WorldWideScience

Sample records for autonomous pathogen detection

  1. Autonomous system for pathogen detection and identification

    International Nuclear Information System (INIS)

    Belgrader, P.; Benett, W.; Langlois, R.; Long, G.; Mariella, R.; Milanovich, F.; Miles, R.; Nelson, W.; Venkateswaran, K.

    1998-01-01

    This purpose of this project is to build a prototype instrument that will, running unattended, detect, identify, and quantify BW agents. In order to accomplish this, we have chosen to start with the world s leading, proven, assays for pathogens: surface-molecular recognition assays, such as antibody-based assays, implemented on a high-performance, identification (ID)-capable flow cytometer, and the polymerase chain reaction (PCR) for nucleic-acid based assays. With these assays, we must integrate the capability to: l collect samples from aerosols, water, or surfaces; l perform sample preparation prior to the assays; l incubate the prepared samples, if necessary, for a period of time; l transport the prepared, incubated samples to the assays; l perform the assays; l interpret and report the results of the assays. Issues such as reliability, sensitivity and accuracy, quantity of consumables, maintenance schedule, etc. must be addressed satisfactorily to the end user. The highest possible sensitivity and specificity of the assay must be combined with no false alarms. Today, we have assays that can, in under 30 minutes, detect and identify stimulants for BW agents at concentrations of a few hundred colony-forming units per ml of solution. If the bio-aerosol sampler of this system collects 1000 Ymin and concentrates the respirable particles into 1 ml of solution with 70% processing efficiency over a period of 5 minutes, then this translates to a detection/ID capability of under 0.1 agent-containing particle/liter of air

  2. Development of a Commercial Prototype of the Autonomous Pathogen Detection System Final Report CRADA No. TC-02077-04

    Energy Technology Data Exchange (ETDEWEB)

    Dzenitis, J. M. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Haigh, P. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2017-09-27

    This was a collaborative effort between The Regents of the University of California, Lawrence Livermore National Laboratory (LLNL), and GE Ion Track, Inc. (GEIT) to develop a commercial prototype of the Autonomous Pathogen Detection System (APDS), an instrument that monitors the air for all three biological threat agents (bacteria, viruses and toxins). This was originally a one year CRADA project, with the cost of the work at LLNL being funded by the Department of Homeland Security's Office of National Laboratories. The original project consisted of five major tasks and deliverables. The CRADA was then amended, converting the CRADA from a programmatically funded CRADA to a funds-in CRADA, extending the project for an additional 14 months, and adding four new tasks and deliverable to the project.

  3. Autonomous Forest Fire Detection

    NARCIS (Netherlands)

    Breejen, E. den; Breuers, M.; Cremer, F.; Kemp, R.A.W.; Roos, M.; Schutte, K.; Vries, J.S. de

    1998-01-01

    Forest fire detection is a very important issue in the pre-suppression process. Timely detection allows the suppression units to reach the fire in its initial stages and this will reduce the suppression costs considerably. The autonomous forest fire detection principle is based on temporal contrast

  4. The Bering Autonomous Target Detection

    DEFF Research Database (Denmark)

    Jørgensen, John Leif; Denver, Troelz; Betto, Maurizio

    2003-01-01

    An autonomous asteroid target detection and tracking method has been developed. The method features near omnidirectionality and focus on high speed operations and completeness of search of the near space rather than the traditional faint object search methods, employed presently at the larger...... telescopes. The method has proven robust in operation and is well suited for use onboard spacecraft. As development target for the method and the associated instrumentation the asteroid research mission Bering has been used. Onboard a spacecraft, the autonomous detection is centered around the fully...... autonomous star tracker the Advanced Stellar Compass (ASC). One feature of this instrument is that potential targets are registered directly in terms of date, right ascension, declination, and intensity, which greatly facilitates both tracking search and registering. Results from ground and inflight tests...

  5. Adaptively detecting changes in Autonomic Grid Computing

    KAUST Repository

    Zhang, Xiangliang; Germain, Cé cile; Sebag, Michè le

    2010-01-01

    Detecting the changes is the common issue in many application fields due to the non-stationary distribution of the applicative data, e.g., sensor network signals, web logs and gridrunning logs. Toward Autonomic Grid Computing, adaptively detecting

  6. Biosensors for plant pathogen detection.

    Science.gov (United States)

    Khater, Mohga; de la Escosura-Muñiz, Alfredo; Merkoçi, Arben

    2017-07-15

    Infectious plant diseases are caused by pathogenic microorganisms such as fungi, bacteria, viruses, viroids, phytoplasma and nematodes. Worldwide, plant pathogen infections are among main factors limiting crop productivity and increasing economic losses. Plant pathogen detection is important as first step to manage a plant disease in greenhouses, field conditions and at the country boarders. Current immunological techniques used to detect pathogens in plant include enzyme-linked immunosorbent assays (ELISA) and direct tissue blot immunoassays (DTBIA). DNA-based techniques such as polymerase chain reaction (PCR), real time PCR (RT-PCR) and dot blot hybridization have also been proposed for pathogen identification and detection. However these methodologies are time-consuming and require complex instruments, being not suitable for in-situ analysis. Consequently, there is strong interest for developing new biosensing systems for early detection of plant diseases with high sensitivity and specificity at the point-of-care. In this context, we revise here the recent advancement in the development of advantageous biosensing systems for plant pathogen detection based on both antibody and DNA receptors. The use of different nanomaterials such as nanochannels and metallic nanoparticles for the development of innovative and sensitive biosensing systems for the detection of pathogens (i.e. bacteria and viruses) at the point-of-care is also shown. Plastic and paper-based platforms have been used for this purpose, offering cheap and easy-to-use really integrated sensing systems for rapid on-site detection. Beside devices developed at research and development level a brief revision of commercially available kits is also included in this review. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Molecular detection of human bacterial pathogens

    National Research Council Canada - National Science Library

    Liu, Dongyou

    2011-01-01

    .... Molecular Detection of Human Bacterial Pathogens addresses this issue, with international scientists in respective bacterial pathogen research and diagnosis providing expert summaries on current...

  8. Autonomous valve for detection of biopolymer degradation

    DEFF Research Database (Denmark)

    Keller, Stephan Urs; Noeth, Nadine-Nicole; Fetz, Stefanie

    2009-01-01

    We present a polymer microvalve that allows the detection of biopolymer degradation without the need of external energy. The valve is based on a polymer container filled with a colored marker solution and closed by a thin lid. This structure is covered by a film of poly(L-lactide) and degradation...... of the biopolymer triggers the release of the color which is detected visually. The autonomous valve has potential for the fast testing of biopolymer degradation under various environmental conditions or by specific enzymes....

  9. Adaptively detecting changes in Autonomic Grid Computing

    KAUST Repository

    Zhang, Xiangliang

    2010-10-01

    Detecting the changes is the common issue in many application fields due to the non-stationary distribution of the applicative data, e.g., sensor network signals, web logs and gridrunning logs. Toward Autonomic Grid Computing, adaptively detecting the changes in a grid system can help to alarm the anomalies, clean the noises, and report the new patterns. In this paper, we proposed an approach of self-adaptive change detection based on the Page-Hinkley statistic test. It handles the non-stationary distribution without the assumption of data distribution and the empirical setting of parameters. We validate the approach on the EGEE streaming jobs, and report its better performance on achieving higher accuracy comparing to the other change detection methods. Meanwhile this change detection process could help to discover the device fault which was not claimed in the system logs. © 2010 IEEE.

  10. Autonomous Chemical Vapour Detection by Micro UAV

    Directory of Open Access Journals (Sweden)

    Kent Rosser

    2015-12-01

    Full Text Available The ability to remotely detect and map chemical vapour clouds in open air environments is a topic of significant interest to both defence and civilian communities. In this study, we integrate a prototype miniature colorimetric chemical sensor developed for methyl salicylate (MeS, as a model chemical vapour, into a micro unmanned aerial vehicle (UAV, and perform flights through a raised MeS vapour cloud. Our results show that that the system is capable of detecting MeS vapours at low ppm concentration in real-time flight and rapidly sending this information to users by on-board telemetry. Further, the results also indicate that the sensor is capable of distinguishing “clean” air from “dirty”, multiple times per flight, allowing us to look towards autonomous cloud mapping and source localization applications. Further development will focus on a broader range of integrated sensors, increased autonomy of detection and improved engineering of the system.

  11. Autonomous Rule Creation for Intrusion Detection

    Energy Technology Data Exchange (ETDEWEB)

    Todd Vollmer; Jim Alves-Foss; Milos Manic

    2011-04-01

    Many computational intelligence techniques for anomaly based network intrusion detection can be found in literature. Translating a newly discovered intrusion recognition criteria into a distributable rule can be a human intensive effort. This paper explores a multi-modal genetic algorithm solution for autonomous rule creation. This algorithm focuses on the process of creating rules once an intrusion has been identified, rather than the evolution of rules to provide a solution for intrusion detection. The algorithm was demonstrated on anomalous ICMP network packets (input) and Snort rules (output of the algorithm). Output rules were sorted according to a fitness value and any duplicates were removed. The experimental results on ten test cases demonstrated a 100 percent rule alert rate. Out of 33,804 test packets 3 produced false positives. Each test case produced a minimum of three rule variations that could be used as candidates for a production system.

  12. Digital PCR for detection of citrus pathogens

    Science.gov (United States)

    Citrus trees are often infected with multiple pathogens of economic importance, especially those with insect or mite vectors. Real-time/quantitative PCR (qPCR) has been used for high-throughput detection and relative quantification of pathogens; however, target reference or standards are required. I...

  13. Autonomous nutrient detection for water quality monitoring

    OpenAIRE

    Maher, Damien; Cleary, John; Cogan, Deirdre; Diamond, Dermot

    2012-01-01

    The ever increasing demand for real time environmental monitoring is currently being driven by strong legislative and societal drivers. Low cost autonomous environmental monitoring systems are required to meet this demand as current monitoring solutions are insufficient. This poster presents an autonomous nutrient analyser platform for water quality monitoring. Results from a field trial of the nutrient analyser are reported along with current work to expand the range of water quality targ...

  14. Waterborne Pathogens: Detection Methods and Challenges

    Directory of Open Access Journals (Sweden)

    Flor Yazmín Ramírez-Castillo

    2015-05-01

    Full Text Available Waterborne pathogens and related diseases are a major public health concern worldwide, not only by the morbidity and mortality that they cause, but by the high cost that represents their prevention and treatment. These diseases are directly related to environmental deterioration and pollution. Despite the continued efforts to maintain water safety, waterborne outbreaks are still reported globally. Proper assessment of pathogens on water and water quality monitoring are key factors for decision-making regarding water distribution systems’ infrastructure, the choice of best water treatment and prevention waterborne outbreaks. Powerful, sensitive and reproducible diagnostic tools are developed to monitor pathogen contamination in water and be able to detect not only cultivable pathogens but also to detect the occurrence of viable but non-culturable microorganisms as well as the presence of pathogens on biofilms. Quantitative microbial risk assessment (QMRA is a helpful tool to evaluate the scenarios for pathogen contamination that involve surveillance, detection methods, analysis and decision-making. This review aims to present a research outlook on waterborne outbreaks that have occurred in recent years. This review also focuses in the main molecular techniques for detection of waterborne pathogens and the use of QMRA approach to protect public health.

  15. Molecular detection of foodborne pathogens

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hartmann

    Microbiological Methods (NordVal) in comparative and collaborative trials, and was approved for detection of Campylobacter in chicken neck skin, cloacal swab and boot swab samples. A comparison study on probe chemistries for real-time PCR was performed on locked nucleic acid (LNA), minor groove binder (MGB...... of the optimization strategy were observed from increasing 1) the sampling volume from the pre-enrichment, 2) the paramagnetic particles applied in the DNA extraction procedure, and 3) the amount of DNA template in the PCR. This method was subsequently validated according to the recommendations of NordVal...

  16. Sensor Fault Detection and Diagnosis for autonomous vehicles

    Directory of Open Access Journals (Sweden)

    Realpe Miguel

    2015-01-01

    Full Text Available In recent years testing autonomous vehicles on public roads has become a reality. However, before having autonomous vehicles completely accepted on the roads, they have to demonstrate safe operation and reliable interaction with other traffic participants. Furthermore, in real situations and long term operation, there is always the possibility that diverse components may fail. This paper deals with possible sensor faults by defining a federated sensor data fusion architecture. The proposed architecture is designed to detect obstacles in an autonomous vehicle’s environment while detecting a faulty sensor using SVM models for fault detection and diagnosis. Experimental results using sensor information from the KITTI dataset confirm the feasibility of the proposed architecture to detect soft and hard faults from a particular sensor.

  17. Electrochemical Methodologies for the Detection of Pathogens.

    Science.gov (United States)

    Amiri, Mandana; Bezaatpour, Abolfazl; Jafari, Hamed; Boukherroub, Rabah; Szunerits, Sabine

    2018-05-25

    Bacterial infections remain one of the principal causes of morbidity and mortality worldwide. The number of deaths due to infections is declining every year by only 1% with a forecast of 13 million deaths in 2050. Among the 1400 recognized human pathogens, the majority of infectious diseases is caused by just a few, about 20 pathogens only. While the development of vaccinations and novel antibacterial drugs and treatments are at the forefront of research, and strongly financially supported by policy makers, another manner to limit and control infectious outbreaks is targeting the development and implementation of early warning systems, which indicate qualitatively and quantitatively the presence of a pathogen. As toxin contaminated food and drink are a potential threat to human health and consequently have a significant socioeconomic impact worldwide, the detection of pathogenic bacteria remains not only a big scientific challenge but also a practical problem of enormous significance. Numerous analytical methods, including conventional culturing and staining techniques as well as molecular methods based on polymerase chain reaction amplification and immunological assays, have emerged over the years and are used to identify and quantify pathogenic agents. While being highly sensitive in most cases, these approaches are highly time, labor, and cost consuming, requiring trained personnel to perform the frequently complex assays. A great challenge in this field is therefore to develop rapid, sensitive, specific, and if possible miniaturized devices to validate the presence of pathogens in cost and time efficient manners. Electrochemical sensors are well accepted powerful tools for the detection of disease-related biomarkers and environmental and organic hazards. They have also found widespread interest in the last years for the detection of waterborne and foodborne pathogens due to their label free character and high sensitivity. This Review is focused on the current

  18. Quantitative multiplex detection of pathogen biomarkers

    Energy Technology Data Exchange (ETDEWEB)

    Mukundan, Harshini; Xie, Hongzhi; Swanson, Basil I.; Martinez, Jennifer; Grace, Wynne K.

    2016-02-09

    The present invention addresses the simultaneous detection and quantitative measurement of multiple biomolecules, e.g., pathogen biomarkers through either a sandwich assay approach or a lipid insertion approach. The invention can further employ a multichannel, structure with multi-sensor elements per channel.

  19. Quantitative multiplex detection of pathogen biomarkers

    Science.gov (United States)

    Mukundan, Harshini; Xie, Hongzhi; Swanson, Basil I; Martinez, Jennifer; Grace, Wynne K

    2014-10-14

    The present invention addresses the simultaneous detection and quantitative measurement of multiple biomolecules, e.g., pathogen biomarkers through either a sandwich assay approach or a lipid insertion approach. The invention can further employ a multichannel, structure with multi-sensor elements per channel.

  20. Human detection for underground autonomous mine vehicles using thermal imaging

    CSIR Research Space (South Africa)

    Dickens, JS

    2011-07-01

    Full Text Available Underground mine automation has the potential to increase safety, productivity and allow the mining of lower-grade resources. In a mining environment with both autonomous robots and humans, it is essential that the robots are able to detect...

  1. Bacteriophages for detection of bacterial pathogens

    International Nuclear Information System (INIS)

    Kutateladze, M.

    2009-01-01

    The G. Eliava Institute of Bacteriophages, Microbiology and Virology (Tbilisi, Georgia) is one of the most famous institutions focused on bacteriophage research for the elaboration of appropriate phage methodologies for human and animal protection. The main direction of the institute is the study and production of bacteriophages against intestinal disorders (dysentery, typhoid, intesti) and purulent-septic infections (staphylococcus, streptococcus, pyophage, etc.). These preparations were successfully introduced during the Soviet era, and for decades were used throughout the former Soviet Union and in other Socialist countries for the treatment, prophylaxis, and diagnosis of various infectious diseases, including those caused by antibiotic-resistant bacterial strains. Bacteriophages were widely used for identifying and detecting infections caused by the most dangerous pathogens and causative agents of epidemiological outbreaks. The specific topic of this presentation is the phage typing of bacterial species, which can be an important method for epidemiological diagnostics. Together with different genetic methodologies - such as PCR-based methods, PFGE, plasmid fingerprinting, and ribosomal typing - phage typing is one method for identifying bacterial pathogens. The method has a high percentage of determination of phage types, high specificity of reaction, and is easy for interpretation and use by health workers. Phage typing was applied for inter-species differentiation of different species of Salmonella, S. typhi, Brucella spp, Staphylococcus aureus, E. col,i Clostridium deficile, Vibrio cholerae, Yersinia pestis, Yersinia enterocolitica, Lysteria monocytogenes, Clostridium perfringens, Clostridium tetani, plant pathogens, and other bacterial pathogens. In addition to addressing the utility and efficacy of phage typing, the paper will discuss the isolation and selection of diagnostic typing phages for interspecies differentiation of pathogens that is necessary

  2. Pathogen detection by the polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Chitpatima, S T; Settachan, D; Pornsilpatip, J; Visawapoka, U [Pramongkutklao College of Medicine, Bangkok (Thailand). Molecular Biology Lab.; Dvorak, D R [Amersham International Ltd., Singapore (Singapore)

    1994-05-01

    In recent years, significant advances in the knowledge of DNA and its make up have led to the development of a powerful technique called polymerase chain reaction (PCR). Since the advent of PCR, laboratories around the globe have been exploiting this technology to bridge limitations or to overcome common problems encountered in molecular biology techniques. In addition, this technology has been employed successfully in diagnostic and basic scientific research and development. The true potentials of this technology is realized in early detection of pathogens and genetic abnormalities. In this paper two PCR protocols are described. The first is for detection of HIV-1 DNA in blood, the other for detection of rabies virus RNA in brain cells. 6 refs, 3 figs, 1 tab.

  3. Integrating Pavement Crack Detection and Analysis Using Autonomous Unmanned Aerial Vehicle Imagery

    Science.gov (United States)

    2015-03-27

    INTEGRATING PAVEMENT CRACK DETECTION AND ANALYSIS USING AUTONOMOUS UNMANNED AERIAL VEHICLE...protection in the United States. AFIT-ENV-MS-15-M-195 INTEGRATING PAVEMENT CRACK DETECTION AND ANALYSIS USING AUTONOMOUS UNMANNED AERIAL...APPROVED FOR PUBLIC RELEASE; DISTRIBUTION UNLIMITED. AFIT-ENV-MS-15-M-195 INTEGRATING PAVEMENT CRACK DETECTION AND ANALYSIS USING AUTONOMOUS

  4. Detection of pathogens from periodontal lesions

    Directory of Open Access Journals (Sweden)

    Malheiros Veruska de João

    2004-01-01

    Full Text Available OBJECTIVE: To comparatively detect A. actinomycetemcomitans and F. nucleatum from periodontal and healthy sites. METHODS: Subgingival clinical samples from 50 periodontitis adult patients and 50 healthy subjects were analyzed. Both organisms were isolated using a trypticase soy agar-bacitracin-vancomycin (TSBV medium and detected by PCR. Conventional biochemical tests were used for bacteria identification. RESULTS: A. actinomycetemcomitans and F. nucleatum were isolated in 18% and 20% of the patients, respectively, and in 2% and 24% of healthy subjects. Among A. actinomycetemcomitans isolates, biotype II was the most prevalent. Primer pair AA was 100% sensitive in the detection of A. actinomycetemcomitans from both subject groups. Primers ASH and FU were also 100% sensitive to detect this organism in healthy subject samples. Primer pair FN5047 was more sensitive to detect F. nucleatum in patients or in healthy samples than primer 5059S. Primers ASH and 5059S were more specific in the detection of A. actinomycetemcomitans and F. nucleatum, respectively, in patients and in healthy subject samples. CONCLUSIONS: PCR is an effective tool for detecting periodontal pathogens in subgingival samples, providing a faster and safer diagnostic tool of periodontal diseases. The method's sensitivity and specificity is conditioned by the choice of the set of primers used.

  5. AUTONOMOUS DETECTION AND TRACKING OF AN OBJECT AUTONOMOUSLY USING AR.DRONE QUADCOPTER

    Directory of Open Access Journals (Sweden)

    Futuhal Arifin

    2014-08-01

    Full Text Available Abstract Nowadays, there are many robotic applications being developed to do tasks autonomously without any interactions or commands from human. Therefore, developing a system which enables a robot to do surveillance such as detection and tracking of a moving object will lead us to more advanced tasks carried out by robots in the future. AR.Drone is a flying robot platform that is able to take role as UAV (Unmanned Aerial Vehicle. Usage of computer vision algorithm such as Hough Transform makes it possible for such system to be implemented on AR.Drone. In this research, the developed algorithm is able to detect and track an object with certain shape and color. Then the algorithm is successfully implemented on AR.Drone quadcopter for detection and tracking.

  6. Autonomous unobtrusive detection of mild cognitive impairment in older adults.

    Science.gov (United States)

    Akl, Ahmad; Taati, Babak; Mihailidis, Alex

    2015-05-01

    The current diagnosis process of dementia is resulting in a high percentage of cases with delayed detection. To address this problem, in this paper, we explore the feasibility of autonomously detecting mild cognitive impairment (MCI) in the older adult population. We implement a signal processing approach equipped with a machine learning paradigm to process and analyze real-world data acquired using home-based unobtrusive sensing technologies. Using the sensor and clinical data pertaining to 97 subjects, acquired over an average period of three years, a number of measures associated with the subjects' walking speed and general activity in the home were calculated. Different time spans of these measures were used to generate feature vectors to train and test two machine learning algorithms namely support vector machines and random forests. We were able to autonomously detect MCI in older adults with an area under the ROC curve of 0.97 and an area under the precision-recall curve of 0.93 using a time window of 24 weeks. This study is of great significance since it can potentially assist in the early detection of cognitive impairment in older adults.

  7. Early Seizure Detection Based on Cardiac Autonomic Regulation Dynamics

    Directory of Open Access Journals (Sweden)

    Jonatas Pavei

    2017-10-01

    Full Text Available Epilepsy is a neurological disorder that causes changes in the autonomic nervous system. Heart rate variability (HRV reflects the regulation of cardiac activity and autonomic nervous system tone. The early detection of epileptic seizures could foster the use of new treatment approaches. This study presents a new methodology for the prediction of epileptic seizures using HRV signals. Eigendecomposition of HRV parameter covariance matrices was used to create an input for a support vector machine (SVM-based classifier. We analyzed clinical data from 12 patients (9 female; 3 male; age 34.5 ± 7.5 years, involving 34 seizures and a total of 55.2 h of interictal electrocardiogram (ECG recordings. Data from 123.6 h of ECG recordings from healthy subjects were used to test false positive rate per hour (FP/h in a completely independent data set. Our methodological approach allowed the detection of impending seizures from 5 min to just before the onset of a clinical/electrical seizure with a sensitivity of 94.1%. The FP rate was 0.49 h−1 in the recordings from patients with epilepsy and 0.19 h−1 in the recordings from healthy subjects. Our results suggest that it is feasible to use the dynamics of HRV parameters for the early detection and, potentially, the prediction of epileptic seizures.

  8. Vision based speed breaker detection for autonomous vehicle

    Science.gov (United States)

    C. S., Arvind; Mishra, Ritesh; Vishal, Kumar; Gundimeda, Venugopal

    2018-04-01

    In this paper, we are presenting a robust and real-time, vision-based approach to detect speed breaker in urban environments for autonomous vehicle. Our method is designed to detect the speed breaker using visual inputs obtained from a camera mounted on top of a vehicle. The method performs inverse perspective mapping to generate top view of the road and segment out region of interest based on difference of Gaussian and median filter images. Furthermore, the algorithm performs RANSAC line fitting to identify the possible speed breaker candidate region. This initial guessed region via RANSAC, is validated using support vector machine. Our algorithm can detect different categories of speed breakers on cement, asphalt and interlock roads at various conditions and have achieved a recall of 0.98.

  9. Surrounding Moving Obstacle Detection for Autonomous Driving Using Stereo Vision

    Directory of Open Access Journals (Sweden)

    Hao Sun

    2013-06-01

    Full Text Available Detection and tracking surrounding moving obstacles such as vehicles and pedestrians are crucial for the safety of mobile robotics and autonomous vehicles. This is especially the case in urban driving scenarios. This paper presents a novel framework for surrounding moving obstacles detection using binocular stereo vision. The contributions of our work are threefold. Firstly, a multiview feature matching scheme is presented for simultaneous stereo correspondence and motion correspondence searching. Secondly, the multiview geometry constraint derived from the relative camera positions in pairs of consecutive stereo views is exploited for surrounding moving obstacles detection. Thirdly, an adaptive particle filter is proposed for tracking of multiple moving obstacles in surrounding areas. Experimental results from real-world driving sequences demonstrate the effectiveness and robustness of the proposed framework.

  10. Real-time door detection for indoor autonomous vehicle

    Science.gov (United States)

    He, Zhihao; Zhu, Ming

    2017-07-01

    Indoor Autonomous Vehicle(IAV) is used in many indoor scenes. Such as hotels and hospitals. Door detection is a key issue to guide the IAV into rooms. In this paper, we consider door detection in the use of indoor navigation of IAV. Since real-time properties are important for real-world IAV, the detection algorithm must be fast enough. Most monocular-camera based door detection model need a perfect detection of the four line segments of the door or the four corners. But in many situations, line segments could be extended or cut off. And there could be many false detected corners. And few of them can distinguish doors from door-like objects with door-like shape effectively. We proposed a 2-D vision model of the door that is made up of line segments. The number of parts detected is used to determine the possibility of a door. Our algorithm is tested on a database of doors.1 The robustness and real-time are verified. The precision is 89.4%. Average time consumed for processing a 640x320 figure is 44.73ms.

  11. Motor execution detection based on autonomic nervous system responses

    International Nuclear Information System (INIS)

    Marchal-Crespo, Laura; Riener, Robert; Zimmermann, Raphael; Lambercy, Olivier; Edelmann, Janis; Fluet, Marie-Christine; Gassert, Roger; Wolf, Martin

    2013-01-01

    Triggered assistance has been shown to be a successful robotic strategy for provoking motor plasticity, probably because it requires neurologic patients’ active participation to initiate a movement involving their impaired limb. Triggered assistance, however, requires sufficient residual motor control to activate the trigger and, thus, is not applicable to individuals with severe neurologic injuries. In these situations, brain and body–computer interfaces have emerged as promising solutions to control robotic devices. In this paper, we investigate the feasibility of a body–machine interface to detect motion execution only monitoring the autonomic nervous system (ANS) response. Four physiological signals were measured (blood pressure, breathing rate, skin conductance response and heart rate) during an isometric pinching task and used to train a classifier based on hidden Markov models. We performed an experiment with six healthy subjects to test the effectiveness of the classifier to detect rest and active pinching periods. The results showed that the movement execution can be accurately classified based only on peripheral autonomic signals, with an accuracy level of 84.5%, sensitivity of 83.8% and specificity of 85.2%. These results are encouraging to perform further research on the use of the ANS response in body–machine interfaces. (paper)

  12. Improving the Lane Reference Detection for Autonomous Road Vehicle Control

    Directory of Open Access Journals (Sweden)

    Felipe Jiménez

    2016-01-01

    Full Text Available Autonomous road vehicles are increasingly becoming more important and there are several techniques and sensors that are being applied for vehicle control. This paper presents an alternative system for maintaining the position of autonomous vehicles without adding additional elements to the standard sensor architecture, by using a 3D laser scanner for continuously detecting a reference element in situations in which the GNSS receiver fails or provides accuracy below the required level. Considering that the guidance variables are more accurately estimated when dealing with reference points in front of and behind the vehicle, an algorithm based on vehicle dynamics mathematical model is proposed to extend the detected points in cases where the sensor is placed at the front of the vehicle. The algorithm has been tested when driving along a lane delimited by New Jersey barriers at both sides and the results show a correct behaviour. The system is capable of estimating the reference element behind the vehicle with sufficient accuracy when the laser scanner is placed at the front of it, so the robustness of the control input variables (lateral and angular errors estimation is improved making it unnecessary to place the sensor on the vehicle roof or to introduce additional sensors.

  13. Aptamer-Based Technologies in Foodborne Pathogen Detection.

    Science.gov (United States)

    Teng, Jun; Yuan, Fang; Ye, Yingwang; Zheng, Lei; Yao, Li; Xue, Feng; Chen, Wei; Li, Baoguang

    2016-01-01

    Aptamers are single stranded DNA or RNA ligands, which can be selected by a method called systematic evolution of ligands by exponential enrichment (SELEX); and they can specifically recognize and bind to their targets. These unique characteristics of aptamers offer great potentials in applications such as pathogen detection and biomolecular screening. Pathogen detection is the critical means in detecting and identifying the problems related to public health and food safety; and only the rapid, sensitive and efficient detection technologies can enable the users to make the accurate assessments on the risks of infections (humans and animals) or contaminations (foods and other commodities) caused by various pathogens. This article reviews the development in the field of the aptamer-based approaches for pathogen detection, including whole-cell SELEX and Genomic SELEX. Nowadays, a variety of aptamer-based biosensors have been developed for pathogen detection. Thus, in this review, we also cover the development in aptamer-based biosensors including optical biosensors for multiple pathogen detection by multiple-labeling or label-free models such as fluorescence detection and surface plasmon resonance, electrochemical biosensors and lateral chromatography test strips, and their applications in pathogen detection and biomolecular screening. While notable progress has been made in the field in the last decade, challenges or drawbacks in their applications such as pathogen detection and biomolecular screening remain to be overcome.

  14. Aptamer-Based Technologies in Foodborne Pathogen Detection

    Directory of Open Access Journals (Sweden)

    Jun Teng

    2016-09-01

    Full Text Available Aptamers are single stranded DNA or RNA ligands, which can be selected by a method called systematic evolution of ligands by exponential enrichment (SELEX; and they can specifically recognize and bind to their targets. These unique characteristics of aptamers offer great potentials in applications such as pathogen detection and biomolecular screening. Pathogen detection is the first and critical means in detecting and identifying the problems related to public health and food safety; and only the rapid, sensitive and efficient detection technologies can enable the users to make to accurate assessments on the risk of infections (humans and animals or contaminations (foods and other commodities caused by various pathogens. This article reviews the developments in the field of the aptamer-based approaches for pathogen detection, including whole-cell SELEX and Genomic SELEX. Nowadays, a variety of aptamer-based biosensors have been developed for pathogen detection. Thus, in this review, we also cover the development of aptamer-based biosensors including optical biosensors for multiple pathogen detection in multiple-labeling or label-free models such as fluorescence detection and surface plasmon resonance, electrochemical biosensors, and lateral chromatography test strips, and their applications in the pathogen detection and biomolecular screening. While notable progress has been made in the field in the last decade, challenges or drawbacks in their applications such as pathogen detection and biomolecular screening, remain to be overcome.

  15. Rapid identification and detection of pathogenic Fungi by padlock probes

    NARCIS (Netherlands)

    Tsui, C.K.M.; Wang, B.; Schoen, C.D.; Hamelin, R.C.

    2013-01-01

    Fungi are important pathogens of human diseases, as well as to agricultural crop and trees. Molecular diagnostics can detect diseases early, and improve identification accuracy and follow-up disease management. The use of padlock probe is effective to facilitate these detections and pathogen

  16. Multiplex detection of plant pathogens using a microsphere immunoassay technology.

    Directory of Open Access Journals (Sweden)

    Ratthaphol Charlermroj

    Full Text Available Plant pathogens are a serious problem for seed export, plant disease control and plant quarantine. Rapid and accurate screening tests are urgently required to protect and prevent plant diseases spreading worldwide. A novel multiplex detection method was developed based on microsphere immunoassays to simultaneously detect four important plant pathogens: a fruit blotch bacterium Acidovorax avenae subsp. citrulli (Aac, chilli vein-banding mottle virus (CVbMV, potyvirus, watermelon silver mottle virus (WSMoV, tospovirus serogroup IV and melon yellow spot virus (MYSV, tospovirus. An antibody for each plant pathogen was linked on a fluorescence-coded magnetic microsphere set which was used to capture corresponding pathogen. The presence of pathogens was detected by R-phycoerythrin (RPE-labeled antibodies specific to the pathogens. The assay conditions were optimized by identifying appropriate antibody pairs, blocking buffer, concentration of RPE-labeled antibodies and assay time. Once conditions were optimized, the assay was able to detect all four plant pathogens precisely and accurately with substantially higher sensitivity than enzyme-linked immunosorbent assay (ELISA when spiked in buffer and in healthy watermelon leaf extract. The assay time of the microsphere immunoassay (1 hour was much shorter than that of ELISA (4 hours. This system was also shown to be capable of detecting the pathogens in naturally infected plant samples and is a major advancement in plant pathogen detection.

  17. Multiplex detection of plant pathogens using a microsphere immunoassay technology.

    Science.gov (United States)

    Charlermroj, Ratthaphol; Himananto, Orawan; Seepiban, Channarong; Kumpoosiri, Mallika; Warin, Nuchnard; Oplatowska, Michalina; Gajanandana, Oraprapai; Grant, Irene R; Karoonuthaisiri, Nitsara; Elliott, Christopher T

    2013-01-01

    Plant pathogens are a serious problem for seed export, plant disease control and plant quarantine. Rapid and accurate screening tests are urgently required to protect and prevent plant diseases spreading worldwide. A novel multiplex detection method was developed based on microsphere immunoassays to simultaneously detect four important plant pathogens: a fruit blotch bacterium Acidovorax avenae subsp. citrulli (Aac), chilli vein-banding mottle virus (CVbMV, potyvirus), watermelon silver mottle virus (WSMoV, tospovirus serogroup IV) and melon yellow spot virus (MYSV, tospovirus). An antibody for each plant pathogen was linked on a fluorescence-coded magnetic microsphere set which was used to capture corresponding pathogen. The presence of pathogens was detected by R-phycoerythrin (RPE)-labeled antibodies specific to the pathogens. The assay conditions were optimized by identifying appropriate antibody pairs, blocking buffer, concentration of RPE-labeled antibodies and assay time. Once conditions were optimized, the assay was able to detect all four plant pathogens precisely and accurately with substantially higher sensitivity than enzyme-linked immunosorbent assay (ELISA) when spiked in buffer and in healthy watermelon leaf extract. The assay time of the microsphere immunoassay (1 hour) was much shorter than that of ELISA (4 hours). This system was also shown to be capable of detecting the pathogens in naturally infected plant samples and is a major advancement in plant pathogen detection.

  18. Towards autonomous radio detection of ultra high energy cosmic rays

    International Nuclear Information System (INIS)

    Garcon, Th.

    2010-01-01

    The radio-detection of extensive air showers, investigated for the first time in the 1960's, obtained promising results but plagued by the technical limitations. At that time, H.R. Allan summed up the state of the art in an extensive review article whose conclusions and predictions are still used today. Set up in 2001 at the Nancay Observatory, the CODALEMA experiment was built first as a demonstrator and successfully showed the feasibility of the radio-detection of extensive air showers. Radically modified in 2005, it allowed to obtain a clear energy correlation, and put in evidence an unambiguous signature of the geomagnetic origin of the electric field emission process associated to the air shower. The switch towards large areas is the next step of the technique's development. Therefore, the autonomy of the detectors becomes essential. After test prototypes installed in 2006 at the Pierre Auger Observatory, a generation of new autonomous detectors was developed. Their first results will be presented. This work is also dedicated to the issues related to the radio-detection technique: the antenna response, the sensitivity, the surrounding effects, the monitoring of a big array. The determination of the shower characteristics independently of other detectors such as the lateral distribution, the energy correlation and the frequency spectrum of the radio transient will be discussed. (author)

  19. Towards Autonomous Agriculture: Automatic Ground Detection Using Trinocular Stereovision

    Directory of Open Access Journals (Sweden)

    Annalisa Milella

    2012-09-01

    Full Text Available Autonomous driving is a challenging problem, particularly when the domain is unstructured, as in an outdoor agricultural setting. Thus, advanced perception systems are primarily required to sense and understand the surrounding environment recognizing artificial and natural structures, topology, vegetation and paths. In this paper, a self-learning framework is proposed to automatically train a ground classifier for scene interpretation and autonomous navigation based on multi-baseline stereovision. The use of rich 3D data is emphasized where the sensor output includes range and color information of the surrounding environment. Two distinct classifiers are presented, one based on geometric data that can detect the broad class of ground and one based on color data that can further segment ground into subclasses. The geometry-based classifier features two main stages: an adaptive training stage and a classification stage. During the training stage, the system automatically learns to associate geometric appearance of 3D stereo-generated data with class labels. Then, it makes predictions based on past observations. It serves as well to provide training labels to the color-based classifier. Once trained, the color-based classifier is able to recognize similar terrain classes in stereo imagery. The system is continuously updated online using the latest stereo readings, thus making it feasible for long range and long duration navigation, over changing environments. Experimental results, obtained with a tractor test platform operating in a rural environment, are presented to validate this approach, showing an average classification precision and recall of 91.0% and 77.3%, respectively.

  20. Rapid methods: the detection of foodborne pathogens

    NARCIS (Netherlands)

    Beumer, R.R.; Hazeleger, W.C.

    2009-01-01

    Although bacteria are the first type of microorganisms that come to mind when discussing microbial food safety, they are by no means the only pathogenic foodborne microorganisms. Mycotoxin producing moulds, human enteric viruses, protozoan parasites and marine biotoxins are also of importance.

  1. Recent developments in pathogen detection arrays: implications for fungal plant pathogens and use in practica

    NARCIS (Netherlands)

    Lievens, B.; Thomma, B.P.H.J.

    2005-01-01

    The failure to adequately identify plant pathogens from culture-based morphological techniques has led to the development of culture-independent molecular approaches. Increasingly, diagnostic laboratories are pursuing fast routine methods that provide reliable identification, sensitive detection,

  2. Autonomic intrusion detection: Adaptively detecting anomalies over unlabeled audit data streams in computer networks

    KAUST Repository

    Wang, Wei; Guyet, Thomas; Quiniou, René ; Cordier, Marie-Odile; Masseglia, Florent; Zhang, Xiangliang

    2014-01-01

    In this work, we propose a novel framework of autonomic intrusion detection that fulfills online and adaptive intrusion detection over unlabeled HTTP traffic streams in computer networks. The framework holds potential for self-managing: self-labeling, self-updating and self-adapting. Our framework employs the Affinity Propagation (AP) algorithm to learn a subject’s behaviors through dynamical clustering of the streaming data. It automatically labels the data and adapts to normal behavior changes while identifies anomalies. Two large real HTTP traffic streams collected in our institute as well as a set of benchmark KDD’99 data are used to validate the framework and the method. The test results show that the autonomic model achieves better results in terms of effectiveness and efficiency compared to adaptive Sequential Karhunen–Loeve method and static AP as well as three other static anomaly detection methods, namely, k-NN, PCA and SVM.

  3. Autonomic intrusion detection: Adaptively detecting anomalies over unlabeled audit data streams in computer networks

    KAUST Repository

    Wang, Wei

    2014-06-22

    In this work, we propose a novel framework of autonomic intrusion detection that fulfills online and adaptive intrusion detection over unlabeled HTTP traffic streams in computer networks. The framework holds potential for self-managing: self-labeling, self-updating and self-adapting. Our framework employs the Affinity Propagation (AP) algorithm to learn a subject’s behaviors through dynamical clustering of the streaming data. It automatically labels the data and adapts to normal behavior changes while identifies anomalies. Two large real HTTP traffic streams collected in our institute as well as a set of benchmark KDD’99 data are used to validate the framework and the method. The test results show that the autonomic model achieves better results in terms of effectiveness and efficiency compared to adaptive Sequential Karhunen–Loeve method and static AP as well as three other static anomaly detection methods, namely, k-NN, PCA and SVM.

  4. Multirobot autonomous landmine detection using distributed multisensor information aggregation

    Science.gov (United States)

    Jumadinova, Janyl; Dasgupta, Prithviraj

    2012-06-01

    We consider the problem of distributed sensor information fusion by multiple autonomous robots within the context of landmine detection. We assume that different landmines can be composed of different types of material and robots are equipped with different types of sensors, while each robot has only one type of landmine detection sensor on it. We introduce a novel technique that uses a market-based information aggregation mechanism called a prediction market. Each robot is provided with a software agent that uses sensory input of the robot and performs calculations of the prediction market technique. The result of the agent's calculations is a 'belief' representing the confidence of the agent in identifying the object as a landmine. The beliefs from different robots are aggregated by the market mechanism and passed on to a decision maker agent. The decision maker agent uses this aggregate belief information about a potential landmine and makes decisions about which other robots should be deployed to its location, so that the landmine can be confirmed rapidly and accurately. Our experimental results show that, for identical data distributions and settings, using our prediction market-based information aggregation technique increases the accuracy of object classification favorably as compared to two other commonly used techniques.

  5. Autonomous long-range open area fire detection and reporting

    Science.gov (United States)

    Engelhaupt, Darell E.; Reardon, Patrick J.; Blackwell, Lisa; Warden, Lance; Ramsey, Brian D.

    2005-03-01

    Approximately 5 billion dollars in US revenue was lost in 2003 due to open area fires. In addition many lives are lost annually. Early detection of open area fires is typically performed by manned observatories, random reporting and aerial surveillance. Optical IR flame detectors have been developed previously. They typically have experienced high false alarms and low flame detection sensitivity due to interference from solar and other causes. Recently a combination of IR detectors has been used in a two or three color mode to reduce false alarms from solar, or background sources. A combination of ultra-violet C (UVC) and near infra-red (NIR) detectors has also been developed recently for flame discrimination. Relatively solar-blind basic detectors are now available but typically detect at only a few tens of meters at ~ 1 square meter fuel flame. We quantify the range and solar issues for IR and visible detectors and qualitatively define UV sensor requirements in terms of the mode of operation, collection area issues and flame signal output by combustion photochemistry. We describe innovative flame signal collection optics for multiple wavelengths using UV and IR as low false alarm detection of open area fires at long range (8-10 km/m2) in daylight (or darkness). A circular array detector and UV-IR reflective and refractive devices including cylindrical or toroidal lens elements for the IR are described. The dispersion in a refractive cylindrical IR lens characterizes the fire and allows a stationary line or circle generator to locate the direction and different flame IR "colors" from a wide FOV. The line generator will produce spots along the line corresponding to the fire which can be discriminated with a linear detector. We demonstrate prototype autonomous sensors with RF digital reporting from various sites.

  6. Detection of mastitis pathogens by analysis of volatile bacterial metabolites

    NARCIS (Netherlands)

    Hettinga, K.A.; Valenberg, van H.J.F.; Lam, T.J.G.M.; Hooijdonk, van A.C.M.

    2008-01-01

    The ability to detect mastitis pathogens based on their volatile metabolites was studied. Milk samples from cows with clinical mastitis, caused by Staphylococcus aureus, coagulase-negative staphylococci, Streptococcus uberis, Streptococcus dysgalactiae, and Escherichia coli were collected. In

  7. Methods for detecting pathogens in the beef food chain: detecting particular pathogens

    Science.gov (United States)

    The main food-borne pathogens of concern in the beef food chain are Shiga toxin-producing Escherichia coli (STEC) and Salmonella spp.; however, the presence of other pathogens, including Listeria monocytogenes, Campylobacter spp., Clostridium spp., Bacillus cereus, and Mycobacterium avium subsp. par...

  8. Waveguide-Based Biosensors for Pathogen Detection

    Directory of Open Access Journals (Sweden)

    Nile Hartman

    2009-07-01

    Full Text Available Optical phenomena such as fluorescence, phosphorescence, polarization, interference and non-linearity have been extensively used for biosensing applications. Optical waveguides (both planar and fiber-optic are comprised of a material with high permittivity/high refractive index surrounded on all sides by materials with lower refractive indices, such as a substrate and the media to be sensed. This arrangement allows coupled light to propagate through the high refractive index waveguide by total internal reflection and generates an electromagnetic wave—the evanescent field—whose amplitude decreases exponentially as the distance from the surface increases. Excitation of fluorophores within the evanescent wave allows for sensitive detection while minimizing background fluorescence from complex, “dirty” biological samples. In this review, we will describe the basic principles, advantages and disadvantages of planar optical waveguide-based biodetection technologies. This discussion will include already commercialized technologies (e.g., Corning’s EPIC® Ô, SRU Biosystems’ BIND™, Zeptosense®, etc. and new technologies that are under research and development. We will also review differing assay approaches for the detection of various biomolecules, as well as the thin-film coatings that are often required for waveguide functionalization and effective detection. Finally, we will discuss reverse-symmetry waveguides, resonant waveguide grating sensors and metal-clad leaky waveguides as alternative signal transducers in optical biosensing.

  9. Advances and Challenges in Viability Detection of Foodborne Pathogens

    Directory of Open Access Journals (Sweden)

    Dexin Zeng

    2016-11-01

    Full Text Available Foodborne outbreaks are a serious public health and food safety concern worldwide. There is a great demand for rapid, sensitive, specific, and accurate methods to detect microbial pathogens in foods. Conventional methods based on cultivation of pathogens have been the gold standard protocols; however, they take up to a week to complete. Molecular assays such as polymerase chain reaction (PCR, sequencing, microarray technologies have been widely used in detection of foodborne pathogens. Among molecular assays, PCR technology conventional and real-time PCR (qPCR is most commonly used in the foodborne pathogen detection because of its high sensitivity and specificity. However, a major drawback of PCR is its inability to differentiate the DNA from dead and viable cells, and this is a critical factor for the food industry, regulatory agencies and the consumer. To remedy this shortcoming, researchers have used biological dyes such as ethidium monoazide (EMA and propidium monoazide (PMA to pretreat samples before DNA extraction to intercalate the DNA of dead cells in food samples, and then proceed with regular DNA preparation and qPCR. By combining PMA treatment with qPCR (PMA-qPCR, scientists have applied this technology to detect viable cells of various bacterial pathogens in foods. The incorporation of PMA into PCR-based assays for viability detection of pathogens in foods has increased significantly in the last decade. On the other hand, some downsides with this approach have been noted, particularly to achieve complete suppression of signal of DNA from the dead cells present in some particular food matrix. Nowadays, there is a tendency of more and more researchers adapting this approach for viability detection; and a few commercial kits based on PMA are available in the market. As time goes on, more scientists apply this approach to a broader range of pathogen detections, this viability approach (PMA or other chemicals such as platinum compound

  10. Detection of mastitis pathogens by analysis of volatile bacterial metabolites.

    Science.gov (United States)

    Hettinga, K A; van Valenberg, H J F; Lam, T J G M; van Hooijdonk, A C M

    2008-10-01

    The ability to detect mastitis pathogens based on their volatile metabolites was studied. Milk samples from cows with clinical mastitis, caused by Staphylococcus aureus, coagulase-negative staphylococci, Streptococcus uberis, Streptococcus dysgalactiae, and Escherichia coli were collected. In addition, samples from cows without clinical mastitis and with low somatic cell count (SCC) were collected for comparison. All mastitis samples were examined by using classical microbiological methods, followed by headspace analysis for volatile metabolites. Milk from culture-negative samples contained a lower number and amount of volatile components compared with cows with clinical mastitis. Because of variability between samples within a group, comparisons between pathogens were not sufficient for classification of the samples by univariate statistics. Therefore, an artificial neural network was trained to classify the pathogen in the milk samples based on the bacterial metabolites. The trained network differentiated milk from uninfected and infected quarters very well. When comparing pathogens, Staph. aureus produced a very different pattern of volatile metabolites compared with the other samples. Samples with coagulase-negative staphylococci and E. coli had enough dissimilarity with the other pathogens, making it possible to separate these 2 pathogens from each other and from the other samples. The 2 streptococcus species did not show significant differences between each other but could be identified as a different group from the other pathogens. Five groups can thus be identified based on the volatile bacterial metabolites: Staph. aureus, coagulase-negative staphylococci, streptococci (Strep. uberis and Strep. dysgalactiae as one group), E. coli, and uninfected quarters.

  11. Detection of Water Hazards for Autonomous Robotic Vehicles

    Science.gov (United States)

    Matthes, Larry; Belluta, Paolo; McHenry, Michael

    2006-01-01

    Four methods of detection of bodies of water are under development as means to enable autonomous robotic ground vehicles to avoid water hazards when traversing off-road terrain. The methods involve processing of digitized outputs of optoelectronic sensors aboard the vehicles. It is planned to implement these methods in hardware and software that would operate in conjunction with the hardware and software for navigation and for avoidance of solid terrain obstacles and hazards. The first method, intended for use during the day, is based on the observation that, under most off-road conditions, reflections of sky from water are easily discriminated from the adjacent terrain by their color and brightness, regardless of the weather and of the state of surface waves on the water. Accordingly, this method involves collection of color imagery by a video camera and processing of the image data by an algorithm that classifies each pixel as soil, water, or vegetation according to its color and brightness values (see figure). Among the issues that arise is the fact that in the presence of reflections of objects on the opposite shore, it is difficult to distinguish water by color and brightness alone. Another issue is that once a body of water has been identified by means of color and brightness, its boundary must be mapped for use in navigation. Techniques for addressing these issues are under investigation. The second method, which is not limited by time of day, is based on the observation that ladar returns from bodies of water are usually too weak to be detected. In this method, ladar scans of the terrain are analyzed for returns and the absence thereof. In appropriate regions, the presence of water can be inferred from the absence of returns. Under some conditions in which reflections from the bottom are detectable, ladar returns could, in principle, be used to determine depth. The third method involves the recognition of bodies of water as dark areas in short

  12. A new oligonucleotide microarray for detection of pathogenic and non-pathogenic Legionella spp.

    Directory of Open Access Journals (Sweden)

    Boyang Cao

    Full Text Available Legionella pneumophila has been recognized as the major cause of legionellosis since the discovery of the deadly disease. Legionella spp. other than L. pneumophila were later found to be responsible to many non-pneumophila infections. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this report, we have sequenced the 16S-23S rRNA gene internal transcribed spacer (ITS of 10 Legionella species and subspecies, including L. anisa, L. bozemanii, L. dumoffii, L. fairfieldensis, L. gormanii, L. jordanis, L. maceachernii, L. micdadei, L. pneumophila subspp. fraseri and L. pneumophila subspp. pasculleii, and developed a rapid oligonucleotide microarray detection technique accordingly to identify 12 most common Legionella spp., which consist of 11 pathogenic species of L. anisa, L. bozemanii, L. dumoffii, L. gormanii, L. jordanis, L. longbeachae, L. maceachernii, L. micdadei, and L. pneumophila (including subspp. pneumophila, subspp. fraseri, and subspp. pasculleii and one non-pathogenic species, L. fairfieldensis. Twenty-nine probes that reproducibly detected multiple Legionella species with high specificity were included in the array. A total of 52 strains, including 30 target pathogens and 22 non-target bacteria, were used to verify the oligonucleotide microarray assay. The sensitivity of the detection was at 1.0 ng with genomic DNA or 13 CFU/100 mL with Legionella cultures. The microarray detected seven samples of air conditioner-condensed water with 100% accuracy, validating the technique as a promising method for applications in basic microbiology, clinical diagnosis, food safety, and epidemiological surveillance. The phylogenetic study based on the ITS has also revealed that the non-pathogenic L. fairfieldensis is the closest to L. pneumophila than the nine other pathogenic Legionella spp.

  13. A New Oligonucleotide Microarray for Detection of Pathogenic and Non-Pathogenic Legionella spp.

    Science.gov (United States)

    Cao, Boyang; Liu, Xiangqian; Yu, Xiang; Chen, Min; Feng, Lu; Wang, Lei

    2014-01-01

    Legionella pneumophila has been recognized as the major cause of legionellosis since the discovery of the deadly disease. Legionella spp. other than L. pneumophila were later found to be responsible to many non-pneumophila infections. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this report, we have sequenced the 16S-23S rRNA gene internal transcribed spacer (ITS) of 10 Legionella species and subspecies, including L. anisa, L. bozemanii, L. dumoffii, L. fairfieldensis, L. gormanii, L. jordanis, L. maceachernii, L. micdadei, L. pneumophila subspp. fraseri and L. pneumophila subspp. pasculleii, and developed a rapid oligonucleotide microarray detection technique accordingly to identify 12 most common Legionella spp., which consist of 11 pathogenic species of L. anisa, L. bozemanii, L. dumoffii, L. gormanii, L. jordanis, L. longbeachae, L. maceachernii, L. micdadei, and L. pneumophila (including subspp. pneumophila, subspp. fraseri, and subspp. pasculleii) and one non-pathogenic species, L. fairfieldensis. Twenty-nine probes that reproducibly detected multiple Legionella species with high specificity were included in the array. A total of 52 strains, including 30 target pathogens and 22 non-target bacteria, were used to verify the oligonucleotide microarray assay. The sensitivity of the detection was at 1.0 ng with genomic DNA or 13 CFU/100 mL with Legionella cultures. The microarray detected seven samples of air conditioner-condensed water with 100% accuracy, validating the technique as a promising method for applications in basic microbiology, clinical diagnosis, food safety, and epidemiological surveillance. The phylogenetic study based on the ITS has also revealed that the non-pathogenic L. fairfieldensis is the closest to L. pneumophila than the nine other pathogenic Legionella spp. PMID:25469776

  14. Deoxyribonucleic Acid Probes Analyses for the Detection of Periodontal Pathogens.

    Science.gov (United States)

    Al Yahfoufi, Zoubeida; Hadchiti, Wahib; Berberi, Antoine

    2015-09-01

    In clinical microbiology several techniques have been used to identify bacteria. Recently, Deoxyribonucleic acid (DNA)-based techniques have been introduced to detect human microbial pathogens in periodontal diseases. Deoxyribonucleic acid probes can detect bacteria at a very low level if we compared with the culture methods. These probes have shown rapid and cost-effective microbial diagnosis, good sensitivity and specificity for some periodontal pathogens in cases of severe periodontitis. Eighty-five patients were recruited for the study. Twenty-one subjects ranging between 22 and 48 years of age fulfilled the inclusion and exclusion criteria. Seventy-eight samples became available for DNA probe analysis from the deepest pockets in each quadrant. All 21 patients showed positive results for Prevotella intermedia; also, Prevotella gingivalis was identified in 19 subjects, Aggregatibacter actinomycetemcomitans in 6 subjects. P. intermedia was diagnosed positive in 82% of the subgingival samples taken, 79% for P. gingivalis, and 23% for A. actinomycetemcomitans. This study shows a high frequency of putative periodontal pathogens by using DNA probe technology, which is semi-quantitative in this study. Deoxyribonucleic acid probes can detect bacteria at very low level about 10(3) which is below the detection level of culture methods. The detection threshold of cultural methods. The three types of bacteria can be detected rapidly with high sensitivity by using the DNA probe by general practitioners, and thus can help in the diagnosis process and the treatment.

  15. DNA microarray technique for detecting food-borne pathogens

    Directory of Open Access Journals (Sweden)

    Xing GAO

    2012-08-01

    Full Text Available Objective To study the application of DNA microarray technique for screening and identifying multiple food-borne pathogens. Methods The oligonucleotide probes were designed by Clustal X and Oligo 6.0 at the conserved regions of specific genes of multiple food-borne pathogens, and then were validated by bioinformatic analyses. The 5' end of each probe was modified by amino-group and 10 Poly-T, and the optimized probes were synthesized and spotted on aldehyde-coated slides. The bacteria DNA template incubated with Klenow enzyme was amplified by arbitrarily primed PCR, and PCR products incorporated into Aminoallyl-dUTP were coupled with fluorescent dye. After hybridization of the purified PCR products with DNA microarray, the hybridization image and fluorescence intensity analysis was acquired by ScanArray and GenePix Pro 5.1 software. A series of detection conditions such as arbitrarily primed PCR and microarray hybridization were optimized. The specificity of this approach was evaluated by 16 different bacteria DNA, and the sensitivity and reproducibility were verified by 4 food-borne pathogens DNA. The samples of multiple bacteria DNA and simulated water samples of Shigella dysenteriae were detected. Results Nine different food-borne bacteria were successfully discriminated under the same condition. The sensitivity of genomic DNA was 102 -103pg/ μl, and the coefficient of variation (CV of the reproducibility of assay was less than 15%. The corresponding specific hybridization maps of the multiple bacteria DNA samples were obtained, and the detection limit of simulated water sample of Shigella dysenteriae was 3.54×105cfu/ml. Conclusions The DNA microarray detection system based on arbitrarily primed PCR can be employed for effective detection of multiple food-borne pathogens, and this assay may offer a new method for high-throughput platform for detecting bacteria.

  16. Rapid detection, characterization, and enumeration of foodborne pathogens

    DEFF Research Database (Denmark)

    Hoorfar, Jeffrey

    2011-01-01

    . The present review discusses the reasons for the increasing interest in rapid methods; current developments in the field, the research needs, and the future trends. The advent of biotechnology has introduced new technologies that led to the emergence of rapid diagnostic methods and altered food testing...... of rapid methods is for fast screening of large number of samples, where most of them are expected to be test-negative, leading to faster product release for sale. This has been the main strength of rapid methods such as real-time Polymerase Chain Reaction (PCR). Enrichment PCR, where a primary culture...... of pathogen in a contaminated product. Another key issue is automation, where the key drivers are miniaturization and multiple testing, which mean that not only one instrument is flexible enough to test for many pathogens but also many pathogens can be detected with one test. The review is mainly based...

  17. Maximizing the chances of detecting pathogenic leptospires in mammals

    DEFF Research Database (Denmark)

    Tulsiani, Suhella; Graham, G C; Dohnt, M F

    2011-01-01

    . In the earlier field investigation, serum, renal tissue and urine were collected from wild mammals, for the detection of pathogenic leptospires by culture, the microscopic agglutination test (MAT), real-time PCR and silver impregnation of smears. Although 27.6% of the rodents investigated were found leptospire....../ml, did not affect the viability or the detection of leptospires in culture, and is therefore unlikely to reduce the chances of isolating leptospires from an animal that has been euthanized with the compound. It appears that collecting multiple samples from each mammal being checked will improve...

  18. Rapid detection, characterization, and enumeration of foodborne pathogens.

    Science.gov (United States)

    Hoorfar, J

    2011-11-01

    As food safety management further develops, microbiological testing will continue to play an important role in assessing whether Food Safety Objectives are achieved. However, traditional microbiological culture-based methods are limited, particularly in their ability to provide timely data. The present review discusses the reasons for the increasing interest in rapid methods, current developments in the field, the research needs, and the future trends. The advent of biotechnology has introduced new technologies that led to the emergence of rapid diagnostic methods and altered food testing practices. Rapid methods are comprised of many different detection technologies, including specialized enzyme substrates, antibodies and DNA, ranging from simple differential plating media to the use of sophisticated instruments. The use of non-invasive sampling techniques for live animals especially came into focus with the 1990s outbreak of bovine spongiform encephalopathy that was linked to the human outbreak of Creutzfeldt Jakob's Disease. Serology is still an important tool in preventing foodborne pathogens to enter the human food supply through meat and milk from animals. One of the primary uses of rapid methods is for fast screening of large number of samples, where most of them are expected to be test-negative, leading to faster product release for sale. This has been the main strength of rapid methods such as real-time Polymerase Chain Reaction (PCR). Enrichment PCR, where a primary culture broth is tested in PCR, is the most common approach in rapid testing. Recent reports show that it is possible both to enrich a sample and enumerate by pathogen-specific real-time PCR, if the enrichment time is short. This can be especially useful in situations where food producers ask for the level of pathogen in a contaminated product. Another key issue is automation, where the key drivers are miniaturization and multiple testing, which mean that not only one instrument is flexible

  19. Integrated Detection of Pathogens and Host Biomarkers for Wounds

    Energy Technology Data Exchange (ETDEWEB)

    Jaing, C

    2012-03-19

    The increasing incidence and complications arising from combat wounds has necessitated a reassessment of methods for effective treatment. Infection, excessive inflammation, and incidence of drug-resistant organisms all contribute toward negative outcomes for afflicted individuals. The organisms and host processes involved in wound progression, however, are incompletely understood. We therefore set out, using our unique technical resources, to construct a profile of combat wounds which did or did not successfully resolve. We employed the Lawrence Livermore Microbial Detection Array and identified a number of nosocomial pathogens present in wound samples. Some of these identities corresponded with bacterial isolates previously cultured, while others were not obtained via standard microbiology. Further, we optimized proteomics protocols for the identification of host biomarkers indicative of various stages in wound progression. In combination with our pathogen data, our biomarker discovery efforts will provide a profile corresponding to wound complications, and will assist significantly in treatment of these complex cases.

  20. Dominant object detection for autonomous vision-based surveillance

    NARCIS (Netherlands)

    Celik, H.

    2010-01-01

    The deployment of visual surveillance and monitoring systems has reached massive proportions. Consequently, a need to automate the processes involved in retrieving useful information from surveillance videos, such as detecting and counting objects, and interpreting their individual and joint

  1. Rapid Detection and Characterization of Emerging Foreign Animal Disease Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Jaing, C. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2016-11-18

    To best safeguard human and animal health requires early detection and characterization of disease events. This must include effective surveillance for emerging infectious diseases. Both deliberate and natural outbreaks have enormous economic and public health impacts, and can present serious threats to national security. In this project, we developed novel next generation detection technologies to protect the agricultural economy and biosecurity. The first technology is a multiplexed assay to simultaneously detection 10 swine viral and bacterial pathogens. The second one is the Lawrence Livermore Microbial Detection Array (LLMDA) which can detect more than 10,000 microbial species including 4219 viruses, 5367 bacteria, 265 fungi, 117 protozoa and 293 archaea. We analyzed a series of swine clinical samples from past disease events to demonstrate the utility of the assays for faster and cheaper detection of emerging and foreign animal disease pathogens, and their utility as s routine diagnosis and surveillance tool. A second goal of the study is to better understand mechanisms of African swine fever virus (ASFV) infection in pigs to aid the development of countermeasures and diagnostics. There is no vaccine available for ASF. ASF outbreak is on the rise on several European countries. Though ASF is not currently in the U.S., a potential outbreak in the U.S. would be detrimental to the swine industry and the US agricultural economy. We pursued a genome-wide approach to characterize the pig immune responses after ASFV infection. We used RNA sequencing and bioinformatics methods to identify genes and pathways that are affected during ASF infection. We have identified a list of most differentially expressed genes that are in the immune response pathways.

  2. Genome-Enhanced Detection and Identification (GEDI of plant pathogens

    Directory of Open Access Journals (Sweden)

    Nicolas Feau

    2018-02-01

    Full Text Available Plant diseases caused by fungi and Oomycetes represent worldwide threats to crops and forest ecosystems. Effective prevention and appropriate management of emerging diseases rely on rapid detection and identification of the causal pathogens. The increase in genomic resources makes it possible to generate novel genome-enhanced DNA detection assays that can exploit whole genomes to discover candidate genes for pathogen detection. A pipeline was developed to identify genome regions that discriminate taxa or groups of taxa and can be converted into PCR assays. The modular pipeline is comprised of four components: (1 selection and genome sequencing of phylogenetically related taxa, (2 identification of clusters of orthologous genes, (3 elimination of false positives by filtering, and (4 assay design. This pipeline was applied to some of the most important plant pathogens across three broad taxonomic groups: Phytophthoras (Stramenopiles, Oomycota, Dothideomycetes (Fungi, Ascomycota and Pucciniales (Fungi, Basidiomycota. Comparison of 73 fungal and Oomycete genomes led the discovery of 5,939 gene clusters that were unique to the targeted taxa and an additional 535 that were common at higher taxonomic levels. Approximately 28% of the 299 tested were converted into qPCR assays that met our set of specificity criteria. This work demonstrates that a genome-wide approach can efficiently identify multiple taxon-specific genome regions that can be converted into highly specific PCR assays. The possibility to easily obtain multiple alternative regions to design highly specific qPCR assays should be of great help in tackling challenging cases for which higher taxon-resolution is needed.

  3. Magnetic Bead Based Immunoassay for Autonomous Detection of Toxins

    Energy Technology Data Exchange (ETDEWEB)

    Kwon, Y; Hara, C A; Knize, M G; Hwang, M H; Venkatesteswaran, K S; Wheeler, E K; Bell, P M; Renzi, R F; Fruetel, J A; Bailey, C G

    2008-05-01

    As a step towards toward the development of a rapid, reliable analyzer for bioagents in the environment, we are developing an automated system for the simultaneous detection of a group of select agents and toxins. To detect toxins, we modified and automated an antibody-based approach previously developed for manual medical diagnostics that uses fluorescent eTag{trademark} reporter molecules and is suitable for highly multiplexed assays. Detection is based on two antibodies binding simultaneously to a single antigen, one of which is labeled with biotin while the other is conjugated to a fluorescent eTag{trademark} through a cleavable linkage. Aqueous samples are incubated with the mixture of antibodies along with streptavidin-coated magnetic beads coupled to a photo-activatable porphyrin complex. In the presence of antigen, a molecular complex is formed where the cleavable linkage is held in proximity to the photoactivable group. Upon excitation at 680 nm, free radicals are generated, which diffuse and cleave the linkage, releasing the eTags{trademark}. Released eTags{trademark} are analyzed using capillary gel electrophoresis with laser-induced fluorescence detection. Limits of detection for ovalbumin and botulinum toxoid individually were 4 ng/mL (or 80 pg) and 16 ng/mL (or 320 pg), respectively, using the manual assay. In addition, we demonstrated the use of pairs of antibodies from different sources in a single assay to decrease the rate of false positives. Automation of the assay was demonstrated on a flow-through format with higher LODs of 125 ng/mL (or 2.5 ng) each of a mixture of ovalbumin and botulinum toxoid. This versatile assay can be easily modified with the appropriate antibodies to detect a wide range of toxins and other proteins.

  4. Vehicle Detection for RCTA/ANS (Autonomous Navigation System)

    Science.gov (United States)

    Brennan, Shane; Bajracharya, Max; Matthies, Larry H.; Howard, Andrew B.

    2012-01-01

    Using a stereo camera pair, imagery is acquired and processed through the JPLV stereo processing pipeline. From this stereo data, large 3D blobs are found. These blobs are then described and classified by their shape to determine which are vehicles and which are not. Prior vehicle detection algorithms are either targeted to specific domains, such as following lead cars, or are intensity- based methods that involve learning typical vehicle appearances from a large corpus of training data. In order to detect vehicles, the JPL Vehicle Detection (JVD) algorithm goes through the following steps: 1. Take as input a left disparity image and left rectified image from JPLV stereo. 2. Project the disparity data onto a two-dimensional Cartesian map. 3. Perform some post-processing of the map built in the previous step in order to clean it up. 4. Take the processed map and find peaks. For each peak, grow it out into a map blob. These map blobs represent large, roughly vehicle-sized objects in the scene. 5. Take these map blobs and reject those that do not meet certain criteria. Build descriptors for the ones that remain. Pass these descriptors onto a classifier, which determines if the blob is a vehicle or not. The probability of detection is the probability that if a vehicle is present in the image, is visible, and un-occluded, then it will be detected by the JVD algorithm. In order to estimate this probability, eight sequences were ground-truthed from the RCTA (Robotics Collaborative Technology Alliances) program, totaling over 4,000 frames with 15 unique vehicles. Since these vehicles were observed at varying ranges, one is able to find the probability of detection as a function of range. At the time of this reporting, the JVD algorithm was tuned to perform best at cars seen from the front, rear, or either side, and perform poorly on vehicles seen from oblique angles.

  5. Human pathogens in plant biofilms: Formation, physiology, and detection.

    Science.gov (United States)

    Ximenes, Eduardo; Hoagland, Lori; Ku, Seockmo; Li, Xuan; Ladisch, Michael

    2017-07-01

    Fresh produce, viewed as an essential part of a healthy life style is usually consumed in the form of raw or minimally processed fruits and vegetables, and is a potentially important source of food-borne human pathogenic bacteria and viruses. These are passed on to the consumer since the bacteria can form biofilms or otherwise populate plant tissues, thereby using plants as vectors to infect animal hosts. The life cycle of the bacteria in plants differs from those in animals or humans and results in altered physiochemical and biological properties (e.g., physiology, immunity, native microflora, physical barriers, mobility, and temperature). Mechanisms by which healthy plants may become contaminated by microorganisms, develop biofilms, and then pass on their pathogenic burden to people are explored in the context of hollow fiber microfiltration by which plant-derived microorganisms may be recovered and rapidly concentrated to facilitate study of their properties. Enzymes, when added to macerated plant tissues, hydrolyze or alter macromolecules that would otherwise foul hollow-fiber microfiltration membranes. Hence, microfiltration may be used to quickly increase the concentration of microorganisms to detectable levels. This review discusses microbial colonization of vegetables, formation and properties of biofilms, and how hollow fiber microfiltration may be used to concentrate microbial targets to detectable levels. The use of added enzymes helps to disintegrate biofilms and minimize hollow fiber membrane fouling, thereby providing a new tool for more time effectively elucidating mechanisms by which biofilms develop and plant tissue becomes contaminated with human pathogens. Biotechnol. Bioeng. 2017;114: 1403-1418. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  6. Humic substances interfere with detection of pathogenic prion protein

    Science.gov (United States)

    Smith, Christen B.; Booth, Clarissa J.; Wadzinski, Tyler J.; Legname, Giuseppe; Chappell, Rick; Johnson, Christopher J.; Pedersen, Joel A.

    2014-01-01

    Studies examining the persistence of prions (the etiological agent of transmissible spongiform encephalopathies) in soil require accurate quantification of pathogenic prion protein (PrPTSE) extracted from or in the presence of soil particles. Here, we demonstrate that natural organic matter (NOM) in soil impacts PrPTSE detection by immunoblotting. Methods commonly used to extract PrPTSE from soils release substantial amounts of NOM, and NOM inhibited PrPTSE immunoblot signal. The degree of immunoblot interference increased with increasing NOM concentration and decreasing NOM polarity. Humic substances affected immunoblot detection of prion protein from both deer and hamsters. We also establish that after interaction with humic acid, PrPTSE remains infectious to hamsters inoculated intracerebrally, and humic acid appeared to slow disease progression. These results provide evidence for interactions between PrPTSE and humic substances that influence both accurate measurement of PrPTSE in soil and disease transmission.

  7. Autonomous detection of ISO fade point with color laser printers

    Science.gov (United States)

    Yan, Ni; Maggard, Eric; Fothergill, Roberta; Jessome, Renee J.; Allebach, Jan P.

    2015-01-01

    Image quality assessment is a very important field in image processing. Human observation is slow and subjective, it also requires strict environment setup for the psychological test 1. Thus developing algorithms to match desired human experiments is always in need. Many studies have focused on detecting the fading phenomenon after the materials are printed, that is to monitor the persistence of the color ink 2-4. However, fading is also a common artifact produced by printing systems when the cartridges run low. We want to develop an automatic system to monitor cartridge life and report fading defects when they appear. In this paper, we first describe a psychological experiment that studies the human perspective on printed fading pages. Then we propose an algorithm based on Color Space Projection and K-means clustering to predict the visibility of fading defects. At last, we integrate the psychological experiment result with our algorithm to give a machine learning tool that monitors cartridge life.

  8. The COMRADE System for Multirobot Autonomous Landmine Detection in Postconflict Regions

    Directory of Open Access Journals (Sweden)

    Prithviraj Dasgupta

    2015-01-01

    Full Text Available We consider the problem of autonomous landmine detection using a team of mobile robots. Previous research on robotic landmine detection mostly employs a single robot equipped with a landmine detection sensor to detect landmines. We envisage that the quality of landmine detection can be significantly improved if multiple robots are coordinated to detect landmines in a cooperative manner by incrementally fusing the landmine-related sensor information they collect and then use that information to visit locations of potential landmines. Towards this objective, we describe a multirobot system called COMRADES to address different aspects of the autonomous landmine detection problem including distributed area coverage to detect and locate landmines, information aggregation to fuse the sensor information obtained by different robots, and multirobot task allocation (MRTA to enable different robots to determine a suitable sequence to visit locations of potential landmines while reducing the time required and battery expended. We have used commercially available all-terrain robots called Coroware Explorer that are customized with a metal detector to detect metallic objects including landmines, as well as indoor Corobot robots, both in simulation and in physical experiments, to test the different techniques in COMRADES.

  9. System for rapid detection of antibiotic resistance of airborne pathogens

    Science.gov (United States)

    Fortin, M.; Noiseux, I.; Mouslinkina, L.; Vernon, M. L.; Laflamme, C.; Filion, G.; Duchaine, C.; Ho, J.

    2009-05-01

    This project uses function-based detection via a fundamental understanding of the genetic markers of AR to distinguish harmful organisms from innocuous ones. This approach circumvents complex analyses to unravel the taxonomic details of 1399 pathogen species, enormously simplifying detection requirements. Laval Hospital's fast permeabilization strategy enables AR revelation in <1hr. Packaging the AR protocols in liquid-processing cartridges and coupling these to our in-house miniature fiber optic flow cell (FOFC) provides first responders with timely information on-site. INO's FOFC platform consists of a specialty optical fiber through which a hole is transversally bored by laser micromachining. The analyte solution is injected into the hole of the fiber and the particles are detected and counted. The advantage with respect to classic free space FC is that alignment occurs in the fabrication process only and complex excitation and collection optics are replaced by optical fibers. Moreover, we use a sheathless configuration which has the advantage of increase the portability of the system, to reduce excess biohazard material and the need for weekly maintenance. In this paper we present the principle of our FOFC along with a, demonstration of the basic capability of the platform for detection of bacillus cereus spores using permeabilized staining.

  10. Detection and characterization of foodborne pathogenic bacteria with hyperspectral microscope imaging

    Science.gov (United States)

    Rapid detection and identification of pathogenic microorganisms naturally occurring during food processing are important in developing intervention and verification strategies. In the poultry industry, contamination of poultry meat with foodborne pathogens (especially, Salmonella and Campylobacter) ...

  11. Molecular diagnostics for the detection and characterization of microbial pathogens.

    Science.gov (United States)

    Procop, Gary W

    2007-09-01

    New and advanced methods of molecular diagnostics are changing the way we practice clinical microbiology, which affects the practice of medicine. Signal amplification and real-time nucleic acid amplification technologies offer a sensitive and specific result with a more rapid turnaround time than has ever before been possible. Numerous methods of postamplification analysis afford the simultaneous detection and differentiation of numerous microbial pathogens, their mechanisms of resistance, and the construction of disease-specific assays. The technical feasibility of these assays has already been demonstrated. How these new, often more expensive tests will be incorporated into routine practice and the impact they will have on patient care remain to be determined. One of the most attractive uses for such techniques is to achieve a more rapid characterization of the infectious agent so that a narrower-spectrum antimicrobial agent may be used, which should have an impact on resistance patterns.

  12. Real-time object detection and semantic segmentation for autonomous driving

    Science.gov (United States)

    Li, Baojun; Liu, Shun; Xu, Weichao; Qiu, Wei

    2018-02-01

    In this paper, we proposed a Highly Coupled Network (HCNet) for joint objection detection and semantic segmentation. It follows that our method is faster and performs better than the previous approaches whose decoder networks of different tasks are independent. Besides, we present multi-scale loss architecture to learn better representation for different scale objects, but without extra time in the inference phase. Experiment results show that our method achieves state-of-the-art results on the KITTI datasets. Moreover, it can run at 35 FPS on a GPU and thus is a practical solution to object detection and semantic segmentation for autonomous driving.

  13. A feature matching and fusion-based positive obstacle detection algorithm for field autonomous land vehicles

    Directory of Open Access Journals (Sweden)

    Tao Wu

    2017-03-01

    Full Text Available Positive obstacles will cause damage to field robotics during traveling in field. Field autonomous land vehicle is a typical field robotic. This article presents a feature matching and fusion-based algorithm to detect obstacles using LiDARs for field autonomous land vehicles. There are three main contributions: (1 A novel setup method of compact LiDAR is introduced. This method improved the LiDAR data density and reduced the blind region of the LiDAR sensor. (2 A mathematical model is deduced under this new setup method. The ideal scan line is generated by using the deduced mathematical model. (3 Based on the proposed mathematical model, a feature matching and fusion (FMAF-based algorithm is presented in this article, which is employed to detect obstacles. Experimental results show that the performance of the proposed algorithm is robust and stable, and the computing time is reduced by an order of two magnitudes by comparing with other exited algorithms. This algorithm has been perfectly applied to our autonomous land vehicle, which has won the champion in the challenge of Chinese “Overcome Danger 2014” ground unmanned vehicle.

  14. Detection and Tracking Strategies for Autonomous Aerial Refuelling Tasks Based on Monocular Vision

    Directory of Open Access Journals (Sweden)

    Yingjie Yin

    2014-07-01

    Full Text Available Detection and tracking strategies based on monocular vision are proposed for autonomous aerial refuelling tasks. The drogue attached to the fuel tanker aircraft has two important features. The grey values of the drogue's inner part are different from the external umbrella ribs, as shown in the image. The shape of the drogue's inner dark part is nearly circular. According to crucial prior knowledge, the rough and fine positioning algorithms are designed to detect the drogue. Particle filter based on the drogue's shape is proposed to track the drogue. A strategy to switch between detection and tracking is proposed to improve the robustness of the algorithms. The inner dark part of the drogue is segmented precisely in the detecting and tracking process and the segmented circular part can be used to measure its spatial position. The experimental results show that the proposed method has good performance in real-time and satisfied robustness and positioning accuracy.

  15. Shuttlecock detection system for fully-autonomous badminton robot with two high-speed video cameras

    Science.gov (United States)

    Masunari, T.; Yamagami, K.; Mizuno, M.; Une, S.; Uotani, M.; Kanematsu, T.; Demachi, K.; Sano, S.; Nakamura, Y.; Suzuki, S.

    2017-02-01

    Two high-speed video cameras are successfully used to detect the motion of a flying shuttlecock of badminton. The shuttlecock detection system is applied to badminton robots that play badminton fully autonomously. The detection system measures the three dimensional position and velocity of a flying shuttlecock, and predicts the position where the shuttlecock falls to the ground. The badminton robot moves quickly to the position where the shuttle-cock falls to, and hits the shuttlecock back into the opponent's side of the court. In the game of badminton, there is a large audience, and some of them move behind a flying shuttlecock, which are a kind of background noise and makes it difficult to detect the motion of the shuttlecock. The present study demonstrates that such noises can be eliminated by the method of stereo imaging with two high-speed cameras.

  16. Hand-Eye LRF-Based Iterative Plane Detection Method for Autonomous Robotic Welding

    Directory of Open Access Journals (Sweden)

    Sungmin Lee

    2015-12-01

    Full Text Available This paper proposes a hand-eye LRF-based (laser range finder welding plane-detection method for autonomous robotic welding in the field of shipbuilding. The hand-eye LRF system consists of a 6 DOF manipulator and an LRF attached to the wrist of the manipulator. The welding plane is detected by the LRF with only the wrist's rotation to minimize a mechanical error caused by the manipulator's motion. A position on the plane is determined as an average position of the detected points on the plane, and a normal vector to the plane is determined by applying PCA (principal component analysis to the detected points. In this case, the accuracy of the detected plane is analysed by simulations with respect to the wrist's angle interval and the plane angle. As a result of the analysis, an iterative plane-detection method with the manipulator's alignment motion is proposed to improve the performance of plane detection. For verifying the feasibility and effectiveness of the proposed plane-detection method, experiments are carried out with a prototype of the hand-eye LRF-based system, which consists of a 1 DOF wrist's joint, an LRF system and a rotatable plane. In addition, the experimental results of the PCA-based plane detection method are compared with those of the two representative plane-detection methods, based on RANSAC (RANdom SAmple Consensus and the 3D Hough transform in both accuracy and computation time's points of view.

  17. Detecting marine hazardous substances and organisms: sensors for pollutants, toxins, and pathogens

    Directory of Open Access Journals (Sweden)

    O. Zielinski

    2009-09-01

    Full Text Available Marine environments are influenced by a wide diversity of anthropogenic and natural substances and organisms that may have adverse effects on human health and ecosystems. Real-time measurements of pollutants, toxins, and pathogens across a range of spatial scales are required to adequately monitor these hazards, manage the consequences, and to understand the processes governing their magnitude and distribution. Significant technological advancements have been made in recent years for the detection and analysis of such marine hazards. In particular, sensors deployed on a variety of mobile and fixed-point observing platforms provide a valuable means to assess hazards. In this review, we present state-of-the-art of sensor technology for the detection of harmful substances and organisms in the ocean. Sensors are classified by their adaptability to various platforms, addressing large, intermediate, or small areal scales. Current gaps and future demands are identified with an indication of the urgent need for new sensors to detect marine hazards at all scales in autonomous real-time mode. Progress in sensor technology is expected to depend on the development of small-scale sensor technologies with a high sensitivity and specificity towards target analytes or organisms. However, deployable systems must comply with platform requirements as these interconnect the three areal scales. Future developments will include the integration of existing methods into complex and operational sensing systems for a comprehensive strategy for long-term monitoring. The combination of sensor techniques on all scales will remain crucial for the demand of large spatial and temporal coverage.

  18. A Path Tracking Algorithm Using Future Prediction Control with Spike Detection for an Autonomous Vehicle Robot

    Directory of Open Access Journals (Sweden)

    Muhammad Aizzat Zakaria

    2013-08-01

    Full Text Available Trajectory tracking is an important aspect of autonomous vehicles. The idea behind trajectory tracking is the ability of the vehicle to follow a predefined path with zero steady state error. The difficulty arises due to the nonlinearity of vehicle dynamics. Therefore, this paper proposes a stable tracking control for an autonomous vehicle. An approach that consists of steering wheel control and lateral control is introduced. This control algorithm is used for a non-holonomic navigation problem, namely tracking a reference trajectory in a closed loop form. A proposed future prediction point control algorithm is used to calculate the vehicle's lateral error in order to improve the performance of the trajectory tracking. A feedback sensor signal from the steering wheel angle and yaw rate sensor is used as feedback information for the controller. The controller consists of a relationship between the future point lateral error, the linear velocity, the heading error and the reference yaw rate. This paper also introduces a spike detection algorithm to track the spike error that occurs during GPS reading. The proposed idea is to take the advantage of the derivative of the steering rate. This paper aims to tackle the lateral error problem by applying the steering control law to the vehicle, and proposes a new path tracking control method by considering the future coordinate of the vehicle and the future estimated lateral error. The effectiveness of the proposed controller is demonstrated by a simulation and a GPS experiment with noisy data. The approach used in this paper is not limited to autonomous vehicles alone since the concept of autonomous vehicle tracking can be used in mobile robot platforms, as the kinematic model of these two platforms is similar.

  19. Detection and treatment of chemical weapons and/or biological pathogens

    Science.gov (United States)

    Mariella Jr., Raymond P.

    2004-09-07

    A system for detection and treatment of chemical weapons and/or biological pathogens uses a detector system, an electrostatic precipitator or scrubber, a circulation system, and a control. The precipitator or scrubber is activated in response to a signal from the detector upon the detection of chemical weapons and/or biological pathogens.

  20. 9 CFR 113.36 - Detection of pathogens by the chicken inoculation test.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Detection of pathogens by the chicken... REQUIREMENTS Standard Procedures § 113.36 Detection of pathogens by the chicken inoculation test. The test for...,000 doses. (b) At least 25 healthy susceptible young chickens, properly identified and obtained from...

  1. 9 CFR 113.37 - Detection of pathogens by the chicken embryo inoculation test.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Detection of pathogens by the chicken... VECTORS STANDARD REQUIREMENTS Standard Procedures § 113.37 Detection of pathogens by the chicken embryo...-serum mixture shall be inoculated into each of at least 20 fully susceptible chicken embryos. (1) Twenty...

  2. An Autonomous Wearable System for Predicting and Detecting Localised Muscle Fatigue

    Directory of Open Access Journals (Sweden)

    Martin Colley

    2011-01-01

    Full Text Available Muscle fatigue is an established area of research and various types of muscle fatigue have been clinically investigated in order to fully understand the condition. This paper demonstrates a non-invasive technique used to automate the fatigue detection and prediction process. The system utilises the clinical aspects such as kinematics and surface electromyography (sEMG of an athlete during isometric contractions. Various signal analysis methods are used illustrating their applicability in real-time settings. This demonstrated system can be used in sports scenarios to promote muscle growth/performance or prevent injury. To date, research on localised muscle fatigue focuses on the clinical side and lacks the implementation for detecting/predicting localised muscle fatigue using an autonomous system. Results show that automating the process of localised muscle fatigue detection/prediction is promising. The autonomous fatigue system was tested on five individuals showing 90.37% accuracy on average of correct classification and an error of 4.35% in predicting the time to when fatigue will onset.

  3. An Autonomous Wearable System for Predicting and Detecting Localised Muscle Fatigue

    Science.gov (United States)

    Al-Mulla, Mohamed R.; Sepulveda, Francisco; Colley, Martin

    2011-01-01

    Muscle fatigue is an established area of research and various types of muscle fatigue have been clinically investigated in order to fully understand the condition. This paper demonstrates a non-invasive technique used to automate the fatigue detection and prediction process. The system utilises the clinical aspects such as kinematics and surface electromyography (sEMG) of an athlete during isometric contractions. Various signal analysis methods are used illustrating their applicability in real-time settings. This demonstrated system can be used in sports scenarios to promote muscle growth/performance or prevent injury. To date, research on localised muscle fatigue focuses on the clinical side and lacks the implementation for detecting/predicting localised muscle fatigue using an autonomous system. Results show that automating the process of localised muscle fatigue detection/prediction is promising. The autonomous fatigue system was tested on five individuals showing 90.37% accuracy on average of correct classification and an error of 4.35% in predicting the time to when fatigue will onset. PMID:22319367

  4. Automatic detection and classification of obstacles with applications in autonomous mobile robots

    Science.gov (United States)

    Ponomaryov, Volodymyr I.; Rosas-Miranda, Dario I.

    2016-04-01

    Hardware implementation of an automatic detection and classification of objects that can represent an obstacle for an autonomous mobile robot using stereo vision algorithms is presented. We propose and evaluate a new method to detect and classify objects for a mobile robot in outdoor conditions. This method is divided in two parts, the first one is the object detection step based on the distance from the objects to the camera and a BLOB analysis. The second part is the classification step that is based on visuals primitives and a SVM classifier. The proposed method is performed in GPU in order to reduce the processing time values. This is performed with help of hardware based on multi-core processors and GPU platform, using a NVIDIA R GeForce R GT640 graphic card and Matlab over a PC with Windows 10.

  5. Canine Detection of the Volatilome: A Review of Implications for Pathogen and Disease Detection.

    Science.gov (United States)

    Angle, Craig; Waggoner, Lowell Paul; Ferrando, Arny; Haney, Pamela; Passler, Thomas

    2016-01-01

    The volatilome is the entire set of volatile organic compounds (VOC) produced by an organism. The accumulation of VOC inside and outside of the body reflects the unique metabolic state of an organism. Scientists are developing technologies to non-invasively detect VOC for the purposes of medical diagnosis, therapeutic monitoring, disease outbreak containment, and disease prevention. Detection dogs are proven to be a valuable real-time mobile detection technology for the detection of VOC related to explosives, narcotics, humans, and many other targets of interests. Little is known about what dogs are detecting when searching for biological targets. It is important to understand where biological VOC originates and how dogs might be able to detect biological targets. This review paper discusses the recent scientific literature involving VOC analysis and postulates potential biological targets for canine detection. Dogs have shown their ability to detect pathogen and disease-specific VOC. Future research will determine if dogs can be employed operationally in hospitals, on borders, in underserved areas, on farms, and in other operational environments to give real-time feedback on the presence of a biological target.

  6. Medium-resolution autonomous in situ gamma detection system for marine and coastal waters

    International Nuclear Information System (INIS)

    Schwantes, J.M.; Addleman, R.S.; Davidson, J.D.; Douglas, M.; Meier, D.; Mullen, O.D.; Myjak, M.; Jones, M.E.; Woodring, M.L.; Johnson, B.; Santschi, P.H.

    2009-01-01

    We are developing a medium-resolution autonomous in situ gamma detection system for marine and coastal waters. The system is designed to extract and preconcentrate isotopes of interest from natural waters prior to detection in order to eliminate signal attenuation of the gamma rays traveling through water and lower the overall background from the presence of naturally occurring radioactive isotopes ( 40 K and U-Th series radionuclides). Filtration is used to preconcentrate target isotopes residing on suspended particles, while chemosorption is employed to preferentially extract truly dissolved components from the water column. Used filter and chemosorbent media will be counted autonomously using two LaBr 3 detectors in a near 4-π configuration around the samples. A compact digital pulse processing system, developed in-house and capable of running in coincidence mode, is used to process the signal from the detectors to a small on-board computer. The entire system is extremely compact (9' dia. x 30' len.) and platform independent, but designed for initial deployment on a research buoy. A variety of commercial and in-house nano-porous chemosorbents have been selected, procured or produced, and these and filter and detector components have been tested. (author)

  7. Using an autonomous Wave Glider to detect seawater anomalies related to submarine groundwater discharge - engineering challenge

    Science.gov (United States)

    Leibold, P.; Brueckmann, W.; Schmidt, M.; Balushi, H. A.; Abri, O. A.

    2017-12-01

    Coastal aquifer systems are amongst the most precious and vulnerable water resources worldwide. While differing in lateral and vertical extent they commonly show a complex interaction with the marine realm. Excessive groundwater extraction can cause saltwater intrusion from the sea into the aquifers, having a strongly negative impact on the groundwater quality. While the reverse pathway, the discharge of groundwater into the sea is well understood in principle, it's mechanisms and quantities not well constrained. We will present a project that combines onshore monitoring and modeling of groundwater in the coastal plain of Salalah, Oman with an offshore autonomous robotic monitoring system, the Liquid Robotics Wave Glider. Eventually, fluxes detected by the Wave Glider system and the onshore monitoring of groundwater will be combined into a 3-D flow model of the coastal and deeper aquifers. The main tool for offshore SGD investigation project is a Wave Glider, an autonomous vehicle based on a new propulsion technology. The Wave Glider is a low-cost satellite-connected marine craft, consisting of a combination of a sea-surface and an underwater component which is propelled by the conversion of ocean wave energy into forward thrust. While the wave energy propulsion system is purely mechanical, electrical energy for onboard computers, communication and sensors is provided by photovoltaic cells. For the project the SGD Wave Glider is being equipped with dedicated sensors to measure temperature, conductivity, Radon isotope (222Rn, 220Rn) activity concentration as well as other tracers of groundwater discharge. Dedicated software using this data input will eventually allow the Wave Glider to autonomously collect information and actively adapt its search pattern to hunt for spatial and temporal anomalies. Our presentation will focus on the engineering and operational challenges ofdetecting submarine groundwater discharges with the Wave Glider system in the Bay of Salalah

  8. Bio-Inspired Autonomous Communications Systems with Anomaly Detection Monitoring, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — We propose to develop and demonstrate BioComm, a bio-inspired autonomous communications system (ACS) aimed at dynamically reconfiguring and redeploying autonomous...

  9. Quantitative detection of pathogens in centrifugal microfluidic disks

    Science.gov (United States)

    Koh, Chung-Yan; Schaff, Ulrich Y.; Sommer, Gregory Jon

    2018-02-27

    A system and methods for detection of a nucleic acid including forming a plurality of nucleic acid detection complexes are described, each of the complexes including a nucleic acid analyte, a detection agent and a functionalized probe. The method further including binding the nucleic acid detection complexes to a plurality of functionalized particles in a fluid sample and separating the functionalized particles having the nucleic acid detection complexes bound thereto from the fluid sample using a density media. The nucleic acid analyte is detected by detecting the detection agent.

  10. Detection of cardiovascular autonomic neuropathy using exercise testing in patients with type 2 diabetes mellitus.

    Science.gov (United States)

    Banthia, Smriti; Bergner, Daniel W; Chicos, Alexandru B; Ng, Jason; Pelchovitz, Daniel J; Subacius, Haris; Kadish, Alan H; Goldberger, Jeffrey J

    2013-01-01

    This study investigated autonomic nervous system function in subjects with diabetes during exercise and recovery. Eighteen type 2 diabetics (age 55±2 years) and twenty healthy controls (age 51±1 years) underwent two 16-min bicycle submaximal ECG stress tests followed by 45 min of recovery. During session #2, atropine (0.04 mg/kg) was administered at peak exercise, and the final two minutes of exercise and entire recovery occurred under parasympathetic blockade. Plasma catecholamines were measured throughout. Parasympathetic effect was defined as the difference between a measured parameter at baseline and after parasympathetic blockade. The parasympathetic effect on the RR interval was blunted (P=.004) in diabetic subjects during recovery. Parasympathetic effect on QT-RR slope during early recovery was diminished in the diabetes group (diabetes 0.13±0.02, control 0.21±0.02, P=.03). Subjects with diabetes had a lower heart rate recovery at 1 min (diabetes 18.5±1.9 bpm, control 27.6±1.5 bpm, Pdiabetes, even with minimal evidence of CAN using current methodology, altered cardiac autonomic balance is present and can be detected through an exercise-based assessment for CAN. The early post-exercise recovery period in diabetes was characterized by enhanced sympathoexcitation, diminished parasympathetic reactivation and delay in heart rate recovery. Copyright © 2013 Elsevier Inc. All rights reserved.

  11. 360-Degree Visual Detection and Target Tracking on an Autonomous Surface Vehicle

    Science.gov (United States)

    Wolf, Michael T; Assad, Christopher; Kuwata, Yoshiaki; Howard, Andrew; Aghazarian, Hrand; Zhu, David; Lu, Thomas; Trebi-Ollennu, Ashitey; Huntsberger, Terry

    2010-01-01

    This paper describes perception and planning systems of an autonomous sea surface vehicle (ASV) whose goal is to detect and track other vessels at medium to long ranges and execute responses to determine whether the vessel is adversarial. The Jet Propulsion Laboratory (JPL) has developed a tightly integrated system called CARACaS (Control Architecture for Robotic Agent Command and Sensing) that blends the sensing, planning, and behavior autonomy necessary for such missions. Two patrol scenarios are addressed here: one in which the ASV patrols a large harbor region and checks for vessels near a fixed asset on each pass and one in which the ASV circles a fixed asset and intercepts approaching vessels. This paper focuses on the ASV's central perception and situation awareness system, dubbed Surface Autonomous Visual Analysis and Tracking (SAVAnT), which receives images from an omnidirectional camera head, identifies objects of interest in these images, and probabilistically tracks the objects' presence over time, even as they may exist outside of the vehicle's sensor range. The integrated CARACaS/SAVAnT system has been implemented on U.S. Navy experimental ASVs and tested in on-water field demonstrations.

  12. Prevalence and pattern of cardiac autonomic dysfunction in newly detected type 2 diabetes mellitus.

    Science.gov (United States)

    Jyotsna, Viveka P; Sahoo, Abhay; Sreenivas, V; Deepak, K K

    2009-01-01

    Cardiac autonomic functions were assessed in 145 consecutive recently detected type 2 diabetics. Ninety-nine healthy persons served as controls. Criteria for normalcy were, heart rate variation during deep breathing >or=15 beats/min, deep breathing expiratory to inspiratory R-R ratio >or=1.21, Valsalva ratio >or=1.21, sustained handgrip test >or=16 mm of mercury, cold pressor test >or=10, BP response to standing or=1.04. An abnormal test was defined as the above parameters being or=30 mm of mercury and autonomic function was normal in 7.8% patients and 32.5% healthy controls.

  13. Human pathogens in plant biofilms: Formation, physiology, and detection

    Science.gov (United States)

    Fresh produce, viewed as an essential part of a healthy life style is usually consumed in the form of raw or minimally processed fruits and vegetables, and is a potentially important source of food-borne human pathogenic bacteria and viruses. These are passed on to the consumer since the bacteria ca...

  14. Pathogen detection and gut bacteria identification in Apis cerana ...

    African Journals Online (AJOL)

    acer

    other lactic acid bacteria, were isolated from larvae and adult workers, but gave conflicting preliminary identities based on their biochemistry-morphology versus sequence analysis of a partial fragment (1.4 kb) of their 16S rRNA. Key words: Apis cerana indica, bee pathogens, gut bacteria, multiplex polymerase chain ...

  15. Fluorescence techniques to detect and to assess viability of plant pathogenic bacteria

    NARCIS (Netherlands)

    Chitarra, L.G.

    2001-01-01

    Plant pathogenic bacteria cause major economic losses in commercial crop production worldwide every year. The current methods used to detect and to assess the viability of bacterial pathogens and to test seed lots or plants for contamination are usually based on plate assays or on

  16. Microfluidic devices for sample preparation and rapid detection of foodborne pathogens.

    Science.gov (United States)

    Kant, Krishna; Shahbazi, Mohammad-Ali; Dave, Vivek Priy; Ngo, Tien Anh; Chidambara, Vinayaka Aaydha; Than, Linh Quyen; Bang, Dang Duong; Wolff, Anders

    2018-03-10

    Rapid detection of foodborne pathogens at an early stage is imperative for preventing the outbreak of foodborne diseases, known as serious threats to human health. Conventional bacterial culturing methods for foodborne pathogen detection are time consuming, laborious, and with poor pathogen diagnosis competences. This has prompted researchers to call the current status of detection approaches into question and leverage new technologies for superior pathogen sensing outcomes. Novel strategies mainly rely on incorporating all the steps from sample preparation to detection in miniaturized devices for online monitoring of pathogens with high accuracy and sensitivity in a time-saving and cost effective manner. Lab on chip is a blooming area in diagnosis, which exploits different mechanical and biological techniques to detect very low concentrations of pathogens in food samples. This is achieved through streamlining the sample handling and concentrating procedures, which will subsequently reduce human errors and enhance the accuracy of the sensing methods. Integration of sample preparation techniques into these devices can effectively minimize the impact of complex food matrix on pathogen diagnosis and improve the limit of detections. Integration of pathogen capturing bio-receptors on microfluidic devices is a crucial step, which can facilitate recognition abilities in harsh chemical and physical conditions, offering a great commercial benefit to the food-manufacturing sector. This article reviews recent advances in current state-of-the-art of sample preparation and concentration from food matrices with focus on bacterial capturing methods and sensing technologies, along with their advantages and limitations when integrated into microfluidic devices for online rapid detection of pathogens in foods and food production line. Copyright © 2018. Published by Elsevier Inc.

  17. DETECTION AND IDENTIFICATION OF PATHOGENIC CANDIDA SPECIES IN WATER USING FLOW CYTOMETRY COUPLED WITH TAQMAN PCR

    Science.gov (United States)

    As the incidence of human fungal infection increases, the ability to detect and identify pathogenic fungi in potential environmental reservoirs becomes increasingly important for disease control. PCR based assays are widely used for diagnostic purposes, but may be inadequate for...

  18. Detection of Seed-Borne Fungal pathogens on Soya beans

    International Nuclear Information System (INIS)

    Wanyera, R

    2002-01-01

    Soya beans (Glycine max max L.) are propagated by seed and are vulnerable to devastating seed-borne diseases where the importance of each disease varies greatly. Seed-borne diseases cause significant losses in seed, food production and quality of seed and grain. Studies on seed borne diseases in Kenya have not been given emphasis on very important seed crops among the soya beans. The identification and rejection of the seed crop is mainly based on visual appraisal in the field with little or no laboratory work undertaken. Three methods were used to analyse the health status of fifty two soyabean seed samples collected from the National Plant Breeding Research Centre-Njoro and farmers' fields in Bahati division of Nakuru district. The analysis was carried out in the laboratory. The objective of the analysis was to identify and inventory seed-borne fungal pathogens of soya beans grown in Kenya. The normal blotter, herbicide and germination test methods were used. The tests revealed the presence of several important fungal pathogens on soyabean seed samples. Among the pathogens recorded Phoma sp, phomopsis sp, fusarium sp, Hainesia lyhri and Cercospora kikuchii were frequently recorded on the seed samples. Results of the germination test between paper method showed low germination (0-6.7%) on the normal sedlings in all the test samples. Hainesia lyhri was a new record on the soyabean seeds

  19. High Throughput Sequencing for Detection of Foodborne Pathogens

    Directory of Open Access Journals (Sweden)

    Camilla Sekse

    2017-10-01

    Full Text Available High-throughput sequencing (HTS is becoming the state-of-the-art technology for typing of microbial isolates, especially in clinical samples. Yet, its application is still in its infancy for monitoring and outbreak investigations of foods. Here we review the published literature, covering not only bacterial but also viral and Eukaryote food pathogens, to assess the status and potential of HTS implementation to inform stakeholders, improve food safety and reduce outbreak impacts. The developments in sequencing technology and bioinformatics have outpaced the capacity to analyze and interpret the sequence data. The influence of sample processing, nucleic acid extraction and purification, harmonized protocols for generation and interpretation of data, and properly annotated and curated reference databases including non-pathogenic “natural” strains are other major obstacles to the realization of the full potential of HTS in analytical food surveillance, epidemiological and outbreak investigations, and in complementing preventive approaches for the control and management of foodborne pathogens. Despite significant obstacles, the achieved progress in capacity and broadening of the application range over the last decade is impressive and unprecedented, as illustrated with the chosen examples from the literature. Large consortia, often with broad international participation, are making coordinated efforts to cope with many of the mentioned obstacles. Further rapid progress can therefore be prospected for the next decade.

  20. An improved specimens handling procedure for pathogen detection of the cerebrospinal fluid by microscope

    Directory of Open Access Journals (Sweden)

    WANG Hua-cheng

    2013-02-01

    Full Text Available Background The diagnosis of encephalitis depends on the finding of pathogens in the brain parenchyma or cerebrospinal fluid (CSF. But the success rates of finding pathogens by microscope are low by the traditional specimens handling procedure in which pathogens are detected by direct centrifugation of CSF getting from lumbar puncture. The process of pathogen collection from the CSF such as centrifugation and washing would cause the destruction and loss of pathogens, resulting in a lower rate of pathogen discovery. Therefore, in order to increase the detection rate of pathogenic microorganisms in CSF, these traditional steps need to be improved. Methods CSF samples of 23 patients with suspected viral encephalitis and 10 control patients with fracture were prepared by two methods: traditional specimens handling procedure (TSHP and improved specimens handling procedure (ISHP. In the ISHP, a final concentration of 2.5% glutaraldehyde was added to CSF in a glass tube, mixed and kept not moving in 4 ℃ for 2 to 4 h or in 37 ℃for 1 h. Then a smear was made from the sediment formed in the tube to check pathogens by microscope. As for the TSHP, pathogens were collected by direct centrifugation of CSF which had not been treated after lumbar puncture, and checked through Gimenze staining. Results There was no statistically significant difference between the two dealing procedures in the control group ( P = 1.000. As for the case group, there were 10 cases showing positive in Pandy test after TSHP, and visible sediments were seen in all the 23 cases after ISHP. There was statistically significant difference between two kinds of CSF treatment for the finding of pathogens (P = 0.000. Seven cases presented pathogen growth in CSF and were diagosed as rickettsial infections by Gimenze staining, immunofluorescence assay (IFA and polymerase chain reaction (PCR. Conclusion Improved specimens handling procedures of CSF contribute to the seperation of cells

  1. Rapid Methods for the Detection of Foodborne Bacterial Pathogens: Principles, Applications, Advantages and Limitations

    Directory of Open Access Journals (Sweden)

    Law eJodi Woan-Fei

    2015-01-01

    Full Text Available The incidence of foodborne diseases has increased over the years and resulted in major public health problem globally. Foodborne pathogens can be found in various foods and it is important to detect foodborne pathogens to provide safe food supply and to prevent foodborne diseases. The conventional methods used to detect foodborne pathogen are time consuming and laborious. Hence, a variety of methods have been developed for rapid detection of foodborne pathogens as it is required in many food analyses. Rapid detection methods can be categorized into nucleic acid-based, biosensor-based and immunological-based methods. This review emphasizes on the principles and application of recent rapid methods for the detection of foodborne bacterial pathogens. Detection methods included are simple polymerase chain reaction (PCR, multiplex PCR, real-time PCR, nucleic acid sequence-based amplification (NASBA, loop-mediated isothermal amplification (LAMP and oligonucleotide DNA microarray which classified as nucleic acid-based methods; optical, electrochemical and mass-based biosensors which classified as biosensor-based methods; enzyme-linked immunosorbent assay (ELISA and lateral flow immunoassay which classified as immunological-based methods. In general, rapid detection methods are generally time-efficient, sensitive, specific and labor-saving. The developments of rapid detection methods are vital in prevention and treatment of foodborne diseases.

  2. An autonomous surface discontinuity detection and quantification method by digital image correlation and phase congruency

    Science.gov (United States)

    Cinar, A. F.; Barhli, S. M.; Hollis, D.; Flansbjer, M.; Tomlinson, R. A.; Marrow, T. J.; Mostafavi, M.

    2017-09-01

    Digital image correlation has been routinely used to measure full-field displacements in many areas of solid mechanics, including fracture mechanics. Accurate segmentation of the crack path is needed to study its interaction with the microstructure and stress fields, and studies of crack behaviour, such as the effect of closure or residual stress in fatigue, require data on its opening displacement. Such information can be obtained from any digital image correlation analysis of cracked components, but it collection by manual methods is quite onerous, particularly for massive amounts of data. We introduce the novel application of Phase Congruency to detect and quantify cracks and their opening. Unlike other crack detection techniques, Phase Congruency does not rely on adjustable threshold values that require user interaction, and so allows large datasets to be treated autonomously. The accuracy of the Phase Congruency based algorithm in detecting cracks is evaluated and compared with conventional methods such as Heaviside function fitting. As Phase Congruency is a displacement-based method, it does not suffer from the noise intensification to which gradient-based methods (e.g. strain thresholding) are susceptible. Its application is demonstrated to experimental data for cracks in quasi-brittle (Granitic rock) and ductile (Aluminium alloy) materials.

  3. Nucleic Acid-based Detection of Bacterial Pathogens Using Integrated Microfluidic Platform Systems

    Directory of Open Access Journals (Sweden)

    Carl A. Batt

    2009-05-01

    Full Text Available The advent of nucleic acid-based pathogen detection methods offers increased sensitivity and specificity over traditional microbiological techniques, driving the development of portable, integrated biosensors. The miniaturization and automation of integrated detection systems presents a significant advantage for rapid, portable field-based testing. In this review, we highlight current developments and directions in nucleic acid-based micro total analysis systems for the detection of bacterial pathogens. Recent progress in the miniaturization of microfluidic processing steps for cell capture, DNA extraction and purification, polymerase chain reaction, and product detection are detailed. Discussions include strategies and challenges for implementation of an integrated portable platform.

  4. Detection of foodborne pathogens by qPCR: A practical approach for food industry applications

    Directory of Open Access Journals (Sweden)

    María-José Chapela

    2015-12-01

    Full Text Available Microbiological analysis of food is an integrated part of microbial safety management in the food chain. Monitoring and controlling foodborne pathogens are traditionally carried out by conventional microbiological methods based on culture-dependent approaches in control laboratories and private companies. However, polymerase chain reaction (PCR has revolutionized microbiological analysis allowing detection of pathogenic microorganisms in food, without the necessity of classical isolation and identification. However, at present, PCR and quantitative polymerase chain reaction (qPCR are essential analytical tools for researchers working in the field of foodborne pathogens. This manuscript reviews recently described qPCR methods applied for foodborne bacteria detection, serving as economical, safe, and reliable alternatives for application in the food industry and control laboratories. Multiplex qPCR, which allows the simultaneous detection of more than one pathogen in one single reaction, saving considerable effort, time, and money, is emphasized in the article.

  5. Detection of Foodborne Pathogenic Bacteria using Bacteriophage Tail Spike Proteins

    Science.gov (United States)

    Poshtiban, Somayyeh

    Foodborne infections are worldwide health problem with tremendous social and financial impacts. Efforts are focused on developing accurate and reliable technologies for detection of food contaminations in early stages preferably on-site. This thesis focuses on interfacing engineering and biology by combining phage receptor binding proteins (RBPs) with engineered platforms including microresonator-based biosensors, magnetic particles and polymerase chain reaction (PCR) to develop bacterial detection sensors. We used phage RBPs as target specific bioreceptors to develop an enhanced microresonator array for bacterial detection. These resonator beams are optimized to feature a high natural frequency while offer large surface area for capture of bacteria. Theoretical analysis indicates a high mass sensitivity with a threshold for the detection of a single bacterial cell. We used phage RBPs as target specific bioreceptors, and successfully demonstrated the application of these phage RBB-immobilized arrays for specific detection of C. jejuni cells. We also developed a RBP-derivatized magnetic pre-enrichment method as an upstream sample preparation method to improve sensitivity and specificity of PCR for detection of bacterial cells in various food samples. The combination of RBP-based magnetic separation and real-time PCR allowed the detection of small number of bacteria in artificially contaminated food samples without any need for time consuming pre-enrichment step through culturing. We also looked into integration of the RBP-based magnetic separation with PCR onto a single microfluidic lab-on-a-chip to reduce the overall turnaround time.

  6. Using infrared HOG-based pedestrian detection for outdoor autonomous searching UAV with embedded system

    Science.gov (United States)

    Shao, Yanhua; Mei, Yanying; Chu, Hongyu; Chang, Zhiyuan; He, Yuxuan; Zhan, Huayi

    2018-04-01

    Pedestrian detection (PD) is an important application domain in computer vision and pattern recognition. Unmanned Aerial Vehicles (UAVs) have become a major field of research in recent years. In this paper, an algorithm for a robust pedestrian detection method based on the combination of the infrared HOG (IR-HOG) feature and SVM is proposed for highly complex outdoor scenarios on the basis of airborne IR image sequences from UAV. The basic flow of our application operation is as follows. Firstly, the thermal infrared imager (TAU2-336), which was installed on our Outdoor Autonomous Searching (OAS) UAV, is used for taking pictures of the designated outdoor area. Secondly, image sequences collecting and processing were accomplished by using high-performance embedded system with Samsung ODROID-XU4 and Ubuntu as the core and operating system respectively, and IR-HOG features were extracted. Finally, the SVM is used to train the pedestrian classifier. Experiment show that, our method shows promising results under complex conditions including strong noise corruption, partial occlusion etc.

  7. Landmark navigation and autonomous landing approach with obstacle detection for aircraft

    Science.gov (United States)

    Fuerst, Simon; Werner, Stefan; Dickmanns, Dirk; Dickmanns, Ernst D.

    1997-06-01

    A machine perception system for aircraft and helicopters using multiple sensor data for state estimation is presented. By combining conventional aircraft sensor like gyros, accelerometers, artificial horizon, aerodynamic measuring devices and GPS with vision data taken by conventional CCD-cameras mounted on a pan and tilt platform, the position of the craft can be determined as well as the relative position to runways and natural landmarks. The vision data of natural landmarks are used to improve position estimates during autonomous missions. A built-in landmark management module decides which landmark should be focused on by the vision system, depending on the distance to the landmark and the aspect conditions. More complex landmarks like runways are modeled with different levels of detail that are activated dependent on range. A supervisor process compares vision data and GPS data to detect mistracking of the vision system e.g. due to poor visibility and tries to reinitialize the vision system or to set focus on another landmark available. During landing approach obstacles like trucks and airplanes can be detected on the runway. The system has been tested in real-time within a hardware-in-the-loop simulation. Simulated aircraft measurements corrupted by noise and other characteristic sensor errors have been fed into the machine perception system; the image processing module for relative state estimation was driven by computer generated imagery. Results from real-time simulation runs are given.

  8. Microfluidic devices for sample preparation and rapid detection of foodborne pathogens

    DEFF Research Database (Denmark)

    Kant, Krishna; Shahbazi, Mohammad-Ali; Dave, Vivek Priy

    2018-01-01

    and improve the limit of detections. Integration of pathogen capturing bio-receptors on microfluidic devices is a crucial step, which can facilitate recognition abilities in harsh chemical and physical conditions, offering a great commercial benefit to the food-manufacturing sector. This article reviews...... diagnosis competences. This has prompted researchers to call the current status of detection approaches into question and leverage new technologies for superior pathogen sensing outcomes. Novel strategies mainly rely on incorporating all the steps from sample preparation to detection in miniaturized devices...... recent advances in current state-of-the-art of sample preparation and concentration from food matrices with focus on bacterial capturing methods and sensing technologies, along with their advantages and limitations when integrated into microfluidic devices for online rapid detection of pathogens in foods...

  9. High throughput screening strategies and technology platforms for detection of pathogens: An Introduction

    Science.gov (United States)

    Globally, foodborne pathogens are a major public health concern. In this chapter, we provide a broad description of the problem of food-borne diseases and current and future detection technologies for food safety assurance and prevention of foodborne illnesses. Current detection approaches include s...

  10. Use of Metagenomic Shotgun Sequencing Technology To Detect Foodborne Pathogens within the Microbiome of the Beef Production Chain

    OpenAIRE

    Yang, Xiang; Noyes, Noelle R.; Doster, Enrique; Martin, Jennifer N.; Linke, Lyndsey M.; Magnuson, Roberta J.; Yang, Hua; Geornaras, Ifigenia; Woerner, Dale R.; Jones, Kenneth L.; Ruiz, Jaime; Boucher, Christina; Morley, Paul S.; Belk, Keith E.

    2016-01-01

    Foodborne illnesses associated with pathogenic bacteria are a global public health and economic challenge. The diversity of microorganisms (pathogenic and nonpathogenic) that exists within the food and meat industries complicates efforts to understand pathogen ecology. Further, little is known about the interaction of pathogens within the microbiome throughout the meat production chain. Here, a metagenomic approach and shotgun sequencing technology were used as tools to detect pathogenic bact...

  11. Biocontrol and Rapid Detection of Food-borne Pathogens Using Bacteriophages and Endolysins

    Directory of Open Access Journals (Sweden)

    Jaewoo eBai

    2016-04-01

    Full Text Available Bacteriophages have been suggested as natural food preservatives as well as rapid detection materials for food-borne pathogens in various foods. Since Listeria monocytogenes-targeting phage cocktail (ListShield was approved for applications in foods, numerous phages have been screened and experimentally characterized for phage applications in foods. A single phage and phage cocktail treatments to various foods contaminated with food-borne pathogens including E. coli O157:H7, Salmonella enterica, Campylobacter jejuni, Listeria monocytogenes, Staphylococcus aureus, Cronobacter sakazakii, and Vibrio spp. revealed that they have great potential to control various food-borne pathogens and may be alternative for conventional food preservatives. In addition, phage-derived endolysins with high host specificity and host lysis activities may be preferred to food applications rather than phages. For rapid detection of food-borne pathogens, cell-wall binding domains (CBDs from endolysins have been suggested due to their high host-specific binding. Fluorescence-tagged CBDs have been successfully evaluated and suggested to be alternative materials of expensive antibodies for various detection applications. Most recently, reporter phage systems have been developed and tested to confirm their usability and accuracy for specific detection. These systems revealed some advantages like rapid detection of only viable pathogenic cells without interference by food components in a very short reaction time, suggesting that these systems may be suitable for monitoring of pathogens in foods. Consequently, phage is the next-generation biocontrol agent as well as rapid detection tool to confirm and even identify the food-borne pathogens present in various foods.

  12. Molecular Detection and Characterization of Tick-borne Pathogens in Dogs and Ticks from Nigeria

    Science.gov (United States)

    Kamani, Joshua; Baneth, Gad; Mumcuoglu, Kosta Y.; Waziri, Ndadilnasiya E.; Eyal, Osnat; Guthmann, Yifat; Harrus, Shimon

    2013-01-01

    Background Only limited information is currently available on the prevalence of vector borne and zoonotic pathogens in dogs and ticks in Nigeria. The aim of this study was to use molecular techniques to detect and characterize vector borne pathogens in dogs and ticks from Nigeria. Methodology/Principal Findings Blood samples and ticks (Rhipicephalus sanguineus, Rhipicephalus turanicus and Heamaphysalis leachi) collected from 181 dogs from Nigeria were molecularly screened for human and animal vector-borne pathogens by PCR and sequencing. DNA of Hepatozoon canis (41.4%), Ehrlichia canis (12.7%), Rickettsia spp. (8.8%), Babesia rossi (6.6%), Anaplasma platys (6.6%), Babesia vogeli (0.6%) and Theileria sp. (0.6%) was detected in the blood samples. DNA of E. canis (23.7%), H. canis (21.1%), Rickettsia spp. (10.5%), Candidatus Neoehrlichia mikurensis (5.3%) and A. platys (1.9%) was detected in 258 ticks collected from 42 of the 181 dogs. Co- infections with two pathogens were present in 37% of the dogs examined and one dog was co-infected with 3 pathogens. DNA of Rickettsia conorii israelensis was detected in one dog and Rhipicephalus sanguineus tick. DNA of another human pathogen, Candidatus N. mikurensis was detected in Rhipicephalus sanguineus and Heamaphysalis leachi ticks, and is the first description of Candidatus N. mikurensis in Africa. The Theileria sp. DNA detected in a local dog in this study had 98% sequence identity to Theileria ovis from sheep. Conclusions/Significance The results of this study indicate that human and animal pathogens are abundant in dogs and their ticks in Nigeria and portray the potential high risk of human exposure to infection with these agents. PMID:23505591

  13. Molecular detection and characterization of tick-borne pathogens in dogs and ticks from Nigeria.

    Directory of Open Access Journals (Sweden)

    Joshua Kamani

    Full Text Available BACKGROUND: Only limited information is currently available on the prevalence of vector borne and zoonotic pathogens in dogs and ticks in Nigeria. The aim of this study was to use molecular techniques to detect and characterize vector borne pathogens in dogs and ticks from Nigeria. METHODOLOGY/PRINCIPAL FINDINGS: Blood samples and ticks (Rhipicephalus sanguineus, Rhipicephalus turanicus and Heamaphysalis leachi collected from 181 dogs from Nigeria were molecularly screened for human and animal vector-borne pathogens by PCR and sequencing. DNA of Hepatozoon canis (41.4%, Ehrlichia canis (12.7%, Rickettsia spp. (8.8%, Babesia rossi (6.6%, Anaplasma platys (6.6%, Babesia vogeli (0.6% and Theileria sp. (0.6% was detected in the blood samples. DNA of E. canis (23.7%, H. canis (21.1%, Rickettsia spp. (10.5%, Candidatus Neoehrlichia mikurensis (5.3% and A. platys (1.9% was detected in 258 ticks collected from 42 of the 181 dogs. Co- infections with two pathogens were present in 37% of the dogs examined and one dog was co-infected with 3 pathogens. DNA of Rickettsia conorii israelensis was detected in one dog and Rhipicephalus sanguineus tick. DNA of another human pathogen, Candidatus N. mikurensis was detected in Rhipicephalus sanguineus and Heamaphysalis leachi ticks, and is the first description of Candidatus N. mikurensis in Africa. The Theileria sp. DNA detected in a local dog in this study had 98% sequence identity to Theileria ovis from sheep. CONCLUSIONS/SIGNIFICANCE: The results of this study indicate that human and animal pathogens are abundant in dogs and their ticks in Nigeria and portray the potential high risk of human exposure to infection with these agents.

  14. Application of bioinformatics on the detection of pathogens by Pcr

    International Nuclear Information System (INIS)

    Rezig, Slim; Sakhri, Saber

    2007-01-01

    Salmonellas are the main responsible agent for the frequent food-borne gastrointestinal diseases. Their detection using classical methods are laborious and their results take a lot of time to be revealed. In this context, we tried to set up a revealing technique of the invA virulence gene, found in the majority of Salmonella species. After amplification with PCR using specific primers created and verified by bioinformatics programs, two couples of primers were set up and they appeared to be very specific and sensitive for the detection of invA gene. (Author)

  15. SERS based point-of-care detection of food-borne pathogens

    International Nuclear Information System (INIS)

    Mungroo, Nawfal Adam; Oliveira, Gustavo; Neethirajan, Suresh

    2016-01-01

    The authors have developed a microfluidic platform for improved detection of pathogenic bacteria by using silver nanoparticles and new platforms for chemometric data analysis, viz. a combination of principle component analysis and linear discriminant analysis. The method can distinguish eight key food borne pathogens (E. coli, S. typhimirium, S. enteritis, Pseudomonas aeruginosa, L. monocytogenes, L. innocua, MRSA 35 and MRSA 86) and, hence, holds good promise for use in the food industry. (author)

  16. Molecular techniques for detection and identification of pathogens in food: advantages and limitations

    OpenAIRE

    Palomino-Camargo, Carolina; Instituto de Ciencia y Tecnología de Alimentos, Facultad de Ciencias, Universidad Central de Venezuela. Caracas, Venezuela. Magíster en Ciencia y Tecnología de los Alimentos licenciada en Biología; González-Muñoz, Yuniesky; Instituto de Ciencia y Tecnología de Alimentos, Facultad de Ciencias, Universidad Central de Venezuela. Caracas, Venezuela. Ministerio del Poder Popular para la Alimentación. Caracas, Venezuela. licenciado en Ciencias de los Alimentos.

    2014-01-01

    Foodborne diseases, caused by pathogenic microorganisms, are a major public health problem worldwide. Microbiological methods commonly used in the detection of these foodborne pathogens are laborious and time consuming. This situation, coupled with the demand for immediate results and with technological advances, has led to the development of a wide range of rapid methods in recent decades. On this basis, this review describes the advantages and limitations of the main molecular methods used ...

  17. Fluorescence immunoassay for detecting periodontal bacterial pathogens in plaque.

    OpenAIRE

    Wolff, L F; Anderson, L; Sandberg, G P; Aeppli, D M; Shelburne, C E

    1991-01-01

    A particle concentration fluorescence immunoassay has been modified into a bacterial concentration fluorescence immunoassay (BCFIA) to rapidly detect periodontopathic bacteria in human plaque samples. The BCFIA utilizes fluorescently tagged monoclonal antibodies (MAbs) directed against the lipopolysaccharide of selected gram-negative plaque bacteria. Microorganisms closely associated with periodontal disease that can be identified in plaque with the BCFIA include Porphyromonas gingivalis, Bac...

  18. Increased detection of mastitis pathogens by real-time PCR compared to bacterial culture.

    Science.gov (United States)

    Keane, O M; Budd, K E; Flynn, J; McCoy, F

    2013-09-21

    Rapid and accurate identification of mastitis pathogens is important for disease control. Bacterial culture and isolate identification is considered the gold standard in mastitis diagnosis but is time consuming and results in many culture-negative samples. Identification of mastitis pathogens by PCR has been proposed as a fast and sensitive alternative to bacterial culture. The results of bacterial culture and PCR for the identification of the aetiological agent of clinical mastitis were compared. The pathogen identified by traditional culture methods was also detected by PCR in 98 per cent of cases indicating good agreement between the positive results of bacterial culture and PCR. A mastitis pathogen could not be recovered from approximately 30 per cent of samples by bacterial culture, however, an aetiological agent was identified by PCR in 79 per cent of these samples. Therefore, a mastitis pathogen was detected in significantly more milk samples by PCR than by bacterial culture (92 per cent and 70 per cent, respectively) although the clinical relevance of PCR-positive culture-negative results remains controversial. A mixed infection of two or more mastitis pathogens was also detected more commonly by PCR. Culture-negative samples due to undetected Staphylococcus aureus infections were rare. The use of PCR technology may assist in rapid mastitis diagnosis, however, accurate interpretation of PCR results in the absence of bacterial culture remains problematic.

  19. Pathogen detection, testing, and control in fresh broccoli sprouts

    Directory of Open Access Journals (Sweden)

    Fahey Jed W

    2006-04-01

    Full Text Available Abstract Background The recent increased interest in consuming green vegetable sprouts has been tempered by the fact that fresh sprouts can in some cases be vehicles for food-borne illnesses. They must be grown according to proper conditions of sanitation and handled as a food product rather than as an agricultural commodity. When sprouts are grown in accordance with the criteria proposed from within the sprout industry, developed by regulatory agencies, and adhered to by many sprouters, green sprouts can be produced with very low risk. Contamination may occur when these guidelines are not followed. Methods A one year program of microbial hold-and-release testing, conducted in concert with strict seed and facility cleaning procedures by 13 U.S. broccoli sprout growers was evaluated. Microbial contamination tests were performed on 6839 drums of sprouts, equivalent to about 5 million consumer packages of fresh green sprouts. Results Only 24 (0.75% of the 3191 sprout samples gave an initial positive test for Escherichia coli O157:H7 or Salmonella spp., and when re-tested, 3 drums again tested positive. Composite testing (e.g., pooling up to 7 drums for pathogen testing was equally sensitive to single drum testing. Conclusion By using a "test-and-re-test" protocol, growers were able to minimize crop destruction. By pooling drums for testing, they were also able to reduce testing costs which now represent a substantial portion of the costs associated with sprout growing. The test-and-hold scheme described herein allowed those few batches of contaminated sprouts to be found prior to packaging and shipping. These events were isolated, and only safe sprouts entered the food supply.

  20. Sensor fusion: lane marking detection and autonomous intelligent cruise control system

    Science.gov (United States)

    Baret, Marc; Baillarin, S.; Calesse, C.; Martin, Lionel

    1995-12-01

    In the past few years MATRA and RENAULT have developed an Autonomous Intelligent Cruise Control (AICC) system based on a LIDAR sensor. This sensor incorporating a charge coupled device was designed to acquire pulsed laser diode emission reflected by standard car reflectors. The absence of moving mechanical parts, the large field of view, the high measurement rate and the very good accuracy for distance range and angular position of targets make this sensor very interesting. It provides the equipped car with the distance and the relative speed of other vehicles enabling the safety distance to be controlled by acting on the throttle and the automatic gear box. Experiments in various real traffic situations have shown the limitations of this kind of system especially on bends. All AICC sensors are unable to distinguish between a bend and a change of lane. This is easily understood if we consider a road without lane markings. This fact has led MATRA to improve its AICC system by providing the lane marking information. Also in the scope of the EUREKA PROMETHEUS project, MATRA and RENAULT have developed a lane keeping system in order to warn of the drivers lack of vigilance. Thus, MATRA have spread this system to far field lane marking detection and have coupled it with the AICC system. Experiments will be carried out on roads to estimate the gain in performance and comfort due to this fusion.

  1. Detection of bovine mastitis pathogens by loop-mediated isothermal amplification and an electrochemical DNA chip.

    Science.gov (United States)

    Kawai, Kazuhiro; Inada, Mika; Ito, Keiko; Hashimoto, Koji; Nikaido, Masaru; Hata, Eiji; Katsuda, Ken; Kiku, Yoshio; Tagawa, Yuichi; Hayashi, Tomohito

    2017-12-22

    Bovine mastitis causes significant economic losses in the dairy industry. Effective prevention of bovine mastitis requires an understanding of the infection status of a pathogenic microorganism in a herd that has not yet shown clinical signs of mastitis and appropriate treatment specific for the pathogenic microorganism. However, bacterial identification by culture has drawbacks in that the sensitivity may be low and the procedure can be complex. In this study, we developed a genetic detection method to identify mastitis pathogens using a simple and highly sensitive electrochemical DNA chip which can specifically detect bacterial DNA in milk specimens. First, we selected microorganisms belonging to 12 families and/or genera associated with mastitis for which testing should be performed. Next, we optimized the conditions for amplifying microorganism DNA by loop-mediated isothermal amplification (LAMP) using 32 primers and the use of a DNA chip capable of measuring all pathogens simultaneously. Sample detection could be completed in just a few hours using this method. Comparison of the results obtained with our DNA chip method and those obtained by bacterial culture verified that when the culture method was set to 100%, the total positive concordance rate of the DNA chip was 85.0% and the total negative concordance rate was 86.9%. Furthermore, the proposed method allows both rapid and highly sensitive detection of mastitis pathogens. We believe that this method will contribute to the development of an effective mastitis control program.

  2. Bacterial contamination of platelet concentrates: pathogen detection and inactivation methods

    Directory of Open Access Journals (Sweden)

    Dana Védy

    2009-04-01

    Full Text Available Whereas the reduction of transfusion related viral transmission has been a priority during the last decade, bacterial infection transmitted by transfusion still remains associated to a high morbidity and mortality, and constitutes the most frequent infectious risk of transfusion. This problem especially concerns platelet concentrates because of their favorable bacterial growth conditions. This review gives an overview of platelet transfusion-related bacterial contamination as well as on the different strategies to reduce this problem by using either bacterial detection or inactivation methods.

  3. Autonomous Soil Assessment System: A Data-Driven Approach to Planetary Mobility Hazard Detection

    Science.gov (United States)

    Raimalwala, K.; Faragalli, M.; Reid, E.

    2018-04-01

    The Autonomous Soil Assessment System predicts mobility hazards for rovers. Its development and performance are presented, with focus on its data-driven models, machine learning algorithms, and real-time sensor data fusion for predictive analytics.

  4. Strategies for the detection of food pathogens and contaminants

    DEFF Research Database (Denmark)

    Hearty, Stephen; Leonard, Paul; Sheehan, Alfredo Darmanin

    2006-01-01

    We routinely use Biacore for affinity ranking and kinetic characterisation of diverse panels of hybridoma-derived and recombinant antibodies against a wide range of different clinically relevant antigens for diagnostic applications. Generally the analytes of interest are haptens or defined protei...... to date with using Biacore for analysis of food contaminants and in particular the challenges associated with large analyte detection...... molecules and once suitably high affinity antibodies have been isolated, it is relatively straightforward to design and optimise concentration-based assays using SPR. Recently we have investigated the potential of applying Biacore technology to routine food analysis. Our experiences have shown...... that molecular contaminants such as microbial toxins and drug/pesticide residues translate well onto Biacore-based assay formats. However, larger and more complex entities such as spores and whole bacterial cells represent an altogether more difficult challenge. Here, we present an overview of our experiences...

  5. Strategies for the detection of food pathogens and contaminants

    DEFF Research Database (Denmark)

    We routinely use Biacore for affinity ranking and kinetic characterisation of diverse panels of hybridoma-derived and recombinant antibodies against a wide range of different clinically relevant antigens for diagnostic applications. Generally the analytes of interest are haptens or defined protei...... to date with using Biacore for analysis of food contaminants and in particular the challenges associated with large analyte detection...... molecules and once suitably high affinity antibodies have been isolated, it is relatively straightforward to design and optimise concentration-based assays using SPR. Recently we have investigated the potential of applying Biacore technology to routine food analysis. Our experiences have shown...... that molecular contaminants such as microbial toxins and drug/pesticide residues translate well onto Biacore-based assay formats. However, larger and more complex entities such as spores and whole bacterial cells represent an altogether more difficult challenge. Here, we present an overview of our experiences...

  6. Standardization of diagnostic PCR for the detection of foodborne pathogens

    DEFF Research Database (Denmark)

    Malorny, B.; Tassios, P.T.; Radstrom, P.

    2003-01-01

    In vitro amplification of nucleic acids using the polymerase chain reaction (PCR) has become, since its discovery in the 1980s, a powerful diagnostic tool for the analysis of microbial infections as well as for the analysis of microorganisms in food samples. However, despite its potential, PCR has...... neither gained wide acceptance in routine diagnostics nor been widely incorporated in standardized methods. Lack of validation and standard protocols, as well as variable quality of reagents and equipment, influence the efficient dissemination of PCR methodology from expert research laboratories to end......-user laboratories. Moreover, the food industry understandably requires and expects officially approved standards. Recognizing this, in 1999, the European Commission approved the research project, FOOD-PCR (http://www.PCR.dk), which aims to validate and standardize the use of diagnostic PCR for the detection...

  7. Luciferase-Zinc-Finger System for the Rapid Detection of Pathogenic Bacteria.

    Science.gov (United States)

    Shi, Chu; Xu, Qing; Ge, Yue; Jiang, Ling; Huang, He

    2017-08-09

    Rapid and reliable detection of pathogenic bacteria is crucial for food safety control. Here, we present a novel luciferase-zinc finger system for the detection of pathogens that offers rapid and specific profiling. The system, which uses a zinc-finger protein domain to probe zinc finger recognition sites, was designed to bind the amplified conserved regions of 16S rDNA, and the obtained products were detected using a modified luciferase. The luciferase-zinc finger system not only maintained luciferase activity but also allowed the specific detection of different bacterial species, with a sensitivity as low as 10 copies and a linear range from 10 to 10 4 copies per microliter of the specific PCR product. Moreover, the system is robust and rapid, enabling the simultaneous detection of 6 species of bacteria in artificially contaminated samples with excellent accuracy. Thus, we envision that our luciferase-zinc finger system will have far-reaching applications.

  8. Multiplex PCR assay for simultaneous detection of six major bacterial pathogens of rice.

    Science.gov (United States)

    Cui, Z; Ojaghian, M R; Tao, Z; Kakar, K U; Zeng, J; Zhao, W; Duan, Y; Vera Cruz, C M; Li, B; Zhu, B; Xie, G

    2016-05-01

    The aim of this study was to develop a multiplex PCR (mPCR) assay for rapid, sensitive and simultaneous detection of six important rice pathogens: Xanthomonas oryzae pv. oryzae, X. oryzae pv. oryzicola, Pseudomonas fuscovaginae, Burkholderia glumae, Burkholderia gladioli and Acidovorax avenae subsp. avenae. Specific primers were designed through a bioinformatics pipeline. Sensitivity of detection was established using both traditional PCR and quantitative real-time PCR on isolated DNA and on bacterial cells both in vitro and in simulated diseased seeds and the parameters were optimized for an mPCR assay. A total of 150 bacterial strains were tested for specificity. The mPCR assay accurately predicted the presence of pathogens among 44 symptomatic and asymptomatic rice seed, sheath and leaf samples. This study confirmed that this mPCR assay is a rapid, reliable and simple tool for the simultaneous detection of six important rice bacterial pathogens. This study is the first report of a method allowing simultaneous detection of six major rice pathogens. The ability to use crude extracts from plants without bacterial isolation or DNA extraction enhances the value of this mPCR technology for rapid detection and aetiological/epidemiological studies. © 2016 The Society for Applied Microbiology.

  9. Detection of multiple potentially pathogenic bacteria in Matang mangrove estuaries, Malaysia.

    Science.gov (United States)

    Ghaderpour, Aziz; Mohd Nasori, Khairul Nazrin; Chew, Li Lee; Chong, Ving Ching; Thong, Kwai Lin; Chai, Lay Ching

    2014-06-15

    The deltaic estuarine system of the Matang Mangrove Forest Reserve of Malaysia is a site where several human settlements and brackish water aquaculture have been established. Here, we evaluated the level of fecal indicator bacteria (FIB) and the presence of potentially pathogenic bacteria in the surface water and sediments. Higher levels of FIB were detected at downstream sampling sites from the fishing village, indicating it as a possible source of anthropogenic pollution to the estuary. Enterococci levels in the estuarine sediments were higher than in the surface water, while total coliforms and E. coli in the estuarine sediments were not detected in all samples. Also, various types of potentially pathogenic bacteria, including Klebsiella pneumoniae, Serratia marcescens and Enterobacter cloacae were isolated. The results indicate that the Matang estuarine system is contaminated with various types of potential human bacterial pathogens which might pose a health risk to the public. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. Bacterial and viral pathogens detected in sea turtles stranded along the coast of Tuscany, Italy.

    Science.gov (United States)

    Fichi, G; Cardeti, G; Cersini, A; Mancusi, C; Guarducci, M; Di Guardo, G; Terracciano, G

    2016-03-15

    During 2014, six loggerhead turtles, Caretta caretta and one green turtle, Chelonia mydas, found stranded on the Tuscany coast of Italy, were examined for the presence of specific bacterial and viral agents, along with their role as carriers of fish and human pathogens. Thirteen different species of bacteria, 10 Gram negative and 3 Gram positive, were identified. Among them, two strains of Vibrio parahaemolyticus and one strain of Lactococcus garviae were recovered and confirmed by specific PCR protocols. No trh and tdh genes were detected in V. parahaemolyticus. The first isolation of L. garviae and the first detection of Betanodavirus in sea turtles indicate the possibility for sea turtles to act as carriers of fish pathogens. Furthermore, the isolation of two strains of V. parahaemolyticus highlights the possible role of these animals in human pathogens' diffusion. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Development of an Automated Microfluidic System for DNA Collection, Amplification, and Detection of Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Hagan, Bethany S.; Bruckner-Lea, Cynthia J.

    2002-12-01

    This project was focused on developing and testing automated routines for a microfluidic Pathogen Detection System. The basic pathogen detection routine has three primary components; cell concentration, DNA amplification, and detection. In cell concentration, magnetic beads are held in a flow cell by an electromagnet. Sample liquid is passed through the flow cell and bacterial cells attach to the beads. These beads are then released into a small volume of fluid and delivered to the peltier device for cell lysis and DNA amplification. The cells are lysed during initial heating in the peltier device, and the released DNA is amplified using polymerase chain reaction (PCR) or strand displacement amplification (SDA). Once amplified, the DNA is then delivered to a laser induced fluorescence detection unit in which the sample is detected. These three components create a flexible platform that can be used for pathogen detection in liquid and sediment samples. Future developments of the system will include on-line DNA detection during DNA amplification and improved capture and release methods for the magnetic beads during cell concentration.

  12. Detection of respiratory bacterial pathogens causing atypical pneumonia by multiplex Lightmix® RT-PCR.

    Science.gov (United States)

    Wagner, Karoline; Springer, Burkard; Imkamp, Frank; Opota, Onya; Greub, Gilbert; Keller, Peter M

    2018-04-01

    Pneumonia is a severe infectious disease. In addition to common viruses and bacterial pathogens (e.g. Streptococcus pneumoniae), fastidious respiratory pathogens like Chlamydia pneumoniae, Mycoplasma pneumoniae and Legionella spp. can cause severe atypical pneumonia. They do not respond to penicillin derivatives, which may cause failure of antibiotic empirical therapy. The same applies for infections with B. pertussis and B. parapertussis, the cause of pertussis disease, that may present atypically and need to be treated with macrolides. Moreover, these fastidious bacteria are difficult to identify by culture or serology, and therefore often remain undetected. Thus, rapid and accurate identification of bacterial pathogens causing atypical pneumonia is crucial. We performed a retrospective method evaluation study to evaluate the diagnostic performance of the new, commercially available Lightmix ® multiplex RT-PCR assay that detects these fastidious bacterial pathogens causing atypical pneumonia. In this retrospective study, 368 clinical respiratory specimens, obtained from patients suffering from atypical pneumonia that have been tested negative for the presence of common agents of pneumonia by culture and viral PCR, were investigated. These clinical specimens have been previously characterized by singleplex RT-PCR assays in our diagnostic laboratory and were used to evaluate the diagnostic performance of the respiratory multiplex Lightmix ® RT-PCR. The multiplex RT-PCR displayed a limit of detection between 5 and 10 DNA copies for different in-panel organisms and showed identical performance characteristics with respect to specificity and sensitivity as in-house singleplex RT-PCRs for pathogen detection. The Lightmix ® multiplex RT-PCR assay represents a low-cost, time-saving and accurate diagnostic tool with high throughput potential. The time-to-result using an automated DNA extraction device for respiratory specimens followed by multiplex RT-PCR detection was

  13. Transmutation of Personal Glucose Meters into Portable and Highly Sensitive Microbial Pathogen Detection Platform.

    Science.gov (United States)

    Wang, Zhenzhen; Chen, Zhaowei; Gao, Nan; Ren, Jinsong; Qu, Xiaogang

    2015-10-07

    Herein, for the first time, we presented a simple and general approach by using personal glucose meters (PGM) for portable and ultrasensitive detection of microbial pathogens. Upon addition of pathogenic bacteria, glucoamylase-quaternized magnetic nanoparticles (GA-QMNPS) conjugates were disrupted by the competitive multivalent interactions between bacteria and QMNPS, resulting in the release of GA. After magnetic separation, the free GA could catalyze the hydrolysis of amylose into glucose for quantitative readout by PGM. In such way, PGM was transmuted into a bacterial detection device and extremely low detection limits down to 20 cells mL(-1) was achieved. More importantly, QMNPS could inhibit the growth of the bacteria and destroy its cellular structure, which enabled bacteria detection and inhibition simultaneously. The simplicity, portability, sensitivity and low cost of presented work make it attractive for clinical applications. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Efficiency of Airborne Sample Analysis Platform (ASAP Bioaerosol Sampler for Pathogen Detection

    Directory of Open Access Journals (Sweden)

    Anurag eSharma

    2015-05-01

    Full Text Available The threat of bioterrorism and pandemics has highlighted the urgency for rapid and reliable bioaerosol detection in different environments. Safeguarding against such threats requires continuous sampling of the ambient air for pathogen detection. In this study we investigated the efficacy of the Airborne Sample Analysis Platform (ASAP 2800 bioaerosol sampler to collect representative samples of air and identify specific viruses suspended as bioaerosols. To test this concept, we aerosolized an innocuous replication-defective bovine adenovirus serotype 3 (BAdV3 in a controlled laboratory environment. The ASAP efficiently trapped the surrogate virus at 5×10E3 plaque-forming units (p.f.u. [2×10E5 genome copy equivalent] concentrations or more resulting in the successful detection of the virus using quantitative PCR. These results support the further development of ASAP for bioaerosol pathogen detection.

  15. Microbial Biosensor for the Detection of Protease-Virulent Factors from Pathogens

    Science.gov (United States)

    2017-04-28

    pathogen signalling molecules. With that goal in mind , researchers have developed various types of biosensors that detect infectious determinants...life to boost their capability for rapid determination of clean water sources during field deployment. Despite the promising results of these studies

  16. Towards On-site Pathogen Detection Using Antibody-based Sensors

    DEFF Research Database (Denmark)

    Skottrup, Peter Durand; Nicolaisen, Mogens; Justesen, Annemarie Fejer

    2008-01-01

    In this paper the recent progress within biosensors for plant pathogen detection will be reviewed. Bio-recognition layers on sensors can be designed in various ways, however the most popular approach is to immobilise antibodies for specific capture of analytes. Focus will be put on antibody surfa...

  17. Multiplex detection of plant pathogens through the luminex magplex bead system

    NARCIS (Netherlands)

    Vlugt, van der R.A.A.; Raaij, van H.M.G.; Weerdt, de M.; Bergervoet, J.H.W.

    2015-01-01

    Here we describe a versatile multiplex method for both the serological and molecular detection of plant pathogens. The Luminex MagPlex bead system uses small paramagnetic microspheres (“beads”), either coated with specific antibodies or oligonucleotides, which capture respectively viruses and/or

  18. FY05 LDRD Final Report A Computational Design Tool for Microdevices and Components in Pathogen Detection Systems

    Energy Technology Data Exchange (ETDEWEB)

    Trebotich, D

    2006-02-07

    We have developed new algorithms to model complex biological flows in integrated biodetection microdevice components. The proposed work is important because the design strategy for the next-generation Autonomous Pathogen Detection System at LLNL is the microfluidic-based Biobriefcase, being developed under the Chemical and Biological Countermeasures Program in the Homeland Security Organization. This miniaturization strategy introduces a new flow regime to systems where biological flow is already complex and not well understood. Also, design and fabrication of MEMS devices is time-consuming and costly due to the current trial-and-error approach. Furthermore, existing devices, in general, are not optimized. There are several MEMS CAD capabilities currently available, but their computational fluid dynamics modeling capabilities are rudimentary at best. Therefore, we proposed a collaboration to develop computational tools at LLNL which will (1) provide critical understanding of the fundamental flow physics involved in bioMEMS devices, (2) shorten the design and fabrication process, and thus reduce costs, (3) optimize current prototypes and (4) provide a prediction capability for the design of new, more advanced microfluidic systems. Computational expertise was provided by Comp-CASC and UC Davis-DAS. The simulation work was supported by key experiments for guidance and validation at UC Berkeley-BioE.

  19. Evolution of Drosophila resistance against different pathogens and infection routes entails no detectable maintenance costs.

    Science.gov (United States)

    Faria, Vítor G; Martins, Nelson E; Paulo, Tânia; Teixeira, Luís; Sucena, Élio; Magalhães, Sara

    2015-11-01

    Pathogens exert a strong selective pressure on hosts, entailing host adaptation to infection. This adaptation often affects negatively other fitness-related traits. Such trade-offs may underlie the maintenance of genetic diversity for pathogen resistance. Trade-offs can be tested with experimental evolution of host populations adapting to parasites, using two approaches: (1) measuring changes in immunocompetence in relaxed-selection lines and (2) comparing life-history traits of evolved and control lines in pathogen-free environments. Here, we used both approaches to examine trade-offs in Drosophila melanogaster populations evolving for over 30 generations under infection with Drosophila C Virus or the bacterium Pseudomonas entomophila, the latter through different routes. We find that resistance is maintained after up to 30 generations of relaxed selection. Moreover, no differences in several classical life-history traits between control and evolved populations were found in pathogen-free environments, even under stresses such as desiccation, nutrient limitation, and high densities. Hence, we did not detect any maintenance costs associated with resistance to pathogens. We hypothesize that extremely high selection pressures commonly used lead to the disproportionate expression of costs relative to their actual occurrence in natural systems. Still, the maintenance of genetic variation for pathogen resistance calls for an explanation. © 2015 The Author(s). Evolution © 2015 The Society for the Study of Evolution.

  20. Matrix approach to the simultaneous detection of multiple potato pathogens by real-time PCR.

    Science.gov (United States)

    Nikitin, M M; Statsyuk, N V; Frantsuzov, P A; Dzhavakhiya, V G; Golikov, A G

    2018-03-01

    Create a method for highly sensitive, selective, rapid and easy-to-use detection and identification of economically significant potato pathogens, including viruses, bacteria and oomycetes, be it single pathogen, or a range of various pathogens occurring simultaneously. Test-systems for real-time PCR, operating in the unified amplification regime, have been developed for Phytophthora infestans, Pectobacterium atrosepticum, Dickeya dianthicola, Dickeya solani, Ralstonia solanacearum, Pectobacterium carotovorum, Clavibacter michiganensis subsp. sepedonicus, potato viruses Y (ordinary and necrotic forms as well as indiscriminative test system, detecting all forms), A, X, S, M, potato leaf roll virus, potato mop top virus and potato spindle tuber viroid. The test-systems (including polymerase and revertase) were immobilized and lyophilized in miniature microreactors (1·2 μl) on silicon DNA/RNA microarrays (micromatrices) to be used with a mobile AriaDNA ® amplifier. Preloaded 30-reaction micromatrices having shelf life of 3 and 6 months (for RNA- and DNA-based pathogens, respectively) at room temperature with no special conditions were successfully tested on both reference and field samples in comparison with traditional ELISA and microbiological methods, showing perfect performance and sensitivity (1 pg). The accurate, rapid and user-friendly diagnostic system in a micromatrix format may significantly contribute to pathogen screening and phytopathological studies. © 2018 The Authors. Journal of Applied Microbiology published by John Wiley & Sons Ltd on behalf of The Society for Applied Microbiology.

  1. Imperfect pathogen detection from non-invasive skin swabs biases disease inference

    Science.gov (United States)

    DiRenzo, Graziella V.; Grant, Evan H. Campbell; Longo, Ana; Che-Castaldo, Christian; Zamudio, Kelly R.; Lips, Karen

    2018-01-01

    1. Conservation managers rely on accurate estimates of disease parameters, such as pathogen prevalence and infection intensity, to assess disease status of a host population. However, these disease metrics may be biased if low-level infection intensities are missed by sampling methods or laboratory diagnostic tests. These false negatives underestimate pathogen prevalence and overestimate mean infection intensity of infected individuals. 2. Our objectives were two-fold. First, we quantified false negative error rates of Batrachochytrium dendrobatidis on non-invasive skin swabs collected from an amphibian community in El Copé, Panama. We swabbed amphibians twice in sequence, and we used a recently developed hierarchical Bayesian estimator to assess disease status of the population. Second, we developed a novel hierarchical Bayesian model to simultaneously account for imperfect pathogen detection from field sampling and laboratory diagnostic testing. We evaluated the performance of the model using simulations and varying sampling design to quantify the magnitude of bias in estimates of pathogen prevalence and infection intensity. 3. We show that Bd detection probability from skin swabs was related to host infection intensity, where Bd infections information in advance, we advocate that the most cautious approach is to assume all errors are possible and to accommodate them by adjusting sampling designs. The modeling framework presented here improves the accuracy in estimating pathogen prevalence and infection intensity.

  2. Detection of Emerging and Re-Emerging Pathogens in Surface Waters Close to an Urban Area

    Directory of Open Access Journals (Sweden)

    Stefania Marcheggiani

    2015-05-01

    Full Text Available Current knowledge about the spread of pathogens in aquatic environments is scarce probably because bacteria, viruses, algae and their toxins tend to occur at low concentrations in water, making them very difficult to measure directly. The purpose of this study was the development and validation of tools to detect pathogens in freshwater systems close to an urban area. In order to evaluate anthropogenic impacts on water microbiological quality, a phylogenetic microarray was developed in the context of the EU project µAQUA to detect simultaneously numerous pathogens and applied to samples from two different locations close to an urban area located upstream and downstream of Rome in the Tiber River. Furthermore, human enteric viruses were also detected. Fifty liters of water were collected and concentrated using a hollow-fiber ultrafiltration approach. The resultant concentrate was further size-fractionated through a series of decreasing pore size filters. RNA was extracted from pooled filters and hybridized to the newly designed microarray to detect pathogenic bacteria, protozoa and toxic cyanobacteria. Diatoms as indicators of the water quality status, were also included in the microarray to evaluate water quality. The microarray results gave positive signals for bacteria, diatoms, cyanobacteria and protozoa. Cross validation of the microarray was performed using standard microbiological methods for the bacteria. The presence of oral-fecal transmitted human enteric-viruses were detected using q-PCR. Significant concentrations of Salmonella, Clostridium, Campylobacter and Staphylococcus as well as Hepatitis E Virus (HEV, noroviruses GI (NoGGI and GII (NoGII and human adenovirus 41 (ADV 41 were found in the Mezzocammino site, whereas lower concentrations of other bacteria and only the ADV41 virus was recovered at the Castel Giubileo site. This study revealed that the pollution level in the Tiber River was considerably higher downstream rather than

  3. Detection of hepatitis E virus and other livestock-related pathogens in Iowa streams

    Science.gov (United States)

    Givens, Carrie E.; Kolpin, Dana W.; Borchardt, Mark A.; Duris, Joseph W.; Moorman, Thomas B.; Spencer, Susan K.

    2016-01-01

    Manure application is a source of pathogens to the environment. Through overland runoff and tile drainage, zoonotic pathogens can contaminate surface water and streambed sediment and could affect both wildlife and human health. This study examined the environmental occurrence of gene markers for livestock-related bacterial, protozoan, and viral pathogens and antibiotic resistance in surface waters within the South Fork Iowa River basin before and after periods of swine manure application on agricultural land. Increased concentrations of indicator bacteria after manure application exceeding Iowa's state bacteria water quality standards suggest that swine manure contributes to diminished water quality and may pose a risk to human health. Additionally, the occurrence of HEV and numerous bacterial pathogen genes for Escherichia coli, Enterococcus spp., Salmonella sp., and Staphylococcus aureus in both manure samples and in corresponding surface water following periods of manure application suggests a potential role for swine in the spreading of zoonotic pathogens to the surrounding environment. During this study, several zoonotic pathogens were detected including Shiga-toxin producing E. coli, Campylobacter jejuni, pathogenic enterococci, and S. aureus; all of which can pose mild to serious health risks to swine, humans, and other wildlife. This research provides the foundational understanding required for future assessment of the risk to environmental health from livestock-related zoonotic pathogen exposures in this region. This information could also be important for maintaining swine herd biosecurity and protecting the health of wildlife near swine facilities.

  4. Detection of Pathogen Exposure in African Buffalo Using Non-Specific Markers of Inflammation

    Directory of Open Access Journals (Sweden)

    Caroline K. Glidden

    2018-01-01

    Full Text Available Detecting exposure to new or emerging pathogens is a critical challenge to protecting human, domestic animal, and wildlife health. Yet, current techniques to detect infections typically target known pathogens of humans or economically important animals. In the face of the current surge in infectious disease emergence, non-specific disease surveillance tools are urgently needed. Tracking common host immune responses indicative of recent infection may have potential as a non-specific diagnostic approach for disease surveillance. The challenge to immunologists is to identify the most promising markers, which ideally should be highly conserved across pathogens and host species, become upregulated rapidly and consistently in response to pathogen invasion, and remain elevated beyond clearance of infection. This study combined an infection experiment and a longitudinal observational study to evaluate the utility of non-specific markers of inflammation [NSMI; two acute phase proteins (haptoglobin and serum amyloid A, two pro-inflammatory cytokines (IFNγ and TNF-α] as indicators of pathogen exposure in a wild mammalian species, African buffalo (Syncerus caffer. Specifically, in the experimental study, we asked (1 How quickly do buffalo mount NSMI responses upon challenge with an endemic pathogen, foot-and-mouth disease virus; (2 for how long do NSMI remain elevated after viral clearance and; (3 how pronounced is the difference between peak NSMI concentration and baseline NSMI concentration? In the longitudinal study, we asked (4 Are elevated NSMI associated with recent exposure to a suite of bacterial and viral respiratory pathogens in a wild population? Among the four NSMI that we tested, haptoglobin showed the strongest potential as a surveillance marker in African buffalo: concentrations quickly and consistently reached high levels in response to experimental infection, remaining elevated for almost a month. Moreover, elevated haptoglobin was

  5. Molecular detection of pathogens in water--the pros and cons of molecular techniques.

    Science.gov (United States)

    Girones, Rosina; Ferrús, Maria Antonia; Alonso, José Luis; Rodriguez-Manzano, Jesus; Calgua, Byron; Corrêa, Adriana de Abreu; Hundesa, Ayalkibet; Carratala, Anna; Bofill-Mas, Sílvia

    2010-08-01

    Pollution of water by sewage and run-off from farms produces a serious public health problem in many countries. Viruses, along with bacteria and protozoa in the intestine or in urine are shed and transported through the sewer system. Even in highly industrialized countries, pathogens, including viruses, are prevalent throughout the environment. Molecular methods are used to monitor viral, bacterial, and protozoan pathogens, and to track pathogen- and source-specific markers in the environment. Molecular techniques, specifically polymerase chain reaction-based methods, provide sensitive, rapid, and quantitative analytical tools with which to study such pathogens, including new or emerging strains. These techniques are used to evaluate the microbiological quality of food and water, and to assess the efficiency of virus removal in drinking and wastewater treatment plants. The range of methods available for the application of molecular techniques has increased, and the costs involved have fallen. These developments have allowed the potential standardization and automation of certain techniques. In some cases they facilitate the identification, genotyping, enumeration, viability assessment, and source-tracking of human and animal contamination. Additionally, recent improvements in detection technologies have allowed the simultaneous detection of multiple targets in a single assay. However, the molecular techniques available today and those under development require further refinement in order to be standardized and applicable to a diversity of matrices. Water disinfection treatments may have an effect on the viability of pathogens and the numbers obtained by molecular techniques may overestimate the quantification of infectious microorganisms. The pros and cons of molecular techniques for the detection and quantification of pathogens in water are discussed. (c) 2010 Elsevier Ltd. All rights reserved.

  6. Equivalence of self- and staff-collected nasal swabs for the detection of viral respiratory pathogens.

    Directory of Open Access Journals (Sweden)

    Manas K Akmatov

    Full Text Available BACKGROUND: The need for the timely collection of diagnostic biosamples during symptomatic episodes represents a major obstacle to large-scale studies on acute respiratory infection (ARI epidemiology. This may be circumvented by having the participants collect their own nasal swabs. We compared self- and staff-collected swabs in terms of swabbing quality and detection of viral respiratory pathogens. METHODOLOGY/PRINCIPAL FINDINGS: We conducted a prospective study among employees of our institution during the ARI season 2010/2011 (December-March. Weekly emails were sent to the participants (n = 84, reminding them to come to the study center in case of new symptoms. The participants self-collected an anterior nasal swab from one nostril, and trained study personnel collected one from the other nostril. The participants self-collected another two swabs (one from each nostril on a subsequent day. Human β-actin DNA concentration was determined in the swabs as a quality control. Viral respiratory pathogens were detected by multiplex RT-PCR (Seeplex RV15 kit, Seegene, Eschborn, Germany. Of 84 participants, 56 (67% reported at least one ARI episode, 18 participants two, and one participant three. Self-swabbing was highly accepted by the participants. The amount of β-actin DNA per swab was higher in the self- than in the staff-collected swabs (p = 0.008. β-actin concentration was lower in the self-swabs collected on day 1 than in those collected on a subsequent day (p<0.0001. A respiratory viral pathogen was detected in 31% (23/75 of staff- and in 35% (26/75 of self-collected swabs (p = 0.36. With both approaches, the most frequently identified pathogens were human rhinoviruses A/B/C (12/75 swabs, 16% and human coronavirus OC43 (4/75 swabs, 5%. There was almost perfect agreement between self- and staff-collected swabs in terms of pathogen detection (agreement = 93%, kappa = 0.85, p<0.0001. CONCLUSIONS/SIGNIFICANCE: Nasal self

  7. Novel aptamer-linked nanoconjugate approach for detection of waterborne bacterial pathogens: an update

    International Nuclear Information System (INIS)

    Singh, Gulshan; Manohar, Murli; Adegoke, Anthony Ayodeji; Stenström, Thor Axel; Shanker, Rishi

    2017-01-01

    The lack of microbiologically safe water in underdeveloped nations is the prime cause of infectious disease outbreaks. The need for the specific identification and detection of microorganisms encourages the development of advanced, rapid, sensitive and highly specific methods for the monitoring of pathogens and management of potential risk to human health. The rapid molecular assays based on detection of specific molecular signatures offer advantages over conventional methods in terms of specificity and sensitivity but require complex instrumentation and skilled personnel. Nanotechnology is an emerging area and provides a robust approach for the identification of pathogenic microorganism utilizing the peculiar properties of nanomaterials, i.e. small size (1–100 nm) and large surface area. This emerging technology promises to fulfill the urgent need of a novel strategy to enhance the bacterial identification and quantitation in the environment. In this context, the peculiar properties of gold nanoparticles, their plasmonic shifts, and changes in magnetic properties have been utilized for the simple and cost-effective detection of bacterial nucleic acids, antigens and toxins with quite improved sensitivity. One of the promising leads to develop an advance detection method might be the coupling of nucleic acid aptamers (capable of interacting specifically with bacteria, protozoa, and viruses) with nanomaterials. Such aptamer-nano conjugate can be used for the specific recognition of infectious agents in different environmental matrices. This review summarizes the application of nanotechnology in the area of pathogen detection and discusses the prospects of coupling nucleic acid aptamers with nanoparticles for the specific detection of targeted pathogens.

  8. Novel aptamer-linked nanoconjugate approach for detection of waterborne bacterial pathogens: an update

    Science.gov (United States)

    Singh, Gulshan; Manohar, Murli; Adegoke, Anthony Ayodeji; Stenström, Thor Axel; Shanker, Rishi

    2017-01-01

    The lack of microbiologically safe water in underdeveloped nations is the prime cause of infectious disease outbreaks. The need for the specific identification and detection of microorganisms encourages the development of advanced, rapid, sensitive and highly specific methods for the monitoring of pathogens and management of potential risk to human health. The rapid molecular assays based on detection of specific molecular signatures offer advantages over conventional methods in terms of specificity and sensitivity but require complex instrumentation and skilled personnel. Nanotechnology is an emerging area and provides a robust approach for the identification of pathogenic microorganism utilizing the peculiar properties of nanomaterials, i.e. small size (1-100 nm) and large surface area. This emerging technology promises to fulfill the urgent need of a novel strategy to enhance the bacterial identification and quantitation in the environment. In this context, the peculiar properties of gold nanoparticles, their plasmonic shifts, and changes in magnetic properties have been utilized for the simple and cost-effective detection of bacterial nucleic acids, antigens and toxins with quite improved sensitivity. One of the promising leads to develop an advance detection method might be the coupling of nucleic acid aptamers (capable of interacting specifically with bacteria, protozoa, and viruses) with nanomaterials. Such aptamer-nano conjugate can be used for the specific recognition of infectious agents in different environmental matrices. This review summarizes the application of nanotechnology in the area of pathogen detection and discusses the prospects of coupling nucleic acid aptamers with nanoparticles for the specific detection of targeted pathogens.

  9. Simultaneous Detection of 13 Key Bacterial Respiratory Pathogens by Combination of Multiplex PCR and Capillary Electrophoresis.

    Science.gov (United States)

    Jiang, Lu Xi; Ren, Hong Yu; Zhou, Hai Jian; Zhao, Si Hong; Hou, Bo Yan; Yan, Jian Ping; Qin, Tian; Chen, Yu

    2017-08-01

    Lower respiratory tract infections continue to pose a significant threat to human health. It is important to accurately and rapidly detect respiratory bacteria. To compensate for the limits of current respiratory bacteria detection methods, we developed a combination of multiplex polymerase chain reaction (PCR) and capillary electrophoresis (MPCE) assay to detect thirteen bacterial pathogens responsible for lower respiratory tract infections, including Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, Pseudomonas aeruginosa, Klebsiella pneumoniae, Escherichia coli, Staphylococcus aureus, Mycoplasma pneumoniae, Legionella spp., Bordetella pertussis, Mycobacterium tuberculosis complex, Corynebacterium diphtheriae, and Streptococcus pyogenes. Three multiplex PCR reactions were built, and the products were analyzed by capillary electrophoresis using the high-throughput DNA analyzer. The specificity of the MPCE assay was examined and the detection limit was evaluated using DNA samples from each bacterial strain and the simulative samples of each strain. This assay was further evaluated using 152 clinical specimens and compared with real-time PCR reactions. For this assay, three nested-multiplex-PCRs were used to detect these clinical specimens. The detection limits of the MPCE assay for the 13 pathogens were very low and ranged from 10-7 to 10-2 ng/μL. Furthermore, analysis of the 152 clinical specimens yielded a specificity ranging from 96.5%-100.0%, and a sensitivity of 100.0% for the 13 pathogens. This study revealed that the MPCE assay is a rapid, reliable, and high-throughput method with high specificity and sensitivity. This assay has great potential in the molecular epidemiological survey of respiratory pathogens. Copyright © 2017 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

  10. Novel aptamer-linked nanoconjugate approach for detection of waterborne bacterial pathogens: an update

    Energy Technology Data Exchange (ETDEWEB)

    Singh, Gulshan, E-mail: gsingh.gulshan@gmail.com [Durban University of Technology, Institute for Water and Wastewater Technology (IWWT) (South Africa); Manohar, Murli [Jamia Hamdard (Hamdard University), Department of Biochemistry (India); Adegoke, Anthony Ayodeji; Stenström, Thor Axel [Durban University of Technology, Institute for Water and Wastewater Technology (IWWT) (South Africa); Shanker, Rishi [Ahmedabad University, Division of Biological & Life Sciences, School of Arts & Sciences (India)

    2017-01-15

    The lack of microbiologically safe water in underdeveloped nations is the prime cause of infectious disease outbreaks. The need for the specific identification and detection of microorganisms encourages the development of advanced, rapid, sensitive and highly specific methods for the monitoring of pathogens and management of potential risk to human health. The rapid molecular assays based on detection of specific molecular signatures offer advantages over conventional methods in terms of specificity and sensitivity but require complex instrumentation and skilled personnel. Nanotechnology is an emerging area and provides a robust approach for the identification of pathogenic microorganism utilizing the peculiar properties of nanomaterials, i.e. small size (1–100 nm) and large surface area. This emerging technology promises to fulfill the urgent need of a novel strategy to enhance the bacterial identification and quantitation in the environment. In this context, the peculiar properties of gold nanoparticles, their plasmonic shifts, and changes in magnetic properties have been utilized for the simple and cost-effective detection of bacterial nucleic acids, antigens and toxins with quite improved sensitivity. One of the promising leads to develop an advance detection method might be the coupling of nucleic acid aptamers (capable of interacting specifically with bacteria, protozoa, and viruses) with nanomaterials. Such aptamer-nano conjugate can be used for the specific recognition of infectious agents in different environmental matrices. This review summarizes the application of nanotechnology in the area of pathogen detection and discusses the prospects of coupling nucleic acid aptamers with nanoparticles for the specific detection of targeted pathogens.

  11. Impact of Aerosol Dust on xMAP Multiplex Detection of Different Class Pathogens

    Directory of Open Access Journals (Sweden)

    Denis A. Kleymenov

    2017-11-01

    Full Text Available Environmental or city-scale bioaerosol surveillance can provide additional value for biodefense and public health. Efficient bioaerosol monitoring should rely on multiplex systems capable of detecting a wide range of biologically hazardous components potentially present in air (bacteria, viruses, toxins and allergens. xMAP technology from LuminexTM allows multiplex bead-based detection of antigens or nucleic acids, but its use for simultaneous detection of different classes of pathogens (bacteria, virus, toxin is questionable. Another problem is the detection of pathogens in complex matrices, e.g., in the presence of dust. In the this research, we developed the model xMAP multiplex test-system aiRDeTeX 1.0, which enables detection of influenza A virus, Adenovirus type 6 Salmonella typhimurium, and cholera toxin B subunit representing RNA virus, DNA virus, gram-negative bacteria and toxin respectively as model organisms of biologically hazardous components potentially present in or spreadable through the air. We have extensively studied the effect of matrix solution (PBS, distilled water, environmental dust and ultrasound treatment for monoplex and multiplex detection efficiency of individual targets. All targets were efficiently detectable in PBS and in the presence of dust. Ultrasound does not improve the detection except for bacterial LPS.

  12. Autonomous learning of robust visual object detection and identification on a humanoid

    NARCIS (Netherlands)

    Leitner, J.; Chandrashekhariah, P.; Harding, S.; Frank, M.; Spina, G.; Förster, A.; Triesch, J.; Schmidhuber, J.

    2012-01-01

    In this work we introduce a technique for a humanoid robot to autonomously learn the representations of objects within its visual environment. Our approach involves an attention mechanism in association with feature based segmentation that explores the environment and provides object samples for

  13. Ground plane detection for autonomous robots in complex environments inclined with flexed far-field terrains

    CSIR Research Space (South Africa)

    Osunmakind, IO

    2009-11-01

    Full Text Available In this paper, collective intelligence of the Emergent Situation Awareness (ESA) technology is proposed as a supportive strategy for autonomous robotic navigation. The ability to reveal uncertainties over time on flexed far-field is a ground plane...

  14. Detection of Antibodies to Seven Priority Pathogens in Backyard Poultry in Trinidad, West Indies

    Directory of Open Access Journals (Sweden)

    Arianne Brown Jordan

    2018-01-01

    Full Text Available Backyard poultry farms in Trinidad and Tobago (T&T play a vital role in providing food and income for rural communities. There is currently no information on the presence and circulation of pathogens in backyard poultry farms in T&T, and little is known in relation to the potential risks of spread of these pathogens to the commercial poultry sector. In order to address this, serum samples were collected from 41 chickens on five backyard farms taken from selected locations in Trinidad. Samples were tested for antibodies to seven priority pathogens of poultry by enzyme-linked immunosorbent assay (ELISA. Antibodies were detected in 65% (CI 95%: 50–78% of the sampled birds for Infectious bronchitis virus (IBV, 67.5% (CI 95%: 52–80% for Infectious bursal disease virus (IBDV, 10% (CI 95%: 4–23% for Newcastle disease virus (NDV, 0% (CI 95%: 0–0% for Avian influenza virus (AIV, 0% (CI 95%: 0–0% for West Nile virus (WNV, 31.7% (CI 95%: 20–47% for Mycoplasm gallisepticum/synoviae and 0% (CI 95%: 0–0% for Salmonella enterica serotype Enteritidis. These results reveal the presence and circulation of important pathogens of poultry in selected backyard farms in Trinidad. The results provide important information which should be taken into consideration when assessing the risks of pathogen transmission between commercial and backyard poultry farms, as well as between poultry and wild birds.

  15. Detection of the emerging amphibian pathogens Batrachochytrium dendrobatidis and ranavirus in Russia

    Science.gov (United States)

    Reshetnikov, Andrey N.; Chestnut, Tara E.; Brunner, Jesse L.; Charles, Kaylene M.; Nebergall, Emily E.; Olson, Deanna H.

    2014-01-01

    In a population of the European common toad Bufo bufo from a rural pond in the region of Lake Glubokoe Regional Reserve in Moscow province, Russia, unexplained mass mortality events involving larvae and metamorphs have been observed over a monitoring period of >20 yr. We tested toads from this and a nearby site for the emerging amphibian pathogens Batrachochytrium dendrobatidis (Bd) and ranavirus (Rv). Both pathogens were detected, and at the rural pond site, with the above-noted losses and decline in toad breeding success, 40% of B. bufo metamorphs were Bd positive, 46% were Rv positive and 20% were co-infected with both pathogens. Toad metamorphs from a neighbouring water body were also Bd and Rv positive (25 and 55%, respectively). This is the first confirmation of these pathogens in Russia. Questions remain as to the origins of these pathogens in Russia and their roles in documented mass mortality events.

  16. Progress in rapid detection and identification of unknown human and agricultural pathogens

    International Nuclear Information System (INIS)

    Barnes, T; Holzrichter, J F; Milanovich, F P

    1999-01-01

    The medical industry is driving pathogen detection technology from its present characteristics of$50/sample, 100 sample capability systems, with several day time responses, having several percent error rates in reported outcomes. The systems described above are capable of providing samples at and lt;$5/test, managing several million samples, and lt; 1-hour cycle times, (or just minutes in some cases) and and lt; 0.1% error rates. Because of their importance to the medical and agricultural communities, all ''important'' pathogens will have detection kits available (within air transport times, anywhere in the world) by 2020, and the most well known pathogens will have kits available within a few years. Many are available now. Because of the importance of the food supply to modern nations, these technologies will be employed everywhere in this industry. For example, the United States imports 30 B tons of food a year, but inspects and lt; 1%. Portable inspection systems will make it possible to test for dangerous pathogens in feed lots, food processing plants, markets, and points of use. Outbreaks of animal or plant disease will be immediately detectable using field instrumentation, and more complex samples can be sent to central testing laboratories where more sophisticated test systems will be available. Unusual pathogens either naturally or purposefully selected or developed, will require special attention because there is not a commercial economic driver for the development of detection systems and curative agents. Their development, and production for sufficient availability, will require significant investments by the world community. The strategy and costs for developing vaccines or curative drugs will be very expensive and will need special attention. However it is important that attention be directed to these problems because such attention has a strong deterrent effect on potential developers or users. The capacity to use the full information content

  17. Evaluation of different enrichment methods for pathogenic Yersinia species detection by real time PCR

    Science.gov (United States)

    2014-01-01

    Background Yersiniosis is a zoonotic disease reported worldwide. Culture and PCR based protocols are the most common used methods for detection of pathogenic Yersinia species in animal samples. PCR sensitivity could be increased by an initial enrichment step. This step is particularly useful in surveillance programs, where PCR is applied to samples from asymptomatic animals. The aim of this study was to evaluate the improvement in pathogenic Yersinia species detection using a suitable enrichment method prior to the real time PCR (rtPCR). Nine different enrichment protocols were evaluated including six different broth mediums (CASO, ITC, PSB, PBS, PBSMSB and PBSSSB). Results The analysis of variance showed significant differences in Yersinia detection by rtPCR according to the enrichment protocol used. These differences were higher for Y. pseudotuberculosis than for Y. enterocolitica. In general, samples incubated at lower temperatures yielded the highest detection rates. The best results were obtained with PBSMSB and PBS2. Application of PBSMSB protocol to free-ranging wild board samples improved the detection of Y. enterocolitica by 21.2% when compared with direct rtPCR. Y. pseudotuberculosis detection was improved by 10.6% when results obtained by direct rtPCR and by PBSMSB enrichment before rtPCR were analyzed in combination. Conclusions The data obtained in the present study indicate a difference in Yersinia detection by rtPCR related to the enrichment protocol used, being PBSMSB enrichment during 15 days at 4°C and PBS during 7 days at 4°C the most efficient. The use of direct rtPCR in combination with PBSMSB enrichment prior to rtPCR resulted in an improvement in the detection rates of pathogenic Yersinia in wild boar and could be useful for application in other animal samples. PMID:25168886

  18. FISHing for bacteria in food--a promising tool for the reliable detection of pathogenic bacteria?

    Science.gov (United States)

    Rohde, Alexander; Hammerl, Jens Andre; Appel, Bernd; Dieckmann, Ralf; Al Dahouk, Sascha

    2015-04-01

    Foodborne pathogens cause millions of infections every year and are responsible for considerable economic losses worldwide. The current gold standard for the detection of bacterial pathogens in food is still the conventional cultivation following standardized and generally accepted protocols. However, these methods are time-consuming and do not provide fast information about food contaminations and thus are limited in their ability to protect consumers in time from potential microbial hazards. Fluorescence in situ hybridization (FISH) represents a rapid and highly specific technique for whole-cell detection. This review aims to summarize the current data on FISH-testing for the detection of pathogenic bacteria in different food matrices and to evaluate its suitability for the implementation in routine testing. In this context, the use of FISH in different matrices and their pretreatment will be presented, the sensitivity and specificity of FISH tests will be considered and the need for automation shall be discussed as well as the use of technological improvements to overcome current hurdles for a broad application in monitoring food safety. In addition, the overall economical feasibility will be assessed in a rough calculation of costs, and strengths and weaknesses of FISH are considered in comparison with traditional and well-established detection methods. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  19. Rapid detection of pathogenic bacteria by volatile organic compound (VOC) analysis

    Science.gov (United States)

    Senecal, Andre G.; Magnone, Joshua; Yeomans, Walter; Powers, Edmund M.

    2002-02-01

    Developments in rapid detection technologies have made countless improvements over the years. However, because of the limited sample that these technologies can process in a single run, the chance of capturing and identifying a small amount of pathogens is difficult. The problem is further magnified by the natural random distribution of pathogens in foods. Methods to simplify pathogenic detection through the identification of bacteria specific VOC were studied. E. coli O157:H7 and Salmonella typhimurium were grown on selected agar medium to model protein, and carbohydrate based foods. Pathogenic and common spoilage bacteria (Pseudomonas and Morexella) were screened for unique VOC production. Bacteria were grown on agar slants in closed vials. Headspace sampling was performed at intervals up to 24 hours using Solid Phase Micro-Extraction (SPME) techniques followed by GC/MS analysis. Development of unique volatiles was followed to establish sensitivity of detection. E. coli produced VOC not found in either Trypticase Soy Yeast (TSY) agar blanks or spoilage organism samples were - indole, 1-decanol, and 2-nonanone. Salmonella specific VOC grown on TSY were 3-methyl-1-butanol, dimethyl sulfide, 2-undecanol, 2-pentadecanol and 1-octanol. Trials on potato dextrose agar (PDA) slants indicated VOC specific for E. coli and Salmonella when compared to PDA blanks and Pseudomonas samples. However, these VOC peaks were similar for both pathogens. Morexella did not grow on PDA slants. Work will continue with model growth mediums at various temperatures, and mixed flora inoculums. As well as, VOC production based on the dynamics of bacterial growth.

  20. Advanced biosensors for detection of pathogens related to livestock and poultry.

    Science.gov (United States)

    Vidic, Jasmina; Manzano, Marisa; Chang, Chung-Ming; Jaffrezic-Renault, Nicole

    2017-02-21

    Infectious animal diseases caused by pathogenic microorganisms such as bacteria and viruses threaten the health and well-being of wildlife, livestock, and human populations, limit productivity and increase significantly economic losses to each sector. The pathogen detection is an important step for the diagnostics, successful treatment of animal infection diseases and control management in farms and field conditions. Current techniques employed to diagnose pathogens in livestock and poultry include classical plate-based methods and conventional biochemical methods as enzyme-linked immunosorbent assays (ELISA). These methods are time-consuming and frequently incapable to distinguish between low and highly pathogenic strains. Molecular techniques such as polymerase chain reaction (PCR) and real time PCR (RT-PCR) have also been proposed to be used to diagnose and identify relevant infectious disease in animals. However these DNA-based methodologies need isolated genetic materials and sophisticated instruments, being not suitable for in field analysis. Consequently, there is strong interest for developing new swift point-of-care biosensing systems for early detection of animal diseases with high sensitivity and specificity. In this review, we provide an overview of the innovative biosensing systems that can be applied for livestock pathogen detection. Different sensing strategies based on DNA receptors, glycan, aptamers and antibodies are presented. Besides devices still at development level some are validated according to standards of the World Organization for Animal Health and are commercially available. Especially, paper-based platforms proposed as an affordable, rapid and easy to perform sensing systems for implementation in field condition are included in this review.

  1. Current Technical Approaches for the Early Detection of Foodborne Pathogens: Challenges and Opportunities

    Directory of Open Access Journals (Sweden)

    Il-Hoon Cho

    2017-09-01

    Full Text Available The development of novel and high-tech solutions for rapid, accurate, and non-laborious microbial detection methods is imperative to improve the global food supply. Such solutions have begun to address the need for microbial detection that is faster and more sensitive than existing methodologies (e.g., classic culture enrichment methods. Multiple reviews report the technical functions and structures of conventional microbial detection tools. These tools, used to detect pathogens in food and food homogenates, were designed via qualitative analysis methods. The inherent disadvantage of these analytical methods is the necessity for specimen preparation, which is a time-consuming process. While some literature describes the challenges and opportunities to overcome the technical issues related to food industry legal guidelines, there is a lack of reviews of the current trials to overcome technological limitations related to sample preparation and microbial detection via nano and micro technologies. In this review, we primarily explore current analytical technologies, including metallic and magnetic nanomaterials, optics, electrochemistry, and spectroscopy. These techniques rely on the early detection of pathogens via enhanced analytical sensitivity and specificity. In order to introduce the potential combination and comparative analysis of various advanced methods, we also reference a novel sample preparation protocol that uses microbial concentration and recovery technologies. This technology has the potential to expedite the pre-enrichment step that precedes the detection process.

  2. Detection of Pathogenic Viruses in Sewage Provided Early Warnings of Hepatitis A Virus and Norovirus Outbreaks

    Science.gov (United States)

    Hellmér, Maria; Paxéus, Nicklas; Magnius, Lars; Enache, Lucica; Arnholm, Birgitta; Johansson, Annette; Bergström, Tomas

    2014-01-01

    Most persons infected with enterically transmitted viruses shed large amounts of virus in feces for days or weeks, both before and after onset of symptoms. Therefore, viruses causing gastroenteritis may be detected in wastewater, even if only a few persons are infected. In this study, the presence of eight pathogenic viruses (norovirus, astrovirus, rotavirus, adenovirus, Aichi virus, parechovirus, hepatitis A virus [HAV], and hepatitis E virus) was investigated in sewage to explore whether their identification could be used as an early warning of outbreaks. Samples of the untreated sewage were collected in proportion to flow at Ryaverket, Gothenburg, Sweden. Daily samples collected during every second week between January and May 2013 were pooled and analyzed for detection of viruses by concentration through adsorption to milk proteins and PCR. The largest amount of noroviruses was detected in sewage 2 to 3 weeks before most patients were diagnosed with this infection in Gothenburg. The other viruses were detected at lower levels. HAV was detected between weeks 5 and 13, and partial sequencing of the structural VP1protein identified three different strains. Two strains were involved in an ongoing outbreak in Scandinavia and were also identified in samples from patients with acute hepatitis A in Gothenburg during spring of 2013. The third strain was unique and was not detected in any patient sample. The method used may thus be a tool to detect incipient outbreaks of these viruses and provide early warning before the causative pathogens have been recognized in health care. PMID:25172863

  3. Current Technical Approaches for the Early Detection of Foodborne Pathogens: Challenges and Opportunities.

    Science.gov (United States)

    Cho, Il-Hoon; Ku, Seockmo

    2017-09-30

    The development of novel and high-tech solutions for rapid, accurate, and non-laborious microbial detection methods is imperative to improve the global food supply. Such solutions have begun to address the need for microbial detection that is faster and more sensitive than existing methodologies (e.g., classic culture enrichment methods). Multiple reviews report the technical functions and structures of conventional microbial detection tools. These tools, used to detect pathogens in food and food homogenates, were designed via qualitative analysis methods. The inherent disadvantage of these analytical methods is the necessity for specimen preparation, which is a time-consuming process. While some literature describes the challenges and opportunities to overcome the technical issues related to food industry legal guidelines, there is a lack of reviews of the current trials to overcome technological limitations related to sample preparation and microbial detection via nano and micro technologies. In this review, we primarily explore current analytical technologies, including metallic and magnetic nanomaterials, optics, electrochemistry, and spectroscopy. These techniques rely on the early detection of pathogens via enhanced analytical sensitivity and specificity. In order to introduce the potential combination and comparative analysis of various advanced methods, we also reference a novel sample preparation protocol that uses microbial concentration and recovery technologies. This technology has the potential to expedite the pre-enrichment step that precedes the detection process.

  4. Analysis of bacterial metagenomes from the Southwestern Gulf of Mexico for pathogens detection.

    Science.gov (United States)

    Escobedo-Hinojosa, Wendy; Pardo-López, Liliana

    2017-07-31

    Little is known about the diversity of bacteria in the Southwestern Gulf of Mexico. The aim of the study illustrated in this perspective was to search for the presence of bacterial pathogens in this ecosystem, using metagenomic data recently generated by the Mexican research group known as the Gulf of Mexico Research Consortium. Several genera of bacteria annotated as pathogens were detected in water and sediment marine samples. As expected, native and ubiquitous pathogenic bacteria genera such as Burkolderia, Halomonas, Pseudomonas, Shewanella and Vibrio were highly represented. Surprisingly, non-native genera of public health concern were also detected, including Borrelia, Ehrlichia, Leptospira, Mycobacterium, Mycoplasma, Salmonella, Staphylococcus, Streptococcus and Treponema. While there are no previous metagenomics studies of this environment, the potential influences of natural, anthropogenic and ecological factors on the diversity of putative pathogenic bacteria found in it are reviewed. The taxonomic annotation herein reported provides a starting point for an improved understanding of bacterial biodiversity in the Southwestern Gulf of Mexico. It also represents a useful tool in public health as it may help identify infectious diseases associated with exposure to marine water and ingestion of fish or shellfish, and thus may be useful in predicting and preventing waterborne disease outbreaks. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  5. Development of genetic methods for detection of pathogenic microorganisms in irradiated food

    International Nuclear Information System (INIS)

    2010-01-01

    The existence of injured microorganisms in food and their recovery during culturing procedures is critical. Injured microorganisms present a potential threat in food safety since they may repair themselves under suitable conditions. This study provides development of recovery methods for detection of injured foodborne microorganisms, after irradiation treatment at different doses. For this purpose, iniatially the methods of recovery were compared at different irradiation doses. At the second step, antibiotic resistance of foodborne pathogens was determined. After determination of antibiotic resistance, recovery methods were modified for reversibly injured foodborne pathogens at different doses after irradiation treatment . Finally, damages of DNA were detected by a spectrophotometric method after 1.0 kGy irradiation treatment

  6. Towards Autonomous Modular UAV Missions: The Detection, Geo-Location and Landing Paradigm

    Science.gov (United States)

    Kyristsis, Sarantis; Antonopoulos, Angelos; Chanialakis, Theofilos; Stefanakis, Emmanouel; Linardos, Christos; Tripolitsiotis, Achilles; Partsinevelos, Panagiotis

    2016-01-01

    Nowadays, various unmanned aerial vehicle (UAV) applications become increasingly demanding since they require real-time, autonomous and intelligent functions. Towards this end, in the present study, a fully autonomous UAV scenario is implemented, including the tasks of area scanning, target recognition, geo-location, monitoring, following and finally landing on a high speed moving platform. The underlying methodology includes AprilTag target identification through Graphics Processing Unit (GPU) parallelized processing, image processing and several optimized locations and approach algorithms employing gimbal movement, Global Navigation Satellite System (GNSS) readings and UAV navigation. For the experimentation, a commercial and a custom made quad-copter prototype were used, portraying a high and a low-computational embedded platform alternative. Among the successful targeting and follow procedures, it is shown that the landing approach can be successfully performed even under high platform speeds. PMID:27827883

  7. Rapid fluorescence detection of pathogenic bacteria using magnetic enrichment technique combined with magnetophoretic chromatography.

    Science.gov (United States)

    Che, Yulan; Xu, Yi; Wang, Renjie; Chen, Li

    2017-08-01

    A rapid and sensitive analytical method was developed to detect pathogenic bacteria which combined magnetic enrichment, fluorescence labeling with polyethylene glycol (PEG) magnetophoretic chromatography. As pathogenic bacteria usually exist in complex matrixes at low concentration, an efficient enrichment is essential for diagnosis. In order to capture series types of pathogenic bacteria in samples, amino-modified magnetic nanoparticles (Fe 3 O 4 @SiO 2 -NH 2 ) were prepared for efficient enrichment by the electrostatic interaction with pathogenic bacteria. It was shown that the capture efficiency reached up to 95.4% for Escherichia coli (E. coli). Furthermore, quantitative analysis of the bacteria was achieved by using acridine orange (AO) as a fluorescence probe for the captured E. coli due to its ability of staining series types of bacteria and rapid labeling. In order to remove the free magnetic nanoparticles and redundant fluorescent reagent, the labeled suspension was poured into a PEG separation column and was separated by applying an external magnetic field. The presence of 100 cfu mL -1 E. coli could be detected for semi-quantitative analysis by observing the separation column with the naked eye, and the concentration could be further evaluated by fluorescence detection. All the above processes were finished within 80 min. It was demonstrated that a good linear relationship existed between the fluorescence intensity and the concentration of E. coli ranging from 10 2 to 10 6  cfu mL -1 , with a detection limit of 100 cfu mL -1 when E. coli acted as target bacteria. The recovery rate of E. coli was 93.6∼102.0% in tap water and cooked meat samples, and the RSD was lower than 7% (n = 6); the result coincided with the conventional plate count method. Graphical abstract ᅟ.

  8. Detection of Pathogenic Biofilms with Bacterial Amyloid Targeting Fluorescent Probe, CDy11

    DEFF Research Database (Denmark)

    Kim, Jun Young; Sahu, Srikanta; Yau, Yin Hoe

    2016-01-01

    Bacterial biofilms are responsible for a wide range of persistent infections. In the clinic, diagnosis of biofilm-associated infections relies heavily on culturing methods, which fail to detect nonculturable bacteria. Identification of novel fluorescent probes for biofilm imaging will greatly...... facilitate diagnosis of pathogenic bacterial infection. Herein, we report a novel fluorescent probe, CDy11 (compound of designation yellow 11), which targets amyloid in the Pseudomonas aeruginosa biofilm matrix through a diversity oriented fluorescent library approach (DOFLA). CDy11 was further demonstrated...

  9. Simultaneous Detection of Five Pathogens from Cerebrospinal Fluid Specimens Using Luminex Technology

    Directory of Open Access Journals (Sweden)

    Linfu Zhou

    2016-02-01

    Full Text Available Early diagnosis and treatment are crucial for the outcome of central nervous system (CNS infections. In this study, we developed a multiplex PCR-Luminex assay for the simultaneous detection of five major pathogens, including Mycobacterium tuberculosis, Cryptococcus neoformans, Streptococcus pneumoniae, and herpes simplex virus types 1 and 2, which frequently cause CNS infections. Through the hybridization reaction between multiplex PCR-amplified targets and oligonucleotide “anti-TAG” sequences, we found that the PCR-Luminex assay could detect as low as 101–102 copies of synthetic pathogen DNAs. Furthermore, 163 cerebrospinal fluid (CSF specimens from patients with suspected CNS infections were used to evaluate the efficiency of this multiplex PCR-Luminex method. Compared with Ziehl-Neelsen stain, this assay showed a high diagnostic accuracy for tuberculosis meningitis (sensitivity, 90.7% and specificity, 99.1%. For cryptococcal meningitis, the sensitivity and specificity were 92% and 97.1%, respectively, compared with the May Grunwald Giemsa (MGG stain. For herpes simplex virus types 1 and 2 encephalitis, the sensitivities were 80.8% and 100%, and the specificities were 94.2% and 99%, respectively, compared with Enzyme Linked Immunosorbent Assay (ELISA assays. Taken together, this multiplex PCR-Luminex assay showed potential efficiency for the simultaneous detection of five pathogens and may be a promising supplement to conventional methods for diagnosing CNS infections.

  10. Nano-particle enhanced impedimetric biosensor for detection of foodborne pathogens

    International Nuclear Information System (INIS)

    Kim, G; Om, A S; Mun, J H

    2007-01-01

    Recent outbreaks of foodborne illness have been increased the need for rapid and sensitive methods for detection of these pathogens. Conventional methods for pathogens detection and identification involve prolonged multiple enrichment steps. Even though some immunological rapid assays are available, these assays still need enrichment steps result in delayed detection. Biosensors have shown great potential for rapid detection of foodborne pathogens. They are capable of direct monitoring the antigen-antibody reactions in real time. Among the biosensors, impedimetric biosensors have been widely adapted as an analysis tool for the study of various biological binding reactions because of their high sensitivity and reagentless operation. In this study a nanoparticle-enhanced impedimetric biosensor for Salmonella enteritidis detection was developed which detected impedance changes caused by the attachment of the cells to the anti-Salmonella antibodies immobilized on interdigitated gold electrodes. Successive immobilization of neutravidin followed by anti-Salmonella antibodies was performed to the sensing area to create a biological detection surface. To enhance the impedance responses generated by antigen-antibody reactions, anti-Salmonella antibody conjugated nanoparticles were introduced on the sensing area. Using a portable impedance analyzer, the impedance across the interdigital electrodes was measured after the series of antigen-antibody bindings. Bacteria cells present in solution attached to capture antibodies and became tethered to the sensor surface. Attached bacteria cells changed the dielectric constant of the media between the electrodes thereby causing a change in measured impedance. Optimum input frequency was determined by analyzing frequency characteristics of the biosensor over ranges of applied frequencies from 10 Hz to 400 Hz. At 100 Hz of input frequency, the biosensor was most sensitive to the changes of the bacteria concentration and this frequency

  11. Monoclonal antibody-based Surface Plasmon Resonance sensors for pathogen detection

    DEFF Research Database (Denmark)

    Skottrup, Peter Durand

    2007-01-01

    essentially transforms molecular interactions into a digital signal, thereby making detection of analytes label-free. Biosensors are used for detection of analytes ranging from small drug molecules to food- and waterborne microorganisms as well as biowarfare pathogens. In future farming, plant production......A biosensor is an analytical device, which incorporates a biological sensing element integrated within a physicochemical transducer. The aim of a biosensor is to produce an electronic signal, which is proportional to the interaction of analytes with the sensing element. This means that the sensor...

  12. Evaluating surveillance strategies for the early detection of low pathogenicity avian influenza infections.

    Science.gov (United States)

    Comin, Arianna; Stegeman, Arjan; Marangon, Stefano; Klinkenberg, Don

    2012-01-01

    In recent years, the early detection of low pathogenicity avian influenza (LPAI) viruses in poultry has become increasingly important, given their potential to mutate into highly pathogenic viruses. However, evaluations of LPAI surveillance have mainly focused on prevalence and not on the ability to act as an early warning system. We used a simulation model based on data from Italian LPAI epidemics in turkeys to evaluate different surveillance strategies in terms of their performance as early warning systems. The strategies differed in terms of sample size, sampling frequency, diagnostic tests, and whether or not active surveillance (i.e., routine laboratory testing of farms) was performed, and were also tested under different epidemiological scenarios. We compared surveillance strategies by simulating within-farm outbreaks. The output measures were the proportion of infected farms that are detected and the farm reproduction number (R(h)). The first one provides an indication of the sensitivity of the surveillance system to detect within-farm infections, whereas R(h) reflects the effectiveness of outbreak detection (i.e., if detection occurs soon enough to bring an epidemic under control). Increasing the sampling frequency was the most effective means of improving the timeliness of detection (i.e., it occurs earlier), whereas increasing the sample size increased the likelihood of detection. Surveillance was only effective in preventing an epidemic if actions were taken within two days of sampling. The strategies were not affected by the quality of the diagnostic test, although performing both serological and virological assays increased the sensitivity of active surveillance. Early detection of LPAI outbreaks in turkeys can be achieved by increasing the sampling frequency for active surveillance, though very frequent sampling may not be sustainable in the long term. We suggest that, when no LPAI virus is circulating yet and there is a low risk of virus introduction

  13. Evaluating surveillance strategies for the early detection of low pathogenicity avian influenza infections.

    Directory of Open Access Journals (Sweden)

    Arianna Comin

    Full Text Available In recent years, the early detection of low pathogenicity avian influenza (LPAI viruses in poultry has become increasingly important, given their potential to mutate into highly pathogenic viruses. However, evaluations of LPAI surveillance have mainly focused on prevalence and not on the ability to act as an early warning system. We used a simulation model based on data from Italian LPAI epidemics in turkeys to evaluate different surveillance strategies in terms of their performance as early warning systems. The strategies differed in terms of sample size, sampling frequency, diagnostic tests, and whether or not active surveillance (i.e., routine laboratory testing of farms was performed, and were also tested under different epidemiological scenarios. We compared surveillance strategies by simulating within-farm outbreaks. The output measures were the proportion of infected farms that are detected and the farm reproduction number (R(h. The first one provides an indication of the sensitivity of the surveillance system to detect within-farm infections, whereas R(h reflects the effectiveness of outbreak detection (i.e., if detection occurs soon enough to bring an epidemic under control. Increasing the sampling frequency was the most effective means of improving the timeliness of detection (i.e., it occurs earlier, whereas increasing the sample size increased the likelihood of detection. Surveillance was only effective in preventing an epidemic if actions were taken within two days of sampling. The strategies were not affected by the quality of the diagnostic test, although performing both serological and virological assays increased the sensitivity of active surveillance. Early detection of LPAI outbreaks in turkeys can be achieved by increasing the sampling frequency for active surveillance, though very frequent sampling may not be sustainable in the long term. We suggest that, when no LPAI virus is circulating yet and there is a low risk of virus

  14. Detection of human bacterial pathogens in ticks collected from Louisiana black bears (Ursus americanus luteolus).

    Science.gov (United States)

    Leydet, Brian F; Liang, Fang-Ting

    2013-04-01

    There are 4 major human-biting tick species in the northeastern United States, which include: Amblyomma americanum, Amblyomma maculatum, Dermacentor variabilis, and Ixodes scapularis. The black bear is a large mammal that has been shown to be parasitized by all the aforementioned ticks. We investigated the bacterial infections in ticks collected from Louisiana black bears (Ursus americanus subspecies luteolus). Eighty-six ticks were collected from 17 black bears in Louisiana from June 2010 to March 2011. All 4 common human-biting tick species were represented. Each tick was subjected to polymerase chain reaction (PCR) targeting select bacterial pathogens and symbionts. Bacterial DNA was detected in 62% of ticks (n=53). Rickettsia parkeri, the causative agent of an emerging spotted fever group rickettsiosis, was identified in 66% of A. maculatum, 28% of D. variabilis, and 11% of I. scapularis. The Lyme disease bacterium, Borrelia burgdorferi, was detected in 2 I. scapularis, while one A. americanum was positive for Borrelia bissettii, a putative human pathogen. The rickettsial endosymbionts Candidatus Rickettsia andeanae, rickettsial endosymbiont of I. scapularis, and Rickettsia amblyommii were detected in their common tick hosts at 21%, 39%, and 60%, respectively. All ticks were PCR-negative for Anaplasma phagocytophilum, Ehrlichia spp., and Babesia microti. This is the first reported detection of R. parkeri in vector ticks in Louisiana; we also report the novel association of R. parkeri with I. scapularis. Detection of both R. parkeri and B. burgdorferi in their respective vectors in Louisiana demands further investigation to determine potential for human exposure to these pathogens. Copyright © 2013 Elsevier GmbH. All rights reserved.

  15. Fault detection and isolation in GPS receiver autonomous integrity monitoring based on chaos particle swarm optimization-particle filter algorithm

    Science.gov (United States)

    Wang, Ershen; Jia, Chaoying; Tong, Gang; Qu, Pingping; Lan, Xiaoyu; Pang, Tao

    2018-03-01

    The receiver autonomous integrity monitoring (RAIM) is one of the most important parts in an avionic navigation system. Two problems need to be addressed to improve this system, namely, the degeneracy phenomenon and lack of samples for the standard particle filter (PF). However, the number of samples cannot adequately express the real distribution of the probability density function (i.e., sample impoverishment). This study presents a GPS receiver autonomous integrity monitoring (RAIM) method based on a chaos particle swarm optimization particle filter (CPSO-PF) algorithm with a log likelihood ratio. The chaos sequence generates a set of chaotic variables, which are mapped to the interval of optimization variables to improve particle quality. This chaos perturbation overcomes the potential for the search to become trapped in a local optimum in the particle swarm optimization (PSO) algorithm. Test statistics are configured based on a likelihood ratio, and satellite fault detection is then conducted by checking the consistency between the state estimate of the main PF and those of the auxiliary PFs. Based on GPS data, the experimental results demonstrate that the proposed algorithm can effectively detect and isolate satellite faults under conditions of non-Gaussian measurement noise. Moreover, the performance of the proposed novel method is better than that of RAIM based on the PF or PSO-PF algorithm.

  16. Detection of bacteriocins produced by plant pathogenic bacteria from the general Erwinia, Pseudomonas and Xanthomonas

    International Nuclear Information System (INIS)

    Biagi, C.M.R. de

    1992-01-01

    Detection of bacteriocin production was studied under distinct conditions using strains of plant pathogenic bacteria from the genera Erwinia, Pseudomonas and Xanthomonas. 58.06%, 79.31% and 40.00% of producing strains were found respectively in the three groups of bacteria using the 523 medium which was the best for the detection of bacteriocin production. Increasing agar concentrations added to the medium up to 1,5% improved the detection. The amount of medium added to the Petri dishes did not affect bacteriocin production. The longest incubation time (72 h.) improved the detection of haloes production. Ultra-violet irradiation in low dosages seems to improve the visualization of haloes production but this is dependent on the tested strains. (author)

  17. Single walled carbon nanotube-based electrical biosensor for the label-free detection of pathogenic bacteria

    DEFF Research Database (Denmark)

    Yoo, S. M.; Baek, Y. K.; Shin, S.

    2016-01-01

    We herein describe the development of a single-walled carbon nanotube (SWNT)-based electrical biosensor consisting of a two-terminal resistor, and report its use for the specific, label-free detection of pathogenic bacteria via changes in conductance. The ability of this biosensor to recognize...... different pathogenic bacteria was analyzed, and conditions were optimized with different probe concentrations. Using this system, the reference strains and clinical isolates of Staphylococcus aureus and Escherichia coli were successfully detected; in both cases, the sensor showed a detection limit of 10 CFU....... This SWNT-based electrical biosensor will prove useful for the development of highly sensitive and specific handheld pathogen detectors....

  18. Development of a real-time PCR for the detection of pathogenic Leptospira spp. in California sea lions.

    Science.gov (United States)

    Wu, Qingzhong; Prager, Katherine C; Goldstein, Tracey; Alt, David P; Galloway, Renee L; Zuerner, Richard L; Lloyd-Smith, James O; Schwacke, Lori

    2014-08-11

    Several real-time PCR assays are currently used for detection of pathogenic Leptospira spp.; however, few methods have been described for the successful evaluation of clinical urine samples. This study reports a rapid assay for the detection of pathogenic Leptospira spp. in California sea lions Zalophus californianus using real-time PCR with primers and a probe targeting the lipL32 gene. The PCR assay had high analytic sensitivity-the limit of detection was 3 genome copies per PCR volume using L. interrogans serovar Pomona DNA and 100% analytic specificity; it detected all pathogenic leptospiral serovars tested and none of the non-pathogenic Leptospira species (L. biflexa and L. meyeri serovar Semaranga), the intermediate species L. inadai, or the non-Leptospira pathogens tested. Our assay had an amplification efficiency of 1.00. Comparisons between the real-time PCR assay and culture isolation for detection of pathogenic Leptospira spp. in urine and kidney tissue samples from California sea lions showed that samples were more often positive by real-time PCR than by culture methods. Inclusion of an internal amplification control in the real-time PCR assay showed no inhibitory effects in PCR negative samples. These studies indicated that our real-time PCR assay has high analytic sensitivity and specificity for the rapid detection of pathogenic Leptospira species in urine and kidney tissue samples.

  19. Fluorescent Silica Nanoparticles in the Detection and Control of the Growth of Pathogen

    International Nuclear Information System (INIS)

    Chitra, K.; Annadurai, G.

    2013-01-01

    In this present study the bio conjugated fluorescent silica nanoparticles give an efficient fluorescent-based immunoassay for the detection of pathogen. The synthesized silica nanoparticles were poly dispersed and the size of the silica nanoparticles was in the range of 114-164 nm. The energy dispersive X-ray spectrophotometer showed the presence of silica at 1.8 keV and the selected area diffractometer showed amorphous nature of silica nanoparticles. The FTIR spectrum confirmed the attachment of dye and carboxyl group onto the silica nanoparticles surface. The fluorescent silica nanoparticles showed highly efficient fluorescence and the fluorescent emission of silica nanoparticles occurred at 536 nm. The SEM image showed the aggregation of nanoparticles and bacteria. The growth of the pathogenic E. coli was controlled using silica nanoparticles; therefore silica nanoparticles could be used in food packaging material, biomedical material, and so forth. This work provides a rapid, simple, and accurate method for the detection of pathogen using fluorescent-based immunoassay.

  20. [Detection of biofilm formation by selected pathogens relevant to the food industry].

    Science.gov (United States)

    Šilhová-Hrušková, L; Moťková, P; Šilha, D; Vytřasová, J

    2015-09-01

    Detection of biofilm formation by microbial pathogens relevant to the food industry and comparison of biofilm formation under different conditions of culture. The following microorganisms were selected for the study: Staphylococcus aureus, Listeria innocua, Listeria ivanovii, Cronobacter sakazakii, Cronobacter muytjensii, Arcobacter butzleri, Arcobacter cryaerophilus, Campylobacter jejuni, and Campylobacter coli. To detect biofilm formation the microtiter plate assay, as described by Christensen and culture on stainless steel coupons were used. The biofilm forming capacity was confirmed in all microorganisms tested, both on the microtiter plates and stainless steel coupons. Biofilm formation was influenced by the culture medium, material used, and culture duration as well as by the test microorganism. It was found that different species and strains of the same genus differ in biofilm formation. Differences were also found between the collection strains and isolates from the environment. Some bacteria tended to form biofilm more readily on the surface of the polyethylene microtiter plates and less readily on stainless steel coupons while others appeared to have an opposite tendency. Some pathogens were able to increase the planktonic cell density in the initial suspension even by three orders of magnitude within 72 hours while producing plenty of biofilm. The study of biofilm formation by high risk pathogens is of utmost importance, not only to the food industry. From the obtained results, it is evident that bacterial biofilms form rapidly (within 24 hours in the present study). Due to their architecture, these biofilms are difficult to eradicate, and therefore, it is crucial to prevent biofilm formation.

  1. Physics Based Model for Online Fault Detection in Autonomous Cryogenic Loading System

    Science.gov (United States)

    Kashani, Ali; Devine, Ekaterina Viktorovna P; Luchinsky, Dmitry Georgievich; Smelyanskiy, Vadim; Sass, Jared P.; Brown, Barbara L.; Patterson-Hine, Ann

    2013-01-01

    We report the progress in the development of the chilldown model for rapid cryogenic loading system developed at KSC. The nontrivial characteristic feature of the analyzed chilldown regime is its active control by dump valves. The two-phase flow model of the chilldown is approximated as one-dimensional homogeneous fluid flow with no slip condition for the interphase velocity. The model is built using commercial SINDAFLUINT software. The results of numerical predictions are in good agreement with the experimental time traces. The obtained results pave the way to the application of the SINDAFLUINT model as a verification tool for the design and algorithm development required for autonomous loading operation.

  2. Development and application of an oligonucleotide microarray and real-time quantitative PCR for detection of wastewater bacterial pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Dae-Young [National Water Research Institute, Environment Canada, 867 Lakeshore Road, Burlington, Ontario, L7R 4A6 (Canada)], E-mail: daeyoung.lee@ec.gc.ca; Lauder, Heather; Cruwys, Heather; Falletta, Patricia [National Water Research Institute, Environment Canada, 867 Lakeshore Road, Burlington, Ontario, L7R 4A6 (Canada); Beaudette, Lee A. [Environmental Science and Technology Centre, Environment Canada, 335 River Road South, Ottawa, Ontario, K1A 0H3 (Canada)], E-mail: lee.beaudette@ec.gc.ca

    2008-07-15

    Conventional microbial water quality test methods are well known for their technical limitations, such as lack of direct pathogen detection capacity and low throughput capability. The microarray assay has recently emerged as a promising alternative for environmental pathogen monitoring. In this study, bacterial pathogens were detected in municipal wastewater using a microarray equipped with short oligonucleotide probes targeting 16S rRNA sequences. To date, 62 probes have been designed against 38 species, 4 genera, and 1 family of pathogens. The detection sensitivity of the microarray for a waterborne pathogen Aeromonas hydrophila was determined to be approximately 1.0% of the total DNA, or approximately 10{sup 3}A. hydrophila cells per sample. The efficacy of the DNA microarray was verified in a parallel study where pathogen genes and E. coli cells were enumerated using real-time quantitative PCR (qPCR) and standard membrane filter techniques, respectively. The microarray and qPCR successfully detected multiple wastewater pathogen species at different stages of the disinfection process (i.e. secondary effluents vs. disinfected final effluents) and at two treatment plants employing different disinfection methods (i.e. chlorination vs. UV irradiation). This result demonstrates the effectiveness of the DNA microarray as a semi-quantitative, high throughput pathogen monitoring tool for municipal wastewater.

  3. Nucleic Acid-Based Detection and Identification of Bacterial and Fungal Plant Pathogens - Final Report

    Energy Technology Data Exchange (ETDEWEB)

    Kingsley, Mark T.

    2001-03-13

    The threat to American interests from terrorists is not limited to attacks against humans. Terrorists might seek to inflict damage to the U.S. economy by attacking our agricultural sector. Infection of commodity crops by bacterial or fungal crop pathogens could adversely impact U.S. agriculture, either directly from damage to crops or indirectly from damage to our ability to export crops suspected of contamination. Recognizing a terrorist attack against U.S. agriculture, to be able to prosecute the terrorists, is among the responsibilities of the members of Hazardous Material Response Unit (HMRU) of the Federal Bureau of Investigation (FBI). Nucleic acid analysis of plant pathogen strains by the use of polymerase chain reaction (PCR) amplification techniques is a powerful method for determining the exact identity of pathogens, as well as their possible region of origin. This type of analysis, however, requires that PCR assays be developed specific to each particular pathogen strain, and analysis protocols developed that are specific to the particular instrument used for detection. The objectives of the work described here were threefold: 1) to assess the potential terrorist threat to U.S. agricultural crops, 2) to determine whether suitable assays exist to monitor that threat, and 3) where assays are needed for priority plant pathogen threats, to modify or develop those assays for use by specialists at the HMRU. The assessment of potential threat to U.S. commodity crops and the availability of assays for those threats were described in detail in the Technical Requirements Document (9) and will be summarized in this report. This report addresses development of specific assays identified in the Technical Requirements Document, and offers recommendations for future development to ensure that HMRU specialists will be prepared with the PCR assays they need to protect against the threat of economic terrorism.

  4. New Trends in Impedimetric Biosensors for the Detection of Foodborne Pathogenic Bacteria

    Science.gov (United States)

    Wang, Yixian; Ye, Zunzhong; Ying, Yibin

    2012-01-01

    The development of a rapid, sensitive, specific method for the foodborne pathogenic bacteria detection is of great importance to ensure food safety and security. In recent years impedimetric biosensors which integrate biological recognition technology and impedance have gained widespread application in the field of bacteria detection. This paper presents an overview on the progress and application of impedimetric biosensors for detection of foodborne pathogenic bacteria, particularly the new trends in the past few years, including the new specific bio-recognition elements such as bacteriophage and lectin, the use of nanomaterials and microfluidics techniques. The applications of these new materials or techniques have provided unprecedented opportunities for the development of high-performance impedance bacteria biosensors. The significant developments of impedimetric biosensors for bacteria detection in the last five years have been reviewed according to the classification of with or without specific bio-recognition element. In addition, some microfluidics systems, which were used in the construction of impedimetric biosensors to improve analytical performance, are introduced in this review. PMID:22737018

  5. Aptamer-based hydrogel barcodes for the capture and detection of multiple types of pathogenic bacteria.

    Science.gov (United States)

    Xu, Yueshuang; Wang, Huan; Luan, Chengxin; Liu, Yuxiao; Chen, Baoan; Zhao, Yuanjin

    2018-02-15

    Rapid and sensitive diagnosing hematological infections based on the separation and detection of pathogenic bacteria in the patient's blood is a significant challenge. To address this, we herein present a new barcodes technology that can simultaneously capture and detect multiple types of pathogenic bacteria from a complex sample. The barcodes are poly (ethylene glycol) (PEG) hydrogel inverse opal particles with characteristic reflection peak codes that remain stable during bacteria capture on their surfaces. As the spherical surface of the particles has ordered porous nanostructure, the barcodes can provide not only more surface area for probe immobilization and reaction, but also a nanopatterned platform for highly efficient bioreactions. In addition, the PEG hydrogel scaffold could decrease the non-specificity adsorption by its anti-adhesive effect, and the decorated aptamer probes in the scaffolds could increase the sensitivity, reliability, and specificity of the bacteria capture and detection. Moreover, the tagged magnetic nanoparticles in the PEG scaffold could impart the barcodes with controllable movement under magnetic fields, which can be used to significantly increase the reaction speed and simplify the processing of the bioassays. Based on the describe barcodes, it was demonstrated that the bacteria could be captured and identified even at low bacterial concentrations (100 CFU mL -1 ) within 2.5h, which is effectively shortened in comparison with the "gold standard" in clinic. These features make the barcodes ideal for capturing and detecting multiple bacteria from clinical samples for hematological infection diagnostics. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Rapid and high-throughput detection of highly pathogenic bacteria by Ibis PLEX-ID technology.

    Directory of Open Access Journals (Sweden)

    Daniela Jacob

    Full Text Available In this manuscript, we describe the identification of highly pathogenic bacteria using an assay coupling biothreat group-specific PCR with electrospray ionization mass spectrometry (PCR/ESI-MS run on an Ibis PLEX-ID high-throughput platform. The biothreat cluster assay identifies most of the potential bioterrorism-relevant microorganisms including Bacillus anthracis, Francisella tularensis, Yersinia pestis, Burkholderia mallei and pseudomallei, Brucella species, and Coxiella burnetii. DNA from 45 different reference materials with different formulations and different concentrations were chosen and sent to a service screening laboratory that uses the PCR/ESI-MS platform to provide a microbial identification service. The standard reference materials were produced out of a repository built up in the framework of the EU funded project "Establishment of Quality Assurances for Detection of Highly Pathogenic Bacteria of Potential Bioterrorism Risk" (EQADeBa. All samples were correctly identified at least to the genus level.

  7. Detection of virulence factors and molecular typing of pathogenic Leptospira from capybara (Hydrochaeris hydrochaeris).

    Science.gov (United States)

    Jorge, Sérgio; Monte, Leonardo G; Coimbra, Marco Antonio; Albano, Ana Paula; Hartwig, Daiane D; Lucas, Caroline; Seixas, Fabiana K; Dellagostin, Odir A; Hartleben, Cláudia P

    2012-10-01

    Leptospirosis is a globally prevalent zoonosis caused by pathogenic Leptospira spp.; several serologic variants have reservoirs in synanthropic rodents. The capybara is the largest living rodent in the world, and it has a wide geographical distribution in Central and South America. This rodent is a significant source of Leptospira since the agent is shed via urine into the environment and is a potential public health threat. In this study, we isolated and identified by molecular techniques a pathogenic Leptospira from capybara in southern Brazil. The isolated strain was characterized by partial rpoB gene sequencing and variable-number tandem-repeats analysis as L. interrogans, serogroup Icterohaemorrhagiae. In addition, to confirm the expression of virulence factors, the bacterial immunoglobulin-like proteins A and B expression was detected by indirect immunofluorescence using leptospiral specific monoclonal antibodies. This report identifies capybaras as an important source of infection and provides insight into the epidemiology of leptospirosis.

  8. Results from the Autonomous Triggering of in situ Sensors on Kilauea Volcano, HI, from Eruption Detection by Spacecraft

    Science.gov (United States)

    Doubleday, J.; Behar, A.; Davies, A.; Mora-Vargas, A.; Tran, D.; Abtahi, A.; Pieri, D. C.; Boudreau, K.; Cecava, J.

    2008-12-01

    Response time in acquiring sensor data in volcanic emergencies can be greatly improved through use of autonomous systems. For instance, ground-based observations and data processing applications of the JPL Volcano Sensor Web have promptly triggered spacecraft observations [e.g., 1]. The reverse command and information flow path can also be useful, using autonomous analysis of spacecraft data to trigger in situ sensors. In this demonstration project, SO2 sensors were incorporated into expendable "Volcano Monitor" capsules and placed downwind of the Pu'u 'O'o vent of Kilauea volcano, Hawai'i. In nominal (low) power conservation mode, data from these sensors were collected and transmitted every hour to the Volcano Sensor Web through the Iridium Satellite Network. When SO2 readings exceeded a predetermined threshold, the modem within the Volcano Monitor sent an alert to the Sensor Web, and triggered a request for prompt Earth Observing-1 (EO-1) spacecraft data acquisition. The Volcano Monitors were also triggered by the Sensor Web in response to an eruption detection by the MODIS instrument on Terra. During these pre- defined "critical events" the Sensor Web ordered the SO2 sensors within the Volcano Monitor to increase their sampling frequency to every 5 minutes (high power "burst mode"). Autonomous control of the sensors' sampling frequency enabled the Sensor Web to monitor and respond to rapidly evolving conditions, and allowed rapid compilation and dissemination of these data to the scientific community. Reference: [1] Davies et al., (2006) Eos, 87, (1), 1 and 5. This work was performed at the Jet Propulsion Laboratory-California Institute of Technology, under contract to NASA. Support was provided by the NASA AIST program, the Idaho Space Grant Consortium, and the New Mexico Space Grant Program. We also especially thank the personnel of the USGS Hawaiian Volcano Observatory for their invaluable scientific guidance and logistical assistance.

  9. Multiplexed lateral flow microarray assay for detection of citrus pathogens Xylella fastidiosa and Xanthomonas axonopodis pv citri

    Energy Technology Data Exchange (ETDEWEB)

    Cary,; Bruce, R [Santa Fe, NM; Stubben, Christopher J [Los Alamos, NM

    2011-03-22

    The invention provides highly sensitive and specific assays for the major citrus pathogens Xylella fastidiosa and Xanthomonas axonopodis, including a field deployable multiplexed assay capable of rapidly assaying for both pathogens simultaneously. The assays are directed at particular gene targets derived from pathogenic strains that specifically cause the major citrus diseases of citrus variegated chlorosis (Xylella fastidiosa 9a5c) and citrus canker (Xanthomonas axonopodis pv citri). The citrus pathogen assays of the invention offer femtomole sensitivity, excellent linear dynamic range, and rapid and specific detection.

  10. High throughput, multiplexed pathogen detection authenticates plague waves in medieval Venice, Italy.

    Science.gov (United States)

    Tran, Thi-Nguyen-Ny; Signoli, Michel; Fozzati, Luigi; Aboudharam, Gérard; Raoult, Didier; Drancourt, Michel

    2011-03-10

    Historical records suggest that multiple burial sites from the 14th-16th centuries in Venice, Italy, were used during the Black Death and subsequent plague epidemics. High throughput, multiplexed real-time PCR detected DNA of seven highly transmissible pathogens in 173 dental pulp specimens collected from 46 graves. Bartonella quintana DNA was identified in five (2.9%) samples, including three from the 16th century and two from the 15th century, and Yersinia pestis DNA was detected in three (1.7%) samples, including two from the 14th century and one from the 16th century. Partial glpD gene sequencing indicated that the detected Y. pestis was the Orientalis biotype. These data document for the first time successive plague epidemics in the medieval European city where quarantine was first instituted in the 14th century.

  11. Multifunctional Nanotechnology-Enabled Sensors for Rapid Capture and Detection of Pathogens.

    Science.gov (United States)

    Mustafa, Fatima; Hassan, Rabeay Y A; Andreescu, Silvana

    2017-09-15

    Nanomaterial-based sensing approaches that incorporate different types of nanoparticles (NPs) and nanostructures in conjunction with natural or synthetic receptors as molecular recognition elements provide opportunities for the design of sensitive and selective assays for rapid detection of contaminants. This review summarizes recent advancements over the past ten years in the development of nanotechnology-enabled sensors and systems for capture and detection of pathogens. The most common types of nanostructures and NPs, their modification with receptor molecules and integration to produce viable sensing systems with biorecognition, amplification and signal readout are discussed. Examples of all-in-one systems that combine multifunctional properties for capture, separation, inactivation and detection are also provided. Current trends in the development of low-cost instrumentation for rapid assessment of food contamination are discussed as well as challenges for practical implementation and directions for future research.

  12. High Throughput, Multiplexed Pathogen Detection Authenticates Plague Waves in Medieval Venice, Italy

    Science.gov (United States)

    Tran, Thi-Nguyen-Ny; Signoli, Michel; Fozzati, Luigi; Aboudharam, Gérard; Raoult, Didier; Drancourt, Michel

    2011-01-01

    Background Historical records suggest that multiple burial sites from the 14th–16th centuries in Venice, Italy, were used during the Black Death and subsequent plague epidemics. Methodology/Principal Findings High throughput, multiplexed real-time PCR detected DNA of seven highly transmissible pathogens in 173 dental pulp specimens collected from 46 graves. Bartonella quintana DNA was identified in five (2.9%) samples, including three from the 16th century and two from the 15th century, and Yersinia pestis DNA was detected in three (1.7%) samples, including two from the 14th century and one from the 16th century. Partial glpD gene sequencing indicated that the detected Y. pestis was the Orientalis biotype. Conclusions These data document for the first time successive plague epidemics in the medieval European city where quarantine was first instituted in the 14th century. PMID:21423736

  13. Autonomic Neuropathy

    Science.gov (United States)

    ... risk of autonomic neuropathy. Other diseases. Amyloidosis, porphyria, hypothyroidism and cancer (usually due to side effects from treatment) may also increase the risk of autonomic neuropathy. ...

  14. Establishment and Application of a Visual DNA Microarray for the Detection of Food-borne Pathogens.

    Science.gov (United States)

    Li, Yongjin

    2016-01-01

    The accurate detection and identification of food-borne pathogenic microorganisms is critical for food safety nowadays. In the present work, a visual DNA microarray was established and applied to detect pathogens commonly found in food, including Salmonella enterica, Shigella flexneri, E. coli O157:H7 and Listeria monocytogenes in food samples. Multiplex PCR (mPCR) was employed to simultaneously amplify specific gene fragments, fimY for Salmonella, ipaH for Shigella, iap for L. monocytogenes and ECs2841 for E. coli O157:H7, respectively. Biotinylated PCR amplicons annealed to the microarray probes were then reacted with a streptavidin-alkaline phosphatase conjugate and nitro blue tetrazolium/5-bromo-4-chloro-3'-indolylphosphate, p-toluidine salt (NBT/BCIP); the positive results were easily visualized as blue dots formatted on the microarray surface. The performance of a DNA microarray was tested against 14 representative collection strains and mock-contamination food samples. The combination of mPCR and a visual micro-plate chip specifically and sensitively detected Salmonella enterica, Shigella flexneri, E. coli O157:H7 and Listeria monocytogenes in standard strains and food matrices with a sensitivity of ∼10(2) CFU/mL of bacterial culture. Thus, the developed method is advantageous because of its high throughput, cost-effectiveness and ease of use.

  15. Direct colorimetric detection of unamplified pathogen DNA by dextrin-capped gold nanoparticles.

    Science.gov (United States)

    Baetsen-Young, Amy M; Vasher, Matthew; Matta, Leann L; Colgan, Phil; Alocilja, Evangelyn C; Day, Brad

    2018-03-15

    The interaction between gold nanoparticles (AuNPs) and nucleic acids has facilitated a variety of diagnostic applications, with further diversification of synthesis match bio-applications while reducing biotoxicity. However, DNA interactions with unique surface capping agents have not been fully defined. Using dextrin-capped AuNPs (d-AuNPs), we have developed a novel unamplified genomic DNA (gDNA) nanosensor, exploiting dispersion and aggregation characteristics of d-AuNPs, in the presence of gDNA, for sequence-specific detection. We demonstrate that d-AuNPs are stable in a five-fold greater salt concentration than citrate-capped AuNPs and the d-AuNPs were stabilized by single stranded DNA probe (ssDNAp). However, in the elevated salt concentrations of the DNA detection assay, the target reactions were surprisingly further stabilized by the formation of a ssDNAp-target gDNA complex. The results presented herein lead us to propose a mechanism whereby genomic ssDNA secondary structure formation during ssDNAp-to-target gDNA binding enables d-AuNP stabilization in elevated ionic environments. Using the assay described herein, we were successful in detecting as little as 2.94 fM of pathogen DNA, and using crude extractions of a pathogen matrix, as few as 18 spores/µL. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. The detection and differentiation of canine respiratory pathogens using oligonucleotide microarrays.

    Science.gov (United States)

    Wang, Lih-Chiann; Kuo, Ya-Ting; Chueh, Ling-Ling; Huang, Dean; Lin, Jiunn-Horng

    2017-05-01

    Canine respiratory diseases are commonly seen in dogs along with co-infections with multiple respiratory pathogens, including viruses and bacteria. Virus infections in even vaccinated dogs were also reported. The clinical signs caused by different respiratory etiological agents are similar, which makes differential diagnosis imperative. An oligonucleotide microarray system was developed in this study. The wild type and vaccine strains of canine distemper virus (CDV), influenza virus, canine herpesvirus (CHV), Bordetella bronchiseptica and Mycoplasma cynos were detected and differentiated simultaneously on a microarray chip. The detection limit is 10, 10, 100, 50 and 50 copy numbers for CDV, influenza virus, CHV, B. bronchiseptica and M. cynos, respectively. The clinical test results of nasal swab samples showed that the microarray had remarkably better efficacy than the multiplex PCR-agarose gel method. The positive detection rate of microarray and agarose gel was 59.0% (n=33) and 41.1% (n=23) among the 56 samples, respectively. CDV vaccine strain and pathogen co-infections were further demonstrated by the microarray but not by the multiplex PCR-agarose gel. The oligonucleotide microarray provides a highly efficient diagnosis alternative that could be applied to clinical usage, greatly assisting in disease therapy and control. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Laser diagnostic technology for early detection of pathogen infestation in orange fruits

    International Nuclear Information System (INIS)

    Giubileo, Gianfranco; Lai, Antonella; Piccinelli, Delinda; Puiu, Adriana

    2010-01-01

    Due to an increased expectation of food products that respect high quality and safety standards, there is a need for the growth of accurate, fast, objective and non-destructive technologies for quality determination of food and agricultural products. For this purpose, a diagnostic system based on laser photoacoustic spectroscopy (LPAS) was developed at ENEA Frascati Molecular Spectroscopy Laboratory (Italy). In the design of the photoacoustic detector, particular emphasis was placed in attaining a high sensitivity in detecting ethylene (ET) down to sub-parts per billion level (minimum detectable concentration 0.2 ppb). This was required due to the necessity to monitor and follow up ET production at a single fruit scale. ET is normally synthesised in very low amounts by healthy citrus fruits; however stress conditions such as pathogen attack may induce a substantial increase in the synthesised ET. In the present paper, the comparison between the ET emitted by healthy oranges (Citrus sinensis L. Osbeck) cv Navel and by Phytophthora citrophthora infested Navel orange fruits are reported. The obtained results show a well evident increase in ET emission from the infested fruit with respect to the healthy one, even 24 h after the inoculation with the pathogen; at that time the tissue necrosis was not yet visible, and the fruit was also not yet damaged. The possibility to perform a real time non-destructive detection of ET traces makes the LPAS a powerful tool for monitoring the healthy state of the citrus fruits.

  18. Laser diagnostic technology for early detection of pathogen infestation in orange fruits

    Science.gov (United States)

    Giubileo, Gianfranco; Lai, Antonella; Piccinelli, Delinda; Puiu, Adriana

    2010-11-01

    Due to an increased expectation of food products that respect high quality and safety standards, there is a need for the growth of accurate, fast, objective and non-destructive technologies for quality determination of food and agricultural products. For this purpose, a diagnostic system based on laser photoacoustic spectroscopy (LPAS) was developed at ENEA Frascati Molecular Spectroscopy Laboratory (Italy). In the design of the photoacoustic detector, particular emphasis was placed in attaining a high sensitivity in detecting ethylene (ET) down to sub-parts per billion level (minimum detectable concentration 0.2 ppb). This was required due to the necessity to monitor and follow up ET production at a single fruit scale. ET is normally synthesised in very low amounts by healthy citrus fruits; however stress conditions such as pathogen attack may induce a substantial increase in the synthesised ET. In the present paper, the comparison between the ET emitted by healthy oranges ( Citrus sinensis L. Osbeck) cv Navel and by Phytophthora citrophthora infested Navel orange fruits are reported. The obtained results show a well evident increase in ET emission from the infested fruit with respect to the healthy one, even 24 h after the inoculation with the pathogen; at that time the tissue necrosis was not yet visible, and the fruit was also not yet damaged. The possibility to perform a real time non-destructive detection of ET traces makes the LPAS a powerful tool for monitoring the healthy state of the citrus fruits.

  19. Laser diagnostic technology for early detection of pathogen infestation in orange fruits

    Energy Technology Data Exchange (ETDEWEB)

    Giubileo, Gianfranco, E-mail: gianfranco.giubileo@frascati.enea.i [ENEA Frascati, Via E. Fermi 45, 00044 (Italy); Lai, Antonella; Piccinelli, Delinda [ENEA Frascati, Via E. Fermi 45, 00044 (Italy); Puiu, Adriana [Tor Vergata University of Rome, Faculty of Engineering, Via del Politecnico 1, 00133 Rome (Italy)

    2010-11-11

    Due to an increased expectation of food products that respect high quality and safety standards, there is a need for the growth of accurate, fast, objective and non-destructive technologies for quality determination of food and agricultural products. For this purpose, a diagnostic system based on laser photoacoustic spectroscopy (LPAS) was developed at ENEA Frascati Molecular Spectroscopy Laboratory (Italy). In the design of the photoacoustic detector, particular emphasis was placed in attaining a high sensitivity in detecting ethylene (ET) down to sub-parts per billion level (minimum detectable concentration 0.2 ppb). This was required due to the necessity to monitor and follow up ET production at a single fruit scale. ET is normally synthesised in very low amounts by healthy citrus fruits; however stress conditions such as pathogen attack may induce a substantial increase in the synthesised ET. In the present paper, the comparison between the ET emitted by healthy oranges (Citrus sinensis L. Osbeck) cv Navel and by Phytophthora citrophthora infested Navel orange fruits are reported. The obtained results show a well evident increase in ET emission from the infested fruit with respect to the healthy one, even 24 h after the inoculation with the pathogen; at that time the tissue necrosis was not yet visible, and the fruit was also not yet damaged. The possibility to perform a real time non-destructive detection of ET traces makes the LPAS a powerful tool for monitoring the healthy state of the citrus fruits.

  20. Simultaneous aptasensor for multiplex pathogenic bacteria detection based on multicolor upconversion nanoparticles labels.

    Science.gov (United States)

    Wu, Shijia; Duan, Nuo; Shi, Zhao; Fang, Congcong; Wang, Zhouping

    2014-03-18

    A highly sensitive and specific multiplex method for the simultaneous detection of three pathogenic bacteria was fabricated using multicolor upconversion nanoparticles (UCNPs) as luminescence labels coupled with aptamers as the molecular recognition elements. Multicolor UCNPs were synthesized via doping with various rare-earth ions to obtain well-separated emission peaks. The aptamer sequences were selected using the systematic evolution of ligands by exponential enrichment (SELEX) strategy for Staphylococcus aureus, Vibrio parahemolyticus, and Salmonella typhimurium. When applied in this method, aptamers can be used for the specific recognition of the bacteria from complex mixtures, including those found in real food matrixes. Aptamers and multicolor UCNPs were employed to selectively capture and simultaneously quantify the three target bacteria on the basis of the independent peaks. Under optimal conditions, the correlation between the concentration of three bacteria and the luminescence signal was found to be linear from 50-10(6) cfu mL(-1). Improved by the magnetic separation and concentration effect of Fe3O4 magnetic nanoparticles, the limits of detection of the developed method were found to be 25, 10, and 15 cfu mL(-1) for S. aureus, V. parahemolyticus, and S. typhimurium, respectively. The capability of the bioassay in real food samples was also investigated, and the results were consistent with experimental results obtained from plate-counting methods. This proposed method for the detection of various pathogenic bacteria based on multicolor UCNPs has great potential in the application of food safety and multiplex nanosensors.

  1. Exploration of Simple Analytical Approaches for Rapid Detection of Pathogenic Bacteria

    Energy Technology Data Exchange (ETDEWEB)

    Rahman, Salma [Iowa State Univ., Ames, IA (United States)

    2005-01-01

    Many of the current methods for pathogenic bacterial detection require long sample-preparation and analysis time, as well as complex instrumentation. This dissertation explores simple analytical approaches (e.g., flow cytometry and diffuse reflectance spectroscopy) that may be applied towards ideal requirements of a microbial detection system, through method and instrumentation development, and by the creation and characterization of immunosensing platforms. This dissertation is organized into six sections. In the general Introduction section a literature review on several of the key aspects of this work is presented. First, different approaches for detection of pathogenic bacteria will be reviewed, with a comparison of the relative strengths and weaknesses of each approach, A general overview regarding diffuse reflectance spectroscopy is then presented. Next, the structure and function of self-assembled monolayers (SAMs) formed from organosulfur molecules at gold and micrometer and sub-micrometer patterning of biomolecules using SAMs will be discussed. This section is followed by four research chapters, presented as separate manuscripts. Chapter 1 describes the efforts and challenges towards the creation of imunosensing platforms that exploit the flexibility and structural stability of SAMs of thiols at gold. 1H, 1H, 2H, 2H-perfluorodecyl-1-thiol SAM (PFDT) and dithio-bis(succinimidyl propionate)-(DSP)-derived SAMs were used to construct the platform. Chapter 2 describes the characterization of the PFDT- and DSP-derived SAMs, and the architectures formed when it is coupled to antibodies as well as target bacteria. These studies used infrared reflection spectroscopy (IRS), X-ray photoelectron spectroscopy (XPS), and electrochemical quartz crystal microbalance (EQCM), Chapter 3 presents a new sensitive, and portable diffuse reflection based technique for the rapid identification and quantification of pathogenic bacteria. Chapter 4 reports research efforts in the

  2. Systematic detection of positive selection in the human-pathogen interactome and lasting effects on infectious disease susceptibility.

    Directory of Open Access Journals (Sweden)

    Erik Corona

    Full Text Available Infectious disease has shaped the natural genetic diversity of humans throughout the world. A new approach to capture positive selection driven by pathogens would provide information regarding pathogen exposure in distinct human populations and the constantly evolving arms race between host and disease-causing agents. We created a human pathogen interaction database and used the integrated haplotype score (iHS to detect recent positive selection in genes that interact with proteins from 26 different pathogens. We used the Human Genome Diversity Panel to identify specific populations harboring pathogen-interacting genes that have undergone positive selection. We found that human genes that interact with 9 pathogen species show evidence of recent positive selection. These pathogens are Yersenia pestis, human immunodeficiency virus (HIV 1, Zaire ebolavirus, Francisella tularensis, dengue virus, human respiratory syncytial virus, measles virus, Rubella virus, and Bacillus anthracis. For HIV-1, GWAS demonstrate that some naturally selected variants in the host-pathogen protein interaction networks continue to have functional consequences for susceptibility to these pathogens. We show that selected human genes were enriched for HIV susceptibility variants (identified through GWAS, providing further support for the hypothesis that ancient humans were exposed to lentivirus pandemics. Human genes in the Italian, Miao, and Biaka Pygmy populations that interact with Y. pestis show significant signs of selection. These results reveal some of the genetic footprints created by pathogens in the human genome that may have left lasting marks on susceptibility to infectious disease.

  3. Dual Enlargement of Gold Nanoparticles: From Mechanism to Scanometric Detection of Pathogenic Bacteria

    DEFF Research Database (Denmark)

    Cao, Cuong; Gontard, Lionel Cervera; Le Ly, Tram Thuy

    2011-01-01

    the electron density of the nanostructures, leading to a stronger intensity for colorimetric discrimination as well as better sensitivity for quantitative measurement. Based on this, a simple scanometric assay for the on‐slide detection of the food‐born pathogen Campylobacter jejuni is developed. After...... capturing the target bacteria, gold‐tagged immunoprobes are added to create a signal on a solid substrate. The signal is then amplified by the dual enlargement process, resulting in a strong color intensity that can easily be recognized by the unaided eye, or measured by an inexpensive flatbed scanner...

  4. Molecular Biosensors for Electrochemical Detection of Infectious Pathogens in Liquid Biopsies: Current Trends and Challenges.

    Science.gov (United States)

    Campuzano, Susana; Yáñez-Sedeño, Paloma; Pingarrón, José Manuel

    2017-11-03

    Rapid and reliable diagnosis of infectious diseases caused by pathogens, and timely initiation of appropriate treatment are critical determinants to promote optimal clinical outcomes and general public health. Conventional in vitro diagnostics for infectious diseases are time-consuming and require centralized laboratories, experienced personnel and bulky equipment. Recent advances in electrochemical affinity biosensors have demonstrated to surpass conventional standards in regards to time, simplicity, accuracy and cost in this field. The tremendous potential offered by electrochemical affinity biosensors to detect on-site infectious pathogens at clinically relevant levels in scarcely treated body fluids is clearly stated in this review. The development and application of selected examples using different specific receptors, assay formats and electrochemical approaches focusing on the determination of specific circulating biomarkers of different molecular (genetic, regulatory and functional) levels associated with bacterial and viral pathogens are critically discussed. Existing challenges still to be addressed and future directions in this rapidly advancing and highly interesting field are also briefly pointed out.

  5. Detection of pathogenic micro-organisms on children's hands and toys during play.

    Science.gov (United States)

    Martínez-Bastidas, T; Castro-del Campo, N; Mena, K D; Castro-del Campo, N; León-Félix, J; Gerba, C P; Chaidez, C

    2014-06-01

    This study aimed to determine if the children's leisure activities impact the presence of pathogens on their hands and toys. To assess the microbiological hazard in playground areas, a pilot study that included 12 children was conducted. We then conducted an intervention study; children's hands and toys were washed before playing. Faecal coliforms, pathogenic bacteria and Giardia lamblia were quantified by membrane filtration, selective media and flotation techniques, respectively; rotavirus, hepatitis A and rhinovirus by RT-PCR. Pilot study results revealed faecal contamination on children's hands and toys after playing on sidewalks and in public parks. Pathogenic bacteria, hepatitis A and G. lamblia on children's hands were also found. In the intervention study, Staphylococcus aureus and Klebsiella pneumoniae were found on children's hands at concentrations up to 2·5 × 10(4) and 1 × 10(4) CFU hands(-1), respectively. E. coli and Kl. pneumoniae were detected on toys (2·4 × 10(3) and 2·7 × 10(4) CFU toy(-1), respectively). Salmonella spp, Serratia spp and G. lamblia cysts were also present on toys. Children's play activities influence microbial presence on hands and toys; the transfer seems to occur in both ways. Control strategy needs to be implemented to protect children from infectious diseases. © 2014 The Society for Applied Microbiology.

  6. TEST KIT FOR THE DETECTION AND GENOTYPING OF HIGHLY PATHOGENIC INFLUENZA VIRUS A H5N1 BY REAL-TIME POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    S. V. Stepaniuk

    2014-06-01

    Full Text Available Results of the annual monitoring of epizooties indicate that highly pathogenic HPAI/H5N1 avian influenza widely circulated in Eurasian region. Over a period of 2010–2013 years more than 165 cases of outbreaks in 14 countries were found out. Ukraine became one of the first countries in Europe where in Autonomous Republic of Crimea in October 2005 outbreak of avian epizootic with HPAI/H5N1 was documented and until February 2008 more than 236,000 poultry were killed. Since then the question of monitoring of infected both migrating birds and poultry in places of cross contact in Ukraine remains of high priority. The test system is developed for identification and genotyping A H5N1 on three genes (M, H5 and N1 HPAI/H5N1 in real-time mode for polymerase chain reaction. Test kit capacity to detect HPAI/h5n1avian influenza virus and differentiate it from the other viral infection agents of birds and animals were studied by testing of HPAI/H5N1 virus isolated during mass infection outbreak in Crimea in 2005 and cultural specimens of other viral pathogens. It was established that the «DIA Real Avian Influenza» test kit was capable to detect RNA influenza A virus of high pathogenic H5N1 strains having high sensitivity (100% while RNA of the Crimean HPAI/H5N1 isolate studying and specificity (100% while RNA viruses of Newcastle birds disease, fowl powershift, syndrome of drop in egg production and horse influenza studying.

  7. Multiplex TaqMan® detection of pathogenic and multi-drug resistant Salmonella.

    Science.gov (United States)

    Singh, Prashant; Mustapha, Azlin

    2013-09-02

    Overuse of antibiotics in the medical and animal industries is one of the major causes for the development of multi-drug-resistant (MDR) food pathogens that are often difficult to treat. In the past few years, higher incidences of outbreaks caused by MDR Salmonella have been increasingly documented. The objective of this study was to develop a rapid multiplex real-time polymerase chain reaction (PCR) assay for simultaneous detection of pathogenic and MDR Salmonella spp. A multiplex TaqMan®real-time PCR was designed by targeting the invasin virulence gene (invA), and four commonly found antibiotic resistance genes, viz. ampicillin, chloramphenicol, streptomycin and tetracycline. To avoid false negative results and to increase the reliability of the assay, an internal amplification control (IAC) was added which was detected using a locked nucleic acid (LNA) probe. In serially diluted (5 ng-50 fg) DNA samples, the assay was able to detect 100 genomic equivalents of Salmonella, while in a multiplex format, the sensitivity was 1000 genomic equivalents. The assay performed equally well on artificially contaminated samples of beef trim, ground beef of different fat contents (73:27, 80:20, 85:15 and 93:7), chicken rinse, ground chicken, ground turkey, egg, spinach and tomato. While the detection limit for un-enriched inoculated food samples was 10(4) CFU/g, this was improved to 10 CFU/g after a 12-h enrichment in buffered peptone water, with 100% reproducibility. The multiplex real-time assay developed in this study can be used as a valuable tool to detect MDR virulent Salmonella, thus enhancing the safety of food. © 2013.

  8. Hyperspectral imaging using a color camera and its application for pathogen detection

    Science.gov (United States)

    Yoon, Seung-Chul; Shin, Tae-Sung; Heitschmidt, Gerald W.; Lawrence, Kurt C.; Park, Bosoon; Gamble, Gary

    2015-02-01

    This paper reports the results of a feasibility study for the development of a hyperspectral image recovery (reconstruction) technique using a RGB color camera and regression analysis in order to detect and classify colonies of foodborne pathogens. The target bacterial pathogens were the six representative non-O157 Shiga-toxin producing Escherichia coli (STEC) serogroups (O26, O45, O103, O111, O121, and O145) grown in Petri dishes of Rainbow agar. The purpose of the feasibility study was to evaluate whether a DSLR camera (Nikon D700) could be used to predict hyperspectral images in the wavelength range from 400 to 1,000 nm and even to predict the types of pathogens using a hyperspectral STEC classification algorithm that was previously developed. Unlike many other studies using color charts with known and noise-free spectra for training reconstruction models, this work used hyperspectral and color images, separately measured by a hyperspectral imaging spectrometer and the DSLR color camera. The color images were calibrated (i.e. normalized) to relative reflectance, subsampled and spatially registered to match with counterpart pixels in hyperspectral images that were also calibrated to relative reflectance. Polynomial multivariate least-squares regression (PMLR) was previously developed with simulated color images. In this study, partial least squares regression (PLSR) was also evaluated as a spectral recovery technique to minimize multicollinearity and overfitting. The two spectral recovery models (PMLR and PLSR) and their parameters were evaluated by cross-validation. The QR decomposition was used to find a numerically more stable solution of the regression equation. The preliminary results showed that PLSR was more effective especially with higher order polynomial regressions than PMLR. The best classification accuracy measured with an independent test set was about 90%. The results suggest the potential of cost-effective color imaging using hyperspectral image

  9. Integrated optical detection of autonomous capillary microfluidic immunoassays:a hand-held point-of-care prototype.

    Science.gov (United States)

    Novo, P; Chu, V; Conde, J P

    2014-07-15

    The miniaturization of biosensors using microfluidics has potential in enabling the development of point-of-care devices, with the added advantages of reduced time and cost of analysis with limits-of-detection comparable to those obtained through traditional laboratory techniques. Interfacing microfluidic devices with the external world can be difficult especially in aspects involving fluid handling and the need for simple sample insertion that avoids special equipment or trained personnel. In this work we present a point-of-care prototype system by integrating capillary microfluidics with a microfabricated photodiode array and electronic instrumentation into a hand-held unit. The capillary microfluidic device is capable of autonomous and sequential fluid flow, including control of the average fluid velocity at any given point of the analysis. To demonstrate the functionality of the prototype, a model chemiluminescence ELISA was performed. The performance of the integrated optical detection in the point-of-care prototype is equal to that obtained with traditional bench-top instrumentation. The photodiode signals were acquired, displayed and processed by a simple graphical user interface using a computer connected to the microcontroller through USB. The prototype performed integrated chemiluminescence ELISA detection in about 15 min with a limit-of-detection of ≈2 nM with an antibody-antigen affinity constant of ≈2×10(7) M(-1). Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Label and label-free based surface-enhanced Raman scattering for pathogen bacteria detection: A review.

    Science.gov (United States)

    Liu, Yu; Zhou, Haibo; Hu, Ziwei; Yu, Guangxia; Yang, Danting; Zhao, Jinshun

    2017-08-15

    Rapid, accurate detection of pathogen bacteria is a highly topical research area for the sake of food safety and public health. Surface-enhanced Raman scattering (SERS) is being considered as a powerful and attractive technique for pathogen bacteria detection, due to its sensitivity, high speed, comparatively low cost, multiplexing ability and portability. This contribution aims to give a comprehensive overview of SERS as a technique for rapid detection of pathogen bacteria based on label and label-free strategies. A brief tutorial on SERS is given first of all. Then we summarize the recent trends and developments of label and label-free based SERS applied to detection of pathogen bacteria, including the relatively complete interpretation of SERS spectra. In addition, multifunctional SERS platforms for pathogen bacteria in matrix are discussed as well. Furthermore, an outlook of the work done and a perspective on the future directions of SERS as a reliable tool for real-time pathogen bacteria detection are given. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Detection and identification of intestinal pathogenic bacteria by hybridization to oligonucleotide microarrays

    Science.gov (United States)

    Jin, Lian-Qun; Li, Jun-Wen; Wang, Sheng-Qi; Chao, Fu-Huan; Wang, Xin-Wei; Yuan, Zheng-Quan

    2005-01-01

    AIM: To detect the common intestinal pathogenic bacteria quickly and accurately. METHODS: A rapid (<3 h) experimental procedure was set up based upon the gene chip technology. Target genes were amplified and hybridized by oligonucleotide microarrays. RESULTS: One hundred and seventy strains of bacteria in pure culture belonging to 11 genera were successfully discriminated under comparatively same conditions, and a series of specific hybridization maps corresponding to each kind of bacteria were obtained. When this method was applied to 26 divided cultures, 25 (96.2%) were identified. CONCLUSION: Salmonella sp., Escherichia coli, Shigella sp., Listeria monocytogenes, Vibrio parahaemolyticus, Staphylococcus aureus, Proteus sp., Bacillus cereus, Vibrio cholerae, Enterococcus faecalis, Yersinia enterocolitica, and Campylobacter jejuni can be detected and identified by our microarrays. The accuracy, range, and discrimination power of this assay can be continually improved by adding further oligonucleotides to the arrays without any significant increase of complexity or cost. PMID:16437687

  12. A Plant Immune Receptor Detects Pathogen Effectors that Target WRKY Transcription Factors.

    Science.gov (United States)

    Sarris, Panagiotis F; Duxbury, Zane; Huh, Sung Un; Ma, Yan; Segonzac, Cécile; Sklenar, Jan; Derbyshire, Paul; Cevik, Volkan; Rallapalli, Ghanasyam; Saucet, Simon B; Wirthmueller, Lennart; Menke, Frank L H; Sohn, Kee Hoon; Jones, Jonathan D G

    2015-05-21

    Defense against pathogens in multicellular eukaryotes depends on intracellular immune receptors, yet surveillance by these receptors is poorly understood. Several plant nucleotide-binding, leucine-rich repeat (NB-LRR) immune receptors carry fusions with other protein domains. The Arabidopsis RRS1-R NB-LRR protein carries a C-terminal WRKY DNA binding domain and forms a receptor complex with RPS4, another NB-LRR protein. This complex detects the bacterial effectors AvrRps4 or PopP2 and then activates defense. Both bacterial proteins interact with the RRS1 WRKY domain, and PopP2 acetylates lysines to block DNA binding. PopP2 and AvrRps4 interact with other WRKY domain-containing proteins, suggesting these effectors interfere with WRKY transcription factor-dependent defense, and RPS4/RRS1 has integrated a "decoy" domain that enables detection of effectors that target WRKY proteins. We propose that NB-LRR receptor pairs, one member of which carries an additional protein domain, enable perception of pathogen effectors whose function is to target that domain. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. A quantum-dot-based fluoroassay for detection of food-borne pathogens.

    Science.gov (United States)

    Mohamadi, Elaheh; Moghaddasi, Mohammadali; Farahbakhsh, Afshin; Kazemi, Abbass

    2017-09-01

    Evaluation of the distribution capability of food-borne pathogens existing in food products by taking the advantage of quantum dots (QDs) for their photoluminescence properties was carried out. Bacteria namely Escherichia coli (E. coli) labelled with CdSe-QDs were examined both on an Agar nutrient and ground fish substrates in order to observe their growth rate in different environments in the Lab. A sample with an appropriate concentration ratio 10 7 CFU/mL of bacteria/CdSe-QDs was empirically selected from the samples which were grown on the Agar containing plates. The selected sample was also tested on a ground fish substrate as a real food sample. The bacterial growth was observed under the irradiation of UV light and the growth patterns were investigated for 3 successive days. The growth patterns indicated that E. coli can stay alive and can be distributed on food products so that the growth can be easily monitored. This approach makes bacterial growth on food products detectable so that it can be used as a bacteria-QD assay for an easy detection of food borne pathogens grown on a food sample. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. 16S rRNA-based detection of oral pathogens in coronary atherosclerotic plaque

    Directory of Open Access Journals (Sweden)

    Mahendra Jaideep

    2010-01-01

    Full Text Available Background: Atherosclerosis develops as a response of the vessel wall to injury. Chronic bacterial infections have been associated with an increased risk for atherosclerosis and coronary artery disease. The ability of oral pathogens to colonize in coronary atheromatous plaque is well known. Aim: The aim of this study was to detect the presence of Treponema denticola, Porphyromonas gingivalis and Campylobacter rectus in the subgingival and atherosclerotic plaques of patients with coronary artery disease. Materials and Methods: Fifty-one patients in the age group of 40-80 years with coronary artery disease were selected for the study. DNA was extracted from the plaque samples. The specific primers for T. denticola, C. rectus and P. gingivalis were used to amplify a part of the 16S rRNA gene by polymerase chain reaction. Statistical Analysis Used: Chi-square analysis, correlation coefficient and prevalence percentage of the microorganisms were carried out for the analysis. Results: Of the 51 patients, T. denticola, C. rectus and P. gingivalis were detected in 49.01%, 21.51% and 45.10% of the atherosclerotic plaque samples. Conclusions: Our study revealed the presence of bacterial DNA of the oral pathogenic microorganisms in coronary atherosclerotic plaques. The presence of the bacterial DNA in the coronary atherosclerotic plaques in significant proportion may suggest the possible relationship between periodontal bacterial infection and genesis of coronary atherosclerosis.

  15. Validation of Metagenomic Next-Generation Sequencing Tests for Universal Pathogen Detection.

    Science.gov (United States)

    Schlaberg, Robert; Chiu, Charles Y; Miller, Steve; Procop, Gary W; Weinstock, George

    2017-06-01

    - Metagenomic sequencing can be used for detection of any pathogens using unbiased, shotgun next-generation sequencing (NGS), without the need for sequence-specific amplification. Proof-of-concept has been demonstrated in infectious disease outbreaks of unknown causes and in patients with suspected infections but negative results for conventional tests. Metagenomic NGS tests hold great promise to improve infectious disease diagnostics, especially in immunocompromised and critically ill patients. - To discuss challenges and provide example solutions for validating metagenomic pathogen detection tests in clinical laboratories. A summary of current regulatory requirements, largely based on prior guidance for NGS testing in constitutional genetics and oncology, is provided. - Examples from 2 separate validation studies are provided for steps from assay design, and validation of wet bench and bioinformatics protocols, to quality control and assurance. - Although laboratory and data analysis workflows are still complex, metagenomic NGS tests for infectious diseases are increasingly being validated in clinical laboratories. Many parallels exist to NGS tests in other fields. Nevertheless, specimen preparation, rapidly evolving data analysis algorithms, and incomplete reference sequence databases are idiosyncratic to the field of microbiology and often overlooked.

  16. Molecular and serological detection of tick-borne pathogens in donkeys (Equus asinus) in Italy.

    Science.gov (United States)

    Veronesi, Fabrizia; Morganti, Giulia; Ravagnan, Silvia; Laus, Fulvio; Spaterna, Andrea; Diaferia, Manuela; Moretti, Annabella; Fioretti, Daniela Piergili; Capelli, Gioia

    2014-10-10

    Donkeys, owing to the frequent outdoor activity, are exposed to a high risk of infection with tick-borne pathogens. This work aimed to detect exposure to Theileria equi, Babesia caballi, Anaplasma phagocytophilum and Borrelia burgdorferi s.l. of donkeys reared in Central Italy. For this purpose 122 adult donkeys were selected within 11 herds and submitted to blood collection. IgG antibodies to T. equi, B. caballi, A. phagocytophilum and B. burgdorferi s.l. were detected by IFAT. Conventional PCRs targeting the genes MSP2 and the flagellin were used for the detection of A. phagocytophilum and B. burgdorferi s.l. respectively and a Real Time PCR Sybr Green was used to detect Babesia/Theileria spp…. The species identity was determined by amplicons sequencing. Forty eight (39.3%) and 58 (47.5%) animals tested positive for T. equi and B. caballi antibodies, respectively; nine animals (7.4%) were found positive for antibodies against A. phagocytophilum whereas negative results were obtained for B. burgdorferi s.l. Twenty-six (21.3%) animals showed antibodies for both T. equi and B. caballi. Twenty-three (18.8%) donkeys were positive to Babesia/Theileria spp. PCR assay. Out of 21 sequenced amplicons, 20 were identified as T. equi, belonging to three main groups designated A, B and D and one as B. caballi group A. Neither A. phagocytophilum nor B. burgdorferi PCR results were positive. The study showed a high exposure of donkeys to tick-borne pathogens and provides information on the genetic identity of the T. equi strains circulating in Central Italy. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Colour-based Object Detection and Tracking for Autonomous Quadrotor UAV

    International Nuclear Information System (INIS)

    Kadouf, Hani Hunud A; Mustafah, Yasir Mohd

    2013-01-01

    With robotics becoming a fundamental aspect of modern society, further research and consequent application is ever increasing. Aerial robotics, in particular, covers applications such as surveillance in hostile military zones or search and rescue operations in disaster stricken areas, where ground navigation is impossible. The increased visual capacity of UAV's (Unmanned Air Vehicles) is also applicable in the support of ground vehicles to provide supplies for emergency assistance, for scouting purposes or to extend communication beyond insurmountable land or water barriers. The Quadrotor, which is a small UAV has its lift generated by four rotors and can be controlled by altering the speeds of its motors relative to each other. The four rotors allow for a higher payload than single or dual rotor UAVs, which makes it safer and more suitable to carry camera and transmitter equipment. An onboard camera is used to capture and transmit images of the Quadrotor's First Person View (FPV) while in flight, in real time, wirelessly to a base station. The aim of this research is to develop an autonomous quadrotor platform capable of transmitting real time video signals to a base station for processing. The result from the image analysis will be used as a feedback in the quadrotor positioning control. To validate the system, the algorithm should have the capacity to make the quadrotor identify, track or hover above stationary or moving objects

  18. Concurrent Detection of Human Norovirus and Bacterial Pathogens in Water Samples from an Agricultural Region in Central California Coast

    Directory of Open Access Journals (Sweden)

    Peng Tian

    2017-08-01

    Full Text Available Bacterial pathogens and human norovirus (HuNoV are major cause for acute gastroenteritis caused by contaminated food and water. Public waterways can become contaminated from a variety of sources and flood after heavy rain events, leading to pathogen contamination of produce fields. We initiated a survey of several public watersheds in a major leafy green produce production region of the Central California Coast to determine the prevalence of HuNoV as well as bacterial pathogens. Moore swabs were used to collect environmental samples bi-monthly at over 30 sampling sites in the region. High prevalence of HuNoV and bacterial pathogens were detected in environmental water samples in the region. The overall detection rates of HuNoV, O157 Shiga toxin-producing Escherichia coli (STEC, non-O157 STEC, Salmonella, and Listeria were 25.58, 7.91, 9.42, 59.65, and 44.30%, respectively. The detection rates of Salmonella and L. monocytogenes were significantly higher in the spring. Fall and spring had elevated detection rates of O157 STEC. The overall detection rates of non-O157 STEC in the fall were lower than the other seasons but not significant. The overall detection rates of HuNoV were highest in fall, followed by spring and winter, with summer being lowest and significantly lower than other seasons. This study presented the first study of evaluating the correlation between the detection rate of HuNoV and the detection rates of four bacterial pathogens from environmental water. Overall, there was no significant difference in HuNoV detection rates between samples testing positive or negative for the four bacterial pathogens tested. Pathogens in animal-impacted and human-impacted areas were investigated. There were significant higher detection rates in animal-impacted areas than that of human-impacted areas for bacterial pathogens. However, there was no difference in HuNoV detection rates between these two areas. The overall detection levels of generic E

  19. Microbial Quality, Safety, and Pathogen Detection by Using Quantitative PCR of Raw Salad Vegetables Sold in Dhanbad City, India.

    Science.gov (United States)

    Mritunjay, Sujeet K; Kumar, Vipin

    2017-01-01

    Consumption of ready-to-eat fresh vegetables has increased worldwide, with a consequent increase in outbreaks caused by foodborne pathogens. In the Indian subcontinent, raw fresh vegetables are usually consumed without washing or other decontamination procedures, thereby leading to new food safety threats. In this study, the microbiological quality and pathogenic profile of raw salad vegetables was evaluated through standard protocols. In total, 480 samples (60 each of eight different salad vegetables) of cucumber, tomato, carrot, coriander, cabbage, beetroot, radish, and spinach were collected from different locations in Dhanbad, a city famous for its coal fields and often called the "Coal Capital of India." The samples were analyzed for total plate count, total coliforms, Escherichia coli , E. coli O157:H7, Listeria monocytogenes , and Salmonella spp. Incidences of pathogens were detected through quantitative PCR subsequent to isolation. Results showed that 46.7% (for total plate counts) and 30% (for total coliforms) of samples were unacceptable for consumption per the Food Safety and Standards Authority of India. Pathogenic microorganisms were detected in 3.7% of total samples. E. coli O157:H7 was detected in three samples of spinach (2) and beetroot ( 1 ); L. monocytogenes was detected in 14 samples of spinach ( 8 ), tomato ( 3 ), cucumber ( 2 ), and radish ( 1 ); and Salmonella spp. were detected in 16 samples of spinach ( 7 ), tomato ( 3 ), beetroot ( 2 ), cucumber ( 2 ), carrot ( 1 ), and radish ( 1 ). Pathogens were not detected in any of the cabbage and coriander samples.

  20. Dual-excitation upconverting nanoparticle and quantum dot aptasensor for multiplexed food pathogen detection.

    Science.gov (United States)

    Kurt, Hasan; Yüce, Meral; Hussain, Babar; Budak, Hikmet

    2016-07-15

    In this report, a dual-excitation sensing method was developed using aptamer-functionalized quantum dots and upconverting nanoparticles, exhibiting Stokes and anti-Stokes type excitation profiles, respectively. Conjugation of the aptamer-functionalized luminescent nanoparticles with the magnetic beads, comprising short DNA sequences that were partially complementary to the aptamer sequences, enabled facile separation of the analyte-free conjugates for fluorescent measurement. UV-Visible spectroscopy, Circular Dichroism spectroscopy, Dynamic Light Scattering and Polyacrylamide Gel Electrophoresis techniques were used to characterize the aptamer probes developed. The target-specific luminescent conjugates were applied for multiplex detection of model food pathogens, Salmonella typhimurium, and Staphylococcus aureus, in which the fluorescent emission spectra were obtained under UV excitation at 325nm for quantum dots and NIR excitation at 980nm for upconverting nanoparticles, respectively. The dual-excitation strategy was aimed to minimize cross-talk between the luminescent signals for multiplexed detection, and yielded limit of detection values of 16 and 28cfumL(-1) for Staphylococcus aureus, and Salmonella typhimurium, respectively. By employing a greater number of quantum dots and upconverting nanoparticles with non-overlapping fluorescent emissions, the proposed methodology might be exploited further to detect several analytes, simultaneously. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Comparison of supervised machine learning algorithms for waterborne pathogen detection using mobile phone fluorescence microscopy

    Science.gov (United States)

    Ceylan Koydemir, Hatice; Feng, Steve; Liang, Kyle; Nadkarni, Rohan; Benien, Parul; Ozcan, Aydogan

    2017-06-01

    Giardia lamblia is a waterborne parasite that affects millions of people every year worldwide, causing a diarrheal illness known as giardiasis. Timely detection of the presence of the cysts of this parasite in drinking water is important to prevent the spread of the disease, especially in resource-limited settings. Here we provide extended experimental testing and evaluation of the performance and repeatability of a field-portable and cost-effective microscopy platform for automated detection and counting of Giardia cysts in water samples, including tap water, non-potable water, and pond water. This compact platform is based on our previous work, and is composed of a smartphone-based fluorescence microscope, a disposable sample processing cassette, and a custom-developed smartphone application. Our mobile phone microscope has a large field of view of 0.8 cm2 and weighs only 180 g, excluding the phone. A custom-developed smartphone application provides a user-friendly graphical interface, guiding the users to capture a fluorescence image of the sample filter membrane and analyze it automatically at our servers using an image processing algorithm and training data, consisting of >30,000 images of cysts and >100,000 images of other fluorescent particles that are captured, including, e.g. dust. The total time that it takes from sample preparation to automated cyst counting is less than an hour for each 10 ml of water sample that is tested. We compared the sensitivity and the specificity of our platform using multiple supervised classification models, including support vector machines and nearest neighbors, and demonstrated that a bootstrap aggregating (i.e. bagging) approach using raw image file format provides the best performance for automated detection of Giardia cysts. We evaluated the performance of this machine learning enabled pathogen detection device with water samples taken from different sources (e.g. tap water, non-potable water, pond water) and achieved a

  2. Comparison of supervised machine learning algorithms for waterborne pathogen detection using mobile phone fluorescence microscopy

    KAUST Repository

    Ceylan Koydemir, Hatice

    2017-06-14

    Giardia lamblia is a waterborne parasite that affects millions of people every year worldwide, causing a diarrheal illness known as giardiasis. Timely detection of the presence of the cysts of this parasite in drinking water is important to prevent the spread of the disease, especially in resource-limited settings. Here we provide extended experimental testing and evaluation of the performance and repeatability of a field-portable and cost-effective microscopy platform for automated detection and counting of Giardia cysts in water samples, including tap water, non-potable water, and pond water. This compact platform is based on our previous work, and is composed of a smartphone-based fluorescence microscope, a disposable sample processing cassette, and a custom-developed smartphone application. Our mobile phone microscope has a large field of view of ~0.8 cm2 and weighs only ~180 g, excluding the phone. A custom-developed smartphone application provides a user-friendly graphical interface, guiding the users to capture a fluorescence image of the sample filter membrane and analyze it automatically at our servers using an image processing algorithm and training data, consisting of >30,000 images of cysts and >100,000 images of other fluorescent particles that are captured, including, e.g. dust. The total time that it takes from sample preparation to automated cyst counting is less than an hour for each 10 ml of water sample that is tested. We compared the sensitivity and the specificity of our platform using multiple supervised classification models, including support vector machines and nearest neighbors, and demonstrated that a bootstrap aggregating (i.e. bagging) approach using raw image file format provides the best performance for automated detection of Giardia cysts. We evaluated the performance of this machine learning enabled pathogen detection device with water samples taken from different sources (e.g. tap water, non-potable water, pond water) and achieved

  3. Comparison of supervised machine learning algorithms for waterborne pathogen detection using mobile phone fluorescence microscopy

    Directory of Open Access Journals (Sweden)

    Ceylan Koydemir Hatice

    2017-06-01

    Full Text Available Giardia lamblia is a waterborne parasite that affects millions of people every year worldwide, causing a diarrheal illness known as giardiasis. Timely detection of the presence of the cysts of this parasite in drinking water is important to prevent the spread of the disease, especially in resource-limited settings. Here we provide extended experimental testing and evaluation of the performance and repeatability of a field-portable and cost-effective microscopy platform for automated detection and counting of Giardia cysts in water samples, including tap water, non-potable water, and pond water. This compact platform is based on our previous work, and is composed of a smartphone-based fluorescence microscope, a disposable sample processing cassette, and a custom-developed smartphone application. Our mobile phone microscope has a large field of view of ~0.8 cm2 and weighs only ~180 g, excluding the phone. A custom-developed smartphone application provides a user-friendly graphical interface, guiding the users to capture a fluorescence image of the sample filter membrane and analyze it automatically at our servers using an image processing algorithm and training data, consisting of >30,000 images of cysts and >100,000 images of other fluorescent particles that are captured, including, e.g. dust. The total time that it takes from sample preparation to automated cyst counting is less than an hour for each 10 ml of water sample that is tested. We compared the sensitivity and the specificity of our platform using multiple supervised classification models, including support vector machines and nearest neighbors, and demonstrated that a bootstrap aggregating (i.e. bagging approach using raw image file format provides the best performance for automated detection of Giardia cysts. We evaluated the performance of this machine learning enabled pathogen detection device with water samples taken from different sources (e.g. tap water, non-potable water, pond

  4. Comparison of supervised machine learning algorithms for waterborne pathogen detection using mobile phone fluorescence microscopy

    KAUST Repository

    Ceylan Koydemir, Hatice; Feng, Steve; Liang, Kyle; Nadkarni, Rohan; Benien, Parul; Ozcan, Aydogan

    2017-01-01

    Giardia lamblia is a waterborne parasite that affects millions of people every year worldwide, causing a diarrheal illness known as giardiasis. Timely detection of the presence of the cysts of this parasite in drinking water is important to prevent the spread of the disease, especially in resource-limited settings. Here we provide extended experimental testing and evaluation of the performance and repeatability of a field-portable and cost-effective microscopy platform for automated detection and counting of Giardia cysts in water samples, including tap water, non-potable water, and pond water. This compact platform is based on our previous work, and is composed of a smartphone-based fluorescence microscope, a disposable sample processing cassette, and a custom-developed smartphone application. Our mobile phone microscope has a large field of view of ~0.8 cm2 and weighs only ~180 g, excluding the phone. A custom-developed smartphone application provides a user-friendly graphical interface, guiding the users to capture a fluorescence image of the sample filter membrane and analyze it automatically at our servers using an image processing algorithm and training data, consisting of >30,000 images of cysts and >100,000 images of other fluorescent particles that are captured, including, e.g. dust. The total time that it takes from sample preparation to automated cyst counting is less than an hour for each 10 ml of water sample that is tested. We compared the sensitivity and the specificity of our platform using multiple supervised classification models, including support vector machines and nearest neighbors, and demonstrated that a bootstrap aggregating (i.e. bagging) approach using raw image file format provides the best performance for automated detection of Giardia cysts. We evaluated the performance of this machine learning enabled pathogen detection device with water samples taken from different sources (e.g. tap water, non-potable water, pond water) and achieved

  5. Antibody array in a multiwell plate format for the sensitive and multiplexed detection of important plant pathogens.

    Science.gov (United States)

    Charlermroj, Ratthaphol; Himananto, Orawan; Seepiban, Channarong; Kumpoosiri, Mallika; Warin, Nuchnard; Gajanandana, Oraprapai; Elliott, Christopher T; Karoonuthaisiri, Nitsara

    2014-07-15

    The global seed market is considered to be an important industry with a total value of $10,543 million US dollars in 2012. Because plant pathogens such as bacteria and viruses cause a significant economic loss to both producers and exporters, the seed export industry urgently requires rapid, sensitive, and inexpensive testing for the pathogens to prevent disease spreading worldwide. This study developed an antibody array in a multiwell plate format to simultaneously detect four crucial plant pathogens, namely, a bacterial fruit blotch bacterium Acidovorax avenae subsp. citrulli (Aac), Chilli veinal mottle virus (ChiVMV, potyvirus), Watermelon silver mottle virus (WSMoV, tospovirus serogroup IV), and Melon yellow spot virus (MYSV, tospovirus). The capture antibodies specific to the pathogens were immobilized on each well at preassigned positions by an automatic microarrayer. The antibodies on the arrays specifically captured the corresponding pathogens present in the sample extracts. The presence of pathogens bound on the capture antibodies was subsequently detected by a cocktail of fluorescently conjugated secondary antibodies. The limits of detection of the developed antibody array for the detection of Aac, ChiVMV, WSMoV, and MYSV were 5 × 10(5) CFU/mL, 30 ng/mL, 1000 ng/mL, and 160 ng/mL, respectively, which were very similar to those of the conventional ELISA method. The antibody array in a multiwell plate format accurately detected plant pathogens in single and multiple detections. Moreover, this format enables easy handling of the assay at a higher speed of operation.

  6. Enteric bacterial pathogen detection in southern sea otters (Enhydra lutris nereis) is associated with coastal urbanization and freshwater runoff.

    Science.gov (United States)

    Miller, Melissa A; Byrne, Barbara A; Jang, Spencer S; Dodd, Erin M; Dorfmeier, Elene; Harris, Michael D; Ames, Jack; Paradies, David; Worcester, Karen; Jessup, David A; Miller, Woutrina A

    2010-01-01

    Although protected for nearly a century, California's sea otters have been slow to recover, in part due to exposure to fecally-associated protozoal pathogens like Toxoplasma gondii and Sarcocystis neurona. However, potential impacts from exposure to fecal bacteria have not been systematically explored. Using selective media, we examined feces from live and dead sea otters from California for specific enteric bacterial pathogens (Campylobacter, Salmonella, Clostridium perfringens, C. difficile and Escherichia coli O157:H7), and pathogens endemic to the marine environment (Vibrio cholerae, V. parahaemolyticus and Plesiomonas shigelloides). We evaluated statistical associations between detection of these pathogens in otter feces and demographic or environmental risk factors for otter exposure, and found that dead otters were more likely to test positive for C. perfringens, Campylobacter and V. parahaemolyticus than were live otters. Otters from more urbanized coastlines and areas with high freshwater runoff (near outflows of rivers or streams) were more likely to test positive for one or more of these bacterial pathogens. Other risk factors for bacterial detection in otters included male gender and fecal samples collected during the rainy season when surface runoff is maximal. Similar risk factors were reported in prior studies of pathogen exposure for California otters and their invertebrate prey, suggesting that land-sea transfer and/or facilitation of pathogen survival in degraded coastal marine habitat may be impacting sea otter recovery. Because otters and humans share many of the same foods, our findings may also have implications for human health.

  7. Enteric bacterial pathogen detection in southern sea otters (Enhydra lutris nereis) is associated with coastal urbanization and freshwater runoff

    Science.gov (United States)

    Miller, Melissa A.; Byrne, Barbara A.; Jang, Spencer S.; Dodd, Erin M.; Dorfmeier, Elene; Harris, Michael D.; Ames, Jack; Paradies, David; Worcester, Karen; Jessup, David A.; Miller, Woutrina A.

    2009-01-01

    Although protected for nearly a century, California’s sea otters have been slow to recover, in part due to exposure to fecally-associated protozoal pathogens like Toxoplasma gondii and Sarcocystis neurona. However, potential impacts from exposure to fecal bacteria have not been systematically explored. Using selective media, we examined feces from live and dead sea otters from California for specific enteric bacterial pathogens (Campylobacter, Salmonella, Clostridium perfringens, C. difficile and Escherichia coli O157:H7), and pathogens endemic to the marine environment (Vibrio cholerae, V. parahaemolyticus and Plesiomonas shigelloides). We evaluated statistical associations between detection of these pathogens in otter feces and demographic or environmental risk factors for otter exposure, and found that dead otters were more likely to test positive for C. perfringens, Campylobacter and V. parahaemolyticus than were live otters. Otters from more urbanized coastlines and areas with high freshwater runoff (near outflows of rivers or streams) were more likely to test positive for one or more of these bacterial pathogens. Other risk factors for bacterial detection in otters included male gender and fecal samples collected during the rainy season when surface runoff is maximal. Similar risk factors were reported in prior studies of pathogen exposure for California otters and their invertebrate prey, suggesting that land-sea transfer and/or facilitation of pathogen survival in degraded coastal marine habitat may be impacting sea otter recovery. Because otters and humans share many of the same foods, our findings may also have implications for human health. PMID:19720009

  8. Depletion of Human DNA in Spiked Clinical Specimens for Improvement of Sensitivity of Pathogen Detection by Next-Generation Sequencing

    OpenAIRE

    Hasan, Mohammad R.; Rawat, Arun; Tang, Patrick; Jithesh, Puthen V.; Thomas, Eva; Tan, Rusung; Tilley, Peter

    2016-01-01

    Next-generation sequencing (NGS) technology has shown promise for the detection of human pathogens from clinical samples. However, one of the major obstacles to the use of NGS in diagnostic microbiology is the low ratio of pathogen DNA to human DNA in most clinical specimens. In this study, we aimed to develop a specimen-processing protocol to remove human DNA and enrich specimens for bacterial and viral DNA for shotgun metagenomic sequencing. Cerebrospinal fluid (CSF) and nasopharyngeal aspi...

  9. Molecular Detection and Characterization of Zoonotic and Veterinary Pathogens in Ticks from Northeastern China

    Science.gov (United States)

    Wei, Feng; Song, Mingxin; Liu, Huanhuan; Wang, Bo; Wang, Shuchao; Wang, Zedong; Ma, Hongyu; Li, Zhongyu; Zeng, Zheng; Qian, Jun; Liu, Quan

    2016-01-01

    Tick-borne diseases are considered as emerging infectious diseases in humans and animals in China. In this study, Ixodes persulcatus (n = 1699), Haemaphysalis concinna (n = 412), Haemaphysalis longicornis (n = 390), Dermacentor nuttalli (n = 253), and Dermacentor silvarum (n = 204) ticks were collected by flagging from northeastern China, and detected for infection with Anaplasma, Ehrlichia, Babesia, and Hepatozoon spp. by using nested polymerase chain reaction assays and sequencing analysis. Anaplasma phagocytophilum was detected in all tick species, i.e., I. persulcatus (9.4%), H. longicornis (1.9%), H. concinna (6.5%), D. nuttalli (1.7%), and D. silvarum (2.3%); Anaplasma bovis was detected in H. longicornis (0.3%) and H. concinna (0.2%); Ehrlichia muris was detected in I. persulcatus (2.5%) and H. concinna (0.2%); Candidatus Neoehrlichia mikurensis was only detected in I. persulcatus (0.4%). The Ehrlichia variant (GenBank access number KU921424), closely related to Ehrlichia ewingii, was found in H. longicornis (0.8%) and H. concinna (0.2%). I. persulcatus was infected with Babesia venatorum (1.2%), Babesia microti (0.6%), and Babesia divergens (0.6%). Additionally, four Babesia sequence variants (GenBank access numbers 862303–862306) were detected in I. persulcatus, H. longicornis, and H. concinna, which belonged to the clusters formed by the parasites of dogs, sheep, and cattle (B. gibsoni, B. motasi, and B. crassa). Two Hepatozoon spp. (GenBank access numbers KX016028 and KX016029) associated with hepatozoonosis in Japanese martens were found in the collected ticks (0.1–3.1%). These findings showed the genetic variability of Anaplasma, Ehrlichia, Babesia, and Hepatozoon spp. circulating in ticks in northeastern China, highlighting the necessity for further research of these tick-associated pathogens and their role in human and animal diseases. PMID:27965644

  10. Molecular detection and characterization of zoonotic and veterinary pathogens in ticks from northeastern China

    Directory of Open Access Journals (Sweden)

    Feng Wei

    2016-11-01

    Full Text Available Tick-borne diseases are considered as emerging infectious diseases in humans and animals in China. In this study, Ixodes persulcatus (n=1699, Haemaphysalis concinna (n=412, Haemaphysalis longicornis (n=390, Dermacentor nuttalli (n=253, and Dermacentor silvarum (n=204 ticks were collected by flagging from northeastern China, and detected for infection with Anaplasma, Ehrlichia, Babesia, and Hepatozoon spp. by using nested polymerase chain reaction assays and sequencing analysis. A. phagocytophilum was detected in all tick species, i.e., I. persulcatus (9.4%, H. longicornis (1.9%, H. concinna (6.5%, D. nuttalli (1.7%, and D. silvarum (2.3%; A. bovis was detected in H. longicornis (0.3% and H. concinna (0.2%; E. muris was detected in I. persulcatus (2.5% and H. concinna (0.2%; Candidatus Neoehrlichia mikurensis was only detected in I. persulcatus (0.4%. The Ehrlichia variant (GenBank access number KU921424, closely related to E. ewingii, was found in H. longicornis (0.8% and H. concinna (0.2%. I. persulcatus was infected with B. venatorum (1.2%, B. microti (0.6%, and B. divergens (0.6%. Additionally, four Babesia sequence variants (GenBank access numbers 862303–862306 were detected in I. persulcatus, H. longicornis, and H. concinna, which belonged to the clusters formed by the parasites of dogs, sheep and cattle (B. gibsoni, B. motasi, and B. crassa. Two Hepatozoon spp. (GenBank access numbers KX016028 and KX016029 associated with hepatozoonosis in Japanese martens were found in the collected ticks (0.1–3.1%. These findings showed the genetic variability of Anaplasma, Ehrlichia, Babesia, and Hepatozoon spp. circulating in ticks in northeastern China, highlighting the necessity for further research of these tick-associated pathogens and their role in human and animal diseases.

  11. Micro-nano-bio acoustic system for the detection of foodborne pathogens in real samples.

    Science.gov (United States)

    Papadakis, George; Murasova, Pavla; Hamiot, Audrey; Tsougeni, Katerina; Kaprou, Georgia; Eck, Michael; Rabus, David; Bilkova, Zuzana; Dupuy, Bruno; Jobst, Gerhard; Tserepi, Angeliki; Gogolides, Evangelos; Gizeli, Electra

    2018-07-15

    The fast and efficient detection of foodborne pathogens is a societal priority, given the large number of food-poisoning outbreaks, and a scientific and technological challenge, given the need to detect as little as 1 viable cell in 25 gr of food. Here, we present the first approach that achieves the above goal, thanks to the use of a micro/nano-technology and the detection capability of acoustic wave sensors. Starting from 1 Salmonella cell in 25 ml of milk, we employ immuno-magnetic beads to capture cells after only 3 h of pre-enrichment and subsequently demonstrate efficient DNA amplification using the Loop Mediated Isothermal Amplification method (LAMP) and acoustic detection in an integrated platform, within an additional ½ h. The demonstrated 4 h sample-to-analysis time comes as a huge improvement to the current need of few days to obtain the same result. In addition, the work presents the first reported Lab-on-Chip platform that comprises an acoustic device as the sensing element, exhibiting impressive analytical features, namely, an acoustic limit of detection of 2 cells/μl or 3 aM of the DNA target and ability to detect in a label-free manner dsDNA amplicons in impure samples. The use of food samples together with the incorporation of the necessary pre-enrichment step and ability for multiple analysis with an internal control, make the proposed methodology highly relevant to real-world applications. Moreover, the work suggests that acoustic wave devices can be used as an attractive alternative to electrochemical sensors in integrated platforms for applications in food safety and the point-of-care diagnostics. Copyright © 2018. Published by Elsevier B.V.

  12. CT-Guided Biopsy in Suspected Spondylodiscitis--The Association of Paravertebral Inflammation with Microbial Pathogen Detection.

    Directory of Open Access Journals (Sweden)

    Daniel Spira

    Full Text Available To search for imaging characteristics distinguishing patients with successful from those with futile microbiological pathogen detection by CT-guided biopsy in suspected spondylodiscitis.34 consecutive patients with suspected spondylodiscitis underwent CT-guided biopsy for pathogen detection. MR-images were assessed for inflammatory infiltration of disks, adjacent vertebrae, epidural and paravertebral space. CT-images were reviewed for arrosion of adjacent end plates and reduced disk height. Biopsy samples were sent for microbiological examination in 34/34 patients, and for additional histological analysis in 28/34 patients.Paravertebral infiltration was present in all 10/10 patients with positive microbiology and occurred in only 12/24 patients with negative microbiology, resulting in a sensitivity of 100% and a specificity of 50% for pathogen detection. Despite its limited sensitivities, epidural infiltration and paravertebral abscesses showed considerably higher specificities of 83.3% and 90.9%, respectively. Paravertebral infiltration was more extensive in patients with positive as compared to negative microbiology (p = 0.002. Even though sensitivities for pathogen detection were also high in case of vertebral and disk infiltration, or end plate arrosion, specificities remained below 10%.Inflammatory infiltration of the paravertebral space indicated successful pathogen detection by CT-guided biopsy. Specificity was increased by the additional occurrence of epidural infiltration or paravertebral abscesses.

  13. Detection of pathogenic Leptospira from selected environment in Kelantan and Terengganu, Malaysia.

    Science.gov (United States)

    Ridzlan, F R; Bahaman, A R; Khairani-Bejo, S; Mutalib, A R

    2010-12-01

    Leptospirosis is recognized as one of the important zoonotic diseases in the world including Malaysia. A total of 145 soil and water samples were collected from selected National Service Training Centres (NSTC) in Kelantan and Terengganu. The samples were inoculated into modified semisolid Ellinghausen McCullough Johnson Harris (EMJH) medium, incubated at room temperature for 1 month and examined under the dark-field microscope. Positive growth of the leptospiral isolates were then confirmed with 8-Azaguanine Test, Polymerase Chain Reaction (PCR) assay and Microscopic Agglutination Test (MAT). Fifteen cultures (10.34%) exhibited positive growths which were seen under dark field microscope whilst only 20% (3/15) were confirmed as pathogenic species. based on 8-Azaguanine Test and PCR. Serological identification of the isolates with MAT showed that hebdomadis was the dominant serovar in Terengganu. Pathogenic leptospires can be detected in Malaysian environment and this has the potential to cause an outbreak. Therefore, precautionary steps against leptospirosis should be taken by camp authorities to ensure the safety of trainees.

  14. Microbiome analysis and detection of pathogenic bacteria of Penaeus monodon from Jakarta Bay and Bali.

    Science.gov (United States)

    Oetama, Vincensius S P; Hennersdorf, Philipp; Abdul-Aziz, Muslihudeen A; Mrotzek, Grit; Haryanti, Haryanti; Saluz, Hans Peter

    2016-09-30

    Penaeus monodon, the Asian black tiger shrimp is one of the most widely consumed marine crustaceans worldwide. In this study, we examine and compare the fecal microbiota of P. monodon from highly polluted waters around Jakarta Bay, with those of less polluted waters of Bali. Using next generation sequencing techniques, we identified potential bacterial pathogens and common viral diseases of shrimp. Proteobacteria (96.08%) was found to be the most predominant phylum, followed by Bacteriodetes (2.32%), Fusobacteria (0.96%), and Firmicutes (0.53%). On the order level, Vibrionales (66.20%) and Pseudoaltermonadales (24.81%) were detected as predominant taxa. qPCR profiling was used as a confirmatory step and further revealed Vibrio alginolyticus and Photobacterium damselae as two potential pathogenic species present in most of the samples. In addition, viral diseases for shrimp were discovered among the samples, WSSV in Jakarta free-living samples, YHV in Bali free-living samples and IHHNV in both. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. TractorEYE: Vision-based Real-time Detection for Autonomous Vehicles in Agriculture

    DEFF Research Database (Denmark)

    Christiansen, Peter

    ) using a smaller memory footprint and 7.3-times faster processing. Low memory footprint and fast processing makes DeepAnomaly suitable for real-time applications running on an embedded GPU. FieldSAFE is a multi-modal dataset for detection of static and moving obstacles in agriculture. The dataset...... (four for rgb camera, one for thermal camera and one for a Multi-beam lidar) and fuse detection information in a common format using either 3D positions or Inverse Sensor Models. A GPU powered computational platform is able to run detection algorithms online. For the rgb camera, a deep learning...... algorithm is proposed DeepAnomaly to perform real-time anomaly detection of distant, heavy occluded and unknown obstacles in agriculture. DeepAnomaly is - compared to a state-of-the-art object detector Faster R-CNN - for an agricultural use-case able to detect humans better and at longer ranges (45-90m...

  16. A Machine Learning Approach to Pedestrian Detection for Autonomous Vehicles Using High-Definition 3D Range Data.

    Science.gov (United States)

    Navarro, Pedro J; Fernández, Carlos; Borraz, Raúl; Alonso, Diego

    2016-12-23

    This article describes an automated sensor-based system to detect pedestrians in an autonomous vehicle application. Although the vehicle is equipped with a broad set of sensors, the article focuses on the processing of the information generated by a Velodyne HDL-64E LIDAR sensor. The cloud of points generated by the sensor (more than 1 million points per revolution) is processed to detect pedestrians, by selecting cubic shapes and applying machine vision and machine learning algorithms to the XY, XZ, and YZ projections of the points contained in the cube. The work relates an exhaustive analysis of the performance of three different machine learning algorithms: k-Nearest Neighbours (kNN), Naïve Bayes classifier (NBC), and Support Vector Machine (SVM). These algorithms have been trained with 1931 samples. The final performance of the method, measured a real traffic scenery, which contained 16 pedestrians and 469 samples of non-pedestrians, shows sensitivity (81.2%), accuracy (96.2%) and specificity (96.8%).

  17. A Machine Learning Approach to Pedestrian Detection for Autonomous Vehicles Using High-Definition 3D Range Data

    Directory of Open Access Journals (Sweden)

    Pedro J. Navarro

    2016-12-01

    Full Text Available This article describes an automated sensor-based system to detect pedestrians in an autonomous vehicle application. Although the vehicle is equipped with a broad set of sensors, the article focuses on the processing of the information generated by a Velodyne HDL-64E LIDAR sensor. The cloud of points generated by the sensor (more than 1 million points per revolution is processed to detect pedestrians, by selecting cubic shapes and applying machine vision and machine learning algorithms to the XY, XZ, and YZ projections of the points contained in the cube. The work relates an exhaustive analysis of the performance of three different machine learning algorithms: k-Nearest Neighbours (kNN, Naïve Bayes classifier (NBC, and Support Vector Machine (SVM. These algorithms have been trained with 1931 samples. The final performance of the method, measured a real traffic scenery, which contained 16 pedestrians and 469 samples of non-pedestrians, shows sensitivity (81.2%, accuracy (96.2% and specificity (96.8%.

  18. Automatic, ECG-based detection of autonomic arousals and their association with cortical arousals, leg movements, and respiratory events in sleep

    DEFF Research Database (Denmark)

    Olsen, Mads; Schneider, Logan Douglas; Cheung, Joseph

    2018-01-01

    The current definition of sleep arousals neglects to address the diversity of arousals and their systemic cohesion. Autonomic arousals (AA) are autonomic activations often associated with cortical arousals (CA), but they may also occur in isolation in relation to a respiratory event, a leg movement...... event or spontaneously, without any other physiological associations. AA should be acknowledged as essential events to understand and explore the systemic implications of arousals. We developed an automatic AA detection algorithm based on intelligent feature selection and advanced machine learning using...... or respiratory events. This indicates that most FP constitute autonomic activations that are indistinguishable from those with cortical cohesion. The proposed algorithm provides an automatic system trained in a clinical environment, which can be utilized to analyse the systemic and clinical impacts of arousals....

  19. Implementation of microfluidic sandwich ELISA for superior detection of plant pathogens.

    Science.gov (United States)

    Thaitrong, Numrin; Charlermroj, Ratthaphol; Himananto, Orawan; Seepiban, Channarong; Karoonuthaisiri, Nitsara

    2013-01-01

    Rapid and economical screening of plant pathogens is a high-priority need in the seed industry. Crop quality control and disease surveillance demand early and accurate detection in addition to robustness, scalability, and cost efficiency typically required for selective breeding and certification programs. Compared to conventional bench-top detection techniques routinely employed, a microfluidic-based approach offers unique benefits to address these needs simultaneously. To our knowledge, this work reports the first attempt to perform microfluidic sandwich ELISA for Acidovorax citrulli (Ac), watermelon silver mottle virus (WSMoV), and melon yellow spot virus (MYSV) screening. The immunoassay occurs on the surface of a reaction chamber represented by a microfluidic channel. The capillary force within the microchannel draws a reagent into the reaction chamber as well as facilitates assay incubation. Because the underlying pad automatically absorbs excess fluid, the only operation required is sequential loading of buffers/reagents. Buffer selection, antibody concentrations, and sample loading scheme were optimized for each pathogen. Assay optimization reveals that the 20-folds lower sample volume demanded by the microchannel structure outweighs the 2- to 4-folds higher antibody concentrations required, resulting in overall 5-10 folds of reagent savings. In addition to cutting the assay time by more than 50%, the new platform offers 65% cost savings from less reagent consumption and labor cost. Our study also shows 12.5-, 2-, and 4-fold improvement in assay sensitivity for Ac, WSMoV, and MYSV, respectively. Practical feasibility is demonstrated using 19 real plant samples. Given a standard 96-well plate format, the developed assay is compatible with commercial fluorescent plate readers and readily amendable to robotic liquid handling systems for completely hand-free assay automation.

  20. [Development of molecular detection of food-borne pathogenic bacteria using miniaturized microfluidic devices].

    Science.gov (United States)

    Iván, Kristóf; Maráz, Anna

    2015-12-20

    Detection and identification of food-borne pathogenic bacteria are key points for the assurance of microbiological food safety. Traditional culture-based methods are more and more replaced by or supplemented with nucleic acid based molecular techniques, targeting specific (preferably virulence) genes in the genomes. Internationally validated DNA amplification - most frequently real-time polymerase chain reaction - methods are applied by the food microbiological testing laboratories for routine analysis, which will result not only in shortening the time for results but they also improve the performance characteristics (e.g. sensitivity, specificity) of the methods. Beside numerous advantages of the polymerase chain reaction based techniques for routine microbiological analysis certain drawbacks have to be mentioned, such as the high cost of the equipment and reagents, as well as the risk of contamination of the laboratory environment by the polymerase chain reaction amplicons, which require construction of an isolated laboratory system. Lab-on-a-chip systems can integrate most of these laboratory processes within a miniaturized device that delivers the same specificity and reliability as the standard protocols. The benefits of miniaturized devices are: simple - often automated - use, small overall size, portability, sterility due to single use possibility. These miniaturized rapid diagnostic tests are being researched and developed at the best research centers around the globe implementing various sample preparation and molecular DNA amplification methods on-chip. In parallel, the aim of the authors' research is to develop microfluidic Lab-on-a-chip devices for the detection and identification of food-borne pathogenic bacteria.

  1. Detection of pathogenic Leptospira species associated with phyllostomid bats (Mammalia: Chiroptera) from Veracruz, Mexico.

    Science.gov (United States)

    Ballados-González, G G; Sánchez-Montes, S; Romero-Salas, D; Colunga Salas, P; Gutiérrez-Molina, R; León-Paniagua, L; Becker, I; Méndez-Ojeda, M L; Barrientos-Salcedo, C; Serna-Lagunes, R; Cruz-Romero, A

    2018-06-01

    The genus Leptospira encompass 22 species of spirochaetes, with ten pathogenic species that have been recorded in more than 160 mammals worldwide. In the last two decades, the numbers of records of these agents associated with bats have increased exponentially, particularly in America. Although order Chiroptera represents the second most diverse order of mammals in Mexico, and leptospirosis represents a human and veterinary problem in the country, few studies have been conducted to identify potential wildlife reservoirs. The aim of this study was to detect the presence and diversity of Leptospira sp. in communities of bats in an endemic state of leptospirosis in Mexico. During January to September 2016, 81 bats of ten species from three localities of Veracruz, Mexico, were collected with mist nets. Kidney samples were obtained from all specimens. For the detection of Leptospira sp., we amplified several genes using specific primers. Amplicons of the expected size were submitted to sequencing, and sequences recovered were compared with those of reference deposited in GenBank using the BLAST tool. To identify their phylogenetic position, we realized a reconstruction using maximum-likelihood (ML) method. Twenty-five samples from three bat species (Artibeus lituratus, Choeroniscus godmani and Desmodus rotundus) showed the presence of Leptospira DNA. Sequences recovered were close to Leptospira noguchii, Leptospira weilii and Leptospira interrogans. Our results include the first record of Leptospira in bats from Mexico and exhibit a high diversity of these pathogens circulating in the state. Due to the finding of a large number of positive wild animals, it is necessary to implement a surveillance system in populations of the positive bats as well as in related species, in order to understand their role as carriers of this bacterial genus. © 2018 Blackwell Verlag GmbH.

  2. Implementation of microfluidic sandwich ELISA for superior detection of plant pathogens.

    Directory of Open Access Journals (Sweden)

    Numrin Thaitrong

    Full Text Available Rapid and economical screening of plant pathogens is a high-priority need in the seed industry. Crop quality control and disease surveillance demand early and accurate detection in addition to robustness, scalability, and cost efficiency typically required for selective breeding and certification programs. Compared to conventional bench-top detection techniques routinely employed, a microfluidic-based approach offers unique benefits to address these needs simultaneously. To our knowledge, this work reports the first attempt to perform microfluidic sandwich ELISA for Acidovorax citrulli (Ac, watermelon silver mottle virus (WSMoV, and melon yellow spot virus (MYSV screening. The immunoassay occurs on the surface of a reaction chamber represented by a microfluidic channel. The capillary force within the microchannel draws a reagent into the reaction chamber as well as facilitates assay incubation. Because the underlying pad automatically absorbs excess fluid, the only operation required is sequential loading of buffers/reagents. Buffer selection, antibody concentrations, and sample loading scheme were optimized for each pathogen. Assay optimization reveals that the 20-folds lower sample volume demanded by the microchannel structure outweighs the 2- to 4-folds higher antibody concentrations required, resulting in overall 5-10 folds of reagent savings. In addition to cutting the assay time by more than 50%, the new platform offers 65% cost savings from less reagent consumption and labor cost. Our study also shows 12.5-, 2-, and 4-fold improvement in assay sensitivity for Ac, WSMoV, and MYSV, respectively. Practical feasibility is demonstrated using 19 real plant samples. Given a standard 96-well plate format, the developed assay is compatible with commercial fluorescent plate readers and readily amendable to robotic liquid handling systems for completely hand-free assay automation.

  3. Hyperspectral image reconstruction using RGB color for foodborne pathogen detection on agar plates

    Science.gov (United States)

    Yoon, Seung-Chul; Shin, Tae-Sung; Park, Bosoon; Lawrence, Kurt C.; Heitschmidt, Gerald W.

    2014-03-01

    This paper reports the latest development of a color vision technique for detecting colonies of foodborne pathogens grown on agar plates with a hyperspectral image classification model that was developed using full hyperspectral data. The hyperspectral classification model depended on reflectance spectra measured in the visible and near-infrared spectral range from 400 and 1,000 nm (473 narrow spectral bands). Multivariate regression methods were used to estimate and predict hyperspectral data from RGB color values. The six representative non-O157 Shiga-toxin producing Eschetichia coli (STEC) serogroups (O26, O45, O103, O111, O121, and O145) were grown on Rainbow agar plates. A line-scan pushbroom hyperspectral image sensor was used to scan 36 agar plates grown with pure STEC colonies at each plate. The 36 hyperspectral images of the agar plates were divided in half to create training and test sets. The mean Rsquared value for hyperspectral image estimation was about 0.98 in the spectral range between 400 and 700 nm for linear, quadratic and cubic polynomial regression models and the detection accuracy of the hyperspectral image classification model with the principal component analysis and k-nearest neighbors for the test set was up to 92% (99% with the original hyperspectral images). Thus, the results of the study suggested that color-based detection may be viable as a multispectral imaging solution without much loss of prediction accuracy compared to hyperspectral imaging.

  4. Automated processing integrated with a microflow cytometer for pathogen detection in clinical matrices.

    Science.gov (United States)

    Golden, J P; Verbarg, J; Howell, P B; Shriver-Lake, L C; Ligler, F S

    2013-02-15

    A spinning magnetic trap (MagTrap) for automated sample processing was integrated with a microflow cytometer capable of simultaneously detecting multiple targets to provide an automated sample-to-answer diagnosis in 40 min. After target capture on fluorescently coded magnetic microspheres, the magnetic trap automatically concentrated the fluorescently coded microspheres, separated the captured target from the sample matrix, and exposed the bound target sequentially to biotinylated tracer molecules and streptavidin-labeled phycoerythrin. The concentrated microspheres were then hydrodynamically focused in a microflow cytometer capable of 4-color analysis (two wavelengths for microsphere identification, one for light scatter to discriminate single microspheres and one for phycoerythrin bound to the target). A three-fold decrease in sample preparation time and an improved detection limit, independent of target preconcentration, was demonstrated for detection of Escherichia coli 0157:H7 using the MagTrap as compared to manual processing. Simultaneous analysis of positive and negative controls, along with the assay reagents specific for the target, was used to obtain dose-response curves, demonstrating the potential for quantification of pathogen load in buffer and serum. Published by Elsevier B.V.

  5. Convolutional neural network guided blue crab knuckle detection for autonomous crab meat picking machine

    Science.gov (United States)

    Wang, Dongyi; Vinson, Robert; Holmes, Maxwell; Seibel, Gary; Tao, Yang

    2018-04-01

    The Atlantic blue crab is among the highest-valued seafood found in the American Eastern Seaboard. Currently, the crab processing industry is highly dependent on manual labor. However, there is great potential for vision-guided intelligent machines to automate the meat picking process. Studies show that the back-fin knuckles are robust features containing information about a crab's size, orientation, and the position of the crab's meat compartments. Our studies also make it clear that detecting the knuckles reliably in images is challenging due to the knuckle's small size, anomalous shape, and similarity to joints in the legs and claws. An accurate and reliable computer vision algorithm was proposed to detect the crab's back-fin knuckles in digital images. Convolutional neural networks (CNNs) can localize rough knuckle positions with 97.67% accuracy, transforming a global detection problem into a local detection problem. Compared to the rough localization based on human experience or other machine learning classification methods, the CNN shows the best localization results. In the rough knuckle position, a k-means clustering method is able to further extract the exact knuckle positions based on the back-fin knuckle color features. The exact knuckle position can help us to generate a crab cutline in XY plane using a template matching method. This is a pioneering research project in crab image analysis and offers advanced machine intelligence for automated crab processing.

  6. Fast and sensitive detection of foodborne pathogen using electrochemical impedance analysis, urease catalysis and microfluidics.

    Science.gov (United States)

    Chen, Qi; Wang, Dan; Cai, Gaozhe; Xiong, Yonghua; Li, Yuntao; Wang, Maohua; Huo, Huiling; Lin, Jianhan

    2016-12-15

    Early screening of pathogenic bacteria is a key to prevent and control of foodborne diseases. In this study, we developed a fast and sensitive bacteria detection method integrating electrochemical impedance analysis, urease catalysis with microfluidics and using Listeria as model. The Listeria cells, the anti-Listeria monoclonal antibodies modified magnetic nanoparticles (MNPs), and the anti-Listeria polyclonal antibodies and urease modified gold nanoparticles (AuNPs) were incubated in a fluidic separation chip with active mixing to form the MNP-Listeria-AuNP-urease sandwich complexes. The complexes were captured in the separation chip by applying a high gradient magnetic field, and the urea was injected to resuspend the complexes and hydrolyzed under the catalysis of the urease on the complexes into ammonium ions and carbonate ions, which were transported into a microfluidic detection chip with an interdigitated microelectrode for impedance measurement to determine the amount of the Listeria cells. The capture efficiency of the Listeria cells in the separation chip was ∼93% with a shorter time of 30min due to the faster immuno-reaction using the active magnetic mixing. The changes on both impedance magnitude and phase angle were demonstrated to be able to detect the Listeria cells as low as 1.6×10(2)CFU/mL. The detection time was reduced from original ∼2h to current ∼1h. The recoveries of the spiked lettuce samples ranged from 82.1% to 89.6%, indicating the applicability of this proposed biosensor. This microfluidic impedance biosensor has shown the potential for online, automatic and sensitive bacteria separation and detection. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Simultaneous Detection of Brown Rot- and Soft Rot-Causing Bacterial Pathogens from Potato Tubers Through Multiplex PCR.

    Science.gov (United States)

    Ranjan, R K; Singh, Dinesh; Baranwal, V K

    2016-11-01

    Ralstonia solanacearum (Smith) Yabuuchi et al. and Erwinia carotovora subsp. carotovora (Jones) Bergey et al. (Pectobacterium carotovorum subsp. carotovorum) are the two major bacterial pathogens of potato causing brown rot (wilt) and soft rot diseases, respectively, in the field and during storage. Reliable and early detection of these pathogens are keys to avoid occurrence of these diseases in potato crops and reduce yield loss. In the present study, multiplex polymerase chain reaction (PCR) protocol was developed for simultaneous detection of R. solanacearum and E. carotovora subsp. carotovora from potato tubers. A set of oligos targeting the pectatelyase (pel) gene of E. carotovora subsp. carotovora and the universal primers based on 16S r RNA gene of R. solanacearum were used. The standardized multiplex PCR protocol could detect R. solanacearum and E. carotovora subsp. carotovora up to 0.01 and 1.0 ng of genomic DNA, respectively. The protocol was further validated on 96 stored potato tuber samples, collected from different potato-growing states of India, viz. Uttarakhand, Odisha, Meghalaya and Delhi. 53.1 % tuber samples were positive for R. solanacearum, and 15.1 % of samples were positive for E. carotovora subsp. carotovora, and both the pathogens were positive in 26.0 % samples when BIO-PCR was used. This method offers sensitive, specific, reliable and fast detection of two major bacterial pathogens from potato tubers simultaneously, particularly pathogen-free seed certification in large scale.

  8. [The Advances in the Contamination and Detection of Foodborne Pathogen Noroviruses in Fresh Produce].

    Science.gov (United States)

    Xie, Yajing; Liu, Xianjin

    2015-11-01

    This article reviewed the researches proceeding on the contamination and detection of the foodborne pathogen noroviruses (NoVs) in fresh produce, which involved the NoVs contaminations in fresh produce, the special attachment of NoVs in fresh produce, the NoVs outbreaks associated with fresh produce and the NoVs detection in fresh produce. There had been an increase in reported infectious disease risks associated with the consumptions of fresh produce for recent 30 years. Because the NoVs, as a primary cause of viral gastroenteritis thoughout the world, were highly contagious, had a low infectious dose, and were persistent in the environment. And also the methods for NoVs detection in food had significantly developed over the last 15 years. Currently NoVs were the most common pathogen accounting for 40% of outbreaks associated with fresh produce (i. e., fruits and vegetables). Data from outbreaks investigations verified fresh produce as the high risk food products for NoVs. The fresh produce were typically eaten raw with no thermal processing, can be contaminated at any step during production and processing from faecally polluted water and fertilizers, the poor hygiene practices by food handlers and the cross-contamination. The attachment of NoVs to the fresh produce was due to the physio-chemical factors of virus protein coat, the special attachment to different fresh produce, and the possibility for internalization of NoVs. It might provide answers to why those high risk foods were more frequently implicated (i. e., lettuce and raspberries). According to the data of foodborne NoVs outbreaks which were associated with fresh produce from EU countries and the USA, the outbreaks in EU countries were mainly associated with NoVs contaminated raspberries and lettuce, while in USA which were associated with NoVs contaminated lettuce. Unfortunately, there were no NoVs detection methods for fresh produce or the data of foodborne NoVs outbreaks which were associated with

  9. Comparison between nasopharyngeal swab and nasal wash, using culture and PCR, in the detection of potential respiratory pathogens.

    Science.gov (United States)

    Gritzfeld, Jenna F; Roberts, Paul; Roche, Lorna; El Batrawy, Sherouk; Gordon, Stephen B

    2011-04-13

    Nasopharyngeal carriage of potential pathogens is important as it is both the major source of transmission and the prerequisite of invasive disease. New methods for detecting carriage could improve comfort, accuracy and laboratory utility. The aims of this study were to compare the sensitivities of a nasopharyngeal swab (NPS) and a nasal wash (NW) in detecting potential respiratory pathogens in healthy adults using microbiological culture and PCR. Healthy volunteers attended for nasal washing and brushing of the posterior nasopharynx. Conventional and real-time PCR were used to detect pneumococcus and meningococcus. Statistical differences between the two nasal sampling methods were determined using a nonparametric Mann-Whitney U test; differences between culture and PCR methods were determined using the McNemar test.Nasal washing was more comfortable for volunteers than swabbing (n = 24). In detection by culture, the NW was significantly more likely to detect pathogens than the NPS (p < 0.00001). Overall, there was a low carriage rate of pathogens in this sample; no significant difference was seen in the detection of bacteria between culture and PCR methods. Nasal washing and PCR may provide effective alternatives to nasopharyngeal swabbing and classical microbiology, respectively.

  10. Molecular-based detection of the gastrointestinal pathogen Campylobacter ureolyticus in unpasteurized milk samples from two cattle farms in Ireland

    Directory of Open Access Journals (Sweden)

    Koziel Monika

    2012-11-01

    Full Text Available Abstract Campylobacter jejuni and coli are collectively regarded as the most prevalent cause of bacterial foodborne illness worldwide. An emerging species, Campylobacter ureolyticus has recently been detected in patients with gastroenteritis, however, the source of this organism has, until now, remained unclear. Herein, we describe the molecular-based detection of this pathogen in bovine faeces (1/20 and unpasteurized milk (6/47 but not in poultry (chicken wings and caeca. This is, to the best of our knowledge, the first report of the presence of this potential gastrointestinal pathogen in an animal source, possibly suggesting a route for its transmission to humans.

  11. High-throughput DNA microarray detection of pathogenic bacteria in shallow well groundwater in the Kathmandu Valley, Nepal.

    Science.gov (United States)

    Inoue, Daisuke; Hinoura, Takuji; Suzuki, Noriko; Pang, Junqin; Malla, Rabin; Shrestha, Sadhana; Chapagain, Saroj Kumar; Matsuzawa, Hiroaki; Nakamura, Takashi; Tanaka, Yasuhiro; Ike, Michihiko; Nishida, Kei; Sei, Kazunari

    2015-01-01

    Because of heavy dependence on groundwater for drinking water and other domestic use, microbial contamination of groundwater is a serious problem in the Kathmandu Valley, Nepal. This study investigated comprehensively the occurrence of pathogenic bacteria in shallow well groundwater in the Kathmandu Valley by applying DNA microarray analysis targeting 941 pathogenic bacterial species/groups. Water quality measurements found significant coliform (fecal) contamination in 10 of the 11 investigated groundwater samples and significant nitrogen contamination in some samples. The results of DNA microarray analysis revealed the presence of 1-37 pathogen species/groups, including 1-27 biosafety level 2 ones, in 9 of the 11 groundwater samples. While the detected pathogens included several feces- and animal-related ones, those belonging to Legionella and Arthrobacter, which were considered not to be directly associated with feces, were detected prevalently. This study could provide a rough picture of overall pathogenic bacterial contamination in the Kathmandu Valley, and demonstrated the usefulness of DNA microarray analysis as a comprehensive screening tool of a wide variety of pathogenic bacteria.

  12. An autonomous image based approach for detecting glacial lake outburst floods

    Directory of Open Access Journals (Sweden)

    R. Koschitzki

    2014-06-01

    Full Text Available The potential danger caused by glacier margin lakes and the related risk of glacier lake outburst floods (GLOF increases constantly due to glaciers retreating in many parts of the world. Reasons for this development are on the one hand the new formation and enlargement of glacier margin lakes due to melt water. On the other hand, retreating and thinning glacier tongues lead to a decrease of the back pressure against the dammed glacier lakes. The paper describes the design of a photogrammetric GLOF monitoring system, based on monoscopic image sequence analysis for automatic detection of water level changes. The presented approach for measuring the water line in an image sequence is based on directional edge detection in LoG-filtered image data. After that, the water level is determined by a transformation of image measurements into object space based on orientation parameters of the camera and a geo-referenced lake basin model. The model can for instance be determined by photogrammetric methods after a GLOF; it may also be determined portion-wise by analysing shore lines at various water levels. Camera orientation parameters are determined by a local GPS-supported photogrammetric network. Comparing the determined water level changes with reference data provided by a water gauge, the precision is estimated in the order of one decimetre. A major challenge is the automatic detection of the water line in image sequences under varying light and visibility conditions. The paper will also discuss promising approaches such as multispectral images as well as a statistical analysis of grey value changes over short image sequences to eliminate disturbing reflections on the rough water surface.

  13. Vaginal microbicides: detecting toxicities in vivo that paradoxically increase pathogen transmission

    Directory of Open Access Journals (Sweden)

    Abusuwwa Raed

    2006-06-01

    Full Text Available Abstract Background Microbicides must protect against STD pathogens without causing unacceptable toxic effects. Microbicides based on nonoxynol-9 (N9 and other detergents disrupt sperm, HSV and HIV membranes, and these agents are effective contraceptives. But paradoxically N9 fails to protect women against HIV and other STD pathogens, most likely because it causes toxic effects that increase susceptibility. The mouse HSV-2 vaginal transmission model reported here: (a Directly tests for toxic effects that increase susceptibility to HSV-2, (b Determines in vivo whether a microbicide can protect against HSV-2 transmission without causing toxicities that increase susceptibility, and (c Identifies those toxic effects that best correlate with the increased HSV susceptibility. Methods Susceptibility was evaluated in progestin-treated mice by delivering a low-dose viral inoculum (0.1 ID50 at various times after delivering the candidate microbicide to detect whether the candidate increased the fraction of mice infected. Ten agents were tested – five detergents: nonionic (N9, cationic (benzalkonium chloride, BZK, anionic (sodium dodecylsulfate, SDS, the pair of detergents in C31G (C14AO and C16B; one surface active agent (chlorhexidine; two non-detergents (BufferGel®, and sulfonated polystyrene, SPS; and HEC placebo gel (hydroxyethylcellulose. Toxic effects were evaluated by histology, uptake of a 'dead cell' dye, colposcopy, enumeration of vaginal macrophages, and measurement of inflammatory cytokines. Results A single dose of N9 protected against HSV-2 for a few minutes but then rapidly increased susceptibility, which reached maximum at 12 hours. When applied at the minimal concentration needed for brief partial protection, all five detergents caused a subsequent increase in susceptibility at 12 hours of ~20–30-fold. Surprisingly, colposcopy failed to detect visible signs of the N9 toxic effect that increased susceptibility at 12 hours. Toxic

  14. Molecular detection of tick-borne pathogens in cattle from Southwestern Ethiopia.

    Directory of Open Access Journals (Sweden)

    Zerihun Hailemariam

    Full Text Available Tick-borne diseases (TBDs cause significant losses among livestock and impact the livelihoods of resource-poor farming communities worldwide. In Ethiopia, detailed studies on the epidemiology of tick-borne pathogens (TBPs in cattle using sensitive molecular detection methods are scarce. The objective of this study was to determine the prevalence and species composition of bovine TBPs of veterinary significance in local cattle populations. A comprehensive cross-sectional epidemiological study was conducted in cattle populations of Illubabor zone in Southwestern Ethiopia from June to August 2013. For this purpose, blood samples were collected from 392 cattle. A combination of polymerase chain reaction (PCR and a Reverse Line Blot (RLB hybridization assay was employed for the detection of TBPs in these samples. The PCR/RLB results of the 392 blood samples indicated a high overall prevalence of 96.9% for TBPs, including Theileria mutans (66.1%, Theileria orientalis (51.8%, Anaplasma sp. Omatjenne (25.5%, Anaplasma marginale (14.5%, Babesia bigemina (14.0% and Theileria velifera (13.0% and minor occurrences of Ehrlichia ruminantium (0.5% and Ehrlichia minasensis (0.26%. Moreover, three novel Anaplasma genotypes were detected in bovine blood samples. A phylogenetic analysis revealed that they most likely represent three, but at least two, new species. The prevalence of the three novel Anaplasma species, preliminary designated as Anaplasma sp. Hadesa, Anaplasma sp. Saso and Anaplasma sp. Dedessa, was 12.5%, 14.3% and 5.6%, respectively. Overall, a total of 227 cattle (57.9% were found to be co-infected with two or more TBPs simultaneously and 86 different species combinations were observed. The findings show a very high burden of infection of cattle with TBPs in Ethiopia. The high frequency of co-infections suggests that clinical manifestations might be complex. Further research is required to determine the pathogenicity, host cell types and vector of

  15. Automated surface-scanning detection of pathogenic bacteria on fresh produce

    Science.gov (United States)

    Horikawa, Shin; Du, Songtao; Liu, Yuzhe; Chen, I.-Hsuan; Xi, Jianguo; Crumpler, Michael S.; Sirois, Donald L.; Best, Steve R.; Wikle, Howard C.; Chin, Bryan A.

    2017-05-01

    This paper investigates the effects of surface-scanning detector position on the resonant frequency and signal amplitude of a wireless magnetoelastic (ME) biosensor for direct pathogen detection on solid surfaces. The experiments were conducted on the surface of a flat polyethylene (PE) plate as a model study. An ME biosensor (1 mm × 0.2 mm × 30 μm) was placed on the PE surface, and a surface-scanning detector was brought close and aligned to the sensor for wireless resonant frequency measurement. The position of the detector was accurately controlled by using a motorized three-axis translation system (i.e., controlled X, Y, and Z positions). The results showed that the resonant frequency variations of the sensor were -125 to +150 Hz for X and Y detector displacements of +/-600 μm and Z displacements of +100 to +500 μm. These resonant frequency variations were small compared to the sensor's initial resonant frequency (< 0.007% of 2.2 MHz initial resonant frequency) measured at the detector home position, indicating high accuracy of the measurement. In addition, the signal amplitude was, as anticipated, found to decrease exponentially with increasing detection distance (i.e., Z distance). Finally, additional experiments were conducted on the surface of cucumbers. Similar results were obtained.

  16. Pyrosequencing detects human and animal pathogenic taxa in the grapevine endosphere.

    Science.gov (United States)

    Yousaf, Sohail; Bulgari, Daniela; Bergna, Alessandro; Pancher, Michael; Quaglino, Fabio; Casati, Paola; Campisano, Andrea

    2014-01-01

    Generally, plants are not considered as hosts for human and animal pathogens (HAP). The recent produce-associated outbreaks of food-borne diseases have drawn attention toward significant deficiencies in our understanding of the ecology of HAP, and their potential for interkingdom transfer. To examine the association of microorganisms classified as HAP with plants, we surveyed the presence and distribution of HAP bacterial taxa (henceforth HAPT, for brevity's sake) in the endosphere of grapevine (Vitis vinifera L.) both in the plant stems and leaves. An enrichment protocol was used on leaves to detect taxa with very low abundance in undisturbed tissues. We used pyrosequencing and phylogenetic analyses of the 16S rDNA gene. We identified several HAPT, and focused on four genera (Propionibacterium, Staphylococcus, Clostridium, and Burkholderia). The majority of the bacterial sequences in the genus Propionibacterium, from grapevine leaf and stem, were identified as P. acnes. Clostridia were detected in leaves and stems, but their number was much higher in leaves after enrichment. HAPT were indentified both in leaves and wood of grapevines. This depicts the ability of these taxa to be internalized within plant tissues and maintain their population levels in a variety of environments. Our analysis highlighted the presence of HAPT in the grapevine endosphere and unexpected occurrence of these bacterial taxa in this atypical environment.

  17. Specific and sensitive detection of the conifer pathogen Gremmeniella abietina by nested PCR

    Directory of Open Access Journals (Sweden)

    Hansson Per

    2005-11-01

    Full Text Available Abstract Background Gremmeniella abietina (Lagerb. Morelet is an ascomycete fungus that causes stem canker and shoot dieback in many conifer species. The fungus is widespread and causes severe damage to forest plantations in Europe, North America and Asia. To facilitate early diagnosis and improve measures to control the spread of the disease, rapid, specific and sensitive detection methods for G. abietina in conifer hosts are needed. Results We designed two pairs of specific primers for G. abietina based on the 18S rDNA sequence variation pattern. These primers were validated against a wide range of fungi and 14 potential conifer hosts. Based on these specific primers, two nested PCR systems were developed. The first system employed universal fungal primers to enrich the fungal DNA targets in the first round, followed by a second round selective amplification of the pathogen. The other system employed G. abietina-specific primers in both PCR steps. Both approaches can detect the presence of G. abietina in composite samples with high sensitivity, as little as 7.5 fg G. abietina DNA in the host genomic background. Conclusion The methods described here are rapid and can be applied directly to a wide range of conifer species, without the need for fungal isolation and cultivation. Therefore, it represents a promising alternative to disease inspection in forest nurseries, plantations and quarantine control facilities.

  18. Detection of virulence-associated genes in pathogenic and commensal avian Escherichia coli isolates.

    Science.gov (United States)

    Paixão, A C; Ferreira, A C; Fontes, M; Themudo, P; Albuquerque, T; Soares, M C; Fevereiro, M; Martins, L; Corrêa de Sá, M I

    2016-07-01

    Poultry colibacillosis due to Avian Pathogenic Escherichia coli (APEC) is responsible for several extra-intestinal pathological conditions, leading to serious economic damage in poultry production. The most commonly associated pathologies are airsacculitis, colisepticemia, and cellulitis in broiler chickens, and salpingitis and peritonitis in broiler breeders. In this work a total of 66 strains isolated from dead broiler breeders affected with colibacillosis and 61 strains from healthy broilers were studied. Strains from broiler breeders were typified with serogroups O2, O18, and O78, which are mainly associated with disease. The serogroup O78 was the most prevalent (58%). All the strains were checked for the presence of 11 virulence genes: 1) arginine succinyltransferase A (astA); ii) E.coli hemeutilization protein A (chuA); iii) colicin V A/B (cvaA/B); iv) fimbriae mannose-binding type 1 (fimC); v) ferric yersiniabactin uptake A (fyuA); vi) iron-repressible high-molecular-weight proteins 2 (irp2); vii) increased serum survival (iss); viii) iron-uptake systems of E.coli D (iucD); ix) pielonefritis associated to pili C (papC); x) temperature sensitive haemaglutinin (tsh), and xi) vacuolating autotransporter toxin (vat), by Multiplex-PCR. The results showed that all genes are present in both commensal and pathogenic E. coli strains. The iron uptake-related genes and the serum survival gene were more prevalent among APEC. The adhesin genes, except tsh, and the toxin genes, except astA, were also more prevalent among APEC isolates. Except for astA and tsh, APEC strains harbored the majority of the virulence-associated genes studied and fimC was the most prevalent gene, detected in 96.97 and 88.52% of APEC and AFEC strains, respectively. Possession of more than one iron transport system seems to play an important role on APEC survival. © 2016 Poultry Science Association Inc.

  19. Use of Metagenomic Shotgun Sequencing Technology To Detect Foodborne Pathogens within the Microbiome of the Beef Production Chain.

    Science.gov (United States)

    Yang, Xiang; Noyes, Noelle R; Doster, Enrique; Martin, Jennifer N; Linke, Lyndsey M; Magnuson, Roberta J; Yang, Hua; Geornaras, Ifigenia; Woerner, Dale R; Jones, Kenneth L; Ruiz, Jaime; Boucher, Christina; Morley, Paul S; Belk, Keith E

    2016-04-01

    Foodborne illnesses associated with pathogenic bacteria are a global public health and economic challenge. The diversity of microorganisms (pathogenic and nonpathogenic) that exists within the food and meat industries complicates efforts to understand pathogen ecology. Further, little is known about the interaction of pathogens within the microbiome throughout the meat production chain. Here, a metagenomic approach and shotgun sequencing technology were used as tools to detect pathogenic bacteria in environmental samples collected from the same groups of cattle at different longitudinal processing steps of the beef production chain: cattle entry to feedlot, exit from feedlot, cattle transport trucks, abattoir holding pens, and the end of the fabrication system. The log read counts classified as pathogens per million reads for Salmonella enterica,Listeria monocytogenes,Escherichia coli,Staphylococcus aureus, Clostridium spp. (C. botulinum and C. perfringens), and Campylobacter spp. (C. jejuni,C. coli, and C. fetus) decreased over subsequential processing steps. Furthermore, the normalized read counts for S. enterica,E. coli, and C. botulinumwere greater in the final product than at the feedlots, indicating that the proportion of these bacteria increased (the effect on absolute numbers was unknown) within the remaining microbiome. From an ecological perspective, data indicated that shotgun metagenomics can be used to evaluate not only the microbiome but also shifts in pathogen populations during beef production. Nonetheless, there were several challenges in this analysis approach, one of the main ones being the identification of the specific pathogen from which the sequence reads originated, which makes this approach impractical for use in pathogen identification for regulatory and confirmation purposes. Copyright © 2016 Yang et al.

  20. Nodeomics: pathogen detection in vertebrate lymph nodes using meta-transcriptomics.

    Directory of Open Access Journals (Sweden)

    Nicola E Wittekindt

    Full Text Available The ongoing emergence of human infections originating from wildlife highlights the need for better knowledge of the microbial community in wildlife species where traditional diagnostic approaches are limited. Here we evaluate the microbial biota in healthy mule deer (Odocoileus hemionus by analyses of lymph node meta-transcriptomes. cDNA libraries from five individuals and two pools of samples were prepared from retropharyngeal lymph node RNA enriched for polyadenylated RNA and sequenced using Roche-454 Life Sciences technology. Protein-coding and 16S ribosomal RNA (rRNA sequences were taxonomically profiled using protein and rRNA specific databases. Representatives of all bacterial phyla were detected in the seven libraries based on protein-coding transcripts indicating that viable microbiota were present in lymph nodes. Residents of skin and rumen, and those ubiquitous in mule deer habitat dominated classifiable bacterial species. Based on detection of both rRNA and protein-coding transcripts, we identified two new proteobacterial species; a Helicobacter closely related to Helicobacter cetorum in the Helicobacter pylori/Helicobacter acinonychis complex and an Acinetobacter related to Acinetobacter schindleri. Among viruses, a novel gamma retrovirus and other members of the Poxviridae and Retroviridae were identified. We additionally evaluated bacterial diversity by amplicon sequencing the hypervariable V6 region of 16S rRNA and demonstrate that overall taxonomic diversity is higher with the meta-transcriptomic approach. These data provide the most complete picture to date of the microbial diversity within a wildlife host. Our research advances the use of meta-transcriptomics to study microbiota in wildlife tissues, which will facilitate detection of novel organisms with pathogenic potential to human and animals.

  1. Recent Advances in Molecular Technologies and Their Application in Pathogen Detection in Foods with Particular Reference to Yersinia

    Directory of Open Access Journals (Sweden)

    Jin Gui

    2011-01-01

    Full Text Available Yersinia enterocolitica is an important zoonotic pathogen that can cause yersiniosis in humans and animals. Food has been suggested to be the main source of yersiniosis. It is critical for the researchers to be able to detect Yersinia or any other foodborne pathogen with increased sensitivity and specificity, as well as in real-time, in the case of a foodborne disease outbreak. Conventional detection methods are known to be labor intensive, time consuming, or expensive. On the other hand, more sensitive molecular-based detection methods like next generation sequencing, microarray, and many others are capable of providing faster results. DNA testing is now possible on a single molecule, and high-throughput analysis allows multiple detection reactions to be performed at once, thus allowing a range of characteristics to be rapidly and simultaneously determined. Despite better detection efficiencies, results derived using molecular biology methods can be affected by the various food matrixes. With the improvements in sample preparation, data analysis, and testing procedures, molecular detection techniques will likely continue to simplify and increase the speed of detection while simultaneously improving the sensitivity and specificity for tracking pathogens in food matrices.

  2. Phage-based surface plasmon resonance strategies for the detection of pathogens

    Science.gov (United States)

    Tawil, Nancy

    We start by reviewing the basic principles and recent advances in biosensing technologies using optical, electrochemical and acoustic platforms for phage-based diagnostics. Although much notable work has been done, a low cost, specific, sensitive optical method for detecting low concentrations of pathogens, in a few minutes, has not been established. We conclude from the limited body of work on the subject that improving immobilization strategies and finding more suitable phage recognition elements would allow for a more sensitive approach. Our aim was to better describe the attachment process of MRSA specific phages on gold surfaces, and the subsequent biodetection of their bacterial hosts by surface plasmon resonance (SPR). With the knowledge that the adsorption characteristics of thiol-containing molecules are necessary for applications involving the attachment of recognition elements to a functionalized surface, we start by providing comparative details on the kinetics of self-assembly of L-cysteine and 11-mercaptoundecanoic acid (MUA) monolayers on gold using SPR[1]. Our purpose, in carrying out these measurements was to establish each molecule's validity and applicability as a linker element for use in biosensing. We find that monolayer formation, for both L-cysteine and MUA, is described by the Langmuir isotherm at low concentrations only. For L-cysteine, both the amine and thiol groups contribute to the initial attachment of the molecule, followed by the replacement of the amine-gold complexes initially formed with more stable thiol-gold complexes. The reorganization of L-cysteine creates more space on the gold surface, and the zwitterionic form of the molecule permits the physisorption of a second layer through electrostatic interactions. On the other hand, MUA deposits randomly onto the surface of gold as a SAM and slowly reorganizes into a denser, vertical state. Surface plasmon resonance was then used for the real-time monitoring of the attachment of

  3. Direct Detection and Differentiation of Pathogenic Leptospira Species Using a Multi-Gene Targeted Real Time PCR Approach

    Science.gov (United States)

    Ferreira, Ana Sofia; Costa, Pedro; Rocha, Teresa; Amaro, Ana; Vieira, Maria Luísa; Ahmed, Ahmed; Thompson, Gertrude; Hartskeerl, Rudy A.; Inácio, João

    2014-01-01

    Leptospirosis is a growing public and veterinary health concern caused by pathogenic species of Leptospira. Rapid and reliable laboratory tests for the direct detection of leptospiral infections in animals are in high demand not only to improve diagnosis but also for understanding the epidemiology of the disease. In this work we describe a novel and simple TaqMan-based multi-gene targeted real-time PCR approach able to detect and differentiate Leptospira interrogans, L. kirschneri, L. borgpeteresenii and L. noguchii, which constitute the veterinary most relevant pathogenic species of Leptospira. The method uses sets of species-specific probes, and respective flanking primers, designed from ompL1 and secY gene sequences. To monitor the presence of inhibitors, a duplex amplification assay targeting both the mammal β-actin and the leptospiral lipL32 genes was implemented. The analytical sensitivity of all primer and probe sets was estimated to be <10 genome equivalents (GE) in the reaction mixture. Application of the amplification reactions on genomic DNA from a variety of pathogenic and non-pathogenic Leptospira strains and other non-related bacteria revealed a 100% analytical specificity. Additionally, pathogenic leptospires were successfully detected in five out of 29 tissue samples from animals (Mus spp., Rattus spp., Dolichotis patagonum and Sus domesticus). Two samples were infected with L. borgpetersenii, two with L. interrogans and one with L. kirschneri. The possibility to detect and identify these pathogenic agents to the species level in domestic and wildlife animals reinforces the diagnostic information and will enhance our understanding of the epidemiology of leptopirosis. PMID:25398140

  4. Direct bacterial loop-mediated isothermal amplification detection on the pathogenic features of the nosocomial pathogen - Methicillin resistant Staphylococcus aureus strains with respiratory origins.

    Science.gov (United States)

    Lin, Qun; Xu, Pusheng; Li, Jiaowu; Chen, Yin; Feng, Jieyi

    2017-08-01

    Loop-mediated isothermal amplification based detection assays using bacterial culture or colony for direct detection of methicillin resistant Staphylococcus aureus(MRSA) had been developed and evaluated, followed by its extensive application on a large scale of clinical MRSA isolated from respiratory origins, including nasal swabs and sputums. Six primers, including outer primers, inner primers and loop primers, were specifically designed for recognizing eight distinct sequences on four targets: 16SrRNA, femA, mecA and orfX. Twenty-seven reference strains were used to develop, evaluate and optimize this assay. Then, a total of 532 clinical MRSA isolates were employed for each detected targets. And the results were determined through both visual observation of the color change by naked eye and electrophoresis. The specific of each primer had been confirmed, and the optimal amplification was obtained under 65 °C for 40 min. The limit of detections (LOD) of bacteria culture LAMP assays were determined to be 10 4  CFU/ml for 16S rRNA, femA, as well as orfX and 10 5  CFU/ml for mecA, respectively. The established novel assays on MRSA detection may provide new strategies for rapid detection of foodborne pathogens. Copyright © 2017. Published by Elsevier Ltd.

  5. The application of flow cytometry and fluorescent probe technology for detection and assessment of viability of plant pathogenic bacteria

    NARCIS (Netherlands)

    Chitarra, L.G.; Bulk, van den R.W.

    2003-01-01

    Conventional methods to detect and assess the viability of plant pathogenic bacteria are usually based on plating assays or serological techniques. Plating assays provide information about the number of viable cells, expressed as colony-forming units, but are time-consuming and laborious.

  6. A novel gold nanoparticle-DNA aptamer-based plasmonic chip for rapid and sensitive detection of bacterial pathogens

    DEFF Research Database (Denmark)

    Sun, Yi; Phuoc Long, Truong; Wolff, Anders

    2016-01-01

    Gold nanoparticles (AuNPs)-based biosensors are emerging technologies for rapid detection of pathogens. However, it is very challenging to develop chip-based AuNP-biosensors for whole cells. This paper describes a novel AuNPs-DNA aptamer-based plasmonic assay which allows DNA aptamers...

  7. Rapid detection and identification of viral and bacterial fish pathogens using a DNA array‐based multiplex assay

    DEFF Research Database (Denmark)

    Lievens, B.; Frans, I.; Heusdens, C.

    2011-01-01

    for the simultaneous detection and identification of all cyprinid herpesviruses (CyHV‐1, CyHV‐2 and CyHV‐3) and some of the most important fish pathogenic Flavobacterium species, including F. branchiophilum, F. columnare and F. psychrophilum. For virus identification, the DNA polymerase and helicase genes were...

  8. A rapid and specific detection of pathogenic serovar Salmonella typhimurium by loop-mediated isothermal amplification method (LAMP

    Directory of Open Access Journals (Sweden)

    Hadi Ravan

    2017-09-01

    Discussion and conclusion: As a result of a high sensitivity and specificity of the method as well as its low cost per assay, it could be concluded that the present LAMP assay is a powerful, accurate, and efficient method for detecting pathogenic serovar Salmonella typhimurium in food-processing industries and diagnostic laboratories.

  9. A Broad-Spectrum Infection Diagnostic that Detects Pathogen-Associated Molecular Patterns (PAMPs) in Whole Blood

    OpenAIRE

    Cartwright, Mark; Rottman, Martin; Shapiro, Nathan I.; Seiler, Benjamin; Lombardo, Patrick; Gamini, Nazita; Tomolonis, Julie; Watters, Alexander L.; Waterhouse, Anna; Leslie, Dan; Bolgen, Dana; Graveline, Amanda; Kang, Joo H.; Didar, Tohid; Dimitrakakis, Nikolaos

    2016-01-01

    Background: Blood cultures, and molecular diagnostic tests that directly detect pathogen DNA in blood, fail to detect bloodstream infections in most infected patients. Thus, there is a need for a rapid test that can diagnose the presence of infection to triage patients, guide therapy, and decrease the incidence of sepsis. Methods: An Enzyme-Linked Lectin-Sorbent Assay (ELLecSA) that uses magnetic microbeads coated with an engineered version of the human opsonin, Mannose Binding Lectin, contai...

  10. Detection of pneumonia associated pathogens using a prototype multiplexed pneumonia test in hospitalized patients with severe pneumonia.

    Directory of Open Access Journals (Sweden)

    Berit Schulte

    Full Text Available Severe pneumonia remains an important cause of morbidity and mortality. Polymerase chain reaction (PCR has been shown to be more sensitive than current standard microbiological methods--particularly in patients with prior antibiotic treatment--and therefore, may improve the accuracy of microbiological diagnosis for hospitalized patients with pneumonia. Conventional detection techniques and multiplex PCR for 14 typical bacterial pneumonia-associated pathogens were performed on respiratory samples collected from adult hospitalized patients enrolled in a prospective multi-center study. Patients were enrolled from March until September 2012. A total of 739 fresh, native samples were eligible for analysis, of which 75 were sputa, 421 aspirates, and 234 bronchial lavages. 276 pathogens were detected by microbiology for which a valid PCR result was generated (positive or negative detection result by Curetis prototype system. Among these, 120 were identified by the prototype assay, 50 pathogens were not detected. Overall performance of the prototype for pathogen identification was 70.6% sensitivity (95% confidence interval (CI lower bound: 63.3%, upper bound: 76.9% and 95.2% specificity (95% CI lower bound: 94.6%, upper bound: 95.7%. Based on the study results, device cut-off settings were adjusted for future series production. The overall performance with the settings of the CE series production devices was 78.7% sensitivity (95% CI lower bound: 72.1% and 96.6% specificity (95% CI lower bound: 96.1%. Time to result was 5.2 hours (median for the prototype test and 43.5 h for standard-of-care. The Pneumonia Application provides a rapid and moderately sensitive assay for the detection of pneumonia-causing pathogens with minimal hands-on time.Deutsches Register Klinischer Studien (DRKS DRKS00005684.

  11. Development and evaluation of a panel of filovirus sequence capture probes for pathogen detection by next-generation sequencing.

    Directory of Open Access Journals (Sweden)

    Jeffrey W Koehler

    Full Text Available A detailed understanding of the circulating pathogens in a particular geographic location aids in effectively utilizing targeted, rapid diagnostic assays, thus allowing for appropriate therapeutic and containment procedures. This is especially important in regions prevalent for highly pathogenic viruses co-circulating with other endemic pathogens such as the malaria parasite. The importance of biosurveillance is highlighted by the ongoing Ebola virus disease outbreak in West Africa. For example, a more comprehensive assessment of the regional pathogens could have identified the risk of a filovirus disease outbreak earlier and led to an improved diagnostic and response capacity in the region. In this context, being able to rapidly screen a single sample for multiple pathogens in a single tube reaction could improve both diagnostics as well as pathogen surveillance. Here, probes were designed to capture identifying filovirus sequence for the ebolaviruses Sudan, Ebola, Reston, Taï Forest, and Bundibugyo and the Marburg virus variants Musoke, Ci67, and Angola. These probes were combined into a single probe panel, and the captured filovirus sequence was successfully identified using the MiSeq next-generation sequencing platform. This panel was then used to identify the specific filovirus from nonhuman primates experimentally infected with Ebola virus as well as Bundibugyo virus in human sera samples from the Democratic Republic of the Congo, thus demonstrating the utility for pathogen detection using clinical samples. While not as sensitive and rapid as real-time PCR, this panel, along with incorporating additional sequence capture probe panels, could be used for broad pathogen screening and biosurveillance.

  12. Sensitive real-time PCR detection of pathogenic Leptospira spp. and a comparison of nucleic acid amplification methods for the diagnosis of leptospirosis.

    Science.gov (United States)

    Waggoner, Jesse J; Balassiano, Ilana; Abeynayake, Janaki; Sahoo, Malaya K; Mohamed-Hadley, Alisha; Liu, Yuanyuan; Vital-Brazil, Juliana Magalhães; Pinsky, Benjamin A

    2014-01-01

    Bacteria of the genus Leptospira, the causative agents of leptospirosis, are categorized into pathogenic and non-pathogenic species. However, the benefit of using a clinical diagnostic that is specific for pathogenic species remains unclear. In this study, we present the development of a real-time PCR (rtPCR) for the detection of pathogenic Leptospira (the pathogenic rtPCR), and we perform a comparison of the pathogenic rtPCR with a published assay that detects all Leptospira species [the undifferentiated febrile illness (UFI) assay] and a reference 16S Leptospira rtPCR, which was originally designed to detect pathogenic species. For the pathogenic rtPCR, a new hydrolysis probe was designed for use with primers from the UFI assay, which targets the 16S gene. The pathogenic rtPCR detected Leptospira DNA in 37/37 cultured isolates from 5 pathogenic and one intermediate species. Two strains of the non-pathogenic L. biflexa produced no signal. Clinical samples from 65 patients with suspected leptospirosis were then tested using the pathogenic rtPCR and a reference Leptospira 16S rtPCR. All 65 samples had tested positive for Leptospira using the UFI assay; 62 (95.4%) samples tested positive using the pathogenic rtPCR (p = 0.24). Only 24 (36.9%) samples tested positive in the reference 16S rtPCR (pLeptospira species in 49/50 cases, including 3 cases that were only detected using the UFI assay. The pathogenic rtPCR displayed similar sensitivity to the UFI assay when testing clinical specimens with no difference in specificity. Both assays proved significantly more sensitive than a real-time molecular test used for comparison. Future studies are needed to investigate the clinical and epidemiologic significance of more sensitive Leptospira detection using these tests.

  13. Workshop summary: detection, impact, and control of specific pathogens in animal resource facilities.

    Science.gov (United States)

    Mansfield, Keith G; Riley, Lela K; Kent, Michael L

    2010-01-01

    Despite advances, infectious diseases remain a threat to animal facilities, continue to affect animal health, and serve as potential confounders of experimental research. A workshop entitled Detection, Impact, and Control of Specific Pathogens in Animal Resource Facilities was sponsored by the National Center for Research Resources (NCRR) and National Institutes of Aging (NIA) and held April 23-24, 2009, at the Lister Hill Conference Center on the National Institutes of Health's (NIH) Bethesda campus. The meeting brought together laboratory animal scientists and veterinarians with experience in fish, rodent, and nonhuman primate models to identify common issues and problems. Session speakers addressed (1) common practices and current knowledge of these species, (2) new technologies in the diagnosis of infectious diseases, (3) impact of environmental quality on infectious disease, (4) normal microbial flora in health and disease, (5) genetics and infectious disease, and (6) specific infectious agents and their impact on research. Attendees discussed current challenges and future needs, highlighting the importance of education and training, the funding of critical infrastructure and resource research, and the need for improved communication of disease risks and integration of these risks with strategic planning. NIH and NCRR have a strong record of supporting resource initiatives that have helped address many of these issues and recent efforts have focused on the building of consortium activities among such programs. This manuscript summarizes the presentations and conclusions of participants at the meeting; abstracts and a full conference report are available online (www.ncrr.nih.gov).

  14. Molecular detection and identification of Rickettsiales pathogens in dog ticks from Costa Rica.

    Science.gov (United States)

    Campos-Calderón, Liliana; Ábrego-Sánchez, Leyda; Solórzano-Morales, Antony; Alberti, Alberto; Tore, Gessica; Zobba, Rosanna; Jiménez-Rocha, Ana E; Dolz, Gaby

    2016-10-01

    Although vector-borne diseases are globally widespread with considerable impact on animal production and on public health, few reports document their presence in Central America. This study focuses on the detection and molecular identification of species belonging to selected bacterial genera (Ehrlichia, Anaplasma and Rickettsia) in ticks sampled from dogs in Costa Rica by targeting several genes: 16S rRNA/dsb genes for Ehrlichia; 16S rRNA/groEL genes for Anaplasma, and ompA/gltA/groEL genes for Rickettsia. PCR and sequence analyses provides evidences of Ehrlichia canis, Anaplasma platys, and Anaplasma phagocytophilum infection in Rhipicephalus sanguineus s.l ticks, and allow establishing the presence of Rickettsia monacensis in Ixodes boliviensis. Furthermore, the presence of recently discovered Mediterranean A. platys-like strains is reported for the first time in Central America. Results provide new background on geographical distribution of selected tick-transmitted bacterial pathogens in Costa Rica and on their molecular epidemiology, and are pivotal to the development of effective and reliable diagnostic tools in Central America. Copyright © 2016 Elsevier GmbH. All rights reserved.

  15. Rapid detection of food pathogens using RNA aptamers-immobilized slide.

    Science.gov (United States)

    Maeng, Jin-Soo; Kim, Namsoo; Kim, Chong-Tai; Han, Seung Ryul; Lee, Young Ju; Lee, Seong-Wook; Lee, Myung-Hyun; Cho, Yong-Jin

    2012-07-01

    The purpose of this study was to develop a simple and rapid detection system for foodborne bacteria, which consisted of an optical microscope and its slide chip with artificial antibodies, or RNA aptamers. From an RNA pool, three each RNA aptamers were built by the method of SELEX (systematic evolution of ligands by exponential enrichment) for components of cell wall, LPS (lipopolysaccharide) from E. coli O157:H7, teichoic acid from Staphylococcus aureus and a cell membrane protein of OmpC from Salmonella typhimurium, respectively. These aptamers were hybridized with thiol-conjugated 16 dT-linker molecules in order to be immobilized on silver surface which was, in advance, fabricated on glass slide, using a spin-coating method. To confirm that each aptamers retained its specific binding activities to their antigenic live bacteria, microscopic view of bound cells immobilized on silver film were observed. Furthermore, we observed the fluorescence-emitting bacteria-aptamer complex immobilized on silver film after adding RNA aptamers hybridized with fluorophore, FAM-conjugated 16 dT-linker molecules. As a result, the RNA aptamers-immobilized slide system developed in this study was a useful new tool to rapidly monitor individual food pathogens.

  16. Widespread detection of highly pathogenic H5 influenza viruses in wild birds from the Pacific Flyway of the United States.

    Science.gov (United States)

    Bevins, S N; Dusek, R J; White, C L; Gidlewski, T; Bodenstein, B; Mansfield, K G; DeBruyn, P; Kraege, D; Rowan, E; Gillin, C; Thomas, B; Chandler, S; Baroch, J; Schmit, B; Grady, M J; Miller, R S; Drew, M L; Stopak, S; Zscheile, B; Bennett, J; Sengl, J; Brady, Caroline; Ip, H S; Spackman, E; Killian, M L; Torchetti, M K; Sleeman, J M; Deliberto, T J

    2016-07-06

    A novel highly pathogenic avian influenza virus belonging to the H5 clade 2.3.4.4 variant viruses was detected in North America in late 2014. Motivated by the identification of these viruses in domestic poultry in Canada, an intensive study was initiated to conduct highly pathogenic avian influenza surveillance in wild birds in the Pacific Flyway of the United States. A total of 4,729 hunter-harvested wild birds were sampled and highly pathogenic avian influenza virus was detected in 1.3% (n = 63). Three H5 clade 2.3.4.4 subtypes were isolated from wild birds, H5N2, H5N8, and H5N1, representing the wholly Eurasian lineage H5N8 and two novel reassortant viruses. Testing of 150 additional wild birds during avian morbidity and mortality investigations in Washington yielded 10 (6.7%) additional highly pathogenic avian influenza isolates (H5N8 = 3 and H5N2 = 7). The geographically widespread detection of these viruses in apparently healthy wild waterfowl suggest that the H5 clade 2.3.4.4 variant viruses may behave similarly in this taxonomic group whereby many waterfowl species are susceptible to infection but do not demonstrate obvious clinical disease. Despite these findings in wild waterfowl, mortality has been documented for some wild bird species and losses in US domestic poultry during the first half of 2015 were unprecedented.

  17. Detection, fate and inactivation of pathogenic norovirus employing settlement and UV treatment in wastewater treatment facilities

    International Nuclear Information System (INIS)

    Barrett, M.; Fitzhenry, K.; O'Flaherty, V.; Dore, W.; Keaveney, S.; Cormican, M.; Rowan, N.; Clifford, E.

    2016-01-01

    It is accepted that discharged wastewaters can be a significant source of pathogenic viruses in receiving water bodies contributing to pollution and may in turn enter the human food chain and pose a risk to human health, thus norovirus (NoV) is often a predominant cause of gastroenteritis globally. Working with NoV poses particular challenges as it cannot be readily identified and detection by molecular methods does not assess infectivity. It has been proposed that the infectivity of NoV may be modelled through the use of an alternative virus; F-specific RNA (FRNA) bacteriophages; GA genotype and other FRNA bacteriophages have been used as a surrogate in studies of NoV inactivation. This study investigated the efficiency of novel pulsed ultraviolet irradiation and low pressure ultraviolet irradiation as a potential pathogen inactivation system for NoV and FRNA bacteriophage (GA) in secondary treated wastewaters. The role of UV dose and the impact of suspended solids concentration on removal efficiency were also examined. The study also investigated the role of settlement processes in wastewater treatment plants in removing NoV. While NoV inactivation could not be determined it was found that at a maximum UV dose of 6.9 J/cm"2 (6900 mJ/cm"2) an average 2.4 log removal of FRNA bacteriophage (GA) was observed; indicating the potential need for high UV doses to remove NoV if FRNA bacteriophage prove a suitable indicator for NoV. The study found that increasing concentrations of suspended solids impacted on PUV efficiency however, it appears the extent of the impact may be site specific. Furthermore, the study found that settlement processes can play a significant role in the removal of FRNA bacteriophage, thus potentially NoV. - Highlights: • Effectiveness of low pressure UV and novel high-intensity pulsed UV disinfection in NoVs removal. • Reduction of FRNA bacteriophage was seen in clarified wastewater after settling. • Adsorption of viral particles to solids

  18. Detection, fate and inactivation of pathogenic norovirus employing settlement and UV treatment in wastewater treatment facilities

    Energy Technology Data Exchange (ETDEWEB)

    Barrett, M. [Microbial Ecology Laboratory, Microbiology, School of Natural sciences, National University of Ireland Galway (Ireland); Ryan Institute, National University of Ireland Galway (Ireland); College of Engineering and Informatics, National University of Ireland Galway (Ireland); Fitzhenry, K. [Ryan Institute, National University of Ireland Galway (Ireland); College of Engineering and Informatics, National University of Ireland Galway (Ireland); O' Flaherty, V. [Microbial Ecology Laboratory, Microbiology, School of Natural sciences, National University of Ireland Galway (Ireland); Ryan Institute, National University of Ireland Galway (Ireland); Dore, W.; Keaveney, S. [Marine Institute, Galway (Ireland); Cormican, M. [Ryan Institute, National University of Ireland Galway (Ireland); Centre for Health from Environment, Ryan Institute, National University of Ireland Galway (Ireland); Rowan, N. [Bioscience Research Institute, Athlone Institute of Technology (Ireland); Clifford, E., E-mail: eoghan.clifford@nuigalway.ie [Ryan Institute, National University of Ireland Galway (Ireland); College of Engineering and Informatics, National University of Ireland Galway (Ireland)

    2016-10-15

    It is accepted that discharged wastewaters can be a significant source of pathogenic viruses in receiving water bodies contributing to pollution and may in turn enter the human food chain and pose a risk to human health, thus norovirus (NoV) is often a predominant cause of gastroenteritis globally. Working with NoV poses particular challenges as it cannot be readily identified and detection by molecular methods does not assess infectivity. It has been proposed that the infectivity of NoV may be modelled through the use of an alternative virus; F-specific RNA (FRNA) bacteriophages; GA genotype and other FRNA bacteriophages have been used as a surrogate in studies of NoV inactivation. This study investigated the efficiency of novel pulsed ultraviolet irradiation and low pressure ultraviolet irradiation as a potential pathogen inactivation system for NoV and FRNA bacteriophage (GA) in secondary treated wastewaters. The role of UV dose and the impact of suspended solids concentration on removal efficiency were also examined. The study also investigated the role of settlement processes in wastewater treatment plants in removing NoV. While NoV inactivation could not be determined it was found that at a maximum UV dose of 6.9 J/cm{sup 2} (6900 mJ/cm{sup 2}) an average 2.4 log removal of FRNA bacteriophage (GA) was observed; indicating the potential need for high UV doses to remove NoV if FRNA bacteriophage prove a suitable indicator for NoV. The study found that increasing concentrations of suspended solids impacted on PUV efficiency however, it appears the extent of the impact may be site specific. Furthermore, the study found that settlement processes can play a significant role in the removal of FRNA bacteriophage, thus potentially NoV. - Highlights: • Effectiveness of low pressure UV and novel high-intensity pulsed UV disinfection in NoVs removal. • Reduction of FRNA bacteriophage was seen in clarified wastewater after settling. • Adsorption of viral particles

  19. Mycosphaerella fijiensis, the black leaf streak pathogen of banana: progress towards understanding pathogen biology and detection, disease development, and the challenges of control.

    Science.gov (United States)

    Churchill, Alice C L

    2011-05-01

    primary hosts of M. fijiensis, the ornamental plant Heliconia psittacorum has been reported as an alternative host. Several valuable tools and resources have been developed to overcome some of the challenges of studying this host-pathogen system. These include a DNA-mediated fungal transformation system and the ability to conduct targeted gene disruptions, reliable quantitative plant bioassays, diagnostic probes to detect and differentiate M. fijiensis from related pathogens and to distinguish strains of different mating types, and a genome sequence that has revealed a wealth of gene sequences and molecular markers to be utilized in functional and population biology studies. http://bananas.bioversityinternational.org/, http://genome.jgi-psf.org/Mycfi2/Mycfi2.home.html, http://www.isppweb.org/names_banana_pathogen.asp#fun, http://www.promusa.org/. © 2010 THE AUTHOR. MOLECULAR PLANT PATHOLOGY © 2010 BSPP AND BLACKWELL PUBLISHING LTD.

  20. Surveillance for early detection of low pathogenicity avian influenza in poultry

    NARCIS (Netherlands)

    Comin, A.

    2012-01-01

    Infection with low pathogenicity avian influenza (LPAI) virus is widespread and has led to outbreaks in domestic birds in many countries. Although infection does not pose a serious concern for animal heath, LPAI virus subtypes H5 and H7 can mutate into the highly pathogenic form (HPAI), which can

  1. Surveillance of low pathogenic avian influenza in layer chickens: risk factors, transmission and early detection

    NARCIS (Netherlands)

    Gonzales Rojas, J.L.

    2012-01-01

    Low pathogenic avian influenza virus (LPAIv) of H5 and H7 subtypes are able to mutate to highly pathogenic avian influenza virus (HPAIv), which are lethal for most poultry species, can cause large epidemics and are a serious threat to public health. Thus, circulation of these LPAIv in poultry is

  2. Methods for detecting pathogens in the beef food chain: an overview

    Science.gov (United States)

    The main food-borne pathogens of concern in the beef chain are Shiga toxin-producing Escherichia coli (STEC) and Salmonella. Other pathogens, including Listeria monocytogenes and Campylobacter spp. may also be present and pose contamination concerns in both the cattle production environment and bee...

  3. A PDMS/paper/glass hybrid microfluidic biochip integrated with aptamer-functionalized graphene oxide nano-biosensors for one-step multiplexed pathogen detection

    OpenAIRE

    Zuo, Peng; Li, XiuJun; Dominguez, Delfina C.; Ye, Bang-Ce

    2013-01-01

    Infectious pathogens often cause serious public health concerns throughout the world. There is an increasing demand for simple, rapid and sensitive approaches for multiplexed pathogen detection. In this paper we have developed a polydimethylsiloxane (PDMS)/paper/glass hybrid microfluidic system integrated with aptamer-functionalized graphene oxide (GO) nano-biosensors for simple, one-step, multiplexed pathogen detection. The paper substrate used in this hybrid microfluidic system facilitated ...

  4. A novel multiplex PCR assay for simultaneous detection of nine clinically significant bacterial pathogens associated with bovine mastitis.

    Science.gov (United States)

    Ashraf, Aqeela; Imran, Muhammad; Yaqub, Tahir; Tayyab, Muhammad; Shehzad, Wasim; Thomson, Peter C

    2017-06-01

    For rapid and simultaneous detection of nine bovine mastitic pathogens, a sensitive and specific multiplex PCR assay was developed. The assay was standardized using reference strains and validated on mastitic milk cultures which were identified to species level based on 16S rRNA sequencing. Multiplex PCR assay also efficiently detected the target bacterial strains directly from milk. The detection limit of the assay was up to 50 pg for DNA isolated from pure cultures and 10 4  CFU/ml for spiked milk samples. As estimated by latent class analysis, the assay was sensitive up to 88% and specific up to 98% for targeted mastitic pathogens, compared with the bacterial culture method and the 16S rRNA sequence analysis. This novel molecular assay could be useful for monitoring and maintaining the bovine udder health, ensuring the bacteriological safety of milk, and conducting epidemiological studies. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Comparison between nasopharyngeal swab and nasal wash, using culture and PCR, in the detection of potential respiratory pathogens

    Directory of Open Access Journals (Sweden)

    El Batrawy Sherouk

    2011-04-01

    Full Text Available Abstract Background Nasopharyngeal carriage of potential pathogens is important as it is both the major source of transmission and the prerequisite of invasive disease. New methods for detecting carriage could improve comfort, accuracy and laboratory utility. The aims of this study were to compare the sensitivities of a nasopharyngeal swab (NPS and a nasal wash (NW in detecting potential respiratory pathogens in healthy adults using microbiological culture and PCR. Results Healthy volunteers attended for nasal washing and brushing of the posterior nasopharynx. Conventional and real-time PCR were used to detect pneumococcus and meningococcus. Statistical differences between the two nasal sampling methods were determined using a nonparametric Mann-Whitney U test; differences between culture and PCR methods were determined using the McNemar test. Nasal washing was more comfortable for volunteers than swabbing (n = 24. In detection by culture, the NW was significantly more likely to detect pathogens than the NPS (p Conclusions Nasal washing and PCR may provide effective alternatives to nasopharyngeal swabbing and classical microbiology, respectively.

  6. Surveillance of vector-borne pathogens under imperfect detection: lessons from Chagas disease risk (mis)measurement.

    Science.gov (United States)

    Minuzzi-Souza, Thaís Tâmara Castro; Nitz, Nadjar; Cuba, César Augusto Cuba; Hagström, Luciana; Hecht, Mariana Machado; Santana, Camila; Ribeiro, Marcelle; Vital, Tamires Emanuele; Santalucia, Marcelo; Knox, Monique; Obara, Marcos Takashi; Abad-Franch, Fernando; Gurgel-Gonçalves, Rodrigo

    2018-01-09

    Vector-borne pathogens threaten human health worldwide. Despite their critical role in disease prevention, routine surveillance systems often rely on low-complexity pathogen detection tests of uncertain accuracy. In Chagas disease surveillance, optical microscopy (OM) is routinely used for detecting Trypanosoma cruzi in its vectors. Here, we use replicate T. cruzi detection data and hierarchical site-occupancy models to assess the reliability of OM-based T. cruzi surveillance while explicitly accounting for false-negative and false-positive results. We investigated 841 triatomines with OM slides (1194 fresh, 1192 Giemsa-stained) plus conventional (cPCR, 841 assays) and quantitative PCR (qPCR, 1682 assays). Detections were considered unambiguous only when parasitologists unmistakably identified T. cruzi in Giemsa-stained slides. qPCR was >99% sensitive and specific, whereas cPCR was ~100% specific but only ~55% sensitive. In routine surveillance, examination of a single OM slide per vector missed ~50-75% of infections and wrongly scored as infected ~7% of the bugs. qPCR-based and model-based infection frequency estimates were nearly three times higher, on average, than OM-based indices. We conclude that the risk of vector-borne Chagas disease may be substantially higher than routine surveillance data suggest. The hierarchical modelling approach we illustrate can help enhance vector-borne disease surveillance systems when pathogen detection is imperfect.

  7. Autonomous houses. Autonomous house

    Energy Technology Data Exchange (ETDEWEB)

    Tanaka, S. (Tokai University, Tokyo (Japan). Faculty of Engineering)

    1991-09-30

    Self-sufficiency type houses are outlined. On condition that people gain a certain amount of income in relation with the society, they self-suffice under the given environment, allowing themselves to accept a minimum of industrial products with small environmental load. Ordinary supply from outside of fossil energy and materials which depend on it is minimized. Types are classified into three: energy, energy materials and perfect self-sufficiency. A study project for environment symbiotic houses is progressing which is planned by the Ministry of Construction and Institute of Building Energy Conservation and is invested by a private company. Its target is making a house for halving an environmental load by CO{sub 2}, for the purpose of creating the environment symbiotic house which is nice to and in harmony with the global environment and human beings. As a part of the studies on energy-saving and resource conservation on houses, introduced is a plan of an autonomous house at Izu-Atagawa. The passive method and high thermal-insulation are used for air conditioning, and hot spring water for hot water supply. Electric power is generated by hydroelectric power generation using mountain streams and by solar cells. Staple food is purchased, while subsidiary food is sufficed. 17 refs., 4 figs., 1 tab.

  8. Simultaneous Detection of Key Bacterial Pathogens Related to Pneumonia and Meningitis Using Multiplex PCR Coupled With Mass Spectrometry

    Directory of Open Access Journals (Sweden)

    Chi Zhang

    2018-04-01

    Full Text Available Pneumonia and meningitis continue to present an enormous public health burden and pose a major threat to young children. Among the causative organisms of pneumonia and meningitis, bacteria are the most common causes of serious disease and deaths. It is challenging to accurately and rapidly identify these agents. To solve this problem, we developed and validated a 12-plex PCR coupled with matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS method (bacterial pathogen-mass spectrometry, BP-MS that can be used to simultaneously screen for 11 key bacterial pathogens related to pneumonia and meningitis. Forty-six nasopharyngeal swabs and 12 isolates were used to determine the specificity of the method. The results showed that, using the BP-MS method, we could accurately identify the expected bacteria without cross-reactivity with other pathogens. For the 11 target bacterial pathogens, the analytical sensitivity of the BP-MS method was as low as 10 copies/reaction. To further evaluate the clinical effectiveness of this method, 204 nasopharyngeal swabs from hospitalized children with suspected pneumonia were tested using this method. In total, 81.9% (167/204 of the samples were positive for at least one of the 11 target pathogens. Among the 167 bacteria-positive samples, the rate of multiple infections was 55.7% (93/167, and the most frequent combination was Streptococcus pneumoniae with Haemophilus influenzae, representing 46.2% (43/93 two-pathogen mixed infections. We used real-time PCR and nested PCR to confirm positive results, with identical results obtained for 81.4% (136/167 of the samples. The BP-MS method is a sensitive and specific molecular detection technique in a multiplex format and with high sample throughput. Therefore, it will be a powerful tool for pathogen screening and antibiotic selection at an early stage of disease.

  9. Quantitative Molecular Detection of Putative Periodontal Pathogens in Clinically Healthy and Periodontally Diseased Subjects

    Science.gov (United States)

    Göhler, André; Hetzer, Adrian; Holtfreter, Birte; Geisel, Marie Henrike; Schmidt, Carsten Oliver; Steinmetz, Ivo; Kocher, Thomas

    2014-01-01

    Periodontitis is a multi-microbial oral infection with high prevalence among adults. Putative oral pathogens are commonly found in periodontally diseased individuals. However, these organisms can be also detected in the oral cavity of healthy subjects. This leads to the hypothesis, that alterations in the proportion of these organisms relative to the total amount of oral microorganisms, namely their abundance, rather than their simple presence might be important in the transition from health to disease. Therefore, we developed a quantitative molecular method to determine the abundance of various oral microorganisms and the portion of bacterial and archaeal nucleic acid relative to the total nucleic acid extracted from individual samples. We applied quantitative real-time PCRs targeting single-copy genes of periodontal bacteria and 16S-rRNA genes of Bacteria and Archaea. Testing tongue scrapings of 88 matched pairs of periodontally diseased and healthy subjects revealed a significantly higher abundance of P. gingivalis and a higher total bacterial abundance in diseased subjects. In fully adjusted models the risk of being periodontally diseased was significantly higher in subjects with high P. gingivalis and total bacterial abundance. Interestingly, we found that moderate abundances of A. actinomycetemcomitans were associated with reduced risk for periodontal disease compared to subjects with low abundances, whereas for high abundances, this protective effect leveled off. Moderate archaeal abundances were health associated compared to subjects with low abundances. In conclusion, our methodological approach unraveled associations of the oral flora with periodontal disease, which would have gone undetected if only qualitative data had been determined. PMID:25029268

  10. A Rapid and Simple Real-Time PCR Assay for Detecting Foodborne Pathogenic Bacteria in Human Feces.

    Science.gov (United States)

    Hanabara, Yutaro; Ueda, Yutaka

    2016-11-22

    A rapid, simple method for detecting foodborne pathogenic bacteria in human feces is greatly needed. Here, we examined the efficacy of a method that employs a combination of a commercial PCR master mix, which is insensitive to PCR inhibitors, and a DNA extraction method which used sodium dodecyl benzene sulfonate (SDBS), and Tween 20 to counteract the inhibitory effects of SDBS on the PCR assay. This method could detect the target genes (stx1 and stx2 of enterohemorrhagic Escherichia coli, invA of Salmonella Enteritidis, tdh of Vibrio parahaemolyticus, gyrA of Campylobacter jejuni, ceuE of Campylobacter coli, SEA of Staphylococcus aureus, ces of Bacillus cereus, and cpe of Clostridium perfringens) in a fecal suspension containing 1.0 × 10 1 to 1.0 × 10 3 CFU/ml. Furthermore, the assay was neither inhibited nor influenced by individual differences among the fecal samples of 10 subjects or fecal concentration (40-160 mg/ml in the fecal suspension). When we attempted to detect the genes of pathogenic bacteria in 4 actual clinical cases, we found that this method was more sensitive than standard culture method. These results showed that this assay is a rapid, simple detection method for foodborne pathogenic bacteria in human feces.

  11. Amaro-autonomous real-time detection of moving maritime objects: introducing a flight experiment for an on-board ship detection system

    Science.gov (United States)

    Schwenk, Kurt; Willburger, Katharina; Pless, Sebastian

    2017-10-01

    Motivated by politics and economy, the monitoring of the world wide ship traffic is a field of high topicality. To detect illegal activities like piracy, illegal fishery, ocean dumping and refugee transportation is of great value. The analysis of satellite images on the ground delivers a great contribution to situation awareness. However, for many applications the up-to-dateness of the data is crucial. With ground based processing, the time between image acquisition and delivery of the data to the end user is in the range of several hours. The highest influence to the duration of ground based processing is the delay caused by the transmission of the large amount of image data from the satellite to the processing centre on the ground. One expensive solution to this issue is the usage of data relay satellites systems like EDRS. Another approach is to analyse the image data directly on-board of the satellite. Since the product data (e.g. ship position, heading, velocity, characteristics) is very small compared to the input image data, real-time connections provided by satellite telecommunication services like Iridium or Orbcomm can be used to send small packets of information directly to the end user without significant delay. The AMARO (Autonomous real-time detection of moving maritime objects) project at DLR is a feasibility study of an on-board ship detection system involving a real-time low bandwidth communication. The operation of a prototype on-board ship detection system will be demonstrated on an airborne platform. In this article, the scope, aim and design of a flight experiment for an on-board ship detection system scheduled for mid of 2018 is presented. First, the scope and the constraints of the experiment are explained in detail. The main goal is to demonstrate the operability of an automatic ship detection system on board of an airplane. For data acquisition the optical high resolution DLR MACS-MARE camera (VIS/NIR) is used. The system will be able to

  12. Synovial fluid multiplex PCR is superior to culture for detection of low-virulent pathogens causing periprosthetic joint infection.

    Science.gov (United States)

    Morgenstern, Christian; Cabric, Sabrina; Perka, Carsten; Trampuz, Andrej; Renz, Nora

    2018-02-01

    Analysis of joint aspirate is the standard preoperative investigation for diagnosis of periprosthetic joint infection (PJI). We compared the diagnostic performance of culture and multiplex polymerase chain reaction (PCR) of synovial fluid for diagnosis of PJI. Patients in whom aspiration of the prosthetic hip or knee joint was performed before revision arthroplasty were prospectively included. The performance of synovial fluid culture and multiplex PCR was compared by McNemar's chi-squared test. A total of 142 patients were included, 82 with knee and 60 with hip prosthesis. PJI was diagnosed in 77 patients (54%) and aseptic failure in 65 patients (46%). The sensitivity of synovial fluid culture and PCR was 52% and 60%, respectively, showing concordant results in 116 patients (82%). In patients with PJI, PCR missed 6 high-virulent pathogens (S. aureus, streptococci, E. faecalis, E. coli) which grew in synovial fluid culture, whereas synovial fluid culture missed 12 pathogens detected by multiplex PCR, predominantly low-virulent pathogens (Cutibacterium acnes and coagulase-negative staphylococci). In patients with aseptic failure, PCR detected 6 low-virulent organisms (predominantly C. acnes). While the overall performance of synovial fluid PCR was comparable to culture, PCR was superior for detection of low-virulent bacteria such as Cutibacterium spp. and coagulase-negative staphylococci. In addition, synovial fluid culture required several days for growth, whereas multiplex PCR provided results within 5hours in an automated manner. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Prevalence of pathogenic germline variants detected by multigene sequencing in unselected Japanese patients with ovarian cancer.

    Science.gov (United States)

    Hirasawa, Akira; Imoto, Issei; Naruto, Takuya; Akahane, Tomoko; Yamagami, Wataru; Nomura, Hiroyuki; Masuda, Kiyoshi; Susumu, Nobuyuki; Tsuda, Hitoshi; Aoki, Daisuke

    2017-12-22

    Pathogenic germline BRCA1 , BRCA2 ( BRCA1/2 ), and several other gene variants predispose women to primary ovarian, fallopian tube, and peritoneal carcinoma (OC), although variant frequency and relevance information is scarce in Japanese women with OC. Using targeted panel sequencing, we screened 230 unselected Japanese women with OC from our hospital-based cohort for pathogenic germline variants in 75 or 79 OC-associated genes. Pathogenic variants of 11 genes were identified in 41 (17.8%) women: 19 (8.3%; BRCA1 ), 8 (3.5%; BRCA2 ), 6 (2.6%; mismatch repair genes), 3 (1.3%; RAD51D ), 2 (0.9%; ATM ), 1 (0.4%; MRE11A ), 1 ( FANCC ), and 1 ( GABRA6 ). Carriers of BRCA1/2 or any other tested gene pathogenic variants were more likely to be diagnosed younger, have first or second-degree relatives with OC, and have OC classified as high-grade serous carcinoma (HGSC). After adjustment for these variables, all 3 features were independent predictive factors for pathogenic variants in any tested genes whereas only the latter two remained for variants in BRCA1/2 . Our data indicate similar variant prevalence in Japanese patients with OC and other ethnic groups and suggest that HGSC and OC family history may facilitate genetic predisposition prediction in Japanese patients with OC and referring high-risk patients for genetic counseling and testing.

  14. Influence of Rack Design and Disease Prevalence on Detection of Rodent Pathogens in Exhaust Debris Samples from Individually Ventilated Caging Systems.

    Science.gov (United States)

    Bauer, Beth A; Besch-Williford, Cynthia; Livingston, Robert S; Crim, Marcus J; Riley, Lela K; Myles, Matthew H

    2016-11-01

    Sampling of bedding debris within the exhaust systems of ventilated racks may be a mechanism for detecting murine pathogens in colony animals. This study examined the effectiveness of detecting pathogens by PCR analysis of exhaust debris samples collected from ventilated racks of 2 different rack designs, one with unfiltered air flow from within the cage to the air-exhaust pathway, and the other had a filter between the cage and the air-exhaust pathway. For 12 wk, racks were populated with either 1 or 5 cages of mice (3 mice per cage) infected with one of the following pathogens: mouse norovirus (MNV), mouse parvovirus (MPV), mouse hepatitis virus (MHV), Helicobacter spp., Pasteurella pneumotropica, pinworms, Entamoeba muris, Tritrichomonas muris, and fur mites. Pathogen shedding by infected mice was monitored throughout the study. In the filter-containing rack, PCR testing of exhaust plenums yielded negative results for all pathogens at all time points of the study. In the rack with open air flow, pathogens detected by PCR analysis of exhaust debris included MHV, Helicobacter spp., P. pneumotropica, pinworms, enteric protozoa, and fur mites; these pathogens were detected in racks housing either 1 or 5 cages of infected mice. Neither MPV nor MNV was detected in exhaust debris, even though prolonged viral shedding was confirmed. These results demonstrate that testing rack exhaust debris from racks with unfiltered air flow detected MHV, enteric bacteria and parasites, and fur mites. However, this method failed to reliably detect MNV or MPV infection of colony animals.

  15. Fluorescence-Free Biosensor Methods in Detection of Food Pathogens with a Special Focus on Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Rajeswaran Radhakrishnan

    2017-12-01

    Full Text Available Food pathogens contaminate food products that allow their growth on the shelf and also under refrigerated conditions. Therefore, it is of utmost importance to lower the limit of detection (LOD of the method used and to obtain the results within hours to few days. Biosensor methods exploit the available technologies to individuate and provide an approximate quantification of the bacteria present in a sample. The main bottleneck of these methods depends on the aspecific binding to the surfaces and on a change in sensitivity when bacteria are in a complex food matrix with respect to bacteria in a liquid food sample. In this review, we introduce surface plasmon resonance (SPR, new advancements in SPR techniques, and electrochemical impedance spectroscopy (EIS, as fluorescence-free biosensing technologies for detection of L. monocytogenes in foods. The application of the two methods has facilitated L. monocytogenes detection with LOD of 1 log CFU/mL. Further advancements are envisaged through the combination of biosensor methods with immunoseparation of bacteria from larger volumes, application of lab-on-chip technologies, and EIS sensing methods for multiplex pathogen detection. Validation efforts are being conducted to demonstrate the robustness of detection, reproducibility and variability in multi-site installations.

  16. Development of a multiplex PCR assay for rapid and simultaneous detection of four genera of fish pathogenic bacteria.

    Science.gov (United States)

    Zhang, D F; Zhang, Q Q; Li, A H

    2014-11-01

    Species of genus Aeromonas, Vibrio, Edwardsiella and Streptococcus are the most common fish pathogenic bacteria that cause economically devastating losses in aquaculture. A multiplex polymerase chain reaction (mPCR) was developed for the simultaneous detection and differentiation of the four genera of fish pathogenic bacteria. Through the use of genus-specific primers instead of species-specific ones, the current mPCR covered much more target bacterial species compared with previously reported species-specific mPCR methods. The specificity of the four putative genus-specific primers was validated experimentally while used exclusively (uniplex PCR) or combined (mPCR) against bacterial genomic DNA templates of the target bacteria and nontarget bacteria. The PCR amplicons for the following genera were obtained as expected: Aeromonas (875 bp), Vibrio (524 bp), Edwardsiella (302 bp) and Streptococcus (197 bp), and the fragments could be separated clearly on the agarose gel electrophoresis. The mPCR did not produce nonspecific amplification products when used to amplify 21 nontarget species of bacteria. The mPCR detection limits for each target bacterial genera were 50 colony-forming units (CFU) in pure culture and 100 CFU in fish tissue samples. In conclusion, the mPCR assay was proven to be a powerful alternative to the conventional culture-based method, given its rapid, specific, sensitive and reliable detection of target pathogens. The fish pathogenic bacteria of genus Aeromonas, Vibrio, Edwardsiella and Streptococcus frequently cause severe outbreaks of diseases in cultured fish, and the genus-specific multiplex PCR assay developed in this study can detect the bacteria of the four genera when present in the samples either alone or mixed. The mPCR assay is expected to identify the causative agents more efficiently than uniplex PCR or species-specific multiplex PCR for clinical diagnosis, resulting in the earlier implementation of control measures. This m

  17. [Performance of Cholera-SMART and Pathogen-Detection-Kit in the quick diagnosis of cholera].

    Science.gov (United States)

    Bolaños, Hilda María; Acuña, María Teresa; Serrano, Ana María; Obando, Xinia; Mairena, Hazel; Cháves, Lorena; Sandí, Flor; Rodríguez, Gina; Tamplin, Mark L; Pérez, Enrique; Campos, Elena

    2004-10-01

    To compare the performance of two rapid systems for the diagnosis of cholera with the culture method, and to propose a strategy for improving the specificity and sensitivity of these systems and reducing the costs involved in making a diagnosis. The following institutions participated in the study: the National Bacteriology Referral Center (Centro Nacional de Referencia en Bacteriologia, CNRB) of the Costa Rican Institute for Research and Teaching in Nutrition and Health (Instituto Costarricense de Investigacion y Ensenanza en Nutricion y Salud, INCIENSA) and various hospitals in the provinces of Alajuela, Guanacaste and San Jose, in Costa Rica. A total of 237 feces samples were used to asses the performance of two tests for the rapid detection of Vibrio cholerae 01: the Pathogen Detection Kit (PDK, Intelligent Monitoring Systems, Gainesville, Florida, USA) and Cholera-SMART (New Horizons Diagnostics Corp., Columbia, Maryland, USA), both when applied directly (direct SMART and direct PDK) and when applied to specimens cultured in broth-enriched medium for 6 hours (SMART-6 and CPK-6) and for 18 hours (SMART-18 and PDK-18) at 37 degrees C in alkaline peptone water. Liquid and partially formed stools were cultured and examined by means of the rapid direct test; when the initial result was negative, the tests were repeated after culture for periods of 6 and 18 hours. Rectal and fecal swabs were obtained from feces cultured in enriched-broth medium for 6 and 18 hours. In addition, we studied the sensitivity of the rapid testing systems by using pure cultures of V. cholerae 01 (strain SOS-833, CNRB, Costa Rica) that were incubated for 18 to 24 hours, and we assessed the usefulness of observing motility under the microscope in order to rationalize the use of rapid methods. The sensitivity of the direct SMART test and of the direct PDK test was 100% when samples obtained from liquid and partially formed stools and from the intestinal contents of dead bodies were used. With

  18. A Broad-Spectrum Infection Diagnostic that Detects Pathogen-Associated Molecular Patterns (PAMPs) in Whole Blood.

    Science.gov (United States)

    Cartwright, Mark; Rottman, Martin; Shapiro, Nathan I; Seiler, Benjamin; Lombardo, Patrick; Gamini, Nazita; Tomolonis, Julie; Watters, Alexander L; Waterhouse, Anna; Leslie, Dan; Bolgen, Dana; Graveline, Amanda; Kang, Joo H; Didar, Tohid; Dimitrakakis, Nikolaos; Cartwright, David; Super, Michael; Ingber, Donald E

    2016-07-01

    Blood cultures, and molecular diagnostic tests that directly detect pathogen DNA in blood, fail to detect bloodstream infections in most infected patients. Thus, there is a need for a rapid test that can diagnose the presence of infection to triage patients, guide therapy, and decrease the incidence of sepsis. An Enzyme-Linked Lectin-Sorbent Assay (ELLecSA) that uses magnetic microbeads coated with an engineered version of the human opsonin, Mannose Binding Lectin, containing the Fc immunoglobulin domain linked to its carbohydrate recognition domain (FcMBL) was developed to quantify pathogen-associated molecular patterns (PAMPs) in whole blood. This assay was tested in rats and pigs to explore whether it can detect infections and monitor disease progression, and in prospectively enrolled, emergency room patients with suspected sepsis. These results were also compared with data obtained from non-infected patients with or without traumatic injuries. The FcMBL ELLecSA was able to detect PAMPS present on, or released by, 85% of clinical isolates representing 47 of 55 different pathogen species, including the most common causes of sepsis. The PAMP assay rapidly (animals, even when blood cultures were negative and bacteriocidal antibiotics were administered. In patients with suspected sepsis, the FcMBL ELLecSA detected infection in 55 of 67 patients with high sensitivity (>81%), specificity (>89%), and diagnostic accuracy of 0·87. It also distinguished infection from trauma-related inflammation in the same patient cohorts with a higher specificity than the clinical sepsis biomarker, C-reactive Protein. The FcMBL ELLecSA-based PAMP assay offers a rapid, simple, sensitive and specific method for diagnosing infections, even when blood cultures are negative and antibiotic therapy has been initiated. It may help to triage patients with suspected systemic infections, and serve as a companion diagnostic to guide administration of emerging dialysis-like sepsis therapies

  19. Development and application of an eDNA method to detect and quantify a pathogenic parasite in aquatic ecosystems.

    Science.gov (United States)

    Huver, J R; Koprivnikar, J; Johnson, P T J; Whyard, S

    2015-06-01

    Approaches based on organismal DNA found in the environment (eDNA) have become increasingly utilized for ecological studies and biodiversity inventories as an alternative to traditional field survey methods. Such DNA-based techniques have largely been used to establish the presence of free-living organisms, but have much potential for detecting and quantifying infectious agents in the environment, which is necessary to evaluate disease risk. We developed an eDNA method to examine the distribution and abundance of the trematode Ribeiroia ondatrae, a pathogenic parasite known to cause malformations in North American amphibians. In addition to comparing this eDNA approach to classical host necropsy, we examined the detectability of R. ondatrae in water samples subject to different degradation conditions (time and temperature). Our test exhibited high specificity and sensitivity to R. ondatrae, capable of detecting as little as 14 fg (femtograms) of this parasite's DNA (1/2500th of a single infectious stage) from field water samples. Compared to our results from amphibian host necropsy, quantitative PCR was -90% concordant with respect to R. ondatrae detection from 15 field sites and was also a significant predictor of host infection abundance. DNA was still detectable in lab samples after 21 days at 25°C, indicating that our method is robust to field conditions. By comparing the advantages and disadvantages of eDNA vs. traditional survey methods for determining pathogen presence and abundance in the field, we found that the lower cost and effort associated with eDNA approaches provide many advantages. The development of alternative tools is critical for disease ecology, as wildlife management and conservation efforts require reliable establishment and monitoring of pathogens.

  20. Autonomous search

    CERN Document Server

    Hamadi, Youssef; Saubion, Frédéric

    2012-01-01

    Autonomous combinatorial search (AS) represents a new field in combinatorial problem solving. Its major standpoint and originality is that it considers that problem solvers must be capable of self-improvement operations. This is the first book dedicated to AS.

  1. Impact of early detection and treatment of diabetes on the 6-year prevalence of cardiac autonomic neuropathy in people with screen-detected diabetes

    DEFF Research Database (Denmark)

    Charles, Morten; Fleischer, J; Witte, Daniel Rinse

    2013-01-01

    Baggrund: Der er begrænset viden om hvordan tidlig multifaktoriel behandling forbedrer konsekvenser af diabetes. Kardiel autonom neuropati (KAN) hos personer med diabetes indikerer omfattende skade på det autonome nervesystem og er relateret til mortalitet og livskvalitet. I dette studie fra...... ADDITION Danmark undersøgte vi effekten af tidlig opsporing og efterfølgende intensive behandling af type 2 diabetes i almen praksis på hyppigheden af kardiel autonom neuropati 6 år efter diagnose. Resultater: Prævalensen af tidlig KAN var 15,1% i rutine behandlingsgruppen (RG) og 15.5% i intensive...... kardiovaskulære risikofaktorer er således ikke nok til at forebygge at mange diabetes patienter udvikler KAN....

  2. Fatty Acid Methyl Ester (FAME) analyses for characterization and detection of grapevine pathogens

    Science.gov (United States)

    Grapevines can become infected by a variety of devastating pathogens, including the bacterium Xylella fastidiosa and canker fungi. Multiple strains of Xylella fastidiosa exist, each causing different diseases on various hosts. Although sequence-based genotyping can assist in distinguishing these str...

  3. Detection of Campylobacter jejuni and other potential pathogens in travellers' diarrhoea in Bangladesh

    NARCIS (Netherlands)

    Speelman, P.; Struelens, M. J.; Sanyal, S. C.; Glass, R. I.

    1983-01-01

    To determine the distribution of pathogens associated with travellers' diarrhoea in Bangladesh, we have studied 269 expatriates who presented with diarrhoea to our clinic, over a one-year period. Patients were interviewed about their history of diarrhoea and a stool specimen examined for parasites

  4. Capacity building efforts and perceptions for wildlife surveillance to detect zoonotic pathogens: comparing stakeholder perspectives.

    Science.gov (United States)

    Schwind, Jessica S; Goldstein, Tracey; Thomas, Kate; Mazet, Jonna A K; Smith, Woutrina A

    2014-07-04

    The capacity to conduct zoonotic pathogen surveillance in wildlife is critical for the recognition and identification of emerging health threats. The PREDICT project, a component of United States Agency for International Development's Emerging Pandemic Threats program, has introduced capacity building efforts to increase zoonotic pathogen surveillance in wildlife in global 'hot spot' regions where zoonotic disease emergence is likely to occur. Understanding priorities, challenges, and opportunities from the perspectives of the stakeholders is a key component of any successful capacity building program. A survey was administered to wildlife officials and to PREDICT-implementing in-country project scientists in 16 participating countries in order to identify similarities and differences in perspectives between the groups regarding capacity needs for zoonotic pathogen surveillance in wildlife. Both stakeholder groups identified some human-animal interfaces (i.e. areas of high contact between wildlife and humans with the potential risk for disease transmission), such as hunting and markets, as important for ongoing targeting of wildlife surveillance. Similarly, findings regarding challenges across stakeholder groups showed some agreement in that a lack of sustainable funding across regions was the greatest challenge for conducting wildlife surveillance for zoonotic pathogens (wildlife officials: 96% and project scientists: 81%). However, the opportunity for improving zoonotic pathogen surveillance capacity identified most frequently by wildlife officials as important was increasing communication or coordination among agencies, sectors, or regions (100% of wildlife officials), whereas the most frequent opportunities identified as important by project scientists were increasing human capacity, increasing laboratory capacity, and the growing interest or awareness regarding wildlife disease or surveillance programs (all identified by 69% of project scientists). A One

  5. The development and application of the two real-time RT-PCR assays to detect the pathogen of HFMD.

    Directory of Open Access Journals (Sweden)

    Aili Cui

    Full Text Available Large-scale Hand, Foot, and Mouth Disease (HFMD outbreaks have frequently occurred in China since 2008, affecting more than one million children and causing several hundred children deaths every year. The pathogens of HFMD are mainly human enteroviruses (HEVs. Among them, human enterovirus 71 (HEV71 and coxsackievirus A16 (CVA16 are the most common pathogens of HFMD. However, other HEVs could also cause HFMD. To rapidly detect HEV71 and CVA16, and ensure detection of all HEVs causing HFMD, two real-time hybridization probe-based RT-PCR assays were developed in this study. One is a multiplex real-time RT-PCR assay, which was developed to detect and differentiate HEV71 specifically from CVA16 directly from clinical specimens within 1-2 h, and the other is a broad-spectrum real-time RT-PCR assay, which targeted almost all HEVs. The experiments confirmed that the two assays have high sensitivity and specificity, and the sensitivity was up to 0.1 TCID50/ml for detection of HEVs, HEV71, and CVA16, respectively. A total of 213 clinical specimens were simultaneously detected by three kinds of assays, including the two real-time RT-PCR assays, direct conventional RT-PCR assay, and virus isolation assay on human rhabdomyosarcoma cells (RD cells. The total positive rate of both HEV71 and CVA16 was 69.48% with real-time RT-PCR assay, 47.42% with RT-PCR assay, and 34.58% with virus isolation assay. One HFMD clinical specimen was positive for HEV, but negative for HEV71 or CVA16, which was identified as Echovirus 11 (Echo11 by virus isolation, RT-PCR, and sequencing for the VP1 gene. The two real-time RT-PCR assays had been applied in 31 provincial HFMD labs to detect the pathogens of HFMD, which has contributed to the rapid identification of the pathogens in the early stages of HFMD outbreaks, and helped to clarify the etiologic agents of HFMD in China.

  6. Direct immobilization of antibodies on Zn-doped Fe_3O_4 nanoclusters for detection of pathogenic bacteria

    International Nuclear Information System (INIS)

    Pal, Monalisa; Lee, Sanghee; Kwon, Donghoon; Hwang, Jeongin; Lee, Hyeonjeong; Hwang, Seokyung; Jeon, Sangmin

    2017-01-01

    Zinc-doped magnetic nanoclusters (Zn-MNCs) were synthesized and used to detect pathogenic bacteria in milk. Hydrothermally synthesized Zn-MNCs exhibited stronger magnetic properties than pure MNCs, which facilitated the magnetic separation from the sample using a permanent magnet. The presence of accessible Zn sites allows the direct immobilization of half-fragmented antibodies over Zn-MNCs through strong Zn−S bonds and prevents the tedious multiple steps of molecular functionalization or coating with costly noble metals prior to conjugation with an antibody. After the capture and magnetic separation of Salmonella in milk using the antibody-functionalized Zn-MNCs, the concentration of bacteria was determined with a portable ATP luminometer and the detection limit was found to be 10 CFU/mL. - Highlights: • Zn-doped Fe_3O_4 nanoclusters (Zn-MNCs) were synthesized by hydrothermal method. • Antibodies were directly immobilized over Zn-MNCs through strong Zn–S_t_h_i_o_l bonds. • Higher magnetization of Zn-MNCs than pure MNCs facilitates the magnetic separation. • Detection limit of pathogenic bacteria in milk was found to be 10 cfu/mL. • Cost effective, sensitive and selective detection of bacteria.

  7. Determining the 95% limit of detection for waterborne pathogen analyses from primary concentration to qPCR

    Science.gov (United States)

    Stokdyk, Joel P.; Firnstahl, Aaron; Spencer, Susan K.; Burch, Tucker R; Borchardt, Mark A.

    2016-01-01

    The limit of detection (LOD) for qPCR-based analyses is not consistently defined or determined in studies on waterborne pathogens. Moreover, the LODs reported often reflect the qPCR assay alone rather than the entire sample process. Our objective was to develop an approach to determine the 95% LOD (lowest concentration at which 95% of positive samples are detected) for the entire process of waterborne pathogen detection. We began by spiking the lowest concentration that was consistently positive at the qPCR step (based on its standard curve) into each procedural step working backwards (i.e., extraction, secondary concentration, primary concentration), which established a concentration that was detectable following losses of the pathogen from processing. Using the fraction of positive replicates (n = 10) at this concentration, we selected and analyzed a second, and then third, concentration. If the fraction of positive replicates equaled 1 or 0 for two concentrations, we selected another. We calculated the LOD using probit analysis. To demonstrate our approach we determined the 95% LOD for Salmonella enterica serovar Typhimurium, adenovirus 41, and vaccine-derived poliovirus Sabin 3, which were 11, 12, and 6 genomic copies (gc) per reaction (rxn), respectively (equivalent to 1.3, 1.5, and 4.0 gc L−1 assuming the 1500 L tap-water sample volume prescribed in EPA Method 1615). This approach limited the number of analyses required and was amenable to testing multiple genetic targets simultaneously (i.e., spiking a single sample with multiple microorganisms). An LOD determined this way can facilitate study design, guide the number of required technical replicates, aid method evaluation, and inform data interpretation.

  8. Detection of HPV and co-infecting pathogens in healthy Italian women by multiplex real-time PCR.

    Science.gov (United States)

    Camporiondo, Maria Pia; Farchi, Francesca; Ciccozzi, Massimo; Denaro, Aurelia; Gallone, Domenica; Maracchioni, Fabio; Favalli, Cartesio; Ciotti, Marco

    2016-01-01

    Several pathogens can be transmitted sexually and are an important cause of morbidity among sexually active women. The aim of the study was to detect the presence of human papillomavirus (HPV), Chlamydia trachomatis (CT), Neisseria gonorrhoeae (NG), Trichomonas vaginalis (TV), Mycoplasma hominis (MH), Mycoplasma genitalium (MG), Ureaplasma urealyticum (UU), and Ureaplasma parvum (UP) in a group of 309 healthy women enrolled at the San Camillo - Forlanini hospital of Rome by using two multiplex real-time PCR assays based on TOCE® technology. The women's ages ranged from 34 to 60 years, median 49 [IQR 45-54]. Of the 309 women tested, HPV DNA was detected in 77/309 (24.9%) patients. Of these, 44 (14.2%) harboured a single infection while 33 (10.7%) were infected by multiple genotypes. Prevalence of HPV infection was highest among females aged 40-50 years (15.2%). Of the other pathogens sought, CT, MG and NG were not detected while positive results were found for MH (12/309, 3.9%), TV (4/309, 1.3%), UP (89/309, 28.8%) and UU (14/309, 4.5%). Co-infections were as follows: 5 MH/HPV, 4 TV/HPV, 34 UP/HPV and 9 UU/HPV. In HPV-positive women, the probability of being infected by UP and UU was 2.5 (p=0.00045) and 6 fold higher (p=0.0016) than in HPV-negative women. The study supports the use of multiplex real-time PCR assays in a routine diagnostic setting. The high sensitivity and specificity of these assays along with the simultaneous detection of the most common sexually transmitted pathogens confers an advantage with respect to more obsolete methods reducing costs and time to diagnosis.

  9. Comparison of direct-plating and broth-enrichment culture methods for detection of potential bacterial pathogens in respiratory secretions.

    Science.gov (United States)

    Kaur, Ravinder; Wischmeyer, Jareth; Morris, Matthew; Pichichero, Michael E

    2017-11-01

    We compared the recovery of potential respiratory bacterial pathogens and normal flora from nasopharyngeal specimens collected from children during health and at the onset of acute otitis media (AOM) by selective direct-plating and overnight broth-enrichment. Overall, 3442 nasal wash (NW) samples collected from young children were analysed from a 10-year prospective study. NWs were cultured by (1) direct-plating to TSAII/5 % sheep blood agar and chocolate agar plates and (2) overnight broth-enrichment in BacT/ALERT SA-broth followed by plating. Standard microbiology techniques were applied to identify three dominant respiratory bacterial pathogens: Streptococcus pneumoniae (Spn), Haemophilus influenzae (Hflu) and Moraxella catarrhalis (Mcat) as well as two common nasal flora, Staphylococcus aureus (SA) and alpha-haemolytic Streptococci (AHS).Results/Key findings. Direct-plating of NW resulted in isolation of Spn from 37.8 %, Hflu from 13.6 % and Mcat from 33.2 % of samples. In comparison, overnight broth-enrichment isolated fewer Spn (30.1 %), Hflu (6.2 %) and Mcat (16.2 %) (Penrichment resulted in significant increased isolation of SA (6.0 %) and AHS (30.1 %) (Penrichment when samples were collected from healthy children but not during AOM. In middle ear fluids (MEF) at the onset of AOM, broth-enrichment resulted in higher recovery of Spn (+10.4 %, Penrichment significantly reduces the accurate detection of bacterial respiratory pathogens and increases identification of SA and AHS in NW. Broth-enrichment improves detection of bacterial respiratory pathogens in MEF samples.

  10. Electromigration techniques - rapid methods for the detection and identification of urinary tract pathogens

    Czech Academy of Sciences Publication Activity Database

    Růžička, F.; Holá, V.; Horká, Marie

    2004-01-01

    Roč. 10, Suppl. 3 (2004), s. 621-622 ISSN 1198-743X. [14th ECCMID. European Congress of Clinical Microbiology and Infectious Diseases /14./. Praha, 01.05.2004-04.05.2004] R&D Projects: GA AV ČR IAA4031302 Institutional research plan: CEZ:AV0Z4031919 Keywords : electromigration techniques * identification * pathogens Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 2.361, year: 2004

  11. Simultaneous detection of periodontal pathogens in subgingival plaque and placenta of women with hypertension in pregnancy.

    Science.gov (United States)

    Swati, P; Thomas, Betsy; Vahab, Saadi Abdul; Kapaettu, Satyamoorthy; Kushtagi, Pralhad

    2012-03-01

    There are many studies documenting increased prevalence of periodontal infection in women with preeclampsia. But, very few studies have attempted to establish causal relationship between the two. To find out causal circumstantial evidence by isolating specific periodontal pathogens in oral and placental samples. Antenatal periodontal screening and subgingival plaque collection was carried out in ten women with hypertension in pregnancy and ten normotensive controls on their hospital admission at term for cesarean delivery. Placental biopsy was obtained after aseptic placental collection at the time of elective cesarean delivery. Subgingival plaque and placental biopsy were studied for Porphyromonas gingivalis, Fusobacterium nucleatum, Treponema denticola, Prevotella intermedia and Aggregatibacter actinomycetemcomitans using quantitative polymerase chain reaction technique. Periodontist and laboratory personnel were unaware of case or control status. Periodontal status was not informed to the obstetrician recruiting the cases and laboratory. Microbiology report was not revealed till end of the study. Periodontal pathogens were found to be high in the group with hypertension than the controls. P gingivalis was found in all the samples from subgingival plaque and placenta, irrespective of the periodontal disease status. In cases with hypertension, periodontal pathogens are present in higher proportion in subgingival plaque and placenta.

  12. Rapid multiplex detection of 10 foodborne pathogens with an up-converting phosphor technology-based 10-channel lateral flow assay

    Science.gov (United States)

    Zhao, Yong; Wang, Haoran; Zhang, Pingping; Sun, Chongyun; Wang, Xiaochen; Wang, Xinrui; Yang, Ruifu; Wang, Chengbin; Zhou, Lei

    2016-01-01

    The rapid high-throughput detection of foodborne pathogens is essential in controlling food safety. In this study, a 10-channel up-converting phosphor technology-based lateral flow (TC-UPT-LF) assay was established for the rapid and simultaneous detection of 10 epidemic foodborne pathogens. Ten different single-target UPT-LF strips were developed and integrated into one TC-UPT-LF disc with optimization. Without enrichment the TC-UPT-LF assay had a detection sensitivity of 104 CFU mL−1 or 105 CFU mL−1 for each pathogen, and after sample enrichment it was 10 CFU/0.6 mg. The assay also showed good linearity, allowing quantitative detection, with a linear fitting coefficient of determination (R2) of 0.916–0.998. The 10 detection channels did not cross-react, so multiple targets could be specifically detected. When 279 real food samples were tested, the assay was highly consistent (100%) with culture-based methods. The results for 110 food samples artificially contaminated with single or multiple targets showed a high detection rate (≥80%) for most target bacteria. Overall, the TC-UPT-LF assay allows the rapid, quantitative, and simultaneous detection of 10 kinds of foodborne pathogens within 20 min, and is especially suitable for the rapid detection and surveillance of foodborne pathogens in food and water. PMID:26884128

  13. A fluorescence model of the murine lung for optical detection of pathogenic bacteria

    Science.gov (United States)

    Durkee, Madeleine S.; Cirillo, Jeffrey D.; Maitland, Kristen C.

    2017-07-01

    We present a computer model of intravital excitation and external fluorescence detection in the murine lungs validated with a three-dimensional lung tissue phantom. The model is applied to optical detection of pulmonary tuberculosis infection.

  14. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

    Directory of Open Access Journals (Sweden)

    J.A. Khan

    2013-09-01

    Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

  15. Detection of pathogenic bacteria in skin lesions of patients with chiclero's ulcer: reluctant response to antimonial treatment

    Directory of Open Access Journals (Sweden)

    Isaac-Márquez Angélica Patricia

    2003-01-01

    Full Text Available We investigated the bacterial flora present in skin lesions of patients with chiclero's ulcer from the Yucatan peninsula of Mexico using conventional culture methods (11 patients, and an immunocolorimetric detection of pathogenic Streptococcus pyogenes (15 patients. Prevalence of bacteria isolated by culture methods was 90.9% (10/11. We cultured, from chiclero's ulcers (60%, pathogenic bacterial such as Staphylococcus aureus (20%, S. pyogenes (1.6%, Pseudomonas aeruginosa (1.6%, Morganella morganii (1.6%, and opportunist pathogenic bacteria such as Klebsiella spp. (20.0%, Enterobacter spp. (20%, and Enterococcus spp. (20%. We also cultured coagulase-negative staphylococci in 40% (4/10 of the remaining patients. Micrococcus spp. and coagulase-negative staphylococci constituted the bacterial genuses more frequently isolated in the normal skin of patients with chiclero's ulcer and healthy individuals used as controls. We also undertook another study to find out the presence of S. pyogenes by an immunocolorimetric assay. This study indicated that 60% (9/15 of the ulcerated lesions, but not normal controls, were contaminated with S. pyogenes. Importantly, individuals with purulent secretion and holding concomitant infections with S. pyogenes, S. aureus, P. aeruginosa, M. morganii, and E. durans took longer to heal Leishmania (L. mexicana infections treated with antimonial drugs. Our results suggest the need to eliminate bacterial purulent infections, by antibiotic treatment, before starting antimonial administration to patients with chiclero's ulcer.

  16. Surveillance programs for detection and characterization of emergent pathogens and antimicrobial resistance: results from the Division of Infectious Diseases, UNIFESP.

    Science.gov (United States)

    Colombo, Arnaldo L; Janini, Mario; Salomão, Reinaldo; Medeiros, Eduardo A S; Wey, Sergio B; Pignatari, Antonio C C

    2009-09-01

    Several epidemiological changes have occurred in the pattern of nosocomial and community acquired infectious diseases during the past 25 years. Social and demographic changes possibly related to this phenomenon include a rapid population growth, the increase in urban migration and movement across international borders by tourists and immigrants, alterations in the habitats of animals and arthropods that transmit disease, as well as the raise of patients with impaired host defense abilities. Continuous surveillance programs of emergent pathogens and antimicrobial resistance are warranted for detecting in real time new pathogens, as well as to characterize molecular mechanisms of resistance. In order to become more effective, surveillance programs of emergent pathogens should be organized as a multicenter laboratory network connected to the main public and private infection control centers. Microbiological data should be integrated to guide therapy, adapting therapy to local ecology and resistance patterns. This paper presents an overview of data generated by the Division of Infectious Diseases, Federal University of São Paulo, along with its participation in different surveillance programs of nosocomial and community acquired infectious diseases.

  17. Sampling and Homogenization Strategies Significantly Influence the Detection of Foodborne Pathogens in Meat.

    Science.gov (United States)

    Rohde, Alexander; Hammerl, Jens Andre; Appel, Bernd; Dieckmann, Ralf; Al Dahouk, Sascha

    2015-01-01

    Efficient preparation of food samples, comprising sampling and homogenization, for microbiological testing is an essential, yet largely neglected, component of foodstuff control. Salmonella enterica spiked chicken breasts were used as a surface contamination model whereas salami and meat paste acted as models of inner-matrix contamination. A systematic comparison of different homogenization approaches, namely, stomaching, sonication, and milling by FastPrep-24 or SpeedMill, revealed that for surface contamination a broad range of sample pretreatment steps is applicable and loss of culturability due to the homogenization procedure is marginal. In contrast, for inner-matrix contamination long treatments up to 8 min are required and only FastPrep-24 as a large-volume milling device produced consistently good recovery rates. In addition, sampling of different regions of the spiked sausages showed that pathogens are not necessarily homogenously distributed throughout the entire matrix. Instead, in meat paste the core region contained considerably more pathogens compared to the rim, whereas in the salamis the distribution was more even with an increased concentration within the intermediate region of the sausages. Our results indicate that sampling and homogenization as integral parts of food microbiology and monitoring deserve more attention to further improve food safety.

  18. A PDMS/paper/glass hybrid microfluidic biochip integrated with aptamer-functionalized graphene oxide nano-biosensors for one-step multiplexed pathogen detection.

    Science.gov (United States)

    Zuo, Peng; Li, XiuJun; Dominguez, Delfina C; Ye, Bang-Ce

    2013-10-07

    Infectious pathogens often cause serious public health concerns throughout the world. There is an increasing demand for simple, rapid and sensitive approaches for multiplexed pathogen detection. In this paper we have developed a polydimethylsiloxane (PDMS)/paper/glass hybrid microfluidic system integrated with aptamer-functionalized graphene oxide (GO) nano-biosensors for simple, one-step, multiplexed pathogen detection. The paper substrate used in this hybrid microfluidic system facilitated the integration of aptamer biosensors on the microfluidic biochip, and avoided complicated surface treatment and aptamer probe immobilization in a PDMS or glass-only microfluidic system. Lactobacillus acidophilus was used as a bacterium model to develop the microfluidic platform with a detection limit of 11.0 cfu mL(-1). We have also successfully extended this method to the simultaneous detection of two infectious pathogens - Staphylococcus aureus and Salmonella enterica. This method is simple and fast. The one-step 'turn on' pathogen assay in a ready-to-use microfluidic device only takes ~10 min to complete on the biochip. Furthermore, this microfluidic device has great potential in rapid detection of a wide variety of different other bacterial and viral pathogens.

  19. Molecular characterization of canine parvovirus strains in Argentina: Detection of the pathogenic variant CPV2c in vaccinated dogs.

    Science.gov (United States)

    Calderon, Marina Gallo; Mattion, Nora; Bucafusco, Danilo; Fogel, Fernando; Remorini, Patricia; La Torre, Jose

    2009-08-01

    PCR amplification with sequence-specific primers was used to detect canine parvovirus (CPV) DNA in 38 rectal swabs from Argentine domestic dogs with symptoms compatible with parvovirus disease. Twenty-seven out of 38 samples analyzed were CPV positive. The classical CPV2 strain was not detected in any of the samples, but nine samples were identified as CPV2a variant and 18 samples as CPV2b variant. Further sequence analysis revealed a mutation at amino acid 426 of the VP2 gene (Asp426Glu), characteristic of the CPV2c variant, in 14 out of 18 of the samples identified initially by PCR as CPV2b. The appearance of CPV2c variant in Argentina might be dated at least to the year 2003. Three different pathogenic CPV variants circulating currently in the Argentine domestic dog population were identified, with CPV2c being the only variant affecting vaccinated and unvaccinated dogs during the year 2008.

  20. Cationic polyelectrolyte functionalized magnetic particles assisted highly sensitive pathogens detection in combination with polymerase chain reaction and capillary electrophoresis.

    Science.gov (United States)

    Chen, Jia; Lin, Yuexin; Wang, Yu; Jia, Li

    2015-06-01

    Pathogenic bacteria cause significant morbidity and mortality to humans. There is a pressing need to establish a simple and reliable method to detect them. Herein, we show that magnetic particles (MPs) can be functionalized by poly(diallyl dimethylammonium chloride) (PDDA), and the particles (PDDA-MPs) can be utilized as adsorbents for capture of pathogenic bacteria from aqueous solution based on electrostatic interaction. The as-prepared PDDA-MPs were characterized by Fourier-transform infrared spectroscopy, zeta potential, vibrating sample magnetometry, X-ray diffraction spectrometry, scanning electron microscopy, and transmission electron microscopy. The adsorption equilibrium time can be achieved in 3min. According to the Langmuir adsorption isotherm, the maximum adsorption capacities for E. coli O157:H7 (Gram-negative bacteria) and L. monocytogenes (Gram-positive bacteria) were calculated to be 1.8×10(9) and 3.1×10(9)cfumg(-1), respectively. The bacteria in spiked mineral water (1000mL) can be completely captured when applying 50mg of PDDA-MPs and an adsorption time of 5min. In addition, PDDA-MPs-based magnetic separation method in combination with polymerase chain reaction and capillary electrophoresis allows for rapid detection of 10(1)cfumL(-1) bacteria. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Oxidative stress and pathogenic attack in plants, studied by laser based photoacoustic trace gas detection

    NARCIS (Netherlands)

    Santosa, Ignatius Edi

    2002-01-01

    Photoacoustic detection has proven to be a sensitive method, which is suitable for trace gas measurement. In this thesis, we improved the photoacoustic detection system to measure new biologically interesting gases, ethane (C2H6) and nitric oxide (NO). A new design of grating holder is incorporated

  2. First detection of the larval chalkbrood disease pathogen Ascosphaera apis (Ascomycota: Eurotiomycetes: Ascosphaerales) in adult bumble bees.

    Science.gov (United States)

    Maxfield-Taylor, Sarah A; Mujic, Alija B; Rao, Sujaya

    2015-01-01

    Fungi in the genus Ascosphaera (Ascomycota: Eurotiomycetes: Ascosphaerales) cause chalkbrood disease in larvae of bees. Here, we report the first-ever detection of the fungus in adult bumble bees that were raised in captivity for studies on colony development. Wild queens of Bombus griseocollis, B. nevadensis and B. vosnesenskii were collected and maintained for establishment of nests. Queens that died during rearing or that did not lay eggs within one month of capture were dissected, and tissues were examined microscopically for the presence of pathogens. Filamentous fungi that were detected were plated on artificial media containing broad spectrum antibiotics for isolation and identification. Based on morphological characters, the fungus was identified as Ascosphaera apis (Maasen ex Claussen) Olive and Spiltoir, a species that has been reported earlier only from larvae of the European honey bee, Apis mellifera, the Asian honey bee, Apis cerana, and the carpenter bee Xylocopa californica arizonensis. The identity of the fungus was confirmed using molecular markers and phylogenetic analysis. Ascosphaera apis was detected in queens of all three bumble bee species examined. Of 150 queens dissected, 12 (8%) contained vegetative and reproductive stages of the fungus. Both fungal stages were also detected in two workers collected from colonies with Ascosphaera-infected B. nevadensis queens. In this study, wild bees could have been infected prior to capture for rearing, or, the A. apis infection could have originated via contaminated European honey bee pollen fed to the bumble bees in captivity. Thus, the discovery of A. apis in adult bumble bees in the current study has important implications for commercial production of bumble bee colonies and highlights potential risks to native bees via pathogen spillover from infected bees and infected pollen.

  3. First detection of the larval chalkbrood disease pathogen Ascosphaera apis (Ascomycota: Eurotiomycetes: Ascosphaerales in adult bumble bees.

    Directory of Open Access Journals (Sweden)

    Sarah A Maxfield-Taylor

    Full Text Available Fungi in the genus Ascosphaera (Ascomycota: Eurotiomycetes: Ascosphaerales cause chalkbrood disease in larvae of bees. Here, we report the first-ever detection of the fungus in adult bumble bees that were raised in captivity for studies on colony development. Wild queens of Bombus griseocollis, B. nevadensis and B. vosnesenskii were collected and maintained for establishment of nests. Queens that died during rearing or that did not lay eggs within one month of capture were dissected, and tissues were examined microscopically for the presence of pathogens. Filamentous fungi that were detected were plated on artificial media containing broad spectrum antibiotics for isolation and identification. Based on morphological characters, the fungus was identified as Ascosphaera apis (Maasen ex Claussen Olive and Spiltoir, a species that has been reported earlier only from larvae of the European honey bee, Apis mellifera, the Asian honey bee, Apis cerana, and the carpenter bee Xylocopa californica arizonensis. The identity of the fungus was confirmed using molecular markers and phylogenetic analysis. Ascosphaera apis was detected in queens of all three bumble bee species examined. Of 150 queens dissected, 12 (8% contained vegetative and reproductive stages of the fungus. Both fungal stages were also detected in two workers collected from colonies with Ascosphaera-infected B. nevadensis queens. In this study, wild bees could have been infected prior to capture for rearing, or, the A. apis infection could have originated via contaminated European honey bee pollen fed to the bumble bees in captivity. Thus, the discovery of A. apis in adult bumble bees in the current study has important implications for commercial production of bumble bee colonies and highlights potential risks to native bees via pathogen spillover from infected bees and infected pollen.

  4. Simulation of laser detection and ranging (LADAR) and forward-looking infrared (FLIR) data for autonomous tracking of airborne objects

    Science.gov (United States)

    Powell, Gavin; Markham, Keith C.; Marshall, David

    2000-06-01

    This paper presents the results of an investigation leading into an implementation of FLIR and LADAR data simulation for use in a multi sensor data fusion automated target recognition system. At present the main areas of application are in military environments but systems can easily be adapted to other areas such as security applications, robotics and autonomous cars. Recent developments have been away from traditional sensor modeling and toward modeling of features that are external to the system, such as atmosphere and part occlusion, to create a more realistic and rounded system. We have implemented such techniques and introduced a means of inserting these models into a highly detailed scene model to provide a rich data set for later processing. From our study and implementation we are able to embed sensor model components into a commercial graphics and animation package, along with object and terrain models, which can be easily used to create a more realistic sequence of images.

  5. Recovery Based Nanowire Field-Effect Transistor Detection of Pathogenic Avian Influenza DNA

    Science.gov (United States)

    Lin, Chih-Heng; Chu, Chia-Jung; Teng, Kang-Ning; Su, Yi-Jr; Chen, Chii-Dong; Tsai, Li-Chu; Yang, Yuh-Shyong

    2012-02-01

    Fast and accurate diagnosis is critical in infectious disease surveillance and management. We proposed a DNA recovery system that can easily be adapted to DNA chip or DNA biosensor for fast identification and confirmation of target DNA. This method was based on the re-hybridization of DNA target with a recovery DNA to free the DNA probe. Functionalized silicon nanowire field-effect transistor (SiNW FET) was demonstrated to monitor such specific DNA-DNA interaction using high pathogenic strain virus hemagglutinin 1 (H1) DNA of avian influenza (AI) as target. Specific electric changes were observed in real-time for AI virus DNA sensing and device recovery when nanowire surface of SiNW FET was modified with complementary captured DNA probe. The recovery based SiNW FET biosensor can be further developed for fast identification and further confirmation of a variety of influenza virus strains and other infectious diseases.

  6. Molecular detection of vector-borne pathogens in dogs and cats from Qatar.

    Science.gov (United States)

    Alho, Ana Margarida; Lima, Clara; Latrofa, Maria Stefania; Colella, Vito; Ravagnan, Silvia; Capelli, Gioia; Madeira de Carvalho, Luís; Cardoso, Luís; Otranto, Domenico

    2017-06-20

    Vector-borne diseases (VBDs) have been increasingly reported in dogs and cats worldwide. However, no data are currently available regarding canine and feline VBDs in Qatar and limited information is available from other Persian Gulf countries. Blood samples from 98 client-owned animals (i.e. 64 dogs and 34 cats) living in Doha (Qatar) were collected and the presence of genomic DNA of Anaplasma spp., Babesia spp., Dirofilaria spp., Ehrlichia spp., Hepatozoon spp., Mycoplasma spp. and Rickettsia spp. was assessed by polymerase chain reaction (PCR), real time-PCR (rt-PCR) and sequence analysis. Of the 64 dogs, 12 (18.8%) were infected with at least one pathogen (i.e. 7.8% with Mycoplasma spp., 4.7% with Babesia vogeli, 3.1% with Ehrlichia canis, and 1.6% with Anaplasma platys, Babesia gibsoni and Hepatozoon canis, each). One of the 12 dogs was co-infected with B. vogeli and E. canis. Of the 34 cats, seven (20.6%) animals were infected with at least one pathogen (i.e. 5.9% were positive for Mycoplasma spp., and 2.9% for Babesia felis, B. vogeli, E. canis, "Candidatus Mycoplasma haemominutum" and Mycoplasma haemofelis, each). No dogs or cats were positive for Dirofilaria spp. or Rickettsia spp. Although the sample sizes of dogs and cats herein analysed was moderately small, data from this study report the occurrence of A. platys, B. vogeli, B. gibsoni, E. canis, H. canis and Mycoplasma spp. in domestic dogs and of B. felis, B. vogeli, "Candidatus M. haemominutum", E. canis and M. haemofelis in domestic cats from Qatar. Further investigations along with prophylactic measures are strongly recommended in order to reduce the risk of dogs and cats acquiring VBDs in Qatar.

  7. Vascular Streak Dieback of cacao in Southeast Asia and Melanesia: in planta detection of the pathogen and a new taxonomy.

    Science.gov (United States)

    Samuels, Gary J; Ismaiel, Adnan; Rosmana, Ade; Junaid, Muhammad; Guest, David; McMahon, Peter; Keane, Philip; Purwantara, Agus; Lambert, Smilja; Rodriguez-Carres, Marianela; Cubeta, Marc A

    2012-01-01

    Vascular Streak Dieback (VSD) disease of cacao (Theobroma cacao) in Southeast Asia and Melanesia is caused by a basidiomycete (Ceratobasidiales) fungus Oncobasidium theobromae (syn. =Thanatephorus theobromae). The most characteristic symptoms of the disease are green-spotted leaf chlorosis or, commonly since about 2004, necrotic blotches, followed by senescence of leaves beginning on the second or third flush behind the shoot apex, and blackening of infected xylem in the vascular traces at the leaf scars resulting from the abscission of infected leaves. Eventually the shoot apex is killed and infected branches die. In susceptible cacao the fungus may grow through the xylem down into the main stem and kill a mature cacao tree. Infections in the stem of young plants prior to the formation of the first 3-4 lateral branches usually kill the plant. Basidiospores released from corticioid basidiomata developed on leaf scars or along cracks in the main vein of infected leaves infect young leaves. The pathogen commonly infects cacao but there are rare reports from avocado. As both crops are introduced to the region, the pathogen is suspected to occur asymptomatically in native vegetation. The pathogen is readily isolated but cultures cannot be maintained. In this study, DNA was extracted from pure cultures of O. theobromae obtained from infected cacao plants sampled from Indonesia. The internal transcribed spacer region (ITS), consisting of ITS1, 5.8S ribosomal RNA and ITS2, and a portion of nuclear large subunit (LSU) were sequenced. Phylogenetic analysis of ITS sequences placed O. theobromae sister to Ceratobasidium anastomosis groups AG-A, AG-Bo, and AG-K with high posterior probability. Therefore the new combination Ceratobasidium theobromae is proposed. A PCR-based protocol was developed to detect and identify C. theobromae in plant tissue of cacao enabling early detection of the pathogen in plants. A second species of Ceratobasidium, Ceratobasidium ramicola

  8. Ultra-Fast Low Concentration Detection of Candida Pathogens Utilizing High Resolution Micropore Chips

    OpenAIRE

    Mulero, Rafael; Lee, Dong Heun; Kutzler, Michele A.; Jacobson, Jeffrey M.; Kim, Min Jun

    2009-01-01

    Although Candida species are the fourth most common cause of nosocomial blood stream infections in the United States, early diagnostic tools for invasive candidemia are lacking. Due to an increasing rate of candidemia, a new screening system is needed to detect the Candida species in a timely manner. Here we describe a novel method of detection using a solid-state micro-scale pore similar to the operational principles of a Coulter counter. With a steady electrolyte current flowing through the...

  9. Use of amplicon sequencing to improve sensitivity in PCR-based detection of microbial pathogen in environmental samples.

    Science.gov (United States)

    Saingam, Prakit; Li, Bo; Yan, Tao

    2018-06-01

    DNA-based molecular detection of microbial pathogens in complex environments is still plagued by sensitivity, specificity and robustness issues. We propose to address these issues by viewing them as inadvertent consequences of requiring specific and adequate amplification (SAA) of target DNA molecules by current PCR methods. Using the invA gene of Salmonella as the model system, we investigated if next generation sequencing (NGS) can be used to directly detect target sequences in false-negative PCR reaction (PCR-NGS) in order to remove the SAA requirement from PCR. False-negative PCR and qPCR reactions were first created using serial dilutions of laboratory-prepared Salmonella genomic DNA and then analyzed directly by NGS. Target invA sequences were detected in all false-negative PCR and qPCR reactions, which lowered the method detection limits near the theoretical minimum of single gene copy detection. The capability of the PCR-NGS approach in correcting false negativity was further tested and confirmed under more environmentally relevant conditions using Salmonella-spiked stream water and sediment samples. Finally, the PCR-NGS approach was applied to ten urban stream water samples and detected invA sequences in eight samples that would be otherwise deemed Salmonella negative. Analysis of the non-target sequences in the false-negative reactions helped to identify primer dime-like short sequences as the main cause of the false negativity. Together, the results demonstrated that the PCR-NGS approach can significantly improve method sensitivity, correct false-negative detections, and enable sequence-based analysis for failure diagnostics in complex environmental samples. Copyright © 2018 Elsevier B.V. All rights reserved.

  10. Detection and typing of highly pathogenic porcine reproductive and respiratory syndrome virus by multiplex real-time rt-PCR.

    Directory of Open Access Journals (Sweden)

    Kerstin Wernike

    Full Text Available Porcine reproductive and respiratory syndrome (PRRS causes economic losses in the pig industry worldwide, and PRRS viruses (PRRSV are classified into the two distinct genotypes "North American (NA, type 2" and "European (EU, type 1". In 2006, a highly pathogenic NA strain of PRRSV (HP-PRRSV, characterized by high fever as well as high morbidity and mortality, emerged in swine farms in China. Therefore, a real-time reverse transcription polymerase chain reaction (RT-qPCR assay specific for HP-PRRSV was developed and combined with type 1- and type 2-specific RT-qPCR systems. Furthermore, an internal control, based on a heterologous RNA, was successfully introduced. This final multiplex PRRSV RT-qPCR, detecting and typing PRRSV, had an analytical sensitivity of less than 200 copies per µl for the type 1-assay and 20 copies per µl for the type 2- and HP assays and a high diagnostic sensitivity. A panel of reference strains and field isolates was reliably detected and samples from an animal trial with a Chinese HP-PRRS strain were used for test validation. The new multiplex PRRSV RT-qPCR system allows for the first time the highly sensitive detection and rapid differentiation of PRRSV of both genotypes as well as the direct detection of HP-PRRSV.

  11. Multiplex detection of pathogen biomarkers in human blood, serum, and saliva using silicon photonic microring resonators

    Science.gov (United States)

    Estrada, I. A.; Burlingame, R. W.; Wang, A. P.; Chawla, K.; Grove, T.; Wang, J.; Southern, S. O.; Iqbal, M.; Gunn, L. C.; Gleeson, M. A.

    2015-05-01

    Genalyte has developed a multiplex silicon photonic chip diagnostics platform (MaverickTM) for rapid detection of up to 32 biological analytes from a drop of sample in just 10 to 20 minutes. The chips are manufactured with waveguides adjacent to ring resonators, and probed with a continuously variable wavelength laser. A shift in the resonant wavelength as mass binds above the ring resonators is measured and is directly proportional to the amount of bound macromolecules. We present here the ability to multiplex the detection of hemorrhagic fever antigens in whole blood, serum, and saliva in a 16 minute assay. Our proof of concept testing of a multiplex antigencapture chip has the ability to detect Zaire Ebola (ZEBOV) recombinant soluble glycoprotein (rsGP), Marburg virus (MARV) Angola recombinant glycoprotein (rGP) and dengue nonstructural protein I (NS1). In parallel, detection of 2 malaria antigens has proven successful, but has yet to be incorporated into multiplex with the others. Each assay performs with sensitivity ranging from 1.6 ng/ml to 39 ng/ml depending on the antigen detected, and with minimal cross-reactivity.

  12. Molecular detection of airborne Emergomyces africanus, a thermally dimorphic fungal pathogen, in Cape Town, South Africa.

    Directory of Open Access Journals (Sweden)

    Ilan S Schwartz

    2018-01-01

    Full Text Available Emergomyces africanus is a thermally dimorphic fungus that causes a systemic mycosis in immunocompromised persons in South Africa. Infection is presumed to follow inhalation of airborne propagules. We developed a quantitative PCR protocol able to detect as few as 5 Es. africanus propagules per day. Samples were collected in Cape Town, South Africa over 50 weeks by a Burkard spore trap with an alternate orifice. We detected Es. africanus in air samples from 34 days (10% distributed over 11 weeks. These results suggest environmental exposure to airborne Es. africanus propagules occurs more commonly in endemic areas than previously appreciated.

  13. Molecular detection of airborne Emergomyces africanus, a thermally dimorphic fungal pathogen, in Cape Town, South Africa.

    Science.gov (United States)

    Schwartz, Ilan S; McLoud, Josh D; Berman, Dilys; Botha, Alfred; Lerm, Barbra; Colebunders, Robert; Levetin, Estelle; Kenyon, Chris

    2018-01-01

    Emergomyces africanus is a thermally dimorphic fungus that causes a systemic mycosis in immunocompromised persons in South Africa. Infection is presumed to follow inhalation of airborne propagules. We developed a quantitative PCR protocol able to detect as few as 5 Es. africanus propagules per day. Samples were collected in Cape Town, South Africa over 50 weeks by a Burkard spore trap with an alternate orifice. We detected Es. africanus in air samples from 34 days (10%) distributed over 11 weeks. These results suggest environmental exposure to airborne Es. africanus propagules occurs more commonly in endemic areas than previously appreciated.

  14. Cybersecurity for aerospace autonomous systems

    Science.gov (United States)

    Straub, Jeremy

    2015-05-01

    High profile breaches have occurred across numerous information systems. One area where attacks are particularly problematic is autonomous control systems. This paper considers the aerospace information system, focusing on elements that interact with autonomous control systems (e.g., onboard UAVs). It discusses the trust placed in the autonomous systems and supporting systems (e.g., navigational aids) and how this trust can be validated. Approaches to remotely detect the UAV compromise, without relying on the onboard software (on a potentially compromised system) as part of the process are discussed. How different levels of autonomy (task-based, goal-based, mission-based) impact this remote characterization is considered.

  15. Direct metagenomic detection of viral pathogens in nasal and fecal specimens using an unbiased high-throughput sequencing approach.

    Directory of Open Access Journals (Sweden)

    Shota Nakamura

    Full Text Available With the severe acute respiratory syndrome epidemic of 2003 and renewed attention on avian influenza viral pandemics, new surveillance systems are needed for the earlier detection of emerging infectious diseases. We applied a "next-generation" parallel sequencing platform for viral detection in nasopharyngeal and fecal samples collected during seasonal influenza virus (Flu infections and norovirus outbreaks from 2005 to 2007 in Osaka, Japan. Random RT-PCR was performed to amplify RNA extracted from 0.1-0.25 ml of nasopharyngeal aspirates (N = 3 and fecal specimens (N = 5, and more than 10 microg of cDNA was synthesized. Unbiased high-throughput sequencing of these 8 samples yielded 15,298-32,335 (average 24,738 reads in a single 7.5 h run. In nasopharyngeal samples, although whole genome analysis was not available because the majority (>90% of reads were host genome-derived, 20-460 Flu-reads were detected, which was sufficient for subtype identification. In fecal samples, bacteria and host cells were removed by centrifugation, resulting in gain of 484-15,260 reads of norovirus sequence (78-98% of the whole genome was covered, except for one specimen that was under-detectable by RT-PCR. These results suggest that our unbiased high-throughput sequencing approach is useful for directly detecting pathogenic viruses without advance genetic information. Although its cost and technological availability make it unlikely that this system will very soon be the diagnostic standard worldwide, this system could be useful for the earlier discovery of novel emerging viruses and bioterrorism, which are difficult to detect with conventional procedures.

  16. Detection of selected antibiotic resistance genes using multiplex PCR assay in mastitis pathogens in the Czech Republic

    Directory of Open Access Journals (Sweden)

    Vladimir Pyatov

    2017-01-01

    Full Text Available The aim of this research was to develop multiplex polymerase chain reaction assays for the detection of aminoglycoside (strA, strB, sulphonamide (sulI, sulII, tetracycline (tetA, tetB, tetK, tetM, tetO, macrolide and lincosamide (msrA, ermA, ermB, ermC, mefA/E genes of resistance in mastitis pathogens (Escherichia coli, Staphylococcus aureus, Streptococcus uberis, Streptococcus agalactiae and Streptococcus dysgalactiae. Applying the established assays, we investigated the distribution of antibiotic resistance genes in the above mentioned species isolated from milk samples in the Czech Republic. Each assay consisted of seven pairs of primers. Six of them amplified fragments of antibiotic resistance genes and one pair a fragment of a species specific gene. Polymerase chain reaction conditions were optimized to amplify seven gene fragments simultaneously in one reaction. In total, 249 isolates were used, among which 111 were positive for E. coli, 52 for S. aureus and 86 for Streptococcus spp. The majority (60.2% of bacteria carried at least one antibiotic resistance gene and 44.6% were multidrug-resistant. The designed multiplex polymerase chain reaction assays may be applied as diagnostic method to replace or complement standard techniques of antibiotic susceptibility testing in the mentioned pathogens.

  17. Pathogenicity and molecular detection of Uruguayan isolates of Greeneria uvicola and Cadophora luteo-olivacea associated with grapevine trunk diseases

    Directory of Open Access Journals (Sweden)

    Fernando NAVARRETE

    2011-12-01

    Full Text Available Normal 0 21 MicrosoftInternetExplorer4 Species from different fungal genera have been indicated as responsible for the development of trunk diseases of grapevines. Greeneria uvicola is responsible for the bitter rot of Vitis vinifera grape bunchesnear harvest, and can also attack other Vitis species. In Uruguay, G. uvicola was isolated from dead arm affected grapevines and as an endophyte from healthy canes. Cadophora luteo-olivacea is a phialophora-likeascomycete with a wide distribution that was isolated from asymptomatic wood tissues in Vitis and Petridisease-affected nursery plants in Uruguay. Pathogenicity of isolates of both species was evaluated on Vitis vinifera cv. Tannat and Cabernet Sauvignon, and rootstocks SO4 and 3309C. Specific primers were developed for the ITS rDNA region for both species. Number of plants showing discoloration, length of discoloration, number of re-isolations and amplifications confirmed the pathogenicity of G. uvicola isolates. Pathogenicityof the isolate of C. luteo-olivacea obtained from symptomatic tissues is discussed. Specific primers can be usedto detect the presence of these fungi in asymptomatic tissues.

  18. Epitope specificity determines pathogenicity and detectability in ANCA-associated vasculitis

    Science.gov (United States)

    ABSTRACT BACKGROUND Anti-neutrophil cytoplasmic autoantibodies (ANCA) specific for myeloperoxidase (MPO) or proteinase 3 (PR3) are detectable in >90% of patients with ANCA-associated vasculitis (AAV). ANCA titers do not correlate well with disease activity. In vivo and in vi...

  19. International Standardisation of a Method for Detection of Human Pathogenic Viruses in Molluscan Shellfish

    DEFF Research Database (Denmark)

    Lees, David; Schultz, Anna Charlotte

    2010-01-01

    The viruses primarily associated with shellfish-borne illness are norovirus, causing gastroenteritis and hepatitis A virus (HAV). Recent years have seen a proliferation of publications on methods for detection of these viruses in shellfish using polymerase chain reaction (PCR). However, currently...

  20. DNA-based detection of the fungal pathogen Geomyces destructans in soils from bat hibernacula

    Science.gov (United States)

    Daniel L. Lindner; Andrea Gargas; Jeffrey M. Lorch; Mark T. Banik; Jessie A. Glaeser; Thomas H. Kunz; David S. Blehert

    2011-01-01

    White-nose syndrome (WNS) is an emerging disease causing unprecedented morbidity and mortality among bats in eastern North America. The disease is characterized by cutaneous infection of hibernating bats by the psychrophilic fungus Geomyces destructans. Detection of G. destructans in environments occupied by bats will be critical...

  1. Development of electrochemical biosensor for detection of pathogenic microorganism in Asian dust events.

    Science.gov (United States)

    Yoo, Min-Sang; Shin, Minguk; Kim, Younghun; Jang, Min; Choi, Yoon-E; Park, Si Jae; Choi, Jonghoon; Lee, Jinyoung; Park, Chulhwan

    2017-05-01

    We developed a single-walled carbon nanotubes (SWCNTs)-based electrochemical biosensor for the detection of Bacillus subtilis, one of the microorganisms observed in Asian dust events, which causes respiratory diseases such as asthma and pneumonia. SWCNTs plays the role of a transducer in biological antigen/antibody reaction for the electrical signal while 1-pyrenebutanoic acid succinimidyl ester (1-PBSE) and ant-B. subtilis were performed as a chemical linker and an acceptor, respectively, for the adhesion of target microorganism in the developed biosensor. The detection range (10 2 -10 10  CFU/mL) and the detection limit (10 2  CFU/mL) of the developed biosensor were identified while the response time was 10 min. The amount of target B. subtilis was the highest in the specificity test of the developed biosensor, compared with the other tested microorganisms (Staphylococcus aureus, Flavobacterium psychrolimnae, and Aquabacterium commune). In addition, target B. subtilis detected by the developed biosensor was observed by scanning electron microscope (SEM) analysis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Autonomous Intersection Management

    Science.gov (United States)

    2009-12-01

    detects that the driver is not slowing sufficiently fast. Jaguar, Honda, and BMW offer similar systems. Nissan and Toyota have recently begun offering...that the driver is not braking hard enough. Both Toyota and BMW are currently selling vehicles that can parallel park completely autonomously, even...other vehicles. The system was tested both in simulation and with a robotic vehicle. This work is sponsored by Toyota , who have also currently have an

  3. Molecular methods for pathogen and microbial community detection and characterization: current and potential application in diagnostic microbiology.

    Science.gov (United States)

    Sibley, Christopher D; Peirano, Gisele; Church, Deirdre L

    2012-04-01

    Clinical microbiology laboratories worldwide have historically relied on phenotypic methods (i.e., culture and biochemical tests) for detection, identification and characterization of virulence traits (e.g., antibiotic resistance genes, toxins) of human pathogens. However, limitations to implementation of molecular methods for human infectious diseases testing are being rapidly overcome allowing for the clinical evaluation and implementation of diverse technologies with expanding diagnostic capabilities. The advantages and limitation of molecular techniques including real-time polymerase chain reaction, partial or whole genome sequencing, molecular typing, microarrays, broad-range PCR and multiplexing will be discussed. Finally, terminal restriction fragment length polymorphism (T-RFLP) and deep sequencing are introduced as technologies at the clinical interface with the potential to dramatically enhance our ability to diagnose infectious diseases and better define the epidemiology and microbial ecology of a wide range of complex infections. Copyright © 2012 Elsevier B.V. All rights reserved.

  4. Detection and prevalence of pathogenic Yersinia enterocolitica in refrigerated and frozen dairy products by duplex PCR and dot hybridization targeting the virF and ail genes.

    Science.gov (United States)

    Ye, Y W; Ling, N; Han, Y J; Wu, Q P

    2014-11-01

    Pathogenic Yersinia enterocolitica is involved in yersiniosis through expression of chromosome-borne or plasmid-borne virulence factors. Yersinia enterocolitica is a cold-tolerant pathogen frequently isolated from refrigerated or frozen foods. However, little attention has been focused on the prevalence of pathogenic Y. enterocolitica in refrigerated or frozen dairy samples in China. In this study, we developed a new duplex PCR targeting the plasmid-borne virF gene and chromosome-borne ail gene for detection of pathogenic Y. enterocolitica isolates. We established a detection limit for the duplex PCR of 6.5 × 10(2)cfu/mL in artificially contaminated dairy samples. In addition, the duplex PCR could detect directly 4.5 to 5.7 cfu of Y. enterocolitica in 5 mL of brain heart infusion broth after 6 h of enrichment at 28 °C. A newly developed dot hybridization assay further confirmed specificity of the duplex PCR for detection of virulent Y. enterocolitica. Furthermore, 13 Y. enterocolitica and 5 pathogenic strains, from 88 commercial frozen or refrigerated dairy products, were detected successfully by the China National Standard method (GB/T4789.8-2008) and the duplex PCR, respectively. Finally, biotypes and serotypes of pathogenic Y. enterocolitica strains were further characterized. The duplex PCR developed here is reliable for large-scale screening, routine monitoring, and risk assessment of pathogenic Y. enterocolitica in refrigerated or frozen dairy products. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  5. Ultra-fast low concentration detection of Candida pathogens utilizing high resolution micropore chips.

    Science.gov (United States)

    Mulero, Rafael; Lee, Dong Heun; Kutzler, Michele A; Jacobson, Jeffrey M; Kim, Min Jun

    2009-01-01

    Although Candida species are the fourth most common cause of nosocomial blood stream infections in the United States, early diagnostic tools for invasive candidemia are lacking. Due to an increasing rate of candidemia, a new screening system is needed to detect the Candida species in a timely manner. Here we describe a novel method of detection using a solid-state micro-scale pore similar to the operational principles of a Coulter counter. With a steady electrolyte current flowing through the pore, measurements are taken of changes in the current corresponding to the shape of individual yeasts as they translocate or travel through the pore. The direct ultra-fast low concentration electrical addressing of C. albicans has established criteria for distinguishing individual yeast based on their structural properties, which may reduce the currently used methods' complexity for both identification and quantification capabilities in mixed blood samples.

  6. Ultra-Fast Low Concentration Detection of Candida Pathogens Utilizing High Resolution Micropore Chips

    Directory of Open Access Journals (Sweden)

    2009-03-01

    Full Text Available Although Candida species are the fourth most common cause of nosocomial blood stream infections in the United States, early diagnostic tools for invasive candidemia are lacking. Due to an increasing rate of candidemia, a new screening system is needed to detect the Candida species in a timely manner. Here we describe a novel method of detection using a solid-state micro-scale pore similar to the operational principles of a Coulter counter. With a steady electrolyte current flowing through the pore, measurements are taken of changes in the current corresponding to the shape of individual yeasts as they translocate or travel through the pore. The direct ultra-fast low concentration electrical addressing of C. albicans has established criteria for distinguishing individual yeast based on their structural properties, which may reduce the currently used methods’ complexity for both identification and quantification capabilities in mixed blood samples

  7. Rapid detection and identification of pathogenic mycobacteria by combining radiometric and nucleic acid probe methods

    International Nuclear Information System (INIS)

    Ellner, P.D.; Kiehn, T.E.; Cammarata, R.; Hosmer, M.

    1988-01-01

    The combination of radiometric methodology (BACTEC 12B) and probe technology for recovery and identification of mycobacteria was studied in two large hospital laboratories. The sediment from vials with positive growth indices was tested with DNA probes specific for Mycobacterium tuberculosis, Mycobacterium avium, and Mycobacterium intracellulare. The sensitivity of the radiometric method and the specificity of the probes resulted in a marked reduction in the time to the final report. Biochemical testing could be eliminated on isolates giving a positive reaction with one of the probes. Some 176 isolates of M. tuberculosis, 110 of M. avium, and 5 of M. intracellulare were recovered. Two-thirds of these isolates were detected and identified within 2 weeks of inoculation and the remainder was detected by 4 weeks, a reduction of 5 to 7 weeks to the final report

  8. Quantitative detection and biological propagation of scrapie seeding activity in vitro facilitate use of prions as model pathogens for disinfection.

    Directory of Open Access Journals (Sweden)

    Sandra Pritzkow

    Full Text Available Prions are pathogens with an unusually high tolerance to inactivation and constitute a complex challenge to the re-processing of surgical instruments. On the other hand, however, they provide an informative paradigm which has been exploited successfully for the development of novel broad-range disinfectants simultaneously active also against bacteria, viruses and fungi. Here we report on the development of a methodological platform that further facilitates the use of scrapie prions as model pathogens for disinfection. We used specifically adapted serial protein misfolding cyclic amplification (PMCA for the quantitative detection, on steel wires providing model carriers for decontamination, of 263K scrapie seeding activity converting normal protease-sensitive into abnormal protease-resistant prion protein. Reference steel wires carrying defined amounts of scrapie infectivity were used for assay calibration, while scrapie-contaminated test steel wires were subjected to fifteen different procedures for disinfection that yielded scrapie titre reductions of ≤10(1- to ≥10(5.5-fold. As confirmed by titration in hamsters the residual scrapie infectivity on test wires could be reliably deduced for all examined disinfection procedures, from our quantitative seeding activity assay. Furthermore, we found that scrapie seeding activity present in 263K hamster brain homogenate or multiplied by PMCA of scrapie-contaminated steel wires both triggered accumulation of protease-resistant prion protein and was further propagated in a novel cell assay for 263K scrapie prions, i.e., cerebral glial cell cultures from hamsters. The findings from our PMCA- and glial cell culture assays revealed scrapie seeding activity as a biochemically and biologically replicative principle in vitro, with the former being quantitatively linked to prion infectivity detected on steel wires in vivo. When combined, our in vitro assays provide an alternative to titrations of biological

  9. Rapid colorimetric sensing platform for the detection of Listeria monocytogenes foodborne pathogen.

    Science.gov (United States)

    Alhogail, Sahar; Suaifan, Ghadeer A R Y; Zourob, Mohammed

    2016-12-15

    Listeria monocytogenes is a serious cause of human foodborne infections worldwide, which needs spending billions of dollars for inspection of bacterial contamination in food every year. Therefore, there is an urgent need for rapid, in-field and cost effective detection techniques. In this study, rapid, low-cost and simple colorimetric assay was developed using magnetic nanoparticles for the detection of listeria bacteria. The protease from the listeria bacteria was detected using D-amino acid substrate. D-amino acid substrate was linked to the carboxylic acid on the magnetic nanoparticles using EDC/NHS chemistry. The cysteine residue at the C-terminal of the substrate was used for the self-assembled monolayer formation on the gold sensor surface, which in turn the black magnetic nanobeads will mask the golden color. The color will change from black to golden color upon the cleavage of the specific peptide sequence by the Listeria protease. The sensor was tested with serial dilutions of Listeria bacteria. It was found that the appearance of the gold surface area is proportional to the bacterial concentrations in CFU/ml. The lowest detection limit of the developed sensor for Listeria was found to be 2.17×10(2) colony forming unit/ml (CFU/ml). The specificity of the biosensor was tested against four different foodborne associated bacteria (Escherichia coli, Salmonella, Shigella flexnerii and Staphylococcus aureus). Finally, the sensor was tested with artificially spiked whole milk and ground meat spiked with listeria. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. DNA-based detection of the fungal pathogen Geomyces destructans in soil from bat hibernacula

    Science.gov (United States)

    Lindner, Daniel L.; Gargas, Andrea; Lorch, Jeffrey M.; Banik, Mark T.; Glaeser, Jessie; Kunz, Thomas H.; Blehert, David S.

    2011-01-01

    White-nose syndrome (WNS) is an emerging disease causing unprecedented morbidity and mortality among bats in eastern North America. The disease is characterized by cutaneous infection of hibernating bats by the psychrophilic fungus Geomyces destructans. Detection of G. destructans in environments occupied by bats will be critical for WNS surveillance, management and characterization of the fungal lifecycle. We initiated an rRNA gene region-based molecular survey to characterize the distribution of G. destructans in soil samples collected from bat hibernacula in the eastern United States with an existing PCR test. Although this test did not specifically detect G. destructans in soil samples based on a presence/absence metric, it did favor amplification of DNA from putative Geomyces species. Cloning and sequencing of PCR products amplified from 24 soil samples revealed 74 unique sequence variants representing 12 clades. Clones with exact sequence matches to G. destructans were identified in three of 19 soil samples from hibernacula in states where WNS is known to occur. Geomyces destructans was not identified in an additional five samples collected outside the region where WNS has been documented. This study highlights the diversity of putative Geomyces spp. in soil from bat hibernacula and indicates that further research is needed to better define the taxonomy of this genus and to develop enhanced diagnostic tests for rapid and specific detection of G. destructans in environmental samples.

  11. Genetically Engineered Virulent Phage Banks in the Detection and Control of Emergent Pathogenic Bacteria

    Science.gov (United States)

    Blois, Hélène; Iris, François

    2010-01-01

    Natural outbreaks of multidrug-resistant microorganisms can cause widespread devastation, and several can be used or engineered as agents of bioterrorism. From a biosecurity standpoint, the capacity to detect and then efficiently control, within hours, the spread and the potential pathological effects of an emergent outbreak, for which there may be no effective antibiotics or vaccines, become key challenges that must be met. We turned to phage engineering as a potentially highly flexible and effective means to both detect and eradicate threats originating from emergent (uncharacterized) bacterial strains. To this end, we developed technologies allowing us to (1) concurrently modify multiple regions within the coding sequence of a gene while conserving intact the remainder of the gene, (2) reversibly interrupt the lytic cycle of an obligate virulent phage (T4) within its host, (3) carry out efficient insertion, by homologous recombination, of any number of engineered genes into the deactivated genomes of a T4 wild-type phage population, and (4) reactivate the lytic cycle, leading to the production of engineered infective virulent recombinant progeny. This allows the production of very large, genetically engineered lytic phage banks containing, in an E. coli host, a very wide spectrum of variants for any chosen phage-associated function, including phage host-range. Screening of such a bank should allow the rapid isolation of recombinant T4 particles capable of detecting (ie, diagnosing), infecting, and destroying hosts belonging to gram-negative bacterial species far removed from the original E. coli host. PMID:20569057

  12. Comparison of the EntericBio multiplex PCR system with routine culture for detection of bacterial enteric pathogens.

    LENUS (Irish Health Repository)

    O'Leary, James

    2009-11-01

    The EntericBio system uses a multiplex PCR assay for the simultaneous detection of Campylobacter spp., Salmonella enterica, Shigella spp., and Escherichia coli O157 from feces. It combines overnight broth enrichment with PCR amplification and detection by hybridization. An evaluation of this system was conducted by comparing the results obtained with the system with those obtained by routine culture, supplemented with alternative PCR detection methods. In a study of 773 samples, routine culture and the EntericBio system yielded 94.6 and 92.4% negative results, respectively. Forty-two samples had positive results by culture, and all of these were positive with the EntericBio system. This system detected an additional 17 positive samples (Campylobacter spp., n = 12; Shigella spp., n = 1; E. coli O157, n = 4), but the results for 5 samples (Campylobacter spp., n = 2; Shigella spp., n = 1; E. coli O157, n = 2) could not be confirmed. The target for Shigella spp. detected by the EntericBio system is the ipaH gene, and the molecular indication of the presence of Shigella spp. was investigated by sequence analysis, which confirmed that the ipaH gene was present in a Klebsiella pneumoniae isolate from the patient. The sensitivity, specificity, positive predictive value, and negative predictive value were 100%, 99.3%, 91.5%, and 100%, respectively. Turnaround times were significantly reduced with the EntericBio system, and a result was available between 24 and 32 h after receipt of the sample in the laboratory. In addition, the amount of laboratory waste was significantly reduced by use of this system. In summary, the EntericBio system proved convenient to use, more sensitive than the conventional culture used in this study, and highly specific; and it generated results significantly faster than routine culture for the pathogens tested.

  13. Studies on learning by detecting impasse and by resulting it for building large scale knowledge base for autonomous plant

    International Nuclear Information System (INIS)

    Sawaragi, Tetsuo

    1997-03-01

    The acquisition of knowledge from human experts in an exhaustive way is extremely difficult, and even if it were possible, the maintenance of such a large knowledge base for realtime operation is not an easy task. The autonomous system having just incomplete knowledge would face with so many problems that contradicts with the system's current beliefs and/or are novel or unknown to the system. Experienced humans can manage to do with such novelty due to their generalizing ability and analogical inference based on the repertoire of precedents, even if they with new problems. Moreover, through experiencing such breakdowns and impasse, they can acquire some novel knowledge by their proactive attempts to interpret a provided problem as well as by updating their beliefs and contents and organization of their prior knowledge. We call such a style of learning as impasse-driven learning, meaning that learning dose occur being motivated by facing with contradiction and impasse. The related studies concerning with such a style of leaning have been studied within a field of machine learning of artificial intelligence so far as well as within a cognitive science field. In this paper, we at first summarize an outline of machine learning methodologies, and then, we detail about the impasse-driven learning. We discuss that from two different perspective of learning, one is from deductive and analogical learning and the other one is from inductive conceptual learning (i.e., concept formation or generalization-based memory). The former mainly discuss about how the learning system updates its prior beliefs and knowledge so that it can explain away the current contradiction using some meta-cognition heuristics. The latter attempts to assimilate a contradicting problem into its prior memory structure by dynamically reorganizing a collection of the precedents. We present those methodologies, and finally we introduce a case study of concept formation for plant anomalies and its usage for

  14. Meta-analysis diagnostic accuracy of SNP-based pathogenicity detection tools: a case of UTG1A1 gene mutations.

    Science.gov (United States)

    Galehdari, Hamid; Saki, Najmaldin; Mohammadi-Asl, Javad; Rahim, Fakher

    2013-01-01

    Crigler-Najjar syndrome (CNS) type I and type II are usually inherited as autosomal recessive conditions that result from mutations in the UGT1A1 gene. The main objective of the present review is to summarize results of all available evidence on the accuracy of SNP-based pathogenicity detection tools compared to published clinical result for the prediction of in nsSNPs that leads to disease using prediction performance method. A comprehensive search was performed to find all mutations related to CNS. Database searches included dbSNP, SNPdbe, HGMD, Swissvar, ensemble, and OMIM. All the mutation related to CNS was extracted. The pathogenicity prediction was done using SNP-based pathogenicity detection tools include SIFT, PHD-SNP, PolyPhen2, fathmm, Provean, and Mutpred. Overall, 59 different SNPs related to missense mutations in the UGT1A1 gene, were reviewed. Comparing the diagnostic OR, PolyPhen2 and Mutpred have the highest detection 4.983 (95% CI: 1.24 - 20.02) in both, following by SIFT (diagnostic OR: 3.25, 95% CI: 1.07 - 9.83). The highest MCC of SNP-based pathogenicity detection tools, was belong to SIFT (34.19%) followed by Provean, PolyPhen2, and Mutpred (29.99%, 29.89%, and 29.89%, respectively). Hence the highest SNP-based pathogenicity detection tools ACC, was fit to SIFT (62.71%) followed by PolyPhen2, and Mutpred (61.02%, in both). Our results suggest that some of the well-established SNP-based pathogenicity detection tools can appropriately reflect the role of a disease-associated SNP in both local and global structures.

  15. Detection of Food Spoilage and Pathogenic Bacteria Based on Ligation Detection Reaction Coupled to Flow-Through Hybridization on Membranes

    Directory of Open Access Journals (Sweden)

    K. Böhme

    2014-01-01

    Full Text Available Traditional culturing methods are still commonly applied for bacterial identification in the food control sector, despite being time and labor intensive. Microarray technologies represent an interesting alternative. However, they require higher costs and technical expertise, making them still inappropriate for microbial routine analysis. The present study describes the development of an efficient method for bacterial identification based on flow-through reverse dot-blot (FT-RDB hybridization on membranes, coupled to the high specific ligation detection reaction (LDR. First, the methodology was optimized by testing different types of ligase enzymes, labeling, and membranes. Furthermore, specific oligonucleotide probes were designed based on the 16S rRNA gene, using the bioinformatic tool Oligonucleotide Retrieving for Molecular Applications (ORMA. Four probes were selected and synthesized, being specific for Aeromonas spp., Pseudomonas spp., Shewanella spp., and Morganella morganii, respectively. For the validation of the probes, 16 reference strains from type culture collections were tested by LDR and FT-RDB hybridization using universal arrays spotted onto membranes. In conclusion, the described methodology could be applied for the rapid, accurate, and cost-effective identification of bacterial species, exhibiting special relevance in food safety and quality.

  16. A molecular assay for sensitive detection of pathogen-specific T-cells.

    Directory of Open Access Journals (Sweden)

    Victoria O Kasprowicz

    Full Text Available Here we describe the development and validation of a highly sensitive assay of antigen-specific IFN-γ production using real time quantitative PCR (qPCR for two reporters--monokine-induced by IFN-γ (MIG and the IFN-γ inducible protein-10 (IP10. We developed and validated the assay and applied it to the detection of CMV, HIV and Mycobacterium tuberculosis (MTB specific responses, in a cohort of HIV co-infected patients. We compared the sensitivity of this assay to that of the ex vivo RD1 (ESAT-6 and CFP-10-specific IFN-γ Elispot assay. We observed a clear quantitative correlation between the two assays (P<0.001. Our assay proved to be a sensitive assay for the detection of MTB-specific T cells, could be performed on whole blood samples of fingerprick (50 uL volumes, and was not affected by HIV-mediated immunosuppression. This assay platform is potentially of utility in diagnosis of infection in this and other clinical settings.

  17. Multiplex real-time PCR (TaqMan) assay for the simultaneous detection and discrimination of potato powdery and common scab diseases and pathogens.

    Science.gov (United States)

    Qu, X S; Wanner, L A; Christ, B J

    2011-03-01

    To develop a multiplex real-time PCR assay using TaqMan probes for the simultaneous detection and discrimination of potato powdery scab and common scab, two potato tuber diseases with similar symptoms, and the causal pathogens Spongospora subterranea and plant pathogenic Streptomyces spp. Real-time PCR primers and a probe for S. subterranea were designed based on the DNA sequence of the ribosomal RNA ITS2 region. Primers and a probe for pathogenic Streptomyces were designed based on the DNA sequence of the txtAB genes. The two sets of primer pairs and probes were used in a single real-time PCR assay. The multiplex real-time PCR assay was confirmed to be specific for S. subterranea and pathogenic Streptomyces. The assay detected DNA quantities of 100 fg for each of the two pathogens and linear responses and high correlation coefficients between the amount of DNA and C(t) values for each pathogen were achieved. The presence of two sets of primer pairs and probes and of plant extracts did not alter the sensitivity and efficiency of multiplex PCR amplification. Using the PCR assay, we could discriminate between powdery scab and common scab tubers with similar symptoms. Common scab and powdery scab were detected in some tubers with no visible symptoms. Mixed infections of common scab and powdery scab on single tubers were also revealed. This multiplex real-time PCR assay is a rapid, cost efficient, specific and sensitive tool for the simultaneous detection and discrimination of the two pathogens on infected potato tubers when visual symptoms are inconclusive or not present. Accurate and quick identification and discrimination of the cause of scab diseases on potatoes will provide critical information to potato growers and researchers for disease management. This is important because management strategies for common and powdery scab diseases are very different. © 2011 The Authors. Journal of Applied Microbiology © 2011 The Society for Applied Microbiology.

  18. Simplifying sampling for African swine fever surveillance: Assessment of antibody and pathogen detection from blood swabs.

    Science.gov (United States)

    Carlson, J; Zani, L; Schwaiger, T; Nurmoja, I; Viltrop, A; Vilem, A; Beer, M; Blome, S

    2018-02-01

    African swine fever (ASF) is a notifiable disease with serious socio-economic consequences that has been present in wild boar in the Baltic States and Poland since 2014. An introduction of ASF is usually accompanied by increased mortality, making fallen wild boar and hunted animals with signs of disease the main target for early warning and passive surveillance. It is difficult, however, to encourage hunters and foresters to report and take samples from these cases. A pragmatic and easy sampling approach with quick-drying swabs could facilitate this. In this study, we further evaluated the use of dry blood swabs for the detection of ASFV antibody and genome with samples from animal trials and diagnostic submissions (blood, bone and organs) from Estonia. Compared to serum samples, dried blood swabs yielded 93.1% (95% confidence interval: [83.3, 98.1]) sensitivity and 100% [95.9, 100.0] specificity in a commercial ASFV antibody ELISA. Similarly, the swabs gave a sensitivity of 98.9% [93.4, 100.0] and a specificity of 98.1% [90.1, 100.0] for genome detection by a standard ASFV p72 qPCR when compared to EDTA blood. The same swabs were tested in a VP72-antibody lateral flow device, with a sensitivity of 94.7% [85.4, 98.9] and specificity of 96.1% [89.0, 99.2] compared to the serum ELISA. When GenoTube samples tested in ELISA and LFD were compared, the sensitivity was 96.3% [87.3, 99.5] and the specificity was 93.8% [86.0, 97.9]. This study demonstrates reliable detection of ASFV antibody and genome from swabs. A field test of the swabs with decomposed wild boar carcasses in an endemic area in Estonia also gave promising results. Thus, this technique is a practical approach for surveillance of ASF in both free and endemic areas. © 2017 Blackwell Verlag GmbH.

  19. Multiple strategies to improve sensitivity, speed and robustness of isothermal nucleic acid amplification for rapid pathogen detection

    Directory of Open Access Journals (Sweden)

    Lemieux Bertrand

    2011-05-01

    Full Text Available Abstract Background In the past decades the rapid growth of molecular diagnostics (based on either traditional PCR or isothermal amplification technologies meet the demand for fast and accurate testing. Although isothermal amplification technologies have the advantages of low cost requirements for instruments, the further improvement on sensitivity, speed and robustness is a prerequisite for the applications in rapid pathogen detection, especially at point-of-care diagnostics. Here, we describe and explore several strategies to improve one of the isothermal technologies, helicase-dependent amplification (HDA. Results Multiple strategies were approached to improve the overall performance of the isothermal amplification: the restriction endonuclease-mediated DNA helicase homing, macromolecular crowding agents, and the optimization of reaction enzyme mix. The effect of combing all strategies was compared with that of the individual strategy. With all of above methods, we are able to detect 50 copies of Neisseria gonorrhoeae DNA in just 20 minutes of amplification using a nearly instrument-free detection platform (BESt™ cassette. Conclusions The strategies addressed in this proof-of-concept study are independent of expensive equipments, and are not limited to particular primers, targets or detection format. However, they make a large difference in assay performance. Some of them can be adjusted and applied to other formats of nucleic acid amplification. Furthermore, the strategies to improve the in vitro assays by maximally simulating the nature conditions may be useful in the general field of developing molecular assays. A new fast molecular assay for Neisseria gonorrhoeae has also been developed which has great potential to be used at point-of-care diagnostics.

  20. Detection and identification of globally distributed mycobacterial fish pathogens in some ornamental fish in India.

    Science.gov (United States)

    Shukla, Shubhra; Sharma, Rolee; Shukla, Sanjeev Kumar

    2013-09-01

    Mycobacteriosis is a progressive disease of a wide range of wild and captive, marine and freshwater fish species. Conventional detection of fish Mycobacteria is based on histopathology, culture, and biochemical characteristics. The present study analyzed the occurrence of Mycobacteria in clinically ill ornamental fish of different species, from different places of India. In first group, 60 fish were examined for presence of granulomatous inflammation and acid-fast bacteria. Thirty-eight (63.34 %) fish were positive for granulomatous inflammations. Presences of acid-fast bacteria were detected in 27 (45 %) fish having granulomatous inflammation and in two (3.33 %) fish without granulomatous inflammation. In total, AFB were found in 29 (48.34 %) of the 60 fish examined. In second group, 20 fish having granulomatous inflammation, 12 (60 %) samples were positive using Ziehl-Neelsen (Z-N) staining and 11 (55 %) of them were culture positive. Eight (40 %) samples were Z-N negative but two (10 %) of them were culture positive. In total, 13 (65 %) of the 20 examined fish were culture positive. On the basis of biochemical tests and 16S rRNA sequencing, 13 isolates were identified: five as Mycobacterium fortuitum, five as Mycobacterium gordonae, and three as Mycobacterium chelonae. In comparison of two decontamination methods, 2 % HCl treatment was better than 4 % NaOH treatment. Mycobacteria recovery from decontaminated samples was significantly high on Lowenstein-Jensen medium compared to Middlebrook 7H11 agar and Stonebrink (SB) media. The disease is transmissible from fish to fish and also from fish to human, so the significance of Mycobacteria in ornamental fish should not be overlooked.

  1. Experiment on Synchronous Timing Signal Detection from ISDB-T Terrestrial Digital TV Signal with Application to Autonomous Distributed ITS-IVC Network

    Science.gov (United States)

    Karasawa, Yoshio; Kumagai, Taichi; Takemoto, Atsushi; Fujii, Takeo; Ito, Kenji; Suzuki, Noriyoshi

    A novel timing synchronizing scheme is proposed for use in inter-vehicle communication (IVC) with an autonomous distributed intelligent transport system (ITS). The scheme determines the timing of packet signal transmission in the IVC network and employs the guard interval (GI) timing in the orthogonal frequency divisional multiplexing (OFDM) signal currently used for terrestrial broadcasts in the Japanese digital television system (ISDB-T). This signal is used because it is expected that the automotive market will demand the capability for cars to receive terrestrial digital TV broadcasts in the near future. The use of broadcasts by automobiles presupposes that the on-board receivers are capable of accurately detecting the GI timing data in an extremely low carrier-to-noise ratio (CNR) condition regardless of a severe multipath environment which will introduce broad scatter in signal arrival times. Therefore, we analyzed actual broadcast signals received in a moving vehicle in a field experiment and showed that the GI timing signal is detected with the desired accuracy even in the case of extremely low-CNR environments. Some considerations were also given about how to use these findings.

  2. Airborne Detection of H5N8 Highly Pathogenic Avian Influenza Virus Genome in Poultry Farms, France.

    Science.gov (United States)

    Scoizec, Axelle; Niqueux, Eric; Thomas, Rodolphe; Daniel, Patrick; Schmitz, Audrey; Le Bouquin, Sophie

    2018-01-01

    In southwestern France, during the winter of 2016-2017, the rapid spread of highly pathogenic avian influenza H5N8 outbreaks despite the implementation of routine control measures, raised the question about the potential role of airborne transmission in viral spread. As a first step to investigate the plausibility of that transmission, air samples were collected inside, outside and downwind from infected duck and chicken facilities. H5 avian influenza virus RNA was detected in all samples collected inside poultry houses, at external exhaust fans and at 5 m distance from poultry houses. For three of the five flocks studied, in the sample collected at 50-110 m distance, viral genomic RNA was detected. The measured viral air concentrations ranged between 4.3 and 6.4 log 10 RNA copies per m 3 , and their geometric mean decreased from external exhaust fans to the downwind measurement point. These findings are in accordance with the possibility of airborne transmission and question the procedures for outbreak depopulation.

  3. Airborne Detection of H5N8 Highly Pathogenic Avian Influenza Virus Genome in Poultry Farms, France

    Directory of Open Access Journals (Sweden)

    Axelle Scoizec

    2018-02-01

    Full Text Available In southwestern France, during the winter of 2016–2017, the rapid spread of highly pathogenic avian influenza H5N8 outbreaks despite the implementation of routine control measures, raised the question about the potential role of airborne transmission in viral spread. As a first step to investigate the plausibility of that transmission, air samples were collected inside, outside and downwind from infected duck and chicken facilities. H5 avian influenza virus RNA was detected in all samples collected inside poultry houses, at external exhaust fans and at 5 m distance from poultry houses. For three of the five flocks studied, in the sample collected at 50–110 m distance, viral genomic RNA was detected. The measured viral air concentrations ranged between 4.3 and 6.4 log10 RNA copies per m3, and their geometric mean decreased from external exhaust fans to the downwind measurement point. These findings are in accordance with the possibility of airborne transmission and question the procedures for outbreak depopulation.

  4. Early detection surveillance for an emerging plant pathogen: a rule of thumb to predict prevalence at first discovery.

    Science.gov (United States)

    Parnell, S; Gottwald, T R; Cunniffe, N J; Alonso Chavez, V; van den Bosch, F

    2015-09-07

    Emerging plant pathogens are a significant problem for conservation and food security. Surveillance is often instigated in an attempt to detect an invading epidemic before it gets out of control. Yet in practice many epidemics are not discovered until already at a high prevalence, partly due to a lack of quantitative understanding of how surveillance effort and the dynamics of an invading epidemic relate. We test a simple rule of thumb to determine, for a surveillance programme taking a fixed number of samples at regular intervals, the distribution of the prevalence an epidemic will have reached on first discovery (discovery-prevalence) and its expectation E(q*). We show that E(q*) = r/(N/Δ), i.e. simply the rate of epidemic growth divided by the rate of sampling; where r is the epidemic growth rate, N is the sample size and Δ is the time between sampling rounds. We demonstrate the robustness of this rule of thumb using spatio-temporal epidemic models as well as data from real epidemics. Our work supports the view that, for the purposes of early detection surveillance, simple models can provide useful insights in apparently complex systems. The insight can inform decisions on surveillance resource allocation in plant health and has potential applicability to invasive species generally. © 2015 The Author(s).

  5. Evaluation of three 5' exonuclease-based real-time polymerase chain reaction assays for detection of pathogenic Leptospira species in canine urine.

    Science.gov (United States)

    Fink, Jamie M; Moore, George E; Landau, Ruth; Vemulapalli, Ramesh

    2015-03-01

    Leptospirosis is caused by several pathogenic Leptospira species, and is an important infectious disease of dogs. Early detection of infection is crucial for an effective antibiotic treatment of the disease. Though different polymerase chain reaction (PCR) assays have been developed for detection of pathogenic Leptospira spp., thorough evaluation of the performance of these assays using dog urine samples has not been carried out. In the current study, the performance of 3 real-time PCR (qPCR) assays was assessed, 1 targeting the 16S ribosomal RNA (rRNA) gene and the other 2 targeting the lipL32 gene, a gene for the LipL32 outer membrane protein. With DNA extracted from laboratory-cultured pathogenic Leptospira spp., all 3 qPCR assays showed 100% specificity and had identical lower limits of detection. Compared to a conventional, gel-based PCR assay, all 3 qPCR assays were 100-fold more sensitive. There was a 100% agreement in the results of the 3 assays when tested on urine samples collected aseptically from 30 dogs suspected for leptospirosis. However, when tested on 30 urine samples that were collected by the free-catch method, the 16S rRNA-based assay falsely detected 13.3% of the samples as positive for pathogenic Leptospira spp. Nucleotide sequence analysis of the amplified DNA fragments showed that the assay resulted in false positives because of unrelated bacteria. All urine samples collected from 100 apparently healthy dogs at a local animal shelter tested negative for pathogenic Leptospira spp. These results highlight the importance of sample-specific validation of PCR-based diagnostic assays and the application of appropriately validated assays for more reliable pathogen detection. © 2015 The Author(s).

  6. Affinity reagent technology development and application to rapid immunochromatographic pathogen detection

    Science.gov (United States)

    Sooter, Letha J.; Stratis-Cullum, Dimitra N.; Zhang, Yanting; Daugherty, Patrick S.; Soh, H. Tom; Pellegrino, Paul; Stagliano, Nancy

    2007-09-01

    Immunochromatography is a rapid, reliable, and cost effective method of detecting biowarfare agents. The format is similar to that of an over-the-counter pregnancy test. A sample is applied to one end of a cassette and then a control line, and possibly a sample line, are visualized at the other end of the cassette. The test is based upon a sandwich assay. For the control, a line of Protein A is immobilized on the membrane. Gold nanoparticle bound IgG flows through the membrane and binds the Protein A, creating a visible line on the membrane. For the sample, one epitope is immobilized on the membrane and another epitope is attached to gold nanoparticles. The sample binds gold bound epitope, travels through the membrane, and binds membrane bound epitope. The two epitopes are not cross-reactive, therefore a sample line is only visible if the sample is present. In order to efficiently screen for binders to a sample target, a novel, Continuous Magnetic Activated Cell Sorter (CMACS) has been developed on a disposable, microfluidic platform. The CMACS chip quickly sorts E. coli peptide libraries for target binders with high affinity. Peptide libraries, are composed of approximately ten million bacteria, each displaying a different peptide on their surface. The target of interest is conjugated to a micrometer sized magnetic particle. After the library and the target are incubated together to allow binding, the mixture is applied to the CMACS chip. In the presence of patterned nickel and an external magnet, separation occurs of the bead-bound bacteria from the bulk material. The bead fraction is added to bacterial growth media where any attached E. coli grow and divide. These cells are cloned, sequenced, and the peptides are assayed for target binding affinity. As a proof-of-principle, assays were developed for human C-reactive protein. More defense relevant targets are currently being pursued.

  7. An ultrasensitive hollow-silica-based biosensor for pathogenic Escherichia coli DNA detection.

    Science.gov (United States)

    Ariffin, Eda Yuhana; Lee, Yook Heng; Futra, Dedi; Tan, Ling Ling; Karim, Nurul Huda Abd; Ibrahim, Nik Nuraznida Nik; Ahmad, Asmat

    2018-03-01

    A novel electrochemical DNA biosensor for ultrasensitive and selective quantitation of Escherichia coli DNA based on aminated hollow silica spheres (HSiSs) has been successfully developed. The HSiSs were synthesized with facile sonication and heating techniques. The HSiSs have an inner and an outer surface for DNA immobilization sites after they have been functionalized with 3-aminopropyltriethoxysilane. From field emission scanning electron microscopy images, the presence of pores was confirmed in the functionalized HSiSs. Furthermore, Brunauer-Emmett-Teller (BET) analysis indicated that the HSiSs have four times more surface area than silica spheres that have no pores. These aminated HSiSs were deposited onto a screen-printed carbon paste electrode containing a layer of gold nanoparticles (AuNPs) to form a AuNP/HSiS hybrid sensor membrane matrix. Aminated DNA probes were grafted onto the AuNP/HSiS-modified screen-printed electrode via imine covalent bonds with use of glutaraldehyde cross-linker. The DNA hybridization reaction was studied by differential pulse voltammetry using an anthraquinone redox intercalator as the electroactive DNA hybridization label. The DNA biosensor demonstrated a linear response over a wide target sequence concentration range of 1.0×10 -12 -1.0×10 -2 μM, with a low detection limit of 8.17×10 -14 μM (R 2 = 0.99). The improved performance of the DNA biosensor appeared to be due to the hollow structure and rough surface morphology of the hollow silica particles, which greatly increased the total binding surface area for high DNA loading capacity. The HSiSs also facilitated molecule diffusion through the silica hollow structure, and substantially improved the overall DNA hybridization assay. Graphical abstract Step-by-step DNA biosensor fabrication based on aminated hollow silica spheres.

  8. A portable and autonomous multichannel fluorescence detector for on-line and in situ explosive detection in aqueous phase.

    Science.gov (United States)

    Xin, Yunhong; Wang, Qi; Liu, Taihong; Wang, Lingling; Li, Jia; Fang, Yu

    2012-11-21

    A multichannel fluorescence detector used to detect nitroaromatic explosives in aqueous phase has been developed, which is composed of a five-channel sample-sensor unit, a measurement and control unit, a microcontroller, and a communication unit. The characteristics of the detector as developed are mainly embedded in the sensor unit, and each sensor consists of a fluorescent sensing film, a light emitting diode (LED), a multi-pixel photon counter (MPPC), and an optical module with special bandpass optical filters. Due to the high sensitivity of the sensing film, the small size and low cost of LED and MPPC, the developed detector not only has a better detecting performance and small size, but also has a very low cost - it is an alternative to the device made with an expensive high power lamp and photomultiplier tube. The wavelengths of the five sensors covered extend from the upper UV through the visible spectrum, 370-640 nm, and thereby it possesses the potential to detect a variety of explosives and other hazardous materials in aqueous phase. An additional function of the detector is its ability to function via a wireless network, by which the data recorded by the detector can be sent to the host computer, and at the same time the instructions can be sent to the detector from the host computer. By means of the powerful computing ability of the host computer, and utilizing the classical principal component analysis (PCA) algorithm, effective classification of the analytes is achieved. Furthermore, the detector has been tested and evaluated using NB, PA, TNT and DNT as the analytes, and toluene, benzene, methanol and ethanol as interferent compounds (concentration various from 10 and 60 μM). It has been shown that the detector can detect the four nitroaromatics with high sensitivity and selectivity.

  9. Behavior-Based Approach for the Detection of Land Mines Utilizing off the Shelf Low Cost Autonomous Robot

    Directory of Open Access Journals (Sweden)

    Abdel Ilah Nour Alshbatat

    2013-03-01

    Full Text Available Several countries all of the world are affected by landmines. The presence of mines represents a major threat to lives and causes economic problems. Currently, detecting and clearing mines demand specific expertise with special equipment. In this context, this paper offers the design and development of an intelligent controller which can control and enable the robot to detect mines by means of sensors and of processing the fused information to guide soldiers when passing landmines.  This is accomplished by broken down the overall system into two subsystems: sensor technologies and robotic device. Sensors devices include infrared distance sensor, metal detector, ultrasonic range finder, accelerometer sensor, while the structure of the robot in our case consists mainly  of a commercial  off-the-shelf  parts which  are  available  at  low  costs. The proposed controller is mainly based on creating fuzzy rules that reflect the behaviors of soldier beings in controlling a robot in a well known landmine. Simulation and experimental results are presented her to prove the efficiency of the proposed approach. The results show that the system is able to detect landmines and guide soldiers while crossing mines area.

  10. Diagnostic accuracy of the ROCHE Septifast PCR system for the rapid detection of blood pathogens in neonatal sepsis-A prospective clinical trial.

    Science.gov (United States)

    Straub, Julia; Paula, Helga; Mayr, Michaela; Kasper, David; Assadian, Ojan; Berger, Angelika; Rittenschober-Böhm, Judith

    2017-01-01

    Diagnosis of neonatal sepsis remains a major challenge in neonatology. Most molecular-based methods are not customized for neonatal requirements. The aim of the present study was to assess the diagnostic accuracy of a modified multiplex PCR protocol for the detection of neonatal sepsis using small blood volumes. 212 episodes of suspected neonatal late onset sepsis were analyzed prospectively using the Roche SeptiFast® MGRADE PCR with a modified DNA extraction protocol and software-handling tool. Results were compared to blood culture, laboratory biomarkers and clinical signs of sepsis. Of 212 episodes, 85 (40.1%) were categorized as "not infected". Among these episodes, 1 was false positive by blood culture (1.2%) and 23 were false positive by PCR (27.1%). Of 51 (24.1%) episodes diagnosed as "culture proven sepsis", the same pathogen was detected by blood culture and PCR in 39 episodes (76.5%). In 8 episodes, more pathogens were detected by PCR compared to blood culture, and in 4 episodes the pathogen detected by blood culture was not found by PCR. One of these episodes was caused by Bacillus cereus, a pathogen not included in the PCR panel. In 76/212 (35.8%) episodes, clinical sepsis was diagnosed. Among these, PCR yielded positive results in 39.5% of episodes (30/76 episodes). For culture-positive sepsis, PCR showed a sensitivity of 90.2% (95%CI 86.2-94.2%) and a specificity of 72.9% (95%CI 67.0-79.0%). The Roche SeptiFast® MGRADE PCR using a modified DNA extraction protocol showed acceptable results for rapid detection of neonatal sepsis in addition to conventional blood culture. The benefit of rapid pathogen detection has to be balanced against the considerable risk of contamination, loss of information on antibiotic sensitivity pattern and increased costs.

  11. Development of Real-Time PCR Methods for the Detection of Bacterial Meningitis Pathogens without DNA Extraction.

    Directory of Open Access Journals (Sweden)

    Jeni Vuong

    Full Text Available Neisseria meningitidis (Nm, Haemophilus influenzae (Hi, and Streptococcus pneumoniae (Sp are the lead causes of bacterial meningitis. Detection of these pathogens from clinical specimens using traditional real-time PCR (rt-PCR requires DNA extraction to remove the PCR inhibitors prior to testing, which is time consuming and labor intensive. In this study, five species-specific (Nm-sodC and -ctrA, Hi-hpd#1 and -hpd#3 and Sp-lytA and six serogroup-specific rt-PCR tests (A, B, C, W, X, Y targeting Nm capsular genes were evaluated in the two direct rt-PCR methods using PerfeCTa and 5x Omni that do not require DNA extraction. The sensitivity and specify of the two direct rt-PCR methods were compared to TaqMan traditional rt-PCR, the current standard rt-PCR method for the detection of meningitis pathogens. The LLD for all 11 rt-PCR tests ranged from 6,227 to 272,229 CFU/ml for TaqMan, 1,824-135,982 for 5x Omni, and 168-6,836 CFU/ml for PerfeCTa. The diagnostic sensitivity using TaqMan ranged from 89.2%-99.6%, except for NmB-csb, which was 69.7%. For 5x Omni, the sensitivity varied from 67.1% to 99.8%, with three tests below 90%. The sensitivity of these tests using PerfeCTa varied from 89.4% to 99.8%. The specificity ranges of the 11 tests were 98.0-99.9%, 97.5-99.9%, and 92.9-99.9% for TaqMan, 5x Omni, and PerfeCTa, respectively. PerfeCTa direct rt-PCR demonstrated similar or better sensitivity compared to 5x Omni direct rt-PCR or TaqMan traditional rt-PCR. Since the direct rt-PCR method does not require DNA extraction, it reduces the time and cost for processing CSF specimens, increases testing throughput, decreases the risk of cross-contamination, and conserves precious CSF. The direct rt-PCR method will be beneficial to laboratories with high testing volume.

  12. Improved real-time PCR assay for detection of the quarantine potato pathogen, Synchytrium endobioticum, in zonal centrifuge extracts from soil and in plants

    NARCIS (Netherlands)

    Gent-Pelzer, van M.P.E.; Krijger, M.C.; Bonants, P.J.M.

    2010-01-01

    Real-time PCR was used for quantitative detection of the potato pathogen, Synchytrium endobioticum, in different substrates: zonal centrifuge extracts, warts and different plant parts of potato. Specific primers and a TaqMan probe, designed from the internal transcribed spacer region of the

  13. Use of DNA sequencing to detect pathogenic, saprotrophic, and stain fungi in sapwood of declining red pine (Pinus resinosa) in the Upper Midwest

    Science.gov (United States)

    M.T. Banik; D.L. Lindner; J. Juzwik; J.A. Glaeser

    2013-01-01

    An inexpensive kit was developed to collect wood samples for molecular detection of pathogenic, saprotrophic and stain fungi in declining Pinus resinosa in the Upper Midwest. The kit contained materials for "clean" collection of sapwood drill shavings, which were then subjected to PCR of the rDNA ITS region with fungal-specific primers,...

  14. Development of a chip-based multiplexed immunoassay using liposomal nanovesicles and its application in the detection of pathogens causing female lower genital tract infections

    Directory of Open Access Journals (Sweden)

    Wen-Hsiang Su

    2013-03-01

    Conclusion: This microarray chip was a rapid, easy, inexpensive and sensitive tool for detecting female lower genital tract Candida infection in a one-time vaginal sampling process, although the data on the four other pathogens were still unavailable. A larger population study is encouraged to test the validity of this multiplexed immunoassay chip.

  15. Approaches for Reverse Line Blot-Based Detection of Microbial Pathogens in Ixodes ricinus Ticks Collected in Austria and Impact of the Chosen Method.

    Science.gov (United States)

    Schötta, Anna-Margarita; Wijnveld, Michiel; Stockinger, Hannes; Stanek, Gerold

    2017-07-01

    Ticks transmit a large number of pathogens capable of causing human disease. In this study, the PCR-reverse line blot (RLB) method was used to screen for pathogens in a total of 554 Ixodes ricinus ticks collected from all provinces of Austria. These pathogens belong to the genera Borrelia , Rickettsiae , Anaplasma / Ehrlichia (including " Candidatus Neoehrlichia"), Babesia , and Coxiella The pathogens with the highest detected prevalence were spirochetes of the Borrelia burgdorferi sensu lato complex, in 142 ticks (25.6%). Borrelia afzelii (80/142) was the most frequently detected species, followed by Borrelia burgdorferi sensu stricto (38/142) and Borrelia valaisiana (36/142). Borrelia garinii/Borrelia bavariensis , Borrelia lusitaniae , and Borrelia spielmanii were found in 28 ticks, 5 ticks, and 1 tick, respectively. Rickettsia spp. were detected in 93 ticks (16.8%): R. helvetica (39/93), R. raoultii (38/93), R. monacensis (2/93), and R. slovaca (1/93). Thirteen Rickettsia samples remain uncharacterized. " Candidatus Neoehrlichia mikurensis," Babesia spp. ( B. venatorum , B. divergens , B. microti ), and Anaplasma phagocytophilum were found in 4.5%, 2.7%, and 0.7%, respectively. Coxiella burnetii was not detected. Multiple microorganisms were detected in 40 ticks (7.2%), and the cooccurrence of Babesia spp. and " Candidatus Neoehrlichia mikurensis" showed a significant positive correlation. We also compared different PCR-RLBs for detection of Borrelia burgdorferi sensu lato and Rickettsia spp. and showed that different detection approaches provide highly diverse results, indicating that analysis of environmental samples remains challenging. IMPORTANCE This study determined the wide spectrum of tick-borne bacterial and protozoal pathogens that can be encountered in Austria. Surveillance of (putative) pathogenic microorganisms occurring in the environment is of medical importance, especially when those agents can be transmitted by ticks and cause disease. The

  16. Graphene-interfaced electrical biosensor for label-free and sensitive detection of foodborne pathogenic E. coli O157:H7.

    Science.gov (United States)

    Pandey, Ashish; Gurbuz, Yasar; Ozguz, Volkan; Niazi, Javed H; Qureshi, Anjum

    2017-05-15

    E. coli O157:H7 is an enterohemorrhagic bacteria responsible for serious foodborne outbreaks that causes diarrhoea, fever and vomiting in humans. Recent foodborne E. coli outbreaks has left a serious concern to public health. Therefore, there is an increasing demand for a simple, rapid and sensitive method for pathogen detection in contaminated foods. In this study, we developed a label-free electrical biosensor interfaced with graphene for sensitive detection of pathogenic bacteria. This biosensor was fabricated by interfacing graphene with interdigitated microelectrodes of capacitors that were biofunctionalized with E. coli O157:H7 specific antibodies for sensitive pathogenic bacteria detection. Here, graphene nanostructures on the sensor surface provided superior chemical properties such as high carrier mobility and biocompatibility with antibodies and bacteria. The sensors transduced the signal based on changes in dielectric properties (capacitance) through (i) polarization of captured cell-surface charges, (ii) cells' internal bioactivity, (iii) cell-wall's electronegativity or dipole moment and their relaxation and (iv) charge carrier mobility of graphene that modulated the electrical properties once the pathogenic E. coli O157:H7 captured on the sensor surface. Sensitive capacitance changes thus observed with graphene based capacitors were specific to E. coli O157:H7 strain with a sensitivity as low as 10-100 cells/ml. The proposed graphene based electrical biosensor provided advantages of speed, sensitivity, specificity and in-situ bacterial detection with no chemical mediators, represents a versatile approach for detection of a wide variety of other pathogens. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Improving vector-borne pathogen surveillance: A laboratory-based study exploring the potential to detect dengue virus and malaria parasites in mosquito saliva.

    Science.gov (United States)

    Melanson, Vanessa R; Jochim, Ryan; Yarnell, Michael; Ferlez, Karen Bingham; Shashikumar, Soumya; Richardson, Jason H

    2017-01-01

    Vector-borne pathogen surveillance programmes typically rely on the collection of large numbers of potential vectors followed by screening protocols focused on detecting pathogens in the arthropods. These processes are laborious, time consuming, expensive, and require screening of large numbers of samples. To streamline the surveillance process, increase sample throughput, and improve cost-effectiveness, a method to detect dengue virus and malaria parasites (Plasmodium falciparum) by leveraging the sugar-feeding behaviour of mosquitoes and their habit of expectorating infectious agents in their saliva during feeding was investigated in this study. Dengue virus 2 (DENV-2) infected female Aedes aegypti mosquitoes and P. falciparum infected female Anopheles stephensi mosquitoes were allowed to feed on honey coated Flinders Technical Associates -FTA® cards dyed with blue food colouring. The feeding resulted in deposition of saliva containing either DENV-2 particles or P. falciparum sporozoites onto the FTA card. Nucleic acid was extracted from each card and the appropriate real-time PCR (qPCR) assay was run to detect the pathogen of interest. As little as one plaque forming unit (PFU) of DENV-2 and as few as 60 P. falciparum parasites deposited on FTA cards from infected mosquitoes were detected via qPCR. Hence, their use to collect mosquito saliva for pathogen detection is a relevant technique for vector surveillance. This study provides laboratory confirmation that FTA cards can be used to capture and stabilize expectorated DENV-2 particles and P. falciparum sporozoites from infectious, sugar-feeding mosquitoes in very low numbers. Thus, the FTA card-based mosquito saliva capture method offers promise to overcome current limitations and revolutionize traditional mosquito-based pathogen surveillance programmes. Field testing and further method development are required to optimize this strategy.

  18. Nucleic Acid Sandwich Hybridization Assay with Quantum Dot-Induced Fluorescence Resonance Energy Transfer for Pathogen Detection

    Science.gov (United States)

    Chou, Cheng-Chung; Huang, Yi-Han

    2012-01-01

    This paper reports a nucleic acid sandwich hybridization assay with a quantum dot (QD)-induced fluorescence resonance energy transfer (FRET) reporter system. Two label-free hemagglutinin H5 sequences (60-mer DNA and 630-nt cDNA fragment) of avian influenza viruses were used as the targets in this work. Two oligonucleotides (16 mers and 18 mers) that specifically recognize two separate but neighboring regions of the H5 sequences were served as the capturing and reporter probes, respectively. The capturing probe was conjugated to QD655 (donor) in a molar ratio of 10:1 (probe-to-QD), and the reporter probe was labeled with Alexa Fluor 660 dye (acceptor) during synthesis. The sandwich hybridization assay was done in a 20 μL transparent, adhesive frame-confined microchamber on a disposable, temperature-adjustable indium tin oxide (ITO) glass slide. The FRET signal in response to the sandwich hybridization was monitored by a homemade optical sensor comprising a single 400 nm UV light-emitting diode (LED), optical fibers, and a miniature 16-bit spectrophotometer. The target with a concentration ranging from 0.5 nM to 1 μM was successfully correlated with both QD emission decrease at 653 nm and dye emission increase at 690 nm. To sum up, this work is beneficial for developing a portable QD-based nucleic acid sensor for on-site pathogen detection. PMID:23211753

  19. Skin lesion-associated pathogens from Octopus vulgaris: first detection of Photobacterium swingsii, Lactococcus garvieae and betanodavirus.

    Science.gov (United States)

    Fichi, G; Cardeti, G; Perrucci, S; Vanni, A; Cersini, A; Lenzi, C; De Wolf, T; Fronte, B; Guarducci, M; Susini, F

    2015-07-23

    The common octopus Octopus vulgaris Cuvier, 1798 is extremely important in fisheries and is a useful protein source in most Mediterranean countries. Here we investigated pathogens associated with skin lesions in 9 naturally deceased specimens that included both cultured and wild common octopus. Within 30 min after death, each octopus was stored at 4°C and microbiologically examined within 24 h. Bacterial colonies, cultured from swabs taken from the lesions, were examined using taxonomical and biochemical analyses. Vibrio alginolyticus and V. parahaemolyticus were only isolated from cultured animals. A conventional PCR targeting the 16S ribosomal RNA (rRNA) gene and sequencing were performed on 2 bacterial isolates that remained unidentified after taxonomical and biochemical analysis. The sequence results indicated that the bacteria had a 99% identity with Lactococcus garvieae and Photobacterium swingsii. L. garvieae was confirmed using a specific PCR based on the 16S-23S rRNA internal transcribed spacer region, while P. swingsii was confirmed by phylogenetic analyses. Although all animals examined were found to be infected by the protozoan species Aggregata octopiana localised in the intestines, it was also present in skin lesions of 2 of the animals. Betanodavirus was detected in both cultured and wild individuals by cell culture, PCR and electron microscopy. These findings are the first report of L. garvieae and betanodavirus from skin lesions of common octopus and the first identification of P. swingsii both in octopus skin lesions and in marine invertebrates in Italy.

  20. Prevalence of pathogenic Yersinia enterocolitica in minced meat, pig tongues and hearts at the retail level in the Czech Republic detected by real time PCR

    Directory of Open Access Journals (Sweden)

    Alena Lorencova

    2016-06-01

    Full Text Available Yersiniosis is the third most frequently reported zoonosis in the European Union and Yersinia enterocolitica is the most common species causing human infections. Pigs are assumed to be the main reservoir of human pathogenic Y. enterocolitica with the presence of bacteria mainly in the tonsils and intestinal content. Undercooked pork and pork products have been suggested as the primary source of human yersiniosis. Nevertheless, data on the prevalence of pathogenic Y. enterocolitica in foodstuffs including pork products are very limited. A molecular based method (real time PCR targeting the ompF gene (detection of Yersinia genus and the ail gene (a chromosomally located virulence marker of Y. enterocolitica was used to determine the prevalence of pathogenic Y. enterocolitica in minced meat and edible pork offal at the retail level in the Czech Republic. A total of 50 pig tongues, 50 pig hearts, and 93 samples of minced meat containing pork were purchased at nine retail outlets in Brno. High detection rates of Yersinia spp. were found in all types of samples (pig tongues, 80.0%; pig hearts, 40.0%; and minced meat, 55.9%. The highest prevalence of pathogenic Y. enterocolitica was found in pig tongues (40.0%, followed by pig hearts (18.0% and minced meat samples (17.2%. Although from the point of view of food safety the merely molecular detection of DNA of the pathogenic bacteria could represent a false positive result, our results indicate the presence of pathogenic Y. enterocolitica in raw pork products at the retail level in the Czech Republic, which may pose a risk of consumer infection. Sufficient heat treatment and prevention of cross-contamination during preparation of food in the kitchen should be recommended.

  1. Harmonizing methods for wildlife abundance estimation and pathogen detection in Europe-a questionnaire survey on three selected host-pathogen combinations

    DEFF Research Database (Denmark)

    Schulz, Jana; Ryser-Degiorgis, Marie-Pierre; Kuiken, Thijs

    2017-01-01

    Background: The need for wildlife health surveillance as part of disease control in wildlife, domestic animals and humans on the global level is widely recognized. However, the objectives, methods and intensity of existing wildlife health surveillance programs vary greatly among European countries......, resulting in a patchwork of data that are difficult to merge and compare. This survey aimed at evaluating the need and potential for data harmonization in wildlife health in Europe. The specific objective was to collect information on methods currently used to estimate host abundance and pathogen prevalence...... estimation, there is an urgent need to develop tools for the routine collection of host abundance data in a harmonized way. Wildlife health experts are encouraged to apply the harmonized APHAEA protocols in epidemiological studies in wildlife and to increase cooperation....

  2. Design and Elementary Evaluation of a Highly-Automated Fluorescence-Based Instrument System for On-Site Detection of Food-Borne Pathogens

    Directory of Open Access Journals (Sweden)

    Zhan Lu

    2017-02-01

    Full Text Available A simple, highly-automated instrument system used for on-site detection of foodborne pathogens based on fluorescence was designed, fabricated, and preliminarily tested in this paper. A corresponding method has been proved effective in our previous studies. This system utilizes a light-emitting diode (LED to excite fluorescent labels and a spectrometer to record the fluorescence signal from samples. A rotation stage for positioning and switching samples was innovatively designed for high-throughput detection, ten at most in one single run. We also developed software based on LabVIEW for data receiving, processing, and the control of the whole system. In the test of using a pure quantum dot (QD solution as a standard sample, detection results from this home-made system were highly-relevant with that from a well-commercialized product and even slightly better reproducibility was found. And in the test of three typical kinds of food-borne pathogens, fluorescence signals recorded by this system are highly proportional to the variation of the sample concentration, with a satisfied limit of detection (LOD (nearly 102–103 CFU·mL−1 in food samples. Additionally, this instrument system is low-cost and easy-to-use, showing a promising potential for on-site rapid detection of food-borne pathogens.

  3. Development of multiplex loop mediated isothermal amplification (m-LAMP) label-based gold nanoparticles lateral flow dipstick biosensor for detection of pathogenic Leptospira

    International Nuclear Information System (INIS)

    Nurul Najian, A.B.; Engku Nur Syafirah, E.A.R.; Ismail, Nabilah; Mohamed, Maizan; Yean, Chan Yean

    2016-01-01

    In recent years extensive numbers of molecular diagnostic methods have been developed to meet the need of point-of-care devices. Efforts have been made towards producing rapid, simple and inexpensive DNA tests, especially in the diagnostics field. We report on the development of a label-based lateral flow dipstick for the rapid and simple detection of multiplex loop-mediated isothermal amplification (m-LAMP) amplicons. A label-based m-LAMP lateral flow dipstick assay was developed for the simultaneous detection of target DNA template and a LAMP internal control. This biosensor operates through a label based system, in which probe-hybridization and the additional incubation step are eliminated. We demonstrated this m-LAMP assay by detecting pathogenic Leptospira, which causes the re-emerging disease Leptospirosis. The lateral flow dipstick was developed to detect of three targets, the LAMP target amplicon, the LAMP internal control amplicon and a chromatography control. Three lines appeared on the dipstick, indicating positive results for all representative pathogenic Leptospira species, whereas two lines appeared, indicating negative results, for other bacterial species. The specificity of this biosensor assay was 100% when it was tested with 13 representative pathogenic Leptospira species, 2 intermediate Leptospira species, 1 non-pathogenic Leptospira species and 28 other bacteria species. This study found that this DNA biosensor was able to detect DNA at concentrations as low as 3.95 × 10 −1 genomic equivalent ml −1 . An integrated m-LAMP and label-based lateral flow dipstick was successfully developed, promising simple and rapid visual detection in clinical diagnostics and serving as a point-of-care device. - Highlights: • We develop multiplex LAMP label-based lateral flow dipstick biosensor for detection of pathogenic Leptospira. • We design primers for multiplex LAMP targeting the conserved LipL32 gene of pathogenic Leptospira and LAMP internal

  4. Development of multiplex loop mediated isothermal amplification (m-LAMP) label-based gold nanoparticles lateral flow dipstick biosensor for detection of pathogenic Leptospira

    Energy Technology Data Exchange (ETDEWEB)

    Nurul Najian, A.B.; Engku Nur Syafirah, E.A.R.; Ismail, Nabilah [Department of Medical Microbiology & Parasitology, School of Medical Sciences, Health Campus, Universiti Sains Malaysia, 16150 Kubang Kerian, Kelantan (Malaysia); Mohamed, Maizan [Faculty of Veterinary Medicine, Universiti Malaysia Kelantan, City Campus, Pengkalan Chepa, Locked Bag 36, 16100 Kota Bharu, Kelantan (Malaysia); Yean, Chan Yean, E-mail: yeancyn@yahoo.com [Department of Medical Microbiology & Parasitology, School of Medical Sciences, Health Campus, Universiti Sains Malaysia, 16150 Kubang Kerian, Kelantan (Malaysia); Institute for Research in Molecular Medicine (INFORMM), Health Campus, Universiti Sains Malaysia, 16150 Kubang Kerian, Kelantan (Malaysia)

    2016-01-15

    In recent years extensive numbers of molecular diagnostic methods have been developed to meet the need of point-of-care devices. Efforts have been made towards producing rapid, simple and inexpensive DNA tests, especially in the diagnostics field. We report on the development of a label-based lateral flow dipstick for the rapid and simple detection of multiplex loop-mediated isothermal amplification (m-LAMP) amplicons. A label-based m-LAMP lateral flow dipstick assay was developed for the simultaneous detection of target DNA template and a LAMP internal control. This biosensor operates through a label based system, in which probe-hybridization and the additional incubation step are eliminated. We demonstrated this m-LAMP assay by detecting pathogenic Leptospira, which causes the re-emerging disease Leptospirosis. The lateral flow dipstick was developed to detect of three targets, the LAMP target amplicon, the LAMP internal control amplicon and a chromatography control. Three lines appeared on the dipstick, indicating positive results for all representative pathogenic Leptospira species, whereas two lines appeared, indicating negative results, for other bacterial species. The specificity of this biosensor assay was 100% when it was tested with 13 representative pathogenic Leptospira species, 2 intermediate Leptospira species, 1 non-pathogenic Leptospira species and 28 other bacteria species. This study found that this DNA biosensor was able to detect DNA at concentrations as low as 3.95 × 10{sup −1} genomic equivalent ml{sup −1}. An integrated m-LAMP and label-based lateral flow dipstick was successfully developed, promising simple and rapid visual detection in clinical diagnostics and serving as a point-of-care device. - Highlights: • We develop multiplex LAMP label-based lateral flow dipstick biosensor for detection of pathogenic Leptospira. • We design primers for multiplex LAMP targeting the conserved LipL32 gene of pathogenic Leptospira and LAMP

  5. Development of multiplex loop mediated isothermal amplification (m-LAMP) label-based gold nanoparticles lateral flow dipstick biosensor for detection of pathogenic Leptospira.

    Science.gov (United States)

    Nurul Najian, A B; Engku Nur Syafirah, E A R; Ismail, Nabilah; Mohamed, Maizan; Yean, Chan Yean

    2016-01-15

    In recent years extensive numbers of molecular diagnostic methods have been developed to meet the need of point-of-care devices. Efforts have been made towards producing rapid, simple and inexpensive DNA tests, especially in the diagnostics field. We report on the development of a label-based lateral flow dipstick for the rapid and simple detection of multiplex loop-mediated isothermal amplification (m-LAMP) amplicons. A label-based m-LAMP lateral flow dipstick assay was developed for the simultaneous detection of target DNA template and a LAMP internal control. This biosensor operates through a label based system, in which probe-hybridization and the additional incubation step are eliminated. We demonstrated this m-LAMP assay by detecting pathogenic Leptospira, which causes the re-emerging disease Leptospirosis. The lateral flow dipstick was developed to detect of three targets, the LAMP target amplicon, the LAMP internal control amplicon and a chromatography control. Three lines appeared on the dipstick, indicating positive results for all representative pathogenic Leptospira species, whereas two lines appeared, indicating negative results, for other bacterial species. The specificity of this biosensor assay was 100% when it was tested with 13 representative pathogenic Leptospira species, 2 intermediate Leptospira species, 1 non-pathogenic Leptospira species and 28 other bacteria species. This study found that this DNA biosensor was able to detect DNA at concentrations as low as 3.95 × 10(-1) genomic equivalent ml(-1). An integrated m-LAMP and label-based lateral flow dipstick was successfully developed, promising simple and rapid visual detection in clinical diagnostics and serving as a point-of-care device. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Test characteristics of milk amyloid A ELISA, somatic cell count, and bacteriological culture for detection of intramammary pathogens that cause subclinical mastitis.

    Science.gov (United States)

    Jaeger, S; Virchow, F; Torgerson, P R; Bischoff, M; Biner, B; Hartnack, S; Rüegg, S R

    2017-09-01

    Bovine mastitis is an important disease in the dairy industry, causing economic losses as a result of withheld milk and treatment costs. Several studies have suggested milk amyloid A (MAA) as a promising biomarker in the diagnosis of mastitis. In the absence of a gold standard for diagnosis of subclinical mastitis, we estimated the diagnostic test accuracy of a commercial MAA-ELISA, somatic cell count (SCC), and bacteriological culture using Bayesian latent class modeling. We divided intramammary infections into 2 classes: those caused by major pathogens (e.g., Escherichia coli, Staphylococcus aureus, streptococci, and lacto-/enterococci) and those caused by all pathogens (major pathogens plus Corynebacterium bovis, coagulase-negative staphylococci, Bacillus spp., Streptomyces spp.). We applied the 3 diagnostic tests to all samples. Of 433 composite milk samples included in this study, 275 (63.5%) contained at least 1 colony of any bacterial species; of those, 56 contained major pathogens and 219 contained minor pathogens. The remaining 158 samples (36.5%) were sterile. We determined 2 different thresholds for the MAA-ELISA using Bayesian latent class modeling: 3.9 µg/mL to detect mastitis caused by major pathogens and 1.6 µg/mL to detect mastitis caused by all pathogens. The optimal SCC threshold for identification of subclinical mastitis was 150,000 cells/mL; this threshold led to higher specificity (Sp) than 100,000 cells/mL. Test accuracy for major-pathogen intramammary infections was as follows: SCC, sensitivity (Se) 92.6% and Sp 72.9%; MAA-ELISA, Se 81.4% and Sp 93.4%; bacteriological culture, Se 23.8% and Sp 95.2%. Test accuracy for all-pathogen intramammary infections was as follows: SCC, sensitivity 90.3% and Sp 71.8%; MAA-ELISA, Se 88.0% and Sp 65.2%; bacteriological culture, Se 83.8% and Sp 54.8%. We suggest the use of SCC and MAA-ELISA as a combined screening procedure for situations such as a Staphylococcus aureus control program. With Bayesian

  7. Microfluidic PCR Amplification and MiSeq Amplicon Sequencing Techniques for High-Throughput Detection and Genotyping of Human Pathogenic RNA Viruses in Human Feces, Sewage, and Oysters

    Directory of Open Access Journals (Sweden)

    Mamoru Oshiki

    2018-04-01

    Full Text Available Detection and genotyping of pathogenic RNA viruses in human and environmental samples are useful for monitoring the circulation and prevalence of these pathogens, whereas a conventional PCR assay followed by Sanger sequencing is time-consuming and laborious. The present study aimed to develop a high-throughput detection-and-genotyping tool for 11 human RNA viruses [Aichi virus; astrovirus; enterovirus; norovirus genogroup I (GI, GII, and GIV; hepatitis A virus; hepatitis E virus; rotavirus; sapovirus; and human parechovirus] using a microfluidic device and next-generation sequencer. Microfluidic nested PCR was carried out on a 48.48 Access Array chip, and the amplicons were recovered and used for MiSeq sequencing (Illumina, Tokyo, Japan; genotyping was conducted by homology searching and phylogenetic analysis of the obtained sequence reads. The detection limit of the 11 tested viruses ranged from 100 to 103 copies/μL in cDNA sample, corresponding to 101–104 copies/mL-sewage, 105–108 copies/g-human feces, and 102–105 copies/g-digestive tissues of oyster. The developed assay was successfully applied for simultaneous detection and genotyping of RNA viruses to samples of human feces, sewage, and artificially contaminated oysters. Microfluidic nested PCR followed by MiSeq sequencing enables efficient tracking of the fate of multiple RNA viruses in various environments, which is essential for a better understanding of the circulation of human pathogenic RNA viruses in the human population.

  8. Nanomaterial-based sensors for detection of foodborne bacterial pathogens and toxins as well as pork adulteration in meat products

    Directory of Open Access Journals (Sweden)

    B. Stephen Inbaraj

    2016-01-01

    Full Text Available Food safety draws considerable attention in the modern pace of the world owing to rapid-changing food recipes and food habits. Foodborne illnesses associated with pathogens, toxins, and other contaminants pose serious threat to human health. Besides, a large amount of money is spent on both analyses and control measures, which causes significant loss to the food industry. Conventional detection methods for bacterial pathogens and toxins are time consuming and laborious, requiring certain sophisticated instruments and trained personnel. In recent years, nanotechnology has emerged as a promising field for solving food safety issues in terms of detecting contaminants, enabling controlled release of preservatives to extend the shelf life of foods, and improving food-packaging strategies. Nanomaterials including metal oxide and metal nanoparticles, carbon nanotubes, and quantum dots are gaining a prominent role in the design of sensors and biosensors for food analysis. In this review, various nanomaterial-based sensors reported in the literature for detection of several foodborne bacterial pathogens and toxins are summarized highlighting their principles, advantages, and limitations in terms of simplicity, sensitivity, and multiplexing capability. In addition, the application through a noncross-linking method without the need for any surface modification is also presented for detection of pork adulteration in meat products.

  9. Gas House Autonomous System Monitoring

    Science.gov (United States)

    Miller, Luke; Edsall, Ashley

    2015-01-01

    Gas House Autonomous System Monitoring (GHASM) will employ Integrated System Health Monitoring (ISHM) of cryogenic fluids in the High Pressure Gas Facility at Stennis Space Center. The preliminary focus of development incorporates the passive monitoring and eventual commanding of the Nitrogen System. ISHM offers generic system awareness, adept at using concepts rather than specific error cases. As an enabler for autonomy, ISHM provides capabilities inclusive of anomaly detection, diagnosis, and abnormality prediction. Advancing ISHM and Autonomous Operation functional capabilities enhances quality of data, optimizes safety, improves cost effectiveness, and has direct benefits to a wide spectrum of aerospace applications.

  10. Multiplex detection of nine food-borne pathogens by mPCR and capillary electrophoresis after using a universal pre-enrichment medium

    Science.gov (United States)

    Villamizar-Rodríguez, Germán; Fernández, Javier; Marín, Laura; Muñiz, Juan; González, Isabel; Lombó, Felipe

    2015-01-01

    Routine microbiological quality analyses in food samples require, in some cases, an initial incubation in pre-enrichment medium. This is necessary in order to ensure that small amounts of pathogenic strains are going to be detected. In this work, a universal pre-enrichment medium has been developed for the simultaneous growth of Bacillus cereus, Campylobacter jejuni, Clostridium perfringens, Cronobacter sakazakii, Escherichia coli, Enterobacteriaceae family (38 species, 27 genera), Listeria monocytogenes, Staphylococcus aureus, Salmonella spp. (two species, 13 strains). Growth confirmation for all these species was achieved in all cases, with excellent enrichments. This was confirmed by plating on the corresponding selective agar media for each bacterium. This GVUM universal pre-enrichment medium could be useful in food microbiological analyses, where different pathogenic bacteria must be detected after a pre-enrichment step. Following, a mPCR reaction for detection of all these pathogens was developed, after designing a set of nine oligonucleotide pairs from specific genetic targets on gDNA from each of these bacteria, covering all available strains already sequenced in GenBank for each pathogen type. The detection limits have been 1 Genome Equivalent (GE), with the exception of the Fam. Enterobacteriaceae (5 GEs). We obtained amplification for all targets (from 70 to 251 bp, depending on the bacteria type), showing the capability of this method to detect the most important industrial and sanitary food-borne pathogens from a universal pre-enrichment medium. This method includes an initial pre-enrichment step (18 h), followed by a mPCR (2 h) and a capillary electrophoresis (30 min); avoiding the tedious and long lasting growing on solid media required in traditional analysis (1–4 days, depending on the specific pathogen and verification procedure). An external testing of this method was conducted in order to compare classical and mPCR methods. This evaluation was

  11. Multiplex detection of nine food-borne pathogens by mPCR and capillary electrophoresis after using a universal pre-enrichment medium.

    Science.gov (United States)

    Villamizar-Rodríguez, Germán; Fernández, Javier; Marín, Laura; Muñiz, Juan; González, Isabel; Lombó, Felipe

    2015-01-01

    Routine microbiological quality analyses in food samples require, in some cases, an initial incubation in pre-enrichment medium. This is necessary in order to ensure that small amounts of pathogenic strains are going to be detected. In this work, a universal pre-enrichment medium has been developed for the simultaneous growth of Bacillus cereus, Campylobacter jejuni, Clostridium perfringens, Cronobacter sakazakii, Escherichia coli, Enterobacteriaceae family (38 species, 27 genera), Listeria monocytogenes, Staphylococcus aureus, Salmonella spp. (two species, 13 strains). Growth confirmation for all these species was achieved in all cases, with excellent enrichments. This was confirmed by plating on the corresponding selective agar media for each bacterium. This GVUM universal pre-enrichment medium could be useful in food microbiological analyses, where different pathogenic bacteria must be detected after a pre-enrichment step. Following, a mPCR reaction for detection of all these pathogens was developed, after designing a set of nine oligonucleotide pairs from specific genetic targets on gDNA from each of these bacteria, covering all available strains already sequenced in GenBank for each pathogen type. The detection limits have been 1 Genome Equivalent (GE), with the exception of the Fam. Enterobacteriaceae (5 GEs). We obtained amplification for all targets (from 70 to 251 bp, depending on the bacteria type), showing the capability of this method to detect the most important industrial and sanitary food-borne pathogens from a universal pre-enrichment medium. This method includes an initial pre-enrichment step (18 h), followed by a mPCR (2 h) and a capillary electrophoresis (30 min); avoiding the tedious and long lasting growing on solid media required in traditional analysis (1-4 days, depending on the specific pathogen and verification procedure). An external testing of this method was conducted in order to compare classical and mPCR methods. This evaluation was

  12. Compact autonomous navigation system (CANS)

    Science.gov (United States)

    Hao, Y. C.; Ying, L.; Xiong, K.; Cheng, H. Y.; Qiao, G. D.

    2017-11-01

    Autonomous navigation of Satellite and constellation has series of benefits, such as to reduce operation cost and ground station workload, to avoid the event of crises of war and natural disaster, to increase spacecraft autonomy, and so on. Autonomous navigation satellite is independent of ground station support. Many systems are developed for autonomous navigation of satellite in the past 20 years. Along them American MANS (Microcosm Autonomous Navigation System) [1] of Microcosm Inc. and ERADS [2] [3] (Earth Reference Attitude Determination System) of Honeywell Inc. are well known. The systems anticipate a series of good features of autonomous navigation and aim low cost, integrated structure, low power consumption and compact layout. The ERADS is an integrated small 3-axis attitude sensor system with low cost and small volume. It has the Earth center measurement accuracy higher than the common IR sensor because the detected ultraviolet radiation zone of the atmosphere has a brightness gradient larger than that of the IR zone. But the ERADS is still a complex system because it has to eliminate many problems such as making of the sapphire sphere lens, birefringence effect of sapphire, high precision image transfer optical fiber flattener, ultraviolet intensifier noise, and so on. The marginal sphere FOV of the sphere lens of the ERADS is used to star imaging that may be bring some disadvantages., i.e. , the image energy and attitude measurements accuracy may be reduced due to the tilt image acceptance end of the fiber flattener in the FOV. Besides Japan, Germany and Russia developed visible earth sensor for GEO [4] [5]. Do we have a way to develop a cheaper/easier and more accurate autonomous navigation system that can be used to all LEO spacecraft, especially, to LEO small and micro satellites? To return this problem we provide a new type of the system—CANS (Compact Autonomous Navigation System) [6].

  13. Medical Devices; Immunology and Microbiology Devices; Classification of the Device To Detect and Identify Microbial Pathogen Nucleic Acids in Cerebrospinal Fluid. Final order.

    Science.gov (United States)

    2017-10-20

    The Food and Drug Administration (FDA or we) is classifying the device to detect and identify microbial pathogen nucleic acids in cerebrospinal fluid into class II (special controls). The special controls that will apply to the device type are identified in this order and will be part of the codified language for the device to detect and identify microbial pathogen nucleic acids in cerebrospinal fluid’s classification. We are taking this action because we have determined that classifying the device into class II (special controls) will provide a reasonable assurance of safety and effectiveness of the device. We believe this action will also enhance patients' access to beneficial innovative devices, in part by reducing regulatory burdens.

  14. New insights in the interpretation of array-CGH: autism spectrum disorder and positive family history for intellectual disability predict the detection of pathogenic variants.

    Science.gov (United States)

    Cappuccio, Gerarda; Vitiello, Francesco; Casertano, Alberto; Fontana, Paolo; Genesio, Rita; Bruzzese, Dario; Ginocchio, Virginia Maria; Mormile, Angela; Nitsch, Lucio; Andria, Generoso; Melis, Daniela

    2016-04-12

    Array-CGH (aCGH) is presently used into routine clinical practice for diagnosis of patients with intellectual disability (ID), multiple congenital anomalies (MCA), and autism spectrum disorder (ASD). ACGH could detect small chromosomal imbalances, copy number variations (CNVs), and closely define their size and gene content. ACGH detects pathogenic imbalances in 14-20 % of patients with ID. The aims of this study were: to establish clinical clues potentially associated with pathogenic CNVs and to identify cytogenetic indicators to predict the pathogenicity of the variants of uncertain significance (VOUS) in a large cohort of paediatric patients. We enrolled 214 patients referred for either: ID, and/or ASD and/or MCA to genetic services at the Federico II University of Naples, Department of Translational Medicine. For each patient we collected clinical and imaging data. All the patients were tested with aCGH or as first-tier test or as part of a wider diagnostic work-up. Pathologic data were detected in 65 individuals (30 %) and 46 CNVs revealed a known syndrome. The pathological CNVs were usually deletions showing the highest gene-dosage content. The positive family history for ID/ASD/MCA and ASD were good indicators for detecting pathological chromosomal rearrangements. Other clinical features as eyes anomalies, hearing loss, neurological signs, cutaneous dyscromia and endocrinological problems seem to be potential predictors of pathological CNVs. Among patients carrying VOUS we analyzed genetic features including CNVs size, presence of deletion or duplication, genic density, multiple CNVs, to clinical features. Higher gene density was found in patients affected by ID. This result suggest that higher gene content has more chances to include pathogenic gene involved and causing ID in these patients. Our study suggest the use of aCGH as first-tier test in patients with neurdevelopmental phenotypes. The inferred results have been used for building a flow-chart to be

  15. Evaluation of a triplex real-time PCR system to detect the plant-pathogenic molds Alternaria spp., Fusarium spp. and C. purpurea.

    Science.gov (United States)

    Grube, Sabrina; Schönling, Jutta; Prange, Alexander

    2015-12-01

    This article describes the development of a triplex real-time PCR system for the simultaneous detection of three major plant-pathogenic mold genera (Alternaria spp., Fusarium spp. and the species Claviceps purpurea). The designed genus-specific primer-probe systems were validated for sensitivity, specificity and amplification in the presence of background DNA. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. A multiplex PCR/LDR assay for simultaneous detection and identification of the NIAID category B bacterial food and water-borne pathogens.

    Science.gov (United States)

    Rundell, Mark S; Pingle, Maneesh; Das, Sanchita; Hussain, Aashiq; Ocheretina, Oksana; Charles, Macarthur; Larone, Davise H; Spitzer, Eric D; Golightly, Linnie; Barany, Francis

    2014-06-01

    Enteric pathogens that cause gastroenteritis remain a major global health concern. The goal of this study was to develop a multiplex PCR/ligation detection reaction (LDR) assay for the detection of all NIAID category B bacterial food and water-borne pathogens directly from stool specimens. To validate the PCR/LDR assay, clinical isolates of Campylobacter spp., Vibrio spp., Shigella spp., Salmonella spp., Listeria monocytogenes, Yersinia enterocolitica, and diarrheagenic Escherichia coli were tested. The sensitivity and specificity of the assay were assessed using a large number of seeded culture-negative stool specimens and a smaller set of clinical specimens from Haiti. The overall sensitivity ranged from 91% to 100% (median 100%) depending on the species. For the majority of organisms, the sensitivity was 100%. The overall specificity based on initial testing ranged from 98% to 100% depending on the species. After additional testing of discordant samples, the lowest specificity was 99.4%. PCR/LDR detected additional category B agents (particularly diarrheagenic E. coli) in 11/40 specimens from Haiti that were culture-positive for V. cholerae and in approximately 1% of routine culture-negative stool specimens from a hospital in New York. This study demonstrated the ability of the PCR/LDR assay to detect a large comprehensive panel of category B enteric bacterial pathogens as well as mixed infections. This type of assay has the potential to provide earlier warnings of possible public health threats and more accurate surveillance of food and water-borne pathogens. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. Development of highly sensitive electrochemical genosensor based on multiwalled carbon nanotubes-chitosan-bismuth and lead sulfide nanoparticles for the detection of pathogenic Aeromonas.

    Science.gov (United States)

    Fernandes, António Maximiano; Abdalhai, Mandour H; Ji, Jian; Xi, Bing-Wen; Xie, Jun; Sun, Jiadi; Noeline, Rasoamandrary; Lee, Byong H; Sun, Xiulan

    2015-01-15

    In this paper, we reported the construction of new high sensitive electrochemical genosensor based on multiwalled carbon nanotubes-chitosan-bismuth complex (MWCNT-Chi-Bi) and lead sulfide nanoparticles for the detection of pathogenic Aeromonas. Lead sulfide nanoparticles capped with 5'-(NH2) oligonucleotides thought amide bond was used as signalizing probe DNA (sz-DNA) and thiol-modified oligonucleotides sequence was used as fixing probe DNA (fDNA). The two probes hybridize with target Aeromonas DNA (tDNA) sequence (fDNA-tDNA-szDNA). The signal of hybridization is detected by differential pulse voltammetry (DPV) after electrodeposition of released lead nanoparticles (PbS) from sz-DNA on the surface of glass carbon electrode decorated with MWCNT-Chi-Bi, which improves the deposition and traducing electrical signal. The optimization of incubation time, hybridization temperature, deposition potential, deposition time and the specificity of the probes were investigated. Our results showed the highest sensibility to detect the target gene when compared with related biosensors and polymerase chain reaction (PCR). The detection limit for this biosensor was 1.0×10(-14) M. We could detect lower than 10(2) CFU mL(-1) of Aeromonas in spiked tap water. This method is rapid and sensitive for the detection of pathogenic bacteria and would become a potential application in biomedical diagnosis, food safety and environmental monitoring. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Molecular detection of vector-borne pathogens in blood and splenic samples from dogs with splenic disease.

    Science.gov (United States)

    Movilla, Rebeca; Altet, Laura; Serrano, Lorena; Tabar, María-Dolores; Roura, Xavier

    2017-03-13

    The spleen is a highly perfused organ involved in the immunological control and elimination of vector-borne pathogens (VBP), which could have a fundamental role in the pathogenesis of splenic disease. This study aimed to evaluate certain VBP in samples from dogs with splenic lesions. Seventy-seven EDTA-blood and 64 splenic tissue samples were collected from 78 dogs with splenic disease in a Mediterranean area. Babesia spp., Bartonella spp., Ehrlichia/Anaplasma spp., Hepatozoon canis, Leishmania infantum, hemotropic Mycoplasma spp. and Rickettsia spp. were targeted using PCR assays. Sixty EDTA-blood samples from dogs without evidence of splenic lesions were included as a control group. More than half (51.56%) of the biopsies (33/64) were consistent with benign lesions and 48.43% (31/64) with malignancy, mostly hemangiosarcoma (25/31). PCR yielded positive results in 13 dogs with spleen alterations (16.67%), for Babesia canis (n = 3), Babesia gibsoni (n = 2), hemotropic Mycoplasma spp. (n = 2), Rickettsia massiliae (n = 1) and "Babesia vulpes" (n = 1), in blood; and for B. canis, B. gibsoni, Ehrlichia canis and L. infantum (n = 1 each), in spleen. Two control dogs (3.3%) were positive for B. gibsoni and H. canis (n = 1 each). Benign lesions were detected in the 61.54% of infected dogs (8/13); the remaining 38.46% were diagnosed with malignancies (5/13). Infection was significantly associated to the presence of splenic disease (P = 0.013). There was no difference in the prevalence of infection between dogs with benign and malignant splenic lesions (P = 0.69); however B. canis was more prevalent in dogs with hemangiosarcoma (P = 0.006). VBP infection could be involved in the pathogenesis of splenic disease. The immunological role of the spleen could predispose to alterations of this organ in infected dogs. Interestingly, all dogs with B. canis infection were diagnosed with hemangiosarcoma in the present survey. As previously

  19. Helicase-dependent isothermal amplification: a novel tool in the development of molecular-based analytical systems for rapid pathogen detection.

    Science.gov (United States)

    Barreda-García, Susana; Miranda-Castro, Rebeca; de-Los-Santos-Álvarez, Noemí; Miranda-Ordieres, Arturo J; Lobo-Castañón, María Jesús

    2018-01-01

    Highly sensitive testing of nucleic acids is essential to improve the detection of pathogens, which pose a major threat for public health worldwide. Currently available molecular assays, mainly based on PCR, have a limited utility in point-of-need control or resource-limited settings. Consequently, there is a strong interest in developing cost-effective, robust, and portable platforms for early detection of these harmful microorganisms. Since its description in 2004, isothermal helicase-dependent amplification (HDA) has been successfully applied in the development of novel molecular-based technologies for rapid, sensitive, and selective detection of viruses and bacteria. In this review, we highlight relevant analytical systems using this simple nucleic acid amplification methodology that takes place at a constant temperature and that is readily compatible with microfluidic technologies. Different strategies for monitoring HDA amplification products are described. In addition, we present technological advances for integrating sample preparation, HDA amplification, and detection. Future perspectives and challenges toward point-of-need use not only for clinical diagnosis but also in food safety testing and environmental monitoring are also discussed. Graphical Abstract Expanding the analytical toolbox for the detection of DNA sequences specific of pathogens with isothermal helicase dependent amplification (HDA).

  20. Multiplex detection of nine food-borne pathogens by mPCR and capillary electrophoresis after using a universal pre-enrichment medium

    Directory of Open Access Journals (Sweden)

    Germán eVillamizar-Rodríguez

    2015-11-01

    Full Text Available Routine microbiological quality analyses in food samples require, in some cases, an initial incubation in pre-enrichment medium. This is necessary in order to assure that small amounts of pathogenic strains are going to be detected. In this work, a universal pre-enrichment medium has been developed for simultaneous growth of Bacillus cereus, Campylobacter jejuni, Clostridium perfringens, Cronobacter sakazakii, Escherichia coli, Enterobacteriaceae family (thirty eight species, twenty seven genera, Listeria monocytogenes, Staphylococcus aureus, Salmonella spp. (two species, thirteen strains. Growth confirmation for all these species was achieved in all cases, with excellent enrichments. This was confirmed by plating on the corresponding selective agar media for each bacterium. This GVUM universal pre-enrichment medium could be useful in food microbiological analyses, where different pathogenic bacteria must be detected after a pre-enrichment step. Following, a mPCR reaction for detection of all these pathogens was developed, after designing a set of nine oligonucleotide pairs from specific genetic targets on gDNA from each of these bacteria, covering all available strains already sequenced in GenBank for them. The detection limits have been 1 Genome Equivalent, with the exception of Fam. Enterobacteriaceae (5 GEs. We obtained amplification for all targets (from 70 to 251 bp, depending on the bacteria type, showing the capability of this method to detect the most important industrial and sanitary food-borne pathogens from a universal pre-enrichment medium. This method includes an initial pre-enrichment step (18 h, followed by a mPCR (2 h and a capillary electrophoresis (30 min; avoiding the tedious and long lasting growing on solid media required in traditional analysis (1 to 4 days, depending on the specific pathogen and verification procedure. An external testing of this method was conducted in order to compare classical and mPCR methods. This

  1. Molecular detection of blood pathogens and their impacts on levels of packed cell volume in stray dogs from Thailand

    Directory of Open Access Journals (Sweden)

    Supawadee Piratae

    2017-04-01

    Full Text Available Objective: To evaluate the prevalence of blood parasite infection in stray dogs by PCR technique and the association between levels of packed cell volume (PCV and blood parasitic infection in stray dogs. Methods: A total of 65 blood samples were collected from stray dogs in animal quarantine station from Mahasarakham, Thailand to evaluate the levels of PCV before molecular screening for tick-borne pathogens infection. Results: Stray dogs were positive with one or more pathogens in 44 (67.69% out of 65 blood samples. Ehrlichia canis [43.1%, 95% confidence interval (CI: 38.1–48.1] was the most common blood pathogen found infecting in stray dogs in Mahasarakham Province, followed by Anaplasma platys (29.2%, 95% CI: 24.2–34.2, Hepatozoon canis (12.3%, 95% CI: 7.3–17.3 and Babesia canis vogeli (6.2%, 95% CI: 1.2–11.2, respectively. Moreover, co-infections with two pathogens were identified in 11 (16.9% of dogs examined and two (2.9% dogs were coinfections with three pathogens. Statistically significant relationship between the PCV levels and Ehrlichia canis infection was found (P < 0.05. Conclusions: This study indicated that blood pathogens are spreading in stray dogs and they are potentially high risk of agent transmission to human via exposure with tick vectors. It was also the first report of Anaplasma platys infection in dogs in north-eastern part of Thailand.

  2. Autonomic Nervous System Disorders

    Science.gov (United States)

    Your autonomic nervous system is the part of your nervous system that controls involuntary actions, such as the beating of your heart ... breathing and swallowing Erectile dysfunction in men Autonomic nervous system disorders can occur alone or as the result ...

  3. Development of Loop-Mediated Isothermal Amplification (LAMP) assay for rapid detection of Fusarium oxysporum f. sp. ciceris - wilt pathogen of chickpea.

    Science.gov (United States)

    Ghosh, Raju; Nagavardhini, Avuthu; Sengupta, Anindita; Sharma, Mamta

    2015-02-11

    Fusarium oxysporum f. sp. ciceris (Foc), the causal agent of Fusarium wilt is a devastating pathogen of chickpea. In chickpea, various soil borne pathogens produce (s) similar symptoms, therefore cannot be distinguished easily at field level. There is real need for a rapid, inexpensive, and easy to operate and maintain genotyping tool to facilitate accurate disease diagnosis and surveillance for better management of Fusarium wilt outbreaks. In this study, we developed a loop-mediated isothermal amplification (LAMP) assay targeting the elongation factor 1 alpha gene sequence for visual detection of Foc. The LAMP reaction was optimal at 63°C for 60 min. When hydroxynaphthol blue (HNB) was added before amplification, samples with Foc DNA developed a characteristic sky blue colour but those without DNA or with the DNA of six other plant pathogenic fungi did not. Results obtained with LAMP and HNB were confirmed when LAMP products were subjected to gel electrophoresis. The detection limit of this LAMP assay for Foc was 10 fg of genomic DNA per reaction, while that of conventional PCR was 100 pg. In conclusion, it was found that a LAMP assay combined with HNB is simple, rapid, sensitive, and specific. The LAMP assay does not require specialized equipment, hence can be used in the field for the rapid detection of Foc. This is the first report of the use of LAMP assay for the detection of Foc. The presented LAMP method provides a specific, sensitive and rapid diagnostic tool for the distinction of Foc, with the potential to be standardized as a detection method for Foc in endemic areas and will be very useful for monitoring the disease complex in the field further suggesting the management strategies.

  4. Real-Time PCR Detection and QUantification of Soilborne Fungal Pathogens : the Case of Rosellinia necatrix, Phytophthora nicotianae, P. citrophthora and Verticillium dahliae

    Directory of Open Access Journals (Sweden)

    L. Schena

    2004-08-01

    Full Text Available Conventional and Scorpion primers were designed from the ITS regions to identify Rosellinia necatrix, Phytophthora nicotianae, and P. citrophthora and from the IGS regions to identify Verticillium dahliae and V. alboatrum. Specificity of primers and probes was assessed using genomic DNA from a large number of fungi from several hosts and by means of BLAST analyses, to exclude the presence of similar sequences in other micro-organisms among available DNA databases (GenBank. Simple and rapid procedures for DNA extraction from naturally infected matrices (soils, roots, bark, and/or woody tissues were utilised to yield DNA of a purity and quality suitable for PCR assays. Combining these protocols with a double amplification (nested Scorpion-PCR, the real-time detection of these pathogens was possible from naturally infested soils and from infected citrus roots (P. nicotianae and P. citrophthora, from the roots and bark of stone fruits and olive (R. necatrix and from olive branches (V. dahliae. For target pathogens, the limit of detection was 1 pg µl-1 in Scorpion-PCR and 1 fg µl-1 in nested Scorpion-PCR. High and significant correlations between pathogen propagule concentrations and real-time PCR cycle thresholds (Ct were obtained. Moreover, specific tests with R. necatrix seem to indicate that its DNA is quite rapidly degraded in the soil, excluding the risk of false positives due to the presence of dead cells.

  5. Monitoring streams and stormwater ponds for early detection of oomycete plant pathogens in western Washington, a citizen science project

    Science.gov (United States)

    Marianne Elliott; Lucy Rollins; Gary Chastagner

    2017-01-01

    Sudden Oak Death (SOD) is the common name for a disease caused by Phytophthora ramorum (oomycetes), an invasive plant pathogen of regulatory concern. The nursery, timber, forest specialty product, and Christmas tree industries in Washington are at risk because of the spread of P. ramorum within nurseries and from nurseries into...

  6. Molecular-based detection of potentially pathogenic bacteria in membrane bioreactor (MBR) systems treating municipal wastewater: a case study.

    Science.gov (United States)

    Harb, Moustapha; Hong, Pei-Ying

    2017-02-01

    Although membrane bioreactor (MBR) systems provide better removal of pathogens compared to conventional activated sludge processes, they do not achieve total log removal. The present study examines two MBR systems treating municipal wastewater, one a full-scale MBR plant and the other a lab-scale anaerobic MBR. Both of these systems were operated using microfiltration (MF) polymeric membranes. High-throughput sequencing and digital PCR quantification were utilized to monitor the log removal values (LRVs) of associated pathogenic species and their abundance in the MBR effluents. Results showed that specific removal rates vary widely regardless of the system employed. Each of the two MBR effluents' microbial communities contained genera associated with opportunistic pathogens (e.g., Pseudomonas, Acinetobacter) with a wide range of log reduction values (5.5). Digital PCR further confirmed that these bacterial groups included pathogenic species, in several instances at LRVs different than those for their respective genera. These results were used to evaluate the potential risks associated both with the reuse of the MBR effluents for irrigation purposes and with land application of the activated sludge from the full-scale MBR system.

  7. Molecular-based detection of potentially pathogenic bacteria in membrane bioreactor (MBR) systems treating municipal wastewater: a case study

    KAUST Repository

    Harb, Moustapha

    2016-12-24

    Although membrane bioreactor (MBR) systems provide better removal of pathogens compared to conventional activated sludge processes, they do not achieve total log removal. The present study examines two MBR systems treating municipal wastewater, one a full-scale MBR plant and the other a lab-scale anaerobic MBR. Both of these systems were operated using microfiltration (MF) polymeric membranes. High-throughput sequencing and digital PCR quantification were utilized to monitor the log removal values (LRVs) of associated pathogenic species and their abundance in the MBR effluents. Results showed that specific removal rates vary widely regardless of the system employed. Each of the two MBR effluents’ microbial communities contained genera associated with opportunistic pathogens (e.g., Pseudomonas, Acinetobacter) with a wide range of log reduction values (< 2 to >5.5). Digital PCR further confirmed that these bacterial groups included pathogenic species, in several instances at LRVs different than those for their respective genera. These results were used to evaluate the potential risks associated both with the reuse of the MBR effluents for irrigation purposes and with land application of the activated sludge from the full-scale MBR system.

  8. A method to detect metal–drug complexes and their interactions with pathogenic bacteria via graphene nanosheet assist laser desorption/ionization mass spectrometry and biosensors

    International Nuclear Information System (INIS)

    Abdelhamid, Hani Nasser; Wu, Hui-Fen

    2012-01-01

    Highlights: ► Probe transition metals-complexes based on noncovalent functionalized graphene for MALDI-MS. ► Study interaction of transition metals complexes with pathogenic bacteria. ► Propose a new biosensor for two pathogenic bacteria. - Abstract: A new method was proposed to probe the interactions between transition metals of Fe(II), Fe(III), Cu(II) with a non steroidal anti-inflammatory drug (NSAID), flufenamic acid (FF) using graphene as a matrix for Graphene assisted laser desorption ionization mass spectrometry (GALDI-MS). Metal–drug complexation was confirmed via UV absorption spectroscopy, fluorescence spectroscopy, pH meter, and change in solution conductivity. The optimal molar ratios for these complexation interactions are stoichiometry 1:2 in both Cu(II) and Fe(II) complexes, and 1:3 in Fe(III) complexes at physiological pH (7.4). Metal complexation of the drug could enhance fluorescence for 20 fold which is due to the charge transfer reaction or increase rigidity of the drug. The main interaction between graphene and flufenamic acid is the Π–Π interaction which allows us to probe the metal–drug complexation. The GALDI-MS could sensitively detect the drug at m/z 281.0 Da (protonated molecule) with detection limit 2.5 pmol (1.0 μM) and complexation at m/z 661.0, 654.0 and 933.0 Da corresponding to [Cu(II)(FF) 2 (H 2 O) 2 + H] + , [Fe(II)(FF) 2 (H 2 O) 2 + H] + and [Fe(III) (FF) 3 (H 2 O) 2 + H] + , respectively (with limit of detection (LOD) 2.0 pmol (10.0 μM). Matrix assisted laser desorption ionization mass spectrometry (MALDI-MS) spectra show change in the protein profile of intact pathogenic bacteria (Pseudomonas aeroginosa, Staphylococcus aureus). The change in the ionization ability (mainly proton affinity) of pathogenic bacteria may be due to the interactions between the bacteria with the drug (or its complexes). Shielding carboxylic group by metals and increase the hydrophilicity could enhance the biocompatibility of complexes

  9. A method to detect metal-drug complexes and their interactions with pathogenic bacteria via graphene nanosheet assist laser desorption/ionization mass spectrometry and biosensors

    Energy Technology Data Exchange (ETDEWEB)

    Abdelhamid, Hani Nasser [Department of Chemistry, National Sun Yat-Sen University, Kaohsiung, 804, Taiwan (China); Wu, Hui-Fen, E-mail: hwu@faculty.nsysu.edu.tw [Department of Chemistry, National Sun Yat-Sen University, Kaohsiung, 804, Taiwan (China); School of Pharmacy, College of Pharmacy, Kaohsiung Medical University, Kaohsiung, 800, Taiwan (China); Center for Nanoscience and Nanotechnology, National Sun Yat-Sen University, Kaohsiung, 804, Taiwan (China); Doctoral Degree Program in Marine Biotechnology, National Sun Yat-Sen University, Kaohsiung, 804, Taiwan (China)

    2012-11-02

    Highlights: Black-Right-Pointing-Pointer Probe transition metals-complexes based on noncovalent functionalized graphene for MALDI-MS. Black-Right-Pointing-Pointer Study interaction of transition metals complexes with pathogenic bacteria. Black-Right-Pointing-Pointer Propose a new biosensor for two pathogenic bacteria. - Abstract: A new method was proposed to probe the interactions between transition metals of Fe(II), Fe(III), Cu(II) with a non steroidal anti-inflammatory drug (NSAID), flufenamic acid (FF) using graphene as a matrix for Graphene assisted laser desorption ionization mass spectrometry (GALDI-MS). Metal-drug complexation was confirmed via UV absorption spectroscopy, fluorescence spectroscopy, pH meter, and change in solution conductivity. The optimal molar ratios for these complexation interactions are stoichiometry 1:2 in both Cu(II) and Fe(II) complexes, and 1:3 in Fe(III) complexes at physiological pH (7.4). Metal complexation of the drug could enhance fluorescence for 20 fold which is due to the charge transfer reaction or increase rigidity of the drug. The main interaction between graphene and flufenamic acid is the {Pi}-{Pi} interaction which allows us to probe the metal-drug complexation. The GALDI-MS could sensitively detect the drug at m/z 281.0 Da (protonated molecule) with detection limit 2.5 pmol (1.0 {mu}M) and complexation at m/z 661.0, 654.0 and 933.0 Da corresponding to [Cu(II)(FF){sub 2}(H{sub 2}O){sub 2} + H]{sup +}, [Fe(II)(FF){sub 2}(H{sub 2}O){sub 2} + H]{sup +} and [Fe(III) (FF){sub 3}(H{sub 2}O){sub 2} + H]{sup +}, respectively (with limit of detection (LOD) 2.0 pmol (10.0 {mu}M). Matrix assisted laser desorption ionization mass spectrometry (MALDI-MS) spectra show change in the protein profile of intact pathogenic bacteria (Pseudomonas aeroginosa, Staphylococcus aureus). The change in the ionization ability (mainly proton affinity) of pathogenic bacteria may be due to the interactions between the bacteria with the drug (or its

  10. A phage-displayed chicken single-chain antibody fused to alkaline phosphatase detects Fusarium pathogens and their presence in cereal grains

    International Nuclear Information System (INIS)

    Hu, Zu-Quan; Li, He-Ping; Zhang, Jing-Bo; Huang, Tao; Liu, Jin-Long; Xue, Sheng; Wu, Ai-Bo; Liao, Yu-Cai

    2013-01-01

    Graphical abstract: A phage-displayed chicken scFv antibody, FvSG7, binds on the surface antigen of conidiospores and the mycelia of F. verticillioides. Its fusion with alkaline phosphatase (AP) through a 218 linker displayed a 4-fold higher affinity compared with the parent scFv antibody and efficiently detected toxigenic Fusarium pathogens in cereal grains. Highlights: ► Generation of a highly reactive scFv antibody against F. verticillioides. ► Localization of the antibody binding to the surface target of F. verticillioides. ► Expression of the antibody–alkaline phosphatase (AP) fusion linked by a 218 linker. ► The antibody–AP fusion has a higher affinity than the parental antibody. ► The antibody–AP fusion detects toxigenic Fusarium pathogens in cereal grains. -- Abstract: Fusarium and its poisonous mycotoxins are distributed worldwide and are of particular interest in agriculture and food safety. A simple analytical method to detect pathogens is essential for forecasting diseases and controlling mycotoxins. This article describes a proposed method for convenient and sensitive detection of Fusarium pathogens that uses the fusion of single-chain variable fragment (scFv) and alkaline phosphatase (AP). A highly reactive scFv antibody specific to soluble cell wall-bound proteins (SCWPs) of F. verticillioides was selected from an immunized chicken phagemid library by phage display. The antibody was verified to bind on the surface of ungerminated conidiospores and mycelia of F. verticillioides. The scFv–AP fusion was constructed, and soluble expression in bacteria was confirmed. Both the antibody properties and enzymatic activity were retained, and the antigen-binding capacity of the fusion was enhanced by the addition of a linker. Surface plasmon resonance measurements confirmed that the fusion displayed 4-fold higher affinity compared with the fusion's parental scFv antibody. Immunoblot analyses showed that the fusion had good binding capacity to

  11. A phage-displayed chicken single-chain antibody fused to alkaline phosphatase detects Fusarium pathogens and their presence in cereal grains

    Energy Technology Data Exchange (ETDEWEB)

    Hu, Zu-Quan [Molecular Biotechnology Laboratory of Triticeae Crops, Huazhong Agricultural University, Wuhan 430070 (China); Li, He-Ping [Molecular Biotechnology Laboratory of Triticeae Crops, Huazhong Agricultural University, Wuhan 430070 (China); College of Life Science and Technology, Huazhong Agricultural University, Wuhan 430070 (China); Zhang, Jing-Bo [Molecular Biotechnology Laboratory of Triticeae Crops, Huazhong Agricultural University, Wuhan 430070 (China); College of Plant Science and Technology, Huazhong Agricultural University, Wuhan 430070 (China); Huang, Tao [Molecular Biotechnology Laboratory of Triticeae Crops, Huazhong Agricultural University, Wuhan 430070 (China); College of Life Science and Technology, Huazhong Agricultural University, Wuhan 430070 (China); Liu, Jin-Long; Xue, Sheng [Molecular Biotechnology Laboratory of Triticeae Crops, Huazhong Agricultural University, Wuhan 430070 (China); Wu, Ai-Bo [Institute for Agri-food Standards and Testing Technology, Laboratory of Quality and Safety Risk Assessment for Agro-products, Ministry of Agriculture, Shanghai Academy of Agricultural Sciences, 1000 Jinqi Road, Shanghai 201403 (China); Liao, Yu-Cai, E-mail: ycliao06@yahoo.com.cn [Molecular Biotechnology Laboratory of Triticeae Crops, Huazhong Agricultural University, Wuhan 430070 (China); College of Plant Science and Technology, Huazhong Agricultural University, Wuhan 430070 (China); National Center of Plant Gene Research, Wuhan 430070 (China)

    2013-02-18

    Graphical abstract: A phage-displayed chicken scFv antibody, FvSG7, binds on the surface antigen of conidiospores and the mycelia of F. verticillioides. Its fusion with alkaline phosphatase (AP) through a 218 linker displayed a 4-fold higher affinity compared with the parent scFv antibody and efficiently detected toxigenic Fusarium pathogens in cereal grains. Highlights: ► Generation of a highly reactive scFv antibody against F. verticillioides. ► Localization of the antibody binding to the surface target of F. verticillioides. ► Expression of the antibody–alkaline phosphatase (AP) fusion linked by a 218 linker. ► The antibody–AP fusion has a higher affinity than the parental antibody. ► The antibody–AP fusion detects toxigenic Fusarium pathogens in cereal grains. -- Abstract: Fusarium and its poisonous mycotoxins are distributed worldwide and are of particular interest in agriculture and food safety. A simple analytical method to detect pathogens is essential for forecasting diseases and controlling mycotoxins. This article describes a proposed method for convenient and sensitive detection of Fusarium pathogens that uses the fusion of single-chain variable fragment (scFv) and alkaline phosphatase (AP). A highly reactive scFv antibody specific to soluble cell wall-bound proteins (SCWPs) of F. verticillioides was selected from an immunized chicken phagemid library by phage display. The antibody was verified to bind on the surface of ungerminated conidiospores and mycelia of F. verticillioides. The scFv–AP fusion was constructed, and soluble expression in bacteria was confirmed. Both the antibody properties and enzymatic activity were retained, and the antigen-binding capacity of the fusion was enhanced by the addition of a linker. Surface plasmon resonance measurements confirmed that the fusion displayed 4-fold higher affinity compared with the fusion's parental scFv antibody. Immunoblot analyses showed that the fusion had good binding

  12. A simple method for normalization of DNA extraction to improve the quantitative detection of soil-borne plant pathogenic oomycetes by real-time PCR.

    Science.gov (United States)

    Li, M; Ishiguro, Y; Kageyama, K; Zhu, Z

    2015-08-01

    Most of the current research into the quantification of soil-borne pathogenic oomycetes lacks determination of DNA extraction efficiency, probably leading to an incorrect estimation of DNA quantity. In this study, we developed a convenient method by using a 100 bp artificially synthesized DNA sequence derived from the mitochondrion NADH dehydrogenase subunit 2 gene of Thunnus thynnus as a control to determine the DNA extraction efficiency. The control DNA was added to soils and then co-extracted along with soil genomic DNA. DNA extraction efficiency was determined by the control DNA. Two different DNA extraction methods were compared and evaluated using different types of soils, and the commercial kit was proved to give more consistent results. We used the control DNA combined with real-time PCR to quantify the oomycete DNAs from 12 naturally infested soils. Detectable target DNA concentrations were three to five times higher after normalization. Our tests also showed that the extraction efficiencies varied on a sample-to-sample basis and were simple and useful for the accurate quantification of soil-borne pathogenic oomycetes. Oomycetes include many important plant pathogens. Accurate quantification of these pathogens is essential in the management of diseases. This study reports an easy method utilizing an external DNA control for the normalization of DNA extraction by real-time PCR. By combining two different efficient soil DNA extraction methods, the developed quantification method dramatically improved the results. This study also proves that the developed normalization method is necessary and useful for the accurate quantification of soil-borne plant pathogenic oomycetes. © 2015 The Society for Applied Microbiology.

  13. Molecular analysis of bacterial communities and detection of potential pathogens in a recirculating aquaculture system for Scophthalmus maximus and Solea senegalensis.

    Science.gov (United States)

    Martins, Patrícia; Cleary, Daniel F R; Pires, Ana C C; Rodrigues, Ana Maria; Quintino, Victor; Calado, Ricardo; Gomes, Newton C M

    2013-01-01

    The present study combined a DGGE and barcoded 16S rRNA pyrosequencing approach to assess bacterial composition in the water of a recirculating aquaculture system (RAS) with a shallow raceway system (SRS) for turbot (Scophthalmus maximus) and sole (Solea senegalensis). Barcoded pyrosequencing results were also used to determine the potential pathogen load in the RAS studied. Samples were collected from the water supply pipeline (Sup), fish production tanks (Pro), sedimentation filter (Sed), biofilter tank (Bio), and protein skimmer (Ozo; also used as an ozone reaction chamber) of twin RAS operating in parallel (one for each fish species). Our results revealed pronounced differences in bacterial community composition between turbot and sole RAS, suggesting that in the systems studied there is a strong species-specific effect on water bacterial communities. Proteobacteria was the most abundant phylum in the water supply and all RAS compartments. Other important taxonomic groups included the phylum Bacteriodetes. The saltwater supplied displayed a markedly lower richness and appeared to have very little influence on bacterial composition. The following potentially pathogenic species were detected: Photobacterium damselae in turbot (all compartments), Tenacibaculum discolor in turbot and sole (all compartments), Tenacibaculum soleae in turbot (all compartments) and sole (Pro, Sed and Bio), and Serratia marcescens in turbot (Sup, Sed, Bio and Ozo) and sole (only Sed) RAS. Despite the presence of these pathogens, no symptomatic fish were observed. Although we were able to identify potential pathogens, this approach should be employed with caution when monitoring aquaculture systems, as the required phylogenetic resolution for reliable identification of pathogens may not always be possible to achieve when employing 16S rRNA gene fragments.

  14. Molecular analysis of bacterial communities and detection of potential pathogens in a recirculating aquaculture system for Scophthalmus maximus and Solea senegalensis.

    Directory of Open Access Journals (Sweden)

    Patrícia Martins

    Full Text Available The present study combined a DGGE and barcoded 16S rRNA pyrosequencing approach to assess bacterial composition in the water of a recirculating aquaculture system (RAS with a shallow raceway system (SRS for turbot (Scophthalmus maximus and sole (Solea senegalensis. Barcoded pyrosequencing results were also used to determine the potential pathogen load in the RAS studied. Samples were collected from the water supply pipeline (Sup, fish production tanks (Pro, sedimentation filter (Sed, biofilter tank (Bio, and protein skimmer (Ozo; also used as an ozone reaction chamber of twin RAS operating in parallel (one for each fish species. Our results revealed pronounced differences in bacterial community composition between turbot and sole RAS, suggesting that in the systems studied there is a strong species-specific effect on water bacterial communities. Proteobacteria was the most abundant phylum in the water supply and all RAS compartments. Other important taxonomic groups included the phylum Bacteriodetes. The saltwater supplied displayed a markedly lower richness and appeared to have very little influence on bacterial composition. The following potentially pathogenic species were detected: Photobacterium damselae in turbot (all compartments, Tenacibaculum discolor in turbot and sole (all compartments, Tenacibaculum soleae in turbot (all compartments and sole (Pro, Sed and Bio, and Serratia marcescens in turbot (Sup, Sed, Bio and Ozo and sole (only Sed RAS. Despite the presence of these pathogens, no symptomatic fish were observed. Although we were able to identify potential pathogens, this approach should be employed with caution when monitoring aquaculture systems, as the required phylogenetic resolution for reliable identification of pathogens may not always be possible to achieve when employing 16S rRNA gene fragments.

  15. Direct immobilization of antibodies on Zn-doped Fe{sub 3}O{sub 4} nanoclusters for detection of pathogenic bacteria

    Energy Technology Data Exchange (ETDEWEB)

    Pal, Monalisa; Lee, Sanghee; Kwon, Donghoon; Hwang, Jeongin; Lee, Hyeonjeong; Hwang, Seokyung; Jeon, Sangmin, E-mail: jeons@postech.ac.kr

    2017-02-01

    Zinc-doped magnetic nanoclusters (Zn-MNCs) were synthesized and used to detect pathogenic bacteria in milk. Hydrothermally synthesized Zn-MNCs exhibited stronger magnetic properties than pure MNCs, which facilitated the magnetic separation from the sample using a permanent magnet. The presence of accessible Zn sites allows the direct immobilization of half-fragmented antibodies over Zn-MNCs through strong Zn−S bonds and prevents the tedious multiple steps of molecular functionalization or coating with costly noble metals prior to conjugation with an antibody. After the capture and magnetic separation of Salmonella in milk using the antibody-functionalized Zn-MNCs, the concentration of bacteria was determined with a portable ATP luminometer and the detection limit was found to be 10 CFU/mL. - Highlights: • Zn-doped Fe{sub 3}O{sub 4} nanoclusters (Zn-MNCs) were synthesized by hydrothermal method. • Antibodies were directly immobilized over Zn-MNCs through strong Zn–S{sub thiol} bonds. • Higher magnetization of Zn-MNCs than pure MNCs facilitates the magnetic separation. • Detection limit of pathogenic bacteria in milk was found to be 10 cfu/mL. • Cost effective, sensitive and selective detection of bacteria.

  16. Indicators for waterborne pathogens

    National Research Council Canada - National Science Library

    Committee on Indicators for Waterborne Pathogens, National Research Council

    2004-01-01

    ... not practical or feasible to monitor for the complete spectrum of microorganisms that may occur in water, and many known pathogens are difficult to detect directly and reliably in water samples.Â...

  17. Poly(HEMA) brushes emerging as a new platform for direct detection of food pathogen in milk samples

    Czech Academy of Sciences Publication Activity Database

    Rodriguez-Emmenegger, Cesar Adolfo; Avramenko, Oxana; Brynda, Eduard; Škvor, J.; Bologna Alles, A.

    2011-01-01

    Roč. 26, č. 11 (2011), s. 4545-4551 ISSN 0956-5663 R&D Projects: GA AV ČR KAN200670701; GA ČR GAP503/10/0664 Institutional research plan: CEZ:AV0Z40500505 Keywords : surface plasmon resonance * food-borne pathogens * polymer brushes Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering Impact factor: 5.602, year: 2011

  18. VRprofile: gene-cluster-detection-based profiling of virulence and antibiotic resistance traits encoded within genome sequences of pathogenic bacteria.

    Science.gov (United States)

    Li, Jun; Tai, Cui; Deng, Zixin; Zhong, Weihong; He, Yongqun; Ou, Hong-Yu

    2017-01-10

    VRprofile is a Web server that facilitates rapid investigation of virulence and antibiotic resistance genes, as well as extends these trait transfer-related genetic contexts, in newly sequenced pathogenic bacterial genomes. The used backend database MobilomeDB was firstly built on sets of known gene cluster loci of bacterial type III/IV/VI/VII secretion systems and mobile genetic elements, including integrative and conjugative elements, prophages, class I integrons, IS elements and pathogenicity/antibiotic resistance islands. VRprofile is thus able to co-localize the homologs of these conserved gene clusters using HMMer or BLASTp searches. With the integration of the homologous gene cluster search module with a sequence composition module, VRprofile has exhibited better performance for island-like region predictions than the other widely used methods. In addition, VRprofile also provides an integrated Web interface for aligning and visualizing identified gene clusters with MobilomeDB-archived gene clusters, or a variety set of bacterial genomes. VRprofile might contribute to meet the increasing demands of re-annotations of bacterial variable regions, and aid in the real-time definitions of disease-relevant gene clusters in pathogenic bacteria of interest. VRprofile is freely available at http://bioinfo-mml.sjtu.edu.cn/VRprofile. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  19. A sensitive biosensor using double-layer capillary based immunomagnetic separation and invertase-nanocluster based signal amplification for rapid detection of foodborne pathogen.

    Science.gov (United States)

    Huang, Fengchun; Zhang, Huilin; Wang, Lei; Lai, Weihua; Lin, Jianhan

    2018-02-15

    Combining double-layer capillary based high gradient immunomagnetic separation, invertase-nanocluster based signal amplification and glucose meter based signal detection, a novel biosensor was developed for sensitive and rapid detection of E. coli O157:H7 in this study. The streptavidin modified magnetic nanobeads (MNBs) were conjugated with the biotinylated polyclonal antibodies against E. coli O157:H7 to form the immune MNBs, which were captured by the high gradient magnetic field in the double-layer capillary to specifically separate and efficiently concentrate the target bacteria. Calcium chloride was used with the monoclonal antibodies against E. coli O157:H7 and the invertase to form the immune invertase-nanoclusters (INCs), which were used to react with the target bacteria to form the MNB-bacteria-INC complexes in the capillary. The sucrose was then injected into the capillary and catalyzed by the invertase on the complexes into the glucose, which was detected using the glucose meter to obtain the concentration of the glucose for final determination of the E. coli O157:H7 cells in the sample. A linear relationship between the readout of the glucose meter and the concentration of the E. coli O157:H7 cells (from 10 2 to 10 7 CFU/mL) was found and the lower detection limit of this biosensor was 79 CFU/mL. This biosensor might be extended for the detection of other foodborne pathogens by changing the antibodies and has shown the potential for the detection of foodborne pathogens in a large volume of sample to further increase the sensitivity. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Research project RoboGas{sup Inspector}. Gas leak detection with autonomous mobile robots; Forschungsprojekt RoboGas{sup Inspector}. Gaslecksuche mit autonomen mobilen Robotern

    Energy Technology Data Exchange (ETDEWEB)

    Habib, Abdelkarim [BAM Bundesanstalt fuer Materialforschung und -pruefung, Berlin (Germany); Bonow, Gero; Kroll, Andreas [Fachgebiet Mess- und Regelungstechnik, Universitaet Kassel, Kassel (Germany); Hegenberg, Jens; Schmidt, Ludger [Fachgebiet Mensch-Maschine-Systemtechnik, Universitaet Kassel, Kassel (Germany); Barz, Thomas; Schulz, Dirk [Fraunhofer FKIE, Unbemannte Systeme, Wachtberg (Germany)

    2013-05-15

    As part of the promotional program AUTONOMIK of the Federal Ministry of Economics and Technology (Berlin, Federal Republic of Germany) a consortium of nine project partners developed a prototype of an autonomous mobile robot looking for gas leaks in extended industrial equipment. The autonomous mobility of the system for any systems was implemented using different types of sensors for self-localization and navigation. The tele-operation enables a manual intervention in the process. The robot performs inspection tasks in industrial plants by means of video technology and remote gas measurement technology without driving into the possible risk areas and without the presence of humans. The robot can be used for routine inspections of facilities or for the targeted inspection of specific plant components. Thanks to the remote sensing technique also plant components can be inspected which are difficult to be inspected due to their limited accessibility by conventional measurement techniques.

  1. Evaluation of an Internally Controlled Multiplex Tth Endonuclease Cleavage Loop-Mediated Isothermal Amplification (TEC-LAMP Assay for the Detection of Bacterial Meningitis Pathogens

    Directory of Open Access Journals (Sweden)

    Owen Higgins

    2018-02-01

    Full Text Available Bacterial meningitis infection is a leading global health concern for which rapid and accurate diagnosis is essential to reduce associated morbidity and mortality. Loop-mediated isothermal amplification (LAMP offers an effective low-cost diagnostic approach; however, multiplex LAMP is difficult to achieve, limiting its application. We have developed novel real-time multiplex LAMP technology, TEC-LAMP, using Tth endonuclease IV and a unique LAMP primer/probe. This study evaluates the analytical specificity, limit of detection (LOD and clinical application of an internally controlled multiplex TEC-LAMP assay for detection of leading bacterial meningitis pathogens: Streptococcus pneumoniae, Neisseria meningitidis and Haemophilus influenzae. Analytical specificities were established by testing 168 bacterial strains, and LODs were determined using Probit analysis. The TEC-LAMP assay was 100% specific, with LODs for S. pneumoniae, N. meningitidis and H. influenzae of 39.5, 17.3 and 25.9 genome copies per reaction, respectively. Clinical performance was evaluated by testing 65 archived PCR-positive samples. Compared to singleplex real-time PCR, the multiplex TEC-LAMP assay demonstrated diagnostic sensitivity and specificity of 92.3% and 100%, respectively. This is the first report of a single-tube internally controlled multiplex LAMP assay for bacterial meningitis pathogen detection, and the first report of Tth endonuclease IV incorporation into nucleic acid amplification diagnostic technology.

  2. Evaluation of an Internally Controlled Multiplex Tth Endonuclease Cleavage Loop-Mediated Isothermal Amplification (TEC-LAMP) Assay for the Detection of Bacterial Meningitis Pathogens

    Science.gov (United States)

    Clancy, Eoin; Cormican, Martin; Boo, Teck Wee; Cunney, Robert

    2018-01-01

    Bacterial meningitis infection is a leading global health concern for which rapid and accurate diagnosis is essential to reduce associated morbidity and mortality. Loop-mediated isothermal amplification (LAMP) offers an effective low-cost diagnostic approach; however, multiplex LAMP is difficult to achieve, limiting its application. We have developed novel real-time multiplex LAMP technology, TEC-LAMP, using Tth endonuclease IV and a unique LAMP primer/probe. This study evaluates the analytical specificity, limit of detection (LOD) and clinical application of an internally controlled multiplex TEC-LAMP assay for detection of leading bacterial meningitis pathogens: Streptococcus pneumoniae, Neisseria meningitidis and Haemophilus influenzae. Analytical specificities were established by testing 168 bacterial strains, and LODs were determined using Probit analysis. The TEC-LAMP assay was 100% specific, with LODs for S. pneumoniae, N. meningitidis and H. influenzae of 39.5, 17.3 and 25.9 genome copies per reaction, respectively. Clinical performance was evaluated by testing 65 archived PCR-positive samples. Compared to singleplex real-time PCR, the multiplex TEC-LAMP assay demonstrated diagnostic sensitivity and specificity of 92.3% and 100%, respectively. This is the first report of a single-tube internally controlled multiplex LAMP assay for bacterial meningitis pathogen detection, and the first report of Tth endonuclease IV incorporation into nucleic acid amplification diagnostic technology. PMID:29425124

  3. Molecular and serological detection of tick-borne pathogens in dogs from an area endemic for Leishmania infantumin Mato Grosso do Sul, Brazil

    Directory of Open Access Journals (Sweden)

    Keyla Carstens Marques de Sousa

    Full Text Available Tick-borne pathogens affect a wide range of vertebrate hosts. To identify tick-borne pathogens among dogs from Campo Grande, MS, Brazil testing seropositive for Leishmania infantum (syn. L. chagasi, a serological and molecular study was conducted to detectEhrlichia canis, Anaplasma platys and Babesia vogeli in 60 serum and spleen samples. A confirmatory diagnosis ofL. infantum based on serological and molecular assays was also performed, as was sequence alignment and phylogenetic analysis to assess the identity of the parasite species infecting these animals. IgG antibodies toEhrlichia spp., B. vogeli and L. infantum were found, respectively, in 39 (65%, 49 (81.6% and 60 (100% of the sampled dogs. Twenty-seven (45%, fifty-four (90%, fifty-three (88.3%, two (3.3% and one (1.6% dog were positive, respectively, forE. canis, Leishmania spp., Leishmania donovani complex, Babesia sp. and Anaplasma sp. in PCR assays. After sequencing, the amplicons showed 99% of identity with E. canis, B. vogeli, A. platys andLeishmania chagasi isolates. The findings of this study indicate that L. infantum-seropositive dogs from Campo Grande are exposed to multiple tick-borne pathogens, which should therefore be included in the differential diagnosis of dogs with clinical suspicion of leishmaniasis.

  4. Evaluation of a new T2 Magnetic Resonance assay for rapid detection of emergent fungal pathogen Candida auris on clinical skin swab samples.

    Science.gov (United States)

    Sexton, D Joseph; Bentz, Meghan L; Welsh, Rory M; Litvintseva, Anastasia P

    2018-06-25

    Candida auris is a multidrug-resistant pathogenic yeast whose recent emergence is of increasing public-health concern. C. auris can colonize multiple body sites, including patients' skin, and survive for weeks in the healthcare environment, facilitating patient-to-patient transmission and fueling healthcare-associated outbreaks. Rapid and accurate detection of C. auris colonization is essential for timely implementation of infection control measures and prevent transmission. Currently, axilla/groin composite swabs, used to assess colonization status, are processed using a culture-based method that is sensitive and specific but requires 14 days. This delay limits the opportunity to respond and highlights the need for a faster alternative. The culture-independent T2 Magnetic Resonance (T2MR) system is a rapid diagnostic platform shown to detect target pathogens of interest from unprocessed blood samples in T2 assay was evaluated for screening of the skin surveillance samples. Inclusivity and limit of detection of the T2 C. auris assay were assessed with spiked samples in a representative skin flora background. The T2 C. auris assay recognized isolates from each of the 4 known clades of C. auris and consistently detected cells at 5 CFU/mL. Finally, 89 clinical axilla/groin swab samples were processed with the T2 C. auris assay. The culture-based diagnostic assay was used as a gold standard to determine performance statistics including sensitivity (0.89) and specificity (0.98). Overall, the T2 C. auris assay performed well as a rapid diagnostic and could help expedite the detection of C. auris in patient skin swabs. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  5. A remote and autonomous continuous monitoring ultrasonic system for flood detection in sub-sea members of offshore steel oil rigs

    Energy Technology Data Exchange (ETDEWEB)

    Mijarez-Castro, Rito

    2006-07-01

    This thesis presents a novel and autonomous continuous monitoring system for flood detection in the hollow sub-sea members of offshore steel oil rigs. The technique offers an alternative to underwater nondestructive testing methods based on ultrasound and x-rays, which have been used to detect the presence of seawater in these applications, often with divers or remote operating vehicles. The research consists of theoretical and experimental work necessary for the development of an integral system that can be used in new fixed offshore oil rig designs. The system employs a single piezoelectric transducer which can be permanently attached to the inner wall of every sub-sea structure and which is powered by a normally inert seawater battery. Upon activation, the sensor transmits ultrasonic chirp or tone encoded pulses in the range of 21 k Hz to 42 k Hz, to a monitoring system at deck level for decoding and identifying flooded members. Two approaches to the system were considered during the investigation, depending on the communication channel exploited. These were based on either using the seawater as a propagation medium or using the steel structure as a wave-guide. A system based on theoretical models was built and field experiments were conducted using a purpose built jointed steel pipe structure, 7 m in length, 0.5 m in diameter and 16 mm in thickness. This structure was flooded by complete immersion in seawater. Results obtained using water as communication medium and a frequency in the order of 38 k Hz yielded an attenuation figure of 0.4 d B m{sub -}1 over 100 m, since losses were predominantly geometric. In contrast, using the tubular structure as a wave-guide and axis symmetric guided waves as the excitation, a gross attenuation figure of 1.3 d B m{sub -}1 was attained. In the straight parts of the structure, the attenuation ranged from 0.3 d B m{sub -} 1 to 0.6 d B m{sub -}1. The modes most likely to have been excited within the structure were L(0,5) - L(0

  6. Rapid and accurate detection of urinary pathogens by mobile IMS-based electronic nose: a proof-of-principle study.

    Science.gov (United States)

    Roine, Antti; Saviauk, Taavi; Kumpulainen, Pekka; Karjalainen, Markus; Tuokko, Antti; Aittoniemi, Janne; Vuento, Risto; Lekkala, Jukka; Lehtimäki, Terho; Tammela, Teuvo L; Oksala, Niku K J

    2014-01-01

    Urinary tract infection (UTI) is a common disease with significant morbidity and economic burden, accounting for a significant part of the workload in clinical microbiology laboratories. Current clinical chemisty point-of-care diagnostics rely on imperfect dipstick analysis which only provides indirect and insensitive evidence of urinary bacterial pathogens. An electronic nose (eNose) is a handheld device mimicking mammalian olfaction that potentially offers affordable and rapid analysis of samples without preparation at athmospheric pressure. In this study we demonstrate the applicability of ion mobility spectrometry (IMS) -based eNose to discriminate the most common UTI pathogens from gaseous headspace of culture plates rapidly and without sample preparation. We gathered a total of 101 culture samples containing four most common UTI bacteries: E. coli, S. saprophyticus, E. faecalis, Klebsiella spp and sterile culture plates. The samples were analyzed using ChemPro 100i device, consisting of IMS cell and six semiconductor sensors. Data analysis was conducted by linear discriminant analysis (LDA) and logistic regression (LR). The results were validated by leave-one-out and 5-fold cross validation analysis. In discrimination of sterile and bacterial samples sensitivity of 95% and specificity of 97% were achieved. The bacterial species were identified with sensitivity of 95% and specificity of 96% using eNose as compared to urine bacterial cultures. These findings strongly demonstrate the ability of our eNose to discriminate bacterial cultures and provides a proof of principle to use this method in urinanalysis of UTI.

  7. Rapid and accurate detection of urinary pathogens by mobile IMS-based electronic nose: a proof-of-principle study.

    Directory of Open Access Journals (Sweden)

    Antti Roine

    Full Text Available Urinary tract infection (UTI is a common disease with significant morbidity and economic burden, accounting for a significant part of the workload in clinical microbiology laboratories. Current clinical chemisty point-of-care diagnostics rely on imperfect dipstick analysis which only provides indirect and insensitive evidence of urinary bacterial pathogens. An electronic nose (eNose is a handheld device mimicking mammalian olfaction that potentially offers affordable and rapid analysis of samples without preparation at athmospheric pressure. In this study we demonstrate the applicability of ion mobility spectrometry (IMS -based eNose to discriminate the most common UTI pathogens from gaseous headspace of culture plates rapidly and without sample preparation. We gathered a total of 101 culture samples containing four most common UTI bacteries: E. coli, S. saprophyticus, E. faecalis, Klebsiella spp and sterile culture plates. The samples were analyzed using ChemPro 100i device, consisting of IMS cell and six semiconductor sensors. Data analysis was conducted by linear discriminant analysis (LDA and logistic regression (LR. The results were validated by leave-one-out and 5-fold cross validation analysis. In discrimination of sterile and bacterial samples sensitivity of 95% and specificity of 97% were achieved. The bacterial species were identified with sensitivity of 95% and specificity of 96% using eNose as compared to urine bacterial cultures.These findings strongly demonstrate the ability of our eNose to discriminate bacterial cultures and provides a proof of principle to use this method in urinanalysis of UTI.

  8. Testing for autonomic neuropathy

    DEFF Research Database (Denmark)

    Hilsted, J

    1984-01-01

    Autonomic neuropathy is a common complication in long-term diabetes, about 30% of the patients showing measurable signs of autonomic dysfunction after 10 years duration of disease. The diagnosis is often difficult to establish because clinical symptoms generally occur late in the course of the di......Autonomic neuropathy is a common complication in long-term diabetes, about 30% of the patients showing measurable signs of autonomic dysfunction after 10 years duration of disease. The diagnosis is often difficult to establish because clinical symptoms generally occur late in the course...

  9. Extraction and sensitive detection of toxins A and B from the human pathogen Clostridium difficile in 40 seconds using microwave-accelerated metal-enhanced fluorescence.

    Directory of Open Access Journals (Sweden)

    Lovleen Tina Joshi

    Full Text Available Clostridium difficile is the primary cause of antibiotic associated diarrhea in humans and is a significant cause of morbidity and mortality. Thus the rapid and accurate identification of this pathogen in clinical samples, such as feces, is a key step in reducing the devastating impact of this disease. The bacterium produces two toxins, A and B, which are thought to be responsible for the majority of the pathology associated with the disease, although the relative contribution of each is currently a subject of debate. For this reason we have developed a rapid detection assay based on microwave-accelerated metal-enhanced fluorescence which is capable of detecting the presence of 10 bacteria in unprocessed human feces within 40 seconds. These promising results suggest that this prototype biosensor has the potential to be developed into a rapid, point of care, real time diagnostic assay for C. difficile.

  10. Surveillance plan for the early detection of H5N1 highly pathogenic avian influenza virus in migratory birds in the United States: surveillance year 2009

    Science.gov (United States)

    Brand, Christopher J.

    2009-01-01

    Executive Summary: This Surveillance Plan (Plan) describes plans for conducting surveillance of wild birds in the United States and its Territories and Freely-Associated States to provide for early detection of the introduction of the H5N1 Highly Pathogenic Avian Influenza (HPAI) subtype of the influenza A virus by migratory birds during the 2009 surveillance year, spanning the period of April 1, 2009 - March 31, 2010. The Plan represents a continuation of surveillance efforts begun in 2006 under the Interagency Strategic Plan for the Early Detection of H5N1 Highly Pathogenic Avian Influenza in Wild Migratory Birds (U.S. Department of Agriculture and U.S. Department of the Interior, 2006). The Plan sets forth sampling plans by: region, target species or species groups to be sampled, locations of sampling, sample sizes, and sampling approaches and methods. This Plan will be reviewed annually and modified as appropriate for subsequent surveillance years based on evaluation of information from previous years of surveillance, changing patterns and threats of H5N1 HPAI, and changes in funding availability for avian influenza surveillance. Specific sampling strategies will be developed accordingly within each of six regions, defined here as Alaska, Hawaiian/Pacific Islands, Lower Pacific Flyway (Washington, Oregon, California, Idaho, Nevada, Arizona), Central Flyway, Mississippi Flyway, and Atlantic Flyway.

  11. Detection of five potentially periodontal pathogenic bacteria in peri-implant disease: A comparison of PCR and real-time PCR.

    Science.gov (United States)

    Schmalz, Gerhard; Tsigaras, Sandra; Rinke, Sven; Kottmann, Tanja; Haak, Rainer; Ziebolz, Dirk

    2016-07-01

    The aim of this study was to compare the microbial analysis methods of polymerase chain reaction (PCR) and real-time PCR (RT-PCR) in terms of detection of five selected potentially periodontal pathogenic bacteria in peri-implant disease. Therefore 45 samples of healthy, mucositis and peri-implantitis (n = 15 each) were assessed according to presence of the following bacteria using PCR (DNA-strip technology) and RT-PCR (fluorescent dye SYBR green-system): Aggregatibacter actinomycetemcomitans (Aa), Porphyromonas gingivalis (Pg), Treponema denticola (Td), Tanerella forsythia (Tf), and Fusobacterium nucleatum (Fn). There were no significant correlations between the bacterial and disease patterns, so the benefit of using microbiological tests for the diagnosis of peri-implant diseases is questionable. Correlations between the methods were highest for Tf (Kendall's Tau: 0.65, Spearman: 0.78), Fn (0.49, 0.61) and Td (0.49, 0.59). For Aa (0.38, 0.42) and Pg (0.04, 0.04), lower correlation values were detected. Accordingly, conventional semi-quantitative PCR seems to be sufficient for analyzing potentially periodontal pathogenic bacterial species. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. Surveillance of low pathogenic novel H7N9 avian influenza in commercial poultry barns: detection of outbreaks and estimation of virus introduction time.

    Science.gov (United States)

    Pinsent, Amy; Blake, Isobel M; White, Michael T; Riley, Steven

    2014-08-01

    Both high and low pathogenic subtype A avian influenza remain ongoing threats to the commercial poultry industry globally. The emergence of a novel low pathogenic H7N9 lineage in China presents itself as a new concern to both human and animal health and may necessitate additional surveillance in commercial poultry operations in affected regions. Sampling data was simulated using a mechanistic model of H7N9 influenza transmission within commercial poultry barns together with a stochastic observation process. Parameters were estimated using maximum likelihood. We assessed the probability of detecting an outbreak at time of slaughter using both real-time polymerase chain reaction (rt-PCR) and a hemagglutinin inhibition assay (HI assay) before considering more intense sampling prior to slaughter. The day of virus introduction and R0 were estimated jointly from weekly flock sampling data. For scenarios where R0 was known, we estimated the day of virus introduction into a barn under different sampling frequencies. If birds were tested at time of slaughter, there was a higher probability of detecting evidence of an outbreak using an HI assay compared to rt-PCR, except when the virus was introduced <2 weeks before time of slaughter. Prior to the initial detection of infection N sample = 50 (1%) of birds were sampled on a weekly basis once, but after infection was detected, N sample = 2000 birds (40%) were sampled to estimate both parameters. We accurately estimated the day of virus introduction in isolation with weekly and 2-weekly sampling. A strong sampling effort would be required to infer both the day of virus introduction and R0. Such a sampling effort would not be required to estimate the day of virus introduction alone once R0 was known, and sampling N sample = 50 of birds in the flock on a weekly or 2 weekly basis would be sufficient.

  13. Detection of mucormycetes and other pathogenic fungi in formalin fixed paraffin embedded and fresh tissues using the extended region of 28S rDNA.

    Science.gov (United States)

    Gade, Lalitha; Hurst, Steven; Balajee, S Arunmozhi; Lockhart, Shawn R; Litvintseva, Anastasia P

    2017-06-01

    Molecular methods of detection based on DNA-sequencing of the internal transcribed spacer 1 and 2 (ITS1 and ITS2) or 5΄ end region of 28S (D1-D2 region) of ribosomal RNA gene (rDNA) have been used extensively for molecular identification and detection of fungal infections. However, these regions are not always informative for identification of mucormycetes and other rare fungal pathogens as they often contain large introns, heterogenic regions, and/or cannot be PCR-amplified using broad range fungal PCR primers. In addition, because of the difficulties of recovering intact fungal DNA from human specimens, smaller regions of DNA are more useful for the direct detection of fungal DNA in tissues and fluids. In this study, we investigated the utility of 12F/13R PCR primers targeting a 200-230 bp region of the extended 28S region of rDNA for molecular identification of fungal DNA in formalin fixed paraffin embedded tissues and other clinical specimens. We demonstrated that this region can be successfully used for identification of all genera and some species of clinically relevant mucormycetes, as well as other medically important fungi, such as Aspergillus, Fusarium, Coccidioides, and Cryptococcus. We also demonstrated that PCR amplification and direct sequencing of the extended 28S region of rDNA was more sensitive compared to targeting the ITS2 region, as we were able to detect and identify mucormycetes and other fungal pathogens in tissues from patients with histopathological and/or culture evidence of fungal infections that were negative with PCR using ITS-specific primers. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology 2016. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  14. Chemiluminescent labels released from long spacer arm-functionalized magnetic particles: a novel strategy for ultrasensitive and highly selective detection of pathogen infections.

    Science.gov (United States)

    Yang, Haowen; Liang, Wenbiao; He, Nongyue; Deng, Yan; Li, Zhiyang

    2015-01-14

    Previously, the unique advantages provided by chemiluminescence (CL) and magnetic particles (MPs) have resulted in the development of many useful nucleic acid detection methods. CL is highly sensitive, but when applied to MPs, its intensity is limited by the inner filter-like effect arising from excess dark MPs. Herein, we describe a modified strategy whereby CL labels are released from MPs to eliminate this negative effect. This approach relies on (1) the magnetic capture of target molecules on long spacer arm-functionalized magnetic particles (LSA-MPs), (2) the conjugation of streptavidin-alkaline phosphatase (SA-AP) to biotinylated amplicons of target pathogens, (3) the release of CL labels (specifically, AP tags), and (4) the detection of the released labels. CL labels were released from LSA-MPs through LSA ultrasonication or DNA enzymolysis, which proved to be the superior method. In contrast to conventional MPs, LSA-MPs exhibited significantly improved CL detection, because of the introduction of LSA, which was made of water-soluble carboxymethylated β-1,3-glucan. Detection of hepatitis B virus with this technique revealed a low detection limit of 50 fM, high selectivity, and excellent reproducibility. Thus, this approach may hold great potential for early stage clinical diagnosis of infectious diseases.

  15. Cardiovascular autonomic neuropathy in diabetes

    DEFF Research Database (Denmark)

    Spallone, Vincenza; Ziegler, Dan; Freeman, Roy

    2011-01-01

    Cardiovascular Autonomic Neuropathy (CAN) Subcommittee of Toronto Consensus Panel on Diabetic Neuropathy worked to update CAN guidelines, with regard to epidemiology, clinical impact, diagnosis, usefulness of CAN testing, and management. CAN is the impairment of cardiovascular autonomic control...... in type 2 diabetes. CAN is a risk marker of mortality and cardiovascular morbidity, and possibly a progression promoter of diabetic nephropathy. Criteria for CAN diagnosis and staging are: 1. one abnormal cardio-vagal test identifies possible or early CAN; 2. at least two abnormal cardio-vagal tests....... diagnosis of CAN clinical forms, 2. detection and tailored treatment of CAN clinical correlates (e.g. tachycardia, OH, nondipping, QT interval prolongation), 3. risk stratification for diabetic complications and cardiovascular morbidity and mortality, and 4. modulation of targets of diabetes therapy...

  16. The Detection of a Low Pathogenicity Avian Influenza Virus Subtype H9 Infection in a Turkey Breeder Flock in the United Kingdom.

    Science.gov (United States)

    Reid, Scott M; Banks, Jill; Ceeraz, Vanessa; Seekings, Amanda; Howard, Wendy A; Puranik, Anita; Collins, Susan; Manvell, Ruth; Irvine, Richard M; Brown, Ian H

    2016-05-01

    In April 2013, an H9N2 low pathogenicity avian influenza (LPAI) virus was isolated in a turkey breeder farm in Eastern England comprising 4966 birds. Point-of-lay turkey breeding birds had been moved from a rearing site and within 5 days had shown rapid onset of clinical signs of dullness, coughing, and anorexia. Three houses were involved, two contained a total of 4727 turkey hens, and the third housed 239 male turkeys. Around 50% of the hens were affected, whereas the male turkeys demonstrated milder clinical signs. Bird morbidity rose from 10% to 90%, with an increase in mortality in both houses of turkey hens to 17 dead birds in one house and 27 birds in the second house by day 6. The birds were treated with an antibiotic but were not responsive. Postmortem investigation revealed air sacculitis but no infraorbital sinus swellings or sinusitis. Standard samples were collected, and influenza A was detected. H9 virus infection was confirmed in all three houses by detection and subtyping of hemagglutinating agents in embryonated specific-pathogen-free fowls' eggs, which were shown to be viruses of H9N2 subtype using neuraminidase inhibition tests and a suite of real-time reverse transcription PCR assays. LPAI virus pathotype was suggested by cleavage site sequencing, and an intravenous pathogenicity index of 0.00 confirmed that the virus was of low pathogenicity. Therefore, no official disease control measures were required, and despite the high morbidity, birds recovered and were kept in production. Neuraminidase sequence analysis revealed a deletion of 78 nucleotides in the stalk region, suggesting an adaptation of the virus to poultry. Hemagglutinin gene sequences of two of the isolates clustered with a group of H9 viruses containing other contemporary European H9 strains in the Y439/Korean-like group. The closest matches to the two isolates were A/turkey/Netherlands/11015452/11 (H9N2; 97.9-98% nucleotide identity) and A/mallard/Finland/Li13384/10 (H9N2; 97

  17. First detection in the USA: new plant pathogen, Phytophthora tentaculata, in native plant nurseries and restoration sites in California

    Science.gov (United States)

    S. Rooney-Latham; C. L. Blomquist; T. Swiecki; E. Bernhardt; S.J. Frankel

    2015-01-01

    Phytophthora tentaculata Kröber & Marwitz, has been detected in several native plant nurseries in 4 California counties and in restoration sites on orange sticky monkey flower (Diplacus aurantiacus subsp. aurantiacus (W. Curtis) Jeps. [Scrophulariaceae]), toyon (Heteromeles...

  18. Semi-Autonomous Systems Laboratory

    Data.gov (United States)

    Federal Laboratory Consortium — VisionThe Semi-Autonomous Systems Lab focuses on developing a comprehensive framework for semi-autonomous coordination of networked robotic systems. Semi-autonomous...

  19. Detection of H5N1 high-pathogenicity avian influenza virus in meat and tracheal samples from experimentally infected chickens.

    Science.gov (United States)

    Das, Amaresh; Spackman, Erica; Thomas, Colleen; Swayne, David E; Suarez, David L

    2008-03-01

    The Asian H5N1 highly pathogenic avian influenza (HPAI) virus causes a systemic disease with high mortality of poultry and is potentially zoonotic. In both chickens and ducks, the virus has been demonstrated to replicate in both cardiac and skeletal muscle cells. Experimentally, H5N1 HPAI virus has been transmitted to chickens through the consumption of raw infected meat. In this study, we investigated virus replication in cardiac and skeletal muscle and in the trachea of chickens after experimental intranasal inoculation with the H5N1 HPAI virus. The virus was detected in tissues by real-time reverse transcription-polymerase chain reaction (RRT-PCR) and virus isolation, and in the trachea by RRT-PCR and a commercial avian influenza (AI) viral antigen detection test. A modified RNA extraction protocol was developed for rapid detection of the virus in tissues by RRT-PCR. The H5N1 HPAI virus was sporadically detected in meat and the tracheas of infected birds without any clinical sign of disease as early as 6 hr postinfection (PI), and was detected in all samples tested at 24 hr PI and later. No differences in sensitivity were seen between virus isolation and RRT-PCR in meat samples. The AI viral antigen detection test on tracheal swabs was a useful method for identifying infected chickens when they were sick or dead, but was less sensitive in detecting infected birds when they were preclinical. This study provides data indicating that preslaughter tracheal swab testing can identify birds infected with HPAI among the daily mortality and prevent infected flocks from being sent to processing plants. In addition, the modified RNA extraction and RRT-PCR test on meat samples provide a rapid and sensitive method of identifying HPAI virus in illegal contraband or domestic meat samples.

  20. An Expert System for Autonomous Spacecraft Control

    Science.gov (United States)

    Sherwood, Rob; Chien, Steve; Tran, Daniel; Cichy, Benjamin; Castano, Rebecca; Davies, Ashley; Rabideau, Gregg

    2005-01-01

    The Autonomous Sciencecraft Experiment (ASE), part of the New Millennium Space Technology 6 Project, is flying onboard the Earth Orbiter 1 (EO-1) mission. The ASE software enables EO-1 to autonomously detect and respond to science events such as: volcanic activity, flooding, and water freeze/thaw. ASE uses classification algorithms to analyze imagery onboard to detect chang-e and science events. Detection of these events is then used to trigger follow-up imagery. Onboard mission planning software then develops a response plan that accounts for target visibility and operations constraints. This plan is then executed using a task execution system that can deal with run-time anomalies. In this paper we describe the autonomy flight software and how it enables a new paradigm of autonomous science and mission operations. We will also describe the current experiment status and future plans.

  1. Towards a pathogenic Escherichia coli detection platform using multiplex SYBR®Green Real-time PCR methods and high resolution melting analysis.

    Directory of Open Access Journals (Sweden)

    Dafni-Maria Kagkli

    Full Text Available Escherichia coli is a group of bacteria which has raised a lot of safety concerns in recent years. Five major intestinal pathogenic groups have been recognized amongst which the verocytotoxin or shiga-toxin (stx1 and/or stx2 producing E. coli (VTEC or STEC respectively have received a lot of attention recently. Indeed, due to the high number of outbreaks related to VTEC strains, the European Food Safety Authority (EFSA has requested the monitoring of the "top-five" serogroups (O26, O103, O111, O145 and O157 most often encountered in food borne diseases and addressed the need for validated VTEC detection methods. Here we report the development of a set of intercalating dye Real-time PCR methods capable of rapidly detecting the presence of the toxin genes together with intimin (eae in the case of VTEC, or aggregative protein (aggR, in the case of the O104:H4 strain responsible for the outbreak in Germany in 2011. All reactions were optimized to perform at the same annealing temperature permitting the multiplex application in order to minimize the need of material and to allow for high-throughput analysis. In addition, High Resolution Melting (HRM analysis allowing the discrimination among strains possessing similar virulence traits was established. The development, application to food samples and the flexibility in use of the methods are thoroughly discussed. Together, these Real-time PCR methods facilitate the detection of VTEC in a new highly efficient way and could represent the basis for developing a simple pathogenic E. coli platform.

  2. A Next-Generation Sequencing Data Analysis Pipeline for Detecting Unknown Pathogens from Mixed Clinical Samples and Revealing Their Genetic Diversity.

    Directory of Open Access Journals (Sweden)

    Yu-Nong Gong

    Full Text Available Forty-two cytopathic effect (CPE-positive isolates were collected from 2008 to 2012. All isolates could not be identified for known viral pathogens by routine diagnostic assays. They were pooled into 8 groups of 5-6 isolates to reduce the sequencing cost. Next-generation sequencing (NGS was conducted for each group of mixed samples, and the proposed data analysis pipeline was used to identify viral pathogens in these mixed samples. Polymerase chain reaction (PCR or enzyme-linked immunosorbent assay (ELISA was individually conducted for each of these 42 isolates depending on the predicted viral types in each group. Two isolates remained unknown after these tests. Moreover, iteration mapping was implemented for each of these 2 isolates, and predicted human parechovirus (HPeV in both. In summary, our NGS pipeline detected the following viruses among the 42 isolates: 29 human rhinoviruses (HRVs, 10 HPeVs, 1 human adenovirus (HAdV, 1 echovirus and 1 rotavirus. We then focused on the 10 identified Taiwanese HPeVs because of their reported clinical significance over HRVs. Their genomes were assembled and their genetic diversity was explored. One novel 6-bp deletion was found in one HPeV-1 virus. In terms of nucleotide heterogeneity, 64 genetic variants were detected from these HPeVs using the mapped NGS reads. Most importantly, a recombination event was found between our HPeV-3 and a known HPeV-4 strain in the database. Similar event was detected in the other HPeV-3 strains in the same clade of the phylogenetic tree. These findings demonstrated that the proposed NGS data analysis pipeline identified unknown viruses from the mixed clinical samples, revealed their genetic identity and variants, and characterized their genetic features in terms of viral evolution.

  3. Genetic autonomic disorders.

    Science.gov (United States)

    Axelrod, Felicia B

    2013-03-01

    Genetic disorders affecting the autonomic nervous system can result in abnormal development of the nervous system or they can be caused by neurotransmitter imbalance, an ion-channel disturbance or by storage of deleterious material. The symptoms indicating autonomic dysfunction, however, will depend upon whether the genetic lesion has disrupted peripheral or central autonomic centers or both. Because the autonomic nervous system is pervasive and affects every organ system in the body, autonomic dysfunction will result in impaired homeostasis and symptoms will vary. The possibility of genetic confirmation by molecular testing for specific diagnosis is increasing but treatments tend to remain only supportive and directed toward particular symptoms. Copyright © 2013 Elsevier Inc. All rights reserved.

  4. Segal’s Law, 16S rRNA gene sequencing, and the perils of foodborne pathogen detection within the American Gut Project

    Directory of Open Access Journals (Sweden)

    James B. Pettengill

    2017-06-01

    Full Text Available Obtaining human population level estimates of the prevalence of foodborne pathogens is critical for understanding outbreaks and ameliorating such threats to public health. Estimates are difficult to obtain due to logistic and financial constraints, but citizen science initiatives like that of the American Gut Project (AGP represent a potential source of information concerning enteric pathogens. With an emphasis on genera Listeria and Salmonella, we sought to document the prevalence of those two taxa within the AGP samples. The results provided by AGP suggest a surprising 14% and 2% of samples contained Salmonella and Listeria, respectively. However, a reanalysis of those AGP sequences described here indicated that results depend greatly on the algorithm for assigning taxonomy and differences persisted across both a range of parameter settings and different reference databases (i.e., Greengenes and HITdb. These results are perhaps to be expected given that AGP sequenced the V4 region of 16S rRNA gene, which may not provide good resolution at the lower taxonomic levels (e.g., species, but it was surprising how often methods differ in classifying reads—even at higher taxonomic ranks (e.g., family. This highlights the misleading conclusions that can be reached when relying on a single method that is not a gold standard; this is the essence of Segal’s Law: an individual with one watch knows what time it is but an individual with two is never sure. Our results point to the need for an appropriate molecular marker for the taxonomic resolution of interest, and calls for the development of more conservative classification methods that are fit for purpose. Thus, with 16S rRNA gene datasets, one must be cautious regarding the detection of taxonomic groups of public health interest (e.g., culture independent identification of foodborne pathogens or taxa associated with a given phenotype.

  5. Segal's Law, 16S rRNA gene sequencing, and the perils of foodborne pathogen detection within the American Gut Project.

    Science.gov (United States)

    Pettengill, James B; Rand, Hugh

    2017-01-01

    Obtaining human population level estimates of the prevalence of foodborne pathogens is critical for understanding outbreaks and ameliorating such threats to public health. Estimates are difficult to obtain due to logistic and financial constraints, but citizen science initiatives like that of the American Gut Project (AGP) represent a potential source of information concerning enteric pathogens. With an emphasis on genera Listeria and Salmonella , we sought to document the prevalence of those two taxa within the AGP samples. The results provided by AGP suggest a surprising 14% and 2% of samples contained Salmonella and Listeria , respectively. However, a reanalysis of those AGP sequences described here indicated that results depend greatly on the algorithm for assigning taxonomy and differences persisted across both a range of parameter settings and different reference databases (i.e., Greengenes and HITdb). These results are perhaps to be expected given that AGP sequenced the V4 region of 16S rRNA gene, which may not provide good resolution at the lower taxonomic levels (e.g., species), but it was surprising how often methods differ in classifying reads-even at higher taxonomic ranks (e.g., family). This highlights the misleading conclusions that can be reached when relying on a single method that is not a gold standard; this is the essence of Segal's Law: an individual with one watch knows what time it is but an individual with two is never sure. Our results point to the need for an appropriate molecular marker for the taxonomic resolution of interest, and calls for the development of more conservative classification methods that are fit for purpose. Thus, with 16S rRNA gene datasets, one must be cautious regarding the detection of taxonomic groups of public health interest (e.g., culture independent identification of foodborne pathogens or taxa associated with a given phenotype).

  6. Early detection of sugar beet pathogen Ramularia beticola in leaf and air samples using qPCR

    DEFF Research Database (Denmark)

    Wieczorek, Thies Marten; Jørgensen, Lise Nistrup; Hansen, Anne Lisbet

    2014-01-01

    A quantitative PCR method (qPCR) was developed for the detection and quantification of Ramularia beticola causing Ramularia leaf spot in sugar beet. R. beticola specific primers were designed based on the internal transcribed spacer region 2 (ITS2). The assay was applied on DNA extracted from...... spores trapped on tape from Burkard spore traps placed in an artificially inoculated sugar beet field trial and in two sugar beet fields with natural infections. R. beticola DNA was detected at variable amounts in the air samples 14 to 16 days prior to first visible symptoms. R. beticola DNA was detected...... in air samples from fields with natural infection at significant and increasing levels from development of the first symptoms, indicating that spore production within the crop plays a major role in the epidemic development of the disease. Sugar beet leaves sampled from the inoculated field trial were...

  7. Attempted molecular detection of the thermally dimorphic human fungal pathogen Emergomyces africanus in terrestrial small mammals in South Africa.

    Science.gov (United States)

    Cronjé, Nadine; Schwartz, Ilan S; Retief, Liezl; Bastos, Armanda D S; Matthee, Sonja; Preiser, Wolfgang; Bennett, Nigel C; Maphanga, Tsidiso; Govender, Nelesh P; Colebunders, Robert; Kenyon, Chris

    2018-06-01

    The ecological niche of Emergomyces africanus (formerly Emmonsia species), a dimorphic fungus that causes an AIDS-related mycosis in South Africa, is unknown. We hypothesized that natural infection with E. africanus occurs in wild small mammals. Using molecular detection with primers specific for E. africanus, we examined 1402 DNA samples from 26 species of mole-rats, rodents, and insectivores trapped in South Africa that included 1324 lung, 37 kidney, and 41 liver specimens. DNA of E. africanus was not detected in any animals. We conclude that natural infection of wild small mammals in South Africa with E. africanus has not been proven.

  8. Multiple advanced logic gates made of DNA-Ag nanocluster and the application for intelligent detection of pathogenic bacterial genes.

    Science.gov (United States)

    Lin, Xiaodong; Liu, Yaqing; Deng, Jiankang; Lyu, Yanlong; Qian, Pengcheng; Li, Yunfei; Wang, Shuo

    2018-02-21

    The integration of multiple DNA logic gates on a universal platform to implement advance logic functions is a critical challenge for DNA computing. Herein, a straightforward and powerful strategy in which a guanine-rich DNA sequence lighting up a silver nanocluster and fluorophore was developed to construct a library of logic gates on a simple DNA-templated silver nanoclusters (DNA-AgNCs) platform. This library included basic logic gates, YES, AND, OR, INHIBIT, and XOR, which were further integrated into complex logic circuits to implement diverse advanced arithmetic/non-arithmetic functions including half-adder, half-subtractor, multiplexer, and demultiplexer. Under UV irradiation, all the logic functions could be instantly visualized, confirming an excellent repeatability. The logic operations were entirely based on DNA hybridization in an enzyme-free and label-free condition, avoiding waste accumulation and reducing cost consumption. Interestingly, a DNA-AgNCs-based multiplexer was, for the first time, used as an intelligent biosensor to identify pathogenic genes, E. coli and S. aureus genes, with a high sensitivity. The investigation provides a prototype for the wireless integration of multiple devices on even the simplest single-strand DNA platform to perform diverse complex functions in a straightforward and cost-effective way.

  9. Flow-through immunomagnetic separation system for waterborne pathogen isolation and detection: Application to Giardia and Cryptosporidium cell isolation

    Energy Technology Data Exchange (ETDEWEB)

    Ramadan, Qasem, E-mail: qasem.alramadan@epfl.ch [Bioelectronics Program, Institute of Microelectronics, 11 Science Park Road, Singapore 117685 (Singapore); Christophe, Lay; Teo, William; ShuJun, Li; Hua, Feng Han [Bioelectronics Program, Institute of Microelectronics, 11 Science Park Road, Singapore 117685 (Singapore)

    2010-07-12

    Simultaneous sample washing and concentration of two waterborne pathogen samples were demonstrated using a rotational magnetic system under continuous flow conditions. The rotation of periodically arranged small permanent magnets close to a fluidic channel carrying magnetic particle suspension allows the trapping and release of particles along the fluidic channel in a periodic manner. Each trapping and release event resembles one washing cycle. The performance of the magnetic separation system (MSS) was evaluated in order to test its functionality to isolate magnetic-labelled protozoan cells from filtered, concentrated tap water, secondary effluent water, and purified water. Experimental protocols described in US Environmental Protection Agency method 1623 which rely on the use of a magnetic particle concentrator, were applied to test and compare our continuous flow cell separation system to the standard magnetic bead-based isolation instruments. The recovery efficiencies for Giardia cysts using the magnetic tube holder and our magnetic separation system were 90.5% and 90.1%, respectively, from a tap water matrix and about 31% and 18.5%, respectively, from a spiked secondary effluent matrix. The recovery efficiencies for Cryptosporidium cells using the magnetic tube holder and our magnetic separation system were 90% and 83.3%, respectively, from a tap water matrix and about 38% and 36%, respectively, from a spiked secondary effluent matrix. Recoveries from all matrices with the continuous flow system were typically higher in glass tubing conduits than in molded plastic conduits.

  10. A novel CMOS image sensor system for quantitative loop-mediated isothermal amplification assays to detect food-borne pathogens.

    Science.gov (United States)

    Wang, Tiantian; Kim, Sanghyo; An, Jeong Ho

    2017-02-01

    Loop-mediated isothermal amplification (LAMP) is considered as one of the alternatives to the conventional PCR and it is an inexpensive portable diagnostic system with minimal power consumption. The present work describes the application of LAMP in real-time photon detection and quantitative analysis of nucleic acids integrated with a disposable complementary-metal-oxide semiconductor (CMOS) image sensor. This novel system works as an amplification-coupled detection platform, relying on a CMOS image sensor, with the aid of a computerized circuitry controller for the temperature and light sources. The CMOS image sensor captures the light which is passing through the sensor surface and converts into digital units using an analog-to-digital converter (ADC). This new system monitors the real-time photon variation, caused by the color changes during amplification. Escherichia coli O157 was used as a proof-of-concept target for quantitative analysis, and compared with the results for Staphylococcus aureus and Salmonella enterica to confirm the efficiency of the system. The system detected various DNA concentrations of E. coli O157 in a short time (45min), with a detection limit of 10fg/μL. The low-cost, simple, and compact design, with low power consumption, represents a significant advance in the development of a portable, sensitive, user-friendly, real-time, and quantitative analytic tools for point-of-care diagnosis. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Detection of Total and Pathogenic Vibrio parahaemolyticus in Shellfish Growing along the South Yellow Sea and the East China Sea.

    Science.gov (United States)

    Han, Feng; Gu, Run-Run; Shen, Xiao-Sheng; Chen, Yuan-Ge; Tian, Liang-Liang; Zhou, Wei-Feng; Cai, You-Qiong

    2017-10-17

    This study was conducted to monitor the densities of total and pathogenic Vibrio parahaemolyticus in 300 samples of nine shellfish species harvested from the coasts of the South Yellow Sea and the East China Sea (N 23° to 34°, E 116° to 124°), People's Republic of China, between May and October 2015. Total V. parahaemolyticus densities were measured, and V. parahaemolyticus isolates were biochemically identified with probes for the thermostable direct hemolysin gene (tdh) and the thermostable direct hemolysin-related hemolysin gene (trh). We found that 202 of the 300 samples were positive for V. parahaemolyticus from all the sites: 58 of the 100 samples from the Fujian province, 71 of the 100 samples from the Zhejiang province, and 73 of the 100 samples from the Jiangsu province. In most (170) of the 300 samples, V. parahaemolyticus densities were 0.3 to 10 most probable number (MPN)/g; five lots exceeded 110 MPN/g, and two lots were estimated at 110 MPN/g. Among the 202 V. parahaemolyticus strains, only one was trh positive. Densities of V. parahaemolyticus in these shellfish were temperature dependent, with highest densities in June and July. Among the nine mollusk species, V. parahaemolyticus was most abundant in the agemaki clam (Sinonovacula constricta). The highest and lowest V. parahaemolyticus prevalences were found in oriental cyclina (Cyclina sinensis, 93.8%) and mussels (Mytilus edulis, 28.1%), respectively. Overall, although V. parahaemolyticus is widely distributed in marine environments, the density of V. parahaemolyticus was low and the prevalence of the main virulence factor was very low in shellfish along the coasts of the South Yellow Sea and East China Sea, which is important from a public health perspective. Data presented here will be useful for correlational research and can be utilized for developing risk management plans that establish food safety guidelines for V. parahaemolyticus in Chinese shellfish.

  12. A comparison of DNA extraction protocols from blood spotted on FTA cards for the detection of tick-borne pathogens by Reverse Line Blot hybridization.

    Science.gov (United States)

    Hailemariam, Zerihun; Ahmed, Jabbar Sabir; Clausen, Peter-Henning; Nijhof, Ard Menzo

    2017-01-01

    An essential step in the molecular detection of tick-borne pathogens (TBPs) in blood is the extraction of DNA. When cooled storage of blood under field conditions prior to DNA extraction in a dedicated laboratory is not possible, the storage of blood on filter paper forms a promising alternative. We evaluated six DNA extraction methods from blood spotted on FTA Classic ® cards (FTA cards), to determine the optimal protocol for the subsequent molecular detection of TBPs by PCR and the Reverse Line Blot hybridization assay (RLB). Ten-fold serial dilutions of bovine blood infected with Babesia bovis, Theileria mutans, Anaplasma marginale or Ehrlichia ruminantium were made by dilution with uninfected blood and spotted on FTA cards. Subsequently, DNA was extracted from FTA cards using six different DNA extraction protocols. DNA was also isolated from whole blood dilutions using a commercial kit. PCR/RLB results showed that washing of 3mm discs punched from FTA cards with FTA purification reagent followed by DNA extraction using Chelex ® resin was the most sensitive procedure. The detection limit could be improved when more discs were used as starting material for the DNA extraction, whereby the use of sixteen 3mm discs proved to be most practical. The presented best practice method for the extraction of DNA from blood spotted on FTA cards will facilitate epidemiological studies on TBPs. It may be particularly useful for field studies where a cold chain is absent. Copyright © 2016 Elsevier GmbH. All rights reserved.

  13. Advancing Autonomous Operations for Deep Space Vehicles

    Science.gov (United States)

    Haddock, Angie T.; Stetson, Howard K.

    2014-01-01

    Starting in Jan 2012, the Advanced Exploration Systems (AES) Autonomous Mission Operations (AMO) Project began to investigate the ability to create and execute "single button" crew initiated autonomous activities [1]. NASA Marshall Space Flight Center (MSFC) designed and built a fluid transfer hardware test-bed to use as a sub-system target for the investigations of intelligent procedures that would command and control a fluid transfer test-bed, would perform self-monitoring during fluid transfers, detect anomalies and faults, isolate the fault and recover the procedures function that was being executed, all without operator intervention. In addition to the development of intelligent procedures, the team is also exploring various methods for autonomous activity execution where a planned timeline of activities are executed autonomously and also the initial analysis of crew procedure development. This paper will detail the development of intelligent procedures for the NASA MSFC Autonomous Fluid Transfer System (AFTS) as well as the autonomous plan execution capabilities being investigated. Manned deep space missions, with extreme communication delays with Earth based assets, presents significant challenges for what the on-board procedure content will encompass as well as the planned execution of the procedures.

  14. [Opinion and Participation in the Regional Early Breast Cancer Detection Program in 2007 on the part of family physicians from a health district in the Autonomous Community of Madrid, Spain].

    Science.gov (United States)

    Garrido Elustondo, Sofía; Sánchez Padilla, Elisabeth; Ramírez Alesón, Victoria; González Hernández, Ma José; González Navarro, Andrés; López Gómez, Carlos

    2008-01-01

    Mammogram screening is the most effective method for the early detection of breast cancer. The objective of this study is to evaluate the degree of knowledge, the opinion and the participation in the early breast cancer detection program on the part of the family physicians of the Autonomous Community of Madrid. The population studied was comprised of family physicians from Madrid Health District Seven. An anonymous, self-administered questionnaire comprised of 30 questions grouped into physicians characteristics and opinion concerning the early breast cancer detection programs. A total of 46% of the physicians replied. A total of 94% of the physicians believed that it is their duty to inform their patients concerning preventive activities, including breast cancer screening, and 95% believed their advice to be useful for convincing women to have a mammogram. A total of 72% believed information to be lacking on this program. During the time when mammograms are being taken at their centres, 24% of the physicians surveyed always or almost always ask the women if they have any doubts or would like further information, 43% having set up appointments for them and 95% advising them to have a mammogram taken. The family physicians have a good opinion of the early breast cancer detection program and feel their advice to be effective for improving the participation in the program. They report lack of information and inform women about the program to only a small degree.

  15. Rapid detection and typing of pathogenic nonpneumophila Legionella spp. isolates using a multiplex real-time PCR assay.

    Science.gov (United States)

    Benitez, Alvaro J; Winchell, Jonas M

    2016-04-01

    We developed a single tube multiplex real-time PCR assay that allows for the rapid detection and typing of 9 nonpneumophila Legionella spp. isolates that are clinically relevant. The multiplex assay is capable of simultaneously detecting and discriminating L. micdadei, L. bozemanii, L. dumoffii, L. longbeachae, L. feeleii, L. anisa, L. parisiensis, L. tucsonensis serogroup (sg) 1 and 3, and L. sainthelensis sg 1 and 2 isolates. Evaluation of the assay with nucleic acid from each of these species derived from both clinical and environmental isolates and typing strains demonstrated 100% sensitivity and 100% specificity when tested against 43 other Legionella spp. Typing of L. anisa, L. parisiensis, and L. tucsonensis sg 1 and 3 isolates was accomplished by developing a real-time PCR assay followed by high-resolution melt (HRM) analysis targeting the ssrA gene. Further typing of L. bozemanii, L. longbeachae, and L. feeleii isolates to the serogroup level was accomplished by developing a real-time PCR assay followed by HRM analysis targeting the mip gene. When used in conjunction with other currently available diagnostic tests, these assays may aid in rapidly identifying specific etiologies associated with Legionella outbreaks, clusters, sporadic cases, and potential environmental sources. Published by Elsevier Inc.

  16. Evaluation of an expanded microarray for detecting antibiotic resistance genes in a broad range of gram-negative bacterial pathogens.

    Science.gov (United States)

    Card, Roderick; Zhang, Jiancheng; Das, Priya; Cook, Charlotte; Woodford, Neil; Anjum, Muna F

    2013-01-01

    A microarray capable of detecting genes for resistance to 75 clinically relevant antibiotics encompassing 19 different antimicrobial classes was tested on 132 Gram-negative bacteria. Microarray-positive results correlated >91% with antimicrobial resistance phenotypes, assessed using British Society for Antimicrobial Chemotherapy clinical breakpoints; the overall test specificity was >83%. Microarray-positive results without a corresponding resistance phenotype matched 94% with PCR results, indicating accurate detection of genes present in the respective bacteria by microarray when expression was low or absent and, hence, undetectable by susceptibility testing. The low sensitivity and negative predictive values of the microarray results for identifying resistance to some antimicrobial resistance classes are likely due to the limited number of resistance genes present on the current microarray for those antimicrobial agents or to mutation-based resistance mechanisms. With regular updates, this microarray can be used for clinical diagnostics to help accurate therapeutic options to be taken following infection with multiple-antibiotic-resistant Gram-negative bacteria and prevent treatment failure.

  17. Techniques for the detection of pathogenic Cryptococcus species in wood decay substrata and the evaluation of viability in stored samples

    Directory of Open Access Journals (Sweden)

    Christian Alvarez

    2013-02-01

    Full Text Available In this study, we evaluated several techniques for the detection of the yeast form of Cryptococcus in decaying wood and measured the viability of these fungi in environmental samples stored in the laboratory. Samples were collected from a tree known to be positive for Cryptococcus and were each inoculated on 10 Niger seed agar (NSA plates. The conventional technique (CT yielded a greater number of positive samples and indicated a higher fungal density [in colony forming units per gram of wood (CFU.g-1] compared to the humid swab technique (ST. However, the difference in positive and false negative results between the CT-ST was not significant. The threshold of detection for the CT was 0.05.10³ CFU.g-1, while the threshold for the ST was greater than 0.1.10³ CFU-1. No colonies were recovered using the dry swab technique. We also determined the viability of Cryptococcus in wood samples stored for 45 days at 25ºC using the CT and ST and found that samples not only continued to yield a positive response, but also exhibited an increase in CFU.g-1, suggesting that Cryptococcus is able to grow in stored environmental samples. The ST.1, in which samples collected with swabs were immediately plated on NSA medium, was more efficient and less laborious than either the CT or ST and required approximately 10 min to perform; however, additional studies are needed to validate this technique.

  18. Autonomous Propellant Loading Project

    Data.gov (United States)

    National Aeronautics and Space Administration — The AES Autonomous Propellant Loading (APL) project consists of three activities. The first is to develop software that will automatically control loading of...

  19. Autonomous Systems and Operations

    Data.gov (United States)

    National Aeronautics and Space Administration — The AES Autonomous Systems and Operations (ASO) project will develop an understanding of the impacts of increasing communication time delays on mission operations,...

  20. Autonomous Star Tracker Algorithms

    DEFF Research Database (Denmark)

    Betto, Maurizio; Jørgensen, John Leif; Kilsgaard, Søren

    1998-01-01

    Proposal, in response to an ESA R.f.P., to design algorithms for autonomous star tracker operations.The proposal also included the development of a star tracker breadboard to test the algorithms performances.......Proposal, in response to an ESA R.f.P., to design algorithms for autonomous star tracker operations.The proposal also included the development of a star tracker breadboard to test the algorithms performances....

  1. Sample pooling for real-time PCR detection and virulence determination of the footrot pathogen Dichelobacter nodosus.

    Science.gov (United States)

    Frosth, Sara; König, Ulrika; Nyman, Ann-Kristin; Aspán, Anna

    2017-09-01

    Dichelobacter nodosus is the principal cause of ovine footrot and strain virulence is an important factor in disease severity. Therefore, detection and virulence determination of D. nodosus is important for proper diagnosis of the disease. Today this is possible by real-time PCR analysis. Analysis of large numbers of samples is costly and laborious; therefore, pooling of individual samples is common in surveillance programs. However, pooling can reduce the sensitivity of the method. The aim of this study was to develop a pooling method for real-time PCR analysis that would allow sensitive detection and simultaneous virulence determination of D. nodosus. A total of 225 sheep from 17 flocks were sampled using ESwabs within the Swedish Footrot Control Program in 2014. Samples were first analysed individually and then in pools of five by real-time PCR assays targeting the 16S rRNA and aprV2/B2 genes of D. nodosus. Each pool consisted of four negative and one positive D. nodosus samples with varying amounts of the bacterium. In the individual analysis, 61 (27.1%) samples were positive in the 16S rRNA and the aprV2/B2 PCR assays and 164 (72.9%) samples were negative. All samples positive in the aprV2/B2 PCR-assay were of aprB2 variant. The pooled analysis showed that all 41 pools were also positive for D. nodosus 16S rRNA and the aprB2 variant. The diagnostic sensitivity for pooled and individual samples was therefore similar. Our method includes concentration of the bacteria before DNA-extraction. This may account for the maintenance of diagnostic sensitivity. Diagnostic sensitivity in the real-time PCR assays of the pooled samples were comparable to the sensitivity obtained for individually analysed samples. Even sub-clinical infections were able to be detected in the pooled PCR samples which is important for control of the disease. This method may therefore be implemented in footrot control programs where it can replace analysis of individual samples.

  2. Evaluation of the NanoCHIP® Gastrointestinal Panel (GIP Test for Simultaneous Detection of Parasitic and Bacterial Enteric Pathogens in Fecal Specimens.

    Directory of Open Access Journals (Sweden)

    Shifra Ken Dror

    Full Text Available Infectious gastroenteritis is a global health problem associated with high morbidity and mortality rates. Rapid and accurate diagnosis is crucial to allow appropriate and timely treatment. Current laboratory stool testing has a long turnaround time (TAT and demands highly qualified personnel and multiple techniques. The need for high throughput and the number of possible enteric pathogens compels the implementation of a molecular approach which uses multiplex technology, without compromising performance requirements. In this work we evaluated the feasibility of the NanoCHIP® Gastrointestinal Panel (GIP (Savyon Diagnostics, Ashdod, IL, a molecular microarray-based screening test, to be used in the routine workflow of our laboratory, a big outpatient microbiology laboratory. The NanoCHIP® GIP test provides simultaneous detection of nine major enteric bacteria and parasites: Campylobacter spp., Salmonella spp., Shigella spp., Giardia sp., Cryptosporidium spp., Entamoeba histolytica, Entamoeba dispar, Dientamoeba fragilis, and Blastocystis spp. The required high-throughput was obtained by the NanoCHIP® detection system together with the MagNA Pure 96 DNA purification system (Roche Diagnostics Ltd., Switzerland. This combined system has demonstrated a higher sensitivity and detection yield compared to the conventional methods in both, retrospective and prospective samples. The identification of multiple parasites and bacteria in a single test also enabled increased efficiency of detecting mixed infections, as well as reduced hands-on time and work load. In conclusion, the combination of these two automated systems is a proper response to the laboratory needs in terms of improving laboratory workflow, turn-around-time, minimizing human errors and can be efficiently integrated in the routine work of the laboratory.

  3. Using European travellers as an early alert to detect emerging pathogens in countries with limited laboratory resources

    Directory of Open Access Journals (Sweden)

    Grais Rebecca

    2007-01-01

    Full Text Available Abstract Background The volume, extent and speed of travel have dramatically increased in the past decades, providing the potential for an infectious disease to spread through the transportation network. By collecting information on the suspected place of infection, existing surveillance systems in industrialized countries may provide timely information for areas of the world without adequate surveillance currently in place. We present the results of a case study using reported cases of Shigella dysenteriae serotype 1 (Sd1 in European travellers to detect "events" of Sd1, related to either epidemic cases or endemic cases in developing countries. Methods We identified papers from a Medline search for reported events of Sd1 from 1940 to 2002. We requested data on shigella infections reported to the responsible surveillance entities in 17 European countries. Reports of Sd1 from the published literature were then compared with Sd1 notified cases among European travellers from 1990 to 2002. Results Prior to a large epidemic in 1999–2000, no cases of Sd1 had been identified in West Africa. However, if travellers had been used as an early warning, Sd1 could have been identified in this region as earlier as 1992. Conclusion This project demonstr