WorldWideScience

Sample records for autonomous pathogen detection

  1. APDS: Autonomous Pathogen Detection System

    Energy Technology Data Exchange (ETDEWEB)

    Langlois, R G; Brown, S; Burris, L; Colston, B; Jones, L; Makarewicz, T; Mariella, R; Masquelier, D; McBride, M; Milanovich, F; Masarabadi, S; Venkateswaran, K; Marshall, G; Olson, D; Wolcott, D

    2002-02-14

    An early warning system to counter bioterrorism, the Autonomous Pathogen Detection System (APDS) continuously monitors the environment for the presence of biological pathogens (e.g., anthrax) and once detected, it sounds an alarm much like a smoke detector warns of a fire. Long before September 11, 2001, this system was being developed to protect domestic venues and events including performing arts centers, mass transit systems, major sporting and entertainment events, and other high profile situations in which the public is at risk of becoming a target of bioterrorist attacks. Customizing off-the-shelf components and developing new components, a multidisciplinary team developed APDS, a stand-alone system for rapid, continuous monitoring of multiple airborne biological threat agents in the environment. The completely automated APDS samples the air, prepares fluid samples in-line, and performs two orthogonal tests: immunoassay and nucleic acid detection. When compared to competing technologies, APDS is unprecedented in terms of flexibility and system performance.

  2. The Autonomous Pathogen Detection System

    Energy Technology Data Exchange (ETDEWEB)

    Dzenitis, J M; Makarewicz, A J

    2009-01-13

    We developed, tested, and now operate a civilian biological defense capability that continuously monitors the air for biological threat agents. The Autonomous Pathogen Detection System (APDS) collects, prepares, reads, analyzes, and reports results of multiplexed immunoassays and multiplexed PCR assays using Luminex{copyright} xMAP technology and flow cytometer. The mission we conduct is particularly demanding: continuous monitoring, multiple threat agents, high sensitivity, challenging environments, and ultimately extremely low false positive rates. Here, we introduce the mission requirements and metrics, show the system engineering and analysis framework, and describe the progress to date including early development and current status.

  3. APDS: The Autonomous Pathogen Detection System

    Energy Technology Data Exchange (ETDEWEB)

    Hindson, B; Makarewicz, A; Setlur, U; Henderer, B; McBride, M; Dzenitis, J

    2004-10-04

    We have developed and tested a fully autonomous pathogen detection system (APDS) capable of continuously monitoring the environment for airborne biological threat agents. The system was developed to provide early warning to civilians in the event of a bioterrorism incident and can be used at high profile events for short-term, intensive monitoring or in major public buildings or transportation nodes for long-term monitoring. The APDS is completely automated, offering continuous aerosol sampling, in-line sample preparation fluidics, multiplexed detection and identification immunoassays, and nucleic-acid based polymerase chain reaction (PCR) amplification and detection. Highly multiplexed antibody-based and duplex nucleic acid-based assays are combined to reduce false positives to a very low level, lower reagent costs, and significantly expand the detection capabilities of this biosensor. This article provides an overview of the current design and operation of the APDS. Certain sub-components of the ADPS are described in detail, including the aerosol collector, the automated sample preparation module that performs multiplexed immunoassays with confirmatory PCR, and the data monitoring and communications system. Data obtained from an APDS that operated continuously for seven days in a major U.S. transportation hub is reported.

  4. Autonomous system for pathogen detection and identification

    Energy Technology Data Exchange (ETDEWEB)

    Belgrader, P. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Benett, W. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Bergman, W. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Langlois, R. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Mariella, R. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Milanovich, F. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Miles, R. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Venkateswaran, K. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Long, G. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Nelson, W. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    1998-09-24

    This purpose of this project is to build a prototype instrument that will, running unattended, detect, identify, and quantify BW agents. In order to accomplish this, we have chosen to start with the world' s leading, proven, assays for pathogens: surface-molecular recognition assays, such as antibody-based assays, implemented on a high-performance, identification (ID)-capable flow cytometer, and the polymerase chain reaction (PCR) for nucleic-acid based assays. With these assays, we must integrate the capability to: l collect samples from aerosols, water, or surfaces; l perform sample preparation prior to the assays; l incubate the prepared samples, if necessary, for a period of time; l transport the prepared, incubated samples to the assays; l perform the assays; l interpret and report the results of the assays. Issues such as reliability, sensitivity and accuracy, quantity of consumables, maintenance schedule, etc. must be addressed satisfactorily to the end user. The highest possible sensitivity and specificity of the assay must be combined with no false alarms. Today, we have assays that can, in under 30 minutes, detect and identify simulants for BW agents at concentrations of a few hundred colony-forming units per ml of solution. If the bio-aerosol sampler of this system collects 1000 Ymin and concentrates the respirable particles into 1 ml of solution with 70% processing efficiency over a period of 5 minutes, then this translates to a detection/ID capability of under 0.1 agent-containing particle/liter of air.

  5. The Bering Autonomous Target Detection

    DEFF Research Database (Denmark)

    Jørgensen, John Leif; Denver, Troelz; Betto, Maurizio;

    2003-01-01

    telescopes. The method has proven robust in operation and is well suited for use onboard spacecraft. As development target for the method and the associated instrumentation the asteroid research mission Bering has been used. Onboard a spacecraft, the autonomous detection is centered around the fully...

  6. Semi autonomous mine detection system

    Energy Technology Data Exchange (ETDEWEB)

    Douglas Few; Roelof Versteeg; Herman Herman

    2010-04-01

    CMMAD is a risk reduction effort for the AMDS program. As part of CMMAD, multiple instances of semi autonomous robotic mine detection systems were created. Each instance consists of a robotic vehicle equipped with sensors required for navigation and marking, a countermine sensors and a number of integrated software packages which provide for real time processing of the countermine sensor data as well as integrated control of the robotic vehicle, the sensor actuator and the sensor. These systems were used to investigate critical interest functions (CIF) related to countermine robotic systems. To address the autonomy CIF, the INL developed RIK was extended to allow for interaction with a mine sensor processing code (MSPC). In limited field testing this system performed well in detecting, marking and avoiding both AT and AP mines. Based on the results of the CMMAD investigation we conclude that autonomous robotic mine detection is feasible. In addition, CMMAD contributed critical technical advances with regard to sensing, data processing and sensor manipulation, which will advance the performance of future fieldable systems. As a result, no substantial technical barriers exist which preclude – from an autonomous robotic perspective – the rapid development and deployment of fieldable systems.

  7. Rapid Detection of Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    David Perlin

    2005-08-14

    Pathogen identification is a crucial first defense against bioterrorism. A major emphasis of our national biodefense strategy is to establish fast, accurate and sensitive assays for diagnosis of infectious diseases agents. Such assays will ensure early and appropriate treatment of infected patients. Rapid diagnostics can also support infection control measures, which monitor and limit the spread of infectious diseases agents. Many select agents are highly transmissible in the early stages of disease, and it is critical to identify infected patients and limit the risk to the remainder of the population and to stem potential panic in the general population. Nucleic acid-based molecular approaches for identification overcome many of the deficiencies associated with conventional culture methods by exploiting both large- and small-scale genomic differences between organisms. PCR-based amplification of highly conserved ribosomal RNA (rRNA) genes, intergenic sequences, and specific toxin genes is currently the most reliable approach for bacterial, fungal and many viral pathogenic agents. When combined with fluorescence-based oligonucleotide detection systems, this approach provides real-time, quantitative, high fidelity analysis capable of single nucleotide allelic discrimination (4). These probe systems offer rapid turn around time (<2 h) and are suitable for high throughput, automated multiplex operations that are critical for clinical diagnostic laboratories. In this pilot program, we have used molecular beacon technology invented at the Public health Research Institute to develop a new generation of molecular probes to rapidly detect important agents of infectious diseases. We have also developed protocols to rapidly extract nucleic acids from a variety of clinical specimen including and blood and tissue to for detection in the molecular assays. This work represented a cooperative research development program between the Kramer-Tyagi/Perlin labs on probe development

  8. Obstacle Detection and Avoidance Autonomous Car

    OpenAIRE

    K.Vasavi; M.V.S.Praveen

    2014-01-01

    Driving models are needed by many researchers to improve traffic safety and to advance autonomous vehicle design. To be most useful, a driving model must state specifically what information is needed and how it is processed. So we developed an “Obstacle Avoidance and Detection Autonomous Car” based on sensor application. The essential part of this autonomous car is that it drives taking the energy from solar panel. This paper explains the method of interfacing the solar panel, relay circuit b...

  9. Multiplex detection of agricultural pathogens

    Energy Technology Data Exchange (ETDEWEB)

    McBride, Mary Teresa (Brentwood, CA); Slezak, Thomas Richard (Livermore, CA); Messenger, Sharon Lee (Kensington, CA)

    2010-09-14

    Described are kits and methods useful for detection of seven agricultural pathogens (BPSV; BHV; BVD; FMDV; BTV; SVD; and VESV) in a sample. Genomic sequence information from 7 agricultural pathogens was analyzed to identify signature sequences, e.g., polynucleotide sequences useful for confirming the presence or absence of a pathogen in a sample. Primer and probe sets were designed and optimized for use in a PCR based, multiplexed Luminex assay to successfully identify the presence or absence of pathogens in a sample.

  10. Multiplex detection of respiratory pathogens

    Energy Technology Data Exchange (ETDEWEB)

    McBride, Mary (Brentwood, CA); Slezak, Thomas (Livermore, CA); Birch, James M. (Albany, CA)

    2012-07-31

    Described are kits and methods useful for detection of respiratory pathogens (influenza A (including subtyping capability for H1, H3, H5 and H7 subtypes) influenza B, parainfluenza (type 2), respiratory syncytial virus, and adenovirus) in a sample. Genomic sequence information from the respiratory pathogens was analyzed to identify signature sequences, e.g., polynucleotide sequences useful for confirming the presence or absence of a pathogen in a sample. Primer and probe sets were designed and optimized for use in a PCR based, multiplexed Luminex assay to successfully identify the presence or absence of pathogens in a sample.

  11. Autonomous valve for detection of biopolymer degradation

    OpenAIRE

    Keller, Stephan Urs; Noeth, Nadine-Nicole; Fetz, Stefanie; Grünefeld, Marco; Geschke, Oliver; Boisen, Anja; Haefliger, D.

    2009-01-01

    We present a polymer microvalve that allows the detection of biopolymer degradation without the need of external energy. The valve is based on a polymer container filled with a colored marker solution and closed by a thin lid. This structure is covered by a film of poly(L-lactide) and degradation of the biopolymer triggers the release of the color which is detected visually. The autonomous valve has potential for the fast testing of biopolymer degradation under various environmental condition...

  12. Spectroscopic Detection of Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    ALAM,M. KATHLEEN; TIMLIN,JERILYN A.; MARTIN,LAURA E.; HJELLE,DRIAN; LYONS,RICK; GARRISON,KRISTIN

    2000-11-01

    The goal of this LDRD Research project was to provide a preliminary examination of the use of infrared spectroscopy as a tool to detect the changes in cell cultures upon activation by an infectious agent. Due to a late arrival of funding, only 5 months were available to transfer and setup equipment at UTTM,develop cell culture lines, test methods of in-situ activation and collect kinetic data from activated cells. Using attenuated total reflectance (ATR) as a sampling method, live cell cultures were examined prior to and after activation. Spectroscopic data were collected from cells immediately after activation in situ and, in many cases for five successive hours. Additional data were collected from cells activated within a test tube (pre-activated), in both transmission mode as well as in ATR mode. Changes in the infrared data were apparent in the transmission data collected from the pre-activated cells as well in some of the pre-activated ATR data. Changes in the in-situ activated spectral data were only occasionally present due to (1) the limited time cells were studied and (2) incomplete activation. Comparison of preliminary data to infrared bands reported in the literature suggests the primary changes seen are due an increase in ribonucleic acid (RNA) production. This work will be continued as part of a 3 year DARPA grant.

  13. Autonomous valve for detection of biopolymer degradation

    DEFF Research Database (Denmark)

    Keller, Stephan Urs; Noeth, Nadine-Nicole; Fetz, Stefanie; Grünefeld, Marco; Geschke, Oliver; Boisen, Anja; Haefliger, D.

    We present a polymer microvalve that allows the detection of biopolymer degradation without the need of external energy. The valve is based on a polymer container filled with a colored marker solution and closed by a thin lid. This structure is covered by a film of poly(L-lactide) and degradation...... of the biopolymer triggers the release of the color which is detected visually. The autonomous valve has potential for the fast testing of biopolymer degradation under various environmental conditions or by specific enzymes....

  14. Adaptively detecting changes in Autonomic Grid Computing

    KAUST Repository

    Zhang, Xiangliang

    2010-10-01

    Detecting the changes is the common issue in many application fields due to the non-stationary distribution of the applicative data, e.g., sensor network signals, web logs and gridrunning logs. Toward Autonomic Grid Computing, adaptively detecting the changes in a grid system can help to alarm the anomalies, clean the noises, and report the new patterns. In this paper, we proposed an approach of self-adaptive change detection based on the Page-Hinkley statistic test. It handles the non-stationary distribution without the assumption of data distribution and the empirical setting of parameters. We validate the approach on the EGEE streaming jobs, and report its better performance on achieving higher accuracy comparing to the other change detection methods. Meanwhile this change detection process could help to discover the device fault which was not claimed in the system logs. © 2010 IEEE.

  15. Molecular detection of foodborne pathogens

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hartmann

    for detection and enumeration of Salmonella and Campylobacter are time-consuming and laborious. They lack specificity and do not enable detection of viable but non-culturable (VBNC) bacteria. The focus of the present thesis has been development and validation of PCR-based detection methods for Salmonella...... of these pathogens in the food chain, in order to improve intervention strategies and make more effective the control of production lines and single food items. To serve this purpose, rapid and reliable detection and quantification methods are imperative. The culture-based standard methods currently applied...... and Campylobacter. A conventional PCR-based method for detection of Campylobacter in chicken carcass rinse following 20 h of enrichment in Bolton broth was successfully compared to the ISO standard culture-based method (10272) on 68 naturally infected chickens. The method was subsequently validated on artificially...

  16. Autonomous Chemical Vapour Detection by Micro UAV

    Directory of Open Access Journals (Sweden)

    Kent Rosser

    2015-12-01

    Full Text Available The ability to remotely detect and map chemical vapour clouds in open air environments is a topic of significant interest to both defence and civilian communities. In this study, we integrate a prototype miniature colorimetric chemical sensor developed for methyl salicylate (MeS, as a model chemical vapour, into a micro unmanned aerial vehicle (UAV, and perform flights through a raised MeS vapour cloud. Our results show that that the system is capable of detecting MeS vapours at low ppm concentration in real-time flight and rapidly sending this information to users by on-board telemetry. Further, the results also indicate that the sensor is capable of distinguishing “clean” air from “dirty”, multiple times per flight, allowing us to look towards autonomous cloud mapping and source localization applications. Further development will focus on a broader range of integrated sensors, increased autonomy of detection and improved engineering of the system.

  17. Autonomous Rule Creation for Intrusion Detection

    Energy Technology Data Exchange (ETDEWEB)

    Todd Vollmer; Jim Alves-Foss; Milos Manic

    2011-04-01

    Many computational intelligence techniques for anomaly based network intrusion detection can be found in literature. Translating a newly discovered intrusion recognition criteria into a distributable rule can be a human intensive effort. This paper explores a multi-modal genetic algorithm solution for autonomous rule creation. This algorithm focuses on the process of creating rules once an intrusion has been identified, rather than the evolution of rules to provide a solution for intrusion detection. The algorithm was demonstrated on anomalous ICMP network packets (input) and Snort rules (output of the algorithm). Output rules were sorted according to a fitness value and any duplicates were removed. The experimental results on ten test cases demonstrated a 100 percent rule alert rate. Out of 33,804 test packets 3 produced false positives. Each test case produced a minimum of three rule variations that could be used as candidates for a production system.

  18. 新疆阿拉山口艾比湖湿地蜱种莱姆病病原体检测%Detection of Lyme disease pathogens in isolated ticks at Aibi Lake, Alataw Pass, Xinjiang Autonomous Region

    Institute of Scientific and Technical Information of China (English)

    王安东; 徐军; 王远志; 徐新龙; 戴莉; 杜景云; 王丽娜; 牟路萌; 肖云霞

    2015-01-01

    目的 了解新疆阿拉山口艾比湖湿地主要蜱种莱姆病螺旋体感染与基因型状况.方法 2014年4-8月,在新疆艾比湖湿地选取3个采集点,采用布旗法采集游离蜱,经形态学鉴定蜱种后,采用巢式PCR法扩增莱姆病病原5S-23S rRNA基因,将PCR产物测序并进行BLAST比对分析.结果 共检测游离蜱152只,其中血红扇头蜱12只、亚洲璃眼蜱59只、边缘革蜱81只.各蜱种莱姆病病原总体阳性率为34.87%(53/152),其中亚洲璃眼蜱阳性率为(57.63%,34/59),边缘革蜱阳性率为(22.22%,18/81),血红扇头蜱阳性率为(8.33%,1/12),亚洲璃眼蜱的阳性率高于边缘革蜱和血红扇头蜱(x2=18.328、9.694,P均<0.05);5S-23SrRNA基因测序比对显示艾比湖湿地莱姆病基因型为伯氏疏螺旋体.结论 首次在新疆阿拉山口艾比湖湿地硬蜱检测到伯氏疏螺旋体,提示新疆艾比湖为莱姆病病原自然疫源地.%Objective In order to understand the major tick species,Borrelia burgdorferi infection and genotype status at Aibi Lake,Alataw Pass,Xinjiang Autonomous Region.Methods Free-living ticks were collected by drag-flag method from April to August,2014,and the morphological identification was carried out.Borrelia spp.was detected by 5S-23S rRNA gene primers.The PCR products were sequenced and analyzed with BLAST.Results One hundred fifty-two isolated ticks were collected,including Rhipicephalus sanguineus (12),Hyalomma asiaticum (59) and Dermacentor Marginatus (81).The positive rate of Borrelia spp.was 34.87% (53/152).The positive rate of Hyalomma asiaticum (57.63%,34/59) was higher than that of Dermacentor Marginatus (22.22%,18/81,x2 =18.328,P < 0.05) and Rhipicephalus sanguineus (8.33%,1/12,x2 =9.694,P < 0.05).The analysis of 5S-23S rRNA sequencing indicated the pathogen was Borrelia burgdorferi sensu stricto.Conclusions Borrelia burgdorferi sensu stricto in ticks is firstly detected in Alataw region.The results conveyed us Aibi

  19. PathogenMip Assay: A Multiplex Pathogen Detection Assay

    OpenAIRE

    Akhras, Michael S.; Sreedevi Thiyagarajan; Villablanca, Andrea C.; Davis, Ronald W; Pål Nyrén; Nader Pourmand

    2007-01-01

    The Molecular Inversion Probe (MIP) assay has been previously applied to a large-scale human SNP detection. Here we describe the PathogenMip Assay, a complete protocol for probe production and applied approaches to pathogen detection. We have demonstrated the utility of this assay with an initial set of 24 probes targeting the most clinically relevant HPV genotypes associated with cervical cancer progression. Probe construction was based on a novel, cost-effective, ligase-based protocol. The ...

  20. Microarrays for Pathogen Detection and Analysis

    OpenAIRE

    McLoughlin, Kevin S.

    2011-01-01

    DNA microarrays have emerged as a viable platform for detection of pathogenic organisms in clinical and environmental samples. These microbial detection arrays occupy a middle ground between low cost, narrowly focused assays such as multiplex PCR and more expensive, broad-spectrum technologies like high-throughput sequencing. While pathogen detection arrays have been used primarily in a research context, several groups are aggressively working to develop arrays for clinical diagnostics, food ...

  1. Metagenomics for pathogen detection in public health

    OpenAIRE

    Miller, Ruth R.; Montoya, Vincent; Gardy, Jennifer L; Patrick, David M.; Tang, Patrick

    2013-01-01

    Traditional pathogen detection methods in public health infectious disease surveillance rely upon the identification of agents that are already known to be associated with a particular clinical syndrome. The emerging field of metagenomics has the potential to revolutionize pathogen detection in public health laboratories by allowing the simultaneous detection of all microorganisms in a clinical sample, without a priori knowledge of their identities, through the use of next-generation DNA sequ...

  2. Digital PCR for detection of citrus pathogens

    Science.gov (United States)

    Citrus trees are often infected with multiple pathogens of economic importance, especially those with insect or mite vectors. Real-time/quantitative PCR (qPCR) has been used for high-throughput detection and relative quantification of pathogens; however, target reference or standards are required. I...

  3. Molecular detection of foodborne pathogens

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hartmann

    Salmonella and Campylobacter are recognised as some of the most important foodborne pathogens worldwide. Human infections have wide health and socioeconomic consequences. Lots of effort has been devoted to increase the knowledge on the prevalence, transmission routes and persistence of these...

  4. Sensor Fault Detection and Diagnosis for autonomous vehicles

    Directory of Open Access Journals (Sweden)

    Realpe Miguel

    2015-01-01

    Full Text Available In recent years testing autonomous vehicles on public roads has become a reality. However, before having autonomous vehicles completely accepted on the roads, they have to demonstrate safe operation and reliable interaction with other traffic participants. Furthermore, in real situations and long term operation, there is always the possibility that diverse components may fail. This paper deals with possible sensor faults by defining a federated sensor data fusion architecture. The proposed architecture is designed to detect obstacles in an autonomous vehicle’s environment while detecting a faulty sensor using SVM models for fault detection and diagnosis. Experimental results using sensor information from the KITTI dataset confirm the feasibility of the proposed architecture to detect soft and hard faults from a particular sensor.

  5. Automated Methods for Multiplexed Pathogen Detection

    Energy Technology Data Exchange (ETDEWEB)

    Straub, Tim M.; Dockendorff, Brian P.; Quinonez-Diaz, Maria D.; Valdez, Catherine O.; Shutthanandan, Janani I.; Tarasevich, Barbara J.; Grate, Jay W.; Bruckner-Lea, Cindy J.

    2005-09-01

    Detection of pathogenic microorganisms in environmental samples is a difficult process. Concentration of the organisms of interest also co-concentrates inhibitors of many end-point detection methods, notably, nucleic acid methods. In addition, sensitive, highly multiplexed pathogen detection continues to be problematic. The primary function of the BEADS (Biodetection Enabling Analyte Delivery System) platform is the automated concentration and purification of target analytes from interfering substances, often present in these samples, via a renewable surface column. In one version of BEADS, automated immunomagnetic separation (IMS) is used to separate cells from their samples. Captured cells are transferred to a flow-through thermal cycler where PCR, using labeled primers, is performed. PCR products are then detected by hybridization to a DNA suspension array. In another version of BEADS, cell lysis is performed, and community RNA is purified and directly labeled. Multiplexed detection is accomplished by direct hybridization of the RNA to a planar microarray. The integrated IMS/PCR version of BEADS can successfully purify and amplify 10 E. coli O157:H7 cells from river water samples. Multiplexed PCR assays for the simultaneous detection of E. coli O157:H7, Salmonella, and Shigella on bead suspension arrays was demonstrated for the detection of as few as 100 cells for each organism. Results for the RNA version of BEADS are also showing promising results. Automation yields highly purified RNA, suitable for multiplexed detection on microarrays, with microarray detection specificity equivalent to PCR. Both versions of the BEADS platform show great promise for automated pathogen detection from environmental samples. Highly multiplexed pathogen detection using PCR continues to be problematic, but may be required for trace detection in large volume samples. The RNA approach solves the issues of highly multiplexed PCR and provides ''live vs. dead

  6. Detection of foodborne pathogens using microarray technology

    Science.gov (United States)

    Assays based on the polymerase chain reaction (PCR) are now accepted methods for rapidly confirming the presence or absence of specific pathogens in foods and other types of samples. Conventional PCR requires the use of agarose gel electrophoresis to detect the PCR product; whereas, real-time PCR c...

  7. Quantitative multiplex detection of pathogen biomarkers

    Energy Technology Data Exchange (ETDEWEB)

    Mukundan, Harshini; Xie, Hongzhi; Swanson, Basil I.; Martinez, Jennifer; Grace, Wynne K.

    2016-02-09

    The present invention addresses the simultaneous detection and quantitative measurement of multiple biomolecules, e.g., pathogen biomarkers through either a sandwich assay approach or a lipid insertion approach. The invention can further employ a multichannel, structure with multi-sensor elements per channel.

  8. Surrounding Moving Obstacle Detection for Autonomous Driving Using Stereo Vision

    OpenAIRE

    Hao Sun; Huanxin Zou; Shilin Zhou; Cheng Wang; Naser El-Sheimy

    2013-01-01

    Detection and tracking surrounding moving obstacles such as vehicles and pedestrians are crucial for the safety of mobile robotics and autonomous vehicles. This is especially the case in urban driving scenarios. This paper presents a novel framework for surrounding moving obstacles detection using binocular stereo vision. The contributions of our work are threefold. Firstly, a multiview feature matching scheme is presented for simultaneous stereo correspondence and motion correspondence searc...

  9. Autonomous Chemical Vapour Detection by Micro UAV

    OpenAIRE

    Kent Rosser; Karl Pavey; Nicholas FitzGerald; Anselm Fatiaki; Daniel Neumann; David Carr; Brian Hanlon; Javaan Chahl

    2015-01-01

    The ability to remotely detect and map chemical vapour clouds in open air environments is a topic of significant interest to both defence and civilian communities. In this study, we integrate a prototype miniature colorimetric chemical sensor developed for methyl salicylate (MeS), as a model chemical vapour, into a micro unmanned aerial vehicle (UAV), and perform flights through a raised MeS vapour cloud. Our results show that that the system is capable of detecting MeS vapours at low ppm con...

  10. Biosensors for the Detection of Food Pathogens

    OpenAIRE

    Palmiro Poltronieri; Valeria Mezzolla; Elisabetta Primiceri; Giuseppe Maruccio

    2014-01-01

    Food pathogens frequently cause foodborne diseases. There is a need to rapidly identify the source of the bacteria in order to contain their spread and epidemics. A pre-enrichment culture or a direct culture on agar plate are standard microbiological methods. In this review, we present an update on alternative molecular methods to nucleic acid-based detection for species identification. Biosensor-based methods rely on the recognition of antigen targets or receptors by antibodies, aptamers o...

  11. Rapid methods: the detection of foodborne pathogens

    OpenAIRE

    Beumer, R. R.; Hazeleger, W. C.

    2009-01-01

    Although bacteria are the first type of microorganisms that come to mind when discussing microbial food safety, they are by no means the only pathogenic foodborne microorganisms. Mycotoxin producing moulds, human enteric viruses, protozoan parasites and marine biotoxins are also of importance. However, since foods are only screened for bacteria routinely, in this article we will focus on the techniques used to detect bacterial contamination.

  12. Bacteriophages for detection of bacterial pathogens

    International Nuclear Information System (INIS)

    The G. Eliava Institute of Bacteriophages, Microbiology and Virology (Tbilisi, Georgia) is one of the most famous institutions focused on bacteriophage research for the elaboration of appropriate phage methodologies for human and animal protection. The main direction of the institute is the study and production of bacteriophages against intestinal disorders (dysentery, typhoid, intesti) and purulent-septic infections (staphylococcus, streptococcus, pyophage, etc.). These preparations were successfully introduced during the Soviet era, and for decades were used throughout the former Soviet Union and in other Socialist countries for the treatment, prophylaxis, and diagnosis of various infectious diseases, including those caused by antibiotic-resistant bacterial strains. Bacteriophages were widely used for identifying and detecting infections caused by the most dangerous pathogens and causative agents of epidemiological outbreaks. The specific topic of this presentation is the phage typing of bacterial species, which can be an important method for epidemiological diagnostics. Together with different genetic methodologies - such as PCR-based methods, PFGE, plasmid fingerprinting, and ribosomal typing - phage typing is one method for identifying bacterial pathogens. The method has a high percentage of determination of phage types, high specificity of reaction, and is easy for interpretation and use by health workers. Phage typing was applied for inter-species differentiation of different species of Salmonella, S. typhi, Brucella spp, Staphylococcus aureus, E. col,i Clostridium deficile, Vibrio cholerae, Yersinia pestis, Yersinia enterocolitica, Lysteria monocytogenes, Clostridium perfringens, Clostridium tetani, plant pathogens, and other bacterial pathogens. In addition to addressing the utility and efficacy of phage typing, the paper will discuss the isolation and selection of diagnostic typing phages for interspecies differentiation of pathogens that is necessary

  13. Detection of pathogens from periodontal lesions

    Directory of Open Access Journals (Sweden)

    Malheiros Veruska de João

    2004-01-01

    Full Text Available OBJECTIVE: To comparatively detect A. actinomycetemcomitans and F. nucleatum from periodontal and healthy sites. METHODS: Subgingival clinical samples from 50 periodontitis adult patients and 50 healthy subjects were analyzed. Both organisms were isolated using a trypticase soy agar-bacitracin-vancomycin (TSBV medium and detected by PCR. Conventional biochemical tests were used for bacteria identification. RESULTS: A. actinomycetemcomitans and F. nucleatum were isolated in 18% and 20% of the patients, respectively, and in 2% and 24% of healthy subjects. Among A. actinomycetemcomitans isolates, biotype II was the most prevalent. Primer pair AA was 100% sensitive in the detection of A. actinomycetemcomitans from both subject groups. Primers ASH and FU were also 100% sensitive to detect this organism in healthy subject samples. Primer pair FN5047 was more sensitive to detect F. nucleatum in patients or in healthy samples than primer 5059S. Primers ASH and 5059S were more specific in the detection of A. actinomycetemcomitans and F. nucleatum, respectively, in patients and in healthy subject samples. CONCLUSIONS: PCR is an effective tool for detecting periodontal pathogens in subgingival samples, providing a faster and safer diagnostic tool of periodontal diseases. The method's sensitivity and specificity is conditioned by the choice of the set of primers used.

  14. Biosensors: tool for food borne pathogen detection

    Directory of Open Access Journals (Sweden)

    Heena Sharma

    2013-12-01

    Full Text Available A paramount and alluring sphere of research, now-a-days, is food analysis, because of the breakneck augmentation of food enterprise and highly hightened maneuverability of today's populations. The management of food quality is very indispensable both for consumer safeguard as well as the food corporations. The biosensors' application in the field of food analysis is quite propitious for the revealing of food borne pathogens. Biosensor, an analytical device, transforms a biological response into an electrical signal. Bioreceptors and transducers are the two main components of a biosensor. Bioreceptor or biorecognition element is the one which leads to the recognition of target analyte and a transducer, for the conversion of recognized event into a measurable electrical signal. The development of biosensors improved the sensitivity and selectivity of detection techniques for food borne pathogens and is rapid, reliable, effective and highly suitable when used in in situ analysis. Since the security in the food supply becomes crucial because of increased perception among consumers and vying nature of food industries, the necessity for expeditious, low volume and sensitive biosensor devices has productively increased. Nevertheless, till date, a very few biosensor systems are available commercially such as Biacore, SpreetaTM, Reichert SR 7000, Analyte 2000, RAPTOR etc. Since, there is ever growing concern regarding safe food and water supply, it is very obvious that the demand for rapid detecting biosensors will also be increasing at par.

  15. Antibody conjugated graphene nanocomposites for pathogen detection

    Science.gov (United States)

    Sign, Chandan; Sumana, Gajjala

    2016-04-01

    Graphene oxide (GO), due to its excellent electrochemical properties and large surface area, known to be highly suitable material for biosensing application. Here, we report in situ synthesis of silver nanopaticles (AgNPs) onto the GO sheets for the electrochemical detection of Salmonella typhimurium (S.typhimurium). The GO-AgNPs composites have been deposited onto the indium tin oxide (ITO) coated glass substrate by the electrophoretic deposition technique. Carbodiimide coupling (EDC-NHS) has been used for the immobilization of antibodies of Salmonella typhimurium (anti-S.typhimurium) for detection of S.typhimurium. The electron microscopy and UV-visible studies reveal successful synthesis GO-AgNPs composites while FT-IR studies suggest the proper immobilization of anti-S.typhi. The cyclic voltammetry (CV) has been utilized for detection using anti-S.typhi/GOAgNPs/ITO based immunoelectrode as a function of S.typhimurium concentration. The fabricated immunosensor shows improved sensitivity of 33.04 μACFU-1mLcm-2 in a wide detection range of 101 to 106 CFUmL-1. This immunosensor may be utilized for the detection of other food borne pathogens like aflatoxin and E.coli also.

  16. Biosensors for the Detection of Food Pathogens

    Directory of Open Access Journals (Sweden)

    Palmiro Poltronieri

    2014-09-01

    Full Text Available Food pathogens frequently cause foodborne diseases. There is a need to rapidly identify the source of the bacteria in order to contain their spread and epidemics. A pre-enrichment culture or a direct culture on agar plate are standard microbiological methods. In this review, we present an update on alternative molecular methods to nucleic acid-based detection for species identification. Biosensor-based methods rely on the recognition of antigen targets or receptors by antibodies, aptamers or high-affinity ligands. The captured antigens may be then directly or indirectly detected through an antibody or high-affinity and high-specificity recognition molecule. Various different detection methods are discussed, from label-free sensors and immunosensors to fluorescence-based ones. Each method shows advantages and disadvantages in terms of equipment, sensitivity, simplicity and cost-effectiveness. Finally, lab-on-a-chip (LOC devices are introduced briefly, with the potential to be fast, sensitive and useful for on-site bacteria detection in food processing laboratories to check potential contamination by sample monitoring combined with a rapid pre-enrichment step.

  17. Robust water hazard detection for autonomous off-road navigation

    Institute of Scientific and Technical Information of China (English)

    Tuo-zhong YAO; Zhi-yu XIANG; Ji-lin LIU

    2009-01-01

    Existing water hazard detection methods usually fail when the features of water surfaces are greatly changed by the surroundings, e.g., by a change in illumination. This paper proposes a novel algorithm to robustly detect different kinds of water hazards for autonomous navigation. Our algorithm combines traditional machine learning and image segmentation and uses only digital cameras, which are usually affordable, as the visual sensors. Active learning is used for automatically dealing with problems caused by the selection, labeling and classification of large numbers of training sets. Mean-shift based image segmentation is used to refine the final classification. Our experimental results show that our new algorithm can accurately detect not only 'common' water hazards, which usually have the features of both high brightness and low texture, but also 'special' water hazards that may have lots of ripples or low brightness.

  18. Surrounding Moving Obstacle Detection for Autonomous Driving Using Stereo Vision

    Directory of Open Access Journals (Sweden)

    Hao Sun

    2013-06-01

    Full Text Available Detection and tracking surrounding moving obstacles such as vehicles and pedestrians are crucial for the safety of mobile robotics and autonomous vehicles. This is especially the case in urban driving scenarios. This paper presents a novel framework for surrounding moving obstacles detection using binocular stereo vision. The contributions of our work are threefold. Firstly, a multiview feature matching scheme is presented for simultaneous stereo correspondence and motion correspondence searching. Secondly, the multiview geometry constraint derived from the relative camera positions in pairs of consecutive stereo views is exploited for surrounding moving obstacles detection. Thirdly, an adaptive particle filter is proposed for tracking of multiple moving obstacles in surrounding areas. Experimental results from real‐world driving sequences demonstrate the effectiveness and robustness of the proposed framework.

  19. Field application of pathogen detection technologies

    Energy Technology Data Exchange (ETDEWEB)

    Straub, Tim M.; Call, Douglas R.; Bruckner-Lea, Cindy J.; Colburn, Heather A.; Baird, Cheryl L.; Bartholomew, Rachel A.; Ozanich, Richard M.; Jarman, Kristin H.

    2016-06-29

    Over the last 10 years there has been a significant increase in commercial products designed for field-based detection of microbial pathogens. This is due, in part, to the anthrax attacks in the United States in 2001, and the need for first responders to quickly identify the composition of suspected white powders and other potential biothreats. Demand for rapid detection is also driven by the need to ensure safe food, water, and environmental systems. From a technology perspective, rapid identification methods have largely capitalized on PCR and other molecular recognition techniques that can be deployed as robust field instrumentation. Examples of the relevant needs include the ability to: 1) declare a water distribution system free of microbial pathogens after a pipe/main break repair; 2) assess risks of contamination such as when produce production and processing plants are located near concentrated animal feeing operations; 3) evaluate the safety of ready-to-eat products; 4) determine the extent of potential serious disease outbreaks in remote and/or disaster stricken areas where access to clinical laboratories is not an immediate option; and 5) quickly assess credible biological terrorism events. Many of the principles underlying rapid detection methods are derived from methods for environmental microbiology, but there is a dearth of literature describing and evaluating field-based detection systems. Thus, the aims of this chapter are to: 1) summarize the different kinds of commercially available sampling kits and field-based biological detectors; 2) highlight some of the continued challenges of sample preparation to stimulate new research towards minimizing the impact of inhibitors on PCR-based detection systems; 3) describe our general rationale and statistically-based approach for instrument evaluation; 4) provide statistical and spatial guidelines for developing valid sampling plans; and 5) summarize some current needs and emerging technologies. This

  20. Obstacle detection for autonomous navigation : an LDRD final report.

    Energy Technology Data Exchange (ETDEWEB)

    Padilla, Denise D.

    2004-03-01

    This report summarizes the analytical and experimental efforts for the Laboratory Directed Research and Development (LDRD) project entitled 'Obstacle Detection for Autonomous Navigation'. The principal goal of this project was to develop a mathematical framework for obstacle detection. The framework provides a basis for solutions to many complex obstacle detection problems critical to successful autonomous navigation. Another goal of this project was to characterize sensing requirements in terms of physical characteristics of obstacles, vehicles, and terrain. For example, a specific vehicle traveling at a specific velocity over a specific terrain requires a sensor with a certain range of detection, resolution, field-of-view, and sufficient sensitivity to specific obstacle characteristics. In some cases, combinations of sensors were required to distinguish between different hazardous obstacles and benign terrain. In our framework, the problem was posed as a multidimensional, multiple-hypothesis, pattern recognition problem. Features were extracted from selected sensors that allow hazardous obstacles to be distinguished from benign terrain and other types of obstacles. Another unique thrust of this project was to characterize different terrain classes with respect to both positive (e.g., rocks, trees, fences) and negative (e.g., holes, ditches, drop-offs) obstacles. The density of various hazards per square kilometer was statistically quantified for different terrain categories (e.g., high desert, ponderosa forest, and prairie). This quantification reflects the scale, or size, and mobility of different types of vehicles. The tradeoffs between obstacle detection, position location, path planning, and vehicle mobility capabilities were also to be characterized.

  1. Motor execution detection based on autonomic nervous system responses

    International Nuclear Information System (INIS)

    Triggered assistance has been shown to be a successful robotic strategy for provoking motor plasticity, probably because it requires neurologic patients’ active participation to initiate a movement involving their impaired limb. Triggered assistance, however, requires sufficient residual motor control to activate the trigger and, thus, is not applicable to individuals with severe neurologic injuries. In these situations, brain and body–computer interfaces have emerged as promising solutions to control robotic devices. In this paper, we investigate the feasibility of a body–machine interface to detect motion execution only monitoring the autonomic nervous system (ANS) response. Four physiological signals were measured (blood pressure, breathing rate, skin conductance response and heart rate) during an isometric pinching task and used to train a classifier based on hidden Markov models. We performed an experiment with six healthy subjects to test the effectiveness of the classifier to detect rest and active pinching periods. The results showed that the movement execution can be accurately classified based only on peripheral autonomic signals, with an accuracy level of 84.5%, sensitivity of 83.8% and specificity of 85.2%. These results are encouraging to perform further research on the use of the ANS response in body–machine interfaces. (paper)

  2. Autonomous Detection of Aerosolized Biological Agents by Multiplexed Immunoassay with PCR Confirmation

    Energy Technology Data Exchange (ETDEWEB)

    Hindson, B J; McBride, M T; Makarewicz, A J; Henderer, B D; Setlur, U S; Smith, S M; Gutierrez, D M; Metz, T R; Nasarabadi, S L; Venkateswaran, K S; Farrow, S W; Colston, Jr., B W; Dzenitis, J M

    2004-05-27

    The autonomous pathogen detection system (APDS) is an automated, podium-sized instrument that continuously monitors the air for biological threat agents (bacteria, viruses, and toxins). The system has been developed to warn of a biological attack in critical or high-traffic facilities and at special events. The APDS performs continuous aerosol collection, sample preparation, and detection using multiplexed immunoassay followed by confirmatory PCR using real-time TaqMan assays. We have integrated completely reusable flow-through devices that perform DNA extraction and PCR amplification. The fully integrated system was challenged with aerosolized Bacillus anthracis, Yersinia pestis, Bacillus globigii and botulinum toxoid. By coupling highly selective antibody and DNA based assays, the probability of an APDS reporting a false positive is extremely low.

  3. Foodborne pathogen detection using hyperspectral imaging

    Science.gov (United States)

    Foodborne pathogens can cause various diseases and even death when humans consume foods contaminated with microbial pathogens. Traditional culture-based direct plating methods are still the “gold standard” for presumptive-positive pathogen screening. Although considerable research has been devoted t...

  4. Autonomous mine detection system (AMDS) neutralization payload module

    Science.gov (United States)

    Majerus, M.; Vanaman, R.; Wright, N.

    2010-04-01

    The Autonomous Mine Detection System (AMDS) program is developing a landmine and explosive hazards standoff detection, marking, and neutralization system for dismounted soldiers. The AMDS Capabilities Development Document (CDD) has identified the requirement to deploy three payload modules for small robotic platforms: mine detection and marking, explosives detection and marking, and neutralization. This paper addresses the neutralization payload module. There are a number of challenges that must be overcome for the neutralization payload module to be successfully integrated into AMDS. The neutralizer must meet stringent size, weight, and power (SWaP) requirements to be compatible with a small robot. The neutralizer must be effective against a broad threat, to include metal and plastic-cased Anti-Personnel (AP) and Anti-Tank (AT) landmines, explosive devices, and Unexploded Explosive Ordnance (UXO.) It must adapt to a variety of threat concealments, overburdens, and emplacement methods, to include soil, gravel, asphalt, and concrete. A unique neutralization technology is being investigated for adaptation to the AMDS Neutralization Module. This paper will describe review this technology and how the other two payload modules influence its design for minimizing SWaP. Recent modeling and experimental efforts will be included.

  5. Microarrays/DNA Chips for the Detection of Waterborne Pathogens.

    Science.gov (United States)

    Vale, Filipa F

    2016-01-01

    DNA microarrays are useful for the simultaneous detection of microorganisms in water samples. Specific probes targeting waterborne pathogens are selected with bioinformatics tools, synthesized and spotted onto a DNA array. Here, the construction of a DNA chip for waterborne pathogen detection is described, including the processes of probe in silico selection, synthesis, validation, and data analysis. PMID:27460375

  6. Towards autonomous radio detection of ultra high energy cosmic rays

    International Nuclear Information System (INIS)

    The radio-detection of extensive air showers, investigated for the first time in the 1960's, obtained promising results but plagued by the technical limitations. At that time, H.R. Allan summed up the state of the art in an extensive review article whose conclusions and predictions are still used today. Set up in 2001 at the Nancay Observatory, the CODALEMA experiment was built first as a demonstrator and successfully showed the feasibility of the radio-detection of extensive air showers. Radically modified in 2005, it allowed to obtain a clear energy correlation, and put in evidence an unambiguous signature of the geomagnetic origin of the electric field emission process associated to the air shower. The switch towards large areas is the next step of the technique's development. Therefore, the autonomy of the detectors becomes essential. After test prototypes installed in 2006 at the Pierre Auger Observatory, a generation of new autonomous detectors was developed. Their first results will be presented. This work is also dedicated to the issues related to the radio-detection technique: the antenna response, the sensitivity, the surrounding effects, the monitoring of a big array. The determination of the shower characteristics independently of other detectors such as the lateral distribution, the energy correlation and the frequency spectrum of the radio transient will be discussed. (author)

  7. Towards Autonomous Agriculture: Automatic Ground Detection Using Trinocular Stereovision

    Directory of Open Access Journals (Sweden)

    Annalisa Milella

    2012-09-01

    Full Text Available Autonomous driving is a challenging problem, particularly when the domain is unstructured, as in an outdoor agricultural setting. Thus, advanced perception systems are primarily required to sense and understand the surrounding environment recognizing artificial and natural structures, topology, vegetation and paths. In this paper, a self-learning framework is proposed to automatically train a ground classifier for scene interpretation and autonomous navigation based on multi-baseline stereovision. The use of rich 3D data is emphasized where the sensor output includes range and color information of the surrounding environment. Two distinct classifiers are presented, one based on geometric data that can detect the broad class of ground and one based on color data that can further segment ground into subclasses. The geometry-based classifier features two main stages: an adaptive training stage and a classification stage. During the training stage, the system automatically learns to associate geometric appearance of 3D stereo-generated data with class labels. Then, it makes predictions based on past observations. It serves as well to provide training labels to the color-based classifier. Once trained, the color-based classifier is able to recognize similar terrain classes in stereo imagery. The system is continuously updated online using the latest stereo readings, thus making it feasible for long range and long duration navigation, over changing environments. Experimental results, obtained with a tractor test platform operating in a rural environment, are presented to validate this approach, showing an average classification precision and recall of 91.0% and 77.3%, respectively.

  8. Method for detecting pathogens attached to specific antibodies

    Science.gov (United States)

    Miles, Robin R.; Venkateswaran, Kodumudi S.; Fuller, Christopher K.

    2005-01-25

    The use of impedance measurements to detect the presence of pathogens attached to antibody-coated beads. In a fluidic device antibodies are immobilized on a surface of a patterned interdigitated electrode. Pathogens in a sample fluid streaming past the electrode attach to the immobilized antibodies, which produces a change in impedance between two adjacent electrodes, which impedance change is measured and used to detect the presence of a pathogen. To amplify the signal, beads coated with antibodies are introduced and the beads would stick to the pathogen causing a greater change in impedance between the two adjacent electrodes.

  9. Autonomic intrusion detection: Adaptively detecting anomalies over unlabeled audit data streams in computer networks

    KAUST Repository

    Wang, Wei

    2014-06-22

    In this work, we propose a novel framework of autonomic intrusion detection that fulfills online and adaptive intrusion detection over unlabeled HTTP traffic streams in computer networks. The framework holds potential for self-managing: self-labeling, self-updating and self-adapting. Our framework employs the Affinity Propagation (AP) algorithm to learn a subject’s behaviors through dynamical clustering of the streaming data. It automatically labels the data and adapts to normal behavior changes while identifies anomalies. Two large real HTTP traffic streams collected in our institute as well as a set of benchmark KDD’99 data are used to validate the framework and the method. The test results show that the autonomic model achieves better results in terms of effectiveness and efficiency compared to adaptive Sequential Karhunen–Loeve method and static AP as well as three other static anomaly detection methods, namely, k-NN, PCA and SVM.

  10. Bio-Functional Au/Si Nanorods for Pathogen Detection

    Science.gov (United States)

    Technical Abstract Nanotechnology applications for food safety and biosecurity, especially development of nanoscale sensors for foodborne pathogen measurement are emerging. A novel bio-functional nanosensor for Salmonella detection was developed using hetero-nanorods. The silica nanorods were fabr...

  11. Optical Biosensors for the Detection of Pathogenic Microorganisms.

    Science.gov (United States)

    Yoo, Seung Min; Lee, Sang Yup

    2016-01-01

    Pathogenic microorganisms are causative agents of various infectious diseases that are becoming increasingly serious worldwide. For the successful treatment of pathogenic infection, the rapid and accurate detection of multiple pathogenic microorganisms is of great importance in all areas related to health and safety. Among various sensor systems, optical biosensors allow easy-to-use, rapid, portable, multiplexed, and cost-effective diagnosis. Here, we review current trends and advances in pathogen-diagnostic optical biosensors. The technological and methodological approaches underlying diverse optical-sensing platforms and methods for detecting pathogenic microorganisms are reviewed, together with the strengths and drawbacks of each technique. Finally, challenges in developing efficient optical biosensor systems and future perspectives are discussed. PMID:26506111

  12. Sensor Fault Detection and Diagnosis for autonomous vehicles

    OpenAIRE

    Realpe Miguel; Vintimilla Boris; Vlacic Ljubo

    2015-01-01

    In recent years testing autonomous vehicles on public roads has become a reality. However, before having autonomous vehicles completely accepted on the roads, they have to demonstrate safe operation and reliable interaction with other traffic participants. Furthermore, in real situations and long term operation, there is always the possibility that diverse components may fail. This paper deals with possible sensor faults by defining a federated sensor data fusion architecture. The proposed ar...

  13. Detection of aerosolized biological agents by immunoassay followed by autonomous PCR confirmation

    Energy Technology Data Exchange (ETDEWEB)

    Dzenitis, J M; Hindson, B J; McBride, M T; Makarewicz, A J; Henderer, B D; Sathyam, U S; Smith, S M; Gutierrez, D M; Metz, T R; Venkateswaran, K S; Colston, B W; Farrow, S W

    2003-12-15

    An Autonomous Pathogen Detection System (APDS) unit is an automated, podium-sized system that monitors the air for all three biological threat agents (bacteria, viruses, and toxins). The system has been developed under the auspices of the U. S. Department of Energy and Department of Homeland Security by the University of California, Lawrence Livermore National Laboratory (LLNL) to protect people in critical or high-traffic facilities and at special events. The system performs continuous aerosol collection, sample preparation, and multiplexed biological tests using advanced immunoassays as the primary screen. Over ten agents are assayed at once, and results are reported hourly. R&D work this year focused on incorporating polymerase chain-reaction (PCR) techniques for detecting DNA as confirmation of immunoassay positives. The primary objective of the Dugway testing was to demonstrate the APDS with immunoassay identification and PCR confirmation of bacteria. A secondary objective was to demonstrate immunoassay identification of a protein toxoid (denatured toxin) aerosol release. A total of 12 agent trials were conducted over 14 days of testing, for a total of four work weeks at Dugway. Both testing objectives were achieved with multiple releases and clear identifications. The APDS was shown to be effective for identifying aerosolized Bacillus anthracis, Yersinia pestis, Bacillus globigii, and botulinum toxoid. The two areas for improvement were operational as opposed to hardware-related. The first was slowing the PCR thermal cycling to achieve stronger signals, which was demonstrated during the later phases of testing. The second area is to improve the parameters for autonomous PCR triggering; this is one of the focuses of the upcoming year's work.

  14. Resequencing Pathogen Microarray (RPM) for prospective detection and identification of emergent pathogen strains and variants

    Science.gov (United States)

    Tibbetts, Clark; Lichanska, Agnieszka M.; Borsuk, Lisa A.; Weslowski, Brian; Morris, Leah M.; Lorence, Matthew C.; Schafer, Klaus O.; Campos, Joseph; Sene, Mohamadou; Myers, Christopher A.; Faix, Dennis; Blair, Patrick J.; Brown, Jason; Metzgar, David

    2010-04-01

    High-density resequencing microarrays support simultaneous detection and identification of multiple viral and bacterial pathogens. Because detection and identification using RPM is based upon multiple specimen-specific target pathogen gene sequences generated in the individual test, the test results enable both a differential diagnostic analysis and epidemiological tracking of detected pathogen strains and variants from one specimen to the next. The RPM assay enables detection and identification of pathogen sequences that share as little as 80% sequence similarity to prototype target gene sequences represented as detector tiles on the array. This capability enables the RPM to detect and identify previously unknown strains and variants of a detected pathogen, as in sentinel cases associated with an infectious disease outbreak. We illustrate this capability using assay results from testing influenza A virus vaccines configured with strains that were first defined years after the design of the RPM microarray. Results are also presented from RPM-Flu testing of three specimens independently confirmed to the positive for the 2009 Novel H1N1 outbreak strain of influenza virus.

  15. Online Detection of Mixed Layer Depth for Autonomous Underwater Vehicles

    Science.gov (United States)

    Chu, S.; Estlin, T.; Castano, R.; Woodward, G.; Gierach, M. M.; Thompson, A. F.; Schaffer, S.

    2015-12-01

    The accurate determination of the mixed layer depth (MLD) plays a crucial role in studying ocean dynamics and climate change. Various methods to estimate MLD have been proposed [1, 2]. However there is no current consensus on the best model, which leads to large uncertainty in the estimation. The variability, coupled with the complexity of physical, chemical and biological processes involved and the uncertainty and instabilities of the upper ocean surface, makes estimating MLD a challenging task. MLD varies significantly, even across a small spatial area (online algorithm for detecting mixed layer depth that would operate onboard an autonomous underwater vehicle (AUV). Using an online method permits a more adaptive approach to estimating MLD. Our proposed algorithm is based on an ensemble approach, which includes data mining techniques for real-time peak and change detection, learned seasonal variability profile, combined with MLD estimation criteria in [1]. In this study, we analyze measurements using glider data collected from the OSMOSIS (Ocean Surface Mixing, Ocean Submesoscale Interaction Study) project, concatenated into a year-long time series [3]. The glider data consists of nine full-depth moorings, which were deployed in a 15 km by 15 km box at the Porcupine Abyssal Plain in the northeast Atlantic, centered at 16.2°W, 48.7°N. Our algorithm utilizes direct measurements of salinity, temperature, depth and time and the design is based on the spatial and temporal variability of MLD learned. We will present our initial work on tracking the MLD based on real-time simulations using the OSMOSIS glider data and discussed for the case of deploying on a single AUV. Using an online algorithm for estimating MLD in-situ enables the system to rapidly adapt to the variability in a real-world environment and also allows for the intelligent operation of the limited sampling resources available on an AUV. We will discuss the autonomy architecture and algorithm design for

  16. Rapid Detection, Characterization, and Enumeration of Foodborne Pathogens

    DEFF Research Database (Denmark)

    This book provides a new focus on the rapid detection of food–borne pathogens, employing food production chains as a starting point instead of a specific method or various detection technologies. This reference is organized by production chains or contamination scenarios, and offers a unique...

  17. Detection of bacterial pathogens in environmental samples using DNA microarrays.

    Science.gov (United States)

    Call, Douglas R; Borucki, Monica K; Loge, Frank J

    2003-05-01

    Polymerase chain reaction (PCR) is an important tool for pathogen detection, but historically, it has not been possible to accurately identify PCR products without sequencing, Southern blots, or dot-blots. Microarrays can be coupled with PCR where they serve as a set of parallel dot-blots to enhance product detection and identification. Microarrays are composed of many discretely located probes on a solid substrate such as glass. Each probe is composed of a sequence that is complimentary to a pathogen-specific gene sequence. PCR is used to amplify one or more genes and the products are then hybridized to the array to identify species-specific polymorphism within one or more genes. We illustrate this type of array using 16S rDNA probes suitable for distinguishing between several salmonid pathogens. We also describe the use of microarrays for direct detection of either RNA or DNA without the aid of PCR, although the sensitivity of these systems currently limits their application for pathogen detection. Finally, microarrays can also be used to "fingerprint" bacterial isolates and they can be used to identify diagnostic markers suitable for developing new PCR-based detection assays. We illustrate this type of array for subtyping an important food-borne pathogen, Listeria monocytogenes. PMID:12654494

  18. Online Detection of Mixed Layer Depth for Autonomous Underwater Vehicles

    Science.gov (United States)

    Chu, S.; Estlin, T.; Castano, R.; Woodward, G.; Gierach, M. M.; Thompson, A. F.; Schaffer, S.

    2015-12-01

    The accurate determination of the mixed layer depth (MLD) plays a crucial role in studying ocean dynamics and climate change. Various methods to estimate MLD have been proposed [1, 2]. However there is no current consensus on the best model, which leads to large uncertainty in the estimation. The variability, coupled with the complexity of physical, chemical and biological processes involved and the uncertainty and instabilities of the upper ocean surface, makes estimating MLD a challenging task. MLD varies significantly, even across a small spatial area (autonomous underwater vehicle (AUV). Using an online method permits a more adaptive approach to estimating MLD. Our proposed algorithm is based on an ensemble approach, which includes data mining techniques for real-time peak and change detection, learned seasonal variability profile, combined with MLD estimation criteria in [1]. In this study, we analyze measurements using glider data collected from the OSMOSIS (Ocean Surface Mixing, Ocean Submesoscale Interaction Study) project, concatenated into a year-long time series [3]. The glider data consists of nine full-depth moorings, which were deployed in a 15 km by 15 km box at the Porcupine Abyssal Plain in the northeast Atlantic, centered at 16.2°W, 48.7°N. Our algorithm utilizes direct measurements of salinity, temperature, depth and time and the design is based on the spatial and temporal variability of MLD learned. We will present our initial work on tracking the MLD based on real-time simulations using the OSMOSIS glider data and discussed for the case of deploying on a single AUV. Using an online algorithm for estimating MLD in-situ enables the system to rapidly adapt to the variability in a real-world environment and also allows for the intelligent operation of the limited sampling resources available on an AUV. We will discuss the autonomy architecture and algorithm design for implementing this methodology and present results from our initial

  19. Detection of Water Hazards for Autonomous Robotic Vehicles

    Science.gov (United States)

    Matthes, Larry; Belluta, Paolo; McHenry, Michael

    2006-01-01

    Four methods of detection of bodies of water are under development as means to enable autonomous robotic ground vehicles to avoid water hazards when traversing off-road terrain. The methods involve processing of digitized outputs of optoelectronic sensors aboard the vehicles. It is planned to implement these methods in hardware and software that would operate in conjunction with the hardware and software for navigation and for avoidance of solid terrain obstacles and hazards. The first method, intended for use during the day, is based on the observation that, under most off-road conditions, reflections of sky from water are easily discriminated from the adjacent terrain by their color and brightness, regardless of the weather and of the state of surface waves on the water. Accordingly, this method involves collection of color imagery by a video camera and processing of the image data by an algorithm that classifies each pixel as soil, water, or vegetation according to its color and brightness values (see figure). Among the issues that arise is the fact that in the presence of reflections of objects on the opposite shore, it is difficult to distinguish water by color and brightness alone. Another issue is that once a body of water has been identified by means of color and brightness, its boundary must be mapped for use in navigation. Techniques for addressing these issues are under investigation. The second method, which is not limited by time of day, is based on the observation that ladar returns from bodies of water are usually too weak to be detected. In this method, ladar scans of the terrain are analyzed for returns and the absence thereof. In appropriate regions, the presence of water can be inferred from the absence of returns. Under some conditions in which reflections from the bottom are detectable, ladar returns could, in principle, be used to determine depth. The third method involves the recognition of bodies of water as dark areas in short

  20. Innovative applications of bacteriophages in rapid detection and identification of foodborne pathogens

    Science.gov (United States)

    Relative to traditional microbiological approaches, biosensors are a rapid method for foodborne bacterial pathogen detection. Biosensors function by detecting the interaction of the target pathogen, or pathogen derived molecule, with a biological recognition component which must have sufficient aff...

  1. Microarray technology in detection of potato pathogens

    Czech Academy of Sciences Publication Activity Database

    Šíp, Miroslav; Bystřická, Dagmar; Lenz, Ondřej; Mráz, Ivan; Petrzik, Karel; Dědič, P.

    Christchurch : Lincoln Univ. Cantebury, 2003. s. 93. [International Congress of Plant Pathology/8./. 02.02.2003-07.02.2003, Christchurch] Institutional research plan: CEZ:AV0Z5051902 Keywords : plant pathology * detection of diseases Subject RIV: EE - Microbiology, Virology

  2. Multimodal plasmonic nanosensor for the detection of pathogenic bacteria

    Science.gov (United States)

    Tay, Li-Lin; Hulse, John; Ryan, Shannon; Tanha, Jamshid; Fraser, Jeff; Wu, Xiaohua

    2009-08-01

    Multi-modal sensing scheme significantly improves the detection accuracy but can also introduce extra complexity in the overall design of the sensor. We overcome this difficulty by utilizing the plasmonic properties of metallic nanoparticles. In this study, we will present a simple dual optical sensing mechanism which harvests signals of the resonantly excited metallic nanostructure in the form of surface enhanced Raman scattering (SERS) and resonant Rayleigh scattering. Silver and gold nanoparticles labeled with appropriate antibodies act as signal transduction units and upon exposure to the targeted pathogen render the targeted species optically active. We demonstrate that detection of a single pathogen cell is easily attainable with the dual detection scheme. Furthermore, we explore the markedly different SERS intensity observed from the use of two very different antibody recognition units during the pathogen labeling process.

  3. Waveguide-Based Biosensors for Pathogen Detection

    Directory of Open Access Journals (Sweden)

    Nile Hartman

    2009-07-01

    Full Text Available Optical phenomena such as fluorescence, phosphorescence, polarization, interference and non-linearity have been extensively used for biosensing applications. Optical waveguides (both planar and fiber-optic are comprised of a material with high permittivity/high refractive index surrounded on all sides by materials with lower refractive indices, such as a substrate and the media to be sensed. This arrangement allows coupled light to propagate through the high refractive index waveguide by total internal reflection and generates an electromagnetic wave—the evanescent field—whose amplitude decreases exponentially as the distance from the surface increases. Excitation of fluorophores within the evanescent wave allows for sensitive detection while minimizing background fluorescence from complex, “dirty” biological samples. In this review, we will describe the basic principles, advantages and disadvantages of planar optical waveguide-based biodetection technologies. This discussion will include already commercialized technologies (e.g., Corning’s EPIC® Ô, SRU Biosystems’ BIND™, Zeptosense®, etc. and new technologies that are under research and development. We will also review differing assay approaches for the detection of various biomolecules, as well as the thin-film coatings that are often required for waveguide functionalization and effective detection. Finally, we will discuss reverse-symmetry waveguides, resonant waveguide grating sensors and metal-clad leaky waveguides as alternative signal transducers in optical biosensing.

  4. From Automatic Sign Detection To Space Usage Rules Mining For Autonomous Driving

    OpenAIRE

    SAMSONOV, Pavel; Hecht, Brent; SCHOENING, Johannes

    2015-01-01

    While there is a large body of related work on the automatic detecting of road signs for (semi-)autonomous vehicles, we believe that these vehicles should also be aware of so-called “space usage rules” (SURs) more generally. Vehicles that understand SURs – e.g. “no swimming”, “no drone flying”, - could provide a novel set of context-aware services for autonomous driving. For instance, an autonomous car navigation system could provide directions to the nearest beach, where swimming is al...

  5. A new oligonucleotide microarray for detection of pathogenic and non-pathogenic Legionella spp.

    Directory of Open Access Journals (Sweden)

    Boyang Cao

    Full Text Available Legionella pneumophila has been recognized as the major cause of legionellosis since the discovery of the deadly disease. Legionella spp. other than L. pneumophila were later found to be responsible to many non-pneumophila infections. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this report, we have sequenced the 16S-23S rRNA gene internal transcribed spacer (ITS of 10 Legionella species and subspecies, including L. anisa, L. bozemanii, L. dumoffii, L. fairfieldensis, L. gormanii, L. jordanis, L. maceachernii, L. micdadei, L. pneumophila subspp. fraseri and L. pneumophila subspp. pasculleii, and developed a rapid oligonucleotide microarray detection technique accordingly to identify 12 most common Legionella spp., which consist of 11 pathogenic species of L. anisa, L. bozemanii, L. dumoffii, L. gormanii, L. jordanis, L. longbeachae, L. maceachernii, L. micdadei, and L. pneumophila (including subspp. pneumophila, subspp. fraseri, and subspp. pasculleii and one non-pathogenic species, L. fairfieldensis. Twenty-nine probes that reproducibly detected multiple Legionella species with high specificity were included in the array. A total of 52 strains, including 30 target pathogens and 22 non-target bacteria, were used to verify the oligonucleotide microarray assay. The sensitivity of the detection was at 1.0 ng with genomic DNA or 13 CFU/100 mL with Legionella cultures. The microarray detected seven samples of air conditioner-condensed water with 100% accuracy, validating the technique as a promising method for applications in basic microbiology, clinical diagnosis, food safety, and epidemiological surveillance. The phylogenetic study based on the ITS has also revealed that the non-pathogenic L. fairfieldensis is the closest to L. pneumophila than the nine other pathogenic Legionella spp.

  6. Innovative hazard detection and avoidance strategy for autonomous safe planetary landing

    Science.gov (United States)

    Jiang, Xiuqiang; Li, Shuang; Tao, Ting

    2016-09-01

    Autonomous hazard detection and avoidance (AHDA) is one of the key technologies for future safe planetary landing missions. In this paper, we address the latest progress on planetary autonomous hazard detection and avoidance technologies. First, the innovative autonomous relay hazard detection and avoidance strategy adopted in Chang'e-3 lunar soft landing mission and its flight results are reported in detail. Second, two new conceptual candidate schemes of hazard detection and avoidance are presented based on the Chang'e-3 AHDA system and the latest developing technologies for the future planetary missions, and some preliminary testing results are also given. Finally, the related supporting technologies for the two candidate schemes above are analyzed.

  7. Automated RNA Extraction and Purification for Multiplexed Pathogen Detection

    Energy Technology Data Exchange (ETDEWEB)

    Bruzek, Amy K.; Bruckner-Lea, Cindy J.

    2005-01-01

    Pathogen detection has become an extremely important part of our nation?s defense in this post 9/11 world where the threat of bioterrorist attacks are a grim reality. When a biological attack takes place, response time is critical. The faster the biothreat is assessed, the faster countermeasures can be put in place to protect the health of the general public. Today some of the most widely used methods for detecting pathogens are either time consuming or not reliable [1]. Therefore, a method that can detect multiple pathogens that is inherently reliable, rapid, automated and field portable is needed. To that end, we are developing automated fluidics systems for the recovery, cleanup, and direct labeling of community RNA from suspect environmental samples. The advantage of using RNA for detection is that there are multiple copies of mRNA in a cell, whereas there are normally only one or two copies of DNA [2]. Because there are multiple copies of mRNA in a cell for highly expressed genes, no amplification of the genetic material may be necessary, and thus rapid and direct detection of only a few cells may be possible [3]. This report outlines the development of both manual and automated methods for the extraction and purification of mRNA. The methods were evaluated using cell lysates from Escherichia coli 25922 (nonpathogenic), Salmonella typhimurium (pathogenic), and Shigella spp (pathogenic). Automated RNA purification was achieved using a custom sequential injection fluidics system consisting of a syringe pump, a multi-port valve and a magnetic capture cell. mRNA was captured using silica coated superparamagnetic beads that were trapped in the tubing by a rare earth magnet. RNA was detected by gel electrophoresis and/or by hybridization of the RNA to microarrays. The versatility of the fluidics systems and the ability to automate these systems allows for quick and easy processing of samples and eliminates the need for an experienced operator.

  8. Recent sensing technologies for pathogen detection in milk: a review.

    Science.gov (United States)

    Mortari, Alessia; Lorenzelli, Leandro

    2014-10-15

    Quality control utilising Hazard Analysis and Critical Control Points in the dairy industry generates a large volume of samples. The associated costs are significant. The development and application of fast, sensitive and cost effective analytical systems for pathogen detection in milk could aid the industry in the reduction of overheads, find new uses in dairy farming and production precision management and unlock new markets. Recent progress in pathogen sensing technologies for milk analysis, in particular nucleic acid amplification and biosensors, is reviewed here. The importance of representative samples, detection probability and Practical Detection Limit is clarified. Methods for sample pretreatment are discussed in association with the most applicable detection methods. The major findings are summarised and future perspectives are drawn to inspire new ideas in the scientific community. PMID:24768759

  9. Bio-functional Au/Si Nanrods for Pathogen Detection

    Science.gov (United States)

    Nanotechnology applications for food safety and biosecurity, especially development of nanoscale sensors for foodborne pathogen measurement are emerging. A novel bio-functional nanosensor for Salmonella detection was developed using hetero-nanorods. The silica nanorods were fabricated by glancing a...

  10. Multiple Pathogen Detection Using Biosensors: Advancements and Challenges

    Science.gov (United States)

    Advancements in biosensor research have considerably impacted clinical diagnostics for human health. Efforts in capitalizing on the sensitivity of biosensors for food pathogen detection are evident in the food safety/security research community. For practical application with foods that normally h...

  11. Hyperspectral Imaging for Detecting Pathogens Grown on Agar Plates

    Science.gov (United States)

    This paper is concerned with the development of a hyperspectral imaging technique for detecting and identifying one of the most common foodborne pathogens, Campylobacter. Direct plating using agars is an effective tool for laboratory tests and analyses of microorganisms. The morphology (size, growth...

  12. AOTF hyperspectral microscope imaging for foodborne pathogenic bacteria detection

    Science.gov (United States)

    Hyperspectral microscope imaging (HMI) method, which provides both spatial and spectral information, can be effective for foodborne pathogen detection. The acousto-optic tunable filter (AOTF)-based HMI method can be used to characterize spectral properties of biofilms formed by Salmonella enteritidi...

  13. Detection of major diarrheagenic bacterial pathogens by multiplex PCR panels.

    Science.gov (United States)

    Sjöling, Åsa; Sadeghipoorjahromi, Leila; Novak, Daniel; Tobias, Joshua

    2015-03-01

    Diarrheal diseases remain a major threat to the youngest population in low- and middle-income countries. The main bacterial pathogens causing diarrhea are diarrheagenic Escherichia coli (DEC) that consists of enteroaggregative (EAEC), enteropathogenic (EPEC), enterotoxigenic (ETEC), enterohemorrhagic EHEC and enteroinvasive E. coli (EIEC), Salmonella, Shigella spp. (S. dysenteria, S. sonnei, S. flexneri) Campylobacter (C. coli, C. jejuni), Vibrio (V. vulnificus, V. parahaemolyticusm, V. cholerae), Yersinia enterocolitica and Aeromonas hydrophila. The aim of this study was to set up rapid multiplex PCR (mPCR) panels to identify these diarrheagenic pathogens based on their specific virulence genes. Primers against specific target genes were combined into three mPCR panels: one for diarrheal E. coli, one for pathogens causing mainly bloody diarrhea, and the third for the remaining pathogens. The panels were tested against a set of stool samples from Swedish children with diarrhea and controls and the analysis identified bacterial pathogens in 14/54 (26%) of the samples. These results show that our three developed mPCR panels can detect main bacterial diarrheagenic pathogens in clinical samples. PMID:25542594

  14. Bio-functional Au/Si nanorods for pathogen detection

    Science.gov (United States)

    Park, Bosoon; Fu, Junxue; Zhao, Yiping; Siragusa, Gregory R.; Cho, Yong-Jin; Lawrence, Kurt C.; Windham, William R.

    2007-09-01

    Nanotechnology applications for food safety and biosecurity, especially development of nanoscale sensors for foodborne pathogen measurement are emerging. A novel bio-functional nanosensor for Salmonella detection was developed using hetero-nanorods. The silica nanorods were fabricated by glancing angle deposition method and the gold was sputtered onto the silica nanorods. Alexa488-succinimide dye was immobilized onto the annealed Si nanorods via the attachment between dye ester and primary amine group supplied by the 3-Aminopropyltriethoxysilane. The anti-Salmonella was conjugated to gold via Dithiobis[succinimidylpropionate] self-assembly monolayer. Due to the high aspect ratio nature of the Si nanorods, hundreds or thousands of dye molecules attached to the Si nanorods produced enhanced fluorescence signal. These biologically functionalized nanorods can be used to detect Salmonella with fluorescent microscopic imaging. This new nanoscale biosensor will be able to detect other foodborne pathogenic bacteria for food safety and security applications.

  15. A Study on Detecting and Identifying Enteric Pathogens With PCR

    Institute of Scientific and Technical Information of China (English)

    JUN-WEN LI; XIU-QUAN SHI; FU-HUAN CHAO; XIN-WEI WANG; JIN-LAI ZHENG; NONG SONG

    2004-01-01

    Objective To develop a rapid and definite diagnostic test of bacterial enteritis caused by pathogenic enterobacteria, the most frequent etiologic agent of infectious enteritis in the world.Methods A set of conventional PCR assays were applied to detect and identify salmonella, shigella,and E. coli O157:H7 directly from pure culture and fecal samples. The general primers of pathogenic enterobacteria were located on the uidA gene, which were found not only in E. coli nuclear acid, but also in Shigella and salmonella genes. Shigella primer was from ipaH gene whose coded invasive plasmid relative antigen existed both in plasmid and in genome. The primers of salmonella were designed from the 16SrRNA sequence. The primer of E. coli O157:H7 was taken from eaeA gene.Five random primers were selected for RAPD. The detection system included common PCR,semi-nested PCR and RAPD. Results This method was more sensitive, specific and efficient and its processing was rapid and simple. For example, the method could be used to specifically detect and identify salmonella, shigella, and E. coli O157:H7, and its sensitivity ranged from 3 to 50 CFU, and its detection time was 4 hours. Conclusion This PCR method, therefore, can serve as a rourine and practical protocol for detecting and identifying pathogenic microorganisms from clinical samples.

  16. DNA microarray technique for detecting food-borne pathogens

    Directory of Open Access Journals (Sweden)

    Xing GAO

    2012-08-01

    Full Text Available Objective To study the application of DNA microarray technique for screening and identifying multiple food-borne pathogens. Methods The oligonucleotide probes were designed by Clustal X and Oligo 6.0 at the conserved regions of specific genes of multiple food-borne pathogens, and then were validated by bioinformatic analyses. The 5' end of each probe was modified by amino-group and 10 Poly-T, and the optimized probes were synthesized and spotted on aldehyde-coated slides. The bacteria DNA template incubated with Klenow enzyme was amplified by arbitrarily primed PCR, and PCR products incorporated into Aminoallyl-dUTP were coupled with fluorescent dye. After hybridization of the purified PCR products with DNA microarray, the hybridization image and fluorescence intensity analysis was acquired by ScanArray and GenePix Pro 5.1 software. A series of detection conditions such as arbitrarily primed PCR and microarray hybridization were optimized. The specificity of this approach was evaluated by 16 different bacteria DNA, and the sensitivity and reproducibility were verified by 4 food-borne pathogens DNA. The samples of multiple bacteria DNA and simulated water samples of Shigella dysenteriae were detected. Results Nine different food-borne bacteria were successfully discriminated under the same condition. The sensitivity of genomic DNA was 102 -103pg/ μl, and the coefficient of variation (CV of the reproducibility of assay was less than 15%. The corresponding specific hybridization maps of the multiple bacteria DNA samples were obtained, and the detection limit of simulated water sample of Shigella dysenteriae was 3.54×105cfu/ml. Conclusions The DNA microarray detection system based on arbitrarily primed PCR can be employed for effective detection of multiple food-borne pathogens, and this assay may offer a new method for high-throughput platform for detecting bacteria.

  17. Detection of periodontal pathogens in the patients with aortic aneurysm

    Institute of Scientific and Technical Information of China (English)

    Ding Fang; Lyu Yalin; Han Xiao; Zhang Hai; Liu Dongyu; Hei Wei; Liu Yinhua

    2014-01-01

    Background The occurrence and development of aortic aneurysm (AA) are associated with infection.Some researchers have detected the DNA of periodontal pathogens in AA samples in certain populations.However,it has not been done in Chinese population.The objective of this study was to evaluate the prevalence of periodontal pathogens in oral tissue samples and aneurysm samples of AA patients.Methods Eighty-nine subjects with AA and 59 subjects without AA were examined.Periodontal clinical parameters were evaluated.Unstimulated saliva and subgingival plaque somples were collected from all subjects.Twenty-six dissected AA samples were obtained.Evidence of eight periodontal pathogens including Porphyromonas gingivalis (Pg),Actinobacillus actinomycetemcomitans (Aa),Prevotella intermedia (Pi),Tannerella forsythensis (Tf),Treponema denticola (Td),Campylobacter rectus (Cr),Fusobacterium nucleatum (Fn),and Prevotella nigrescens (Pn) was ascertained in all samples by 16S rRNA-based polymerase chain reaction (PCR) assay.Results The periodontal indexes including plaque index (PLI),probing depth (PD),bleeding index (BI),and clinical attachment loss (CAL),of the six Ramfjord index teeth were significantly higher in the AA group than those in the control group (P <0.01).Eight periodontal pathogens in subgingival plaque samples were more frequently detected in the AA group than in control group.The difference in prevalence between the groups was significant for six (out of eight) periodontal pathogens assayed (Pg,Pi,Fn,Pn,Tf,and Td,P <0.01).Additionally,all eight periodontal pathogens were more frequently detected in saliva samples of the AA group than in those of the control group,again with six (out of eight) (Pg,Pi,Fn,Cr,Tf,and Td) displaying significant differences in prevalence between the two groups (P <0.01).Out of 26 aneurysm samples examined,Pg,Pi,Fn,Crand Tfwere detected in 6 (23.1%),2 (7.7%),3 (11.5%),1 (3.8%),2 (7.7%),respectively,and Aa,Pn,and Td were not

  18. Standardization of diagnostic PCR for the detection of foodborne pathogens

    DEFF Research Database (Denmark)

    Malorny, B.; Tassios, P.T.; Radstrom, P.;

    2003-01-01

    neither gained wide acceptance in routine diagnostics nor been widely incorporated in standardized methods. Lack of validation and standard protocols, as well as variable quality of reagents and equipment, influence the efficient dissemination of PCR methodology from expert research laboratories to end......-user laboratories. Moreover, the food industry understandably requires and expects officially approved standards. Recognizing this, in 1999, the European Commission approved the research project, FOOD-PCR (http://www.PCR.dk), which aims to validate and standardize the use of diagnostic PCR for the detection of...... pathogenic bacteria in foods. The present review focuses on the harmonization procedure and standardization criteria for detection of foodborne pathogens by PCR. The progress of standardization so far and future perspectives of diagnostic PCR are discussed....

  19. Detection of pathogenic gram negative bacteria using infrared thermography

    Science.gov (United States)

    Lahiri, B. B.; Divya, M. P.; Bagavathiappan, S.; Thomas, Sabu; Philip, John

    2012-11-01

    Detection of viable bacteria is of prime importance in all fields of microbiology and biotechnology. Conventional methods of enumerating bacteria are often time consuming and labor-intensive. All living organisms generate heat due to metabolic activities and hence, measurement of heat energy is a viable tool for detection and quantification of bacteria. In this article, we employ a non-contact and real time method - infrared thermography (IRT) for measurement of temperature variations in four clinically significant gram negative pathogenic bacteria, viz. Vibrio cholerae, Vibrio mimicus, Proteus mirabilis and Pseudomonas aeruginosa. We observe that, the energy content, defined as the ratio of heat generated by bacterial metabolic activities to the heat lost from the liquid medium to the surrounding, vary linearly with the bacterial concentration in all the four pathogenic bacteria. The amount of energy content observed in different species is attributed to their metabolisms and morphologies that affect the convection velocity and hence heat transport in the medium.

  20. Multiplex detection of four pathogenic retroviruses using molecular beacons

    OpenAIRE

    Vet, Jacqueline A. M.; Majithia, Amit R.; Marras, Salvatore A. E.; Tyagi, Sanjay; DUBE, SYAMALIMA; Poiesz, Bernard J; Kramer, Fred Russell

    1999-01-01

    We describe a multiplex nucleic acid assay that identifies and determines the abundance of four different pathogenic retroviruses (HIV-1, HIV-2, and human T-lymphotrophic virus types I and II). Retroviral DNA sequences are amplified in a single, sealed tube by simultaneous PCR assays, and the resulting amplicons are detected in real time by the hybridization of four differently colored, amplicon-specific molecular beacons. The color of the fluorescence generated in the course of amplification...

  1. Airborne multisensor system for the autonomous detection of land mines

    Science.gov (United States)

    Scheerer, Klaus

    1997-07-01

    A concept of a modular multisensor system for use on an airborne platform is presented. THe sensor system comprises two high resolution IR sensors working in the mid and far IR spectral regions, a RGB video camera with its sensitivity extended to the near IR in connection with a laser illuminator, and a radar with a spatial resolution adapted to the expected mine sizes. The sensor concept emerged from the evaluation of comprehensive static and airborne measurements on numerous buried and unburied mines. The measurements were performed on single mines and on minefields, layed down according to military requirements. The system has an on-board realtime image processing capability and is intended to operate autonomously with a data link to a mobile groundstation. Data from a navigation unit serve to transform the location of identified mines into a geodetic coordinate system. The system will be integrated into a cylindrical structure of about 40 cm diameter. This may be a drone or simply a tube which can be mounted on any carrier whatever. The realization of a simplified demonstrator for captive flight tests is planned by 1998.

  2. Dominant object detection for autonomous vision-based surveillance

    NARCIS (Netherlands)

    Celik, H.

    2010-01-01

    The deployment of visual surveillance and monitoring systems has reached massive proportions. Consequently, a need to automate the processes involved in retrieving useful information from surveillance videos, such as detecting and counting objects, and interpreting their individual and joint behavio

  3. Market Disease Pathogens Detection of Imported Fruits in Shanghai

    Institute of Scientific and Technical Information of China (English)

    MA Teng-fei; YANG Bo; YU Yue; WANG Yi-wen; LIU Yi; XU Zhen; LIU Yan; ZHU Pin-kuan; ZHANG Wei; ZHANG Zai-bao; Toyoda Hideyoshi; XU Ling

    2009-01-01

    A tremendous amount of imported fresh fruits has been delivered to Shanghai markets,increasing the risk of invasion by harmful plant pathogens.Therefore,it is important to establish an effective detection and supervision system to survey the outbreak of the market diseases of the imported fruits during marketing.The samples were regularly surveyed in different markets to examine varieties,prices,localities,selling conditions,and diseases of the imported fruits from 2004 to 2008.The survey showed that 58 species of 30 different fruits were imported to Shanghai from 16 countries with more expensive price.The larger products were bananas,grapes,apples,and oranges.During the investigation,we found that the imported fruits frequently brought about the relatively serious market diseases.On the basis of morphology and the nuclear internal transcribed spacer (ITS) of ribosomal DNA (rDNA) analysis,151 isolates of 15 fungi genera,which shown to be pathogenic afcer the inoculation assay.were finally identified.Among the identified fungi,Alternaria was the most frequent one with the highest detection rate (47.68%),followed by Penicillium (14.57%) and Fusarium (11.92%),respectively.Additionally,Pestalotiopsis microspora (detected in grapes Red-Globe coming from the USA) and Botrytis sp.(detected in black-plums coming from the USA)were first reported in China market.The present study summarized the selling situation of the imported fruits in Shanghai markets and constructed a library of the pathogens detected in the imported fruits during the selling period.The results obtained are useful to offer technical parameters for Chinese quarantine in order to prevent an invasion of the foreign harmful micro-organisms.

  4. Actual Pathogen Detection: Sensors and Algorithms - a Review

    Directory of Open Access Journals (Sweden)

    Federico Hahn

    2009-03-01

    Full Text Available Pathogens feed on fruits and vegetables causing great food losses or at least reduction of their shelf life. These pathogens can cause losses of the final product or in the farms were the products are grown, attacking leaves, stems and trees. This review analyses disease detection sensors and algorithms for both the farm and postharvest management of fruit and vegetable quality. Mango, avocado, apple, tomato, potato, citrus and grapes were selected as the fruits and vegetables for study due to their world-wide consumption. Disease warning systems for predicting pathogens and insects on farms during fruit and vegetable production are commonly used for all the crops and are available where meteorological stations are present. It can be seen that these disease risk systems are being slowly replaced by remote sensing monitoring in developed countries. Satellite images have reduced their temporal resolution, but are expensive and must become cheaper for their use world-wide. In the last 30 years, a lot of research has been carried out in non-destructive sensors for food quality. Actually, non-destructive technology has been applied for sorting high quality fruit which is desired by the consumer. The sensors require algorithms to work properly; the most used being discriminant analysis and training neural networks. New algorithms will be required due to the high quantity of data acquired and its processing, and for disease warning strategies for disease detection.

  5. Vehicle Detection for RCTA/ANS (Autonomous Navigation System)

    Science.gov (United States)

    Brennan, Shane; Bajracharya, Max; Matthies, Larry H.; Howard, Andrew B.

    2012-01-01

    Using a stereo camera pair, imagery is acquired and processed through the JPLV stereo processing pipeline. From this stereo data, large 3D blobs are found. These blobs are then described and classified by their shape to determine which are vehicles and which are not. Prior vehicle detection algorithms are either targeted to specific domains, such as following lead cars, or are intensity- based methods that involve learning typical vehicle appearances from a large corpus of training data. In order to detect vehicles, the JPL Vehicle Detection (JVD) algorithm goes through the following steps: 1. Take as input a left disparity image and left rectified image from JPLV stereo. 2. Project the disparity data onto a two-dimensional Cartesian map. 3. Perform some post-processing of the map built in the previous step in order to clean it up. 4. Take the processed map and find peaks. For each peak, grow it out into a map blob. These map blobs represent large, roughly vehicle-sized objects in the scene. 5. Take these map blobs and reject those that do not meet certain criteria. Build descriptors for the ones that remain. Pass these descriptors onto a classifier, which determines if the blob is a vehicle or not. The probability of detection is the probability that if a vehicle is present in the image, is visible, and un-occluded, then it will be detected by the JVD algorithm. In order to estimate this probability, eight sequences were ground-truthed from the RCTA (Robotics Collaborative Technology Alliances) program, totaling over 4,000 frames with 15 unique vehicles. Since these vehicles were observed at varying ranges, one is able to find the probability of detection as a function of range. At the time of this reporting, the JVD algorithm was tuned to perform best at cars seen from the front, rear, or either side, and perform poorly on vehicles seen from oblique angles.

  6. Magnetic Bead Based Immunoassay for Autonomous Detection of Toxins

    Energy Technology Data Exchange (ETDEWEB)

    Kwon, Y; Hara, C A; Knize, M G; Hwang, M H; Venkatesteswaran, K S; Wheeler, E K; Bell, P M; Renzi, R F; Fruetel, J A; Bailey, C G

    2008-05-01

    As a step towards toward the development of a rapid, reliable analyzer for bioagents in the environment, we are developing an automated system for the simultaneous detection of a group of select agents and toxins. To detect toxins, we modified and automated an antibody-based approach previously developed for manual medical diagnostics that uses fluorescent eTag{trademark} reporter molecules and is suitable for highly multiplexed assays. Detection is based on two antibodies binding simultaneously to a single antigen, one of which is labeled with biotin while the other is conjugated to a fluorescent eTag{trademark} through a cleavable linkage. Aqueous samples are incubated with the mixture of antibodies along with streptavidin-coated magnetic beads coupled to a photo-activatable porphyrin complex. In the presence of antigen, a molecular complex is formed where the cleavable linkage is held in proximity to the photoactivable group. Upon excitation at 680 nm, free radicals are generated, which diffuse and cleave the linkage, releasing the eTags{trademark}. Released eTags{trademark} are analyzed using capillary gel electrophoresis with laser-induced fluorescence detection. Limits of detection for ovalbumin and botulinum toxoid individually were 4 ng/mL (or 80 pg) and 16 ng/mL (or 320 pg), respectively, using the manual assay. In addition, we demonstrated the use of pairs of antibodies from different sources in a single assay to decrease the rate of false positives. Automation of the assay was demonstrated on a flow-through format with higher LODs of 125 ng/mL (or 2.5 ng) each of a mixture of ovalbumin and botulinum toxoid. This versatile assay can be easily modified with the appropriate antibodies to detect a wide range of toxins and other proteins.

  7. Integrated Detection of Pathogens and Host Biomarkers for Wounds

    Energy Technology Data Exchange (ETDEWEB)

    Jaing, C

    2012-03-19

    The increasing incidence and complications arising from combat wounds has necessitated a reassessment of methods for effective treatment. Infection, excessive inflammation, and incidence of drug-resistant organisms all contribute toward negative outcomes for afflicted individuals. The organisms and host processes involved in wound progression, however, are incompletely understood. We therefore set out, using our unique technical resources, to construct a profile of combat wounds which did or did not successfully resolve. We employed the Lawrence Livermore Microbial Detection Array and identified a number of nosocomial pathogens present in wound samples. Some of these identities corresponded with bacterial isolates previously cultured, while others were not obtained via standard microbiology. Further, we optimized proteomics protocols for the identification of host biomarkers indicative of various stages in wound progression. In combination with our pathogen data, our biomarker discovery efforts will provide a profile corresponding to wound complications, and will assist significantly in treatment of these complex cases.

  8. Autonomous Onboard Point Source Detection by Small Exploration Spacecraft

    Science.gov (United States)

    Huffman, W.; Thompson, D. R.; Bue, B.; Castillo-Rogez, J.; Boland, J.

    2015-12-01

    Small spacecraft platforms are a promising low-cost approach to accelerate exploration of small bodies, addressing the space community's interest in origin science, planetary resources, and planetary defense. However, they can be challenging platforms for detecting and imaging low brightness targets. Difficulties include constrained bandwidth, which limits the volume of data that can be downlinked; attitude instability, which limits exposure time; small instrument apertures, which reduce sensitivity; and cosmic ray contamination, which creates illusory sources. Mission designers can address all these problems simultaneously by shifting image analysis across the communications gap. Spacecraft can use onboard data analysis to detect sources directly, or downlink parsimonious summary products for detection on the ground. One promising approach is to acquire stacks of short consecutive exposures, and then coregister and coadd them onboard. This work analyzes a coaddition algorithm that is designed to be robust against small spacecraft challenges. We evaluate factors affecting performance, such as attitude control and camera noise systematics, in regimes typical of small spacecraft missions. We motivate the algorithm design by considering its application to NEAScout, a mission representing a new generation of small (sub-50 kg) exploration spacecraft having very small instrument apertures and data rates below 1 kbyte s-1. Here, onboard analysis allows detection and rendezvous with far smaller and fainter objects, dramatically reducing the cost and complexity of primitive bodies exploration.

  9. System for rapid detection of antibiotic resistance of airborne pathogens

    Science.gov (United States)

    Fortin, M.; Noiseux, I.; Mouslinkina, L.; Vernon, M. L.; Laflamme, C.; Filion, G.; Duchaine, C.; Ho, J.

    2009-05-01

    This project uses function-based detection via a fundamental understanding of the genetic markers of AR to distinguish harmful organisms from innocuous ones. This approach circumvents complex analyses to unravel the taxonomic details of 1399 pathogen species, enormously simplifying detection requirements. Laval Hospital's fast permeabilization strategy enables AR revelation in alignment occurs in the fabrication process only and complex excitation and collection optics are replaced by optical fibers. Moreover, we use a sheathless configuration which has the advantage of increase the portability of the system, to reduce excess biohazard material and the need for weekly maintenance. In this paper we present the principle of our FOFC along with a, demonstration of the basic capability of the platform for detection of bacillus cereus spores using permeabilized staining.

  10. Nanoparticles based DNA conjugates for detection of pathogenic microorganisms

    Science.gov (United States)

    Jamdagni, Pragati; Khatri, Poonam; Rana, J. S.

    2016-01-01

    Infectious diseases have been on rise in the recent past. Early diagnosis plays a role as important as proper treatment and prophylaxis. The current practices of detection are time consuming which may result in unnecessary delays in treatment. Advances in nanodiagnostic approaches have been in focus lately. The rising interest and better understanding of nanoparticles have led to opening up of new frontiers in the concerned area. Optical properties of nanoparticles are being exploited to design detection systems that can provide fast, one-step and reliable results. Based on conserved DNA sequences unique to the target organism, the results offer accuracy comparable to conventional tests. Further, visual or spectrophotometric analysis omits the need of costly apparatus for result interpretation. The present review aims at putting together the information on nanoparticles based DNA conjugate systems for detection of pathogenic microorganisms.

  11. LABRADOR: a learning autonomous behavior-based robot for adaptive detection and object retrieval

    Science.gov (United States)

    Yamauchi, Brian; Moseley, Mark; Brookshire, Jonathan

    2013-01-01

    As part of the TARDEC-funded CANINE (Cooperative Autonomous Navigation in a Networked Environment) Program, iRobot developed LABRADOR (Learning Autonomous Behavior-based Robot for Adaptive Detection and Object Retrieval). LABRADOR was based on the rugged, man-portable, iRobot PackBot unmanned ground vehicle (UGV) equipped with an explosives ordnance disposal (EOD) manipulator arm and a custom gripper. For LABRADOR, we developed a vision-based object learning and recognition system that combined a TLD (track-learn-detect) filter based on object shape features with a color-histogram-based object detector. Our vision system was able to learn in real-time to recognize objects presented to the robot. We also implemented a waypoint navigation system based on fused GPS, IMU (inertial measurement unit), and odometry data. We used this navigation capability to implement autonomous behaviors capable of searching a specified area using a variety of robust coverage strategies - including outward spiral, random bounce, random waypoint, and perimeter following behaviors. While the full system was not integrated in time to compete in the CANINE competition event, we developed useful perception, navigation, and behavior capabilities that may be applied to future autonomous robot systems.

  12. Detection of pathogenic clostridia in biogas plant wastes.

    Science.gov (United States)

    Neuhaus, Jürgen; Shehata, Awad A; Krüger, Monika

    2015-01-01

    As the number of biogas plants has grown rapidly in the last decade, the amount of potentially contaminated wastes with pathogenic Clostridium spp. has increased as well. This study reports the results from examining 203 biogas plant wastes (BGWs). The following Clostridium spp. with different frequencies could be isolated via a new enrichment medium (Krüne medium) and detected by matrix-assisted laser desorption/ionization-time-of-flight mass spectrometry (MALDI-TOF MS): Clostridium perfringens (58 %) then Clostridium bifermentans (27 %), Clostridium tertium (23 %) and Clostridium butyricum (19 %), Clostridium cadaveris (15 %), Clostridium parapurificum (6 %), Clostridium glycolicum (5 %), Clostridium baratii (4 %), Clostridium sporogenes (2 %), Clostridium sordellii (1 %) and Clostridium subterminale (0.5 %). The mean most probable number (MPN) count of sulfite reducing bacteria was between 10(3) and 10(4)/mL, and the higher the MPN, the more pathogenic Clostridium spp. were present. Also, real-time PCR was used to be compared with culture method for C. perfringens, C. bifermentans, C. butyricum, C. sporogenes/Clostridium botulinum and C. sordellii. Although real-time PCR was more sensitive than the culture method, both systems improve the recovery rate but in different ways and are useful to determine pathogenic clostridia in biogas plants. In conclusion, BGWs could present a biohazard risk of clostridia for humans and animals. PMID:24984829

  13. The COMRADE System for Multirobot Autonomous Landmine Detection in Postconflict Regions

    Directory of Open Access Journals (Sweden)

    Prithviraj Dasgupta

    2015-01-01

    Full Text Available We consider the problem of autonomous landmine detection using a team of mobile robots. Previous research on robotic landmine detection mostly employs a single robot equipped with a landmine detection sensor to detect landmines. We envisage that the quality of landmine detection can be significantly improved if multiple robots are coordinated to detect landmines in a cooperative manner by incrementally fusing the landmine-related sensor information they collect and then use that information to visit locations of potential landmines. Towards this objective, we describe a multirobot system called COMRADES to address different aspects of the autonomous landmine detection problem including distributed area coverage to detect and locate landmines, information aggregation to fuse the sensor information obtained by different robots, and multirobot task allocation (MRTA to enable different robots to determine a suitable sequence to visit locations of potential landmines while reducing the time required and battery expended. We have used commercially available all-terrain robots called Coroware Explorer that are customized with a metal detector to detect metallic objects including landmines, as well as indoor Corobot robots, both in simulation and in physical experiments, to test the different techniques in COMRADES.

  14. Autonomous detection of ISO fade point with color laser printers

    Science.gov (United States)

    Yan, Ni; Maggard, Eric; Fothergill, Roberta; Jessome, Renee J.; Allebach, Jan P.

    2015-01-01

    Image quality assessment is a very important field in image processing. Human observation is slow and subjective, it also requires strict environment setup for the psychological test 1. Thus developing algorithms to match desired human experiments is always in need. Many studies have focused on detecting the fading phenomenon after the materials are printed, that is to monitor the persistence of the color ink 2-4. However, fading is also a common artifact produced by printing systems when the cartridges run low. We want to develop an automatic system to monitor cartridge life and report fading defects when they appear. In this paper, we first describe a psychological experiment that studies the human perspective on printed fading pages. Then we propose an algorithm based on Color Space Projection and K-means clustering to predict the visibility of fading defects. At last, we integrate the psychological experiment result with our algorithm to give a machine learning tool that monitors cartridge life.

  15. New quantitative detection of pathogens in heterogeneous environmental samples

    Science.gov (United States)

    Lee, Eun-Hee; Wang, Xiaofang; Mitchell, Kristi; Chae, Seon-Ha; Son, Ahjeong

    2015-04-01

    Quantum dots and magnetic beads based genomic assay (NanoGene assay) has been developed for sensitive and inhibition resistant gene quantification to achieve in-situ bacteria monitoring in environmental samples. In this study, eaeA gene of pathogenic E. coli O157:H7 was quantified. The result demonstrated the excellent sensitivity (i.e., limit of detection: 87 gene copies for dsDNA and 890 zeptomolar for ssDNA) in the presence of nonspecific microbial populations (Kim et al., 2010; 2011a). The feasibility of the developed gene quantification for non-laboratory environment usage (in-situ use) was investigated. Therefore, DNA hybridization was achieved at ambient temperature and minimum agitation, and the analysis was completed within hours. Most importantly, the NanoGene assay demonstrated the resistance to the presence of naturally occurring inhibitors (humic acids, cations) and residual reagents (surfactants, alcohols) from DNA extraction (Kim et al., 2011b). The assay was also applied to humic acids laden soils (7 types of soils with various amount of organic matters) and successfully quantified 105 to 108 CFU of E. coli O157:H7 per gram soil (R2 = 0.99). The results indicate that the presented NanoGene assay is suitable for further development as an in-situ bacteria monitoring method for working with heterogeneous environmental samples (Wang et al., 2013). Another aspect of the method is to transform the NanoGene assay into a portable device that can be used as a pathogenic bacteria detector in environment. The project consisted of the first inline fluidic components development and characterization as well as the first integration effort on a briefcase platform for the in-situ pathogen detection system (IPDS) (Mitchell et al., 2014). Our long term vision is to further miniaturize the briefcase platform implementation of the IPDS and to commercialize the handheld version of the IPDS.

  16. Humic substances interfere with detection of pathogenic prion protein

    Science.gov (United States)

    Smith, Christen B.; Booth, Clarissa J.; Wadzinski, Tyler J.; Legname, Giuseppe; Chappell, Rick; Johnson, Christopher J.; Pedersen, Joel A.

    2014-01-01

    Studies examining the persistence of prions (the etiological agent of transmissible spongiform encephalopathies) in soil require accurate quantification of pathogenic prion protein (PrPTSE) extracted from or in the presence of soil particles. Here, we demonstrate that natural organic matter (NOM) in soil impacts PrPTSE detection by immunoblotting. Methods commonly used to extract PrPTSE from soils release substantial amounts of NOM, and NOM inhibited PrPTSE immunoblot signal. The degree of immunoblot interference increased with increasing NOM concentration and decreasing NOM polarity. Humic substances affected immunoblot detection of prion protein from both deer and hamsters. We also establish that after interaction with humic acid, PrPTSE remains infectious to hamsters inoculated intracerebrally, and humic acid appeared to slow disease progression. These results provide evidence for interactions between PrPTSE and humic substances that influence both accurate measurement of PrPTSE in soil and disease transmission.

  17. Hyperspectral imaging for detecting pathogens grown on agar plates

    Science.gov (United States)

    Yoon, Seung Chul; Lawrence, Kurt C.; Siragusa, Gregory R.; Line, John E.; Park, Bosoon; Windham, William R.

    2007-09-01

    This paper is concerned with the development of a hyperspectral imaging technique for detecting and identifying one of the most common foodborne pathogens, Campylobacter. Direct plating using agars is an effective tool for laboratory tests and analyses of microorganisms. The morphology (size, growth pattern, color, etc.) of colonies grown on agar plates has been widely used to tentatively differentiate organisms. However, it is sometimes difficult to differentiate target organisms like Campylobacters from other contaminants grown together on the same agar plates. A hyperspectral imaging system operating at the visible and near infrared (VNIR) spectral region from 400 nm to 900 nm was set up to measure spectral signatures of 17 different Campylobacter and non-Campylobacter subspecies. Protocols for culturing, imaging samples and for calibrating measured data were developed. The VNIR spectral library of all 17 organisms commonly encountered in poultry was established from calibrated hyperspectral images. A classification algorithm was developed to locate and identify Campylobacters, non-Campylobacter contaminants, and background agars with 99.29% accuracy. This research has a potential to be expanded to detect other pathogens grown on agar media.

  18. A liquid-crystal-based DNA biosensor for pathogen detection

    Science.gov (United States)

    Khan, Mashooq; Khan, Abdur Rahim; Shin, Jae-Ho; Park, Soo-Young

    2016-03-01

    A liquid-crystal (LC)-filled transmission electron microscopy (TEM) grid cell coated with the cationic surfactant dodecyltrimethylammonium bromide (DTAB), to which a single-stranded deoxyribonucleic acid probe (ssDNAprobe) was adsorbed at the LC/aqueous interface (TEMDTAB/DNA), was applied for the highly specific detection of target DNA molecules. The DTAB-coated E7 (used LC mixture) in the TEM grid (TEMDTAB) exhibited a homeotropic orientation, and changed to a planar orientation upon adsorption of the ssDNAprobe. The TEMDTAB/DNA was then exposed to complementary (target) ssDNA, which resulted in a planar-to-homeotropic configurational change of E7 that could be observed through a polarized optical microscope under crossed polarizers. The optimum adsorption density (2 μM) of ssDNAprobe enabled the detection of ≥0.05 nM complementary ssDNA. This TEMDTAB/DNA biosensor could differentiate complementary ssDNA from mismatched ssDNA as well as double-stranded DNA. It also successfully detected the genomic DNAs of the bacterium Erwinia carotovora and the fungi Rhazictonia solani. Owe to the high specificity, sensitivity, and label-free detection, this biosensor may broaden the applications of LC-based biosensors to pathogen detection.

  19. POMDP-based online target detection and recognition for autonomous UAVs

    OpenAIRE

    Ponzoni Carvalho Chanel, Caroline; Teichteil-Königsbuch, Florent; Lesire, Charles

    2012-01-01

    This paper presents a target detection and recognition mission by an autonomous Unmanned Aerial Vehicule (UAV), modeled as a Partially Observable Markov Decision Process (POMDP). The POMDP model deals in a single framework with both perception actions (controlling the camera's view angle), and mission actions (moving between zones and flight levels, landing) needed to achieve the goal of the mission, i.e. landing in a zone containing a car whose model is recognized as a desired target model w...

  20. Detection of Biological Pathogens Using Multiple Wireless Magnetoelastic Biosensors

    Science.gov (United States)

    Shen, Wen

    A number of recent, high-profile incidences of food-borne illness spreading through the food supply and the use of anthrax by terrorists after the September 11, 2001 attacks have demonstrated the need for new technologies that can rapidly detect the presence of biological pathogens. A bevy of biosensors show excellent detection sensitivity and specificity. However, false positive and false negative signals remain one of the primary reasons that many of these newly developed biosensors have not found application in the marketplace. The research described in this dissertation focuses on developing a free-standing magnetoelastic based bio-sensing system using a pulse method. This method allows fast detection, eliminates the bias magnetic field that is necessary in current methods, makes the system more simply and suitable for in-field detection. This system has two pairs of transformer coils, where a measurement sensor and a control sensor can be put in each pair of coils. The control sensor is used to compensate for environmental variables. The effect of pulse power on the performance of the magnetoelastic sensors in the pulse system is studied. The system is found to have excellent stability, good detection repeatability when used with multiple sensors. This research has investigated and demonstrated a multiple sensors approach. Because it will involve the simultaneous measurement of many sensors, it will significantly reduce problems encountered with false positive indications. The positioning and interference of sensors are investigated. By adding a multi-channel structure to the pulse detection system, the effect of sensor interference is minimized. The result of the repeatability test shows that the standard deviation when measuring three 1 mm magnetoelastic sensors is around 500 Hz, which is smaller than the minimum requirement for actual spores/bacteria detection. Magnetoelastic sensors immobilized with JRB7 phages and E2 phages have been used to specifically

  1. Flood Detection and Monitoring by Autonomous Satellite Operations: the ASE Experience

    Science.gov (United States)

    Ip, F.; Dohm, J. M.; Baker, V. R.; Doggett, T.; Davies, A. G.; Castano, R.; Chien, S.; Cichy, B.; Greeley, R.; Sherwood, R.; Tran, D. Q.; Rabideau, G.

    2006-05-01

    We developed a satellite-based floodwater classification algorithm, ASE_FLOOD, to autonomously detect, monitor and respond to flooding events as they occur. It monitors selected river locations around the world for flood conditions in near real time through the Autonomous Sciencecraft Experiment (ASE). Normally, an ongoing flood might be missed because of the time required for the spacecraft to send its data to ground controllers for image processing and data analysis. The ASE approach cuts lengthy time lags inherent to taking an observation, transmitting it to the ground for study, and subsequently deciding to direct further satellite observations of an event. By introducing spaceborne data analysis and autonomous decision-making ability, ASE provides an innovative way for early detection, tracking and "rapid response" to dynamic transient flood events without any human intervention or prior knowledge. Tested and proven on NASA's EO-1 spacecraft, ASE's onboard data analysis detects flood/non-flood/cloudy conditions on the ground, and responds to the detected conditions accordingly using its ASE-facilitated autonomous decision making ability. Cloudy scenes and scenes with no significant flooding are dropped and not be transmitted, thereby saving downlink resources. When significant flooding is detected, ASE autonomously triggers the satellite to acquire additional images of the same target or adjacent flood-affected regions on the next orbital passes to track flood progress and map flood extent. This conditional change- based triggering allows the satellite to change its acquisition priorities and retarget its sensors to the emerging flood regions. The ASE approach greatly reduces the response time to floods from 2 weeks down to a possible 3 hours. It optimizes satellite downlink resources by eliminating useless scenes (e.g., cloudy) and preferentially transmitting onboard-derived data of high science value (e.g., time series of floodwater inundation maps). This

  2. Detection of pathogenic organisms in food, water, and body fluids

    Science.gov (United States)

    Wallace, William H.; Henley, Michael V.; Sayler, Gary S.

    2002-06-01

    The construction of specific bioluminescent bacteriophage for detection of pathogenic organism can be developed to overcome interferences in complex matrices such as food, water and body fluids. Detection and identification of bacteria often require several days and frequently weeks by standard methods of isolation, growth and biochemical test. Immunoassay detection often requires the expression of the bacterial toxin, which can lead to non-detection of cells that may express the toxin under conditions different from testing protocols. Immunoassays require production of a specific antibody to the agent for detection and interference by contaminants frequently affects results. PCR based detection may be inhibited by substances in complex matrices. Modified methods of the PCR technique, such as magnetic capture-hybridization PCR (MCH-PCR), appear to improve the technique by removing the DNA products away from the inhibitors. However, the techniques required for PCR-based detection are slow and the procedures require skilled personnel working with labile reagents. Our approach is based on transferring bioluminescence (lux) genes into a selected bacteriophage. Bacteriophages are bacterial viruses that are widespread in nature and often are genus and species specific. This specificity eliminates or reduces false positives in a bacteriophage assay. The phage recognizes a specific receptor molecule on the surface of a susceptible bacterium, attaches and then injects the viral nucleic acid into the cell. The injected viral genome is expressed and then replicated, generating numerous exact copies of the viral genetic material including the lux genes, often resulting in an increase in bioluminescence by several hundred fold.

  3. Fluorimetric detection of pathogenic bacteria using magnetic carbon dots.

    Science.gov (United States)

    Bhaisare, Mukesh Lavkush; Gedda, Gangaraju; Khan, M Shahnawaz; Wu, Hui-Fen

    2016-05-12

    A novel and facile approach of pathogenic bacteria detection, which utilizes fluorescent sensing and bacteria capture with Magnetic carbon dots (Mag-CDs), was proposed in this work. Magnetic nanoparticles were synthesized and then decorated with C-dots, and further functionalized with amine groups (chitosan). In this way, bacteria were strongly anchored on the hybrid material Mag-CDs for highly sensitive fluorescent detection. The Mag-CDs were characterized by UV-vis, FT-IR spectra, TEM images, XRD, and EDX. The characterizations validate the fabrication of amine-Mag-CDs and the promising applications of this material. Fluorescence spectroscope and MALDI-MS were used for the detection and identification of bacterial strains, respectively. The limit of detection for Staphylococcus aureus and Escherichia coli was found to be 3 × 10(2) and 3.5 × 10(2) cfu mL(-1), respectively. With these encouraging results, it is expected that it would open revenues for promising applications of Mag-CDs nanomaterial. PMID:27114224

  4. Grid-Based Multi-Sensor Fusion for On-Road Obstacle Detection: Application to Autonomous Driving

    OpenAIRE

    Gálvez del Postigo Fernández, Carlos

    2015-01-01

    Self-driving cars have recently become a challenging research topic, with the aim of making transportation safer and more efficient. Current advanced driving assistance systems (ADAS) allow cars to drive autonomously by following lane markings, identifying road signs and detecting pedestrians and other vehicles. In this thesis work we improve the robustness of autonomous cars by designing an on-road obstacle detection system. The proposed solution consists on the low-level fusion of radar and...

  5. Molecular Detection of Common Bacterial Pathogens Causing Meningitis

    Directory of Open Access Journals (Sweden)

    H Sadighian

    2009-03-01

    Full Text Available "nBackground: The clinical diagnosis of meningitis is crucial, particularly in children. The early diagnosis and empiric an­tibi­otic treatments have led to a reduction in morbidity and mortality rates. PCR and the enzymatic digestion of 16SrDNA frag­ment which is produced by universal primers led up fast and sensitive determination. The purpose of this study was to investi­gate a rapid method for detection of common bacterial pathogens causing meningitis."nMethods: According to the gene encoding 16SrDNA found in all bacteria, a pair of primers was designed. Then the univer­sal PCR was performed for bacterial agents of meningitis (Streptococcus pneumoniae, Neisseria meningitidis, Haemophilus influ­enzae, etc. by employing broad- range DNA extraction method. The ob­tained uni­versal PCR products were digested with restriction enzymes (HaeIII, AluI and MnlI to identify bacterial species. "nResults: By the enzymatic digestion of the universal products of each standard strain of the above bacteria, specific patterns were achieved. These specific patterns may be used for comparison in CSF examination. The analytical sensitivity of the as­say was approximately 1.5´102 CFU/ml of CSF even in samples with high amount of proteins. Conclusion: The universal PCR coupled with enzymatic digestion can be used to detect and identify bacterial pathogens in clini­cal specimens rapidly and accurately. Molecular diagnostic of bacterial meningitis, though expensive and labor-inten­sive, but is valuable and critical in patient management.

  6. Enzyme-free amplified detection of DNA by an autonomous ligation DNAzyme machinery.

    Science.gov (United States)

    Wang, Fuan; Elbaz, Johann; Willner, Itamar

    2012-03-28

    The Zn(2+)-dependent ligation DNAzyme is implemented as a biocatalyst for the amplified detection of a target DNA by the autonomous replication of a nucleic acid reporter unit that is generated by the catalyzed ligation process. The reporter units enhance the formation of active DNAzyme units, thus leading to the isothermal autocatalytic formation of the reporter elements. The system was further developed and applied for the amplified detection of Tay-Sachs genetic disorder mutant, with a detection limit of 1.0 × 10(-11) M. Besides providing a versatile paradigm for the amplified detection of DNA, the system reveals a new, enzyme-free, isothermal, autocatalytic mechanism that introduces means for effective programmed synthesis. PMID:22404383

  7. A Path Tracking Algorithm Using Future Prediction Control with Spike Detection for an Autonomous Vehicle Robot

    Directory of Open Access Journals (Sweden)

    Muhammad Aizzat Zakaria

    2013-08-01

    Full Text Available Trajectory tracking is an important aspect of autonomous vehicles. The idea behind trajectory tracking is the ability of the vehicle to follow a predefined path with zero steady state error. The difficulty arises due to the nonlinearity of vehicle dynamics. Therefore, this paper proposes a stable tracking control for an autonomous vehicle. An approach that consists of steering wheel control and lateral control is introduced. This control algorithm is used for a non-holonomic navigation problem, namely tracking a reference trajectory in a closed loop form. A proposed future prediction point control algorithm is used to calculate the vehicle’s lateral error in order to improve the performance of the trajectory tracking. A feedback sensor signal from the steering wheel angle and yaw rate sensor is used as feedback information for the controller. The controller consists of a relationship between the future point lateral error, the linear velocity, the heading error and the reference yaw rate. This paper also introduces a spike detection algorithm to track the spike error that occurs during GPS reading. The proposed idea is to take the advantage of the derivative of the steering rate. This paper aims to tackle the lateral error problem by applying the steering control law to the vehicle, and proposes a new path tracking control method by considering the future coordinate of the vehicle and the future estimated lateral error. The effectiveness of the proposed controller is demonstrated by a simulation and a GPS experiment with noisy data. The approach used in this paper is not limited to autonomous vehicles alone since the concept of autonomous vehicle tracking can be used in mobile robot platforms, as the kinematic model of these two platforms is similar.

  8. An Autonomous Wearable System for Predicting and Detecting Localised Muscle Fatigue

    Directory of Open Access Journals (Sweden)

    Martin Colley

    2011-01-01

    Full Text Available Muscle fatigue is an established area of research and various types of muscle fatigue have been clinically investigated in order to fully understand the condition. This paper demonstrates a non-invasive technique used to automate the fatigue detection and prediction process. The system utilises the clinical aspects such as kinematics and surface electromyography (sEMG of an athlete during isometric contractions. Various signal analysis methods are used illustrating their applicability in real-time settings. This demonstrated system can be used in sports scenarios to promote muscle growth/performance or prevent injury. To date, research on localised muscle fatigue focuses on the clinical side and lacks the implementation for detecting/predicting localised muscle fatigue using an autonomous system. Results show that automating the process of localised muscle fatigue detection/prediction is promising. The autonomous fatigue system was tested on five individuals showing 90.37% accuracy on average of correct classification and an error of 4.35% in predicting the time to when fatigue will onset.

  9. Automatic detection and classification of obstacles with applications in autonomous mobile robots

    Science.gov (United States)

    Ponomaryov, Volodymyr I.; Rosas-Miranda, Dario I.

    2016-04-01

    Hardware implementation of an automatic detection and classification of objects that can represent an obstacle for an autonomous mobile robot using stereo vision algorithms is presented. We propose and evaluate a new method to detect and classify objects for a mobile robot in outdoor conditions. This method is divided in two parts, the first one is the object detection step based on the distance from the objects to the camera and a BLOB analysis. The second part is the classification step that is based on visuals primitives and a SVM classifier. The proposed method is performed in GPU in order to reduce the processing time values. This is performed with help of hardware based on multi-core processors and GPU platform, using a NVIDIA R GeForce R GT640 graphic card and Matlab over a PC with Windows 10.

  10. Vision-based real-time obstacle detection and tracking for autonomous vehicle guidance

    Science.gov (United States)

    Yang, Ming; Yu, Qian; Wang, Hong; Zhang, Bo

    2002-03-01

    The ability of obstacles detection and tracking is essential for safe visual guidance of autonomous vehicles, especially in urban environments. In this paper, we first overview different plane projective transformation (PPT) based obstacle detection approaches under the planar ground assumption. Then, we give a simple proof of this approach with relative affine, a unified framework that includes the Euclidean, projective and affine frameworks by generalization and specialization. Next, we present a real-time hybrid obstacle detection method, which combined the PPT based method with the region segmentation based method to provide more accurate locations of obstacles. At last, with the vehicle's position information, a Kalman Filter is applied to track obstacles from frame to frame. This method has been tested on THMR-V (Tsinghua Mobile Robot V). Through various experiments we successfully demonstrate its real-time performance, high accuracy, and high robustness.

  11. Detecting marine hazardous substances and organisms: sensors for pollutants, toxins, and pathogens

    Directory of Open Access Journals (Sweden)

    O. Zielinski

    2009-09-01

    Full Text Available Marine environments are influenced by a wide diversity of anthropogenic and natural substances and organisms that may have adverse effects on human health and ecosystems. Real-time measurements of pollutants, toxins, and pathogens across a range of spatial scales are required to adequately monitor these hazards, manage the consequences, and to understand the processes governing their magnitude and distribution. Significant technological advancements have been made in recent years for the detection and analysis of such marine hazards. In particular, sensors deployed on a variety of mobile and fixed-point observing platforms provide a valuable means to assess hazards. In this review, we present state-of-the-art of sensor technology for the detection of harmful substances and organisms in the ocean. Sensors are classified by their adaptability to various platforms, addressing large, intermediate, or small areal scales. Current gaps and future demands are identified with an indication of the urgent need for new sensors to detect marine hazards at all scales in autonomous real-time mode. Progress in sensor technology is expected to depend on the development of small-scale sensor technologies with a high sensitivity and specificity towards target analytes or organisms. However, deployable systems must comply with platform requirements as these interconnect the three areal scales. Future developments will include the integration of existing methods into complex and operational sensing systems for a comprehensive strategy for long-term monitoring. The combination of sensor techniques on all scales will remain crucial for the demand of large spatial and temporal coverage.

  12. Detecting marine hazardous substances and organisms: sensors for pollutants, toxins, and pathogens

    Directory of Open Access Journals (Sweden)

    O. Zielinski

    2009-05-01

    Full Text Available Marine environments are influenced by a wide diversity of anthropogenic and natural substances and organisms that may have adverse effects on human health and ecosystems. Real-time measurements of pollutants, toxins, and pathogens across a range of spatial scales are required to adequately monitor these hazards, manage the consequences, and to understand the processes governing their magnitude and distribution. Significant technological advancements have been made in recent years for the detection and analysis of such marine hazards. In particular, sensors deployed on a variety of mobile and fixed-point observing platforms provide a valuable means to assess hazards. In this review, we present state-of-the-art of sensor technology for the detection of harmful substances and organisms in the ocean. Sensors are classified by their adaptability to various platforms, addressing large, intermediate, or small areal scales. Current gaps and future demands are identified with an indication of the urgent need for new sensors to detect marine hazards at all scales in autonomous real-time mode. Progress in sensor technology is expected to depend on the development of small-scale sensor technologies with a high sensitivity and specificity towards target analytes or organisms. However, deployable systems must comply with platform requirements as these interconnect the three areal scales. Future developments will include the integration of existing methods into complex and operational sensing systems for a comprehensive strategy for long-term monitoring. The combination of sensor techniques on all scales will remain crucial for the demand of large spatial and temporal coverage.

  13. A Multiplexed Diagnostic Platform for Point-of-Care Pathogen Detection

    Energy Technology Data Exchange (ETDEWEB)

    Regan, J F; Letant, S E; Adams, K L; Mahnke, R C; Nguyen, N T; Dzenitis, J M; Hindson, B J; Hadley, D R; Makarewicz, T J; Henderer, B D; Breneman, J W; Tammero, L F; Ortiz, J I; Derlet, R W; Cohen, S; Colston, W W; McBride, M T; Birch, J M

    2008-02-04

    We developed an automated point-of-care diagnostic instrument that is capable of analyzing nasal swab samples for the presence of respiratory diseases. This robust instrument, called FluIDx, performs autonomous multiplexed RT-PCR reactions that are analyzed by microsphere xMAP technology. We evaluated the performance of FluIDx, in comparison rapid tests specific for influenza and respiratory syncytial virus, in a clinical study performed at the UC Davis Medical Center. The clinical study included samples positive for RSV (n = 71), influenza A (n = 16), influenza B (n = 4), adenovirus (n = 5), parainfluenza virus (n = 2), and 44 negative samples, according to a composite reference method. FluIDx and the rapid tests detected 85.9% and 62.0% of the RSV positive samples, respectively. Similar sensitivities were recorded for the influenza B samples; whereas the influenza A samples were poorly detected, likely due to the utilization of an influenza A signature that did not accurately match currently circulating influenza A strains. Data for all pathogens were compiled and indicate that FluIDx is more sensitive than the rapid tests, detecting 74.2% (95% C.I. of 64.7-81.9%) of the positive samples in comparison to 53.6% (95% C.I. of 43.7-63.2%) for the rapid tests. The higher sensitivity of FluIDx was partially offset by a lower specificity, 77.3% versus 100.0%. Overall, these data suggest automated flow-through PCR-based instruments that perform multiplexed assays can successfully screen clinical samples for infectious diseases.

  14. Detection and avoidance of simulated potholes in autonomous vehicle navigation in an unstructured environment

    Science.gov (United States)

    Karuppuswamy, Jaiganesh; Selvaraj, Vishnuvardhanaraj; Ganesh, Meyyappa M.; Hall, Ernest L.

    2000-10-01

    In the navigation of an autonomous vehicle, tracking and avoidance of the obstacles presents an interesting problem as this involves the integration of the vision and the motion systems. In an unstructured environment, the problem becomes much more severe as the obstacles have to be clearly recognized for any decisive action to be taken. In this paper, we discuss a solution to detection and avoidance of simulated potholes in the path of an autonomous vehicle operating in an unstructured environment. Pothole avoidance may be considered similar to other obstacle avoidance except that the potholes are depressions rather than extrusions form a surface. A non-contact vision approach has been taken since potholes usually are significantly different visually from a background surface. Large potholes more than 2 feet in diameter will be detected. Furthermore, only white potholes will be detected on a background of grass, asphalt, sand or green painted bridges. The signals from the environment are captured by the vehicle's vision systems and pre-processed appropriately. A histogram is used to determine a brightness threshold to determine if a pothole is within the field of view. Then, a binary image is formed. Regions are then detected in the binary image. Regions that have a diameter close to 2 feet and a ratio of circumference to diameter close to pi are considered potholes. The neuro-fuzzy logic controller where navigational strategies are evaluated uses these signals to decide a final course of navigation. The primary significance of the solution is that it is interfaced seamlessly into the existing central logic controller. The solution can also be easily extended to detect and avoid any two dimensional shape.

  15. Medium-resolution autonomous in situ gamma detection system for marine and coastal waters

    International Nuclear Information System (INIS)

    We are developing a medium-resolution autonomous in situ gamma detection system for marine and coastal waters. The system is designed to extract and preconcentrate isotopes of interest from natural waters prior to detection in order to eliminate signal attenuation of the gamma rays traveling through water and lower the overall background from the presence of naturally occurring radioactive isotopes (40K and U-Th series radionuclides). Filtration is used to preconcentrate target isotopes residing on suspended particles, while chemosorption is employed to preferentially extract truly dissolved components from the water column. Used filter and chemosorbent media will be counted autonomously using two LaBr3 detectors in a near 4-π configuration around the samples. A compact digital pulse processing system, developed in-house and capable of running in coincidence mode, is used to process the signal from the detectors to a small on-board computer. The entire system is extremely compact (9' dia. x 30' len.) and platform independent, but designed for initial deployment on a research buoy. A variety of commercial and in-house nano-porous chemosorbents have been selected, procured or produced, and these and filter and detector components have been tested. (author)

  16. Characterization of novel sufraces by FTIR spectroscopy and atomic force microscopy for food pathogen detection

    Science.gov (United States)

    Single molecular detection of pathogens and toxins of interest to food safety is within grasp using technology such as Atomic Force Microscopy. Using antibodies or specific aptamers connected to the AFM tip make it possible to detect a pathogen molecule on a surface. However, it also becomes necess...

  17. A microarray approach for simultaneous detection of multiple pathogens in food

    Science.gov (United States)

    A pathogen detection microarray was developed for simultaneous detection of the four most prominent foodborne pathogens including Escherichia coli O157:H7, Salmonella enterica, Listeria monocytogenes and Campylobacter jejuni. The approach utilized 14 species-specific gene targets to design a variety...

  18. 9 CFR 113.37 - Detection of pathogens by the chicken embryo inoculation test.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Detection of pathogens by the chicken... VECTORS STANDARD REQUIREMENTS Standard Procedures § 113.37 Detection of pathogens by the chicken embryo...-serum mixture shall be inoculated into each of at least 20 fully susceptible chicken embryos. (1)...

  19. Autonomous absolute calibration of an ICCD camera in single-photon detection regime

    CERN Document Server

    Qi, Luo; Leuchs, Gerd; Chekhova, Maria V

    2016-01-01

    Intensified charge coupled device (ICCD) cameras are widely used in various applications such as microscopy, astronomy, spectroscopy. Often they are used as single-photon detectors, with thresholding being an essential part of the readout. In this paper, we measure the quantum efficiency of an ICCD camera in the single-photon detection mode using the Klyshko absolute calibration technique. The quantum efficiency is obtained as a function of the threshold value and of the wavelength of the detected light. In addition, we study the homogeneity of the photon sensitivity over the camera chip area. The experiment is performed in the autonomous regime, without using any additional detectors. We therefore demonstrate the self-calibration of an ICCD camera.

  20. A Novel Robust Scene Change Detection Algorithm for Autonomous Robots Using Mixtures of Gaussians

    Directory of Open Access Journals (Sweden)

    Luis J. Manso

    2014-02-01

    Full Text Available Interest in change detection techniques has considerably increased during recent years in the field of autonomous robotics. This is partly because changes in a robot’s working environment are useful for several robotic skills (e.g., spatial cognition, modelling or navigation and applications (e.g., surveillance or guidance robots. Changes are usually detected by comparing current data provided by the robot’s sensors with a previously known map or model of the environment. When the data consists of a large point cloud, dealing with it is a computationally expensive task, mainly due to the amount of points and the redundancy. Using Gaussian Mixture Models (GMM instead of raw point clouds leads to a more compact feature space that can be used to efficiently process the input data. This allows us to successfully segment the set of 3D points acquired by the sensor and reduce the computational load of the change detection algorithm. However, the segmentation of the environment as a Mixture of Gaussians has some problems that need to be properly addressed. In this paper, a novel change detection algorithm is described in order to improve the robustness and computational cost of previous approaches. The proposal is based on the classic Expectation Maximization (EM algorithm, for which different selection criteria are evaluated. As demonstrated in the experimental results section, the proposed change detection algorithm achieves the detection of changes in the robot’s working environment faster and more accurately than similar approaches.

  1. Hand-eye LRF-based Iterative Plane Detection Method for Autonomous Robotic Welding

    Directory of Open Access Journals (Sweden)

    Sungmin Lee

    2015-12-01

    Full Text Available This paper proposes a hand-eye LRF-based (laser range finder welding plane-detection method for autonomous robotic welding in the field of shipbuilding. The hand-eye LRF system consists of a 6 DOF manipulator and an LRF attached to the wrist of the manipulator. The welding plane is detected by the LRF with only the wrist’s rotation to minimize a mechanical error caused by the manipulator’s motion. A position on the plane is determined as an average position of the detected points on the plane, and a normal vector to the plane is determined by applying PCA (principal component analysis to the detected points. In this case, the accuracy of the detected plane is analysed by simulations with respect to the wrist’s angle interval and the plane angle. As a result of the analysis, an iterative plane-detection method with the manipulator’s alignment motion is proposed to improve the performance of plane detection. For verifying the feasibility and effectiveness of the proposed plane-detection method, experiments are carried out with a prototype of the hand-eye LRF-based system, which consists of a 1 DOF wrist’s joint, an LRF system and a rotatable plane. In addition, the experimental results of the PCA-based plane detection method are compared with those of the two representative plane-detection methods, based on RANSAC (RANdom SAmple Consensus and the 3D Hough transform in both accuracy and computation time’s points of view.

  2. Canine Detection of the Volatilome: A Review of Implications for Pathogen and Disease Detection

    Science.gov (United States)

    Angle, Craig; Waggoner, Lowell Paul; Ferrando, Arny; Haney, Pamela; Passler, Thomas

    2016-01-01

    The volatilome is the entire set of volatile organic compounds (VOC) produced by an organism. The accumulation of VOC inside and outside of the body reflects the unique metabolic state of an organism. Scientists are developing technologies to non-invasively detect VOC for the purposes of medical diagnosis, therapeutic monitoring, disease outbreak containment, and disease prevention. Detection dogs are proven to be a valuable real-time mobile detection technology for the detection of VOC related to explosives, narcotics, humans, and many other targets of interests. Little is known about what dogs are detecting when searching for biological targets. It is important to understand where biological VOC originates and how dogs might be able to detect biological targets. This review paper discusses the recent scientific literature involving VOC analysis and postulates potential biological targets for canine detection. Dogs have shown their ability to detect pathogen and disease-specific VOC. Future research will determine if dogs can be employed operationally in hospitals, on borders, in underserved areas, on farms, and in other operational environments to give real-time feedback on the presence of a biological target. PMID:27446935

  3. Bio-Inspired Autonomous Communications Systems with Anomaly Detection Monitoring Project

    Data.gov (United States)

    National Aeronautics and Space Administration — We propose to develop and demonstrate BioComm, a bio-inspired autonomous communications system (ACS) aimed at dynamically reconfiguring and redeploying autonomous...

  4. 360-Degree Visual Detection and Target Tracking on an Autonomous Surface Vehicle

    Science.gov (United States)

    Wolf, Michael T; Assad, Christopher; Kuwata, Yoshiaki; Howard, Andrew; Aghazarian, Hrand; Zhu, David; Lu, Thomas; Trebi-Ollennu, Ashitey; Huntsberger, Terry

    2010-01-01

    This paper describes perception and planning systems of an autonomous sea surface vehicle (ASV) whose goal is to detect and track other vessels at medium to long ranges and execute responses to determine whether the vessel is adversarial. The Jet Propulsion Laboratory (JPL) has developed a tightly integrated system called CARACaS (Control Architecture for Robotic Agent Command and Sensing) that blends the sensing, planning, and behavior autonomy necessary for such missions. Two patrol scenarios are addressed here: one in which the ASV patrols a large harbor region and checks for vessels near a fixed asset on each pass and one in which the ASV circles a fixed asset and intercepts approaching vessels. This paper focuses on the ASV's central perception and situation awareness system, dubbed Surface Autonomous Visual Analysis and Tracking (SAVAnT), which receives images from an omnidirectional camera head, identifies objects of interest in these images, and probabilistically tracks the objects' presence over time, even as they may exist outside of the vehicle's sensor range. The integrated CARACaS/SAVAnT system has been implemented on U.S. Navy experimental ASVs and tested in on-water field demonstrations.

  5. A hybrid FPGA/Tilera compute element for autonomous hazard detection and navigation

    Science.gov (United States)

    Villalpando, C. Y.; Werner, R. A.; Carson, J. M.; Khanoyan, G.; Stern, R. A.; Trawny, N.

    To increase safety for future missions landing on other planetary or lunar bodies, the Autonomous Landing and Hazard Avoidance Technology (ALHAT) program is developing an integrated sensor for autonomous surface analysis and hazard determination. The ALHAT Hazard Detection System (HDS) consists of a Flash LIDAR for measuring the topography of the landing site, a gimbal to scan across the terrain, and an Inertial Measurement Unit (IMU), along with terrain analysis algorithms to identify the landing site and the local hazards. An FPGA and Manycore processor system was developed to interface all the devices in the HDS, to provide high-resolution timing to accurately measure system state, and to run the surface analysis algorithms quickly and efficiently. In this paper, we will describe how we integrated COTS components such as an FPGA evaluation board, a TILExpress64, and multi-threaded/multi-core aware software to build the HDS Compute Element (HDSCE). The ALHAT program is also working with the NASA Morpheus Project and has integrated the HDS as a sensor on the Morpheus Lander. This paper will also describe how the HDS is integrated with the Morpheus lander and the results of the initial test flights with the HDS installed. We will also describe future improvements to the HDSCE.

  6. A Hybrid FPGA/Tilera Compute Element for Autonomous Hazard Detection and Navigation

    Science.gov (United States)

    Villalpando, Carlos Y.; Werner, Robert A.; Carson, John M., III; Khanoyan, Garen; Stern, Ryan A.; Trawny, Nikolas

    2013-01-01

    To increase safety for future missions landing on other planetary or lunar bodies, the Autonomous Landing and Hazard Avoidance Technology (ALHAT) program is developing an integrated sensor for autonomous surface analysis and hazard determination. The ALHAT Hazard Detection System (HDS) consists of a Flash LIDAR for measuring the topography of the landing site, a gimbal to scan across the terrain, and an Inertial Measurement Unit (IMU), along with terrain analysis algorithms to identify the landing site and the local hazards. An FPGA and Manycore processor system was developed to interface all the devices in the HDS, to provide high-resolution timing to accurately measure system state, and to run the surface analysis algorithms quickly and efficiently. In this paper, we will describe how we integrated COTS components such as an FPGA evaluation board, a TILExpress64, and multi-threaded/multi-core aware software to build the HDS Compute Element (HDSCE). The ALHAT program is also working with the NASA Morpheus Project and has integrated the HDS as a sensor on the Morpheus Lander. This paper will also describe how the HDS is integrated with the Morpheus lander and the results of the initial test flights with the HDS installed. We will also describe future improvements to the HDSCE.

  7. Pathogen detection in milk samples by ligation detection reaction-mediated universal array method.

    Science.gov (United States)

    Cremonesi, P; Pisoni, G; Severgnini, M; Consolandi, C; Moroni, P; Raschetti, M; Castiglioni, B

    2009-07-01

    This paper describes a new DNA chip, based on the use of a ligation detection reaction coupled to a universal array, developed to detect and analyze, directly from milk samples, microbial pathogens known to cause bovine, ovine, and caprine mastitis or to be responsible for foodborne intoxication or infection, or both. Probes were designed for the identification of 15 different bacterial groups: Staphylococcus aureus, Streptococcus agalactiae, nonaureus staphylococci, Streptococcus bovis, Streptococcus equi, Streptococcus canis, Streptococcus dysgalactiae, Streptococcus parauberis, Streptococcus uberis, Streptococcus pyogenes, Mycoplasma spp., Salmonella spp., Bacillus spp., Campylobacter spp., and Escherichia coli and related species. These groups were identified based on the 16S rRNA gene. For microarray validation, 22 strains from the American Type Culture Collection or other culture collections and 50 milk samples were tested. The results demonstrated high specificity, with sensitivity as low as 6 fmol. Moreover, the ligation detection reaction-universal array assay allowed for the identification of Mycoplasma spp. in a few hours, avoiding the long incubation times of traditional microbiological identification methods. The universal array described here is a versatile tool able to identify milk pathogens efficiently and rapidly. PMID:19528580

  8. Engineered nanoconstructs for the multiplexed and sensitive detection of high-risk pathogens

    Science.gov (United States)

    Seo, Youngmin; Kim, Ji-Eun; Jeong, Yoon; Lee, Kwan Hong; Hwang, Jangsun; Hong, Jongwook; Park, Hansoo; Choi, Jonghoon

    2016-01-01

    Many countries categorize the causative agents of severe infectious diseases as high-risk pathogens. Given their extreme infectivity and potential to be used as biological weapons, a rapid and sensitive method for detection of high-risk pathogens (e.g., Bacillus anthracis, Francisella tularensis, Yersinia pestis, and Vaccinia virus) is highly desirable. Here, we report the construction of a novel detection platform comprising two units: (1) magnetic beads separately conjugated with multiple capturing antibodies against four different high-risk pathogens for simple and rapid isolation, and (2) genetically engineered apoferritin nanoparticles conjugated with multiple quantum dots and detection antibodies against four different high-risk pathogens for signal amplification. For each high-risk pathogen, we demonstrated at least 10-fold increase in sensitivity compared to traditional lateral flow devices that utilize enzyme-based detection methods. Multiplexed detection of high-risk pathogens in a sample was also successful by using the nanoconstructs harboring the dye molecules with fluorescence at different wavelengths. We ultimately envision the use of this novel nanoprobe detection platform in future applications that require highly sensitive on-site detection of high-risk pathogens.

  9. Drogue detection for vision-based autonomous aerial refueling via low rank and sparse decomposition with multiple features

    Science.gov (United States)

    Gao, Shibo; Cheng, Yongmei; Song, Chunhua

    2013-09-01

    The technology of vision-based probe-and-drogue autonomous aerial refueling is an amazing task in modern aviation for both manned and unmanned aircraft. A key issue is to determine the relative orientation and position of the drogue and the probe accurately for relative navigation system during the approach phase, which requires locating the drogue precisely. Drogue detection is a challenging task due to disorderly motion of drogue caused by both the tanker wake vortex and atmospheric turbulence. In this paper, the problem of drogue detection is considered as a problem of moving object detection. A drogue detection algorithm based on low rank and sparse decomposition with local multiple features is proposed. The global and local information of drogue is introduced into the detection model in a unified way. The experimental results on real autonomous aerial refueling videos show that the proposed drogue detection algorithm is effective.

  10. Autonomous detection and anticipation of jam fronts from messages propagated by inter-vehicle communication

    CERN Document Server

    Sch"onhof, M; Kesting, A; Helbing, D; Sch\\"onhof, Martin; Treiber, Martin; Kesting, Arne; Helbing, Dirk

    2006-01-01

    In this paper, a minimalist, completely distributed freeway traffic information system is introduced. It involves an autonomous, vehicle-based jam front detection, the information transmission via inter-vehicle communication, and the forecast of the spatial position of jam fronts by reconstructing the spatiotemporal traffic situation based on the transmitted information. The whole system is simulated with an integrated traffic simulator, that is based on a realistic microscopic traffic model for longitudinal movements and lane changes. The function of its communication module has been explicitly validated by comparing the simulation results with analytical calculations. By means of simulations, we show that the algorithms for a congestion-front recognition, message transmission, and processing predict reliably the existence and position of jam fronts for vehicle equipment rates as low as 3%. A reliable mode of operation already for small market penetrations is crucial for the successful introduction of inter-...

  11. Validation of real-time PCR assays for bioforensic detection of model plant pathogens.

    Science.gov (United States)

    James, Mindy; Blagden, Trenna; Moncrief, Ian; Burans, James P; Schneider, Katherine; Fletcher, Jacqueline

    2014-03-01

    The U.S. agricultural sector is vulnerable to intentionally introduced microbial threats because of its wide and open distribution and economic importance. To investigate such events, forensically valid assays for plant pathogen detection are needed. In this work, real-time PCR assays were developed for three model plant pathogens: Pseudomonas syringae pathovar tomato, Xylella fastidiosa, and Wheat streak mosaic virus. Validation included determination of the linearity and range, limit of detection, sensitivity, specificity, and exclusivity of each assay. Additionally, positive control plasmids, distinguishable from native signature by restriction enzyme digestion, were developed to support forensic application of the assays. Each assay displayed linear amplification of target nucleic acid, detected 100 fg or less of target nucleic acid, and was specific to its target pathogen. Results obtained with these model pathogens provide the framework for development and validation of similar assays for other plant pathogens of high consequence. PMID:24261870

  12. Hyperspectral imaging using a color camera and its application for pathogen detection

    Science.gov (United States)

    This paper reports the results of a feasibility study for the development of a hyperspectral image recovery (reconstruction) technique using a RGB color camera and regression analysis in order to detect and classify colonies of foodborne pathogens. The target bacterial pathogens were the six represe...

  13. DETECTION AND IDENTIFICATION OF PATHOGENIC CANDIDA SPECIES IN WATER USING FLOW CYTOMETRY COUPLED WITH TAQMAN PCR

    Science.gov (United States)

    As the incidence of human fungal infection increases, the ability to detect and identify pathogenic fungi in potential environmental reservoirs becomes increasingly important for disease control. PCR based assays are widely used for diagnostic purposes, but may be inadequate for...

  14. Damage detection in composite structures using autonomous wireless systems: simulation and validation

    Energy Technology Data Exchange (ETDEWEB)

    Dumas, D; Lani, F [Cenaero, Centre de Recherche en Aeronautique, 29 Rue des freres Wright, B-6041 Gosselies (Belgium); Monnier, T [Universite de Lyon, INSA-Lyon, F-69621, Villeurbanne cedex (France); Smaili, R; Loyer, J, E-mail: david.dumas@cenaero.be [GOODRICH Actuation Systems, 106 Rue Fourny, F-78530, Buc (France)

    2011-07-19

    In the European FP6 project ADVICE, units that harvest energy from structural vibrations have been developed. These autonomous units are capable of wireless communication and are used as actuators of guided ultrasonic waves used to identify changes in structural behaviour. The growing use of composite structures in aeronautics brings new challenges to be able to predict and detect damage that may occur in these new materials. Part of the ADVICE project focused on studying the possibilities of damage detection in structures using Lamb waves. In order to do this, finite element simulations were performed and were compared with experimental data. This paper presents the finite element simulations performed to predict the behaviour of a structural health monitoring system. Using the technique and algorithms developed to quantify the amount of damage, we compare the numerical results to those that were obtained experimentally on a small representative composite structure. This allows evaluating how it is possible to design a monitoring system for composite structures and what needs to be addressed in the future.

  15. Landmark navigation and autonomous landing approach with obstacle detection for aircraft

    Science.gov (United States)

    Fuerst, Simon; Werner, Stefan; Dickmanns, Dirk; Dickmanns, Ernst D.

    1997-06-01

    A machine perception system for aircraft and helicopters using multiple sensor data for state estimation is presented. By combining conventional aircraft sensor like gyros, accelerometers, artificial horizon, aerodynamic measuring devices and GPS with vision data taken by conventional CCD-cameras mounted on a pan and tilt platform, the position of the craft can be determined as well as the relative position to runways and natural landmarks. The vision data of natural landmarks are used to improve position estimates during autonomous missions. A built-in landmark management module decides which landmark should be focused on by the vision system, depending on the distance to the landmark and the aspect conditions. More complex landmarks like runways are modeled with different levels of detail that are activated dependent on range. A supervisor process compares vision data and GPS data to detect mistracking of the vision system e.g. due to poor visibility and tries to reinitialize the vision system or to set focus on another landmark available. During landing approach obstacles like trucks and airplanes can be detected on the runway. The system has been tested in real-time within a hardware-in-the-loop simulation. Simulated aircraft measurements corrupted by noise and other characteristic sensor errors have been fed into the machine perception system; the image processing module for relative state estimation was driven by computer generated imagery. Results from real-time simulation runs are given.

  16. A Monocular Vision Sensor-Based Obstacle Detection Algorithm for Autonomous Robots

    Science.gov (United States)

    Lee, Tae-Jae; Yi, Dong-Hoon; Cho, Dong-Il “Dan”

    2016-01-01

    This paper presents a monocular vision sensor-based obstacle detection algorithm for autonomous robots. Each individual image pixel at the bottom region of interest is labeled as belonging either to an obstacle or the floor. While conventional methods depend on point tracking for geometric cues for obstacle detection, the proposed algorithm uses the inverse perspective mapping (IPM) method. This method is much more advantageous when the camera is not high off the floor, which makes point tracking near the floor difficult. Markov random field-based obstacle segmentation is then performed using the IPM results and a floor appearance model. Next, the shortest distance between the robot and the obstacle is calculated. The algorithm is tested by applying it to 70 datasets, 20 of which include nonobstacle images where considerable changes in floor appearance occur. The obstacle segmentation accuracies and the distance estimation error are quantitatively analyzed. For obstacle datasets, the segmentation precision and the average distance estimation error of the proposed method are 81.4% and 1.6 cm, respectively, whereas those for a conventional method are 57.5% and 9.9 cm, respectively. For nonobstacle datasets, the proposed method gives 0.0% false positive rates, while the conventional method gives 17.6%. PMID:26938540

  17. A Monocular Vision Sensor-Based Obstacle Detection Algorithm for Autonomous Robots.

    Science.gov (United States)

    Lee, Tae-Jae; Yi, Dong-Hoon; Cho, Dong-Il Dan

    2016-01-01

    This paper presents a monocular vision sensor-based obstacle detection algorithm for autonomous robots. Each individual image pixel at the bottom region of interest is labeled as belonging either to an obstacle or the floor. While conventional methods depend on point tracking for geometric cues for obstacle detection, the proposed algorithm uses the inverse perspective mapping (IPM) method. This method is much more advantageous when the camera is not high off the floor, which makes point tracking near the floor difficult. Markov random field-based obstacle segmentation is then performed using the IPM results and a floor appearance model. Next, the shortest distance between the robot and the obstacle is calculated. The algorithm is tested by applying it to 70 datasets, 20 of which include nonobstacle images where considerable changes in floor appearance occur. The obstacle segmentation accuracies and the distance estimation error are quantitatively analyzed. For obstacle datasets, the segmentation precision and the average distance estimation error of the proposed method are 81.4% and 1.6 cm, respectively, whereas those for a conventional method are 57.5% and 9.9 cm, respectively. For nonobstacle datasets, the proposed method gives 0.0% false positive rates, while the conventional method gives 17.6%. PMID:26938540

  18. Fully Autonomous Multiplet Event Detection: Application to Local-Distance Monitoring of Blood Falls Seismicity

    Energy Technology Data Exchange (ETDEWEB)

    Carmichael, Joshua Daniel [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Carr, Christina [Univ. of Alaska, Fairbanks, AK (United States); Pettit, Erin C. [Univ. of Alaska, Fairbanks, AK (United States)

    2015-06-18

    We apply a fully autonomous icequake detection methodology to a single day of high-sample rate (200 Hz) seismic network data recorded from the terminus of Taylor Glacier, ANT that temporally coincided with a brine release episode near Blood Falls (May 13, 2014). We demonstrate a statistically validated procedure to assemble waveforms triggered by icequakes into populations of clusters linked by intra-event waveform similarity. Our processing methodology implements a noise-adaptive power detector coupled with a complete-linkage clustering algorithm and noise-adaptive correlation detector. This detector-chain reveals a population of 20 multiplet sequences that includes ~150 icequakes and produces zero false alarms on the concurrent, diurnally variable noise. Our results are very promising for identifying changes in background seismicity associated with the presence or absence of brine release episodes. We thereby suggest that our methodology could be applied to longer time periods to establish a brine-release monitoring program for Blood Falls that is based on icequake detections.

  19. Damage detection in composite structures using autonomous wireless systems: simulation and validation

    International Nuclear Information System (INIS)

    In the European FP6 project ADVICE, units that harvest energy from structural vibrations have been developed. These autonomous units are capable of wireless communication and are used as actuators of guided ultrasonic waves used to identify changes in structural behaviour. The growing use of composite structures in aeronautics brings new challenges to be able to predict and detect damage that may occur in these new materials. Part of the ADVICE project focused on studying the possibilities of damage detection in structures using Lamb waves. In order to do this, finite element simulations were performed and were compared with experimental data. This paper presents the finite element simulations performed to predict the behaviour of a structural health monitoring system. Using the technique and algorithms developed to quantify the amount of damage, we compare the numerical results to those that were obtained experimentally on a small representative composite structure. This allows evaluating how it is possible to design a monitoring system for composite structures and what needs to be addressed in the future.

  20. Nucleic Acid-based Detection of Bacterial Pathogens Using Integrated Microfluidic Platform Systems

    Directory of Open Access Journals (Sweden)

    Carl A. Batt

    2009-05-01

    Full Text Available The advent of nucleic acid-based pathogen detection methods offers increased sensitivity and specificity over traditional microbiological techniques, driving the development of portable, integrated biosensors. The miniaturization and automation of integrated detection systems presents a significant advantage for rapid, portable field-based testing. In this review, we highlight current developments and directions in nucleic acid-based micro total analysis systems for the detection of bacterial pathogens. Recent progress in the miniaturization of microfluidic processing steps for cell capture, DNA extraction and purification, polymerase chain reaction, and product detection are detailed. Discussions include strategies and challenges for implementation of an integrated portable platform.

  1. Detection of foodborne pathogens by qPCR: A practical approach for food industry applications

    Directory of Open Access Journals (Sweden)

    María-José Chapela

    2015-12-01

    Full Text Available Microbiological analysis of food is an integrated part of microbial safety management in the food chain. Monitoring and controlling foodborne pathogens are traditionally carried out by conventional microbiological methods based on culture-dependent approaches in control laboratories and private companies. However, polymerase chain reaction (PCR has revolutionized microbiological analysis allowing detection of pathogenic microorganisms in food, without the necessity of classical isolation and identification. However, at present, PCR and quantitative polymerase chain reaction (qPCR are essential analytical tools for researchers working in the field of foodborne pathogens. This manuscript reviews recently described qPCR methods applied for foodborne bacteria detection, serving as economical, safe, and reliable alternatives for application in the food industry and control laboratories. Multiplex qPCR, which allows the simultaneous detection of more than one pathogen in one single reaction, saving considerable effort, time, and money, is emphasized in the article.

  2. Integrating disparity and edge detection algorithms to autonomously follow linear-shaped structures at low altitude

    NARCIS (Netherlands)

    C.R. Verschoor; A. Visser

    2013-01-01

    One of the main requirements in enabling autonomous flight of Micro Aerial Vehicles is the ability of autonomous navigation. One possible solution to solve this navigation problem is to use vision-based line-following algorithms. Such vision-based algorithm could rely on the various linear structure

  3. Tandem Mass Spectrometry for the Detection of Plant Pathogenic Fungi and the Effects of Database Composition on Protein Inferences

    Science.gov (United States)

    Mass spectrometry has shown potential for identifying and detecting plant pathogens. Unlike antibody-based assays like ELISA, mass spectrometry does not require the use of pathogen-specific reagents for the detection of pathogen-specific proteins and peptides. However, the mass spectrometry appro...

  4. Development of Multiplex PCR for Simultaneous Detection of Three Pathogenic Shigella Species

    OpenAIRE

    Reza Ranjbar; Davoud Afshar; Ali Mehrabi Tavana; Ali Najafi; Fatemeh Pourali; Zahra Safiri; Rahim Sorouri Zanjani; Nematollah Jonaidi Jafari

    2014-01-01

    Background: Shigella species are among the common causes of bacterial diarrhoeal diseases. Traditional detection methods are time-consuming resulting in delay in treatment and control of Shigella infections thus there is a need to develop molecular methods for rapid and simultaneous detection of Shigella spp. In this study a rapid multiplex PCR were developed for simultaneous detection of three pathogenic Shigella species. Methods: For detection of Shigella spp., a pair of primers was used to...

  5. Detection of the emerging amphibian pathogens Batrachochytrium dendrobatidis and ranavirus in Russia

    Science.gov (United States)

    Reshetnikov, Andrey N.; Chestnut, Tara E.; Brunner, Jesse L.; Charles, Kaylene M.; Nebergall, Emily E.; Olson, Deanna H.

    2014-01-01

    In a population of the European common toad Bufo bufo from a rural pond in the region of Lake Glubokoe Regional Reserve in Moscow province, Russia, unexplained mass mortality events involving larvae and metamorphs have been observed over a monitoring period of >20 yr. We tested toads from this and a nearby site for the emerging amphibian pathogens Batrachochytrium dendrobatidis (Bd) and ranavirus (Rv). Both pathogens were detected, and at the rural pond site, with the above-noted losses and decline in toad breeding success, 40% of B. bufo metamorphs were Bd positive, 46% were Rv positive and 20% were co-infected with both pathogens. Toad metamorphs from a neighbouring water body were also Bd and Rv positive (25 and 55%, respectively). This is the first confirmation of these pathogens in Russia. Questions remain as to the origins of these pathogens in Russia and their roles in documented mass mortality events.

  6. Sensor fusion: lane marking detection and autonomous intelligent cruise control system

    Science.gov (United States)

    Baret, Marc; Baillarin, S.; Calesse, C.; Martin, Lionel

    1995-12-01

    In the past few years MATRA and RENAULT have developed an Autonomous Intelligent Cruise Control (AICC) system based on a LIDAR sensor. This sensor incorporating a charge coupled device was designed to acquire pulsed laser diode emission reflected by standard car reflectors. The absence of moving mechanical parts, the large field of view, the high measurement rate and the very good accuracy for distance range and angular position of targets make this sensor very interesting. It provides the equipped car with the distance and the relative speed of other vehicles enabling the safety distance to be controlled by acting on the throttle and the automatic gear box. Experiments in various real traffic situations have shown the limitations of this kind of system especially on bends. All AICC sensors are unable to distinguish between a bend and a change of lane. This is easily understood if we consider a road without lane markings. This fact has led MATRA to improve its AICC system by providing the lane marking information. Also in the scope of the EUREKA PROMETHEUS project, MATRA and RENAULT have developed a lane keeping system in order to warn of the drivers lack of vigilance. Thus, MATRA have spread this system to far field lane marking detection and have coupled it with the AICC system. Experiments will be carried out on roads to estimate the gain in performance and comfort due to this fusion.

  7. Rapid detection, characterization, and enumeration of foodborne pathogens

    DEFF Research Database (Denmark)

    Hoorfar, Jeffrey

    2011-01-01

    As food safety management further develops, microbiological testing will continue to play an important role in assessing whether Food Safety Objectives are achieved. However, traditional microbiological culture-based methods are limited, particularly in their ability to provide timely data....... The present review discusses the reasons for the increasing interest in rapid methods; current developments in the field, the research needs, and the future trends. The advent of biotechnology has introduced new technologies that led to the emergence of rapid diagnostic methods and altered food testing...... into focus with the 1990s outbreak of bovine spongiform encephalopathy that was linked to the human outbreak of Creutzfeldt Jakob's Disease. Serology is still an important tool in preventing foodborne pathogens to enter the human food supply through meat and milk from animals. One of the primary uses...

  8. Surface plasmon resonance biosensors for detection of foodborne pathogens and toxins

    Science.gov (United States)

    Homola, Jiří; Hegnerová, Kateřina; Vala, Milan

    2009-02-01

    In the last decade surface plasmon resonance (SPR) biosensors have made great strides both in terms of technology and its applications. SPR biosensors have become a central tool for study of molecular interactions and have been widely used for detection of chemical and biological analytes. Food analysis belongs to major areas of potential applications of SPR biosensors. Therefore, numerous SPR biosensors for detection of analytes implicated in food safety (e.g. pathogens, toxins, drug residues, vitamins, hormones, chemical contaminants, and allergens) have been developed. This paper reviews recent developments in the field of SPR biosensors for food safety, in particular, for detection of foodborne pathogens and toxins.

  9. Towards On-site Pathogen Detection Using Antibody-based Sensors

    DEFF Research Database (Denmark)

    Skottrup, Peter Durand; Nicolaisen, Mogens; Justesen, Annemarie Fejer

    2008-01-01

    In this paper the recent progress within biosensors for plant pathogen detection will be reviewed. Bio-recognition layers on sensors can be designed in various ways, however the most popular approach is to immobilise antibodies for specific capture of analytes. Focus will be put on antibody surface......-immobilisation strategies as well as the use of antibodies in the widely used sensors, quartz crystal microbalance, surface plasmon resonance and cantilevers. We will describe the available data on antibody-based plant pathogen detection and furthermore use examples from detection of the pathogens Salmonella, Listeria...... monocytogenes, Streptococcus mutans, Bacillus cereus, Bacillus anthracis, Campylobacter and Escherichia coli. We will touch upon optimal assay design and further discuss the strengths and limitations of current sensor technologies for detection of viruses, bacteria and fungi....

  10. Universal primer PCR with DGGE for rapid detection of bacterial pathogens.

    Science.gov (United States)

    Ji, Niannian; Peng, Bo; Wang, Guizhong; Wang, Sanying; Peng, Xuanxian

    2004-06-01

    A universal primer PCR (UPPCR) combined with denaturing gradient gel electrophoresis (DGGE) was evaluated as a method permitting the rapid detection of pathogens. The results show that this method is efficient at amplifying the conserved regions of bacterial 16S rRNA genes with universal primers and can detect causative bacterial pathogens rapidly. Six species of bacteria from fisheries (Pseudomonas fluorescens, Vibrio anguillarum, Aeromonas hydrophila, Vibrio fluvialis, Providencia rettgeri and Aeromonas sobria) were examined. Our results indicate that the approach we undertook can be adopted not only for axenic bacterial populations but also for mixed communities as well. Furthermore, we were able to achieve the rapid detection of multiple bacteria a single in sample. In addition, UPPCR-DGGE was shown to be better than previously reported UPPCR-single-stranded conformation polymorphism (SSCP)-based methods for the rapid detection of bacterial pathogens. PMID:15134888

  11. Towards on-site pathogen detection using antibody-based sensors.

    Science.gov (United States)

    Skottrup, Peter Durand; Nicolaisen, Mogens; Justesen, Annemarie Fejer

    2008-11-15

    In this paper, the recent progress within biosensors for plant pathogen detection will be reviewed. Bio-recognition layers on sensors can be designed in various ways, however the most popular approach is to immobilise antibodies for specific capture of analytes. Focus will be put on antibody surface-immobilisation strategies as well as the use of antibodies in the widely used sensors, quartz crystal microbalance, surface plasmon resonance and cantilevers. We will describe the available data on antibody-based plant pathogen detection and furthermore use examples from detection of the pathogens Salmonella, Listeria monocytogenes, Streptococcus mutans, Bacillus cereus, Bacillus anthracis, Campylobacter and Escherichia coli. We will touch upon optimal assay design and further discuss the strengths and limitations of current sensor technologies for detection of viruses, bacteria and fungi. PMID:18675543

  12. Bacteriophage Amplification-Coupled Detection and Identification of Bacterial Pathogens

    Science.gov (United States)

    Cox, Christopher R.; Voorhees, Kent J.

    Current methods of species-specific bacterial detection and identification are complex, time-consuming, and often require expensive specialized equipment and highly trained personnel. Numerous biochemical and genotypic identification methods have been applied to bacterial characterization, but all rely on tedious microbiological culturing practices and/or costly sequencing protocols which render them impractical for deployment as rapid, cost-effective point-of-care or field detection and identification methods. With a view towards addressing these shortcomings, we have exploited the evolutionarily conserved interactions between a bacteriophage (phage) and its bacterial host to develop species-specific detection methods. Phage amplification-coupled matrix assisted laser desorption time-of-flight mass spectrometry (MALDI-TOF-MS) was utilized to rapidly detect phage propagation resulting from species-specific in vitro bacterial infection. This novel signal amplification method allowed for bacterial detection and identification in as little as 2 h, and when combined with disulfide bond reduction methods developed in our laboratory to enhance MALDI-TOF-MS resolution, was observed to lower the limit of detection by several orders of magnitude over conventional spectroscopy and phage typing methods. Phage amplification has been combined with lateral flow immunochromatography (LFI) to develop rapid, easy-to-operate, portable, species-specific point-of-care (POC) detection devices. Prototype LFI detectors have been developed and characterized for Yersinia pestis and Bacillus anthracis, the etiologic agents of plague and anthrax, respectively. Comparable sensitivity and rapidity was observed when phage amplification was adapted to a species-specific handheld LFI detector, thus allowing for rapid, simple, POC bacterial detection and identification while eliminating the need for bacterial culturing or DNA isolation and amplification techniques.

  13. High throughput screening strategies and technology platforms for detection of pathogens: An Introduction

    Science.gov (United States)

    Globally, foodborne pathogens are a major public health concern. In this chapter, we provide a broad description of the problem of food-borne diseases and current and future detection technologies for food safety assurance and prevention of foodborne illnesses. Current detection approaches include s...

  14. Molecular detection and identification of intimin alleles in pathogenic Escherichia coli by multiplex PCR.

    Science.gov (United States)

    Reid, S D; Betting, D J; Whittam, T S

    1999-08-01

    A multiplex PCR was designed to detect the eae gene and simultaneously identify specific alleles in pathogenic Escherichia coli. The method was tested on 87 strains representing the diarrheagenic E. coli clones. The results show that the PCR assay accurately detects eae and resolves alleles encoding the alpha, beta, and gamma intimin variants. PMID:10405431

  15. Development of a High Throughput Assay for Rapid and Accurate 10-Plex Detection of Citrus Pathogens

    Science.gov (United States)

    The need to reliably detect and identify multiple plant pathogens simultaneously, especially in woody perennial hosts, has led to development of new molecular diagnostic approaches. In this study, a Luminex-based system was developed that provided a robust and sensitive test for simultaneous detect...

  16. Molecular detection and characterization of tick-borne pathogens in dogs and ticks from Nigeria.

    Directory of Open Access Journals (Sweden)

    Joshua Kamani

    Full Text Available BACKGROUND: Only limited information is currently available on the prevalence of vector borne and zoonotic pathogens in dogs and ticks in Nigeria. The aim of this study was to use molecular techniques to detect and characterize vector borne pathogens in dogs and ticks from Nigeria. METHODOLOGY/PRINCIPAL FINDINGS: Blood samples and ticks (Rhipicephalus sanguineus, Rhipicephalus turanicus and Heamaphysalis leachi collected from 181 dogs from Nigeria were molecularly screened for human and animal vector-borne pathogens by PCR and sequencing. DNA of Hepatozoon canis (41.4%, Ehrlichia canis (12.7%, Rickettsia spp. (8.8%, Babesia rossi (6.6%, Anaplasma platys (6.6%, Babesia vogeli (0.6% and Theileria sp. (0.6% was detected in the blood samples. DNA of E. canis (23.7%, H. canis (21.1%, Rickettsia spp. (10.5%, Candidatus Neoehrlichia mikurensis (5.3% and A. platys (1.9% was detected in 258 ticks collected from 42 of the 181 dogs. Co- infections with two pathogens were present in 37% of the dogs examined and one dog was co-infected with 3 pathogens. DNA of Rickettsia conorii israelensis was detected in one dog and Rhipicephalus sanguineus tick. DNA of another human pathogen, Candidatus N. mikurensis was detected in Rhipicephalus sanguineus and Heamaphysalis leachi ticks, and is the first description of Candidatus N. mikurensis in Africa. The Theileria sp. DNA detected in a local dog in this study had 98% sequence identity to Theileria ovis from sheep. CONCLUSIONS/SIGNIFICANCE: The results of this study indicate that human and animal pathogens are abundant in dogs and their ticks in Nigeria and portray the potential high risk of human exposure to infection with these agents.

  17. Biocontrol and Rapid Detection of Food-borne Pathogens Using Bacteriophages and Endolysins

    Directory of Open Access Journals (Sweden)

    Jaewoo eBai

    2016-04-01

    Full Text Available Bacteriophages have been suggested as natural food preservatives as well as rapid detection materials for food-borne pathogens in various foods. Since Listeria monocytogenes-targeting phage cocktail (ListShield was approved for applications in foods, numerous phages have been screened and experimentally characterized for phage applications in foods. A single phage and phage cocktail treatments to various foods contaminated with food-borne pathogens including E. coli O157:H7, Salmonella enterica, Campylobacter jejuni, Listeria monocytogenes, Staphylococcus aureus, Cronobacter sakazakii, and Vibrio spp. revealed that they have great potential to control various food-borne pathogens and may be alternative for conventional food preservatives. In addition, phage-derived endolysins with high host specificity and host lysis activities may be preferred to food applications rather than phages. For rapid detection of food-borne pathogens, cell-wall binding domains (CBDs from endolysins have been suggested due to their high host-specific binding. Fluorescence-tagged CBDs have been successfully evaluated and suggested to be alternative materials of expensive antibodies for various detection applications. Most recently, reporter phage systems have been developed and tested to confirm their usability and accuracy for specific detection. These systems revealed some advantages like rapid detection of only viable pathogenic cells without interference by food components in a very short reaction time, suggesting that these systems may be suitable for monitoring of pathogens in foods. Consequently, phage is the next-generation biocontrol agent as well as rapid detection tool to confirm and even identify the food-borne pathogens present in various foods.

  18. Biocontrol and Rapid Detection of Food-Borne Pathogens Using Bacteriophages and Endolysins

    Science.gov (United States)

    Bai, Jaewoo; Kim, You-Tae; Ryu, Sangryeol; Lee, Ju-Hoon

    2016-01-01

    Bacteriophages have been suggested as natural food preservatives as well as rapid detection materials for food-borne pathogens in various foods. Since Listeria monocytogenes-targeting phage cocktail (ListShield) was approved for applications in foods, numerous phages have been screened and experimentally characterized for phage applications in foods. A single phage and phage cocktail treatments to various foods contaminated with food-borne pathogens including E. coli O157:H7, Salmonella enterica, Campylobacter jejuni, Listeria monocytogenes, Staphylococcus aureus, Cronobacter sakazakii, and Vibrio spp. revealed that they have great potential to control various food-borne pathogens and may be alternative for conventional food preservatives. In addition, phage-derived endolysins with high host specificity and host lysis activities may be preferred to food applications rather than phages. For rapid detection of food-borne pathogens, cell-wall binding domains (CBDs) from endolysins have been suggested due to their high host-specific binding. Fluorescence-tagged CBDs have been successfully evaluated and suggested to be alternative materials of expensive antibodies for various detection applications. Most recently, reporter phage systems have been developed and tested to confirm their usability and accuracy for specific detection. These systems revealed some advantages like rapid detection of only viable pathogenic cells without interference by food components in a very short reaction time, suggesting that these systems may be suitable for monitoring of pathogens in foods. Consequently, phage is the next-generation biocontrol agent as well as rapid detection tool to confirm and even identify the food-borne pathogens present in various foods. PMID:27092128

  19. Detection of hepatitis E virus and other livestock-related pathogens in Iowa streams.

    Science.gov (United States)

    Givens, Carrie E; Kolpin, Dana W; Borchardt, Mark A; Duris, Joseph W; Moorman, Thomas B; Spencer, Susan K

    2016-10-01

    Manure application is a source of pathogens to the environment. Through overland runoff and tile drainage, zoonotic pathogens can contaminate surface water and streambed sediment and could affect both wildlife and human health. This study examined the environmental occurrence of gene markers for livestock-related bacterial, protozoan, and viral pathogens and antibiotic resistance in surface waters within the South Fork Iowa River basin before and after periods of swine manure application on agricultural land. Increased concentrations of indicator bacteria after manure application exceeding Iowa's state bacteria water quality standards suggest that swine manure contributes to diminished water quality and may pose a risk to human health. Additionally, the occurrence of HEV and numerous bacterial pathogen genes for Escherichia coli, Enterococcus spp., Salmonella sp., and Staphylococcus aureus in both manure samples and in corresponding surface water following periods of manure application suggests a potential role for swine in the spreading of zoonotic pathogens to the surrounding environment. During this study, several zoonotic pathogens were detected including Shiga-toxin producing E. coli, Campylobacter jejuni, pathogenic enterococci, and S. aureus; all of which can pose mild to serious health risks to swine, humans, and other wildlife. This research provides the foundational understanding required for future assessment of the risk to environmental health from livestock-related zoonotic pathogen exposures in this region. This information could also be important for maintaining swine herd biosecurity and protecting the health of wildlife near swine facilities. PMID:27318519

  20. Flash 3D Enhancements for Autonomous Precision Landing and Hazard Detection and Avoidance Project

    Data.gov (United States)

    National Aeronautics and Space Administration — With NASA's exploration initiative to return to Lunar Exploration and eventual human exploration of Mars, NASA has an increased need for advanced Autonomous...

  1. Application of bioinformatics on the detection of pathogens by Pcr

    International Nuclear Information System (INIS)

    Salmonellas are the main responsible agent for the frequent food-borne gastrointestinal diseases. Their detection using classical methods are laborious and their results take a lot of time to be revealed. In this context, we tried to set up a revealing technique of the invA virulence gene, found in the majority of Salmonella species. After amplification with PCR using specific primers created and verified by bioinformatics programs, two couples of primers were set up and they appeared to be very specific and sensitive for the detection of invA gene. (Author)

  2. Real-time automated road, lane and car detection for autonomous driving

    OpenAIRE

    Birdal, Tolga; Erçil, Aytül; Ercil, Aytul

    2007-01-01

    In this paper, we discuss a vision based system for autonomous guidance of vehicles. An autonomous intelligent vehicle has to perform a number of functionalities. Segmentation of the road, determining the boundaries to drive in and recognizing the vehicles and obstacles around are the main tasks for vision guided vehicle navigation. In this article we propose a set of algorithms which lead to the solution of road and vehicle segmentation using data from a color camera. The algorithms descr...

  3. Molecular Detection of Foodborne Pathogens: A Rapid and Accurate Answer to Food Safety.

    Science.gov (United States)

    Mangal, Manisha; Bansal, Sangita; Sharma, Satish K; Gupta, Ram K

    2016-07-01

    Food safety is a global health concern. For the prevention and recognition of problems related to health and safety, detection of foodborne pathogen is of utmost importance at all levels of food production chain. For several decades, a lot of research has been targeted at the development of rapid methodology as reducing the time needed to complete pathogen detection tests has been the primary goal of food microbiologists. With the result, food microbiology laboratories now have a wide array of detection methods and automated technologies such as enzyme immunoassay, polymerase chain reaction, and microarrays, which can cut test times considerably. Nucleic acid amplification strategies and advances in amplicon detection methodologies have been the key factors in the progress of molecular microbiology. A comprehensive literature survey has been carried out to give an overview in the field of foodborne pathogen detection. In this paper, we describe the conventional methods, as well as recent developments in food pathogen detection, identification, and quantification, with a major emphasis on molecular detection methods. PMID:25830555

  4. Robust visual detection and tracking of complex objects : applications to space autonomous rendez-vous and proximity operations

    OpenAIRE

    Petit, Antoine

    2013-01-01

    In this thesis, we address the issue of fully localizing a known object through computer vision, using a monocular camera, what is a central problem in robotics. A particular attention is here paid on space robotics applications, with the aims of providing a unified visual localization system for autonomous navigation purposes for space rendezvous and proximity operations. Two main challenges of the problem are tackled: initially detecting the targeted object and then tracking it frame-by-fra...

  5. Planning for perception and perceiving for decision: POMDP-like online target detection and recognition for autonomous UAVs

    OpenAIRE

    Ponzoni Carvalho Chanel, Caroline; Teichteil-Königsbuch, Florent; Lesire, Charles

    2012-01-01

    This paper studies the use of POMDP-like techniques to tackle an online multi-target detection and recognition mission by an autonomous rotorcraft UAV. Such robotics missions are complex and too large to be solved off-line, and acquiring information about the environment is as important as achieving some symbolic goals. The POMDP model deals in a single framework with both perception actions (controlling the camera's view angle), and mission actions (moving between zones and flight levels, la...

  6. Identification of fungal pathogens in a patient with acute myelogenic leukemia using a pathogen detection array technology.

    Science.gov (United States)

    Banerjee, Sagarika; Peck, Kristen N; Feldman, Michael D; Schuster, Mindy G; Alwine, James C; Robertson, Erle S

    2016-04-01

    Invasive zygomycosis in immunocompromised patients results in a high mortality rate, and early identification is crucial to optimize therapy and to reduce morbidity. However, diagnosing specific species of zygomycetes fungi possess challenge in the clinical laboratories. A need for a rapid and sensitive diagnostic tool for early recognition of a zygomycetes fungus in clinical samples to the species level will lead to prompt and accurate therapy and the PathoChip provides one such platform. We utilized a pathogen array technology referred to as PathoChip, comprised of oligonucleotide probes that can detect all the sequenced viruses as well as known pathogenic bacteria, fungi and parasites and family-specific conserved probes, thus providing a means for detecting previously uncharacterized members of a family. We rapidly identified a zygomycetous fungus, Rhizomucor pusillus, an otherwise challenge for the clinical laboratories, predominantly in a patient with acute myelogenous leukemia. This report highlights the value of PathoChip as a diagnostic tool to identify micro-organisms to the species level, especially for those difficult to identify in most clinical laboratories. It will also help clinicians to obtain a critical snapshot of the infection profile of a patient to plan treatment strategies. PMID:26619325

  7. Detection of pathogens using on-chip electrochemical analysis of PCR amplified DNA molecules

    Science.gov (United States)

    Hodko, Dalibor; Raymer, Lindsay; Herbst, Stephanie M.; Magnuson, James W.; Gaskin, David

    2001-05-01

    The sensitivity and speed of methods for the detection of microorganisms and/or cells need to be constantly improved to provide timely and accurate analysis in large number of important applications. Such applications range from detection of pathogens in drinking water, biological warfare agents, biomedical diagnostics and food industry. The trends toward miniaturization of sensors using microfluidic and nanofluidic on-chip devices will push current detection limits to lower concentrations than what is offered by the present analytical equipment and/or detection kids. Microfluidic devices have been used to perform DNA analysis, polymerase chain reaction analysis, capillary electrophoresis and hybridization to oligonucleotide probes. This paper describes a new approach for the detection of pathogens on contaminated surfaces, which will integrated sampling, concentration and detection of targeted microorganisms.

  8. Development of a Multiplex PCR Method to Detect Fungal Pathogens for Quarantine on Exported Cacti.

    Science.gov (United States)

    Cho, Hyun Ji; Hong, Seong Won; Kim, Hyun-Ju; Kwak, Youn-Sig

    2016-02-01

    Major diseases in grafted cacti have been reported and Fusarium oxysporum, Bipolaris cactivora, Phytophthora spp. and Collectotrichum spp. are known as causal pathogens. These pathogens can lead to plant death after infection. Therefore, some European countries have quarantined imported cacti that are infected with specific fungal pathogens. Consequently, we developed PCR detection methods to identify four quarantined fungal pathogens and reduce export rejection rates of Korean grafted cacti. The pathogen specific primer sets F.oF-F.oR, B.CF-B.CR, P.nF-P.nR, and P.cF-P.CR were tested for F. oxysporum, B. cactivora, P. nicotinae, and P. cactorum, respectively. The F.oF-F.oR primer set was designed from the Fusarium ITS region; the B.CF-B.CR and P.nF-P.nR primers respectively from Bipolaris and Phytophthora ITS1; and the P.cF-P.CR primer set from the Ypt1protein gene region. The quarantine fungal pathogen primer pairs were amplified to the specific number of base pairs in each of the following fungal pathogens: 210-bp (F. oxysporum), 510-bp (B. cactivora), 313-bp (P. nicotinae), and 447-bp (P. cactorum). The detection limit for the mono- and multiplex PCR primer sets was 0.1 ng of template DNA under in vitro conditions. Therefore, each primer set successfully diagnosed contamination of quarantine pathogens in export grafted cacti. Consequently, our methodology is a viable tool to screen contamination of the fungal pathogen in exported grafted cacti. PMID:26889115

  9. Pathogen detection, testing, and control in fresh broccoli sprouts

    Directory of Open Access Journals (Sweden)

    Fahey Jed W

    2006-04-01

    Full Text Available Abstract Background The recent increased interest in consuming green vegetable sprouts has been tempered by the fact that fresh sprouts can in some cases be vehicles for food-borne illnesses. They must be grown according to proper conditions of sanitation and handled as a food product rather than as an agricultural commodity. When sprouts are grown in accordance with the criteria proposed from within the sprout industry, developed by regulatory agencies, and adhered to by many sprouters, green sprouts can be produced with very low risk. Contamination may occur when these guidelines are not followed. Methods A one year program of microbial hold-and-release testing, conducted in concert with strict seed and facility cleaning procedures by 13 U.S. broccoli sprout growers was evaluated. Microbial contamination tests were performed on 6839 drums of sprouts, equivalent to about 5 million consumer packages of fresh green sprouts. Results Only 24 (0.75% of the 3191 sprout samples gave an initial positive test for Escherichia coli O157:H7 or Salmonella spp., and when re-tested, 3 drums again tested positive. Composite testing (e.g., pooling up to 7 drums for pathogen testing was equally sensitive to single drum testing. Conclusion By using a "test-and-re-test" protocol, growers were able to minimize crop destruction. By pooling drums for testing, they were also able to reduce testing costs which now represent a substantial portion of the costs associated with sprout growing. The test-and-hold scheme described herein allowed those few batches of contaminated sprouts to be found prior to packaging and shipping. These events were isolated, and only safe sprouts entered the food supply.

  10. Molecular detection of plant pathogenic bacteria using polymerase chain reaction single-strand conformation polymorphism

    Institute of Scientific and Technical Information of China (English)

    Chandrashekar Srinivasa; Umesha Sharanaiah; Chandan Shivamallu

    2012-01-01

    The application of polymerase chain reaction (PCR) technology to molecular diagnostics holds great promise for the early identification of agriculturally important plant pathogens.Ralstonia solanacearum,Xanthomoans axonopodis pv.vesicatoria,and Xanthomonas oryzae pv.oryzae are phytopathogenic bacteria,which can infect vegetables,cause severe yield loss.PCR-single-strand conformation polymorphism (PCR-SSCP) is a simple and powerful technique for identifying sequence changes in amplified DNA.The technique of PCR-SSCP is being exploited so far,only to detect and diagnose human bacterial pathogens in addition to plant pathogenic fungi.Selective media and serology are the commonly used methods for the detection of plant pathogens in infected plant materials.In this study,we developed PCR-SSCP technique to identify phytopathogenic bacteria.The PCR product was denatured and separated on a non-denaturing polyacrylamide gel.SSCP banding patterns were detected by silver staining of nucleic acids.We tested over 56 isolates of R. solanacearum,44 isolates of X. axonopodis pv.vesicatoria,and 20 isolates of X.oryzae pv.oryzae.With the use of universal primer 16S rRNA,we could discriminate such species at the genus and species levels.Speciesspecific patterns were obtained for bacteria R.solanacearum,X.axonopodis pv.vesicatoria,and X.oryzae pv.oryzae.The potential use of PCR-SSCP technique for the detection and diagnosis of phytobacterial pathogens is discussed in the present paper.

  11. Detection of pathogenic Vibrio parahaemolyticus in Butrinti Lagoon shellfish

    Directory of Open Access Journals (Sweden)

    FATMIRA SHEHU

    2014-06-01

    Full Text Available Given the considerable public health implications, monitoring of V. parahaemolyticus in shellfish is crucial. The 50 shellfish samples from Butrinti Lagoon showed bacteriological parameters, Salmonella and E. coli, according to Commission Regulation EC No. 2073/2005 on microbiological criteria for foodstuffs. In particular, Salmonella was absent in 25 g and E. coli less 230/100 g of flesh and intra-valvular liquid. The PCRs performed on enrichment broth from each sample gave positive results for V. parahaemolyticus in 45/50 shellfish samples. The TDH virulence factor was detected in 15/45 samples only, whereas TRH factor was not highlighted at all. The results confirmed the need for a specific shellfish inspection plan to detect the presence of Vibrio species and viruses in order to eliminate public health risks associated with shellfish consumption

  12. Magnetic Barcode Assay for Genetic Detection of Pathogens

    OpenAIRE

    Liong, Monty; Hoang, Anh N.; Chung, Jaehoon; Gural, Nil; Ford, Christopher B; Min, Changwook; Shah, Rupal R.; Ahmad, Rushdy; Fernandez-Suarez, Marta; Fortune, Sarah M.; Toner, Mehmet; Lee, Hakho; Weissleder, Ralph

    2013-01-01

    The task of rapidly identifying patients infected with Mycobacterium tuberculosis (MTB) in resource-constrained environments remains a challenge. A sensitive and robust platform that does not require bacterial isolation or culture is critical in making informed diagnostic and therapeutic decisions. Here we introduce a platform for the detection of nucleic acids based on a magnetic barcoding strategy. PCR-amplified mycobacterial genes are sequence-specifically captured on microspheres, labeled...

  13. Molecular Detection of Bloodstream Pathogens in Critical Illness

    OpenAIRE

    Al_griw, Huda Hm

    2012-01-01

    Background: Critically ill patients are at particular risk of developing bloodstream infection. Such infections are associated with the development of sepsis, leading to a marked increase in mortality rate. Early detection of the causative organism and appropriate antibiotic treatment are therefore critical for optimum outcome of patients with nosocomial infection. Current infection diagnosis is based on standard blood culture techniques. However, microbiological culture has a number of limi...

  14. Magnetic Barcode Assay for Genetic Detection of Pathogens

    Science.gov (United States)

    Liong, Monty; Hoang, Anh N.; Chung, Jaehoon; Gural, Nil; Ford, Christopher B.; Min, Changwook; Shah, Rupal R.; Ahmad, Rushdy; Fernandez-Suarez, Marta; Fortune, Sarah M.; Toner, Mehmet; Lee, Hakho; Weissleder, Ralph

    2013-01-01

    The task of rapidly identifying patients infected with Mycobacterium tuberculosis (MTB) in resource-constrained environments remains a challenge. A sensitive and robust platform that does not require bacterial isolation or culture is critical in making informed diagnostic and therapeutic decisions. Here we introduce a platform for the detection of nucleic acids based on a magnetic barcoding strategy. PCR-amplified mycobacterial genes are sequence-specifically captured on microspheres, labeled by magnetic nanoprobes, and detected by nuclear magnetic resonance. All components are integrated into a single, small fluidic cartridge for streamlined on-chip operation. We use this platform to detect MTB and identify drug-resistance strains from mechanically processed sputum samples within 2.5 hours. The specificity of the assay is confirmed by a panel of clinically relevant non-MTB bacteria, and the clinical utility is demonstrated by the measurements in MTB-positive patient specimens. Combined with portable systems, the magnetic barcode assay holds promise to become a sensitive, high-throughput, and low-cost platform for point-of-care diagnostics. PMID:23612293

  15. Comparing Luminex NxTAG-Respiratory Pathogen Panel and RespiFinder-22 for multiplex detection of respiratory pathogens.

    Science.gov (United States)

    Beckmann, Christiane; Hirsch, Hans H

    2016-08-01

    Respiratory tract infection (RTI) involves a variety of viruses and bacteria, which can be conveniently detected by multiplex nucleic acid amplification testing (NAT). To compare the novel Luminex-based NxTAG-Respiratory Pathogen Panel (NxTAG-RPP) with the routine multiplex-ligation-NAT based RespiFinder-22® (RF-22), 282 respiratory specimens including nasopharyngeal swabs (71%), broncho-alveolar lavage (27%), throat swabs, tracheal secretions, and sputum (2%) from 116 children and 155 adults were extracted using a Corbett CAS1200 (Qiagen), and analyzed in parallel by the routine RF-22 and NxTAG-RPP. Concordant results were obtained in 263 (93.3%) cases consisting of concordant positives in 167 (59.2%) and concordant negatives in 96 (34%). Results were discordant in 19 (6.7%) consisting of 15 positive:negative, and 4 negative:positive results by NxTAG-RPP versus RF-22, respectively. Co-infections were observed in 10.3% with NxTAG-RPP and in 5.9% with RF-22. Most additional viral pathogens identified by the NxTAG-RPP involved dual infections with rhinovirus and RSV. Discordant samples were mainly due to low genome signals of Ct less than 36, when retested by QNAT suggesting a higher sensitivity of the NxTAG-RPP, also when detecting multiple infections. Hands-on time after extraction for 24 and 96 samples was 0.25 and <0.5 hr for the NxTAG-RPP, and 2 and 4 hr for the RF-22, respectively. The median turn-around time was 6 hr (range 5-7 hr) for NxTAG-RPP and 12 hr (range 8-16 hr) for RF-22. The NxTAG-RPP showed comparable detection rates for most respiratory pathogens, while hands-on and turn-around time were considerably shorter. The clinical significance of detecting multiple viruses needs further clinical evaluation. J. Med. Virol. 88:1319-1324, 2016. © 2016 Wiley Periodicals, Inc. PMID:26856438

  16. A handheld real time thermal cycler for bacterial pathogen detection.

    Science.gov (United States)

    Higgins, James A; Nasarabadi, Shanavaz; Karns, Jeffrey S; Shelton, Daniel R; Cooper, Mary; Gbakima, Aiah; Koopman, Ronald P

    2003-08-15

    The handheld advanced nucleic acid analyzer (HANAA) is a portable real time thermal cycler unit that weighs under 1 kg and uses silicon and platinum-based thermalcycler units to conduct rapid heating and cooling of plastic reaction tubes. Two light emitting diodes (LED) provide greater than 1 mW of electrical power at wavelengths of 490 nm (blue) and 525 nm (green), allowing detection of the dyes FAM and JOE/TAMRA. Results are displayed in real time as bar graphs, and up to three, 4-sample assays can be run on the charge of the 12 V portable battery pack. The HANAA was evaluated for detection of defined Escherichia coli strains, and wild-type colonies isolated from stream water, using PCR for the lac Z and Tir genes. PCR reactions using SYBR Green dye allowed detection of E. coli ATCC 11775 and E. coli O157:H7 cells in under 30 min of assay time; however, background fluorescence associated with dye binding to nonspecific PCR products was present. DNA extracted from three isolates of Bacillus anthracis Ames, linked to a bioterrorism incident in Washington DC in October 2001, were also successfully tested on the HANAA using primers for the vrrA and capA genes. Positive results were observed at 32 and 22 min of assay time, respectively. A TaqMan probe specific to the aroQ gene of Erwinia herbicola was tested on the HANAA and when 500 cells were used as template, positive results were observed after only 7 min of assay time. Background fluorescence associated with the use of the probe was negligible. The HANAA is unique in offering real time PCR in a handheld format suitable for field use; a commercial version of the instrument, offering six reaction chambers, is available as of Fall 2002. PMID:12788554

  17. Strategies for the detection of food pathogens and contaminants

    DEFF Research Database (Denmark)

    Hearty, Stephen; Leonard, Paul; Sheehan, Alfredo Darmanin;

    molecular contaminants such as microbial toxins and drug/pesticide residues translate well onto Biacore-based assay formats. However, larger and more complex entities such as spores and whole bacterial cells represent an altogether more difficult challenge. Here, we present an overview of our experiences to...... date with using Biacore for analysis of food contaminants and in particular the challenges associated with large analyte detection...... molecules and once suitably high affinity antibodies have been isolated, it is relatively straightforward to design and optimise concentration-based assays using SPR. Recently we have investigated the potential of applying Biacore technology to routine food analysis. Our experiences have shown that...

  18. Strategies for the detection of food pathogens and contaminants

    DEFF Research Database (Denmark)

    Hearty, Stephen; Leonard, Paul; Sheehan, Alfredo Darmanin; Stapleton, Sharon; Tully, Elizabeth; Dunne, Lynsey; Daly, Stephen; McDonnell, Barry; Skottrup, Peter; O'Kennedy, Richard

    molecules and once suitably high affinity antibodies have been isolated, it is relatively straightforward to design and optimise concentration-based assays using SPR. Recently we have investigated the potential of applying Biacore technology to routine food analysis. Our experiences have shown that...... molecular contaminants such as microbial toxins and drug/pesticide residues translate well onto Biacore-based assay formats. However, larger and more complex entities such as spores and whole bacterial cells represent an altogether more difficult challenge. Here, we present an overview of our experiences to...... date with using Biacore for analysis of food contaminants and in particular the challenges associated with large analyte detection...

  19. Bacterial contamination of platelet concentrates: pathogen detection and inactivation methods

    Directory of Open Access Journals (Sweden)

    Dana Védy

    2009-04-01

    Full Text Available Whereas the reduction of transfusion related viral transmission has been a priority during the last decade, bacterial infection transmitted by transfusion still remains associated to a high morbidity and mortality, and constitutes the most frequent infectious risk of transfusion. This problem especially concerns platelet concentrates because of their favorable bacterial growth conditions. This review gives an overview of platelet transfusion-related bacterial contamination as well as on the different strategies to reduce this problem by using either bacterial detection or inactivation methods.

  20. Strategies for the detection of food pathogens and contaminants

    DEFF Research Database (Denmark)

    Hearty, Stephen; Leonard, Paul; Sheehan, Alfredo Darmanin;

    that molecular contaminants such as microbial toxins and drug/pesticide residues translate well onto Biacore-based assay formats. However, larger and more complex entities such as spores and whole bacterial cells represent an altogether more difficult challenge. Here, we present an overview of our experiences...... to date with using Biacore for analysis of food contaminants and in particular the challenges associated with large analyte detection...... molecules and once suitably high affinity antibodies have been isolated, it is relatively straightforward to design and optimise concentration-based assays using SPR. Recently we have investigated the potential of applying Biacore technology to routine food analysis. Our experiences have shown...

  1. Application of Geologic Mapping Techniques and Autonomous Feature Detection to Future Exploration of Europa

    Science.gov (United States)

    Bunte, M. K.; Tanaka, K. L.; Doggett, T.; Figueredo, P. H.; Lin, Y.; Greeley, R.; Saripalli, S.; Bell, J. F.

    2013-12-01

    disrupted surface morphologies. Areas of high interest include lineaments and chaos margins. The limitations on detecting activity at these locations are approximated by studying similar observed conditions on other bodies. By adapting machine learning and data mining techniques to signatures of plumes and morphology, I have demonstrated autonomous rule-based detection of known features using edge-detection and supervised classification methods. These methods successfully detect ≤94% of known volcanic plumes or jets at Io, Enceladus, and comets. They also allow recognition of multiple feature types. Applying these results to conditions expected for Europa enables a prediction of the potential for detection of similar features and enables recommendations for mission concepts to increase the science return and efficiency of future missions to observe Europa. This post-Galileo view of Europa provides a synthesis of the overall history of this unique icy satellite and will be a useful frame of reference for future exploration of the jovian system and other potentially active outer solar system bodies.

  2. Adaptive information filter for the fusion of data from the object-detecting sensors of an autonomous vehicle

    Energy Technology Data Exchange (ETDEWEB)

    Becker, J.C. [Technical Univ. Braunschweig (Germany). Inst. of Control Engineering

    2000-07-01

    This paper describes an adaptive information filter for the fusion of sensor data of an autonomous vehicle. The vehicle sensor system for object detection consists of a stereo vision sensor, four laserscanners and a radar sensor and provides a high redundancy in the observed area in front of the vehicle. The derivation of the information filter as well as its application to sensor data fusion is presented. Maneuver of observed targets are detected and the filter parameter are adapted accordingly. The information filter fusion is compared to the Kalman filter based measurement fusion. (orig.)

  3. RCA-Based Biosensor for Electrical and Colorimetric Detection of Pathogen DNA

    Science.gov (United States)

    Jeong, Jaepil; Kim, Hyejin; Lee, Dong Jun; Jung, Byung Jun; Lee, Jong Bum

    2016-05-01

    For the diagnosis and prevention of diseases, a range of strategies for the detection of pathogens have been developed. In this study, we synthesized the rolling circle amplification (RCA)-based biosensor that enables detection of pathogen DNA in two analytical modes. Only in the presence of the target DNA, the template DNA can be continuously polymerized by simply carrying out RCA, which gives rise to a change of surface structure of Au electrodes and the gap between the electrodes. Electrical signal was generated after introducing hydrogen tetrachloroaurate (HAuCl4) to the DNA-coated biosensor for the improvement of the conductivity of DNA, which indicates that the presence of the pathogen DNA can be detected in an electrical approach. Furthermore, the existence of the target DNA was readily detected by the naked eyes through change in colors of the electrodes from bright yellow to orange-red after RCA reaction. The RCA-based biosensor offers a new platform for monitoring of pathogenic DNA with two different detection modes in one system.

  4. RCA-Based Biosensor for Electrical and Colorimetric Detection of Pathogen DNA.

    Science.gov (United States)

    Jeong, Jaepil; Kim, Hyejin; Lee, Dong Jun; Jung, Byung Jun; Lee, Jong Bum

    2016-12-01

    For the diagnosis and prevention of diseases, a range of strategies for the detection of pathogens have been developed. In this study, we synthesized the rolling circle amplification (RCA)-based biosensor that enables detection of pathogen DNA in two analytical modes. Only in the presence of the target DNA, the template DNA can be continuously polymerized by simply carrying out RCA, which gives rise to a change of surface structure of Au electrodes and the gap between the electrodes. Electrical signal was generated after introducing hydrogen tetrachloroaurate (HAuCl4) to the DNA-coated biosensor for the improvement of the conductivity of DNA, which indicates that the presence of the pathogen DNA can be detected in an electrical approach. Furthermore, the existence of the target DNA was readily detected by the naked eyes through change in colors of the electrodes from bright yellow to orange-red after RCA reaction. The RCA-based biosensor offers a new platform for monitoring of pathogenic DNA with two different detection modes in one system. PMID:27142880

  5. Rapid detection of intestinal pathogens in fecal samples by an improved reverse dot blot method

    Institute of Scientific and Technical Information of China (English)

    Jian-Ming Xing; Su Zhang; Ying Du; Dan Bi; Li-Hui Yao

    2009-01-01

    AIM:To develop a new, rapid and accurate reverse dot blot (RDB) method for the detection of intestinal pathogens in fecal samples.METHODS:The 12 intestinal pathogens tested were Salmonella spp., Brucella spp., Escherichia coli O157:H7,Clostridium botulinum, Bacillus cereus,Clostridium perfringens, Vibrio parahaemolyticus,Shigella spp., Yersinia enterocolitica, Vibrio cholerae,Listeria monocytogenes and Staphylococcus aureus.The two universal primers were designed to amplify two variable regions of bacterial 16S and 23S rDNA genes from all of the 12 bacterial species tested. Five hundred and forty fecal samples from the diarrhea patients were detected using the improved RDB assay.RESULTS:The methods could identify the 12 intestinal pathogens specifically, and the detection limit was as low as 103 CFUs. The consistent detection rate of the improved RDB assay compared with the traditional culture method was up to 88.75%.CONCLUSION:The hybridization results indicated that the improved RDB assay developed was a reliable method for the detection of intestinal pathogen in fecal samples.

  6. Simultaneous Detection of Multiple Fish Pathogens Using a Naked-Eye Readable DNA Microarray

    Directory of Open Access Journals (Sweden)

    King-Jung Lin

    2012-02-01

    Full Text Available We coupled 16S rDNA PCR and DNA hybridization technology to construct a microarray for simultaneous detection and discrimination of eight fish pathogens (Aeromonas hydrophila, Edwardsiella tarda, Flavobacterium columnare, Lactococcus garvieae, Photobacterium damselae, Pseudomonas anguilliseptica, Streptococcus iniae and Vibrio anguillarum commonly encountered in aquaculture. The array comprised short oligonucleotide probes (30 mer complementary to the polymorphic regions of 16S rRNA genes for the target pathogens. Targets annealed to the microarray probes were reacted with streptavidin-conjugated alkaline phosphatase and nitro blue tetrazolium/5-bromo-4-chloro-3′-indolylphosphate, p-toluidine salt (NBT/BCIP, resulting in blue spots that are easily visualized by the naked eye. Testing was performed against a total of 168 bacterial strains, i.e., 26 representative collection strains, 81 isolates of target fish pathogens, and 61 ecologically or phylogenetically related strains. The results showed that each probe consistently identified its corresponding target strain with 100% specificity. The detection limit of the microarray was estimated to be in the range of 1 pg for genomic DNA and 103 CFU/mL for pure pathogen cultures. These high specificity and sensitivity results demonstrate the feasibility of using DNA microarrays in the diagnostic detection of fish pathogens.

  7. Simultaneous detection of multiple fish pathogens using a naked-eye readable DNA microarray.

    Science.gov (United States)

    Chang, Chin-I; Hung, Pei-Hsin; Wu, Chia-Che; Cheng, Ta Chih; Tsai, Jyh-Ming; Lin, King-Jung; Lin, Chung-Yen

    2012-01-01

    We coupled 16S rDNA PCR and DNA hybridization technology to construct a microarray for simultaneous detection and discrimination of eight fish pathogens (Aeromonas hydrophila, Edwardsiella tarda, Flavobacterium columnare, Lactococcus garvieae, Photobacterium damselae, Pseudomonas anguilliseptica, Streptococcus iniae and Vibrio anguillarum) commonly encountered in aquaculture. The array comprised short oligonucleotide probes (30 mer) complementary to the polymorphic regions of 16S rRNA genes for the target pathogens. Targets annealed to the microarray probes were reacted with streptavidin-conjugated alkaline phosphatase and nitro blue tetrazolium/5-bromo-4-chloro-3'-indolylphosphate, p-toluidine salt (NBT/BCIP), resulting in blue spots that are easily visualized by the naked eye. Testing was performed against a total of 168 bacterial strains, i.e., 26 representative collection strains, 81 isolates of target fish pathogens, and 61 ecologically or phylogenetically related strains. The results showed that each probe consistently identified its corresponding target strain with 100% specificity. The detection limit of the microarray was estimated to be in the range of 1 pg for genomic DNA and 10(3) CFU/mL for pure pathogen cultures. These high specificity and sensitivity results demonstrate the feasibility of using DNA microarrays in the diagnostic detection of fish pathogens. PMID:22736973

  8. Development of an Automated Microfluidic System for DNA Collection, Amplification, and Detection of Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Hagan, Bethany S.; Bruckner-Lea, Cynthia J.

    2002-12-01

    This project was focused on developing and testing automated routines for a microfluidic Pathogen Detection System. The basic pathogen detection routine has three primary components; cell concentration, DNA amplification, and detection. In cell concentration, magnetic beads are held in a flow cell by an electromagnet. Sample liquid is passed through the flow cell and bacterial cells attach to the beads. These beads are then released into a small volume of fluid and delivered to the peltier device for cell lysis and DNA amplification. The cells are lysed during initial heating in the peltier device, and the released DNA is amplified using polymerase chain reaction (PCR) or strand displacement amplification (SDA). Once amplified, the DNA is then delivered to a laser induced fluorescence detection unit in which the sample is detected. These three components create a flexible platform that can be used for pathogen detection in liquid and sediment samples. Future developments of the system will include on-line DNA detection during DNA amplification and improved capture and release methods for the magnetic beads during cell concentration.

  9. FY05 LDRD Final Report A Computational Design Tool for Microdevices and Components in Pathogen Detection Systems

    Energy Technology Data Exchange (ETDEWEB)

    Trebotich, D

    2006-02-07

    We have developed new algorithms to model complex biological flows in integrated biodetection microdevice components. The proposed work is important because the design strategy for the next-generation Autonomous Pathogen Detection System at LLNL is the microfluidic-based Biobriefcase, being developed under the Chemical and Biological Countermeasures Program in the Homeland Security Organization. This miniaturization strategy introduces a new flow regime to systems where biological flow is already complex and not well understood. Also, design and fabrication of MEMS devices is time-consuming and costly due to the current trial-and-error approach. Furthermore, existing devices, in general, are not optimized. There are several MEMS CAD capabilities currently available, but their computational fluid dynamics modeling capabilities are rudimentary at best. Therefore, we proposed a collaboration to develop computational tools at LLNL which will (1) provide critical understanding of the fundamental flow physics involved in bioMEMS devices, (2) shorten the design and fabrication process, and thus reduce costs, (3) optimize current prototypes and (4) provide a prediction capability for the design of new, more advanced microfluidic systems. Computational expertise was provided by Comp-CASC and UC Davis-DAS. The simulation work was supported by key experiments for guidance and validation at UC Berkeley-BioE.

  10. Efficiency of Airborne Sample Analysis Platform (ASAP) bioaerosol sampler for pathogen detection.

    Science.gov (United States)

    Sharma, Anurag; Clark, Elizabeth; McGlothlin, James D; Mittal, Suresh K

    2015-01-01

    The threat of bioterrorism and pandemics has highlighted the urgency for rapid and reliable bioaerosol detection in different environments. Safeguarding against such threats requires continuous sampling of the ambient air for pathogen detection. In this study we investigated the efficacy of the Airborne Sample Analysis Platform (ASAP) 2800 bioaerosol sampler to collect representative samples of air and identify specific viruses suspended as bioaerosols. To test this concept, we aerosolized an innocuous replication-defective bovine adenovirus serotype 3 (BAdV3) in a controlled laboratory environment. The ASAP efficiently trapped the surrogate virus at 5 × 10(3) plaque-forming units (p.f.u.) [2 × 10(5) genome copy equivalent] concentrations or more resulting in the successful detection of the virus using quantitative PCR. These results support the further development of ASAP for bioaerosol pathogen detection. PMID:26074900

  11. Electroanalytical Sensors and Devices for Multiplexed Detection of Foodborne Pathogen Microorganisms

    Directory of Open Access Journals (Sweden)

    Susana Campuzano

    2009-07-01

    Full Text Available The detection and identification of pathogen microorganisms still rely on conventional culturing techniques, which are not suitable for on-site monitoring. Therefore, a great research challenge in this field is focused on the need to develop rapid, reliable, specific, and sensitive methods to detect these bacteria at low cost. Moreover, the growing interest in biochip development for large scale screening analysis implies improved miniaturization, reduction of analysis time and cost, and multi-analyte detection, which has nowadays become a crucial challenge. This paper reviews multiplexed foodborne pathogen microorganisms detection methods based on electrochemical sensors incorporating microarrays and other platforms. These devices usually involve antibody-antigen and DNA hybridization specific interactions, although other approaches such as the monitoring of oxygen consumption are also considered.

  12. Development of multiplex PCR assay for simultaneous detection of five bacterial fish pathogens.

    Science.gov (United States)

    Altinok, Ilhan; Capkin, Erol; Kayis, Sevki

    2008-10-15

    A multiplex polymerase chain reaction (PCR) method was designed for the simultaneous detection of the five major fish pathogens, Aeromonas hydrophila, Aeromonas salmonicida subsp. salmonicida, Flavobacterium columnare, Renibacterium salmoninarum, and Yersinia ruckeri. Each of the five pairs of oligonucleotide primers exclusively amplified the targeted gene of the specific microorganism. The detection limits of the multiplex PCR was in the range of 2, 1, 1, 3, and 1CFU for A. hydrophila, A. salmonicida, F. columnare, R. salmoninarum, and Y. ruckeri, respectively. Multiplex PCR did not produce any nonspecific amplification products when tested against 23 related species of bacteria. The multiplex PCR assay was useful for the detection of the bacteria in naturally infected fish. This assay is a sensitive and specific and reproducible diagnostic tool for the simultaneous detection of five pathogenic bacteria that cause disease in fish. Therefore, it could be a useful alternative to the conventional culture based method. PMID:18499358

  13. 9 CFR 113.36 - Detection of pathogens by the chicken inoculation test.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Detection of pathogens by the chicken inoculation test. 113.36 Section 113.36 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE... vaccine being tested by each of the following routes: Subcutaneous, intratracheal, eye-drop, and...

  14. Efficiency of Airborne Sample Analysis Platform (ASAP) bioaerosol sampler for pathogen detection

    OpenAIRE

    Sharma, Anurag; Clark, Elizabeth; McGlothlin, James D.; Mittal, Suresh K.

    2015-01-01

    The threat of bioterrorism and pandemics has highlighted the urgency for rapid and reliable bioaerosol detection in different environments. Safeguarding against such threats requires continuous sampling of the ambient air for pathogen detection. In this study we investigated the efficacy of the Airborne Sample Analysis Platform (ASAP) 2800 bioaerosol sampler to collect representative samples of air and identify specific viruses suspended as bioaerosols. To test this concept, we aerosolized an...

  15. Rapid Detection and Identification of Infectious Pathogens Based on High-throughput Sequencing

    Directory of Open Access Journals (Sweden)

    Pei-Xiang Ni

    2015-01-01

    Full Text Available Background: The dilemma of pathogens identification in patients with unidentified clinical symptoms such as fever of unknown origin exists, which not only poses a challenge to both the diagnostic and therapeutic process by itself, but also to expert physicians. Methods: In this report, we have attempted to increase the awareness of unidentified pathogens by developing a method to investigate hitherto unidentified infectious pathogens based on unbiased high-throughput sequencing. Results: Our observations show that this method supplements current diagnostic technology that predominantly relies on information derived five cases from the intensive care unit. This methodological approach detects viruses and corrects the incidence of false positive detection rates of pathogens in a much shorter period. Through our method is followed by polymerase chain reaction validation, we could identify infection with Epstein-Barr virus, and in another case, we could identify infection with Streptococcus viridians based on the culture, which was false positive. Conclusions: This technology is a promising approach to revolutionize rapid diagnosis of infectious pathogens and to guide therapy that might result in the improvement of personalized medicine.

  16. Detection of hepatitis E virus and other livestock-related pathogens in Iowa streams

    Science.gov (United States)

    Givens, Carrie E.; Kolpin, Dana W.; Borchardt, Mark A.; Duris, Joseph; Moorman, Thomas B.; Spencer, Susan K.

    2016-01-01

    Manure application is a source of pathogens to the environment. Through overland runoff and tile drainage, zoonotic pathogens can contaminate surface water and streambed sediment and could affect both wildlife and human health. This study examined the environmental occurrence of gene markers for livestock-related bacterial, protozoan, and viral pathogens and antibiotic resistance in surface waters within the South Fork Iowa River basin before and after periods of swine manure application on agricultural land. Increased concentrations of indicator bacteria after manure application exceeding Iowa's state bacteria water quality standards suggest that swine manure contributes to diminished water quality and may pose a risk to human health. Additionally, the occurrence of HEV and numerous bacterial pathogen genes for Escherichia coli, Enterococcus spp., Salmonella sp., and Staphylococcus aureus in both manure samples and in corresponding surface water following periods of manure application suggests a potential role for swine in the spreading of zoonotic pathogens to the surrounding environment. During this study, several zoonotic pathogens were detected including Shiga-toxin producing E. coli, Campylobacter jejuni, pathogenic enterococci, and S. aureus; all of which can pose mild to serious health risks to swine, humans, and other wildlife. This research provides the foundational understanding required for future assessment of the risk to environmental health from livestock-related zoonotic pathogen exposures in this region. This information could also be important for maintaining swine herd biosecurity and protecting the health of wildlife near swine facilities.

  17. Bioelectronic DNA detection of human papillomaviruses using eSensor™: a model system for detection of multiple pathogens

    Directory of Open Access Journals (Sweden)

    Miller Donna L

    2003-06-01

    Full Text Available Abstract Background We used human papillomaviruses (HPV as a model system to evaluate the utility of a nucleic acid, hybridization-based bioelectronic DNA detection platform (eSensor™ in identifying multiple pathogens. Methods Two chips were spotted with capture probes consisting of DNA oligonucleotide sequences specific for HPV types. Electrically conductive signal probes were synthesized to be complementary to a distinct region of the amplified HPV target DNA. A portion of the HPV L1 region that was amplified by using consensus primers served as target DNA. The amplified target was mixed with a cocktail of signal probes and added to a cartridge containing a DNA chip to allow for hybridization with complementary capture probes. Results Two bioelectric chips were designed and successfully detected 86% of the HPV types contained in clinical samples. Conclusions This model system demonstrates the potential of the eSensor platform for rapid and integrated detection of multiple pathogens.

  18. Detection of Emerging and Re-Emerging Pathogens in Surface Waters Close to an Urban Area

    Directory of Open Access Journals (Sweden)

    Stefania Marcheggiani

    2015-05-01

    Full Text Available Current knowledge about the spread of pathogens in aquatic environments is scarce probably because bacteria, viruses, algae and their toxins tend to occur at low concentrations in water, making them very difficult to measure directly. The purpose of this study was the development and validation of tools to detect pathogens in freshwater systems close to an urban area. In order to evaluate anthropogenic impacts on water microbiological quality, a phylogenetic microarray was developed in the context of the EU project µAQUA to detect simultaneously numerous pathogens and applied to samples from two different locations close to an urban area located upstream and downstream of Rome in the Tiber River. Furthermore, human enteric viruses were also detected. Fifty liters of water were collected and concentrated using a hollow-fiber ultrafiltration approach. The resultant concentrate was further size-fractionated through a series of decreasing pore size filters. RNA was extracted from pooled filters and hybridized to the newly designed microarray to detect pathogenic bacteria, protozoa and toxic cyanobacteria. Diatoms as indicators of the water quality status, were also included in the microarray to evaluate water quality. The microarray results gave positive signals for bacteria, diatoms, cyanobacteria and protozoa. Cross validation of the microarray was performed using standard microbiological methods for the bacteria. The presence of oral-fecal transmitted human enteric-viruses were detected using q-PCR. Significant concentrations of Salmonella, Clostridium, Campylobacter and Staphylococcus as well as Hepatitis E Virus (HEV, noroviruses GI (NoGGI and GII (NoGII and human adenovirus 41 (ADV 41 were found in the Mezzocammino site, whereas lower concentrations of other bacteria and only the ADV41 virus was recovered at the Castel Giubileo site. This study revealed that the pollution level in the Tiber River was considerably higher downstream rather than

  19. Detection of Pathogenic Vibrio spp. in Shellfish by Using Multiplex PCR and DNA Microarrays

    OpenAIRE

    Panicker, Gitika; Call, Douglas R.; Krug, Melissa J.; Bej, Asim K.

    2004-01-01

    This study describes the development of a gene-specific DNA microarray coupled with multiplex PCR for the comprehensive detection of pathogenic vibrios that are natural inhabitants of warm coastal waters and shellfish. Multiplex PCR with vvh and viuB for Vibrio vulnificus, with ompU, toxR, tcpI, and hlyA for V. cholerae, and with tlh, tdh, trh, and open reading frame 8 for V. parahaemolyticus helped to ensure that total and pathogenic strains, including subtypes of the three Vibrio spp., coul...

  20. Fully automated and colorimetric foodborne pathogen detection on an integrated centrifugal microfluidic device.

    Science.gov (United States)

    Oh, Seung Jun; Park, Byung Hyun; Choi, Goro; Seo, Ji Hyun; Jung, Jae Hwan; Choi, Jong Seob; Kim, Do Hyun; Seo, Tae Seok

    2016-05-21

    This work describes fully automated and colorimetric foodborne pathogen detection on an integrated centrifugal microfluidic device, which is called a lab-on-a-disc. All the processes for molecular diagnostics including DNA extraction and purification, DNA amplification and amplicon detection were integrated on a single disc. Silica microbeads incorporated in the disc enabled extraction and purification of bacterial genomic DNA from bacteria-contaminated milk samples. We targeted four kinds of foodborne pathogens (Escherichia coli O157:H7, Salmonella typhimurium, Vibrio parahaemolyticus and Listeria monocytogenes) and performed loop-mediated isothermal amplification (LAMP) to amplify the specific genes of the targets. Colorimetric detection mediated by a metal indicator confirmed the results of the LAMP reactions with the colour change of the LAMP mixtures from purple to sky blue. The whole process was conducted in an automated manner using the lab-on-a-disc and a miniaturized rotary instrument equipped with three heating blocks. We demonstrated that a milk sample contaminated with foodborne pathogens can be automatically analysed on the centrifugal disc even at the 10 bacterial cell level in 65 min. The simplicity and portability of the proposed microdevice would provide an advanced platform for point-of-care diagnostics of foodborne pathogens, where prompt confirmation of food quality is needed. PMID:27112702

  1. Commercially Available Rapid Methods for Detection of Selected Food-borne Pathogens.

    Science.gov (United States)

    Valderrama, Wladir B; Dudley, Edward G; Doores, Stephanie; Cutter, Catherine N

    2016-07-01

    Generally, the enumeration and isolation of food-borne pathogens is performed using culture-dependent methods. These methods are sensitive, inexpensive, and provide both qualitative and quantitative assessment of the microorganisms present in a sample, but these are time-consuming. For this reason, researchers are developing new techniques that allow detection of food pathogens in shorter period of time. This review identifies commercially available methods for rapid detection and quantification of Listeria monocytogenes, Salmonella spp., Staphylococcus aureus, and Shiga toxin-producing Escherichia coli in food samples. Three categories are discussed: immunologically based methods, nucleic acid-based assays, and biosensors. This review describes the basic mechanism and capabilities of each method, discusses the difficulties of choosing the most convenient method, and provides an overview of the future challenges for the technology for rapid detection of microorganisms. PMID:25749054

  2. Rapid Detection and Identification of a Pathogen's DNA Using Phi29 DNA Polymerase

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Y.; Dunn, J.; Gao, S.; Bruno, J. F.; Luft, B. J.

    2008-10-31

    Zoonotic pathogens including those transmitted by insect vectors are some of the most deadly of all infectious diseases known to mankind. A number of these agents have been further weaponized and are widely recognized as being potentially significant biothreat agents. We describe a novel method based on multiply-primed rolling circle in vitro amplification for profiling genomic DNAs to permit rapid, cultivation-free differential detection and identification of circular plasmids in infectious agents. Using Phi29 DNA polymerase and a two-step priming reaction we could reproducibly detect and characterize by DNA sequencing circular DNA from Borrelia burgdorferi B31 in DNA samples containing as little as 25 pg of Borrelia DNA amongst a vast excess of human DNA. This simple technology can ultimately be adapted as a sensitive method to detect specific DNA from both known and unknown pathogens in a wide variety of complex environments.

  3. High-Throughput Biosensors for Multiplexed Food-Borne Pathogen Detection

    Science.gov (United States)

    Gehring, Andrew G.; Tu, Shu-I.

    2011-07-01

    Incidental contamination of foods by pathogenic bacteria and/or their toxins is a serious threat to public health and the global economy. The presence of food-borne pathogens and toxins must be rapidly determined at various stages of food production, processing, and distribution. Producers, processors, regulators, retailers, and public health professionals need simple and cost-effective methods to detect different species or serotypes of bacteria and associated toxins in large numbers of food samples. This review addresses the desire to replace traditional microbiological plate culture with more timely and less cumbersome rapid, biosensor-based methods. Emphasis focuses on high-throughput, multiplexed techniques that allow for simultaneous testing of numerous samples, in rapid succession, for multiple food-borne analytes (primarily pathogenic bacteria and/or toxins).

  4. Progress in rapid detection and identification of unknown human and agricultural pathogens

    International Nuclear Information System (INIS)

    The medical industry is driving pathogen detection technology from its present characteristics of$50/sample, 100 sample capability systems, with several day time responses, having several percent error rates in reported outcomes. The systems described above are capable of providing samples at and lt;$5/test, managing several million samples, and lt; 1-hour cycle times, (or just minutes in some cases) and and lt; 0.1% error rates. Because of their importance to the medical and agricultural communities, all ''important'' pathogens will have detection kits available (within air transport times, anywhere in the world) by 2020, and the most well known pathogens will have kits available within a few years. Many are available now. Because of the importance of the food supply to modern nations, these technologies will be employed everywhere in this industry. For example, the United States imports 30 B tons of food a year, but inspects and lt; 1%. Portable inspection systems will make it possible to test for dangerous pathogens in feed lots, food processing plants, markets, and points of use. Outbreaks of animal or plant disease will be immediately detectable using field instrumentation, and more complex samples can be sent to central testing laboratories where more sophisticated test systems will be available. Unusual pathogens either naturally or purposefully selected or developed, will require special attention because there is not a commercial economic driver for the development of detection systems and curative agents. Their development, and production for sufficient availability, will require significant investments by the world community. The strategy and costs for developing vaccines or curative drugs will be very expensive and will need special attention. However it is important that attention be directed to these problems because such attention has a strong deterrent effect on potential developers or users. The capacity to use the full information content

  5. Progress in rapid detection and identification of unknown human and agricultural pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Barnes, T; Holzrichter, J F; Milanovich, F P

    1999-08-13

    The medical industry is driving pathogen detection technology from its present characteristics of $50/sample, 100 sample capability systems, with several day time responses, having several percent error rates in reported outcomes. The systems described above are capable of providing samples at < $5/test, managing several million samples, < 1-hour cycle times, (or just minutes in some cases) and < 0.1% error rates. Because of their importance to the medical and agricultural communities, all ''important'' pathogens will have detection kits available (within air transport times, anywhere in the world) by 2020, and the most well known pathogens will have kits available within a few years. Many are available now. Because of the importance of the food supply to modern nations, these technologies will be employed everywhere in this industry. For example, the United States imports 30 B tons of food a year, but inspects < 1%. Portable inspection systems will make it possible to test for dangerous pathogens in feed lots, food processing plants, markets, and points of use. Outbreaks of animal or plant disease will be immediately detectable using field instrumentation, and more complex samples can be sent to central testing laboratories where more sophisticated test systems will be available. Unusual pathogens either naturally or purposefully selected or developed, will require special attention because there is not a commercial economic driver for the development of detection systems and curative agents. Their development, and production for sufficient availability, will require significant investments by the world community. The strategy and costs for developing vaccines or curative drugs will be very expensive and will need special attention. However it is important that attention be directed to these problems because such attention has a strong deterrent effect on potential developers or users. The capacity to use the full information content contained

  6. An improved detection and quantification method for the coral pathogen Vibrio coralliilyticus.

    Directory of Open Access Journals (Sweden)

    Bryan Wilson

    Full Text Available DNA- and RNA-based PCR and reverse-transcription real-time PCR assays were developed for diagnostic detection of the vcpA zinc-metalloprotease implicated in the virulence of the coral pathogen Vibrio coralliilyticus. Both PCR methods were highly specific for V. coralliilyticus and failed to amplify strains of closely-related Vibrio species. The assays correctly detected all globally occurring V. coralliilyticus isolates including a newly-described isolate [TAV24] infecting gorgonians in the Mediterranean Sea and highlighted those isolates that had been potentially misidentified, in particular V. tubiashii strains ATCC 19105 and RE22, historically described as important oyster pathogens. The real-time assay is sensitive, detecting 10 gene copies and the relationships between gene copy number and cycle threshold (C T were highly linear (R(2≥ 99.7. The real-time assay was also not affected by interference from non-target DNA. These assays are useful for rapid detection of V. coralliilyticus and monitoring of virulence levels in environmental samples, allowing for implementation of timely management steps to limit and possibly prevent losses due to V. coralliilyticus infection, as well as furthering investigations of factors affecting pathogenesis of this important marine pathogen.

  7. Low-cost, real-time, continuous flow PCR system for pathogen detection.

    Science.gov (United States)

    Fernández-Carballo, B Leticia; McGuiness, Ian; McBeth, Christine; Kalashnikov, Maxim; Borrós, Salvador; Sharon, Andre; Sauer-Budge, Alexis F

    2016-04-01

    In this paper, we present a portable and low cost point-of-care (POC) PCR system for quantitative detection of pathogens. Our system is based on continuous flow PCR which maintains fixed temperatures zones and pushes the PCR solution between two heated areas allowing for faster heat transfer and as a result, a faster PCR. The PCR system is built around a 46.0 mm × 30.9 mm × 0.4 mm disposable thermoplastic chip. In order to make the single-use chip economically viable, it was manufactured by hot embossing and was designed to be compatible with roll-to-roll embossing for large scale production. The prototype instrumentation surrounding the chip includes two heaters, thermal sensors, and an optical system. The optical system allows for pathogen detection via real time fluorescence measurements. FAM probes were used as fluorescent reporters of the amplicons generated during the PCR. To demonstrate the function of the chip, two infectious bacteria targets were selected: Chlamydia trachomatis and Escherichia coli O157:H7. For both bacteria, the limit of detection of the system was determined, PCR efficiencies were calculated, and different flow velocities were tested. We have demonstrated successful detection for these two bacterial pathogens highlighting the versatility and broad utility of our portable, low-cost, and rapid PCR diagnostic device. PMID:26995085

  8. Molecular detection of avian pathogens in poultry red mite (Dermanyssus gallinae) collected in chicken farms.

    Science.gov (United States)

    Huong, Chu Thi Thanh; Murano, Takako; Uno, Yukiko; Usui, Tatsufumi; Yamaguchi, Tsuyoshi

    2014-12-01

    Poultry red mite (PRM, Dermanyssus gallinae) is a blood-sucking ectoparasite as well as a possible vector of several avian pathogens. In this study, to define the role of PRM in the prevalence of avian infectious agents, we used polymerase chain reaction (PCR) to check for the presence of seven pathogens: Avipox virus (APV), Fowl Adenovirus (FAdV), Marek's disease virus (MDV), Erysipelothrix rhusiopathiae (ER), Salmonella enterica (SE), Mycoplasma synoviae (MS) and Mycoplasma gallisepticum (MG). A total of 159 PRM samples collected between 2004 and 2012 from 142 chicken farms in 38 prefectures in Japan were examined. APV DNA was detected in 22 samples (13.8%), 19 of which were wild-type APV. 16S ribosomal RNA (16S rRNA) of MS was detected in 15 samples (9.4%), and the mgc2 gene of MG was detected in 2 samples (1.3%). Eight of 15 MS 16S rRNA sequences differed from the vaccine sequence, indicating they were wild-type strains, while both of the MG mgc2 gene sequences detected were identical to the vaccine sequences. Of these avian pathogen-positive mite samples, three were positive for both wild-types of APV and MS. On the other hand, the DNAs of ER, SE, FAdV and MDV were not detected in any samples. These findings indicated that PRM can harbor the wild-type pathogens and might play a role as a vector in spreading these diseases in farms. PMID:25649939

  9. A novel microbial source tracking microarray for pathogen detection and fecal source identification in environmental systems.

    Science.gov (United States)

    Li, Xiang; Harwood, Valerie J; Nayak, Bina; Staley, Christopher; Sadowsky, Michael J; Weidhaas, Jennifer

    2015-06-16

    Pathogen detection and the identification of fecal contamination sources are challenging in environmental waters. Factors including pathogen diversity and ubiquity of fecal indicator bacteria hamper risk assessment and remediation of contamination sources. A custom microarray targeting pathogens (viruses, bacteria, protozoa), microbial source tracking (MST) markers, and antibiotic resistance genes was tested against DNA obtained from whole genome amplification (WGA) of RNA and DNA from sewage and animal (avian, cattle, poultry, and swine) feces. Perfect and mismatch probes established the specificity of the microarray in sewage, and fluorescence decrease of positive probes over a 1:10 dilution series demonstrated semiquantitative measurement. Pathogens, including norovirus, Campylobacter fetus, Helicobacter pylori, Salmonella enterica, and Giardia lamblia were detected in sewage, as well as MST markers and resistance genes to aminoglycosides, beta-lactams, and tetracycline. Sensitivity (percentage true positives) of MST results in sewage and animal waste samples (21-33%) was lower than specificity (83-90%, percentage of true negatives). Next generation DNA sequencing revealed two dominant bacterial families that were common to all sample types: Ruminococcaceae and Lachnospiraceae. Five dominant phyla and 15 dominant families comprised 97% and 74%, respectively, of sequences from all fecal sources. Phyla and families not represented on the microarray are possible candidates for inclusion in subsequent array designs. PMID:25970344

  10. Development of genetic methods for detection of pathogenic microorganisms in irradiated food

    International Nuclear Information System (INIS)

    The existence of injured microorganisms in food and their recovery during culturing procedures is critical. Injured microorganisms present a potential threat in food safety since they may repair themselves under suitable conditions. This study provides development of recovery methods for detection of injured foodborne microorganisms, after irradiation treatment at different doses. For this purpose, iniatially the methods of recovery were compared at different irradiation doses. At the second step, antibiotic resistance of foodborne pathogens was determined. After determination of antibiotic resistance, recovery methods were modified for reversibly injured foodborne pathogens at different doses after irradiation treatment . Finally, damages of DNA were detected by a spectrophotometric method after 1.0 kGy irradiation treatment

  11. Detection and Characterization of Cancer Cells and Pathogenic Bacteria Using Aptamer-Based Nano-Conjugates

    Directory of Open Access Journals (Sweden)

    Vinayakumar Gedi

    2014-09-01

    Full Text Available Detection and characterization of cells using aptamers and aptamer-conjugated nanoprobes has evolved a great deal over the past few decades. This evolution has been driven by the easy selection of aptamers via in vitro cell-SELEX, permitting sensitive discrimination between target and normal cells, which includes pathogenic prokaryotic and cancerous eukaryotic cells. Additionally, when the aptamer-based strategies are used in conjunction with nanomaterials, there is the potential for cell targeting and therapeutic effects with improved specificity and sensitivity. Here we review recent advances in aptamer-based nano-conjugates and their applications for detecting cancer cells and pathogenic bacteria. The multidisciplinary research utilized in this field will play an increasingly significant role in clinical medicine and drug discovery.

  12. Robust and Real Time Detection of Curvy Lanes (Curves Having Desired Slopes for Driving Assistance and Autonomous Vehicles

    Directory of Open Access Journals (Sweden)

    Amartansh Dubey

    2015-01-01

    Full Text Available One of the biggest reasons for road accidents is cu rvy lanes and blind turns. Even one of the biggest hurdles for new autonomous vehicles is to d etect curvy lanes, multiple lanes and lanes with a lot of discontinuity and noise. This paper p resents very efficient and advanced algorithm for detecting curves having desired slopes (especia lly for detecting curvy lanes in real time and detection of curves (lanes with a lot of noise , discontinuity and disturbances. Overall aim is to develop robust method for this task which is applicable even in adverse conditions. Even in some of most famous and useful libraries like OpenC V and Matlab, there is no function available for detecting curves having desired slope s, shapes, discontinuities. Only few predefined shapes like circle, ellipse, etc, can be detected using presently available functions. Proposed algorithm can not only detect curves with discontinuity, noise, desired slope but also it can perform shadow and illumination correction a nd detect/ differentiate between different curves.

  13. Compact multi-channel surface plasmon resonance sensor for rapid detection of bacterial pathogens

    Czech Academy of Sciences Publication Activity Database

    Vala, Milan; Šípová, Hana; Špringer, Tomáš; Chadt, Karel; Piliarik, Marek; Homola, Jiří

    Vol. XConference on Optical Chemical Sensors and Biosensors. Praha : Institute of Photonics and Electronics AS CR, v.v.i, 2010 - (Homola, J.). s. 214-214 ISBN 978-80-86269-20-7. [EUROPT(R)ODE X – X.Conference on Optical Chemical Sensors and Biosensors. 28.03.2010-31.3.2010, Praha] Institutional research plan: CEZ:AV0Z20670512 Keywords : surface plasmon resonance * biosensor * detection of pathogens Subject RIV: JB - Sensors, Measurment, Regulation

  14. Fluorescence in situ hybridization for the tissue detection of bacterial pathogens associated with porcine infections

    DEFF Research Database (Denmark)

    Jensen, Henrik Elvang; Jensen, Louise Kruse; Barington, Kristiane;

    2015-01-01

    sequences within intact cells. FISH allows direct histological localization of the bacteria in the tissue and thereby a correlation between the infection and the histopathological changes present. This chapter presents protocols for FISH identification of bacterial pathogens in fixed deparaffinized tissue......Fluorescence in situ hybridization (FISH) is an efficient technique for the identification of specific bacteria in tissue of both experimental and spontaneous infections. The method detects specific sequences of nucleic acids by hybridization of fluorescently labeled probes to complementary target...

  15. Fluorescence In Situ Hybridization for the Tissue Detection of Bacterial Pathogens Associated with Porcine Infections

    DEFF Research Database (Denmark)

    Elvang Jensen, Henrik; Jensen, Louise Kruse; Barington, Kristiane;

    2015-01-01

    sequences within intact cells. FISH allows direct histological localization of the bacteria in the tissue and thereby a correlation between the infection and the histopathological changes present. This chapter presents protocols for FISH identification of bacterial pathogens in fixed deparaffinized tissue......Fluorescence in situ hybridization (FISH) is an efficient technique for the identification of specific bacteria in tissue of both experimental and spontaneous infections. The method detects specific sequences of nucleic acids by hybridization of fluorescently labeled probes to complementary target...

  16. HIGH SENSITIVE PCR METHOD FOR DETECTION OF PATHOGENIC Leptospira spp. IN PARAFFIN-EMBEDDED TISSUES

    OpenAIRE

    Angel Alberto Noda; Islay Rodríguez; Yaindrys Rodríguez; Anamays Govín; Carmen Fernández; Ana Margarita Obregón

    2014-01-01

    This study describes the development and application of a new PCR assay for the specific detection of pathogenic leptospires and its comparison with a previously reported PCR protocol. New primers were designed for PCR optimization and evaluation in artificially-infected paraffin-embedded tissues. PCR was then applied to post-mortem, paraffin-embedded samples, followed by amplicon sequencing. The PCR was more efficient than the reported protocol, allowing the amplification of expected DNA fra...

  17. Development of omics methodologies for the detection and indetification of pathogenic and spoilage bacteria in seafood

    OpenAIRE

    Böhme, Karola

    2012-01-01

    The project bases on the development of analytical methods for the rapid detection and identification of the main pathogenic and food-borne spoilage microorganisms, present in fish products and products of the aquaculture. Traditionally the methods to identify bacteria were time consuming and tediously. However the application of molecular methods by genomic and proteomic analysis offer an attractive alternative for the rapid and simple identification and characterization of bacteria. The mai...

  18. Fluorescent Silica Nanoparticles in the Detection and Control of the Growth of Pathogen

    OpenAIRE

    Kethirabalan Chitra; Gurusamy Annadurai

    2013-01-01

    In this present study the bioconjugated fluorescent silica nanoparticles give an efficient fluorescent-based immunoassay for the detection of pathogen. The synthesized silica nanoparticles were polydispersed and the size of the silica nanoparticles was in the range of 114–164 nm. The energy dispersive X-ray spectrophotometer showed the presence of silica at 1.8 kev and the selected area diffractometer showed amorphous nature of silica nanoparticles. The FTIR spectrum confirmed the attachment ...

  19. Ultrarapid Detection of Pathogenic Bacteria Using a 3D Immunomagnetic Flow Assay

    OpenAIRE

    Lee, Wonjae; Kwon, Donghoon; Chung, Boram; Jung, Gyoo Yeol; Au, Anthony; Folch, Albert; Jeon, Sangmin

    2014-01-01

    We developed a novel 3D immunomagnetic flow assay for the rapid detection of pathogenic bacteria in a large-volume food sample. Antibody-functionalized magnetic nanoparticle clusters (AbMNCs) were magnetically immobilized on the surfaces of a 3D-printed cylindrical microchannel. The injection of a Salmonella-spiked sample solution into the microchannel produced instant binding between the AbMNCs and the Salmonella bacteria due to their efficient collisions. Nearly perfect capture of the AbMNC...

  20. Development of Multiplex PCR for Simultaneous Detection of Three Pathogenic Shigella Species.

    Directory of Open Access Journals (Sweden)

    Reza Ranjbar

    2014-12-01

    Full Text Available Shigella species are among the common causes of bacterial diarrhoeal diseases. Traditional detection methods are time-consuming resulting in delay in treatment and control of Shigella infections thus there is a need to develop molecular methods for rapid and simultaneous detection of Shigella spp. In this study a rapid multiplex PCR were developed for simultaneous detection of three pathogenic Shigella species.For detection of Shigella spp., a pair of primers was used to replicate a chromosomal sequence. Three other sets of primers were also designed to amplify the target genes of three most common species of Shigella in Iran including S. sonnei, S. flexneri and S. boydii. The multiplex PCR assay was optimized for simultaneous detection and differentiation of three pathogenic Shigella species. The assay specificity was investigated by testing different strains of Shigella and other additional strains belonging to non Shigella species, but responsible for foodborne diseases.The Shigella genus specific PCR yielded the expected DNA band of 159 bp in all tested strains belonging to four Shigella species. The standard and multiplex PCR assays also produced the expected fragments of 248 bp, 503 bp, and 314 bp, for S. boydii, S. sonnei and S. flexneri, respectively. Each species-specific primer pair did not show any cross-reactivity.Both standard and multiplex PCR protocols had a good specificity. They can provide a valuable tool for the rapid and simultaneous detection and differentiation of three most prevalent Shigella species in Iran.

  1. Physics Based Model for Online Fault Detection in Autonomous Cryogenic Loading System

    Science.gov (United States)

    Kashani, Ali; Devine, Ekaterina Viktorovna P; Luchinsky, Dmitry Georgievich; Smelyanskiy, Vadim; Sass, Jared P.; Brown, Barbara L.; Patterson-Hine, Ann

    2013-01-01

    We report the progress in the development of the chilldown model for rapid cryogenic loading system developed at KSC. The nontrivial characteristic feature of the analyzed chilldown regime is its active control by dump valves. The two-phase flow model of the chilldown is approximated as one-dimensional homogeneous fluid flow with no slip condition for the interphase velocity. The model is built using commercial SINDAFLUINT software. The results of numerical predictions are in good agreement with the experimental time traces. The obtained results pave the way to the application of the SINDAFLUINT model as a verification tool for the design and algorithm development required for autonomous loading operation.

  2. Nano-particle enhanced impedimetric biosensor for detection of foodborne pathogens

    International Nuclear Information System (INIS)

    Recent outbreaks of foodborne illness have been increased the need for rapid and sensitive methods for detection of these pathogens. Conventional methods for pathogens detection and identification involve prolonged multiple enrichment steps. Even though some immunological rapid assays are available, these assays still need enrichment steps result in delayed detection. Biosensors have shown great potential for rapid detection of foodborne pathogens. They are capable of direct monitoring the antigen-antibody reactions in real time. Among the biosensors, impedimetric biosensors have been widely adapted as an analysis tool for the study of various biological binding reactions because of their high sensitivity and reagentless operation. In this study a nanoparticle-enhanced impedimetric biosensor for Salmonella enteritidis detection was developed which detected impedance changes caused by the attachment of the cells to the anti-Salmonella antibodies immobilized on interdigitated gold electrodes. Successive immobilization of neutravidin followed by anti-Salmonella antibodies was performed to the sensing area to create a biological detection surface. To enhance the impedance responses generated by antigen-antibody reactions, anti-Salmonella antibody conjugated nanoparticles were introduced on the sensing area. Using a portable impedance analyzer, the impedance across the interdigital electrodes was measured after the series of antigen-antibody bindings. Bacteria cells present in solution attached to capture antibodies and became tethered to the sensor surface. Attached bacteria cells changed the dielectric constant of the media between the electrodes thereby causing a change in measured impedance. Optimum input frequency was determined by analyzing frequency characteristics of the biosensor over ranges of applied frequencies from 10 Hz to 400 Hz. At 100 Hz of input frequency, the biosensor was most sensitive to the changes of the bacteria concentration and this frequency

  3. An Economical Tandem Multiplex Real-Time PCR Technique for the Detection of a Comprehensive Range of Respiratory Pathogens

    OpenAIRE

    Glenys R. Chidlow; Harnett, Gerry B.; Shellam, Geoffrey R.; Smith, David W.

    2009-01-01

    This study used real-time PCR assays to screen small sample volumes for a comprehensive range of 35 respiratory pathogens. Initial thermocycling was limited to 20 cycles to avoid competition for reagents, followed by a secondary real-time multiplex PCR. Supplementary semi-nested human metapneumovirus and picornavirus PCR assays were required to complete the acute respiratory pathogen profile. Potential pathogens were detected in 85 (70%) of pernasal aspirates collected from 121 children with ...

  4. Development and application of an oligonucleotide microarray and real-time quantitative PCR for detection of wastewater bacterial pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Dae-Young [National Water Research Institute, Environment Canada, 867 Lakeshore Road, Burlington, Ontario, L7R 4A6 (Canada)], E-mail: daeyoung.lee@ec.gc.ca; Lauder, Heather; Cruwys, Heather; Falletta, Patricia [National Water Research Institute, Environment Canada, 867 Lakeshore Road, Burlington, Ontario, L7R 4A6 (Canada); Beaudette, Lee A. [Environmental Science and Technology Centre, Environment Canada, 335 River Road South, Ottawa, Ontario, K1A 0H3 (Canada)], E-mail: lee.beaudette@ec.gc.ca

    2008-07-15

    Conventional microbial water quality test methods are well known for their technical limitations, such as lack of direct pathogen detection capacity and low throughput capability. The microarray assay has recently emerged as a promising alternative for environmental pathogen monitoring. In this study, bacterial pathogens were detected in municipal wastewater using a microarray equipped with short oligonucleotide probes targeting 16S rRNA sequences. To date, 62 probes have been designed against 38 species, 4 genera, and 1 family of pathogens. The detection sensitivity of the microarray for a waterborne pathogen Aeromonas hydrophila was determined to be approximately 1.0% of the total DNA, or approximately 10{sup 3}A. hydrophila cells per sample. The efficacy of the DNA microarray was verified in a parallel study where pathogen genes and E. coli cells were enumerated using real-time quantitative PCR (qPCR) and standard membrane filter techniques, respectively. The microarray and qPCR successfully detected multiple wastewater pathogen species at different stages of the disinfection process (i.e. secondary effluents vs. disinfected final effluents) and at two treatment plants employing different disinfection methods (i.e. chlorination vs. UV irradiation). This result demonstrates the effectiveness of the DNA microarray as a semi-quantitative, high throughput pathogen monitoring tool for municipal wastewater.

  5. Development and application of an oligonucleotide microarray and real-time quantitative PCR for detection of wastewater bacterial pathogens

    International Nuclear Information System (INIS)

    Conventional microbial water quality test methods are well known for their technical limitations, such as lack of direct pathogen detection capacity and low throughput capability. The microarray assay has recently emerged as a promising alternative for environmental pathogen monitoring. In this study, bacterial pathogens were detected in municipal wastewater using a microarray equipped with short oligonucleotide probes targeting 16S rRNA sequences. To date, 62 probes have been designed against 38 species, 4 genera, and 1 family of pathogens. The detection sensitivity of the microarray for a waterborne pathogen Aeromonas hydrophila was determined to be approximately 1.0% of the total DNA, or approximately 103A. hydrophila cells per sample. The efficacy of the DNA microarray was verified in a parallel study where pathogen genes and E. coli cells were enumerated using real-time quantitative PCR (qPCR) and standard membrane filter techniques, respectively. The microarray and qPCR successfully detected multiple wastewater pathogen species at different stages of the disinfection process (i.e. secondary effluents vs. disinfected final effluents) and at two treatment plants employing different disinfection methods (i.e. chlorination vs. UV irradiation). This result demonstrates the effectiveness of the DNA microarray as a semi-quantitative, high throughput pathogen monitoring tool for municipal wastewater

  6. Development and application of an oligonucleotide microarray and real-time quantitative PCR for detection of wastewater bacterial pathogens.

    Science.gov (United States)

    Lee, Dae-Young; Lauder, Heather; Cruwys, Heather; Falletta, Patricia; Beaudette, Lee A

    2008-07-15

    Conventional microbial water quality test methods are well known for their technical limitations, such as lack of direct pathogen detection capacity and low throughput capability. The microarray assay has recently emerged as a promising alternative for environmental pathogen monitoring. In this study, bacterial pathogens were detected in municipal wastewater using a microarray equipped with short oligonucleotide probes targeting 16S rRNA sequences. To date, 62 probes have been designed against 38 species, 4 genera, and 1 family of pathogens. The detection sensitivity of the microarray for a waterborne pathogen Aeromonas hydrophila was determined to be approximately 1.0% of the total DNA, or approximately 10(3)A. hydrophila cells per sample. The efficacy of the DNA microarray was verified in a parallel study where pathogen genes and E. coli cells were enumerated using real-time quantitative PCR (qPCR) and standard membrane filter techniques, respectively. The microarray and qPCR successfully detected multiple wastewater pathogen species at different stages of the disinfection process (i.e. secondary effluents vs. disinfected final effluents) and at two treatment plants employing different disinfection methods (i.e. chlorination vs. UV irradiation). This result demonstrates the effectiveness of the DNA microarray as a semi-quantitative, high throughput pathogen monitoring tool for municipal wastewater. PMID:18423816

  7. Physics based model for online fault detection in autonomous cryogenic loading system

    International Nuclear Information System (INIS)

    We report the progress in the development of the chilldown model for a rapid cryogenic loading system developed at NASA-Kennedy Space Center. The nontrivial characteristic feature of the analyzed chilldown regime is its active control by dump valves. The two-phase flow model of the chilldown is approximated as one-dimensional homogeneous fluid flow with no slip condition for the interphase velocity. The model is built using commercial SINDA/FLUINT software. The results of numerical predictions are in good agreement with the experimental time traces. The obtained results pave the way to the application of the SINDA/FLUINT model as a verification tool for the design and algorithm development required for autonomous loading operation

  8. Nucleic Acid-Based Detection and Identification of Bacterial and Fungal Plant Pathogens - Final Report

    Energy Technology Data Exchange (ETDEWEB)

    Kingsley, Mark T.

    2001-03-13

    The threat to American interests from terrorists is not limited to attacks against humans. Terrorists might seek to inflict damage to the U.S. economy by attacking our agricultural sector. Infection of commodity crops by bacterial or fungal crop pathogens could adversely impact U.S. agriculture, either directly from damage to crops or indirectly from damage to our ability to export crops suspected of contamination. Recognizing a terrorist attack against U.S. agriculture, to be able to prosecute the terrorists, is among the responsibilities of the members of Hazardous Material Response Unit (HMRU) of the Federal Bureau of Investigation (FBI). Nucleic acid analysis of plant pathogen strains by the use of polymerase chain reaction (PCR) amplification techniques is a powerful method for determining the exact identity of pathogens, as well as their possible region of origin. This type of analysis, however, requires that PCR assays be developed specific to each particular pathogen strain, and analysis protocols developed that are specific to the particular instrument used for detection. The objectives of the work described here were threefold: 1) to assess the potential terrorist threat to U.S. agricultural crops, 2) to determine whether suitable assays exist to monitor that threat, and 3) where assays are needed for priority plant pathogen threats, to modify or develop those assays for use by specialists at the HMRU. The assessment of potential threat to U.S. commodity crops and the availability of assays for those threats were described in detail in the Technical Requirements Document (9) and will be summarized in this report. This report addresses development of specific assays identified in the Technical Requirements Document, and offers recommendations for future development to ensure that HMRU specialists will be prepared with the PCR assays they need to protect against the threat of economic terrorism.

  9. Using metagenomic analyses to estimate the consequences of enrichment bias for pathogen detection

    Directory of Open Access Journals (Sweden)

    Pettengill James B

    2012-07-01

    Full Text Available Abstract Background Enriching environmental samples to increase the probability of detection has been standard practice throughout the history of microbiology. However, by its very nature, the process of enrichment creates a biased sample that may have unintended consequences for surveillance or resolving a pathogenic outbreak. With the advent of next-generation sequencing and metagenomic approaches, the possibility now exists to quantify enrichment bias at an unprecedented taxonomic breadth. Findings We investigated differences in taxonomic profiles of three enriched and unenriched tomato phyllosphere samples taken from three different tomato fields (n = 18. 16S rRNA gene meteganomes were created for each of the 18 samples using 454/Roche’s pyrosequencing platform, resulting in a total of 165,259 sequences. Significantly different taxonomic profiles and abundances at a number of taxonomic levels were observed between the two treatments. Although as many as 28 putative Salmonella sequences were detected in enriched samples, there was no significant difference in the abundance of Salmonella between enriched and unenriched treatments. Conclusions Our results illustrate that the process of enriching greatly alters the taxonomic profile of an environmental sample beyond that of the target organism. We also found evidence suggesting that enrichment may not increase the probability of detecting a target. In conclusion, our results further emphasize the need to develop metagenomics as a validated culture independent method for pathogen detection.

  10. Simultaneous detection of marine fish pathogens by using multiplex PCR and a DNA microarray.

    Science.gov (United States)

    González, Santiago F; Krug, Melissa J; Nielsen, Michael E; Santos, Ysabel; Call, Douglas R

    2004-04-01

    We coupled multiplex PCR and a DNA microarray to construct an assay suitable for the simultaneous detection of five important marine fish pathogens (Vibrio vulnificus, Listonella anguillarum, Photobacterium damselae subsp. damselae, Aeromonas salmonicida subsp. salmonicida, and Vibrio parahaemolyticus). The array was composed of nine short oligonucleotide probes (25-mer) complementary to seven chromosomal loci (cyt, rpoN, gyrB, toxR, ureC, dly, and vapA) and two plasmid-borne loci (fatA and A.sal). Nine primer sets were designed to amplify short fragments of these loci (100 to 177 bp) in a multiplex PCR. PCR products were subsequently labeled by nick translation and hybridized to the microarray. All strains of the five target species (n = 1 to 21) hybridized to at least one species-specific probe. Assay sensitivities ranged from 100% for seven probes to 83 and 67% for the two remaining probes. Multiplex PCR did not produce any nonspecific amplification products when tested against 23 related species of bacteria (n = 40 strains; 100% specificity). Using purified genomic DNA, we were able to detect PCR products with detecting PCR products. In addition, our method allowed the tentative identification of virulent strains of L. anguillarum serotype O1 based on the presence of the fatA gene (67% sensitivity and 100% specificity). This assay is a sensitive and specific tool for the simultaneous detection of multiple pathogenic bacteria that cause disease in fish and humans. PMID:15070982

  11. Ultrarapid detection of pathogenic bacteria using a 3D immunomagnetic flow assay.

    Science.gov (United States)

    Lee, Wonjae; Kwon, Donghoon; Chung, Boram; Jung, Gyoo Yeol; Au, Anthony; Folch, Albert; Jeon, Sangmin

    2014-07-01

    We developed a novel 3D immunomagnetic flow assay for the rapid detection of pathogenic bacteria in a large-volume food sample. Antibody-functionalized magnetic nanoparticle clusters (AbMNCs) were magnetically immobilized on the surfaces of a 3D-printed cylindrical microchannel. The injection of a Salmonella-spiked sample solution into the microchannel produced instant binding between the AbMNCs and the Salmonella bacteria due to their efficient collisions. Nearly perfect capture of the AbMNCs and AbMNCs-Salmonella complexes was achieved under a high flow rate by stacking permanent magnets with spacers inside the cylindrical separator to maximize the magnetic force. The concentration of the bacteria in solution was determined using ATP luminescence measurements. The detection limit was better than 10 cfu/mL, and the overall assay time, including the binding, rinsing, and detection steps for a 10 mL sample took less than 3 min. To our knowledge, the 3D immunomagnetic flow assay described here provides the fastest high-sensitivity, high-capacity method for the detection of pathogenic bacteria. PMID:24856003

  12. Rapid and high-throughput detection of highly pathogenic bacteria by Ibis PLEX-ID technology.

    Directory of Open Access Journals (Sweden)

    Daniela Jacob

    Full Text Available In this manuscript, we describe the identification of highly pathogenic bacteria using an assay coupling biothreat group-specific PCR with electrospray ionization mass spectrometry (PCR/ESI-MS run on an Ibis PLEX-ID high-throughput platform. The biothreat cluster assay identifies most of the potential bioterrorism-relevant microorganisms including Bacillus anthracis, Francisella tularensis, Yersinia pestis, Burkholderia mallei and pseudomallei, Brucella species, and Coxiella burnetii. DNA from 45 different reference materials with different formulations and different concentrations were chosen and sent to a service screening laboratory that uses the PCR/ESI-MS platform to provide a microbial identification service. The standard reference materials were produced out of a repository built up in the framework of the EU funded project "Establishment of Quality Assurances for Detection of Highly Pathogenic Bacteria of Potential Bioterrorism Risk" (EQADeBa. All samples were correctly identified at least to the genus level.

  13. Two Laboratory Activities Using Conventional or Real-Time PCR to Simulate Pathogenic E. coli Detection

    Directory of Open Access Journals (Sweden)

    Joanna R. Klein

    2014-02-01

    Full Text Available In these lab activities, students perform conventional PCR and real-time PCR to simulate pathogenic E. coli detection. The labs were designed to complement a previously published virtual PCR classroom activity in which students are asked to design a PCR-based diagnostic test for a pathogenic strain of E. coli. In the virtual PCR activity, students use bioinformatics to discover that the Shiga toxin genes (stx1 and stx2 are unique to the Enterohemorrhagic E. coli (EHEC strain O157:H7. Thus they come to the conclusion that doing PCR with primers designed for shiga toxin should be able to differentiate O157:H7 from other strains of E. coli. In the lab activity described here, students actually perform the PCR assay. Performing PCR enhanced student understanding of the technique beyond what was accomplished through the virtual PCR classroom activity and is recommended as an addition to the case study.

  14. Simultaneous detection of multiple lower genital tract pathogens by an impedimetric immunochip.

    Science.gov (United States)

    Chiriacò, Maria Serena; Primiceri, Elisabetta; De Feo, Francesco; Montanaro, Alessandro; Monteduro, Anna Grazia; Tinelli, Andrea; Megha, Marcella; Carati, Davide; Maruccio, Giuseppe

    2016-05-15

    Lower genital tract infections caused by both sexually and not-sexually transmitted pathogens in women are a key public health priority worldwide, especially in developing countries. Since standard analyses are time-consuming, appropriate therapeutic intervention is often neglected or delayed. Lab-on-chips and biosensors open new perspectives and offer innovative tools to simplify the diagnosis by medical staff, especially in countries with inadequate resources. Here we report a biosensing platform based on Electrochemical Impedance Spectroscopy (EIS) that allows multiplexed detection of Candida albicans, Streptococcus agalactiae and Chlamydia trachomatis with a single biochip, enabling a quick screening thanks to the presence of different immobilized antibodies, each specific for one of the different target pathogens. PMID:26686917

  15. Coliform detection in cheese is associated with specific cheese characteristics, but no association was found with pathogen detection.

    Science.gov (United States)

    Trmčić, A; Chauhan, K; Kent, D J; Ralyea, R D; Martin, N H; Boor, K J; Wiedmann, M

    2016-08-01

    Coliform detection in finished products, including cheese, has traditionally been used to indicate whether a given product has been manufactured under unsanitary conditions. As our understanding of the diversity of coliforms has improved, it is necessary to assess whether coliforms are a good indicator organism and whether coliform detection in cheese is associated with the presence of pathogens. The objective of this study was (1) to evaluate cheese available on the market for presence of coliforms and key pathogens, and (2) to characterize the coliforms present to assess their likely sources and public health relevance. A total of 273 cheese samples were tested for presence of coliforms and for Salmonella, Staphylococcus aureus, Shiga toxin-producing Escherichia coli, Listeria monocytogenes, and other Listeria species. Among all tested cheese samples, 27% (75/273) tested positive for coliforms in concentrations >10cfu/g. Pasteurization, pH, water activity, milk type, and rind type were factors significantly associated with detection of coliforms in cheese; for example, a higher coliform prevalence was detected in raw milk cheeses (42% with >10cfu/g) compared with pasteurized milk cheese (21%). For cheese samples contaminated with coliforms, only water activity was significantly associated with coliform concentration. Coliforms isolated from cheese samples were classified into 13 different genera, including the environmental coliform genera Hafnia, Raoultella, and Serratia, which represent the 3 genera most frequently isolated across all cheeses. Escherichia, Hafnia, and Enterobacter were significantly more common among raw milk cheeses. Based on sequencing of the housekeeping gene clpX, most Escherichia isolates were confirmed as members of fecal commensal clades of E. coli. All cheese samples tested negative for Salmonella, Staph. aureus, and Shiga toxin-producing E. coli. Listeria spp. were found in 12 cheese samples, including 5 samples positive for L

  16. Multiplexed lateral flow microarray assay for detection of citrus pathogens Xylella fastidiosa and Xanthomonas axonopodis pv citri

    Science.gov (United States)

    Cary; R. Bruce; Stubben, Christopher J.

    2011-03-22

    The invention provides highly sensitive and specific assays for the major citrus pathogens Xylella fastidiosa and Xanthomonas axonopodis, including a field deployable multiplexed assay capable of rapidly assaying for both pathogens simultaneously. The assays are directed at particular gene targets derived from pathogenic strains that specifically cause the major citrus diseases of citrus variegated chlorosis (Xylella fastidiosa 9a5c) and citrus canker (Xanthomonas axonopodis pv citri). The citrus pathogen assays of the invention offer femtomole sensitivity, excellent linear dynamic range, and rapid and specific detection.

  17. Development and comparison of two assay formats for parallel detection of four biothreat pathogens by using suspension microarrays.

    Directory of Open Access Journals (Sweden)

    Ingmar Janse

    Full Text Available Microarrays provide a powerful analytical tool for the simultaneous detection of multiple pathogens. We developed diagnostic suspension microarrays for sensitive and specific detection of the biothreat pathogens Bacillus anthracis, Yersinia pestis, Francisella tularensis and Coxiella burnetii. Two assay chemistries for amplification and labeling were developed, one method using direct hybridization and the other using target-specific primer extension, combined with hybridization to universal arrays. Asymmetric PCR products for both assay chemistries were produced by using a multiplex asymmetric PCR amplifying 16 DNA signatures (16-plex. The performances of both assay chemistries were compared and their advantages and disadvantages are discussed. The developed microarrays detected multiple signature sequences and an internal control which made it possible to confidently identify the targeted pathogens and assess their virulence potential. The microarrays were highly specific and detected various strains of the targeted pathogens. Detection limits for the different pathogen signatures were similar or slightly higher compared to real-time PCR. Probit analysis showed that even a few genomic copies could be detected with 95% confidence. The microarrays detected DNA from different pathogens mixed in different ratios and from spiked or naturally contaminated samples. The assays that were developed have a potential for application in surveillance and diagnostics.

  18. Combining information of autonomic modulation and CGM measurements enables prediction and improves detection of spontaneous hypoglycemic events

    DEFF Research Database (Denmark)

    Cichosz, Simon Lebech; Frystyk, Jan; Tarnow, Lise;

    2015-01-01

    We have previously tested, in a laboratory setting, a novel algorithm that enables prediction of hypoglycemia. The algorithm integrates information of autonomic modulation, based on heart rate variability (HRV), and data based on a continuous glucose monitoring (CGM) device. Now, we investigate...... whether the algorithm is suitable for prediction of hypoglycemia and for improvement of hypoglycemic detection during normal daily activities. Twenty-one adults (13 men) with T1D prone to hypoglycemia were recruited and monitored with CGM and a Holter device while they performed normal daily activities......+HRV model-combining model (ii) with HRV data. A total of 12 hypoglycemic events (glucose levels < 3.9 mmol/L, 70 mg/dL) and 237 euglycemic measurements were included. For a 20-minute prediction, model (i) resulted in a ROC AUC of 0.69. If a high sensitivity of 100% was chosen, the corresponding specificity...

  19. A Multiplex PCR Assay for the Detection of Pathogenic Genes of EPEC, ETEC and EIEC

    Institute of Scientific and Technical Information of China (English)

    ZHANG Tienan; LI Jichang; LU Chengwu; HUO Guicheng

    2006-01-01

    A multiplex polymerase chain reaction (PCR) was developed to detect three pathogenic genes of enteropathogenic, enterotocigenic and enteroinvasive Escherichia coli.. In this study three different sets of oligonucleotide primer were simultaneously used, and in this way, specific fragments of 880, 600, 150 bp for EPEC eaeA,EIEC ipaH and ETEC ST genes were amplified, respectively. The best condition of the multiplex PCR was: after an initial heat denaturation step at 95℃ for 5 min, followed by 30 cycles of denaturation at 94 ℃ for 40 s, primer annealing at 51.3 ℃ for 40 s and extension at 72 ℃ for 1 min, final extension at 72 ℃ for 10 min. The detection limit of tively. It may be a good way for the detection and identification of Diarrhea-causing E. coli..

  20. High throughput, multiplexed pathogen detection authenticates plague waves in medieval Venice, Italy.

    Directory of Open Access Journals (Sweden)

    Thi-Nguyen-Ny Tran

    Full Text Available BACKGROUND: Historical records suggest that multiple burial sites from the 14th-16th centuries in Venice, Italy, were used during the Black Death and subsequent plague epidemics. METHODOLOGY/PRINCIPAL FINDINGS: High throughput, multiplexed real-time PCR detected DNA of seven highly transmissible pathogens in 173 dental pulp specimens collected from 46 graves. Bartonella quintana DNA was identified in five (2.9% samples, including three from the 16th century and two from the 15th century, and Yersinia pestis DNA was detected in three (1.7% samples, including two from the 14th century and one from the 16th century. Partial glpD gene sequencing indicated that the detected Y. pestis was the Orientalis biotype. CONCLUSIONS: These data document for the first time successive plague epidemics in the medieval European city where quarantine was first instituted in the 14th century.

  1. Evaluation of Luminex xTAG Gastrointestinal Pathogen Panel Assay for Detection of Multiple Diarrheal Pathogens in Fecal Samples in Vietnam.

    Science.gov (United States)

    Duong, Vu Thuy; Phat, Voong Vinh; Tuyen, Ha Thanh; Dung, Tran Thi Ngoc; Trung, Pham Duc; Minh, Pham Van; Tu, Le Thi Phuong; Campbell, James I; Le Phuc, Hoang; Ha, Ton Thi Thanh; Ngoc, Nguyen Minh; Huong, Nguyen Thi Thanh; Tam, Pham Thi Thanh; Huong, Dang Thao; Xang, Nguyen Van; Dong, Nguyen; Phuong, Le Thi; Hung, Nguyen Van; Phu, Bui Duc; Phuc, Tran My; Thwaites, Guy E; Vi, Lu Lan; Rabaa, Maia A; Thompson, Corinne N; Baker, Stephen

    2016-04-01

    Diarrheal disease is a complex syndrome that remains a leading cause of global childhood morbidity and mortality. The diagnosis of enteric pathogens in a timely and precise manner is important for making treatment decisions and informing public health policy, but accurate diagnosis is a major challenge in industrializing countries. Multiplex molecular diagnostic techniques may represent a significant improvement over classical approaches. We evaluated the Luminex xTAG gastrointestinal pathogen panel (GPP) assay for the detection of common enteric bacterial and viral pathogens in Vietnam. Microbiological culture and real-time PCR were used as gold standards. The tests were performed on 479 stool samples collected from people admitted to the hospital for diarrheal disease throughout Vietnam. Sensitivity and specificity were calculated for the xTAG GPP for the seven principal diarrheal etiologies. The sensitivity and specificity for the xTAG GPP were >88% forShigellaspp.,Campylobacterspp., rotavirus, norovirus genotype 1/2 (GI/GII), and adenovirus compared to those of microbiological culture and/or real-time PCR. However, the specificity was low (∼60%) forSalmonellaspecies. Additionally, a number of important pathogens that are not identified in routine hospital procedures in this setting, such asCryptosporidiumspp. andClostridium difficile, were detected with the GPP. The use of the Luminex xTAG GPP for the detection of enteric pathogens in settings, like Vietnam, would dramatically improve the diagnostic accuracy and capacity of hospital laboratories, allowing for timely and appropriate therapy decisions and a wider understanding of the epidemiology of pathogens associated with severe diarrheal disease in low-resource settings. PMID:26865681

  2. Evaluation of Luminex xTAG Gastrointestinal Pathogen Panel Assay for Detection of Multiple Diarrheal Pathogens in Fecal Samples in Vietnam

    Science.gov (United States)

    Duong, Vu Thuy; Phat, Voong Vinh; Tuyen, Ha Thanh; Dung, Tran Thi Ngoc; Trung, Pham Duc; Minh, Pham Van; Tu, Le Thi Phuong; Campbell, James I.; Le Phuc, Hoang; Ha, Ton Thi Thanh; Ngoc, Nguyen Minh; Huong, Nguyen Thi Thanh; Tam, Pham Thi Thanh; Huong, Dang Thao; Xang, Nguyen Van; Dong, Nguyen; Phuong, Le Thi; Hung, Nguyen Van; Phu, Bui Duc; Phuc, Tran My; Thwaites, Guy E.; Vi, Lu Lan; Rabaa, Maia A.; Baker, Stephen

    2016-01-01

    Diarrheal disease is a complex syndrome that remains a leading cause of global childhood morbidity and mortality. The diagnosis of enteric pathogens in a timely and precise manner is important for making treatment decisions and informing public health policy, but accurate diagnosis is a major challenge in industrializing countries. Multiplex molecular diagnostic techniques may represent a significant improvement over classical approaches. We evaluated the Luminex xTAG gastrointestinal pathogen panel (GPP) assay for the detection of common enteric bacterial and viral pathogens in Vietnam. Microbiological culture and real-time PCR were used as gold standards. The tests were performed on 479 stool samples collected from people admitted to the hospital for diarrheal disease throughout Vietnam. Sensitivity and specificity were calculated for the xTAG GPP for the seven principal diarrheal etiologies. The sensitivity and specificity for the xTAG GPP were >88% for Shigella spp., Campylobacter spp., rotavirus, norovirus genotype 1/2 (GI/GII), and adenovirus compared to those of microbiological culture and/or real-time PCR. However, the specificity was low (∼60%) for Salmonella species. Additionally, a number of important pathogens that are not identified in routine hospital procedures in this setting, such as Cryptosporidium spp. and Clostridium difficile, were detected with the GPP. The use of the Luminex xTAG GPP for the detection of enteric pathogens in settings, like Vietnam, would dramatically improve the diagnostic accuracy and capacity of hospital laboratories, allowing for timely and appropriate therapy decisions and a wider understanding of the epidemiology of pathogens associated with severe diarrheal disease in low-resource settings. PMID:26865681

  3. Recent Advances in Molecular Technologies and Their Application in Pathogen Detection in Foods with Particular Reference to Yersinia

    OpenAIRE

    Jin Gui; Patel, Isha R.

    2011-01-01

    Yersinia enterocolitica is an important zoonotic pathogen that can cause yersiniosis in humans and animals. Food has been suggested to be the main source of yersiniosis. It is critical for the researchers to be able to detect Yersinia or any other foodborne pathogen with increased sensitivity and specificity, as well as in real-time, in the case of a foodborne disease outbreak. Conventional detection methods are known to be labor intensive, time consuming, or expensive. On the other hand, mor...

  4. PCR-based specific techniques used for detecting the most important pathogens on strawberry: a systematic review

    OpenAIRE

    Mirmajlessi, Seyed Mahyar; Destefanis, Marialaura; Gottsberger, Richard Alexander; Mänd, Marika; Loit, Evelin

    2015-01-01

    Background Strawberry diseases are a major limiting factor that severely impact plant agronomic performance. Regarding limitations of traditional techniques for detection of pathogens, researchers have developed specific DNA-based tests as sensitive and specific techniques. The aim of this review is to provide an overview of polymerase chain reaction (PCR)-based methods used for detection or quantification of the most widespread strawberry pathogens, such as Fusarium oxysporum f.sp. fragariae...

  5. Assessment of an extraction protocol to detect the major mastitis-causing pathogens in bovine milk.

    Science.gov (United States)

    Cressier, B; Bissonnette, N

    2011-05-01

    Despite all efforts to control its spread, mastitis remains the most costly disease for dairy farmers worldwide. One key component of better control of this disease is identification of the causative bacterial agent during udder infections in cows. Mastitis is complex, however, given the diversity of pathogens that must be identified. Development of a rapid and efficient bacterial species identification tool is thus necessary. This study was conducted to demonstrate the feasibility of bacterial DNA extraction for the automated molecular detection of major mastitis-causing pathogens directly in milk samples to complement traditional microbiological identification. Extraction and detection procedures were designed and optimized to achieve detection in a respectable time frame, at a reasonable cost, and with a high throughput capacity. The following species were identified: Staphylococcus aureus, Escherichia coli, Streptococcus uberis, Streptococcus agalactiae, Streptococcus dysgalactiae, and Klebsiella spp. (including Klebsiella oxytoca and Klebsiella pneumoniae). The detection procedure includes specific genomic DNA amplification by multiplex PCR for each species, separation by capillary electrophoresis, and laser-assisted automated detection. The specificity of the primers was assessed with a panel of bacteria representing mastitis-negative control species. The extraction protocol comprised multiple steps, starting with centrifugation for fat removal, followed by heating in the presence of a cation exchange resin to trap divalent ions. The analytical sensitivity was 100 cfu/mL for milk samples spiked with Staph. aureus, Strep. dysgalactiae, and E. coli, with a tendency for K. pneumoniae. The detection limit was 500 cfu/mL for Strep. uberis and Strep. agalactiae. The overall diagnostic sensitivity (95.4%) and specificity (97.3%) were determined in a double-blind randomized assay by processing 172 clinical milk samples with microbiological characterization as the

  6. Laser diagnostic technology for early detection of pathogen infestation in orange fruits

    International Nuclear Information System (INIS)

    Due to an increased expectation of food products that respect high quality and safety standards, there is a need for the growth of accurate, fast, objective and non-destructive technologies for quality determination of food and agricultural products. For this purpose, a diagnostic system based on laser photoacoustic spectroscopy (LPAS) was developed at ENEA Frascati Molecular Spectroscopy Laboratory (Italy). In the design of the photoacoustic detector, particular emphasis was placed in attaining a high sensitivity in detecting ethylene (ET) down to sub-parts per billion level (minimum detectable concentration 0.2 ppb). This was required due to the necessity to monitor and follow up ET production at a single fruit scale. ET is normally synthesised in very low amounts by healthy citrus fruits; however stress conditions such as pathogen attack may induce a substantial increase in the synthesised ET. In the present paper, the comparison between the ET emitted by healthy oranges (Citrus sinensis L. Osbeck) cv Navel and by Phytophthora citrophthora infested Navel orange fruits are reported. The obtained results show a well evident increase in ET emission from the infested fruit with respect to the healthy one, even 24 h after the inoculation with the pathogen; at that time the tissue necrosis was not yet visible, and the fruit was also not yet damaged. The possibility to perform a real time non-destructive detection of ET traces makes the LPAS a powerful tool for monitoring the healthy state of the citrus fruits.

  7. Establishment and Application of a Visual DNA Microarray for the Detection of Food-borne Pathogens.

    Science.gov (United States)

    Li, Yongjin

    2016-01-01

    The accurate detection and identification of food-borne pathogenic microorganisms is critical for food safety nowadays. In the present work, a visual DNA microarray was established and applied to detect pathogens commonly found in food, including Salmonella enterica, Shigella flexneri, E. coli O157:H7 and Listeria monocytogenes in food samples. Multiplex PCR (mPCR) was employed to simultaneously amplify specific gene fragments, fimY for Salmonella, ipaH for Shigella, iap for L. monocytogenes and ECs2841 for E. coli O157:H7, respectively. Biotinylated PCR amplicons annealed to the microarray probes were then reacted with a streptavidin-alkaline phosphatase conjugate and nitro blue tetrazolium/5-bromo-4-chloro-3'-indolylphosphate, p-toluidine salt (NBT/BCIP); the positive results were easily visualized as blue dots formatted on the microarray surface. The performance of a DNA microarray was tested against 14 representative collection strains and mock-contamination food samples. The combination of mPCR and a visual micro-plate chip specifically and sensitively detected Salmonella enterica, Shigella flexneri, E. coli O157:H7 and Listeria monocytogenes in standard strains and food matrices with a sensitivity of ∼10(2) CFU/mL of bacterial culture. Thus, the developed method is advantageous because of its high throughput, cost-effectiveness and ease of use. PMID:26860568

  8. Laser diagnostic technology for early detection of pathogen infestation in orange fruits

    Energy Technology Data Exchange (ETDEWEB)

    Giubileo, Gianfranco, E-mail: gianfranco.giubileo@frascati.enea.i [ENEA Frascati, Via E. Fermi 45, 00044 (Italy); Lai, Antonella; Piccinelli, Delinda [ENEA Frascati, Via E. Fermi 45, 00044 (Italy); Puiu, Adriana [Tor Vergata University of Rome, Faculty of Engineering, Via del Politecnico 1, 00133 Rome (Italy)

    2010-11-11

    Due to an increased expectation of food products that respect high quality and safety standards, there is a need for the growth of accurate, fast, objective and non-destructive technologies for quality determination of food and agricultural products. For this purpose, a diagnostic system based on laser photoacoustic spectroscopy (LPAS) was developed at ENEA Frascati Molecular Spectroscopy Laboratory (Italy). In the design of the photoacoustic detector, particular emphasis was placed in attaining a high sensitivity in detecting ethylene (ET) down to sub-parts per billion level (minimum detectable concentration 0.2 ppb). This was required due to the necessity to monitor and follow up ET production at a single fruit scale. ET is normally synthesised in very low amounts by healthy citrus fruits; however stress conditions such as pathogen attack may induce a substantial increase in the synthesised ET. In the present paper, the comparison between the ET emitted by healthy oranges (Citrus sinensis L. Osbeck) cv Navel and by Phytophthora citrophthora infested Navel orange fruits are reported. The obtained results show a well evident increase in ET emission from the infested fruit with respect to the healthy one, even 24 h after the inoculation with the pathogen; at that time the tissue necrosis was not yet visible, and the fruit was also not yet damaged. The possibility to perform a real time non-destructive detection of ET traces makes the LPAS a powerful tool for monitoring the healthy state of the citrus fruits.

  9. Exploration of Simple Analytical Approaches for Rapid Detection of Pathogenic Bacteria

    Energy Technology Data Exchange (ETDEWEB)

    Salma Rahman

    2005-12-17

    Many of the current methods for pathogenic bacterial detection require long sample-preparation and analysis time, as well as complex instrumentation. This dissertation explores simple analytical approaches (e.g., flow cytometry and diffuse reflectance spectroscopy) that may be applied towards ideal requirements of a microbial detection system, through method and instrumentation development, and by the creation and characterization of immunosensing platforms. This dissertation is organized into six sections. In the general Introduction section a literature review on several of the key aspects of this work is presented. First, different approaches for detection of pathogenic bacteria will be reviewed, with a comparison of the relative strengths and weaknesses of each approach, A general overview regarding diffuse reflectance spectroscopy is then presented. Next, the structure and function of self-assembled monolayers (SAMs) formed from organosulfur molecules at gold and micrometer and sub-micrometer patterning of biomolecules using SAMs will be discussed. This section is followed by four research chapters, presented as separate manuscripts. Chapter 1 describes the efforts and challenges towards the creation of imunosensing platforms that exploit the flexibility and structural stability of SAMs of thiols at gold. 1H, 1H, 2H, 2H-perfluorodecyl-1-thiol SAM (PFDT) and dithio-bis(succinimidyl propionate)-(DSP)-derived SAMs were used to construct the platform. Chapter 2 describes the characterization of the PFDT- and DSP-derived SAMs, and the architectures formed when it is coupled to antibodies as well as target bacteria. These studies used infrared reflection spectroscopy (IRS), X-ray photoelectron spectroscopy (XPS), and electrochemical quartz crystal microbalance (EQCM), Chapter 3 presents a new sensitive, and portable diffuse reflection based technique for the rapid identification and quantification of pathogenic bacteria. Chapter 4 reports research efforts in the

  10. Dual Enlargement of Gold Nanoparticles: From Mechanism to Scanometric Detection of Pathogenic Bacteria

    DEFF Research Database (Denmark)

    Cao, Cuong; Gontard, Lionel Cervera; Le Ly, Tram Thuy;

    2011-01-01

    electron density of the nanostructures, leading to a stronger intensity for colorimetric discrimination as well as better sensitivity for quantitative measurement. Based on this, a simple scanometric assay for the on‐slide detection of the food‐born pathogen Campylobacter jejuni is developed. After...... capturing the target bacteria, gold‐tagged immunoprobes are added to create a signal on a solid substrate. The signal is then amplified by the dual enlargement process, resulting in a strong color intensity that can easily be recognized by the unaided eye, or measured by an inexpensive flatbed scanner. In...

  11. Surface plasmon resonance biosensors for detection of foodborne pathogens and toxins

    Czech Academy of Sciences Publication Activity Database

    Homola, Jiří; Hegnerová, Kateřina; Vala, Milan

    Bellingham, Washington: SPIE, 2009, 716705-1-716705-10. (Proceedings of SPIE. Progress in Biomedical Optics and Imaging. 7167). ISBN 978-0-8194-7413-1. ISSN 0277-786X. [Conference On Frontiers in Pathogen Detection - From Nanosensors to Systems. San Jose (US), 24.01.2009-26.01.2009] R&D Projects: GA AV ČR KAN200670701 Institutional research plan: CEZ:AV0Z20670512 Keywords : Surface plasmon resonance * Biosensor * Food safety Subject RIV: JB - Sensors, Measurment, Regulation

  12. Colour-based Object Detection and Tracking for Autonomous Quadrotor UAV

    Science.gov (United States)

    Kadouf, Hani Hunud A.; Mohd Mustafah, Yasir

    2013-12-01

    With robotics becoming a fundamental aspect of modern society, further research and consequent application is ever increasing. Aerial robotics, in particular, covers applications such as surveillance in hostile military zones or search and rescue operations in disaster stricken areas, where ground navigation is impossible. The increased visual capacity of UAV's (Unmanned Air Vehicles) is also applicable in the support of ground vehicles to provide supplies for emergency assistance, for scouting purposes or to extend communication beyond insurmountable land or water barriers. The Quadrotor, which is a small UAV has its lift generated by four rotors and can be controlled by altering the speeds of its motors relative to each other. The four rotors allow for a higher payload than single or dual rotor UAVs, which makes it safer and more suitable to carry camera and transmitter equipment. An onboard camera is used to capture and transmit images of the Quadrotor's First Person View (FPV) while in flight, in real time, wirelessly to a base station. The aim of this research is to develop an autonomous quadrotor platform capable of transmitting real time video signals to a base station for processing. The result from the image analysis will be used as a feedback in the quadrotor positioning control. To validate the system, the algorithm should have the capacity to make the quadrotor identify, track or hover above stationary or moving objects.

  13. Colour-based Object Detection and Tracking for Autonomous Quadrotor UAV

    International Nuclear Information System (INIS)

    With robotics becoming a fundamental aspect of modern society, further research and consequent application is ever increasing. Aerial robotics, in particular, covers applications such as surveillance in hostile military zones or search and rescue operations in disaster stricken areas, where ground navigation is impossible. The increased visual capacity of UAV's (Unmanned Air Vehicles) is also applicable in the support of ground vehicles to provide supplies for emergency assistance, for scouting purposes or to extend communication beyond insurmountable land or water barriers. The Quadrotor, which is a small UAV has its lift generated by four rotors and can be controlled by altering the speeds of its motors relative to each other. The four rotors allow for a higher payload than single or dual rotor UAVs, which makes it safer and more suitable to carry camera and transmitter equipment. An onboard camera is used to capture and transmit images of the Quadrotor's First Person View (FPV) while in flight, in real time, wirelessly to a base station. The aim of this research is to develop an autonomous quadrotor platform capable of transmitting real time video signals to a base station for processing. The result from the image analysis will be used as a feedback in the quadrotor positioning control. To validate the system, the algorithm should have the capacity to make the quadrotor identify, track or hover above stationary or moving objects

  14. Development of a semi-autonomous directional and spectroscopic radiation detection mobile platform

    International Nuclear Information System (INIS)

    This paper presents a method for a small, inexpensive mobile robot equipped with a single high resolution scintillation detector to quickly survey an area and convey information about local sources of gamma radiation to a remote human operator. This is achieved by surrounding the detector with a lead sheath that blocks all gamma-rays except those incident along the detector's axial direction. A 180° horizontal scan is performed by rotating the detector and a directional profile of gamma radiation is constructed. In addition, a 180° visual panorama of the local area is assembled using a camera mounted on the detector. A plot of the detector count rate versus angle is then overlaid on top of the visual panorama and visible peaks clearly indicate the direction of local gamma radiation sources. Measuring the energy spectrum of gamma-rays in each direction produces a 2D count frequency histogram where distinct peaks indicate the energy and direction of local gamma-ray sources allowing the identification of different radio-isotopes. The mobile robot can use the peaks as goal directions and autonomously move towards gamma-ray sources. - Highlights: • We present a method for a small, inexpensive robot to survey an area and convey information about local gamma-ray sources. • We use a LaBr3 detector inside a lead collimator for directional and spectroscopic gamma-ray measurements. • Overlaying radiation measurement data on 180° visual panoramas indicates the location of radioactive sources

  15. Quantitative Molecular Detection of 19 Major Pathogens in the Interdental Biofilm of Periodontally Healthy Young Adults.

    Science.gov (United States)

    Carrouel, Florence; Viennot, Stéphane; Santamaria, Julie; Veber, Philippe; Bourgeois, Denis

    2016-01-01

    pathogen in adult periodontal disease, represents 8.08% of the 19 bacteria analyzed. P. gingivalis was detected in 19% of healthy subjects and represents 0.02% of the interdental biofilm. T. forsythensis and T. denticola (0.02 and 0.04% of the interdental biofilm) were detected in 93 and 49% of healthy subjects, respectively. The effective presence of periodontal pathogens is a strong indicator of the need to develop new methods for disrupting interdental biofilm in daily oral hygiene. PMID:27313576

  16. Quantitative molecular detection of 19 major pathogens in the interdental biofilm of periodontally healthy young adults

    Directory of Open Access Journals (Sweden)

    Florence eCarrouel

    2016-06-01

    Full Text Available In oral health, the interdental spaces are a real ecological niche for which the body has few or no alternative defenses and where the traditional daily methods for control by disrupting biofilm are not adequate. The interdental spaces are the source of many hypotheses regarding their potential associations with and/or causes of cardiovascular disease, diabetes, chronic kidney disease, degenerative disease, and depression. This PCR study is the first to describe the interdental microbiota in healthy adults aged 18-35 yrs old with reference to the Socransky complexes. The complexes tended to reflect microbial succession events in developing dental biofilms. Early colonizers included members of the yellow, green and purple complexes. The orange complex bacteria generally appear after the early colonizers and include many putative periodontal pathogens, such as F. nucleatum. The red complex (P. gingivalis, T. forsythia and T. denticola was considered the climax community and is on the list of putative periodontal pathogens. The 19 major periodontal pathogens tested were expressed at various levels. F. nucleatum was the most abundant species, and the least abundant were A. viscosus, P. gingivalis and A. actino. a. The genome counts for E. corrodens, C. concisus, C. rectus, T. denticola and T. forsythensis increased significantly with subject age. The study highlights the observation that bacteria from the yellow complex (Streptococcus spp., S. mitis, the green complex (E. corrodens, C. gracilis, C. ochracea, C. sputigena, A. actino a, the purple complex (V. parvula, A. ondotolitycus and the blue complex (A. viscosus are correlated. Concerning the orange complex, F. nucleatum is the most abundant species in interdental biofilm. The red complex, which is recognized as the most important pathogen in adult periodontal disease, represents 8.08% of the 19 bacteria analyzed. P. gingivalis was detected in 19% of healthy subjects and represents 0.02% of the

  17. Quantitative Molecular Detection of 19 Major Pathogens in the Interdental Biofilm of Periodontally Healthy Young Adults

    Science.gov (United States)

    Carrouel, Florence; Viennot, Stéphane; Santamaria, Julie; Veber, Philippe; Bourgeois, Denis

    2016-01-01

    pathogen in adult periodontal disease, represents 8.08% of the 19 bacteria analyzed. P. gingivalis was detected in 19% of healthy subjects and represents 0.02% of the interdental biofilm. T. forsythensis and T. denticola (0.02 and 0.04% of the interdental biofilm) were detected in 93 and 49% of healthy subjects, respectively. The effective presence of periodontal pathogens is a strong indicator of the need to develop new methods for disrupting interdental biofilm in daily oral hygiene. PMID:27313576

  18. Surface plasmon resonance biosensors for detection of pathogenic microorganisms: strategies to secure food and environmental safety.

    Science.gov (United States)

    Bergwerff, Aldert A; van Knapen, Frans

    2006-01-01

    This review describes the exploitation of exclusively optical surface plasmon resonance (SPR) biosensors for the direct and indirect detection of pathogenic microorganisms in food chains and the environment. Direct detection is, in most cases, facilitated by the use of defined monoclonal or polyclonal antibodies raised against (a part of) the target pathogenic microorganisms. The antibodies were immobilized to a solid phase of the sensor to capture the microbe from the sample. Alternatively, antibodies were used in an inhibition-like assay involving incubation with the target organism prior to analysis of nonbound antibodies. The free immunoglobins were screened on a sensor surface coated with either purified antigens or with Fc or Fab binding antibodies. Discussed examples of these approaches are the determination of Escherichia coli O1 57:H7, Salmonella spp., and Listeria monocytogenes. Another direct detection strategy involved SPR analysis of polymerase chain reaction products of Shiga toxin-2 genes reporting the presence of E. coli O157:H7 in human stool. Metabolic products have been exploited as biomarkers for the presence of a microbial agent, such as enterotoxin B and a virulence factor for the occurrence of Staphylococcus aureus and Streptococcus suis, respectively. Indirect detection, on the other hand, is performed by analysis of a humoral immune response of the infected animal or human. By immobilization of specific antigenic structures, infections with Herpes simplex and human immunodeficiency viruses, Salmonella and Treponema pallidum bacteria, and Schistosoma spp. parasites were revealed using human, avian, and porcine sera and avian eggs. Bound antibodies were easily isotyped using an SPR biosensor to reveal the infection history of the individual. Discussed studies show the recent recognition of the suitability of this type of instrument for (rapid) detection of health-threatening microbes to food and environmental microbial safety. PMID:16792081

  19. Biosensors based on modularly designed synthetic peptides for recognition, detection and live/dead differentiation of pathogenic bacteria.

    Science.gov (United States)

    Liu, Xiaobo; Marrakchi, Mouna; Xu, Dawei; Dong, He; Andreescu, Silvana

    2016-06-15

    Rapid and sensitive detection of bacterial pathogens is critical for assessing public health, food and environmental safety. We report the use of modularly designed and site-specifically oriented synthetic antimicrobial peptides (sAMPs) as novel recognition agents enabling detection and quantification of bacterial pathogens. The oriented assembly of the synthetic peptides on electrode surfaces through an engineered cysteine residue coupled with impedimetric detection facilitated rapid and sensitive detection of bacterial pathogens with a detection limit of 10(2)CFU/mL for four bacterial strains including Escherichia coli (E. coli), Pseudomonas aeruginosa (P. aeruginosa), Staphylococcus aureus (S. aureus) and Staphylococcus epidermidis (S. epidermidis). The approach enabled differentiation between live and dead bacteria. The fabrication of the sAMPs functionalized surface and the importance of the sAMPs orientation for providing optimum recognition and detection ability against pathogens are discussed. The proposed methodology provides a universal platform for the detection of bacterial pathogens based on engineered peptides, as alternative to the most commonly used immunological and gene based assays. The method can also be used to fabricate antimicrobial coatings and surfaces for inactivation and screening of viable bacteria. PMID:26802747

  20. Deception detection with behavioral, autonomic, and neural measures: Conceptual and methodological considerations that warrant modesty.

    Science.gov (United States)

    Meijer, Ewout H; Verschuere, Bruno; Gamer, Matthias; Merckelbach, Harald; Ben-Shakhar, Gershon

    2016-05-01

    The detection of deception has attracted increased attention among psychological researchers, legal scholars, and ethicists during the last decade. Much of this has been driven by the possibility of using neuroimaging techniques for lie detection. Yet, neuroimaging studies addressing deception detection are clouded by lack of conceptual clarity and a host of methodological problems that are not unique to neuroimaging. We review the various research paradigms and the dependent measures that have been adopted to study deception and its detection. In doing so, we differentiate between basic research designed to shed light on the neurocognitive mechanisms underlying deceptive behavior and applied research aimed at detecting lies. We also stress the distinction between paradigms attempting to detect deception directly and those attempting to establish involvement by detecting crime-related knowledge, and discuss the methodological difficulties and threats to validity associated with each paradigm. Our conclusion is that the main challenge of future research is to find paradigms that can isolate cognitive factors associated with deception, rather than the discovery of a unique (brain) correlate of lying. We argue that the Comparison Question Test currently applied in many countries has weak scientific validity, which cannot be remedied by using neuroimaging measures. Other paradigms are promising, but the absence of data from ecologically valid studies poses a challenge for legal admissibility of their outcomes. PMID:26787599

  1. Pathogenic chytrid fungus Batrachochytrium dendrobatidis, but not B. salamandrivorans, detected on eastern hellbenders.

    Science.gov (United States)

    Bales, Emma K; Hyman, Oliver J; Loudon, Andrew H; Harris, Reid N; Lipps, Gregory; Chapman, Eric; Roblee, Kenneth; Kleopfer, John D; Terrell, Kimberly A

    2015-01-01

    Recent worldwide declines and extinctions of amphibian populations have been attributed to chytridiomycosis, a disease caused by the pathogenic fungus Batrachochytrium dendrobatidis (Bd). Until recently, Bd was thought to be the only Batrachochytrium species that infects amphibians; however a newly described species, Batrachochytrium salamandrivorans (Bs), is linked to die-offs in European fire salamanders (Salamandra salamandra). Little is known about the distribution, host range, or origin of Bs. In this study, we surveyed populations of an aquatic salamander that is declining in the United States, the eastern hellbender (Cryptobranchus alleganiensis alleganiensis), for the presence of Bs and Bd. Skin swabs were collected from a total of 91 individuals in New York, Pennsylvania, Ohio, and Virginia, and tested for both pathogens using duplex qPCR. Bs was not detected in any samples, suggesting it was not present in these hellbender populations (0% prevalence, 95% confidence intervals of 0.0-0.04). Bd was found on 22 hellbenders (24% prevalence, 95% confidence intervals of 0.16 ≤ 0.24 ≤ 0.34), representing all four states. All positive samples had low loads of Bd zoospores (12.7 ± 4.9 S.E.M. genome equivalents) compared to other Bd susceptible species. More research is needed to determine the impact of Batrachochytrium infection on hellbender fitness and population viability. In particular, understanding how hellbenders limit Bd infection intensity in an aquatic environment may yield important insights for amphibian conservation. This study is among the first to evaluate the distribution of Bs in the United States, and is consistent with another, which failed to detect Bs in the U.S. Knowledge about the distribution, host-range, and origin of Bs may help control the spread of this pathogen, especially to regions of high salamander diversity, such as the eastern United States. PMID:25695636

  2. Pathogenic chytrid fungus Batrachochytrium dendrobatidis, but not B. salamandrivorans, detected on eastern hellbenders.

    Directory of Open Access Journals (Sweden)

    Emma K Bales

    Full Text Available Recent worldwide declines and extinctions of amphibian populations have been attributed to chytridiomycosis, a disease caused by the pathogenic fungus Batrachochytrium dendrobatidis (Bd. Until recently, Bd was thought to be the only Batrachochytrium species that infects amphibians; however a newly described species, Batrachochytrium salamandrivorans (Bs, is linked to die-offs in European fire salamanders (Salamandra salamandra. Little is known about the distribution, host range, or origin of Bs. In this study, we surveyed populations of an aquatic salamander that is declining in the United States, the eastern hellbender (Cryptobranchus alleganiensis alleganiensis, for the presence of Bs and Bd. Skin swabs were collected from a total of 91 individuals in New York, Pennsylvania, Ohio, and Virginia, and tested for both pathogens using duplex qPCR. Bs was not detected in any samples, suggesting it was not present in these hellbender populations (0% prevalence, 95% confidence intervals of 0.0-0.04. Bd was found on 22 hellbenders (24% prevalence, 95% confidence intervals of 0.16 ≤ 0.24 ≤ 0.34, representing all four states. All positive samples had low loads of Bd zoospores (12.7 ± 4.9 S.E.M. genome equivalents compared to other Bd susceptible species. More research is needed to determine the impact of Batrachochytrium infection on hellbender fitness and population viability. In particular, understanding how hellbenders limit Bd infection intensity in an aquatic environment may yield important insights for amphibian conservation. This study is among the first to evaluate the distribution of Bs in the United States, and is consistent with another, which failed to detect Bs in the U.S. Knowledge about the distribution, host-range, and origin of Bs may help control the spread of this pathogen, especially to regions of high salamander diversity, such as the eastern United States.

  3. Detection and identification of intestinal pathogenic bacteria by hybridization to oligonucleotide microarrays

    Institute of Scientific and Technical Information of China (English)

    Lian-Qun Jin; Jun-Wen Li; Sheng-Qi Wang; Fu-Huan Chao; Xin-Wei Wang; Zheng-Quan Yuan

    2005-01-01

    AIM: To detect the common intestinal pathogenic bacteria quickly and accurately.METHODS: A rapid (<3 h) experimental procedure was set up based upon the gene chip technology. Target genes were amplified and hybridized by oligonucleotide microarrays.RESULTS: One hundred and seventy strains of bacteria in pure culture belonging to 11 genera were successfully discriminated under comparatively same conditions, and a series of specific hybridization maps corresponding to each kind of bacteria were obtained. When this method was applied to 26 divided cultures, 25 (96.2%) were identified.CONCLUSION: Salmonella sp., Escherichia coli, Shigella sp., Listeria monocytogenes, Vibrio parahaemolyticus,Staphylococcus aureus, Proteus sp., Bacillus cereus,Vibrio cholerae, Enterococcus faecalis, Yersinia enterocolitica, and Campylobacter jejuni can be detected and identified by our microarrays. The accuracy, range,and discrimination power of this assay can be continually improved by adding further oligonucleotides to the arrays without any significant increase of complexity or cost.

  4. The amphibian pathogen Batrachochytrium dendrobatidis detected in a community of stream and wetland amphibians

    Science.gov (United States)

    Grant, E.H.C.; Bailey, L.L.; Ware, J.L.; Duncan, K.C.

    2008-01-01

    The amphibian chytrid fungus Batrachochytrium dendrobatidis, responsible for the potentially fatal amphibian disease chytridiomycosis, is known to occur in a large and ever increasing number of amphibian populations around the world. However, sampling has been biased towards stream- and wetland-breeding anurans, with little attention paid to stream-associated salamanders. We sampled three frog and three salamander species in the Chesapeake and Ohio Canal National Historic Park, Maryland, by swabbing animals for PCR analysis to detect DNA of B. dendrobatidis. Using PCR, we detected B. dendrobatidis DNA in both stream and wetland amphibians, and report here the first occurrence of the pathogen in two species of stream-associated salamanders. Future research should focus on mechanisms within habitats that may affect persistence and dissemination of B. dendrobatidis among stream-associated salamanders.

  5. Monoclonal antibody-based Surface Plasmon Resonance sensors for pathogen detection

    DEFF Research Database (Denmark)

    Skottrup, Peter Durand

    2007-01-01

    A biosensor is an analytical device, which incorporates a biological sensing element integrated within a physicochemical transducer. The aim of a biosensor is to produce an electronic signal, which is proportional to the interaction of analytes with the sensing element. This means that the sensor...... agriculture is to have real-time, robust and low-cost sensors, for both soil and air, which can be operated by personnel with limited or no training in plant pathology. In the present thesis focus is put on the development of immunological sensors for detection of two model plant pathogens, Puccinia...... Puccinia species. The subtractive inhibition assay was further developed for label-free detection using a Surface Plasmon Resonance sensor. The polyclonal anti-mouse IgM was immobilised on a sensor surface and used for capture and quantification of mAb8. Optimal regeneration conditions were identified and...

  6. 16S rRNA-based detection of oral pathogens in coronary atherosclerotic plaque

    Directory of Open Access Journals (Sweden)

    Mahendra Jaideep

    2010-01-01

    Full Text Available Background: Atherosclerosis develops as a response of the vessel wall to injury. Chronic bacterial infections have been associated with an increased risk for atherosclerosis and coronary artery disease. The ability of oral pathogens to colonize in coronary atheromatous plaque is well known. Aim: The aim of this study was to detect the presence of Treponema denticola, Porphyromonas gingivalis and Campylobacter rectus in the subgingival and atherosclerotic plaques of patients with coronary artery disease. Materials and Methods: Fifty-one patients in the age group of 40-80 years with coronary artery disease were selected for the study. DNA was extracted from the plaque samples. The specific primers for T. denticola, C. rectus and P. gingivalis were used to amplify a part of the 16S rRNA gene by polymerase chain reaction. Statistical Analysis Used: Chi-square analysis, correlation coefficient and prevalence percentage of the microorganisms were carried out for the analysis. Results: Of the 51 patients, T. denticola, C. rectus and P. gingivalis were detected in 49.01%, 21.51% and 45.10% of the atherosclerotic plaque samples. Conclusions: Our study revealed the presence of bacterial DNA of the oral pathogenic microorganisms in coronary atherosclerotic plaques. The presence of the bacterial DNA in the coronary atherosclerotic plaques in significant proportion may suggest the possible relationship between periodontal bacterial infection and genesis of coronary atherosclerosis.

  7. Isolation and detection of duck astrovirus CPH: implications for epidemiology and pathogenicity.

    Science.gov (United States)

    Liu, Ning; Jiang, Meng; Wang, Minghang; Wang, Fumin; Zhang, Bing; Zhang, Dabing

    2016-04-01

    The transmission routes of duck astrovirus CPH (DAstV/CPH) and its pathogenicity in duck embryos were investigated. Using a reverse transcription-polymerase chain reaction (RT-PCR) developed in this study, DAstV/CPH was detected in 23/50 fresh droppings of breeder ducks, 39/65 breeding eggs, 26/31 dead embryos, and 6/10 newly hatched ducklings, which were taken from a Pekin duck farm where DAstV/CPH had previously been identified. This finding, and the detection of DAstV/CPH in 36/130 dead-in-shell duck embryo samples collected from different hatcheries located in six provinces, suggests that the virus may be horizontally and vertically transmitted and associated with hatchability problems. Inoculation and repeated passages in embryonating duck eggs resulted in isolation of DAstV/CPH. The virus caused severe chorioallantoic membrane lesions as well as growth retardation and embryo mortality, indicating that DAstV/CPH is pathogenic for duck embryos. The effect of DAstV/CPH on hatching was confirmed by an embryo infection experiment in which 8/10 9-day-old duck embryos inoculated with the third passage of DAstV/CPH were unable to hatch, with most embryos succumbing in the final stage of incubation. The use of RT-PCR on the hatched ducklings provided evidence that the embryos could develop into infected ducklings. PMID:26814629

  8. Comparison of individual and pooled sampling methods for detecting bacterial pathogens of fish

    Science.gov (United States)

    Mumford, Sonia; Patterson, Chris; Evered, J.; Brunson, Ray; Levine, J.; Winton, J.

    2005-01-01

    Examination of finfish populations for viral and bacterial pathogens is an important component of fish disease control programs worldwide. Two methods are commonly used for collecting tissue samples for bacteriological culture, the currently accepted standards for detection of bacterial fish pathogens. The method specified in the Office International des Epizooties Manual of Diagnostic Tests for Aquatic Animals permits combining renal and splenic tissues from as many as 5 fish into pooled samples. The American Fisheries Society (AFS) Blue Book/US Fish and Wildlife Service (USFWS) Inspection Manual specifies the use of a bacteriological loop for collecting samples from the kidney of individual fish. An alternative would be to more fully utilize the pooled samples taken for virology. If implemented, this approach would provide substantial savings in labor and materials. To compare the relative performance of the AFS/USFWS method and this alternative approach, cultures of Yersinia ruckeri were used to establish low-level infections in groups of rainbow trout (Oncorhynchus mykiss) that were sampled by both methods. Yersinia ruckeri was cultured from 22 of 37 groups by at least 1 method. The loop method yielded 18 positive groups, with 1 group positive in the loop samples but negative in the pooled samples. The pooled samples produced 21 positive groups, with 4 groups positive in the pooled samples but negative in the loop samples. There was statistically significant agreement (Spearman coefficient 0.80, P sampling methods to permit detection of low-level bacterial infections of rainbow trout.

  9. Pathogen enrichment device (PED) enables one-step growth, enrichment and separation of pathogen from food matrices for detection using bioanalytical platforms.

    Science.gov (United States)

    Hahm, Byoung-Kwon; Kim, Hyochin; Singh, Atul K; Bhunia, Arun K

    2015-10-01

    The bottleneck for accurate detection of foodborne pathogens is separation of target analytes from complex food matrices. Currently used sample preparation methods are cumbersome, arduous and lengthy; thus, a user-friendly system is desirable. A hand-held sample preparation system designated pathogen enrichment device (PED) was built that contains a growth chamber, filters, and an ion exchange cartridge to deliver bacteria directly onto the detection platforms. Escherichia coli O157:H7, Salmonella enterica and Listeria monocytogenes were used as model pathogens. Spinach, ground beef, hotdogs, and eggs were used as model foods to evaluate PED performance, and results were compared with traditional bag enrichment method. Bacterial cells were inoculated at 1, 10, and 100 CFU/g of the sample and enriched in PED using appropriate pathogen-specific selective enrichment broths. The bacterial cell counts in both PED and stomacher-bag were comparable and the pH in PED-recovered cell suspension was close to neutral whereas the pH of cell suspension in the stomacher-bag was slightly acidic. The bacterial recovery from the PED was 79-100% and was directly detected by lateral-flow immunoassay (LFIA), quantitative PCR (qPCR) and light scattering sensor with sample-to-result time of 8-24h with a detection limit of 1CFU/g. In qPCR, the amplified PCR products appeared in 4-5 cycles earlier with PED-enriched cultures compared to the cultures enriched in stomacher-bag. The hand-held PED proved to be a one-step procedure for enrichment and recovery of homogenous particle-free bacterial cells for detection using immunological, molecular or biosensor-based platforms. PMID:26211638

  10. Differential efficiency among DNA extraction methods influences detection of the amphibian pathogen Batrachochytrium dendrobatidis.

    Science.gov (United States)

    Bletz, M C; Rebollar, E A; Harris, R N

    2015-02-10

    Chytridiomycosis, caused by the fungal pathogen Batrachochytrium dendrobatidis (Bd), is responsible for massive declines and extinctions of amphibians worldwide. The most common method for detecting Bd is quantitative polymerase chain reaction (qPCR). qPCR is a highly sensitive detection technique, but its ability to determine the presence and accurately quantify the amount of Bd is also contingent on the efficiency of the DNA extraction method used prior to PCR. Using qPCR, we compared the extraction efficiency of 3 different extraction methods commonly used for Bd detection across a range of zoospore quantities: PrepMan Ultra Reagent, Qiagen DNeasy Blood and Tissue Kit, and Mobio PowerSoil DNA Isolation Kit. We show that not all extraction methods led to successful detection of Bd for the low zoospore quantities and that there was variation in the estimated zoospore equivalents among the methods, which demonstrates that these methods have different extraction efficiencies. These results highlight the importance of considering the extraction method when comparing across studies. The Qiagen DNeasy kit had the highest efficiency. We also show that replicated estimates of less than 1 zoospore can result from known zoospore concentrations; therefore, such results should be considered when obtained from field data. Additionally, we discuss the implications of our findings for interpreting previous studies and for conducting future Bd surveys. It is imperative to use the most efficient DNA extraction method in tandem with the highly sensitive qPCR technique in order to accurately diagnose the presence of Bd as well as other pathogens. PMID:25667331

  11. Identification of pathogenic microbial cells and spores by electrochemical detection on a biochip

    Directory of Open Access Journals (Sweden)

    Andresen Heiko

    2004-04-01

    Full Text Available Abstract Background Bacillus cereus constitutes a significant cause of acute food poisoning in humans. Despite the recent development of different detection methods, new effective control measures and better diagnostic tools are required for quick and reliable detection of pathogenic micro-organisms. Thus, the objective of this study was to determine a simple method for rapid identification of enterotoxic Bacillus strains. Here, a special attention is given to an electrochemical biosensor since it meets the requirements of minimal size, lower costs and decreased power consumption. Results A bead-based sandwich hybridization system was employed in conjugation with electric chips for detection of vegetative cells and spores of Bacillus strains based on their toxin-encoding genes. The system consists of a silicon chip based potentiometric cell, and utilizes paramagnetic beads as solid carriers of the DNA probes. The specific signals from 20 amol of bacterial cell or spore DNA were achieved in less than 4 h. The method was also successful when applied directly to unpurified spore and cell extract samples. The assay for the haemolytic enterotoxin genes resulted in reproducible signals from B. cereus and B. thuringiensis while haemolysin-negative B. subtilis strain did not yield any signal. Conclusions The sensitivity, convenience and specificity of the system have shown its potential. In this respect an electrochemical detection on a chip enabling a fast characterization and monitoring of pathogens in food is of interest. This system can offer a contribution in the rapid identification of bacteria based on the presence of specific genes without preceding nucleic acid amplification.

  12. Rapid Detection of Pathogenic Bacteria from Fresh Produce by Filtration and Surface-Enhanced Raman Spectroscopy

    Science.gov (United States)

    Wu, Xiaomeng; Han, Caiqin; Chen, Jing; Huang, Yao-Wen; Zhao, Yiping

    2016-04-01

    The detection of Salmonella Poona from cantaloupe cubes and E. coli O157:H7 from lettuce has been explored by using a filtration method and surface-enhanced Raman spectroscopy (SERS) based on vancomycin-functionalized silver nanorod array substrates. It is found that with a two-step filtration process, the limit of detection (LOD) of Salmonella Poona from cantaloupe cubes can be as low as 100 CFU/mL in less than 4 h, whereas the chlorophyll in the lettuce causes severe SERS spectral interference. To improve the LOD of lettuce, a three-step filtration method with a hydrophobic filter is proposed. The hydrophobic filter can effectively eliminate the interferences from chlorophyll and achieve a LOD of 1000 CFU/mL detection of E. coli O157:H7 from lettuce samples within 5 h. With the low LODs and rapid detection time, the SERS biosensing platform has demonstrated its potential as a rapid, simple, and inexpensive means for pathogenic bacteria detection from fresh produce.

  13. Agent, autonomous

    OpenAIRE

    Luciani, Annie

    2007-01-01

    The expression autonomous agents, widely used in virtual reality, computer graphics, artificial intelligence and artificial life, corresponds to the simulation of autonomous creatures, virtual (i.e. totally computed by a program), or embodied in a physical envelope, as done in autonomous robots.

  14. A simple extraction procedure for efficient routine detection of pathogenic bacteria in plant material by polymerase chain reaction.

    Science.gov (United States)

    Llop, P; Caruso, P; Cubero, J; Morente, C; López, M M

    1999-07-01

    A simple and rapid method for extracting DNA from plants based on the use of an extraction buffer and precipitation with isopropanol was assayed to see its usefulness in detecting pathogenic bacteria in plant material. The method was compared with a phenol-chloroform standard procedure obtaining higher sensitivity levels of detection. The protocol developed was efficient for detecting a Gram-positive bacterium, Clavibacter michiganensis subsp. sepedonicus and several Gram-negative pathogenic bacteria (Ralstonia solanacearum, Erwinia amylovora, Xanthomonas axonopodis pv. citri) with a sensitivity of 10(2)-10(3) cfu/ml in spiked samples. It was also efficient to specifically identify such bacteria in naturally infected plant material. This procedure is proposed as a routine tool for detection of plant pathogenic bacteria, as well as in environmental microbiology and biotechnology studies. PMID:10395461

  15. Development of a real-time PCR for the detection of pathogenic Leptospira spp. in California sea lions

    Science.gov (United States)

    Rapid detection of pathogenic Leptospira spp. in marine mammals is challenging: microbiological culture can take 3-6 months and has low sensitivity, immunohistochemical staining of kidney to detect leptospires is invasive and time consuming, and serological methods, such as the microscopic agglutina...

  16. Preponderance of toxigenic Escherichia coli in stool pathogens correlates with toxin detection in accessible drinking-water sources.

    Science.gov (United States)

    Igbokwe, H; Bhattacharyya, S; Gradus, S; Khubbar, M; Griswold, D; Navidad, J; Igwilo, C; Masson-Meyers, D; Azenabor, A A

    2015-02-01

    Since early detection of pathogens and their virulence factors contribute to intervention and control strategies, we assessed the enteropathogens in diarrhoea disease and investigated the link between toxigenic strains of Escherichia coli from stool and drinking-water sources; and determined the expression of toxin genes by antibiotic-resistant E. coli in Lagos, Nigeria. This was compared with isolates from diarrhoeal stool and water from Wisconsin, USA. The new Luminex xTAG GPP (Gastroplex) technique and conventional real-time PCR were used to profile enteric pathogens and E. coli toxin gene isolates, respectively. Results showed the pathogen profile of stool and indicated a relationship between E. coli toxin genes in water and stool from Lagos which was absent in Wisconsin isolates. The Gastroplex technique was efficient for multiple enteric pathogens and toxin gene detection. The co-existence of antibiotic resistance with enteroinvasive E. coli toxin genes suggests an additional prognostic burden on patients. PMID:24787554

  17. Autonomous real-time detection of plumes and jets from moons and comets

    International Nuclear Information System (INIS)

    Dynamic activity on the surface of distant moons, asteroids, and comets can manifest as jets or plumes. These phenomena provide information about the interior of the bodies and the forces (gravitation, radiation, thermal) they experience. Fast detection and follow-up study is imperative since the phenomena may be time-varying and because the observing window may be limited (e.g., during a flyby). We have developed an advanced method for real-time detection of plumes and jets using onboard analysis of the data as it is collected. In contrast to prior work, our technique is not restricted to plume detection from spherical bodies, making it relevant for irregularly shaped bodies such as comets. Further, our study analyzes raw data, the form in which it is available on board the spacecraft, rather than fully processed image products. In summary, we contribute a vital assessment of a technique that can be used on board tomorrow's deep space missions to detect, and respond quickly to, new occurrences of plumes and jets.

  18. [Selective detection of viable pathogenic bacteria in water using reverse transcription quantitative PCR].

    Science.gov (United States)

    Lin, Yi-Wen; Li, Dan; Wu, Shu-Xu; He, Miao; Yang, Tian

    2012-11-01

    A reverse transcription q quantitative PCR (RT-qPCR) assay method was established, which can quantify the copy numbers of RNA in pathogenic bacteria of E. coli and Enterococcus faecium. The results showed that cDNA was generated with the RT-PCR reagents, target gene was quantified with the qPCR, the copy numbers of RNA were stable at about 1 copies x CFU(-1) for E. coli and 7.98 x 10(2) copies x CFU(-1) for Enterococcus faecium respectively during the stationary grow phase for the both indicator bacteria [E. coli (6-18 h) and Enterococcus faecium (10-38 h)]. The established RT-qPCR method can quantify the numbers of viable bacteria through detecting bacterial RNA targets. Through detecting the heat-treated E. coli and Enterococcus faecium by three methods (culture method, qPCR, RT-qPCR), we found that the qPCR and RT-qPCR can distinguish 1.43 lg copy non-viable E. coli and 2.5 lg copy non-viable Enterococcus faecium. These results indicated that the established methods could effectively distinguish viable bacteria from non-viable bacteria. Finally we used this method to evaluate the real effluents of the secondary sedimentation of wastewater treatment plant (WWTP), the results showed that the correlation coefficients (R2) between RT-qPCR and culture method were 0.930 (E. coli) and 0.948 (Enterococcus faecium), and this established RT-PCR method can rapidly detect viable pathogenic bacteria in genuine waters. PMID:23323443

  19. Sensitivity and specificity of histology for diagnoses of four common pathogens and detection of nontarget pathogens in adult Chinook salmon (Oncorhynchus tshawytscha) in fresh water.

    Science.gov (United States)

    Kent, Michael L; Benda, Susan; St-Hilaire, Sophie; Schreck, Carl B

    2013-05-01

    Histology is often underutilized in aquatic animal disease screening and diagnostics. The agreement between histological classifications of infection and results using diagnostic testing from the American Fisheries Society's Blue Book was conducted with 4 common salmon pathogens: Aeromonas salmonicida, Renibacterium salmoninarum, Ceratomyxa shasta, and Nanophyetus salmincola. Adult Chinook salmon (Oncorhynchus tshawytscha) in Oregon were evaluated, and agreement between tests was calculated. Live and dead (both pre- and postspawning) salmon were collected from the Willamette River, Oregon, its tributaries, the Willamette Hatchery, and after holding in cool, pathogen-free water during maturation at Oregon State University. Sensitivity and specificity of histology compared to Blue Book methods for all fish, live fish only, and dead (pre- and postspawned combined) fish only were, respectively, as follows: A. salmonicida (n = 105): specificity 87.5%, 87.5%, 87.5% and sensitivity 38.6%, 14.8%, 60.0%; R. salmoninarum (n = 111): specificity 91.9%, 85.7%, 97.7% and sensitivity 16.0%, 7.1%, 27.2%; C. shasta (n = 136): specificity 56.0%, 63.3%, 28.6% and sensitivity 83.3%, 86.2%, 71.4%; N. salmincola (n = 228): specificity 68.2%, 66.7%, not possible to calculate for dead fish and sensitivity 83.5%, 80.5%, 87.3%. The specificity was good for bacterial pathogens. This was not the case for C. shasta, likely due to detection of presporogenic forms only by histology. Sensitivity of histology for bacterial pathogens was low with the exception of dead fish with A. salmonicida. Kappa analysis for agreement between Blue Book and histology methods was poor to moderate. However, histological observations revealed the presence of other pathogens that would not be detected by other methods. PMID:23536613

  20. Dual-excitation upconverting nanoparticle and quantum dot aptasensor for multiplexed food pathogen detection.

    Science.gov (United States)

    Kurt, Hasan; Yüce, Meral; Hussain, Babar; Budak, Hikmet

    2016-07-15

    In this report, a dual-excitation sensing method was developed using aptamer-functionalized quantum dots and upconverting nanoparticles, exhibiting Stokes and anti-Stokes type excitation profiles, respectively. Conjugation of the aptamer-functionalized luminescent nanoparticles with the magnetic beads, comprising short DNA sequences that were partially complementary to the aptamer sequences, enabled facile separation of the analyte-free conjugates for fluorescent measurement. UV-Visible spectroscopy, Circular Dichroism spectroscopy, Dynamic Light Scattering and Polyacrylamide Gel Electrophoresis techniques were used to characterize the aptamer probes developed. The target-specific luminescent conjugates were applied for multiplex detection of model food pathogens, Salmonella typhimurium, and Staphylococcus aureus, in which the fluorescent emission spectra were obtained under UV excitation at 325nm for quantum dots and NIR excitation at 980nm for upconverting nanoparticles, respectively. The dual-excitation strategy was aimed to minimize cross-talk between the luminescent signals for multiplexed detection, and yielded limit of detection values of 16 and 28cfumL(-1) for Staphylococcus aureus, and Salmonella typhimurium, respectively. By employing a greater number of quantum dots and upconverting nanoparticles with non-overlapping fluorescent emissions, the proposed methodology might be exploited further to detect several analytes, simultaneously. PMID:26971274

  1. Enteric bacterial pathogen detection in southern sea otters (Enhydra lutris nereis) is associated with coastal urbanization and freshwater runoff.

    Science.gov (United States)

    Miller, Melissa A; Byrne, Barbara A; Jang, Spencer S; Dodd, Erin M; Dorfmeier, Elene; Harris, Michael D; Ames, Jack; Paradies, David; Worcester, Karen; Jessup, David A; Miller, Woutrina A

    2010-01-01

    Although protected for nearly a century, California's sea otters have been slow to recover, in part due to exposure to fecally-associated protozoal pathogens like Toxoplasma gondii and Sarcocystis neurona. However, potential impacts from exposure to fecal bacteria have not been systematically explored. Using selective media, we examined feces from live and dead sea otters from California for specific enteric bacterial pathogens (Campylobacter, Salmonella, Clostridium perfringens, C. difficile and Escherichia coli O157:H7), and pathogens endemic to the marine environment (Vibrio cholerae, V. parahaemolyticus and Plesiomonas shigelloides). We evaluated statistical associations between detection of these pathogens in otter feces and demographic or environmental risk factors for otter exposure, and found that dead otters were more likely to test positive for C. perfringens, Campylobacter and V. parahaemolyticus than were live otters. Otters from more urbanized coastlines and areas with high freshwater runoff (near outflows of rivers or streams) were more likely to test positive for one or more of these bacterial pathogens. Other risk factors for bacterial detection in otters included male gender and fecal samples collected during the rainy season when surface runoff is maximal. Similar risk factors were reported in prior studies of pathogen exposure for California otters and their invertebrate prey, suggesting that land-sea transfer and/or facilitation of pathogen survival in degraded coastal marine habitat may be impacting sea otter recovery. Because otters and humans share many of the same foods, our findings may also have implications for human health. PMID:19720009

  2. Single walled carbon nanotube-based electrical biosensor for the label-free detection of pathogenic bacteria

    DEFF Research Database (Denmark)

    Yoo, S. M.; Baek, Y. K.; Shin, S.;

    2016-01-01

    We herein describe the development of a single-walled carbon nanotube (SWNT)-based electrical biosensor consisting of a two-terminal resistor, and report its use for the specific, label-free detection of pathogenic bacteria via changes in conductance. The ability of this biosensor to recognize....... This SWNT-based electrical biosensor will prove useful for the development of highly sensitive and specific handheld pathogen detectors....

  3. A Comparison between Transcriptome Sequencing and 16S Metagenomics for Detection of Bacterial Pathogens in Wildlife.

    Directory of Open Access Journals (Sweden)

    Maria Razzauti

    Full Text Available Rodents are major reservoirs of pathogens responsible for numerous zoonotic diseases in humans and livestock. Assessing their microbial diversity at both the individual and population level is crucial for monitoring endemic infections and revealing microbial association patterns within reservoirs. Recently, NGS approaches have been employed to characterize microbial communities of different ecosystems. Yet, their relative efficacy has not been assessed. Here, we compared two NGS approaches, RNA-Sequencing (RNA-Seq and 16S-metagenomics, assessing their ability to survey neglected zoonotic bacteria in rodent populations.We first extracted nucleic acids from the spleens of 190 voles collected in France. RNA extracts were pooled, randomly retro-transcribed, then RNA-Seq was performed using HiSeq. Assembled bacterial sequences were assigned to the closest taxon registered in GenBank. DNA extracts were analyzed via a 16S-metagenomics approach using two sequencers: the 454 GS-FLX and the MiSeq. The V4 region of the gene coding for 16S rRNA was amplified for each sample using barcoded universal primers. Amplicons were multiplexed and processed on the distinct sequencers. The resulting datasets were de-multiplexed, and each read was processed through a pipeline to be taxonomically classified using the Ribosomal Database Project. Altogether, 45 pathogenic bacterial genera were detected. The bacteria identified by RNA-Seq were comparable to those detected by 16S-metagenomics approach processed with MiSeq (16S-MiSeq. In contrast, 21 of these pathogens went unnoticed when the 16S-metagenomics approach was processed via 454-pyrosequencing (16S-454. In addition, the 16S-metagenomics approaches revealed a high level of coinfection in bank voles.We concluded that RNA-Seq and 16S-MiSeq are equally sensitive in detecting bacteria. Although only the 16S-MiSeq method enabled identification of bacteria in each individual reservoir, with subsequent derivation of

  4. An Autonomous Wearable System for Predicting and Detecting Localised Muscle Fatigue

    OpenAIRE

    Martin Colley,; Al-Mulla, Mohamed R.; Francisco Sepulveda

    2011-01-01

    Muscle fatigue is an established area of research and various types of muscle fatigue have been clinically investigated in order to fully understand the condition. This paper demonstrates a non-invasive technique used to automate the fatigue detection and prediction process. The system utilises the clinical aspects such as kinematics and surface electromyography (sEMG) of an athlete during isometric contractions. Various signal analysis methods are used illustrating their applicability in rea...

  5. 3D model-based detection and tracking for space autonomous and uncooperative rendezvous

    Science.gov (United States)

    Shang, Yang; Zhang, Yueqiang; Liu, Haibo

    2015-10-01

    In order to fully navigate using a vision sensor, a 3D edge model based detection and tracking technique was developed. Firstly, we proposed a target detection strategy over a sequence of several images from the 3D model to initialize the tracking. The overall purpose of such approach is to robustly match each image with the model views of the target. Thus we designed a line segment detection and matching method based on the multi-scale space technology. Experiments on real images showed that our method is highly robust under various image changes. Secondly, we proposed a method based on 3D particle filter (PF) coupled with M-estimation to track and estimate the pose of the target efficiently. In the proposed approach, a similarity observation model was designed according to a new distance function of line segments. Then, based on the tracking results of PF, the pose was optimized using M-estimation. Experiments indicated that the proposed method can effectively track and accurately estimate the pose of freely moving target in unconstrained environment.

  6. Report on the Workshop on DNA Isolation and Detection of Tsetse Pathogens and Symbionts using PCR

    International Nuclear Information System (INIS)

    The workshop on DNA isolation and detection of tsetse pathogens and symbionts using PCR was hosted by the Centre International de Recherche-Developpement Sur l'Elevage en Zone Subhumide (CIRDES) and was attended by eight participants and three lecturers from eleven countries. Several oral presentations were given that provided an overview on general principles of the PCR, on the factors that might affect the obtained results, on the different applications of the PCR for the Salivary Gland Hyperplasia Virus (SGHV) work, and on the current progress of the work on Wolbachia and Sodalis. Two sessions of tsetse dissections were organised, which focussed on the detection of hypertrophied salivary gland symptoms, on the separation of ovaries and testes, and on the collection of the haemolymph under aseptic conditions to initiate Sodalis cultures. Using the monitor connected to the microscope, all participants could view the dissection demonstrations, and were given later the opportunity to practice the dissections themselves. In addition, demonstrations were given on how to prepare slides to observe Sodalis bacteria under the compound microscope. In addition, several practical sessions were organised on DNA extraction for virus detection and demonstrations were given on extractions of the genomic DNA from the tsetse abdomen using the cetyltrimethylammo-niumbromide (CTAB) for Wolbachia diagnosis and using the DNeasy kit (Qiagen) method for Sodalis diagnosis. Finally, there were three sessions on the use of PCR and how to detect the virus in the samples extracted by the manual method using two sets of primers. Methods were likewise demonstrated on detecting Wolbachia and Sodalis in the DNA samples extracted by the CTAB and DNeasy methods, and a comparison was made of the three different methods to detect the SGHV, Wolbachia and Sodalis

  7. A method for the rapid detection and identification of halo blight pathogen on common bean

    Directory of Open Access Journals (Sweden)

    Popović Tatjana

    2014-01-01

    Full Text Available A diagnostic method based on nested-PCR, followed by ELISA and conventional bacteriology tests, for the rapid and reliable detection of halo blight pathogen Pseudomonas savastanoi pv. phaseolicola (Psp collected from infected bean leaves and seeds is described. Psp formed white, small and flat colonies on nutrient agar medium, creamy white, flat and circular on Milk-Tween agar medium and light yellow, convex and shiny on modified sucrose peptone agar medium. Eighteen Gram-negative, catalase-positive and oxidase-negative strains were subjected to nested PCR with primers P 5.1/P 3.1 and P 5.2/P 3.2, which directed the amplification of the 450 bp target DNA fragment in all tested strains. According to the results of DAS- and PTA-ELISA with respect to reactivity to specific antibodies, all analyzed strains belonged to Psp bacterium. Pathogenicity was tested on bean pods and cotyledon leaves, on which greasy spots were formed. Psp did not cause hypersensitive reaction on the leaves of tobacco and geranium. Strains produced levan, fluorescent pigment, oxidative metabolism of glucose, did not reduce nitrate, did not produce indole and H2S, did not hydrolyze starch, gelatin and esculin; they produced acid from glucose, mannose, sucrose and glycerol, and did not produce acid from maltose, starch, esculin, dulcite, sorbitol, inositol and erythritol.

  8. How to Calculate Renyi Entropy from Heart Rate Variability, and Why it Matters for Detecting Cardiac Autonomic Neuropathy

    Directory of Open Access Journals (Sweden)

    David eCornforth

    2014-09-01

    Full Text Available Cardiac Autonomic Neuropathy (CAN is a disease that involves nerve damage leading to an abnormal control of heart rate. An open question is to what extent this condition is detectable from Heart Rate Variability (HRV, which provides information only on successive intervals between heart beats, yet is non-invasive and easy to obtain from a 3-lead ECG recording. A variety of measures may be extracted from HRV, including time domain, frequency domain and more complex non-linear measures. Among the latter, Renyi Entropy has been proposed as a suitable measure that can be used to discriminate CAN from controls. However, all entropy methods require estimation of probabilities, and there are a number of ways in which this estimation can be made. In this work, we calculate Renyi entropy using several variations of the histogram method, and a density method based on sequences of RR intervals. In all, we calculate Renyi entropy using nine methods, and compare their effectiveness in separating the different classes of participants. We find that the histogram method using single RR intervals yields an entropy measure that is either incapable of discriminating CAN from controls, or that it provides little information that could not be gained from the standard deviation of the RR intervals. In contrast, probabilities calculated using a density method, based on sequences of RR intervals, yield an entropy measure that provides good separation between groups of participants, and provides information not available from the standard deviation. The main contribution of this work is that different approaches to calculating probability may affect the success of detecting disease. Our results bring new clarity to the methods used to calculate the Renyi entropy in general, and in particular, to the successful detection of CAN.

  9. Optimization of PMA-PCR Protocol for Viability Detection of Pathogens

    Science.gov (United States)

    Mikkelson, Brian J.; Lee, Christine M.; Ponce, Adrian

    2011-01-01

    This presented study demonstrates the need that PMA-PCR can be used to capture the loss of viability of a sample that is much more specific and time-efficient than alternative methods. This protocol is particularly useful in scenarios in which sterilization treatments may inactivate organisms but not degrade their DNA. The use of a PCR-based method of pathogen detection without first inactivating the DNA of nonviable cells will potentially lead to false positives. The loss of culturability, by heat-killing, did not prevent amplified PCR products, which supports the use of PMA to prevent amplification and differentiate between viable and dead cells. PMA was shown to inhibit the amplification of DNA by PCR in vegetative cells that had been heat-killed.

  10. Quantitative polymerase chain reaction (PCR) for detection of aquatic animal pathogens in a diagnostic laboratory setting

    Science.gov (United States)

    Purcell, Maureen K.; Getchell, Rodman G.; McClure, Carol A.; Weber, S.E.; Garver, Kyle A.

    2011-01-01

    Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.

  11. Development of an autonomous continuous monitoring system for mechanical damage detection.

    Energy Technology Data Exchange (ETDEWEB)

    Sohn, H. (Hoon); Allen, D. W. (David W.); Farrar, C. R. (Charles R.); Worden, K.

    2002-01-01

    The primary objective of damage identification is to ascertain the existence of damage within a mechanical system. This study applies the Sequential Probability Ratio Test (SPRT) to examine if damage is present or not. In the original formulation of the SPRT, the distribution of data is assumed Gaussian and thresholds for monitoring are set focusing on the center mass properties of the distribution. Decision-making for damage identification is, however, often sensitive to the tails of the distribution and the tails may not necessarily be governed by Gaussian characteristics. By modeling the tails using the technique of Extreme Value Statistics (EVS), the thresholds for the SPRT may be set more accurately avoiding the unnecessary normality assumption. The proposed combination of the SPRT and the EVS is demonstrated using experimental data collected from a three-story frame structure with bolted connections. The primary goal of structural health monitoring is simply to identify from measured data if a structure has deviated from a normal operational condition. Particularly, vibration-based damage detection techniques assume that changes of the structure's integrity affect characteristics of the measured vibration signals enabling one to detect damage. Many current approaches to this problem involve methods that leave much to the interpretation of analysts. These methods may enable a trained eye to discern and locate damage but are not easily automated or objective. In an attempt to automate the damage identification procedure, the SPRT is employed for the decision-making procedure. The original SPRT assumes that the extracted features have a Gaussian distribution. This normality assumption, however, may place misleading constraints on the tails of the distribution. As the problem of damage detection specifically focuses attention on the tails, the assumption of normality is likely to lead the analysis astray. To overcome this difficulty, the performance of the

  12. Auto Landing Process for Autonomous Flying Robot by Using Image Processing Based on Edge Detection

    Directory of Open Access Journals (Sweden)

    Bahram Lavi Sefidgari

    2014-01-01

    Full Text Available In today’s technological life, everyone is quite familiar with the importance of security measures in our lives. So in this regard, many attempts have been made by researchers and one of them is flying robots technology. One well-known usage of flying robot, perhaps, is its capability in security and care measurements which made this device extremely practical, not only for its unmanned movement, but also for the unique manoeuvre during flight over the arbitrary areas. In this research, the automatic landing of a flying robot is discussed. The system is based on the frequent interruptions that is sent from main microcontroller to camera module in order to take images; these images have been distinguished by image processing system based on edge detection, after analysing the image the system can tell whether or not to land on the ground. This method shows better performance in terms of precision as well as experimentally.

  13. [The Advances in the Contamination and Detection of Foodborne Pathogen Noroviruses in Fresh Produce].

    Science.gov (United States)

    Xie, Yajing; Liu, Xianjin

    2015-11-01

    This article reviewed the researches proceeding on the contamination and detection of the foodborne pathogen noroviruses (NoVs) in fresh produce, which involved the NoVs contaminations in fresh produce, the special attachment of NoVs in fresh produce, the NoVs outbreaks associated with fresh produce and the NoVs detection in fresh produce. There had been an increase in reported infectious disease risks associated with the consumptions of fresh produce for recent 30 years. Because the NoVs, as a primary cause of viral gastroenteritis thoughout the world, were highly contagious, had a low infectious dose, and were persistent in the environment. And also the methods for NoVs detection in food had significantly developed over the last 15 years. Currently NoVs were the most common pathogen accounting for 40% of outbreaks associated with fresh produce (i. e., fruits and vegetables). Data from outbreaks investigations verified fresh produce as the high risk food products for NoVs. The fresh produce were typically eaten raw with no thermal processing, can be contaminated at any step during production and processing from faecally polluted water and fertilizers, the poor hygiene practices by food handlers and the cross-contamination. The attachment of NoVs to the fresh produce was due to the physio-chemical factors of virus protein coat, the special attachment to different fresh produce, and the possibility for internalization of NoVs. It might provide answers to why those high risk foods were more frequently implicated (i. e., lettuce and raspberries). According to the data of foodborne NoVs outbreaks which were associated with fresh produce from EU countries and the USA, the outbreaks in EU countries were mainly associated with NoVs contaminated raspberries and lettuce, while in USA which were associated with NoVs contaminated lettuce. Unfortunately, there were no NoVs detection methods for fresh produce or the data of foodborne NoVs outbreaks which were associated with

  14. Molecular-based detection of the gastrointestinal pathogen Campylobacter ureolyticus in unpasteurized milk samples from two cattle farms in Ireland

    Directory of Open Access Journals (Sweden)

    Koziel Monika

    2012-11-01

    Full Text Available Abstract Campylobacter jejuni and coli are collectively regarded as the most prevalent cause of bacterial foodborne illness worldwide. An emerging species, Campylobacter ureolyticus has recently been detected in patients with gastroenteritis, however, the source of this organism has, until now, remained unclear. Herein, we describe the molecular-based detection of this pathogen in bovine faeces (1/20 and unpasteurized milk (6/47 but not in poultry (chicken wings and caeca. This is, to the best of our knowledge, the first report of the presence of this potential gastrointestinal pathogen in an animal source, possibly suggesting a route for its transmission to humans.

  15. Detection of respiratory pathogens in air samples from acutely infected pigs

    OpenAIRE

    Hermann, Joseph R.; Brockmeier, Susan L.; Yoon, Kyoung-Jin; Zimmerman, Jeffrey J.

    2008-01-01

    Pathogens causing significant respiratory disease in growing pigs include Porcine reproductive and respiratory syndrome virus, Porcine circovirus 2, swine influenza virus, porcine respiratory coronavirus, Mycoplasma hyopneumoniae, and Bordetella bronchiseptica. The objective of this research was to characterize the respiratory excretion of these pathogens by acutely infected pigs. Pigs were inoculated under experimental conditions with 1 pathogen. Samples were collected from the upper respira...

  16. Impedance Biosensing to detect food allergens, endocrine disrupting chemicals, and food pathogens

    Science.gov (United States)

    Radhakrishnan, Rajeswaran

    Electrochemical impedance biosensors can be viewed as an AC electroanalytical method for the analyte detection in the fields of biomedicine, environmental monitoring, and food and agriculture, amongst others. The most common format for AC impedance biosensing involves surface immobilization of an antibody, receptor protein, DNA strand, or other species capable of bio-recognition, and AC impedance detection of the binding event. Technological application of AC impedance biosensors has been hindered by several obstacles, including the more complex circuitry required for AC relative to DC electrochemistry, chemical and physical interference arising from non-specific adsorption, and the stability and reproducibility of protein immobilization. One focus of these PhD studies is on methods to reduce or compensate for non-specific adsorption, including sample dilution, site blocking with BSA, and the use of control electrodes onto which reference antibodies are immobilized. Examples that will be presented include impedance detection of food pathogens, such as Listeria monocytogenes, using a mouse monoclonal antibody immobilized onto an Au electrode. This yields detection limits of 5 CFU/ml and 4 CFU/ml for ideal solutions and filtered tomato extract, respectively. Control experiments with an Au electrode onto which a mouse monoclonal antibody to GAPDH is immobilized demonstrate that non-specific adsorption is insignificant for the system and methodology studied here. Control experiments with Salmonella enterica demonstrate no cross-reactivity to this food pathogen. In addition, Detection of two endocrine-disrupting chemicals (EDC), norfluoxetine and BDE-47, is reported here by impedance biosensing, with a detection limit of 8.5 and 1.3 ng/ml for norfluoxetine and BDE-47, respectively. Additional research has focused on alternative substrates and linker chemistries for protein immobilization, including the use of degenerate (highly doped) Si and bidendate thiol monolayer

  17. Magnetic-optical nanohybrids for targeted detection, separation, and photothermal ablation of drug-resistant pathogens.

    Science.gov (United States)

    Ondera, Thomas J; Hamme, Ashton T

    2015-12-01

    A rapid, sensitive and quantitative immunoassay for the targeted detection and decontamination of E. coli based on Fe3O4 magnetic nanoparticles (MNPs) and plasmonic popcorn-shaped gold nanostructure attached single-walled carbon nanotubes (AuNP@SWCNT) is presented. The MNPs were synthesized as the support for a monoclonal antibody (mAb@MNP). E. coli (49979) was captured and rapidly preconcentrated from the sample with the mAb@MNP, followed by binding with Raman-tagged concanavalin A-AuNP@SWCNTs (Con A-AuNP@SWCNTs) as detector nanoprobes. A Raman tag 5,5'-dithiobis-(2-nitrobenzoic acid) (DTNB) generated a Raman signal upon 670 nm laser excitation enabling the detection and quantification of E. coli concentration with a limit of detection of 10(2) CFU mL(-1) and a linear logarithmic response range of 1.0 × 10(2) to 1.0 × 10(7) CFU mL(-1). The mAb@MNP could remove more than 98% of E. coli (initial concentration of 1.3 × 10(4) CFU mL(-1)) from water. The potential of the immunoassay to detect E. coli bacteria in real water samples was investigated and the results were compared with the experimental results from the classical count method. There was no statistically significant difference between the two methods (p > 0.05). Furthermore, the MNP/AuNP@SWCNT hybrid system exhibits an enhanced photothermal killing effect. The sandwich-like immunoassay possesses potential for rapid bioanalysis and the simultaneous biosensing of multiple pathogenic agents. PMID:26469636

  18. Comparison of the detection of periodontal pathogens in bacteraemia after tooth brushing by culture and molecular techniques

    Science.gov (United States)

    Figuero, Elena; González, Itziar; O´Connor, Ana; Diz, Pedro; Álvarez, Maximiliano; Herrera, David; Sanz, Mariano

    2016-01-01

    Background The prevalence and amounts of periodontal pathogens detected in bacteraemia samples after tooth brushing-induced by means of four diagnostic technique, three based on culture and one in a molecular-based technique, have been compared in this study. Material and Methods Blood samples were collected from thirty-six subjects with different periodontal status (17 were healthy, 10 with gingivitis and 9 with periodontitis) at baseline and 2 minutes after tooth brushing. Each sample was analyzed by three culture-based methods [direct anaerobic culturing (DAC), hemo-culture (BACTEC), and lysis-centrifugation (LC)] and one molecular-based technique [quantitative polymerase chain reaction (qPCR)]. With culture any bacterial isolate was detected and quantified, while with qPCR only Porphyromonas gingivalis and Aggregatibacter actinomycetemcomitans were detected and quantified. Descriptive analyses, ANOVA and Chi-squared tests, were performed. Results Neither BACTEC nor qPCR detected any type of bacteria in the blood samples. Only LC (2.7%) and DAC (8.3%) detected bacteraemia, although not in the same patients. Fusobacterium nucleatum was the most frequently detected bacterial species. Conclusions The disparity in the results when the same samples were analyzed with four different microbiological detection methods highlights the need for a proper validation of the methodology to detect periodontal pathogens in bacteraemia samples, mainly when the presence of periodontal pathogens in blood samples after tooth brushing was very seldom. Key words:Bacteraemia, periodontitis, culture, PCR, tooth brushing. PMID:26946197

  19. A Modular Software and Hardware Framework with Application to Unmanned Autonomous Systems: Interacting Modules, Error Detection and Hardware Design

    OpenAIRE

    Skøien, Kristoffer Rist

    2011-01-01

    The Department of Engineering Cybernetics at the Norwegian University of Science andTechnology established the Unmanned Vehicle Laboratory fall 2010. The goal is to havestudents develop a fully functional autonomous aerial vehicle over time as part of projects and master’s theses. A range of projects were carried out fall 2010, among others the report General Platform for Unmanned Autonomous Systems was written on the topic of hardware, operating systems and peripheral interfacing.This m...

  20. Duplex real-time SYBR green PCR assays for detection of 17 species of food- or waterborne pathogens in stools.

    Science.gov (United States)

    Fukushima, Hiroshi; Tsunomori, Yoshie; Seki, Ryotaro

    2003-11-01

    A duplex real-time SYBR Green LightCycler PCR (LC-PCR) assay with DNA extraction using the QIAamp DNA Stool Mini kit was evaluated with regard to detection of 8 of 17 species of food- or waterborne pathogens in five stool specimens in 2 h or less. The protocol used the same LC-PCR with 20 pairs of specific primers. The products formed were identified based on a melting point temperature (T(m)) curve analysis. The 17 species of food- or waterborne pathogens examined were enteroinvasive Escherichia coli, enteropathogenic E. coli, enterohemorrhagic E. coli, enterotoxigenic E. coli, enteroaggregative E. coli, Salmonella spp., Shigella spp., Yersinia enterocolitica, Yersinia pseudotuberculosis, Campylobacter jejuni, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Aeromonas spp., Staphylococcus aureus, Clostridium perfringens, and Bacillus cereus. No interference with the LC-PCR assay was observed when stool specimens were artificially inoculated with each bacterial species. The detection levels were approximately 10(5) food- or waterborne pathogenic bacteria per g of stool. The protocol for processing stool specimens for less than 10(4) food- or waterborne pathogenic bacteria per g of stool requires an overnight enrichment step to achieve adequate sensitivity. However, the rapid amplification and reliable detection of specific genes of greater than 10(5) food- or waterborne pathogenic bacteria per g in samples should facilitate the diagnosis and management of food- or waterborne outbreaks. PMID:14605150

  1. Modular microfluidic system fabricated in thermoplastics for the strain-specific detection of bacterial pathogens.

    Science.gov (United States)

    Chen, Yi-Wen; Wang, Hong; Hupert, Mateusz; Witek, Makgorzata; Dharmasiri, Udara; Pingle, Maneesh R; Barany, Francis; Soper, Steven A

    2012-09-21

    The recent outbreaks of a lethal E. coli strain in Germany have aroused renewed interest in developing rapid, specific and accurate systems for detecting and characterizing bacterial pathogens in suspected contaminated food and/or water supplies. To address this need, we have designed, fabricated and tested an integrated modular-based microfluidic system and the accompanying assay for the strain-specific identification of bacterial pathogens. The system can carry out the entire molecular processing pipeline in a single disposable fluidic cartridge and detect single nucleotide variations in selected genes to allow for the identification of the bacterial species, even its strain with high specificity. The unique aspect of this fluidic cartridge is its modular format with task-specific modules interconnected to a fluidic motherboard to permit the selection of the target material. In addition, to minimize the amount of finishing steps for assembling the fluidic cartridge, many of the functional components were produced during the polymer molding step used to create the fluidic network. The operation of the cartridge was provided by electronic, mechanical, optical and hydraulic controls located off-chip and packaged into a small footprint instrument (1 ft(3)). The fluidic cartridge was capable of performing cell enrichment, cell lysis, solid-phase extraction (SPE) of genomic DNA, continuous flow (CF) PCR, CF ligase detection reaction (LDR) and universal DNA array readout. The cartridge was comprised of modules situated on a fluidic motherboard; the motherboard was made from polycarbonate, PC, and used for cell lysis, SPE, CF PCR and CF LDR. The modules were task-specific units and performed universal zip-code array readout or affinity enrichment of the target cells with both made from poly(methylmethacrylate), PMMA. Two genes, uidA and sipB/C, were used to discriminate between E. coli and Salmonella, and evaluated as a model system. Results showed that the fluidic

  2. Vaginal microbicides: detecting toxicities in vivo that paradoxically increase pathogen transmission

    Directory of Open Access Journals (Sweden)

    Abusuwwa Raed

    2006-06-01

    Full Text Available Abstract Background Microbicides must protect against STD pathogens without causing unacceptable toxic effects. Microbicides based on nonoxynol-9 (N9 and other detergents disrupt sperm, HSV and HIV membranes, and these agents are effective contraceptives. But paradoxically N9 fails to protect women against HIV and other STD pathogens, most likely because it causes toxic effects that increase susceptibility. The mouse HSV-2 vaginal transmission model reported here: (a Directly tests for toxic effects that increase susceptibility to HSV-2, (b Determines in vivo whether a microbicide can protect against HSV-2 transmission without causing toxicities that increase susceptibility, and (c Identifies those toxic effects that best correlate with the increased HSV susceptibility. Methods Susceptibility was evaluated in progestin-treated mice by delivering a low-dose viral inoculum (0.1 ID50 at various times after delivering the candidate microbicide to detect whether the candidate increased the fraction of mice infected. Ten agents were tested – five detergents: nonionic (N9, cationic (benzalkonium chloride, BZK, anionic (sodium dodecylsulfate, SDS, the pair of detergents in C31G (C14AO and C16B; one surface active agent (chlorhexidine; two non-detergents (BufferGel®, and sulfonated polystyrene, SPS; and HEC placebo gel (hydroxyethylcellulose. Toxic effects were evaluated by histology, uptake of a 'dead cell' dye, colposcopy, enumeration of vaginal macrophages, and measurement of inflammatory cytokines. Results A single dose of N9 protected against HSV-2 for a few minutes but then rapidly increased susceptibility, which reached maximum at 12 hours. When applied at the minimal concentration needed for brief partial protection, all five detergents caused a subsequent increase in susceptibility at 12 hours of ~20–30-fold. Surprisingly, colposcopy failed to detect visible signs of the N9 toxic effect that increased susceptibility at 12 hours. Toxic

  3. Specific and sensitive detection of the conifer pathogen Gremmeniella abietina by nested PCR

    Directory of Open Access Journals (Sweden)

    Hansson Per

    2005-11-01

    Full Text Available Abstract Background Gremmeniella abietina (Lagerb. Morelet is an ascomycete fungus that causes stem canker and shoot dieback in many conifer species. The fungus is widespread and causes severe damage to forest plantations in Europe, North America and Asia. To facilitate early diagnosis and improve measures to control the spread of the disease, rapid, specific and sensitive detection methods for G. abietina in conifer hosts are needed. Results We designed two pairs of specific primers for G. abietina based on the 18S rDNA sequence variation pattern. These primers were validated against a wide range of fungi and 14 potential conifer hosts. Based on these specific primers, two nested PCR systems were developed. The first system employed universal fungal primers to enrich the fungal DNA targets in the first round, followed by a second round selective amplification of the pathogen. The other system employed G. abietina-specific primers in both PCR steps. Both approaches can detect the presence of G. abietina in composite samples with high sensitivity, as little as 7.5 fg G. abietina DNA in the host genomic background. Conclusion The methods described here are rapid and can be applied directly to a wide range of conifer species, without the need for fungal isolation and cultivation. Therefore, it represents a promising alternative to disease inspection in forest nurseries, plantations and quarantine control facilities.

  4. Molecular detection of multiple emerging pathogens in sputa from cystic fibrosis patients.

    Directory of Open Access Journals (Sweden)

    Fadi Bittar

    Full Text Available BACKGROUND: There is strong evidence that culture-based methods detect only a small proportion of bacteria present in the respiratory tracts of cystic fibrosis (CF patients. METHODOLOGY/PRINCIPAL FINDINGS: Standard microbiological culture and phenotypic identification of bacteria in sputa from CF patients have been compared to molecular methods by the use of 16S rDNA amplification, cloning and sequencing. Twenty-five sputa from CF patients were cultured that yield 33 isolates (13 species known to be pathogens during CF. For molecular cloning, 760 clones were sequenced (7.2+/-3.9 species/sputum, and 53 different bacterial species were identified including 16 species of anaerobes (30%. Discrepancies between culture and molecular data were numerous and demonstrate that accurate identification remains challenging. New or emerging bacteria not or rarely reported in CF patients were detected including Dolosigranulum pigrum, Dialister pneumosintes, and Inquilinus limosus. CONCLUSIONS/SIGNIFICANCE: Our results demonstrate the complex microbial community in sputa from CF patients, especially anaerobic bacteria that are probably an underestimated cause of CF lung pathology. Metagenomic analysis is urgently needed to better understand those complex communities in CF pulmonary infections.

  5. Detection of Goss's Wilt Pathogen Clavibacter michiganensis subsp. nebraskensis in Maize by Loop-Mediated Amplification.

    Science.gov (United States)

    Yasuhara-Bell, Jarred; de Silva, Asoka; Heuchelin, Scott A; Chaky, Jennifer L; Alvarez, Anne M

    2016-03-01

    The Goss's wilt pathogen, Clavibacter michiganensis subsp. nebraskensis, can cause considerable losses in maize (Zea mays) production. Diagnosis of Goss's wilt currently is based on symptomology and identification of C. michiganensis subsp. nebraskensis, following isolation on a semiselective medium and/or serological testing. In an effort to provide a more efficient identification method, a loop-mediated amplification (LAMP) assay was developed to detect the tripartite ATP-independent periplasmic (TRAP)-type C4-dicarboxylate transport system large permease component and tested using strains of C. michiganensis subsp. nebraskensis, all other C. michiganensis subspecies and several genera of nontarget bacteria. Only strains of C. michiganensis subsp. nebraskensis reacted positively with the LAMP assay. The LAMP assay was then used to identify bacterial isolates from diseased maize. 16S rDNA and dnaA sequence analyses were used to confirm the identity of the maize isolates and validate assay specificity. The Cmm ImmunoStrip assay was included as a presumptive identification test of C. michiganensis subsp. nebraskensis at the species level. The Cmn-LAMP assay was further tested using symptomatic leaf tissue. The Cmn-LAMP assay was run in a hand-held real-time monitoring device (SMART-DART) and performed equally to in-lab quantitative polymerase chain reaction equipment. The Cmn-LAMP assay accurately identified C. michiganensis subsp. nebraskensis and has potential as a field test. The targeted sequence also has potential application in other molecular detection platforms. PMID:26595113

  6. Use of Metagenomic Shotgun Sequencing Technology To Detect Foodborne Pathogens within the Microbiome of the Beef Production Chain

    Science.gov (United States)

    Yang, Xiang; Noyes, Noelle R.; Doster, Enrique; Martin, Jennifer N.; Linke, Lyndsey M.; Magnuson, Roberta J.; Yang, Hua; Geornaras, Ifigenia; Woerner, Dale R.; Jones, Kenneth L.; Ruiz, Jaime; Boucher, Christina; Morley, Paul S.

    2016-01-01

    Foodborne illnesses associated with pathogenic bacteria are a global public health and economic challenge. The diversity of microorganisms (pathogenic and nonpathogenic) that exists within the food and meat industries complicates efforts to understand pathogen ecology. Further, little is known about the interaction of pathogens within the microbiome throughout the meat production chain. Here, a metagenomic approach and shotgun sequencing technology were used as tools to detect pathogenic bacteria in environmental samples collected from the same groups of cattle at different longitudinal processing steps of the beef production chain: cattle entry to feedlot, exit from feedlot, cattle transport trucks, abattoir holding pens, and the end of the fabrication system. The log read counts classified as pathogens per million reads for Salmonella enterica, Listeria monocytogenes, Escherichia coli, Staphylococcus aureus, Clostridium spp. (C. botulinum and C. perfringens), and Campylobacter spp. (C. jejuni, C. coli, and C. fetus) decreased over subsequential processing steps. Furthermore, the normalized read counts for S. enterica, E. coli, and C. botulinum were greater in the final product than at the feedlots, indicating that the proportion of these bacteria increased (the effect on absolute numbers was unknown) within the remaining microbiome. From an ecological perspective, data indicated that shotgun metagenomics can be used to evaluate not only the microbiome but also shifts in pathogen populations during beef production. Nonetheless, there were several challenges in this analysis approach, one of the main ones being the identification of the specific pathogen from which the sequence reads originated, which makes this approach impractical for use in pathogen identification for regulatory and confirmation purposes. PMID:26873315

  7. Use of Metagenomic Shotgun Sequencing Technology To Detect Foodborne Pathogens within the Microbiome of the Beef Production Chain.

    Science.gov (United States)

    Yang, Xiang; Noyes, Noelle R; Doster, Enrique; Martin, Jennifer N; Linke, Lyndsey M; Magnuson, Roberta J; Yang, Hua; Geornaras, Ifigenia; Woerner, Dale R; Jones, Kenneth L; Ruiz, Jaime; Boucher, Christina; Morley, Paul S; Belk, Keith E

    2016-04-01

    Foodborne illnesses associated with pathogenic bacteria are a global public health and economic challenge. The diversity of microorganisms (pathogenic and nonpathogenic) that exists within the food and meat industries complicates efforts to understand pathogen ecology. Further, little is known about the interaction of pathogens within the microbiome throughout the meat production chain. Here, a metagenomic approach and shotgun sequencing technology were used as tools to detect pathogenic bacteria in environmental samples collected from the same groups of cattle at different longitudinal processing steps of the beef production chain: cattle entry to feedlot, exit from feedlot, cattle transport trucks, abattoir holding pens, and the end of the fabrication system. The log read counts classified as pathogens per million reads for Salmonella enterica,Listeria monocytogenes,Escherichia coli,Staphylococcus aureus, Clostridium spp. (C. botulinum and C. perfringens), and Campylobacter spp. (C. jejuni,C. coli, and C. fetus) decreased over subsequential processing steps. Furthermore, the normalized read counts for S. enterica,E. coli, and C. botulinumwere greater in the final product than at the feedlots, indicating that the proportion of these bacteria increased (the effect on absolute numbers was unknown) within the remaining microbiome. From an ecological perspective, data indicated that shotgun metagenomics can be used to evaluate not only the microbiome but also shifts in pathogen populations during beef production. Nonetheless, there were several challenges in this analysis approach, one of the main ones being the identification of the specific pathogen from which the sequence reads originated, which makes this approach impractical for use in pathogen identification for regulatory and confirmation purposes. PMID:26873315

  8. Rapid detection and identification of viral and bacterial fish pathogens using a DNA array‐based multiplex assay

    DEFF Research Database (Denmark)

    Lievens, B.; Frans, I.; Heusdens, C.;

    2011-01-01

    Fish diseases can be caused by a variety of diverse organisms, including bacteria, fungi, viruses and protozoa, and pose a universal threat to the ornamental fish industry and aquaculture. The lack of rapid, accurate and reliable means by which fish pathogens can be detected and identified has been...... one of the main limitations in fish pathogen diagnosis and fish disease management and has consequently stimulated the search for alternative diagnostic techniques. Here, we describe a method based on multiplex and broad‐range PCR amplification combined with DNA array hybridization...... for the simultaneous detection and identification of all cyprinid herpesviruses (CyHV‐1, CyHV‐2 and CyHV‐3) and some of the most important fish pathogenic Flavobacterium species, including F. branchiophilum, F. columnare and F. psychrophilum. For virus identification, the DNA polymerase and helicase genes were...

  9. Direct detection and differentiation of pathogenic Leptospira species using a multi-gene targeted real time PCR approach.

    Directory of Open Access Journals (Sweden)

    Ana Sofia Ferreira

    Full Text Available Leptospirosis is a growing public and veterinary health concern caused by pathogenic species of Leptospira. Rapid and reliable laboratory tests for the direct detection of leptospiral infections in animals are in high demand not only to improve diagnosis but also for understanding the epidemiology of the disease. In this work we describe a novel and simple TaqMan-based multi-gene targeted real-time PCR approach able to detect and differentiate Leptospira interrogans, L. kirschneri, L. borgpeteresenii and L. noguchii, which constitute the veterinary most relevant pathogenic species of Leptospira. The method uses sets of species-specific probes, and respective flanking primers, designed from ompL1 and secY gene sequences. To monitor the presence of inhibitors, a duplex amplification assay targeting both the mammal β-actin and the leptospiral lipL32 genes was implemented. The analytical sensitivity of all primer and probe sets was estimated to be <10 genome equivalents (GE in the reaction mixture. Application of the amplification reactions on genomic DNA from a variety of pathogenic and non-pathogenic Leptospira strains and other non-related bacteria revealed a 100% analytical specificity. Additionally, pathogenic leptospires were successfully detected in five out of 29 tissue samples from animals (Mus spp., Rattus spp., Dolichotis patagonum and Sus domesticus. Two samples were infected with L. borgpetersenii, two with L. interrogans and one with L. kirschneri. The possibility to detect and identify these pathogenic agents to the species level in domestic and wildlife animals reinforces the diagnostic information and will enhance our understanding of the epidemiology of leptopirosis.

  10. Phage-based surface plasmon resonance strategies for the detection of pathogens

    Science.gov (United States)

    Tawil, Nancy

    We start by reviewing the basic principles and recent advances in biosensing technologies using optical, electrochemical and acoustic platforms for phage-based diagnostics. Although much notable work has been done, a low cost, specific, sensitive optical method for detecting low concentrations of pathogens, in a few minutes, has not been established. We conclude from the limited body of work on the subject that improving immobilization strategies and finding more suitable phage recognition elements would allow for a more sensitive approach. Our aim was to better describe the attachment process of MRSA specific phages on gold surfaces, and the subsequent biodetection of their bacterial hosts by surface plasmon resonance (SPR). With the knowledge that the adsorption characteristics of thiol-containing molecules are necessary for applications involving the attachment of recognition elements to a functionalized surface, we start by providing comparative details on the kinetics of self-assembly of L-cysteine and 11-mercaptoundecanoic acid (MUA) monolayers on gold using SPR[1]. Our purpose, in carrying out these measurements was to establish each molecule's validity and applicability as a linker element for use in biosensing. We find that monolayer formation, for both L-cysteine and MUA, is described by the Langmuir isotherm at low concentrations only. For L-cysteine, both the amine and thiol groups contribute to the initial attachment of the molecule, followed by the replacement of the amine-gold complexes initially formed with more stable thiol-gold complexes. The reorganization of L-cysteine creates more space on the gold surface, and the zwitterionic form of the molecule permits the physisorption of a second layer through electrostatic interactions. On the other hand, MUA deposits randomly onto the surface of gold as a SAM and slowly reorganizes into a denser, vertical state. Surface plasmon resonance was then used for the real-time monitoring of the attachment of

  11. Assay platforms for the rapid detection of viral pathogens by the ultrahigh sensitivity monitoring of antigen-antibody binding

    Science.gov (United States)

    The drive for early disease detection and growing threat of bioterrorism has markedly amplified the demand for ultrasensitive, high-speed diagnostic tests for viral pathogens. This presentation describes innovations in the development of platforms and readout methodologies that potentially address d...

  12. The application of flow cytometry and fluorescent probe technology for detection and assessment of viability of plant pathogenic bacteria

    NARCIS (Netherlands)

    Chitarra, L.G.; Bulk, van den R.W.

    2003-01-01

    Conventional methods to detect and assess the viability of plant pathogenic bacteria are usually based on plating assays or serological techniques. Plating assays provide information about the number of viable cells, expressed as colony-forming units, but are time-consuming and laborious. Serologica

  13. Simultaneous Detection of Bacterial Fish Pathogens, Edwardsiella ictaluri, Flavobacterium columnnare and Aeromonas Hydrophila by Multiplex-PCR

    Science.gov (United States)

    Edwardsiella ictaluri, Flavobacterium columnare and Aeromonas hydrophila are three major bacterial pathogens of fish that cause diseases with significant economic impact on the aquaculture industry world-wide. Rapid detection of multiple infections with these bacteria in the same host is important f...

  14. Simultaneous detection of major blackleg and soft rot bacterial pathogens in potato by multiplex polymerase chain reaction‡

    OpenAIRE

    Potrykus, M; Sledz, W; Golanowska, M; Slawiak, M.; Binek, A; Motyka, A; Zoledowska, S; Czajkowski, R; E.Lojkowska

    2014-01-01

    A multiplex polymerase chain reaction (PCR) assay for simultaneous, fast and reliable detection of the main soft rot and blackleg potato pathogens in Europe has been developed. It utilises three pairs of primers and enables detection of three groups of pectinolytic bacteria frequently found in potato, namely: Pectobacterium atrosepticum, Pectobacterium carotovorum subsp. carotovorum together with Pectobacterium wasabiae and Dickeya spp. in a multiplex PCR assay. In studies with axenic culture...

  15. Unbiased Parallel Detection of Viral Pathogens in Clinical Samples by Use of a Metagenomic Approach▿‡

    OpenAIRE

    Yang, Jian; Yang, Fan; Ren, Lili; Xiong, Zhaohui; Wu, Zhiqiang; Dong, Jie; Sun, Lilian; Zhang, Ting; Hu, Yongfeng; Du, Jiang; Wang, Jianwei; Jin, Qi

    2011-01-01

    Viral infectious diseases represent a major threat to public health and are among the greatest disease burdens worldwide. Rapid and accurate identification of viral agents is crucial for both outbreak control and estimating regional disease burdens. Recently developed metagenomic methods have proven to be powerful tools for simultaneous pathogen detection. Here, we performed a systematic study of the capability of the short-read-based metagenomic approach in the molecular detection of viral p...

  16. Direct Detection and Differentiation of Pathogenic Leptospira Species Using a Multi-Gene Targeted Real Time PCR Approach

    OpenAIRE

    Ana Sofia Ferreira; Pedro Costa; Teresa Rocha; Ana Amaro; Maria Luísa Vieira; Ahmed Ahmed; Gertrude Thompson; Hartskeerl, Rudy A.; João Inácio

    2014-01-01

    Leptospirosis is a growing public and veterinary health concern caused by pathogenic species of Leptospira. Rapid and reliable laboratory tests for the direct detection of leptospiral infections in animals are in high demand not only to improve diagnosis but also for understanding the epidemiology of the disease. In this work we describe a novel and simple TaqMan-based multi-gene targeted real-time PCR approach able to detect and differentiate Leptospira interrogans, L. kirschneri, L. borgpet...

  17. Rapid Detection and Identification of Infectious Pathogens Based on High-throughput Sequencing

    OpenAIRE

    Pei-Xiang Ni; Xin Ding; Yin-Xin Zhang; Xue Yao; Rui-Xue Sun; Peng Wang; Yan-Ping Gong; Jia-Li Zhou; Dong-Fang Li; Hong-Long Wu; Xin Yi; Ling Yang; Yun Long

    2015-01-01

    Background: The dilemma of pathogens identification in patients with unidentified clinical symptoms such as fever of unknown origin exists, which not only poses a challenge to both the diagnostic and therapeutic process by itself, but also to expert physicians. Methods: In this report, we have attempted to increase the awareness of unidentified pathogens by developing a method to investigate hitherto unidentified infectious pathogens based on unbiased high-throughput sequencing. Resul...

  18. Development and evaluation of a panel of filovirus sequence capture probes for pathogen detection by next-generation sequencing.

    Directory of Open Access Journals (Sweden)

    Jeffrey W Koehler

    Full Text Available A detailed understanding of the circulating pathogens in a particular geographic location aids in effectively utilizing targeted, rapid diagnostic assays, thus allowing for appropriate therapeutic and containment procedures. This is especially important in regions prevalent for highly pathogenic viruses co-circulating with other endemic pathogens such as the malaria parasite. The importance of biosurveillance is highlighted by the ongoing Ebola virus disease outbreak in West Africa. For example, a more comprehensive assessment of the regional pathogens could have identified the risk of a filovirus disease outbreak earlier and led to an improved diagnostic and response capacity in the region. In this context, being able to rapidly screen a single sample for multiple pathogens in a single tube reaction could improve both diagnostics as well as pathogen surveillance. Here, probes were designed to capture identifying filovirus sequence for the ebolaviruses Sudan, Ebola, Reston, Taï Forest, and Bundibugyo and the Marburg virus variants Musoke, Ci67, and Angola. These probes were combined into a single probe panel, and the captured filovirus sequence was successfully identified using the MiSeq next-generation sequencing platform. This panel was then used to identify the specific filovirus from nonhuman primates experimentally infected with Ebola virus as well as Bundibugyo virus in human sera samples from the Democratic Republic of the Congo, thus demonstrating the utility for pathogen detection using clinical samples. While not as sensitive and rapid as real-time PCR, this panel, along with incorporating additional sequence capture probe panels, could be used for broad pathogen screening and biosurveillance.

  19. Non-protein coding RNA-based genosensor with quantum dots as electrochemical labels for attomolar detection of multiple pathogens.

    Science.gov (United States)

    Vijian, Dinesh; Chinni, Suresh V; Yin, Lee Su; Lertanantawong, Benchaporn; Surareungchai, Werasak

    2016-03-15

    The ability of a diagnostic test to detect multiple pathogens simultaneously is useful to obtain meaningful information for clinical treatment and preventive measures. We report a highly sensitive and specific electrochemical biosensor assay for simultaneous detection of three gene targets using quantum dots (QDs). The targets are novel non-protein coding RNA (npcRNA) sequences of Vibrio cholerae, Salmonella sp. and Shigella sp., which cause diarrheal diseases. QDs (PbS, CdS, ZnS) were synthesized and functionalized with DNA probes that were specific to each pathogen. Electrochemical detection of QDs was performed using square wave anodic stripping voltammetry (SWASV). The QDs gave distinct peaks at 0.5 V (PbS), 0.75 V (CdS) and 1.1 V (ZnS). There was no interference in signal response when all three QDs were mixed and detected simultaneously. The detection limits of single and multiplex assays with linear targets and PCR products were in the attomolar ranges. The high assay sensitivity, in combination with specific npcRNA sequences as novel diagnostic targets, makes it a viable tool for detecting pathogens from food, environment and clinical samples. PMID:26513287

  20. Integrated microfluidic system with automatic sampling for permanent molecular and antigen-based detection of CBRNE-related pathogens

    Science.gov (United States)

    Becker, Holger; Schattschneider, Sebastian; Klemm, Richard; Hlawatsch, Nadine; Gärtner, Claudia

    2015-03-01

    The continuous monitoring of the environment for lethal pathogens is a central task in the field of biothreat detection. Typical scenarios involve air-sampling in locations such as public transport systems or large public events and a subsequent analysis of the samples by a portable instrument. Lab-on-a-chip technologies are one of the promising technological candidates for such a system. We have developed an integrated microfluidic system with automatic sampling for the detection of CBRNE-related pathogens. The chip contains a two-pronged analysis strategy, on the one hand an immunological track using antibodies immobilized on a frit and a subsequent photometric detection, on the other hand a molecular biology approach using continuous-flow PCR with a fluorescence end-point detection. The cartridge contains two-component molded rotary valve to allow active fluid control and switching between channels. The accompanying instrument contains all elements for fluidic and valve actuation, thermal control, as well as the two detection modalities. Reagents are stored in dedicated reagent packs which are connected directly to the cartridge. With this system, we have been able to demonstrate the detection of a variety of pathogen species.

  1. Duplex Real-Time SYBR Green PCR Assays for Detection of 17 Species of Food- or Waterborne Pathogens in Stools

    OpenAIRE

    FUKUSHIMA, Hiroshi; Tsunomori, Yoshie; Seki, Ryotaro

    2003-01-01

    A duplex real-time SYBR Green LightCycler PCR (LC-PCR) assay with DNA extraction using the QIAamp DNA Stool Mini kit was evaluated with regard to detection of 8 of 17 species of food- or waterborne pathogens in five stool specimens in 2 h or less. The protocol used the same LC-PCR with 20 pairs of specific primers. The products formed were identified based on a melting point temperature (Tm) curve analysis. The 17 species of food- or waterborne pathogens examined were enteroinvasive Escherich...

  2. Comparative evaluation of two commercial multiplex panels for detection of gastrointestinal pathogens by use of clinical stool specimens.

    Science.gov (United States)

    Khare, Reeti; Espy, Mark J; Cebelinski, Elizabeth; Boxrud, David; Sloan, Lynne M; Cunningham, Scott A; Pritt, Bobbi S; Patel, Robin; Binnicker, Matthew J

    2014-10-01

    The detection of pathogens associated with gastrointestinal disease may be important in certain patient populations, such as immunocompromised hosts, the critically ill, or individuals with prolonged disease that is refractory to treatment. In this study, we evaluated two commercially available multiplex panels (the FilmArray gastrointestinal [GI] panel [BioFire Diagnostics, Salt Lake City, UT] and the Luminex xTag gastrointestinal pathogen panel [GPP] [Luminex Corporation, Toronto, Canada]) using Cary-Blair stool samples (n = 500) submitted to our laboratory for routine GI testing (e.g., culture, antigen testing, microscopy, and individual real-time PCR). At the time of this study, the prototype (non-FDA-cleared) FilmArray GI panel targeted 23 pathogens (14 bacterial, 5 viral, and 4 parasitic), and testing of 200 μl of Cary-Blair stool was recommended. In contrast, the Luminex GPP assay was FDA cleared for the detection of 11 pathogens (7 bacterial, 2 viral, and 2 parasitic), but had the capacity to identify 4 additional pathogens using a research-use-only protocol. Importantly, the Luminex assay was FDA cleared for 100 μl raw stool; however, 100 μl Cary-Blair stool was tested by the Luminex assay in this study. Among 230 prospectively collected samples, routine testing was positive for one or more GI pathogens in 19 (8.3%) samples, compared to 76 (33.0%) by the FilmArray and 69 (30.3%) by the Luminex assay. Clostridium difficile (12.6 to 13.9% prevalence) and norovirus genogroup I (GI)/GII (5.7 to 13.9% prevalence) were two of the pathogens most commonly detected by both assays among prospective samples. Sapovirus was also commonly detected (5.7% positive rate) by the FilmArray assay. Among 270 additional previously characterized samples, both multiplex panels demonstrated high sensitivity (>90%) for the majority of targets, with the exception of several pathogens, notably Aeromonas sp. (23.8%) by FilmArray and Yersinia enterocolitica (48.1%) by the Luminex

  3. DNA Extraction Method Affects the Detection of a Fungal Pathogen in Formalin-Fixed Specimens Using qPCR.

    Directory of Open Access Journals (Sweden)

    Andrea J Adams

    Full Text Available Museum collections provide indispensable repositories for obtaining information about the historical presence of disease in wildlife populations. The pathogenic amphibian chytrid fungus Batrachochytrium dendrobatidis (Bd has played a significant role in global amphibian declines, and examining preserved specimens for Bd can improve our understanding of its emergence and spread. Quantitative PCR (qPCR enables Bd detection with minimal disturbance to amphibian skin and is significantly more sensitive to detecting Bd than histology; therefore, developing effective qPCR methodologies for detecting Bd DNA in formalin-fixed specimens can provide an efficient and effective approach to examining historical Bd emergence and prevalence. Techniques for detecting Bd in museum specimens have not been evaluated for their effectiveness in control specimens that mimic the conditions of animals most likely to be encountered in museums, including those with low pathogen loads. We used American bullfrogs (Lithobates catesbeianus of known infection status to evaluate the success of qPCR to detect Bd in formalin-fixed specimens after three years of ethanol storage. Our objectives were to compare the most commonly used DNA extraction method for Bd (PrepMan, PM to Macherey-Nagel DNA FFPE (MN, test optimizations for Bd detection with PM, and provide recommendations for maximizing Bd detection. We found that successful detection is relatively high (80-90% when Bd loads before formalin fixation are high, regardless of the extraction method used; however, at lower infection levels, detection probabilities were significantly reduced. The MN DNA extraction method increased Bd detection by as much as 50% at moderate infection levels. Our results indicate that, for animals characterized by lower pathogen loads (i.e., those most commonly encountered in museum collections, current methods may underestimate the proportion of Bd-infected amphibians. Those extracting DNA from

  4. DNA Extraction Method Affects the Detection of a Fungal Pathogen in Formalin-Fixed Specimens Using qPCR

    Science.gov (United States)

    Adams, Andrea J.; LaBonte, John P.; Ball, Morgan L.; Richards-Hrdlicka, Kathryn L.; Toothman, Mary H.; Briggs, Cheryl J.

    2015-01-01

    Museum collections provide indispensable repositories for obtaining information about the historical presence of disease in wildlife populations. The pathogenic amphibian chytrid fungus Batrachochytrium dendrobatidis (Bd) has played a significant role in global amphibian declines, and examining preserved specimens for Bd can improve our understanding of its emergence and spread. Quantitative PCR (qPCR) enables Bd detection with minimal disturbance to amphibian skin and is significantly more sensitive to detecting Bd than histology; therefore, developing effective qPCR methodologies for detecting Bd DNA in formalin-fixed specimens can provide an efficient and effective approach to examining historical Bd emergence and prevalence. Techniques for detecting Bd in museum specimens have not been evaluated for their effectiveness in control specimens that mimic the conditions of animals most likely to be encountered in museums, including those with low pathogen loads. We used American bullfrogs (Lithobates catesbeianus) of known infection status to evaluate the success of qPCR to detect Bd in formalin-fixed specimens after three years of ethanol storage. Our objectives were to compare the most commonly used DNA extraction method for Bd (PrepMan, PM) to Macherey-Nagel DNA FFPE (MN), test optimizations for Bd detection with PM, and provide recommendations for maximizing Bd detection. We found that successful detection is relatively high (80–90%) when Bd loads before formalin fixation are high, regardless of the extraction method used; however, at lower infection levels, detection probabilities were significantly reduced. The MN DNA extraction method increased Bd detection by as much as 50% at moderate infection levels. Our results indicate that, for animals characterized by lower pathogen loads (i.e., those most commonly encountered in museum collections), current methods may underestimate the proportion of Bd-infected amphibians. Those extracting DNA from archived museum

  5. Development of a DNA Microarray-Based Assay for the Detection of Sugar Beet Root Rot Pathogens.

    Science.gov (United States)

    Liebe, Sebastian; Christ, Daniela S; Ehricht, Ralf; Varrelmann, Mark

    2016-01-01

    Sugar beet root rot diseases that occur during the cropping season or in storage are accompanied by high yield losses and a severe reduction of processing quality. The vast diversity of microorganism species involved in rot development requires molecular tools allowing simultaneous identification of many different targets. Therefore, a new microarray technology (ArrayTube) was applied in this study to improve diagnosis of sugar beet root rot diseases. Based on three marker genes (internal transcribed spacer, translation elongation factor 1 alpha, and 16S ribosomal DNA), 42 well-performing probes enabled the identification of prevalent field pathogens (e.g., Aphanomyces cochlioides), storage pathogens (e.g., Botrytis cinerea), and ubiquitous spoilage fungi (e.g., Penicillium expansum). All probes were proven for specificity with pure cultures from 73 microorganism species as well as for in planta detection of their target species using inoculated sugar beet tissue. Microarray-based identification of root rot pathogens in diseased field beets was successfully confirmed by classical detection methods. The high discriminatory potential was proven by Fusarium species differentiation based on a single nucleotide polymorphism. The results demonstrate that the ArrayTube constitute an innovative tool allowing a rapid and reliable detection of plant pathogens particularly when multiple microorganism species are present. PMID:26524545

  6. Widespread detection of highly pathogenic H5 influenza viruses in wild birds from the Pacific Flyway of the United States.

    Science.gov (United States)

    Bevins, S N; Dusek, R J; White, C L; Gidlewski, T; Bodenstein, B; Mansfield, K G; DeBruyn, P; Kraege, D; Rowan, E; Gillin, C; Thomas, B; Chandler, S; Baroch, J; Schmit, B; Grady, M J; Miller, R S; Drew, M L; Stopak, S; Zscheile, B; Bennett, J; Sengl, J; Brady, Caroline; Ip, H S; Spackman, E; Killian, M L; Torchetti, M K; Sleeman, J M; Deliberto, T J

    2016-01-01

    A novel highly pathogenic avian influenza virus belonging to the H5 clade 2.3.4.4 variant viruses was detected in North America in late 2014. Motivated by the identification of these viruses in domestic poultry in Canada, an intensive study was initiated to conduct highly pathogenic avian influenza surveillance in wild birds in the Pacific Flyway of the United States. A total of 4,729 hunter-harvested wild birds were sampled and highly pathogenic avian influenza virus was detected in 1.3% (n = 63). Three H5 clade 2.3.4.4 subtypes were isolated from wild birds, H5N2, H5N8, and H5N1, representing the wholly Eurasian lineage H5N8 and two novel reassortant viruses. Testing of 150 additional wild birds during avian morbidity and mortality investigations in Washington yielded 10 (6.7%) additional highly pathogenic avian influenza isolates (H5N8 = 3 and H5N2 = 7). The geographically widespread detection of these viruses in apparently healthy wild waterfowl suggest that the H5 clade 2.3.4.4 variant viruses may behave similarly in this taxonomic group whereby many waterfowl species are susceptible to infection but do not demonstrate obvious clinical disease. Despite these findings in wild waterfowl, mortality has been documented for some wild bird species and losses in US domestic poultry during the first half of 2015 were unprecedented. PMID:27381241

  7. Surveillance of low pathogenic avian influenza in layer chickens: risk factors, transmission and early detection

    NARCIS (Netherlands)

    Gonzales Rojas, J.L.

    2012-01-01

    Low pathogenic avian influenza virus (LPAIv) of H5 and H7 subtypes are able to mutate to highly pathogenic avian influenza virus (HPAIv), which are lethal for most poultry species, can cause large epidemics and are a serious threat to public health. Thus, circulation of these LPAIv in poultry is und

  8. Comparison between nasopharyngeal swab and nasal wash, using culture and PCR, in the detection of potential respiratory pathogens

    Directory of Open Access Journals (Sweden)

    El Batrawy Sherouk

    2011-04-01

    Full Text Available Abstract Background Nasopharyngeal carriage of potential pathogens is important as it is both the major source of transmission and the prerequisite of invasive disease. New methods for detecting carriage could improve comfort, accuracy and laboratory utility. The aims of this study were to compare the sensitivities of a nasopharyngeal swab (NPS and a nasal wash (NW in detecting potential respiratory pathogens in healthy adults using microbiological culture and PCR. Results Healthy volunteers attended for nasal washing and brushing of the posterior nasopharynx. Conventional and real-time PCR were used to detect pneumococcus and meningococcus. Statistical differences between the two nasal sampling methods were determined using a nonparametric Mann-Whitney U test; differences between culture and PCR methods were determined using the McNemar test. Nasal washing was more comfortable for volunteers than swabbing (n = 24. In detection by culture, the NW was significantly more likely to detect pathogens than the NPS (p Conclusions Nasal washing and PCR may provide effective alternatives to nasopharyngeal swabbing and classical microbiology, respectively.

  9. Optical Imaging of Paramagnetic Bead-DNA Aggregation Inhibition Allows for Low Copy Number Detection of Infectious Pathogens.

    Directory of Open Access Journals (Sweden)

    Jacquelyn A DuVall

    Full Text Available DNA-paramagnetic silica bead aggregation in a rotating magnetic field facilitates the quantification of DNA with femtogram sensitivity, but yields no sequence-specific information. Here we provide an original description of aggregation inhibition for the detection of DNA and RNA in a sequence-specific manner following loop-mediated isothermal amplification (LAMP. The fragments generated via LAMP fail to induce chaotrope-mediated bead aggregation; however, due to their ability to passivate the bead surface, they effectively inhibit bead aggregation by longer 'trigger' DNA. We demonstrate the utility of aggregation inhibition as a method for the detection of bacterial and viral pathogens with sensitivity that approaches single copies of the target. We successfully use this methodology for the detection of notable food-borne pathogens Escherichia coli O157:H7 and Salmonella enterica, as well as Rift Valley fever virus, a weaponizable virus of national security concern. We also show the concentration dependence of aggregation inhibition, suggesting the potential for quantification of target nucleic acid in clinical and environmental samples. Lastly, we demonstrate the ability to rapidly detect infectious pathogens by utilizing a cell phone and custom-written application (App, making this novel detection modality fully portable for point-of-care use.

  10. Clinical Evaluation of the New High-Throughput Luminex NxTAG Respiratory Pathogen Panel Assay for Multiplex Respiratory Pathogen Detection.

    Science.gov (United States)

    Chen, Jonathan H K; Lam, Ho-Yin; Yip, Cyril C Y; Wong, Sally C Y; Chan, Jasper F W; Ma, Edmond S K; Cheng, Vincent C C; Tang, Bone S F; Yuen, Kwok-Yung

    2016-07-01

    A broad range of viral and bacterial pathogens can cause acute respiratory tract infection. For rapid detection of a broad respiratory pathogen spectrum, multiplex real-time PCR is ideal. This study evaluated the performance of the new Luminex NxTAG Respiratory Pathogen Panel (NxTAG-RPP) in comparison with the BioFire FilmArray Respiratory Panel (FA-RP) or singleplex real-time PCR as reference. A total of 284 clinical respiratory specimens and 3 influenza A/H7N9 viral culture samples were tested. All clinical specimens were processed and analyzed in parallel using NxTAG-RPP and the reference standard method. The H7N9 viral culture samples were tested using NxTAG-RPP only. Overall, the NxTAG-RPP demonstrated ≥93% sensitivity and specificity for all respiratory targets except human coronavirus OC43 (HCoV-OC43) and HCoV-HKU1. The H7N9 virus was detected by the influenza A virus matrix gene target, while other influenza A virus subtyping gene targets in the panel remained negative. Complete concordance between NxTAG-RPP and FA-RP was observed in 98.8% (318/322) of positive results (kappa = 0.92). Substantial agreement was found for most respiratory targets, but significant differences were observed in human metapneumovirus (P = 0.001) and parainfluenza virus type 3 (P = 0.031). NxTAG-RPP has a higher sample throughput than FA-RP (96 samples versus 1 sample per run) while the turnaround times for NxTAG-RPP and FA-RP were 5 h (up to 96 samples) and 1 h (for one sample), respectively. Overall, NxTAG-RPP demonstrated good diagnostic performance for most respiratory pathogens. The high sample throughput with reasonable turnaround time of this new assay makes it a suitable multiplex platform for routine screening of respiratory specimens in hospital-based laboratories. PMID:27122380

  11. Detection and Comparison of Pathogen of Virus Disease in Pumpkin by RT-PCR and IC-PCR

    Institute of Scientific and Technical Information of China (English)

    YANG Guohui; ZHANG Zhongkai; CUI Chongshi

    2006-01-01

    Two kinds of methods RT-PCR and IC-PCR were used to detect pathogen of virus disease of pumpkin and the sensitivity of the two methods was compared. The results showed that PRSV-W and CMV were detected in diseased samples gathered in Yunnan Province, while WMV and CMV were detected in diseased samples gathered in Heilongjiang Province. The sensitivity of RT-PCR is higher than that of IC-PCR, but the effect of IC-PCR in the specialization of bonding reaction and requisition for experiment material is better than that of RT-PCR.

  12. Host-Seeking Behavior and Arbovirus Detection in Mosquitoes of Habahe County, Xinjiang Uigur Autonomous Region, China.

    Science.gov (United States)

    Guo, Xiao-Xia; Zhang, Ying-Mei; Li, Chun-Xiao; Zhang, Gui-Lin; Zheng, Zhong; Dong, Yan-De; Xue, Rui-De; Xing, Dan; Zhao, Tong-Yan

    2015-12-01

    Mosquitoes in Habahe County of Xinjiang Uigur Autonomous Region in China are considered a serious nuisance problem to local residents, but little is known of their role in enzootic disease. Therefore, host-seeking behavior and virus detection in mosquitoes were investigated in this study. Adult host-seeking mosquitoes were sampled using the Centers for Disease Control and Prevention (CDC) light traps operated at three locations in June through August 2008. Nine traps were used at each location at 3 different heights (1 m, 3 m, and 5 m). Seven mosquito species from 4 genera were collected by CDC light traps in different habitats. In total, 90,055 mosquitoes were captured, of which Aedes vexans was the most abundant species, comprising 88.02% of all mosquitoes collected. The second most abundant species was Anopheles messese, which comprised about 5.86%. Other species caught were Culex modestus (2.89%), Aedes caspius (1.11%), Coquillettidia richiardii (0.61%), Ae. dorsalis (1.36%), and An. hyrcanus (0.14%). About 93.5% of Ae. vexans individuals were caught in CO2-baited CDC light traps at 1 m above the ground. The highest numbers of Cx. modestus were caught at the highest trap level, 5 m above ground. Overall, significantly more mosquitoes of all species were collected at dusk than at dawn. Based on blood-meal analyses, Ae. vexans and An. messese fed on various vertebrate hosts, whereas Cx. modestus fed on ducks only. From a total of 335 mosquito pools tested, 10 pools of Ae. vexans were found positive for alphavirus. Comparison with the gene database revealed that the alphavirus deoxyribonucleic acid fragment obtained (GenBank accession no. HM160530) was 100% homologous at the nucleotide level to chikungunya virus isolate LK (PB) chik3408, chikungunya virus isolate SGEHICHD122508, and chikungunya virus strain FD080231. The results of this study suggest that ongoing, integrated mosquito and arbovirus surveillance is necessary in this river wetland. PMID:26675454

  13. Simultaneous detection of LipL32 and LipL21 genes of pathogenic leptospira from serum samples of bovines by multiplex PCR

    Directory of Open Access Journals (Sweden)

    Timiri V. Meenambigai

    2011-12-01

    Full Text Available Leptospirosis is a worldwide zoonotic disease of cattle associated with pathogenic leptospiral infection. This study focuses in the use of a molecular tool to detect pathogenic leptospiral infection in bovines by targeting the outer membrane proteins LipL32 and LipL21 simultaneously in a multiplex PCR. Sixteen pathogenic reference strains and 10 bovine serum samples were analyzed for simultaneous detection of both genes at appropriate annealing conditions. These findings are suggestive of the fact that multiplex PCR can be used to detect major outer membrane proteins of pathogenic leptospira from serum samples. Further it aided in the differentiation of pathogenic and non-pathogenic species of leptospires too. This study will definitely serve as a valuable tool, as it suggests the importance of LipL32 genes as potential candidates for vaccine development to control animal Leptospirosis.

  14. Ultrasensitive electrochemical detection of nucleic acid by coupling an autonomous cascade target replication and enzyme/gold nanoparticle-based post-amplification.

    Science.gov (United States)

    Liu, Shufeng; Wei, Wenji; Wang, Yanqun; Fang, Li; Wang, Li; Li, Feng

    2016-06-15

    Owing to the intrinsic importance of nucleic acid as bio-targets, the development of isothermal and ultrasensitive electrochemical DNA biosensor is very essential for biological studies and medical diagnostics. Herein, the autonomous cascade DNA replication strategy was effectively married with the enzyme/gold nanoparticle-based post-amplification strategy to promote the detection performance toward target DNA. A hairpin DNA probe (HP) is designed that consists of an overhang at 3'-end as the recognition unit for target DNA, a recognition site for nicking endonuclease, and an alkane spacer to terminate polymerization reaction. The autonomous DNA replication-scission-displacement reaction operated by the nicking endonuclease/KF polymerase induced the autocatalytic opening of HP, which was then specifically bound by the enzyme/gold nanoparticles for further dual-signal amplification toward target-related sensing events. A low detection limit of 0.065fM with an excellent selectivity toward target DNA could be achieved. The proposed biosensor could be also easily regenerated for target detection. The developed biosensor creates an opportunity for the effective coupling of the target replication with post-amplification strategies and thus opens a promising avenue for the detection of nucleic acid with low abundance in bioanalysis and clinical biomedicine. PMID:26849348

  15. Rapid pathogen detection by lateral-flow immunochromatographic assay with gold nanoparticle-assisted enzyme signal amplification.

    Science.gov (United States)

    Cho, Il-Hoon; Bhunia, Arun; Irudayaraj, Joseph

    2015-08-01

    To date most LF-ICA format for pathogen detection is based on generating color signals from gold nanoparticle (AuNP) tracers that are perceivable by naked eye but often these methods exhibit sensitivity lower than those associated with the conventional enzyme-based immunological methods or mandated by the regulatory guidelines. By developing AuNP avidin-biotin constructs in which a number of enzymes can be labeled we report on an enhanced LF-ICA system to detect pathogens at very low levels. With this approach we show that as low as 100 CFU/mL of Escherichia coli O157:H7 can be detected, indicating that the limit of detection can be increased by about 1000-fold due to our signal amplification approach. In addition, extensive cross-reactivity experiments were conducted (19 different organisms were used) to test and successfully validate the specificity of the assay. Semi-quantitative analysis can be performed using signal intensities which were correlated with the target pathogen concentrations for calibration by image processing. PMID:25955290

  16. Detection and characterization of human pathogenic viruses circulating in community wastewater using multi target microarrays and polymerase chain reaction.

    Science.gov (United States)

    Wong, Mark V M; Hashsham, Syed A; Gulari, Erdogan; Rouillard, Jean-Marie; Aw, Tiong Gim; Rose, Joan B

    2013-12-01

    Sewage pollution remains the most significant source of human waterborne pathogens. This study describes the detection and characterization of human enteric viruses in community wastewaters using cell culture coupled with multiple target microarrays (with a total of 780 unique probes targeting 27 different groups of both DNA and RNA viruses) and polymerase chain reaction (PCR) assays. Over a 13-month sampling period, RNA viruses (astroviruses and enteroviruses) were more frequently detected compared to DNA viruses (adenoviruses, particularly type 41 and BK polyomavirus). Overall, many more viruses were shed during the winter months (December-February) compared to the summer months. Exploration of the multiple types of enteric viruses particularly in winter months identified much more significant prevalence of key viral pathogens associated with sewage pollution of the water environment than previously realized and seasonal disinfection used in some parts of the world may lead to a seeding of ambient waters. Molecular characterization of pathogenic viruses in community wastewater will improve the understanding of the potential risk of waterborne disease transmission of viral pathogens. PMID:24334840

  17. Quantitative molecular detection of putative periodontal pathogens in clinically healthy and periodontally diseased subjects.

    Directory of Open Access Journals (Sweden)

    André Göhler

    Full Text Available Periodontitis is a multi-microbial oral infection with high prevalence among adults. Putative oral pathogens are commonly found in periodontally diseased individuals. However, these organisms can be also detected in the oral cavity of healthy subjects. This leads to the hypothesis, that alterations in the proportion of these organisms relative to the total amount of oral microorganisms, namely their abundance, rather than their simple presence might be important in the transition from health to disease. Therefore, we developed a quantitative molecular method to determine the abundance of various oral microorganisms and the portion of bacterial and archaeal nucleic acid relative to the total nucleic acid extracted from individual samples. We applied quantitative real-time PCRs targeting single-copy genes of periodontal bacteria and 16S-rRNA genes of Bacteria and Archaea. Testing tongue scrapings of 88 matched pairs of periodontally diseased and healthy subjects revealed a significantly higher abundance of P. gingivalis and a higher total bacterial abundance in diseased subjects. In fully adjusted models the risk of being periodontally diseased was significantly higher in subjects with high P. gingivalis and total bacterial abundance. Interestingly, we found that moderate abundances of A. actinomycetemcomitans were associated with reduced risk for periodontal disease compared to subjects with low abundances, whereas for high abundances, this protective effect leveled off. Moderate archaeal abundances were health associated compared to subjects with low abundances. In conclusion, our methodological approach unraveled associations of the oral flora with periodontal disease, which would have gone undetected if only qualitative data had been determined.

  18. Multiplex polymerase chain reaction for the detection and differentiation of avian influenza viruses and other poultry respiratory pathogens.

    Science.gov (United States)

    Rashid, S; Naeem, K; Ahmed, Z; Saddique, N; Abbas, M A; Malik, S A

    2009-12-01

    A multiplex reverse transcription-PCR (mRT-PCR) was developed and standardized for the detection of type A influenza viruses, avian influenza virus (AIV) subtype H7, H9, and H5 hemagglutinin gene with simultaneous detection of 3 other poultry respiratory pathogens, Newcastle disease virus (NDV), infectious bronchitis virus (IBV), and infectious laryngotracheitis virus (ILTV). Seven sets of specific oligonucleotide primers were used in this study for the M gene of AIV and hemagglutinin gene of subtypes H7, H9, and H5 of AIV. Three sets of other specific oligonucleotide primers were used for the detection of avian respiratory pathogens other than AIV. The mRT-PCR DNA products were visualized by agarose gel electrophoresis and consisted of DNA fragments of 1,023 bp for M gene of AIV, 149 bp for IBV, 320 bp for NDV, and 647 bp for ILTV. The second set of primers used for m-RT-PCR of H7N3, H9N2, and H5N1 provided DNA products of 300 bp for H7, 456 bp for H5, and 808 bp for H9. The mRT-PCR products for the third format consisted of DNA fragments of 149 bp for IBV, 320 bp for NDV, 647 bp for ILTV, 300 bp for H7, 456 bp for H5, and 808 bp for H9. The sensitivity and specificity of mRT-PCR was determined and the test was found to be sensitive and specific for the detection of AIV and other poultry respiratory pathogens. In this present study, multiplex PCR technique has been developed to simultaneously detect and differentiate the 3 most important subtypes of AIV along with the 3 most common avian respiratory pathogens prevalent in poultry in Pakistan. Therefore, a mRT-PCR that can rapidly differentiate between these pathogens will be very important for the control of disease transmission in poultry and in humans, along with the identification of 3 of the most common respiratory pathogens often seen as mixed infections in poultry, and hence economic losses will be reduced in poultry. PMID:19903950

  19. A simple and rapid immunochromatographic test strip for detection of pathogenic isolates of Vibrio harveyi.

    Science.gov (United States)

    Sithigorngul, Paisarn; Rukpratanporn, Sombat; Pecharaburanin, Nilawan; Suksawat, Pornthip; Longyant, Siwaporn; Chaivisuthangkura, Parin; Sithigorngul, Weerawan

    2007-12-01

    Mouse monoclonal antibodies (MAbs) and rabbit polyclonal antibody (PAb) against Vibrio harveyi were generated from immunization of mice and rabbits with highly virulent isolate of V. harveyi. Two MAbs specific to virulent isolates of V. harveyi were obtained and one of them (VH4) was selected to conjugate with colloidal gold as the detector antibody was laid on a sample pad. Rabbit polyclonal antibody was used as the capture antibody at the test line (T) and goat anti-mouse IgG antibody (GAM) was used as the capture antibody at the control line (C) of nitrocellulose strip. The ready-to-use strip was held in a plastic case and then stored in a desiccated plastic bag. A sample volume of 100 microl of bacterial suspension from various sources mixed with application buffer was applied to the sample chamber at one end of the strip and allowed to flow by chromatography through the nitrocellulose membrane to the other end. In test samples containing virulent isolates of V. harveyi, the bacteria would bind to the monoclonal antibody conjugated with colloidal gold and the resulting complex would be captured by the antibodies at the test line to give a reddish-purple band. Any unbound monoclonal antibody conjugated with colloidal gold moved across the test line would be captured by the GAM and form a band at the control line (C). In sample without V. harveyi or with V. harveyi below the limit (<10(6) CFU/ml) of detection for the kit, only the control line band was observed. If the test sample was pre-enriched in tryptic soy broth (TSB) for 6 h before application to the strip, the sensitivity would increase to 1-10 CFU/ml which is comparable to that of PCR. This method could be used to detect pathogenic isolates of V. harveyi in pond water or infected shrimp in order to monitor and to reduce the risk of V. harveyi outbreak in the shrimp culture. The beneficial features of this kit are that simple, convenient and quick results (within 15 min) can be obtained without the

  20. Evaluation of Statens Serum Institut Enteric Medium for Detection of Enteric Pathogens

    OpenAIRE

    Blom, Marianne; Meyer, Aase; Gerner-Smidt, Peter; Gaarslev, Knud; Espersen, Frank

    1999-01-01

    The efficacy of the Statens Serum Institut (SSI) enteric medium for isolation and direct identification of enteric pathogens was evaluated. Six different biochemical reactions can be read by using the SSI enteric medium, allowing direct identification of a range of enteric pathogens. All 248 gram-negative bacterial species that were tested grew on the SSI enteric medium. Only 10 of 248 bacteria (4%) showed discrepant results in the biochemical reactions, and none of these were enteric pathoge...

  1. Molecular Detection of Avian Pathogens in Poultry Red Mite (Dermanyssus gallinae) Collected in Chicken Farms

    OpenAIRE

    HUONG, Chu Thi Thanh; MURANO, Takako; UNO, Yukiko; USUI, Tatsufumi; Yamaguchi, Tsuyoshi

    2014-01-01

    Poultry red mite (PRM, Dermanyssus gallinae) is a blood-sucking ectoparasite as well as a possible vector of several avian pathogens. In this study, to define the role of PRM in the prevalence of avian infectious agents, we used polymerase chain reaction (PCR) to check for the presence of seven pathogens: Avipox virus (APV), Fowl Adenovirus (FAdV), Marek’s disease virus (MDV), Erysipelothrix rhusiopathiae (ER), Salmonella enterica (SE), Mycoplasma synoviae (MS) and Mycoplasma gallisepticum (M...

  2. Vaginal microbicides: detecting toxicities in vivo that paradoxically increase pathogen transmission

    OpenAIRE

    Abusuwwa Raed; Wong XiXi; Hoen Timothy; Cone Richard A; Anderson Deborah J; Moench Thomas R

    2006-01-01

    Abstract Background Microbicides must protect against STD pathogens without causing unacceptable toxic effects. Microbicides based on nonoxynol-9 (N9) and other detergents disrupt sperm, HSV and HIV membranes, and these agents are effective contraceptives. But paradoxically N9 fails to protect women against HIV and other STD pathogens, most likely because it causes toxic effects that increase susceptibility. The mouse HSV-2 vaginal transmission model reported here: (a) Directly tests for toxi...

  3. A system for detection and identification of foodborne pathogenic bacteria based on a “Combinatory qPCR” technology

    OpenAIRE

    Piednoir, Elodie

    2014-01-01

    Foodborne outbreaks are important issues worldwide. Two of the most important foodborne pathogens are Salmonella spp. and Listeria monocytogenes. The reference methods to detect foodborne bacteria are international standard operating procedures, ISO methods, which are recognized in the whole world. These methods are mostly culture-based methods that are time consuming (several days) and labor intensive. In order to identify faster the source of foodborne outbreaks, to better manage food-relat...

  4. First detection of highly pathogenic avian influenza virus H5N1 in common kestrel falcon (Falco tinnunculus) in Egypt

    OpenAIRE

    ElBakrey, Reham M.; Mansour, Shimaa M. G.; Ali, Haytham; Knudsen, David E. B.; Eid, Amal A. M.

    2016-01-01

    Highly pathogenic avian influenza virus (HPAIV) poses threats to animal and human health worldwide. A common kestrel (Falco tinnunculus) was submitted to Avian and Rabbit Medicine Department, Zagazig University, Egypt. It exhibited torticollis, incoordination, and inability to stand. Conjunctivitis and crust formation were seen. Postmortem findings revealed congestion in internal organs and greenish content in gizzard. No avian pox virus was detected in cutaneous lesions neither in histopatho...

  5. Detection of pathogenic copy number variants in children with idiopathic intellectual disability using 500 K SNP array genomic hybridization

    OpenAIRE

    Li H Irene; Lemyre Emmanuelle; Langlois Sylvie; Gibson William T; Flibotte Stephane; Delaney Allen D; Chai David; Chan Susanna; Boerkoel Cornelius; Birch Patricia; Baross Agnes; Armstrong Linlea; Arbour Laura; Adam Shelin; Friedman JM

    2009-01-01

    Abstract Background Array genomic hybridization is being used clinically to detect pathogenic copy number variants in children with intellectual disability and other birth defects. However, there is no agreement regarding the kind of array, the distribution of probes across the genome, or the resolution that is most appropriate for clinical use. Results We performed 500 K Affymetrix GeneChip® array genomic hybridization in 100 idiopathic intellectual disability trios, each comprised of a chil...

  6. Evaluation of the California mastitis test to detect an intramammary infection with a major pathogen in early lactation dairy cows.

    Science.gov (United States)

    Dingwell, Randy T; Leslie, Ken E; Schukken, Ynte H; Sargeant, Jan M; Timms, Leo L

    2003-05-01

    The purpose of this study was to evaluate the usefulness of the California mastitis test (CMT) to detect an intramammary infection caused by a major mastitis pathogen in early lactation cows. The gold standard used for comparison was bacteriological culture of single milk samples. The sensitivity (82.4%) and specificity (80.6%) of a positive CMT were highest on the 4th day of lactation. PMID:12757133

  7. Evaluation of the California mastitis test to detect an intramammary infection with a major pathogen in early lactation dairy cows

    OpenAIRE

    Dingwell, Randy T.; Leslie, Ken E.; Schukken, Ynte H.; Sargeant, Jan M; Leo L Timms

    2003-01-01

    The purpose of this study was to evaluate the usefulness of the California mastitis test (CMT) to detect an intramammary infection caused by a major mastitis pathogen in early lactation cows. The gold standard used for comparison was bacteriological culture of single milk samples. The sensitivity (82.4%) and specificity (80.6%) of a positive CMT were highest on the 4th day of lactation.

  8. Detection of Fusarium wilt pathogens of Psidium guajava L. in soil using culture independent PCR (ciPCR)

    OpenAIRE

    Mishra, Rupesh K.; Pandey, Brajesh K.; Muthukumar, M.; Pathak, Neelam; Zeeshan, Mohammad

    2012-01-01

    Traditional culturing methods take a long time for identification of pathogenic isolates. A protocol has been developed for the detection of Fusarium from soil samples in the early stage of infection. Seventeen soil samples from different locations were collected before the onset of rains to find out the presence of Fusarium spp. population present in the soil of guava orchards and to correlate its presence with incidence of wilt. A PCR based method was developed for the molecular characteriz...

  9. An optical biosensor for detection of pathogen biomarkers from Shiga toxin-producing Escherichia coli in ground beef samples

    Science.gov (United States)

    Lamoureux, Loreen; Adams, Peter; Banisadr, Afsheen; Stromberg, Zachary; Graves, Steven; Montano, Gabriel; Moxley, Rodney; Mukundan, Harshini

    2014-03-01

    Shiga toxin-producing Escherichia coli (STEC) poses a serious threat to human health through the consumption of contaminated food products, particularly beef and produce. Early detection in the food chain, and discrimination from other non-pathogenic Escherichia coli (E. coli), is critical to preventing human outbreaks, and meeting current agricultural screening standards. These pathogens often present in low concentrations in contaminated samples, making discriminatory detection difficult without the use of costly, time-consuming methods (e.g. culture). Using multiple signal transduction schemes (including novel optical methods designed for amphiphiles), specific recognition antibodies, and a waveguide-based optical biosensor developed at Los Alamos National Laboratory, we have developed ultrasensitive detection methods for lipopolysaccharides (LPS), and protein biomarkers (Shiga toxin) of STEC in complex samples (e.g. beef lysates). Waveguides functionalized with phospholipid bilayers were used to pull down amphiphilic LPS, using methods (membrane insertion) developed by our team. The assay format exploits the amphiphilic biochemistry of lipoglycans, and allows for rapid, sensitive detection with a single fluorescent reporter. We have used a combination of biophysical methods (atomic force and fluorescence microscopy) to characterize the interaction of amphiphiles with lipid bilayers, to efficiently design these assays. Sandwich immunoassays were used for detection of protein toxins. Biomarkers were spiked into homogenated ground beef samples to determine performance and limit of detection. Future work will focus on the development of discriminatory antibodies for STEC serotypes, and using quantum dots as the fluorescence reporter to enable multiplex screening of biomarkers.

  10. Sensitive Real-Time PCR Detection of Pathogenic Leptospira spp. and a Comparison of Nucleic Acid Amplification Methods for the Diagnosis of Leptospirosis

    Science.gov (United States)

    Waggoner, Jesse J.; Balassiano, Ilana; Abeynayake, Janaki; Sahoo, Malaya K.; Mohamed-Hadley, Alisha; Liu, Yuanyuan; Vital-Brazil, Juliana Magalhães; Pinsky, Benjamin A.

    2014-01-01

    Background Bacteria of the genus Leptospira, the causative agents of leptospirosis, are categorized into pathogenic and non-pathogenic species. However, the benefit of using a clinical diagnostic that is specific for pathogenic species remains unclear. In this study, we present the development of a real-time PCR (rtPCR) for the detection of pathogenic Leptospira (the pathogenic rtPCR), and we perform a comparison of the pathogenic rtPCR with a published assay that detects all Leptospira species [the undifferentiated febrile illness (UFI) assay] and a reference 16S Leptospira rtPCR, which was originally designed to detect pathogenic species. Methodology/Principal Findings For the pathogenic rtPCR, a new hydrolysis probe was designed for use with primers from the UFI assay, which targets the 16S gene. The pathogenic rtPCR detected Leptospira DNA in 37/37 cultured isolates from 5 pathogenic and one intermediate species. Two strains of the non-pathogenic L. biflexa produced no signal. Clinical samples from 65 patients with suspected leptospirosis were then tested using the pathogenic rtPCR and a reference Leptospira 16S rtPCR. All 65 samples had tested positive for Leptospira using the UFI assay; 62 (95.4%) samples tested positive using the pathogenic rtPCR (p = 0.24). Only 24 (36.9%) samples tested positive in the reference 16S rtPCR (p<0.0001 for comparison with the pathogenic rtPCR and UFI assays). Amplicon sequencing confirmed the detection of pathogenic Leptospira species in 49/50 cases, including 3 cases that were only detected using the UFI assay. Conclusions/Significance The pathogenic rtPCR displayed similar sensitivity to the UFI assay when testing clinical specimens with no difference in specificity. Both assays proved significantly more sensitive than a real-time molecular test used for comparison. Future studies are needed to investigate the clinical and epidemiologic significance of more sensitive Leptospira detection using these tests. PMID:25379890

  11. Sonication cultures of explanted components as an add-on test to routinely conducted microbiological diagnostics improve pathogen detection.

    Science.gov (United States)

    Holinka, Johannes; Bauer, Leonhard; Hirschl, Alexander M; Graninger, Wolfgang; Windhager, Reinhard; Presterl, Elisabeth

    2011-04-01

    The purpose of this study was to improve the pathogen detection in prosthetic joint infections, particularly to evaluate the feasibility of the sonication culture method in the clinical routine. Explanted components of all patients with presumptive prosthetic or implant infection were sonicated separately in sterile containers to dislodge the adherent bacteria from the surfaces and cultured. The results of sonication culture were compared to the conventional tissue culture. We investigated 60 consecutive patients with loosening of the prostheses or implants Forty patients had septic and 20 aseptic loosening (24 knee prostheses, 21 hip prostheses, 6 mega-prostheses, 2 shoulder prostheses, 6 osteosynthesis, 1 spinal instrumentation). The sensitivity of sonication fluid culture was 83.3%, of single positive tissue culture was 72.2% and 61.1% when two or more cultures yielded the same microorganism. In patients receiving antibiotic therapy the sensitivity was 65.9%, 57.5%, and 42.5%, respectively. Pathogens detected in a single tissue culture as well as in sonication culture yielded a significantly higher rate of prosthetic infection than conventional tissue culture alone (p = 0.008), even in patients receiving continuous antibiotic therapy before explantation (p = 0.016). The sonication method represents an essential add-on in pathogen detection compared to conventional tissue culture. PMID:21337398

  12. Application of real-time quantitative PCR for the detection of selected bacterial pathogens during municipal wastewater treatment.

    Science.gov (United States)

    Shannon, K E; Lee, D-Y; Trevors, J T; Beaudette, L A

    2007-08-15

    Bacteria were detected at five stages of municipal wastewater treatment using TaqMan(R) real-time quantitative PCR (qPCR). Thirteen probe and primer sets were tested for diverse pathogens that may be present in wastewater, including Aeromonas hydrophila, Bacillus cereus, Clostridium perfringens, Enterococcus faecalis, Escherichia coli, E. coli O157:H7, Helicobacter pylori, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Pseudomonas aeruginosa, Salmonella sp., and Staphylococcus aureus. The sensitivity of the assay was 100 fg of genomic DNA (=22 gene copies), based on a standard curve generated using A. hydrophila purified DNA. Samples from five stages of wastewater treatment were collected, including raw wastewater, primary effluents, mixed liquor, waste activated sludge and final effluents. In duplicate samples, E. coli, K. pneumoniae, C. perfringens and E. faecalis were detected throughout the wastewater process, and their numbers decreased by 3.52-3.98, 4.23-4.33, 3.15-3.39, and 3.24 orders of magnitude respectively, between the raw wastewater and final effluent stage. This qPCR method was effective for the detection of pathogens in wastewater and confirmed that the risk of exposure to pathogens in the wastewater discharge was well within the Environment Canada guidelines. PMID:17462712

  13. Direct detection and differentiation of pathogenic Leptospira species using a multi-gene targeted real time PCR approach.

    Science.gov (United States)

    Ferreira, Ana Sofia; Costa, Pedro; Rocha, Teresa; Amaro, Ana; Vieira, Maria Luísa; Ahmed, Ahmed; Thompson, Gertrude; Hartskeerl, Rudy A; Inácio, João

    2014-01-01

    Leptospirosis is a growing public and veterinary health concern caused by pathogenic species of Leptospira. Rapid and reliable laboratory tests for the direct detection of leptospiral infections in animals are in high demand not only to improve diagnosis but also for understanding the epidemiology of the disease. In this work we describe a novel and simple TaqMan-based multi-gene targeted real-time PCR approach able to detect and differentiate Leptospira interrogans, L. kirschneri, L. borgpeteresenii and L. noguchii, which constitute the veterinary most relevant pathogenic species of Leptospira. The method uses sets of species-specific probes, and respective flanking primers, designed from ompL1 and secY gene sequences. To monitor the presence of inhibitors, a duplex amplification assay targeting both the mammal β-actin and the leptospiral lipL32 genes was implemented. The analytical sensitivity of all primer and probe sets was estimated to be Dolichotis patagonum and Sus domesticus). Two samples were infected with L. borgpetersenii, two with L. interrogans and one with L. kirschneri. The possibility to detect and identify these pathogenic agents to the species level in domestic and wildlife animals reinforces the diagnostic information and will enhance our understanding of the epidemiology of leptopirosis. PMID:25398140

  14. A Comparison of In-House Real-Time LAMP Assays with a Commercial Assay for the Detection of Pathogenic Bacteria

    OpenAIRE

    Deguo Wang; Yongzhen Wang; Fugang Xiao; Weiyun Guo; Yongqing Zhang; Aiping Wang; Yanhong Liu

    2015-01-01

    Molecular detection of bacterial pathogens based on LAMP methods is a faster and simpler approach than conventional culture methods. Although different LAMP-based methods for pathogenic bacterial detection are available, a systematic comparison of these different LAMP assays has not been performed. In this paper, we compared 12 in-house real-time LAMP assays with a commercialized kit (Isothermal Master Mix) for the detection of Listeria monocytogenes, Salmonella spp, Staphylococcus aureus, E...

  15. Characterization of ISR region and development of a PCR assay for rapid detection of the fish pathogen Tenacibaculum soleae.

    Science.gov (United States)

    López, Jose R; Hamman-Khalifa, Abdel M; Navas, José I; de la Herran, Roberto

    2011-11-01

    The aims of this work were to characterize the 16S-23S internal spacer region of the fish pathogen Tenacibaculum soleae and to develop a PCR assay for its identification and detection. All T. soleae strains tested displayed a single internal spacer region class, containing tRNA(I) (le) and tRNA(A) (la) genes; nevertheless, a considerable intraspecific heterogeneity was observed. However, this region proved to be useful for differentiation of T. soleae from related and non-related species. Species-specific primers were designed targeting the 16S rRNA gene and the internal spacer region region, yielding a 1555-bp fragment. Detection limit was of 1 pg DNA per reaction (< 30 bacterial cells) when using pure cultures. The detection level in the presence of DNA from fish or other bacteria was lower; however, 10 pg were detected at a target/background ratio of 1 : 10(5) . The PCR assay proved to be more sensitive than agar cultivation for the detection of T. soleae from naturally diseased fish, offering a useful tool for diagnosis and for understanding the epidemiology of this pathogen. PMID:22092820

  16. Simultaneous detection of six diarrhea-causing bacterial pathogens with an in-house PCR-luminex assay.

    Science.gov (United States)

    Liu, Jie; Gratz, Jean; Maro, Athanasia; Kumburu, Happy; Kibiki, Gibson; Taniuchi, Mami; Howlader, Arif Mahmud; Sobuz, Shihab U; Haque, Rashidul; Talukder, Kaisar A; Qureshi, Shahida; Zaidi, Anita; Haverstick, Doris M; Houpt, Eric R

    2012-01-01

    Diarrhea can be caused by a range of pathogens, including several bacteria. Conventional diagnostic methods, such as culture, biochemical tests, and enzyme-linked immunosorbent assay (ELISA), are laborious. We developed a 7-plex PCR-Luminex assay to simultaneously screen for several of the major diarrhea-causing bacteria directly in fecal specimens, including pathogenic Aeromonas, Campylobacter jejuni, Campylobacter coli, Salmonella, Shigella, enteroinvasive Escherichia coli (EIEC), Vibrio, and Yersinia. We included an extrinsic control to verify extraction and amplification. The assay was first validated with reference strains or isolates and exhibited a limit of detection of 10(3) to 10(5) CFU/g of stool for each pathogen as well as quantitative detection up to 10(9) CFU/g. A total of 205 clinical fecal specimens from individuals with diarrhea, previously cultured for enteric pathogens and tested for Campylobacter by ELISA, were evaluated. Using these predicate methods as standards, sensitivities and specificities of the PCR-Luminex assay were 89% and 94% for Aeromonas, 89% and 93% for Campylobacter, 96% and 95% for Salmonella, 94% and 94% for Shigella, 92% and 97% for Vibrio, and 100% and 100% for Yersinia, respectively. All discrepant results were further examined by singleplex real-time PCR assays targeting different gene regions, which revealed 89% (55/62 results) concordance with the PCR-Luminex assay. The fluorescent signals obtained with this approach exhibited a statistically significant correlation with the cycle threshold (C(T)) values from the cognate real-time PCR assays (P PCR-Luminex assay enables sensitive, specific, and quantitative detection of the major bacterial causes of gastroenteritis. PMID:22075596

  17. Development of a versatile lab-on-a-chip enzyme assay platform for pathogen detection in CBRNE scenarios

    Science.gov (United States)

    Klemm, Richard; Schattschneider, Sebastian; Jahn, Tobias; Hlawatsch, Nadine; Julich, Sandra; Becker, Holger; Gärtner, Claudia

    2013-05-01

    The ability to integrate complete assays on a microfluidic chip helps to greatly simplify instrument requirements and allows the use of lab-on-a-chip technology in the field. A core application for such field-portable systems is the detection of pathogens in a CBRNE scenario such as permanent monitoring of airborne pathogens, e.g. in metro stations or hospitals etc. As one assay methodology for the pathogen identification, enzymatic assays were chosen. In order evaluate different detection strategies, the realized on-chip enzyme assay module has been designed as a general platform chip. In all application cases, the assays are based on immobilized probes located in microfluidic channels. Therefore a microfluidic chip was realized containing a set of three individually addressable channels, not only for detection of the sample itself also to have a set of references for a quantitative analysis. It furthermore includes two turning valves and a waste container for clear and sealed storage of potential pathogenic liquids to avoid contamination of the environment. All liquids remain in the chip and can be disposed of in proper way subsequently to the analysis. The chip design includes four inlet ports consisting of one sample port (Luer interface) and three mini Luer interfaces for fluidic support of e.g. washing buffer, substrate and enzyme solution. The sample can be applied via a special, sealable sampling vessel with integrated female Luer interface. Thereby also pre-anaytical contamination of the environment can be provided. Other reagents that are required for analysis will be stored off chip.

  18. Impact of early detection and treatment of diabetes on the 6-year prevalence of cardiac autonomic neuropathy in people with screen-detected diabetes

    DEFF Research Database (Denmark)

    Charles, Morten; Fleischer, J; Witte, Daniel Rinse;

    2013-01-01

    ADDITION Danmark undersøgte vi effekten af tidlig opsporing og efterfølgende intensive behandling af type 2 diabetes i almen praksis på hyppigheden af kardiel autonom neuropati 6 år efter diagnose. Resultater: Prævalensen af tidlig KAN var 15,1% i rutine behandlingsgruppen (RG) og 15.5% i intensive...

  19. Separation and detection of bacteria pathogenic on tomatoes by electromigration techniques

    Czech Academy of Sciences Publication Activity Database

    Horký, J.; Horká, Marie; Matoušková, H.

    Kusadasi : E.U. Faculty of Agriculture, 2007. s. 121. [International Symposium on Tomato Diseases /2./. 08.10.2007-12.10.2007, Kusadasi] R&D Projects: GA AV ČR IAAX00310701 Institutional research plan: CEZ:AV0Z40310501 Keywords : capilary isoelectric focusing * bacteria pathogens * tomato es Subject RIV: CB - Analytical Chemistry, Separation

  20. The development and application of the two real-time RT-PCR assays to detect the pathogen of HFMD.

    Directory of Open Access Journals (Sweden)

    Aili Cui

    Full Text Available Large-scale Hand, Foot, and Mouth Disease (HFMD outbreaks have frequently occurred in China since 2008, affecting more than one million children and causing several hundred children deaths every year. The pathogens of HFMD are mainly human enteroviruses (HEVs. Among them, human enterovirus 71 (HEV71 and coxsackievirus A16 (CVA16 are the most common pathogens of HFMD. However, other HEVs could also cause HFMD. To rapidly detect HEV71 and CVA16, and ensure detection of all HEVs causing HFMD, two real-time hybridization probe-based RT-PCR assays were developed in this study. One is a multiplex real-time RT-PCR assay, which was developed to detect and differentiate HEV71 specifically from CVA16 directly from clinical specimens within 1-2 h, and the other is a broad-spectrum real-time RT-PCR assay, which targeted almost all HEVs. The experiments confirmed that the two assays have high sensitivity and specificity, and the sensitivity was up to 0.1 TCID50/ml for detection of HEVs, HEV71, and CVA16, respectively. A total of 213 clinical specimens were simultaneously detected by three kinds of assays, including the two real-time RT-PCR assays, direct conventional RT-PCR assay, and virus isolation assay on human rhabdomyosarcoma cells (RD cells. The total positive rate of both HEV71 and CVA16 was 69.48% with real-time RT-PCR assay, 47.42% with RT-PCR assay, and 34.58% with virus isolation assay. One HFMD clinical specimen was positive for HEV, but negative for HEV71 or CVA16, which was identified as Echovirus 11 (Echo11 by virus isolation, RT-PCR, and sequencing for the VP1 gene. The two real-time RT-PCR assays had been applied in 31 provincial HFMD labs to detect the pathogens of HFMD, which has contributed to the rapid identification of the pathogens in the early stages of HFMD outbreaks, and helped to clarify the etiologic agents of HFMD in China.

  1. Detection of HPV and co-infecting pathogens in healthy Italian women by multiplex real-time PCR.

    Science.gov (United States)

    Camporiondo, Maria Pia; Farchi, Francesca; Ciccozzi, Massimo; Denaro, Aurelia; Gallone, Domenica; Maracchioni, Fabio; Favalli, Cartesio; Ciotti, Marco

    2016-01-01

    Several pathogens can be transmitted sexually and are an important cause of morbidity among sexually active women. The aim of the study was to detect the presence of human papillomavirus (HPV), Chlamydia trachomatis (CT), Neisseria gonorrhoeae (NG), Trichomonas vaginalis (TV), Mycoplasma hominis (MH), Mycoplasma genitalium (MG), Ureaplasma urealyticum (UU), and Ureaplasma parvum (UP) in a group of 309 healthy women enrolled at the San Camillo - Forlanini hospital of Rome by using two multiplex real-time PCR assays based on TOCE® technology. The women's ages ranged from 34 to 60 years, median 49 [IQR 45-54]. Of the 309 women tested, HPV DNA was detected in 77/309 (24.9%) patients. Of these, 44 (14.2%) harboured a single infection while 33 (10.7%) were infected by multiple genotypes. Prevalence of HPV infection was highest among females aged 40-50 years (15.2%). Of the other pathogens sought, CT, MG and NG were not detected while positive results were found for MH (12/309, 3.9%), TV (4/309, 1.3%), UP (89/309, 28.8%) and UU (14/309, 4.5%). Co-infections were as follows: 5 MH/HPV, 4 TV/HPV, 34 UP/HPV and 9 UU/HPV. In HPV-positive women, the probability of being infected by UP and UU was 2.5 (p=0.00045) and 6 fold higher (p=0.0016) than in HPV-negative women. The study supports the use of multiplex real-time PCR assays in a routine diagnostic setting. The high sensitivity and specificity of these assays along with the simultaneous detection of the most common sexually transmitted pathogens confers an advantage with respect to more obsolete methods reducing costs and time to diagnosis. PMID:27031891

  2. Ultrafiltration and Microarray for Detection of Microbial Source Tracking Marker and Pathogen Genes in Riverine and Marine Systems.

    Science.gov (United States)

    Li, Xiang; Harwood, Valerie J; Nayak, Bina; Weidhaas, Jennifer L

    2016-03-01

    Pathogen identification and microbial source tracking (MST) to identify sources of fecal pollution improve evaluation of water quality. They contribute to improved assessment of human health risks and remediation of pollution sources. An MST microarray was used to simultaneously detect genes for multiple pathogens and indicators of fecal pollution in freshwater, marine water, sewage-contaminated freshwater and marine water, and treated wastewater. Dead-end ultrafiltration (DEUF) was used to concentrate organisms from water samples, yielding a recovery efficiency of >95% for Escherichia coli and human polyomavirus. Whole-genome amplification (WGA) increased gene copies from ultrafiltered samples and increased the sensitivity of the microarray. Viruses (adenovirus, bocavirus, hepatitis A virus, and human polyomaviruses) were detected in sewage-contaminated samples. Pathogens such as Legionella pneumophila, Shigella flexneri, and Campylobacter fetus were detected along with genes conferring resistance to aminoglycosides, beta-lactams, and tetracycline. Nonmetric dimensional analysis of MST marker genes grouped sewage-spiked freshwater and marine samples with sewage and apart from other fecal sources. The sensitivity (percent true positives) of the microarray probes for gene targets anticipated in sewage was 51 to 57% and was lower than the specificity (percent true negatives; 79 to 81%). A linear relationship between gene copies determined by quantitative PCR and microarray fluorescence was found, indicating the semiquantitative nature of the MST microarray. These results indicate that ultrafiltration coupled with WGA provides sufficient nucleic acids for detection of viruses, bacteria, protozoa, and antibiotic resistance genes by the microarray in applications ranging from beach monitoring to risk assessment. PMID:26729716

  3. Simultaneous Detection of Four Human Pathogenic Microsporidian Species from Clinical Samples by Oligonucleotide Microarray

    OpenAIRE

    Wang, Zheng; Orlandi, Palmer A.; David A Stenger

    2005-01-01

    Microsporidian species have been rapidly emerging as human enteric pathogens in immunocompromised and immunocompetent individuals in recent years. Routine diagnostic techniques for microsporidia in clinical laboratories are laborious and insensitive and tend to underestimate their presence. In most instances, they are unable to differentiate species of spores due to their small sizes and similar morphologies. In this study, we report the development of another protozoan oligonucleotide microa...

  4. Pathogenic Chytrid Fungus Batrachochytrium dendrobatidis, but Not B. salamandrivorans, Detected on Eastern Hellbenders

    OpenAIRE

    Bales, Emma K.; Oliver J Hyman; Loudon, Andrew H.; Harris, Reid N.; Lipps, Gregory; Chapman, Eric; Roblee, Kenneth; John D Kleopfer; Terrell, Kimberly A.

    2015-01-01

    Recent worldwide declines and extinctions of amphibian populations have been attributed to chytridiomycosis, a disease caused by the pathogenic fungus Batrachochytrium dendrobatidis (Bd). Until recently, Bd was thought to be the only Batrachochytrium species that infects amphibians; however a newly described species, Batrachochytrium salamandrivorans (Bs), is linked to die-offs in European fire salamanders (Salamandra salamandra). Little is known about the distribution, host range, or origin ...

  5. Light scattering sensing detection of pathogens based on the molecular recognition of immunoglobulin with cell wall-associated protein A

    International Nuclear Information System (INIS)

    In this contribution, we report a rapid optical detection method of pathogens using Staphylococcus aureus (S. aureus) as the model analyte based on the molecular recognition of immunoglobulin with cell wall-associated Protein A (SpA). It was found that the molecular recognition of human immunoglobulin (IgG) with protein A on the cell wall of S. aureus on glass slide sensing area could result in strong surface enhanced light scattering (SELS) signals, and the SELS intensity (ΔI) increases proportionally with the concentration of S. aureus over the range of 2.5 x 105-1.0 x 108 CFU mL-1 with right angle light scattering (RALS) signals detection mode. In order to identify the solid support based molecular recognition between IgG with SpA, we also employed water-soluble CdS quantum dots (CdS-QDs) as a fluorescent marker for IgG by immobilizing the IgG onto the surfaces of CdS-QDs through covalent binding in order to generate recognition probes for SpA on the cell wall of S. aureus. Consequently, the fluorescent method also showed that the detection for pathogens with solid supports is reliable based on the molecular recognition of IgG with SpA

  6. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

    Directory of Open Access Journals (Sweden)

    J.A. Khan

    2013-09-01

    Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

  7. Detection of pathogenic bacteria in skin lesions of patients with chiclero's ulcer: reluctant response to antimonial treatment

    Directory of Open Access Journals (Sweden)

    Isaac-Márquez Angélica Patricia

    2003-01-01

    Full Text Available We investigated the bacterial flora present in skin lesions of patients with chiclero's ulcer from the Yucatan peninsula of Mexico using conventional culture methods (11 patients, and an immunocolorimetric detection of pathogenic Streptococcus pyogenes (15 patients. Prevalence of bacteria isolated by culture methods was 90.9% (10/11. We cultured, from chiclero's ulcers (60%, pathogenic bacterial such as Staphylococcus aureus (20%, S. pyogenes (1.6%, Pseudomonas aeruginosa (1.6%, Morganella morganii (1.6%, and opportunist pathogenic bacteria such as Klebsiella spp. (20.0%, Enterobacter spp. (20%, and Enterococcus spp. (20%. We also cultured coagulase-negative staphylococci in 40% (4/10 of the remaining patients. Micrococcus spp. and coagulase-negative staphylococci constituted the bacterial genuses more frequently isolated in the normal skin of patients with chiclero's ulcer and healthy individuals used as controls. We also undertook another study to find out the presence of S. pyogenes by an immunocolorimetric assay. This study indicated that 60% (9/15 of the ulcerated lesions, but not normal controls, were contaminated with S. pyogenes. Importantly, individuals with purulent secretion and holding concomitant infections with S. pyogenes, S. aureus, P. aeruginosa, M. morganii, and E. durans took longer to heal Leishmania (L. mexicana infections treated with antimonial drugs. Our results suggest the need to eliminate bacterial purulent infections, by antibiotic treatment, before starting antimonial administration to patients with chiclero's ulcer.

  8. Simulation of laser detection and ranging (LADAR) and forward-looking infrared (FLIR) data for autonomous tracking of airborne objects

    Science.gov (United States)

    Powell, Gavin; Markham, Keith C.; Marshall, David

    2000-06-01

    This paper presents the results of an investigation leading into an implementation of FLIR and LADAR data simulation for use in a multi sensor data fusion automated target recognition system. At present the main areas of application are in military environments but systems can easily be adapted to other areas such as security applications, robotics and autonomous cars. Recent developments have been away from traditional sensor modeling and toward modeling of features that are external to the system, such as atmosphere and part occlusion, to create a more realistic and rounded system. We have implemented such techniques and introduced a means of inserting these models into a highly detailed scene model to provide a rich data set for later processing. From our study and implementation we are able to embed sensor model components into a commercial graphics and animation package, along with object and terrain models, which can be easily used to create a more realistic sequence of images.

  9. Low-fouling surface plasmon resonance biosensor for multi-step detection of foodborne bacterial pathogens in complex food samples.

    Science.gov (United States)

    Vaisocherová-Lísalová, Hana; Víšová, Ivana; Ermini, Maria Laura; Špringer, Tomáš; Song, Xue Chadtová; Mrázek, Jan; Lamačová, Josefína; Scott Lynn, N; Šedivák, Petr; Homola, Jiří

    2016-06-15

    Recent outbreaks of foodborne illnesses have shown that foodborne bacterial pathogens present a significant threat to public health, resulting in an increased need for technologies capable of fast and reliable screening of food commodities. The optimal method of pathogen detection in foods should: (i) be rapid, specific, and sensitive; (ii) require minimum sample preparation; and (iii) be robust and cost-effective, thus enabling use in the field. Here we report the use of a SPR biosensor based on ultra-low fouling and functionalizable poly(carboxybetaine acrylamide) (pCBAA) brushes for the rapid and sensitive detection of bacterial pathogens in crude food samples utilizing a three-step detection assay. We studied both the surface resistance to fouling and the functional capabilities of these brushes with respect to each step of the assay, namely: (I) incubation of the sensor with crude food samples, resulting in the capture of bacteria by antibodies immobilized to the pCBAA coating, (II) binding of secondary biotinylated antibody (Ab2) to previously captured bacteria, and (III) binding of streptavidin-coated gold nanoparticles to the biotinylated Ab2 in order to enhance the sensor response. We also investigated the effects of the brush thickness on the biorecognition capabilities of the gold-grafted functionalized pCBAA coatings. We demonstrate that pCBAA-compared to standard low-fouling OEG-based alkanethiolate self-assemabled monolayers-exhibits superior surface resistance regarding both fouling from complex food samples as well as the non-specific binding of S-AuNPs. We further demonstrate that a SPR biosensor based on a pCBAA brush with a thickness as low as 20 nm was capable of detecting E. coli O157:H7 and Salmonella sp. in complex hamburger and cucumber samples with extraordinary sensitivity and specificity. The limits of detection for the two bacteria in cucumber and hamburger extracts were determined to be 57 CFU/mL and 17 CFU/mL for E. coli and 7.4 × 10

  10. Cybersecurity for aerospace autonomous systems

    Science.gov (United States)

    Straub, Jeremy

    2015-05-01

    High profile breaches have occurred across numerous information systems. One area where attacks are particularly problematic is autonomous control systems. This paper considers the aerospace information system, focusing on elements that interact with autonomous control systems (e.g., onboard UAVs). It discusses the trust placed in the autonomous systems and supporting systems (e.g., navigational aids) and how this trust can be validated. Approaches to remotely detect the UAV compromise, without relying on the onboard software (on a potentially compromised system) as part of the process are discussed. How different levels of autonomy (task-based, goal-based, mission-based) impact this remote characterization is considered.

  11. Detection of respiratory viral and bacterial pathogens causing pediatric community-acquired pneumonia in Beijing using real-time PCR

    Institute of Scientific and Technical Information of China (English)

    Tie-Gang Zhang; Ai-Hua Li; Min Lyu; Meng Chen; Fang Huang; Jiang Wu

    2015-01-01

    Objective: The aim of this study was to determine the etiology and prevalence of pediatric CAP in Beijing using a real-time polymerase chain reaction (PCR) technique. Methods: Between February 15, 2011 and January 18, 2012, 371 pediatric patients with CAP were enrolled at Beijing Children's Hospital. Sixteen respiratory viruses and two bacteria were detected from tracheal aspirate specimens using commercially available multiplex real-time reverse transcription PCR (RT-PCR) kits. Results: A single viral pathogen was detected in 35.3%of enrolled patients, multiple viruses in 11.6%, and virus/bacteria co-infection in 17.8%. In contrast, only 6.5%of patients had a single bacterial pathogen and 2.2%were infected with multiple bacteria. The etiological agent was unknown for 26.7% of patients. The most common viruses were respiratory syncytial virus (RSV) (43.9%), rhinovirus (14.8%), parainfluenza virus (9.4%), and adenovirus (8.6%). In patients under three years of age, RSV (44.6%), rhinovirus (12.8%), and Streptococcus pneumoniae (9.9%) were the most frequent pathogens. In children aged 3e7 years, S. pneumoniae (38.9%), RSV (30.6%), Haemophilus influenzae (19.4%), and adenovirus (19.4%) were most prevalent. Finally in children over seven years, RSV (47.3%), S. pneumoniae (41.9%), and rhinovirus (21.5%) infections were most frequent. Conclusions: Viral pathogens, specifically RSV, were responsible for the majority of CAP in pediatric patients. However, both S. pneumoniae and H. influenzae contributed as major causes of disease. Commercially available multiplexing real-time PCR allowed for rapid detection of the etiological agent. Copyright © 2015, Chinese Medical Association Production. Production and hosting by Elsevier B.V. on behalf of KeAi Communications Co., Ltd. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

  12. Radio detection of cosmic ray air showers by the RAuger experiment, a fully autonomous and self-triggered system installed at the Pierre Auger Observatory

    International Nuclear Information System (INIS)

    RAuger is a radio experiment constituting three fully autonomous and self-triggered radio stations installed at the center of the Pierre Auger Observatory's Surface Detector (SD). It aims at the radio detection of the electric field emitted by the secondary charged particles of the atmospherical shower initiated by ultra-high energy cosmic rays. Installed in November 2006, we recorded the first atmospherical showers in coincidence with the SD in July 2007. Up to now, 65 such coincidences have been obtained. The skymap in local coordinates (zenith angle, azimuth) of these events presents a strong azimuthal asymmetry in agreement with what was observed in the Northern hemisphere by the CODALEMA experiment (the asymmetry is simply switched by 180° in azimuth). We also recorded a threefold coincidence making possible a complete reconstruction: both the radio reconstructed shower axis and the shower energy are in perfect agreement with the SD estimations.

  13. Sampling and Homogenization Strategies Significantly Influence the Detection of Foodborne Pathogens in Meat

    Directory of Open Access Journals (Sweden)

    Alexander Rohde

    2015-01-01

    Full Text Available Efficient preparation of food samples, comprising sampling and homogenization, for microbiological testing is an essential, yet largely neglected, component of foodstuff control. Salmonella enterica spiked chicken breasts were used as a surface contamination model whereas salami and meat paste acted as models of inner-matrix contamination. A systematic comparison of different homogenization approaches, namely, stomaching, sonication, and milling by FastPrep-24 or SpeedMill, revealed that for surface contamination a broad range of sample pretreatment steps is applicable and loss of culturability due to the homogenization procedure is marginal. In contrast, for inner-matrix contamination long treatments up to 8 min are required and only FastPrep-24 as a large-volume milling device produced consistently good recovery rates. In addition, sampling of different regions of the spiked sausages showed that pathogens are not necessarily homogenously distributed throughout the entire matrix. Instead, in meat paste the core region contained considerably more pathogens compared to the rim, whereas in the salamis the distribution was more even with an increased concentration within the intermediate region of the sausages. Our results indicate that sampling and homogenization as integral parts of food microbiology and monitoring deserve more attention to further improve food safety.

  14. First detection of the larval chalkbrood disease pathogen Ascosphaera apis (Ascomycota: Eurotiomycetes: Ascosphaerales in adult bumble bees.

    Directory of Open Access Journals (Sweden)

    Sarah A Maxfield-Taylor

    Full Text Available Fungi in the genus Ascosphaera (Ascomycota: Eurotiomycetes: Ascosphaerales cause chalkbrood disease in larvae of bees. Here, we report the first-ever detection of the fungus in adult bumble bees that were raised in captivity for studies on colony development. Wild queens of Bombus griseocollis, B. nevadensis and B. vosnesenskii were collected and maintained for establishment of nests. Queens that died during rearing or that did not lay eggs within one month of capture were dissected, and tissues were examined microscopically for the presence of pathogens. Filamentous fungi that were detected were plated on artificial media containing broad spectrum antibiotics for isolation and identification. Based on morphological characters, the fungus was identified as Ascosphaera apis (Maasen ex Claussen Olive and Spiltoir, a species that has been reported earlier only from larvae of the European honey bee, Apis mellifera, the Asian honey bee, Apis cerana, and the carpenter bee Xylocopa californica arizonensis. The identity of the fungus was confirmed using molecular markers and phylogenetic analysis. Ascosphaera apis was detected in queens of all three bumble bee species examined. Of 150 queens dissected, 12 (8% contained vegetative and reproductive stages of the fungus. Both fungal stages were also detected in two workers collected from colonies with Ascosphaera-infected B. nevadensis queens. In this study, wild bees could have been infected prior to capture for rearing, or, the A. apis infection could have originated via contaminated European honey bee pollen fed to the bumble bees in captivity. Thus, the discovery of A. apis in adult bumble bees in the current study has important implications for commercial production of bumble bee colonies and highlights potential risks to native bees via pathogen spillover from infected bees and infected pollen.

  15. Recovery Based Nanowire Field-Effect Transistor Detection of Pathogenic Avian Influenza DNA

    Science.gov (United States)

    Lin, Chih-Heng; Chu, Chia-Jung; Teng, Kang-Ning; Su, Yi-Jr; Chen, Chii-Dong; Tsai, Li-Chu; Yang, Yuh-Shyong

    2012-02-01

    Fast and accurate diagnosis is critical in infectious disease surveillance and management. We proposed a DNA recovery system that can easily be adapted to DNA chip or DNA biosensor for fast identification and confirmation of target DNA. This method was based on the re-hybridization of DNA target with a recovery DNA to free the DNA probe. Functionalized silicon nanowire field-effect transistor (SiNW FET) was demonstrated to monitor such specific DNA-DNA interaction using high pathogenic strain virus hemagglutinin 1 (H1) DNA of avian influenza (AI) as target. Specific electric changes were observed in real-time for AI virus DNA sensing and device recovery when nanowire surface of SiNW FET was modified with complementary captured DNA probe. The recovery based SiNW FET biosensor can be further developed for fast identification and further confirmation of a variety of influenza virus strains and other infectious diseases.

  16. Autonomous Search

    CERN Document Server

    Hamadi, Youssef; Saubion, Frédéric

    2012-01-01

    Decades of innovations in combinatorial problem solving have produced better and more complex algorithms. These new methods are better since they can solve larger problems and address new application domains. They are also more complex which means that they are hard to reproduce and often harder to fine-tune to the peculiarities of a given problem. This last point has created a paradox where efficient tools are out of reach of practitioners. Autonomous search (AS) represents a new research field defined to precisely address the above challenge. Its major strength and originality consist in the

  17. Molecular techniques for pathogen identification and fungus detection in the environment

    OpenAIRE

    Tsui, C.K.M.; Woodhall, J.; Chen, W.; Lévesque, C.A.; Lau, A; Schoen, C.D.; Baschien, C.; Najafzadeh, M.J.; Hoog, de, G.S.

    2011-01-01

    Many species of fungi can cause disease in plants, animals and humans. Accurate and robust detection and quantification of fungi is essential for diagnosis, modeling and surveillance. Also direct detection of fungi enables a deeper understanding of natural microbial communities, particularly as a great many fungi are difficult or impossible to cultivate. In the last decade, effective amplification platforms, probe development and various quantitative PCR technologies have revolutionized resea...

  18. Multiplex-PCR for simultaneous detection of 3 bacterial fish pathogens, Flavobacterium columnare, Edwardsiella ictaluri, and Aeromonas hydrophila.

    Science.gov (United States)

    Panangala, Victor S; Shoemaker, Craig A; Van Santen, Vicky L; Dybvig, Kevin; Klesius, Phillip H

    2007-03-13

    A multiplex PCR (m-PCR) method was developed for simultaneous detection of 3 important fish pathogens in warm water aquaculture. The m-PCR to amplify target DNA fragments from Flavobacterium columnare (504 bp), Edwardsiella ictaluri (407 bp) and Aeromonas hydrophila (209 bp) was optimized by adjustment of reaction buffers and a touchdown protocol. The lower detection limit for each of the 3 bacteria was 20 pg of nucleic acid template from each bacteria per m-PCR reaction mixture. The sensitivity threshold for detection of the 3 bacteria in tissues ranged between 3.4 x 10(2) and 2.5 x 10(5) cells g(-1) of tissue (channel catfish Ictalurus punctatus Rafinesque). The diagnostic sensitivity and specificity of the m-PCR was evaluated with 10 representative isolates of each of the 3 bacteria and 11 other Gram-negative and 2 Gram-positive bacteria that are taxonomically related or ubiquitous in the aquatic environment. Except for a single species (A. salmonicida subsp. salmonicida), each set of primers specifically amplified the target DNA of the cognate species of bacteria. m-PCR was compared with bacteriological culture for identification of bacteria in experimentally infected fish. The m-PCR appears promising for the rapid, sensitive and simultaneous detection of Flavobacterium columnare, E. ictaluri and A. hydrophila in infected fish compared to the time-consuming traditional bacteriological culture techniques. PMID:17465305

  19. Use of sensitive, broad-spectrum molecular assays and human airway epithelium cultures for detection of respiratory pathogens.

    Directory of Open Access Journals (Sweden)

    Krzysztof Pyrc

    Full Text Available Rapid and accurate detection and identification of viruses causing respiratory tract infections is important for patient care and disease control. Despite the fact that several assays are available, identification of an etiological agent is not possible in ~30% of patients suffering from respiratory tract diseases. Therefore, the aim of the current study was to develop a diagnostic set for the detection of respiratory viruses with sensitivity as low as 1-10 copies per reaction. Evaluation of the assay using a training clinical sample set showed that viral nucleic acids were identified in ~76% of cases. To improve assay performance and facilitate the identification of novel species or emerging strains, cultures of fully differentiated human airway epithelium were used to pre-amplify infectious viruses. This additional step resulted in the detection of pathogens in all samples tested. Based on these results it can be hypothesized that the lack of an etiological agent in some clinical samples, both reported previously and observed in the present study, may result not only from the presence of unknown viral species, but also from imperfections in the detection methods used.

  20. Detection and typing of highly pathogenic porcine reproductive and respiratory syndrome virus by multiplex real-time rt-PCR.

    Directory of Open Access Journals (Sweden)

    Kerstin Wernike

    Full Text Available Porcine reproductive and respiratory syndrome (PRRS causes economic losses in the pig industry worldwide, and PRRS viruses (PRRSV are classified into the two distinct genotypes "North American (NA, type 2" and "European (EU, type 1". In 2006, a highly pathogenic NA strain of PRRSV (HP-PRRSV, characterized by high fever as well as high morbidity and mortality, emerged in swine farms in China. Therefore, a real-time reverse transcription polymerase chain reaction (RT-qPCR assay specific for HP-PRRSV was developed and combined with type 1- and type 2-specific RT-qPCR systems. Furthermore, an internal control, based on a heterologous RNA, was successfully introduced. This final multiplex PRRSV RT-qPCR, detecting and typing PRRSV, had an analytical sensitivity of less than 200 copies per µl for the type 1-assay and 20 copies per µl for the type 2- and HP assays and a high diagnostic sensitivity. A panel of reference strains and field isolates was reliably detected and samples from an animal trial with a Chinese HP-PRRS strain were used for test validation. The new multiplex PRRSV RT-qPCR system allows for the first time the highly sensitive detection and rapid differentiation of PRRSV of both genotypes as well as the direct detection of HP-PRRSV.

  1. Comparison of subgingival bacterial sampling with oral lavage for detection and quantification of periodontal pathogens by real-time polymerase chain reaction

    OpenAIRE

    Boutaga, Khalil; Savelkoul, Paul H. M.; Winkel, Edwin G.; van Winkelhoff, Arie J.

    2007-01-01

    Background: Saliva has been studied for the presence of subgingival pathogens in periodontitis patients. With the anaerobic culture technique, the discrepancy between salivary recovery and subgingival presence has been significant, which makes this approach not suitable for practical use in the microbial diagnosis of periodontitis patients. The real-time polymerase chain reaction (PCR) technique represents a very sensitive technique to detect and quantify bacterial pathogens. The aim of the s...

  2. Nanomaterial-based sensors for detection of foodborne bacterial pathogens and toxins as well as pork adulteration in meat products

    OpenAIRE

    Stephen Inbaraj, B; Chen, B H

    2016-01-01

    Food safety draws considerable attention in the modern pace of the world owing to rapid-changing food recipes and food habits. Foodborne illnesses associated with pathogens, toxins, and other contaminants pose serious threat to human health. Besides, a large amount of money is spent on both analyses and control measures, which causes significant loss to the food industry. Conventional detection methods for bacterial pathogens and toxins are time consuming and laborious, requiring certain soph...

  3. Studies on learning by detecting impasse and by resulting it for building large scale knowledge base for autonomous plant

    International Nuclear Information System (INIS)

    The acquisition of knowledge from human experts in an exhaustive way is extremely difficult, and even if it were possible, the maintenance of such a large knowledge base for realtime operation is not an easy task. The autonomous system having just incomplete knowledge would face with so many problems that contradicts with the system's current beliefs and/or are novel or unknown to the system. Experienced humans can manage to do with such novelty due to their generalizing ability and analogical inference based on the repertoire of precedents, even if they with new problems. Moreover, through experiencing such breakdowns and impasse, they can acquire some novel knowledge by their proactive attempts to interpret a provided problem as well as by updating their beliefs and contents and organization of their prior knowledge. We call such a style of learning as impasse-driven learning, meaning that learning dose occur being motivated by facing with contradiction and impasse. The related studies concerning with such a style of leaning have been studied within a field of machine learning of artificial intelligence so far as well as within a cognitive science field. In this paper, we at first summarize an outline of machine learning methodologies, and then, we detail about the impasse-driven learning. We discuss that from two different perspective of learning, one is from deductive and analogical learning and the other one is from inductive conceptual learning (i.e., concept formation or generalization-based memory). The former mainly discuss about how the learning system updates its prior beliefs and knowledge so that it can explain away the current contradiction using some meta-cognition heuristics. The latter attempts to assimilate a contradicting problem into its prior memory structure by dynamically reorganizing a collection of the precedents. We present those methodologies, and finally we introduce a case study of concept formation for plant anomalies and its usage for

  4. A novel electrochemical aptasensor for highly sensitive detection of thrombin based on the autonomous assembly of hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme nanowires

    International Nuclear Information System (INIS)

    Highlights: • This assay is label-free, the signal can be read out by measuring the electrochemical signal of hemin. • The hemin/G-quadruplex HRP-DNAzyme nanowires were formed via EXPAR reaction and HCR. • The prepared aptasensor exhibited low detection limit and wide linear range to TB. - Abstract: In this work, a new signal amplified strategy was constructed based on isothermal exponential amplification reaction (EXPAR) and hybridization chain reaction (HCR) generating the hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme (HRP-mimicking DNAzyme) nanowires as signal output component for the sensitive detection of thrombin (TB). We employed EXPAR’s ultra-high amplification efficiency to produce a large amount of two hairpin helper DNAs within a minutes. And then the resultant two hairpin helper DNAs could autonomously assemble the hemin/G-quadruplex HRP-mimicking DNAzymes nanowires as the redox-active reporter units on the electrode surface via hybridization chain reaction (HCR). The hemin/G-quadruplex structures simultaneously served as electron transfer medium and electrocatalyst to amplify the signal in the presence of H2O2. Specifically, only when the EXPAR reaction process has occurred, the HCR could be achieved and the hemin/G-quadruplex complexes could be formed on the surface of an electrode to give a detectable signal. The proposed strategy combines the amplification power of the EXPAR, HCR, and the inherent high sensitivity of the electrochemical detection. With such design, the proposed assay showed a good linear relationship within the range of 0.1 pM–50 nM with a detection limit of 33 fM (defined as S/N = 3) for TB

  5. A novel electrochemical aptasensor for highly sensitive detection of thrombin based on the autonomous assembly of hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme nanowires

    Energy Technology Data Exchange (ETDEWEB)

    Xie, Shunbi, E-mail: xieshunbi@163.com; Chai, Yaqin, E-mail: yaqinchai@swu.edu.cn; Yuan, Yali; Bai, Lijuan; Yuan, Ruo, E-mail: yuanruo@swu.edu.cn

    2014-06-01

    Highlights: • This assay is label-free, the signal can be read out by measuring the electrochemical signal of hemin. • The hemin/G-quadruplex HRP-DNAzyme nanowires were formed via EXPAR reaction and HCR. • The prepared aptasensor exhibited low detection limit and wide linear range to TB. - Abstract: In this work, a new signal amplified strategy was constructed based on isothermal exponential amplification reaction (EXPAR) and hybridization chain reaction (HCR) generating the hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme (HRP-mimicking DNAzyme) nanowires as signal output component for the sensitive detection of thrombin (TB). We employed EXPAR’s ultra-high amplification efficiency to produce a large amount of two hairpin helper DNAs within a minutes. And then the resultant two hairpin helper DNAs could autonomously assemble the hemin/G-quadruplex HRP-mimicking DNAzymes nanowires as the redox-active reporter units on the electrode surface via hybridization chain reaction (HCR). The hemin/G-quadruplex structures simultaneously served as electron transfer medium and electrocatalyst to amplify the signal in the presence of H{sub 2}O{sub 2}. Specifically, only when the EXPAR reaction process has occurred, the HCR could be achieved and the hemin/G-quadruplex complexes could be formed on the surface of an electrode to give a detectable signal. The proposed strategy combines the amplification power of the EXPAR, HCR, and the inherent high sensitivity of the electrochemical detection. With such design, the proposed assay showed a good linear relationship within the range of 0.1 pM–50 nM with a detection limit of 33 fM (defined as S/N = 3) for TB.

  6. Pure Autonomic Failure

    Science.gov (United States)

    ... Drugs GARD Information Navigator FAQs About Rare Diseases Pure autonomic failure Title Other Names: Bradbury Eggleston syndrome; ... Categories: Nervous System Diseases ; RDCRN Summary Summary Listen Pure autonomic failure is characterized by generalized autonomic failure ...

  7. DNA Sequence Signatures for Rapid Detection of Six Target Bacterial Pathogens Using PCR Assays.

    Science.gov (United States)

    Nagamine, Kenjiro; Hung, Guo-Chiuan; Li, Bingjie; Lo, Shyh-Ching

    2015-01-01

    Using Streptococcus pyogenes as a model, we previously established a stepwise computational workflow to effectively identify species-specific DNA signatures that could be used as PCR primer sets to detect target bacteria with high specificity and sensitivity. In this study, we extended the workflow for the rapid development of PCR assays targeting Enterococcus faecalis, Enterococcus faecium, Clostridium perfringens, Clostridium difficile, Clostridium tetani, and Staphylococcus aureus, which are of safety concern for human tissue intended for transplantation. Twenty-one primer sets that had sensitivity of detecting 5-50 fg DNA from target bacteria with high specificity were selected. These selected primer sets can be used in a PCR array for detecting target bacteria with high sensitivity and specificity. The workflow could be widely applicable for the rapid development of PCR-based assays for a wide range of target bacteria, including those of biothreat agents. PMID:26279626

  8. Detection of pathogenic Campylobacter, E. coli O157:H7 and Salmonella spp. in wastewater by PCR assay.

    Science.gov (United States)

    Bonetta, Si; Pignata, C; Lorenzi, E; De Ceglia, M; Meucci, L; Bonetta, Sa; Gilli, G; Carraro, E

    2016-08-01

    The aim of this study was the evaluation of the occurrence of pathogenic Campylobacter, Escherichia coli O157:H7, E. coli virulence genes and Salmonella spp. in different wastewater treatment plants (WWTPs) using a method based on an enrichment step and PCR. This method was sensitive enough to detect low levels (∼2 CFU100 ml(-1) of raw sewage) of all the investigated pathogens. In the WWTP samples, E. coli O157:H7 DNA and the eae gene were never found, but 33 % of influents and effluents exhibited amplicons corresponding to Shiga-like toxin I. Twenty-five percent of the influent and 8 % of the effluent exhibited the presence of Shiga-like toxin II. Campylobacter jejuni and C. coli DNA were identified in 50 and 25 % of the influents and in 8 and 25 % of the effluents, respectively. Salmonella spp. DNA was present in all the samples. Considering the results obtained, the method tested here offers a reliable and expeditious tool for evaluating the efficiency of the effluent treatment in order to mitigate contamination risk. Influent contamination by Salmonella spp. and Campylobacter spp. provides indirect information about their circulation; moreover, their presence in effluents underlines the role of WWTPs in the contamination of the receiving surface waters, which affects public health directly or indirectly. PMID:27106076

  9. Widespread occurrence of diverse human pathogenic types of the fungus Fusarium detected in plumbing drains.

    Science.gov (United States)

    Short, Dylan P G; O'Donnell, Kerry; Zhang, Ning; Juba, Jean H; Geiser, David M

    2011-12-01

    It has been proposed that plumbing systems might serve as a significant environmental reservoir of human-pathogenic isolates of Fusarium. We tested this hypothesis by performing the first extensive multilocus sequence typing (MLST) survey of plumbing drain-associated Fusarium isolates and comparing the diversity observed to the known diversity of clinical Fusarium isolates. We sampled 471 drains, mostly in bathroom sinks, from 131 buildings in the United States using a swabbing method. We found that 66% of sinks and 80% of buildings surveyed yielded at least one Fusarium culture. A total of 297 isolates of Fusarium collected were subjected to MLST to identify the phylogenetic species and sequence types (STs) of these isolates. Our survey revealed that the six most common STs in sinks were identical to the six most frequently associated with human infections. We speculate that the most prevalent STs, by virtue of their ability to form and grow in biofilms, are well adapted to plumbing systems. Six major Fusarium STs were frequently isolated from plumbing drains within a broad geographic area and were identical to STs frequently associated with human infections. PMID:21976755

  10. Au/Si nanorod-based biosensor for food pathogen detection

    Science.gov (United States)

    Technical Abstract Among several potentials of nanotechnology applications for food industry, development of nanoscale sensors for food safety and quality measurement are emerging. A novel biosensor for Salmonella detection was developed using Au/Si nanorods. The Si nanorods were fabricated by gla...

  11. International Standardisation of a Method for Detection of Human Pathogenic Viruses in Molluscan Shellfish

    DEFF Research Database (Denmark)

    Lees, David; Schultz, Anna Charlotte

    2010-01-01

    The viruses primarily associated with shellfish-borne illness are norovirus, causing gastroenteritis and hepatitis A virus (HAV). Recent years have seen a proliferation of publications on methods for detection of these viruses in shellfish using polymerase chain reaction (PCR). However, currently...

  12. An Immunofluorescence Assay to Detect Urediniospores of the Soybean Rust Pathogen, Phakopsora pachyrhizi

    Science.gov (United States)

    An indirect immunofluorescence spore assay (IFSA) was developed to detect urediniospores of Phakopsora pachyrhizi, utilizing rabbit polyclonal antisera produced in response to intact non-germinated (SBR1A) or germinated (SBR2) urediniospores of P. pachyrhizi. Both antisera were specific to Phakopso...

  13. Detection of the Bacterial Potato Pathogens Pectobacterium and Dickeya spp. Using Conventional and Real-Time PCR.

    Science.gov (United States)

    Humphris, Sonia N; Cahill, Greig; Elphinstone, John G; Kelly, Rachel; Parkinson, Neil M; Pritchard, Leighton; Toth, Ian K; Saddler, Gerry S

    2015-01-01

    Blackleg and soft rot of potato, caused by Pectobacterium and Dickeya spp., are major production constraints in many potato-growing regions of the world. Despite advances in our understanding of the causative organisms, disease epidemiology, and control, blackleg remains the principal cause of down-grading and rejection of potato seed in classification schemes across Northern Europe and many other parts of the world. Although symptom recognition is relatively straightforward and is applied universally in seed classification schemes, attributing disease to a specific organism is problematic and can only be achieved through the use of diagnostics. Similarly as disease spread is largely through the movement of asymptomatically infected seed tubers and, possibly in the case of Dickeya spp., irrigation waters, accurate and sensitive diagnostics are a prerequisite for detection. This chapter describes the diagnostic pathway that can be applied to identify the principal potato pathogens within the genera Pectobacterium and Dickeya. PMID:25981242

  14. Experiment on Synchronous Timing Signal Detection from ISDB-T Terrestrial Digital TV Signal with Application to Autonomous Distributed ITS-IVC Network

    Science.gov (United States)

    Karasawa, Yoshio; Kumagai, Taichi; Takemoto, Atsushi; Fujii, Takeo; Ito, Kenji; Suzuki, Noriyoshi

    A novel timing synchronizing scheme is proposed for use in inter-vehicle communication (IVC) with an autonomous distributed intelligent transport system (ITS). The scheme determines the timing of packet signal transmission in the IVC network and employs the guard interval (GI) timing in the orthogonal frequency divisional multiplexing (OFDM) signal currently used for terrestrial broadcasts in the Japanese digital television system (ISDB-T). This signal is used because it is expected that the automotive market will demand the capability for cars to receive terrestrial digital TV broadcasts in the near future. The use of broadcasts by automobiles presupposes that the on-board receivers are capable of accurately detecting the GI timing data in an extremely low carrier-to-noise ratio (CNR) condition regardless of a severe multipath environment which will introduce broad scatter in signal arrival times. Therefore, we analyzed actual broadcast signals received in a moving vehicle in a field experiment and showed that the GI timing signal is detected with the desired accuracy even in the case of extremely low-CNR environments. Some considerations were also given about how to use these findings.

  15. Detection of pathogenic Yersinia enterocolitica in slaughtered pigs by cultural methods and real-time polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Rina Mazzette

    2015-05-01

    Full Text Available Healthy pigs carrying pathogenic to human Yersinia enterocolitica strains are the main source of entry into slaughterhouse, where cross-contamination of carcasses can happen. The aim of this work was to determine Y. enterocolitica prevalence in slaughtered pigs, investigating the presence of carriers in relation to carcass contamination. A total of 132 pig samples (tonsils, mesenteric lymph nodes, colon content, carcass surface were collected from 4 Sardinian slaughterhouses. All the samples were examined by the ISO 10273:2003 method, and the prevalence was also determined by direct plating on CIN Agar. Moreover, to detect the ail positive Y. enterocolitica strains in enrichment broths and isolates a real-time polymerase chain reaction (PCR was applied. Y. enterocolitica prevalence was 19% with direct plating and 12% with enrichment methods. Carcass surfaces and tonsils prevalence was 5.30% by direct plating, and 5.3% and 2.2%, respectively, by enrichment method. Tonsil samples showed an average contamination level of 3.2×103 CFU/g, while the mean value on carcass was 8.7×102 CFU/g. An overall prevalence of 9.8% of ail positive Y. enterocolitica broths was detected by RT-PCR, that found a higher prevalence in tonsils (7.5% with respect to cultural methods, confirming the greater sensitivity of this technique when applied for tonsils and faeces samples. The results show a relatively low pathogenic Y. enterocolitica prevalence in pigs slaughtered in Sardinia. Good hygiene measures should be applied at slaughterhouse in order to prevent the entry of carriers and control carcass contamination.

  16. A Two-Tube Multiplex Reverse Transcription PCR Assay for Simultaneous Detection of Viral and Bacterial Pathogens of Infectious Diarrhea

    Directory of Open Access Journals (Sweden)

    Ji Wang

    2014-01-01

    Full Text Available Diarrhea caused by viral and bacterial infections is a major health problem in developing countries. The purpose of this study is to develop a two-tube multiplex PCR assay using automatic electrophoresis for simultaneous detection of 13 diarrhea-causative viruses or bacteria, with an intended application in provincial Centers for Diseases Control and Prevention, China. The assay was designed to detect rotavirus A, norovirus genogroups GI and GII, human astrovirus, enteric adenoviruses, and human bocavirus (tube 1, and Salmonella, Vibrio parahaemolyticus, diarrheagenic Escherichia coli, Campylobacter jejuni, Shigella, Yersinia, and Vibrio cholera (tube 2. The analytical specificity was examined with positive controls for each pathogen. The analytical sensitivity was evaluated by performing the assay on serial tenfold dilutions of in vitro transcribed RNA, recombinant plasmids, or bacterial culture. A total of 122 stool samples were tested by this two-tube assay and the results were compared with those obtained from reference methods. The two-tube assay achieved a sensitivity of 20–200 copies for a single virus and 102-103 CFU/mL for bacteria. The clinical performance demonstrated that the two-tube assay had comparable sensitivity and specificity to those of reference methods. In conclusion, the two-tube assay is a rapid, cost-effective, sensitive, specific, and high throughput method for the simultaneous detection of enteric bacteria and virus.

  17. A sensitive nested reverse transcriptase PCR assay to detect viable cells of the fish pathogen Renibacterium salmoninarum in Atlantic salmon (Salmo salar L.).

    Science.gov (United States)

    Cook, M; Lynch, W H

    1999-07-01

    A nested reverse transcriptase (RT) PCR assay detected mRNA of the salmonid pathogen Renibacterium salmoninarum in samples of RNA extracts of between 1 and 10 cells. Total RNA was extracted from cultured bacteria, Atlantic salmon (Salmo salar L.) kidney tissue and ovarian fluid seeded with the pathogen, and kidney tissue from both experimentally challenged and commercially raised fish. Following DNase treatment, extracted RNA was amplified by both RT PCR and PCR by using primers specific for the gene encoding the major protein antigen of R. salmoninarum. A 349-bp amplicon was detected by polyacrylamide gel electrophoresis and silver stain. Inactivation of cultured bacteria by rifampin or erythromycin produced a loss of nested RT PCR mRNA detection corresponding to a loss of bacterial cell viability determined from plate counts but no loss of DNA detection by PCR. In subclinically diseased fish, nested RT PCR identified similar levels of infected fish as determined by viable pathogen culture. Higher percentages of fish testing positive were generated by PCR, particularly in samples from fish previously subjected to antibiotic chemotherapy where 93% were PCR positive, but only 7% were nested RT PCR and culture positive. PCR can generate false-positive data from amplification of target DNA from nonviable pathogen cells. Therefore, nested RT PCR may prove useful for monitoring cultured Atlantic salmon for the presence of viable R. salmoninarum within a useful time frame, particularly samples from broodstock where antibiotic chemotherapy is used prior to spawning to reduce vertical pathogen transmission. PMID:10388701

  18. Comparison of the EntericBio multiplex PCR system with routine culture for detection of bacterial enteric pathogens.

    LENUS (Irish Health Repository)

    O'Leary, James

    2009-11-01

    The EntericBio system uses a multiplex PCR assay for the simultaneous detection of Campylobacter spp., Salmonella enterica, Shigella spp., and Escherichia coli O157 from feces. It combines overnight broth enrichment with PCR amplification and detection by hybridization. An evaluation of this system was conducted by comparing the results obtained with the system with those obtained by routine culture, supplemented with alternative PCR detection methods. In a study of 773 samples, routine culture and the EntericBio system yielded 94.6 and 92.4% negative results, respectively. Forty-two samples had positive results by culture, and all of these were positive with the EntericBio system. This system detected an additional 17 positive samples (Campylobacter spp., n = 12; Shigella spp., n = 1; E. coli O157, n = 4), but the results for 5 samples (Campylobacter spp., n = 2; Shigella spp., n = 1; E. coli O157, n = 2) could not be confirmed. The target for Shigella spp. detected by the EntericBio system is the ipaH gene, and the molecular indication of the presence of Shigella spp. was investigated by sequence analysis, which confirmed that the ipaH gene was present in a Klebsiella pneumoniae isolate from the patient. The sensitivity, specificity, positive predictive value, and negative predictive value were 100%, 99.3%, 91.5%, and 100%, respectively. Turnaround times were significantly reduced with the EntericBio system, and a result was available between 24 and 32 h after receipt of the sample in the laboratory. In addition, the amount of laboratory waste was significantly reduced by use of this system. In summary, the EntericBio system proved convenient to use, more sensitive than the conventional culture used in this study, and highly specific; and it generated results significantly faster than routine culture for the pathogens tested.

  19. Ultra-Fast Low Concentration Detection of Candida Pathogens Utilizing High Resolution Micropore Chips

    Directory of Open Access Journals (Sweden)

    2009-03-01

    Full Text Available Although Candida species are the fourth most common cause of nosocomial blood stream infections in the United States, early diagnostic tools for invasive candidemia are lacking. Due to an increasing rate of candidemia, a new screening system is needed to detect the Candida species in a timely manner. Here we describe a novel method of detection using a solid-state micro-scale pore similar to the operational principles of a Coulter counter. With a steady electrolyte current flowing through the pore, measurements are taken of changes in the current corresponding to the shape of individual yeasts as they translocate or travel through the pore. The direct ultra-fast low concentration electrical addressing of C. albicans has established criteria for distinguishing individual yeast based on their structural properties, which may reduce the currently used methods’ complexity for both identification and quantification capabilities in mixed blood samples

  20. Molecular detection of multiple emerging pathogens in Sputa from cystic fibrosis patients

    OpenAIRE

    Bittar, Fadi; Richet, Hervé; Dubus, Jean-Christophe; Reynaud-Gaubert, Martine; Stremler, Nathalie; Sarles, Jacques; Raoult, Didier; Rolain, Jean-Marc

    2008-01-01

    Background: There is strong evidence that culture-based methods detect only a small proportion of bacteria present in the respiratory tracts of cystic fibrosis (CF) patients. Methodology/Principal Findings: Standard microbiological culture and phenotypic identification of bacteria in sputa from CF patients have been compared to molecular methods by the use of 16S rDNA amplification, cloning and sequencing. Twenty-five sputa from CF patients were cultured that yield 33 isolates (13 species) kn...

  1. Molecular Detection of Multiple Emerging Pathogens in Sputa from Cystic Fibrosis Patients

    OpenAIRE

    Fadi Bittar; Hervé Richet; Jean-Christophe Dubus; Martine Reynaud-Gaubert; Nathalie Stremler; Jacques Sarles; Didier Raoult; Jean-Marc Rolain

    2008-01-01

    Background: There is strong evidence that culture-based methods detect only a small proportion of bacteria present in the respiratory tracts of cystic fibrosis (CF) patients. Methodology/Principal Findings: Standard microbiological culture and phenotypic identification of bacteria in sputa from CF patients have been compared to molecular methods by the use of 16S rDNA amplification, cloning and sequencing. Twenty-five sputa from CF patients were cultured that yield 33 isolates (13 species) kn...

  2. DNA-based detection of the fungal pathogen Geomyces destructans in soil from bat hibernacula

    Science.gov (United States)

    Lindner, Daniel L.; Gargas, Andrea; Lorch, Jeffrey M.; Banik, Mark T.; Glaeser, Jessie; Kunz, Thomas H.; Blehert, David S.

    2011-01-01

    White-nose syndrome (WNS) is an emerging disease causing unprecedented morbidity and mortality among bats in eastern North America. The disease is characterized by cutaneous infection of hibernating bats by the psychrophilic fungus Geomyces destructans. Detection of G. destructans in environments occupied by bats will be critical for WNS surveillance, management and characterization of the fungal lifecycle. We initiated an rRNA gene region-based molecular survey to characterize the distribution of G. destructans in soil samples collected from bat hibernacula in the eastern United States with an existing PCR test. Although this test did not specifically detect G. destructans in soil samples based on a presence/absence metric, it did favor amplification of DNA from putative Geomyces species. Cloning and sequencing of PCR products amplified from 24 soil samples revealed 74 unique sequence variants representing 12 clades. Clones with exact sequence matches to G. destructans were identified in three of 19 soil samples from hibernacula in states where WNS is known to occur. Geomyces destructans was not identified in an additional five samples collected outside the region where WNS has been documented. This study highlights the diversity of putative Geomyces spp. in soil from bat hibernacula and indicates that further research is needed to better define the taxonomy of this genus and to develop enhanced diagnostic tests for rapid and specific detection of G. destructans in environmental samples.

  3. DNA-Directed Antibody Immobilization for Enhanced Detection of Single Viral Pathogens.

    Science.gov (United States)

    Seymour, Elif; Daaboul, George G; Zhang, Xirui; Scherr, Steven M; Ünlü, Nese Lortlar; Connor, John H; Ünlü, M Selim

    2015-10-20

    Here, we describe the use of DNA-conjugated antibodies for rapid and sensitive detection of whole viruses using a single-particle interferometric reflectance imaging sensor (SP-IRIS), a simple, label-free biosensor capable of imaging individual nanoparticles. First, we characterize the elevation of the antibodies conjugated to a DNA sequence on a three-dimensional (3-D) polymeric surface using a fluorescence axial localization technique, spectral self-interference fluorescence microscopy (SSFM). Our results indicate that using DNA linkers results in significant elevation of the antibodies on the 3-D polymeric surface. We subsequently show the specific detection of pseudotyped vesicular stomatitis virus (VSV) as a model virus on SP-IRIS platform. We demonstrate that DNA-conjugated antibodies improve the capture efficiency by achieving the maximal virus capture for an antibody density as low as 0.72 ng/mm(2), whereas for unmodified antibody, the optimal virus capture requires six times greater antibody density on the sensor surface. We also show that using DNA conjugated anti-EBOV GP (Ebola virus glycoprotein) improves the sensitivity of EBOV-GP carrying VSV detection compared to directly immobilized antibodies. Furthermore, utilizing a DNA surface for conversion to an antibody array offers an easier manufacturing process by replacing the antibody printing step with DNA printing. The DNA-directed immobilization technique also has the added advantages of programmable sensor surface generation based on the need and resistance to high temperatures required for microfluidic device fabrication. These capabilities improve the existing SP-IRIS technology, resulting in a more robust and versatile platform, ideal for point-of-care diagnostics applications. PMID:26378807

  4. A portable and autonomous multichannel fluorescence detector for on-line and in situ explosive detection in aqueous phase.

    Science.gov (United States)

    Xin, Yunhong; Wang, Qi; Liu, Taihong; Wang, Lingling; Li, Jia; Fang, Yu

    2012-11-21

    A multichannel fluorescence detector used to detect nitroaromatic explosives in aqueous phase has been developed, which is composed of a five-channel sample-sensor unit, a measurement and control unit, a microcontroller, and a communication unit. The characteristics of the detector as developed are mainly embedded in the sensor unit, and each sensor consists of a fluorescent sensing film, a light emitting diode (LED), a multi-pixel photon counter (MPPC), and an optical module with special bandpass optical filters. Due to the high sensitivity of the sensing film, the small size and low cost of LED and MPPC, the developed detector not only has a better detecting performance and small size, but also has a very low cost - it is an alternative to the device made with an expensive high power lamp and photomultiplier tube. The wavelengths of the five sensors covered extend from the upper UV through the visible spectrum, 370-640 nm, and thereby it possesses the potential to detect a variety of explosives and other hazardous materials in aqueous phase. An additional function of the detector is its ability to function via a wireless network, by which the data recorded by the detector can be sent to the host computer, and at the same time the instructions can be sent to the detector from the host computer. By means of the powerful computing ability of the host computer, and utilizing the classical principal component analysis (PCA) algorithm, effective classification of the analytes is achieved. Furthermore, the detector has been tested and evaluated using NB, PA, TNT and DNT as the analytes, and toluene, benzene, methanol and ethanol as interferent compounds (concentration various from 10 and 60 μM). It has been shown that the detector can detect the four nitroaromatics with high sensitivity and selectivity. PMID:23007322

  5. Development of sensitive, high-throughput one-tube RT-PCR-enzyme hybridisation assay to detect selected bacterial fish pathogens.

    Science.gov (United States)

    Wilson, T; Carson, J

    2003-03-31

    Bacterial monitoring and surveillance is critical for the early detection of pathogens to avoid the spread of disease. To facilitate this, an efficient, high-performance and high-throughput method to detect the presence of femotgram amounts of ribosomal RNA from 4 bacterial fish pathogens: Aeromonas salmonicida; Tenacibaculum maritimum (formerly Flexibacter maritimus); Lactococcus garvieae; and Yersinia ruckeri was developed. The system uses NucleoLink strips for liquid- and solid-phase PCR in 1 tube, to perform RT-PCR-enzyme hybridisation assays (RT-PCR-EHA) detecting 4 fg or less of rRNA from pure cultures and between 1 and 9 CFU per 200 microl sample volume from selective-enrichment culture media. The liquid-phase amplicons were visualised by gel electrophoresis and the solid-phase amplicons detected using internal probes and visualised using colorimetric detection and p-nitrophenylphosphate. PMID:12747638

  6. Comparison of PCR,DIA and Pathogenicity Assay for Detection of Xanthomonas axonopodis pv.citri,the Causal Agent of Citrus Bacterial Canker Disease

    Institute of Scientific and Technical Information of China (English)

    WANG Zhong-kang; SUN Xian-yun; YIN You-ping; ZHOU Chang-yong; XIA Yu-xian

    2004-01-01

    Polymerase chain reaction (PCR) approach based on newly designed primers, JYF5/JYR5, was applied for specific detection of Xanthomonas axonopodis pv.citri(Xac). The efficiency and reliability of PCR method were compared with dot immunobinding assay (DIA) and classical pathogenicity test techniques for detecting suspensions of pure cells of Xac and soaking sap of citrus tissues. Detection sensitivity of PCR was about 4.5 cells or 1.56 pg target DNA per reaction which was higher than that of DIA (ca. 450 cells per dot).These three techniques (PCR assay, DIA and Pathogenecity test) could always detect Xac from symptomatic citrus samples. Different performances were obtained from citrus materials without symptoms, and the positive detection frequency was PCR, DIA and pathogenicity test.

  7. Fluorescence detection of telomerase activity in cancer cell extracts based on autonomous exonuclease III-assisted isothermal cycling signal amplification.

    Science.gov (United States)

    Ding, Caifeng; Li, Xiaoqian; Wang, Wei; Chen, Yaoyao

    2016-09-15

    Based on the extension reaction of a telomerase substrate (TS) primer in the presence of the telomerase, strand-displacement process to perform more stable longer duplex chain, and stepwise hydrolysis of mononucleotides from the blunt or the recessed 3'-hydroxyl termini of duplex DNA in the presence of Exonuclease III (Exo III), an amplified fluorescence detection of telomerase activity in the cancer cells was described in this manuscript. A fluorescence probe DNA, a quencher DNA, and a TS primer were mixed to construct a three-chain DNA structure and a two-chain DNA structure because the amount of the TS primer was less than the other two DNA. In the presence of the telomerase, the quencher DNA was replaced from the probe DNA and the telomerase activity could be determined with the fluorescence enhancement. The telomerase activity in HeLa extracts equivalent to 6-2000 cells was detected by this method. Moreover, the strategy was further proved by using telomerase extracted from Romas cells. With the multiple rounds of isothermal strand displacement and the hydrolysis process, constituted consecutive of signal amplification for the novel detection paradigm that allowed measuring of telomerase activity in crude cancer cell extracts confirmed the reliability and practicality of the protocol, which reveal this platform holds great promise in the biochemical assay for the telomerase activity in early diagnosis for cancers. PMID:27108253

  8. Behavior-Based Approach for the Detection of Land Mines Utilizing off the Shelf Low Cost Autonomous Robot

    Directory of Open Access Journals (Sweden)

    Abdel Ilah Nour Alshbatat

    2013-03-01

    Full Text Available Several countries all of the world are affected by landmines. The presence of mines represents a major threat to lives and causes economic problems. Currently, detecting and clearing mines demand specific expertise with special equipment. In this context, this paper offers the design and development of an intelligent controller which can control and enable the robot to detect mines by means of sensors and of processing the fused information to guide soldiers when passing landmines.  This is accomplished by broken down the overall system into two subsystems: sensor technologies and robotic device. Sensors devices include infrared distance sensor, metal detector, ultrasonic range finder, accelerometer sensor, while the structure of the robot in our case consists mainly  of a commercial  off-the-shelf  parts which  are  available  at  low  costs. The proposed controller is mainly based on creating fuzzy rules that reflect the behaviors of soldier beings in controlling a robot in a well known landmine. Simulation and experimental results are presented her to prove the efficiency of the proposed approach. The results show that the system is able to detect landmines and guide soldiers while crossing mines area.

  9. Rapid screening of waterborne pathogens using phage-mediated separation coupled with real-time PCR detection.

    Science.gov (United States)

    Wang, Ziyuan; Wang, Danhui; Kinchla, Amanda J; Sela, David A; Nugen, Sam R

    2016-06-01

    Escherichia coli O157:H7 is a ubiquitous pathogen which can be linked to foodborne outbreaks worldwide. In addition to the significant illnesses, hospitalizations, and deaths resulting from the outbreaks, there can be severe economic consequences to farmers, food manufacturers, and municipalities. A rapid detection assay which can validate sanitation and water quality would prove beneficial to these situations. Here, we report a novel bacteriophage-mediated detection of E. coli O157:H7 which utilizes the specific recognition between phages and their host cell as well as the natural lysis component of the infection cycle for DNA release. Carboxylic acid-functionalized magnetic beads were conjugated with bacteriophage and used to separate and concentrate E. coli O157:H7. The effects of bead incubation time, salinity, pH, and temperature on the bio-magnetic separation were investigated and compared to an antibody-based counterpart. The conditions of 0.01 M PBS, pH 7.0, and 20 min of reaction at 37 °C were found to be optimal. The capture efficiency of the coupled assay was approximately 20 % higher than that of antibody-based separation under extreme conditions. The resulting bead-phage-bacteria complexes were quantitatively detected by real-time PCR (qPCR). Our results demonstrated that the use of phage-based magnetic separation coupled with qPCR improved the sensitivity of detection by 2 orders of magnitude compared that without phage-based pre-concentration. Specificity and selectivity of the assay system was evaluated, and no cross-reactivity occurred when Salmonella typhimurium, Staphylococcus aureus, and Pseudomonas aeruginosa were tested. The total assay time was less than 2 h. PMID:27071764

  10. Detection of genes encoding multidrug resistance and biofilm virulence factor in uterine pathogenic bacteria in postpartum dairy cows.

    Science.gov (United States)

    Kasimanickam, V R; Owen, K; Kasimanickam, R K

    2016-01-15

    Reckless use of antibiotics and/or development of biofilm are the rationale for the development of multidrug resistance (MDR) of pathogenic bacteria. The objective of the present study was to detect MDR genes in Trueperella pyogenes and to detect biofilm virulence factor (VF) genes in Escherichia coli isolated from the uterus of postpartum dairy cows. Uterine secretions from different parity postpartum Holstein cows (n = 40) were collected using cytobrush technique after a sterile procedure from cows with varying degree of uterine inflammatory conditions. The cytobrush was stored in a specimen collector, placed in a cooler with ice, and transported to the laboratory within 2 hours. The pathogens were isolated and were identified initially by their colony morphology and biochemical characteristics. To further identify and classify the single species, and to determine the presence of MDR and VF genes, the genes fragments were amplified using the respective primers by either singleplex or multiplex polymerase chain reaction protocol, and amplicons were detected by electrophoresis method. T pyogenes was isolated in 17 of 40 (42.5%) cows in the study population as recognized by the 16S rRNA gene. Of the positive T pyogenes samples, 8 of 17 (42.1%) were positive for integron type 1 (intI I), and none were positive for integron type 2 (intI II). Of those 8 positive for intI I, six of eight (66.7%) were positive for amplicons aadA5 and aadA24-ORF1 at 1048 and 1608 bp, respectively, associated with specific drug resistance. Presence of addA5 indicated resistance to sulfadiazine, bacitracin, florfenicol, and ceftiofur. Presence of addA24-ORF1 indicated resistant to sulfadiazine, bacitracin, penicillin, clindamycin, and erythromycin. E coli was isolated in 18 of 40 (45.0%) cows in the study population. The genes for VF, Agn43a, and Agn43 b, associated with biofilm production, were found in 6 of 18 (33.3%) of the positive isolates. Both T pyogenes MDR gene and E coli

  11. Real-time PCR Detection of Food-borne Pathogenic Salmonella spp

    DEFF Research Database (Denmark)

    Malorny, B.; Mäde, D.; Löfström, Charlotta

    2013-01-01

    Infections by Salmonella enterica are a significant public health concern worldwide. Salmonellae form a complex group of bacteria consisting of two species, six subspecies and more than 2500 serovars (serotypes). Mainly through ingestion of contaminated food or feed, they cause self......-limiting gastrointestinal disease in a wide range of mammalian hosts. Within the last decade, numerous real-time PCR assays have been developed for rapid detection of salmonellae in potentially contaminated food or feed. Some of them were extensively validated and are useful for diagnostic laboratories. Furthermore......, effective sample preparation prior to the analytical real-time PCR assay avoids inhibitory substances disturbing the PCR and contributes to a high sensitivity. We discuss appropriate sample preparation methods including enrichment procedures for various food items and analytical real-time PCR assays for the...

  12. Autonomous underwater riser inspection tool

    Energy Technology Data Exchange (ETDEWEB)

    Camerini, Claudio; Marnet, Robson [Petrobras SA, (Brazil); Freitas, Miguel; Von der Weid, Jean Pierre [CPTI/PUC-Rio, Rio de Janeiro, (Brazil); Artigas Lander, Ricardo [EngeMOVI, Curitiba, (Brazil)

    2010-07-01

    The detection of damage on the riser is a serious concern for pipeline companies. Visual examinations by remotely operated vehicle (ROV) are presently carried out to detect the defects but this process has limitations and is expensive. This paper presents the development of a new tool to ensure autonomous underwater riser inspection (AURI) that uses the riser itself for guidance. The AURI, which is autonomous in terms of control and power supply, is equipped with several cameras that perform a complete visual inspection of the riser with 100 % coverage of the external surface of the riser. The paper presents the detailed characteristics of the first AURI prototype, describes its launching procedure and provides the preliminary test results from pool testing. The results showed that the AURI is a viable system for autonomous riser inspection. Offshore tests on riser pipelines are scheduled to be performed shortly.

  13. Prevalence of ergot derivatives in natural ryegrass pastures: detection and pathogenicity in the horse.

    Science.gov (United States)

    Lezica, F P; Filip, R; Gorzalczany, S; Ferraro, G; de Erausquin, G A; Rivas, C; Ladaga, G J B

    2009-02-01

    In the present study, we determined the incidence and effects of season and weather on clinical manifestations of endophyte-infected ryegrass toxicity, performed chemical detection and pharmacological bioassays on ryegrass extracts, and conducted trials on: (i) effects of domperidone or metochlopramide on ovarian inactivity induced by endophyte-infected ryegrass; (ii) efficacy of buspirone or dihydrochloro phenyl piperazine (m-CPP) for preventing suppressed milk production induced by endophyte-infected ryegrass; and (iii) efficacy of domperidone to induce ovulation during winter anestrus. Mares with toxicosis had prolonged gestation, embryonic losses, dystocia, poor mammary gland development, low milk production, prolonged uterine involution, and suppressed ovarian activity. Foals had respiratory failure, abnormalities of the skin, umbilicus, bone, and muscle, failure to thrive, blindness, testicular atrophy, and decreased serum total immunoglobulin concentrations. Endophyte-infected ryegrass and the incidence of toxicosis were correlated (r=0.861, P=0.03). Ergot alkaloids were not detected in extracts of endophyte-infected ryegrass by either thin-layer chromatography or spectrophotometry, but their presence was inferred in bioassays of extracts (dose-related increases in the contractile response of rat uterus). Mares given metoclopropamide (0.6 mg/kg/d), given orally every 8h for up to 7d) ovulated earlier (4-7d vs. 15-18d, Pmilk production, the latter did not induce ovarian cyclicity in healthy mares during seasonal anestrus. Based on these findings, we inferred that endophyte-infected ryegrass is associated with ergot alkaloid intoxication in horse. PMID:18823653

  14. Loop-Mediated Isothermal Amplification Procedure (LAMP) for Detection of the Potato Zebra Chip Pathogen "Candidatus Liberibacter solanacearum".

    Science.gov (United States)

    Ravindran, Aravind; Lévy, Julien; Pierson, Elizabeth; Gross, Dennis C

    2015-01-01

    An efficient loop-mediated isothermal amplification procedure (LAMP) for the detection of "Candidatus Liberibacter solanacearum" (Lso), the bacterial causal agent of potato zebra chip (ZC) disease, is described in this chapter. Similar to the polymerase chain reaction (PCR), the LAMP employs a bacterial polymerase to amplify specific DNA sequences. However, the method differs from conventional PCR in that it uses six primers specific to the target region to generate a loop structure and autocycling strand displacement rather than thermocycling for sequence amplification. Moreover, unlike PCR that requires agarose gel electrophoresis for resolution, the positive LAMP results can be visualized directly as a precipitate within the reaction tubes. The 16S rDNA gene of "Ca. Liberibacter solanacearum" was used as the target for the design of the six LAMP primers. The LAMP technique is a reliable, rapid, and cost-effective method of detecting the "Ca. Liberibacter solanacearum" pathogen in the potato/tomato psyllid, Bactericera cockerelli, and in field-grown potato plants and tubers. PMID:25981248

  15. Pathogen Sensors

    Directory of Open Access Journals (Sweden)

    Joseph Irudayaraj

    2009-10-01

    Full Text Available The development of sensors for detecting foodborne pathogens has been motivated by the need to produce safe foods and to provide better healthcare. However, in the more recent times, these needs have been expanded to encompass issues relating to biosecurity, detection of plant and soil pathogens, microbial communities, and the environment. The range of technologies that currently flood the sensor market encompass PCR and microarray-based methods, an assortment of optical sensors (including bioluminescence and fluorescence, in addition to biosensor-based approaches that include piezoelectric, potentiometric, amperometric, and conductometric sensors to name a few. More recently, nanosensors have come into limelight, as a more sensitive and portable alternative, with some commercial success. However, key issues affecting the sensor community is the lack of standardization of the testing protocols and portability, among other desirable elements, which include timeliness, cost-effectiveness, user-friendliness, sensitivity and specificity. [...

  16. Assessment of molecular methods as a tool for detecting pathogenic protozoa isolated from water bodies.

    Science.gov (United States)

    Adamska, M; Sawczuk, M; Kolodziejczyk, L; Skotarczak, B

    2015-12-01

    Several species belong to the Cryptosporidium and Giardia genus, the main parasitic protozoa occurring in water, but only some of them are infectious to humans. We investigated the occurrence of Cryptosporidium and Giardia and identified their species in the water samples collected from natural water bodies in north-western Poland. A total of 600 samples from water bodies used for bathing, sewage discharge, as drinking water sources and watering places for animals were screened. The samples were collected during a 3-year period in each of the four seasons and filtered using Filta-Max (IDEXX Laboratories, USA). Genomic DNA was extracted from all samples and used as a target sequence for polymerase chain reaction (PCR) and TaqMan real-time PCR, as well as for reverse line blotting (RLB) methods. PCR methods seem to be more sensitive to detect Giardia and Cryptosporidium DNA in water samples than RLB methods. All PCR products were sequenced and three were identified as C. parvum and four as G. intestinalis. The overall prevalence of C. parvum (0.5%) and G. intestinalis (0.6%) in the samples suggests that the risk of Cryptosporidium and Giardia infections in north-western Poland is minimal. PMID:26608757

  17. Automated detection of rare-event pathogens through time-gated luminescence scanning microscopy.

    Science.gov (United States)

    Lu, Yiqing; Jin, Dayong; Leif, Robert C; Deng, Wei; Piper, James A; Yuan, Jingli; Duan, Yusheng; Huo, Yujing

    2011-05-01

    Many microorganisms have a very low threshold (time-gated luminescent scanning for accurate counting of rare-event cells, which exploits the large difference in luminescence lifetimes between the lanthanide biolabels, >100 μs, and the autofluorescence backgrounds, analysis, the background-free feature allows a single-element photomultiplier to locate rare-event cells, so that requirements for data storage and analysis are minimized to the level of image confirmation only at the final step. We have evaluated this concept in a prototype instrument using a 2D scanning stage and applied it to rare-event Giardia detection labeled by a europium complex. For a slide area of 225 mm(2) , the time-gated scanning method easily reduced the original 40,000 adjacent elements (0.075 mm × 0.075 mm) down to a few "elements of interest" containing the Giardia cysts. We achieved an averaged signal-to-background ratio of 41.2 (minimum ratio of 12.1). Such high contrasts ensured the accurate mapping of all the potential Giardia cysts free of false positives or negatives. This was confirmed by the automatic retrieving and time-gated luminescence bioimaging of these Giardia cysts. Such automated microscopy based on time-gated scanning can provide novel solutions for quantitative diagnostics in advanced biological, environmental, and medical sciences. PMID:21462305

  18. Affinity reagent technology development and application to rapid immunochromatographic pathogen detection

    Science.gov (United States)

    Sooter, Letha J.; Stratis-Cullum, Dimitra N.; Zhang, Yanting; Daugherty, Patrick S.; Soh, H. Tom; Pellegrino, Paul; Stagliano, Nancy

    2007-09-01

    Immunochromatography is a rapid, reliable, and cost effective method of detecting biowarfare agents. The format is similar to that of an over-the-counter pregnancy test. A sample is applied to one end of a cassette and then a control line, and possibly a sample line, are visualized at the other end of the cassette. The test is based upon a sandwich assay. For the control, a line of Protein A is immobilized on the membrane. Gold nanoparticle bound IgG flows through the membrane and binds the Protein A, creating a visible line on the membrane. For the sample, one epitope is immobilized on the membrane and another epitope is attached to gold nanoparticles. The sample binds gold bound epitope, travels through the membrane, and binds membrane bound epitope. The two epitopes are not cross-reactive, therefore a sample line is only visible if the sample is present. In order to efficiently screen for binders to a sample target, a novel, Continuous Magnetic Activated Cell Sorter (CMACS) has been developed on a disposable, microfluidic platform. The CMACS chip quickly sorts E. coli peptide libraries for target binders with high affinity. Peptide libraries, are composed of approximately ten million bacteria, each displaying a different peptide on their surface. The target of interest is conjugated to a micrometer sized magnetic particle. After the library and the target are incubated together to allow binding, the mixture is applied to the CMACS chip. In the presence of patterned nickel and an external magnet, separation occurs of the bead-bound bacteria from the bulk material. The bead fraction is added to bacterial growth media where any attached E. coli grow and divide. These cells are cloned, sequenced, and the peptides are assayed for target binding affinity. As a proof-of-principle, assays were developed for human C-reactive protein. More defense relevant targets are currently being pursued.

  19. Correlation between Detection of a Plasmid and High-Level Virulence of Vibrio nigripulchritudo, a Pathogen of the Shrimp Litopenaeus stylirostris▿

    Science.gov (United States)

    Reynaud, Yann; Saulnier, Denis; Mazel, Didier; Goarant, Cyrille; Le Roux, Frédérique

    2008-01-01

    Vibrio nigripulchritudo, the etiological agent of Litopenaeus stylirostris summer syndrome, is responsible for mass mortalities of shrimp in New Caledonia. Epidemiological studies led to the suggestion that this disease is caused by an emergent group of pathogenic strains. Genomic subtractive hybridization was carried out between two isolates exhibiting low and high virulence. Our subtraction library was constituted of 521 specific fragments; 55 of these were detected in all virulent isolates from our collection (n = 32), and 13 were detected only in the isolates demonstrating the highest pathogenicity (n = 19), suggesting that they could be used as genetic markers for high virulence capacity. Interestingly, 10 of these markers are carried by a replicon of 11.2 kbp that contains sequences highly similar to those of a plasmid detected in Vibrio shilonii, a coral pathogen. The detection of this plasmid was correlated with the highest pathogenicity status of the isolates from our collection. The origin and consequence of this plasmid acquisition are discussed. PMID:18359828

  20. Correlation between detection of a plasmid and high-level virulence of Vibrio nigripulchritudo, a pathogen of the shrimp Litopenaeus stylirostris.

    Science.gov (United States)

    Reynaud, Yann; Saulnier, Denis; Mazel, Didier; Goarant, Cyrille; Le Roux, Frédérique

    2008-05-01

    Vibrio nigripulchritudo, the etiological agent of Litopenaeus stylirostris summer syndrome, is responsible for mass mortalities of shrimp in New Caledonia. Epidemiological studies led to the suggestion that this disease is caused by an emergent group of pathogenic strains. Genomic subtractive hybridization was carried out between two isolates exhibiting low and high virulence. Our subtraction library was constituted of 521 specific fragments; 55 of these were detected in all virulent isolates from our collection (n = 32), and 13 were detected only in the isolates demonstrating the highest pathogenicity (n = 19), suggesting that they could be used as genetic markers for high virulence capacity. Interestingly, 10 of these markers are carried by a replicon of 11.2 kbp that contains sequences highly similar to those of a plasmid detected in Vibrio shilonii, a coral pathogen. The detection of this plasmid was correlated with the highest pathogenicity status of the isolates from our collection. The origin and consequence of this plasmid acquisition are discussed. PMID:18359828

  1. Evaluation of a triplex real-time PCR system to detect the plant-pathogenic molds Alternaria spp., Fusarium spp. and C. purpurea.

    Science.gov (United States)

    Grube, Sabrina; Schönling, Jutta; Prange, Alexander

    2015-12-01

    This article describes the development of a triplex real-time PCR system for the simultaneous detection of three major plant-pathogenic mold genera (Alternaria spp., Fusarium spp. and the species Claviceps purpurea). The designed genus-specific primer-probe systems were validated for sensitivity, specificity and amplification in the presence of background DNA. PMID:26545945

  2. Detection of H5 and H7 highly pathogenic avian influenza virus with lateral flow devices: performance with healthy, sick and dead chickens

    Science.gov (United States)

    Rapid detection of highly pathogenic avian influenza virus (HPAIV) in the field is critical for effective disease control and to differentiate it from other diseases, such as Newcastle disease. Lateral flow devices (LFD) are commercially available and provide a fast, highly specific, on-site test fo...

  3. Development of Real-Time PCR Methods for the Detection of Bacterial Meningitis Pathogens without DNA Extraction.

    Directory of Open Access Journals (Sweden)

    Jeni Vuong

    Full Text Available Neisseria meningitidis (Nm, Haemophilus influenzae (Hi, and Streptococcus pneumoniae (Sp are the lead causes of bacterial meningitis. Detection of these pathogens from clinical specimens using traditional real-time PCR (rt-PCR requires DNA extraction to remove the PCR inhibitors prior to testing, which is time consuming and labor intensive. In this study, five species-specific (Nm-sodC and -ctrA, Hi-hpd#1 and -hpd#3 and Sp-lytA and six serogroup-specific rt-PCR tests (A, B, C, W, X, Y targeting Nm capsular genes were evaluated in the two direct rt-PCR methods using PerfeCTa and 5x Omni that do not require DNA extraction. The sensitivity and specify of the two direct rt-PCR methods were compared to TaqMan traditional rt-PCR, the current standard rt-PCR method for the detection of meningitis pathogens. The LLD for all 11 rt-PCR tests ranged from 6,227 to 272,229 CFU/ml for TaqMan, 1,824-135,982 for 5x Omni, and 168-6,836 CFU/ml for PerfeCTa. The diagnostic sensitivity using TaqMan ranged from 89.2%-99.6%, except for NmB-csb, which was 69.7%. For 5x Omni, the sensitivity varied from 67.1% to 99.8%, with three tests below 90%. The sensitivity of these tests using PerfeCTa varied from 89.4% to 99.8%. The specificity ranges of the 11 tests were 98.0-99.9%, 97.5-99.9%, and 92.9-99.9% for TaqMan, 5x Omni, and PerfeCTa, respectively. PerfeCTa direct rt-PCR demonstrated similar or better sensitivity compared to 5x Omni direct rt-PCR or TaqMan traditional rt-PCR. Since the direct rt-PCR method does not require DNA extraction, it reduces the time and cost for processing CSF specimens, increases testing throughput, decreases the risk of cross-contamination, and conserves precious CSF. The direct rt-PCR method will be beneficial to laboratories with high testing volume.

  4. Improved Detection of Bacterial Pathogens in Patients Presenting with Gastroenteritis by Use of the EntericBio Real-Time Gastro Panel I Assay

    OpenAIRE

    Koziel, Monika; Kiely, Rachel; Blake, Liam; O'Callaghan, Isabelle; Corcoran, Gerard D; Lucey, Brigid; Sleator, Roy D

    2013-01-01

    In this study, we evaluated the use of EntericBio real-time Gastro Panel I (Serosep, Limerick, Ireland) for routine use in a clinical microbiology laboratory for simultaneous detection of Campylobacter jejuni, coli, and lari, Shiga toxin-producing Escherichia coli (STEC), Salmonella spp., and Shigella spp. in feces. This system differs from its predecessor (the EntericBio Panel II system, Serosep) in that it allows real-time detection of pathogens directly from feces, without pre-enrichment. ...

  5. Application of DNA Aptamers and Quantum Dots to Lateral Flow Test Strips for Detection of Foodborne Pathogens with Improved Sensitivity versus Colloidal Gold

    OpenAIRE

    John G. Bruno

    2014-01-01

    Preliminary studies aimed at improving the sensitivity of foodborne pathogen detection via lateral flow (LF) test strips by use of high affinity DNA aptamers for capture and reporter functions when coupled to red-emitting quantum dots (Qdot 655) are reported. A variety of DNA aptamers developed against Escherichia coli, Listeria monocytogenes, and Salmonella enterica were paired in capture and reporter combinations to determine which yielded the strongest detection of their cognate bacteria u...

  6. Gas House Autonomous System Monitoring

    Science.gov (United States)

    Miller, Luke; Edsall, Ashley

    2015-01-01

    Gas House Autonomous System Monitoring (GHASM) will employ Integrated System Health Monitoring (ISHM) of cryogenic fluids in the High Pressure Gas Facility at Stennis Space Center. The preliminary focus of development incorporates the passive monitoring and eventual commanding of the Nitrogen System. ISHM offers generic system awareness, adept at using concepts rather than specific error cases. As an enabler for autonomy, ISHM provides capabilities inclusive of anomaly detection, diagnosis, and abnormality prediction. Advancing ISHM and Autonomous Operation functional capabilities enhances quality of data, optimizes safety, improves cost effectiveness, and has direct benefits to a wide spectrum of aerospace applications.

  7. Prevalence of pathogenic Yersinia enterocolitica in minced meat, pig tongues and hearts at the retail level in the Czech Republic detected by real time PCR

    Directory of Open Access Journals (Sweden)

    Alena Lorencova

    2016-06-01

    Full Text Available Yersiniosis is the third most frequently reported zoonosis in the European Union and Yersinia enterocolitica is the most common species causing human infections. Pigs are assumed to be the main reservoir of human pathogenic Y. enterocolitica with the presence of bacteria mainly in the tonsils and intestinal content. Undercooked pork and pork products have been suggested as the primary source of human yersiniosis. Nevertheless, data on the prevalence of pathogenic Y. enterocolitica in foodstuffs including pork products are very limited. A molecular based method (real time PCR targeting the ompF gene (detection of Yersinia genus and the ail gene (a chromosomally located virulence marker of Y. enterocolitica was used to determine the prevalence of pathogenic Y. enterocolitica in minced meat and edible pork offal at the retail level in the Czech Republic. A total of 50 pig tongues, 50 pig hearts, and 93 samples of minced meat containing pork were purchased at nine retail outlets in Brno. High detection rates of Yersinia spp. were found in all types of samples (pig tongues, 80.0%; pig hearts, 40.0%; and minced meat, 55.9%. The highest prevalence of pathogenic Y. enterocolitica was found in pig tongues (40.0%, followed by pig hearts (18.0% and minced meat samples (17.2%. Although from the point of view of food safety the merely molecular detection of DNA of the pathogenic bacteria could represent a false positive result, our results indicate the presence of pathogenic Y. enterocolitica in raw pork products at the retail level in the Czech Republic, which may pose a risk of consumer infection. Sufficient heat treatment and prevention of cross-contamination during preparation of food in the kitchen should be recommended.

  8. The melioidosis agent Burkholderia pseudomallei and related opportunistic pathogens detected in faecal matter of wildlife and livestock in northern Australia.

    Science.gov (United States)

    Höger, A C R; Mayo, M; Price, E P; Theobald, V; Harrington, G; Machunter, B; Choy, J Low; Currie, B J; Kaestli, M

    2016-07-01

    The Darwin region in northern Australia has experienced rapid population growth in recent years, and with it, an increased incidence of melioidosis. Previous studies in Darwin have associated the environmental presence of Burkholderia pseudomallei, the causative agent of melioidosis, with anthropogenic land usage and proximity to animals. In our study, we estimated the occurrence of B. pseudomallei and Burkholderia spp. relatives in faecal matter of wildlife, livestock and domestic animals in the Darwin region. A total of 357 faecal samples were collected and bacteria isolated through culture and direct DNA extraction after enrichment in selective media. Identification of B. pseudomallei, B. ubonensis, and other Burkholderia spp. was carried out using TTS1, Bu550, and recA BUR3-BUR4 quantitative PCR assays, respectively. B. pseudomallei was detected in seven faecal samples from wallabies and a chicken. B. cepacia complex spp. and Pandoraea spp. were cultured from wallaby faecal samples, and B. cenocepacia and B. cepacia were also isolated from livestock animals. Various bacteria isolated in this study represent opportunistic human pathogens, raising the possibility that faecal shedding contributes to the expanding geographical distribution of not just B. pseudomallei but other Burkholderiaceae that can cause human disease. PMID:26935879

  9. Colorimetric detection of PCR products of DNA from pathogenic bacterial targets based on a simultaneously amplified DNAzyme

    International Nuclear Information System (INIS)

    A novel strategy was devised for colorimetric analysis of the products of the polymerase chain reaction (PCR). The method takes advantage of simultaneous amplification of a horseradish peroxidase-mimicking DNAzyme (HRPzyme) during the PCR process. It is performed using a DNA specific forward primer and a universal reverse primer containing a complementary HRPzyme sequence. The double-strand PCR products, which include the HRPzyme sequence, are treated with a mixture of hemin and TMB (3,3′,5,5′–tetramethylbenzidine) in the presence of hydrogen peroxide. The resulting HRPzyme/hemin complex then promotes a peroxidase mimicking reaction, which produces the blue colored oxidized TMB. This colorimetric method can be more easily performed than previously developed gel based detection procedures and, as a result, can be conveniently applied to the specific and sensitive colorimetric analysis of DNA sequences arising from pathogenic bacteria. The potentially broad applicability of the new method has been demonstrated by its use in the identification of the 16s rDNA of Salmonella Typhimurium. (author)

  10. Detection and assessment of chemical hormesis on the radial growth in vitro of oomycetes and fungal plant pathogens.

    Science.gov (United States)

    Flores, Francisco J; Garzon, Carla D

    2012-01-01

    Although plant diseases can be caused by bacteria, viruses, and protists, most are caused by fungi and fungus-like oomycetes. Intensive use of fungicides with the same mode of action can lead to selection of resistant strains increasing the risk of unmanageable epidemics. In spite of the integrated use of nonchemical plant disease management strategies, agricultural productivity relies heavily on the use of chemical pesticides and biocides for disease prevention and treatment and sanitation of tools and substrates. Despite the prominent use of fungi in early hormesis studies and the continuous use of yeast as a research model, the relevance of hormesis in agricultural systems has not been investigated by plant pathologists, until recently. A protocol was standardized for detection and assessment of chemical hormesis in fungi and oomycetes using radial growth as endpoint. Biphasic dose-responses were observed in Pythium aphanidermatum exposed to sub-inhibitory doses of ethanol, cyazofamid, and propamocarb, and in Rhizoctonia zeae exposed to ethanol. This report provides an update on chemical hormesis in fungal plant pathogens and a perspective on the potential risks it poses to crop productivity and global food supply. PMID:23983664

  11. [A Case of Leptospirosis in which the Causative Pathogen was Detected Using Cerebrospinal Fluid PCR Eight Days after Onset].

    Science.gov (United States)

    Arita, Yuki; Tono, Toshihiro; Hosoda, Tomohiro; Taguchi, Hiroaki; Sakamoto, Mitsuo; Osone, Yasuo; Nozaki, Hiroyuki

    2016-05-01

    We report a patient with leptospirosis caused by infection with Leptospira interrogans serovar Rachmati. A 30-year-old Japanese man took part in a survival camp on Iriomote Island, Okinawa, from July 9 to July 15, 2014. During the camp, he swam in the river and kayaked. He developed a high fever and fatigue 7 days after completing his trip and was admitted to our hospital on July 22. On admission, he complained of a posterior cervical pain and a loss of appetite. Laboratory findings revealed granulocytosis, mildly elevated AST and ALT levels, elevated BUN and Cr levels, and a significantly elevated CRP level. No pathogenic bacteria were isolated from blood, urine, or cerebrospinal fluid cultures. We included leptospirosis in the differential diagnosis because of the patient's history of participating in a survival camp on Iriomote Island. Minocycline 200 mg, p.o. showed an excellent efficacy. The Leptospira flagellar gene FlaB was detected using a cerebrospinal fluid PCR. A microscopic agglutination test (MAT) during the convalescent stage demonstrated significant increases in antibodies against L. interrogans serovar Rachmati, confirming the diagnosis of leptospirosis. A medical history including occupation and recent travel history, and an adequate specimen sampling are crucial for the accurate and early diagnosis of leptospirosis. PMID:27529969

  12. Heteropolymeric triplex-based genomic assay to detect pathogens or single-nucleotide polymorphisms in human genomic samples.

    Directory of Open Access Journals (Sweden)

    Jasmine I Daksis

    Full Text Available Human genomic samples are complex and are considered difficult to assay directly without denaturation or PCR amplification. We report the use of a base-specific heteropolymeric triplex, formed by native duplex genomic target and an oligonucleotide third strand probe, to assay for low copy pathogen genomes present in a sample also containing human genomic duplex DNA, or to assay human genomic duplex DNA for Single Nucleotide Polymorphisms (SNP, without PCR amplification. Wild-type and mutant probes are used to identify triplexes containing FVL G1691A, MTHFR C677T and CFTR mutations. The specific triplex structure forms rapidly at room temperature in solution and may be detected without a separation step. YOYO-1, a fluorescent bis-intercalator, promotes and signals the formation of the specific triplex. Genomic duplexes may be assayed homogeneously with single base pair resolution. The specific triple-stranded structures of the assay may approximate homologous recombination intermediates, which various models suggest may form in either the major or minor groove of the duplex. The bases of the stable duplex target are rendered specifically reactive to the bases of the probe because of the activity of intercalated YOYO-1, which is known to decondense duplex locally 1.3 fold. This may approximate the local decondensation effected by recombination proteins such as RecA in vivo. Our assay, while involving triplex formation, is sui generis, as it is not homopurine sequence-dependent, as are "canonical triplexes". Rather, the base pair-specific heteropolymeric triplex of the assay is conformation-dependent. The highly sensitive diagnostic assay we present allows for the direct detection of base sequence in genomic duplex samples, including those containing human genomic duplex DNA, thereby bypassing the inherent problems and cost associated with conventional PCR based diagnostic assays.

  13. Site-specific clinical evaluation of the Luminex xTAG gastrointestinal pathogen panel for detection of infectious gastroenteritis in fecal specimens.

    Science.gov (United States)

    Patel, Anami; Navidad, Jose; Bhattacharyya, Sanjib

    2014-08-01

    We evaluate the clinical performance of the Luminex xTAG gastrointestinal (GI) pathogen in vitro diagnostic (IVD) assay in a comparison between clinical and public health laboratories. The site reproducibility study showed 98.7% sensitivity with high positive and negative agreement values (96.2% and 99.8%, respectively), while assay performance against confirmatory methods resulted in 96.4% sensitivity with similar positive and negative agreement values (90.1% and 99.5%, respectively). High-throughput detection of multiple GI pathogens improved turnaround time, consolidated laboratory workflow, and simplified stool culture practices, thus reducing the overall cost and number of specimens processed. PMID:24899032

  14. Real-time PCR and spore trap-based detection of the downy mildew pathogen, Peronospora effusa

    Science.gov (United States)

    Peronospora effusa is an obligate pathogen and the causal agent of downy mildew on spinach. The pathogen can be dispersed by splashing rain and wind, and may overwinter as oospores. Outbreaks of downy mildew on spinach are common in the cool climate of central coastal California, including the Sal...

  15. Development of multiplex loop mediated isothermal amplification (m-LAMP) label-based gold nanoparticles lateral flow dipstick biosensor for detection of pathogenic Leptospira.

    Science.gov (United States)

    Nurul Najian, A B; Engku Nur Syafirah, E A R; Ismail, Nabilah; Mohamed, Maizan; Yean, Chan Yean

    2016-01-15

    In recent years extensive numbers of molecular diagnostic methods have been developed to meet the need of point-of-care devices. Efforts have been made towards producing rapid, simple and inexpensive DNA tests, especially in the diagnostics field. We report on the development of a label-based lateral flow dipstick for the rapid and simple detection of multiplex loop-mediated isothermal amplification (m-LAMP) amplicons. A label-based m-LAMP lateral flow dipstick assay was developed for the simultaneous detection of target DNA template and a LAMP internal control. This biosensor operates through a label based system, in which probe-hybridization and the additional incubation step are eliminated. We demonstrated this m-LAMP assay by detecting pathogenic Leptospira, which causes the re-emerging disease Leptospirosis. The lateral flow dipstick was developed to detect of three targets, the LAMP target amplicon, the LAMP internal control amplicon and a chromatography control. Three lines appeared on the dipstick, indicating positive results for all representative pathogenic Leptospira species, whereas two lines appeared, indicating negative results, for other bacterial species. The specificity of this biosensor assay was 100% when it was tested with 13 representative pathogenic Leptospira species, 2 intermediate Leptospira species, 1 non-pathogenic Leptospira species and 28 other bacteria species. This study found that this DNA biosensor was able to detect DNA at concentrations as low as 3.95 × 10(-1) genomic equivalent ml(-1). An integrated m-LAMP and label-based lateral flow dipstick was successfully developed, promising simple and rapid visual detection in clinical diagnostics and serving as a point-of-care device. PMID:26709307

  16. Survey of culture, goldengate assay, universal biosensor assay, and 16S rRNA Gene sequencing as alternative methods of bacterial pathogen detection.

    Science.gov (United States)

    Lindsay, Brianna; Pop, Mihai; Antonio, Martin; Walker, Alan W; Mai, Volker; Ahmed, Dilruba; Oundo, Joseph; Tamboura, Boubou; Panchalingam, Sandra; Levine, Myron M; Kotloff, Karen; Li, Shan; Magder, Laurence S; Paulson, Joseph N; Liu, Bo; Ikumapayi, Usman; Ebruke, Chinelo; Dione, Michel; Adeyemi, Mitchell; Rance, Richard; Stares, Mark D; Ukhanova, Maria; Barnes, Bret; Lewis, Ian; Ahmed, Firoz; Alam, Meer Taifur; Amin, Ruhul; Siddiqui, Sabbir; Ochieng, John B; Ouma, Emmanuel; Juma, Jane; Mailu, Eunice; Omore, Richard; O'Reilly, Ciara E; Hannis, James; Manalili, Sheri; Deleon, Jonna; Yasuda, Irene; Blyn, Lawrence; Ranken, Raymond; Li, Feng; Housley, Roberta; Ecker, David J; Hossain, M Anowar; Breiman, Robert F; Morris, J Glenn; McDaniel, Timothy K; Parkhill, Julian; Saha, Debasish; Sampath, Rangarajan; Stine, O Colin; Nataro, James P

    2013-10-01

    Cultivation-based assays combined with PCR or enzyme-linked immunosorbent assay (ELISA)-based methods for finding virulence factors are standard methods for detecting bacterial pathogens in stools; however, with emerging molecular technologies, new methods have become available. The aim of this study was to compare four distinct detection technologies for the identification of pathogens in stools from children under 5 years of age in The Gambia, Mali, Kenya, and Bangladesh. The children were identified, using currently accepted clinical protocols, as either controls or cases with moderate to severe diarrhea. A total of 3,610 stool samples were tested by established clinical culture techniques: 3,179 DNA samples by the Universal Biosensor assay (Ibis Biosciences, Inc.), 1,466 DNA samples by the GoldenGate assay (Illumina), and 1,006 DNA samples by sequencing of 16S rRNA genes. Each method detected different proportions of samples testing positive for each of seven enteric pathogens, enteroaggregative Escherichia coli (EAEC), enterotoxigenic E. coli (ETEC), enteropathogenic E. coli (EPEC), Shigella spp., Campylobacter jejuni, Salmonella enterica, and Aeromonas spp. The comparisons among detection methods included the frequency of positive stool samples and kappa values for making pairwise comparisons. Overall, the standard culture methods detected Shigella spp., EPEC, ETEC, and EAEC in smaller proportions of the samples than either of the methods based on detection of the virulence genes from DNA in whole stools. The GoldenGate method revealed the greatest agreement with the other methods. The agreement among methods was higher in cases than in controls. The new molecular technologies have a high potential for highly sensitive identification of bacterial diarrheal pathogens. PMID:23884998

  17. Novel technologies for foodborne pathogenic microorganism detection%食源性致病微生物的检测新技术

    Institute of Scientific and Technical Information of China (English)

    陈玉婷; 程楠; 许文涛

    2015-01-01

    研究和建立食源性致病微生物的有效检测方法对于食品安全风险控制及人们的身体健康具有重要意义。本文在简要介绍微生物传统检测技术的基础上,系统地介绍了各类食源性致病微生物检测新方法,包括微生物试纸片检测技术、微生物代谢物检测技术、微生物免疫学检测技术、微生物DNA检测技术、微生物传感器检测技术等,分析了各类食源性微生物检测方法的基本原理、优缺点和应用,并对食源性致病微生物的检测新技术的发展提出了设想。%It is very important to establish an effective detection method of foodborne pathogenic microorganism for food safety risk control and people's health. Based on a brief introduction to traditional microbial detection technology, some novel methods to detect foodborne pathogenic microorganism were introduced in this paper, including microbial test paper detection technology, microbial metabolites detection technology, microbial immunological detection technology, microbial DNA detection technology, microbial sensor detection technology, etc. Then the basic principle, advantages and disadvantages and application were analyzed, respectively. Finally, the trends of novel detection technologies for foodborne pathogenic microorganism were proposed.

  18. Novel technologies for foodborne pathogenic microorganism detection%食源性致病微生物的检测新技术

    Institute of Scientific and Technical Information of China (English)

    陈玉婷; 程楠; 许文涛

    2015-01-01

    It is very important to establish an effective detection method of foodborne pathogenic microorganism for food safety risk control and people's health. Based on a brief introduction to traditional microbial detection technology, some novel methods to detect foodborne pathogenic microorganism were introduced in this paper, including microbial test paper detection technology, microbial metabolites detection technology, microbial immunological detection technology, microbial DNA detection technology, microbial sensor detection technology, etc. Then the basic principle, advantages and disadvantages and application were analyzed, respectively. Finally, the trends of novel detection technologies for foodborne pathogenic microorganism were proposed.%研究和建立食源性致病微生物的有效检测方法对于食品安全风险控制及人们的身体健康具有重要意义。本文在简要介绍微生物传统检测技术的基础上,系统地介绍了各类食源性致病微生物检测新方法,包括微生物试纸片检测技术、微生物代谢物检测技术、微生物免疫学检测技术、微生物DNA检测技术、微生物传感器检测技术等,分析了各类食源性微生物检测方法的基本原理、优缺点和应用,并对食源性致病微生物的检测新技术的发展提出了设想。

  19. A Detailed Protocol to Enable Safe-Handling, Preemptive Detection, and Systematic Surveillance of Rat-Vectored Pathogens in the Urban Environment

    Science.gov (United States)

    Parsons, Michael H.; Sarno, Ronald J.; Deutsch, Michael A.

    2016-01-01

    We detail a five-stage protocol to address physical barriers and experimental limitations that have hindered routine pathogen monitoring of wild rats in urban settings. New York City potentially harbors from 2 to 32 million rats among its 8-million people. However, at a time, when people are most vulnerable to disease from over-crowdedness brought on by increased urbanization of society, the difficulty of studying wild rats has led to a paucity of ecological and epidemiological research. Challenges of safely handling animals and the difficulties of identifying individual animals and the emergence of their respective pathogen loads (timing of infection) have impeded progress. We previously reported a method using radio frequency identification paired with load cell and camera traps to enable the identification of individual animals and subsequent monitoring of the animals’ weights (an indicator of health). However, efficient pathogen surveillance requires repeated captures of the same individual in order to isolate and document the emergence of new pathogens, or variations in pathogen load, over time. Most of these barriers are now addressed in our protocol, which is aided by the use of a mobile, outdoor laboratory, followed by incorporation of pheromone-based lures to attract individuals back to active sensors, within a camera trap. This approach allows for the assessment of individual animal health, behaviors under camera, and changing pathogen loads and weights in most urban environments (e.g., financial district, docks, sewers, and residential). Five phases are described and presented: (1) site selection and urban trapping, (2) anesthetization, (3) serological and ectoparasite collection, (4) microchip implantation, and (5) retrapping and luring animals back to active remote sensors. In order to fulfill the unmet call for preemptive pathogen surveillance, public health officials and researchers may wish to adapt, or modify, similar protocols to ensure early

  20. Autonomic Nervous System Disorders

    Science.gov (United States)

    Your autonomic nervous system is the part of your nervous system that controls involuntary actions, such as the beating of your heart ... breathing and swallowing Erectile dysfunction in men Autonomic nervous system disorders can occur alone or as the result ...

  1. Autoimmune Autonomic Ganglionopathy

    Science.gov (United States)

    ... Accessed 9/2/2015. Autoimmune Autonomic Ganglionopathy Summary. Dysautonomia International . http://www.dysautonomiainternational.org/page.php?ID= ... page Basic Information In Depth Information Basic Information Dysautonomia International offers an information page on Autoimmune autonomic ...

  2. Nanomaterial-based sensors for detection of foodborne bacterial pathogens and toxins as well as pork adulteration in meat products

    Directory of Open Access Journals (Sweden)

    B. Stephen Inbaraj

    2016-01-01

    Full Text Available Food safety draws considerable attention in the modern pace of the world owing to rapid-changing food recipes and food habits. Foodborne illnesses associated with pathogens, toxins, and other contaminants pose serious threat to human health. Besides, a large amount of money is spent on both analyses and control measures, which causes significant loss to the food industry. Conventional detection methods for bacterial pathogens and toxins are time consuming and laborious, requiring certain sophisticated instruments and trained personnel. In recent years, nanotechnology has emerged as a promising field for solving food safety issues in terms of detecting contaminants, enabling controlled release of preservatives to extend the shelf life of foods, and improving food-packaging strategies. Nanomaterials including metal oxide and metal nanoparticles, carbon nanotubes, and quantum dots are gaining a prominent role in the design of sensors and biosensors for food analysis. In this review, various nanomaterial-based sensors reported in the literature for detection of several foodborne bacterial pathogens and toxins are summarized highlighting their principles, advantages, and limitations in terms of simplicity, sensitivity, and multiplexing capability. In addition, the application through a noncross-linking method without the need for any surface modification is also presented for detection of pork adulteration in meat products.

  3. Detection and identification of bacterial pathogens of fish in kidney tissue using terminal restriction fragment length polymorphism (T-RFLP) analysis of 16S rRNA genes.

    Science.gov (United States)

    Nilsson, William B; Strom, Mark S

    2002-04-01

    We report the application of a nucleic acid-based assay that enables direct detection and identification of bacterial pathogens in fish kidney tissue without the need for bacterial culture. The technique, known as terminal restriction fragment length polymorphism (T-RFLP), employs the polymerase chain reaction (PCR) using a primer pair that targets 2 highly conserved regions of the gene that encodes for the 16S small subunit of the bacterial ribosome. Each primer is 5' labeled with a different fluorescent dye, which results in each terminus of the resulting amplicon having a distinguishable fluorescent tag. The amplicon is then digested with a series of 6 restriction endonucleases, followed by size determination of the 2 labeled terminal fragments by capillary electrophoresis with laser-induced fluorescence detection. Comparison of the lengths of the full set of 12 terminal fragments with those predicted based on analyses of GenBank submissions of 16S sequences leads to presumptive identification of the pathogen to at least the genus, but more typically the species level. Results of T-RFLP analyses of genomic DNA from multiple strains of a number of fish bacterial pathogens are presented. The assay is further demonstrated on fish kidney tissue spiked with a known number of cells of Flavobacterium psychrophilum where a detection limit of ca. 30 CFU mg(-1) of tissue was estimated. A similar detection limit was observed for several other gram-negative pathogens. This procedure was also used to detect Aeromonas salmonicida and Renibacterium salmoninarum in the kidney tissue of 2 naturally infected salmonids. PMID:12033704

  4. Human GBP1 does not localize to pathogen vacuoles but restricts Toxoplasma gondii.

    Science.gov (United States)

    Johnston, Ashleigh C; Piro, Anthony; Clough, Barbara; Siew, Malvin; Virreira Winter, Sebastian; Coers, Jörn; Frickel, Eva-Maria

    2016-08-01

    Guanylate binding proteins (GBPs) are a family of large interferon-inducible GTPases that are transcriptionally upregulated upon infection with intracellular pathogens. Murine GBPs (mGBPs) including mGBP1 and 2 localize to and disrupt pathogen-containing vacuoles (PVs) resulting in the cell-autonomous clearing or innate immune detection of PV-resident pathogens. Human GBPs (hGBPs) are known to exert antiviral host defense and activate the NLRP3 inflammasome, but it is unclear whether hGBPs can directly recognize and control intravacuolar pathogens. Here, we report that endogenous or ectopically expressed hGBP1 fails to associate with PVs formed in human cells by the bacterial pathogens Chlamydia trachomatis or Salmonella typhimurium or the protozoan pathogen Toxoplasma gondii. While we find that hGBP1 expression has no discernible effect on intracellular replication of C. trachomatis and S. typhimurium, we observed enhanced early Toxoplasma replication in CRISPR hGBP1-deleted human epithelial cells. We thus identified a novel role for hGBP1 in cell-autonomous immunity that is independent of PV translocation, as observed for mGBPs. This study highlights fundamental differences between human and murine GBPs and underlines the need to study the functions of GBPs at cellular locations away from PVs. PMID:26874079

  5. Enteric bacterial pathogen detection in southern sea otters (Enhydra lutris nereis) is associated with coastal urbanization and freshwater runoff

    OpenAIRE

    Miller, Melissa A.; Byrne, Barbara A.; Jang, Spencer S.; Dodd, Erin M.; Dorfmeier, Elene; Harris, Michael D.; Ames, Jack; Paradies, David; Worcester, Karen; Jessup, David A.; Miller, Woutrina A.

    2009-01-01

    Although protected for nearly a century, California's sea otters have been slow to recover, in part due to exposure to fecally-associated protozoal pathogens like Toxoplasma gondii and Sarcocystis neurona. However, potential impacts from exposure to fecal bacteria have not been systematically explored. Using selective media, we examined feces from live and dead sea otters from California for specific enteric bacterial pathogens (Campylobacter, Salmonella, Clostridium perfringens, C. difficile...

  6. Correlation between Detection of a Plasmid and High-Level Virulence of Vibrio nigripulchritudo, a Pathogen of the Shrimp Litopenaeus stylirostris▿

    OpenAIRE

    Reynaud, Yann; Saulnier, Denis; Mazel, Didier; Goarant, Cyrille; Le Roux, Frédérique

    2008-01-01

    Vibrio nigripulchritudo, the etiological agent of Litopenaeus stylirostris summer syndrome, is responsible for mass mortalities of shrimp in New Caledonia. Epidemiological studies led to the suggestion that this disease is caused by an emergent group of pathogenic strains. Genomic subtractive hybridization was carried out between two isolates exhibiting low and high virulence. Our subtraction library was constituted of 521 specific fragments; 55 of these were detected in all virulent isolates...

  7. DNA Detection and Genotypic Identification of Potentially Human-Pathogenic Microsporidia from Asymptomatic Pet Parrots in South Korea as a Risk Factor for Zoonotic Emergence ▿

    OpenAIRE

    Lee, So-Young; Lee, Sung-Seok; Lyoo, Young S.; Park, Hee-Myung

    2011-01-01

    We detected and identified genotypes of human-pathogenic microsporidia in fecal samples from 51 asymptomatic captive-bred pet parrots in South Korea. Microsporidia were identified in 8 samples (15.7%); 7 parrots tested positive for Encephalitozoon hellem, and 1 parrot tested positive for both E. hellem and Encephalitozoon cuniculi. In genotypic identifications, E. hellem was present in genotypes 1A and 2B and E. cuniculi was present in genotype II. Pet parrots might be a source of human micro...

  8. What makes pathogens pathogenic

    OpenAIRE

    Ehrlich, Garth D.; Hiller, N.Luisa; Hu, Fen Ze

    2008-01-01

    Metazoans contain multiple complex microbial ecosystems in which the balance between host and microbe can be tipped from commensalism to pathogenicity. This transition is likely to depend both on the prevailing environmental conditions and on specific gene-gene interactions placed within the context of the entire ecosystem.

  9. Development of highly sensitive electrochemical genosensor based on multiwalled carbon nanotubes-chitosan-bismuth and lead sulfide nanoparticles for the detection of pathogenic Aeromonas.

    Science.gov (United States)

    Fernandes, António Maximiano; Abdalhai, Mandour H; Ji, Jian; Xi, Bing-Wen; Xie, Jun; Sun, Jiadi; Noeline, Rasoamandrary; Lee, Byong H; Sun, Xiulan

    2015-01-15

    In this paper, we reported the construction of new high sensitive electrochemical genosensor based on multiwalled carbon nanotubes-chitosan-bismuth complex (MWCNT-Chi-Bi) and lead sulfide nanoparticles for the detection of pathogenic Aeromonas. Lead sulfide nanoparticles capped with 5'-(NH2) oligonucleotides thought amide bond was used as signalizing probe DNA (sz-DNA) and thiol-modified oligonucleotides sequence was used as fixing probe DNA (fDNA). The two probes hybridize with target Aeromonas DNA (tDNA) sequence (fDNA-tDNA-szDNA). The signal of hybridization is detected by differential pulse voltammetry (DPV) after electrodeposition of released lead nanoparticles (PbS) from sz-DNA on the surface of glass carbon electrode decorated with MWCNT-Chi-Bi, which improves the deposition and traducing electrical signal. The optimization of incubation time, hybridization temperature, deposition potential, deposition time and the specificity of the probes were investigated. Our results showed the highest sensibility to detect the target gene when compared with related biosensors and polymerase chain reaction (PCR). The detection limit for this biosensor was 1.0×10(-14) M. We could detect lower than 10(2) CFU mL(-1) of Aeromonas in spiked tap water. This method is rapid and sensitive for the detection of pathogenic bacteria and would become a potential application in biomedical diagnosis, food safety and environmental monitoring. PMID:25127474

  10. Simultaneous detection of pathogenic bacteria using an aptamer based biosensor and dual fluorescence resonance energy transfer from quantum dots to carbon nanoparticles

    International Nuclear Information System (INIS)

    We report on a method for simultaneous detection of the pathogens Vibrio parahaemolyticus and Salmonella typhimurium. It is based on dual fluorescence resonance energy transfer (FRET) from green-emitting quantum-dots (gQDs) and red-emitting quantum-dots (rQDs) as donors, and on novel amorphous carbon nanoparticles (CNPs) that act as acceptor. The gQDs were modified with an aptamer (Apt 1) recognizing V. parahaemolyticus, and the rQDs with an aptamer (Apt 2) recognizing S. typhimurium. The fluorescence of both QDs is strongly quenched in the presence of CNPs. However, on addition of the target analytes, the QDs-aptamer-target complex is formed and quenching by CNPs is suppressed. The fluorescence of the QDs is linearly proportional to the concentration of the two pathogens in the range from 50 to 106 cfu·mL−1, with detection limits as low as 25 cfu·mL−1 for V. parahaemolyticus, and of 35 cfu·mL−1 for S. typhimurium. The assay was applied to real food samples, and the results were consistent with the results obtained with plate counting methods. We presume that this strategy can be extended to the detection of other pathogenic bacteria and biomolecules by simply substituting the aptamer. (author)

  11. A Novel High-Throughput Method for Molecular Detection of Human Pathogenic Viruses Using a Nanofluidic Real-Time PCR System

    OpenAIRE

    Coudray-Meunier, Coralie; Fraisse, Audrey; Martin-Latil, Sandra; Delannoy, Sabine; Fach, Patrick; Perelle, Sylvie

    2016-01-01

    Human enteric viruses are recognized as the main causes of food- and waterborne diseases worldwide. Sensitive and quantitative detection of human enteric viruses is typically achieved through quantitative RT-PCR (RT-qPCR). A nanofluidic real-time PCR system was used to develop novel high-throughput methods for qualitative molecular detection (RT-qPCR array) and quantification of human pathogenic viruses by digital RT-PCR (RT-dPCR). The performance of high-throughput PCR methods was investigat...

  12. LEO AUTONOMOUS NAVIGATION BASED ON IMAGE MOTION

    Institute of Scientific and Technical Information of China (English)

    DUANFang; LIUJian-ye; YUFeng

    2005-01-01

    A method of LEO autonomous navigation is presented based on the nonlinear satellite velocity relative to the earth. The velocity is detected by a high-speed camera, with the attitude information detected by a star sensor. Compared with traditional autonomous navigation by landmark identification, the satellite velocity relarive to the earth is obtained by correlativity analysis of images. It does not need to recognize ground objects or views. Since it is not necessary to pre-store the database of ground marks, lots of memory space can be saved.The state and observation equations are constructed, and the filtering is processed by the Kalman filter. Simulation results show that the system has high autonomous navigation precision in LEO autonomous navigation.

  13. Serological detection of 'Candidatus Liberibacter asiaticus' in citrus, and identification by GeLC-MS/MS of a chaperone protein responding to cellular pathogens.

    Science.gov (United States)

    Ding, Fang; Duan, Yongping; Yuan, Qing; Shao, Jonathan; Hartung, John S

    2016-01-01

    We describe experiments with antibodies against 'Candidatus Liberibacter asiaticus used to detect the pathogen in infected plants. We used scFv selected to bind epitopes exposed on the surface of the bacterium in tissue prints, with secondary monoclonal antibodies directed at a FLAG epitope included at the carboxyl end of the scFv. Unexpectedly, the anti-FLAG secondary antibody produced positive results with CaLas diseased samples when the primary scFv were not used. The anti-FLAG monoclonal antibody (Mab) also identified plants infected with other vascular pathogens. We then identified a paralogous group of secreted chaperone proteins in the HSP-90 family that contained the amino acid sequence DDDDK identical to the carboxy-terminal sequence of the FLAG epitope. A rabbit polyclonal antibody against one of the same epitopes combined with a goat anti-rabbit secondary antibody produced very strong purple color in individual phloem cells, as expected for this pathogen. These results were entirely specific for CaLas-infected citrus. The simplicity, cost and ability to scale the tissue print assay makes this an attractive assay to complement PCR-based assays currently in use. The partial FLAG epitope may itself be useful as a molecular marker for the rapid screening of citrus plants for the presence of vascular pathogens. PMID:27381064

  14. Breath analysis for in vivo detection of pathogens related to ventilator-associated pneumonia in intensive care patients: a prospective pilot study.

    Science.gov (United States)

    Filipiak, Wojciech; Beer, Ronny; Sponring, Andreas; Filipiak, Anna; Ager, Clemens; Schiefecker, Alois; Lanthaler, Simon; Helbok, Raimund; Nagl, Markus; Troppmair, Jakob; Amann, Anton

    2015-03-01

    Existing methods for the early detection of infections in mechanically ventilated (MV) patients at intensive care units (ICUs) are unsatisfactory. Here we present an exploratory study assessing the feasibility of breath VOC analyses for the non-invasive detection of pathogens in the lower respiratory tract of ventilated patients. An open uncontrolled clinical pilot study was performed by enrolling 28 mechanically ventilated (MV) patients with severe intracranial disease, being at risk for the development of or already with confirmed ventilation-associated pneumonia (VAP). The recently developed sampling technique enabled the collection of breath gas with a maximized contribution of alveolar air directly from the respiratory circuit under continuous capnography control, adsorptive preconcentration and final analysis by means of gas chromatography-mass spectrometry (GC-MS).VAP was confirmed in 22/28 preselected patients (78%). The most common microorganisms were Staphylococcus aureus (5/22 VAP patients), Escherichia coli (5/22 VAP patients) and Candida spp. (5/22 VAP patients). 12/32 metabolites released by S. aureus in our previous in vitro studies were also detected in the end-tidal air of VAP patients infected with this pathogen. A similar overlap was seen in Candida albicans infections (8/29 VOCs). Moreover, the concentration profile of selected compounds correlated with the course of the infection.This prospective pilot study provides proof of the concept that the appearance and the concentration profile of pathogen-derived metabolites (elucidated from in vitro experiments) in the breath of ventilated patients during clinically confirmed VAP correlates with the presence of a particular pathogen. PMID:25557917

  15. Simultaneous detection of eight swine reproductive and respiratory pathogens using a novel GeXP analyser-based multiplex PCR assay.

    Science.gov (United States)

    Zhang, Minxiu; Xie, Zhixun; Xie, Liji; Deng, Xianwen; Xie, Zhiqin; Luo, Sisi; Liu, Jiabo; Pang, Yaoshan; Khan, Mazhar I

    2015-11-01

    A new high-throughput GenomeLab Gene Expression Profiler (GeXP) analyser-based multiplex PCR assay was developed for the detection of eight reproductive and respiratory pathogens in swine. The reproductive and respiratory pathogens include North American porcine reproductive and respiratory syndrome virus (PRRSV-NA), classical swine fever virus (CSFV), porcine circovirus 2 (PCV-2), swine influenza virus (SIV) (including H1 and H3 subtypes), porcine parvovirus (PPV), pseudorabies virus (PRV) and Japanese encephalitis virus (JEV). Nine pairs of specific chimeric primers were designed and used to initiate PCRs, and one pair of universal primers was used for subsequent PCR cycles. The specificity of the GeXP assay was examined using positive controls for each virus. The sensitivity was evaluated using serial ten-fold dilutions of in vitro-transcribed RNA from all of the RNA viruses and plasmids from DNA viruses. The GeXP assay was further evaluated using 114 clinical specimens and was compared with real-time PCR/single RT-PCR methods. The specificity of the GeXP assay for each pathogen was examined using single cDNA/DNA template. Specific amplification peaks of the reproductive and respiratory pathogens were observed on the GeXP analyser. The minimum copies per reaction detected for each virus by the GeXP assay were as follows: 1000 copies/μl for PRV; 100 copies/μl for CSFV, JEV, PCV-2 and PPV; and 10 copies/μl for SIV-H1, SIV-H3 and PRRSV-NA. Analysis of 114 clinical samples using the GeXP assay demonstrated that the GeXP assay had comparable detection to real-time PCR/single RT-PCR. This study demonstrated that the GeXP assay is a new method with high sensitivity and specificity for the identification of these swine reproductive and respiratory pathogens. The GeXP assay may be adopted for molecular epidemiological surveys of these reproductive and respiratory pathogens in swine populations. PMID:26259690

  16. Robotic perception for autonomous navigation

    OpenAIRE

    Furlan,

    2014-01-01

    This thesis presents the research work the author carried on during his PhD on the topic of robotic perception for autonomous navigation. In particular, the efforts focus on the Self-Localization, Scene Understanding and Object Detection and Tracking problems, proposing for each of these three topics one or more approaches that present an improvement over the state-of-the-art. In some cases the proposed approaches mutually exploit the generated information to improve the quality of the final ...

  17. Research progress in detection techniques for foodborne pathogen%食源性致病细菌检测技术研究进展

    Institute of Scientific and Technical Information of China (English)

    侯进慧; 蔡侃; 樊继强

    2012-01-01

    对几种常见的食源性致病细菌检测技术进行了综述,对以聚合酶链式反应(PCR)方法为基础的检测技术进行了分析,将PCR检测食源性致病菌所需要用到的靶基因及其引物等进行了归纳,并对食源性致病菌检测技术的发展提出了建议。%Several kinds of detection techniques for common foodborne pathegens were reviewed.Detection methods based on PCR were analyzed especially,and target genes and their primers of some foodborne pathogens involved in PCR detection were summarized.Furthermore,some suggestions were given to the development of detection techniques for foodborne pathegens.

  18. Detection of respiratory pathogens in pediatric acute otitis media by PCR and comparison of findings in the middle ear and nasopharynx.

    Science.gov (United States)

    Yatsyshina, Svetlana; Mayanskiy, Nikolay; Shipulina, Olga; Kulichenko, Tatiana; Alyabieva, Natalia; Katosova, Lyubovj; Lazareva, Anna; Skachkova, Tatyana; Elkina, Maria; Matosova, Svetlana; Shipulin, German

    2016-05-01

    We conducted a series of polymerase chain reactions (PCRs) in order to detect bacteria (7 species) and viruses (17 species) in middle ear fluid (MEF) and nasopharynx (Nph) of children with acute otitis media (AOM; n=179). Bacterial and viral nucleic acids were detected in MEF of 78.8% and 14.5% patients, respectively. The prevalence was as follows: Streptococcus pneumoniae, 70.4%; Haemophilus influenzae, 17.9%; Staphylococcus aureus, 16.8%; Streptococcus pyogenes, 12.3%; Moraxella catarrhalis, 9.5%; rhinovirus, 9.5%; and adenovirus, 3.4%. The overall rate of PCR-positive specimens for bacterial pathogens was 2.6 times higher, compared to culture results. The rate of PCR-positive results and the distribution of pathogens in the Nph were similar to those in the MEF. Nph PCR results had variable positive predictive values and high negative predictive values in predicting MEF findings. Our results indicate that Nph PCR could be a practical tool for examining respiratory pathogens in children with acute infections. PMID:26971180

  19. A method to detect metal–drug complexes and their interactions with pathogenic bacteria via graphene nanosheet assist laser desorption/ionization mass spectrometry and biosensors

    International Nuclear Information System (INIS)

    Highlights: ► Probe transition metals-complexes based on noncovalent functionalized graphene for MALDI-MS. ► Study interaction of transition metals complexes with pathogenic bacteria. ► Propose a new biosensor for two pathogenic bacteria. - Abstract: A new method was proposed to probe the interactions between transition metals of Fe(II), Fe(III), Cu(II) with a non steroidal anti-inflammatory drug (NSAID), flufenamic acid (FF) using graphene as a matrix for Graphene assisted laser desorption ionization mass spectrometry (GALDI-MS). Metal–drug complexation was confirmed via UV absorption spectroscopy, fluorescence spectroscopy, pH meter, and change in solution conductivity. The optimal molar ratios for these complexation interactions are stoichiometry 1:2 in both Cu(II) and Fe(II) complexes, and 1:3 in Fe(III) complexes at physiological pH (7.4). Metal complexation of the drug could enhance fluorescence for 20 fold which is due to the charge transfer reaction or increase rigidity of the drug. The main interaction between graphene and flufenamic acid is the Π–Π interaction which allows us to probe the metal–drug complexation. The GALDI-MS could sensitively detect the drug at m/z 281.0 Da (protonated molecule) with detection limit 2.5 pmol (1.0 μM) and complexation at m/z 661.0, 654.0 and 933.0 Da corresponding to [Cu(II)(FF)2(H2O)2 + H]+, [Fe(II)(FF)2(H2O)2 + H]+ and [Fe(III) (FF)3(H2O)2 + H]+, respectively (with limit of detection (LOD) 2.0 pmol (10.0 μM). Matrix assisted laser desorption ionization mass spectrometry (MALDI-MS) spectra show change in the protein profile of intact pathogenic bacteria (Pseudomonas aeroginosa, Staphylococcus aureus). The change in the ionization ability (mainly proton affinity) of pathogenic bacteria may be due to the interactions between the bacteria with the drug (or its complexes). Shielding carboxylic group by metals and increase the hydrophilicity could enhance the biocompatibility of complexes toward the pathogenic

  20. Cultivation and qPCR Detection of Pathogenic and Antibiotic-Resistant Bacterial Establishment in Naive Broiler Houses.

    Science.gov (United States)

    Brooks, J P; McLaughlin, M R; Adeli, A; Miles, D M

    2016-05-01

    Conventional commercial broiler production involves the rearing of more than 20,000 broilers in a single confined space for approximately 6.5 wk. This environment is known for harboring pathogens and antibiotic-resistant bacteria, but studies have focused on previously established houses with mature litter microbial populations. In the current study, a set of three naive houses were followed from inception through 11 broiler flocks and monitored for ambient climatic conditions, bacterial pathogens, and antibiotic resistance. Within the first 3 wk of the first flock cycle, 100% of litter samples were positive for and , whereas was cultivation negative but PCR positive. Antibiotic resistance genes were ubiquitously distributed throughout the litter within the first flock, approaching 10 to 10 genomic units g. Preflock litter levels were approximately 10 CFU g for heterotrophic plate count bacteria, whereas midflock levels were >10 colony forming units (CFU) g; other indicators demonstrated similar increases. The influence of intrahouse sample location was minor. In all likelihood, given that preflock levels were negative for pathogens and antibiotic resistance genes and 4 to 5 Log lower than flock levels for indicators, incoming birds most likely provided the colonizing microbiome, although other sources were not ruled out. Most bacterial groups experienced a cyclical pattern of litter contamination seen in other studies, whereas microbial stabilization required approximately four flocks. This study represents a first-of-its-kind view into the time required for bacterial pathogens and antibiotic resistance to colonize and establish in naive broiler houses. PMID:27136163

  1. Research project RoboGas{sup Inspector}. Gas leak detection with autonomous mobile robots; Forschungsprojekt RoboGas{sup Inspector}. Gaslecksuche mit autonomen mobilen Robotern

    Energy Technology Data Exchange (ETDEWEB)

    Habib, Abdelkarim [BAM Bundesanstalt fuer Materialforschung und -pruefung, Berlin (Germany); Bonow, Gero; Kroll, Andreas [Fachgebiet Mess- und Regelungstechnik, Universitaet Kassel, Kassel (Germany); Hegenberg, Jens; Schmidt, Ludger [Fachgebiet Mensch-Maschine-Systemtechnik, Universitaet Kassel, Kassel (Germany); Barz, Thomas; Schulz, Dirk [Fraunhofer FKIE, Unbemannte Systeme, Wachtberg (Germany)

    2013-05-15

    As part of the promotional program AUTONOMIK of the Federal Ministry of Economics and Technology (Berlin, Federal Republic of Germany) a consortium of nine project partners developed a prototype of an autonomous mobile robot looking for gas leaks in extended industrial equipment. The autonomous mobility of the system for any systems was implemented using different types of sensors for self-localization and navigation. The tele-operation enables a manual intervention in the process. The robot performs inspection tasks in industrial plants by means of video technology and remote gas measurement technology without driving into the possible risk areas and without the presence of humans. The robot can be used for routine inspections of facilities or for the targeted inspection of specific plant components. Thanks to the remote sensing technique also plant components can be inspected which are difficult to be inspected due to their limited accessibility by conventional measurement techniques.

  2. Molecular analysis of bacterial communities and detection of potential pathogens in a recirculating aquaculture system for Scophthalmus maximus and Solea senegalensis.

    Science.gov (United States)

    Martins, Patrícia; Cleary, Daniel F R; Pires, Ana C C; Rodrigues, Ana Maria; Quintino, Victor; Calado, Ricardo; Gomes, Newton C M

    2013-01-01

    The present study combined a DGGE and barcoded 16S rRNA pyrosequencing approach to assess bacterial composition in the water of a recirculating aquaculture system (RAS) with a shallow raceway system (SRS) for turbot (Scophthalmus maximus) and sole (Solea senegalensis). Barcoded pyrosequencing results were also used to determine the potential pathogen load in the RAS studied. Samples were collected from the water supply pipeline (Sup), fish production tanks (Pro), sedimentation filter (Sed), biofilter tank (Bio), and protein skimmer (Ozo; also used as an ozone reaction chamber) of twin RAS operating in parallel (one for each fish species). Our results revealed pronounced differences in bacterial community composition between turbot and sole RAS, suggesting that in the systems studied there is a strong species-specific effect on water bacterial communities. Proteobacteria was the most abundant phylum in the water supply and all RAS compartments. Other important taxonomic groups included the phylum Bacteriodetes. The saltwater supplied displayed a markedly lower richness and appeared to have very little influence on bacterial composition. The following potentially pathogenic species were detected: Photobacterium damselae in turbot (all compartments), Tenacibaculum discolor in turbot and sole (all compartments), Tenacibaculum soleae in turbot (all compartments) and sole (Pro, Sed and Bio), and Serratia marcescens in turbot (Sup, Sed, Bio and Ozo) and sole (only Sed) RAS. Despite the presence of these pathogens, no symptomatic fish were observed. Although we were able to identify potential pathogens, this approach should be employed with caution when monitoring aquaculture systems, as the required phylogenetic resolution for reliable identification of pathogens may not always be possible to achieve when employing 16S rRNA gene fragments. PMID:24278329

  3. Molecular analysis of bacterial communities and detection of potential pathogens in a recirculating aquaculture system for Scophthalmus maximus and Solea senegalensis.

    Directory of Open Access Journals (Sweden)

    Patrícia Martins

    Full Text Available The present study combined a DGGE and barcoded 16S rRNA pyrosequencing approach to assess bacterial composition in the water of a recirculating aquaculture system (RAS with a shallow raceway system (SRS for turbot (Scophthalmus maximus and sole (Solea senegalensis. Barcoded pyrosequencing results were also used to determine the potential pathogen load in the RAS studied. Samples were collected from the water supply pipeline (Sup, fish production tanks (Pro, sedimentation filter (Sed, biofilter tank (Bio, and protein skimmer (Ozo; also used as an ozone reaction chamber of twin RAS operating in parallel (one for each fish species. Our results revealed pronounced differences in bacterial community composition between turbot and sole RAS, suggesting that in the systems studied there is a strong species-specific effect on water bacterial communities. Proteobacteria was the most abundant phylum in the water supply and all RAS compartments. Other important taxonomic groups included the phylum Bacteriodetes. The saltwater supplied displayed a markedly lower richness and appeared to have very little influence on bacterial composition. The following potentially pathogenic species were detected: Photobacterium damselae in turbot (all compartments, Tenacibaculum discolor in turbot and sole (all compartments, Tenacibaculum soleae in turbot (all compartments and sole (Pro, Sed and Bio, and Serratia marcescens in turbot (Sup, Sed, Bio and Ozo and sole (only Sed RAS. Despite the presence of these pathogens, no symptomatic fish were observed. Although we were able to identify potential pathogens, this approach should be employed with caution when monitoring aquaculture systems, as the required phylogenetic resolution for reliable identification of pathogens may not always be possible to achieve when employing 16S rRNA gene fragments.

  4. A phage-displayed chicken single-chain antibody fused to alkaline phosphatase detects Fusarium pathogens and their presence in cereal grains

    International Nuclear Information System (INIS)

    Graphical abstract: A phage-displayed chicken scFv antibody, FvSG7, binds on the surface antigen of conidiospores and the mycelia of F. verticillioides. Its fusion with alkaline phosphatase (AP) through a 218 linker displayed a 4-fold higher affinity compared with the parent scFv antibody and efficiently detected toxigenic Fusarium pathogens in cereal grains. Highlights: ► Generation of a highly reactive scFv antibody against F. verticillioides. ► Localization of the antibody binding to the surface target of F. verticillioides. ► Expression of the antibody–alkaline phosphatase (AP) fusion linked by a 218 linker. ► The antibody–AP fusion has a higher affinity than the parental antibody. ► The antibody–AP fusion detects toxigenic Fusarium pathogens in cereal grains. -- Abstract: Fusarium and its poisonous mycotoxins are distributed worldwide and are of particular interest in agriculture and food safety. A simple analytical method to detect pathogens is essential for forecasting diseases and controlling mycotoxins. This article describes a proposed method for convenient and sensitive detection of Fusarium pathogens that uses the fusion of single-chain variable fragment (scFv) and alkaline phosphatase (AP). A highly reactive scFv antibody specific to soluble cell wall-bound proteins (SCWPs) of F. verticillioides was selected from an immunized chicken phagemid library by phage display. The antibody was verified to bind on the surface of ungerminated conidiospores and mycelia of F. verticillioides. The scFv–AP fusion was constructed, and soluble expression in bacteria was confirmed. Both the antibody properties and enzymatic activity were retained, and the antigen-binding capacity of the fusion was enhanced by the addition of a linker. Surface plasmon resonance measurements confirmed that the fusion displayed 4-fold higher affinity compared with the fusion's parental scFv antibody. Immunoblot analyses showed that the fusion had good binding capacity to

  5. A phage-displayed chicken single-chain antibody fused to alkaline phosphatase detects Fusarium pathogens and their presence in cereal grains

    Energy Technology Data Exchange (ETDEWEB)

    Hu, Zu-Quan [Molecular Biotechnology Laboratory of Triticeae Crops, Huazhong Agricultural University, Wuhan 430070 (China); Li, He-Ping [Molecular Biotechnology Laboratory of Triticeae Crops, Huazhong Agricultural University, Wuhan 430070 (China); College of Life Science and Technology, Huazhong Agricultural University, Wuhan 430070 (China); Zhang, Jing-Bo [Molecular Biotechnology Laboratory of Triticeae Crops, Huazhong Agricultural University, Wuhan 430070 (China); College of Plant Science and Technology, Huazhong Agricultural University, Wuhan 430070 (China); Huang, Tao [Molecular Biotechnology Laboratory of Triticeae Crops, Huazhong Agricultural University, Wuhan 430070 (China); College of Life Science and Technology, Huazhong Agricultural University, Wuhan 430070 (China); Liu, Jin-Long; Xue, Sheng [Molecular Biotechnology Laboratory of Triticeae Crops, Huazhong Agricultural University, Wuhan 430070 (China); Wu, Ai-Bo [Institute for Agri-food Standards and Testing Technology, Laboratory of Quality and Safety Risk Assessment for Agro-products, Ministry of Agriculture, Shanghai Academy of Agricultural Sciences, 1000 Jinqi Road, Shanghai 201403 (China); Liao, Yu-Cai, E-mail: ycliao06@yahoo.com.cn [Molecular Biotechnology Laboratory of Triticeae Crops, Huazhong Agricultural University, Wuhan 430070 (China); College of Plant Science and Technology, Huazhong Agricultural University, Wuhan 430070 (China); National Center of Plant Gene Research, Wuhan 430070 (China)

    2013-02-18

    Graphical abstract: A phage-displayed chicken scFv antibody, FvSG7, binds on the surface antigen of conidiospores and the mycelia of F. verticillioides. Its fusion with alkaline phosphatase (AP) through a 218 linker displayed a 4-fold higher affinity compared with the parent scFv antibody and efficiently detected toxigenic Fusarium pathogens in cereal grains. Highlights: ► Generation of a highly reactive scFv antibody against F. verticillioides. ► Localization of the antibody binding to the surface target of F. verticillioides. ► Expression of the antibody–alkaline phosphatase (AP) fusion linked by a 218 linker. ► The antibody–AP fusion has a higher affinity than the parental antibody. ► The antibody–AP fusion detects toxigenic Fusarium pathogens in cereal grains. -- Abstract: Fusarium and its poisonous mycotoxins are distributed worldwide and are of particular interest in agriculture and food safety. A simple analytical method to detect pathogens is essential for forecasting diseases and controlling mycotoxins. This article describes a proposed method for convenient and sensitive detection of Fusarium pathogens that uses the fusion of single-chain variable fragment (scFv) and alkaline phosphatase (AP). A highly reactive scFv antibody specific to soluble cell wall-bound proteins (SCWPs) of F. verticillioides was selected from an immunized chicken phagemid library by phage display. The antibody was verified to bind on the surface of ungerminated conidiospores and mycelia of F. verticillioides. The scFv–AP fusion was constructed, and soluble expression in bacteria was confirmed. Both the antibody properties and enzymatic activity were retained, and the antigen-binding capacity of the fusion was enhanced by the addition of a linker. Surface plasmon resonance measurements confirmed that the fusion displayed 4-fold higher affinity compared with the fusion's parental scFv antibody. Immunoblot analyses showed that the fusion had good binding

  6. Application of DNA Aptamers and Quantum Dots to Lateral Flow Test Strips for Detection of Foodborne Pathogens with Improved Sensitivity versus Colloidal Gold.

    Science.gov (United States)

    Bruno, John G

    2014-01-01

    Preliminary studies aimed at improving the sensitivity of foodborne pathogen detection via lateral flow (LF) test strips by use of high affinity DNA aptamers for capture and reporter functions when coupled to red-emitting quantum dots (Qdot 655) are reported. A variety of DNA aptamers developed against Escherichia coli, Listeria monocytogenes, and Salmonella enterica were paired in capture and reporter combinations to determine which yielded the strongest detection of their cognate bacteria using a colloidal gold screening system. Several promising sandwich combinations were identified for each of the three bacterial LF strip systems. The best E. coli aptamer-LF system was further studied and yielded a visible limit of detection (LOD) of ~3,000 E. coli 8739 and ~6,000 E. coli O157:H7 in buffer. These LODs were reduced to ~300-600 bacterial cells per test respectively by switching to a Qdot 655 aptamer-LF system. Novel aspects of these assays such as the use of high levels of detergents to avoid quantum dot agglutination and enhance migration in analytical membranes, identification of optimal analytical membrane types, UV-immobilization of capture aptamers, and novel dual biotin/digoxigenin-end labeled aptamer streptavidin-colloidal gold or -Qdot 655 conjugates plus anti-digoxigenin antibody control lines are also discussed. In general, this work provides proof-of-principle for highly sensitive aptamer-Qdot LF strip assays for rapid foodborne pathogen detection. PMID:25437803

  7. Application of DNA Aptamers and Quantum Dots to Lateral Flow Test Strips for Detection of Foodborne Pathogens with Improved Sensitivity versus Colloidal Gold

    Directory of Open Access Journals (Sweden)

    John G. Bruno

    2014-04-01

    Full Text Available Preliminary studies aimed at improving the sensitivity of foodborne pathogen detection via lateral flow (LF test strips by use of high affinity DNA aptamers for capture and reporter functions when coupled to red-emitting quantum dots (Qdot 655 are reported. A variety of DNA aptamers developed against Escherichia coli, Listeria monocytogenes, and Salmonella enterica were paired in capture and reporter combinations to determine which yielded the strongest detection of their cognate bacteria using a colloidal gold screening system. Several promising sandwich combinations were identified for each of the three bacterial LF strip systems. The best E. coli aptamer-LF system was further studied and yielded a visible limit of detection (LOD of ~3,000 E. coli 8739 and ~6,000 E. coli O157:H7 in buffer. These LODs were reduced to ~300–600 bacterial cells per test respectively by switching to a Qdot 655 aptamer-LF system. Novel aspects of these assays such as the use of high levels of detergents to avoid quantum dot agglutination and enhance migration in analytical membranes, identification of optimal analytical membrane types, UV-immobilization of capture aptamers, and novel dual biotin/digoxigenin-end labeled aptamer streptavidin-colloidal gold or -Qdot 655 conjugates plus anti-digoxigenin antibody control lines are also discussed. In general, this work provides proof-of-principle for highly sensitive aptamer-Qdot LF strip assays for rapid foodborne pathogen detection.

  8. Phylogenetic Analysis of Downy Mildew Pathogens of Opium Poppy and PCR-Based In Planta and Seed Detection of Peronospora arborescens.

    Science.gov (United States)

    Landa, Blanca B; Montes-Borrego, Miguel; Muñoz-Ledesma, Francisco J; Jiménez-Díaz, Rafael M

    2007-11-01

    ABSTRACT Severe downy mildew diseases of opium poppy (Papaver somniferum) can be caused by Peronospora arborescens and P. cristata, but differentiating between the two pathogens is difficult because they share morphological features and a similar host range. In Spain, where severe epidemics of downy mildew of opium poppy have occurred recently, the pathogen was identified as P. arborescens on the basis of morphological traits. In this current study, sequence homology and phylogenetic analyses of the internal transcribed spacer regions (ITS) of the ribosomal DNA (rDNA) were carried out with DNA from P. arborescens and P. cristata from diverse geographic origins, which suggested that only P. arborescens occurs in cultivated Papaver somniferum in Spain. Moreover, analyses of the rDNA ITS region from 27 samples of downy-mildew-affected tissues from all opium-poppy-growing regions in Spain showed that genetic diversity exists within P. arborescens populations in Spain and that these are phylogenetically distinct from P. cristata. P. cristata instead shares a more recent, common ancestor with a range of Peronospora species that includes those found on host plants that are not members of the Papaveraceae. Species-specific primers and a PCR assay protocol were developed that differentiated P. arborescens and P. cristata and proved useful for the detection of P. arborescens in symptomatic and asymptomatic opium poppy plant parts. Use of these primers demonstrated that P. arborescens can be transmitted in seeds and that commercial seed stocks collected from crops with high incidence of the disease were frequently infected. Field experiments conducted in microplots free from P. arborescens using seed stocks harvested from infected capsules further demonstrated that transmission from seedborne P. arborescens to opium poppy plants can occur. Therefore, the specific-PCR detection protocol developed in this study can be of use for epidemiological studies and diagnosing the

  9. Comparative Analysis of Two Broad-Range PCR Assays for Pathogen Detection in Positive-Blood-Culture Bottles: PCR–High-Resolution Melting Analysis versus PCR-Mass Spectrometry

    OpenAIRE

    Jeng, Kevin; Gaydos, Charlotte A; Blyn, Lawrence B.; Yang, Samuel; Won, Helen; Matthews, Heather; Toleno, Donna; Hsieh, Yu-Hsiang; Carroll, Karen C.; Hardick, Justin; Masek, Billy; Kecojevic, Alexander; Sampath, Rangarajan; Peterson, Stephen; Rothman, Richard E.

    2012-01-01

    Detection of pathogens in bloodstream infections is important for directing antimicrobial treatment, but current culture-based approaches can be problematic. Broad-range PCR assays which target conserved genomic motifs for postamplification amplicon analysis permit detection of sepsis-causing pathogens. Comparison of different broad-range assays is important for informing future implementation strategies. In this study, we compared positive-blood-culture bottles processed by PCR coupled to hi...

  10. An alternative chemical redox method for the production of bispecific antibodies: implication in rapid detection of food borne pathogens.

    Directory of Open Access Journals (Sweden)

    Mohammad Owais

    Full Text Available Bi-functional antibodies with the ability to bind two unrelated epitopes have remarkable potential in diagnostic and bio-sensing applications. In the present study, bispecific antibodies that recognize human red blood cell (RBC and the food borne pathogen Listeria monocytogenes (L. monocytogenes were engineered. The procedure involves initial reduction of a mixture of anti-RBC and anti-Listeria antibodies followed by gradual re-oxidation of the reduced disulphides. This facilitates association of the separated antibody chains and formation of hybrid immunoglobulins with affinity for the L. monocytogenes and human RBC. The bispecific antibodies caused the agglutination of the RBCs only in the presence of L. monocytogenes cells. The agglutination process necessitated the specific presence of L. monocytogenes and the red colored clumps formed were readily visible with naked eyes. The RBC agglutination assay described here provides a remarkably simple approach for the rapid and highly specific screening of various pathogens in their biological niches.

  11. Genetic characterization of porcine kobuvirus and detection of coinfecting pathogens in diarrheic pigs in Jiangsu Province, China.

    Science.gov (United States)

    Yang, Zhen; Jin, Wenjie; Zhao, Zhenpeng; Lin, Weidong; Zhang, Di; Yu, Enqi; Qin, Aijian; Yang, Hanchun

    2014-12-01

    In this study, 396 samples from diarrheic pigs on 46 pig farms in Jiangsu Province, China, were analyzed by RT-PCR. One-hundred eighty-one pigs from 37 farms tested positive for porcine kobuvirus (PKV). Phylogenetic analysis of the 3D gene from 19 isolates showed sequence homology of 88.0 %-100 % and 69.4 %-100 % for nucleotides and amino acids, respectively, while similarity to isolates of other kobuviruses was 69.6 %-78.8 % and 27.8 %-56.9 %, respectively. One-hundred eighty-five samples contained two or more pathogens, and 31/68 PKV-positive samples tested positive for other diarrheic pathogens, confirming the existence of PKV infection and coinfection. PMID:25119679

  12. Predictive Models for Escherichia coli Concentrations at Inland Lake Beaches and Relationship of Model Variables to Pathogen Detection

    OpenAIRE

    Francy, Donna S.; Stelzer, Erin A.; Duris, Joseph W.; Brady, Amie M. G.; Harrison, John H.; Johnson, Heather E.; Ware, Michael W.

    2013-01-01

    Predictive models, based on environmental and water quality variables, have been used to improve the timeliness and accuracy of recreational water quality assessments, but their effectiveness has not been studied in inland waters. Sampling at eight inland recreational lakes in Ohio was done in order to investigate using predictive models for Escherichia coli and to understand the links between E. coli concentrations, predictive variables, and pathogens. Based upon results from 21 beach sites,...

  13. Detection of DOPA-Melanin in the Dimorphic Fungal Pathogen Penicillium marneffei and Its Effect on Macrophage Phagocytosis In Vitro

    OpenAIRE

    Donghua Liu; Lili Wei; Ting Guo; Weifen Tan

    2014-01-01

    The fungal pathogen Penicillium marneffei produces melanin-like pigment in vitro. The synthetic pathway of melanin and its possible influence in the protective yeast cells surviving within macrophage cells are not known. In this work, P. marneffei produced brown black pigment in the presence of L-DOPA and black particles were extracted from yeast cells treated with proteolytic enzymes, denaturant and concentrated hot acid. Kojic acid inhibited the brown-black pigment production of P. marneffe...

  14. Detection of Melanin-Like Pigments in the Dimorphic Fungal Pathogen Paracoccidioides brasiliensis In Vitro and during Infection

    OpenAIRE

    Gómez, Beatriz L.; Nosanchuk, Joshua D.; Díez, Soraya; Youngchim, Sirida; Aisen, Philip; Cano, Luz E.; Restrepo, Angela; Casadevall, Arturo; Hamilton, Andrew J.

    2001-01-01

    Melanins are implicated in the pathogenesis of several human diseases, including some microbial infections. In this study, we analyzed whether the conidia and the yeasts of the thermally dimorphic fungal pathogen Paracoccidioides brasiliensis produce melanin or melanin-like compounds in vitro and during infection. Growth of P. brasiliensis mycelia on water agar alone produced pigmented conidia, and growth of yeasts in minimal medium with l-3,4-dihydroxyphenylalanine (l-DOPA) produced pigmente...

  15. Poly(HEMA) brushes emerging as a new platform for direct detection of food pathogen in milk samples

    Czech Academy of Sciences Publication Activity Database

    Rodriguez-Emmenegger, Cesar Adolfo; Avramenko, Oxana; Brynda, Eduard; Škvor, J.; Bologna Alles, A.

    2011-01-01

    Roč. 26, č. 11 (2011), s. 4545-4551. ISSN 0956-5663 R&D Projects: GA AV ČR KAN200670701; GA ČR GAP503/10/0664 Institutional research plan: CEZ:AV0Z40500505 Keywords : surface plasmon resonance * food-borne pathogens * polymer brushes Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering Impact factor: 5.602, year: 2011

  16. Real-time PCR detection of pathogenic microorganisms in roof-harvested rainwater in Southeast Queensland, Australia.

    Science.gov (United States)

    Ahmed, W; Huygens, F; Goonetilleke, A; Gardner, T

    2008-09-01

    In this study, the microbiological quality of roof-harvested rainwater was assessed by monitoring the concentrations of Escherichia coli, enterococci, Clostridium perfringens, and Bacteroides spp. in rainwater obtained from tanks in Southeast Queensland, Australia. Samples were also tested using real-time PCR (with SYBR Green I dye) for the presence of potential pathogenic microorganisms. Of the 27 rainwater samples tested, 17 (63%), 21 (78%), 13 (48%), and 24 (89%) were positive for E. coli, enterococci, C. perfringens, and Bacteroides spp., respectively. Of the 27 samples, 11 (41%), 7 (26%), 4 (15%), 3 (11%), and 1 (4%) were PCR positive for the Campylobacter coli ceuE gene, the Legionella pneumophila mip gene, the Aeromonas hydrophila lip gene, the Salmonella invA gene, and the Campylobacter jejuni mapA gene. Of the 21 samples tested, 4 (19%) were positive for the Giardia lamblia beta-giardin gene. The binary logistic regression model indicated a positive correlation (P < 0.02) between the presence/absence of enterococci and A. hydrophila. In contrast, the presence/absence of the remaining potential pathogens did not correlate with traditional fecal indicators. The poor correlation between fecal indicators and potential pathogens suggested that fecal indicators may not be adequate to assess the microbiological quality of rainwater and consequent health risk. PMID:18621865

  17. Rapid detection of fungal pathogens in bronchoalveolar lavage samples using panfungal PCR combined with high resolution melting analysis.

    Science.gov (United States)

    Bezdicek, Matej; Lengerova, Martina; Ricna, Dita; Weinbergerova, Barbora; Kocmanova, Iva; Volfova, Pavlina; Drgona, Lubos; Poczova, Miroslava; Mayer, Jiri; Racil, Zdenek

    2016-10-01

    Despite advances in the treatment of invasive fungal diseases (IFD), mortality rates remain high. Moreover, due to the expanding spectrum of causative agents, fast and accurate pathogen identification is necessary. We designed a panfungal polymerase chain reaction (PCR), which targets the highly variable ITS2 region of rDNA genes and uses high resolution melting analysis (HRM) for subsequent species identification. The sensitivity and specificity of this method was tested on a broad spectrum of the most clinically important fungal pathogens including Aspergillus spp., Candida spp. and mucormycetes. Despite the fact that fluid from bronchoalveolar lavage (BAL) is one of the most frequently tested materials there is a lack of literature sources aimed at panfungal PCR as an IFD diagnostic tool from BAL samples. The applicability of this method in routine practice was evaluated on 104 BAL samples from immunocompromised patients. Due to high ITS region variability, we obtained divergent melting peaks for different fungal species. Thirteen out of 18 patients with proven or probable IFD were positive. Therefore, the sensitivity, specificity, positive predictive value and negative predictive value of our method were 67%, 100%, 100%, and 94%, respectively. In our assay, fungal pathogens identification is based on HRM, therefore omitting the expensive and time consuming sequencing step. With the high specificity, positive and negative predictive values, short time needed to obtain a result, and low price, the presented assay is intended to be used as a quick screening method for patients at risk of IFD. PMID:27161789

  18. A remote and autonomous continuous monitoring ultrasonic system for flood detection in sub-sea members of offshore steel oil rigs

    Energy Technology Data Exchange (ETDEWEB)

    Mijarez-Castro, Rito

    2006-07-01

    This thesis presents a novel and autonomous continuous monitoring system for flood detection in the hollow sub-sea members of offshore steel oil rigs. The technique offers an alternative to underwater nondestructive testing methods based on ultrasound and x-rays, which have been used to detect the presence of seawater in these applications, often with divers or remote operating vehicles. The research consists of theoretical and experimental work necessary for the development of an integral system that can be used in new fixed offshore oil rig designs. The system employs a single piezoelectric transducer which can be permanently attached to the inner wall of every sub-sea structure and which is powered by a normally inert seawater battery. Upon activation, the sensor transmits ultrasonic chirp or tone encoded pulses in the range of 21 k Hz to 42 k Hz, to a monitoring system at deck level for decoding and identifying flooded members. Two approaches to the system were considered during the investigation, depending on the communication channel exploited. These were based on either using the seawater as a propagation medium or using the steel structure as a wave-guide. A system based on theoretical models was built and field experiments were conducted using a purpose built jointed steel pipe structure, 7 m in length, 0.5 m in diameter and 16 mm in thickness. This structure was flooded by complete immersion in seawater. Results obtained using water as communication medium and a frequency in the order of 38 k Hz yielded an attenuation figure of 0.4 d B m{sub -}1 over 100 m, since losses were predominantly geometric. In contrast, using the tubular structure as a wave-guide and axis symmetric guided waves as the excitation, a gross attenuation figure of 1.3 d B m{sub -}1 was attained. In the straight parts of the structure, the attenuation ranged from 0.3 d B m{sub -} 1 to 0.6 d B m{sub -}1. The modes most likely to have been excited within the structure were L(0,5) - L(0

  19. FilmArray, an automated nested multiplex PCR system for multi-pathogen detection: development and application to respiratory tract infection.

    Directory of Open Access Journals (Sweden)

    Mark A Poritz

    Full Text Available The ideal clinical diagnostic system should deliver rapid, sensitive, specific and reproducible results while minimizing the requirements for specialized laboratory facilities and skilled technicians. We describe an integrated diagnostic platform, the "FilmArray", which fully automates the detection and identification of multiple organisms from a single sample in about one hour. An unprocessed biologic/clinical sample is subjected to nucleic acid purification, reverse transcription, a high-order nested multiplex polymerase chain reaction and amplicon melt curve analysis. Biochemical reactions are enclosed in a disposable pouch, minimizing the PCR contamination risk. FilmArray has the potential to detect greater than 100 different nucleic acid targets at one time. These features make the system well-suited for molecular detection of infectious agents. Validation of the FilmArray technology was achieved through development of a panel of assays capable of identifying 21 common viral and bacterial respiratory pathogens. Initial testing of the system using both cultured organisms and clinical nasal aspirates obtained from children demonstrated an analytical and clinical sensitivity and specificity comparable to existing diagnostic platforms. We demonstrate that automated identification of pathogens from their corresponding target amplicon(s can be accomplished by analysis of the DNA melting curve of the amplicon.

  20. 食源性致病菌快速检测技术研究进展%Rapid Detection Technique of Foodborne Pathogen

    Institute of Scientific and Technical Information of China (English)

    王大勇; 方振东; 谢朝新; 张春秀

    2009-01-01

    Foodborne pathogen is one the most primary factors affected food safety. Traditional methods to detect foodborne pathogens are complex and time-consuming, especially some of the bacteria are difficult to cultivate that make the needs of the control and prevention of the foodborne diseases difficult, and therefore, a rapid, simple, and specific detection has become a research hot spot. The application research of electrical impedance, radiation meas-urement, micro-heat, ELISA, PCR, gene chip, and bio-sensor technology to rapidly detect foodborne pathogenic bac-teria such as Staphylococcus aureus, Salmonella, enterohemorrhagie E. coli were summarized in this paper.%食源性致病菌是影响食品安全的主要因素之一,传统的细菌分离、培养与鉴定由于需时较长,特剐是有的细菌难以培养,难以适应食源性疾病预防控制的需要,因而快速、简便、特异的检测方法成为研究的热点.对电阻抗、放射测量、微热量、ELISA、PCR、基因芯片和生物传感器技术在金黄色葡萄球菌、沙门菌、肠出血性大肠埃希菌等食源性致病菌快速检测中的应用研究进行综述.

  1. Door Detection Algorithm for Autonomous Navigation Robot Based on Computer Vision%基于计算机视觉的自主导航机器人门检测算法

    Institute of Scientific and Technical Information of China (English)

    陈祥

    2012-01-01

    Door detection problem in Autonomous navigation robot was studied. For robot autonomous navigation area, no - visual sensor is not suitable for closed door detection, so the major work is how to effectively improve the indoor door detection's location. According to indoor door shape characteristic, this paper put forward a computer vision based autonomous navigation robot door detection algorithm. Algorithm only needs monocular vision image collection. According to the height, width and the characteristics of the shape of the door, the door detection can be realized. In the detecting process of, of the door features, the improved linear detection algorithm was used with high detection speed and high efficiency. The experimental results show that this method can be applied in not only a single background of doors, but also the more complex background. The door detection is effective and more robust. Therefore, it has great application value for robot autonomous navigation of home intelligence service.%研究了自主导航机器人中如何有效提高室内房门检测定位的问题.针对导航中非视觉传感器通过探测距离来判断门的位置,而关闭状态的门和周边的墙几乎处于同一平面无法定位,导致检测不准.可根据室内房门的形状特点,提出了一种计算机视觉的自主导航机器人门检测算法,能在单且视觉下进行图像采集,并根据房门的高度、宽度比以及门的形状特征,进而实现图像中门的检测.由于在检测门特征过程中使用了改进了的直线检测算法,因此具有检测速度快、效率高的特点.实验结果表明,与传统非视觉距离探测方法相比,改进方案不仅适用于单一背景下开状态的门检测,更对关闭状态门的检测具有有效性,完成导航平均处理时间约为2.2s,速度较高,对于家庭智能服务机器人的自主导航具有很大的应用价值.

  2. Trigeminal autonomic cephalgias

    OpenAIRE

    Benoliel, Rafael

    2012-01-01

    1. Trigeminal autonomic cephalgias (TACs) are headaches/facial pains classified together based on:a suspected common pathophysiology involving the trigeminovascular system, the trigeminoparasympathetic reflex and centres controlling circadian rhythms;a similar clinical presentation of trigeminal pain, and autonomic activation.

  3. Testing for autonomic neuropathy

    DEFF Research Database (Denmark)

    Hilsted, J

    1984-01-01

    disease, and may be nonspecific. A number of recently developed quantifiable and reproducible autonomic nerve function tests are reviewed, with emphasis on the physiological basis of the tests and on practical applicability. Finally, diagnostic criteria, based on autonomic nerve function tests, are...

  4. Detection and investigation of foodborne bacterial pathogens in Ningbo%宁波地区食品中致病菌污染物检测与调查

    Institute of Scientific and Technical Information of China (English)

    盛冬萍; 谢益君; 陈米娜; 徐景野

    2013-01-01

    Objective objective To understand the presence,contamination and cross contamination of foodborne bacterial pathogens in Ningbo city,provide basis for foodborne disease control,and trace the source of foodborne disease.Methods Strains were detected directly or after enrichment with biochemistry and API method,and subtyped with serum agglutination method.Antibiotic resistance and relative genes were detected with K-B method and PCR method respectively.Results 2 331 (7 species and 12 types) strains were detected from 6 812 food samples and the detection rate is 34.22% (2 331/6 812).The prevalent pathogens were Vibrio parahaemolyticus,and the detection rate was significantly different from the other types (P < 0.005).Vibrio parahaemolyticus could be classified into 10 sero-groups,and O6 and O5 were proved as the prevalent sero-groups.Most of the pathogens were sensitive to antibiotics.Three strains of Aeromonas were found multi-resistant with aacc resistance gene.Conclusion Various distribution was proved in foodborne bacteria in Ningbo.Contamination of foodborne pathogens was a major factor of foodborne diseases.Vibrio parahaemolyticus was the prevalent pathogenic bacteria.Most of the pathogens were sensitive to antibiotics.Bacteria with aacc resistance gene were found,which should raise concerns to control the spread of the resistant strains through rational administration of antibiotics and resistance surveillance.%目的 了解宁波地区食品中携带或污染的致病菌,为控制食源性疾病提供依据.方法 致病菌检测采用直接分离与增菌分离相结合的方法;细菌鉴定采用生化筛检和API等方法;血清分型采用诊断血清凝集法;药敏试验采用K-B法;采用PCR检测耐药基因.结果 从6 812份食品标本中检出致病菌7类12种,共2 331株,检出率为34.22%,以副溶血性弧菌检出率最高,与其他病原菌检出率比较差异有统计学意义(P<0.005).主要流行株

  5. Detection of Pathogens Causing Citrus Black Spot of Guanxi Honey Pomelo by Nested PCR%巢式PCR检测琯溪蜜柚黑斑病病原菌

    Institute of Scientific and Technical Information of China (English)

    郑域茹; 罗金水; 张汉荣; 卢松茂; 林智明; 王宏毅; 李美桂

    2013-01-01

    Citrus black spot is a fungal disease in most Guanxi honey pomelo. By using the specific primers, a unique 487 bp band was obtained by PCR amplification from genomic DNA of the pathogen causing citrus black spot of Guanxi honey pomelo and the method could accurately distinguish the honey pomelo black spot pathogen from the other disease pathogens of Sphaceloma fawcetti Jenk, Colletotrichum gleosporioides Penz and Mycosphaerella cirri White-Side in Guanxi honey pomelo. The sensitivity was determined by nested PCR. For the genomic DNA of honey pomelo black spot pathogen, the sensibility of nested PCR reached 100 fg/μL, 100 times higher than that of routine PCR. For the DNA of diseased tissues, the sensibility of nested PCR reached 100μg of DNA sample. Through nested PCR assay, the pathogen of honey pomelo black spot could be specifically detected form diseased and symptom latent infection honey pomelo tissues with the detection rate of 96.67% and 90%, respectively.%利用特异性引物从琯溪蜜柚黑斑病菌基因组DNA中扩增出一条分子量为487 bp的特异性条带,准确地与疮痂病、炭疽病和黄斑病菌等蜜柚常发性真菌病害区分开.采用巢式PCR对该引物的检测灵敏度进行测定,结果显示,对于黑斑病菌基因组DNA,巢式PCR的检测灵敏度为100 fg/μL,灵敏度比常规PCR至少提高100倍;对于发病组织,巢式PCR可从病斑组织含量为100 μg的DNA样品中检测到黑斑病菌.采用巢式PCR检测技术,可从蜜柚的黑斑病显症组织和未显症组织特异性地检测到病原菌,且检出率分别为96.67%和90%.

  6. A cloud-assisted design for autonomous driving

    OpenAIRE

    Suresh Kumar, Swarun; Gollakota, Shyamnath; Katabi, Dina

    2012-01-01

    This paper presents Carcel, a cloud-assisted system for autonomous driving. Carcel enables the cloud to have access to sensor data from autonomous vehicles as well as the roadside infrastructure. The cloud assists autonomous vehicles that use this system to avoid obstacles such as pedestrians and other vehicles that may not be directly detected by sensors on the vehicle. Further, Carcel enables vehicles to plan efficient paths that account for unexpected events such as road-work or accidents....

  7. Conventional and real-time PCRs for detection of Erwinia piriflorinigrans allow its distinction from the fire blight pathogen, Erwinia amylovora.

    Science.gov (United States)

    Barbé, Silvia; Bertolini, Edson; Roselló, Montserrat; Llop, Pablo; López, María M

    2014-04-01

    Erwinia piriflorinigrans is a new pathogenic species of the bacterial genus Erwinia that has been described recently in Spain. Accurate detection and identification of E. piriflorinigrans are challenging because its symptoms on pear blossoms are similar to those caused by Erwinia amylovora, the causal agent of fire blight. Moreover, these two species share phenotypic and molecular characteristics. Two specific and sensitive conventional and real-time PCR protocols were developed to identify and detect E. piriflorinigrans and to differentiate it from E. amylovora and other species of this genus. These protocols were based on sequences from plasmid pEPIR37, which is present in all strains of E. piriflorinigrans analyzed. After the stability of the plasmid was demonstrated, the specificities of the protocols were confirmed by the amplification of all E. piriflorinigrans strains tested, whereas 304 closely related pathogenic and nonpathogenic Erwinia strains and microbiota from pear trees were not amplified. In sensitivity assays, 10(3) cells/ml extract were detected in spiked plant material by conventional or real-time PCR, and 10(2) cells/ml were detected in DNA extracted from spiked plant material by real-time PCR. The protocols developed here succeeded in detecting E. piriflorinigrans in 102 out of 564 symptomatic and asymptomatic naturally infected pear samples (flowers, cortex stem tissue, leaves, shoots, and fruitlets), in necrotic Pyracantha sp. blossoms, and in necrotic pear and apple tissues infected with both E. amylovora and E. piriflorinigrans. Therefore, these new tools can be used in epidemiological studies that will enhance our understanding of the life cycle of E. piriflorinigrans in different hosts and plant tissues and its interaction with E. amylovora. PMID:24509928

  8. Denaturing gradient gel electrophoresis for nonlethal detection of Aeromonas salmonicida in salmonid mucus and its potential for other bacterial fish pathogens.

    Science.gov (United States)

    Quinn, Robert A; Stevenson, Roselynn M W

    2012-05-01

    Denaturing gradient gel electrophoresis (DGGE) of 16S rDNA was used to nonlethally detect Aeromonas salmonicida and other bacteria in salmonid skin mucus. Mucus samples from wild spawning coho salmon (Oncorhynchus kisutch) with endemic A. salmonicida and from cultured lake trout (Salvelinus namaycush) were tested by PCR-DGGE and were compared with mucus culture on Coomassie brilliant blue agar and internal organ culture. PCR-DGGE gave a highly reproducible 4-band pattern for 9 strains of typical A. salmonicida, which was different from other Aeromonas spp. Aeromonas salmonicida presence in mucus was evident as a band that comigrated with the bottom band of the A. salmonicida 4-band pattern and was verified by sequencing. PCR-DGGE found 36 of 52 coho salmon positive for A. salmonicida, compared with 31 positive by mucus culture and 16 by organ culture. Numerous other bacteria were detected in salmonid mucus, including Pseudomonas spp., Shewanella putrefaciens, Aeromonas hydrophila and other aeromonads. However, Yersinia ruckeri was not detected in mucus from 27 lake trout, but 1 fish had a sorbitol-positive Y. ruckeri isolated from organ culture. Yersinia ruckeri seeded into a mucus sample suggested that PCR-DGGE detection of this bacterium from mucus was possible. PCR-DGGE allows nonlethal detection of A. salmonicida in mucus and differentiation of some Aeromonas spp. and has the potential to allow simultaneous detection of other pathogens present in fish mucus. PMID:22506865

  9. Research advances for fast detection of food borne pathogenic bacteria%食品病原微生物快速检测技术研究进展

    Institute of Scientific and Technical Information of China (English)

    杨春光; 王宏伟; 彭心婷; 苏明明; 徐静; 李莉; 孙兴权; 曹际娟

    2015-01-01

    Now with the rapid development of food industry, food safety is concerned all over the world. Many factors affect the food safety, among which pathogenic microbe is one of the most primary factor. In order to effectively and efficiently monitor the food safety, it is more and more important for food quality control and supervision to control the pathogenic microorganism in food processing, and establish the method for rapid detection of food pathogen. Traditional methods for detection of food borne pathogens are quite complex, and cost much time, so more researches focus on the quick, convenient and differential methods. The scope of application of rapid detection method is very extensive, and more sensitive than the traditional detection method. This article introduced several advanced fast detection technology of food pathogenic bacteria, including molecular biology technology, immunity technology, metabolism technology and biosensor technology, and the rapid detection technology of those more advanced analysis and summarize the current mainstream, aiming to provide a reference for the further study.%随着现在食品工业的快速发展,食品安全越来越受到各国的重视。影响食品安全的因素很多,其中食品中的病原微生物是影响食品安全的主要因素之一。为了对食品安全进行有效、快速的监测,控制食品加工中的病原微生物,研究和建立食品病原快速检测方法对于食品质量控制和监管及人们健康也就越来越重要。食源性致病菌的传统检测方法繁琐复杂、周期较长,因而快速、简便、特异的检测方法成为研究的热点。快速检测方法的应用范围非常广泛,并且比传统的检测方法更加敏感。本文主要从分子生物学技术、免疫技术、代谢技术、生物传感器技术等方面介绍了目前国内外用于食品微生物检测的先进技术,并对这些在当前较为先进的主流的快速检测技术

  10. Extraction and Sensitive Detection of Toxins A and B from the Human Pathogen Clostridium difficile in 40 Seconds Using Microwave-Accelerated Metal-Enhanced Fluorescence

    Science.gov (United States)

    Joshi, Lovleen Tina; Mali, Buddha L.; Geddes, Chris D.; Baillie, Les

    2014-01-01

    Clostridium difficile is the primary cause of antibiotic associated diarrhea in humans and is a significant cause of morbidity and mortality. Thus the rapid and accurate identification of this pathogen in clinical samples, such as feces, is a key step in reducing the devastating impact of this disease. The bacterium produces two toxins, A and B, which are thought to be responsible for the majority of the pathology associated with the disease, although the relative contribution of each is currently a subject of debate. For this reason we have developed a rapid detection assay based on microwave-accelerated metal-enhanced fluorescence which is capable of detecting the presence of 10 bacteria in unprocessed human feces within 40 seconds. These promising results suggest that this prototype biosensor has the potential to be developed into a rapid, point of care, real time diagnostic assay for C. difficile. PMID:25162622

  11. 3D-printed microfluidic device for the detection of pathogenic bacteria using size-based separation in helical channel with trapezoid cross-section.

    Science.gov (United States)

    Lee, Wonjae; Kwon, Donghoon; Choi, Woong; Jung, Gyoo Yeol; Jeon, Sangmin

    2015-01-01

    A facile method has been developed to detect pathogenic bacteria using magnetic nanoparticle clusters (MNCs) and a 3D-printed helical microchannel. Antibody-functionalized MNCs were used to capture E. coli (EC) bacteria in milk, and the free MNCs and MNC-EC complexes were separated from the milk using a permanent magnet. The free MNCs and MNC-EC complexes were dispersed in a buffer solution, then the solution was injected into a helical microchannel device with or without a sheath flow. The MNC-EC complexes were separated from the free MNCs via the Dean drag force and lift force, and the separation was facilitated in the presence of a sheath flow. The concentration of the E. coli bacteria was determined using a light absorption spectrometer, and the limit of detection was found to be 10 cfu/mL in buffer solution and 100 cfu/mL in milk. PMID:25578942

  12. Extraction and sensitive detection of toxins A and B from the human pathogen Clostridium difficile in 40 seconds using microwave-accelerated metal-enhanced fluorescence.

    Directory of Open Access Journals (Sweden)

    Lovleen Tina Joshi

    Full Text Available Clostridium difficile is the primary cause of antibiotic associated diarrhea in humans and is a significant cause of morbidity and mortality. Thus the rapid and accurate identification of this pathogen in clinical samples, such as feces, is a key step in reducing the devastating impact of this disease. The bacterium produces two toxins, A and B, which are thought to be responsible for the majority of the pathology associated with the disease, although the relative contribution of each is currently a subject of debate. For this reason we have developed a rapid detection assay based on microwave-accelerated metal-enhanced fluorescence which is capable of detecting the presence of 10 bacteria in unprocessed human feces within 40 seconds. These promising results suggest that this prototype biosensor has the potential to be developed into a rapid, point of care, real time diagnostic assay for C. difficile.

  13. Evaluation of different buffered peptone water (BPW) based enrichment broths for detection of Gram-negative foodborne pathogens from various food matrices.

    Science.gov (United States)

    Margot, H; Zwietering, M H; Joosten, H; O'Mahony, Emer; Stephan, R

    2015-12-01

    This study evaluated the effects of changing the composition of the pre-enrichment medium buffered peptone water (BPW) on the growth of stressed and unstressed Gram-negative foodborne pathogens in a one-broth enrichment strategy. BPW supplemented with an available iron source and sodium pyruvate, along with low levels of 8-hydroxyquinoline and sodium deoxycholate (BPW-S) improved the recovery of desiccated Cronobacter spp. from powdered infant formula. Growth of Salmonella and STEC was comparable in all BPW variants tested for different food matrices. In products with high levels of Gram-negative background flora (e.g. sprouts), the target organisms could not be reliably detected by PCR in any of the BPW variants tested unless the initial level exceeded 10(3) cfu/10 g of sprouts. Based on these results we suggest BPW-S for a one-broth enrichment strategy of stressed Gram-negative foodborne pathogens from dry products. However, a one-broth enrichment strategy based on BPW variants tested in this evaluation is not recommended for produce with a high level of Gram-negative background flora due to very high detection limits. PMID:26267889

  14. A phage-displayed chicken single-chain antibody fused to alkaline phosphatase detects Fusarium pathogens and their presence in cereal grains.

    Science.gov (United States)

    Hu, Zu-Quan; Li, He-Ping; Zhang, Jing-Bo; Huang, Tao; Liu, Jin-Long; Xue, Sheng; Wu, Ai-Bo; Liao, Yu-Cai

    2013-02-18

    Fusarium and its poisonous mycotoxins are distributed worldwide and are of particular interest in agriculture and food safety. A simple analytical method to detect pathogens is essential for forecasting diseases and controlling mycotoxins. This article describes a proposed method for convenient and sensitive detection of Fusarium pathogens that uses the fusion of single-chain variable fragment (scFv) and alkaline phosphatase (AP). A highly reactive scFv antibody specific to soluble cell wall-bound proteins (SCWPs) of F. verticillioides was selected from an immunized chicken phagemid library by phage display. The antibody was verified to bind on the surface of ungerminated conidiospores and mycelia of F. verticillioides. The scFv-AP fusion was constructed, and soluble expression in bacteria was confirmed. Both the antibody properties and enzymatic activity were retained, and the antigen-binding capacity of the fusion was enhanced by the addition of a linker. Surface plasmon resonance measurements confirmed that the fusion displayed 4-fold higher affinity compared with the fusion's parental scFv antibody. Immunoblot analyses showed that the fusion had good binding capacity to the components from SCWPs of F. verticillioides, and enzyme-linked immunosorbent assays revealed that the detection limit of the fungus was below 10(-2) μg mL(-1), superior to the scFv antibody. The fusion protein was able to detect fungal concentrations as low as 10(-3) mg g(-1) of maize grains in both naturally and artificially contaminated samples. Thus, the fusion can be applied in rapid and simple diagnosis of Fusarium contamination in field and stored grain or in food. PMID:23374219

  15. Advancing Autonomous Operations for Deep Space Vehicles

    Science.gov (United States)

    Haddock, Angie T.; Stetson, Howard K.

    2014-01-01

    Starting in Jan 2012, the Advanced Exploration Systems (AES) Autonomous Mission Operations (AMO) Project began to investigate the ability to create and execute "single button" crew initiated autonomous activities [1]. NASA Marshall Space Flight Center (MSFC) designed and built a fluid transfer hardware test-bed to use as a sub-system target for the investigations of intelligent procedures that would command and control a fluid transfer test-bed, would perform self-monitoring during fluid transfers, detect anomalies and faults, isolate the fault and recover the procedures function that was being executed, all without operator intervention. In addition to the development of intelligent procedures, the team is also exploring various methods for autonomous activity execution where a planned timeline of activities are executed autonomously and also the initial analysis of crew procedure development. This paper will detail the development of intelligent procedures for the NASA MSFC Autonomous Fluid Transfer System (AFTS) as well as the autonomous plan execution capabilities being investigated. Manned deep space missions, with extreme communication delays with Earth based assets, presents significant challenges for what the on-board procedure content will encompass as well as the planned execution of the procedures.

  16. Autonomous control systems - Architecture and fundamental issues

    Science.gov (United States)

    Antsaklis, P. J.; Passino, K. M.; Wang, S. J.

    1988-01-01

    A hierarchical functional autonomous controller architecture is introduced. In particular, the architecture for the control of future space vehicles is described in detail; it is designed to ensure the autonomous operation of the control system and it allows interaction with the pilot and crew/ground station, and the systems on board the autonomous vehicle. The fundamental issues in autonomous control system modeling and analysis are discussed. It is proposed to utilize a hybrid approach to modeling and analysis of autonomous systems. This will incorporate conventional control methods based on differential equations and techniques for the analysis of systems described with a symbolic formalism. In this way, the theory of conventional control can be fully utilized. It is stressed that autonomy is the design requirement and intelligent control methods appear at present, to offer some of the necessary tools to achieve autonomy. A conventional approach may evolve and replace some or all of the `intelligent' functions. It is shown that in addition to conventional controllers, the autonomous control system incorporates planning, learning, and FDI (fault detection and identification).

  17. Autonomous linear lossless systems

    OpenAIRE

    Rao, Shodhan; Rapisarda, Paolo

    2008-01-01

    We define a lossless autonomous system as one having a quadratic differential form associated with it called an energy function, which is positive and which is conserved. We define an oscillatory system as one which has all its trajectories bounded on the entire time axis. In this paper, we show that an autonomous system is lossless if and only if it is oscillatory. Next we discuss a few properties of energy functions of autonomous lossless systems and a suitable way of splitting a given ener...

  18. Autonomous surveillance for biosecurity.

    Science.gov (United States)

    Jurdak, Raja; Elfes, Alberto; Kusy, Branislav; Tews, Ashley; Hu, Wen; Hernandez, Emili; Kottege, Navinda; Sikka, Pavan

    2015-04-01

    The global movement of people and goods has increased the risk of biosecurity threats and their potential to incur large economic, social, and environmental costs. Conventional manual biosecurity surveillance methods are limited by their scalability in space and time. This article focuses on autonomous surveillance systems, comprising sensor networks, robots, and intelligent algorithms, and their applicability to biosecurity threats. We discuss the spatial and temporal attributes of autonomous surveillance technologies and map them to three broad categories of biosecurity threat: (i) vector-borne diseases; (ii) plant pests; and (iii) aquatic pests. Our discussion reveals a broad range of opportunities to serve biosecurity needs through autonomous surveillance. PMID:25744760

  19. The nicotine paradox: effect of smoking on autonomic discrimination.

    Science.gov (United States)

    Lombardo, T W; Epstein, L H

    1986-01-01

    Smoking reduces negative affect while it increases sympathetic nervous system activity. However, theories of emotion predict that increased autonomic arousal should increase rather than reduce negative affect. One explanation for this paradox is that nicotine interferes with perception of autonomic activity. We evaluated the effect of smoking on autonomic activity perception by measuring performance on a heartbeat detection task after a high or low dose of nicotine or not smoking. A group of nonsmokers also completed the task. Results failed to support the hypothesis. In light of previous research, the results suggest EMG perception may be more important to the negative affect reduction phenomenon than perception of autonomic activity. PMID:3739820

  20. Pathogen Phytosensing: Plants to Report Plant Pathogens

    Directory of Open Access Journals (Sweden)

    C. Neal Stewart

    2008-04-01

    pathogens with the regulation of detectable reporter gene could provide biological evidence to define the functional differences between pathogens, and provide new technology and applications for transgenic plants as phytosensors.