conditioning, and hot spring water for hot water supply. Electric power is generated by hydroelectric power generation using mountain streams and by solar cells. Staple food is purchased, while subsidiary food is sufficed. 17 refs., 4 figs., 1 tab.

  20. Nodeomics: Pathogen Detection in Vertebrate Lymph Nodes Using Meta-Transcriptomics

    Science.gov (United States)

    Wittekindt, Nicola E.; Padhi, Abinash; Schuster, Stephan C.; Qi, Ji; Zhao, Fangqing; Tomsho, Lynn P.; Kasson, Lindsay R.; Packard, Michael; Cross, Paul C.; Poss, Mary

    2010-01-01

    The ongoing emergence of human infections originating from wildlife highlights the need for better knowledge of the microbial community in wildlife species where traditional diagnostic approaches are limited. Here we evaluate the microbial biota in healthy mule deer (Odocoileus hemionus) by analyses of lymph node meta-transcriptomes. cDNA libraries from five individuals and two pools of samples were prepared from retropharyngeal lymph node RNA enriched for polyadenylated RNA and sequenced using Roche-454 Life Sciences technology. Protein-coding and 16S ribosomal RNA (rRNA) sequences were taxonomically profiled using protein and rRNA specific databases. Representatives of all bacterial phyla were detected in the seven libraries based on protein-coding transcripts indicating that viable microbiota were present in lymph nodes. Residents of skin and rumen, and those ubiquitous in mule deer habitat dominated classifiable bacterial species. Based on detection of both rRNA and protein-coding transcripts, we identified two new proteobacterial species; a Helicobacter closely related to Helicobacter cetorum in the Helicobacter pylori/Helicobacter acinonychis complex and an Acinetobacter related to Acinetobacter schindleri. Among viruses, a novel gamma retrovirus and other members of the Poxviridae and Retroviridae were identified. We additionally evaluated bacterial diversity by amplicon sequencing the hypervariable V6 region of 16S rRNA and demonstrate that overall taxonomic diversity is higher with the meta-transcriptomic approach. These data provide the most complete picture to date of the microbial diversity within a wildlife host. Our research advances the use of meta-transcriptomics to study microbiota in wildlife tissues, which will facilitate detection of novel organisms with pathogenic potential to human and animals.

  1. Nodeomics: pathogen detection in vertebrate lymph nodes using meta-transcriptomics.

    Directory of Open Access Journals (Sweden)

    Nicola E Wittekindt

    Full Text Available The ongoing emergence of human infections originating from wildlife highlights the need for better knowledge of the microbial community in wildlife species where traditional diagnostic approaches are limited. Here we evaluate the microbial biota in healthy mule deer (Odocoileus hemionus by analyses of lymph node meta-transcriptomes. cDNA libraries from five individuals and two pools of samples were prepared from retropharyngeal lymph node RNA enriched for polyadenylated RNA and sequenced using Roche-454 Life Sciences technology. Protein-coding and 16S ribosomal RNA (rRNA sequences were taxonomically profiled using protein and rRNA specific databases. Representatives of all bacterial phyla were detected in the seven libraries based on protein-coding transcripts indicating that viable microbiota were present in lymph nodes. Residents of skin and rumen, and those ubiquitous in mule deer habitat dominated classifiable bacterial species. Based on detection of both rRNA and protein-coding transcripts, we identified two new proteobacterial species; a Helicobacter closely related to Helicobacter cetorum in the Helicobacter pylori/Helicobacter acinonychis complex and an Acinetobacter related to Acinetobacter schindleri. Among viruses, a novel gamma retrovirus and other members of the Poxviridae and Retroviridae were identified. We additionally evaluated bacterial diversity by amplicon sequencing the hypervariable V6 region of 16S rRNA and demonstrate that overall taxonomic diversity is higher with the meta-transcriptomic approach. These data provide the most complete picture to date of the microbial diversity within a wildlife host. Our research advances the use of meta-transcriptomics to study microbiota in wildlife tissues, which will facilitate detection of novel organisms with pathogenic potential to human and animals.

  2. Recent Advances in Molecular Technologies and Their Application in Pathogen Detection in Foods with Particular Reference to Yersinia

    Directory of Open Access Journals (Sweden)

    Jin Gui

    2011-01-01

    Full Text Available Yersinia enterocolitica is an important zoonotic pathogen that can cause yersiniosis in humans and animals. Food has been suggested to be the main source of yersiniosis. It is critical for the researchers to be able to detect Yersinia or any other foodborne pathogen with increased sensitivity and specificity, as well as in real-time, in the case of a foodborne disease outbreak. Conventional detection methods are known to be labor intensive, time consuming, or expensive. On the other hand, more sensitive molecular-based detection methods like next generation sequencing, microarray, and many others are capable of providing faster results. DNA testing is now possible on a single molecule, and high-throughput analysis allows multiple detection reactions to be performed at once, thus allowing a range of characteristics to be rapidly and simultaneously determined. Despite better detection efficiencies, results derived using molecular biology methods can be affected by the various food matrixes. With the improvements in sample preparation, data analysis, and testing procedures, molecular detection techniques will likely continue to simplify and increase the speed of detection while simultaneously improving the sensitivity and specificity for tracking pathogens in food matrices.

  3. Phage-based surface plasmon resonance strategies for the detection of pathogens

    Science.gov (United States)

    Tawil, Nancy

    We start by reviewing the basic principles and recent advances in biosensing technologies using optical, electrochemical and acoustic platforms for phage-based diagnostics. Although much notable work has been done, a low cost, specific, sensitive optical method for detecting low concentrations of pathogens, in a few minutes, has not been established. We conclude from the limited body of work on the subject that improving immobilization strategies and finding more suitable phage recognition elements would allow for a more sensitive approach. Our aim was to better describe the attachment process of MRSA specific phages on gold surfaces, and the subsequent biodetection of their bacterial hosts by surface plasmon resonance (SPR). With the knowledge that the adsorption characteristics of thiol-containing molecules are necessary for applications involving the attachment of recognition elements to a functionalized surface, we start by providing comparative details on the kinetics of self-assembly of L-cysteine and 11-mercaptoundecanoic acid (MUA) monolayers on gold using SPR[1]. Our purpose, in carrying out these measurements was to establish each molecule's validity and applicability as a linker element for use in biosensing. We find that monolayer formation, for both L-cysteine and MUA, is described by the Langmuir isotherm at low concentrations only. For L-cysteine, both the amine and thiol groups contribute to the initial attachment of the molecule, followed by the replacement of the amine-gold complexes initially formed with more stable thiol-gold complexes. The reorganization of L-cysteine creates more space on the gold surface, and the zwitterionic form of the molecule permits the physisorption of a second layer through electrostatic interactions. On the other hand, MUA deposits randomly onto the surface of gold as a SAM and slowly reorganizes into a denser, vertical state. Surface plasmon resonance was then used for the real-time monitoring of the attachment of

  4. Rapid detection and identification of viral and bacterial fish pathogens using a DNA array‐based multiplex assay

    DEFF Research Database (Denmark)

    Lievens, B.; Frans, I.; Heusdens, C.

    2011-01-01

    Fish diseases can be caused by a variety of diverse organisms, including bacteria, fungi, viruses and protozoa, and pose a universal threat to the ornamental fish industry and aquaculture. The lack of rapid, accurate and reliable means by which fish pathogens can be detected and identified has been...... one of the main limitations in fish pathogen diagnosis and fish disease management and has consequently stimulated the search for alternative diagnostic techniques. Here, we describe a method based on multiplex and broad‐range PCR amplification combined with DNA array hybridization...... for the simultaneous detection and identification of all cyprinid herpesviruses (CyHV‐1, CyHV‐2 and CyHV‐3) and some of the most important fish pathogenic Flavobacterium species, including F. branchiophilum, F. columnare and F. psychrophilum. For virus identification, the DNA polymerase and helicase genes were...

  5. Automatic, electrocardiographic-based detection of autonomic arousals and their association with cortical arousals, leg movements, and respiratory events in sleep.

    Science.gov (United States)

    Olsen, Mads; Schneider, Logan Douglas; Cheung, Joseph; Peppard, Paul E; Jennum, Poul J; Mignot, Emmanuel; Sorensen, Helge Bjarup Dissing

    2018-03-01

    The current definition of sleep arousals neglects to address the diversity of arousals and their systemic cohesion. Autonomic arousals (AA) are autonomic activations often associated with cortical arousals (CA), but they may also occur in relation to a respiratory event, a leg movement event or spontaneously, without any other physiological associations. AA should be acknowledged as essential events to understand and explore the systemic implications of arousals. We developed an automatic AA detection algorithm based on intelligent feature selection and advanced machine learning using the electrocardiogram. The model was trained and tested with respect to CA systematically scored in 258 (181 training size/77 test size) polysomnographic recordings from the Wisconsin Sleep Cohort. A precision value of 0.72 and a sensitivity of 0.63 were achieved when evaluated with respect to CA. Further analysis indicated that 81% of the non-CA-associated AAs were associated with leg movement (38%) or respiratory (43%) events. The presented algorithm shows good performance when considering that more than 80% of the false positives (FP) found by the detection algorithm appeared in relation to either leg movement or respiratory events. This indicates that most FP constitute autonomic activations that are indistinguishable from those with cortical cohesion. The proposed algorithm provides an automatic system trained in a clinical environment, which can be utilized to analyze the systemic and clinical impacts of arousals.

  6. Direct Detection and Differentiation of Pathogenic Leptospira Species Using a Multi-Gene Targeted Real Time PCR Approach

    Science.gov (United States)

    Ferreira, Ana Sofia; Costa, Pedro; Rocha, Teresa; Amaro, Ana; Vieira, Maria Luísa; Ahmed, Ahmed; Thompson, Gertrude; Hartskeerl, Rudy A.; Inácio, João

    2014-01-01

    Leptospirosis is a growing public and veterinary health concern caused by pathogenic species of Leptospira. Rapid and reliable laboratory tests for the direct detection of leptospiral infections in animals are in high demand not only to improve diagnosis but also for understanding the epidemiology of the disease. In this work we describe a novel and simple TaqMan-based multi-gene targeted real-time PCR approach able to detect and differentiate Leptospira interrogans, L. kirschneri, L. borgpeteresenii and L. noguchii, which constitute the veterinary most relevant pathogenic species of Leptospira. The method uses sets of species-specific probes, and respective flanking primers, designed from ompL1 and secY gene sequences. To monitor the presence of inhibitors, a duplex amplification assay targeting both the mammal β-actin and the leptospiral lipL32 genes was implemented. The analytical sensitivity of all primer and probe sets was estimated to be <10 genome equivalents (GE) in the reaction mixture. Application of the amplification reactions on genomic DNA from a variety of pathogenic and non-pathogenic Leptospira strains and other non-related bacteria revealed a 100% analytical specificity. Additionally, pathogenic leptospires were successfully detected in five out of 29 tissue samples from animals (Mus spp., Rattus spp., Dolichotis patagonum and Sus domesticus). Two samples were infected with L. borgpetersenii, two with L. interrogans and one with L. kirschneri. The possibility to detect and identify these pathogenic agents to the species level in domestic and wildlife animals reinforces the diagnostic information and will enhance our understanding of the epidemiology of leptopirosis. PMID:25398140

  7. Automatic, ECG-based detection of autonomic arousals and their association with cortical arousals, leg movements, and respiratory events in sleep

    DEFF Research Database (Denmark)

    Olsen, Mads; Schneider, Logan Douglas; Cheung, Joseph

    2018-01-01

    The current definition of sleep arousals neglects to address the diversity of arousals and their systemic cohesion. Autonomic arousals (AA) are autonomic activations often associated with cortical arousals (CA), but they may also occur in isolation in relation to a respiratory event, a leg movement...... event or spontaneously, without any other physiological associations. AA should be acknowledged as essential events to understand and explore the systemic implications of arousals. We developed an automatic AA detection algorithm based on intelligent feature selection and advanced machine learning using...... the electrocardiogram. The model was trained and tested with respect to CA systematically scored in 258 (181 training size/77 test size) polysomnographic recordings from the Wisconsin Sleep Cohort. A precision value of 0.72 and a sensitivity of 0.63 were achieved when evaluated with respect to CA. Further analysis...

  8. Direct bacterial loop-mediated isothermal amplification detection on the pathogenic features of the nosocomial pathogen - Methicillin resistant Staphylococcus aureus strains with respiratory origins.

    Science.gov (United States)

    Lin, Qun; Xu, Pusheng; Li, Jiaowu; Chen, Yin; Feng, Jieyi

    2017-08-01

    Loop-mediated isothermal amplification based detection assays using bacterial culture or colony for direct detection of methicillin resistant Staphylococcus aureus(MRSA) had been developed and evaluated, followed by its extensive application on a large scale of clinical MRSA isolated from respiratory origins, including nasal swabs and sputums. Six primers, including outer primers, inner primers and loop primers, were specifically designed for recognizing eight distinct sequences on four targets: 16SrRNA, femA, mecA and orfX. Twenty-seven reference strains were used to develop, evaluate and optimize this assay. Then, a total of 532 clinical MRSA isolates were employed for each detected targets. And the results were determined through both visual observation of the color change by naked eye and electrophoresis. The specific of each primer had been confirmed, and the optimal amplification was obtained under 65 °C for 40 min. The limit of detections (LOD) of bacteria culture LAMP assays were determined to be 10 4  CFU/ml for 16S rRNA, femA, as well as orfX and 10 5  CFU/ml for mecA, respectively. The established novel assays on MRSA detection may provide new strategies for rapid detection of foodborne pathogens. Copyright © 2017. Published by Elsevier Ltd.

  9. Single walled carbon nanotube-based electrical biosensor for the label-free detection of pathogenic bacteria

    DEFF Research Database (Denmark)

    Yoo, S. M.; Baek, Y. K.; Shin, S.

    2016-01-01

    We herein describe the development of a single-walled carbon nanotube (SWNT)-based electrical biosensor consisting of a two-terminal resistor, and report its use for the specific, label-free detection of pathogenic bacteria via changes in conductance. The ability of this biosensor to recognize...

  10. Development of a panel of recombinase polymerase amplification assays for detection of common bacterial urinary tract infection pathogens.

    Science.gov (United States)

    Raja, B; Goux, H J; Marapadaga, A; Rajagopalan, S; Kourentzi, K; Willson, R C

    2017-08-01

    To develop and evaluate the performance of a panel of isothermal real-time recombinase polymerase amplification (RPA) assays for detection of common bacterial urinary tract infection (UTI) pathogens. The panel included RPAs for Escherichia coli, Klebsiella pneumoniae, Proteus mirabilis, Pseudomonas aeruginosa and Enterococcus faecalis. All five RPAs required reaction times of under 12 min to reach their lower limit of detection of 100 genomes per reaction or less, and did not cross-react with high concentrations of nontarget bacterial genomic DNA. In a 50-sample retrospective clinical study, the five-RPA assay panel was found to have a specificity of 100% (95% CI, 78-100%) and a sensitivity of 89% (95% CI, 75-96%) for UTI detection. The analytical and clinical validity of RPA for the rapid and sensitive detection of common UTI pathogens was established. Rapid identification of the causative pathogens of UTIs can be valuable in preventing serious complications by helping avoid the empirical treatment necessitated by traditional urine culture's 48-72-h turnaround time. The routine and widespread use of RPA to supplement or replace culture-based methods could profoundly impact UTI management and the emergence of multidrug-resistant pathogens. © 2017 The Society for Applied Microbiology.

  11. A novel gold nanoparticle-DNA aptamer-based plasmonic chip for rapid and sensitive detection of bacterial pathogens

    DEFF Research Database (Denmark)

    Sun, Yi; Phuoc Long, Truong; Wolff, Anders

    2016-01-01

    Gold nanoparticles (AuNPs)-based biosensors are emerging technologies for rapid detection of pathogens. However, it is very challenging to develop chip-based AuNP-biosensors for whole cells. This paper describes a novel AuNPs-DNA aptamer-based plasmonic assay which allows DNA aptamers to be detac...

  12. A rapid and specific detection of pathogenic serovar Salmonella typhimurium by loop-mediated isothermal amplification method (LAMP

    Directory of Open Access Journals (Sweden)

    Hadi Ravan

    2017-09-01

    Discussion and conclusion: As a result of a high sensitivity and specificity of the method as well as its low cost per assay, it could be concluded that the present LAMP assay is a powerful, accurate, and efficient method for detecting pathogenic serovar Salmonella typhimurium in food-processing industries and diagnostic laboratories.

  13. Determining the 95% limit of detection for waterborne pathogen analyses from primary concentration to qPCR

    Science.gov (United States)

    The limit of detection (LOD) for qPCR-based analyses is not consistently defined or determined in studies on waterborne pathogens. Moreover, the LODs reported often reflect the qPCR assay rather than the entire sample process. Our objective was to develop a method to determine the 95% LOD (lowest co...

  14. A model system for pathogen detection using a two-component bacteriophage/bioluminescent signal amplification assay

    Science.gov (United States)

    Bright, Nathan G.; Carroll, Richard J.; Applegate, Bruce M.

    2004-03-01

    Microbial contamination has become a mounting concern the last decade due to an increased emphasis of minimally processed food products specifically produce, and the recognition of foodborne pathogens such as Campylobacter jejuni, Escherichia coli O157:H7, and Listeria monocytogenes. This research investigates a detection approach utilizing bacteriophage pathogen specificity coupled with a bacterial bioluminescent bioreporter utilizing the quorum sensing molecule from Vibrio fischeri, N-(3-oxohexanoyl)-homoserine lactone (3-oxo-C6-HSL). The 3-oxo-C6-HSL molecules diffuse out of the target cell after infection and induce bioluminescence from a population of 3-oxo-C6-HSL bioreporters (ROLux). E. coli phage M13, a well-characterized bacteriophage, offers a model system testing the use of bacteriophage for pathogen detection through cell-to-cell communication via a LuxR/3-oxo-C6-HSL system. Simulated temperate phage assays tested functionality of the ROLux reporter and production of 3-oxo-C6-HSL by various test strains. These assays showed detection limits of 102cfu after 24 hours in a varietry of detection formats. Assays incorporating the bacteriophage M13-luxI with the ROLux reporter and a known population of target cells were subsequently developed and have shown consistent detection limits of 105cfu target organisms. Measurable light response from high concentrations of target cells was almost immediate, suggesting an enrichment step to further improve detection limits and reduce assay time.

  15. Multitarget Quantitative PCR Improves Detection and Predicts Cultivability of the Pathogen Burkholderia pseudomallei.

    Science.gov (United States)

    Göhler, Andre; Trung, Trinh Thanh; Hopf, Verena; Kohler, Christian; Hartleib, Jörg; Wuthiekanun, Vanaporn; Peacock, Sharon J; Limmathurotsakul, Direk; Tuanyok, Apichai; Steinmetz, Ivo

    2017-04-15

    Burkholderia pseudomallei is present in the environment in many parts of the world and causes the often-fatal disease melioidosis. The sensitive detection and quantification of B. pseudomallei in the environment are a prerequisite for assessing the risk of infection. We recently reported the direct detection of B. pseudomallei in soil samples using a quantitative PCR (qPCR) targeting a single type three secretion system 1 (TTSS1) gene. Here, we extend the qPCR-based analysis of B. pseudomallei in soil by validating novel qPCR gene targets selected from a comparative genomic analysis. Two hundred soil samples from two rice paddies in northeast Thailand were evaluated, of which 47% (94/200) were B. pseudomallei culture positive. The TTSS1 qPCR and two novel qPCR assays that targeted open reading frames (ORFs) BPSS0087 and BPSS0745 exhibited detection rates of 76.5% (153/200), 34.5% (69/200), and 74.5% (150/200), respectively. The combination of TTSS1 and BPSS0745 qPCR increased the detection rate to 90% (180/200). Combining the results of the three qPCR assays and the BPSS1187 nested PCR previously published, all 200 samples were positive by at least one PCR assay. Samples positive by either TTSS1 ( n = 153) or BPSS0745 ( n = 150) qPCR were more likely to be direct-culture positive, with odds ratios of 4.0 (95% confidence interval [CI], 1.7 to 9.5; P qPCR improved the B. pseudomallei detection rate in soil samples and predicted culture positivity. This approach has the potential for use as a sensitive environmental screening method for B. pseudomallei IMPORTANCE The worldwide environmental distribution of the soil bacterium Burkholderia pseudomallei remains to be determined. So far, most environmental studies have relied on culture-based approaches to detect this pathogen. Since current culture methods are laborious, are time consuming, and have limited sensitivity, culture-independent and more sensitive methods are needed. In this study, we show that a B

  16. Workshop summary: detection, impact, and control of specific pathogens in animal resource facilities.

    Science.gov (United States)

    Mansfield, Keith G; Riley, Lela K; Kent, Michael L

    2010-01-01

    Despite advances, infectious diseases remain a threat to animal facilities, continue to affect animal health, and serve as potential confounders of experimental research. A workshop entitled Detection, Impact, and Control of Specific Pathogens in Animal Resource Facilities was sponsored by the National Center for Research Resources (NCRR) and National Institutes of Aging (NIA) and held April 23-24, 2009, at the Lister Hill Conference Center on the National Institutes of Health's (NIH) Bethesda campus. The meeting brought together laboratory animal scientists and veterinarians with experience in fish, rodent, and nonhuman primate models to identify common issues and problems. Session speakers addressed (1) common practices and current knowledge of these species, (2) new technologies in the diagnosis of infectious diseases, (3) impact of environmental quality on infectious disease, (4) normal microbial flora in health and disease, (5) genetics and infectious disease, and (6) specific infectious agents and their impact on research. Attendees discussed current challenges and future needs, highlighting the importance of education and training, the funding of critical infrastructure and resource research, and the need for improved communication of disease risks and integration of these risks with strategic planning. NIH and NCRR have a strong record of supporting resource initiatives that have helped address many of these issues and recent efforts have focused on the building of consortium activities among such programs. This manuscript summarizes the presentations and conclusions of participants at the meeting; abstracts and a full conference report are available online (www.ncrr.nih.gov).

  17. Development and evaluation of a panel of filovirus sequence capture probes for pathogen detection by next-generation sequencing.

    Directory of Open Access Journals (Sweden)

    Jeffrey W Koehler

    Full Text Available A detailed understanding of the circulating pathogens in a particular geographic location aids in effectively utilizing targeted, rapid diagnostic assays, thus allowing for appropriate therapeutic and containment procedures. This is especially important in regions prevalent for highly pathogenic viruses co-circulating with other endemic pathogens such as the malaria parasite. The importance of biosurveillance is highlighted by the ongoing Ebola virus disease outbreak in West Africa. For example, a more comprehensive assessment of the regional pathogens could have identified the risk of a filovirus disease outbreak earlier and led to an improved diagnostic and response capacity in the region. In this context, being able to rapidly screen a single sample for multiple pathogens in a single tube reaction could improve both diagnostics as well as pathogen surveillance. Here, probes were designed to capture identifying filovirus sequence for the ebolaviruses Sudan, Ebola, Reston, Taï Forest, and Bundibugyo and the Marburg virus variants Musoke, Ci67, and Angola. These probes were combined into a single probe panel, and the captured filovirus sequence was successfully identified using the MiSeq next-generation sequencing platform. This panel was then used to identify the specific filovirus from nonhuman primates experimentally infected with Ebola virus as well as Bundibugyo virus in human sera samples from the Democratic Republic of the Congo, thus demonstrating the utility for pathogen detection using clinical samples. While not as sensitive and rapid as real-time PCR, this panel, along with incorporating additional sequence capture probe panels, could be used for broad pathogen screening and biosurveillance.

  18. Sensitive real-time PCR detection of pathogenic Leptospira spp. and a comparison of nucleic acid amplification methods for the diagnosis of leptospirosis.

    Science.gov (United States)

    Waggoner, Jesse J; Balassiano, Ilana; Abeynayake, Janaki; Sahoo, Malaya K; Mohamed-Hadley, Alisha; Liu, Yuanyuan; Vital-Brazil, Juliana Magalhães; Pinsky, Benjamin A

    2014-01-01

    Bacteria of the genus Leptospira, the causative agents of leptospirosis, are categorized into pathogenic and non-pathogenic species. However, the benefit of using a clinical diagnostic that is specific for pathogenic species remains unclear. In this study, we present the development of a real-time PCR (rtPCR) for the detection of pathogenic Leptospira (the pathogenic rtPCR), and we perform a comparison of the pathogenic rtPCR with a published assay that detects all Leptospira species [the undifferentiated febrile illness (UFI) assay] and a reference 16S Leptospira rtPCR, which was originally designed to detect pathogenic species. For the pathogenic rtPCR, a new hydrolysis probe was designed for use with primers from the UFI assay, which targets the 16S gene. The pathogenic rtPCR detected Leptospira DNA in 37/37 cultured isolates from 5 pathogenic and one intermediate species. Two strains of the non-pathogenic L. biflexa produced no signal. Clinical samples from 65 patients with suspected leptospirosis were then tested using the pathogenic rtPCR and a reference Leptospira 16S rtPCR. All 65 samples had tested positive for Leptospira using the UFI assay; 62 (95.4%) samples tested positive using the pathogenic rtPCR (p = 0.24). Only 24 (36.9%) samples tested positive in the reference 16S rtPCR (pLeptospira species in 49/50 cases, including 3 cases that were only detected using the UFI assay. The pathogenic rtPCR displayed similar sensitivity to the UFI assay when testing clinical specimens with no difference in specificity. Both assays proved significantly more sensitive than a real-time molecular test used for comparison. Future studies are needed to investigate the clinical and epidemiologic significance of more sensitive Leptospira detection using these tests.

  19. The Effect of Antibiotic Exposure and Specimen Volume on the Detection of Bacterial Pathogens in Children With Pneumonia.

    Science.gov (United States)

    Driscoll, Amanda J; Deloria Knoll, Maria; Hammitt, Laura L; Baggett, Henry C; Brooks, W Abdullah; Feikin, Daniel R; Kotloff, Karen L; Levine, Orin S; Madhi, Shabir A; O'Brien, Katherine L; Scott, J Anthony G; Thea, Donald M; Howie, Stephen R C; Adrian, Peter V; Ahmed, Dilruba; DeLuca, Andrea N; Ebruke, Bernard E; Gitahi, Caroline; Higdon, Melissa M; Kaewpan, Anek; Karani, Angela; Karron, Ruth A; Mazumder, Razib; McLellan, Jessica; Moore, David P; Mwananyanda, Lawrence; Park, Daniel E; Prosperi, Christine; Rhodes, Julia; Saifullah, Md; Seidenberg, Phil; Sow, Samba O; Tamboura, Boubou; Zeger, Scott L; Murdoch, David R

    2017-06-15

    Antibiotic exposure and specimen volume are known to affect pathogen detection by culture. Here we assess their effects on bacterial pathogen detection by both culture and polymerase chain reaction (PCR) in children. PERCH (Pneumonia Etiology Research for Child Health) is a case-control study of pneumonia in children aged 1-59 months investigating pathogens in blood, nasopharyngeal/oropharyngeal (NP/OP) swabs, and induced sputum by culture and PCR. Antibiotic exposure was ascertained by serum bioassay, and for cases, by a record of antibiotic treatment prior to specimen collection. Inoculated blood culture bottles were weighed to estimate volume. Antibiotic exposure ranged by specimen type from 43.5% to 81.7% in 4223 cases and was detected in 2.3% of 4863 controls. Antibiotics were associated with a 45% reduction in blood culture yield and approximately 20% reduction in yield from induced sputum culture. Reduction in yield of Streptococcus pneumoniae from NP culture was approximately 30% in cases and approximately 32% in controls. Several bacteria had significant but marginal reductions (by 5%-7%) in detection by PCR in NP/OP swabs from both cases and controls, with the exception of S. pneumoniae in exposed controls, which was detected 25% less frequently compared to nonexposed controls. Bacterial detection in induced sputum by PCR decreased 7% for exposed compared to nonexposed cases. For every additional 1 mL of blood culture specimen collected, microbial yield increased 0.51% (95% confidence interval, 0.47%-0.54%), from 2% when volume was ≤1 mL to approximately 6% for ≥3 mL. Antibiotic exposure and blood culture volume affect detection of bacterial pathogens in children with pneumonia and should be accounted for in studies of etiology and in clinical management. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America.

  20. DNA Extraction Method Affects the Detection of a Fungal Pathogen in Formalin-Fixed Specimens Using qPCR.

    Directory of Open Access Journals (Sweden)

    Andrea J Adams

    Full Text Available Museum collections provide indispensable repositories for obtaining information about the historical presence of disease in wildlife populations. The pathogenic amphibian chytrid fungus Batrachochytrium dendrobatidis (Bd has played a significant role in global amphibian declines, and examining preserved specimens for Bd can improve our understanding of its emergence and spread. Quantitative PCR (qPCR enables Bd detection with minimal disturbance to amphibian skin and is significantly more sensitive to detecting Bd than histology; therefore, developing effective qPCR methodologies for detecting Bd DNA in formalin-fixed specimens can provide an efficient and effective approach to examining historical Bd emergence and prevalence. Techniques for detecting Bd in museum specimens have not been evaluated for their effectiveness in control specimens that mimic the conditions of animals most likely to be encountered in museums, including those with low pathogen loads. We used American bullfrogs (Lithobates catesbeianus of known infection status to evaluate the success of qPCR to detect Bd in formalin-fixed specimens after three years of ethanol storage. Our objectives were to compare the most commonly used DNA extraction method for Bd (PrepMan, PM to Macherey-Nagel DNA FFPE (MN, test optimizations for Bd detection with PM, and provide recommendations for maximizing Bd detection. We found that successful detection is relatively high (80-90% when Bd loads before formalin fixation are high, regardless of the extraction method used; however, at lower infection levels, detection probabilities were significantly reduced. The MN DNA extraction method increased Bd detection by as much as 50% at moderate infection levels. Our results indicate that, for animals characterized by lower pathogen loads (i.e., those most commonly encountered in museum collections, current methods may underestimate the proportion of Bd-infected amphibians. Those extracting DNA from

  1. DNA Extraction Method Affects the Detection of a Fungal Pathogen in Formalin-Fixed Specimens Using qPCR.

    Science.gov (United States)

    Adams, Andrea J; LaBonte, John P; Ball, Morgan L; Richards-Hrdlicka, Kathryn L; Toothman, Mary H; Briggs, Cheryl J

    2015-01-01

    Museum collections provide indispensable repositories for obtaining information about the historical presence of disease in wildlife populations. The pathogenic amphibian chytrid fungus Batrachochytrium dendrobatidis (Bd) has played a significant role in global amphibian declines, and examining preserved specimens for Bd can improve our understanding of its emergence and spread. Quantitative PCR (qPCR) enables Bd detection with minimal disturbance to amphibian skin and is significantly more sensitive to detecting Bd than histology; therefore, developing effective qPCR methodologies for detecting Bd DNA in formalin-fixed specimens can provide an efficient and effective approach to examining historical Bd emergence and prevalence. Techniques for detecting Bd in museum specimens have not been evaluated for their effectiveness in control specimens that mimic the conditions of animals most likely to be encountered in museums, including those with low pathogen loads. We used American bullfrogs (Lithobates catesbeianus) of known infection status to evaluate the success of qPCR to detect Bd in formalin-fixed specimens after three years of ethanol storage. Our objectives were to compare the most commonly used DNA extraction method for Bd (PrepMan, PM) to Macherey-Nagel DNA FFPE (MN), test optimizations for Bd detection with PM, and provide recommendations for maximizing Bd detection. We found that successful detection is relatively high (80-90%) when Bd loads before formalin fixation are high, regardless of the extraction method used; however, at lower infection levels, detection probabilities were significantly reduced. The MN DNA extraction method increased Bd detection by as much as 50% at moderate infection levels. Our results indicate that, for animals characterized by lower pathogen loads (i.e., those most commonly encountered in museum collections), current methods may underestimate the proportion of Bd-infected amphibians. Those extracting DNA from archived museum

  2. Amaro-autonomous real-time detection of moving maritime objects: introducing a flight experiment for an on-board ship detection system

    Science.gov (United States)

    Schwenk, Kurt; Willburger, Katharina; Pless, Sebastian

    2017-10-01

    Motivated by politics and economy, the monitoring of the world wide ship traffic is a field of high topicality. To detect illegal activities like piracy, illegal fishery, ocean dumping and refugee transportation is of great value. The analysis of satellite images on the ground delivers a great contribution to situation awareness. However, for many applications the up-to-dateness of the data is crucial. With ground based processing, the time between image acquisition and delivery of the data to the end user is in the range of several hours. The highest influence to the duration of ground based processing is the delay caused by the transmission of the large amount of image data from the satellite to the processing centre on the ground. One expensive solution to this issue is the usage of data relay satellites systems like EDRS. Another approach is to analyse the image data directly on-board of the satellite. Since the product data (e.g. ship position, heading, velocity, characteristics) is very small compared to the input image data, real-time connections provided by satellite telecommunication services like Iridium or Orbcomm can be used to send small packets of information directly to the end user without significant delay. The AMARO (Autonomous real-time detection of moving maritime objects) project at DLR is a feasibility study of an on-board ship detection system involving a real-time low bandwidth communication. The operation of a prototype on-board ship detection system will be demonstrated on an airborne platform. In this article, the scope, aim and design of a flight experiment for an on-board ship detection system scheduled for mid of 2018 is presented. First, the scope and the constraints of the experiment are explained in detail. The main goal is to demonstrate the operability of an automatic ship detection system on board of an airplane. For data acquisition the optical high resolution DLR MACS-MARE camera (VIS/NIR) is used. The system will be able to

  3. Detection, fate and inactivation of pathogenic norovirus employing settlement and UV treatment in wastewater treatment facilities

    International Nuclear Information System (INIS)

    Barrett, M.; Fitzhenry, K.; O'Flaherty, V.; Dore, W.; Keaveney, S.; Cormican, M.; Rowan, N.; Clifford, E.

    2016-01-01

    It is accepted that discharged wastewaters can be a significant source of pathogenic viruses in receiving water bodies contributing to pollution and may in turn enter the human food chain and pose a risk to human health, thus norovirus (NoV) is often a predominant cause of gastroenteritis globally. Working with NoV poses particular challenges as it cannot be readily identified and detection by molecular methods does not assess infectivity. It has been proposed that the infectivity of NoV may be modelled through the use of an alternative virus; F-specific RNA (FRNA) bacteriophages; GA genotype and other FRNA bacteriophages have been used as a surrogate in studies of NoV inactivation. This study investigated the efficiency of novel pulsed ultraviolet irradiation and low pressure ultraviolet irradiation as a potential pathogen inactivation system for NoV and FRNA bacteriophage (GA) in secondary treated wastewaters. The role of UV dose and the impact of suspended solids concentration on removal efficiency were also examined. The study also investigated the role of settlement processes in wastewater treatment plants in removing NoV. While NoV inactivation could not be determined it was found that at a maximum UV dose of 6.9 J/cm 2 (6900 mJ/cm 2 ) an average 2.4 log removal of FRNA bacteriophage (GA) was observed; indicating the potential need for high UV doses to remove NoV if FRNA bacteriophage prove a suitable indicator for NoV. The study found that increasing concentrations of suspended solids impacted on PUV efficiency however, it appears the extent of the impact may be site specific. Furthermore, the study found that settlement processes can play a significant role in the removal of FRNA bacteriophage, thus potentially NoV. - Highlights: • Effectiveness of low pressure UV and novel high-intensity pulsed UV disinfection in NoVs removal. • Reduction of FRNA bacteriophage was seen in clarified wastewater after settling. • Adsorption of viral particles to solids

  4. Detection, fate and inactivation of pathogenic norovirus employing settlement and UV treatment in wastewater treatment facilities

    Energy Technology Data Exchange (ETDEWEB)

    Barrett, M. [Microbial Ecology Laboratory, Microbiology, School of Natural sciences, National University of Ireland Galway (Ireland); Ryan Institute, National University of Ireland Galway (Ireland); College of Engineering and Informatics, National University of Ireland Galway (Ireland); Fitzhenry, K. [Ryan Institute, National University of Ireland Galway (Ireland); College of Engineering and Informatics, National University of Ireland Galway (Ireland); O' Flaherty, V. [Microbial Ecology Laboratory, Microbiology, School of Natural sciences, National University of Ireland Galway (Ireland); Ryan Institute, National University of Ireland Galway (Ireland); Dore, W.; Keaveney, S. [Marine Institute, Galway (Ireland); Cormican, M. [Ryan Institute, National University of Ireland Galway (Ireland); Centre for Health from Environment, Ryan Institute, National University of Ireland Galway (Ireland); Rowan, N. [Bioscience Research Institute, Athlone Institute of Technology (Ireland); Clifford, E., E-mail: eoghan.clifford@nuigalway.ie [Ryan Institute, National University of Ireland Galway (Ireland); College of Engineering and Informatics, National University of Ireland Galway (Ireland)

    2016-10-15

    It is accepted that discharged wastewaters can be a significant source of pathogenic viruses in receiving water bodies contributing to pollution and may in turn enter the human food chain and pose a risk to human health, thus norovirus (NoV) is often a predominant cause of gastroenteritis globally. Working with NoV poses particular challenges as it cannot be readily identified and detection by molecular methods does not assess infectivity. It has been proposed that the infectivity of NoV may be modelled through the use of an alternative virus; F-specific RNA (FRNA) bacteriophages; GA genotype and other FRNA bacteriophages have been used as a surrogate in studies of NoV inactivation. This study investigated the efficiency of novel pulsed ultraviolet irradiation and low pressure ultraviolet irradiation as a potential pathogen inactivation system for NoV and FRNA bacteriophage (GA) in secondary treated wastewaters. The role of UV dose and the impact of suspended solids concentration on removal efficiency were also examined. The study also investigated the role of settlement processes in wastewater treatment plants in removing NoV. While NoV inactivation could not be determined it was found that at a maximum UV dose of 6.9 J/cm{sup 2} (6900 mJ/cm{sup 2}) an average 2.4 log removal of FRNA bacteriophage (GA) was observed; indicating the potential need for high UV doses to remove NoV if FRNA bacteriophage prove a suitable indicator for NoV. The study found that increasing concentrations of suspended solids impacted on PUV efficiency however, it appears the extent of the impact may be site specific. Furthermore, the study found that settlement processes can play a significant role in the removal of FRNA bacteriophage, thus potentially NoV. - Highlights: • Effectiveness of low pressure UV and novel high-intensity pulsed UV disinfection in NoVs removal. • Reduction of FRNA bacteriophage was seen in clarified wastewater after settling. • Adsorption of viral particles

  5. Molecular Detection of Tick-Borne Pathogens in Humans with Tick Bites and Erythema Migrans, in the Netherlands.

    Directory of Open Access Journals (Sweden)

    Setareh Jahfari

    2016-10-01

    Full Text Available Tick-borne diseases are the most prevalent vector-borne diseases in Europe. Knowledge on the incidence and clinical presentation of other tick-borne diseases than Lyme borreliosis and tick-borne encephalitis is minimal, despite the high human exposure to these pathogens through tick bites. Using molecular detection techniques, the frequency of tick-borne infections after exposure through tick bites was estimated.Ticks, blood samples and questionnaires on health status were collected from patients that visited their general practitioner with a tick bite or erythema migrans in 2007 and 2008. The presence of several tick-borne pathogens in 314 ticks and 626 blood samples of this cohort were analyzed using PCR-based methods. Using multivariate logistic regression, associations were explored between pathogens detected in blood and self-reported symptoms at enrolment and during a three-month follow-up period.Half of the ticks removed from humans tested positive for Borrelia burgdorferi sensu lato, Anaplasma phagocytophilum, Candidatus Neoehrlichia mikurensis, Rickettsia helvetica, Rickettsia monacensis, Borrelia miyamotoi and several Babesia species. Among 92 Borrelia burgdorferi s. l. positive ticks, 33% carried another pathogen from a different genus. In blood of sixteen out of 626 persons with tick bites or erythema migrans, DNA was detected from Candidatus Neoehrlichia mikurensis (n = 7, Anaplasma phagocytophilum (n = 5, Babesia divergens (n = 3, Borrelia miyamotoi (n = 1 and Borrelia burgdorferi s. l. (n = 1. None of these sixteen individuals reported any overt symptoms that would indicate a corresponding illness during the three-month follow-up period. No associations were found between the presence of pathogen DNA in blood and; self-reported symptoms, with pathogen DNA in the corresponding ticks (n = 8, reported tick attachment duration, tick engorgement, or antibiotic treatment at enrolment.Based on molecular detection techniques, the

  6. Molecular Detection of Tick-Borne Pathogens in Humans with Tick Bites and Erythema Migrans, in the Netherlands.

    Science.gov (United States)

    Jahfari, Setareh; Hofhuis, Agnetha; Fonville, Manoj; van der Giessen, Joke; van Pelt, Wilfrid; Sprong, Hein

    2016-10-01

    Tick-borne diseases are the most prevalent vector-borne diseases in Europe. Knowledge on the incidence and clinical presentation of other tick-borne diseases than Lyme borreliosis and tick-borne encephalitis is minimal, despite the high human exposure to these pathogens through tick bites. Using molecular detection techniques, the frequency of tick-borne infections after exposure through tick bites was estimated. Ticks, blood samples and questionnaires on health status were collected from patients that visited their general practitioner with a tick bite or erythema migrans in 2007 and 2008. The presence of several tick-borne pathogens in 314 ticks and 626 blood samples of this cohort were analyzed using PCR-based methods. Using multivariate logistic regression, associations were explored between pathogens detected in blood and self-reported symptoms at enrolment and during a three-month follow-up period. Half of the ticks removed from humans tested positive for Borrelia burgdorferi sensu lato, Anaplasma phagocytophilum, Candidatus Neoehrlichia mikurensis, Rickettsia helvetica, Rickettsia monacensis, Borrelia miyamotoi and several Babesia species. Among 92 Borrelia burgdorferi s. l. positive ticks, 33% carried another pathogen from a different genus. In blood of sixteen out of 626 persons with tick bites or erythema migrans, DNA was detected from Candidatus Neoehrlichia mikurensis (n = 7), Anaplasma phagocytophilum (n = 5), Babesia divergens (n = 3), Borrelia miyamotoi (n = 1) and Borrelia burgdorferi s. l. (n = 1). None of these sixteen individuals reported any overt symptoms that would indicate a corresponding illness during the three-month follow-up period. No associations were found between the presence of pathogen DNA in blood and; self-reported symptoms, with pathogen DNA in the corresponding ticks (n = 8), reported tick attachment duration, tick engorgement, or antibiotic treatment at enrolment. Based on molecular detection techniques, the probability of

  7. Clinical impact of a commercially available multiplex PCR system for rapid detection of pathogens in patients with presumed sepsis

    Directory of Open Access Journals (Sweden)

    Linde Hans-Jörg

    2009-08-01

    Full Text Available Abstract Background Timely identification of pathogens is crucial to minimize mortality in patients with severe infections. Detection of bacterial and fungal pathogens in blood by nucleic acid amplification promises to yield results faster than blood cultures (BC. We analyzed the clinical impact of a commercially available multiplex PCR system in patients with suspected sepsis. Methods Blood samples from patients with presumed sepsis were cultured with the Bactec 9240™ system (Becton Dickinson, Heidelberg, Germany and aliquots subjected to analysis with the LightCycler® SeptiFast® (SF Test (Roche Diagnostics, Mannheim, Germany at a tertiary care centre. For samples with PCR-detected pathogens, the actual impact on clinical management was determined by chart review. Furthermore a comparison between the time to a positive blood culture result and the SF result, based on a fictive assumption that it was done either on a once or twice daily basis, was made. Results Of 101 blood samples from 77 patients, 63 (62% yielded concordant negative results, 14 (13% concordant positive and 9 (9% were BC positive only. In 14 (13% samples pathogens were detected by SF only, resulting in adjustment of antibiotic therapy in 5 patients (7,7% of patients. In 3 samples a treatment adjustment would have been made earlier resulting in a total of 8 adjustments in all 101 samples (8%. Conclusion The addition of multiplex PCR to conventional blood cultures had a relevant impact on clinical management for a subset of patients with presumed sepsis.

  8. Widespread detection of highly pathogenic H5 influenza viruses in wild birds from the Pacific Flyway of the United States

    Science.gov (United States)

    Bevins, S.N.; Dusek, Robert J.; White, C. LeAnn; Gidlewski, Thomas; Bodenstein, B.; Mansfield, Kristin G.; DeBruyn, Paul; Kraege, Donald K.; Rowan, E.L.; Gillin, Colin; Thomas, B.; Chandler, S.; Baroch, J.; Schmit, B.; Grady, M. J.; Miller, R. S.; Drew, M.L.; Stopak, S.; Zscheile, B.; Bennett, J.; Sengl, J.; Brady, Caroline; Ip, Hon S.; Spackman, Erica; Killian, M. L.; Kim Torchetti, Mia; Sleeman, Jonathan M.; DeLiberto, T.J.

    2016-01-01

    A novel highly pathogenic avian influenza virus belonging to the H5 clade 2.3.4.4 variant viruses was detected in North America in late 2014. Motivated by the identification of these viruses in domestic poultry in Canada, an intensive study was initiated to conduct highly pathogenic avian influenza surveillance in wild birds in the Pacific Flyway of the United States. A total of 4,729 hunter-harvested wild birds were sampled and highly pathogenic avian influenza virus was detected in 1.3% (n = 63). Three H5 clade 2.3.4.4 subtypes were isolated from wild birds, H5N2, H5N8, and H5N1, representing the wholly Eurasian lineage H5N8 and two novel reassortant viruses. Testing of 150 additional wild birds during avian morbidity and mortality investigations in Washington yielded 10 (6.7%) additional highly pathogenic avian influenza isolates (H5N8 = 3 and H5N2 = 7). The geographically widespread detection of these viruses in apparently healthy wild waterfowl suggest that the H5 clade 2.3.4.4 variant viruses may behave similarly in this taxonomic group whereby many waterfowl species are susceptible to infection but do not demonstrate obvious clinical disease. Despite these findings in wild waterfowl, mortality has been documented for some wild bird species and losses in US domestic poultry during the first half of 2015 were unprecedented.

  9. Development of a one-run real-time PCR detection system for pathogens associated with bovine respiratory disease complex.

    Science.gov (United States)

    Kishimoto, Mai; Tsuchiaka, Shinobu; Rahpaya, Sayed Samim; Hasebe, Ayako; Otsu, Keiko; Sugimura, Satoshi; Kobayashi, Suguru; Komatsu, Natsumi; Nagai, Makoto; Omatsu, Tsutomu; Naoi, Yuki; Sano, Kaori; Okazaki-Terashima, Sachiko; Oba, Mami; Katayama, Yukie; Sato, Reiichiro; Asai, Tetsuo; Mizutani, Tetsuya

    2017-03-18

    Bovine respiratory disease complex (BRDC) is frequently found in cattle worldwide. The etiology of BRDC is complicated by infections with multiple pathogens, making identification of the causal pathogen difficult. Here, we developed a detection system by applying TaqMan real-time PCR (Dembo respiratory-PCR) to screen a broad range of microbes associated with BRDC in a single run. We selected 16 bovine respiratory pathogens (bovine viral diarrhea virus, bovine coronavirus, bovine parainfluenza virus 3, bovine respiratory syncytial virus, influenza D virus, bovine rhinitis A virus, bovine rhinitis B virus, bovine herpesvirus 1, bovine adenovirus 3, bovine adenovirus 7, Mannheimia haemolytica, Pasteurella multocida, Histophilus somni, Trueperella pyogenes, Mycoplasma bovis and Ureaplasma diversum) as detection targets and designed novel specific primer-probe sets for nine of them. The assay performance was assessed using standard curves from synthesized DNA. In addition, the sensitivity of the assay was evaluated by spiking solutions extracted from nasal swabs that were negative by Dembo respiratory-PCR for nucleic acids of pathogens or synthesized DNA. All primer-probe sets showed high sensitivity. In this study, a total of 40 nasal swab samples from cattle on six farms were tested by Dembo respiratory-PCR. Dembo respiratory-PCR can be applied as a screening system with wide detection targets.

  10. Surveillance for early detection of low pathogenicity avian influenza in poultry

    NARCIS (Netherlands)

    Comin, A.

    2012-01-01

    Infection with low pathogenicity avian influenza (LPAI) virus is widespread and has led to outbreaks in domestic birds in many countries. Although infection does not pose a serious concern for animal heath, LPAI virus subtypes H5 and H7 can mutate into the highly pathogenic form (HPAI), which can

  11. Surveillance of low pathogenic avian influenza in layer chickens: risk factors, transmission and early detection

    NARCIS (Netherlands)

    Gonzales Rojas, J.L.

    2012-01-01

    Low pathogenic avian influenza virus (LPAIv) of H5 and H7 subtypes are able to mutate to highly pathogenic avian influenza virus (HPAIv), which are lethal for most poultry species, can cause large epidemics and are a serious threat to public health. Thus, circulation of these LPAIv in poultry is

  12. Methods for detecting pathogens in the beef food chain: an overview

    Science.gov (United States)

    The main food-borne pathogens of concern in the beef chain are Shiga toxin-producing Escherichia coli (STEC) and Salmonella. Other pathogens, including Listeria monocytogenes and Campylobacter spp. may also be present and pose contamination concerns in both the cattle production environment and bee...

  13. Molecular approaches to detecting and discriminating among prions, a class of pathogenic molecules(Abstract)

    Science.gov (United States)

    Prions (PrPSc)are the pathogens that cause a set of fatal neurological diseases that include scrapie and chronic wasting disease (CWD). They are composed solely of protein and unlike viral, bacterial, or fungal pathogens, the information necessary to convert the normal cellular prion protein (PrPC) ...

  14. A novel multiplex PCR assay for simultaneous detection of nine clinically significant bacterial pathogens associated with bovine mastitis.

    Science.gov (United States)

    Ashraf, Aqeela; Imran, Muhammad; Yaqub, Tahir; Tayyab, Muhammad; Shehzad, Wasim; Thomson, Peter C

    2017-06-01

    For rapid and simultaneous detection of nine bovine mastitic pathogens, a sensitive and specific multiplex PCR assay was developed. The assay was standardized using reference strains and validated on mastitic milk cultures which were identified to species level based on 16S rRNA sequencing. Multiplex PCR assay also efficiently detected the target bacterial strains directly from milk. The detection limit of the assay was up to 50 pg for DNA isolated from pure cultures and 10 4  CFU/ml for spiked milk samples. As estimated by latent class analysis, the assay was sensitive up to 88% and specific up to 98% for targeted mastitic pathogens, compared with the bacterial culture method and the 16S rRNA sequence analysis. This novel molecular assay could be useful for monitoring and maintaining the bovine udder health, ensuring the bacteriological safety of milk, and conducting epidemiological studies. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Surveillance of vector-borne pathogens under imperfect detection: lessons from Chagas disease risk (mis)measurement.

    Science.gov (United States)

    Minuzzi-Souza, Thaís Tâmara Castro; Nitz, Nadjar; Cuba, César Augusto Cuba; Hagström, Luciana; Hecht, Mariana Machado; Santana, Camila; Ribeiro, Marcelle; Vital, Tamires Emanuele; Santalucia, Marcelo; Knox, Monique; Obara, Marcos Takashi; Abad-Franch, Fernando; Gurgel-Gonçalves, Rodrigo

    2018-01-09

    Vector-borne pathogens threaten human health worldwide. Despite their critical role in disease prevention, routine surveillance systems often rely on low-complexity pathogen detection tests of uncertain accuracy. In Chagas disease surveillance, optical microscopy (OM) is routinely used for detecting Trypanosoma cruzi in its vectors. Here, we use replicate T. cruzi detection data and hierarchical site-occupancy models to assess the reliability of OM-based T. cruzi surveillance while explicitly accounting for false-negative and false-positive results. We investigated 841 triatomines with OM slides (1194 fresh, 1192 Giemsa-stained) plus conventional (cPCR, 841 assays) and quantitative PCR (qPCR, 1682 assays). Detections were considered unambiguous only when parasitologists unmistakably identified T. cruzi in Giemsa-stained slides. qPCR was >99% sensitive and specific, whereas cPCR was ~100% specific but only ~55% sensitive. In routine surveillance, examination of a single OM slide per vector missed ~50-75% of infections and wrongly scored as infected ~7% of the bugs. qPCR-based and model-based infection frequency estimates were nearly three times higher, on average, than OM-based indices. We conclude that the risk of vector-borne Chagas disease may be substantially higher than routine surveillance data suggest. The hierarchical modelling approach we illustrate can help enhance vector-borne disease surveillance systems when pathogen detection is imperfect.

  16. Optical Imaging of Paramagnetic Bead-DNA Aggregation Inhibition Allows for Low Copy Number Detection of Infectious Pathogens.

    Directory of Open Access Journals (Sweden)

    Jacquelyn A DuVall

    Full Text Available DNA-paramagnetic silica bead aggregation in a rotating magnetic field facilitates the quantification of DNA with femtogram sensitivity, but yields no sequence-specific information. Here we provide an original description of aggregation inhibition for the detection of DNA and RNA in a sequence-specific manner following loop-mediated isothermal amplification (LAMP. The fragments generated via LAMP fail to induce chaotrope-mediated bead aggregation; however, due to their ability to passivate the bead surface, they effectively inhibit bead aggregation by longer 'trigger' DNA. We demonstrate the utility of aggregation inhibition as a method for the detection of bacterial and viral pathogens with sensitivity that approaches single copies of the target. We successfully use this methodology for the detection of notable food-borne pathogens Escherichia coli O157:H7 and Salmonella enterica, as well as Rift Valley fever virus, a weaponizable virus of national security concern. We also show the concentration dependence of aggregation inhibition, suggesting the potential for quantification of target nucleic acid in clinical and environmental samples. Lastly, we demonstrate the ability to rapidly detect infectious pathogens by utilizing a cell phone and custom-written application (App, making this novel detection modality fully portable for point-of-care use.

  17. Mycosphaerella fijiensis, the black leaf streak pathogen of banana: progress towards understanding pathogen biology and detection, disease development, and the challenges of control.

    Science.gov (United States)

    Churchill, Alice C L

    2011-05-01

    primary hosts of M. fijiensis, the ornamental plant Heliconia psittacorum has been reported as an alternative host. Several valuable tools and resources have been developed to overcome some of the challenges of studying this host-pathogen system. These include a DNA-mediated fungal transformation system and the ability to conduct targeted gene disruptions, reliable quantitative plant bioassays, diagnostic probes to detect and differentiate M. fijiensis from related pathogens and to distinguish strains of different mating types, and a genome sequence that has revealed a wealth of gene sequences and molecular markers to be utilized in functional and population biology studies. http://bananas.bioversityinternational.org/, http://genome.jgi-psf.org/Mycfi2/Mycfi2.home.html, http://www.isppweb.org/names_banana_pathogen.asp#fun, http://www.promusa.org/. © 2010 THE AUTHOR. MOLECULAR PLANT PATHOLOGY © 2010 BSPP AND BLACKWELL PUBLISHING LTD.

  18. Quantitative, multiplexed detection of bacterial pathogens: DNA and protein applications of the Luminex LabMAP system.

    Science.gov (United States)

    Dunbar, Sherry A; Vander Zee, Coe A; Oliver, Kerry G; Karem, Kevin L; Jacobson, James W

    2003-05-01

    Escherichia coli, Salmonella, Listeria monocytogenes and Campylobacter jejuni are bacterial pathogens commonly implicated in foodborne illnesses. Generally used detection methods (i.e., culture, biochemical testing, ELISA and nucleic acid amplification) can be laborious, time-consuming and require multiple tests to detect all of the pathogens. Our objective was to develop rapid assays to simultaneously detect these four organisms through the presence of antigen or DNA using the Luminex LabMAP system. For nucleic acid detection, organism-specific capture probes corresponding to the 23S ribosomal RNA gene (rrl) were coupled covalently to LabMAP microspheres. Target molecules included synthetic complementary oligonucleotides and genomic DNA isolated from ATCC type strains or other well-characterized strains of each organism. Universal PCR primers were designed to amplify variable regions of bacterial 23S ribosomal DNA, yielding biotinylated amplicons of 86 to 109 bp in length. Varying quantities of targets were hybridized to the combined microsphere sets, labeled with streptavidin-R-phycoerythrin and analyzed on the Luminex(100) system. Results of nucleic acid detection assays, obtained in 30 to 40 min following amplification, correctly and specifically identified each bacterial species with a detection sensitivity of 10(3) to 10(5) genome copies. Capture-sandwich immunoassays were developed with organism-specific antibodies coupled to different microsphere sets. Microspheres were incubated with organism-specific standards and reactivity was assessed with biotinylated detection antibodies and streptavidin-R-phycoerythrin. In the immunoassays, microsphere-associated fluorescence was organism concentration dependent with detectable response at detection of pathogens. The practical significance of this multiplexing approach would be to provide more timely, economical and comprehensive information than is available with conventional isolation and identification

  19. Multiplex and quantitative pathogen detection with high-resolution capillary electrophoresis-based single-strand conformation polymorphism.

    Science.gov (United States)

    Hwang, Hee Sung; Shin, Gi Won; Chung, Boram; Na, Jeongkyeong; Jung, Gyoo Yeol

    2013-01-01

    Among the molecular diagnostic methods for bacteria-induced diseases, capillary electrophoresis-based single-strand conformation polymorphism (CE-SSCP) combined with 16S rRNA gene-specific PCR has enormous potential because it can separate sequence variants using a simple procedure. However, conventional CE-SSCP systems have limited resolution and cannot separate most 16S rRNA gene-specific markers into separate peaks. A high-resolution CE-SSCP system that uses a poly(ethyleneoxide)-poly(propyleneoxide)-poly(ethyleneoxide) triblock copolymer matrix was recently developed and shown to effectively separate highly similar PCR products. In this report, a protocol for the detection of 12 pathogenic bacteria is provided. Pathogen markers were amplified by PCR using universal primers and separated by CE-SSCP; each marker peak was well separated at baseline and showed a characteristic mobility, allowing the easy identification of the pathogens.

  20. PCR-based specific techniques used for detecting the most important pathogens on strawberry: a systematic review.

    Science.gov (United States)

    Mirmajlessi, Seyed Mahyar; Destefanis, Marialaura; Gottsberger, Richard Alexander; Mänd, Marika; Loit, Evelin

    2015-01-15

    Strawberry diseases are a major limiting factor that severely impact plant agronomic performance. Regarding limitations of traditional techniques for detection of pathogens, researchers have developed specific DNA-based tests as sensitive and specific techniques. The aim of this review is to provide an overview of polymerase chain reaction (PCR)-based methods used for detection or quantification of the most widespread strawberry pathogens, such as Fusarium oxysporum f.sp. fragariae, Phytophthora fragariae, Colletotrichum acutatum, Verticillium dahliae, Botrytis cinerea, Macrophomina phaseolina, and Xanthomonas fragariae. An updated and detailed list of published PCR protocols is presented and discussed, aimed at facilitating access to information that could be particularly useful for diagnostic laboratories in order to develop a rapid, cost-effective, and reliable monitoring technique. The study design was a systematic review of PCR-based techniques used for detection and quantification of strawberry pathogens. Using appropriate subject headings, AGRICOLA, AGRIS, BASE, Biological Abstracts, CAB Abstracts, Google Scholar, Scopus, Web of Knowledge, and SpringerLink databases were searched from their inception up to April 2014. Two assessors independently reviewed the titles, abstracts, and full articles of all identified citations. Selected articles were included if one of the mentioned strawberry pathogens was investigated based on PCR methods, and a summary of pre-analytical requirements for PCR was provided. A total of 259 titles and abstracts were reviewed, of which 22 full texts met all the inclusion criteria. Our systematic review identified ten different protocols for X. fragariae, eight for P. fragariae, four for B. cinerea, six for C. acutatum, three for V. dahlia, and only one for F. oxysporum. The accuracy and sensitivity of PCR diagnostic methods is the focus of most studies included in this review. However, a large proportion of errors in laboratories

  1. Simultaneous Detection of Key Bacterial Pathogens Related to Pneumonia and Meningitis Using Multiplex PCR Coupled With Mass Spectrometry

    Directory of Open Access Journals (Sweden)

    Chi Zhang

    2018-04-01

    Full Text Available Pneumonia and meningitis continue to present an enormous public health burden and pose a major threat to young children. Among the causative organisms of pneumonia and meningitis, bacteria are the most common causes of serious disease and deaths. It is challenging to accurately and rapidly identify these agents. To solve this problem, we developed and validated a 12-plex PCR coupled with matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS method (bacterial pathogen-mass spectrometry, BP-MS that can be used to simultaneously screen for 11 key bacterial pathogens related to pneumonia and meningitis. Forty-six nasopharyngeal swabs and 12 isolates were used to determine the specificity of the method. The results showed that, using the BP-MS method, we could accurately identify the expected bacteria without cross-reactivity with other pathogens. For the 11 target bacterial pathogens, the analytical sensitivity of the BP-MS method was as low as 10 copies/reaction. To further evaluate the clinical effectiveness of this method, 204 nasopharyngeal swabs from hospitalized children with suspected pneumonia were tested using this method. In total, 81.9% (167/204 of the samples were positive for at least one of the 11 target pathogens. Among the 167 bacteria-positive samples, the rate of multiple infections was 55.7% (93/167, and the most frequent combination was Streptococcus pneumoniae with Haemophilus influenzae, representing 46.2% (43/93 two-pathogen mixed infections. We used real-time PCR and nested PCR to confirm positive results, with identical results obtained for 81.4% (136/167 of the samples. The BP-MS method is a sensitive and specific molecular detection technique in a multiplex format and with high sample throughput. Therefore, it will be a powerful tool for pathogen screening and antibiotic selection at an early stage of disease.

  2. SEPSIS BIOMARKERS AND PATHOGEN DETECTION METHODS — STATE OF THE ART

    Directory of Open Access Journals (Sweden)

    Schmitz P. H. Roland

    2014-04-01

    Full Text Available Evidence-based blood culture testing is of utmost importance for ICU patients with suspected sepsis or organ infection. Knowledge of the etiologic agent (bacteria or fungi and their susceptibility against antimicrobials enables the clinician to initiate an appropriate antimicrobial therapy and guides diagnostic procedures. This has been shown to reduce mortality, ICU-stay and antibiotic overuse. Whereas microbiological laboratory practice has been highly standardized, short- falls in the preanalytic procedures in the ICU (indication, timing, volume, numbers, collection of blood cultures have a significant effect on the diagnostic yield. Due to system-related drawbacks of molecular diagnostics, i.e. PCR-based pathogen detection, which are arguable sensitivities, the failing of the ’fast time-to-result argument’, no solution to establish a comprising antibiogram, still ongoing discussions on the coverage of the target panel, high overall costs, and the lacking of resilient data on clinical utility, non-culture-based NATs do currently not represent an alternative to blood culture testing. Inflammatory markers are recognized to play an increasingly important role in the diagnosis and monitoring of sepsis. This is partly due to low specificity of clinical symptoms and conventional inflammatory signs for the diagnosis of sepsis but also to a lack of correlation with the severity of the inflammatory response. Elevated serum PCT levels indicate systemic inflammation reliably. PCT is the only sepsis marker that is helpful in the differentiation between infectious and non-infectious causes of organ dysfunction and shock and might support antibiotic therapy.

  3. Autonomous search

    CERN Document Server

    Hamadi, Youssef; Saubion, Frédéric

    2012-01-01

    Autonomous combinatorial search (AS) represents a new field in combinatorial problem solving. Its major standpoint and originality is that it considers that problem solvers must be capable of self-improvement operations. This is the first book dedicated to AS.

  4. An integrated microfluidic device utilizing dielectrophoresis and multiplex array PCR for point-of-care detection of pathogens.

    Science.gov (United States)

    Cai, Dongyang; Xiao, Meng; Xu, Peng; Xu, Ying-Chun; Du, Wenbin

    2014-10-21

    The early identification of causative pathogens in clinical specimens that require no cultivation is essential for directing evidence-based antimicrobial treatments in resource limited settings. Here, we describe an integrated microfluidic device for the rapid identification of pathogens in complex physiological matrices such as blood. The device was designed and fabricated using SlipChip technologies, which integrated four channels processing independent samples and identifying up to twenty different pathogens. Briefly, diluted whole human blood samples were directly injected into the device for analysis. The pathogens were extracted from the blood by dielectrophoresis, retained in an array of grooves, and identified by multiplex array PCR in nanoliter volumes with end-point fluorescence detection. The universality of the dielectrophoretic separation of pathogens from physiological fluids was evaluated with a panel of clinical isolates covering predominant bacterial and fungal species. Using this system, we simultaneously identified Pseudomonas aeruginosa, Staphylococcus aureus and Escherichia coli O157:H7 within 3 h. In addition to the prompt diagnosis of bloodstream infections, this method may also be utilized for differentiating microorganisms in contaminated water and environmental samples.

  5. Multiplex PCR for detection of the Vibrio genus and five pathogenic Vibrio species with primer sets designed using comparative genomics.

    Science.gov (United States)

    Kim, Hyun-Joong; Ryu, Ji-Oh; Lee, Shin-Young; Kim, Ei-Seul; Kim, Hae-Yeong

    2015-10-26

    The genus Vibrio is clinically significant and major pathogenic Vibrio species causing human Vibrio infections are V. cholerae, V. parahaemolyticus, V. vulnificus, V. alginolyticus and V. mimicus. In this study, we screened for novel genetic markers using comparative genomics and developed a Vibrio multiplex PCR for the reliable diagnosis of the Vibrio genus and the associated major pathogenic Vibrio species. A total of 30 Vibrio genome sequences were subjected to comparative genomics, and specific genes of the Vibrio genus and five major pathogenic Vibrio species were screened. The designed primer sets from the screened genes were evaluated by single PCR using DNAs from various Vibrio spp. and other non-Vibrio bacterial strains. A sextuplet multiplex PCR using six primer sets was developed to enable detection of the Vibrio genus and five pathogenic Vibrio species. The designed primer sets from the screened genes yielded specific diagnostic results for target the Vibrio genus and Vibrio species. The specificity of the developed multiplex PCR was confirmed with various Vibrio and non-Vibrio strains. This Vibrio multiplex PCR was evaluated using 117 Vibrio strains isolated from the south seashore areas in Korea and Vibrio isolates were identified as Vibrio spp., V. parahaemolyticus, V. vulnificus and V. alginolyticus, demonstrating the specificity and discriminative ability of the assay towards Vibrio species. This novel multiplex PCR method could provide reliable and informative identification of the Vibrio genus and major pathogenic Vibrio species in the food safety industry and in early clinical treatment, thereby protecting humans against Vibrio infection.

  6. A Rapid and Simple Real-Time PCR Assay for Detecting Foodborne Pathogenic Bacteria in Human Feces.

    Science.gov (United States)

    Hanabara, Yutaro; Ueda, Yutaka

    2016-11-22

    A rapid, simple method for detecting foodborne pathogenic bacteria in human feces is greatly needed. Here, we examined the efficacy of a method that employs a combination of a commercial PCR master mix, which is insensitive to PCR inhibitors, and a DNA extraction method which used sodium dodecyl benzene sulfonate (SDBS), and Tween 20 to counteract the inhibitory effects of SDBS on the PCR assay. This method could detect the target genes (stx1 and stx2 of enterohemorrhagic Escherichia coli, invA of Salmonella Enteritidis, tdh of Vibrio parahaemolyticus, gyrA of Campylobacter jejuni, ceuE of Campylobacter coli, SEA of Staphylococcus aureus, ces of Bacillus cereus, and cpe of Clostridium perfringens) in a fecal suspension containing 1.0 × 10 1 to 1.0 × 10 3 CFU/ml. Furthermore, the assay was neither inhibited nor influenced by individual differences among the fecal samples of 10 subjects or fecal concentration (40-160 mg/ml in the fecal suspension). When we attempted to detect the genes of pathogenic bacteria in 4 actual clinical cases, we found that this method was more sensitive than standard culture method. These results showed that this assay is a rapid, simple detection method for foodborne pathogenic bacteria in human feces.

  7. Development of a gold nanoparticle-based universal oligonucleotide microarray for multiplex and low-cost detection of foodborne pathogens.

    Science.gov (United States)

    Wang, Xiaoqiang; Ying, Sisi; Wei, Xiaoguang; Yuan, Jun

    2017-07-17

    Bacterial foodborne diseases remain major threats to food safety and public health, especially in developing countries. In this study a novel assay, combining gold nanoparticle (GNP)-based multiplex oligonucleotide ligation-PCR and universal oligonucleotide microarray technology, was developed for inexpensive, specific, sensitive, and multiplex detection of eight common foodborne pathogens, including Shigella spp., Campylobacter jejuni, Bacillus cereus, Escherichia coli O157:H7, Listeria monocytogenes, Salmonella enterica, Staphylococcus aureus, and Vibrio parahaemolyticus. The target fragments of the eight pathogens were enriched by multiplex PCR and subjected to multiplex ligase detection reaction. Ligation products were enriched and labeled with GNPs by universal asymmetric PCR, using excess GNP-conjugated primers. The labeled single-stranded amplicons containing complementary tag sequences were captured by the corresponding tag sequences immobilized on microarrays, followed by silver staining for signal enhancement. Black images of microarray spots were visualized by naked eyes or scanned on a simple flatbed scanner, and quantified. The results indicated that this assay could unambiguously discriminate all eight pathogens in single and multiple infections, with detection sensitivity of 3.3-85CFU/mL for pure cultures. Microarray results of ninety-five artificially contaminated and retail food samples were consistent with traditional culture, biochemical and real-time PCR findings. Therefore, the novel assay has the potential to be used for routine detection due to rapidity, low cost, and high specificity and sensitivity. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Impact of early detection and treatment of diabetes on the 6-year prevalence of cardiac autonomic neuropathy in people with screen-detected diabetes

    DEFF Research Database (Denmark)

    Charles, Morten; Fleischer, J; Witte, Daniel Rinse

    2013-01-01

    Baggrund: Der er begrænset viden om hvordan tidlig multifaktoriel behandling forbedrer konsekvenser af diabetes. Kardiel autonom neuropati (KAN) hos personer med diabetes indikerer omfattende skade på det autonome nervesystem og er relateret til mortalitet og livskvalitet. I dette studie fra...... ADDITION Danmark undersøgte vi effekten af tidlig opsporing og efterfølgende intensive behandling af type 2 diabetes i almen praksis på hyppigheden af kardiel autonom neuropati 6 år efter diagnose. Resultater: Prævalensen af tidlig KAN var 15,1% i rutine behandlingsgruppen (RG) og 15.5% i intensive...... kardiovaskulære risikofaktorer er således ikke nok til at forebygge at mange diabetes patienter udvikler KAN....

  9. Viral Pathogen Detection by Metagenomics and Pan-Viral Group Polymerase Chain Reaction in Children With Pneumonia Lacking Identifiable Etiology.

    Science.gov (United States)

    Schlaberg, Robert; Queen, Krista; Simmon, Keith; Tardif, Keith; Stockmann, Chris; Flygare, Steven; Kennedy, Brett; Voelkerding, Karl; Bramley, Anna; Zhang, Jing; Eilbeck, Karen; Yandell, Mark; Jain, Seema; Pavia, Andrew T; Tong, Suxiang; Ampofo, Krow

    2017-05-01

    Community-acquired pneumonia (CAP) is a leading cause of pediatric hospitalization. Pathogen identification fails in approximately 20% of children but is critical for optimal treatment and prevention of hospital-acquired infections. We used two broad-spectrum detection strategies to identify pathogens in test-negative children with CAP and asymptomatic controls. Nasopharyngeal/oropharyngeal (NP/OP) swabs from 70 children <5 years with CAP of unknown etiology and 90 asymptomatic controls were tested by next-generation sequencing (RNA-seq) and pan viral group (PVG) PCR for 19 viral families. Association of viruses with CAP was assessed by adjusted odds ratios (aOR) and 95% confidence intervals controlling for season and age group. RNA-seq/PVG PCR detected previously missed, putative pathogens in 34% of patients. Putative viral pathogens included human parainfluenza virus 4 (aOR 9.3, P = .12), human bocavirus (aOR 9.1, P < .01), Coxsackieviruses (aOR 5.1, P = .09), rhinovirus A (aOR 3.5, P = .34), and rhinovirus C (aOR 2.9, P = .57). RNA-seq was more sensitive for RNA viruses whereas PVG PCR detected more DNA viruses. RNA-seq and PVG PCR identified additional viruses, some known to be pathogenic, in NP/OP specimens from one-third of children hospitalized with CAP without a previously identified etiology. Both broad-range methods could be useful tools in future epidemiologic and diagnostic studies. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

  10. Detection of low numbers of pathogenic Yersinia enterocolitica in environmental water and sewage samples by nested polymerase chain reaction.

    Science.gov (United States)

    Waage, A S; Vardund, T; Lund, V; Kapperud, G

    1999-12-01

    Isolation of pathogenic Yersinia enterocolitica from water and sewage by traditional culture techniques is time-consuming and subsequent differentiation between pathogenic and non-pathogenic strains can be difficult and unreliable. A nested polymerase chain reaction (PCR) procedure was used for the detection of low numbers of Y. enterocolitica in spiked samples from natural surface sources with variable background flora ranging from oligotrophic water to sewage. Water and sewage samples were filtered and filters enriched overnight in a non-selective medium. Nested PCR conducted on enriched broth, prepared by use of a rapid and simple preparation step consisting of centrifugation, proteinase K treatment and boiling, enabled the detection of 8-17 cfu 100 ml-1 water with background levels of up to 8700 heterotrophic organisms ml-1 and 10,000 cfu coliform organisms 100 ml-1 water. The analysis can be completed within 2-3 d and should be a significant tool in monitoring environmental waters and drinking water sources for the presence of pathogenic Y. enterocolitica.

  11. A quantitative polymerase chain reaction assay for rapid detection of 9 pathogens directly from stools of travelers with diarrhea.

    Science.gov (United States)

    Antikainen, Jenni; Kantele, Anu; Pakkanen, Sari H; Lääveri, Tinja; Riutta, Jukka; Vaara, Martti; Kirveskari, Juha

    2013-10-01

    Every year, 80 million tourists traveling to tropical and subtropical areas contract traveler's diarrhea (TD). Forty percent to 80% of cases are caused by bacteria, yet clinical diagnostic tests are available to identify only a few of the strains that cause TD. We aimed to develop a quantitative polymerase chain reaction (qPCR) assay to identify all major pathogens in stool samples. We developed a low-cost, high-throughput, multiplex qPCR assay for simultaneous detection of 9 bacterial pathogens in stool samples: Salmonella, Yersinia, Campylobacter, and Vibrio cholerae, as well as Shigella or enteroinvasive Escherichia coli, enterohemorrhagic E coli, enterotoxigenic E coli (ETEC), enteroaggregative E coli (EAEC), and enteropathogenic E coli (EPEC). The assay was validated using positive (n = 245) and negative (n = 243) control strains, as well as preselected positive and negative stool samples. In addition, stool samples were collected from 96 returning travelers with TD. The findings were compared with those from routine diagnostic tests. The assay detected the bacterial strains with 100% sensitivity and specificity, compared with results from the reference tests. Of all stool samples collected from travelers with TD, EPEC was found in 47%, EAEC in 46%, ETEC in 22%, enterohemorrhagic E coli in 7%, Campylobacter in 6%, Shigella or enteroinvasive E coli in 2%, and Salmonella in 2%. Multiple pathogens were found in 37% of all samples. We developed a low-cost, high-throughput qPCR assay for use in routine diagnostic analysis and research. It detects the pathogenic bacteria most commonly associated with TD in stool samples with 100% sensitivity and specificity, compared with reference methods. The assay requires 4 hours, whereas current detection methods require 1 to 7 days. At least 1 TD pathogen was identified in stool samples from 76% of returning travelers, whereas conventional methods found a pathogen in only 17%. The most commonly detected bacteria were EPEC

  12. A novel gold nanoparticle-DNA aptamer-based plasmonic chip for rapid and sensitive detection of bacterial pathogens

    DEFF Research Database (Denmark)

    Sun, Yi; Phuoc Long, Truong; Wolff, Anders

    2016-01-01

    Gold nanoparticles (AuNPs)-based biosensors are emerging technologies for rapid detection of pathogens. However, it is very challenging to develop chip-based AuNP-biosensors for whole cells. This paper describes a novel AuNPs-DNA aptamer-based plasmonic assay which allows DNA aptamers to be detac......Gold nanoparticles (AuNPs)-based biosensors are emerging technologies for rapid detection of pathogens. However, it is very challenging to develop chip-based AuNP-biosensors for whole cells. This paper describes a novel AuNPs-DNA aptamer-based plasmonic assay which allows DNA aptamers...... to be detached from AuNPs when interacting with bacteria. The new strategy greatly increases the sensitivity and specificity of chip-based whole-cell biosensing....

  13. High-throughput detection of food-borne pathogenic bacteria using oligonucleotide microarray with quantum dots as fluorescent labels.

    Science.gov (United States)

    Huang, Aihua; Qiu, Zhigang; Jin, Min; Shen, Zhiqiang; Chen, Zhaoli; Wang, Xinwei; Li, Jun-Wen

    2014-08-18

    Bacterial pathogens are mostly responsible for food-borne diseases, and there is still substantial room for improvement in the effective detection of these organisms. In the present study, we explored a new method to detect target pathogens easily and rapidly with high sensitivity and specificity. This method uses an oligonucleotide microarray combined with quantum dots as fluorescent labels. Oligonucleotide probes targeting the 16SrRNA gene were synthesized to create an oligonucleotide microarray. The PCR products labeled with biotin were subsequently hybridized using an oligonucleotide microarray. Following incubation with CdSe/ZnS quantum dots coated with streptavidin, fluorescent signals were detected with a PerkinElmer Gx Microarray Scanner. The results clearly showed specific hybridization profiles corresponding to the bacterial species assessed. Two hundred and sixteen strains of food-borne bacterial pathogens, including standard strains and isolated strains from food samples, were used to test the specificity, stability, and sensitivity of the microarray system. We found that the oligonucleotide microarray combined with quantum dots used as fluorescent labels can successfully discriminate the bacterial organisms at the genera or species level, with high specificity and stability as well as a sensitivity of 10 colony forming units (CFU)/mL of pure culture. We further tested 105 mock-contaminated food samples and achieved consistent results as those obtained from traditional biochemical methods. Together, these results indicate that the quantum dot-based oligonucleotide microarray has the potential to be a powerful tool in the detection and identification of pathogenic bacteria in foods. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Phylogenetic typing and molecular detection of virulence factors of avian pathogenic Escherichia coli isolated from colibacillosis cases in Japanese quail

    OpenAIRE

    Alizade, Hesam; Ghanbarpour, Reza; Jajarami, Maziar; Askari, Asma

    2017-01-01

    Colibacillosis caused by avian pathogenic Escherichia coli (APEC) is an economic threat to the poultry industry throughout the world. Some of the virulence genes may enhance the ability of E. coli isolates to grow in the tissues of broilers. The APEC strains are assigned to a few distinct phylogenetic groups. The purpose of the present study was to detect the virulence genes and phylogenetic groups of E. coli isolates from colibacillosis cases in Japanese quail in 2014 in Kerman, Iran. In the...

  15. A system for detection and identification of foodborne pathogenic bacteria based on a “Combinatory qPCR” technology

    OpenAIRE

    Piednoir, Elodie

    2014-01-01

    Foodborne outbreaks are important issues worldwide. Two of the most important foodborne pathogens are Salmonella spp. and Listeria monocytogenes. The reference methods to detect foodborne bacteria are international standard operating procedures, ISO methods, which are recognized in the whole world. These methods are mostly culture-based methods that are time consuming (several days) and labor intensive. In order to identify faster the source of foodborne outbreaks, to better manage food-relat...

  16. Comparison of the detection of periodontal pathogens in bacteraemia after tooth brushing by culture and molecular techniques

    OpenAIRE

    Mar?n, Mar?a-Jose; Figuero, Elena; Gonz?lez, Itziar; O?Connor, Ana; Diz, Pedro; ?lvarez, Maximiliano; Herrera, David; Sanz, Mariano

    2016-01-01

    Background The prevalence and amounts of periodontal pathogens detected in bacteraemia samples after tooth brushing-induced by means of four diagnostic technique, three based on culture and one in a molecular-based technique, have been compared in this study. Material and Methods Blood samples were collected from thirty-six subjects with different periodontal status (17 were healthy, 10 with gingivitis and 9 with periodontitis) at baseline and 2 minutes after tooth brushing. Each sample was a...

  17. Multicenter Evaluation of the ePlex Respiratory Pathogen Panel for the Detection of Viral and Bacterial Respiratory Tract Pathogens in Nasopharyngeal Swabs.

    Science.gov (United States)

    Babady, N Esther; England, Matthew R; Jurcic Smith, Kristen L; He, Taojun; Wijetunge, Dona Saumya; Tang, Yi-Wei; Chamberland, Robin R; Menegus, Marilyn; Swierkosz, Ella M; Jerris, Robert C; Greene, Wallace

    2018-02-01

    The performance of the new ePlex Respiratory Pathogen (RP) panel (GenMark Diagnostics) for the simultaneous detection of 19 viruses (influenza A virus; influenza A H1 virus; influenza A 2009 H1 virus; influenza A H3 virus; influenza B virus; adenovirus; coronaviruses [HKU1, OC43, NL63, and 229E]; human rhinovirus/enterovirus; human metapneumovirus; parainfluenza viruses 1, 2, 3, and 4; and respiratory syncytial virus [RSV] [RSV subtype A and RSV subtype B]) and 2 bacteria ( Mycoplasma pneumoniae and Chlamydia pneumoniae ) was evaluated. Prospectively and retrospectively collected nasopharyngeal swab (NPS) specimens ( n = 2,908) were evaluated by using the ePlex RP panel, with the bioMérieux/BioFire FilmArray Respiratory Panel (BioFire RP) as the comparator method. Discordance analysis was performed by using target-specific PCRs and bidirectional sequencing. The reproducibility of the assay was evaluated by using reproducibility panels comprised of 6 pathogens. The overall agreement between the ePlex RP and BioFire RP results was >95% for all targets. Positive percent agreement with the BioFire RP result for viruses ranged from 85.1% (95% confidence interval [CI], 80.2% to 88.9%) to 95.1% (95% CI, 89.0% to 97.9%), while negative percent agreement values ranged from 99.5% (95% CI, 99.1% to 99.7%) to 99.8% (95% CI, 99.5% to 99.9%). Additional testing of discordant targets (12%; 349/2,908) confirmed the results of ePlex RP for 38% (131/349) of samples tested. Reproducibility was 100% for all targets tested, with the exception of adenovirus, for which reproducibilities were 91.6% at low virus concentrations and 100% at moderate virus concentrations. The ePlex RP panel offers a new, rapid, and sensitive "sample-to-answer" multiplex panel for the detection of the most common viral and bacterial respiratory pathogens. Copyright © 2018 Babady et al.

  18. Synovial fluid multiplex PCR is superior to culture for detection of low-virulent pathogens causing periprosthetic joint infection.

    Science.gov (United States)

    Morgenstern, Christian; Cabric, Sabrina; Perka, Carsten; Trampuz, Andrej; Renz, Nora

    2018-02-01

    Analysis of joint aspirate is the standard preoperative investigation for diagnosis of periprosthetic joint infection (PJI). We compared the diagnostic performance of culture and multiplex polymerase chain reaction (PCR) of synovial fluid for diagnosis of PJI. Patients in whom aspiration of the prosthetic hip or knee joint was performed before revision arthroplasty were prospectively included. The performance of synovial fluid culture and multiplex PCR was compared by McNemar's chi-squared test. A total of 142 patients were included, 82 with knee and 60 with hip prosthesis. PJI was diagnosed in 77 patients (54%) and aseptic failure in 65 patients (46%). The sensitivity of synovial fluid culture and PCR was 52% and 60%, respectively, showing concordant results in 116 patients (82%). In patients with PJI, PCR missed 6 high-virulent pathogens (S. aureus, streptococci, E. faecalis, E. coli) which grew in synovial fluid culture, whereas synovial fluid culture missed 12 pathogens detected by multiplex PCR, predominantly low-virulent pathogens (Cutibacterium acnes and coagulase-negative staphylococci). In patients with aseptic failure, PCR detected 6 low-virulent organisms (predominantly C. acnes). While the overall performance of synovial fluid PCR was comparable to culture, PCR was superior for detection of low-virulent bacteria such as Cutibacterium spp. and coagulase-negative staphylococci. In addition, synovial fluid culture required several days for growth, whereas multiplex PCR provided results within 5hours in an automated manner. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. [Performance of Cholera-SMART and Pathogen-Detection-Kit in the quick diagnosis of cholera].

    Science.gov (United States)

    Bolaños, Hilda María; Acuña, María Teresa; Serrano, Ana María; Obando, Xinia; Mairena, Hazel; Cháves, Lorena; Sandí, Flor; Rodríguez, Gina; Tamplin, Mark L; Pérez, Enrique; Campos, Elena

    2004-10-01

    To compare the performance of two rapid systems for the diagnosis of cholera with the culture method, and to propose a strategy for improving the specificity and sensitivity of these systems and reducing the costs involved in making a diagnosis. The following institutions participated in the study: the National Bacteriology Referral Center (Centro Nacional de Referencia en Bacteriologia, CNRB) of the Costa Rican Institute for Research and Teaching in Nutrition and Health (Instituto Costarricense de Investigacion y Ensenanza en Nutricion y Salud, INCIENSA) and various hospitals in the provinces of Alajuela, Guanacaste and San Jose, in Costa Rica. A total of 237 feces samples were used to asses the performance of two tests for the rapid detection of Vibrio cholerae 01: the Pathogen Detection Kit (PDK, Intelligent Monitoring Systems, Gainesville, Florida, USA) and Cholera-SMART (New Horizons Diagnostics Corp., Columbia, Maryland, USA), both when applied directly (direct SMART and direct PDK) and when applied to specimens cultured in broth-enriched medium for 6 hours (SMART-6 and CPK-6) and for 18 hours (SMART-18 and PDK-18) at 37 degrees C in alkaline peptone water. Liquid and partially formed stools were cultured and examined by means of the rapid direct test; when the initial result was negative, the tests were repeated after culture for periods of 6 and 18 hours. Rectal and fecal swabs were obtained from feces cultured in enriched-broth medium for 6 and 18 hours. In addition, we studied the sensitivity of the rapid testing systems by using pure cultures of V. cholerae 01 (strain SOS-833, CNRB, Costa Rica) that were incubated for 18 to 24 hours, and we assessed the usefulness of observing motility under the microscope in order to rationalize the use of rapid methods. The sensitivity of the direct SMART test and of the direct PDK test was 100% when samples obtained from liquid and partially formed stools and from the intestinal contents of dead bodies were used. With

  20. A species-specific method for detecting pathogenic Streptomyces species from soil and potato tubers in Argentina

    Directory of Open Access Journals (Sweden)

    Viviana A. Barrera

    Full Text Available Potato common scab is caused by several soil-inhabiting pathogenic Streptomyces species. In the present study, a species-specific PCR method was used to detect Streptomyces species in potato tuber lesions and soils. Total genomic DNA from soil samples from six locations and tuber samples from four potato cultivars (Spunta, Shepody, Innovator and Russet Burbank were assessed. Streptomyces scabies, Streptomyces acidiscabies, and Streptomyces turgidiscabies were detected in soybean, tobacco and potato soils and in all potato varieties except Russet Burbank. The phylogenetic analysis of the sequences obtained confirmed the identification. The method proposed proved to be time-saving and cost effective for the rapid detection of Streptomyces species. This is the first report of the detection of S. acidiscabies and S. turgidiscabies in soils and potato tubers from Argentina.

  1. Development and application of an eDNA method to detect and quantify a pathogenic parasite in aquatic ecosystems.

    Science.gov (United States)

    Huver, J R; Koprivnikar, J; Johnson, P T J; Whyard, S

    2015-06-01

    Approaches based on organismal DNA found in the environment (eDNA) have become increasingly utilized for ecological studies and biodiversity inventories as an alternative to traditional field survey methods. Such DNA-based techniques have largely been used to establish the presence of free-living organisms, but have much potential for detecting and quantifying infectious agents in the environment, which is necessary to evaluate disease risk. We developed an eDNA method to examine the distribution and abundance of the trematode Ribeiroia ondatrae, a pathogenic parasite known to cause malformations in North American amphibians. In addition to comparing this eDNA approach to classical host necropsy, we examined the detectability of R. ondatrae in water samples subject to different degradation conditions (time and temperature). Our test exhibited high specificity and sensitivity to R. ondatrae, capable of detecting as little as 14 fg (femtograms) of this parasite's DNA (1/2500th of a single infectious stage) from field water samples. Compared to our results from amphibian host necropsy, quantitative PCR was -90% concordant with respect to R. ondatrae detection from 15 field sites and was also a significant predictor of host infection abundance. DNA was still detectable in lab samples after 21 days at 25°C, indicating that our method is robust to field conditions. By comparing the advantages and disadvantages of eDNA vs. traditional survey methods for determining pathogen presence and abundance in the field, we found that the lower cost and effort associated with eDNA approaches provide many advantages. The development of alternative tools is critical for disease ecology, as wildlife management and conservation efforts require reliable establishment and monitoring of pathogens.

  2. A Broad-Spectrum Infection Diagnostic that Detects Pathogen-Associated Molecular Patterns (PAMPs) in Whole Blood.

    Science.gov (United States)

    Cartwright, Mark; Rottman, Martin; Shapiro, Nathan I; Seiler, Benjamin; Lombardo, Patrick; Gamini, Nazita; Tomolonis, Julie; Watters, Alexander L; Waterhouse, Anna; Leslie, Dan; Bolgen, Dana; Graveline, Amanda; Kang, Joo H; Didar, Tohid; Dimitrakakis, Nikolaos; Cartwright, David; Super, Michael; Ingber, Donald E

    2016-07-01

    Blood cultures, and molecular diagnostic tests that directly detect pathogen DNA in blood, fail to detect bloodstream infections in most infected patients. Thus, there is a need for a rapid test that can diagnose the presence of infection to triage patients, guide therapy, and decrease the incidence of sepsis. An Enzyme-Linked Lectin-Sorbent Assay (ELLecSA) that uses magnetic microbeads coated with an engineered version of the human opsonin, Mannose Binding Lectin, containing the Fc immunoglobulin domain linked to its carbohydrate recognition domain (FcMBL) was developed to quantify pathogen-associated molecular patterns (PAMPs) in whole blood. This assay was tested in rats and pigs to explore whether it can detect infections and monitor disease progression, and in prospectively enrolled, emergency room patients with suspected sepsis. These results were also compared with data obtained from non-infected patients with or without traumatic injuries. The FcMBL ELLecSA was able to detect PAMPS present on, or released by, 85% of clinical isolates representing 47 of 55 different pathogen species, including the most common causes of sepsis. The PAMP assay rapidly (blood cultures were negative and bacteriocidal antibiotics were administered. In patients with suspected sepsis, the FcMBL ELLecSA detected infection in 55 of 67 patients with high sensitivity (>81%), specificity (>89%), and diagnostic accuracy of 0·87. It also distinguished infection from trauma-related inflammation in the same patient cohorts with a higher specificity than the clinical sepsis biomarker, C-reactive Protein. The FcMBL ELLecSA-based PAMP assay offers a rapid, simple, sensitive and specific method for diagnosing infections, even when blood cultures are negative and antibiotic therapy has been initiated. It may help to triage patients with suspected systemic infections, and serve as a companion diagnostic to guide administration of emerging dialysis-like sepsis therapies. Copyright © 2016 The

  3. Detection of highly pathogenic avian influenza (H5N1) in apparently ...

    African Journals Online (AJOL)

    Nigeria reported the first outbreak of Highly Pathogenic Avian Influenza (HPAI) in Africa, February 2006. Since then effort by relevant authorities to control the spread and persistence of the disease has been effective, with only sporadic resurgence in backyard and live bird markets. Surveillance for HPAI was carried out in ...

  4. Detection of Campylobacter jejuni and other potential pathogens in travellers' diarrhoea in Bangladesh

    NARCIS (Netherlands)

    Speelman, P.; Struelens, M. J.; Sanyal, S. C.; Glass, R. I.

    1983-01-01

    To determine the distribution of pathogens associated with travellers' diarrhoea in Bangladesh, we have studied 269 expatriates who presented with diarrhoea to our clinic, over a one-year period. Patients were interviewed about their history of diarrhoea and a stool specimen examined for parasites

  5. The development and application of the two real-time RT-PCR assays to detect the pathogen of HFMD.

    Directory of Open Access Journals (Sweden)

    Aili Cui

    Full Text Available Large-scale Hand, Foot, and Mouth Disease (HFMD outbreaks have frequently occurred in China since 2008, affecting more than one million children and causing several hundred children deaths every year. The pathogens of HFMD are mainly human enteroviruses (HEVs. Among them, human enterovirus 71 (HEV71 and coxsackievirus A16 (CVA16 are the most common pathogens of HFMD. However, other HEVs could also cause HFMD. To rapidly detect HEV71 and CVA16, and ensure detection of all HEVs causing HFMD, two real-time hybridization probe-based RT-PCR assays were developed in this study. One is a multiplex real-time RT-PCR assay, which was developed to detect and differentiate HEV71 specifically from CVA16 directly from clinical specimens within 1-2 h, and the other is a broad-spectrum real-time RT-PCR assay, which targeted almost all HEVs. The experiments confirmed that the two assays have high sensitivity and specificity, and the sensitivity was up to 0.1 TCID50/ml for detection of HEVs, HEV71, and CVA16, respectively. A total of 213 clinical specimens were simultaneously detected by three kinds of assays, including the two real-time RT-PCR assays, direct conventional RT-PCR assay, and virus isolation assay on human rhabdomyosarcoma cells (RD cells. The total positive rate of both HEV71 and CVA16 was 69.48% with real-time RT-PCR assay, 47.42% with RT-PCR assay, and 34.58% with virus isolation assay. One HFMD clinical specimen was positive for HEV, but negative for HEV71 or CVA16, which was identified as Echovirus 11 (Echo11 by virus isolation, RT-PCR, and sequencing for the VP1 gene. The two real-time RT-PCR assays had been applied in 31 provincial HFMD labs to detect the pathogens of HFMD, which has contributed to the rapid identification of the pathogens in the early stages of HFMD outbreaks, and helped to clarify the etiologic agents of HFMD in China.

  6. Direct immobilization of antibodies on Zn-doped Fe3O4 nanoclusters for detection of pathogenic bacteria

    International Nuclear Information System (INIS)

    Pal, Monalisa; Lee, Sanghee; Kwon, Donghoon; Hwang, Jeongin; Lee, Hyeonjeong; Hwang, Seokyung; Jeon, Sangmin

    2017-01-01

    Zinc-doped magnetic nanoclusters (Zn-MNCs) were synthesized and used to detect pathogenic bacteria in milk. Hydrothermally synthesized Zn-MNCs exhibited stronger magnetic properties than pure MNCs, which facilitated the magnetic separation from the sample using a permanent magnet. The presence of accessible Zn sites allows the direct immobilization of half-fragmented antibodies over Zn-MNCs through strong Zn−S bonds and prevents the tedious multiple steps of molecular functionalization or coating with costly noble metals prior to conjugation with an antibody. After the capture and magnetic separation of Salmonella in milk using the antibody-functionalized Zn-MNCs, the concentration of bacteria was determined with a portable ATP luminometer and the detection limit was found to be 10 CFU/mL. - Highlights: • Zn-doped Fe 3 O 4 nanoclusters (Zn-MNCs) were synthesized by hydrothermal method. • Antibodies were directly immobilized over Zn-MNCs through strong Zn–S thiol bonds. • Higher magnetization of Zn-MNCs than pure MNCs facilitates the magnetic separation. • Detection limit of pathogenic bacteria in milk was found to be 10 cfu/mL. • Cost effective, sensitive and selective detection of bacteria.

  7. Real-time polymerase chain-reaction detection of pathogens is feasible to supplement the diagnostic sequence for urinary tract infections.

    Science.gov (United States)

    Lehmann, Lutz E; Hauser, Stefan; Malinka, Thomas; Klaschik, Sven; Stüber, Frank; Book, Malte

    2010-07-01

    To evaluate, in a prospective pilot study, the feasibility of identifying pathogens in urine using real-time polymerase chain reaction (PCR), and to compare the results with the conventional urine culture-based procedures. Severe urinary tract infections (UTIs) are frequent in critically ill patients in the intensive-care unit (ICU) and in outpatients, and thus the reliable and fast identification of the bacteria is mandatory, but routine urine culture is time-consuming and the therapeutic regimen is often calculated and not culture-based. The study included 301 prospectively collected urine samples from 189 patients with suspected UTI, based in a university hospital in 2005, and included outpatients and those in the ICU. Urine culture with Cled-, MacConkey- and malt extract agar of all samples was followed by microbiological identification of the pathogens in 98 samples with visible growth. In parallel, all samples were assessed using qualitative real-time PCR-based DNA detection and identification by labelled hybridization probes. In all, 15 dipstick culture-negative samples showed positive pathogen DNA identification by PCR. By contrast, 17 PCR-negative samples showed detectable pathogens by culture, of which 10 were not detectable on PCR because the identified pathogens were not represented in the probe panel. The sensitivity and specificity for detecting contaminated samples was 0.90 and 0.87, respectively. Overall, 95% of the mono-infection pathogens and 57% of the multiple-infection pathogens were detected concordantly with both methods. In this prospective pilot study PCR-based identification of pathogens was feasible for supplementing conventional culture methods for the diagnosis of UTI. The main advantage is the time saved in identifying the pathogens. The limited pathogen detection in multiple-infection-samples by PCR might be explained by competitive PCR amplification conditions.

  8. Ultrafiltration and Microarray for Detection of Microbial Source Tracking Marker and Pathogen Genes in Riverine and Marine Systems.

    Science.gov (United States)

    Li, Xiang; Harwood, Valerie J; Nayak, Bina; Weidhaas, Jennifer L

    2016-01-04

    Pathogen identification and microbial source tracking (MST) to identify sources of fecal pollution improve evaluation of water quality. They contribute to improved assessment of human health risks and remediation of pollution sources. An MST microarray was used to simultaneously detect genes for multiple pathogens and indicators of fecal pollution in freshwater, marine water, sewage-contaminated freshwater and marine water, and treated wastewater. Dead-end ultrafiltration (DEUF) was used to concentrate organisms from water samples, yielding a recovery efficiency of >95% for Escherichia coli and human polyomavirus. Whole-genome amplification (WGA) increased gene copies from ultrafiltered samples and increased the sensitivity of the microarray. Viruses (adenovirus, bocavirus, hepatitis A virus, and human polyomaviruses) were detected in sewage-contaminated samples. Pathogens such as Legionella pneumophila, Shigella flexneri, and Campylobacter fetus were detected along with genes conferring resistance to aminoglycosides, beta-lactams, and tetracycline. Nonmetric dimensional analysis of MST marker genes grouped sewage-spiked freshwater and marine samples with sewage and apart from other fecal sources. The sensitivity (percent true positives) of the microarray probes for gene targets anticipated in sewage was 51 to 57% and was lower than the specificity (percent true negatives; 79 to 81%). A linear relationship between gene copies determined by quantitative PCR and microarray fluorescence was found, indicating the semiquantitative nature of the MST microarray. These results indicate that ultrafiltration coupled with WGA provides sufficient nucleic acids for detection of viruses, bacteria, protozoa, and antibiotic resistance genes by the microarray in applications ranging from beach monitoring to risk assessment. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  9. Detection of HPV and co-infecting pathogens in healthy Italian women by multiplex real-time PCR.

    Science.gov (United States)

    Camporiondo, Maria Pia; Farchi, Francesca; Ciccozzi, Massimo; Denaro, Aurelia; Gallone, Domenica; Maracchioni, Fabio; Favalli, Cartesio; Ciotti, Marco

    2016-01-01

    Several pathogens can be transmitted sexually and are an important cause of morbidity among sexually active women. The aim of the study was to detect the presence of human papillomavirus (HPV), Chlamydia trachomatis (CT), Neisseria gonorrhoeae (NG), Trichomonas vaginalis (TV), Mycoplasma hominis (MH), Mycoplasma genitalium (MG), Ureaplasma urealyticum (UU), and Ureaplasma parvum (UP) in a group of 309 healthy women enrolled at the San Camillo - Forlanini hospital of Rome by using two multiplex real-time PCR assays based on TOCE® technology. The women's ages ranged from 34 to 60 years, median 49 [IQR 45-54]. Of the 309 women tested, HPV DNA was detected in 77/309 (24.9%) patients. Of these, 44 (14.2%) harboured a single infection while 33 (10.7%) were infected by multiple genotypes. Prevalence of HPV infection was highest among females aged 40-50 years (15.2%). Of the other pathogens sought, CT, MG and NG were not detected while positive results were found for MH (12/309, 3.9%), TV (4/309, 1.3%), UP (89/309, 28.8%) and UU (14/309, 4.5%). Co-infections were as follows: 5 MH/HPV, 4 TV/HPV, 34 UP/HPV and 9 UU/HPV. In HPV-positive women, the probability of being infected by UP and UU was 2.5 (p=0.00045) and 6 fold higher (p=0.0016) than in HPV-negative women. The study supports the use of multiplex real-time PCR assays in a routine diagnostic setting. The high sensitivity and specificity of these assays along with the simultaneous detection of the most common sexually transmitted pathogens confers an advantage with respect to more obsolete methods reducing costs and time to diagnosis.

  10. Establishment of Multiplex Solid-Phase Strip PCR Test for Detection of 24 Ocular Infectious Disease Pathogens.

    Science.gov (United States)

    Nakano, Satoko; Sugita, Sunao; Tomaru, Yasuhiro; Hono, Ayumi; Nakamuro, Takako; Kubota, Toshiaki; Takase, Hiroshi; Mochizuki, Manabu; Takahashi, Masayo; Shimizu, Norio

    2017-03-01

    To establish and evaluate a new multiplex solid-phase strip polymerase chain reaction (strip PCR) for concurrent detection of common ocular infectious disease pathogens. A new multiplex strip PCR was established to detect 24 common ocular infectious disease pathogens: herpes simplex virus (HSV) 1, HSV2, varicella-zoster virus (VZV), Epstein-Barr virus (EBV), cytomegalovirus (CMV), human herpes virus (HHV) 6, HHV7, HHV8, human T-cell lymphotropic virus (HTLV)-1, adenovirus, Mycobacterium tuberculosis, Treponema pallidum, Propionibacterium acnes (P. acnes), bacterial 16S ribosomal RNA (rRNA), Candida species (Candida sp.), C. glabrata, C. krusei, Aspergillus, Fusarium, fungal 28S rRNA, Toxoplasma (T. gondii), Toxocara, Chlamydia trachomatis (C. trachomatis), and Acanthamoeba. Strip PCR was tested with a negative control (distilled water) and standard positive control DNA. Cutoffs of quantification cycle (Cq) values were determined with noninfectious ocular samples to avoid false-positives caused by contamination with P. acnes, bacterial 16S, and fungal 28S from reagents and ocular surfaces. A pilot study to evaluate the strip PCR was performed using infectious ocular samples (aqueous humor, vitreous, cornea, and tears) by strip PCR and previously developed capillary-type multiplex PCR and quantitative real-time PCR (qPCR). Strip PCR was verified with negative and positive controls. Strip PCR rapidly detected HSV1, HSV2, VZV, EBV, CMV, HHV6, HHV7, HTLV-1, adenovirus, P. acnes, bacterial 16S, Candida sp., C. glabrata, Aspergillus, fungal 28S, T. gondii, C. trachomatis, and Acanthamoeba in patient samples. The sensitivity was comparable to that of qPCR. Our novel strip PCR assay is a simple, rapid, and high-sensitivity method for detecting ocular infectious disease pathogens.

  11. Determining the 95% limit of detection for waterborne pathogen analyses from primary concentration to qPCR

    Science.gov (United States)

    Stokdyk, Joel P.; Firnstahl, Aaron; Spencer, Susan K.; Burch, Tucker R; Borchardt, Mark A.

    2016-01-01

    The limit of detection (LOD) for qPCR-based analyses is not consistently defined or determined in studies on waterborne pathogens. Moreover, the LODs reported often reflect the qPCR assay alone rather than the entire sample process. Our objective was to develop an approach to determine the 95% LOD (lowest concentration at which 95% of positive samples are detected) for the entire process of waterborne pathogen detection. We began by spiking the lowest concentration that was consistently positive at the qPCR step (based on its standard curve) into each procedural step working backwards (i.e., extraction, secondary concentration, primary concentration), which established a concentration that was detectable following losses of the pathogen from processing. Using the fraction of positive replicates (n = 10) at this concentration, we selected and analyzed a second, and then third, concentration. If the fraction of positive replicates equaled 1 or 0 for two concentrations, we selected another. We calculated the LOD using probit analysis. To demonstrate our approach we determined the 95% LOD for Salmonella enterica serovar Typhimurium, adenovirus 41, and vaccine-derived poliovirus Sabin 3, which were 11, 12, and 6 genomic copies (gc) per reaction (rxn), respectively (equivalent to 1.3, 1.5, and 4.0 gc L−1 assuming the 1500 L tap-water sample volume prescribed in EPA Method 1615). This approach limited the number of analyses required and was amenable to testing multiple genetic targets simultaneously (i.e., spiking a single sample with multiple microorganisms). An LOD determined this way can facilitate study design, guide the number of required technical replicates, aid method evaluation, and inform data interpretation.

  12. Determining the 95% limit of detection for waterborne pathogen analyses from primary concentration to qPCR.

    Science.gov (United States)

    Stokdyk, Joel P; Firnstahl, Aaron D; Spencer, Susan K; Burch, Tucker R; Borchardt, Mark A

    2016-06-01

    The limit of detection (LOD) for qPCR-based analyses is not consistently defined or determined in studies on waterborne pathogens. Moreover, the LODs reported often reflect the qPCR assay alone rather than the entire sample process. Our objective was to develop an approach to determine the 95% LOD (lowest concentration at which 95% of positive samples are detected) for the entire process of waterborne pathogen detection. We began by spiking the lowest concentration that was consistently positive at the qPCR step (based on its standard curve) into each procedural step working backwards (i.e., extraction, secondary concentration, primary concentration), which established a concentration that was detectable following losses of the pathogen from processing. Using the fraction of positive replicates (n = 10) at this concentration, we selected and analyzed a second, and then third, concentration. If the fraction of positive replicates equaled 1 or 0 for two concentrations, we selected another. We calculated the LOD using probit analysis. To demonstrate our approach we determined the 95% LOD for Salmonella enterica serovar Typhimurium, adenovirus 41, and vaccine-derived poliovirus Sabin 3, which were 11, 12, and 6 genomic copies (gc) per reaction (rxn), respectively (equivalent to 1.3, 1.5, and 4.0 gc L(-1) assuming the 1500 L tap-water sample volume prescribed in EPA Method 1615). This approach limited the number of analyses required and was amenable to testing multiple genetic targets simultaneously (i.e., spiking a single sample with multiple microorganisms). An LOD determined this way can facilitate study design, guide the number of required technical replicates, aid method evaluation, and inform data interpretation. Published by Elsevier Ltd.

  13. Development of real-time PCR array for simultaneous detection of eight human blood-borne viral pathogens.

    Directory of Open Access Journals (Sweden)

    Natalia Pripuzova

    Full Text Available BACKGROUND: Real-time PCR array for rapid detection of multiple viral pathogens should be highly useful in cases where the sample volume and the time of testing are limited, i.e. in the eligibility testing of tissue and organ donors. FINDINGS: We developed a real-time PCR array capable of simultaneously detecting eight human viral pathogens: human immunodeficiency virus types 1 and 2 (HIV-1 and -2, hepatitis B virus (HBV, hepatitis C virus (HCV, human T-cell leukemia virus-1 and -2 (HTLV-1 and -2, vaccinia virus (VACV and West Nile virus (WNV. One hundred twenty (120 primers were designed using a combination of bioinformatics approaches, and, after experimental testing, 24 primer sets targeting eight viral pathogens were selected to set up the array with SYBR Green chemistry. The specificity and sensitivity of the virus-specific primer sets selected for the array were evaluated using analytical panels with known amounts of viruses spiked into human plasma. The array detected: 10 genome equivalents (geq/ml of HIV-2 and HCV, 50 geq of HIV-1 (subtype B, HBV (genotype A and WNV. It detected 100-1,000 geq/ml of plasma of HIV-1 subtypes (A - G, group N and CRF (AE and AG isolates. Further evaluation with a panel consisting of 28 HIV-1 and HIV-2 clinical isolates revealed no cross-reactivity of HIV-1 or HIV-2 specific primers with another type of HIV. All 28 viral isolates were identified with specific primer sets targeting the most conserved genome areas. The PCR array correctly identified viral infections in a panel of 17 previously quantified clinical plasma samples positive for HIV-1, HCV or HBV at as low as several geq per PCR reaction. CONCLUSIONS: The viral array described here demonstrated adequate performance in the testing of donors' clinical samples. Further improvement in its sensitivity for the broad spectrum of HIV-1 subtypes is under development.

  14. Simulation of laser detection and ranging (LADAR) and forward-looking infrared (FLIR) data for autonomous tracking of airborne objects

    Science.gov (United States)

    Powell, Gavin; Markham, Keith C.; Marshall, David

    2000-06-01

    This paper presents the results of an investigation leading into an implementation of FLIR and LADAR data simulation for use in a multi sensor data fusion automated target recognition system. At present the main areas of application are in military environments but systems can easily be adapted to other areas such as security applications, robotics and autonomous cars. Recent developments have been away from traditional sensor modeling and toward modeling of features that are external to the system, such as atmosphere and part occlusion, to create a more realistic and rounded system. We have implemented such techniques and introduced a means of inserting these models into a highly detailed scene model to provide a rich data set for later processing. From our study and implementation we are able to embed sensor model components into a commercial graphics and animation package, along with object and terrain models, which can be easily used to create a more realistic sequence of images.

  15. Electromigration techniques - rapid methods for the detection and identification of urinary tract pathogens

    Czech Academy of Sciences Publication Activity Database

    Růžička, F.; Holá, V.; Horká, Marie

    2004-01-01

    Roč. 10, Suppl. 3 (2004), s. 621-622 ISSN 1198-743X. [14th ECCMID. European Congress of Clinical Microbiology and Infectious Diseases /14./. Praha, 01.05.2004-04.05.2004] R&D Projects: GA AV ČR IAA4031302 Institutional research plan: CEZ:AV0Z4031919 Keywords : electromigration techniques * identification * pathogens Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 2.361, year: 2004

  16. Light scattering sensing detection of pathogens based on the molecular recognition of immunoglobulin with cell wall-associated protein A

    International Nuclear Information System (INIS)

    Liu Zhongde; Chen Shaofen; Cheng Zhihuang; Zhen Shujun; Liao Qiegen

    2007-01-01

    In this contribution, we report a rapid optical detection method of pathogens using Staphylococcus aureus (S. aureus) as the model analyte based on the molecular recognition of immunoglobulin with cell wall-associated Protein A (SpA). It was found that the molecular recognition of human immunoglobulin (IgG) with protein A on the cell wall of S. aureus on glass slide sensing area could result in strong surface enhanced light scattering (SELS) signals, and the SELS intensity (ΔI) increases proportionally with the concentration of S. aureus over the range of 2.5 x 10 5 -1.0 x 10 8 CFU mL -1 with right angle light scattering (RALS) signals detection mode. In order to identify the solid support based molecular recognition between IgG with SpA, we also employed water-soluble CdS quantum dots (CdS-QDs) as a fluorescent marker for IgG by immobilizing the IgG onto the surfaces of CdS-QDs through covalent binding in order to generate recognition probes for SpA on the cell wall of S. aureus. Consequently, the fluorescent method also showed that the detection for pathogens with solid supports is reliable based on the molecular recognition of IgG with SpA

  17. Multiplex tandem PCR: a novel platform for rapid detection and identification of fungal pathogens from blood culture specimens.

    Science.gov (United States)

    Lau, Anna; Sorrell, Tania C; Chen, Sharon; Stanley, Keith; Iredell, Jonathan; Halliday, Catriona

    2008-09-01

    We describe the first development and evaluation of a rapid multiplex tandem PCR (MT-PCR) assay for the detection and identification of fungi directly from blood culture specimens that have been flagged as positive. The assay uses a short-cycle multiplex amplification, followed by 12 simultaneous PCRs which target the fungal internal transcribed spacer 1 (ITS1) and ITS2 region, elongation factor 1-alpha (EF1-alpha), and beta-tubulin genes to identify 11 fungal pathogens: Candida albicans, Candida dubliniensis, Candida glabrata, Candida guilliermondii, Candida krusei, Candida parapsilosis complex, Candida tropicalis, Cryptococcus neoformans complex, Fusarium solani, Fusarium species, and Scedosporium prolificans. The presence or absence of a fungal target was confirmed by melting curve analysis. Identification by MT-PCR correlated with culture-based identification for 44 (100%) patients. No cross-reactivity was detected in 200 blood culture specimens that contained bacteria or in 30 blood cultures without microorganisms. Fungi were correctly identified in five specimens with bacterial coinfection and in blood culture samples that were seeded with a mixture of yeast cells. The MT-PCR assay was able to provide rapid (detection and identification of fungal pathogens directly from blood culture specimens.

  18. A Modified Quantum Dot-Based Dot Blot Assay for Rapid Detection of Fish Pathogen Vibrio anguillarum.

    Science.gov (United States)

    Zhang, Yang; Xiao, Jingfan; Wang, Qiyao; Zhang, Yuanxing

    2016-08-28

    Vibrio anguillarum, a devastating pathogen causing vibriosis among marine fish, is prevailing in worldwide fishery industries and accounts for grievous economic losses. Therefore, a rapid on-site detection and diagnostic technique for this pathogen is in urgent need. In this study, two mouse monoclonal antibodies (MAbs) against V. anguillarum, 6B3-C5 and 8G3-B5, were generated by using hybridoma technology and their isotypes were characterized. MAb 6B3-C5 was chosen as the detector antibody and conjugated with quantum dots. Based on MAb 6B3- C5 labeled with quantum dots, a modified dot blot assay was developed for the on-site determination of V. anguillarum. It was found that the method had no cross-reactivity with other than V. anguillarum bacteria. The detection limit (LOD) for V. anguillarum was 1 × 10(3) CFU/ml in cultured bacterial suspension samples, which was a 100-fold higher sensitivity than the reported colloidal gold immunochromatographic test strip. When V. anguillarum was mixed with turbot tissue homogenates, the LOD was 1 × 10(3) CFU/ml, suggesting that tissue homogenates did not influence the detection capabilities. Preenrichment with the tissue homogenates for 12 h could raise the LOD up to 1 × 10(2) CFU/ml, confirming the reliability of the method.

  19. Optimization of a real-time PCR assay for the detection of the quarantine pathogen Melampsora medusae f. sp. deltoidae.

    Science.gov (United States)

    Boutigny, Anne-Laure; Guinet, Cécile; Vialle, Agathe; Hamelin, Richard C; Andrieux, Axelle; Frey, Pascal; Husson, Claude; Ioos, Renaud

    2013-06-01

    Melampsora medusae (Mm), one of the causal agents of poplar rust, is classified as an A2 quarantine pest for European Plant Protection Organization (EPPO) and its presence in Europe is strictly controlled. Two formae speciales have been described within Mm, Melampsora medusae f. sp. deltoidae (Mmd), and Melampsora medusae f. sp. tremuloidae (Mmt) on the basis of their pathogenicity on Populus species from the section Aigeiros (e.g. Populus deltoides) or Populus (e.g. Populus tremuloides), respectively. In this study, a real-time polymerase chain reaction (PCR) assay was developed allowing the detection of Mmd, the forma specialis that is economically harmful. A set of primers and hydrolysis probe were designed based on sequence polymorphisms in the large ribosomal RNA subunit (28S). The real-time PCR assay was optimized and performance criteria of the detection method, i.e. sensitivity, specificity, repeatability, reproducibility, and robustness, were assessed. The real-time PCR method was highly specific and sensitive and allowed the detection of one single urediniospore of Mmd in a mixture of 2 mg of urediniospores of other Melampsora species. This test offers improved specificity over currently existing conventional PCR tests and can be used for specific surveys in European nurseries and phytosanitary controls, in order to avoid introduction and spread of this pathogen in Europe. Copyright © 2013 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  20. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

    Directory of Open Access Journals (Sweden)

    J.A. Khan

    2013-09-01

    Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

  1. Multiplex Tandem PCR: a Novel Platform for Rapid Detection and Identification of Fungal Pathogens from Blood Culture Specimens▿

    OpenAIRE

    Lau, Anna; Sorrell, Tania C.; Chen, Sharon; Stanley, Keith; Iredell, Jonathan; Halliday, Catriona

    2008-01-01

    We describe the first development and evaluation of a rapid multiplex tandem PCR (MT-PCR) assay for the detection and identification of fungi directly from blood culture specimens that have been flagged as positive. The assay uses a short-cycle multiplex amplification, followed by 12 simultaneous PCRs which target the fungal internal transcribed spacer 1 (ITS1) and ITS2 region, elongation factor 1-α (EF1-α), and β-tubulin genes to identify 11 fungal pathogens: Candida albicans, Candida dublin...

  2. Detecting presence of live and dead pathogenic organisms in water and the water solutions by laser spectroscopy

    Science.gov (United States)

    Moguilnaya, T.; Suminov, I.; Ignatov, S.

    2017-05-01

    Presented is a new method for the recognition of live or dead pathogens in water. This method is based on the diagnostics of non-linear effects that comprise two phenomena: an induced luminescence of DNA under the influence of laser radiation, and a stimulated Brillouin scattering (SBS). The following model parameters were selected for the identification: the peak positions of spectral lines corresponding to pathogens and the difference between two wavelengths corresponding, respectively, to a laser mode maximum, and to a peak of the spectral line of a pathogen. A large volume of experimental data has been obtained and statistical analysis using Student’s test was carried out in order to determine the probability of the detection of spectra. The dynamics of the spectra of direct dispersion have been studied for a number of bacteria. Based on these results, the method and the device were developed. That device was tested in a water pipe line. In addition, we have studied the dynamics of changes in the spectra for solutions containing live bacteria and dead cells.

  3. Detection of pathogenic bacteria in skin lesions of patients with chiclero's ulcer: reluctant response to antimonial treatment

    Directory of Open Access Journals (Sweden)

    Isaac-Márquez Angélica Patricia

    2003-01-01

    Full Text Available We investigated the bacterial flora present in skin lesions of patients with chiclero's ulcer from the Yucatan peninsula of Mexico using conventional culture methods (11 patients, and an immunocolorimetric detection of pathogenic Streptococcus pyogenes (15 patients. Prevalence of bacteria isolated by culture methods was 90.9% (10/11. We cultured, from chiclero's ulcers (60%, pathogenic bacterial such as Staphylococcus aureus (20%, S. pyogenes (1.6%, Pseudomonas aeruginosa (1.6%, Morganella morganii (1.6%, and opportunist pathogenic bacteria such as Klebsiella spp. (20.0%, Enterobacter spp. (20%, and Enterococcus spp. (20%. We also cultured coagulase-negative staphylococci in 40% (4/10 of the remaining patients. Micrococcus spp. and coagulase-negative staphylococci constituted the bacterial genuses more frequently isolated in the normal skin of patients with chiclero's ulcer and healthy individuals used as controls. We also undertook another study to find out the presence of S. pyogenes by an immunocolorimetric assay. This study indicated that 60% (9/15 of the ulcerated lesions, but not normal controls, were contaminated with S. pyogenes. Importantly, individuals with purulent secretion and holding concomitant infections with S. pyogenes, S. aureus, P. aeruginosa, M. morganii, and E. durans took longer to heal Leishmania (L. mexicana infections treated with antimonial drugs. Our results suggest the need to eliminate bacterial purulent infections, by antibiotic treatment, before starting antimonial administration to patients with chiclero's ulcer.

  4. Development of a fluorogenic 5' nuclease PCR assay for detection of the ail gene of pathogenic Yersinia enterocolitica.

    Science.gov (United States)

    Jourdan, A D; Johnson, S C; Wesley, I V

    2000-09-01

    In this report we describe the development and evaluation of a fluorogenic PCR assay for the detection of pathogenic Yersinia enterocolitica. The assay targets the chromosomally encoded attachment and invasion gene, ail. Three primer-probe sets (TM1, TM2, and TM3) amplifying different, yet overlapping, regions of ail were examined for their specificity and sensitivity. All three primer-probe sets were able to detect between 0.25 and 0.5 pg of purified Y. enterocolitica DNA. TM1 identified all 26 Y. enterocolitica strains examined. TM3 was able to detect all strains except one, whereas TM2 was unable to detect 10 of the Y. enterocolitica strains tested. None of the primer-probe sets cross-reacted with any of the 21 non-Y. enterocolitica strains examined. When the TM1 set was utilized, the fluorogenic PCR assay was able to detect detecting

  5. Microbiological quality indicators in waters of dairy farms: detection of pathogens by PCR in real time.

    Science.gov (United States)

    Rodríguez, Diana Catalina; Pino, Nancy; Peñuela, Gustavo

    2012-06-15

    When contaminated water is used to wash the udders of dairy cattle and milking utensils, raw milk may become contaminated with pathogens. Washing with high quality water is essential to reduce the microbial contamination of milk. Furthermore, the wastewater generated in dairy herds also contains high populations of pathogens, antibiotics and nutrients that more often are thrown into the water bodies without any treatment. In this work, both supply water and wastewater from 20 dairy farms from Antioquia, Colombia was monitored for 10months to determine the presence of pathogenic microorganisms. Both Cryptosporidium and Fasciola were determined by the Polymerase Chain Reaction (PCR) technique in real time. The results showed that the supply water used for drinking and activities involving the herd, has high populations of Fasciola hepatica and Cryptosporidium parvum, with percentages of about 53.7% and 64.75% respectively. Additionally high populations of Pseudomonas aeruginosa, Shigella, Salmonella, total coliforms and Escherichia coli were found in both types of water, with values around 9.4×10(7), 2.1×10(7), 1.8×10(7), 1.9×10(10) and 1.5×10(10) UFC/100 ml respectively for the wastewater and 3.1×10(4), 1.9×10(4), 7.3×10(3), 1.2×10(5) and 6.2×10(3) UFC/100 ml for the supply water. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. Optimization of quantitative polymerase chain reactions for detection and quantification of eight periodontal bacterial pathogens

    Directory of Open Access Journals (Sweden)

    Decat Ellen

    2012-12-01

    Full Text Available Abstract Background The aim of this study was to optimize quantitative (real-time polymerase chain reaction (qPCR assays for 8 major periodontal pathogens, i.e. Aggregatibacter actinomycetemcomitans, Fusobacterium nucleatum, Parvimonas micros, Porphyromonas gingivalis, Prevotella intermedia, Tanerella forsythia and Treponema denticola, and of the caries pathogen Streptococcus mutans. Results Eighteen different primer pairs were analyzed in silico regarding specificity (using BLAST analysis and the presence of secondary structures at primer binding sites (using mFOLD. The most specific and efficiently binding primer pairs, according to these analyses, were selected for qPCR-analysis to determine amplification efficiency, limit of quantification and intra-run reproducibility. For the selected primer pairs, one for each species, the specificity was confirmed by assessing amplification of DNA extracts from isolates of closely related species. For these primer pairs, the intercycler portability was evaluated on 3 different thermal cyclers (the Applied Biosystems 7300, the Bio-Rad iQ5 and the Roche Light Cycler 480. For all assays on the different cyclers, a good correlation of the standard series was obtained (i.e. r2 ≥ 0.98, but quantification limits varied among cyclers. The overall best quantification limit was obtained by using a 2 μl sample in a final volume of 10 μl on the Light Cycler 480. Conclusions In conclusion, the proposed assays allow to quantify the bacterial loads of S. mutans, 6 periodontal pathogenic species and the genus Fusobacterium.This can be of use in assessing periodontal risk, determination of the optimal periodontal therapy and evaluation of this treatment.

  7. Cybersecurity for aerospace autonomous systems

    Science.gov (United States)

    Straub, Jeremy

    2015-05-01

    High profile breaches have occurred across numerous information systems. One area where attacks are particularly problematic is autonomous control systems. This paper considers the aerospace information system, focusing on elements that interact with autonomous control systems (e.g., onboard UAVs). It discusses the trust placed in the autonomous systems and supporting systems (e.g., navigational aids) and how this trust can be validated. Approaches to remotely detect the UAV compromise, without relying on the onboard software (on a potentially compromised system) as part of the process are discussed. How different levels of autonomy (task-based, goal-based, mission-based) impact this remote characterization is considered.

  8. Interferometric biosensing platform for multiplexed digital detection of viral pathogens and biomarkers

    Science.gov (United States)

    Daaboul, George

    Label-free optical biosensors have been established as proven tools for monitoring specific biomolecular interactions. However, compact and robust embodiments of such instruments have yet to be introduced in order to provide sensitive, quantitative, and high-throughput biosensing for low-cost research and clinical applications. Here we present the interferometric reflectance-imaging sensor (IRIS). IRIS allows sensitive label free analysis using an inexpensive and durable multi-color LED illumination source on a silicon based surface. IRIS monitors biomolecular interaction through measurement of biomass addition to the sensor's surface. We demonstrate the capability of this system to dynamically monitor antigen---antibody interactions with a noise floor of 5.2 pg/mm 2 and DNA single mismatch detection under isothermal melting conditions in an array format. Ensemble detection of binding events using IRIS did not provide the sensitivity needed for detection of infectious disease and biomarkers at clinically relevant concentrations. Therefore, a new approach was adapted to the IRIS platform that allowed the detection and identification of individual nanoparticles on the sensor's surface. The new detection method was termed single-particle IRIS (SP-IRIS). We developed two detection modalities for SP-IRIS. The first modality is when the target is a nanoparticle such as a virus. We verified that SP-IRIS can accurately detect and size individual viral particles. Then we demonstrated that single nanoparticle counting and sizing methodology on SP-IRIS leads to a specific and sensitive virus sensor that can be multiplexed. Finally, we developed an assay for the detection of Ebola and Marburg. A detection limit of 3 x 103 PFU/ml was demonstrated for vesicular stomatitis virus (VSV) pseudotyped with Ebola or Marburg virus glycoprotein. We have demonstrated that virus detection can be done in human whole blood directly without the need for sample preparation. The second modality

  9. Detection, Identification, and Prevalence of Pathogenic Vibrio parahaemolyticus in Fish and Coastal Environment in Jordan.

    Science.gov (United States)

    Alaboudi, Akram R; Ababneh, Mustafa; Osaili, Tareq M; Al Shloul, Khalaf

    2016-01-01

    Vibrio parahaemolyticus is widely distributed in the marine environments and considered the leading cause of human gastroenteritis in Asian countries. A total of 150 marketed fish and 50 water and sediment samples from the Gulf of Aqaba were examined for the prevalence of pathogenic strains of V. parahaemolyticus. A total of 132 typical isolates obtained from the primary selective medium (thiosulfate-citrate bile salt sucrose agar) and showed positive biochemical properties were subjected to confirmation by polymerase chain reaction targeting the gyrB and toxR genes. These genes were confirmed at rates of 82% (108 isolates) and 72% (95 isolates), respectively. The toxR positive isolates were tested for the presence of thermolabile hemolysin (tlh), thermostable direct hemolysin (tdh), and tdh-related hemolysin (trh) virulence genes. Accordingly, the prevalence rates of pathogenic V. parahaemolyticus were 4%, 8%, and 12% in sediment, water, and fish samples, respectively. The 16S rRNA amplification and sequences were conducted for confirmation of the isolates and showing the relatedness among these isolates. The results showed that both 16S rRNA and toxR assays had same sensitivity and tested isolates had high nucleotide similarity irrespective of their sources. © 2015 Institute of Food Technologists®

  10. Impedance based detection of pathogenic E. coli O157:H7 using a ferrocene-antimicrobial peptide modified biosensor.

    Science.gov (United States)

    Li, Yongxin; Afrasiabi, Rouzbeh; Fathi, Farkhondeh; Wang, Nan; Xiang, Cuili; Love, Ryan; She, Zhe; Kraatz, Heinz-Bernhard

    2014-08-15

    Escherichia coli O157:H7 can cause life-threatening gastrointestinal diseases and has been a severe public health problem worldwide in recent years. A novel biosensor for the detection of E. coli O157:H7 is described here using a film composed of ferrocene-peptide conjugates, in which the antimicrobial peptide magainin I has been incorporated as the biorecognition element. Electrochemical impedance spectroscopy was employed to investigate the surface characteristics of the newly developed biosensor and to monitor the interactions between the peptide film and the pathogenic bacteria. X-ray photoelectron spectroscopy and time-of-flight secondary ion mass spectrometry (ToF-SIMS) were employed to confirm the immobilization of ferrocene-conjugate onto the gold surface. Non-pathogenic E. coli K12, Staphylococcus epidermidis and Bacillus subtilis were used in this study to evaluate the selectivity of the proposed biosensor. The results have shown the order of the preferential selectivity of the method is E. coli O157:H7>non-pathogenic E. coli>gram positive species. The detection of E. coli O157:H7 with a sensitivity of 10(3)cfu/mL is enabled by the biosensor. The experimental conditions have been optimized and the plot of changes of charge transfer resistance (ΔRCT) and the logarithm of the cell concentration of E. coli O157:H7 shows a linear correlation in the range of 10(3)-10(7)cfu/mL with a correlation coefficient of 0.983. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. [Evaluation of the role of Campylobacter spp. in the occurrence of foodborne diseases and modern methods to detect the pathogen].

    Science.gov (United States)

    Efimochkina, N R

    2015-01-01

    Infections caused by Campylobacter spp. are now considered to be one of the most important foodborne diseases worldwide, this organism is one of the most epidemiologically significant zoonotic pathogens. Among these pathogens Campylobacter jejuni have the greatest epidemiological importance, they are responsible for 90% of laboratory confirmed cases of food campylobacteriosis. The frequency of detection of campylobacters in the environmental and on many raw foods, of both plant and animal origin, in normal intestine biota of domestic and wild animal and birds, indicates the prevalence of these bacteria and the high risk of contamination of food and water. The main factors of transmission in sporadic campylobacteriosis are the poultry and poultry products (up to 70% of the total number of cases), water (8%), raw milk (5%). One of the risk factors for the spread of emergent pathogen is its ability to persist in aquatic ecosystems. Continuing changes in landscape and agricultural intensification can cause further enhance microbial contamination of freshwater bodies and groundwater, and the associated increase in the number of cases of waterborne campylobacteriosis. Intensification of agriculture, expanding the range of applied disinfectants and antiseptics, uncontrolled use of antibiotics in livestock often leads to the selection of the sustainable strains of Campylobacter spp., which have antibiotic resistance and multiple virulence determinants. This paper presents an overview of modern methods for the detection of Campylobacter spp., detailed culture and biochemical methods for the isolation of C. jejuni based on the use of selective culture media and diagnostic kits for the characterization of the phenotypic profiles of the strains. These methods are the starting point in selecting the most effective schemes of food control and surveillance. It is emphasized that the basis of microbiological analysis should be molecular methods based on real-time PCR, which allows

  12. Taxonomer: an interactive metagenomics analysis portal for universal pathogen detection and host mRNA expression profiling.

    Science.gov (United States)

    Flygare, Steven; Simmon, Keith; Miller, Chase; Qiao, Yi; Kennedy, Brett; Di Sera, Tonya; Graf, Erin H; Tardif, Keith D; Kapusta, Aurélie; Rynearson, Shawn; Stockmann, Chris; Queen, Krista; Tong, Suxiang; Voelkerding, Karl V; Blaschke, Anne; Byington, Carrie L; Jain, Seema; Pavia, Andrew; Ampofo, Krow; Eilbeck, Karen; Marth, Gabor; Yandell, Mark; Schlaberg, Robert

    2016-05-26

    High-throughput sequencing enables unbiased profiling of microbial communities, universal pathogen detection, and host response to infectious diseases. However, computation times and algorithmic inaccuracies have hindered adoption. We present Taxonomer, an ultrafast, web-tool for comprehensive metagenomics data analysis and interactive results visualization. Taxonomer is unique in providing integrated nucleotide and protein-based classification and simultaneous host messenger RNA (mRNA) transcript profiling. Using real-world case-studies, we show that Taxonomer detects previously unrecognized infections and reveals antiviral host mRNA expression profiles. To facilitate data-sharing across geographic distances in outbreak settings, Taxonomer is publicly available through a web-based user interface. Taxonomer enables rapid, accurate, and interactive analyses of metagenomics data on personal computers and mobile devices.

  13. Detection of food-borne pathogens by nanoparticle technology coupled to a low-cost cell reader

    Science.gov (United States)

    Noiseux, Isabelle; Bouchard, Jean-Pierre; Gallant, Pascal; Bourqui, Pascal; Cao, Honghe; Vernon, Marci; Johnson, Roger; Chen, Shu; Mermut, Ozzy

    2010-02-01

    The detection, identification and quantification of pathogenic microorganisms at low cost are of great interest to the agro-food industry. We have developed a simple, rapid, sensitive, and specific method for detection of food-borne pathogens based on use of nanoparticles alongside a low cost fluorescence cell reader for the bioassay. The nanoparticles are coupled with antibodies that allow specific recognition of the targeted Listeria in either a liquid or food matrix. The bioconjugated nanoparticles (FNP) contain thousands of dye molecules enabling significant amplification of the fluorescent signal emitted from each bacterium. The developed fluorescence Cell Reader is an LED-based reader coupled with suitable optics and a camera that acquires high resolution images. The dedicated algorithm allowed the counting of each individual nanoparticles-fluorescent bacterial cells thus enabling highly sensitive reading. The system allows, within 1 hour, the recovery and counting of 104 to 108 cfu/mL of Listeria in pure culture. However, neither the Cell Reader nor the algorithm can differentiate between the FNPs specifically-bound to the target and the residual unbound FNPs limiting sensitivity of the system. Since FNPs are too small to be washed in the bioassay, a dual tagging approach was implemented to allow online optical separation of the fluorescent background caused by free FNPs.

  14. Detection of the Amphibian Chytrid Fungus Batrachochytrium dendrobatidis in Museum Specimens of Andean Aquatic Birds: Implications for Pathogen Dispersal.

    Science.gov (United States)

    Burrowes, Patricia A; De la Riva, Ignacio

    2017-04-01

    The occurrence of the pathogenic chytrid fungus Batrachochytrium dendrobatidis (Bd) in the feet of live waterfowl has been documented, but the potential role of birds as dispersers has not been studied. We report the presence of Bd in the feet of preserved aquatic birds in the Bolivian high Andes during the time of drastic amphibian declines in the country. We sampled 48 aquatic birds from the Bolivian Andes that were preserved in museum collections. Birds were sampled for the presence of Bd DNA by swabbing, taking small pieces of tissue from toe webbing, or both. We detected Bd by DNA using quantitative PCR in 42% of the birds sampled via toe tissue pieces. This method was significantly better than swabbing at detecting Bd from bird feet. We confirmed Bd presence by sequencing Bd -positive samples and found 91-98% homology with Bd sequences from GenBank. Our study confirms that aquatic birds can carry Bd and thus may serve as potential vectors of this pathogen across large distances and complex landscapes. In addition, we recommend using DNA from preserved birds as a novel source of data to test hypotheses on the spread of chytridiomycosis in amphibians.

  15. Characterization, validation and application of a DNA microarray for the detection of mandatory and other waterborne pathogens.

    Science.gov (United States)

    Gomes, Maria; Vieira, Helena; Vale, Filipa F

    2015-11-01

    Culture methods for the detection of indicator bacteria are currently used for detection of waterborne bacteria. The need for an increased range of analyzed bacteria coupled with the obtainment of rapid and early results justify the development of a DNA microarray for the identification of waterborne pathogens. This DNA microarray has 16 implanted probes with a median size of 147 bases, targeting 12 different parameters, including all mandatory indicator microorganisms, such as Escherichia coli, Clostridium perfringens, Pseudomonas aeruginosa, Staphylococcus aureus, total and fecal coliforms and enterococci. The validation performed with DNA extracted from pure microbial cultures showed the suitability of the probes for detection of the target microorganism. To overcome the high dilution of water samples it was included either a prior culture step of bacterial contaminants retained after filtering 100 ml of water, or a 10-fold increase in the volume of filtered water, that resulted in the increase of the detected bacteria. The analysis of complex environmental water samples using culture methods and the DNA microarray revealed that the latter detected the same parameters plus other bacteria tested only in the DNA microarray. The results show that this DNA microarray may be a useful tool for water microbiological surveillance. © The Authors 2015. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  16. A cost-effective Z-folding controlled liquid handling microfluidic paper analysis device for pathogen detection via ATP quantification.

    Science.gov (United States)

    Jin, Sheng-Quan; Guo, Su-Miao; Zuo, Peng; Ye, Bang-Ce

    2015-01-15

    A cost-effective microfluidic paper analysis device (μPAD) was developed with a special Z-folding design for controlling the fluidic flowing and substrate transportation. This presented μPAD can be easily fabricated through wax printing by using a solid ink printer which deposits wax onto the surface of a chromatographic paper, and then baked on a hotplate by penetrating the molten wax into the paper to create a hydrophobic barrier. After μPAD fabrication, liquid control and substrate transportation can be easily carried out by twice folding the μPAD following Z shape. The Z folding made two separated reagent holding zone connected while the detection reaction occurred with the connection. In this paper, a pathogens detection indicated by ATP quantification was took as a proof-in-principle application of using this presented μPAD, the limit of detection (LOD) was 1 μM for ATP detection and 2.6×10(7) CFU/mL for Salmonella live cell detection, which showed a great potential for Point-of-Care Testing (POCT) applications. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. First detection of the larval chalkbrood disease pathogen Ascosphaera apis (Ascomycota: Eurotiomycetes: Ascosphaerales) in adult bumble bees.

    Science.gov (United States)

    Maxfield-Taylor, Sarah A; Mujic, Alija B; Rao, Sujaya

    2015-01-01

    Fungi in the genus Ascosphaera (Ascomycota: Eurotiomycetes: Ascosphaerales) cause chalkbrood disease in larvae of bees. Here, we report the first-ever detection of the fungus in adult bumble bees that were raised in captivity for studies on colony development. Wild queens of Bombus griseocollis, B. nevadensis and B. vosnesenskii were collected and maintained for establishment of nests. Queens that died during rearing or that did not lay eggs within one month of capture were dissected, and tissues were examined microscopically for the presence of pathogens. Filamentous fungi that were detected were plated on artificial media containing broad spectrum antibiotics for isolation and identification. Based on morphological characters, the fungus was identified as Ascosphaera apis (Maasen ex Claussen) Olive and Spiltoir, a species that has been reported earlier only from larvae of the European honey bee, Apis mellifera, the Asian honey bee, Apis cerana, and the carpenter bee Xylocopa californica arizonensis. The identity of the fungus was confirmed using molecular markers and phylogenetic analysis. Ascosphaera apis was detected in queens of all three bumble bee species examined. Of 150 queens dissected, 12 (8%) contained vegetative and reproductive stages of the fungus. Both fungal stages were also detected in two workers collected from colonies with Ascosphaera-infected B. nevadensis queens. In this study, wild bees could have been infected prior to capture for rearing, or, the A. apis infection could have originated via contaminated European honey bee pollen fed to the bumble bees in captivity. Thus, the discovery of A. apis in adult bumble bees in the current study has important implications for commercial production of bumble bee colonies and highlights potential risks to native bees via pathogen spillover from infected bees and infected pollen.

  18. A novel molecular toolkit for rapid detection of the pathogen and primary vector of thousand cankers disease.

    Directory of Open Access Journals (Sweden)

    Emel Oren

    Full Text Available Thousand Cankers Disease (TCD of Juglans and Pterocarya (Juglandaceae involves a fungal pathogen, Geosmithia morbida, and a primary insect vector, Pityophthorus juglandis. TCD was described originally from dying Juglans nigra trees in the western United States (USA, but it was reported subsequently from the eastern USA and northern Italy. The disease is often difficult to diagnose due to the absence of symptoms or signs on the bark surface of the host. Furthermore, disease symptoms can be confused with those caused by other biotic and abiotic agents. Thus, there is a critical need for a method for rapid detection of the pathogen and vector of TCD. Using species-specific microsatellite DNA markers, we developed a molecular protocol for the detection of G. morbida and P. juglandis. To demonstrate the utility of the method for delineating TCD quarantine zones, we tested whether geographical occurrence of symptoms and signs of TCD was correlated with molecular evidence for the presence of the cryptic TCD organisms. A total of 1600 drill cores were taken from branch sections collected from three regions (n = 40 trees for each location: California-J. hindsii (heavy disease incidence; Tennessee-J. nigra (mild disease incidence; and outside the known TCD zone (Missouri-J. nigra, no record of the disease. California samples had the highest incidence of the TCD organisms (85%, 34/40. Tennessee had intermediate incidence (42.5%, 17/40, whereas neither organism was detected in samples from Missouri. The low cost molecular protocol developed here has a high degree of sensitivity and specificity, and it significantly reduces sample-processing time, making the protocol a powerful tool for rapid detection of TCD.

  19. First detection of the larval chalkbrood disease pathogen Ascosphaera apis (Ascomycota: Eurotiomycetes: Ascosphaerales in adult bumble bees.

    Directory of Open Access Journals (Sweden)

    Sarah A Maxfield-Taylor

    Full Text Available Fungi in the genus Ascosphaera (Ascomycota: Eurotiomycetes: Ascosphaerales cause chalkbrood disease in larvae of bees. Here, we report the first-ever detection of the fungus in adult bumble bees that were raised in captivity for studies on colony development. Wild queens of Bombus griseocollis, B. nevadensis and B. vosnesenskii were collected and maintained for establishment of nests. Queens that died during rearing or that did not lay eggs within one month of capture were dissected, and tissues were examined microscopically for the presence of pathogens. Filamentous fungi that were detected were plated on artificial media containing broad spectrum antibiotics for isolation and identification. Based on morphological characters, the fungus was identified as Ascosphaera apis (Maasen ex Claussen Olive and Spiltoir, a species that has been reported earlier only from larvae of the European honey bee, Apis mellifera, the Asian honey bee, Apis cerana, and the carpenter bee Xylocopa californica arizonensis. The identity of the fungus was confirmed using molecular markers and phylogenetic analysis. Ascosphaera apis was detected in queens of all three bumble bee species examined. Of 150 queens dissected, 12 (8% contained vegetative and reproductive stages of the fungus. Both fungal stages were also detected in two workers collected from colonies with Ascosphaera-infected B. nevadensis queens. In this study, wild bees could have been infected prior to capture for rearing, or, the A. apis infection could have originated via contaminated European honey bee pollen fed to the bumble bees in captivity. Thus, the discovery of A. apis in adult bumble bees in the current study has important implications for commercial production of bumble bee colonies and highlights potential risks to native bees via pathogen spillover from infected bees and infected pollen.

  20. Simultaneous detection of major blackleg and soft rot bacterial pathogens in potato by multiplex polymerase chain reaction‡

    Science.gov (United States)

    Potrykus, M; Sledz, W; Golanowska, M; Slawiak, M; Binek, A; Motyka, A; Zoledowska, S; Czajkowski, R; Lojkowska, E

    2014-01-01

    A multiplex polymerase chain reaction (PCR) assay for simultaneous, fast and reliable detection of the main soft rot and blackleg potato pathogens in Europe has been developed. It utilises three pairs of primers and enables detection of three groups of pectinolytic bacteria frequently found in potato, namely: Pectobacterium atrosepticum, Pectobacterium carotovorum subsp. carotovorum together with Pectobacterium wasabiae and Dickeya spp. in a multiplex PCR assay. In studies with axenic cultures of bacteria, the multiplex assay was specific as it gave positive results only with strains of the target species and negative results with 18 non-target species of bacteria that can possibly coexist with pectinolytic bacteria in a potato ecosystem. The developed assay could detect as little as 0.01 ng µL–1 of Dickeya sp. genomic DNA, and down to 0.1 ng µL–1 of P. atrosepticum and P. carotovorum subsp. carotovorum genomic DNA in vitro. In the presence of competitor genomic DNA, isolated from Pseudomonas fluorescens cells, the sensitivity of the multiplex PCR decreased tenfold for P. atrosepticum and Dickeya sp., while no change was observed for P. carotovorum subsp. carotovorum and P. wasabiae. In spiked potato haulm and tuber samples, the threshold level for target bacteria was 101 cfu mL–1 plant extract (102 cfu g–1 plant tissue), 102 cfu mL–1 plant extract (103 cfu g–1 plant tissue), 103 cfu mL–1 plant extract (104 cfu g–1 plant tissue), for Dickeya spp., P. atrosepticum and P. carotovorum subsp. carotovorum/P. wasabiae, respectively. Most of all, this assay allowed reliable detection and identification of soft rot and blackleg pathogens in naturally infected symptomatic and asymptomatic potato stem and progeny tuber samples collected from potato fields all over Poland. PMID:25506085

  1. Studies on learning by detecting impasse and by resulting it for building large scale knowledge base for autonomous plant

    International Nuclear Information System (INIS)

    Sawaragi, Tetsuo

    1997-03-01

    The acquisition of knowledge from human experts in an exhaustive way is extremely difficult, and even if it were possible, the maintenance of such a large knowledge base for realtime operation is not an easy task. The autonomous system having just incomplete knowledge would face with so many problems that contradicts with the system's current beliefs and/or are novel or unknown to the system. Experienced humans can manage to do with such novelty due to their generalizing ability and analogical inference based on the repertoire of precedents, even if they with new problems. Moreover, through experiencing such breakdowns and impasse, they can acquire some novel knowledge by their proactive attempts to interpret a provided problem as well as by updating their beliefs and contents and organization of their prior knowledge. We call such a style of learning as impasse-driven learning, meaning that learning dose occur being motivated by facing with contradiction and impasse. The related studies concerning with such a style of leaning have been studied within a field of machine learning of artificial intelligence so far as well as within a cognitive science field. In this paper, we at first summarize an outline of machine learning methodologies, and then, we detail about the impasse-driven learning. We discuss that from two different perspective of learning, one is from deductive and analogical learning and the other one is from inductive conceptual learning (i.e., concept formation or generalization-based memory). The former mainly discuss about how the learning system updates its prior beliefs and knowledge so that it can explain away the current contradiction using some meta-cognition heuristics. The latter attempts to assimilate a contradicting problem into its prior memory structure by dynamically reorganizing a collection of the precedents. We present those methodologies, and finally we introduce a case study of concept formation for plant anomalies and its usage for

  2. Detection of pathogenic bioaerosols and occupational risk in a Philippine landfill site.

    Science.gov (United States)

    Pagalilauan, Hera Angela M; Paraoan, Cielo Emar M; Vital, Pierangeli G

    2018-03-04

    Payatas landfill site is one of the major dumpsites in the Philippines. In this study, the landfill was evaluated regarding the presence and concentration of pathogenic bacterial aerosols through culture and molecular techniques. Bioaerosols are biological airborne particles that may or may not cause diseases. Active sampling was done using MAS-100 Air Sampler from both indoor and outdoor locations. To test the accuracy of the culture method, those that were presumptively identified as Staphylococcus aureus and Klebsiella pneumoniae were subjected to molecular analysis using 16s rRNA sequencing, and as a result, they were identified as different species. The exposure assessment done by interview showed matches among prevalent diseases. The results of this study can be used as a basis for creating standards and regulations for workers' and residents' safety and health in the landfill site.

  3. Molecular detection of vector-borne pathogens in dogs and cats from Qatar.

    Science.gov (United States)

    Alho, Ana Margarida; Lima, Clara; Latrofa, Maria Stefania; Colella, Vito; Ravagnan, Silvia; Capelli, Gioia; Madeira de Carvalho, Luís; Cardoso, Luís; Otranto, Domenico

    2017-06-20

    Vector-borne diseases (VBDs) have been increasingly reported in dogs and cats worldwide. However, no data are currently available regarding canine and feline VBDs in Qatar and limited information is available from other Persian Gulf countries. Blood samples from 98 client-owned animals (i.e. 64 dogs and 34 cats) living in Doha (Qatar) were collected and the presence of genomic DNA of Anaplasma spp., Babesia spp., Dirofilaria spp., Ehrlichia spp., Hepatozoon spp., Mycoplasma spp. and Rickettsia spp. was assessed by polymerase chain reaction (PCR), real time-PCR (rt-PCR) and sequence analysis. Of the 64 dogs, 12 (18.8%) were infected with at least one pathogen (i.e. 7.8% with Mycoplasma spp., 4.7% with Babesia vogeli, 3.1% with Ehrlichia canis, and 1.6% with Anaplasma platys, Babesia gibsoni and Hepatozoon canis, each). One of the 12 dogs was co-infected with B. vogeli and E. canis. Of the 34 cats, seven (20.6%) animals were infected with at least one pathogen (i.e. 5.9% were positive for Mycoplasma spp., and 2.9% for Babesia felis, B. vogeli, E. canis, "Candidatus Mycoplasma haemominutum" and Mycoplasma haemofelis, each). No dogs or cats were positive for Dirofilaria spp. or Rickettsia spp. Although the sample sizes of dogs and cats herein analysed was moderately small, data from this study report the occurrence of A. platys, B. vogeli, B. gibsoni, E. canis, H. canis and Mycoplasma spp. in domestic dogs and of B. felis, B. vogeli, "Candidatus M. haemominutum", E. canis and M. haemofelis in domestic cats from Qatar. Further investigations along with prophylactic measures are strongly recommended in order to reduce the risk of dogs and cats acquiring VBDs in Qatar.

  4. Multitarget Quantitative PCR Improves Detection and Predicts Cultivability of the Pathogen Burkholderia pseudomallei

    OpenAIRE

    Göhler, A; Trung, TT; Hopf, V; Kohler, C; Hartleib, J; Wuthiekanun, V; Peacock, SJ; Limmathurotsakul, D; Tuanyok, A; Steinmetz, I

    2017-01-01

    : Burkholderia pseudomallei is present in the environment in many parts of the world and causes the often-fatal disease melioidosis. The sensitive detection and quantification of B. pseudomallei in the environment are a prerequisite for assessing the risk of infection. We recently reported the direct detection of B. pseudomallei in soil samples using a quantitative PCR (qPCR) targeting a single type three secretion system 1 (TTSS1) gene. Here, we extend the qPCR-based analysis of B. pseudomal...

  5. Vascular Streak Dieback of cacao in Southeast Asia and Melanesia: in planta detection of the pathogen and a new taxonomy.

    Science.gov (United States)

    Samuels, Gary J; Ismaiel, Adnan; Rosmana, Ade; Junaid, Muhammad; Guest, David; McMahon, Peter; Keane, Philip; Purwantara, Agus; Lambert, Smilja; Rodriguez-Carres, Marianela; Cubeta, Marc A

    2012-01-01

    Vascular Streak Dieback (VSD) disease of cacao (Theobroma cacao) in Southeast Asia and Melanesia is caused by a basidiomycete (Ceratobasidiales) fungus Oncobasidium theobromae (syn. =Thanatephorus theobromae). The most characteristic symptoms of the disease are green-spotted leaf chlorosis or, commonly since about 2004, necrotic blotches, followed by senescence of leaves beginning on the second or third flush behind the shoot apex, and blackening of infected xylem in the vascular traces at the leaf scars resulting from the abscission of infected leaves. Eventually the shoot apex is killed and infected branches die. In susceptible cacao the fungus may grow through the xylem down into the main stem and kill a mature cacao tree. Infections in the stem of young plants prior to the formation of the first 3-4 lateral branches usually kill the plant. Basidiospores released from corticioid basidiomata developed on leaf scars or along cracks in the main vein of infected leaves infect young leaves. The pathogen commonly infects cacao but there are rare reports from avocado. As both crops are introduced to the region, the pathogen is suspected to occur asymptomatically in native vegetation. The pathogen is readily isolated but cultures cannot be maintained. In this study, DNA was extracted from pure cultures of O. theobromae obtained from infected cacao plants sampled from Indonesia. The internal transcribed spacer region (ITS), consisting of ITS1, 5.8S ribosomal RNA and ITS2, and a portion of nuclear large subunit (LSU) were sequenced. Phylogenetic analysis of ITS sequences placed O. theobromae sister to Ceratobasidium anastomosis groups AG-A, AG-Bo, and AG-K with high posterior probability. Therefore the new combination Ceratobasidium theobromae is proposed. A PCR-based protocol was developed to detect and identify C. theobromae in plant tissue of cacao enabling early detection of the pathogen in plants. A second species of Ceratobasidium, Ceratobasidium ramicola

  6. Label-Free 3D Ag Nanoflower-Based Electrochemical Immunosensor for the Detection of Escherichia coli O157:H7 Pathogens

    Science.gov (United States)

    Huang, He; Liu, Minghuan; Wang, Xiangsheng; Zhang, Wenjie; Yang, Da-Peng; Cui, Lianhua; Wang, Xiansong

    2016-11-01

    It is highly desirable to develop a rapid and simple method to detect pathogens. Combining nanomaterials with electrochemical techniques is an efficient way for pathogen detection. Herein, a novel 3D Ag nanoflower was prepared via a biomineralization method by using bovine serum albumin (BSA) as a template. It was adopted as a sensing interface to construct an electrochemical bacteria immunosensor for the rapid detection of foodborne pathogens Escherichia coli ( E. coli) O157:H7. Bacterial antibody was immobilized onto the surface of Ag nanoflowers through covalent conjugation. Electrochemical impedance spectroscopy (EIS) was used to detect and validate the resistance changes, where [Fe(CN)6]3-/4- acted as the redox probe. A linear relation between R et and E. coli concentration was obtained in the E. coli concentration range of 3.0 × 102-3.0 × 108 cfu mL-1. The as-prepared biosensor gave rise to an obvious response to E. coli but had no distinct response to Cronobacter sakazakii, methicillin-resistant Staphylococcus aureus (MRSA), Staphylococcus albus, Lactobacillus easei, and Shigella flexneri, revealing a high selectivity for the detection of the pathogens down to 100 cfu mL-1 in a short time. We believe that this BSA-conjugated 3D Ag nanoflowers could be used as a powerful interface material with good conductivity and biocompatibility for improving pathogen detection and treatment in the field of medicine, environment, and food safety.

  7. Insect E-probe Diagnostic Nucleic acid Analysis (EDNA): the application of a novel bioinformatic tool to detection of vectors and pathogens in individual insect and simulated insect trap metagenomes

    Science.gov (United States)

    Plant pathogen detection takes many forms. In simple cases, researchers are attempting to detect a known pathogen from a known host utilizing targeted nucleic acid or antigenic assays. However, in more complex scenarios researchers may not know the identity of a pathogen, or they may need to screen ...

  8. Detection and typing of highly pathogenic porcine reproductive and respiratory syndrome virus by multiplex real-time rt-PCR.

    Directory of Open Access Journals (Sweden)

    Kerstin Wernike

    Full Text Available Porcine reproductive and respiratory syndrome (PRRS causes economic losses in the pig industry worldwide, and PRRS viruses (PRRSV are classified into the two distinct genotypes "North American (NA, type 2" and "European (EU, type 1". In 2006, a highly pathogenic NA strain of PRRSV (HP-PRRSV, characterized by high fever as well as high morbidity and mortality, emerged in swine farms in China. Therefore, a real-time reverse transcription polymerase chain reaction (RT-qPCR assay specific for HP-PRRSV was developed and combined with type 1- and type 2-specific RT-qPCR systems. Furthermore, an internal control, based on a heterologous RNA, was successfully introduced. This final multiplex PRRSV RT-qPCR, detecting and typing PRRSV, had an analytical sensitivity of less than 200 copies per µl for the type 1-assay and 20 copies per µl for the type 2- and HP assays and a high diagnostic sensitivity. A panel of reference strains and field isolates was reliably detected and samples from an animal trial with a Chinese HP-PRRS strain were used for test validation. The new multiplex PRRSV RT-qPCR system allows for the first time the highly sensitive detection and rapid differentiation of PRRSV of both genotypes as well as the direct detection of HP-PRRSV.

  9. DNA Sequence Signatures for Rapid Detection of Six Target Bacterial Pathogens Using PCR Assays

    Directory of Open Access Journals (Sweden)

    Kenjiro Nagamine

    2015-01-01

    Full Text Available Using Streptococcus pyogenes as a model, we previously established a stepwise computational workflow to effectively identify species-specific DNA signatures that could be used as PCR primer sets to detect target bacteria with high specificity and sensitivity. In this study, we extended the workflow for the rapid development of PCR assays targeting Enterococcus faecalis, Enterococcus faecium, Clostridium perfringens, Clostridium difficile, Clostridium tetani , and Staphylococcus aureus , which are of safety concern for human tissue intended for transplantation. Twenty-one primer sets that had sensitivity of detecting 5–50 fg DNA from target bacteria with high specificity were selected. These selected primer sets can be used in a PCR array for detecting target bacteria with high sensitivity and specificity. The workflow could be widely applicable for the rapid development of PCR-based assays for a wide range of target bacteria, including those of biothreat agents.

  10. Multitarget Quantitative PCR Improves Detection and Predicts Cultivability of the Pathogen Burkholderia pseudomallei

    OpenAIRE

    G?hler, Andre; Trung, Trinh Thanh; Hopf, Verena; Kohler, Christian; Hartleib, J?rg; Wuthiekanun, Vanaporn; Peacock, Sharon J.; Limmathurotsakul, Direk; Tuanyok, Apichai; Steinmetz, Ivo

    2017-01-01

    ABSTRACT Burkholderia pseudomallei is present in the environment in many parts of the world and causes the often-fatal disease melioidosis. The sensitive detection and quantification of B. pseudomallei in the environment are a prerequisite for assessing the risk of infection. We recently reported the direct detection of B. pseudomallei in soil samples using a quantitative PCR (qPCR) targeting a single type three secretion system 1 (TTSS1) gene. Here, we extend the qPCR-based analysis of B. ps...

  11. Molecular detection of airborne Emergomyces africanus, a thermally dimorphic fungal pathogen, in Cape Town, South Africa.

    Directory of Open Access Journals (Sweden)

    Ilan S Schwartz

    2018-01-01

    Full Text Available Emergomyces africanus is a thermally dimorphic fungus that causes a systemic mycosis in immunocompromised persons in South Africa. Infection is presumed to follow inhalation of airborne propagules. We developed a quantitative PCR protocol able to detect as few as 5 Es. africanus propagules per day. Samples were collected in Cape Town, South Africa over 50 weeks by a Burkard spore trap with an alternate orifice. We detected Es. africanus in air samples from 34 days (10% distributed over 11 weeks. These results suggest environmental exposure to airborne Es. africanus propagules occurs more commonly in endemic areas than previously appreciated.

  12. Molecular detection of airborne Emergomyces africanus, a thermally dimorphic fungal pathogen, in Cape Town, South Africa.

    Science.gov (United States)

    Schwartz, Ilan S; McLoud, Josh D; Berman, Dilys; Botha, Alfred; Lerm, Barbra; Colebunders, Robert; Levetin, Estelle; Kenyon, Chris

    2018-01-01

    Emergomyces africanus is a thermally dimorphic fungus that causes a systemic mycosis in immunocompromised persons in South Africa. Infection is presumed to follow inhalation of airborne propagules. We developed a quantitative PCR protocol able to detect as few as 5 Es. africanus propagules per day. Samples were collected in Cape Town, South Africa over 50 weeks by a Burkard spore trap with an alternate orifice. We detected Es. africanus in air samples from 34 days (10%) distributed over 11 weeks. These results suggest environmental exposure to airborne Es. africanus propagules occurs more commonly in endemic areas than previously appreciated.

  13. Experiment on Synchronous Timing Signal Detection from ISDB-T Terrestrial Digital TV Signal with Application to Autonomous Distributed ITS-IVC Network

    Science.gov (United States)

    Karasawa, Yoshio; Kumagai, Taichi; Takemoto, Atsushi; Fujii, Takeo; Ito, Kenji; Suzuki, Noriyoshi

    A novel timing synchronizing scheme is proposed for use in inter-vehicle communication (IVC) with an autonomous distributed intelligent transport system (ITS). The scheme determines the timing of packet signal transmission in the IVC network and employs the guard interval (GI) timing in the orthogonal frequency divisional multiplexing (OFDM) signal currently used for terrestrial broadcasts in the Japanese digital television system (ISDB-T). This signal is used because it is expected that the automotive market will demand the capability for cars to receive terrestrial digital TV broadcasts in the near future. The use of broadcasts by automobiles presupposes that the on-board receivers are capable of accurately detecting the GI timing data in an extremely low carrier-to-noise ratio (CNR) condition regardless of a severe multipath environment which will introduce broad scatter in signal arrival times. Therefore, we analyzed actual broadcast signals received in a moving vehicle in a field experiment and showed that the GI timing signal is detected with the desired accuracy even in the case of extremely low-CNR environments. Some considerations were also given about how to use these findings.

  14. Direct metagenomic detection of viral pathogens in nasal and fecal specimens using an unbiased high-throughput sequencing approach.

    Directory of Open Access Journals (Sweden)

    Shota Nakamura

    Full Text Available With the severe acute respiratory syndrome epidemic of 2003 and renewed attention on avian influenza viral pandemics, new surveillance systems are needed for the earlier detection of emerging infectious diseases. We applied a "next-generation" parallel sequencing platform for viral detection in nasopharyngeal and fecal samples collected during seasonal influenza virus (Flu infections and norovirus outbreaks from 2005 to 2007 in Osaka, Japan. Random RT-PCR was performed to amplify RNA extracted from 0.1-0.25 ml of nasopharyngeal aspirates (N = 3 and fecal specimens (N = 5, and more than 10 microg of cDNA was synthesized. Unbiased high-throughput sequencing of these 8 samples yielded 15,298-32,335 (average 24,738 reads in a single 7.5 h run. In nasopharyngeal samples, although whole genome analysis was not available because the majority (>90% of reads were host genome-derived, 20-460 Flu-reads were detected, which was sufficient for subtype identification. In fecal samples, bacteria and host cells were removed by centrifugation, resulting in gain of 484-15,260 reads of norovirus sequence (78-98% of the whole genome was covered, except for one specimen that was under-detectable by RT-PCR. These results suggest that our unbiased high-throughput sequencing approach is useful for directly detecting pathogenic viruses without advance genetic information. Although its cost and technological availability make it unlikely that this system will very soon be the diagnostic standard worldwide, this system could be useful for the earlier discovery of novel emerging viruses and bioterrorism, which are difficult to detect with conventional procedures.

  15. Detection of Pathogenic Protozoa in the Diagnostic Laboratory: Result Reproducibility, Specimen Pooling, and Competency Assessment▿

    Science.gov (United States)

    Libman, M. D.; Gyorkos, T. W.; Kokoskin, E.; MacLean, J. D.

    2008-01-01

    Stool microscopy as performed in clinical parasitology laboratories is a complex procedure with subjective interpretation. Quality assurance (QA) programs often emphasize proficiency testing as an assessment tool. We describe a result reproducibility assessment tool, which can form part of a broader QA program, and which is based on the blinded resubmission of selected clinical samples, using concordance between the reports of the initial and resubmitted specimen as an indicator. Specimens preserved in sodium acetate-acetic acid-formalin can be stored for several months for use in such a program. The presence of multiple protozoa in one specimen does not affect concordance. Some dilution of specimens occurs in this process, and this may explain poor concordance when specimens with low protozoal concentrations are resubmitted. Evaluation of this tool in a large parasitology laboratory revealed concordance rates for pathogenic protozoa (Entamoeba histolytica/Entamoeba dispar, Giardia lamblia, and Dientamoeba fragilis) of about 80%, which may be considered for use as a benchmark value. We also used this tool to demonstrate that when pairs of specimens from one patient are pooled to create a single specimen, concordance between the results of the individual and pooled specimens is high. PMID:18448690

  16. Multiplex surface plasmon resonance imaging platform for label-free detection of foodborne pathogens

    Science.gov (United States)

    Salmonellae are among the leading causes of foodborne outbreaks in the United States, and more rapid and efficient detection methods are needed. Surface plasmon resonance imaging (SPRi) is an emerging optical technique, which allows for rapid and label-free screening of multiple targets simultaneous...

  17. DNA-based detection of the fungal pathogen Geomyces destructans in soils from bat hibernacula

    Science.gov (United States)

    Daniel L. Lindner; Andrea Gargas; Jeffrey M. Lorch; Mark T. Banik; Jessie A. Glaeser; Thomas H. Kunz; David S. Blehert

    2011-01-01

    White-nose syndrome (WNS) is an emerging disease causing unprecedented morbidity and mortality among bats in eastern North America. The disease is characterized by cutaneous infection of hibernating bats by the psychrophilic fungus Geomyces destructans. Detection of G. destructans in environments occupied by bats will be critical...

  18. Development of electrochemical biosensor for detection of pathogenic microorganism in Asian dust events.

    Science.gov (United States)

    Yoo, Min-Sang; Shin, Minguk; Kim, Younghun; Jang, Min; Choi, Yoon-E; Park, Si Jae; Choi, Jonghoon; Lee, Jinyoung; Park, Chulhwan

    2017-05-01

    We developed a single-walled carbon nanotubes (SWCNTs)-based electrochemical biosensor for the detection of Bacillus subtilis, one of the microorganisms observed in Asian dust events, which causes respiratory diseases such as asthma and pneumonia. SWCNTs plays the role of a transducer in biological antigen/antibody reaction for the electrical signal while 1-pyrenebutanoic acid succinimidyl ester (1-PBSE) and ant-B. subtilis were performed as a chemical linker and an acceptor, respectively, for the adhesion of target microorganism in the developed biosensor. The detection range (10 2 -10 10  CFU/mL) and the detection limit (10 2  CFU/mL) of the developed biosensor were identified while the response time was 10 min. The amount of target B. subtilis was the highest in the specificity test of the developed biosensor, compared with the other tested microorganisms (Staphylococcus aureus, Flavobacterium psychrolimnae, and Aquabacterium commune). In addition, target B. subtilis detected by the developed biosensor was observed by scanning electron microscope (SEM) analysis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Epitope specificity determines pathogenicity and detectability in ANCA-associated vasculitis

    Science.gov (United States)

    ABSTRACT BACKGROUND Anti-neutrophil cytoplasmic autoantibodies (ANCA) specific for myeloperoxidase (MPO) or proteinase 3 (PR3) are detectable in >90% of patients with ANCA-associated vasculitis (AAV). ANCA titers do not correlate well with disease activity. In vivo and in vi...

  20. Rapid and potentially portable detection and quantification technologies for foodborne pathogens

    Science.gov (United States)

    Introduction Traditional microbial culture methods are able to detect and identify a single specific bacterium, but may require days or weeks and typically do not produce quantitative data. The quest for faster, quantitative results has spurred development of “rapid methods” which usually employ bio...

  1. Nucleic Acid Lateral Flow Immunoassay for the Detection of Pathogenic Bacteria from Food

    NARCIS (Netherlands)

    Blazkova, M.; Koets, M.; Wichers, J.H.; Amerongen, van A.; Fukal, L.; Rauch, P.

    2009-01-01

    Nucleic acid lateral flow immunoassay (NALFIA) is a method combining molecular biological principle of detection with immunochemical principle of visualisation. Following isolation of DNA from the sample, a duplex PCR with two primer sets, of which one was labelled with biotin and the other with

  2. Pathogenicity and molecular detection of Uruguayan isolates of Greeneria uvicola and Cadophora luteo-olivacea associated with grapevine trunk diseases

    Directory of Open Access Journals (Sweden)

    Fernando NAVARRETE

    2011-12-01

    Full Text Available Normal 0 21 MicrosoftInternetExplorer4 Species from different fungal genera have been indicated as responsible for the development of trunk diseases of grapevines. Greeneria uvicola is responsible for the bitter rot of Vitis vinifera grape bunchesnear harvest, and can also attack other Vitis species. In Uruguay, G. uvicola was isolated from dead arm affected grapevines and as an endophyte from healthy canes. Cadophora luteo-olivacea is a phialophora-likeascomycete with a wide distribution that was isolated from asymptomatic wood tissues in Vitis and Petridisease-affected nursery plants in Uruguay. Pathogenicity of isolates of both species was evaluated on Vitis vinifera cv. Tannat and Cabernet Sauvignon, and rootstocks SO4 and 3309C. Specific primers were developed for the ITS rDNA region for both species. Number of plants showing discoloration, length of discoloration, number of re-isolations and amplifications confirmed the pathogenicity of G. uvicola isolates. Pathogenicityof the isolate of C. luteo-olivacea obtained from symptomatic tissues is discussed. Specific primers can be usedto detect the presence of these fungi in asymptomatic tissues.

  3. Detection of selected antibiotic resistance genes using multiplex PCR assay in mastitis pathogens in the Czech Republic

    Directory of Open Access Journals (Sweden)

    Vladimir Pyatov

    2017-01-01

    Full Text Available The aim of this research was to develop multiplex polymerase chain reaction assays for the detection of aminoglycoside (strA, strB, sulphonamide (sulI, sulII, tetracycline (tetA, tetB, tetK, tetM, tetO, macrolide and lincosamide (msrA, ermA, ermB, ermC, mefA/E genes of resistance in mastitis pathogens (Escherichia coli, Staphylococcus aureus, Streptococcus uberis, Streptococcus agalactiae and Streptococcus dysgalactiae. Applying the established assays, we investigated the distribution of antibiotic resistance genes in the above mentioned species isolated from milk samples in the Czech Republic. Each assay consisted of seven pairs of primers. Six of them amplified fragments of antibiotic resistance genes and one pair a fragment of a species specific gene. Polymerase chain reaction conditions were optimized to amplify seven gene fragments simultaneously in one reaction. In total, 249 isolates were used, among which 111 were positive for E. coli, 52 for S. aureus and 86 for Streptococcus spp. The majority (60.2% of bacteria carried at least one antibiotic resistance gene and 44.6% were multidrug-resistant. The designed multiplex polymerase chain reaction assays may be applied as diagnostic method to replace or complement standard techniques of antibiotic susceptibility testing in the mentioned pathogens.

  4. Detection of pathogenic Campylobacter, E. coli O157:H7 and Salmonella spp. in wastewater by PCR assay.

    Science.gov (United States)

    Bonetta, Si; Pignata, C; Lorenzi, E; De Ceglia, M; Meucci, L; Bonetta, Sa; Gilli, G; Carraro, E

    2016-08-01

    The aim of this study was the evaluation of the occurrence of pathogenic Campylobacter, Escherichia coli O157:H7, E. coli virulence genes and Salmonella spp. in different wastewater treatment plants (WWTPs) using a method based on an enrichment step and PCR. This method was sensitive enough to detect low levels (∼2 CFU100 ml(-1) of raw sewage) of all the investigated pathogens. In the WWTP samples, E. coli O157:H7 DNA and the eae gene were never found, but 33 % of influents and effluents exhibited amplicons corresponding to Shiga-like toxin I. Twenty-five percent of the influent and 8 % of the effluent exhibited the presence of Shiga-like toxin II. Campylobacter jejuni and C. coli DNA were identified in 50 and 25 % of the influents and in 8 and 25 % of the effluents, respectively. Salmonella spp. DNA was present in all the samples. Considering the results obtained, the method tested here offers a reliable and expeditious tool for evaluating the efficiency of the effluent treatment in order to mitigate contamination risk. Influent contamination by Salmonella spp. and Campylobacter spp. provides indirect information about their circulation; moreover, their presence in effluents underlines the role of WWTPs in the contamination of the receiving surface waters, which affects public health directly or indirectly.

  5. Rapid detection and identification of pathogenic mycobacteria by combining radiometric and nucleic acid probe methods

    International Nuclear Information System (INIS)

    Ellner, P.D.; Kiehn, T.E.; Cammarata, R.; Hosmer, M.

    1988-01-01

    The combination of radiometric methodology (BACTEC 12B) and probe technology for recovery and identification of mycobacteria was studied in two large hospital laboratories. The sediment from vials with positive growth indices was tested with DNA probes specific for Mycobacterium tuberculosis, Mycobacterium avium, and Mycobacterium intracellulare. The sensitivity of the radiometric method and the specificity of the probes resulted in a marked reduction in the time to the final report. Biochemical testing could be eliminated on isolates giving a positive reaction with one of the probes. Some 176 isolates of M. tuberculosis, 110 of M. avium, and 5 of M. intracellulare were recovered. Two-thirds of these isolates were detected and identified within 2 weeks of inoculation and the remainder was detected by 4 weeks, a reduction of 5 to 7 weeks to the final report

  6. Ultra-Fast Low Concentration Detection of Candida Pathogens Utilizing High Resolution Micropore Chips

    Directory of Open Access Journals (Sweden)

    2009-03-01

    Full Text Available Although Candida species are the fourth most common cause of nosocomial blood stream infections in the United States, early diagnostic tools for invasive candidemia are lacking. Due to an increasing rate of candidemia, a new screening system is needed to detect the Candida species in a timely manner. Here we describe a novel method of detection using a solid-state micro-scale pore similar to the operational principles of a Coulter counter. With a steady electrolyte current flowing through the pore, measurements are taken of changes in the current corresponding to the shape of individual yeasts as they translocate or travel through the pore. The direct ultra-fast low concentration electrical addressing of C. albicans has established criteria for distinguishing individual yeast based on their structural properties, which may reduce the currently used methods’ complexity for both identification and quantification capabilities in mixed blood samples

  7. Real-time PCR Detection of Food-borne Pathogenic Salmonella spp

    DEFF Research Database (Denmark)

    Malorny, B.; Mäde, D.; Löfström, Charlotta

    2013-01-01

    -limiting gastrointestinal disease in a wide range of mammalian hosts. Within the last decade, numerous real-time PCR assays have been developed for rapid detection of salmonellae in potentially contaminated food or feed. Some of them were extensively validated and are useful for diagnostic laboratories. Furthermore......, effective sample preparation prior to the analytical real-time PCR assay avoids inhibitory substances disturbing the PCR and contributes to a high sensitivity. We discuss appropriate sample preparation methods including enrichment procedures for various food items and analytical real-time PCR assays...... for the detection of Salmonella and give a state-of-the-art summary what targets are used and how valid the assays are to apply as diagnostic tool. Furthermore, recommendations for selection of an appropriate real-time PCR method are presented....

  8. A disposable bacterial lysis cartridge (BLC) suitable for an in situ water-borne pathogen detection system.

    Science.gov (United States)

    Lee, Eun-Hee; Lim, Hyun Jeong; Son, Ahjeong; Chua, Beelee

    2015-11-21

    We constructed a disposable bacterial lysis cartridge (BLC) suitable for an in situ pathogen detection system. It had an in-built micro corona discharge based ozone generator that provided ozone for cell lysis. Using a custom sample handling platform, its performance was evaluated with a Gram-positive bacterium of Bacillus subtilis. It was capable of achieving a similar degree of lysis as a commercial ultrasonic dismembrator with a P-1 microprobe in 10 min at an air pump flow rate of 29.4 ml min(-1) and an ozone generator operating voltage of 1600 V. The lysing duration could be significantly reduced to 5 min by increasing the air pump flow rate and the ozone generator operating voltage as well as by the addition of sodium dodecyl sulfate (SDS).

  9. A Two-Tube Multiplex Reverse Transcription PCR Assay for Simultaneous Detection of Viral and Bacterial Pathogens of Infectious Diarrhea

    Directory of Open Access Journals (Sweden)

    Ji Wang

    2014-01-01

    Full Text Available Diarrhea caused by viral and bacterial infections is a major health problem in developing countries. The purpose of this study is to develop a two-tube multiplex PCR assay using automatic electrophoresis for simultaneous detection of 13 diarrhea-causative viruses or bacteria, with an intended application in provincial Centers for Diseases Control and Prevention, China. The assay was designed to detect rotavirus A, norovirus genogroups GI and GII, human astrovirus, enteric adenoviruses, and human bocavirus (tube 1, and Salmonella, Vibrio parahaemolyticus, diarrheagenic Escherichia coli, Campylobacter jejuni, Shigella, Yersinia, and Vibrio cholera (tube 2. The analytical specificity was examined with positive controls for each pathogen. The analytical sensitivity was evaluated by performing the assay on serial tenfold dilutions of in vitro transcribed RNA, recombinant plasmids, or bacterial culture. A total of 122 stool samples were tested by this two-tube assay and the results were compared with those obtained from reference methods. The two-tube assay achieved a sensitivity of 20–200 copies for a single virus and 102-103 CFU/mL for bacteria. The clinical performance demonstrated that the two-tube assay had comparable sensitivity and specificity to those of reference methods. In conclusion, the two-tube assay is a rapid, cost-effective, sensitive, specific, and high throughput method for the simultaneous detection of enteric bacteria and virus.

  10. Association Between Pathogens Detected Using Quantitative Polymerase Chain Reaction With Airway Inflammation in COPD at Stable State and Exacerbations

    Science.gov (United States)

    Barker, Bethan L.; Haldar, Koirobi; Patel, Hemu; Pavord, Ian D.; Barer, Michael R.; Brightling, Christopher E.

    2015-01-01

    BACKGROUND: Relationships between airway inflammation and respiratory potentially pathogenic microorganisms (PPMs) quantified using quantitative polymerase chain reaction (qPCR) in subjects with COPD are unclear. Our aim was to evaluate mediators of airway inflammation and their association with PPMs in subjects with COPD at stable state and during exacerbations. METHODS: Sputum from 120 stable subjects with COPD was analyzed for bacteriology (colony-forming units; total 16S; and qPCR targeting Haemophilus influenzae, Moraxella catarrhalis, and Streptococcus pneumoniae), differential cell counts, and inflammatory mediators using the Meso-Scale Discovery Platform. Subjects were classified as colonized if any PPM was identified above the threshold of detection by qPCR. Symptoms were quantified using the visual analog scale. RESULTS: At stable state, 60% of subjects were qPCR positive for H influenzae, 48% for M catarrhalis, and 28% for S pneumoniae. Elevated sputum concentrations of IL-1β, IL-10, and tumor necrosis factor (TNF)-α were detected in samples qPCR positive for either H influenzae or M catarrhalis. Bacterial loads of H influenzae positively correlated with IL-1β, IL-8, IL-10, TNF-α, and symptoms; and M catarrhalis correlated with IL-10 and TNF-α. H influenzae qPCR bacterial load was an independent predictor of sputum TNF-α and IL-1β. In 55 subjects with paired exacerbation data, qPCR bacterial load fold change at exacerbation in M catarrhalis but not H influenzae correlated to changes in sputum TNF-α and IL-1β concentrations. CONCLUSIONS: At stable state, H influenzae is associated with increased airway inflammation in COPD. The relationship between bacterial load changes of specific pathogens and airway inflammation at exacerbation and recovery warrants further investigation. PMID:25103335

  11. Quantitative detection and biological propagation of scrapie seeding activity in vitro facilitate use of prions as model pathogens for disinfection.

    Directory of Open Access Journals (Sweden)

    Sandra Pritzkow

    Full Text Available Prions are pathogens with an unusually high tolerance to inactivation and constitute a complex challenge to the re-processing of surgical instruments. On the other hand, however, they provide an informative paradigm which has been exploited successfully for the development of novel broad-range disinfectants simultaneously active also against bacteria, viruses and fungi. Here we report on the development of a methodological platform that further facilitates the use of scrapie prions as model pathogens for disinfection. We used specifically adapted serial protein misfolding cyclic amplification (PMCA for the quantitative detection, on steel wires providing model carriers for decontamination, of 263K scrapie seeding activity converting normal protease-sensitive into abnormal protease-resistant prion protein. Reference steel wires carrying defined amounts of scrapie infectivity were used for assay calibration, while scrapie-contaminated test steel wires were subjected to fifteen different procedures for disinfection that yielded scrapie titre reductions of ≤10(1- to ≥10(5.5-fold. As confirmed by titration in hamsters the residual scrapie infectivity on test wires could be reliably deduced for all examined disinfection procedures, from our quantitative seeding activity assay. Furthermore, we found that scrapie seeding activity present in 263K hamster brain homogenate or multiplied by PMCA of scrapie-contaminated steel wires both triggered accumulation of protease-resistant prion protein and was further propagated in a novel cell assay for 263K scrapie prions, i.e., cerebral glial cell cultures from hamsters. The findings from our PMCA- and glial cell culture assays revealed scrapie seeding activity as a biochemically and biologically replicative principle in vitro, with the former being quantitatively linked to prion infectivity detected on steel wires in vivo. When combined, our in vitro assays provide an alternative to titrations of biological

  12. Detection of pathogenic Yersinia enterocolitica in slaughtered pigs by cultural methods and real-time polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Rina Mazzette

    2015-05-01

    Full Text Available Healthy pigs carrying pathogenic to human Yersinia enterocolitica strains are the main source of entry into slaughterhouse, where cross-contamination of carcasses can happen. The aim of this work was to determine Y. enterocolitica prevalence in slaughtered pigs, investigating the presence of carriers in relation to carcass contamination. A total of 132 pig samples (tonsils, mesenteric lymph nodes, colon content, carcass surface were collected from 4 Sardinian slaughterhouses. All the samples were examined by the ISO 10273:2003 method, and the prevalence was also determined by direct plating on CIN Agar. Moreover, to detect the ail positive Y. enterocolitica strains in enrichment broths and isolates a real-time polymerase chain reaction (PCR was applied. Y. enterocolitica prevalence was 19% with direct plating and 12% with enrichment methods. Carcass surfaces and tonsils prevalence was 5.30% by direct plating, and 5.3% and 2.2%, respectively, by enrichment method. Tonsil samples showed an average contamination level of 3.2×103 CFU/g, while the mean value on carcass was 8.7×102 CFU/g. An overall prevalence of 9.8% of ail positive Y. enterocolitica broths was detected by RT-PCR, that found a higher prevalence in tonsils (7.5% with respect to cultural methods, confirming the greater sensitivity of this technique when applied for tonsils and faeces samples. The results show a relatively low pathogenic Y. enterocolitica prevalence in pigs slaughtered in Sardinia. Good hygiene measures should be applied at slaughterhouse in order to prevent the entry of carriers and control carcass contamination.

  13. Optimization of Multiple Pathogen Detection Using the TaqMan Array Card: Application for a Population-Based Study of Neonatal Infection.

    Directory of Open Access Journals (Sweden)

    Maureen H Diaz

    Full Text Available Identification of etiology remains a significant challenge in the diagnosis of infectious diseases, particularly in resource-poor settings. Viral, bacterial, and fungal pathogens, as well as parasites, play a role for many syndromes, and optimizing a single diagnostic system to detect a range of pathogens is challenging. The TaqMan Array Card (TAC is a multiple-pathogen detection method that has previously been identified as a valuable technique for determining etiology of infections and holds promise for expanded use in clinical microbiology laboratories and surveillance studies. We selected TAC for use in the Aetiology of Neonatal Infection in South Asia (ANISA study for identifying etiologies of severe disease in neonates in Bangladesh, India, and Pakistan. Here we report optimization of TAC to improve pathogen detection and overcome technical challenges associated with use of this technology in a large-scale surveillance study. Specifically, we increased the number of assay replicates, implemented a more robust RT-qPCR enzyme formulation, and adopted a more efficient method for extraction of total nucleic acid from blood specimens. We also report the development and analytical validation of ten new assays for use in the ANISA study. Based on these data, we revised the study-specific TACs for detection of 22 pathogens in NP/OP swabs and 12 pathogens in blood specimens as well as two control reactions (internal positive control and human nucleic acid control for each specimen type. The cumulative improvements realized through these optimization studies will benefit ANISA and perhaps other studies utilizing multiple-pathogen detection approaches. These lessons may also contribute to the expansion of TAC technology to the clinical setting.

  14. Detection and prevalence of pathogenic Yersinia enterocolitica in refrigerated and frozen dairy products by duplex PCR and dot hybridization targeting the virF and ail genes.

    Science.gov (United States)

    Ye, Y W; Ling, N; Han, Y J; Wu, Q P

    2014-11-01

    Pathogenic Yersinia enterocolitica is involved in yersiniosis through expression of chromosome-borne or plasmid-borne virulence factors. Yersinia enterocolitica is a cold-tolerant pathogen frequently isolated from refrigerated or frozen foods. However, little attention has been focused on the prevalence of pathogenic Y. enterocolitica in refrigerated or frozen dairy samples in China. In this study, we developed a new duplex PCR targeting the plasmid-borne virF gene and chromosome-borne ail gene for detection of pathogenic Y. enterocolitica isolates. We established a detection limit for the duplex PCR of 6.5 × 10(2)cfu/mL in artificially contaminated dairy samples. In addition, the duplex PCR could detect directly 4.5 to 5.7 cfu of Y. enterocolitica in 5 mL of brain heart infusion broth after 6 h of enrichment at 28 °C. A newly developed dot hybridization assay further confirmed specificity of the duplex PCR for detection of virulent Y. enterocolitica. Furthermore, 13 Y. enterocolitica and 5 pathogenic strains, from 88 commercial frozen or refrigerated dairy products, were detected successfully by the China National Standard method (GB/T4789.8-2008) and the duplex PCR, respectively. Finally, biotypes and serotypes of pathogenic Y. enterocolitica strains were further characterized. The duplex PCR developed here is reliable for large-scale screening, routine monitoring, and risk assessment of pathogenic Y. enterocolitica in refrigerated or frozen dairy products. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  15. Synthesis and electrochemical detection of a thiazolyl-indole natural product isolated from the nosocomial pathogen Pseudomonas aeruginosa.

    Science.gov (United States)

    Buzid, Alyah; Muimhneacháin, Eoin Ó; Reen, F Jerry; Hayes, Phyllis E; Pardo, Leticia M; Shang, Fengjun; O'Gara, Fergal; Sperry, Jonathan; Luong, John H T; Glennon, Jeremy D; McGlacken, Gerard P

    2016-09-01

    Pseudomonas aeruginosa is a Gram-negative opportunistic pathogen, capable of surviving in a broad range of natural environments and quickly acquiring resistance. It is associated with hospital-acquired infections, particularly in patients with compromised immunity, and is the primary cause of morbidity and mortality in cystic fibrosis (CF) patients. P. aeruginosa is also of nosocomial importance on dairy farms and veterinary hospitals, where it is a key morbidity factor in bovine mastitis. P. aeruginosa uses a cell-cell communication system consisting of signalling molecules to coordinate bacterial secondary metabolites, biofilm formation, and virulence. Simple and sensitive methods for the detection of biomolecules as indicators of P. aeruginosa infection would be of great clinical importance. Here, we report the synthesis of the P. aeruginosa natural product, barakacin, which was recently isolated from the bovine ruminal strain ZIO. A simple and sensitive electrochemical method was used for barakacin detection using a boron-doped diamond (BDD) and glassy carbon (GC) electrodes, based on cyclic voltammetry (CV) and differential pulse voltammetry (DPV). The influence of electrolyte pH on the peak potential and peak currents was also investigated. At pH 2.0, the peak current was linearly dependent on barakacin concentration (in the range used, 1-10 μM), with correlation coefficients greater than 0.98 on both electrodes. The detection limit (S/N = 3) on the BDD electrode was 100-fold lower than that obtained on the GC electrode. The optimized method using the BDD electrode was extended to bovine (cow feces) and human (sputum of a CF patient) samples. Spiked barakacin was easily detected in these matrices at a limit of 0.5 and 0.05 μM, respectively. Graphical abstract Electrochemical detection of barakacin.

  16. Comparison of the EntericBio multiplex PCR system with routine culture for detection of bacterial enteric pathogens.

    LENUS (Irish Health Repository)

    O'Leary, James

    2009-11-01

    The EntericBio system uses a multiplex PCR assay for the simultaneous detection of Campylobacter spp., Salmonella enterica, Shigella spp., and Escherichia coli O157 from feces. It combines overnight broth enrichment with PCR amplification and detection by hybridization. An evaluation of this system was conducted by comparing the results obtained with the system with those obtained by routine culture, supplemented with alternative PCR detection methods. In a study of 773 samples, routine culture and the EntericBio system yielded 94.6 and 92.4% negative results, respectively. Forty-two samples had positive results by culture, and all of these were positive with the EntericBio system. This system detected an additional 17 positive samples (Campylobacter spp., n = 12; Shigella spp., n = 1; E. coli O157, n = 4), but the results for 5 samples (Campylobacter spp., n = 2; Shigella spp., n = 1; E. coli O157, n = 2) could not be confirmed. The target for Shigella spp. detected by the EntericBio system is the ipaH gene, and the molecular indication of the presence of Shigella spp. was investigated by sequence analysis, which confirmed that the ipaH gene was present in a Klebsiella pneumoniae isolate from the patient. The sensitivity, specificity, positive predictive value, and negative predictive value were 100%, 99.3%, 91.5%, and 100%, respectively. Turnaround times were significantly reduced with the EntericBio system, and a result was available between 24 and 32 h after receipt of the sample in the laboratory. In addition, the amount of laboratory waste was significantly reduced by use of this system. In summary, the EntericBio system proved convenient to use, more sensitive than the conventional culture used in this study, and highly specific; and it generated results significantly faster than routine culture for the pathogens tested.

  17. Detection of food spoilage and pathogenic bacteria based on ligation detection reaction coupled to flow-through hybridization on membranes.

    Science.gov (United States)

    Böhme, K; Cremonesi, P; Severgnini, M; Villa, Tomás G; Fernández-No, I C; Barros-Velázquez, J; Castiglioni, B; Calo-Mata, P

    2014-01-01

    Traditional culturing methods are still commonly applied for bacterial identification in the food control sector, despite being time and labor intensive. Microarray technologies represent an interesting alternative. However, they require higher costs and technical expertise, making them still inappropriate for microbial routine analysis. The present study describes the development of an efficient method for bacterial identification based on flow-through reverse dot-blot (FT-RDB) hybridization on membranes, coupled to the high specific ligation detection reaction (LDR). First, the methodology was optimized by testing different types of ligase enzymes, labeling, and membranes. Furthermore, specific oligonucleotide probes were designed based on the 16S rRNA gene, using the bioinformatic tool Oligonucleotide Retrieving for Molecular Applications (ORMA). Four probes were selected and synthesized, being specific for Aeromonas spp., Pseudomonas spp., Shewanella spp., and Morganella morganii, respectively. For the validation of the probes, 16 reference strains from type culture collections were tested by LDR and FT-RDB hybridization using universal arrays spotted onto membranes. In conclusion, the described methodology could be applied for the rapid, accurate, and cost-effective identification of bacterial species, exhibiting special relevance in food safety and quality.

  18. Detection of Food Spoilage and Pathogenic Bacteria Based on Ligation Detection Reaction Coupled to Flow-Through Hybridization on Membranes

    Directory of Open Access Journals (Sweden)

    K. Böhme

    2014-01-01

    Full Text Available Traditional culturing methods are still commonly applied for bacterial identification in the food control sector, despite being time and labor intensive. Microarray technologies represent an interesting alternative. However, they require higher costs and technical expertise, making them still inappropriate for microbial routine analysis. The present study describes the development of an efficient method for bacterial identification based on flow-through reverse dot-blot (FT-RDB hybridization on membranes, coupled to the high specific ligation detection reaction (LDR. First, the methodology was optimized by testing different types of ligase enzymes, labeling, and membranes. Furthermore, specific oligonucleotide probes were designed based on the 16S rRNA gene, using the bioinformatic tool Oligonucleotide Retrieving for Molecular Applications (ORMA. Four probes were selected and synthesized, being specific for Aeromonas spp., Pseudomonas spp., Shewanella spp., and Morganella morganii, respectively. For the validation of the probes, 16 reference strains from type culture collections were tested by LDR and FT-RDB hybridization using universal arrays spotted onto membranes. In conclusion, the described methodology could be applied for the rapid, accurate, and cost-effective identification of bacterial species, exhibiting special relevance in food safety and quality.

  19. Detection of Food Spoilage and Pathogenic Bacteria Based on Ligation Detection Reaction Coupled to Flow-Through Hybridization on Membranes

    Science.gov (United States)

    Böhme, K.; Cremonesi, P.; Severgnini, M.; Villa, Tomás G.; Fernández-No, I. C.; Barros-Velázquez, J.; Castiglioni, B.; Calo-Mata, P.

    2014-01-01

    Traditional culturing methods are still commonly applied for bacterial identification in the food control sector, despite being time and labor intensive. Microarray technologies represent an interesting alternative. However, they require higher costs and technical expertise, making them still inappropriate for microbial routine analysis. The present study describes the development of an efficient method for bacterial identification based on flow-through reverse dot-blot (FT-RDB) hybridization on membranes, coupled to the high specific ligation detection reaction (LDR). First, the methodology was optimized by testing different types of ligase enzymes, labeling, and membranes. Furthermore, specific oligonucleotide probes were designed based on the 16S rRNA gene, using the bioinformatic tool Oligonucleotide Retrieving for Molecular Applications (ORMA). Four probes were selected and synthesized, being specific for Aeromonas spp., Pseudomonas spp., Shewanella spp., and Morganella morganii, respectively. For the validation of the probes, 16 reference strains from type culture collections were tested by LDR and FT-RDB hybridization using universal arrays spotted onto membranes. In conclusion, the described methodology could be applied for the rapid, accurate, and cost-effective identification of bacterial species, exhibiting special relevance in food safety and quality. PMID:24818128

  20. Development of a new resequencing pathogen microarray based assay for detection of broad-spectrum respiratory tract viruses in patients with community-acquired pneumonia.

    Directory of Open Access Journals (Sweden)

    Hongwei Shen

    Full Text Available A Resequencing Pathogen Microarray (RPM is a single, highly multiplexed assay for detecting and differentiating similarly related pathogens by using closely overlapping probe sets to determine a target organism's nucleotide sequence. In this study, a new RPM (RPM-IVDC1 that consisted of 224-bp detector tiles corresponding to 9 influenza A subtypes, 11 rhinoviruses, 28 enteroviruses and 38 other respiratory viruses was developed and optimized to provide individual and simultaneous detection sensitivities ranging from 15 to 750 genomic copies for 16 common respiratory pathogens. A total of 110 consecutive patients with community-acquired pneumonia (CAP admitted to 5 district general hospitals in Beijing during a 1-year period were assessed using the new assay. Among the children (under age 5 and adult patients (above age 18, respiratory syncytial virus (RSV and rhinovirus (RV were the most common etiological agents, respectively, which is consistent with reference assays. Atypical pathogens that may cause CAP-like illness, including rubella virus, measles virus, influenza type C virus, human herpesvirus (HHV were also detected. The results show the capability of RPM-IVDC1 for the accurate detection and identification of multiple virus types, which may be of significant use in epidemic surveillance and outbreak investigations of atypical pathogens.

  1. Detection of biomarkers of pathogenic Naegleria fowleri through mass spectrometry and proteomics.

    Science.gov (United States)

    Moura, Hercules; Izquierdo, Fernando; Woolfitt, Adrian R; Wagner, Glauber; Pinto, Tatiana; del Aguila, Carmen; Barr, John R

    2015-01-01

    Emerging methods based on mass spectrometry (MS) can be used in the rapid identification of microorganisms. Thus far, these practical and rapidly evolving methods have mainly been applied to characterize prokaryotes. We applied matrix-assisted laser-desorption-ionization-time-of-flight mass spectrometry MALDI-TOF MS in the analysis of whole cells of 18 N. fowleri isolates belonging to three genotypes. Fourteen originated from the cerebrospinal fluid or brain tissue of primary amoebic meningoencephalitis patients and four originated from water samples of hot springs, rivers, lakes or municipal water supplies. Whole Naegleria trophozoites grown in axenic cultures were washed and mixed with MALDI matrix. Mass spectra were acquired with a 4700 TOF-TOF instrument. MALDI-TOF MS yielded consistent patterns for all isolates examined. Using a combination of novel data processing methods for visual peak comparison, statistical analysis and proteomics database searching we were able to detect several biomarkers that can differentiate all species and isolates studied, along with common biomarkers for all N. fowleri isolates. Naegleria fowleri could be easily separated from other species within the genus Naegleria. A number of peaks detected were tentatively identified. MALDI-TOF MS fingerprinting is a rapid, reproducible, high-throughput alternative method for identifying Naegleria isolates. This method has potential for studying eukaryotic agents. © 2014 The Author(s) Journal of Eukaryotic Microbiology © 2014 International Society of Protistologists.

  2. A molecular assay for sensitive detection of pathogen-specific T-cells.

    Directory of Open Access Journals (Sweden)

    Victoria O Kasprowicz

    Full Text Available Here we describe the development and validation of a highly sensitive assay of antigen-specific IFN-γ production using real time quantitative PCR (qPCR for two reporters--monokine-induced by IFN-γ (MIG and the IFN-γ inducible protein-10 (IP10. We developed and validated the assay and applied it to the detection of CMV, HIV and Mycobacterium tuberculosis (MTB specific responses, in a cohort of HIV co-infected patients. We compared the sensitivity of this assay to that of the ex vivo RD1 (ESAT-6 and CFP-10-specific IFN-γ Elispot assay. We observed a clear quantitative correlation between the two assays (P<0.001. Our assay proved to be a sensitive assay for the detection of MTB-specific T cells, could be performed on whole blood samples of fingerprick (50 uL volumes, and was not affected by HIV-mediated immunosuppression. This assay platform is potentially of utility in diagnosis of infection in this and other clinical settings.

  3. Gold-nanoparticle based electrochemical DNA sensor for the detection of fish pathogen Aphanomyces invadans.

    Science.gov (United States)

    Kuan, Guan Chin; Sheng, Liew Pei; Rijiravanich, Patsamon; Marimuthu, Kasi; Ravichandran, Manickam; Yin, Lee Su; Lertanantawong, Benchaporn; Surareungchai, Werasak

    2013-12-15

    Epizootic ulcerative syndrome (EUS) is a devastating fish disease caused by the fungus, Aphanomyces invadans. Rapid diagnosis of EUS is needed to control and treat this highly invasive disease. The current diagnostic methods for EUS are labor intensive. We have developed a highly sensitive and specific electrochemical genosensor towards the 18S rRNA and internal transcribed spacer regions of A. invadans. Multiple layers of latex were synthesized with the help of polyelectrolytes, and labeled with gold nanoparticles to enhance sensitivity. The gold-latex spheres were functionalized with specific DNA probes. We describe here the novel application of this improved platform for detection of PCR product from real sample of A. invadans using a premix sandwich hybridization assay. The premix assay was easier, more specific and gave higher sensitivity of one log unit when compared to the conventional method of step-by-step hybridization. The limit of detection was 0.5 fM (4.99 zmol) of linear target DNA and 1 fM (10 amol) of PCR product. The binding positions of the probes to the PCR amplicons were optimized for efficient hybridization. Probes that hybridized close to the 5' or 3' terminus of the PCR amplicons gave the highest signal due to minimal steric hindrance for hybridization. The genosensor is highly suitable as a surveillance and diagnostic tool for EUS in the aquaculture industry. © 2013 Elsevier B.V. All rights reserved.

  4. A New Protocol to Detect Multiple Foodborne Pathogens with PCR Dipstick DNA Chromatography after a Six-Hour Enrichment Culture in a Broad-Range Food Pathogen Enrichment Broth

    Directory of Open Access Journals (Sweden)

    Masahiro Hayashi

    2013-01-01

    Full Text Available A quick foodborne pathogen screening method after six-hour enrichment culture with a broad-range food pathogen enrichment broth is described. Pathogenic factors of Salmonella enterica, Shigella spp., enteroinvasive Escherichia coli, and enterohemorrhagic E. coli are amplified with a cocktail primer and rapid polymerase chain reaction (PCR, which finishes amplification in 30 min. The PCR amplicon was differentiated with a dipstick DNA chromatography assay in 5–10 min. Starting from a four- to six-hour enrichment culture, this assay was finished within 45 min. Detection sensitivity of this protocol was less than 2.5 CFU/25 g for S. enterica and 3.3 CFU/25 g for enterohemorrhagic E. coli in spiked ground meat experiments.

  5. Periodontal pathogen detection in gingiva/tooth and tongue flora samples from 18- to 48-month-old children and periodontal status of their mothers.

    Science.gov (United States)

    Yang, E Y; Tanner, A C R; Milgrom, P; Mokeem, S A; Riedy, C A; Spadafora, A T; Page, Roy C; Bruss, J

    2002-02-01

    Few studies have detected periodontal pathogens in young children, and when detected the prevalence has been relatively low. In this epidemiological study, we determined the prevalence of periodontal pathogen colonization in young children and examined the relationship between periodontitis in mothers and detection of periodontal pathogens in their children aged 18-48 months. Children were selected and enrolled randomly into the study; tongue and gingival/tooth plaque samples were harvested and analyzed by DNA probe checkerboard assay for Porphyromonas gingivalis and Bacteroides forsythus. Clinical measurements included a gingival bleeding score in the children and a periodontal screening and recording (PSR) score in the mothers. Mothers having one or more periodontal sites with probing depths > 5.5 mm were classified as having periodontitis. In this population, 71% (66/93) of the 18- to 48-month-old children were infected with at least one periodontal pathogen. Detection rates for children were 68.8% for P. gingivalis and 29.0% for B. forsythus. About 13.8% (11/80) of children had gingival bleeding in response to a toothpick inserted interproximally. Children in whom B. forsythus was detected were about 6 times more likely to have gingival bleeding than other children. There was no relationship between bleeding and detection of P. gingivalis. 17.0% (16/94) of the mothers had periodontitis. When all mother-child pairs were considered, the periodontal status of the mother was found not to be a determinant for detection of periodontal pathogens in the floral samples from the children. However, the odds ratio that a daughter of a mother with periodontitis would be colonized was 5.2 for B. forsythus. A much higher proportion of children in this population were colonized by P. gingivalis and/or B. forsythus than has been previously reported for other populations. A modest level of association between manifestations of periodontitis in mothers and detection of B

  6. Multiplex real-time PCR (TaqMan) assay for the simultaneous detection and discrimination of potato powdery and common scab diseases and pathogens.

    Science.gov (United States)

    Qu, X S; Wanner, L A; Christ, B J

    2011-03-01

    To develop a multiplex real-time PCR assay using TaqMan probes for the simultaneous detection and discrimination of potato powdery scab and common scab, two potato tuber diseases with similar symptoms, and the causal pathogens Spongospora subterranea and plant pathogenic Streptomyces spp. Real-time PCR primers and a probe for S. subterranea were designed based on the DNA sequence of the ribosomal RNA ITS2 region. Primers and a probe for pathogenic Streptomyces were designed based on the DNA sequence of the txtAB genes. The two sets of primer pairs and probes were used in a single real-time PCR assay. The multiplex real-time PCR assay was confirmed to be specific for S. subterranea and pathogenic Streptomyces. The assay detected DNA quantities of 100 fg for each of the two pathogens and linear responses and high correlation coefficients between the amount of DNA and C(t) values for each pathogen were achieved. The presence of two sets of primer pairs and probes and of plant extracts did not alter the sensitivity and efficiency of multiplex PCR amplification. Using the PCR assay, we could discriminate between powdery scab and common scab tubers with similar symptoms. Common scab and powdery scab were detected in some tubers with no visible symptoms. Mixed infections of common scab and powdery scab on single tubers were also revealed. This multiplex real-time PCR assay is a rapid, cost efficient, specific and sensitive tool for the simultaneous detection and discrimination of the two pathogens on infected potato tubers when visual symptoms are inconclusive or not present. Accurate and quick identification and discrimination of the cause of scab diseases on potatoes will provide critical information to potato growers and researchers for disease management. This is important because management strategies for common and powdery scab diseases are very different. © 2011 The Authors. Journal of Applied Microbiology © 2011 The Society for Applied Microbiology.

  7. [Detection of fibria-like surface structures in Staphylococcus saprophyticus as a pathogen in chronic pyelonephritis].

    Science.gov (United States)

    Schmidt, H; Schmidt, R; Naumann, G; Putzke, H P

    1988-07-01

    It is reported on a 25-year-old female patient suffering from chronic pyelonephritis. Six times coagulase-negative staphylococci were bacteriological proved in a significant number. Four strains were identified as Staphylococcus saprophyticus. The in each case in the autumn occurring complaints could be correlated well with the seasonal fluctuations of urinary tract infections by S. saprophyticus as described in the literature. Chemotherapeutic measures be determined by the clinical symptoms and subjective complaints of the patient. By an antibiotic therapy only a temporary loss of complaint and normalization of urinary findings, respectively, were obtained. In the presence of a marked leukocyturia a capsula-fashioned variant of S. saprophyticus was established. By scanning electron microscopy investigations fimbria-like surface structures were detected for the first time in this germ species. Three morphological different appendage structures are described. By a hypothetical model possible functions of these structures in the adherence process are discussed.