WorldWideScience

Sample records for autonomous pathogen detection

  1. APDS: Autonomous Pathogen Detection System

    Energy Technology Data Exchange (ETDEWEB)

    Langlois, R G; Brown, S; Burris, L; Colston, B; Jones, L; Makarewicz, T; Mariella, R; Masquelier, D; McBride, M; Milanovich, F; Masarabadi, S; Venkateswaran, K; Marshall, G; Olson, D; Wolcott, D

    2002-02-14

    An early warning system to counter bioterrorism, the Autonomous Pathogen Detection System (APDS) continuously monitors the environment for the presence of biological pathogens (e.g., anthrax) and once detected, it sounds an alarm much like a smoke detector warns of a fire. Long before September 11, 2001, this system was being developed to protect domestic venues and events including performing arts centers, mass transit systems, major sporting and entertainment events, and other high profile situations in which the public is at risk of becoming a target of bioterrorist attacks. Customizing off-the-shelf components and developing new components, a multidisciplinary team developed APDS, a stand-alone system for rapid, continuous monitoring of multiple airborne biological threat agents in the environment. The completely automated APDS samples the air, prepares fluid samples in-line, and performs two orthogonal tests: immunoassay and nucleic acid detection. When compared to competing technologies, APDS is unprecedented in terms of flexibility and system performance.

  2. The Autonomous Pathogen Detection System

    Energy Technology Data Exchange (ETDEWEB)

    Dzenitis, J M; Makarewicz, A J

    2009-01-13

    We developed, tested, and now operate a civilian biological defense capability that continuously monitors the air for biological threat agents. The Autonomous Pathogen Detection System (APDS) collects, prepares, reads, analyzes, and reports results of multiplexed immunoassays and multiplexed PCR assays using Luminex{copyright} xMAP technology and flow cytometer. The mission we conduct is particularly demanding: continuous monitoring, multiple threat agents, high sensitivity, challenging environments, and ultimately extremely low false positive rates. Here, we introduce the mission requirements and metrics, show the system engineering and analysis framework, and describe the progress to date including early development and current status.

  3. APDS: The Autonomous Pathogen Detection System

    Energy Technology Data Exchange (ETDEWEB)

    Hindson, B; Makarewicz, A; Setlur, U; Henderer, B; McBride, M; Dzenitis, J

    2004-10-04

    We have developed and tested a fully autonomous pathogen detection system (APDS) capable of continuously monitoring the environment for airborne biological threat agents. The system was developed to provide early warning to civilians in the event of a bioterrorism incident and can be used at high profile events for short-term, intensive monitoring or in major public buildings or transportation nodes for long-term monitoring. The APDS is completely automated, offering continuous aerosol sampling, in-line sample preparation fluidics, multiplexed detection and identification immunoassays, and nucleic-acid based polymerase chain reaction (PCR) amplification and detection. Highly multiplexed antibody-based and duplex nucleic acid-based assays are combined to reduce false positives to a very low level, lower reagent costs, and significantly expand the detection capabilities of this biosensor. This article provides an overview of the current design and operation of the APDS. Certain sub-components of the ADPS are described in detail, including the aerosol collector, the automated sample preparation module that performs multiplexed immunoassays with confirmatory PCR, and the data monitoring and communications system. Data obtained from an APDS that operated continuously for seven days in a major U.S. transportation hub is reported.

  4. Autonomous system for pathogen detection and identification

    Energy Technology Data Exchange (ETDEWEB)

    Belgrader, P. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Benett, W. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Bergman, W. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Langlois, R. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Mariella, R. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Milanovich, F. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Miles, R. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Venkateswaran, K. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Long, G. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Nelson, W. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    1998-09-24

    This purpose of this project is to build a prototype instrument that will, running unattended, detect, identify, and quantify BW agents. In order to accomplish this, we have chosen to start with the world' s leading, proven, assays for pathogens: surface-molecular recognition assays, such as antibody-based assays, implemented on a high-performance, identification (ID)-capable flow cytometer, and the polymerase chain reaction (PCR) for nucleic-acid based assays. With these assays, we must integrate the capability to: l collect samples from aerosols, water, or surfaces; l perform sample preparation prior to the assays; l incubate the prepared samples, if necessary, for a period of time; l transport the prepared, incubated samples to the assays; l perform the assays; l interpret and report the results of the assays. Issues such as reliability, sensitivity and accuracy, quantity of consumables, maintenance schedule, etc. must be addressed satisfactorily to the end user. The highest possible sensitivity and specificity of the assay must be combined with no false alarms. Today, we have assays that can, in under 30 minutes, detect and identify simulants for BW agents at concentrations of a few hundred colony-forming units per ml of solution. If the bio-aerosol sampler of this system collects 1000 Ymin and concentrates the respirable particles into 1 ml of solution with 70% processing efficiency over a period of 5 minutes, then this translates to a detection/ID capability of under 0.1 agent-containing particle/liter of air.

  5. Autonomously Sensing Hydrogels for the Rapid and Selective Detection of Pathogenic Bacteria.

    Science.gov (United States)

    Ebrahimi, Mir-Morteza Sadat; Laabei, Maisem; Jenkins, A Tobias A; Schönherr, Holger

    2015-12-01

    The development of a versatile approach for the rapid and sensitive detection of relevant pathogenic bacteria and autonomous signaling of the detection events in reporter hydrogel film coatings is reported. Exploiting chitosan hydrogel films equipped with chromogenic or fluorogenic reporter moieties, the presence of the Gram-negative bacterium Pseudomonas aeruginosa and the Gram-positive bacterium Staphylococcus aureus is sensed within 1 h by detecting the characteristic enzymes α-glucosidase and elastase with limits of detection (LOD) hydrogels comprise an interesting platform for the rapid detection of bacteria.

  6. On-chip quantitative detection of pathogen genes by autonomous microfluidic PCR platform.

    Science.gov (United States)

    Tachibana, Hiroaki; Saito, Masato; Shibuya, Shogo; Tsuji, Koji; Miyagawa, Nobuyuki; Yamanaka, Keiichiro; Tamiya, Eiichi

    2015-12-15

    Polymerase chain reaction (PCR)-based genetic testing has become a routine part of clinical diagnoses and food testing. In these fields, rapid, easy-to-use, and cost-efficient PCR chips are expected to be appeared for providing such testing on-site. In this study, a new autonomous disposable plastic microfluidic PCR chip was created, and was utilized for quantitative detection of pathogenic microorganisms. To control the capillary flow of the following solution in the PCR microchannel, a driving microchannel was newly designed behind the PCR microchannel. This allowed the effective PCR by simply dropping the PCR solution onto the inlet without any external pumps. In order to achieve disposability, injection-molded cyclo-olefin polymer (COP) of a cost-competitive plastic was used for the PCR chip. We discovered that coating the microchannel walls with non-ionic surfactant produced a suitable hydrophilic surface for driving the capillary flow through the 1250-mm long microchannel. As a result, quantitative real-time PCR with the lowest initial concentration of human, Escherichia coli (E. coli), and pathogenic E. coli O157 genomic DNA of 4, 0.0019, 0.031 pg/μl, respectively, was successfully achieved in less than 18 min. Our results indicate that the platform presented in this study provided a rapid, easy-to-use, and low-cost real-time PCR system that could be potentially used for on-site gene testing.

  7. Autonomous Forest Fire Detection

    NARCIS (Netherlands)

    Breejen, E. den; Breuers, M.; Cremer, F.; Kemp, R.A.W.; Roos, M.; Schutte, K.; Vries, J.S. de

    1998-01-01

    Forest fire detection is a very important issue in the pre-suppression process. Timely detection allows the suppression units to reach the fire in its initial stages and this will reduce the suppression costs considerably. The autonomous forest fire detection principle is based on temporal contrast

  8. The Bering Autonomous Target Detection

    DEFF Research Database (Denmark)

    Jørgensen, John Leif; Denver, Troelz; Betto, Maurizio

    2003-01-01

    An autonomous asteroid target detection and tracking method has been developed. The method features near omnidirectionality and focus on high speed operations and completeness of search of the near space rather than the traditional faint object search methods, employed presently at the larger...... telescopes. The method has proven robust in operation and is well suited for use onboard spacecraft. As development target for the method and the associated instrumentation the asteroid research mission Bering has been used. Onboard a spacecraft, the autonomous detection is centered around the fully...

  9. Semi autonomous mine detection system

    Energy Technology Data Exchange (ETDEWEB)

    Douglas Few; Roelof Versteeg; Herman Herman

    2010-04-01

    CMMAD is a risk reduction effort for the AMDS program. As part of CMMAD, multiple instances of semi autonomous robotic mine detection systems were created. Each instance consists of a robotic vehicle equipped with sensors required for navigation and marking, a countermine sensors and a number of integrated software packages which provide for real time processing of the countermine sensor data as well as integrated control of the robotic vehicle, the sensor actuator and the sensor. These systems were used to investigate critical interest functions (CIF) related to countermine robotic systems. To address the autonomy CIF, the INL developed RIK was extended to allow for interaction with a mine sensor processing code (MSPC). In limited field testing this system performed well in detecting, marking and avoiding both AT and AP mines. Based on the results of the CMMAD investigation we conclude that autonomous robotic mine detection is feasible. In addition, CMMAD contributed critical technical advances with regard to sensing, data processing and sensor manipulation, which will advance the performance of future fieldable systems. As a result, no substantial technical barriers exist which preclude – from an autonomous robotic perspective – the rapid development and deployment of fieldable systems.

  10. Semi autonomous mine detection system

    Science.gov (United States)

    Few, Doug; Versteeg, Roelof; Herman, Herman

    2010-04-01

    CMMAD is a risk reduction effort for the AMDS program. As part of CMMAD, multiple instances of semi autonomous robotic mine detection systems were created. Each instance consists of a robotic vehicle equipped with sensors required for navigation and marking, countermine sensors and a number of integrated software packages which provide for real time processing of the countermine sensor data as well as integrated control of the robotic vehicle, the sensor actuator and the sensor. These systems were used to investigate critical interest functions (CIF) related to countermine robotic systems. To address the autonomy CIF, the INL developed RIK was extended to allow for interaction with a mine sensor processing code (MSPC). In limited field testing this system performed well in detecting, marking and avoiding both AT and AP mines. Based on the results of the CMMAD investigation we conclude that autonomous robotic mine detection is feasible. In addition, CMMAD contributed critical technical advances with regard to sensing, data processing and sensor manipulation, which will advance the performance of future fieldable systems. As a result, no substantial technical barriers exist which preclude - from an autonomous robotic perspective - the rapid development and deployment of fieldable systems.

  11. Rapid Detection of Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    David Perlin

    2005-08-14

    Pathogen identification is a crucial first defense against bioterrorism. A major emphasis of our national biodefense strategy is to establish fast, accurate and sensitive assays for diagnosis of infectious diseases agents. Such assays will ensure early and appropriate treatment of infected patients. Rapid diagnostics can also support infection control measures, which monitor and limit the spread of infectious diseases agents. Many select agents are highly transmissible in the early stages of disease, and it is critical to identify infected patients and limit the risk to the remainder of the population and to stem potential panic in the general population. Nucleic acid-based molecular approaches for identification overcome many of the deficiencies associated with conventional culture methods by exploiting both large- and small-scale genomic differences between organisms. PCR-based amplification of highly conserved ribosomal RNA (rRNA) genes, intergenic sequences, and specific toxin genes is currently the most reliable approach for bacterial, fungal and many viral pathogenic agents. When combined with fluorescence-based oligonucleotide detection systems, this approach provides real-time, quantitative, high fidelity analysis capable of single nucleotide allelic discrimination (4). These probe systems offer rapid turn around time (<2 h) and are suitable for high throughput, automated multiplex operations that are critical for clinical diagnostic laboratories. In this pilot program, we have used molecular beacon technology invented at the Public health Research Institute to develop a new generation of molecular probes to rapidly detect important agents of infectious diseases. We have also developed protocols to rapidly extract nucleic acids from a variety of clinical specimen including and blood and tissue to for detection in the molecular assays. This work represented a cooperative research development program between the Kramer-Tyagi/Perlin labs on probe development

  12. Pathogen detection using engineered bacteriophages.

    Science.gov (United States)

    Smartt, Abby E; Xu, Tingting; Jegier, Patricia; Carswell, Jessica J; Blount, Samuel A; Sayler, Gary S; Ripp, Steven

    2012-04-01

    Bacteriophages, or phages, are bacterial viruses that can infect a broad or narrow range of host organisms. Knowing the host range of a phage allows it to be exploited in targeting various pathogens. Applying phages for the identification of microorganisms related to food and waterborne pathogens and pathogens of clinical significance to humans and animals has a long history, and there has to some extent been a recent revival in these applications as phages have become more extensively integrated into novel detection, identification, and monitoring technologies. Biotechnological and genetic engineering strategies applied to phages are responsible for some of these new methods, but even natural unmodified phages are widely applicable when paired with appropriate innovative detector platforms. This review highlights the use of phages as pathogen detector interfaces to provide the reader with an up-to-date inventory of phage-based biodetection strategies.

  13. Autonomous valve for detection of biopolymer degradation

    DEFF Research Database (Denmark)

    Keller, Stephan Urs; Noeth, Nadine-Nicole; Fetz, Stefanie

    2009-01-01

    We present a polymer microvalve that allows the detection of biopolymer degradation without the need of external energy. The valve is based on a polymer container filled with a colored marker solution and closed by a thin lid. This structure is covered by a film of poly(L-lactide) and degradation...... of the biopolymer triggers the release of the color which is detected visually. The autonomous valve has potential for the fast testing of biopolymer degradation under various environmental conditions or by specific enzymes....

  14. Adaptively detecting changes in Autonomic Grid Computing

    KAUST Repository

    Zhang, Xiangliang

    2010-10-01

    Detecting the changes is the common issue in many application fields due to the non-stationary distribution of the applicative data, e.g., sensor network signals, web logs and gridrunning logs. Toward Autonomic Grid Computing, adaptively detecting the changes in a grid system can help to alarm the anomalies, clean the noises, and report the new patterns. In this paper, we proposed an approach of self-adaptive change detection based on the Page-Hinkley statistic test. It handles the non-stationary distribution without the assumption of data distribution and the empirical setting of parameters. We validate the approach on the EGEE streaming jobs, and report its better performance on achieving higher accuracy comparing to the other change detection methods. Meanwhile this change detection process could help to discover the device fault which was not claimed in the system logs. © 2010 IEEE.

  15. Autonomous Chemical Vapour Detection by Micro UAV

    Directory of Open Access Journals (Sweden)

    Kent Rosser

    2015-12-01

    Full Text Available The ability to remotely detect and map chemical vapour clouds in open air environments is a topic of significant interest to both defence and civilian communities. In this study, we integrate a prototype miniature colorimetric chemical sensor developed for methyl salicylate (MeS, as a model chemical vapour, into a micro unmanned aerial vehicle (UAV, and perform flights through a raised MeS vapour cloud. Our results show that that the system is capable of detecting MeS vapours at low ppm concentration in real-time flight and rapidly sending this information to users by on-board telemetry. Further, the results also indicate that the sensor is capable of distinguishing “clean” air from “dirty”, multiple times per flight, allowing us to look towards autonomous cloud mapping and source localization applications. Further development will focus on a broader range of integrated sensors, increased autonomy of detection and improved engineering of the system.

  16. Bacteriophage-Based Pathogen Detection

    Science.gov (United States)

    Ripp, Steven

    Considered the most abundant organism on Earth, at a population approaching 1031, bacteriophage, or phage for short, mediate interactions with myriad bacterial hosts that has for decades been exploited in phage typing schemes for signature identification of clinical, food-borne, and water-borne pathogens. With over 5,000 phage being morphologically characterized and grouped as to susceptible host, there exists an enormous cache of bacterial-specific sensors that has more recently been incorporated into novel bio-recognition assays with heightened sensitivity, specificity, and speed. These assays take many forms, ranging from straightforward visualization of labeled phage as they attach to their specific bacterial hosts to reporter phage that genetically deposit trackable signals within their bacterial hosts to the detection of progeny phage or other uniquely identifiable elements released from infected host cells. A comprehensive review of these and other phage-based detection assays, as directed towards the detection and monitoring of bacterial pathogens, will be provided in this chapter.

  17. Autonomous Rule Creation for Intrusion Detection

    Energy Technology Data Exchange (ETDEWEB)

    Todd Vollmer; Jim Alves-Foss; Milos Manic

    2011-04-01

    Many computational intelligence techniques for anomaly based network intrusion detection can be found in literature. Translating a newly discovered intrusion recognition criteria into a distributable rule can be a human intensive effort. This paper explores a multi-modal genetic algorithm solution for autonomous rule creation. This algorithm focuses on the process of creating rules once an intrusion has been identified, rather than the evolution of rules to provide a solution for intrusion detection. The algorithm was demonstrated on anomalous ICMP network packets (input) and Snort rules (output of the algorithm). Output rules were sorted according to a fitness value and any duplicates were removed. The experimental results on ten test cases demonstrated a 100 percent rule alert rate. Out of 33,804 test packets 3 produced false positives. Each test case produced a minimum of three rule variations that could be used as candidates for a production system.

  18. Detection of Lyme disease pathogens in isolated ticks at Aibi Lake, Alataw Pass, Xinjiang Autonomous Region%新疆阿拉山口艾比湖湿地蜱种莱姆病病原体检测

    Institute of Scientific and Technical Information of China (English)

    王安东; 徐军; 王远志; 徐新龙; 戴莉; 杜景云; 王丽娜; 牟路萌; 肖云霞

    2015-01-01

    Objective In order to understand the major tick species,Borrelia burgdorferi infection and genotype status at Aibi Lake,Alataw Pass,Xinjiang Autonomous Region.Methods Free-living ticks were collected by drag-flag method from April to August,2014,and the morphological identification was carried out.Borrelia spp.was detected by 5S-23S rRNA gene primers.The PCR products were sequenced and analyzed with BLAST.Results One hundred fifty-two isolated ticks were collected,including Rhipicephalus sanguineus (12),Hyalomma asiaticum (59) and Dermacentor Marginatus (81).The positive rate of Borrelia spp.was 34.87% (53/152).The positive rate of Hyalomma asiaticum (57.63%,34/59) was higher than that of Dermacentor Marginatus (22.22%,18/81,x2 =18.328,P < 0.05) and Rhipicephalus sanguineus (8.33%,1/12,x2 =9.694,P < 0.05).The analysis of 5S-23S rRNA sequencing indicated the pathogen was Borrelia burgdorferi sensu stricto.Conclusions Borrelia burgdorferi sensu stricto in ticks is firstly detected in Alataw region.The results conveyed us Aibi Lake was natural epidemic focus of Lyme disease.%目的 了解新疆阿拉山口艾比湖湿地主要蜱种莱姆病螺旋体感染与基因型状况.方法 2014年4-8月,在新疆艾比湖湿地选取3个采集点,采用布旗法采集游离蜱,经形态学鉴定蜱种后,采用巢式PCR法扩增莱姆病病原5S-23S rRNA基因,将PCR产物测序并进行BLAST比对分析.结果 共检测游离蜱152只,其中血红扇头蜱12只、亚洲璃眼蜱59只、边缘革蜱81只.各蜱种莱姆病病原总体阳性率为34.87%(53/152),其中亚洲璃眼蜱阳性率为(57.63%,34/59),边缘革蜱阳性率为(22.22%,18/81),血红扇头蜱阳性率为(8.33%,1/12),亚洲璃眼蜱的阳性率高于边缘革蜱和血红扇头蜱(x2=18.328、9.694,P均<0.05);5S-23SrRNA基因测序比对显示艾比湖湿地莱姆病基因型为伯氏疏螺旋体.结论 首次在新疆阿拉山口艾比湖湿地硬蜱检测到伯氏疏螺旋体,提示新

  19. Autonomous Underwater Munitions and Explosives of Concern Detection System

    Science.gov (United States)

    2015-03-01

    MR-201002) Autonomous Underwater Munitions and Explosives of Concern Detection System March 2015 This document has been... Autonomous Underwater Munitions and Explosives of Concern Detection System 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR...Certification Program (ESTCP), 4800 Mark Center Drive , Suite 17D08,Alexandria,VA,22350-3605 8. PERFORMING ORGANIZATION REPORT NUMBER 9. SPONSORING

  20. Real Time Detection of Foodborne Pathogens

    Science.gov (United States)

    Velusamy, V.; Arshak, K.; Korostynka, O.; Vaseashta, Ashok; Adley, C.

    Contamination of foods by harmful bacteria by natural events or malicious intent poses a serious threat to public health and safety. This review introduces current technologies in detecting pathogens in food and foodborne illnesses. Causes of foodborne diseases and trends impacting foodborne diseases such as globalization and changes in micro-organisms, human populations, lifestyles, and climates are addressed. In addition, a review of the limitations in detecting pathogens with conventional technologies is presented. Finally, a review of nanostructured and nanomaterials based sensing technologies by pathogen, detection limits, and advantages is described.

  1. Digital PCR for detection of citrus pathogens

    Science.gov (United States)

    Citrus trees are often infected with multiple pathogens of economic importance, especially those with insect or mite vectors. Real-time/quantitative PCR (qPCR) has been used for high-throughput detection and relative quantification of pathogens; however, target reference or standards are required. I...

  2. Road boundary detection for autonomous vehicle navigation

    Energy Technology Data Exchange (ETDEWEB)

    Davis, L.S.; Kushner, T.R.; LeMoigne, J.J.; Waxman, A.M.

    1986-03-01

    The Computer Vision Laboratory at the University Maryland for the past year has been developing a computer vision system for autonomous ground navigation of roads and road networks for the Defense Advanced Research Projects Agency's Strategic Computing Program. The complete system runs on a VAX 11/785, but certain parts of it have been reimplemented on a VICOM image processing sysem for experimentation on an autonomous vehicle built for the Martin Marietta Corp., Aerospace Division, in Denver, Colorado. A brief overview is given of the principal software components of the system and the VICOM implementation in detail.

  3. Waterborne Pathogens: Detection Methods and Challenges

    Directory of Open Access Journals (Sweden)

    Flor Yazmín Ramírez-Castillo

    2015-05-01

    Full Text Available Waterborne pathogens and related diseases are a major public health concern worldwide, not only by the morbidity and mortality that they cause, but by the high cost that represents their prevention and treatment. These diseases are directly related to environmental deterioration and pollution. Despite the continued efforts to maintain water safety, waterborne outbreaks are still reported globally. Proper assessment of pathogens on water and water quality monitoring are key factors for decision-making regarding water distribution systems’ infrastructure, the choice of best water treatment and prevention waterborne outbreaks. Powerful, sensitive and reproducible diagnostic tools are developed to monitor pathogen contamination in water and be able to detect not only cultivable pathogens but also to detect the occurrence of viable but non-culturable microorganisms as well as the presence of pathogens on biofilms. Quantitative microbial risk assessment (QMRA is a helpful tool to evaluate the scenarios for pathogen contamination that involve surveillance, detection methods, analysis and decision-making. This review aims to present a research outlook on waterborne outbreaks that have occurred in recent years. This review also focuses in the main molecular techniques for detection of waterborne pathogens and the use of QMRA approach to protect public health.

  4. Molecular detection of foodborne pathogens

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hartmann

    Microbiological Methods (NordVal) in comparative and collaborative trials, and was approved for detection of Campylobacter in chicken neck skin, cloacal swab and boot swab samples. A comparison study on probe chemistries for real-time PCR was performed on locked nucleic acid (LNA), minor groove binder (MGB......Val in comparative and collaborative trials and was approved as an alternative method for detection of Salmonella in chicken neck skin, minced meat and pig carcass swabs. In conclusion, this thesis presents the development and validation of real-time PCR methods for detection of Salmonella and Campylobacter...... for detection and enumeration of Salmonella and Campylobacter are time-consuming and laborious. They lack specificity and do not enable detection of viable but non-culturable (VBNC) bacteria. The focus of the present thesis has been development and validation of PCR-based detection methods for Salmonella...

  5. Malicious Hubs: Detecting Abnormally Malicious Autonomous Systems

    Energy Technology Data Exchange (ETDEWEB)

    Kalafut, Andrew J. [Indiana University; Shue, Craig A [ORNL; Gupta, Prof. Minaxi [Indiana University

    2010-01-01

    While many attacks are distributed across botnets, investigators and network operators have recently targeted malicious networks through high profile autonomous system (AS) de-peerings and network shut-downs. In this paper, we explore whether some ASes indeed are safe havens for malicious activity. We look for ISPs and ASes that exhibit disproportionately high malicious behavior using 12 popular blacklists. We find that some ASes have over 80% of their routable IP address space blacklisted and others account for large fractions of blacklisted IPs. Overall, we conclude that examining malicious activity at the AS granularity can unearth networks with lax security or those that harbor cybercrime.

  6. Molecular detection of foodborne pathogens

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hartmann

    ), Scorpion and TaqMan probes. The LNA probe was shown to be the most sensitive probe chemistry in the real-time PCR assay for detection of Campylobacter, producing the highest amplification efficiency. Choice of probe chemistry was found to impact the sensitivity of PCR assays, and should be considered...

  7. Quantitative multiplex detection of pathogen biomarkers

    Energy Technology Data Exchange (ETDEWEB)

    Mukundan, Harshini; Xie, Hongzhi; Swanson, Basil I.; Martinez, Jennifer; Grace, Wynne K.

    2016-02-09

    The present invention addresses the simultaneous detection and quantitative measurement of multiple biomolecules, e.g., pathogen biomarkers through either a sandwich assay approach or a lipid insertion approach. The invention can further employ a multichannel, structure with multi-sensor elements per channel.

  8. Quantitative multiplex detection of pathogen biomarkers

    Science.gov (United States)

    Mukundan, Harshini; Xie, Hongzhi; Swanson, Basil I; Martinez, Jennifer; Grace, Wynne K

    2014-10-14

    The present invention addresses the simultaneous detection and quantitative measurement of multiple biomolecules, e.g., pathogen biomarkers through either a sandwich assay approach or a lipid insertion approach. The invention can further employ a multichannel, structure with multi-sensor elements per channel.

  9. Surrounding Moving Obstacle Detection for Autonomous Driving Using Stereo Vision

    OpenAIRE

    Hao Sun; Huanxin Zou; Shilin Zhou; Cheng Wang; Naser El-Sheimy

    2013-01-01

    Detection and tracking surrounding moving obstacles such as vehicles and pedestrians are crucial for the safety of mobile robotics and autonomous vehicles. This is especially the case in urban driving scenarios. This paper presents a novel framework for surrounding moving obstacles detection using binocular stereo vision. The contributions of our work are threefold. Firstly, a multiview feature matching scheme is presented for simultaneous stereo correspondence and motion correspondence searc...

  10. Detection of pathogens from periodontal lesions

    Directory of Open Access Journals (Sweden)

    Malheiros Veruska de João

    2004-01-01

    Full Text Available OBJECTIVE: To comparatively detect A. actinomycetemcomitans and F. nucleatum from periodontal and healthy sites. METHODS: Subgingival clinical samples from 50 periodontitis adult patients and 50 healthy subjects were analyzed. Both organisms were isolated using a trypticase soy agar-bacitracin-vancomycin (TSBV medium and detected by PCR. Conventional biochemical tests were used for bacteria identification. RESULTS: A. actinomycetemcomitans and F. nucleatum were isolated in 18% and 20% of the patients, respectively, and in 2% and 24% of healthy subjects. Among A. actinomycetemcomitans isolates, biotype II was the most prevalent. Primer pair AA was 100% sensitive in the detection of A. actinomycetemcomitans from both subject groups. Primers ASH and FU were also 100% sensitive to detect this organism in healthy subject samples. Primer pair FN5047 was more sensitive to detect F. nucleatum in patients or in healthy samples than primer 5059S. Primers ASH and 5059S were more specific in the detection of A. actinomycetemcomitans and F. nucleatum, respectively, in patients and in healthy subject samples. CONCLUSIONS: PCR is an effective tool for detecting periodontal pathogens in subgingival samples, providing a faster and safer diagnostic tool of periodontal diseases. The method's sensitivity and specificity is conditioned by the choice of the set of primers used.

  11. Bacteriophage based probes for pathogen detection.

    Science.gov (United States)

    Singh, Amit; Arutyunov, Denis; Szymanski, Christine M; Evoy, Stephane

    2012-08-01

    Rapid and specific detection of pathogenic bacteria is important for the proper treatment, containment and prevention of human, animal and plant diseases. Identifying unique biological probes to achieve a high degree of specificity and minimize false positives has therefore garnered much interest in recent years. Bacteriophages are obligate intracellular parasites that subvert bacterial cell resources for their own multiplication and production of disseminative new virions, which repeat the cycle by binding specifically to the host surface receptors and injecting genetic material into the bacterial cells. The precision of host recognition in phages is imparted by the receptor binding proteins (RBPs) that are often located in the tail-spike or tail fiber protein assemblies of the virions. Phage host recognition specificity has been traditionally exploited for bacterial typing using laborious and time consuming bacterial growth assays. At the same time this feature makes phage virions or RBPs an excellent choice for the development of probes capable of selectively capturing bacteria on solid surfaces with subsequent quick and automatic detection of the binding event. This review focuses on the description of pathogen detection approaches based on immobilized phage virions as well as pure recombinant RBPs. Specific advantages of RBP-based molecular probes are also discussed.

  12. Antibody conjugated graphene nanocomposites for pathogen detection

    Science.gov (United States)

    Sign, Chandan; Sumana, Gajjala

    2016-04-01

    Graphene oxide (GO), due to its excellent electrochemical properties and large surface area, known to be highly suitable material for biosensing application. Here, we report in situ synthesis of silver nanopaticles (AgNPs) onto the GO sheets for the electrochemical detection of Salmonella typhimurium (S.typhimurium). The GO-AgNPs composites have been deposited onto the indium tin oxide (ITO) coated glass substrate by the electrophoretic deposition technique. Carbodiimide coupling (EDC-NHS) has been used for the immobilization of antibodies of Salmonella typhimurium (anti-S.typhimurium) for detection of S.typhimurium. The electron microscopy and UV-visible studies reveal successful synthesis GO-AgNPs composites while FT-IR studies suggest the proper immobilization of anti-S.typhi. The cyclic voltammetry (CV) has been utilized for detection using anti-S.typhi/GOAgNPs/ITO based immunoelectrode as a function of S.typhimurium concentration. The fabricated immunosensor shows improved sensitivity of 33.04 μACFU-1mLcm-2 in a wide detection range of 101 to 106 CFUmL-1. This immunosensor may be utilized for the detection of other food borne pathogens like aflatoxin and E.coli also.

  13. Robust water hazard detection for autonomous off-road navigation

    Institute of Scientific and Technical Information of China (English)

    Tuo-zhong YAO; Zhi-yu XIANG; Ji-lin LIU

    2009-01-01

    Existing water hazard detection methods usually fail when the features of water surfaces are greatly changed by the surroundings, e.g., by a change in illumination. This paper proposes a novel algorithm to robustly detect different kinds of water hazards for autonomous navigation. Our algorithm combines traditional machine learning and image segmentation and uses only digital cameras, which are usually affordable, as the visual sensors. Active learning is used for automatically dealing with problems caused by the selection, labeling and classification of large numbers of training sets. Mean-shift based image segmentation is used to refine the final classification. Our experimental results show that our new algorithm can accurately detect not only 'common' water hazards, which usually have the features of both high brightness and low texture, but also 'special' water hazards that may have lots of ripples or low brightness.

  14. Surrounding Moving Obstacle Detection for Autonomous Driving Using Stereo Vision

    Directory of Open Access Journals (Sweden)

    Hao Sun

    2013-06-01

    Full Text Available Detection and tracking surrounding moving obstacles such as vehicles and pedestrians are crucial for the safety of mobile robotics and autonomous vehicles. This is especially the case in urban driving scenarios. This paper presents a novel framework for surrounding moving obstacles detection using binocular stereo vision. The contributions of our work are threefold. Firstly, a multiview feature matching scheme is presented for simultaneous stereo correspondence and motion correspondence searching. Secondly, the multiview geometry constraint derived from the relative camera positions in pairs of consecutive stereo views is exploited for surrounding moving obstacles detection. Thirdly, an adaptive particle filter is proposed for tracking of multiple moving obstacles in surrounding areas. Experimental results from real‐world driving sequences demonstrate the effectiveness and robustness of the proposed framework.

  15. Field application of pathogen detection technologies

    Energy Technology Data Exchange (ETDEWEB)

    Straub, Tim M.; Call, Douglas R.; Bruckner-Lea, Cindy J.; Colburn, Heather A.; Baird, Cheryl L.; Bartholomew, Rachel A.; Ozanich, Richard M.; Jarman, Kristin H.

    2016-06-29

    Over the last 10 years there has been a significant increase in commercial products designed for field-based detection of microbial pathogens. This is due, in part, to the anthrax attacks in the United States in 2001, and the need for first responders to quickly identify the composition of suspected white powders and other potential biothreats. Demand for rapid detection is also driven by the need to ensure safe food, water, and environmental systems. From a technology perspective, rapid identification methods have largely capitalized on PCR and other molecular recognition techniques that can be deployed as robust field instrumentation. Examples of the relevant needs include the ability to: 1) declare a water distribution system free of microbial pathogens after a pipe/main break repair; 2) assess risks of contamination such as when produce production and processing plants are located near concentrated animal feeing operations; 3) evaluate the safety of ready-to-eat products; 4) determine the extent of potential serious disease outbreaks in remote and/or disaster stricken areas where access to clinical laboratories is not an immediate option; and 5) quickly assess credible biological terrorism events. Many of the principles underlying rapid detection methods are derived from methods for environmental microbiology, but there is a dearth of literature describing and evaluating field-based detection systems. Thus, the aims of this chapter are to: 1) summarize the different kinds of commercially available sampling kits and field-based biological detectors; 2) highlight some of the continued challenges of sample preparation to stimulate new research towards minimizing the impact of inhibitors on PCR-based detection systems; 3) describe our general rationale and statistically-based approach for instrument evaluation; 4) provide statistical and spatial guidelines for developing valid sampling plans; and 5) summarize some current needs and emerging technologies. This

  16. Obstacle detection for autonomous navigation : an LDRD final report.

    Energy Technology Data Exchange (ETDEWEB)

    Padilla, Denise D.

    2004-03-01

    This report summarizes the analytical and experimental efforts for the Laboratory Directed Research and Development (LDRD) project entitled 'Obstacle Detection for Autonomous Navigation'. The principal goal of this project was to develop a mathematical framework for obstacle detection. The framework provides a basis for solutions to many complex obstacle detection problems critical to successful autonomous navigation. Another goal of this project was to characterize sensing requirements in terms of physical characteristics of obstacles, vehicles, and terrain. For example, a specific vehicle traveling at a specific velocity over a specific terrain requires a sensor with a certain range of detection, resolution, field-of-view, and sufficient sensitivity to specific obstacle characteristics. In some cases, combinations of sensors were required to distinguish between different hazardous obstacles and benign terrain. In our framework, the problem was posed as a multidimensional, multiple-hypothesis, pattern recognition problem. Features were extracted from selected sensors that allow hazardous obstacles to be distinguished from benign terrain and other types of obstacles. Another unique thrust of this project was to characterize different terrain classes with respect to both positive (e.g., rocks, trees, fences) and negative (e.g., holes, ditches, drop-offs) obstacles. The density of various hazards per square kilometer was statistically quantified for different terrain categories (e.g., high desert, ponderosa forest, and prairie). This quantification reflects the scale, or size, and mobility of different types of vehicles. The tradeoffs between obstacle detection, position location, path planning, and vehicle mobility capabilities were also to be characterized.

  17. Improving the Lane Reference Detection for Autonomous Road Vehicle Control

    Directory of Open Access Journals (Sweden)

    Felipe Jiménez

    2016-01-01

    Full Text Available Autonomous road vehicles are increasingly becoming more important and there are several techniques and sensors that are being applied for vehicle control. This paper presents an alternative system for maintaining the position of autonomous vehicles without adding additional elements to the standard sensor architecture, by using a 3D laser scanner for continuously detecting a reference element in situations in which the GNSS receiver fails or provides accuracy below the required level. Considering that the guidance variables are more accurately estimated when dealing with reference points in front of and behind the vehicle, an algorithm based on vehicle dynamics mathematical model is proposed to extend the detected points in cases where the sensor is placed at the front of the vehicle. The algorithm has been tested when driving along a lane delimited by New Jersey barriers at both sides and the results show a correct behaviour. The system is capable of estimating the reference element behind the vehicle with sufficient accuracy when the laser scanner is placed at the front of it, so the robustness of the control input variables (lateral and angular errors estimation is improved making it unnecessary to place the sensor on the vehicle roof or to introduce additional sensors.

  18. Autonomous Detection of Aerosolized Biological Agents by Multiplexed Immunoassay with PCR Confirmation

    Energy Technology Data Exchange (ETDEWEB)

    Hindson, B J; McBride, M T; Makarewicz, A J; Henderer, B D; Setlur, U S; Smith, S M; Gutierrez, D M; Metz, T R; Nasarabadi, S L; Venkateswaran, K S; Farrow, S W; Colston, Jr., B W; Dzenitis, J M

    2004-05-27

    The autonomous pathogen detection system (APDS) is an automated, podium-sized instrument that continuously monitors the air for biological threat agents (bacteria, viruses, and toxins). The system has been developed to warn of a biological attack in critical or high-traffic facilities and at special events. The APDS performs continuous aerosol collection, sample preparation, and detection using multiplexed immunoassay followed by confirmatory PCR using real-time TaqMan assays. We have integrated completely reusable flow-through devices that perform DNA extraction and PCR amplification. The fully integrated system was challenged with aerosolized Bacillus anthracis, Yersinia pestis, Bacillus globigii and botulinum toxoid. By coupling highly selective antibody and DNA based assays, the probability of an APDS reporting a false positive is extremely low.

  19. Aptamer-Based Technologies in Foodborne Pathogen Detection

    Science.gov (United States)

    Teng, Jun; Yuan, Fang; Ye, Yingwang; Zheng, Lei; Yao, Li; Xue, Feng; Chen, Wei; Li, Baoguang

    2016-01-01

    Aptamers are single stranded DNA or RNA ligands, which can be selected by a method called systematic evolution of ligands by exponential enrichment (SELEX); and they can specifically recognize and bind to their targets. These unique characteristics of aptamers offer great potentials in applications such as pathogen detection and biomolecular screening. Pathogen detection is the critical means in detecting and identifying the problems related to public health and food safety; and only the rapid, sensitive and efficient detection technologies can enable the users to make the accurate assessments on the risks of infections (humans and animals) or contaminations (foods and other commodities) caused by various pathogens. This article reviews the development in the field of the aptamer-based approaches for pathogen detection, including whole-cell SELEX and Genomic SELEX. Nowadays, a variety of aptamer-based biosensors have been developed for pathogen detection. Thus, in this review, we also cover the development in aptamer-based biosensors including optical biosensors for multiple pathogen detection by multiple-labeling or label-free models such as fluorescence detection and surface plasmon resonance, electrochemical biosensors and lateral chromatography test strips, and their applications in pathogen detection and biomolecular screening. While notable progress has been made in the field in the last decade, challenges or drawbacks in their applications such as pathogen detection and biomolecular screening remain to be overcome. PMID:27672383

  20. Aptamer-Based Technologies in Foodborne Pathogen Detection

    Directory of Open Access Journals (Sweden)

    Jun Teng

    2016-09-01

    Full Text Available Aptamers are single stranded DNA or RNA ligands, which can be selected by a method called systematic evolution of ligands by exponential enrichment (SELEX; and they can specifically recognize and bind to their targets. These unique characteristics of aptamers offer great potentials in applications such as pathogen detection and biomolecular screening. Pathogen detection is the first and critical means in detecting and identifying the problems related to public health and food safety; and only the rapid, sensitive and efficient detection technologies can enable the users to make to accurate assessments on the risk of infections (humans and animals or contaminations (foods and other commodities caused by various pathogens. This article reviews the developments in the field of the aptamer-based approaches for pathogen detection, including whole-cell SELEX and Genomic SELEX. Nowadays, a variety of aptamer-based biosensors have been developed for pathogen detection. Thus, in this review, we also cover the development of aptamer-based biosensors including optical biosensors for multiple pathogen detection in multiple-labeling or label-free models such as fluorescence detection and surface plasmon resonance, electrochemical biosensors, and lateral chromatography test strips, and their applications in the pathogen detection and biomolecular screening. While notable progress has been made in the field in the last decade, challenges or drawbacks in their applications such as pathogen detection and biomolecular screening, remain to be overcome.

  1. Ultrasound and fluoroscopic images fusion by autonomous ultrasound probe detection.

    Science.gov (United States)

    Mountney, Peter; Ionasec, Razvan; Kaizer, Markus; Mamaghani, Sina; Wu, Wen; Chen, Terrence; John, Matthias; Boese, Jan; Comaniciu, Dorin

    2012-01-01

    New minimal-invasive interventions such as transcatheter valve procedures exploit multiple imaging modalities to guide tools (fluoroscopy) and visualize soft tissue (transesophageal echocardiography (TEE)). Currently, these complementary modalities are visualized in separate coordinate systems and on separate monitors creating a challenging clinical workflow. This paper proposes a novel framework for fusing TEE and fluoroscopy by detecting the pose of the TEE probe in the fluoroscopic image. Probe pose detection is challenging in fluoroscopy and conventional computer vision techniques are not well suited. Current research requires manual initialization or the addition of fiducials. The main contribution of this paper is autonomous six DoF pose detection by combining discriminative learning techniques with a fast binary template library. The pose estimation problem is reformulated to incrementally detect pose parameters by exploiting natural invariances in the image. The theoretical contribution of this paper is validated on synthetic, phantom and in vivo data. The practical application of this technique is supported by accurate results (< 5 mm in-plane error) and computation time of 0.5s.

  2. Autonomous mine detection system (AMDS) neutralization payload module

    Science.gov (United States)

    Majerus, M.; Vanaman, R.; Wright, N.

    2010-04-01

    The Autonomous Mine Detection System (AMDS) program is developing a landmine and explosive hazards standoff detection, marking, and neutralization system for dismounted soldiers. The AMDS Capabilities Development Document (CDD) has identified the requirement to deploy three payload modules for small robotic platforms: mine detection and marking, explosives detection and marking, and neutralization. This paper addresses the neutralization payload module. There are a number of challenges that must be overcome for the neutralization payload module to be successfully integrated into AMDS. The neutralizer must meet stringent size, weight, and power (SWaP) requirements to be compatible with a small robot. The neutralizer must be effective against a broad threat, to include metal and plastic-cased Anti-Personnel (AP) and Anti-Tank (AT) landmines, explosive devices, and Unexploded Explosive Ordnance (UXO.) It must adapt to a variety of threat concealments, overburdens, and emplacement methods, to include soil, gravel, asphalt, and concrete. A unique neutralization technology is being investigated for adaptation to the AMDS Neutralization Module. This paper will describe review this technology and how the other two payload modules influence its design for minimizing SWaP. Recent modeling and experimental efforts will be included.

  3. A Portable and Autonomous Magnetic Detection Platform for Biosensing

    Directory of Open Access Journals (Sweden)

    Moisés S. Piedade

    2009-05-01

    Full Text Available This paper presents a prototype of a platform for biomolecular recognition detection. The system is based on a magnetoresistive biochip that performs biorecognition assays by detecting magnetically tagged targets. All the electronic circuitry for addressing, driving and reading out signals from spin-valve or magnetic tunnel junctions sensors is implemented using off-the-shelf components. Taking advantage of digital signal processing techniques, the acquired signals are processed in real time and transmitted to a digital analyzer that enables the user to control and follow the experiment through a graphical user interface. The developed platform is portable and capable of operating autonomously for nearly eight hours. Experimental results show that the noise level of the described platform is one order of magnitude lower than the one presented by the previously used measurement set-up. Experimental results also show that this device is able to detect magnetic nanoparticles with a diameter of 250 nm at a concentration of about 40 fM. Finally, the biomolecular recognition detection capabilities of the platform are demonstrated by performing a hybridization assay using complementary and non-complementary probes and a magnetically tagged 20mer single stranded DNA target.

  4. Rapid identification and detection of pathogenic Fungi by padlock probes

    NARCIS (Netherlands)

    Tsui, C.K.M.; Wang, B.; Schoen, C.D.; Hamelin, R.C.

    2013-01-01

    Fungi are important pathogens of human diseases, as well as to agricultural crop and trees. Molecular diagnostics can detect diseases early, and improve identification accuracy and follow-up disease management. The use of padlock probe is effective to facilitate these detections and pathogen identif

  5. Towards Autonomous Agriculture: Automatic Ground Detection Using Trinocular Stereovision

    Directory of Open Access Journals (Sweden)

    Annalisa Milella

    2012-09-01

    Full Text Available Autonomous driving is a challenging problem, particularly when the domain is unstructured, as in an outdoor agricultural setting. Thus, advanced perception systems are primarily required to sense and understand the surrounding environment recognizing artificial and natural structures, topology, vegetation and paths. In this paper, a self-learning framework is proposed to automatically train a ground classifier for scene interpretation and autonomous navigation based on multi-baseline stereovision. The use of rich 3D data is emphasized where the sensor output includes range and color information of the surrounding environment. Two distinct classifiers are presented, one based on geometric data that can detect the broad class of ground and one based on color data that can further segment ground into subclasses. The geometry-based classifier features two main stages: an adaptive training stage and a classification stage. During the training stage, the system automatically learns to associate geometric appearance of 3D stereo-generated data with class labels. Then, it makes predictions based on past observations. It serves as well to provide training labels to the color-based classifier. Once trained, the color-based classifier is able to recognize similar terrain classes in stereo imagery. The system is continuously updated online using the latest stereo readings, thus making it feasible for long range and long duration navigation, over changing environments. Experimental results, obtained with a tractor test platform operating in a rural environment, are presented to validate this approach, showing an average classification precision and recall of 91.0% and 77.3%, respectively.

  6. Autonomic intrusion detection: Adaptively detecting anomalies over unlabeled audit data streams in computer networks

    KAUST Repository

    Wang, Wei

    2014-06-22

    In this work, we propose a novel framework of autonomic intrusion detection that fulfills online and adaptive intrusion detection over unlabeled HTTP traffic streams in computer networks. The framework holds potential for self-managing: self-labeling, self-updating and self-adapting. Our framework employs the Affinity Propagation (AP) algorithm to learn a subject’s behaviors through dynamical clustering of the streaming data. It automatically labels the data and adapts to normal behavior changes while identifies anomalies. Two large real HTTP traffic streams collected in our institute as well as a set of benchmark KDD’99 data are used to validate the framework and the method. The test results show that the autonomic model achieves better results in terms of effectiveness and efficiency compared to adaptive Sequential Karhunen–Loeve method and static AP as well as three other static anomaly detection methods, namely, k-NN, PCA and SVM.

  7. Multirobot autonomous landmine detection using distributed multisensor information aggregation

    Science.gov (United States)

    Jumadinova, Janyl; Dasgupta, Prithviraj

    2012-06-01

    We consider the problem of distributed sensor information fusion by multiple autonomous robots within the context of landmine detection. We assume that different landmines can be composed of different types of material and robots are equipped with different types of sensors, while each robot has only one type of landmine detection sensor on it. We introduce a novel technique that uses a market-based information aggregation mechanism called a prediction market. Each robot is provided with a software agent that uses sensory input of the robot and performs calculations of the prediction market technique. The result of the agent's calculations is a 'belief' representing the confidence of the agent in identifying the object as a landmine. The beliefs from different robots are aggregated by the market mechanism and passed on to a decision maker agent. The decision maker agent uses this aggregate belief information about a potential landmine and makes decisions about which other robots should be deployed to its location, so that the landmine can be confirmed rapidly and accurately. Our experimental results show that, for identical data distributions and settings, using our prediction market-based information aggregation technique increases the accuracy of object classification favorably as compared to two other commonly used techniques.

  8. Recent developments in pathogen detection arrays: implications for fungal plant pathogens and use in practica

    NARCIS (Netherlands)

    Lievens, B.; Thomma, B.P.H.J.

    2005-01-01

    The failure to adequately identify plant pathogens from culture-based morphological techniques has led to the development of culture-independent molecular approaches. Increasingly, diagnostic laboratories are pursuing fast routine methods that provide reliable identification, sensitive detection, an

  9. Rapid methods: the detection of foodborne pathogens

    NARCIS (Netherlands)

    Beumer, R.R.; Hazeleger, W.C.

    2009-01-01

    Although bacteria are the first type of microorganisms that come to mind when discussing microbial food safety, they are by no means the only pathogenic foodborne microorganisms. Mycotoxin producing moulds, human enteric viruses, protozoan parasites and marine biotoxins are also of importance. Howev

  10. Advances in rapid detection methods for foodborne pathogens.

    Science.gov (United States)

    Zhao, Xihong; Lin, Chii-Wann; Wang, Jun; Oh, Deog Hwan

    2014-03-28

    Food safety is increasingly becoming an important public health issue, as foodborne diseases present a widespread and growing public health problem in both developed and developing countries. The rapid and precise monitoring and detection of foodborne pathogens are some of the most effective ways to control and prevent human foodborne infections. Traditional microbiological detection and identification methods for foodborne pathogens are well known to be time consuming and laborious as they are increasingly being perceived as insufficient to meet the demands of rapid food testing. Recently, various kinds of rapid detection, identification, and monitoring methods have been developed for foodborne pathogens, including nucleic-acid-based methods, immunological methods, and biosensor-based methods, etc. This article reviews the principles, characteristics, and applications of recent rapid detection methods for foodborne pathogens.

  11. Large scale multiplex PCR improves pathogen detection by DNA microarrays

    Directory of Open Access Journals (Sweden)

    Krönke Martin

    2009-01-01

    Full Text Available Abstract Background Medium density DNA microchips that carry a collection of probes for a broad spectrum of pathogens, have the potential to be powerful tools for simultaneous species identification, detection of virulence factors and antimicrobial resistance determinants. However, their widespread use in microbiological diagnostics is limited by the problem of low pathogen numbers in clinical specimens revealing relatively low amounts of pathogen DNA. Results To increase the detection power of a fluorescence-based prototype-microarray designed to identify pathogenic microorganisms involved in sepsis, we propose a large scale multiplex PCR (LSplex PCR for amplification of several dozens of gene-segments of 9 pathogenic species. This protocol employs a large set of primer pairs, potentially able to amplify 800 different gene segments that correspond to the capture probes spotted on the microarray. The LSplex protocol is shown to selectively amplify only the gene segments corresponding to the specific pathogen present in the analyte. Application of LSplex increases the microarray detection of target templates by a factor of 100 to 1000. Conclusion Our data provide a proof of principle for the improvement of detection of pathogen DNA by microarray hybridization by using LSplex PCR.

  12. Detection of aerosolized biological agents by immunoassay followed by autonomous PCR confirmation

    Energy Technology Data Exchange (ETDEWEB)

    Dzenitis, J M; Hindson, B J; McBride, M T; Makarewicz, A J; Henderer, B D; Sathyam, U S; Smith, S M; Gutierrez, D M; Metz, T R; Venkateswaran, K S; Colston, B W; Farrow, S W

    2003-12-15

    An Autonomous Pathogen Detection System (APDS) unit is an automated, podium-sized system that monitors the air for all three biological threat agents (bacteria, viruses, and toxins). The system has been developed under the auspices of the U. S. Department of Energy and Department of Homeland Security by the University of California, Lawrence Livermore National Laboratory (LLNL) to protect people in critical or high-traffic facilities and at special events. The system performs continuous aerosol collection, sample preparation, and multiplexed biological tests using advanced immunoassays as the primary screen. Over ten agents are assayed at once, and results are reported hourly. R&D work this year focused on incorporating polymerase chain-reaction (PCR) techniques for detecting DNA as confirmation of immunoassay positives. The primary objective of the Dugway testing was to demonstrate the APDS with immunoassay identification and PCR confirmation of bacteria. A secondary objective was to demonstrate immunoassay identification of a protein toxoid (denatured toxin) aerosol release. A total of 12 agent trials were conducted over 14 days of testing, for a total of four work weeks at Dugway. Both testing objectives were achieved with multiple releases and clear identifications. The APDS was shown to be effective for identifying aerosolized Bacillus anthracis, Yersinia pestis, Bacillus globigii, and botulinum toxoid. The two areas for improvement were operational as opposed to hardware-related. The first was slowing the PCR thermal cycling to achieve stronger signals, which was demonstrated during the later phases of testing. The second area is to improve the parameters for autonomous PCR triggering; this is one of the focuses of the upcoming year's work.

  13. Detection of foodborne bacterial pathogens from individual filth flies.

    Science.gov (United States)

    Pava-Ripoll, Monica; Pearson, Rachel E G; Miller, Amy K; Ziobro, George C

    2015-02-13

    There is unanimous consensus that insects are important vectors of foodborne pathogens. However, linking insects as vectors of the pathogen causing a particular foodborne illness outbreak has been challenging. This is because insects are not being aseptically collected as part of an environmental sampling program during foodborne outbreak investigations and because there is not a standardized method to detect foodborne bacteria from individual insects. To take a step towards solving this problem, we adapted a protocol from a commercially available PCR-based system that detects foodborne pathogens from food and environmental samples, to detect foodborne pathogens from individual flies.Using this standardized protocol, we surveyed 100 wild-caught flies for the presence of Cronobacter spp., Salmonella enterica, and Listeria monocytogenes and demonstrated that it was possible to detect and further isolate these pathogens from the body surface and the alimentary canal of a single fly. Twenty-two percent of the alimentary canals and 8% of the body surfaces from collected wild flies were positive for at least one of the three foodborne pathogens. The prevalence of Cronobacter spp. on either body part of the flies was statistically higher (19%) than the prevalence of S. enterica (7%) and L.monocytogenes (4%). No false positives were observed when detecting S. enterica and L. monocytogenes using this PCR-based system because pure bacterial cultures were obtained from all PCR-positive results. However, pure Cronobacter colonies were not obtained from about 50% of PCR-positive samples, suggesting that the PCR-based detection system for this pathogen cross-reacts with other Enterobacteriaceae present among the highly complex microbiota carried by wild flies. The standardized protocol presented here will allow laboratories to detect bacterial foodborne pathogens from aseptically collected insects, thereby giving public health officials another line of evidence to find out how

  14. PathogenMIPer: a tool for the design of molecular inversion probes to detect multiple pathogens

    Directory of Open Access Journals (Sweden)

    Akhras Michael

    2006-11-01

    Full Text Available Abstract Background Here we describe PathogenMIPer, a software program for designing molecular inversion probe (MIP oligonucleotides for use in pathogen identification and detection. The software designs unique and specific oligonucleotide probes targeting microbial or other genomes. The tool tailors all probe sequence components (including target-specific sequences, barcode sequences, universal primers and restriction sites and combines these components into ready-to-order probes for use in a MIP assay. The system can harness the genetic variability available in an entire genome in designing specific probes for the detection of multiple co-infections in a single tube using a MIP assay. Results PathogenMIPer can accept sequence data in FASTA file format, and other parameter inputs from the user through a graphical user interface. It can design MIPs not only for pathogens, but for any genome for use in parallel genomic analyses. The software was validated experimentally by applying it to the detection of human papilloma virus (HPV as a model system, which is associated with various human malignancies including cervical and skin cancers. Initial tests of laboratory samples using the MIPs developed by the PathogenMIPer to recognize 24 different types of HPVs gave very promising results, detecting even a small viral load of single as well as multiple infections (Akhras et al, personal communication. Conclusion PathogenMIPer is a software for designing molecular inversion probes for detection of multiple target DNAs in a sample using MIP assays. It enables broader use of MIP technology in the detection through genotyping of pathogens that are complex, difficult-to-amplify, or present in multiple subtypes in a sample.

  15. xMAP Technology: Applications in Detection of Pathogens

    Science.gov (United States)

    Reslova, Nikol; Michna, Veronika; Kasny, Martin; Mikel, Pavel; Kralik, Petr

    2017-01-01

    xMAP technology is applicable for high-throughput, multiplex and simultaneous detection of different analytes within a single complex sample. xMAP multiplex assays are currently available in various nucleic acid and immunoassay formats, enabling simultaneous detection and typing of pathogenic viruses, bacteria, parasites and fungi and also antigen or antibody interception. As an open architecture platform, the xMAP technology is beneficial to end users and therefore it is used in various pharmaceutical, clinical and research laboratories. The main aim of this review is to summarize the latest findings and applications in the field of pathogen detection using microsphere-based multiplex assays. PMID:28179899

  16. Online Detection of Mixed Layer Depth for Autonomous Underwater Vehicles

    Science.gov (United States)

    Chu, S.; Estlin, T.; Castano, R.; Woodward, G.; Gierach, M. M.; Thompson, A. F.; Schaffer, S.

    2015-12-01

    The accurate determination of the mixed layer depth (MLD) plays a crucial role in studying ocean dynamics and climate change. Various methods to estimate MLD have been proposed [1, 2]. However there is no current consensus on the best model, which leads to large uncertainty in the estimation. The variability, coupled with the complexity of physical, chemical and biological processes involved and the uncertainty and instabilities of the upper ocean surface, makes estimating MLD a challenging task. MLD varies significantly, even across a small spatial area (autonomous underwater vehicle (AUV). Using an online method permits a more adaptive approach to estimating MLD. Our proposed algorithm is based on an ensemble approach, which includes data mining techniques for real-time peak and change detection, learned seasonal variability profile, combined with MLD estimation criteria in [1]. In this study, we analyze measurements using glider data collected from the OSMOSIS (Ocean Surface Mixing, Ocean Submesoscale Interaction Study) project, concatenated into a year-long time series [3]. The glider data consists of nine full-depth moorings, which were deployed in a 15 km by 15 km box at the Porcupine Abyssal Plain in the northeast Atlantic, centered at 16.2°W, 48.7°N. Our algorithm utilizes direct measurements of salinity, temperature, depth and time and the design is based on the spatial and temporal variability of MLD learned. We will present our initial work on tracking the MLD based on real-time simulations using the OSMOSIS glider data and discussed for the case of deploying on a single AUV. Using an online algorithm for estimating MLD in-situ enables the system to rapidly adapt to the variability in a real-world environment and also allows for the intelligent operation of the limited sampling resources available on an AUV. We will discuss the autonomy architecture and algorithm design for implementing this methodology and present results from our initial

  17. Detection of Water Hazards for Autonomous Robotic Vehicles

    Science.gov (United States)

    Matthes, Larry; Belluta, Paolo; McHenry, Michael

    2006-01-01

    Four methods of detection of bodies of water are under development as means to enable autonomous robotic ground vehicles to avoid water hazards when traversing off-road terrain. The methods involve processing of digitized outputs of optoelectronic sensors aboard the vehicles. It is planned to implement these methods in hardware and software that would operate in conjunction with the hardware and software for navigation and for avoidance of solid terrain obstacles and hazards. The first method, intended for use during the day, is based on the observation that, under most off-road conditions, reflections of sky from water are easily discriminated from the adjacent terrain by their color and brightness, regardless of the weather and of the state of surface waves on the water. Accordingly, this method involves collection of color imagery by a video camera and processing of the image data by an algorithm that classifies each pixel as soil, water, or vegetation according to its color and brightness values (see figure). Among the issues that arise is the fact that in the presence of reflections of objects on the opposite shore, it is difficult to distinguish water by color and brightness alone. Another issue is that once a body of water has been identified by means of color and brightness, its boundary must be mapped for use in navigation. Techniques for addressing these issues are under investigation. The second method, which is not limited by time of day, is based on the observation that ladar returns from bodies of water are usually too weak to be detected. In this method, ladar scans of the terrain are analyzed for returns and the absence thereof. In appropriate regions, the presence of water can be inferred from the absence of returns. Under some conditions in which reflections from the bottom are detectable, ladar returns could, in principle, be used to determine depth. The third method involves the recognition of bodies of water as dark areas in short

  18. Waveguide-Based Biosensors for Pathogen Detection

    Directory of Open Access Journals (Sweden)

    Nile Hartman

    2009-07-01

    Full Text Available Optical phenomena such as fluorescence, phosphorescence, polarization, interference and non-linearity have been extensively used for biosensing applications. Optical waveguides (both planar and fiber-optic are comprised of a material with high permittivity/high refractive index surrounded on all sides by materials with lower refractive indices, such as a substrate and the media to be sensed. This arrangement allows coupled light to propagate through the high refractive index waveguide by total internal reflection and generates an electromagnetic wave—the evanescent field—whose amplitude decreases exponentially as the distance from the surface increases. Excitation of fluorophores within the evanescent wave allows for sensitive detection while minimizing background fluorescence from complex, “dirty” biological samples. In this review, we will describe the basic principles, advantages and disadvantages of planar optical waveguide-based biodetection technologies. This discussion will include already commercialized technologies (e.g., Corning’s EPIC® Ô, SRU Biosystems’ BIND™, Zeptosense®, etc. and new technologies that are under research and development. We will also review differing assay approaches for the detection of various biomolecules, as well as the thin-film coatings that are often required for waveguide functionalization and effective detection. Finally, we will discuss reverse-symmetry waveguides, resonant waveguide grating sensors and metal-clad leaky waveguides as alternative signal transducers in optical biosensing.

  19. Innovative tools for detection of plant pathogenic viruses and bacteria.

    Science.gov (United States)

    López, María M; Bertolini, Edson; Olmos, Antonio; Caruso, Paola; Gorris, María Teresa; Llop, Pablo; Penyalver, Ramón; Cambra, Mariano

    2003-12-01

    Detection of harmful viruses and bacteria in plant material, vectors or natural reservoirs is essential to ensure safe and sustainable agriculture. The techniques available have evolved significantly in the last few years to achieve rapid and reliable detection of pathogens, extraction of the target from the sample being important for optimising detection. For viruses, sample preparation has been simplified by imprinting or squashing plant material or insect vectors onto membranes. To improve the sensitivity of techniques for bacterial detection, a prior enrichment step in liquid or solid medium is advised. Serological and molecular techniques are currently the most appropriate when high numbers of samples need to be analysed. Specific monoclonal and/or recombinant antibodies are available for many plant pathogens and have contributed to the specificity of serological detection. Molecular detection can be optimised through the automatic purification of nucleic acids from pathogens by columns or robotics. New variants of PCR, such as simple or multiplex nested PCR in a single closed tube, co-operative-PCR and real-time monitoring of amplicons or quantitative PCR, allow high sensitivity in the detection of one or several pathogens in a single assay. The latest development in the analysis of nucleic acids is micro-array technology, but it requires generic DNA/RNA extraction and pre-amplification methods to increase detection sensitivity. The advances in research that will result from the sequencing of many plant pathogen genomes, especially now in the era of proteomics, represent a new source of information for the future development of sensitive and specific detection techniques for these microorganisms.

  20. Advances and Challenges in Viability Detection of Foodborne Pathogens.

    Science.gov (United States)

    Zeng, Dexin; Chen, Zi; Jiang, Yuan; Xue, Feng; Li, Baoguang

    2016-01-01

    Foodborne outbreaks are a serious public health and food safety concern worldwide. There is a great demand for rapid, sensitive, specific, and accurate methods to detect microbial pathogens in foods. Conventional methods based on cultivation of pathogens have been the gold standard protocols; however, they take up to a week to complete. Molecular assays such as polymerase chain reaction (PCR), sequencing, microarray technologies have been widely used in detection of foodborne pathogens. Among molecular assays, PCR technology [conventional and real-time PCR (qPCR)] is most commonly used in the foodborne pathogen detection because of its high sensitivity and specificity. However, a major drawback of PCR is its inability to differentiate the DNA from dead and viable cells, and this is a critical factor for the food industry, regulatory agencies and the consumer. To remedy this shortcoming, researchers have used biological dyes such as ethidium monoazide and propidium monoazide (PMA) to pretreat samples before DNA extraction to intercalate the DNA of dead cells in food samples, and then proceed with regular DNA preparation and qPCR. By combining PMA treatment with qPCR (PMA-qPCR), scientists have applied this technology to detect viable cells of various bacterial pathogens in foods. The incorporation of PMA into PCR-based assays for viability detection of pathogens in foods has increased significantly in the last decade. On the other hand, some downsides with this approach have been noted, particularly to achieve complete suppression of signal of DNA from the dead cells present in some particular food matrix. Nowadays, there is a tendency of more and more researchers adapting this approach for viability detection; and a few commercial kits based on PMA are available in the market. As time goes on, more scientists apply this approach to a broader range of pathogen detections, this viability approach (PMA or other chemicals such as platinum compound) may eventually

  1. A new oligonucleotide microarray for detection of pathogenic and non-pathogenic Legionella spp.

    Science.gov (United States)

    Cao, Boyang; Liu, Xiangqian; Yu, Xiang; Chen, Min; Feng, Lu; Wang, Lei

    2014-01-01

    Legionella pneumophila has been recognized as the major cause of legionellosis since the discovery of the deadly disease. Legionella spp. other than L. pneumophila were later found to be responsible to many non-pneumophila infections. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this report, we have sequenced the 16S-23S rRNA gene internal transcribed spacer (ITS) of 10 Legionella species and subspecies, including L. anisa, L. bozemanii, L. dumoffii, L. fairfieldensis, L. gormanii, L. jordanis, L. maceachernii, L. micdadei, L. pneumophila subspp. fraseri and L. pneumophila subspp. pasculleii, and developed a rapid oligonucleotide microarray detection technique accordingly to identify 12 most common Legionella spp., which consist of 11 pathogenic species of L. anisa, L. bozemanii, L. dumoffii, L. gormanii, L. jordanis, L. longbeachae, L. maceachernii, L. micdadei, and L. pneumophila (including subspp. pneumophila, subspp. fraseri, and subspp. pasculleii) and one non-pathogenic species, L. fairfieldensis. Twenty-nine probes that reproducibly detected multiple Legionella species with high specificity were included in the array. A total of 52 strains, including 30 target pathogens and 22 non-target bacteria, were used to verify the oligonucleotide microarray assay. The sensitivity of the detection was at 1.0 ng with genomic DNA or 13 CFU/100 mL with Legionella cultures. The microarray detected seven samples of air conditioner-condensed water with 100% accuracy, validating the technique as a promising method for applications in basic microbiology, clinical diagnosis, food safety, and epidemiological surveillance. The phylogenetic study based on the ITS has also revealed that the non-pathogenic L. fairfieldensis is the closest to L. pneumophila than the nine other pathogenic Legionella spp.

  2. Multiple Pathogen Detection Using Biosensors: Advancements and Challenges

    Science.gov (United States)

    Advancements in biosensor research have considerably impacted clinical diagnostics for human health. Efforts in capitalizing on the sensitivity of biosensors for food pathogen detection are evident in the food safety/security research community. For practical application with foods that normally h...

  3. Rapid detection, characterization, and enrumeration of food-borne pathogens

    Science.gov (United States)

    In recent years, there has been much research activity on the development of methodologies that are rapid, accurate, and ultrasensitive for detecting pathogenic microorganisms in food. Rapid methods include immunological systems such as the lateral flow assays and enzyme-linked immunosorbent assays...

  4. A Hybrid Approach for Fault Detection in Autonomous Physical Agents

    Science.gov (United States)

    2014-05-01

    brea nexpected beh otion as a heu reak – the SF FDD. Supervised m aults, and poten ffline static fau lso computati upervised meth omain of phys...unknown fau modeled analy modeled outpu in the domain o the behavior o t of the physica al. [6] use a mo control softw s utilized for servers that...different s listic and cann proaches, supe a natural appea ata driven app knowledge-ba lied and a dec ression of a fau tations and thu autonomous ph in

  5. Application of bacteriophages for detection of foodborne pathogens.

    Science.gov (United States)

    Schmelcher, Mathias; Loessner, Martin J

    2014-01-01

    Bacterial contamination of food products presents a challenge for the food industry and poses a high risk for the consumer. Despite increasing awareness and improved hygiene measures, foodborne pathogens remain a threat for public health, and novel methods for detection of these organisms are needed. Bacteriophages represent ideal tools for diagnostic assays because of their high target cell specificity, inherent signal-amplifying properties, easy and inexpensive production, and robustness. Every stage of the phage lytic multiplication cycle, from the initial recognition of the host cell to the final lysis event, may be harnessed in several ways for the purpose of bacterial detection. Besides intact phage particles, phage-derived affinity molecules such as cell wall binding domains and receptor binding proteins can serve for this purpose. This review provides an overview of existing phage-based technologies for detection of foodborne pathogens, and highlights the most recent developments in this field, with particular emphasis on phage-based biosensors.

  6. A Study on Detecting and Identifying Enteric Pathogens With PCR

    Institute of Scientific and Technical Information of China (English)

    JUN-WEN LI; XIU-QUAN SHI; FU-HUAN CHAO; XIN-WEI WANG; JIN-LAI ZHENG; NONG SONG

    2004-01-01

    Objective To develop a rapid and definite diagnostic test of bacterial enteritis caused by pathogenic enterobacteria, the most frequent etiologic agent of infectious enteritis in the world.Methods A set of conventional PCR assays were applied to detect and identify salmonella, shigella,and E. coli O157:H7 directly from pure culture and fecal samples. The general primers of pathogenic enterobacteria were located on the uidA gene, which were found not only in E. coli nuclear acid, but also in Shigella and salmonella genes. Shigella primer was from ipaH gene whose coded invasive plasmid relative antigen existed both in plasmid and in genome. The primers of salmonella were designed from the 16SrRNA sequence. The primer of E. coli O157:H7 was taken from eaeA gene.Five random primers were selected for RAPD. The detection system included common PCR,semi-nested PCR and RAPD. Results This method was more sensitive, specific and efficient and its processing was rapid and simple. For example, the method could be used to specifically detect and identify salmonella, shigella, and E. coli O157:H7, and its sensitivity ranged from 3 to 50 CFU, and its detection time was 4 hours. Conclusion This PCR method, therefore, can serve as a rourine and practical protocol for detecting and identifying pathogenic microorganisms from clinical samples.

  7. The immunity-related GTPases in mammals: a fast-evolving cell-autonomous resistance system against intracellular pathogens.

    Science.gov (United States)

    Hunn, Julia P; Feng, Carl G; Sher, Alan; Howard, Jonathan C

    2011-02-01

    The immunity-related GTPases (IRGs) belong to the family of large, interferon-inducible GTPases and constitute a cell-autonomous resistance system essential for the control of vacuolar pathogens like Toxoplasma gondii in mice. Recent results demonstrated that numerous IRG members accumulate collaboratively at the parasitophorous vacuole of invading T. gondii leading to the destruction of the vacuole and the parasite and subsequent necrotic host cell death. Complex regulatory interactions between different IRG proteins are necessary for these processes. Disturbance of this finely balanced system, e.g., by single genetic deficiency for the important negative regulator Irgm1 or the autophagic regulator Atg5, leads to spontaneous activation of the effector IRG proteins when induced by IFNγ. This activation has cytotoxic consequences resulting in a severe lymphopenia, macrophage defects, and failure of the adaptive immune system in Irgm1-deficient mice. However, alternative functions in phagosome maturation and induction of autophagy have been proposed for Irgm1. The IRG system has been studied primarily in mice, but IRG genes are present throughout the mammalian lineage. Interestingly, the number, type, and diversity of genes present differ greatly even between closely related species, probably reflecting intimate host-pathogen coevolution driven by an armed race between the IRG resistance proteins and pathogen virulence factors. IRG proteins are targets for polymorphic T. gondii virulence factors, and genetic variation in the IRG system between different mouse strains correlates with resistance and susceptibility to virulent T. gondii strains.

  8. DNA microarray technique for detecting food-borne pathogens

    Directory of Open Access Journals (Sweden)

    Xing GAO

    2012-08-01

    Full Text Available Objective To study the application of DNA microarray technique for screening and identifying multiple food-borne pathogens. Methods The oligonucleotide probes were designed by Clustal X and Oligo 6.0 at the conserved regions of specific genes of multiple food-borne pathogens, and then were validated by bioinformatic analyses. The 5' end of each probe was modified by amino-group and 10 Poly-T, and the optimized probes were synthesized and spotted on aldehyde-coated slides. The bacteria DNA template incubated with Klenow enzyme was amplified by arbitrarily primed PCR, and PCR products incorporated into Aminoallyl-dUTP were coupled with fluorescent dye. After hybridization of the purified PCR products with DNA microarray, the hybridization image and fluorescence intensity analysis was acquired by ScanArray and GenePix Pro 5.1 software. A series of detection conditions such as arbitrarily primed PCR and microarray hybridization were optimized. The specificity of this approach was evaluated by 16 different bacteria DNA, and the sensitivity and reproducibility were verified by 4 food-borne pathogens DNA. The samples of multiple bacteria DNA and simulated water samples of Shigella dysenteriae were detected. Results Nine different food-borne bacteria were successfully discriminated under the same condition. The sensitivity of genomic DNA was 102 -103pg/ μl, and the coefficient of variation (CV of the reproducibility of assay was less than 15%. The corresponding specific hybridization maps of the multiple bacteria DNA samples were obtained, and the detection limit of simulated water sample of Shigella dysenteriae was 3.54×105cfu/ml. Conclusions The DNA microarray detection system based on arbitrarily primed PCR can be employed for effective detection of multiple food-borne pathogens, and this assay may offer a new method for high-throughput platform for detecting bacteria.

  9. Rapid detection, characterization, and enumeration of foodborne pathogens

    DEFF Research Database (Denmark)

    Hoorfar, Jeffrey

    2011-01-01

    As food safety management further develops, microbiological testing will continue to play an important role in assessing whether Food Safety Objectives are achieved. However, traditional microbiological culture-based methods are limited, particularly in their ability to provide timely data...... into focus with the 1990s outbreak of bovine spongiform encephalopathy that was linked to the human outbreak of Creutzfeldt Jakob's Disease. Serology is still an important tool in preventing foodborne pathogens to enter the human food supply through meat and milk from animals. One of the primary uses...... following a short log-phase enrichment, (iv) detection of foodborne pathogens in air samples, and finally (v) biotracing of pathogens based on mathematical modeling, even in the absence of isolate. Rapid methods are discussed in a broad global health perspective, international food supply...

  10. Investigation of magnetic microdiscs for bacterial pathogen detection

    Science.gov (United States)

    Castillo-Torres, Keisha Y.; Garraud, Nicolas; Arnold, David P.; McLamore, Eric S.

    2016-05-01

    Despite strict regulations to control the presence of human pathogens in our food supply, recent foodborne outbreaks have heightened public concern about food safety and created urgency to improve methods for pathogen detection. Herein we explore a potentially portable, low-cost system that uses magnetic microdiscs for the detection of bacterial pathogens in liquid samples. The system operates by optically measuring the rotational dynamics of suspended magnetic microdiscs functionalized with pathogen-binding aptamers. The soft ferromagnetic (Ni80Fe20) microdiscs exhibit a closed magnetic spin arrangement (i.e. spin vortex) with zero magnetic stray field, leading to no disc agglomeration when in free suspension. With very high surface area for functionalization and volumes 10,000x larger than commonly used superparamagnetic nanoparticles, these 1.5-μm-diameter microdiscs are well suited for tagging, trapping, actuating, or interrogating bacterial targets. This work reports a wafer-level microfabrication process for fabrication of 600 million magnetic microdiscs per substrate and measurement of their rotational dynamics response. Additionally, the biofunctionalization of the microdiscs with DNA aptamers, subsequent binding to E. coli bacteria, and their magnetic manipulation is reported.

  11. Autonomous Gait Event Detection with Portable Single-Camera Gait Kinematics Analysis System

    Directory of Open Access Journals (Sweden)

    Cheng Yang

    2016-01-01

    Full Text Available Laboratory-based nonwearable motion analysis systems have significantly advanced with robust objective measurement of the limb motion, resulting in quantified, standardized, and reliable outcome measures compared with traditional, semisubjective, observational gait analysis. However, the requirement for large laboratory space and operational expertise makes these systems impractical for gait analysis at local clinics and homes. In this paper, we focus on autonomous gait event detection with our bespoke, relatively inexpensive, and portable, single-camera gait kinematics analysis system. Our proposed system includes video acquisition with camera calibration, Kalman filter + Structural-Similarity-based marker tracking, autonomous knee angle calculation, video-frame-identification-based autonomous gait event detection, and result visualization. The only operational effort required is the marker-template selection for tracking initialization, aided by an easy-to-use graphic user interface. The knee angle validation on 10 stroke patients and 5 healthy volunteers against a gold standard optical motion analysis system indicates very good agreement. The autonomous gait event detection shows high detection rates for all gait events. Experimental results demonstrate that the proposed system can automatically measure the knee angle and detect gait events with good accuracy and thus offer an alternative, cost-effective, and convenient solution for clinical gait kinematics analysis.

  12. Detection of periodontal pathogens in the patients with aortic aneurysm

    Institute of Scientific and Technical Information of China (English)

    Ding Fang; Lyu Yalin; Han Xiao; Zhang Hai; Liu Dongyu; Hei Wei; Liu Yinhua

    2014-01-01

    Background The occurrence and development of aortic aneurysm (AA) are associated with infection.Some researchers have detected the DNA of periodontal pathogens in AA samples in certain populations.However,it has not been done in Chinese population.The objective of this study was to evaluate the prevalence of periodontal pathogens in oral tissue samples and aneurysm samples of AA patients.Methods Eighty-nine subjects with AA and 59 subjects without AA were examined.Periodontal clinical parameters were evaluated.Unstimulated saliva and subgingival plaque somples were collected from all subjects.Twenty-six dissected AA samples were obtained.Evidence of eight periodontal pathogens including Porphyromonas gingivalis (Pg),Actinobacillus actinomycetemcomitans (Aa),Prevotella intermedia (Pi),Tannerella forsythensis (Tf),Treponema denticola (Td),Campylobacter rectus (Cr),Fusobacterium nucleatum (Fn),and Prevotella nigrescens (Pn) was ascertained in all samples by 16S rRNA-based polymerase chain reaction (PCR) assay.Results The periodontal indexes including plaque index (PLI),probing depth (PD),bleeding index (BI),and clinical attachment loss (CAL),of the six Ramfjord index teeth were significantly higher in the AA group than those in the control group (P <0.01).Eight periodontal pathogens in subgingival plaque samples were more frequently detected in the AA group than in control group.The difference in prevalence between the groups was significant for six (out of eight) periodontal pathogens assayed (Pg,Pi,Fn,Pn,Tf,and Td,P <0.01).Additionally,all eight periodontal pathogens were more frequently detected in saliva samples of the AA group than in those of the control group,again with six (out of eight) (Pg,Pi,Fn,Cr,Tf,and Td) displaying significant differences in prevalence between the two groups (P <0.01).Out of 26 aneurysm samples examined,Pg,Pi,Fn,Crand Tfwere detected in 6 (23.1%),2 (7.7%),3 (11.5%),1 (3.8%),2 (7.7%),respectively,and Aa,Pn,and Td were not

  13. Detection of pathogenic gram negative bacteria using infrared thermography

    Science.gov (United States)

    Lahiri, B. B.; Divya, M. P.; Bagavathiappan, S.; Thomas, Sabu; Philip, John

    2012-11-01

    Detection of viable bacteria is of prime importance in all fields of microbiology and biotechnology. Conventional methods of enumerating bacteria are often time consuming and labor-intensive. All living organisms generate heat due to metabolic activities and hence, measurement of heat energy is a viable tool for detection and quantification of bacteria. In this article, we employ a non-contact and real time method - infrared thermography (IRT) for measurement of temperature variations in four clinically significant gram negative pathogenic bacteria, viz. Vibrio cholerae, Vibrio mimicus, Proteus mirabilis and Pseudomonas aeruginosa. We observe that, the energy content, defined as the ratio of heat generated by bacterial metabolic activities to the heat lost from the liquid medium to the surrounding, vary linearly with the bacterial concentration in all the four pathogenic bacteria. The amount of energy content observed in different species is attributed to their metabolisms and morphologies that affect the convection velocity and hence heat transport in the medium.

  14. Food Microbial Pathogen Detection and Analysis Using DNA Microarray Technologies

    OpenAIRE

    Rasooly, Avraham; Herold, Keith E.

    2008-01-01

    Culture-based methods used for microbial detection and identification are simple to use, relatively inexpensive, and sensitive. However, culture-based methods are too time-consuming for high-throughput testing and too tedious for analysis of samples with multiple organisms and provide little clinical information regarding the pathogen (e.g., antibiotic resistance genes, virulence factors, or strain subtype). DNA-based methods, such as polymerase chain reaction (PCR), overcome some these limit...

  15. Sample preparation and assay refinements for pathogen detection platforms

    Science.gov (United States)

    Lim, Daniel V.; Kearns, Elizabeth A.; Leskinen, Stephaney D.; Magaña, Sonia; Stroot, Joyce M.; Hunter, Dawn M.; Schlemmer, Sarah M.

    2009-02-01

    Food-borne and waterborne microbial pathogens are a potential problem in biowarfare and public health. Such pathogens can affect the health, combat readiness, and effectiveness of the warfighter in a battlefield environment and present potential threats to the civilian population through intentional or natural contamination of food and water. Conventional procedures to detect and identify microbial pathogens in food, water, and other materials can take days to perform and may provide inconclusive information. Research at the University of South Florida's Advanced Biosensors Laboratory (ABL) focuses on development of sample processing procedures and biosensor-based assays for rapid detection of biothreat agents. Rapid processing methods, including use of an automated concentrator of microorganisms in water, have been developed for complex matrix samples including ground beef, apple juice, produce, potable water and recreational water, enabling such samples to be directly tested by biosensor assays for target analytes. Bacillus atrophaeus spores and other bacteria can be concentrated from potable and recreational water at low levels with a dead-end hollow-fiber ultrafiltration concentration system. Target bacteria recovered by these processing procedures can be identified by evanescent wave, fiber optic biosensors or other detection platforms. Fiber optic biosensor assays have been improved to include subsequent PCR analysis and viability determination of captured target bacteria using broth enrichment and/or ATP luminescence.

  16. Multi-modal target detection for autonomous wide area search and surveillance

    Science.gov (United States)

    Breckon, Toby P.; Gaszczak, Anna; Han, Jiwan; Eichner, Marcin L.; Barnes, Stuart E.

    2013-10-01

    Generalised wide are search and surveillance is a common-place tasking for multi-sensory equipped autonomous systems. Here we present on a key supporting topic to this task - the automatic interpretation, fusion and detected target reporting from multi-modal sensor information received from multiple autonomous platforms deployed for wide-area environment search. We detail the realization of a real-time methodology for the automated detection of people and vehicles using combined visible-band (EO), thermal-band (IR) and radar sensing from a deployed network of multiple autonomous platforms (ground and aerial). This facilities real-time target detection, reported with varying levels of confidence, using information from both multiple sensors and multiple sensor platforms to provide environment-wide situational awareness. A range of automatic classification approaches are proposed, driven by underlying machine learning techniques, that facilitate the automatic detection of either target type with cross-modal target confirmation. Extended results are presented that show both the detection of people and vehicles under varying conditions in both isolated rural and cluttered urban environments with minimal false positive detection. Performance evaluation is presented at an episodic level with individual classifiers optimized for maximal each object of interest (vehicle/person) detection over a given search path/pattern of the environment, across all sensors and modalities, rather than on a per sensor sample basis. Episodic target detection, evaluated over a number of wide-area environment search and reporting tasks, generally exceeds 90%+ for the targets considered here.

  17. Market Disease Pathogens Detection of Imported Fruits in Shanghai

    Institute of Scientific and Technical Information of China (English)

    MA Teng-fei; YANG Bo; YU Yue; WANG Yi-wen; LIU Yi; XU Zhen; LIU Yan; ZHU Pin-kuan; ZHANG Wei; ZHANG Zai-bao; Toyoda Hideyoshi; XU Ling

    2009-01-01

    A tremendous amount of imported fresh fruits has been delivered to Shanghai markets,increasing the risk of invasion by harmful plant pathogens.Therefore,it is important to establish an effective detection and supervision system to survey the outbreak of the market diseases of the imported fruits during marketing.The samples were regularly surveyed in different markets to examine varieties,prices,localities,selling conditions,and diseases of the imported fruits from 2004 to 2008.The survey showed that 58 species of 30 different fruits were imported to Shanghai from 16 countries with more expensive price.The larger products were bananas,grapes,apples,and oranges.During the investigation,we found that the imported fruits frequently brought about the relatively serious market diseases.On the basis of morphology and the nuclear internal transcribed spacer (ITS) of ribosomal DNA (rDNA) analysis,151 isolates of 15 fungi genera,which shown to be pathogenic afcer the inoculation assay.were finally identified.Among the identified fungi,Alternaria was the most frequent one with the highest detection rate (47.68%),followed by Penicillium (14.57%) and Fusarium (11.92%),respectively.Additionally,Pestalotiopsis microspora (detected in grapes Red-Globe coming from the USA) and Botrytis sp.(detected in black-plums coming from the USA)were first reported in China market.The present study summarized the selling situation of the imported fruits in Shanghai markets and constructed a library of the pathogens detected in the imported fruits during the selling period.The results obtained are useful to offer technical parameters for Chinese quarantine in order to prevent an invasion of the foreign harmful micro-organisms.

  18. Dominant object detection for autonomous vision-based surveillance

    NARCIS (Netherlands)

    Celik, H.

    2010-01-01

    The deployment of visual surveillance and monitoring systems has reached massive proportions. Consequently, a need to automate the processes involved in retrieving useful information from surveillance videos, such as detecting and counting objects, and interpreting their individual and joint behavio

  19. Rapid detection, characterization, and enumeration of foodborne pathogens.

    Science.gov (United States)

    Hoorfar, J

    2011-11-01

    As food safety management further develops, microbiological testing will continue to play an important role in assessing whether Food Safety Objectives are achieved. However, traditional microbiological culture-based methods are limited, particularly in their ability to provide timely data. The present review discusses the reasons for the increasing interest in rapid methods, current developments in the field, the research needs, and the future trends. The advent of biotechnology has introduced new technologies that led to the emergence of rapid diagnostic methods and altered food testing practices. Rapid methods are comprised of many different detection technologies, including specialized enzyme substrates, antibodies and DNA, ranging from simple differential plating media to the use of sophisticated instruments. The use of non-invasive sampling techniques for live animals especially came into focus with the 1990s outbreak of bovine spongiform encephalopathy that was linked to the human outbreak of Creutzfeldt Jakob's Disease. Serology is still an important tool in preventing foodborne pathogens to enter the human food supply through meat and milk from animals. One of the primary uses of rapid methods is for fast screening of large number of samples, where most of them are expected to be test-negative, leading to faster product release for sale. This has been the main strength of rapid methods such as real-time Polymerase Chain Reaction (PCR). Enrichment PCR, where a primary culture broth is tested in PCR, is the most common approach in rapid testing. Recent reports show that it is possible both to enrich a sample and enumerate by pathogen-specific real-time PCR, if the enrichment time is short. This can be especially useful in situations where food producers ask for the level of pathogen in a contaminated product. Another key issue is automation, where the key drivers are miniaturization and multiple testing, which mean that not only one instrument is flexible

  20. Actual Pathogen Detection: Sensors and Algorithms - a Review

    Directory of Open Access Journals (Sweden)

    Federico Hahn

    2009-03-01

    Full Text Available Pathogens feed on fruits and vegetables causing great food losses or at least reduction of their shelf life. These pathogens can cause losses of the final product or in the farms were the products are grown, attacking leaves, stems and trees. This review analyses disease detection sensors and algorithms for both the farm and postharvest management of fruit and vegetable quality. Mango, avocado, apple, tomato, potato, citrus and grapes were selected as the fruits and vegetables for study due to their world-wide consumption. Disease warning systems for predicting pathogens and insects on farms during fruit and vegetable production are commonly used for all the crops and are available where meteorological stations are present. It can be seen that these disease risk systems are being slowly replaced by remote sensing monitoring in developed countries. Satellite images have reduced their temporal resolution, but are expensive and must become cheaper for their use world-wide. In the last 30 years, a lot of research has been carried out in non-destructive sensors for food quality. Actually, non-destructive technology has been applied for sorting high quality fruit which is desired by the consumer. The sensors require algorithms to work properly; the most used being discriminant analysis and training neural networks. New algorithms will be required due to the high quantity of data acquired and its processing, and for disease warning strategies for disease detection.

  1. Integrated Detection of Pathogens and Host Biomarkers for Wounds

    Energy Technology Data Exchange (ETDEWEB)

    Jaing, C

    2012-03-19

    The increasing incidence and complications arising from combat wounds has necessitated a reassessment of methods for effective treatment. Infection, excessive inflammation, and incidence of drug-resistant organisms all contribute toward negative outcomes for afflicted individuals. The organisms and host processes involved in wound progression, however, are incompletely understood. We therefore set out, using our unique technical resources, to construct a profile of combat wounds which did or did not successfully resolve. We employed the Lawrence Livermore Microbial Detection Array and identified a number of nosocomial pathogens present in wound samples. Some of these identities corresponded with bacterial isolates previously cultured, while others were not obtained via standard microbiology. Further, we optimized proteomics protocols for the identification of host biomarkers indicative of various stages in wound progression. In combination with our pathogen data, our biomarker discovery efforts will provide a profile corresponding to wound complications, and will assist significantly in treatment of these complex cases.

  2. Magnetic Bead Based Immunoassay for Autonomous Detection of Toxins

    Energy Technology Data Exchange (ETDEWEB)

    Kwon, Y; Hara, C A; Knize, M G; Hwang, M H; Venkatesteswaran, K S; Wheeler, E K; Bell, P M; Renzi, R F; Fruetel, J A; Bailey, C G

    2008-05-01

    As a step towards toward the development of a rapid, reliable analyzer for bioagents in the environment, we are developing an automated system for the simultaneous detection of a group of select agents and toxins. To detect toxins, we modified and automated an antibody-based approach previously developed for manual medical diagnostics that uses fluorescent eTag{trademark} reporter molecules and is suitable for highly multiplexed assays. Detection is based on two antibodies binding simultaneously to a single antigen, one of which is labeled with biotin while the other is conjugated to a fluorescent eTag{trademark} through a cleavable linkage. Aqueous samples are incubated with the mixture of antibodies along with streptavidin-coated magnetic beads coupled to a photo-activatable porphyrin complex. In the presence of antigen, a molecular complex is formed where the cleavable linkage is held in proximity to the photoactivable group. Upon excitation at 680 nm, free radicals are generated, which diffuse and cleave the linkage, releasing the eTags{trademark}. Released eTags{trademark} are analyzed using capillary gel electrophoresis with laser-induced fluorescence detection. Limits of detection for ovalbumin and botulinum toxoid individually were 4 ng/mL (or 80 pg) and 16 ng/mL (or 320 pg), respectively, using the manual assay. In addition, we demonstrated the use of pairs of antibodies from different sources in a single assay to decrease the rate of false positives. Automation of the assay was demonstrated on a flow-through format with higher LODs of 125 ng/mL (or 2.5 ng) each of a mixture of ovalbumin and botulinum toxoid. This versatile assay can be easily modified with the appropriate antibodies to detect a wide range of toxins and other proteins.

  3. Vehicle Detection for RCTA/ANS (Autonomous Navigation System)

    Science.gov (United States)

    Brennan, Shane; Bajracharya, Max; Matthies, Larry H.; Howard, Andrew B.

    2012-01-01

    Using a stereo camera pair, imagery is acquired and processed through the JPLV stereo processing pipeline. From this stereo data, large 3D blobs are found. These blobs are then described and classified by their shape to determine which are vehicles and which are not. Prior vehicle detection algorithms are either targeted to specific domains, such as following lead cars, or are intensity- based methods that involve learning typical vehicle appearances from a large corpus of training data. In order to detect vehicles, the JPL Vehicle Detection (JVD) algorithm goes through the following steps: 1. Take as input a left disparity image and left rectified image from JPLV stereo. 2. Project the disparity data onto a two-dimensional Cartesian map. 3. Perform some post-processing of the map built in the previous step in order to clean it up. 4. Take the processed map and find peaks. For each peak, grow it out into a map blob. These map blobs represent large, roughly vehicle-sized objects in the scene. 5. Take these map blobs and reject those that do not meet certain criteria. Build descriptors for the ones that remain. Pass these descriptors onto a classifier, which determines if the blob is a vehicle or not. The probability of detection is the probability that if a vehicle is present in the image, is visible, and un-occluded, then it will be detected by the JVD algorithm. In order to estimate this probability, eight sequences were ground-truthed from the RCTA (Robotics Collaborative Technology Alliances) program, totaling over 4,000 frames with 15 unique vehicles. Since these vehicles were observed at varying ranges, one is able to find the probability of detection as a function of range. At the time of this reporting, the JVD algorithm was tuned to perform best at cars seen from the front, rear, or either side, and perform poorly on vehicles seen from oblique angles.

  4. Rapid pathogen detection with bacterial-assembled magnetic mesoporous silica.

    Science.gov (United States)

    Lee, Soo Youn; Lee, Jiho; Lee, Hye Sun; Chang, Jeong Ho

    2014-03-15

    We report rapid and accurate pathogen detection by coupling with high efficiency magnetic separation of pathogen by Ni(2+)-heterogeneous magnetic mesoporous silica (Ni-HMMS) and real time-polymerase chain reaction (RT-PCR) technique. Ni-HMMS was developed with a significant incorporation of Fe particles within the silica mesopores by programmed thermal hydrogen reaction and functionalized with Ni(2+) ion on the surface by the wet impregnation process. High abundant Ni(2+) ions on the Ni-HMMS surface were able to assemble with cell wall component protein NikA (nickel-binding membrane protein), which contains several pathogenic bacteria including Escherichia coli O157:H7. NikA protein expression experiment showed the outstanding separation rate of the nikA gene-overexpressed E. coli (pSY-Nik) when comparing with wild-type E. coli (44.5 ± 13%) or not over-expressed E. coli (pSY-Nik) (53.2 ± 2.7%). Moreover, Ni-HMMS showed lower obstacle effect by large reaction volume (10 mL) than spherical core/shell-type silica magnetic nanoparticles functionalized with Ni(2+) (ca. 40 nm-diameters). Finally, the Ni-HMMS was successfully assessed to separate pathogenic E. coli O157:H7 and applied to direct and rapid RT-PCR to quantitative detection at ultralow concentration (1 Log10 cfu mL(-1)) in the real samples (milk and Staphylococcus aureus culture broth) without bacterial amplification and DNA extraction step.

  5. LABRADOR: a learning autonomous behavior-based robot for adaptive detection and object retrieval

    Science.gov (United States)

    Yamauchi, Brian; Moseley, Mark; Brookshire, Jonathan

    2013-01-01

    As part of the TARDEC-funded CANINE (Cooperative Autonomous Navigation in a Networked Environment) Program, iRobot developed LABRADOR (Learning Autonomous Behavior-based Robot for Adaptive Detection and Object Retrieval). LABRADOR was based on the rugged, man-portable, iRobot PackBot unmanned ground vehicle (UGV) equipped with an explosives ordnance disposal (EOD) manipulator arm and a custom gripper. For LABRADOR, we developed a vision-based object learning and recognition system that combined a TLD (track-learn-detect) filter based on object shape features with a color-histogram-based object detector. Our vision system was able to learn in real-time to recognize objects presented to the robot. We also implemented a waypoint navigation system based on fused GPS, IMU (inertial measurement unit), and odometry data. We used this navigation capability to implement autonomous behaviors capable of searching a specified area using a variety of robust coverage strategies - including outward spiral, random bounce, random waypoint, and perimeter following behaviors. While the full system was not integrated in time to compete in the CANINE competition event, we developed useful perception, navigation, and behavior capabilities that may be applied to future autonomous robot systems.

  6. Rapid Detection and Characterization of Emerging Foreign Animal Disease Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Jaing, C. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2016-11-18

    To best safeguard human and animal health requires early detection and characterization of disease events. This must include effective surveillance for emerging infectious diseases. Both deliberate and natural outbreaks have enormous economic and public health impacts, and can present serious threats to national security. In this project, we developed novel next generation detection technologies to protect the agricultural economy and biosecurity. The first technology is a multiplexed assay to simultaneously detection 10 swine viral and bacterial pathogens. The second one is the Lawrence Livermore Microbial Detection Array (LLMDA) which can detect more than 10,000 microbial species including 4219 viruses, 5367 bacteria, 265 fungi, 117 protozoa and 293 archaea. We analyzed a series of swine clinical samples from past disease events to demonstrate the utility of the assays for faster and cheaper detection of emerging and foreign animal disease pathogens, and their utility as s routine diagnosis and surveillance tool. A second goal of the study is to better understand mechanisms of African swine fever virus (ASFV) infection in pigs to aid the development of countermeasures and diagnostics. There is no vaccine available for ASF. ASF outbreak is on the rise on several European countries. Though ASF is not currently in the U.S., a potential outbreak in the U.S. would be detrimental to the swine industry and the US agricultural economy. We pursued a genome-wide approach to characterize the pig immune responses after ASFV infection. We used RNA sequencing and bioinformatics methods to identify genes and pathways that are affected during ASF infection. We have identified a list of most differentially expressed genes that are in the immune response pathways.

  7. The COMRADE System for Multirobot Autonomous Landmine Detection in Postconflict Regions

    Directory of Open Access Journals (Sweden)

    Prithviraj Dasgupta

    2015-01-01

    Full Text Available We consider the problem of autonomous landmine detection using a team of mobile robots. Previous research on robotic landmine detection mostly employs a single robot equipped with a landmine detection sensor to detect landmines. We envisage that the quality of landmine detection can be significantly improved if multiple robots are coordinated to detect landmines in a cooperative manner by incrementally fusing the landmine-related sensor information they collect and then use that information to visit locations of potential landmines. Towards this objective, we describe a multirobot system called COMRADES to address different aspects of the autonomous landmine detection problem including distributed area coverage to detect and locate landmines, information aggregation to fuse the sensor information obtained by different robots, and multirobot task allocation (MRTA to enable different robots to determine a suitable sequence to visit locations of potential landmines while reducing the time required and battery expended. We have used commercially available all-terrain robots called Coroware Explorer that are customized with a metal detector to detect metallic objects including landmines, as well as indoor Corobot robots, both in simulation and in physical experiments, to test the different techniques in COMRADES.

  8. Autonomous detection of ISO fade point with color laser printers

    Science.gov (United States)

    Yan, Ni; Maggard, Eric; Fothergill, Roberta; Jessome, Renee J.; Allebach, Jan P.

    2015-01-01

    Image quality assessment is a very important field in image processing. Human observation is slow and subjective, it also requires strict environment setup for the psychological test 1. Thus developing algorithms to match desired human experiments is always in need. Many studies have focused on detecting the fading phenomenon after the materials are printed, that is to monitor the persistence of the color ink 2-4. However, fading is also a common artifact produced by printing systems when the cartridges run low. We want to develop an automatic system to monitor cartridge life and report fading defects when they appear. In this paper, we first describe a psychological experiment that studies the human perspective on printed fading pages. Then we propose an algorithm based on Color Space Projection and K-means clustering to predict the visibility of fading defects. At last, we integrate the psychological experiment result with our algorithm to give a machine learning tool that monitors cartridge life.

  9. Humic substances interfere with detection of pathogenic prion protein

    Science.gov (United States)

    Smith, Christen B.; Booth, Clarissa J.; Wadzinski, Tyler J.; Legname, Giuseppe; Chappell, Rick; Johnson, Christopher J.; Pedersen, Joel A.

    2014-01-01

    Studies examining the persistence of prions (the etiological agent of transmissible spongiform encephalopathies) in soil require accurate quantification of pathogenic prion protein (PrPTSE) extracted from or in the presence of soil particles. Here, we demonstrate that natural organic matter (NOM) in soil impacts PrPTSE detection by immunoblotting. Methods commonly used to extract PrPTSE from soils release substantial amounts of NOM, and NOM inhibited PrPTSE immunoblot signal. The degree of immunoblot interference increased with increasing NOM concentration and decreasing NOM polarity. Humic substances affected immunoblot detection of prion protein from both deer and hamsters. We also establish that after interaction with humic acid, PrPTSE remains infectious to hamsters inoculated intracerebrally, and humic acid appeared to slow disease progression. These results provide evidence for interactions between PrPTSE and humic substances that influence both accurate measurement of PrPTSE in soil and disease transmission.

  10. Autonomous robot for detecting subsurface voids and tunnels using microgravity

    Science.gov (United States)

    Wilson, Stacy S.; Crawford, Nicholas C.; Croft, Leigh Ann; Howard, Michael; Miller, Stephen; Rippy, Thomas

    2006-05-01

    Tunnels have been used to evade security of defensive positions both during times of war and peace for hundreds of years. Tunnels are presently being built under the Mexican Border by drug smugglers and possibly terrorists. Several have been discovered at the border crossing at Nogales near Tucson, Arizona, along with others at other border towns. During this war on terror, tunnels under the Mexican Border pose a significant threat for the security of the United States. It is also possible that terrorists will attempt to tunnel under strategic buildings and possibly discharge explosives. The Center for Cave and Karst Study (CCKS) at Western Kentucky University has a long and successful history of determining the location of caves and subsurface voids using microgravity technology. Currently, the CCKS is developing a remotely controlled robot which will be used to locate voids underground. The robot will be a remotely controlled vehicle that will use microgravity and GPS to accurately detect and measure voids below the surface. It is hoped that this robot will also be used in military applications to locate other types of voids underground such as tunnels and bunkers. It is anticipated that the robot will be able to function up to a mile from the operator. This paper will describe the construction of the robot and the use of microgravity technology to locate subsurface voids with the robot.

  11. Fluorescence spectroscopy for rapid detection and classification of bacterial pathogens.

    Science.gov (United States)

    Sohn, Miryeong; Himmelsbach, David S; Barton, Franklin E; Fedorka-Cray, Paula J

    2009-11-01

    This study deals with the rapid detection and differentiation of Escherichia coli, Salmonella, and Campylobacter, which are the most commonly identified commensal and pathogenic bacteria in foods, using fluorescence spectroscopy and multivariate analysis. Each bacterial sample cultured under controlled conditions was diluted in physiologic saline for analysis. Fluorescence spectra were collected over a range of 200-700 nm with 0.5 nm intervals on the PerkinElmer Fluorescence Spectrometer. The synchronous scan technique was employed to find the optimum excitation (lambda(ex)) and emission (lambda(em)) wavelengths for individual bacteria with the wavelength interval (Deltalambda) being varied from 10 to 200 nm. The synchronous spectra and two-dimensional plots showed two maximum lambda(ex) values at 225 nm and 280 nm and one maximum lambda(em) at 335-345 nm (lambda(em) = lambda(ex) + Deltalambda), which correspond to the lambda(ex) = 225 nm, Deltalambda = 110-120 nm, and lambda(ex) = 280 nm, Deltalambda = 60-65 nm. For all three bacterial genera, the same synchronous scan results were obtained. The emission spectra from the three bacteria groups were very similar, creating difficulty in classification. However, the application of principal component analysis (PCA) to the fluorescence spectra resulted in successful classification of the bacteria by their genus as well as determining their concentration. The detection limit was approximately 10(3)-10(4) cells/mL for each bacterial sample. These results demonstrated that fluorescence spectroscopy, when coupled with PCA processing, has the potential to detect and to classify bacterial pathogens in liquids. The methodology is rapid (>10 min), inexpensive, and requires minimal sample preparation compared to standard analytical methods for bacterial detection.

  12. A liquid-crystal-based DNA biosensor for pathogen detection

    Science.gov (United States)

    Khan, Mashooq; Khan, Abdur Rahim; Shin, Jae-Ho; Park, Soo-Young

    2016-03-01

    A liquid-crystal (LC)-filled transmission electron microscopy (TEM) grid cell coated with the cationic surfactant dodecyltrimethylammonium bromide (DTAB), to which a single-stranded deoxyribonucleic acid probe (ssDNAprobe) was adsorbed at the LC/aqueous interface (TEMDTAB/DNA), was applied for the highly specific detection of target DNA molecules. The DTAB-coated E7 (used LC mixture) in the TEM grid (TEMDTAB) exhibited a homeotropic orientation, and changed to a planar orientation upon adsorption of the ssDNAprobe. The TEMDTAB/DNA was then exposed to complementary (target) ssDNA, which resulted in a planar-to-homeotropic configurational change of E7 that could be observed through a polarized optical microscope under crossed polarizers. The optimum adsorption density (2 μM) of ssDNAprobe enabled the detection of ≥0.05 nM complementary ssDNA. This TEMDTAB/DNA biosensor could differentiate complementary ssDNA from mismatched ssDNA as well as double-stranded DNA. It also successfully detected the genomic DNAs of the bacterium Erwinia carotovora and the fungi Rhazictonia solani. Owe to the high specificity, sensitivity, and label-free detection, this biosensor may broaden the applications of LC-based biosensors to pathogen detection.

  13. Detection of pathogenic organisms in food, water, and body fluids

    Science.gov (United States)

    Wallace, William H.; Henley, Michael V.; Sayler, Gary S.

    2002-06-01

    The construction of specific bioluminescent bacteriophage for detection of pathogenic organism can be developed to overcome interferences in complex matrices such as food, water and body fluids. Detection and identification of bacteria often require several days and frequently weeks by standard methods of isolation, growth and biochemical test. Immunoassay detection often requires the expression of the bacterial toxin, which can lead to non-detection of cells that may express the toxin under conditions different from testing protocols. Immunoassays require production of a specific antibody to the agent for detection and interference by contaminants frequently affects results. PCR based detection may be inhibited by substances in complex matrices. Modified methods of the PCR technique, such as magnetic capture-hybridization PCR (MCH-PCR), appear to improve the technique by removing the DNA products away from the inhibitors. However, the techniques required for PCR-based detection are slow and the procedures require skilled personnel working with labile reagents. Our approach is based on transferring bioluminescence (lux) genes into a selected bacteriophage. Bacteriophages are bacterial viruses that are widespread in nature and often are genus and species specific. This specificity eliminates or reduces false positives in a bacteriophage assay. The phage recognizes a specific receptor molecule on the surface of a susceptible bacterium, attaches and then injects the viral nucleic acid into the cell. The injected viral genome is expressed and then replicated, generating numerous exact copies of the viral genetic material including the lux genes, often resulting in an increase in bioluminescence by several hundred fold.

  14. Detection and characterization of foodborne pathogenic bacteria with hyperspectral microscope imaging

    Science.gov (United States)

    Rapid detection and identification of pathogenic microorganisms naturally occurring during food processing are important in developing intervention and verification strategies. In the poultry industry, contamination of poultry meat with foodborne pathogens (especially, Salmonella and Campylobacter) ...

  15. AOTF hyperspectral microscopic imaging for foodborne pathogenic bacteria detection

    Science.gov (United States)

    Park, Bosoon; Lee, Sangdae; Yoon, Seung-Chul; Sundaram, Jaya; Windham, William R.; Hinton, Arthur, Jr.; Lawrence, Kurt C.

    2011-06-01

    Hyperspectral microscope imaging (HMI) method which provides both spatial and spectral information can be effective for foodborne pathogen detection. The AOTF-based hyperspectral microscope imaging method can be used to characterize spectral properties of biofilm formed by Salmonella enteritidis as well as Escherichia coli. The intensity of spectral imagery and the pattern of spectral distribution varied with system parameters (integration time and gain) of HMI system. The preliminary results demonstrated determination of optimum parameter values of HMI system and the integration time must be no more than 250 ms for quality image acquisition from biofilm formed by S. enteritidis. Among the contiguous spectral imagery between 450 and 800 nm, the intensity of spectral images at 498, 522, 550 and 594 nm were distinctive for biofilm; whereas, the intensity of spectral images at 546 nm was distinctive for E. coli. For more accurate comparison of intensity from spectral images, a calibration protocol, using neutral density filters and multiple exposures, need to be developed to standardize image acquisition. For the identification or classification of unknown food pathogen samples, ground truth regions-of-interest pixels need to be selected for "spectrally pure fingerprints" for the Salmonella and E. coli species.

  16. Application of H-Infinity Fault Detection to Model-Scale Autonomous Aircraft

    Science.gov (United States)

    Vasconcelos, J. F.; Rosa, P.; Kerr, Murray; Latorre Sierra, Antonio; Recupero, Cristina; Hernandez, Lucia

    2015-09-01

    This paper describes the development of a fault detection system for a model scale autonomous aircraft. The considered fault scenario is defined by malfunctions in the elevator, namely bias and stuck-in-place of the surface. The H∞ design methodology is adopted, with an LFT description of the aircraft longitudinal dynamics, that allows for fault detection explicitly synthesized for a wide range of operating airspeeds. The obtained filter is validated in two stages: in a Functional Engineering Simulator (FES), providing preliminary results of the filter performance; and with experimental data, collected in field tests with actual injection of faults in the elevator surface.

  17. Molecular Detection of Common Bacterial Pathogens Causing Meningitis

    Directory of Open Access Journals (Sweden)

    H Sadighian

    2009-03-01

    Full Text Available "nBackground: The clinical diagnosis of meningitis is crucial, particularly in children. The early diagnosis and empiric an­tibi­otic treatments have led to a reduction in morbidity and mortality rates. PCR and the enzymatic digestion of 16SrDNA frag­ment which is produced by universal primers led up fast and sensitive determination. The purpose of this study was to investi­gate a rapid method for detection of common bacterial pathogens causing meningitis."nMethods: According to the gene encoding 16SrDNA found in all bacteria, a pair of primers was designed. Then the univer­sal PCR was performed for bacterial agents of meningitis (Streptococcus pneumoniae, Neisseria meningitidis, Haemophilus influ­enzae, etc. by employing broad- range DNA extraction method. The ob­tained uni­versal PCR products were digested with restriction enzymes (HaeIII, AluI and MnlI to identify bacterial species. "nResults: By the enzymatic digestion of the universal products of each standard strain of the above bacteria, specific patterns were achieved. These specific patterns may be used for comparison in CSF examination. The analytical sensitivity of the as­say was approximately 1.5´102 CFU/ml of CSF even in samples with high amount of proteins. Conclusion: The universal PCR coupled with enzymatic digestion can be used to detect and identify bacterial pathogens in clini­cal specimens rapidly and accurately. Molecular diagnostic of bacterial meningitis, though expensive and labor-inten­sive, but is valuable and critical in patient management.

  18. On the autonomous detection of coronal mass ejections in heliospheric imager data

    Science.gov (United States)

    Tappin, S. J.; Howard, T. A.; Hampson, M. M.; Thompson, R. N.; Burns, C. E.

    2012-05-01

    We report on the development of an Automatic Coronal Mass Ejection (CME) Detection tool (AICMED) for the Solar Mass Ejection Imager (SMEI). CMEs observed with heliospheric imagers are much more difficult to detect than those observed by coronagraphs as they have a lower contrast compared with the background light, have a larger range of intensity variation and are easily confused with other transient activity. CMEs appear in SMEI images as very faint often-fragmented arcs amongst a much brighter and often variable background. AICMED operates along the same lines as Computer Aided CME Tracking (CACTus), using the Hough Transform on elongation-time J-maps to extract straight lines from the data set. We compare AICMED results with manually measured CMEs on almost three years of data from early in SMEI operations. AICMED identified 83 verifiable events. Of these 46 could be matched with manually identified events, the majority of the non-detections can be explained. The remaining 37 AICMED events were newly discovered CMEs. The proportion of false identification was high, at 71% of the autonomously detected events. We find that AICMED is very effective as a region of interest highlighter, and is a promising first step in autonomous heliospheric imager CME detection, but the SMEI data are too noisy for the tool to be completely automated.

  19. Using dynamic pupillometry as a simple screening tool to detect autonomic neuropathy in patients with diabetes: a pilot study

    Directory of Open Access Journals (Sweden)

    Schneider Fábio K

    2010-06-01

    Full Text Available Abstract Background Autonomic neuropathy is a common and serious complication of diabetes. Early detection is essential to enable appropriate interventional therapy and management. Dynamic pupillometry has been proposed as a simpler and more sensitive tool to detect subclinical autonomic dysfunction. The aim of this study was to investigate pupil responsiveness in diabetic subjects with and without cardiovascular autonomic neuropathy (CAN using dynamic pupillometry in two sets of experiments. Methods During the first experiment, one flash was administered and the pupil response was recorded for 3 s. In the second experiment, 25 flashes at 1-s interval were administered and the pupil response was recorded for 30 s. Several time and pupil-iris radius-related parameters were computed from the acquired data. A total of 24 diabetic subjects (16 without and 8 with CAN and 16 healthy volunteers took part in the study. Results Our results show that diabetic subjects with and without CAN have sympathetic and parasympathetic dysfunction, evidenced by diminished amplitude reflexes and significant smaller pupil radius. It suggests that pupillary autonomic dysfunction occurs before a more generalized involvement of the autonomic nervous system, and this could be used to detect early autonomic dysfunction. Conclusions Dynamic pupillometry provides a simple, inexpensive, and noninvasive tool to screen high-risk diabetic patients for diabetic autonomic neuropathy.

  20. Bacteriophage functional genomics and its role in bacterial pathogen detection.

    Science.gov (United States)

    Klumpp, Jochen; Fouts, Derrick E; Sozhamannan, Shanmuga

    2013-07-01

    Emerging and reemerging bacterial infectious diseases are a major public health concern worldwide. The role of bacteriophages in the emergence of novel bacterial pathogens by horizontal gene transfer was highlighted by the May 2011 Escherichia coli O104:H4 outbreaks that originated in Germany and spread to other European countries. This outbreak also highlighted the pivotal role played by recent advances in functional genomics in rapidly deciphering the virulence mechanism elicited by this novel pathogen and developing rapid diagnostics and therapeutics. However, despite a steady increase in the number of phage sequences in the public databases, boosted by the next-generation sequencing technologies, few functional genomics studies of bacteriophages have been conducted. Our definition of 'functional genomics' encompasses a range of aspects: phage genome sequencing, annotation and ascribing functions to phage genes, prophage identification in bacterial sequences, elucidating the events in various stages of phage life cycle using genomic, transcriptomic and proteomic approaches, defining the mechanisms of host takeover including specific bacterial-phage protein interactions and identifying virulence and other adaptive features encoded by phages and finally, using prophage genomic information for bacterial detection/diagnostics. Given the breadth and depth of this definition and the fact that some of these aspects (especially phage-encoded virulence/adaptive features) have been treated extensively in other reviews, we restrict our focus only on certain aspects. These include phage genome sequencing and annotation, identification of prophages in bacterial sequences and genetic characterization of phages, functional genomics of the infection process and finally, bacterial identification using genomic information.

  1. A real-time method for autonomous passive acoustic detection-classification of humpback whales.

    Science.gov (United States)

    Abbot, Ted A; Premus, Vincent E; Abbot, Philip A

    2010-05-01

    This paper describes a method for real-time, autonomous, joint detection-classification of humpback whale vocalizations. The approach adapts the spectrogram correlation method used by Mellinger and Clark [J. Acoust. Soc. Am. 107, 3518-3529 (2000)] for bowhead whale endnote detection to the humpback whale problem. The objective is the implementation of a system to determine the presence or absence of humpback whales with passive acoustic methods and to perform this classification with low false alarm rate in real time. Multiple correlation kernels are used due to the diversity of humpback song. The approach also takes advantage of the fact that humpbacks tend to vocalize repeatedly for extended periods of time, and identification is declared only when multiple song units are detected within a fixed time interval. Humpback whale vocalizations from Alaska, Hawaii, and Stellwagen Bank were used to train the algorithm. It was then tested on independent data obtained off Kaena Point, Hawaii in February and March of 2009. Results show that the algorithm successfully classified humpback whales autonomously in real time, with a measured probability of correct classification in excess of 74% and a measured probability of false alarm below 1%.

  2. An Autonomous Wearable System for Predicting and Detecting Localised Muscle Fatigue

    Directory of Open Access Journals (Sweden)

    Martin Colley

    2011-01-01

    Full Text Available Muscle fatigue is an established area of research and various types of muscle fatigue have been clinically investigated in order to fully understand the condition. This paper demonstrates a non-invasive technique used to automate the fatigue detection and prediction process. The system utilises the clinical aspects such as kinematics and surface electromyography (sEMG of an athlete during isometric contractions. Various signal analysis methods are used illustrating their applicability in real-time settings. This demonstrated system can be used in sports scenarios to promote muscle growth/performance or prevent injury. To date, research on localised muscle fatigue focuses on the clinical side and lacks the implementation for detecting/predicting localised muscle fatigue using an autonomous system. Results show that automating the process of localised muscle fatigue detection/prediction is promising. The autonomous fatigue system was tested on five individuals showing 90.37% accuracy on average of correct classification and an error of 4.35% in predicting the time to when fatigue will onset.

  3. Automatic detection and classification of obstacles with applications in autonomous mobile robots

    Science.gov (United States)

    Ponomaryov, Volodymyr I.; Rosas-Miranda, Dario I.

    2016-04-01

    Hardware implementation of an automatic detection and classification of objects that can represent an obstacle for an autonomous mobile robot using stereo vision algorithms is presented. We propose and evaluate a new method to detect and classify objects for a mobile robot in outdoor conditions. This method is divided in two parts, the first one is the object detection step based on the distance from the objects to the camera and a BLOB analysis. The second part is the classification step that is based on visuals primitives and a SVM classifier. The proposed method is performed in GPU in order to reduce the processing time values. This is performed with help of hardware based on multi-core processors and GPU platform, using a NVIDIA R GeForce R GT640 graphic card and Matlab over a PC with Windows 10.

  4. An algorithm for image clusters detection and identification based on color for an autonomous mobile robot

    Energy Technology Data Exchange (ETDEWEB)

    Uy, D.L.

    1996-02-01

    An algorithm for detection and identification of image clusters or {open_quotes}blobs{close_quotes} based on color information for an autonomous mobile robot is developed. The input image data are first processed using a crisp color fuszzyfier, a binary smoothing filter, and a median filter. The processed image data is then inputed to the image clusters detection and identification program. The program employed the concept of {open_quotes}elastic rectangle{close_quotes}that stretches in such a way that the whole blob is finally enclosed in a rectangle. A C-program is develop to test the algorithm. The algorithm is tested only on image data of 8x8 sizes with different number of blobs in them. The algorithm works very in detecting and identifying image clusters.

  5. Development of a Multiplex PCR Method to Detect Fungal Pathogens for Quarantine on Exported Cacti

    OpenAIRE

    Hyun ji Cho; Seong Won Hong; Hyun-ju Kim; Youn-Sig Kwak

    2016-01-01

    Major diseases in grafted cacti have been reported and Fusarium oxysporum, Bipolaris cactivora, Phytophthora spp. and Collectotrichum spp. are known as causal pathogens. These pathogens can lead to plant death after infection. Therefore, some European countries have quarantined imported cacti that are infected with specific fungal pathogens. Consequently, we developed PCR detection methods to identify four quarantined fungal pathogens and reduce export rejection rates of Korean grafted cacti....

  6. A Multiplexed Diagnostic Platform for Point-of-Care Pathogen Detection

    Energy Technology Data Exchange (ETDEWEB)

    Regan, J F; Letant, S E; Adams, K L; Mahnke, R C; Nguyen, N T; Dzenitis, J M; Hindson, B J; Hadley, D R; Makarewicz, T J; Henderer, B D; Breneman, J W; Tammero, L F; Ortiz, J I; Derlet, R W; Cohen, S; Colston, W W; McBride, M T; Birch, J M

    2008-02-04

    We developed an automated point-of-care diagnostic instrument that is capable of analyzing nasal swab samples for the presence of respiratory diseases. This robust instrument, called FluIDx, performs autonomous multiplexed RT-PCR reactions that are analyzed by microsphere xMAP technology. We evaluated the performance of FluIDx, in comparison rapid tests specific for influenza and respiratory syncytial virus, in a clinical study performed at the UC Davis Medical Center. The clinical study included samples positive for RSV (n = 71), influenza A (n = 16), influenza B (n = 4), adenovirus (n = 5), parainfluenza virus (n = 2), and 44 negative samples, according to a composite reference method. FluIDx and the rapid tests detected 85.9% and 62.0% of the RSV positive samples, respectively. Similar sensitivities were recorded for the influenza B samples; whereas the influenza A samples were poorly detected, likely due to the utilization of an influenza A signature that did not accurately match currently circulating influenza A strains. Data for all pathogens were compiled and indicate that FluIDx is more sensitive than the rapid tests, detecting 74.2% (95% C.I. of 64.7-81.9%) of the positive samples in comparison to 53.6% (95% C.I. of 43.7-63.2%) for the rapid tests. The higher sensitivity of FluIDx was partially offset by a lower specificity, 77.3% versus 100.0%. Overall, these data suggest automated flow-through PCR-based instruments that perform multiplexed assays can successfully screen clinical samples for infectious diseases.

  7. 9 CFR 113.36 - Detection of pathogens by the chicken inoculation test.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Detection of pathogens by the chicken... REQUIREMENTS Standard Procedures § 113.36 Detection of pathogens by the chicken inoculation test. The test for...,000 doses. (b) At least 25 healthy susceptible young chickens, properly identified and obtained...

  8. Characterization of novel sufraces by FTIR spectroscopy and atomic force microscopy for food pathogen detection

    Science.gov (United States)

    Single molecular detection of pathogens and toxins of interest to food safety is within grasp using technology such as Atomic Force Microscopy. Using antibodies or specific aptamers connected to the AFM tip make it possible to detect a pathogen molecule on a surface. However, it also becomes necess...

  9. Autonomous absolute calibration of an ICCD camera in single-photon detection regime

    CERN Document Server

    Qi, Luo; Leuchs, Gerd; Chekhova, Maria V

    2016-01-01

    Intensified charge coupled device (ICCD) cameras are widely used in various applications such as microscopy, astronomy, spectroscopy. Often they are used as single-photon detectors, with thresholding being an essential part of the readout. In this paper, we measure the quantum efficiency of an ICCD camera in the single-photon detection mode using the Klyshko absolute calibration technique. The quantum efficiency is obtained as a function of the threshold value and of the wavelength of the detected light. In addition, we study the homogeneity of the photon sensitivity over the camera chip area. The experiment is performed in the autonomous regime, without using any additional detectors. We therefore demonstrate the self-calibration of an ICCD camera.

  10. Erythrophore cell response to food-associated pathogenic bacteria: implications for detection.

    Science.gov (United States)

    Hutchison, Janine R; Dukovcic, Stephanie R; Dierksen, Karen P; Carlyle, Calvin A; Caldwell, Bruce A; Trempy, Janine E

    2008-09-01

    Cell-based biosensors have been proposed for use as function-based detectors of toxic agents. We report the use of Betta splendens chromatophore cells, specifically erythrophore cells, for detection of food-associated pathogenic bacteria. Evaluation of erythrophore cell response, using Bacillus spp., has revealed that this response can distinguish pathogenic Bacillus cereus from a non-pathogenic B. cereus ΔplcR deletion mutant and a non-pathogenic Bacillus subtilis. Erythrophore cells were exposed to Salmonella enteritidis, Clostridium perfringens and Clostridium botulinum. Each bacterial pathogen elicited a response from erythrophore cells that was distinguished from the corresponding bacterial growth medium, and this observed response was unique for each bacterial pathogen. These findings suggest that erythrophore cell response has potential for use as a biosensor in the detection and toxicity assessment for food-associated pathogenic bacteria.

  11. Erythrophore cell response to food‐associated pathogenic bacteria: implications for detection

    Science.gov (United States)

    Hutchison, Janine R.; Dukovcic, Stephanie R.; Dierksen, Karen P.; Carlyle, Calvin A.; Caldwell, Bruce A.; Trempy, Janine E.

    2008-01-01

    Summary Cell‐based biosensors have been proposed for use as function‐based detectors of toxic agents. We report the use of Betta splendens chromatophore cells, specifically erythrophore cells, for detection of food‐associated pathogenic bacteria. Evaluation of erythrophore cell response, using Bacillus spp., has revealed that this response can distinguish pathogenic Bacillus cereus from a non‐pathogenic B. cereus ΔplcR deletion mutant and a non‐pathogenic Bacillus subtilis. Erythrophore cells were exposed to Salmonella enteritidis, Clostridium perfringens and Clostridium botulinum. Each bacterial pathogen elicited a response from erythrophore cells that was distinguished from the corresponding bacterial growth medium, and this observed response was unique for each bacterial pathogen. These findings suggest that erythrophore cell response has potential for use as a biosensor in the detection and toxicity assessment for food‐associated pathogenic bacteria. PMID:21261862

  12. Multi-robot terrain coverage and task allocation for autonomous detection of landmines

    Science.gov (United States)

    Dasgupta, Prithviraj; Muñoz-Meléndez, Angélica; Guruprasad, K. R.

    2012-06-01

    Multi-robot systems comprising of heterogeneous autonomous vehicles on land, air, water are being increasingly used to assist or replace humans in different hazardous missions. Two crucial aspects in such multi-robot systems are to: a) explore an initially unknown region of interest to discover tasks, and, b) allocate and share the discovered tasks between the robots in a coordinated manner using a multi-robot task allocation (MRTA) algorithm. In this paper, we describe results from our research on multi-robot terrain coverage and MRTA algorithms within an autonomous landmine detection scenario, done as part of the COMRADES project. Each robot is equipped with a different type of landmine detection sensor and different sensors, even of the same type, can have different degrees of accuracy. The landmine detection-related operations performed by each robot are abstracted as tasks and multiple robots are required to complete a single task. First, we describe a distributed and robust terrain coverage algorithm that employs Voronoi partitions to divide the area of interest among the robots and then uses a single-robot coverage algorithm to explore each partition for potential landmines. Then, we describe MRTA algorithms that use the location information of discovered potential landmines and employ either a greedy strategy, or, an opportunistic strategy to allocate tasks among the robots while attempting to minimize the time (energy) expended by the robots to perform the tasks. We report experimental results of our algorithms using accurately-simulated Corobot robots within the Webots simulator performing a multi-robot, landmine detection operation.

  13. A Novel Robust Scene Change Detection Algorithm for Autonomous Robots Using Mixtures of Gaussians

    Directory of Open Access Journals (Sweden)

    Luis J. Manso

    2014-02-01

    Full Text Available Interest in change detection techniques has considerably increased during recent years in the field of autonomous robotics. This is partly because changes in a robot’s working environment are useful for several robotic skills (e.g., spatial cognition, modelling or navigation and applications (e.g., surveillance or guidance robots. Changes are usually detected by comparing current data provided by the robot’s sensors with a previously known map or model of the environment. When the data consists of a large point cloud, dealing with it is a computationally expensive task, mainly due to the amount of points and the redundancy. Using Gaussian Mixture Models (GMM instead of raw point clouds leads to a more compact feature space that can be used to efficiently process the input data. This allows us to successfully segment the set of 3D points acquired by the sensor and reduce the computational load of the change detection algorithm. However, the segmentation of the environment as a Mixture of Gaussians has some problems that need to be properly addressed. In this paper, a novel change detection algorithm is described in order to improve the robustness and computational cost of previous approaches. The proposal is based on the classic Expectation Maximization (EM algorithm, for which different selection criteria are evaluated. As demonstrated in the experimental results section, the proposed change detection algorithm achieves the detection of changes in the robot’s working environment faster and more accurately than similar approaches.

  14. Sepsis biomarkers and pathogen detection methods: State of the art

    Directory of Open Access Journals (Sweden)

    Schmitz Roland P.H.

    2014-01-01

    Full Text Available Evidence-based blood culture testing is of utmost importance for ICU patients with suspected sepsis or organ infection. Knowledge of the etiologic agent (bacteria or fungi and their susceptibility against antimicrobials enables the clinician to initiate an appropriate antimicrobial therapy and guides diagnostic procedures. This has been shown to reduce mortality, ICU-stay and antibiotic overuse. Whereas microbiological laboratory practice has been highly standardized, short­falls in the preanalytic procedures in the ICU (indication, timing, volume, numbers, collection of blood cultures have a significant effect on the diagnostic yield. Due to system-related drawbacks of molecular diagnostics, i.e. PCR-based pathogen detection, which are arguable sensitivities, the failing of the 'fast time-to-result argument', no solution to establish a comprising antibiogram, still ongoing discussions on the coverage of the tar­get panel, high overall costs, and the lacking of resilient data on clinical utility, non-culture-based NATs do currently not represent an alternative to blood culture testing. Inflammatory markers are recognized to play an increasingly important role in the diagnosis and monitoring of sepsis. This is partly due to low specificity of clinical symptoms and conventional inflammatory signs for the diagnosis of sepsis but also to a lack of correlation with the severity of the inflammatory response. Elevated serum PCT levels indicate systemic inflammation reliably. PCT is the only sepsis marker that is helpful in the differentiation between infectious and non-infectious causes of organ dysfunction and shock and might support antibiotic therapy.

  15. Hand-eye LRF-based Iterative Plane Detection Method for Autonomous Robotic Welding

    Directory of Open Access Journals (Sweden)

    Sungmin Lee

    2015-12-01

    Full Text Available This paper proposes a hand-eye LRF-based (laser range finder welding plane-detection method for autonomous robotic welding in the field of shipbuilding. The hand-eye LRF system consists of a 6 DOF manipulator and an LRF attached to the wrist of the manipulator. The welding plane is detected by the LRF with only the wrist’s rotation to minimize a mechanical error caused by the manipulator’s motion. A position on the plane is determined as an average position of the detected points on the plane, and a normal vector to the plane is determined by applying PCA (principal component analysis to the detected points. In this case, the accuracy of the detected plane is analysed by simulations with respect to the wrist’s angle interval and the plane angle. As a result of the analysis, an iterative plane-detection method with the manipulator’s alignment motion is proposed to improve the performance of plane detection. For verifying the feasibility and effectiveness of the proposed plane-detection method, experiments are carried out with a prototype of the hand-eye LRF-based system, which consists of a 1 DOF wrist’s joint, an LRF system and a rotatable plane. In addition, the experimental results of the PCA-based plane detection method are compared with those of the two representative plane-detection methods, based on RANSAC (RANdom SAmple Consensus and the 3D Hough transform in both accuracy and computation time’s points of view.

  16. Bio-Inspired Autonomous Communications Systems with Anomaly Detection Monitoring Project

    Data.gov (United States)

    National Aeronautics and Space Administration — We propose to develop and demonstrate BioComm, a bio-inspired autonomous communications system (ACS) aimed at dynamically reconfiguring and redeploying autonomous...

  17. 360-Degree Visual Detection and Target Tracking on an Autonomous Surface Vehicle

    Science.gov (United States)

    Wolf, Michael T; Assad, Christopher; Kuwata, Yoshiaki; Howard, Andrew; Aghazarian, Hrand; Zhu, David; Lu, Thomas; Trebi-Ollennu, Ashitey; Huntsberger, Terry

    2010-01-01

    This paper describes perception and planning systems of an autonomous sea surface vehicle (ASV) whose goal is to detect and track other vessels at medium to long ranges and execute responses to determine whether the vessel is adversarial. The Jet Propulsion Laboratory (JPL) has developed a tightly integrated system called CARACaS (Control Architecture for Robotic Agent Command and Sensing) that blends the sensing, planning, and behavior autonomy necessary for such missions. Two patrol scenarios are addressed here: one in which the ASV patrols a large harbor region and checks for vessels near a fixed asset on each pass and one in which the ASV circles a fixed asset and intercepts approaching vessels. This paper focuses on the ASV's central perception and situation awareness system, dubbed Surface Autonomous Visual Analysis and Tracking (SAVAnT), which receives images from an omnidirectional camera head, identifies objects of interest in these images, and probabilistically tracks the objects' presence over time, even as they may exist outside of the vehicle's sensor range. The integrated CARACaS/SAVAnT system has been implemented on U.S. Navy experimental ASVs and tested in on-water field demonstrations.

  18. A Hybrid FPGA/Tilera Compute Element for Autonomous Hazard Detection and Navigation

    Science.gov (United States)

    Villalpando, Carlos Y.; Werner, Robert A.; Carson, John M., III; Khanoyan, Garen; Stern, Ryan A.; Trawny, Nikolas

    2013-01-01

    To increase safety for future missions landing on other planetary or lunar bodies, the Autonomous Landing and Hazard Avoidance Technology (ALHAT) program is developing an integrated sensor for autonomous surface analysis and hazard determination. The ALHAT Hazard Detection System (HDS) consists of a Flash LIDAR for measuring the topography of the landing site, a gimbal to scan across the terrain, and an Inertial Measurement Unit (IMU), along with terrain analysis algorithms to identify the landing site and the local hazards. An FPGA and Manycore processor system was developed to interface all the devices in the HDS, to provide high-resolution timing to accurately measure system state, and to run the surface analysis algorithms quickly and efficiently. In this paper, we will describe how we integrated COTS components such as an FPGA evaluation board, a TILExpress64, and multi-threaded/multi-core aware software to build the HDS Compute Element (HDSCE). The ALHAT program is also working with the NASA Morpheus Project and has integrated the HDS as a sensor on the Morpheus Lander. This paper will also describe how the HDS is integrated with the Morpheus lander and the results of the initial test flights with the HDS installed. We will also describe future improvements to the HDSCE.

  19. Molecular inversion probe: a new tool for highly specific detection of plant pathogens.

    Directory of Open Access Journals (Sweden)

    Han Yih Lau

    Full Text Available Highly specific detection methods, capable of reliably identifying plant pathogens are crucial in plant disease management strategies to reduce losses in agriculture by preventing the spread of diseases. We describe a novel molecular inversion probe (MIP assay that can be potentially developed into a robust multiplex platform to detect and identify plant pathogens. A MIP has been designed for the plant pathogenic fungus Fusarium oxysporum f.sp. conglutinans and the proof of concept for the efficiency of this technology is provided. We demonstrate that this methodology can detect as little as 2.5 ng of pathogen DNA and is highly specific, being able to accurately differentiate Fusarium oxysporum f.sp. conglutinans from other fungal pathogens such as Botrytis cinerea and even pathogens of the same species such as Fusarium oxysporum f.sp. lycopersici. The MIP assay was able to detect the presence of the pathogen in infected Arabidopsis thaliana plants as soon as the tissues contained minimal amounts of pathogen. MIP methods are intrinsically highly multiplexable and future development of specific MIPs could lead to the establishment of a diagnostic method that could potentially screen infected plants for hundreds of pathogens in a single assay.

  20. Engineered nanoconstructs for the multiplexed and sensitive detection of high-risk pathogens

    Science.gov (United States)

    Seo, Youngmin; Kim, Ji-Eun; Jeong, Yoon; Lee, Kwan Hong; Hwang, Jangsun; Hong, Jongwook; Park, Hansoo; Choi, Jonghoon

    2016-01-01

    Many countries categorize the causative agents of severe infectious diseases as high-risk pathogens. Given their extreme infectivity and potential to be used as biological weapons, a rapid and sensitive method for detection of high-risk pathogens (e.g., Bacillus anthracis, Francisella tularensis, Yersinia pestis, and Vaccinia virus) is highly desirable. Here, we report the construction of a novel detection platform comprising two units: (1) magnetic beads separately conjugated with multiple capturing antibodies against four different high-risk pathogens for simple and rapid isolation, and (2) genetically engineered apoferritin nanoparticles conjugated with multiple quantum dots and detection antibodies against four different high-risk pathogens for signal amplification. For each high-risk pathogen, we demonstrated at least 10-fold increase in sensitivity compared to traditional lateral flow devices that utilize enzyme-based detection methods. Multiplexed detection of high-risk pathogens in a sample was also successful by using the nanoconstructs harboring the dye molecules with fluorescence at different wavelengths. We ultimately envision the use of this novel nanoprobe detection platform in future applications that require highly sensitive on-site detection of high-risk pathogens.

  1. Autonomous detection and anticipation of jam fronts from messages propagated by inter-vehicle communication

    CERN Document Server

    Sch"onhof, M; Kesting, A; Helbing, D; Sch\\"onhof, Martin; Treiber, Martin; Kesting, Arne; Helbing, Dirk

    2006-01-01

    In this paper, a minimalist, completely distributed freeway traffic information system is introduced. It involves an autonomous, vehicle-based jam front detection, the information transmission via inter-vehicle communication, and the forecast of the spatial position of jam fronts by reconstructing the spatiotemporal traffic situation based on the transmitted information. The whole system is simulated with an integrated traffic simulator, that is based on a realistic microscopic traffic model for longitudinal movements and lane changes. The function of its communication module has been explicitly validated by comparing the simulation results with analytical calculations. By means of simulations, we show that the algorithms for a congestion-front recognition, message transmission, and processing predict reliably the existence and position of jam fronts for vehicle equipment rates as low as 3%. A reliable mode of operation already for small market penetrations is crucial for the successful introduction of inter-...

  2. Detection of Intestinal Pathogens in River, Shore, and Drinking Water in Lima, Peru

    Science.gov (United States)

    Grothen, David C.; Zach, Sydney J.; Davis, Paul H.

    2017-01-01

    Water quality management is an ongoing struggle for many locations worldwide. Current testing of water supplies can be time-consuming, expensive, and lack sensitivity. This study describes an alternative, easy-to-use, and inexpensive method to water sampling and testing at remote locations. This method was employed to detect a number of intestinal pathogens in various locations of Lima, Peru. A total of 34 PCR primer pairs were tested for specificity and high-yield amplification for 12 different pathogens using known DNA templates. Select primers for each pathogen were then tested for minimum detection limits of DNA. Water samples were collected from 22 locations. PCR was used to detect the presence of a pathogen, virulence factors, or differentiate between pathogenic species. In 22 water samples, cholera toxin gene was detected in 4.5% of samples, C. perfringens DNA was detected in 50% of samples, E. histolytica DNA was detected in 54.5% of samples, Giardia intestinalis DNA was detected in 4.5% of samples, Leptospira spp. DNA was detected in 29% of samples, and T. gondii DNA was detected in 31.8% of samples. DNA from three pathogens, C. perfringens, E. histolytica, and T. gondii, were found in residential samples, which accounted for 10 out of 22 samples. PMID:28138344

  3. A Selective Chromogenic Plate, YECA, for the Detection of Pathogenic Yersinia enterocolitica: Specificity, Sensitivity, and Capacity to Detect Pathogenic Y. enterocolitica from Pig Tonsils

    Directory of Open Access Journals (Sweden)

    M. Denis

    2011-01-01

    Full Text Available A new selective chromogenic plate, YECA, was tested for its specificity, sensitivity, and accuracy to detect pathogenic Y. enterocolitica from pig tonsils. We tested a panel of 26 bacterial strains on YECA and compared it to PCA, CIN, and YeCM media. Detection of pathogenic Y. enterocolitica was carried out on 50 pig tonsils collected in one slaughter house. Enrichment was done in PSB and ITC broths. Streaking on YECA and CIN was done in direct, after 24H incubation of ITC, after 48H incubation of PSB and ITC. All the plates were incubated at 30∘C during 24 hours. Presence of typical colonies on CIN and YECA was checked, and isolates were biotyped. Pathogenic Y. enterocolitica strains showed an important growth on YECA with small and red fuchsia colonies while biotype 1A exhibited very few violet colonies. Enrichment in ITC during 48H gave the best performance for detecting positive samples in pathogenic Y. enterocolitica, and YECA could detect directly pathogenic Y. enterocolitica strains (2, 3, and 4. Use of YECA in combination with ITC generates a time-saver by giving a positive test in 72H.

  4. [Development of single base extension-tags microarray for the detection of food-borne pathogens].

    Science.gov (United States)

    Lu, Changyong; Shi, Chunlei; Zhang, Chunxiu; Chen, Jing; Shi, Xianming

    2009-04-01

    We developed single base extension-tags (SBE-tags) microarray to detect eight common food-borne pathogens, including Staphylococcus aureus, Vibrio parahaemolyticus, Listeria monocytogenes, Salmonella, Enterobacter sakazaki, Shigella, Escherichia coli O157:H7 and Campylobacter jejuni. With specific PCR primers identified and integrated for eight food-borne pathogens, target sequences were amplified and purified as template DNA of single base extension-tags reaction. The products were hybridized to microarrays and scanned for fluorescence intensity. The experiment showed a specific and simultaneous detection of eight food-borne pathogens. The system limits is 0.1 pg for a genomic DNA and 5x10(2) CFU/mL for Salmonella typhimurium cultures. The single base extension-tags assay can be used to detect food-borne pathogens rapidly and accurately with a high sensitivity, and provide an efficient way for diagnosis and control of disease caused by food-borne pathogens.

  5. Pathogen detection in produce using applications of immunomagnetic beads and biosensors

    Science.gov (United States)

    The presence of pathogenic bacteria is of increasing public health concerns. Rapid and sensitive tests to detect pathogens are required to keep the safety of food supply. In this chapter we summarized our previous investigations where we applied immunomagnetic-bead (IMB) capture and various biosen...

  6. Fluorescence techniques to detect and to assess viability of plant pathogenic bacteria

    NARCIS (Netherlands)

    Chitarra, L.G.

    2001-01-01

    Plant pathogenic bacteria cause major economic losses in commercial crop production worldwide every year. The current methods used to detect and to assess the viability of bacterial pathogens and to test seed lots or plants for contamination are usually based on plate assays or on serological techni

  7. Hyperspectral imaging using a color camera and its application for pathogen detection

    Science.gov (United States)

    This paper reports the results of a feasibility study for the development of a hyperspectral image recovery (reconstruction) technique using a RGB color camera and regression analysis in order to detect and classify colonies of foodborne pathogens. The target bacterial pathogens were the six represe...

  8. Metagenomic analysis for detecting pathogens in culture-negative infective endocarditis.

    Science.gov (United States)

    Fukui, Yuto; Aoki, Kotaro; Okuma, Shinnosuke; Sato, Takahiro; Ishii, Yoshikazu; Tateda, Kazuhiro

    2015-12-01

    Pathogen identification is important for proper diagnosis and optimal treatment of infective endocarditis (IE). Blood and valve cultures are the gold standard for detecting pathogens responsible for IE. However, these tests only detect culturable pathogens, and have low sensitivity, especially in patients previously treated with antibiotics. Culture-negative IE is still a major clinical problem and a diagnostic challenge. Recently, metagenomic analysis using next generation sequencing has been used to detect pathogens directly from clinical samples. However, there are very few reports of the use of metagenomic analysis for pathogen identification in culture-negative IE cases and the usefulness of this new method is unknown. Here, we report a case of successful pathogen detection with metagenomic analysis in a patient of culture-negative IE. The patient underwent valve replacement surgery and received antibiotics for 5 weeks and survived. Using metagenomic analysis of resected vegetation, we detected Abiotrophia defectiva, which is often associated with culture-negative IE due to its fastidious growth. This method may be useful for pathogen identification in future cases of culture-negative IE.

  9. Multiplex polymerase chain reaction tests for detection of pathogens associated with gastroenteritis.

    Science.gov (United States)

    Zhang, Hongwei; Morrison, Scott; Tang, Yi-Wei

    2015-06-01

    A wide range of enteric pathogens can cause infectious gastroenteritis. Conventional diagnostic algorithms are time-consuming and often lack sensitivity and specificity. Advances in molecular technology have provided new clinical diagnostic tools. Multiplex polymerase chain reaction (PCR)-based testing has been used in gastroenterology diagnostics in recent years. This article presents a review of recent laboratory-developed multiplex PCR tests and current commercial multiplex gastrointestinal pathogen tests. It focuses on two commercial syndromic multiplex tests: Luminex xTAG Gastrointestinal Pathogen Panel and BioFire FilmArray gastrointestinal test. Multiplex PCR tests have shown superior sensitivity to conventional methods for detection of most pathogens.

  10. Molecular detection of bacterial pathogens using microparticle enhanced double-stranded DNA probes.

    Science.gov (United States)

    Riahi, Reza; Mach, Kathleen E; Mohan, Ruchika; Liao, Joseph C; Wong, Pak Kin

    2011-08-15

    Rapid, specific, and sensitive detection of bacterial pathogens is essential toward clinical management of infectious diseases. Traditional approaches for pathogen detection, however, often require time-intensive bacterial culture and amplification procedures. Herein, a microparticle enhanced double-stranded DNA probe is demonstrated for rapid species-specific detection of bacterial 16S rRNA. In this molecular assay, the binding of the target sequence to the fluorophore conjugated probe thermodynamically displaces the quencher probe and allows the fluorophore to fluoresce. By incorporation of streptavidin-coated microparticles to localize the biotinylated probes, the sensitivity of the assay can be improved by 3 orders of magnitude. The limit of detection of the assay is as few as eight bacteria without target amplification and is highly specific against other common pathogens. Its applicability toward clinical diagnostics is demonstrated by directly identifying bacterial pathogens in urine samples from patients with urinary tract infections.

  11. Application of a Non-amplification based Technology to Detect Invasive Fungal Pathogens

    Science.gov (United States)

    Hsu, Joe L.; Binkley, Jon; Clemons, Karl V.; Stevens, David A.; Nicolls, Mark R.; Holodniy, Mark

    2014-01-01

    Current diagnostic techniques for fungal diseases could be improved with respect to sensitivity, specificity and timeliness. To address this clinical need, we adapted a non-amplification based nucleic acid detection technology to identify fungal pathogens. We demonstrate a high-specificity, detection sensitivity, reproducibility and multiplex capacity for detecting fungal strains. PMID:24359934

  12. A microfluidic nano-biosensor for the detection of pathogenic Salmonella.

    Science.gov (United States)

    Kim, Giyoung; Moon, Ji-Hea; Moh, Chang-Yeon; Lim, Jong-guk

    2015-05-15

    Rapid detection of pathogenic Salmonella in food products is extremely important for protecting the public from salmonellosis. The objective of the present study was to explore the feasibility of using a microfluidic nano-biosensor to rapidly detect pathogenic Salmonella. Quantum dot nanoparticles were used to detect Salmonella cells. For selective detection of Salmonella, anti-Salmonella polyclonal antibodies were covalently immobilized onto the quantum dot surface. To separate and concentrate the cells from the sample, superparamagnetic particles and a microfluidic chip were used. A portable fluorometer was developed to measure the fluorescence signal from the quantum dot nanoparticles attached to Salmonella in the samples. The sensitivity for detection of pathogenic Salmonella was evaluated using serially diluted Salmonella Typhimurium in borate buffer and chicken extract. The fluorescence response of the nano-biosensor increased with increasing cell concentration. The detection limit of the sensor was 10(3) CFU/mL Salmonella in both borate buffer and food extract.

  13. A Monocular Vision Sensor-Based Obstacle Detection Algorithm for Autonomous Robots

    Directory of Open Access Journals (Sweden)

    Tae-Jae Lee

    2016-03-01

    Full Text Available This paper presents a monocular vision sensor-based obstacle detection algorithm for autonomous robots. Each individual image pixel at the bottom region of interest is labeled as belonging either to an obstacle or the floor. While conventional methods depend on point tracking for geometric cues for obstacle detection, the proposed algorithm uses the inverse perspective mapping (IPM method. This method is much more advantageous when the camera is not high off the floor, which makes point tracking near the floor difficult. Markov random field-based obstacle segmentation is then performed using the IPM results and a floor appearance model. Next, the shortest distance between the robot and the obstacle is calculated. The algorithm is tested by applying it to 70 datasets, 20 of which include nonobstacle images where considerable changes in floor appearance occur. The obstacle segmentation accuracies and the distance estimation error are quantitatively analyzed. For obstacle datasets, the segmentation precision and the average distance estimation error of the proposed method are 81.4% and 1.6 cm, respectively, whereas those for a conventional method are 57.5% and 9.9 cm, respectively. For nonobstacle datasets, the proposed method gives 0.0% false positive rates, while the conventional method gives 17.6%.

  14. Fully Autonomous Multiplet Event Detection: Application to Local-Distance Monitoring of Blood Falls Seismicity

    Energy Technology Data Exchange (ETDEWEB)

    Carmichael, Joshua Daniel [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Carr, Christina [Univ. of Alaska, Fairbanks, AK (United States); Pettit, Erin C. [Univ. of Alaska, Fairbanks, AK (United States)

    2015-06-18

    We apply a fully autonomous icequake detection methodology to a single day of high-sample rate (200 Hz) seismic network data recorded from the terminus of Taylor Glacier, ANT that temporally coincided with a brine release episode near Blood Falls (May 13, 2014). We demonstrate a statistically validated procedure to assemble waveforms triggered by icequakes into populations of clusters linked by intra-event waveform similarity. Our processing methodology implements a noise-adaptive power detector coupled with a complete-linkage clustering algorithm and noise-adaptive correlation detector. This detector-chain reveals a population of 20 multiplet sequences that includes ~150 icequakes and produces zero false alarms on the concurrent, diurnally variable noise. Our results are very promising for identifying changes in background seismicity associated with the presence or absence of brine release episodes. We thereby suggest that our methodology could be applied to longer time periods to establish a brine-release monitoring program for Blood Falls that is based on icequake detections.

  15. A Monocular Vision Sensor-Based Obstacle Detection Algorithm for Autonomous Robots

    Science.gov (United States)

    Lee, Tae-Jae; Yi, Dong-Hoon; Cho, Dong-Il “Dan”

    2016-01-01

    This paper presents a monocular vision sensor-based obstacle detection algorithm for autonomous robots. Each individual image pixel at the bottom region of interest is labeled as belonging either to an obstacle or the floor. While conventional methods depend on point tracking for geometric cues for obstacle detection, the proposed algorithm uses the inverse perspective mapping (IPM) method. This method is much more advantageous when the camera is not high off the floor, which makes point tracking near the floor difficult. Markov random field-based obstacle segmentation is then performed using the IPM results and a floor appearance model. Next, the shortest distance between the robot and the obstacle is calculated. The algorithm is tested by applying it to 70 datasets, 20 of which include nonobstacle images where considerable changes in floor appearance occur. The obstacle segmentation accuracies and the distance estimation error are quantitatively analyzed. For obstacle datasets, the segmentation precision and the average distance estimation error of the proposed method are 81.4% and 1.6 cm, respectively, whereas those for a conventional method are 57.5% and 9.9 cm, respectively. For nonobstacle datasets, the proposed method gives 0.0% false positive rates, while the conventional method gives 17.6%. PMID:26938540

  16. Phage-amplified bioluminescent bioreporters for the detection of foodborne pathogens

    Science.gov (United States)

    Ripp, Steven; Young, Jacque C.; Ozen, Aysu; Jegier, Patricia; Johnson, Courtney; Daumer, Kathleen; Garland, Jay; Sayler, Gary S.

    2004-06-01

    The objective of this investigation is to develop a bioluminescent bioreporter system for the detection and monitoring of pathogenic microbial species. Current detection methodologies typically rely on time-consuming sample pre-enrichment steps to elevate pathogen concentrations to detectable levels or DNA based polymerase chain reaction (PCR) techniques that require extensive user training and expensive instrumentation. Detection utilizing bioluminescent bioreporter organisms, however, can provide a simple and rapid means of monitoring foodborne pathogens. Bioluminescent bioreporters are engineered to produce light in response to specific environmental inducers. The light signal is then measured with photodetector devices to generate a quantitative assessment of inducer concentration. The immediate goal of this research effort is to integrate key quorum sensing signal transduction elements into pathogen specific bacteriophages. Upon infection of a unique pathogenic species by the bacteriophages, quorum sensing signals will be generated that will subsequently stimulate bioluminescence in neighboring bioluminescent bioreporter cells. Utilizing both bacteriophages and bioluminescent bioreporters, we realize exceptional pathogen specificity while attaining enhanced bioluminescence production. This integrative approach will lead to rapid pathogen identification without requisite sample pre-enrichment. Additionally, since the bioluminescent response is completely intrinsic to the bioreporter organism, no user interventions are required for generating light signals; the protocol requires only addition of the food sample with the bacteriophage/bioluminescent bioreporter system. Measurement of light responses can be achieved using high-throughput microtiter plate readers, hand-held photomultiplier units, or microchip luminometers.

  17. Rapid methods for the detection of foodborne bacterial pathogens: principles, applications, advantages and limitations.

    Science.gov (United States)

    Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han

    2014-01-01

    The incidence of foodborne diseases has increased over the years and resulted in major public health problem globally. Foodborne pathogens can be found in various foods and it is important to detect foodborne pathogens to provide safe food supply and to prevent foodborne diseases. The conventional methods used to detect foodborne pathogen are time consuming and laborious. Hence, a variety of methods have been developed for rapid detection of foodborne pathogens as it is required in many food analyses. Rapid detection methods can be categorized into nucleic acid-based, biosensor-based and immunological-based methods. This review emphasizes on the principles and application of recent rapid methods for the detection of foodborne bacterial pathogens. Detection methods included are simple polymerase chain reaction (PCR), multiplex PCR, real-time PCR, nucleic acid sequence-based amplification (NASBA), loop-mediated isothermal amplification (LAMP) and oligonucleotide DNA microarray which classified as nucleic acid-based methods; optical, electrochemical and mass-based biosensors which classified as biosensor-based methods; enzyme-linked immunosorbent assay (ELISA) and lateral flow immunoassay which classified as immunological-based methods. In general, rapid detection methods are generally time-efficient, sensitive, specific and labor-saving. The developments of rapid detection methods are vital in prevention and treatment of foodborne diseases.

  18. Rapid Methods for the Detection of Foodborne Bacterial Pathogens: Principles, Applications, Advantages and Limitations

    Directory of Open Access Journals (Sweden)

    Law eJodi Woan-Fei

    2015-01-01

    Full Text Available The incidence of foodborne diseases has increased over the years and resulted in major public health problem globally. Foodborne pathogens can be found in various foods and it is important to detect foodborne pathogens to provide safe food supply and to prevent foodborne diseases. The conventional methods used to detect foodborne pathogen are time consuming and laborious. Hence, a variety of methods have been developed for rapid detection of foodborne pathogens as it is required in many food analyses. Rapid detection methods can be categorized into nucleic acid-based, biosensor-based and immunological-based methods. This review emphasizes on the principles and application of recent rapid methods for the detection of foodborne bacterial pathogens. Detection methods included are simple polymerase chain reaction (PCR, multiplex PCR, real-time PCR, nucleic acid sequence-based amplification (NASBA, loop-mediated isothermal amplification (LAMP and oligonucleotide DNA microarray which classified as nucleic acid-based methods; optical, electrochemical and mass-based biosensors which classified as biosensor-based methods; enzyme-linked immunosorbent assay (ELISA and lateral flow immunoassay which classified as immunological-based methods. In general, rapid detection methods are generally time-efficient, sensitive, specific and labor-saving. The developments of rapid detection methods are vital in prevention and treatment of foodborne diseases.

  19. Nucleic Acid-based Detection of Bacterial Pathogens Using Integrated Microfluidic Platform Systems

    Directory of Open Access Journals (Sweden)

    Carl A. Batt

    2009-05-01

    Full Text Available The advent of nucleic acid-based pathogen detection methods offers increased sensitivity and specificity over traditional microbiological techniques, driving the development of portable, integrated biosensors. The miniaturization and automation of integrated detection systems presents a significant advantage for rapid, portable field-based testing. In this review, we highlight current developments and directions in nucleic acid-based micro total analysis systems for the detection of bacterial pathogens. Recent progress in the miniaturization of microfluidic processing steps for cell capture, DNA extraction and purification, polymerase chain reaction, and product detection are detailed. Discussions include strategies and challenges for implementation of an integrated portable platform.

  20. Integrating disparity and edge detection algorithms to autonomously follow linear-shaped structures at low altitude

    NARCIS (Netherlands)

    C.R. Verschoor; A. Visser

    2013-01-01

    One of the main requirements in enabling autonomous flight of Micro Aerial Vehicles is the ability of autonomous navigation. One possible solution to solve this navigation problem is to use vision-based line-following algorithms. Such vision-based algorithm could rely on the various linear structure

  1. Detection of foodborne pathogens by qPCR: A practical approach for food industry applications

    Directory of Open Access Journals (Sweden)

    María-José Chapela

    2015-12-01

    Full Text Available Microbiological analysis of food is an integrated part of microbial safety management in the food chain. Monitoring and controlling foodborne pathogens are traditionally carried out by conventional microbiological methods based on culture-dependent approaches in control laboratories and private companies. However, polymerase chain reaction (PCR has revolutionized microbiological analysis allowing detection of pathogenic microorganisms in food, without the necessity of classical isolation and identification. However, at present, PCR and quantitative polymerase chain reaction (qPCR are essential analytical tools for researchers working in the field of foodborne pathogens. This manuscript reviews recently described qPCR methods applied for foodborne bacteria detection, serving as economical, safe, and reliable alternatives for application in the food industry and control laboratories. Multiplex qPCR, which allows the simultaneous detection of more than one pathogen in one single reaction, saving considerable effort, time, and money, is emphasized in the article.

  2. Meeting current public health needs: optical biosensors for pathogen detection and analysis

    Science.gov (United States)

    Yang, Minghui; Sapsford, Kim E.; Sergeev, Nikolay; Sun, Steven; Rasooly, Avraham

    2009-02-01

    Pathogen detection and analysis is critical for medicine, food safety, agriculture, public health and biosecurity. Many current microbial detection approaches are based on century-old culturing methods which, while reliable, are slow, provide relatively little information about the pathogens and are not adaptable to high throughput operations. Optical biodetection represents a potential alternative. Most ELISA and chromatography systems are based on optical methods that are also used for analysis of molecular interactions, such as DNA hybridization and protein-protein interactions (e.g. microarrays or SPR biosensors). Various optical biosensor platforms have been developed that have many of the characteristics essential for modern pathogen molecular analysis including sensitivity, speed of analysis, multi-channel capability, relative simplicity and low cost. Here we provide several examples of the use of optical biosensor technology for pathogen detection and analysis including high throughput DNA microarray analysis, SPR-based rapid direct detection of bacterial toxins, CCD-based fluorescent activity analysis of microbial toxins and a simple ECL-based CCD detection system. However, while effective for molecular analysis, most of these technologies are not as sensitive as traditional culturing methods for detecting microorganisms. There is a need to combine optical biosensors with traditional methods to speed culture-based detection and to provide more information regarding the pathogens.

  3. Detection of Foodborne Pathogenic Bacteria using Bacteriophage Tail Spike Proteins

    Science.gov (United States)

    Poshtiban, Somayyeh

    Foodborne infections are worldwide health problem with tremendous social and financial impacts. Efforts are focused on developing accurate and reliable technologies for detection of food contaminations in early stages preferably on-site. This thesis focuses on interfacing engineering and biology by combining phage receptor binding proteins (RBPs) with engineered platforms including microresonator-based biosensors, magnetic particles and polymerase chain reaction (PCR) to develop bacterial detection sensors. We used phage RBPs as target specific bioreceptors to develop an enhanced microresonator array for bacterial detection. These resonator beams are optimized to feature a high natural frequency while offer large surface area for capture of bacteria. Theoretical analysis indicates a high mass sensitivity with a threshold for the detection of a single bacterial cell. We used phage RBPs as target specific bioreceptors, and successfully demonstrated the application of these phage RBB-immobilized arrays for specific detection of C. jejuni cells. We also developed a RBP-derivatized magnetic pre-enrichment method as an upstream sample preparation method to improve sensitivity and specificity of PCR for detection of bacterial cells in various food samples. The combination of RBP-based magnetic separation and real-time PCR allowed the detection of small number of bacteria in artificially contaminated food samples without any need for time consuming pre-enrichment step through culturing. We also looked into integration of the RBP-based magnetic separation with PCR onto a single microfluidic lab-on-a-chip to reduce the overall turnaround time.

  4. Sensor fusion: lane marking detection and autonomous intelligent cruise control system

    Science.gov (United States)

    Baret, Marc; Baillarin, S.; Calesse, C.; Martin, Lionel

    1995-12-01

    In the past few years MATRA and RENAULT have developed an Autonomous Intelligent Cruise Control (AICC) system based on a LIDAR sensor. This sensor incorporating a charge coupled device was designed to acquire pulsed laser diode emission reflected by standard car reflectors. The absence of moving mechanical parts, the large field of view, the high measurement rate and the very good accuracy for distance range and angular position of targets make this sensor very interesting. It provides the equipped car with the distance and the relative speed of other vehicles enabling the safety distance to be controlled by acting on the throttle and the automatic gear box. Experiments in various real traffic situations have shown the limitations of this kind of system especially on bends. All AICC sensors are unable to distinguish between a bend and a change of lane. This is easily understood if we consider a road without lane markings. This fact has led MATRA to improve its AICC system by providing the lane marking information. Also in the scope of the EUREKA PROMETHEUS project, MATRA and RENAULT have developed a lane keeping system in order to warn of the drivers lack of vigilance. Thus, MATRA have spread this system to far field lane marking detection and have coupled it with the AICC system. Experiments will be carried out on roads to estimate the gain in performance and comfort due to this fusion.

  5. Detection of Multiple Waterborne Pathogens Using Microsequencing Arrays

    Science.gov (United States)

    Aims: A microarray was developed to simultaneously detect Cryptosporidium parvum, Cryptosporidium hominis, Enterococcus faecium, Bacillus anthracis and Francisella tularensis in water. Methods and Results: A DNA microarray was designed to contain probes that specifically dete...

  6. Bacteriophage Amplification-Coupled Detection and Identification of Bacterial Pathogens

    Science.gov (United States)

    Cox, Christopher R.; Voorhees, Kent J.

    Current methods of species-specific bacterial detection and identification are complex, time-consuming, and often require expensive specialized equipment and highly trained personnel. Numerous biochemical and genotypic identification methods have been applied to bacterial characterization, but all rely on tedious microbiological culturing practices and/or costly sequencing protocols which render them impractical for deployment as rapid, cost-effective point-of-care or field detection and identification methods. With a view towards addressing these shortcomings, we have exploited the evolutionarily conserved interactions between a bacteriophage (phage) and its bacterial host to develop species-specific detection methods. Phage amplification-coupled matrix assisted laser desorption time-of-flight mass spectrometry (MALDI-TOF-MS) was utilized to rapidly detect phage propagation resulting from species-specific in vitro bacterial infection. This novel signal amplification method allowed for bacterial detection and identification in as little as 2 h, and when combined with disulfide bond reduction methods developed in our laboratory to enhance MALDI-TOF-MS resolution, was observed to lower the limit of detection by several orders of magnitude over conventional spectroscopy and phage typing methods. Phage amplification has been combined with lateral flow immunochromatography (LFI) to develop rapid, easy-to-operate, portable, species-specific point-of-care (POC) detection devices. Prototype LFI detectors have been developed and characterized for Yersinia pestis and Bacillus anthracis, the etiologic agents of plague and anthrax, respectively. Comparable sensitivity and rapidity was observed when phage amplification was adapted to a species-specific handheld LFI detector, thus allowing for rapid, simple, POC bacterial detection and identification while eliminating the need for bacterial culturing or DNA isolation and amplification techniques.

  7. Detection of the emerging amphibian pathogens Batrachochytrium dendrobatidis and ranavirus in Russia

    Science.gov (United States)

    Reshetnikov, Andrey N.; Chestnut, Tara E.; Brunner, Jesse L.; Charles, Kaylene M.; Nebergall, Emily E.; Olson, Deanna H.

    2014-01-01

    In a population of the European common toad Bufo bufo from a rural pond in the region of Lake Glubokoe Regional Reserve in Moscow province, Russia, unexplained mass mortality events involving larvae and metamorphs have been observed over a monitoring period of >20 yr. We tested toads from this and a nearby site for the emerging amphibian pathogens Batrachochytrium dendrobatidis (Bd) and ranavirus (Rv). Both pathogens were detected, and at the rural pond site, with the above-noted losses and decline in toad breeding success, 40% of B. bufo metamorphs were Bd positive, 46% were Rv positive and 20% were co-infected with both pathogens. Toad metamorphs from a neighbouring water body were also Bd and Rv positive (25 and 55%, respectively). This is the first confirmation of these pathogens in Russia. Questions remain as to the origins of these pathogens in Russia and their roles in documented mass mortality events.

  8. Surface plasmon resonance biosensors for detection of foodborne pathogens and toxins

    Science.gov (United States)

    Homola, Jiří; Hegnerová, Kateřina; Vala, Milan

    2009-02-01

    In the last decade surface plasmon resonance (SPR) biosensors have made great strides both in terms of technology and its applications. SPR biosensors have become a central tool for study of molecular interactions and have been widely used for detection of chemical and biological analytes. Food analysis belongs to major areas of potential applications of SPR biosensors. Therefore, numerous SPR biosensors for detection of analytes implicated in food safety (e.g. pathogens, toxins, drug residues, vitamins, hormones, chemical contaminants, and allergens) have been developed. This paper reviews recent developments in the field of SPR biosensors for food safety, in particular, for detection of foodborne pathogens and toxins.

  9. Towards On-site Pathogen Detection Using Antibody-based Sensors

    DEFF Research Database (Denmark)

    Skottrup, Peter Durand; Nicolaisen, Mogens; Justesen, Annemarie Fejer

    2008-01-01

    In this paper the recent progress within biosensors for plant pathogen detection will be reviewed. Bio-recognition layers on sensors can be designed in various ways, however the most popular approach is to immobilise antibodies for specific capture of analytes. Focus will be put on antibody surface......-immobilisation strategies as well as the use of antibodies in the widely used sensors, quartz crystal microbalance, surface plasmon resonance and cantilevers. We will describe the available data on antibody-based plant pathogen detection and furthermore use examples from detection of the pathogens Salmonella, Listeria...... monocytogenes, Streptococcus mutans, Bacillus cereus, Bacillus anthracis, Campylobacter and Escherichia coli. We will touch upon optimal assay design and further discuss the strengths and limitations of current sensor technologies for detection of viruses, bacteria and fungi....

  10. Recent Advancements in Nanobioassays and Nanobiosensors for Foodborne Pathogenic Bacteria Detection.

    Science.gov (United States)

    Chen, Jing; Park, Bosoon

    2016-06-01

    Bacterial pathogens are one of the leading causes of food safety incidents and product recalls worldwide. Timely detection and identification of microbial contamination in agricultural and food products is crucial for disease prevention and outbreak investigation. In efforts to improve and/or replace time-consuming and laborious "gold standards" for pathogen detection, numerous alternative rapid methods have been proposed in the past 15 years, with a trend toward incorporating nanotechnology and nanomaterials in food pathogen detection. This article is a review of the use of nanotechnology in various detection and sample preparation techniques and advancements in nanotechnology applications in food matrices. Some practical considerations in nanobioassay design are discussed, and the gaps between research status quo and market demands are identified.

  11. High throughput screening strategies and technology platforms for detection of pathogens: An Introduction

    Science.gov (United States)

    Globally, foodborne pathogens are a major public health concern. In this chapter, we provide a broad description of the problem of food-borne diseases and current and future detection technologies for food safety assurance and prevention of foodborne illnesses. Current detection approaches include s...

  12. Molecular detection and characterization of tick-borne pathogens in dogs and ticks from Nigeria.

    Directory of Open Access Journals (Sweden)

    Joshua Kamani

    Full Text Available BACKGROUND: Only limited information is currently available on the prevalence of vector borne and zoonotic pathogens in dogs and ticks in Nigeria. The aim of this study was to use molecular techniques to detect and characterize vector borne pathogens in dogs and ticks from Nigeria. METHODOLOGY/PRINCIPAL FINDINGS: Blood samples and ticks (Rhipicephalus sanguineus, Rhipicephalus turanicus and Heamaphysalis leachi collected from 181 dogs from Nigeria were molecularly screened for human and animal vector-borne pathogens by PCR and sequencing. DNA of Hepatozoon canis (41.4%, Ehrlichia canis (12.7%, Rickettsia spp. (8.8%, Babesia rossi (6.6%, Anaplasma platys (6.6%, Babesia vogeli (0.6% and Theileria sp. (0.6% was detected in the blood samples. DNA of E. canis (23.7%, H. canis (21.1%, Rickettsia spp. (10.5%, Candidatus Neoehrlichia mikurensis (5.3% and A. platys (1.9% was detected in 258 ticks collected from 42 of the 181 dogs. Co- infections with two pathogens were present in 37% of the dogs examined and one dog was co-infected with 3 pathogens. DNA of Rickettsia conorii israelensis was detected in one dog and Rhipicephalus sanguineus tick. DNA of another human pathogen, Candidatus N. mikurensis was detected in Rhipicephalus sanguineus and Heamaphysalis leachi ticks, and is the first description of Candidatus N. mikurensis in Africa. The Theileria sp. DNA detected in a local dog in this study had 98% sequence identity to Theileria ovis from sheep. CONCLUSIONS/SIGNIFICANCE: The results of this study indicate that human and animal pathogens are abundant in dogs and their ticks in Nigeria and portray the potential high risk of human exposure to infection with these agents.

  13. Biocontrol and Rapid Detection of Food-borne Pathogens Using Bacteriophages and Endolysins

    Directory of Open Access Journals (Sweden)

    Jaewoo eBai

    2016-04-01

    Full Text Available Bacteriophages have been suggested as natural food preservatives as well as rapid detection materials for food-borne pathogens in various foods. Since Listeria monocytogenes-targeting phage cocktail (ListShield was approved for applications in foods, numerous phages have been screened and experimentally characterized for phage applications in foods. A single phage and phage cocktail treatments to various foods contaminated with food-borne pathogens including E. coli O157:H7, Salmonella enterica, Campylobacter jejuni, Listeria monocytogenes, Staphylococcus aureus, Cronobacter sakazakii, and Vibrio spp. revealed that they have great potential to control various food-borne pathogens and may be alternative for conventional food preservatives. In addition, phage-derived endolysins with high host specificity and host lysis activities may be preferred to food applications rather than phages. For rapid detection of food-borne pathogens, cell-wall binding domains (CBDs from endolysins have been suggested due to their high host-specific binding. Fluorescence-tagged CBDs have been successfully evaluated and suggested to be alternative materials of expensive antibodies for various detection applications. Most recently, reporter phage systems have been developed and tested to confirm their usability and accuracy for specific detection. These systems revealed some advantages like rapid detection of only viable pathogenic cells without interference by food components in a very short reaction time, suggesting that these systems may be suitable for monitoring of pathogens in foods. Consequently, phage is the next-generation biocontrol agent as well as rapid detection tool to confirm and even identify the food-borne pathogens present in various foods.

  14. Biocontrol and Rapid Detection of Food-Borne Pathogens Using Bacteriophages and Endolysins.

    Science.gov (United States)

    Bai, Jaewoo; Kim, You-Tae; Ryu, Sangryeol; Lee, Ju-Hoon

    2016-01-01

    Bacteriophages have been suggested as natural food preservatives as well as rapid detection materials for food-borne pathogens in various foods. Since Listeria monocytogenes-targeting phage cocktail (ListShield) was approved for applications in foods, numerous phages have been screened and experimentally characterized for phage applications in foods. A single phage and phage cocktail treatments to various foods contaminated with food-borne pathogens including E. coli O157:H7, Salmonella enterica, Campylobacter jejuni, Listeria monocytogenes, Staphylococcus aureus, Cronobacter sakazakii, and Vibrio spp. revealed that they have great potential to control various food-borne pathogens and may be alternative for conventional food preservatives. In addition, phage-derived endolysins with high host specificity and host lysis activities may be preferred to food applications rather than phages. For rapid detection of food-borne pathogens, cell-wall binding domains (CBDs) from endolysins have been suggested due to their high host-specific binding. Fluorescence-tagged CBDs have been successfully evaluated and suggested to be alternative materials of expensive antibodies for various detection applications. Most recently, reporter phage systems have been developed and tested to confirm their usability and accuracy for specific detection. These systems revealed some advantages like rapid detection of only viable pathogenic cells without interference by food components in a very short reaction time, suggesting that these systems may be suitable for monitoring of pathogens in foods. Consequently, phage is the next-generation biocontrol agent as well as rapid detection tool to confirm and even identify the food-borne pathogens present in various foods.

  15. Maximizing the chances of detecting pathogenic leptospires in mammals

    DEFF Research Database (Denmark)

    Tulsiani, Suhella; Graham, G C; Dohnt, M F

    2011-01-01

    of these studies have now been carefully analysed in attempts to see which method of detection and type of test sample were best. The effects of pentobarbitone sodium used to euthanize wild mammals before collection of necropsy samples, on the survival and detection of leptospires in vitro, were also explored...... agreed fairly well with those of the PCR-based investigation of such tissue, with a Cohen's unweighted kappa coefficient (κ) of 0.5 (P = 0.04). The levels of agreement between other pairs of tests were generally poor. The presence of pentobarbitone sodium, at final concentrations of 27.8 or 167 mg...

  16. DETECTION OF PATHOGENS CAUSING GENITAL ULCER DISEASE BY MULTIPLEX POLYMERASE CHAIN REACTION

    Institute of Scientific and Technical Information of China (English)

    Ai-ying Liu; Ming-jun Jiang; Yue-ping Yin; Jiang-fang Sun

    2005-01-01

    Objective To establish a multiplex polymerase chain reaction (M-PCR) assay for simultaneous detection of pathogens causing genital ulcer disease (GUD).Methods Based on the gene-specific region of the following pathogens: Chlamydia trachomatis ompl/ompb, herpes simplex virus (HSV) DNA polymerase, Treponema pallidum tpp47, Haemophilus ducreyi 16s rRNA, four sets of primers were designed and an M-PCR assay was developed to detect four pathogens in one test. The assay was evaluated with diagnostic result of golden standard for each pathogen.Results Of the 51 clinical samples, M-PCR showed slightly higher positive rate (47.1%) of HSV than cell culture (23.6%).Meanwhile, the positive rate of T. p allidum detected by M-PCR and dark-field microscopy was 19.6% ( 10/51) and 15.7% (8/51),respectively. Only one sample was positive for H. ducreyiand no sample was positive for C. trachomatis detected by both M-PCR assay and culture.Conclusion This primary study indicated that M-PCR assay can simultaneously and rapidly detect the four etiologic pathogens causing GUD.

  17. Centrifugal loop-mediated isothermal amplification microdevice for rapid, multiplex and colorimetric foodborne pathogen detection.

    Science.gov (United States)

    Oh, Seung Jun; Park, Byung Hyun; Jung, Jae Hwan; Choi, Goro; Lee, Doh C; Kim, Do Hyun; Seo, Tae Seok

    2016-01-15

    We present a centrifugal microfluidic device which enables multiplex foodborne pathogen identification by loop-mediated isothermal amplification (LAMP) and colorimetric detection using Eriochrome Black T (EBT). Five identical structures were designed in the centrifugal microfluidic system to perform the genetic analysis of 25 pathogen samples in a high-throughput manner. The sequential loading and aliquoting of the LAMP cocktail, the primer mixtures, and the DNA sample solutions were accomplished by the optimized zigzag-shaped microchannels and RPM control. We targeted three kinds of pathogenic bacteria (Escherichia coli O157:H7, Salmonella typhimurium and Vibrio parahaemolyticus) and detected the amplicons of the LAMP reaction by the EBT-mediated colorimetric method. For the limit-of-detection (LOD) test, we carried out the LAMP reaction on a chip with serially diluted DNA templates of E. coli O157:H7, and could observe the color change with 380 copies. The used primer sets in the LAMP reaction were specific only to the genomic DNA of E. coli O157:H7, enabling the on-chip selective, sensitive, and high-throughput pathogen identification with the naked eyes. The entire process was completed in 60min. Since the proposed microsystem does not require any bulky and expensive instrumentation for end-point detection, our microdevice would be adequate for point-of-care (POC) testing with high simplicity and high speed, providing an advanced genetic analysis microsystem for foodborne pathogen detection.

  18. Flash 3D Enhancements for Autonomous Precision Landing and Hazard Detection and Avoidance Project

    Data.gov (United States)

    National Aeronautics and Space Administration — With NASA's exploration initiative to return to Lunar Exploration and eventual human exploration of Mars, NASA has an increased need for advanced Autonomous...

  19. Multiplex Polymerase Chain Reaction for Detection of Gastrointestinal Pathogens in Migrant Workers in Qatar.

    Science.gov (United States)

    Humphrey, John M; Ranbhise, Sanjay; Ibrahim, Emad; Al-Romaihi, Hamad E; Farag, Elmoubasher; Abu-Raddad, Laith J; Glesby, Marshall J

    2016-12-07

    The causes of infectious diarrhea among the migrant worker population in Qatar are not well understood. We conducted a prospective observational study to understand the demographic and clinical characteristics and infectious causes of diarrhea among migrant workers in Doha, Qatar. A total of 126 male workers presenting to the Qatar Red Crescent Worker's Health Center outpatient clinic or emergency department were studied over a 5-month period in 2015-2016. Epidemiologic surveys were administered to all subjects and the prevalence of 22 different stool pathogens was determined using multiplex polymerase chain reaction (PCR) (FilmArray(®) Gastrointestinal PCR). A target pathogen was identified in 62.7% of subjects. Enteropathogenic Escherichia coli was the most prevalent pathogen and was detected in 24.6% of subjects, followed by Salmonella (22.2%), enteroaggregative E. coli (15.1%), Giardia lamblia (9.5%), and enterotoxigenic E. coli (8.7%). Multiple pathogens were identified in 49.3% of positive stool samples. In a multivariable analysis, the presence of a heart rate ≥ 90 (adjusted odds ratio [OR] = 3.7, 95% confidence interval [CI] = 1.4-10.0) and > 5 fecal leukocytes/high-power field (adjusted OR = 2.8, 95% CI = 1.2-7.0) were significant predictors of detecting an acute inflammatory pathogen by PCR. Use of multiplex PCR enabled the detection of gastrointestinal pathogens in a high proportion of cases, illustrating the utility of this diagnostic tool in epidemiologic studies of infectious diarrhea.

  20. Molecular Detection of Foodborne Pathogens: A Rapid and Accurate Answer to Food Safety.

    Science.gov (United States)

    Mangal, Manisha; Bansal, Sangita; Sharma, Satish K; Gupta, Ram K

    2016-07-03

    Food safety is a global health concern. For the prevention and recognition of problems related to health and safety, detection of foodborne pathogen is of utmost importance at all levels of food production chain. For several decades, a lot of research has been targeted at the development of rapid methodology as reducing the time needed to complete pathogen detection tests has been the primary goal of food microbiologists. With the result, food microbiology laboratories now have a wide array of detection methods and automated technologies such as enzyme immunoassay, polymerase chain reaction, and microarrays, which can cut test times considerably. Nucleic acid amplification strategies and advances in amplicon detection methodologies have been the key factors in the progress of molecular microbiology. A comprehensive literature survey has been carried out to give an overview in the field of foodborne pathogen detection. In this paper, we describe the conventional methods, as well as recent developments in food pathogen detection, identification, and quantification, with a major emphasis on molecular detection methods.

  1. Recent advances in bacteriophage based biosensors for food-borne pathogen detection.

    Science.gov (United States)

    Singh, Amit; Poshtiban, Somayyeh; Evoy, Stephane

    2013-01-30

    Foodborne diseases are a major health concern that can have severe impact on society and can add tremendous financial burden to our health care systems. Rapid early detection of food contamination is therefore relevant for the containment of food-borne pathogens. Conventional pathogen detection methods, such as microbiological and biochemical identification are time-consuming and laborious, while immunological or nucleic acid-based techniques require extensive sample preparation and are not amenable to miniaturization for on-site detection. Biosensors have shown tremendous promise to overcome these limitations and are being aggressively studied to provide rapid, reliable and sensitive detection platforms for such applications. Novel biological recognition elements are studied to improve the selectivity and facilitate integration on the transduction platform for sensitive detection. Bacteriophages are one such unique biological entity that show excellent host selectivity and have been actively used as recognition probes for pathogen detection. This review summarizes the extensive literature search on the application of bacteriophages (and recently their receptor binding proteins) as probes for sensitive and selective detection of foodborne pathogens, and critically outlines their advantages and disadvantages over other recognition elements.

  2. Recent Advances in Bacteriophage Based Biosensors for Food-Borne Pathogen Detection

    Directory of Open Access Journals (Sweden)

    Somayyeh Poshtiban

    2013-01-01

    Full Text Available Foodborne diseases are a major health concern that can have severe impact on society and can add tremendous financial burden to our health care systems. Rapid early detection of food contamination is therefore relevant for the containment of food-borne pathogens. Conventional pathogen detection methods, such as microbiological and biochemical identification are time-consuming and laborious, while immunological or nucleic acid-based techniques require extensive sample preparation and are not amenable to miniaturization for on-site detection. Biosensors have shown tremendous promise to overcome these limitations and are being aggressively studied to provide rapid, reliable and sensitive detection platforms for such applications. Novel biological recognition elements are studied to improve the selectivity and facilitate integration on the transduction platform for sensitive detection. Bacteriophages are one such unique biological entity that show excellent host selectivity and have been actively used as recognition probes for pathogen detection. This review summarizes the extensive literature search on the application of bacteriophages (and recently their receptor binding proteins as probes for sensitive and selective detection of foodborne pathogens, and critically outlines their advantages and disadvantages over other recognition elements.

  3. Evaluation of 3M Molecular Detection System and ANSR Pathogen Detection System for rapid detection of Salmonella from egg products.

    Science.gov (United States)

    Hu, L; Ma, L M; Zheng, S; He, X; Wang, H; Brown, E W; Hammack, T S; Zhang, G

    2016-11-02

    Isothermal amplification assay is a novel simple detection technology that amplifies DNA with high speed, efficiency, and specificity under isothermal conditions. The objective of this study was to evaluate the effectiveness of the 3M Molecular Detection System (MDS) and ANSR Pathogen Detection System (PDS) for the detection of Salmonella in egg products as compared to the Food and Drug Administration's Bacteriological Analytical Manual (BAM) culture method and a modified culture method (3M MDS and ANSR PDS preferred method). Two Salmonella ser. Enteritidis (18579, PT4; CDC_2010K_1441, PT8), one Salmonella ser. Heidelberg (607310-1), and one Salmonella ser. Typhimurium (0723) isolates were used in this study. Seven wet egg products and 13 dry egg products were inoculated with these strains individually at 1 to 5 CFU/25 g. One set of test portions was prepared following FDA BAM procedures [with lactose broth (LB) as pre-enrichment broth]. Another set of test portions was prepared using buffered peptone water (BPW) as pre-enrichment broth, as instructed by the 2 detection systems. Results from 3M MDS and ANSR PDS were 100% in agreement with their BPW-based culture method results. When LB was used as pre-enrichment broth, the number of Salmonella positive test portions (80 tested), identified with the BAM, 3M MDS, and ANSR PDS, were 63, 61, and 60, respectively. In conclusion, both 3M MDS and ANSR PDS Salmonella assays were as effective as their BPW based culture methods and were equivalent to the BAM culture method for the detection of Salmonella in egg products. These sensitive isothermal assays can be used as rapid detection tools for Salmonella in egg products provided that BPW is used as pre-enrichment broth.

  4. Detection of pathogenic Vibrio parahaemolyticus in Butrinti Lagoon shellfish

    Directory of Open Access Journals (Sweden)

    FATMIRA SHEHU

    2014-06-01

    Full Text Available Given the considerable public health implications, monitoring of V. parahaemolyticus in shellfish is crucial. The 50 shellfish samples from Butrinti Lagoon showed bacteriological parameters, Salmonella and E. coli, according to Commission Regulation EC No. 2073/2005 on microbiological criteria for foodstuffs. In particular, Salmonella was absent in 25 g and E. coli less 230/100 g of flesh and intra-valvular liquid. The PCRs performed on enrichment broth from each sample gave positive results for V. parahaemolyticus in 45/50 shellfish samples. The TDH virulence factor was detected in 15/45 samples only, whereas TRH factor was not highlighted at all. The results confirmed the need for a specific shellfish inspection plan to detect the presence of Vibrio species and viruses in order to eliminate public health risks associated with shellfish consumption

  5. Development of a Multiplex PCR Method to Detect Fungal Pathogens for Quarantine on Exported Cacti

    Directory of Open Access Journals (Sweden)

    Hyun ji Cho

    2016-02-01

    Full Text Available Major diseases in grafted cacti have been reported and Fusarium oxysporum, Bipolaris cactivora, Phytophthora spp. and Collectotrichum spp. are known as causal pathogens. These pathogens can lead to plant death after infection. Therefore, some European countries have quarantined imported cacti that are infected with specific fungal pathogens. Consequently, we developed PCR detection methods to identify four quarantined fungal pathogens and reduce export rejection rates of Korean grafted cacti. The pathogen specific primer sets F.oF-F.oR, B.CF-B.CR, P.nF-P.nR, and P.cF-P.CR were tested for F. oxysporum, B. cactivora, P. nicotinae, and P. cactorum, respectively. The F.oF-F.oR primer set was designed from the Fusarium ITS region; the B.CF-B.CR and P.nF-P.nR primers respectively from Bipolaris and Phytophthora ITS1; and the P.cF-P.CR primer set from the Ypt1protein gene region. The quarantine fungal pathogen primer pairs were amplified to the specific number of base pairs in each of the following fungal pathogens: 210-bp (F. oxysporum, 510-bp (B. cactivora, 313-bp (P. nicotinae, and 447-bp (P. cactorum. The detection limit for the mono- and multiplex PCR primer sets was 0.1 ng of template DNA under in vitro conditions. Therefore, each primer set successfully diagnosed contamination of quarantine pathogens in export grafted cacti. Consequently, our methodology is a viable tool to screen contamination of the fungal pathogen in exported grafted cacti.

  6. Development of a Multiplex PCR Method to Detect Fungal Pathogens for Quarantine on Exported Cacti.

    Science.gov (United States)

    Cho, Hyun Ji; Hong, Seong Won; Kim, Hyun-Ju; Kwak, Youn-Sig

    2016-02-01

    Major diseases in grafted cacti have been reported and Fusarium oxysporum, Bipolaris cactivora, Phytophthora spp. and Collectotrichum spp. are known as causal pathogens. These pathogens can lead to plant death after infection. Therefore, some European countries have quarantined imported cacti that are infected with specific fungal pathogens. Consequently, we developed PCR detection methods to identify four quarantined fungal pathogens and reduce export rejection rates of Korean grafted cacti. The pathogen specific primer sets F.oF-F.oR, B.CF-B.CR, P.nF-P.nR, and P.cF-P.CR were tested for F. oxysporum, B. cactivora, P. nicotinae, and P. cactorum, respectively. The F.oF-F.oR primer set was designed from the Fusarium ITS region; the B.CF-B.CR and P.nF-P.nR primers respectively from Bipolaris and Phytophthora ITS1; and the P.cF-P.CR primer set from the Ypt1protein gene region. The quarantine fungal pathogen primer pairs were amplified to the specific number of base pairs in each of the following fungal pathogens: 210-bp (F. oxysporum), 510-bp (B. cactivora), 313-bp (P. nicotinae), and 447-bp (P. cactorum). The detection limit for the mono- and multiplex PCR primer sets was 0.1 ng of template DNA under in vitro conditions. Therefore, each primer set successfully diagnosed contamination of quarantine pathogens in export grafted cacti. Consequently, our methodology is a viable tool to screen contamination of the fungal pathogen in exported grafted cacti.

  7. Development of a Multiplex PCR Method to Detect Fungal Pathogens for Quarantine on Exported Cacti

    Science.gov (United States)

    Cho, Hyun ji; Hong, Seong Won; Kim, Hyun-ju; Kwak, Youn-Sig

    2016-01-01

    Major diseases in grafted cacti have been reported and Fusarium oxysporum, Bipolaris cactivora, Phytophthora spp. and Collectotrichum spp. are known as causal pathogens. These pathogens can lead to plant death after infection. Therefore, some European countries have quarantined imported cacti that are infected with specific fungal pathogens. Consequently, we developed PCR detection methods to identify four quarantined fungal pathogens and reduce export rejection rates of Korean grafted cacti. The pathogen specific primer sets F.oF-F.oR, B.CF-B.CR, P.nF-P.nR, and P.cF-P.CR were tested for F. oxysporum, B. cactivora, P. nicotinae, and P. cactorum, respectively. The F.oF-F.oR primer set was designed from the Fusarium ITS region; the B.CF-B.CR and P.nF-P.nR primers respectively from Bipolaris and Phytophthora ITS1; and the P.cF-P.CR primer set from the Ypt1protein gene region. The quarantine fungal pathogen primer pairs were amplified to the specific number of base pairs in each of the following fungal pathogens: 210-bp (F. oxysporum), 510-bp (B. cactivora), 313-bp (P. nicotinae), and 447-bp (P. cactorum). The detection limit for the mono- and multiplex PCR primer sets was 0.1 ng of template DNA under in vitro conditions. Therefore, each primer set successfully diagnosed contamination of quarantine pathogens in export grafted cacti. Consequently, our methodology is a viable tool to screen contamination of the fungal pathogen in exported grafted cacti. PMID:26889115

  8. Molecular versus conventional culture for detection of respiratory bacterial pathogens in poultry.

    Science.gov (United States)

    Ammar, A M; Abd El-Aziz, N K; Abd El Wanis, S; Bakry, N R

    2016-02-29

    Acute respiratory tract infections are leading causes of morbidity in poultry farms allover the world. Six pathogens; Escherichia coli, Mycoplasma gallisepticum, Staphylococcus aureus, Pasteurella multocida, Mannheimia haemolytica and Pseudomonas aeruginosa were involved in respiratory infections in poultry. Herein, conventional identification procedures and polymerase chain reaction (PCR) were applied for detection of the most common respiratory bacterial pathogens in clinical specimens of poultry obtained from 53 Egyptian farms with various respiratory problems and the results were compared statistically. The analyzed data demonstrated a significantly higher rate of detection of the most recovered microorganisms (Ppoultry farms were E. coli and Ps. aeruginosa (54.71% each), followed by M. haemolylica (35.85%) and M. gallisepticum (20.75%). In conclusion, PCR assay offered an effective alternative to traditional typing methods for the identification and simultaneous detection of the most clinically relevant respiratory pathogens in poultry.

  9. Molecular detection of plant pathogenic bacteria using polymerase chain reaction single-strand conformation polymorphism.

    Science.gov (United States)

    Srinivasa, Chandrashekar; Sharanaiah, Umesha; Shivamallu, Chandan

    2012-03-01

    The application of polymerase chain reaction (PCR) technology to molecular diagnostics holds great promise for the early identification of agriculturally important plant pathogens. Ralstonia solanacearum, Xanthomoans axonopodis pv. vesicatoria, and Xanthomonas oryzae pv. oryzae are phytopathogenic bacteria, which can infect vegetables, cause severe yield loss. PCR-single-strand conformation polymorphism (PCR-SSCP) is a simple and powerful technique for identifying sequence changes in amplified DNA. The technique of PCR-SSCP is being exploited so far, only to detect and diagnose human bacterial pathogens in addition to plant pathogenic fungi. Selective media and serology are the commonly used methods for the detection of plant pathogens in infected plant materials. In this study, we developed PCR-SSCP technique to identify phytopathogenic bacteria. The PCR product was denatured and separated on a non-denaturing polyacrylamide gel. SSCP banding patterns were detected by silver staining of nucleic acids. We tested over 56 isolates of R. solanacearum, 44 isolates of X. axonopodis pv. vesicatoria, and 20 isolates of X. oryzae pv. oryzae. With the use of universal primer 16S rRNA, we could discriminate such species at the genus and species levels. Species-specific patterns were obtained for bacteria R. solanacearum, X. axonopodis pv. vesicatoria, and X. oryzae pv. oryzae. The potential use of PCR-SSCP technique for the detection and diagnosis of phytobacterial pathogens is discussed in the present paper.

  10. Molecular detection of plant pathogenic bacteria using polymerase chain reaction single-strand conformation polymorphism

    Institute of Scientific and Technical Information of China (English)

    Chandrashekar Srinivasa; Umesha Sharanaiah; Chandan Shivamallu

    2012-01-01

    The application of polymerase chain reaction (PCR) technology to molecular diagnostics holds great promise for the early identification of agriculturally important plant pathogens.Ralstonia solanacearum,Xanthomoans axonopodis pv.vesicatoria,and Xanthomonas oryzae pv.oryzae are phytopathogenic bacteria,which can infect vegetables,cause severe yield loss.PCR-single-strand conformation polymorphism (PCR-SSCP) is a simple and powerful technique for identifying sequence changes in amplified DNA.The technique of PCR-SSCP is being exploited so far,only to detect and diagnose human bacterial pathogens in addition to plant pathogenic fungi.Selective media and serology are the commonly used methods for the detection of plant pathogens in infected plant materials.In this study,we developed PCR-SSCP technique to identify phytopathogenic bacteria.The PCR product was denatured and separated on a non-denaturing polyacrylamide gel.SSCP banding patterns were detected by silver staining of nucleic acids.We tested over 56 isolates of R. solanacearum,44 isolates of X. axonopodis pv.vesicatoria,and 20 isolates of X.oryzae pv.oryzae.With the use of universal primer 16S rRNA,we could discriminate such species at the genus and species levels.Speciesspecific patterns were obtained for bacteria R.solanacearum,X.axonopodis pv.vesicatoria,and X.oryzae pv.oryzae.The potential use of PCR-SSCP technique for the detection and diagnosis of phytobacterial pathogens is discussed in the present paper.

  11. Comparing Luminex NxTAG-Respiratory Pathogen Panel and RespiFinder-22 for multiplex detection of respiratory pathogens.

    Science.gov (United States)

    Beckmann, Christiane; Hirsch, Hans H

    2016-08-01

    Respiratory tract infection (RTI) involves a variety of viruses and bacteria, which can be conveniently detected by multiplex nucleic acid amplification testing (NAT). To compare the novel Luminex-based NxTAG-Respiratory Pathogen Panel (NxTAG-RPP) with the routine multiplex-ligation-NAT based RespiFinder-22® (RF-22), 282 respiratory specimens including nasopharyngeal swabs (71%), broncho-alveolar lavage (27%), throat swabs, tracheal secretions, and sputum (2%) from 116 children and 155 adults were extracted using a Corbett CAS1200 (Qiagen), and analyzed in parallel by the routine RF-22 and NxTAG-RPP. Concordant results were obtained in 263 (93.3%) cases consisting of concordant positives in 167 (59.2%) and concordant negatives in 96 (34%). Results were discordant in 19 (6.7%) consisting of 15 positive:negative, and 4 negative:positive results by NxTAG-RPP versus RF-22, respectively. Co-infections were observed in 10.3% with NxTAG-RPP and in 5.9% with RF-22. Most additional viral pathogens identified by the NxTAG-RPP involved dual infections with rhinovirus and RSV. Discordant samples were mainly due to low genome signals of Ct less than 36, when retested by QNAT suggesting a higher sensitivity of the NxTAG-RPP, also when detecting multiple infections. Hands-on time after extraction for 24 and 96 samples was 0.25 and <0.5 hr for the NxTAG-RPP, and 2 and 4 hr for the RF-22, respectively. The median turn-around time was 6 hr (range 5-7 hr) for NxTAG-RPP and 12 hr (range 8-16 hr) for RF-22. The NxTAG-RPP showed comparable detection rates for most respiratory pathogens, while hands-on and turn-around time were considerably shorter. The clinical significance of detecting multiple viruses needs further clinical evaluation. J. Med. Virol. 88:1319-1324, 2016. © 2016 Wiley Periodicals, Inc.

  12. Bacterial contamination of platelet concentrates: pathogen detection and inactivation methods

    Directory of Open Access Journals (Sweden)

    Dana Védy

    2009-04-01

    Full Text Available Whereas the reduction of transfusion related viral transmission has been a priority during the last decade, bacterial infection transmitted by transfusion still remains associated to a high morbidity and mortality, and constitutes the most frequent infectious risk of transfusion. This problem especially concerns platelet concentrates because of their favorable bacterial growth conditions. This review gives an overview of platelet transfusion-related bacterial contamination as well as on the different strategies to reduce this problem by using either bacterial detection or inactivation methods.

  13. The development of a real-time PCR to detect pathogenic Leptospira species in kidney tissue.

    Science.gov (United States)

    Fearnley, C; Wakeley, P R; Gallego-Beltran, J; Dalley, C; Williamson, S; Gaudie, C; Woodward, M J

    2008-08-01

    A LightCycler real-time PCR hybridization probe-based assay that detects a conserved region of the16S rRNA gene of pathogenic but not saprophytic Leptospira species was developed for the rapid detection of pathogenic leptospires directly from processed tissue samples. In addition, a differential PCR specific for saprophytic leptospires and a control PCR targeting the porcine beta-actin gene were developed. To assess the suitability of these PCR methods for diagnosis, a trial was performed on kidneys taken from adult pigs with evidence of leptospiral infection, primarily a history of reproductive disease and serological evidence of exposure to pathogenic leptospires (n=180) and aborted pig foetuses (n=24). Leptospire DNA was detected by the 'pathogenic' specific PCR in 25 tissues (14%) and the control beta-actin PCR was positive in all 204 samples confirming DNA was extracted from all samples. No leptospires were isolated from these samples by culture and no positives were detected with the 'saprophytic' PCR. In a subsidiary experiment, the 'pathogenic' PCR was used to analyse kidney samples from rodents (n=7) collected as part of vermin control in a zoo, with show animals with high microagglutination titres to Leptospira species, and five were positive. Fifteen PCR amplicons from 1 mouse, 2 rat and 14 pig kidney samples, were selected at random from positive PCRs (n=30) and sequenced. Sequence data indicated L. interrogans DNA in the pig and rat samples and L. inadai DNA, which is considered of intermediate pathogenicity, in the mouse sample. The only successful culture was from this mouse kidney and the isolate was confirmed to be L. inadai by classical serology. These data suggest this suite of PCRs is suitable for testing for the presence of pathogenic leptospires in pig herds where abortions and infertility occur and potentially in other animals such as rodents.

  14. Application of Geologic Mapping Techniques and Autonomous Feature Detection to Future Exploration of Europa

    Science.gov (United States)

    Bunte, M. K.; Tanaka, K. L.; Doggett, T.; Figueredo, P. H.; Lin, Y.; Greeley, R.; Saripalli, S.; Bell, J. F.

    2013-12-01

    disrupted surface morphologies. Areas of high interest include lineaments and chaos margins. The limitations on detecting activity at these locations are approximated by studying similar observed conditions on other bodies. By adapting machine learning and data mining techniques to signatures of plumes and morphology, I have demonstrated autonomous rule-based detection of known features using edge-detection and supervised classification methods. These methods successfully detect ≤94% of known volcanic plumes or jets at Io, Enceladus, and comets. They also allow recognition of multiple feature types. Applying these results to conditions expected for Europa enables a prediction of the potential for detection of similar features and enables recommendations for mission concepts to increase the science return and efficiency of future missions to observe Europa. This post-Galileo view of Europa provides a synthesis of the overall history of this unique icy satellite and will be a useful frame of reference for future exploration of the jovian system and other potentially active outer solar system bodies.

  15. Standardization of diagnostic PCR for the detection of foodborne pathogens

    DEFF Research Database (Denmark)

    Malorny, B.; Tassios, P.T.; Radstrom, P.;

    2003-01-01

    In vitro amplification of nucleic acids using the polymerase chain reaction (PCR) has become, since its discovery in the 1980s, a powerful diagnostic tool for the analysis of microbial infections as well as for the analysis of microorganisms in food samples. However, despite its potential, PCR has...... neither gained wide acceptance in routine diagnostics nor been widely incorporated in standardized methods. Lack of validation and standard protocols, as well as variable quality of reagents and equipment, influence the efficient dissemination of PCR methodology from expert research laboratories to end......-user laboratories. Moreover, the food industry understandably requires and expects officially approved standards. Recognizing this, in 1999, the European Commission approved the research project, FOOD-PCR (http://www.PCR.dk), which aims to validate and standardize the use of diagnostic PCR for the detection...

  16. Strategies for the detection of food pathogens and contaminants

    DEFF Research Database (Denmark)

    Hearty, Stephen; Leonard, Paul; Sheehan, Alfredo Darmanin;

    We routinely use Biacore for affinity ranking and kinetic characterisation of diverse panels of hybridoma-derived and recombinant antibodies against a wide range of different clinically relevant antigens for diagnostic applications. Generally the analytes of interest are haptens or defined protei...... to date with using Biacore for analysis of food contaminants and in particular the challenges associated with large analyte detection......We routinely use Biacore for affinity ranking and kinetic characterisation of diverse panels of hybridoma-derived and recombinant antibodies against a wide range of different clinically relevant antigens for diagnostic applications. Generally the analytes of interest are haptens or defined protein...... molecules and once suitably high affinity antibodies have been isolated, it is relatively straightforward to design and optimise concentration-based assays using SPR. Recently we have investigated the potential of applying Biacore technology to routine food analysis. Our experiences have shown...

  17. Rapid detection of intestinal pathogens in fecal samples by an improved reverse dot blot method

    Institute of Scientific and Technical Information of China (English)

    Jian-Ming Xing; Su Zhang; Ying Du; Dan Bi; Li-Hui Yao

    2009-01-01

    AIM:To develop a new, rapid and accurate reverse dot blot (RDB) method for the detection of intestinal pathogens in fecal samples.METHODS:The 12 intestinal pathogens tested were Salmonella spp., Brucella spp., Escherichia coli O157:H7,Clostridium botulinum, Bacillus cereus,Clostridium perfringens, Vibrio parahaemolyticus,Shigella spp., Yersinia enterocolitica, Vibrio cholerae,Listeria monocytogenes and Staphylococcus aureus.The two universal primers were designed to amplify two variable regions of bacterial 16S and 23S rDNA genes from all of the 12 bacterial species tested. Five hundred and forty fecal samples from the diarrhea patients were detected using the improved RDB assay.RESULTS:The methods could identify the 12 intestinal pathogens specifically, and the detection limit was as low as 103 CFUs. The consistent detection rate of the improved RDB assay compared with the traditional culture method was up to 88.75%.CONCLUSION:The hybridization results indicated that the improved RDB assay developed was a reliable method for the detection of intestinal pathogen in fecal samples.

  18. Molecular detection of avian pathogens in poultry red mite (Dermanyssus gallinae) collected in chicken farms.

    Science.gov (United States)

    Huong, Chu Thi Thanh; Murano, Takako; Uno, Yukiko; Usui, Tatsufumi; Yamaguchi, Tsuyoshi

    2014-12-01

    Poultry red mite (PRM, Dermanyssus gallinae) is a blood-sucking ectoparasite as well as a possible vector of several avian pathogens. In this study, to define the role of PRM in the prevalence of avian infectious agents, we used polymerase chain reaction (PCR) to check for the presence of seven pathogens: Avipox virus (APV), Fowl Adenovirus (FAdV), Marek's disease virus (MDV), Erysipelothrix rhusiopathiae (ER), Salmonella enterica (SE), Mycoplasma synoviae (MS) and Mycoplasma gallisepticum (MG). A total of 159 PRM samples collected between 2004 and 2012 from 142 chicken farms in 38 prefectures in Japan were examined. APV DNA was detected in 22 samples (13.8%), 19 of which were wild-type APV. 16S ribosomal RNA (16S rRNA) of MS was detected in 15 samples (9.4%), and the mgc2 gene of MG was detected in 2 samples (1.3%). Eight of 15 MS 16S rRNA sequences differed from the vaccine sequence, indicating they were wild-type strains, while both of the MG mgc2 gene sequences detected were identical to the vaccine sequences. Of these avian pathogen-positive mite samples, three were positive for both wild-types of APV and MS. On the other hand, the DNAs of ER, SE, FAdV and MDV were not detected in any samples. These findings indicated that PRM can harbor the wild-type pathogens and might play a role as a vector in spreading these diseases in farms.

  19. Detection of pathogens in food using a SERS-based assay in just a few hours

    Science.gov (United States)

    Shende, Chetan; Sengupta, Atanu; Huang, Hermes; Farquharson, Stuart

    2014-05-01

    In 2011 Escherichia, Listeria, and Salmonella species infected over 1.2 million people in the United States, resulting in over 23,000 hospitalizations and 650 deaths. In January 2013 President Obama signed into law the Food and Drug Administration (FDA) Food Safety Modernization Act (FSMA), which requires constant microbial testing of food processing equipment and food to minimize contamination and distribution of food tainted with pathogens. The challenge to preventing distribution and consumption of contaminated foods lies in the fact that just a few bacterial cells can rapidly multiply to millions, reaching infectious doses within a few days. Unfortunately, current methods used to detect these few cells rely on similar growth steps to multiply the cells to the point of detection, which also takes a few days. Consequently, there is a critical need for an analyzer that can rapidly extract and detect foodborne pathogens at 1000 colony forming units per gram of food in 1-2 hours (not days), and with a specificity that differentiates from indigenous microflora, so that false alarms are eliminated. In an effort to meet this need, we have been developing an assay that extracts such pathogens from food, selectively binds these pathogens, and produces surface-enhanced Raman spectra (SERS) when read by a Raman analyzer. Here we present SERS measurements of these pathogens in actual food samples using this assay.

  20. Autoimmune autonomic disorders.

    Science.gov (United States)

    Mckeon, Andrew; Benarroch, Eduardo E

    2016-01-01

    Autoimmune autonomic disorders occur because of an immune response directed against sympathetic, parasympathetic, and enteric ganglia, autonomic nerves, or central autonomic pathways. In general, peripheral autoimmune disorders manifest with either generalized or restricted autonomic failure, whereas central autoimmune disorders manifest primarily with autonomic hyperactivity. Some autonomic disorders are generalized, and others are limited in their anatomic extent, e.g., isolated gastrointestinal dysmotility. Historically, these disorders were poorly recognized, and thought to be neurodegenerative. Over the last 20 years a number of autoantibody biomarkers have been discovered that have enabled the identification of certain patients as having an autoimmune basis for either autonomic failure or hyperactivity. Peripheral autoimmune autonomic disorders include autoimmune autonomic ganglionopathy (AAG), paraneoplastic autonomic neuropathy, and acute autonomic and sensory neuropathy. AAG manifests with acute or subacute onset of generalized or selective autonomic failure. Antibody targeting the α3 subunit of the ganglionic-type nicotinic acetylcholine receptor (α3gAChR) is detected in approximately 50% of cases of AAG. Some other disorders are characterized immunologically by paraneoplastic antibodies with a high positive predictive value for cancer, such as antineuronal nuclear antibody, type 1 (ANNA-1: anti-Hu); others still are seronegative. Recognition of an autoimmune basis for autonomic disorders is important, as their manifestations are disabling, may reflect an underlying neoplasm, and have the potential to improve with a combination of symptomatic and immune therapies.

  1. FY05 LDRD Final Report A Computational Design Tool for Microdevices and Components in Pathogen Detection Systems

    Energy Technology Data Exchange (ETDEWEB)

    Trebotich, D

    2006-02-07

    We have developed new algorithms to model complex biological flows in integrated biodetection microdevice components. The proposed work is important because the design strategy for the next-generation Autonomous Pathogen Detection System at LLNL is the microfluidic-based Biobriefcase, being developed under the Chemical and Biological Countermeasures Program in the Homeland Security Organization. This miniaturization strategy introduces a new flow regime to systems where biological flow is already complex and not well understood. Also, design and fabrication of MEMS devices is time-consuming and costly due to the current trial-and-error approach. Furthermore, existing devices, in general, are not optimized. There are several MEMS CAD capabilities currently available, but their computational fluid dynamics modeling capabilities are rudimentary at best. Therefore, we proposed a collaboration to develop computational tools at LLNL which will (1) provide critical understanding of the fundamental flow physics involved in bioMEMS devices, (2) shorten the design and fabrication process, and thus reduce costs, (3) optimize current prototypes and (4) provide a prediction capability for the design of new, more advanced microfluidic systems. Computational expertise was provided by Comp-CASC and UC Davis-DAS. The simulation work was supported by key experiments for guidance and validation at UC Berkeley-BioE.

  2. Bacterial and viral pathogens detected in sea turtles stranded along the coast of Tuscany, Italy.

    Science.gov (United States)

    Fichi, G; Cardeti, G; Cersini, A; Mancusi, C; Guarducci, M; Di Guardo, G; Terracciano, G

    2016-03-15

    During 2014, six loggerhead turtles, Caretta caretta and one green turtle, Chelonia mydas, found stranded on the Tuscany coast of Italy, were examined for the presence of specific bacterial and viral agents, along with their role as carriers of fish and human pathogens. Thirteen different species of bacteria, 10 Gram negative and 3 Gram positive, were identified. Among them, two strains of Vibrio parahaemolyticus and one strain of Lactococcus garviae were recovered and confirmed by specific PCR protocols. No trh and tdh genes were detected in V. parahaemolyticus. The first isolation of L. garviae and the first detection of Betanodavirus in sea turtles indicate the possibility for sea turtles to act as carriers of fish pathogens. Furthermore, the isolation of two strains of V. parahaemolyticus highlights the possible role of these animals in human pathogens' diffusion.

  3. Bacteriophages for detection and control of bacterial pathogens in food and food-processing environment.

    Science.gov (United States)

    Brovko, Lubov Y; Anany, Hany; Griffiths, Mansel W

    2012-01-01

    This chapter presents recent advances in bacteriophage research and their application in the area of food safety. Section 1 describes general facts on phage biology that are relevant to their application for control and detection of bacterial pathogens in food and environmental samples. Section 2 summarizes the recently acquired data on application of bacteriophages to control growth of bacterial pathogens and spoilage organisms in food and food-processing environment. Section 3 deals with application of bacteriophages for detection and identification of bacterial pathogens. Advantages of bacteriophage-based methods are presented and their shortcomings are discussed. The chapter is intended for food scientist and food product developers, and people in food inspection and health agencies with the ultimate goal to attract their attention to the new developing technology that has a tremendous potential in providing means for producing wholesome and safe food.

  4. Efficiency of Airborne Sample Analysis Platform (ASAP) bioaerosol sampler for pathogen detection.

    Science.gov (United States)

    Sharma, Anurag; Clark, Elizabeth; McGlothlin, James D; Mittal, Suresh K

    2015-01-01

    The threat of bioterrorism and pandemics has highlighted the urgency for rapid and reliable bioaerosol detection in different environments. Safeguarding against such threats requires continuous sampling of the ambient air for pathogen detection. In this study we investigated the efficacy of the Airborne Sample Analysis Platform (ASAP) 2800 bioaerosol sampler to collect representative samples of air and identify specific viruses suspended as bioaerosols. To test this concept, we aerosolized an innocuous replication-defective bovine adenovirus serotype 3 (BAdV3) in a controlled laboratory environment. The ASAP efficiently trapped the surrogate virus at 5 × 10(3) plaque-forming units (p.f.u.) [2 × 10(5) genome copy equivalent] concentrations or more resulting in the successful detection of the virus using quantitative PCR. These results support the further development of ASAP for bioaerosol pathogen detection.

  5. Efficiency of Airborne Sample Analysis Platform (ASAP Bioaerosol Sampler for Pathogen Detection

    Directory of Open Access Journals (Sweden)

    Anurag eSharma

    2015-05-01

    Full Text Available The threat of bioterrorism and pandemics has highlighted the urgency for rapid and reliable bioaerosol detection in different environments. Safeguarding against such threats requires continuous sampling of the ambient air for pathogen detection. In this study we investigated the efficacy of the Airborne Sample Analysis Platform (ASAP 2800 bioaerosol sampler to collect representative samples of air and identify specific viruses suspended as bioaerosols. To test this concept, we aerosolized an innocuous replication-defective bovine adenovirus serotype 3 (BAdV3 in a controlled laboratory environment. The ASAP efficiently trapped the surrogate virus at 5×10E3 plaque-forming units (p.f.u. [2×10E5 genome copy equivalent] concentrations or more resulting in the successful detection of the virus using quantitative PCR. These results support the further development of ASAP for bioaerosol pathogen detection.

  6. Electroanalytical Sensors and Devices for Multiplexed Detection of Foodborne Pathogen Microorganisms

    Directory of Open Access Journals (Sweden)

    Susana Campuzano

    2009-07-01

    Full Text Available The detection and identification of pathogen microorganisms still rely on conventional culturing techniques, which are not suitable for on-site monitoring. Therefore, a great research challenge in this field is focused on the need to develop rapid, reliable, specific, and sensitive methods to detect these bacteria at low cost. Moreover, the growing interest in biochip development for large scale screening analysis implies improved miniaturization, reduction of analysis time and cost, and multi-analyte detection, which has nowadays become a crucial challenge. This paper reviews multiplexed foodborne pathogen microorganisms detection methods based on electrochemical sensors incorporating microarrays and other platforms. These devices usually involve antibody-antigen and DNA hybridization specific interactions, although other approaches such as the monitoring of oxygen consumption are also considered.

  7. Electroanalytical sensors and devices for multiplexed detection of foodborne pathogen microorganisms.

    Science.gov (United States)

    Pedrero, María; Campuzano, Susana; Pingarrón, José M

    2009-01-01

    The detection and identification of pathogen microorganisms still rely on conventional culturing techniques, which are not suitable for on-site monitoring. Therefore, a great research challenge in this field is focused on the need to develop rapid, reliable, specific, and sensitive methods to detect these bacteria at low cost. Moreover, the growing interest in biochip development for large scale screening analysis implies improved miniaturization, reduction of analysis time and cost, and multi-analyte detection, which has nowadays become a crucial challenge. This paper reviews multiplexed foodborne pathogen microorganisms detection methods based on electrochemical sensors incorporating microarrays and other platforms. These devices usually involve antibody-antigen and DNA hybridization specific interactions, although other approaches such as the monitoring of oxygen consumption are also considered.

  8. Electroanalytical biosensors and their potential for food pathogen and toxin detection.

    Science.gov (United States)

    Palchetti, Ilaria; Mascini, Marco

    2008-05-01

    The detection and identification of foodborne pathogens continue to rely on conventional culturing techniques. These are very elaborate, time-consuming, and have to be completed in a microbiology laboratory and are therefore not suitable for on-site monitoring. The need for a more rapid, reliable, specific, and sensitive method of detecting a target analyte, at low cost, is the focus of a great deal of research. Biosensor technology has the potential to speed up the detection, increase specificity and sensitivity, enable high-throughput analysis, and to be used for monitoring of critical control points in food production. This article reviews food pathogen detection methods based on electrochemical biosensors, specifically amperometric, potentiometric, and impedimetric biosensors. The underlying principles and application of these biosensors are discussed with special emphasis on new biorecognition elements, nanomaterials, and lab on a chip technology.

  9. Detection of Multiple Pathogenic Species in Saliva Is Associated with Periodontal Infection in Adults▿

    OpenAIRE

    2008-01-01

    We investigated whether certain bacterial species and their combinations in saliva can be used as markers for periodontitis. In 1,198 subjects, the detection of multiple species, rather than the presence of a certain pathogen, in saliva was associated with periodontitis as determined by the number of teeth with deepened periodontal pockets.

  10. Multiplex detection of plant pathogens through the luminex magplex bead system

    NARCIS (Netherlands)

    Vlugt, van der R.A.A.; Raaij, van H.M.G.; Weerdt, de M.; Bergervoet, J.H.W.

    2015-01-01

    Here we describe a versatile multiplex method for both the serological and molecular detection of plant pathogens. The Luminex MagPlex bead system uses small paramagnetic microspheres (“beads”), either coated with specific antibodies or oligonucleotides, which capture respectively viruses and/or bac

  11. 9 CFR 113.37 - Detection of pathogens by the chicken embryo inoculation test.

    Science.gov (United States)

    2010-01-01

    ... embryo inoculation test. 113.37 Section 113.37 Animals and Animal Products ANIMAL AND PLANT HEALTH... VECTORS STANDARD REQUIREMENTS Standard Procedures § 113.37 Detection of pathogens by the chicken embryo...-serum mixture shall be inoculated into each of at least 20 fully susceptible chicken embryos. (1)...

  12. Validation of a multiplex reverse transcriptase PCR ELISA for the detection of 19 respiratory tract pathogens

    NARCIS (Netherlands)

    Puppe, W.; Weigl, J.; Groendahl, B.; Knuf, M.; Rockahr, S.; von Bismarck, P.; Aron, G.; Niesters, H. G. M.; Osterhaus, A. D. M. E.; Schmitt, H. -J.

    2013-01-01

    Introduction Since acute respiratory tract infections inflict a high burden of disease in children worldwide, a multiplex reverse transcription polymerase chain reaction combined with a microwell hybridization assay (m-RT-PCR ELISA) to detect 19 different respiratory pathogens was developed and vali

  13. Improvement of methods for the detection of Gram-negative foodborne pathogens

    NARCIS (Netherlands)

    Margot, H.F.T.

    2016-01-01

    Foodborne diseases are a major source of morbidity and mortality worldwide. In most cases, these diseases are caused by contaminated food products, but transmission can also subsequently occur via person to person contact. The ability to detect the pathogens is an important aspect in the verificatio

  14. Ultrasensitive detection and rapid identification of multiple foodborne pathogens with the naked eyes.

    Science.gov (United States)

    Zhang, Heng; Zhang, Yali; Lin, Yankui; Liang, Tongwen; Chen, Zhihua; Li, Jinfeng; Yue, Zhenfeng; Lv, Jingzhang; Jiang, Qing; Yi, Changqing

    2015-09-15

    In this study, a novel approach for ultrasensitive detection and rapid high-throughput identification of a panel of common foodborne pathogens with the naked eyes is presented. As a proof-of-concept application, a multiple pathogen analysis array is fabricated through immobilizing three specific polyT-capture probes which can respectively recognize rfbE gene (Escherichia coli O157:H7), invA gene (Salmonella enterica), inlA gene (Listeria monocytogenes) on the plastic substrates. PCR has been developed for amplification and labeling target genes of rfbE, invA, inlA with biotin. The biotinated target DNA is then captured onto the surface of plastic strips through specific DNA hybridization. The succeeding staining of biotinated DNA duplexes with avidin-horseradish peroxidise (AV-HRP) and biotinated anti-HRP antibody greatly amplifies the detectable signal through the multiple cycle signal amplification strategy, and thus realizing ultrasensitive and specific detection of the above three pathogens in food samples with the naked eyes. Results showed approximately 5 copies target pathogenic DNA could be detected with the naked eyes. This simple but very efficient colorimetric assay also show excellent anti-interference capability and good stability, and can be readily applied to point-of-care diagnosis.

  15. Identification of pathogenic microbial cells and spores by electrochemical detection on a biochip

    OpenAIRE

    Andresen Heiko; Gabig-Ciminska Magdalena; Albers Joerg; Hintsche Rainer; Enfors Sven-Olof

    2004-01-01

    Abstract Background Bacillus cereus constitutes a significant cause of acute food poisoning in humans. Despite the recent development of different detection methods, new effective control measures and better diagnostic tools are required for quick and reliable detection of pathogenic micro-organisms. Thus, the objective of this study was to determine a simple method for rapid identification of enterotoxic Bacillus strains. Here, a special attention is given to an electrochemical biosensor sin...

  16. Evolution of Drosophila resistance against different pathogens and infection routes entails no detectable maintenance costs.

    Science.gov (United States)

    Faria, Vítor G; Martins, Nelson E; Paulo, Tânia; Teixeira, Luís; Sucena, Élio; Magalhães, Sara

    2015-11-01

    Pathogens exert a strong selective pressure on hosts, entailing host adaptation to infection. This adaptation often affects negatively other fitness-related traits. Such trade-offs may underlie the maintenance of genetic diversity for pathogen resistance. Trade-offs can be tested with experimental evolution of host populations adapting to parasites, using two approaches: (1) measuring changes in immunocompetence in relaxed-selection lines and (2) comparing life-history traits of evolved and control lines in pathogen-free environments. Here, we used both approaches to examine trade-offs in Drosophila melanogaster populations evolving for over 30 generations under infection with Drosophila C Virus or the bacterium Pseudomonas entomophila, the latter through different routes. We find that resistance is maintained after up to 30 generations of relaxed selection. Moreover, no differences in several classical life-history traits between control and evolved populations were found in pathogen-free environments, even under stresses such as desiccation, nutrient limitation, and high densities. Hence, we did not detect any maintenance costs associated with resistance to pathogens. We hypothesize that extremely high selection pressures commonly used lead to the disproportionate expression of costs relative to their actual occurrence in natural systems. Still, the maintenance of genetic variation for pathogen resistance calls for an explanation.

  17. Development of a DNA-based microarray for the detection of zoonotic pathogens in rodent species.

    Science.gov (United States)

    Giles, Timothy; Yon, Lisa; Hannant, Duncan; Barrow, Paul; Abu-Median, Abu-Bakr

    2015-12-01

    The demand for diagnostic tools that allow simultaneous screening of samples for multiple pathogens is increasing because they overcome the limitations of other methods, which can only screen for a single or a few pathogens at a time. Microarrays offer the advantages of being capable to test a large number of samples simultaneously, screening for multiple pathogen types per sample and having comparable sensitivity to existing methods such as PCR. Array design is often considered the most important process in any microarray experiment and can be the deciding factor in the success of a study. There are currently no microarrays for simultaneous detection of rodent-borne pathogens. The aim of this report is to explicate the design, development and evaluation of a microarray platform for use as a screening tool that combines ease of use and rapid identification of a number of rodent-borne pathogens of zoonotic importance. Nucleic acid was amplified by multiplex biotinylation PCR prior to hybridisation onto microarrays. The array sensitivity was comparable to standard PCR, though less sensitive than real-time PCR. The array presented here is a prototype microarray identification system for zoonotic pathogens that can infect rodent species.

  18. Simultaneous, specific and real-time detection of biothreat and frequently encountered food-borne pathogens

    Science.gov (United States)

    Woubit, Abdela Salah; Yehualaeshet, Teshome; Habtemariam, Tsegaye; Samuel, Temesgen

    2012-01-01

    The bacterial genera Escherichia, Salmonella, Shigella, Vibrio, Yersinia and Francisella include important food safety and biothreat agents causing food-related and other human illnesses worldwide. We aimed to develop rapid methods with the capability to simultaneously and differentially detect all six pathogens in one run. Our initial experiments to use previously reported sets of primers revealed non-specificity of some of the sequences when tested against a broader array of pathogens, or proved not optimal for simultaneous detection parameters. By extensive mining of the whole genome and protein databases of diverse closely and distantly related bacterial species and strains, we have identified unique genome regions, which we utilized to develop a detection platform. Twelve of the specific genomic targets we have identified to design the primers in F. tularensis ssp. tularensis, F. tularensis ssp. novicida, S. dysentriae, S. typhimurium, V. cholera, Y. pestis, and Y. pseudotuberculosis contained either hypothetical or putative proteins, the functions of which have not been clearly defined. Corresponding primer sets were designed from the target regions for use in real-time PCR assays to detect specific biothreat pathogens at species or strain levels. The primer sets were first tested by in-silico PCR against whole genome sequences of different species, sub-species, or strains and then by in vitro PCR against genomic DNA preparations from 23 strains representing six biothreat agents (E.coli O157:H7 strain EDL 933, Shigella dysentriae, Salmonella typhi, Francisella tularensis ssp. tularensis, Vibrio cholera, and Yersinia pestis) and six foodborne pathogens (Salmonella typhimurium, Salmonella saintpaul, Shigella sonnei, Francisella novicida, Vibrio parahemolytica and Yersinia pseudotuberculosis). Each pathogen was specifically identifiable at the genus and species levels. Sensitivity assays performed using purified DNA showed the lowest detection limit of 640 fg

  19. Bioelectronic DNA detection of human papillomaviruses using eSensor™: a model system for detection of multiple pathogens

    Directory of Open Access Journals (Sweden)

    Miller Donna L

    2003-06-01

    Full Text Available Abstract Background We used human papillomaviruses (HPV as a model system to evaluate the utility of a nucleic acid, hybridization-based bioelectronic DNA detection platform (eSensor™ in identifying multiple pathogens. Methods Two chips were spotted with capture probes consisting of DNA oligonucleotide sequences specific for HPV types. Electrically conductive signal probes were synthesized to be complementary to a distinct region of the amplified HPV target DNA. A portion of the HPV L1 region that was amplified by using consensus primers served as target DNA. The amplified target was mixed with a cocktail of signal probes and added to a cartridge containing a DNA chip to allow for hybridization with complementary capture probes. Results Two bioelectric chips were designed and successfully detected 86% of the HPV types contained in clinical samples. Conclusions This model system demonstrates the potential of the eSensor platform for rapid and integrated detection of multiple pathogens.

  20. Rapid Detection and Identification of Infectious Pathogens Based on High-throughput Sequencing

    Institute of Scientific and Technical Information of China (English)

    Pei-Xiang Ni; Xin Ding; Yin-Xin Zhang; Xue Yao; Rui-Xue Sun; Peng Wang; Yan-Ping Gong

    2015-01-01

    Background:The dilemma of pathogens identification in patients with unidentified clinical symptoms such as fever of unknown origin exists,which not only poses a challenge to both the diagnostic and therapeutic process by itself,but also to expert physicians.Methods:In this report,we have attempted to increase the awareness of unidentified pathogens by developing a method to investigate hitherto unidentified infectious pathogens based on unbiased high-throughput sequencing.Results:Our observations show that this method supplements current diagnostic technology that predominantly relies on information derived five cases from the intensive care unit.This methodological approach detects viruses and corrects the incidence of false positive detection rates of pathogens in a much shorter period.Through our method is followed by polymerase chain reaction validation,we could identify infection with Epstein-Barr virus,and in another case,we could identify infection with Streptococcus viridians based on the culture,which was false positive.Conclusions:This technology is a promising approach to revolutionize rapid diagnosis of infectious pathogens and to guide therapy that might result in the improvement of personalized medicine.

  1. Detection of Emerging and Re-Emerging Pathogens in Surface Waters Close to an Urban Area

    Directory of Open Access Journals (Sweden)

    Stefania Marcheggiani

    2015-05-01

    Full Text Available Current knowledge about the spread of pathogens in aquatic environments is scarce probably because bacteria, viruses, algae and their toxins tend to occur at low concentrations in water, making them very difficult to measure directly. The purpose of this study was the development and validation of tools to detect pathogens in freshwater systems close to an urban area. In order to evaluate anthropogenic impacts on water microbiological quality, a phylogenetic microarray was developed in the context of the EU project µAQUA to detect simultaneously numerous pathogens and applied to samples from two different locations close to an urban area located upstream and downstream of Rome in the Tiber River. Furthermore, human enteric viruses were also detected. Fifty liters of water were collected and concentrated using a hollow-fiber ultrafiltration approach. The resultant concentrate was further size-fractionated through a series of decreasing pore size filters. RNA was extracted from pooled filters and hybridized to the newly designed microarray to detect pathogenic bacteria, protozoa and toxic cyanobacteria. Diatoms as indicators of the water quality status, were also included in the microarray to evaluate water quality. The microarray results gave positive signals for bacteria, diatoms, cyanobacteria and protozoa. Cross validation of the microarray was performed using standard microbiological methods for the bacteria. The presence of oral-fecal transmitted human enteric-viruses were detected using q-PCR. Significant concentrations of Salmonella, Clostridium, Campylobacter and Staphylococcus as well as Hepatitis E Virus (HEV, noroviruses GI (NoGGI and GII (NoGII and human adenovirus 41 (ADV 41 were found in the Mezzocammino site, whereas lower concentrations of other bacteria and only the ADV41 virus was recovered at the Castel Giubileo site. This study revealed that the pollution level in the Tiber River was considerably higher downstream rather than

  2. Detection of hepatitis E virus and other livestock-related pathogens in Iowa streams

    Science.gov (United States)

    Givens, Carrie E.; Kolpin, Dana W.; Borchardt, Mark A.; Duris, Joseph; Moorman, Thomas B.; Spencer, Susan K.

    2016-01-01

    Manure application is a source of pathogens to the environment. Through overland runoff and tile drainage, zoonotic pathogens can contaminate surface water and streambed sediment and could affect both wildlife and human health. This study examined the environmental occurrence of gene markers for livestock-related bacterial, protozoan, and viral pathogens and antibiotic resistance in surface waters within the South Fork Iowa River basin before and after periods of swine manure application on agricultural land. Increased concentrations of indicator bacteria after manure application exceeding Iowa's state bacteria water quality standards suggest that swine manure contributes to diminished water quality and may pose a risk to human health. Additionally, the occurrence of HEV and numerous bacterial pathogen genes for Escherichia coli, Enterococcus spp., Salmonella sp., and Staphylococcus aureus in both manure samples and in corresponding surface water following periods of manure application suggests a potential role for swine in the spreading of zoonotic pathogens to the surrounding environment. During this study, several zoonotic pathogens were detected including Shiga-toxin producing E. coli, Campylobacter jejuni, pathogenic enterococci, and S. aureus; all of which can pose mild to serious health risks to swine, humans, and other wildlife. This research provides the foundational understanding required for future assessment of the risk to environmental health from livestock-related zoonotic pathogen exposures in this region. This information could also be important for maintaining swine herd biosecurity and protecting the health of wildlife near swine facilities.

  3. Multiplex Polymerase Chain Reaction for Detection of Gastrointestinal Pathogens in Migrant Workers in Qatar

    Science.gov (United States)

    Humphrey, John M.; Ranbhise, Sanjay; Ibrahim, Emad; Al-Romaihi, Hamad E.; Farag, Elmoubasher; Abu-Raddad, Laith J.; Glesby, Marshall J.

    2016-01-01

    The causes of infectious diarrhea among the migrant worker population in Qatar are not well understood. We conducted a prospective observational study to understand the demographic and clinical characteristics and infectious causes of diarrhea among migrant workers in Doha, Qatar. A total of 126 male workers presenting to the Qatar Red Crescent Worker's Health Center outpatient clinic or emergency department were studied over a 5-month period in 2015–2016. Epidemiologic surveys were administered to all subjects and the prevalence of 22 different stool pathogens was determined using multiplex polymerase chain reaction (PCR) (FilmArray® Gastrointestinal PCR). A target pathogen was identified in 62.7% of subjects. Enteropathogenic Escherichia coli was the most prevalent pathogen and was detected in 24.6% of subjects, followed by Salmonella (22.2%), enteroaggregative E. coli (15.1%), Giardia lamblia (9.5%), and enterotoxigenic E. coli (8.7%). Multiple pathogens were identified in 49.3% of positive stool samples. In a multivariable analysis, the presence of a heart rate ≥ 90 (adjusted odds ratio [OR] = 3.7, 95% confidence interval [CI] = 1.4–10.0) and > 5 fecal leukocytes/high-power field (adjusted OR = 2.8, 95% CI = 1.2–7.0) were significant predictors of detecting an acute inflammatory pathogen by PCR. Use of multiplex PCR enabled the detection of gastrointestinal pathogens in a high proportion of cases, illustrating the utility of this diagnostic tool in epidemiologic studies of infectious diarrhea. PMID:27928081

  4. Loop-mediated isothermal amplification (LAMP): A novel rapid detection platform for pathogens.

    Science.gov (United States)

    Li, Yanmei; Fan, Penghui; Zhou, Shishui; Zhang, Li

    2017-03-18

    Foodborne bacterial infections and diseases have been considered to be a major threat for public health in the worldwide. Increased incidence of human diseases caused by foodborne pathogens have been correlated with growing world population and mobility. Loop-mediated isothermal amplification (LAMP) has been regarded as an innovative gene amplification technology and emerged as an alternative to PCR-based methodologies in both clinical laboratory and food safety testing. Nowadays, LAMP has been applied to detection and identification on pathogens from microbial diseases, as it showed significant advantage in high sensitivity, specificity and rapidity. The high sensitivity of LAMP enables detection of the pathogens in sample materials even without time consuming sample preparation. An overview of LAMP mainly containing the development history, reaction principle and its application to four kind of foodborne pathogens detection are presented in this paper. As concluded, with the advantages of rapidity, simplicity, sensitivity, specificity and robustness, LAMP is capable of applications for clinical diagnosis as well as surveillance of infection diseases. Moreover, the main purpose of this paper is to provide theoretical basis for the clinical application of LAMP technology.

  5. Rapid Detection and Identification of a Pathogen's DNA Using Phi29 DNA Polymerase

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Y.; Dunn, J.; Gao, S.; Bruno, J. F.; Luft, B. J.

    2008-10-31

    Zoonotic pathogens including those transmitted by insect vectors are some of the most deadly of all infectious diseases known to mankind. A number of these agents have been further weaponized and are widely recognized as being potentially significant biothreat agents. We describe a novel method based on multiply-primed rolling circle in vitro amplification for profiling genomic DNAs to permit rapid, cultivation-free differential detection and identification of circular plasmids in infectious agents. Using Phi29 DNA polymerase and a two-step priming reaction we could reproducibly detect and characterize by DNA sequencing circular DNA from Borrelia burgdorferi B31 in DNA samples containing as little as 25 pg of Borrelia DNA amongst a vast excess of human DNA. This simple technology can ultimately be adapted as a sensitive method to detect specific DNA from both known and unknown pathogens in a wide variety of complex environments.

  6. A new pentaplex-nested PCR to detect five pathogenic bacteria in free living amoebae.

    Science.gov (United States)

    Calvo, L; Gregorio, I; García, A; Fernández, M T; Goñi, P; Clavel, A; Peleato, M L; Fillat, M F

    2013-02-01

    Changes in water use and anthropogenic activity have major impacts on the quality of natural aquatic ecosystems, water distribution and wastewater plants. One of the main problems is the presence of some pathogenic microorganisms that are resistant to disinfection procedures when they are hosted by free living amoeba and that in many cases are hardly detectable by culture-based procedures. In this work we report a sensitive, low-cost procedure consisting of a pentaplex-nested PCR that allows simultaneous detection of Legionella pneumophila, Mycobacterium spp., Pseudomonas spp., Vibrio cholerae and the microcystin-producing cyanobacteria Microcystis aeruginosa. The method has been used to detect the presence of these pathogenic bacteria in water and inside free living amoeba. Its validation in 72 samples obtained from different water sources from Aragon (Spain) evidences that Mycobacterium and Pseudomonas spp are prevailing as amoeba-resistant bacteria.

  7. Equivalence of self- and staff-collected nasal swabs for the detection of viral respiratory pathogens.

    Directory of Open Access Journals (Sweden)

    Manas K Akmatov

    Full Text Available BACKGROUND: The need for the timely collection of diagnostic biosamples during symptomatic episodes represents a major obstacle to large-scale studies on acute respiratory infection (ARI epidemiology. This may be circumvented by having the participants collect their own nasal swabs. We compared self- and staff-collected swabs in terms of swabbing quality and detection of viral respiratory pathogens. METHODOLOGY/PRINCIPAL FINDINGS: We conducted a prospective study among employees of our institution during the ARI season 2010/2011 (December-March. Weekly emails were sent to the participants (n = 84, reminding them to come to the study center in case of new symptoms. The participants self-collected an anterior nasal swab from one nostril, and trained study personnel collected one from the other nostril. The participants self-collected another two swabs (one from each nostril on a subsequent day. Human β-actin DNA concentration was determined in the swabs as a quality control. Viral respiratory pathogens were detected by multiplex RT-PCR (Seeplex RV15 kit, Seegene, Eschborn, Germany. Of 84 participants, 56 (67% reported at least one ARI episode, 18 participants two, and one participant three. Self-swabbing was highly accepted by the participants. The amount of β-actin DNA per swab was higher in the self- than in the staff-collected swabs (p = 0.008. β-actin concentration was lower in the self-swabs collected on day 1 than in those collected on a subsequent day (p<0.0001. A respiratory viral pathogen was detected in 31% (23/75 of staff- and in 35% (26/75 of self-collected swabs (p = 0.36. With both approaches, the most frequently identified pathogens were human rhinoviruses A/B/C (12/75 swabs, 16% and human coronavirus OC43 (4/75 swabs, 5%. There was almost perfect agreement between self- and staff-collected swabs in terms of pathogen detection (agreement = 93%, kappa = 0.85, p<0.0001. CONCLUSIONS/SIGNIFICANCE: Nasal self

  8. Novel aptamer-linked nanoconjugate approach for detection of waterborne bacterial pathogens: an update

    Science.gov (United States)

    Singh, Gulshan; Manohar, Murli; Adegoke, Anthony Ayodeji; Stenström, Thor Axel; Shanker, Rishi

    2017-01-01

    The lack of microbiologically safe water in underdeveloped nations is the prime cause of infectious disease outbreaks. The need for the specific identification and detection of microorganisms encourages the development of advanced, rapid, sensitive and highly specific methods for the monitoring of pathogens and management of potential risk to human health. The rapid molecular assays based on detection of specific molecular signatures offer advantages over conventional methods in terms of specificity and sensitivity but require complex instrumentation and skilled personnel. Nanotechnology is an emerging area and provides a robust approach for the identification of pathogenic microorganism utilizing the peculiar properties of nanomaterials, i.e. small size (1-100 nm) and large surface area. This emerging technology promises to fulfill the urgent need of a novel strategy to enhance the bacterial identification and quantitation in the environment. In this context, the peculiar properties of gold nanoparticles, their plasmonic shifts, and changes in magnetic properties have been utilized for the simple and cost-effective detection of bacterial nucleic acids, antigens and toxins with quite improved sensitivity. One of the promising leads to develop an advance detection method might be the coupling of nucleic acid aptamers (capable of interacting specifically with bacteria, protozoa, and viruses) with nanomaterials. Such aptamer-nano conjugate can be used for the specific recognition of infectious agents in different environmental matrices. This review summarizes the application of nanotechnology in the area of pathogen detection and discusses the prospects of coupling nucleic acid aptamers with nanoparticles for the specific detection of targeted pathogens.

  9. Towards Autonomous Modular UAV Missions: The Detection, Geo-Location and Landing Paradigm

    Directory of Open Access Journals (Sweden)

    Sarantis Kyristsis

    2016-11-01

    Full Text Available Nowadays, various unmanned aerial vehicle (UAV applications become increasingly demanding since they require real-time, autonomous and intelligent functions. Towards this end, in the present study, a fully autonomous UAV scenario is implemented, including the tasks of area scanning, target recognition, geo-location, monitoring, following and finally landing on a high speed moving platform. The underlying methodology includes AprilTag target identification through Graphics Processing Unit (GPU parallelized processing, image processing and several optimized locations and approach algorithms employing gimbal movement, Global Navigation Satellite System (GNSS readings and UAV navigation. For the experimentation, a commercial and a custom made quad-copter prototype were used, portraying a high and a low-computational embedded platform alternative. Among the successful targeting and follow procedures, it is shown that the landing approach can be successfully performed even under high platform speeds.

  10. Towards Autonomous Modular UAV Missions: The Detection, Geo-Location and Landing Paradigm.

    Science.gov (United States)

    Kyristsis, Sarantis; Antonopoulos, Angelos; Chanialakis, Theofilos; Stefanakis, Emmanouel; Linardos, Christos; Tripolitsiotis, Achilles; Partsinevelos, Panagiotis

    2016-11-03

    Nowadays, various unmanned aerial vehicle (UAV) applications become increasingly demanding since they require real-time, autonomous and intelligent functions. Towards this end, in the present study, a fully autonomous UAV scenario is implemented, including the tasks of area scanning, target recognition, geo-location, monitoring, following and finally landing on a high speed moving platform. The underlying methodology includes AprilTag target identification through Graphics Processing Unit (GPU) parallelized processing, image processing and several optimized locations and approach algorithms employing gimbal movement, Global Navigation Satellite System (GNSS) readings and UAV navigation. For the experimentation, a commercial and a custom made quad-copter prototype were used, portraying a high and a low-computational embedded platform alternative. Among the successful targeting and follow procedures, it is shown that the landing approach can be successfully performed even under high platform speeds.

  11. Multistatic, Concurrent Detection, Classification and Localization Concepts for Autonomous, Shallow Water Mine Counter Measures

    Science.gov (United States)

    2012-09-30

    the adaptive model provides 86% more compression than the widely used Compact Control Language, a marshalling scheme that is widely used in the field...Compact Control Language (DCCL) as their subsea messaging scheme, the Ocean Observatories Initiative is adopting Goby2 for AUV communications, and...Schmidt, “Integrated Perception, Modeling and Control for Bistatic Sonar Tracking by Autonomous Underwater Vehicles”, Submitted to IEEE J. Oceanic Eng., (2012).

  12. Multiplex detection of plant pathogens through the Luminex MagPlex bead system.

    Science.gov (United States)

    van der Vlugt, René A A; van Raaij, Henry; de Weerdt, Marjanne; Bergervoet, Jan H W

    2015-01-01

    Here we describe a versatile multiplex method for both the serological and molecular detection of plant pathogens. The Luminex MagPlex bead system uses small paramagnetic microspheres ("beads"), either coated with specific antibodies or oligonucleotides, which capture respectively viruses and/or bacteria or PCR products obtained from their genetic material. The Luminex MagPlex bead system allows true multiplex detection of up to 500 targets in a single sample on a routine basis. The liquid suspension nature of the method significantly improves (1) assay speed, (2) detection limits and (3) dynamic range. It can also considerably reduce labor and consumables costs.

  13. DNA microarray-based detection of multiple pathogens: Mycoplasma spp. and Chlamydia spp.

    Science.gov (United States)

    Schnee, Christiane; Sachse, Konrad

    2015-01-01

    Rapid detection of slow-growing or non-culturable microorganisms, such as Mycoplasma spp. and Chlamydia spp., is still a challenge to diagnosticians in the veterinary field. In addition, as epidemiological evidence on the frequency of mixed infections involving two and more bacterial species has been emerging, detection methods allowing simultaneous identification of different pathogens are required. In the present chapter, we describe DNA microarray-based procedures for the detection of 83 Mollicutes species (Mycoplasma assay) and 11 Chlamydia spp. (Chlamydia assay). The assays are suitable for use in a routine diagnostic environment, as well as in microbiological research.

  14. Progress in rapid detection and identification of unknown human and agricultural pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Barnes, T; Holzrichter, J F; Milanovich, F P

    1999-08-13

    The medical industry is driving pathogen detection technology from its present characteristics of $50/sample, 100 sample capability systems, with several day time responses, having several percent error rates in reported outcomes. The systems described above are capable of providing samples at < $5/test, managing several million samples, < 1-hour cycle times, (or just minutes in some cases) and < 0.1% error rates. Because of their importance to the medical and agricultural communities, all ''important'' pathogens will have detection kits available (within air transport times, anywhere in the world) by 2020, and the most well known pathogens will have kits available within a few years. Many are available now. Because of the importance of the food supply to modern nations, these technologies will be employed everywhere in this industry. For example, the United States imports 30 B tons of food a year, but inspects < 1%. Portable inspection systems will make it possible to test for dangerous pathogens in feed lots, food processing plants, markets, and points of use. Outbreaks of animal or plant disease will be immediately detectable using field instrumentation, and more complex samples can be sent to central testing laboratories where more sophisticated test systems will be available. Unusual pathogens either naturally or purposefully selected or developed, will require special attention because there is not a commercial economic driver for the development of detection systems and curative agents. Their development, and production for sufficient availability, will require significant investments by the world community. The strategy and costs for developing vaccines or curative drugs will be very expensive and will need special attention. However it is important that attention be directed to these problems because such attention has a strong deterrent effect on potential developers or users. The capacity to use the full information content contained

  15. Low-cost, real-time, continuous flow PCR system for pathogen detection.

    Science.gov (United States)

    Fernández-Carballo, B Leticia; McGuiness, Ian; McBeth, Christine; Kalashnikov, Maxim; Borrós, Salvador; Sharon, Andre; Sauer-Budge, Alexis F

    2016-04-01

    In this paper, we present a portable and low cost point-of-care (POC) PCR system for quantitative detection of pathogens. Our system is based on continuous flow PCR which maintains fixed temperatures zones and pushes the PCR solution between two heated areas allowing for faster heat transfer and as a result, a faster PCR. The PCR system is built around a 46.0 mm × 30.9 mm × 0.4 mm disposable thermoplastic chip. In order to make the single-use chip economically viable, it was manufactured by hot embossing and was designed to be compatible with roll-to-roll embossing for large scale production. The prototype instrumentation surrounding the chip includes two heaters, thermal sensors, and an optical system. The optical system allows for pathogen detection via real time fluorescence measurements. FAM probes were used as fluorescent reporters of the amplicons generated during the PCR. To demonstrate the function of the chip, two infectious bacteria targets were selected: Chlamydia trachomatis and Escherichia coli O157:H7. For both bacteria, the limit of detection of the system was determined, PCR efficiencies were calculated, and different flow velocities were tested. We have demonstrated successful detection for these two bacterial pathogens highlighting the versatility and broad utility of our portable, low-cost, and rapid PCR diagnostic device.

  16. In-situ detection of multiple pathogenic bacteria on food surfaces

    Science.gov (United States)

    Chai, Yating; Horikawa, Shin; Hu, Jiajia; Chen, I.-Hsuan; Hu, Jing; Barbaree, James M.; Chin, Bryan A.

    2015-05-01

    Real-time in-situ detection of pathogenic bacteria on fresh food surfaces was accomplished with phage-based magnetoelastic (ME) biosensors. The ME biosensor is constructed of a small rectangular strip of ME material that is coated with a biomolecular recognition element (phage, antibodies or proteins, etc.) that is specific to the target pathogen. This mass-sensitive ME biosensor is wirelessly actuated into mechanical resonance by an externally applied time-varying magnetic field. When the biosensor binds with target bacteria, the mass of the sensor increases, resulting in a decrease in the sensor's resonant frequency. In order to compensate for nonspecific binding, control biosensors without phage were used in this experiment. In previous research, the biosensors were measured one by one. However, the simultaneous measurement of multiple sensors was accomplished in this research, and promises to greatly shorten the analysis time for bacterial detection. Additionally, the use of multiple biosensors enables the possibility of simultaneous detection of different pathogenic bacteria. This paper presents results of experiments in which multiple phage-based ME biosensors were simultaneously monitored. The E2 phage and JRB7 phage from a landscape phage library served as the bio-recognition element that have the capability of binding specifically with Salmonella typhimurium and B. anthracis spores, respectively. Real-time in-situ detection of Salmonella typhimurium and B. anthracis spores on food surfaces are presented.

  17. An improved detection and quantification method for the coral pathogen Vibrio coralliilyticus.

    Directory of Open Access Journals (Sweden)

    Bryan Wilson

    Full Text Available DNA- and RNA-based PCR and reverse-transcription real-time PCR assays were developed for diagnostic detection of the vcpA zinc-metalloprotease implicated in the virulence of the coral pathogen Vibrio coralliilyticus. Both PCR methods were highly specific for V. coralliilyticus and failed to amplify strains of closely-related Vibrio species. The assays correctly detected all globally occurring V. coralliilyticus isolates including a newly-described isolate [TAV24] infecting gorgonians in the Mediterranean Sea and highlighted those isolates that had been potentially misidentified, in particular V. tubiashii strains ATCC 19105 and RE22, historically described as important oyster pathogens. The real-time assay is sensitive, detecting 10 gene copies and the relationships between gene copy number and cycle threshold (C T were highly linear (R(2≥ 99.7. The real-time assay was also not affected by interference from non-target DNA. These assays are useful for rapid detection of V. coralliilyticus and monitoring of virulence levels in environmental samples, allowing for implementation of timely management steps to limit and possibly prevent losses due to V. coralliilyticus infection, as well as furthering investigations of factors affecting pathogenesis of this important marine pathogen.

  18. Detection of viral respiratory pathogens in mild and severe acute respiratory infections in Singapore

    Science.gov (United States)

    Jiang, Lili; Lee, Vernon Jian Ming; Cui, Lin; Lin, Raymond; Tan, Chyi Lin; Tan, Linda Wei Lin; Lim, Wei-yen; Leo, Yee-Sin; Low, Louie; Hibberd, Martin; Chen, Mark I-Cheng

    2017-01-01

    To investigate the performance of laboratory methods and clinical case definitions in detecting the viral pathogens for acute respiratory infections (ARIs) from a prospective community cohort and hospital inpatients, nasopharyngeal swabs from cohort members reporting ARIs (community-ARI) and inpatients admitted with ARIs (inpatient-ARI) were tested by Singleplex Real Time-Polymerase Chain Reaction (SRT-PCR), multiplex RT-PCR (MRT-PCR) and pathogen-chip system (PathChip) between April 2012 and December 2013. Community-ARI and inpatient-ARI was also combined with mild and severe cases of influenza from a historical prospective study as mild-ARI and severe-ARI respectively to evaluate the performance of clinical case definitions. We analysed 130 community-ARI and 140 inpatient-ARI episodes (5 inpatient-ARI excluded because multiple pathogens were detected), involving 138 and 207 samples respectively. Detection by PCR declined with days post-onset for influenza virus; decrease was faster for community-ARI than for inpatient-ARI. No such patterns were observed for non-influenza respiratory virus infections. PathChip added substantially to viruses detected for community-ARI only. Clinical case definitions discriminated influenza from other mild-ARI but performed poorly for severe-ARI and for older participants. Rational strategies for diagnosis and surveillance of influenza and other respiratory virus must acknowledge the differences between ARIs presenting in community and hospital settings. PMID:28218288

  19. Detection and enumeration of four foodborne pathogens in raw commingled silo milk in the United States.

    Science.gov (United States)

    Jackson, Emily E; Erten, Edibe S; Maddi, Neeraj; Graham, Thomas E; Larkin, John W; Blodgett, Robert J; Schlesser, Joseph E; Reddy, Ravinder M

    2012-08-01

    A nationwide survey was conducted to obtain qualitative and quantitative data on bacterial contamination of raw commingled silo milk intended for pasteurization. The levels of total aerobic bacteria, total coliforms, Enterobacteriaceae, Escherichia coli, and Staphylococcus aureus were determined using the TEMPO system. The prevalence rates and levels of presumptive Bacillus cereus, E. coli O157:H7, Listeria monocytogenes, and Salmonella spp. were determined in 214 samples. B. cereus was detected in 8.91% of samples, at 3.0 to 93 CFU/ml. E. coli O157:H7 was detected in 3.79 to 9.05% of samples, at bacteria were slightly lower in samples containing no pathogens. No correlation was observed between the levels of organisms detected with the TEMPO system and the presence or levels of any pathogen except E. coli O157:H7. A higher average log-transformed count of total viable bacteria was observed in samples positive for this organism. The high prevalence rates of target pathogens may be attributed to a variety of factors, including detection methods, sample size, and commingling of the milk in the silo. The effects of commingling likely contributed to the high prevalence rates and low levels of target pathogens because of the inclusion of milk from multiple bulk tanks. The high prevalence rates also may be the result of analysis of larger sample volumes using more sensitive detection methods. These quantitative data could be utilized to perform more accurate risk assessments and to better estimate the appropriate level of protection for dairy products and processing technologies.

  20. Phage-protease-peptide: a novel trifecta enabling multiplex detection of viable bacterial pathogens.

    Science.gov (United States)

    Alcaine, S D; Tilton, L; Serrano, M A C; Wang, M; Vachet, R W; Nugen, S R

    2015-10-01

    Bacteriophages represent rapid, readily targeted, and easily produced molecular probes for the detection of bacterial pathogens. Molecular biology techniques have allowed researchers to make significant advances in the bioengineering of bacteriophage to further improve speed and sensitivity of detection. Despite their host specificity, bacteriophages have not been meaningfully leveraged in multiplex detection of bacterial pathogens. We propose a proof-of-principal phage-based scheme to enable multiplex detection. Our scheme involves bioengineering bacteriophage to carry a gene for a specific protease, which is expressed during infection of the target cell. Upon lysis, the protease is released to cleave a reporter peptide, and the signal detected. Here we demonstrate the successful (i) modification of T7 bacteriophage to carry tobacco etch virus (TEV) protease; (ii) expression of TEV protease by Escherichia coli following infection by our modified T7, an average of 2000 units of protease per phage are produced during infection; and (iii) proof-of-principle detection of E. coli in 3 h after a primary enrichment via TEV protease activity using a fluorescent peptide and using a designed target peptide for matrix-assisted laser desorption/ionization time-of-flight mass spectrometry analysis (MALDI-TOF MS) analysis. This proof-of-principle can be translated to other phage-protease-peptide combinations to enable multiplex bacterial detection and readily adopted on multiple platforms, like MALDI-TOF MS or fluorescent readers, commonly found in labs.

  1. Identification of upper respiratory tract pathogens using electrochemical detection on an oligonucleotide microarray.

    Directory of Open Access Journals (Sweden)

    Michael J Lodes

    Full Text Available Bacterial and viral upper respiratory infections (URI produce highly variable clinical symptoms that cannot be used to identify the etiologic agent. Proper treatment, however, depends on correct identification of the pathogen involved as antibiotics provide little or no benefit with viral infections. Here we describe a rapid and sensitive genotyping assay and microarray for URI identification using standard amplification and hybridization techniques, with electrochemical detection (ECD on a semiconductor-based oligonucleotide microarray. The assay was developed to detect four bacterial pathogens (Bordetella pertussis, Streptococcus pyogenes, Chlamydia pneumoniae and Mycoplasma pneumoniae and 9 viral pathogens (adenovirus 4, coronavirus OC43, 229E and HK, influenza A and B, parainfluenza types 1, 2, and 3 and respiratory syncytial virus. This new platform forms the basis for a fully automated diagnostics system that is very flexible and can be customized to suit different or additional pathogens. Multiple probes on a flexible platform allow one to test probes empirically and then select highly reactive probes for further iterative evaluation. Because ECD uses an enzymatic reaction to create electrical signals that can be read directly from the array, there is no need for image analysis or for expensive and delicate optical scanning equipment. We show assay sensitivity and specificity that are excellent for a multiplexed format.

  2. Detection of Gastrointestinal Pathogens from Stool Samples on Hemoccult Cards by Multiplex PCR

    Directory of Open Access Journals (Sweden)

    Martin Alberer

    2017-01-01

    Full Text Available Purpose. Up to 30% of international travelers are affected by travelers’ diarrhea (TD. Reliable data on the etiology of TD is lacking. Sufficient laboratory capacity at travel destinations is often unavailable and transporting conventional stool samples to the home country is inconvenient. We evaluated the use of Hemoccult cards for stool sampling combined with a multiplex PCR for the detection of model viral, bacterial, and protozoal TD pathogens. Methods. Following the creation of serial dilutions for each model pathogen, last positive dilution steps (LPDs and thereof calculated last positive sample concentrations (LPCs were compared between conventional stool samples and card samples. Furthermore, card samples were tested after a prolonged time interval simulating storage during a travel duration of up to 6 weeks. Results. The LPDs/LPCs were comparable to testing of conventional stool samples. After storage on Hemoccult cards, the recovery rate was 97.6% for C. jejuni, 100% for E. histolytica, 97.6% for norovirus GI, and 100% for GII. Detection of expected pathogens was possible at weekly intervals up to 42 days. Conclusion. Stool samples on Hemoccult cards stored at room temperature can be used in combination with a multiplex PCR as a reliable tool for testing of TD pathogens.

  3. Rapid method for detection, identification, and susceptibility testing of enteric pathogens.

    Science.gov (United States)

    Stager, C E; Erikson, E; Davis, J R

    1983-01-01

    Three hundred and seven colonies believed to be enteric pathogens were selected from primary plates of MacConkey, xylose desoxycholate, or salmonella-shigella agar for inoculation to lactose-sucrose broth, urea-41 motility medium, modified Andrade glucose broth with inverted Durham tube, pregrowth broth, triple sugar iron agar, lysine iron agar (LIA), and Christensen urea agar. The rapid screen consisted of interpreting the lactose-sucrose, urea-41 motility, and modified Andrade glucose broth gas reactions after 4 to 6 h at 35 degrees C. These rapid screening biochemicals plus LIA were incubated for 24 h if further interpretation was required. Reference biochemicals (triple sugar iron, LIA, and Christensen urea agars) were interpreted at 24 h. Of 307 isolates, 49 (16%) were reported as negative for enteric pathogens after 4 to 6 h because their biochemical profiles were not compatible with those for enteric pathogens. A total of 87 (28.3%) isolates produced biochemical profiles at 4 to 6 h that were presumptive for enteric pathogens. The 87 presumptive pathogens were inoculated into the AutoMicrobic system Gram-Negative General Susceptibility Card and the AutoMicrobic system Enterobacteriaceae-Plus Biochemical Card (AMS-EBC+) after 4 to 6 h of growth in pregrowth broth. Of these isolates, 63 were confirmed to be enteric pathogens, of which 61 (96.8%) were correctly identified by the AMS-EBC+. One isolate was identified as Shigella dysenteriae by AMS-EBC+ but confirmed as Shigella flexneri biotype 6 by a reference laboratory. The other isolate was identified as Arizona hinshawii by AMS-EBC+ but was confirmed as Salmonella enteritidis. Of the 307 isolates, 166 (54.1%) required further interpretation of the rapid screening biochemicals plus LIA at 24 h; 5 of these were detected as enteric pathogens. The same 68 enteric pathogens were detected by both the rapid method and the reference method. The results from the general susceptibility card agreed with agar diffusion

  4. Microbial Diagnostic Microarrays for the Detection and Typing of Food- and Water-Borne (Bacterial) Pathogens.

    Science.gov (United States)

    Kostić, Tanja; Sessitsch, Angela

    2011-10-14

    Reliable and sensitive pathogen detection in clinical and environmental (including food and water) samples is of greatest importance for public health. Standard microbiological methods have several limitations and improved alternatives are needed. Most important requirements for reliable analysis include: (i) specificity; (ii) sensitivity; (iii) multiplexing potential; (iv) robustness; (v) speed; (vi) automation potential; and (vii) low cost. Microarray technology can, through its very nature, fulfill many of these requirements directly and the remaining challenges have been tackled. In this review, we attempt to compare performance characteristics of the microbial diagnostic microarrays developed for the detection and typing of food and water pathogens, and discuss limitations, points still to be addressed and issues specific for the analysis of food, water and environmental samples.

  5. Microbial Diagnostic Microarrays for the Detection and Typing of Food- and Water-Borne (Bacterial Pathogens

    Directory of Open Access Journals (Sweden)

    Tanja Kostić

    2011-10-01

    Full Text Available Reliable and sensitive pathogen detection in clinical and environmental (including food and water samples is of greatest importance for public health. Standard microbiological methods have several limitations and improved alternatives are needed. Most important requirements for reliable analysis include: (i specificity; (ii sensitivity; (iii multiplexing potential; (iv robustness; (v speed; (vi automation potential; and (vii low cost. Microarray technology can, through its very nature, fulfill many of these requirements directly and the remaining challenges have been tackled. In this review, we attempt to compare performance characteristics of the microbial diagnostic microarrays developed for the detection and typing of food and water pathogens, and discuss limitations, points still to be addressed and issues specific for the analysis of food, water and environmental samples.

  6. Engineering the stereochemistry of cephalosporin for specific detection of pathogenic carbapenemase-expressing bacteria.

    Science.gov (United States)

    Shi, Haibin; Cheng, Yunfeng; Lee, Kyung Hyun; Luo, Robert F; Banaei, Niaz; Rao, Jianghong

    2014-07-28

    Reported herein is the design of fluorogenic probes specific for carbapenem-resistant Enterobacteriaceae (CRE) and they were designed based on stereochemically modified cephalosporin having a 6,7-trans configuration. Through experiments using recombinant β-lactamase enzymes and live bacterial species, these probes demonstrate the potential for use in the specific detection of carbapenemases, including metallo-β-lactamases in active bacterial pathogens.

  7. Fluorescence in situ hybridization for the tissue detection of bacterial pathogens associated with porcine infections

    DEFF Research Database (Denmark)

    Jensen, Henrik Elvang; Jensen, Louise Kruse; Barington, Kristiane

    2015-01-01

    sequences within intact cells. FISH allows direct histological localization of the bacteria in the tissue and thereby a correlation between the infection and the histopathological changes present. This chapter presents protocols for FISH identification of bacterial pathogens in fixed deparaffinized tissue......Fluorescence in situ hybridization (FISH) is an efficient technique for the identification of specific bacteria in tissue of both experimental and spontaneous infections. The method detects specific sequences of nucleic acids by hybridization of fluorescently labeled probes to complementary target...

  8. Physics Based Model for Online Fault Detection in Autonomous Cryogenic Loading System

    Science.gov (United States)

    Kashani, Ali; Devine, Ekaterina Viktorovna P; Luchinsky, Dmitry Georgievich; Smelyanskiy, Vadim; Sass, Jared P.; Brown, Barbara L.; Patterson-Hine, Ann

    2013-01-01

    We report the progress in the development of the chilldown model for rapid cryogenic loading system developed at KSC. The nontrivial characteristic feature of the analyzed chilldown regime is its active control by dump valves. The two-phase flow model of the chilldown is approximated as one-dimensional homogeneous fluid flow with no slip condition for the interphase velocity. The model is built using commercial SINDAFLUINT software. The results of numerical predictions are in good agreement with the experimental time traces. The obtained results pave the way to the application of the SINDAFLUINT model as a verification tool for the design and algorithm development required for autonomous loading operation.

  9. Simultaneous Detection of Five Pathogens from Cerebrospinal Fluid Specimens Using Luminex Technology

    Directory of Open Access Journals (Sweden)

    Linfu Zhou

    2016-02-01

    Full Text Available Early diagnosis and treatment are crucial for the outcome of central nervous system (CNS infections. In this study, we developed a multiplex PCR-Luminex assay for the simultaneous detection of five major pathogens, including Mycobacterium tuberculosis, Cryptococcus neoformans, Streptococcus pneumoniae, and herpes simplex virus types 1 and 2, which frequently cause CNS infections. Through the hybridization reaction between multiplex PCR-amplified targets and oligonucleotide “anti-TAG” sequences, we found that the PCR-Luminex assay could detect as low as 101–102 copies of synthetic pathogen DNAs. Furthermore, 163 cerebrospinal fluid (CSF specimens from patients with suspected CNS infections were used to evaluate the efficiency of this multiplex PCR-Luminex method. Compared with Ziehl-Neelsen stain, this assay showed a high diagnostic accuracy for tuberculosis meningitis (sensitivity, 90.7% and specificity, 99.1%. For cryptococcal meningitis, the sensitivity and specificity were 92% and 97.1%, respectively, compared with the May Grunwald Giemsa (MGG stain. For herpes simplex virus types 1 and 2 encephalitis, the sensitivities were 80.8% and 100%, and the specificities were 94.2% and 99%, respectively, compared with Enzyme Linked Immunosorbent Assay (ELISA assays. Taken together, this multiplex PCR-Luminex assay showed potential efficiency for the simultaneous detection of five pathogens and may be a promising supplement to conventional methods for diagnosing CNS infections.

  10. Detection of enteric pathogens in Turkey flocks affected with severe enteritis, in Brazil.

    Science.gov (United States)

    Moura-Alvarez, Joelma; Nuñez, Luis F N; Astolfi-Ferreira, Claudete S; Knöbl, Terezinha; Chacón, Jorge L; Moreno, Andrea M; Jones, Richard C; Ferreira, Antonio J Piantino

    2014-08-01

    Twenty-two flocks of turkeys affected by enteric problems, with ages between 10 and 104 days and located in the Southern region of Brazil, were surveyed for turkey by PCR for turkey astrovirus type 2 (TAstV-2), turkey coronavirus (TCoV), hemorrhagic enteritis virus (HEV), rotavirus, reovirus, Salmonella spp., and Lawsonia intracellularis (Li) infections. Eleven profiles of pathogen combination were observed. The most frequently encountered pathogen combinations were TCoV-Li, followed by TCoV-TAstV-2-Li, TCoV-TastV-2. Only TCoV was detected as the sole pathogen in three flocks. Eight and 19 flocks of the 22 were positive for TAstV-2 and TCoV, respectively. Six were positive for Salmonella spp. and L. intracellularis was detected in 12 turkey flocks. Reovirus and HEV were not detected in this survey. These results throw new light on the multiple etiology of enteritis in turkeys. The implications of these findings and their correlation with the clinical signs are comprehensively discussed, illustrating the complexity of the enteric diseases.

  11. SUSCEPTIBILITY AND DETECTION OF EXTENDED SPECTRUM β-LACTAMASE ENZYMES FROM OTITIS MEDIA PATHOGENS

    Directory of Open Access Journals (Sweden)

    Ejikeugwu Chika

    2013-01-01

    Full Text Available Otitis media is the bacterial infection of the middle ear usually accompanied with inflammation, effusions and pain. It can present clinically in two major forms: Acute Otitis Media (AOM and Otitis Media with Effusion (OME and it is one of the leading cause of hospital visits and antibiotic prescriptions amongst children and even adults. Antibiotic resistance is a global public health problem and Extended Spectrum β-Lactamase (ESBL enzymes is one of the new mechanisms of resistance in especially Gram negative bacteria including Escherichia coli, Klebsiella pneumoniae and Pseudomonas aeruginosa. ESBLs are plasmid-mediated β-lactamase enzymes that hydrolyze extended-spectrum oxyimino 3rd generation cephalosporins and monobactams. Organisms producing ESBLs have remained important nosocomial and community-acquired pathogens over the years. Ear swab specimens of children (aged 0-7 with suspected Otitis media infections and who attended a tertiary hospital in Enugu, Nigeria were cultured on growth media. E. coli, K. pneumoniae and P. aeruginosa were isolated and identified by standard microbiological techniques. Antibiogram was conducted on all isolated ear pathogens by Kirby-Bauer disk diffusion method and ESBL production was evaluated by the Double Disk Synergy Test (DDST method. Imipenem and meropenem were the most active antibiotics against the E. coli, K. pneumoniae and P. aeruginosa ear pathogens. Sulphamethoxazole-trimethoprim was the least active agent against the tested ear pathogens and this was followed by ofloxacin, ciprofloxacin, gentamicin, cefotaxime and ceftazidime. None of the E. coli, K. pneumoniae and P. aeruginosa ear pathogens produced ESBLs by the method used. ESBL production by pathogenic bacteria confers on organisms the ability to be multidrug resistant. Their prompt and accurate detection from clinical specimens, together with reporting them along with hospitals routine antibiogram results is vital as this will help to

  12. Atypical sensors for direct and rapid neuronal detection of bacterial pathogens.

    Science.gov (United States)

    Lim, Ji Yeon; Choi, Seung-In; Choi, Geunyeol; Hwang, Sun Wook

    2016-03-09

    Bacterial infection can threaten the normal biological functions of a host, often leading to a disease. Hosts have developed complex immune systems to cope with the danger. Preceding the elimination of pathogens, selective recognition of the non-self invaders is necessary. At the forefront of the body's defenses are the innate immune cells, which are equipped with particular sensor molecules that can detect common exterior patterns of invading pathogens and their secreting toxins as well as with phagocytic machinery. Inflammatory mediators and cytokines released from these innate immune cells and infected tissues can boost the inflammatory cascade and further recruit adaptive immune cells to maximize the elimination and resolution. The nervous system also seems to interact with this process, mostly known to be affected by the inflammatory mediators through the binding of neuronal receptors, consequently activating neural circuits that tune the local and systemic inflammatory states. Recent research has suggested new contact points: direct interactions of sensory neurons with pathogens. Latest findings demonstrated that the sensory neurons not only share pattern recognition mechanisms with innate immune cells, but also utilize endogenous and exogenous electrogenic components for bacterial pathogen detection, by which the electrical firing prompts faster information flow than what could be achieved when the immune system is solely involved. As a result, rapid pain generation and active accommodation of the immune status occur. Here we introduced the sensory neuron-specific detector molecules for directly responding to bacterial pathogens and their signaling mechanisms. We also discussed extended issues that need to be explored in the future.

  13. Nano-particle enhanced impedimetric biosensor for detection of foodborne pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Kim, G [National Institute of Agricultural Engineering, 249 Seodun-dong, Suwon, Republic of Korea, 441-100 (Korea, Republic of); Om, A S [Department of Food and Nutrient, Hanyang University, 17 Haengdang-dong, Seoul, Republic of Korea, 133-791 (Korea, Republic of); Mun, J H [Department of Food and Nutrient, Hanyang University, 17 Haengdang-dong, Seoul, Republic of Korea, 133-791 (Korea, Republic of)

    2007-03-15

    Recent outbreaks of foodborne illness have been increased the need for rapid and sensitive methods for detection of these pathogens. Conventional methods for pathogens detection and identification involve prolonged multiple enrichment steps. Even though some immunological rapid assays are available, these assays still need enrichment steps result in delayed detection. Biosensors have shown great potential for rapid detection of foodborne pathogens. They are capable of direct monitoring the antigen-antibody reactions in real time. Among the biosensors, impedimetric biosensors have been widely adapted as an analysis tool for the study of various biological binding reactions because of their high sensitivity and reagentless operation. In this study a nanoparticle-enhanced impedimetric biosensor for Salmonella enteritidis detection was developed which detected impedance changes caused by the attachment of the cells to the anti-Salmonella antibodies immobilized on interdigitated gold electrodes. Successive immobilization of neutravidin followed by anti-Salmonella antibodies was performed to the sensing area to create a biological detection surface. To enhance the impedance responses generated by antigen-antibody reactions, anti-Salmonella antibody conjugated nanoparticles were introduced on the sensing area. Using a portable impedance analyzer, the impedance across the interdigital electrodes was measured after the series of antigen-antibody bindings. Bacteria cells present in solution attached to capture antibodies and became tethered to the sensor surface. Attached bacteria cells changed the dielectric constant of the media between the electrodes thereby causing a change in measured impedance. Optimum input frequency was determined by analyzing frequency characteristics of the biosensor over ranges of applied frequencies from 10 Hz to 400 Hz. At 100 Hz of input frequency, the biosensor was most sensitive to the changes of the bacteria concentration and this frequency

  14. Results from the Autonomous Triggering of in situ Sensors on Kilauea Volcano, HI, from Eruption Detection by Spacecraft

    Science.gov (United States)

    Doubleday, J.; Behar, A.; Davies, A.; Mora-Vargas, A.; Tran, D.; Abtahi, A.; Pieri, D. C.; Boudreau, K.; Cecava, J.

    2008-12-01

    Response time in acquiring sensor data in volcanic emergencies can be greatly improved through use of autonomous systems. For instance, ground-based observations and data processing applications of the JPL Volcano Sensor Web have promptly triggered spacecraft observations [e.g., 1]. The reverse command and information flow path can also be useful, using autonomous analysis of spacecraft data to trigger in situ sensors. In this demonstration project, SO2 sensors were incorporated into expendable "Volcano Monitor" capsules and placed downwind of the Pu'u 'O'o vent of Kilauea volcano, Hawai'i. In nominal (low) power conservation mode, data from these sensors were collected and transmitted every hour to the Volcano Sensor Web through the Iridium Satellite Network. When SO2 readings exceeded a predetermined threshold, the modem within the Volcano Monitor sent an alert to the Sensor Web, and triggered a request for prompt Earth Observing-1 (EO-1) spacecraft data acquisition. The Volcano Monitors were also triggered by the Sensor Web in response to an eruption detection by the MODIS instrument on Terra. During these pre- defined "critical events" the Sensor Web ordered the SO2 sensors within the Volcano Monitor to increase their sampling frequency to every 5 minutes (high power "burst mode"). Autonomous control of the sensors' sampling frequency enabled the Sensor Web to monitor and respond to rapidly evolving conditions, and allowed rapid compilation and dissemination of these data to the scientific community. Reference: [1] Davies et al., (2006) Eos, 87, (1), 1 and 5. This work was performed at the Jet Propulsion Laboratory-California Institute of Technology, under contract to NASA. Support was provided by the NASA AIST program, the Idaho Space Grant Consortium, and the New Mexico Space Grant Program. We also especially thank the personnel of the USGS Hawaiian Volcano Observatory for their invaluable scientific guidance and logistical assistance.

  15. Detection of American lineage low pathogenic avian influenza viruses in Uria lomvia in Greenland

    DEFF Research Database (Denmark)

    Hjulsager, Charlotte Kristiane; Hartby, Christina Marie; Krog, Jesper Schak

    of Denmark. Five birds were randomly selected for diagnostic investigation and samples were taken from the cadavers (pooled oropharyngeal swabs, cloacal swabs, lung/trachea/heart tissues and liver/spleen/kidney tissues, and separate preparation of stomach from a single bird). Avian influenza virus (AIV...... screened for AIV in oropharyngeal and cloacal swab specimens from each bird by RT-PCR. American lineage H11N2 AIV was detected in both oropharyngeal and cloacal swabs from one bird, and American lineage low pathogenic AIV with subtype H5N1 was detected in the cloacal swab from another bird. The sparse...

  16. Duplex microfluidic SERS detection of pathogen antigens with nanoyeast single-chain variable fragments.

    Science.gov (United States)

    Wang, Yuling; Rauf, Sakandar; Grewal, Yadveer S; Spadafora, Lauren J; Shiddiky, Muhammad J A; Cangelosi, Gerard A; Schlücker, Sebastian; Trau, Matt

    2014-10-07

    Quantitative and accurate detection of multiple biomarkers would allow for the rapid diagnosis and treatment of diseases induced by pathogens. Monoclonal antibodies are standard affinity reagents applied for biomarkers detection; however, their production is expensive and labor-intensive. Herein, we report on newly developed nanoyeast single-chain variable fragments (NYscFv) as an attractive alternative to monoclonal antibodies, which offers the unique advantage of a cost-effective production, stability in solution, and target-specificity. By combination of surface-enhanced Raman scattering (SERS) microspectroscopy using glass-coated, highly purified SERS nanoparticle clusters as labels, with a microfluidic device comprising multiple channels, a robust platform for the sensitive duplex detection of pathogen antigens has been developed. Highly sensitive detection for individual Entamoeba histolytica antigen EHI_115350 (limit of detection = 1 pg/mL, corresponding to 58.8 fM) and EHI_182030 (10 pg/mL, corresponding 453 fM) with high specificity has been achieved, employing the newly developed corresponding NYscFv as probe in combination with SERS microspectroscopy at a single laser excitation wavelength. Our first report on SERS-based immunoassays using the novel NYscFv affinity reagent demonstrates the flexibility of NYscFv fragments as viable alternatives to monoclonal antibodies in a range of bioassay platforms and paves the way for further applications.

  17. Bacteria Murmur: Application of an Acoustic Biosensor for Plant Pathogen Detection.

    Directory of Open Access Journals (Sweden)

    George Papadakis

    Full Text Available A multi-targeting protocol for the detection of three of the most important bacterial phytopathogens, based on their scientific and economic importance, was developed using an acoustic biosensor (the Quartz Crystal Microbalance for DNA detection. Acoustic detection was based on a novel approach where DNA amplicons were monitored and discriminated based on their length rather than mass. Experiments were performed during real time monitoring of analyte binding and in a direct manner, i.e. without the use of labels for enhancing signal transduction. The proposed protocol improves time processing by circumventing gel electrophoresis and can be incorporated as a routine detection method in a diagnostic lab or an automated lab-on-a-chip system for plant pathogen diagnostics.

  18. Bacteria Murmur: Application of an Acoustic Biosensor for Plant Pathogen Detection.

    Science.gov (United States)

    Papadakis, George; Skandalis, Nicholas; Dimopoulou, Anastasia; Glynos, Paraskevas; Gizeli, Electra

    2015-01-01

    A multi-targeting protocol for the detection of three of the most important bacterial phytopathogens, based on their scientific and economic importance, was developed using an acoustic biosensor (the Quartz Crystal Microbalance) for DNA detection. Acoustic detection was based on a novel approach where DNA amplicons were monitored and discriminated based on their length rather than mass. Experiments were performed during real time monitoring of analyte binding and in a direct manner, i.e. without the use of labels for enhancing signal transduction. The proposed protocol improves time processing by circumventing gel electrophoresis and can be incorporated as a routine detection method in a diagnostic lab or an automated lab-on-a-chip system for plant pathogen diagnostics.

  19. Agarose-based microfluidic device for point-of-care concentration and detection of pathogen.

    Science.gov (United States)

    Li, Yiwei; Yan, Xinghua; Feng, Xiaojun; Wang, Jie; Du, Wei; Wang, Yachao; Chen, Peng; Xiong, Liang; Liu, Bi-Feng

    2014-11-04

    Preconcentration of pathogens from patient samples represents a great challenge in point-of-care (POC) diagnostics. Here, a low-cost, rapid, and portable agarose-based microfluidic device was developed to concentrate biological fluid from micro- to picoliter volume. The microfluidic concentrator consisted of a glass slide simply covered by an agarose layer with a binary tree-shaped microchannel, in which pathogens could be concentrated at the end of the microchannel due to the capillary effect and the strong water permeability of the agarose gel. The fluorescent Escherichia coli strain OP50 was used to demonstrate the capacity of the agarose-based device. Results showed that 90% recovery efficiency could be achieved with a million-fold volume reduction from 400 μL to 400 pL. For concentration of 1 × 10(3) cells mL(-1) bacteria, approximately ten million-fold enrichment in cell density was realized with volume reduction from 100 μL to 1.6 pL. Urine and blood plasma samples were further tested to validate the developed method. In conjugation with fluorescence immunoassay, we successfully applied the method to the concentration and detection of infectious Staphylococcus aureus in clinics. The agarose-based microfluidic concentrator provided an efficient approach for POC detection of pathogens.

  20. Detection of Bacterial Wilt Pathogen and Isolation of Its Bacteriophage from Banana in Lumajang Area, Indonesia

    Directory of Open Access Journals (Sweden)

    Hardian Susilo Addy

    2016-01-01

    Full Text Available Bacterial wilt disease on banana is an important disease in Lumajang District and causes severe yield loss. Utilizing bacteriophage as natural enemy of pathogenic bacteria has been widely known as one of the control strategies. This research was aimed at determining the causing agent of bacterial wilt on banana isolated from Lumajang area, to obtain wide-host range bacteriophages against bacterial wilt pathogen and to know the basic characteristic of bacteriophages, particularly its nucleic acid type. Causative agent of bacterial wilt was isolated from symptomatic banana trees from seven districts in Lumajang area on determinative CPG plates followed by rapid detection by PCR technique using specific pair-primer. Bacteriophages were also isolated from soil of infected banana crop in Sukodono District. Morphological observation showed that all bacterial isolates have similar characteristic as common bacterial wilt pathogen, Ralstonia solanacearum. In addition, detection of FliC region in all isolates confirmed that all isolates were R. solanacearum according to the presence of 400 bp of FliC DNA fragment. Moreover, two bacteriophages were obtained from this experiment (ϕRSSKD1 and ϕRSSKD2, which were able to infect all nine R. solanacearum isolates. Nucleic acid analysis showed that the nucleic acid of bacteriophages was DNA (deoxyribonucleic acid.

  1. Real-time PCR for detection and quantification of fungal and oomycete tomato pathogens in plant and soil samples

    NARCIS (Netherlands)

    Lievens, B.; Brouwer, M.; Vanachter, A.C.R.C.; Cammue, B.P.A.; Thomma, B.P.H.J.

    2006-01-01

    Although new, rapid detection and identification technologies are becoming available more and more for various plant pathogens, pathogen quantification remains one of the main challenges in the disease management of many crops. Currently, real-time polymerase chain reaction (PCR) is the most straigh

  2. Nucleic Acid-Based Detection and Identification of Bacterial and Fungal Plant Pathogens - Final Report

    Energy Technology Data Exchange (ETDEWEB)

    Kingsley, Mark T.

    2001-03-13

    The threat to American interests from terrorists is not limited to attacks against humans. Terrorists might seek to inflict damage to the U.S. economy by attacking our agricultural sector. Infection of commodity crops by bacterial or fungal crop pathogens could adversely impact U.S. agriculture, either directly from damage to crops or indirectly from damage to our ability to export crops suspected of contamination. Recognizing a terrorist attack against U.S. agriculture, to be able to prosecute the terrorists, is among the responsibilities of the members of Hazardous Material Response Unit (HMRU) of the Federal Bureau of Investigation (FBI). Nucleic acid analysis of plant pathogen strains by the use of polymerase chain reaction (PCR) amplification techniques is a powerful method for determining the exact identity of pathogens, as well as their possible region of origin. This type of analysis, however, requires that PCR assays be developed specific to each particular pathogen strain, and analysis protocols developed that are specific to the particular instrument used for detection. The objectives of the work described here were threefold: 1) to assess the potential terrorist threat to U.S. agricultural crops, 2) to determine whether suitable assays exist to monitor that threat, and 3) where assays are needed for priority plant pathogen threats, to modify or develop those assays for use by specialists at the HMRU. The assessment of potential threat to U.S. commodity crops and the availability of assays for those threats were described in detail in the Technical Requirements Document (9) and will be summarized in this report. This report addresses development of specific assays identified in the Technical Requirements Document, and offers recommendations for future development to ensure that HMRU specialists will be prepared with the PCR assays they need to protect against the threat of economic terrorism.

  3. Detection of pathogenic mycobacteria based on functionalized quantum dots coupled with immunomagnetic separation.

    Directory of Open Access Journals (Sweden)

    Emmanouil Liandris

    Full Text Available Mycobacteria have always proven difficult to identify due to their low growth rate and fastidious nature. Therefore molecular biology and more recently nanotechnology, have been exploited from early on for the detection of these pathogens. Here we present the first stage of development of an assay incorporating cadmium selenide quantum dots (QDs for the detection of mycobacterial surface antigens. The principle of the assay is the separation of bacterial cells using magnetic beads coupled with genus-specific polyclonal antibodies and monoclonal antibodies for heparin-binding hemagglutinin. These complexes are then tagged with anti-mouse biotinylated antibody and finally streptavidin-conjugated QDs which leads to the detection of a fluorescent signal. For the evaluation of performance, the method under study was applied on Mycobacterium bovis BCG and Mycobacterium tuberculosis (positive controls, as well as E. coli and Salmonella spp. that constituted the negative controls. The direct observation of the latter category of samples did not reveal fluorescence as opposed to the mycobacteria mentioned above. The minimum detection limit of the assay was defined to 10(4 bacteria/ml, which could be further decreased by a 1 log when fluorescence was measured with a spectrofluorometer. The method described here can be easily adjusted for any other protein target of either the pathogen or the host, and once fully developed it will be directly applicable on clinical samples.

  4. In situ DNA amplification with magnetic primers for the electrochemical detection of food pathogens.

    Science.gov (United States)

    Lermo, A; Campoy, S; Barbé, J; Hernández, S; Alegret, S; Pividori, M I

    2007-04-15

    A sensitive and selective genomagnetic assay for the electrochemical detection of food pathogens based on in situ DNA amplification with magnetic primers has been designed. The performance of the genomagnetic assay was firstly demonstrated for a DNA synthetic target by its double-hybridization with both a digoxigenin probe and a biotinylated capture probe, and further binding to streptavidin-modified magnetic beads. The DNA sandwiched target bound on the magnetic beads is then separated by using a magneto electrode based on graphite-epoxy composite. The electrochemical detection is finally achieved by an enzyme marker, anti-digoxigenin horseradish peroxidase (HRP). The novel strategy was used for the rapid and sensitive detection of polymerase chain reaction (PCR) amplified samples. Promising resultants were also achieved for the DNA amplification directly performed on magnetic beads by using a novel magnetic primer, i.e., the up PCR primer bound to magnetic beads. Moreover, the magneto DNA biosensing assay was able to detect changes at single nucleotide polymorphism (SNP) level, when stringent hybridization conditions were used. The reliability of the assay was tested for Salmonella spp., the most important pathogen affecting food safety.

  5. New Trends in Impedimetric Biosensors for the Detection of Foodborne Pathogenic Bacteria

    Directory of Open Access Journals (Sweden)

    Yixian Wang

    2012-03-01

    Full Text Available The development of a rapid, sensitive, specific method for the foodborne pathogenic bacteria detection is of great importance to ensure food safety and security. In recent years impedimetric biosensors which integrate biological recognition technology and impedance have gained widespread application in the field of bacteria detection. This paper presents an overview on the progress and application of impedimetric biosensors for detection of foodborne pathogenic bacteria, particularly the new trends in the past few years, including the new specific bio-recognition elements such as bacteriophage and lectin, the use of nanomaterials and microfluidics techniques. The applications of these new materials or techniques have provided unprecedented opportunities for the development of high-performance impedance bacteria biosensors. The significant developments of impedimetric biosensors for bacteria detection in the last five years have been reviewed according to the classification of with or without specific bio-recognition element. In addition, some microfluidics systems, which were used in the construction of impedimetric biosensors to improve analytical performance, are introduced in this review.

  6. Electrochemical impedance immunosensor for rapid detection of stressed pathogenic Staphylococcus aureus bacteria.

    Science.gov (United States)

    Bekir, Karima; Barhoumi, Houcine; Braiek, Mohamed; Chrouda, Amani; Zine, Nadia; Abid, Nabil; Maaref, Abdelrazek; Bakhrouf, Amina; Ouada, Hafedh Ben; Jaffrezic-Renault, Nicole; Mansour, Hedi Ben

    2015-10-01

    In this work, we report the adaptation of bacteria to stress conditions that induce instability of their cultural, morphological, and enzymatic characters, on which the identification of pathogenic bacteria is based. These can raise serious issues during the characterization of bacteria. The timely detection of pathogens is also a subject of great importance. For this reason, our objective is oriented towards developing an immunosensing system for rapid detection and quantification of Staphylococcus aureus. Polyclonal anti-S. aureus are immobilized onto modified gold electrode by self-assembled molecular monolayer (SAM) method. The electrochemical performances of the developed immunosensor were evaluated by impedance spectroscopy through the monitoring of the charge transfer resistance at the modified solid/liquid interface using ferri-/ferrocyanide as redox probe. The developed immunosensor was applied to detect stressed and resuscitate bacteria. As a result, a stable and reproducible immunosensor with sensitivity of 15 kΩ/decade and a detection limit of 10 CFU/mL was obtained for the S. aureus concentrations ranging from 10(1) to 10(7) CFU/mL. A low deviation in the immunosensor response (±10 %) was signed when it is exposed to stressed and not stressed bacteria.

  7. Detection of virulence factors and molecular typing of pathogenic Leptospira from capybara (Hydrochaeris hydrochaeris).

    Science.gov (United States)

    Jorge, Sérgio; Monte, Leonardo G; Coimbra, Marco Antonio; Albano, Ana Paula; Hartwig, Daiane D; Lucas, Caroline; Seixas, Fabiana K; Dellagostin, Odir A; Hartleben, Cláudia P

    2012-10-01

    Leptospirosis is a globally prevalent zoonosis caused by pathogenic Leptospira spp.; several serologic variants have reservoirs in synanthropic rodents. The capybara is the largest living rodent in the world, and it has a wide geographical distribution in Central and South America. This rodent is a significant source of Leptospira since the agent is shed via urine into the environment and is a potential public health threat. In this study, we isolated and identified by molecular techniques a pathogenic Leptospira from capybara in southern Brazil. The isolated strain was characterized by partial rpoB gene sequencing and variable-number tandem-repeats analysis as L. interrogans, serogroup Icterohaemorrhagiae. In addition, to confirm the expression of virulence factors, the bacterial immunoglobulin-like proteins A and B expression was detected by indirect immunofluorescence using leptospiral specific monoclonal antibodies. This report identifies capybaras as an important source of infection and provides insight into the epidemiology of leptospirosis.

  8. Rapid and high-throughput detection of highly pathogenic bacteria by Ibis PLEX-ID technology.

    Directory of Open Access Journals (Sweden)

    Daniela Jacob

    Full Text Available In this manuscript, we describe the identification of highly pathogenic bacteria using an assay coupling biothreat group-specific PCR with electrospray ionization mass spectrometry (PCR/ESI-MS run on an Ibis PLEX-ID high-throughput platform. The biothreat cluster assay identifies most of the potential bioterrorism-relevant microorganisms including Bacillus anthracis, Francisella tularensis, Yersinia pestis, Burkholderia mallei and pseudomallei, Brucella species, and Coxiella burnetii. DNA from 45 different reference materials with different formulations and different concentrations were chosen and sent to a service screening laboratory that uses the PCR/ESI-MS platform to provide a microbial identification service. The standard reference materials were produced out of a repository built up in the framework of the EU funded project "Establishment of Quality Assurances for Detection of Highly Pathogenic Bacteria of Potential Bioterrorism Risk" (EQADeBa. All samples were correctly identified at least to the genus level.

  9. Multiplexed lateral flow microarray assay for detection of citrus pathogens Xylella fastidiosa and Xanthomonas axonopodis pv citri

    Energy Technology Data Exchange (ETDEWEB)

    Cary; R. Bruce (Santa Fe, NM); Stubben, Christopher J. (Los Alamos, NM)

    2011-03-22

    The invention provides highly sensitive and specific assays for the major citrus pathogens Xylella fastidiosa and Xanthomonas axonopodis, including a field deployable multiplexed assay capable of rapidly assaying for both pathogens simultaneously. The assays are directed at particular gene targets derived from pathogenic strains that specifically cause the major citrus diseases of citrus variegated chlorosis (Xylella fastidiosa 9a5c) and citrus canker (Xanthomonas axonopodis pv citri). The citrus pathogen assays of the invention offer femtomole sensitivity, excellent linear dynamic range, and rapid and specific detection.

  10. A Multiplex PCR Assay for the Detection of Pathogenic Genes of EPEC, ETEC and EIEC

    Institute of Scientific and Technical Information of China (English)

    ZHANG Tienan; LI Jichang; LU Chengwu; HUO Guicheng

    2006-01-01

    A multiplex polymerase chain reaction (PCR) was developed to detect three pathogenic genes of enteropathogenic, enterotocigenic and enteroinvasive Escherichia coli.. In this study three different sets of oligonucleotide primer were simultaneously used, and in this way, specific fragments of 880, 600, 150 bp for EPEC eaeA,EIEC ipaH and ETEC ST genes were amplified, respectively. The best condition of the multiplex PCR was: after an initial heat denaturation step at 95℃ for 5 min, followed by 30 cycles of denaturation at 94 ℃ for 40 s, primer annealing at 51.3 ℃ for 40 s and extension at 72 ℃ for 1 min, final extension at 72 ℃ for 10 min. The detection limit of tively. It may be a good way for the detection and identification of Diarrhea-causing E. coli..

  11. High throughput, multiplexed pathogen detection authenticates plague waves in medieval Venice, Italy.

    Directory of Open Access Journals (Sweden)

    Thi-Nguyen-Ny Tran

    Full Text Available BACKGROUND: Historical records suggest that multiple burial sites from the 14th-16th centuries in Venice, Italy, were used during the Black Death and subsequent plague epidemics. METHODOLOGY/PRINCIPAL FINDINGS: High throughput, multiplexed real-time PCR detected DNA of seven highly transmissible pathogens in 173 dental pulp specimens collected from 46 graves. Bartonella quintana DNA was identified in five (2.9% samples, including three from the 16th century and two from the 15th century, and Yersinia pestis DNA was detected in three (1.7% samples, including two from the 14th century and one from the 16th century. Partial glpD gene sequencing indicated that the detected Y. pestis was the Orientalis biotype. CONCLUSIONS: These data document for the first time successive plague epidemics in the medieval European city where quarantine was first instituted in the 14th century.

  12. TEST KIT FOR THE DETECTION AND GENOTYPING OF HIGHLY PATHOGENIC INFLUENZA VIRUS A H5N1 BY REAL-TIME POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    S. V. Stepaniuk

    2014-06-01

    Full Text Available Results of the annual monitoring of epizooties indicate that highly pathogenic HPAI/H5N1 avian influenza widely circulated in Eurasian region. Over a period of 2010–2013 years more than 165 cases of outbreaks in 14 countries were found out. Ukraine became one of the first countries in Europe where in Autonomous Republic of Crimea in October 2005 outbreak of avian epizootic with HPAI/H5N1 was documented and until February 2008 more than 236,000 poultry were killed. Since then the question of monitoring of infected both migrating birds and poultry in places of cross contact in Ukraine remains of high priority. The test system is developed for identification and genotyping A H5N1 on three genes (M, H5 and N1 HPAI/H5N1 in real-time mode for polymerase chain reaction. Test kit capacity to detect HPAI/h5n1avian influenza virus and differentiate it from the other viral infection agents of birds and animals were studied by testing of HPAI/H5N1 virus isolated during mass infection outbreak in Crimea in 2005 and cultural specimens of other viral pathogens. It was established that the «DIA Real Avian Influenza» test kit was capable to detect RNA influenza A virus of high pathogenic H5N1 strains having high sensitivity (100% while RNA of the Crimean HPAI/H5N1 isolate studying and specificity (100% while RNA viruses of Newcastle birds disease, fowl powershift, syndrome of drop in egg production and horse influenza studying.

  13. Assessment of an extraction protocol to detect the major mastitis-causing pathogens in bovine milk.

    Science.gov (United States)

    Cressier, B; Bissonnette, N

    2011-05-01

    Despite all efforts to control its spread, mastitis remains the most costly disease for dairy farmers worldwide. One key component of better control of this disease is identification of the causative bacterial agent during udder infections in cows. Mastitis is complex, however, given the diversity of pathogens that must be identified. Development of a rapid and efficient bacterial species identification tool is thus necessary. This study was conducted to demonstrate the feasibility of bacterial DNA extraction for the automated molecular detection of major mastitis-causing pathogens directly in milk samples to complement traditional microbiological identification. Extraction and detection procedures were designed and optimized to achieve detection in a respectable time frame, at a reasonable cost, and with a high throughput capacity. The following species were identified: Staphylococcus aureus, Escherichia coli, Streptococcus uberis, Streptococcus agalactiae, Streptococcus dysgalactiae, and Klebsiella spp. (including Klebsiella oxytoca and Klebsiella pneumoniae). The detection procedure includes specific genomic DNA amplification by multiplex PCR for each species, separation by capillary electrophoresis, and laser-assisted automated detection. The specificity of the primers was assessed with a panel of bacteria representing mastitis-negative control species. The extraction protocol comprised multiple steps, starting with centrifugation for fat removal, followed by heating in the presence of a cation exchange resin to trap divalent ions. The analytical sensitivity was 100 cfu/mL for milk samples spiked with Staph. aureus, Strep. dysgalactiae, and E. coli, with a tendency for K. pneumoniae. The detection limit was 500 cfu/mL for Strep. uberis and Strep. agalactiae. The overall diagnostic sensitivity (95.4%) and specificity (97.3%) were determined in a double-blind randomized assay by processing 172 clinical milk samples with microbiological characterization as the

  14. Laser diagnostic technology for early detection of pathogen infestation in orange fruits

    Energy Technology Data Exchange (ETDEWEB)

    Giubileo, Gianfranco, E-mail: gianfranco.giubileo@frascati.enea.i [ENEA Frascati, Via E. Fermi 45, 00044 (Italy); Lai, Antonella; Piccinelli, Delinda [ENEA Frascati, Via E. Fermi 45, 00044 (Italy); Puiu, Adriana [Tor Vergata University of Rome, Faculty of Engineering, Via del Politecnico 1, 00133 Rome (Italy)

    2010-11-11

    Due to an increased expectation of food products that respect high quality and safety standards, there is a need for the growth of accurate, fast, objective and non-destructive technologies for quality determination of food and agricultural products. For this purpose, a diagnostic system based on laser photoacoustic spectroscopy (LPAS) was developed at ENEA Frascati Molecular Spectroscopy Laboratory (Italy). In the design of the photoacoustic detector, particular emphasis was placed in attaining a high sensitivity in detecting ethylene (ET) down to sub-parts per billion level (minimum detectable concentration 0.2 ppb). This was required due to the necessity to monitor and follow up ET production at a single fruit scale. ET is normally synthesised in very low amounts by healthy citrus fruits; however stress conditions such as pathogen attack may induce a substantial increase in the synthesised ET. In the present paper, the comparison between the ET emitted by healthy oranges (Citrus sinensis L. Osbeck) cv Navel and by Phytophthora citrophthora infested Navel orange fruits are reported. The obtained results show a well evident increase in ET emission from the infested fruit with respect to the healthy one, even 24 h after the inoculation with the pathogen; at that time the tissue necrosis was not yet visible, and the fruit was also not yet damaged. The possibility to perform a real time non-destructive detection of ET traces makes the LPAS a powerful tool for monitoring the healthy state of the citrus fruits.

  15. Leptospira wolffii, a potential new pathogenic Leptospira species detected in human, sheep and dog.

    Science.gov (United States)

    Zakeri, Sedigheh; Khorami, Nargess; Ganji, Zahra F; Sepahian, Neda; Malmasi, Abdol-Ali; Gouya, Mohammad Mehdi; Djadid, Navid D

    2010-03-01

    Leptospirosis is the most common zoonotic disease, which is transmitted to humans through contaminated water or direct exposure to the urine of infected animals. In this study, the presence and prevalence of Leptospira species in the infected samples of human (n=369) and sheep (n=75) sera and also dogs' urine (n=150), collected from four provinces of Iran, were investigated by using nested-PCR/RFLP assay followed by sequencing analysis. Nested-PCR assay detected that 98/369 (26.5%) human, 13/75 (17.33%) of sheep's sera and 33/150 (22%) dogs' urine samples were positive for Leptospira DNA. RFLP assay detected that all positive cases had either pathogenic or intermediate Leptospira species. By sequence analysis, Leptospira interrogans was the most prevalent species among the examined samples of human (53/82, 64.6%) and sheep (11/13, 84.6%). However, in dog samples, Leptospira wolffii (27/29, 93.1%) was detected for the first time and was the dominant species. The presence of L. wolffii with 100% identity in clinical human samples and animals suspected with Leptospira may provide evidence for circulation of L. wolffii and its role in transmission cycle within human and animal hosts. In addition, this species can be potentially pathogenic to human and probably animal hosts. A large epidemiology survey would be needed to define the presence and the prevalence of this species in global endemic regions.

  16. Exploration of Simple Analytical Approaches for Rapid Detection of Pathogenic Bacteria

    Energy Technology Data Exchange (ETDEWEB)

    Salma Rahman

    2005-12-17

    Many of the current methods for pathogenic bacterial detection require long sample-preparation and analysis time, as well as complex instrumentation. This dissertation explores simple analytical approaches (e.g., flow cytometry and diffuse reflectance spectroscopy) that may be applied towards ideal requirements of a microbial detection system, through method and instrumentation development, and by the creation and characterization of immunosensing platforms. This dissertation is organized into six sections. In the general Introduction section a literature review on several of the key aspects of this work is presented. First, different approaches for detection of pathogenic bacteria will be reviewed, with a comparison of the relative strengths and weaknesses of each approach, A general overview regarding diffuse reflectance spectroscopy is then presented. Next, the structure and function of self-assembled monolayers (SAMs) formed from organosulfur molecules at gold and micrometer and sub-micrometer patterning of biomolecules using SAMs will be discussed. This section is followed by four research chapters, presented as separate manuscripts. Chapter 1 describes the efforts and challenges towards the creation of imunosensing platforms that exploit the flexibility and structural stability of SAMs of thiols at gold. 1H, 1H, 2H, 2H-perfluorodecyl-1-thiol SAM (PFDT) and dithio-bis(succinimidyl propionate)-(DSP)-derived SAMs were used to construct the platform. Chapter 2 describes the characterization of the PFDT- and DSP-derived SAMs, and the architectures formed when it is coupled to antibodies as well as target bacteria. These studies used infrared reflection spectroscopy (IRS), X-ray photoelectron spectroscopy (XPS), and electrochemical quartz crystal microbalance (EQCM), Chapter 3 presents a new sensitive, and portable diffuse reflection based technique for the rapid identification and quantification of pathogenic bacteria. Chapter 4 reports research efforts in the

  17. Exploration of Simple Analytical Approaches for Rapid Detection of Pathogenic Bacteria

    Energy Technology Data Exchange (ETDEWEB)

    Rahman, Salma [Iowa State Univ., Ames, IA (United States)

    2005-01-01

    Many of the current methods for pathogenic bacterial detection require long sample-preparation and analysis time, as well as complex instrumentation. This dissertation explores simple analytical approaches (e.g., flow cytometry and diffuse reflectance spectroscopy) that may be applied towards ideal requirements of a microbial detection system, through method and instrumentation development, and by the creation and characterization of immunosensing platforms. This dissertation is organized into six sections. In the general Introduction section a literature review on several of the key aspects of this work is presented. First, different approaches for detection of pathogenic bacteria will be reviewed, with a comparison of the relative strengths and weaknesses of each approach, A general overview regarding diffuse reflectance spectroscopy is then presented. Next, the structure and function of self-assembled monolayers (SAMs) formed from organosulfur molecules at gold and micrometer and sub-micrometer patterning of biomolecules using SAMs will be discussed. This section is followed by four research chapters, presented as separate manuscripts. Chapter 1 describes the efforts and challenges towards the creation of imunosensing platforms that exploit the flexibility and structural stability of SAMs of thiols at gold. 1H, 1H, 2H, 2H-perfluorodecyl-1-thiol SAM (PFDT) and dithio-bis(succinimidyl propionate)-(DSP)-derived SAMs were used to construct the platform. Chapter 2 describes the characterization of the PFDT- and DSP-derived SAMs, and the architectures formed when it is coupled to antibodies as well as target bacteria. These studies used infrared reflection spectroscopy (IRS), X-ray photoelectron spectroscopy (XPS), and electrochemical quartz crystal microbalance (EQCM), Chapter 3 presents a new sensitive, and portable diffuse reflection based technique for the rapid identification and quantification of pathogenic bacteria. Chapter 4 reports research efforts in the

  18. Current molecular and emerging nanobiotechnology approaches for the detection of microbial pathogens.

    Science.gov (United States)

    Theron, Jacques; Eugene Cloete, Thomas; de Kwaadsteniet, Michele

    2010-11-01

    Waterborne microbial diseases are escalating worldwide increasing the need for powerful and sensitive diagnostics tools. Molecular methodologies, including immunological and nucleic acid-based methods, have only recently been applied in the water sector. Advances in nanotechnology and nanomaterials have opened the door for the development of new diagnostic tools with increased sensitivity and speed, and reduced cost and labor. Quantum dots, flo dots, gold nanoparticles, magnetic nanoparticles, carbon nanotubes, nanowires, and nanocantilevers, with their unique optical and physical properties, have already been applied in nanodiagnostics. Nanobiotechnology, once remaining technical and practical problems has been addressed, will play an important role in the detection of microbial pathogens.

  19. Detection of Pathogenic Biofilms with Bacterial Amyloid Targeting Fluorescent Probe, CDy11

    DEFF Research Database (Denmark)

    Jun-Young, Kim; Srikanta, Sahu; Yin-Hoe, Yau

    2016-01-01

    Bacterial biofilms are responsible for a wide range of persistent infections. In the clinic, diagnosis of biofilm-associated infections relies heavily on culturing methods, which fail to detect nonculturable bacteria. Identification of novel fluorescent probes for biofilm imaging will greatly...... facilitate diagnosis of pathogenic bacterial infection. Herein, we report a novel fluorescent probe, CDy11 (compound of designation yellow 11), which targets amyloid in the Pseudomonas aeruginosa biofilm matrix through a diversity oriented fluorescent library approach (DOFLA). CDy11 was further demonstrated...... for in vivo imaging of P. aeruginosa in implant and corneal infection mice models....

  20. Fluorescence in situ hybridization rapidly detects three different pathogenic bacteria in urinary tract infection samples.

    Science.gov (United States)

    Wu, Qing; Li, Yan; Wang, Ming; Pan, Xiao P; Tang, Yong F

    2010-11-01

    The detection of pathogenic bacteria in urine is an important criterion for diagnosing urinary tract infections (UTIs). By using fluorescence in situ hybridization (FISH) with rRNA-targeted, fluorescently labeled oligonucleotide probes, bacterial pathogens present in urine samples were identified within 3-4 h. In this study, three probes that are specific for Escherichia coli, Enterococcus faecalis and Staphylococcus aureus were designed based on the conserved 16S RNA sequences, whereas probe Eub338 broadly recognizes all bacteria. We collected a total of 1000 urine samples, and 325 of these samples tested positive for a UTI via traditional culturing techniques; additionally, all 325 of these samples tested positive with the Eub338 probe in FISH analysis. FISH analyses with species-specific probes were performed in parallel to the test the ability to differentiate among several pathogenic bacteria. The samples for these experiments included 76 E. coli infected samples, 32 E. faecalis infected samples and 9 S. aureus infected samples. Compared to conventional methods of bacterial identification, the FISH method produced positive results for >90% of the samples tested. FISH has the potential to become an extremely useful diagnostic tool for UTIs because it has a quick turnaround time and high accuracy.

  1. Colour-based Object Detection and Tracking for Autonomous Quadrotor UAV

    Science.gov (United States)

    Kadouf, Hani Hunud A.; Mohd Mustafah, Yasir

    2013-12-01

    With robotics becoming a fundamental aspect of modern society, further research and consequent application is ever increasing. Aerial robotics, in particular, covers applications such as surveillance in hostile military zones or search and rescue operations in disaster stricken areas, where ground navigation is impossible. The increased visual capacity of UAV's (Unmanned Air Vehicles) is also applicable in the support of ground vehicles to provide supplies for emergency assistance, for scouting purposes or to extend communication beyond insurmountable land or water barriers. The Quadrotor, which is a small UAV has its lift generated by four rotors and can be controlled by altering the speeds of its motors relative to each other. The four rotors allow for a higher payload than single or dual rotor UAVs, which makes it safer and more suitable to carry camera and transmitter equipment. An onboard camera is used to capture and transmit images of the Quadrotor's First Person View (FPV) while in flight, in real time, wirelessly to a base station. The aim of this research is to develop an autonomous quadrotor platform capable of transmitting real time video signals to a base station for processing. The result from the image analysis will be used as a feedback in the quadrotor positioning control. To validate the system, the algorithm should have the capacity to make the quadrotor identify, track or hover above stationary or moving objects.

  2. A microfluidic-based hybrid SPR/molecular imaging biosensor for the multiplexed detection of foodborne pathogens

    Science.gov (United States)

    Zordan, Michael D.; Grafton, Meggie M. G.; Acharya, Ghanashyam; Reece, Lisa M.; Aronson, Arthur I.; Park, Kinam; Leary, James F.

    2009-02-01

    It is important to screen our food supply for pathogen contaminations. Current methods to screen for bacterial contamination involve using costly reagents such as antibodies or PCR reagents or time-costly growth in cultures. There is need for portable, real-time, multiplex pathogen detection technology that can predict the safety of food where it is produced or distributed. Surface plasmon resonance (SPR) imaging is a sensitive, label-free method that can detect the binding of an analyte to a surface due to changes in refractive index that occur upon binding. It can be used for label-free detection of the presence of potential pathogens. Simultaneous fluorescence molecular imaging on the other side of the biochip can be used to ascertain pathogen status or functional state which may affect its potential danger to humans or animals. We are designing and testing hybrid microfluidic biochips to detect multiple pathogens using a combination of SPRI and fluorescence imaging. The device consists of an array of gold spots, each functionalized with a peptide targeting a specific pathogen. This peptide biosensor array is enclosed by a PDMS microfluidic flow chamber that delivers a magnetically concentrated sample to be tested. An SPR image is taken from the bottom of the biochip. Image analysis is used to quantify the amount of pathogen (both live and dead) bound to each spot. Since PDMS is very transmissive to visible light, an epi-fluorescence image is taken from the top of the biochip. Fluorescence imaging determines the live:dead ratio of each pathogen using an inexpensive SYTO 9(R)-Propidium Iodide assay. The volume of sample that the biochip can analyze is small, so possible pathogens are pre-concentrated using immunomagnetic separation. Functionalized magnetic particles are bound to pathogens present in the sample, and a magnet is used to separate them from the bulk fluid.

  3. Quantitative molecular detection of 19 major pathogens in the interdental biofilm of periodontally healthy young adults

    Directory of Open Access Journals (Sweden)

    Florence eCarrouel

    2016-06-01

    Full Text Available In oral health, the interdental spaces are a real ecological niche for which the body has few or no alternative defenses and where the traditional daily methods for control by disrupting biofilm are not adequate. The interdental spaces are the source of many hypotheses regarding their potential associations with and/or causes of cardiovascular disease, diabetes, chronic kidney disease, degenerative disease, and depression. This PCR study is the first to describe the interdental microbiota in healthy adults aged 18-35 yrs old with reference to the Socransky complexes. The complexes tended to reflect microbial succession events in developing dental biofilms. Early colonizers included members of the yellow, green and purple complexes. The orange complex bacteria generally appear after the early colonizers and include many putative periodontal pathogens, such as F. nucleatum. The red complex (P. gingivalis, T. forsythia and T. denticola was considered the climax community and is on the list of putative periodontal pathogens. The 19 major periodontal pathogens tested were expressed at various levels. F. nucleatum was the most abundant species, and the least abundant were A. viscosus, P. gingivalis and A. actino. a. The genome counts for E. corrodens, C. concisus, C. rectus, T. denticola and T. forsythensis increased significantly with subject age. The study highlights the observation that bacteria from the yellow complex (Streptococcus spp., S. mitis, the green complex (E. corrodens, C. gracilis, C. ochracea, C. sputigena, A. actino a, the purple complex (V. parvula, A. ondotolitycus and the blue complex (A. viscosus are correlated. Concerning the orange complex, F. nucleatum is the most abundant species in interdental biofilm. The red complex, which is recognized as the most important pathogen in adult periodontal disease, represents 8.08% of the 19 bacteria analyzed. P. gingivalis was detected in 19% of healthy subjects and represents 0.02% of the

  4. Simultaneous detection of pathogenic bacteria using agglutination test based on colored silica nanoparticles.

    Science.gov (United States)

    Yu, Hui; Zhao, Guangying; Dou, Wenchao

    2015-01-01

    Aimed to explore an agglutination test which can simultaneously detect two pathogenic bacteria, an agglutination test based on colored silica nanoparticles (colored-SiNps) was established in this work. Monodisperse colored-SiNps were used as agglutination test carriers; red-SiNps and blue-SiNps were prepared by reverse microemulsion with C.I. Reactive red 136 and C.I. Reactive Blue 14. Then the red-SiNps were sensitized with antibodies against E. sakazaki and denoted as IgG-red-SiNps; The blue-SiNps were coated with antibodies against S. pullorum and S. Gallinarum and denoted as IgGblue- SiNps. The mixture solution of IgG-red-SiNps and IgG-blue-SiNps could simultaneously agglutinate with E. sakazakii and S. pullorum and S. gallinarum on glass slide. The E. sakazakii and S. pullorum and S. gallinarum could be simultaneously detected by agglutination test with obvious agglutination phenomena. The E. sakazakii and S. pullorum and S. gallinarum could both be detected in a range from 4×10(3) to 4×10(9) CFU/mL. The pullorum and S. gallinarum and E. sakazakii in the infected food sample were detected by mixture solution of IgG-red-SiNps and IgG-blue-SiNps too. This agglutination test was easy and rapid, it might be useful for in situ rapid detection method for simultaneously screening different pathogenic microorganisms of foods and feeds in the field.

  5. Surface plasmon resonance biosensors for detection of pathogenic microorganisms: strategies to secure food and environmental safety.

    Science.gov (United States)

    Bergwerff, Aldert A; van Knapen, Frans

    2006-01-01

    This review describes the exploitation of exclusively optical surface plasmon resonance (SPR) biosensors for the direct and indirect detection of pathogenic microorganisms in food chains and the environment. Direct detection is, in most cases, facilitated by the use of defined monoclonal or polyclonal antibodies raised against (a part of) the target pathogenic microorganisms. The antibodies were immobilized to a solid phase of the sensor to capture the microbe from the sample. Alternatively, antibodies were used in an inhibition-like assay involving incubation with the target organism prior to analysis of nonbound antibodies. The free immunoglobins were screened on a sensor surface coated with either purified antigens or with Fc or Fab binding antibodies. Discussed examples of these approaches are the determination of Escherichia coli O1 57:H7, Salmonella spp., and Listeria monocytogenes. Another direct detection strategy involved SPR analysis of polymerase chain reaction products of Shiga toxin-2 genes reporting the presence of E. coli O157:H7 in human stool. Metabolic products have been exploited as biomarkers for the presence of a microbial agent, such as enterotoxin B and a virulence factor for the occurrence of Staphylococcus aureus and Streptococcus suis, respectively. Indirect detection, on the other hand, is performed by analysis of a humoral immune response of the infected animal or human. By immobilization of specific antigenic structures, infections with Herpes simplex and human immunodeficiency viruses, Salmonella and Treponema pallidum bacteria, and Schistosoma spp. parasites were revealed using human, avian, and porcine sera and avian eggs. Bound antibodies were easily isotyped using an SPR biosensor to reveal the infection history of the individual. Discussed studies show the recent recognition of the suitability of this type of instrument for (rapid) detection of health-threatening microbes to food and environmental microbial safety.

  6. Hyperspectral imaging using a color camera and its application for pathogen detection

    Science.gov (United States)

    Yoon, Seung-Chul; Shin, Tae-Sung; Heitschmidt, Gerald W.; Lawrence, Kurt C.; Park, Bosoon; Gamble, Gary

    2015-02-01

    This paper reports the results of a feasibility study for the development of a hyperspectral image recovery (reconstruction) technique using a RGB color camera and regression analysis in order to detect and classify colonies of foodborne pathogens. The target bacterial pathogens were the six representative non-O157 Shiga-toxin producing Escherichia coli (STEC) serogroups (O26, O45, O103, O111, O121, and O145) grown in Petri dishes of Rainbow agar. The purpose of the feasibility study was to evaluate whether a DSLR camera (Nikon D700) could be used to predict hyperspectral images in the wavelength range from 400 to 1,000 nm and even to predict the types of pathogens using a hyperspectral STEC classification algorithm that was previously developed. Unlike many other studies using color charts with known and noise-free spectra for training reconstruction models, this work used hyperspectral and color images, separately measured by a hyperspectral imaging spectrometer and the DSLR color camera. The color images were calibrated (i.e. normalized) to relative reflectance, subsampled and spatially registered to match with counterpart pixels in hyperspectral images that were also calibrated to relative reflectance. Polynomial multivariate least-squares regression (PMLR) was previously developed with simulated color images. In this study, partial least squares regression (PLSR) was also evaluated as a spectral recovery technique to minimize multicollinearity and overfitting. The two spectral recovery models (PMLR and PLSR) and their parameters were evaluated by cross-validation. The QR decomposition was used to find a numerically more stable solution of the regression equation. The preliminary results showed that PLSR was more effective especially with higher order polynomial regressions than PMLR. The best classification accuracy measured with an independent test set was about 90%. The results suggest the potential of cost-effective color imaging using hyperspectral image

  7. [Autonomic neuropathies].

    Science.gov (United States)

    Siepmann, T; Penzlin, A I; Illigens, B M W

    2013-07-01

    Autonomic neuropathies are a heterogeneous group of diseases that involve damage of small peripheral autonomic Aδ- and C-fibers. Causes of autonomic nerve fiber damage are disorders such as diabetes mellitus and HIV-infection. Predominant symptoms of autonomic neuropathy are orthostatic hypotension, gastro-intestinal problems, urogenital dysfunction, and cardiac arrhythmia, which can severely impair the quality of life in affected patients. Furthermore, autonomic neuropathies can be induced by autoimmune diseases such as acute inflammatory demyelinating polyneuropathy, hereditary disorders such as the lysosomal storage disorder Fabry disease and hereditary sensory and autonomic neuropathies, as well as certain toxins and drugs.

  8. Deception detection with behavioral, autonomic, and neural measures: Conceptual and methodological considerations that warrant modesty.

    Science.gov (United States)

    Meijer, Ewout H; Verschuere, Bruno; Gamer, Matthias; Merckelbach, Harald; Ben-Shakhar, Gershon

    2016-05-01

    The detection of deception has attracted increased attention among psychological researchers, legal scholars, and ethicists during the last decade. Much of this has been driven by the possibility of using neuroimaging techniques for lie detection. Yet, neuroimaging studies addressing deception detection are clouded by lack of conceptual clarity and a host of methodological problems that are not unique to neuroimaging. We review the various research paradigms and the dependent measures that have been adopted to study deception and its detection. In doing so, we differentiate between basic research designed to shed light on the neurocognitive mechanisms underlying deceptive behavior and applied research aimed at detecting lies. We also stress the distinction between paradigms attempting to detect deception directly and those attempting to establish involvement by detecting crime-related knowledge, and discuss the methodological difficulties and threats to validity associated with each paradigm. Our conclusion is that the main challenge of future research is to find paradigms that can isolate cognitive factors associated with deception, rather than the discovery of a unique (brain) correlate of lying. We argue that the Comparison Question Test currently applied in many countries has weak scientific validity, which cannot be remedied by using neuroimaging measures. Other paradigms are promising, but the absence of data from ecologically valid studies poses a challenge for legal admissibility of their outcomes.

  9. Pathogenic chytrid fungus Batrachochytrium dendrobatidis, but not B. salamandrivorans, detected on eastern hellbenders.

    Directory of Open Access Journals (Sweden)

    Emma K Bales

    Full Text Available Recent worldwide declines and extinctions of amphibian populations have been attributed to chytridiomycosis, a disease caused by the pathogenic fungus Batrachochytrium dendrobatidis (Bd. Until recently, Bd was thought to be the only Batrachochytrium species that infects amphibians; however a newly described species, Batrachochytrium salamandrivorans (Bs, is linked to die-offs in European fire salamanders (Salamandra salamandra. Little is known about the distribution, host range, or origin of Bs. In this study, we surveyed populations of an aquatic salamander that is declining in the United States, the eastern hellbender (Cryptobranchus alleganiensis alleganiensis, for the presence of Bs and Bd. Skin swabs were collected from a total of 91 individuals in New York, Pennsylvania, Ohio, and Virginia, and tested for both pathogens using duplex qPCR. Bs was not detected in any samples, suggesting it was not present in these hellbender populations (0% prevalence, 95% confidence intervals of 0.0-0.04. Bd was found on 22 hellbenders (24% prevalence, 95% confidence intervals of 0.16 ≤ 0.24 ≤ 0.34, representing all four states. All positive samples had low loads of Bd zoospores (12.7 ± 4.9 S.E.M. genome equivalents compared to other Bd susceptible species. More research is needed to determine the impact of Batrachochytrium infection on hellbender fitness and population viability. In particular, understanding how hellbenders limit Bd infection intensity in an aquatic environment may yield important insights for amphibian conservation. This study is among the first to evaluate the distribution of Bs in the United States, and is consistent with another, which failed to detect Bs in the U.S. Knowledge about the distribution, host-range, and origin of Bs may help control the spread of this pathogen, especially to regions of high salamander diversity, such as the eastern United States.

  10. Pathogenic chytrid fungus Batrachochytrium dendrobatidis, but not B. salamandrivorans, detected on eastern hellbenders.

    Science.gov (United States)

    Bales, Emma K; Hyman, Oliver J; Loudon, Andrew H; Harris, Reid N; Lipps, Gregory; Chapman, Eric; Roblee, Kenneth; Kleopfer, John D; Terrell, Kimberly A

    2015-01-01

    Recent worldwide declines and extinctions of amphibian populations have been attributed to chytridiomycosis, a disease caused by the pathogenic fungus Batrachochytrium dendrobatidis (Bd). Until recently, Bd was thought to be the only Batrachochytrium species that infects amphibians; however a newly described species, Batrachochytrium salamandrivorans (Bs), is linked to die-offs in European fire salamanders (Salamandra salamandra). Little is known about the distribution, host range, or origin of Bs. In this study, we surveyed populations of an aquatic salamander that is declining in the United States, the eastern hellbender (Cryptobranchus alleganiensis alleganiensis), for the presence of Bs and Bd. Skin swabs were collected from a total of 91 individuals in New York, Pennsylvania, Ohio, and Virginia, and tested for both pathogens using duplex qPCR. Bs was not detected in any samples, suggesting it was not present in these hellbender populations (0% prevalence, 95% confidence intervals of 0.0-0.04). Bd was found on 22 hellbenders (24% prevalence, 95% confidence intervals of 0.16 ≤ 0.24 ≤ 0.34), representing all four states. All positive samples had low loads of Bd zoospores (12.7 ± 4.9 S.E.M. genome equivalents) compared to other Bd susceptible species. More research is needed to determine the impact of Batrachochytrium infection on hellbender fitness and population viability. In particular, understanding how hellbenders limit Bd infection intensity in an aquatic environment may yield important insights for amphibian conservation. This study is among the first to evaluate the distribution of Bs in the United States, and is consistent with another, which failed to detect Bs in the U.S. Knowledge about the distribution, host-range, and origin of Bs may help control the spread of this pathogen, especially to regions of high salamander diversity, such as the eastern United States.

  11. Characterization and molecular methods for detection of a novel spiroplasma pathogenic to Penaeus vannamei.

    Science.gov (United States)

    Nunan, Linda M; Pantoja, Carlos R; Salazar, Marcela; Aranguren, Fernando; Lightner, Donald V

    2004-12-13

    Traditionally, Spiroplasma spp. have only been isolated from the surfaces of flowers and other plant parts, from the guts and hemolymph of various insects, and from vascular plant fluids (phloem sap) and insects that feed on these fluids. In this article, we report the first pathogenic spiroplasma to be discovered in shrimp and the results of its characterization through histological evaluation, in situ hybridization assays, transmission electron microscopy, 16S rRNA sequence homology, and injection infectivity studies. In addition, molecular methods are described that were developed for the detection of this microorganism, which was determined to be the causative disease agent in Colombian farm-raised Penaeus vannamei suffering from high mortalities. Using standard histological methods and in situ hybridization assays, it was confirmed that P. vannamei was infected with this pathogenic spiroplasma. Histological analysis revealed systemic inflammatory reactions in affected organs/tissues. In an attempt to identify the bacteria, frozen infected P. vannamei samples, from the initial epizootic, were used to sequence the 16S rRNA gene and develop molecular detection methods. The 16S rRNA gene was amplified by PCR and then sequenced. The sequence data were analyzed using the GenBank BLAST search and the results revealed a 98% homology with Spiroplasma citri, a pathogen of citrus trees. The 16S rRNA sequence data were evaluated for development of unique PCR primers to the putative spiroplasma. Using PCR primers developed for the spiralin gene of Spiroplasma spp., a digoxigenin-labeled probe was developed and tested. This probe was species-specific, with no positive reactions or cross-reactivity occurring with other bacterial samples tested in this format.

  12. Detection and identification of intestinal pathogenic bacteria by hybridization to oligonucleotide microarrays

    Institute of Scientific and Technical Information of China (English)

    Lian-Qun Jin; Jun-Wen Li; Sheng-Qi Wang; Fu-Huan Chao; Xin-Wei Wang; Zheng-Quan Yuan

    2005-01-01

    AIM: To detect the common intestinal pathogenic bacteria quickly and accurately.METHODS: A rapid (<3 h) experimental procedure was set up based upon the gene chip technology. Target genes were amplified and hybridized by oligonucleotide microarrays.RESULTS: One hundred and seventy strains of bacteria in pure culture belonging to 11 genera were successfully discriminated under comparatively same conditions, and a series of specific hybridization maps corresponding to each kind of bacteria were obtained. When this method was applied to 26 divided cultures, 25 (96.2%) were identified.CONCLUSION: Salmonella sp., Escherichia coli, Shigella sp., Listeria monocytogenes, Vibrio parahaemolyticus,Staphylococcus aureus, Proteus sp., Bacillus cereus,Vibrio cholerae, Enterococcus faecalis, Yersinia enterocolitica, and Campylobacter jejuni can be detected and identified by our microarrays. The accuracy, range,and discrimination power of this assay can be continually improved by adding further oligonucleotides to the arrays without any significant increase of complexity or cost.

  13. Monoclonal antibody-based Surface Plasmon Resonance sensors for pathogen detection

    DEFF Research Database (Denmark)

    Skottrup, Peter Durand

    2007-01-01

    , that can detect and quantify specific plant pathogens and map these to defined positions within the field, would enable the farm manager to perform a precise and targeted application of pesticides and thereby reduce and optimise the use of agrochemicals. The ideal scenario for precision agriculture...... will be concentrated at few and very large farms. In order to reduce the pesticide use, it is necessary for the farm manager to have detailed knowledge of the distribution of weeds, diseases and pests within the fields. However, field-monitoring by manual inspection is time consuming and expensive. Biosensors...... species. The subtractive inhibition assay was further developed for label-free detection using a Surface Plasmon Resonance sensor. The polyclonal anti-mouse IgM was immobilised on a sensor surface and used for capture and quantification of mAb8. Optimal regeneration conditions were identified and 20 m...

  14. Design of a multiplex PCR method for detection of toxigenic- pathogenic inVibrio cholerae

    Institute of Scientific and Technical Information of China (English)

    Imani Fooladi AA; Iman Islamieh D; Hosseini Doust R; Karami A; Marashi SM

    2013-01-01

    Objective:To study virulence and regulatory genes (hlyA,ctxB,tcpI) in clinical strains ofVibrio cholerae (V. cholerae), simultaneously.Methods:Three important genes,tcpI,hlyA andctxB were used for detection of toxigenic and pathogenicV. cholera by chain reaction assay method. Results:According to the results of thePCR, the incidence ofhlyA,tcpI, andctxB genes in clinical isolates was obtained as94.7% (72 sample),90.8% (69 sample), and92.1% (70 sample), respectively.Five strains possessed all genes exceptctxB, six strains possessed all genes except tcpI, four strains possessed all genes excepthlyA, one strain possessed onlyhlyA and60 strains contained a combination of three genes,IncludinghlyA,ctxB andtcpI.Conclusions:Result show that this method could be reliable to detect toxigenic-pathogenic strains ofV. cholerae in Iran.

  15. Modeling and simulation of DNA flow in a microfluidic-based pathogen detection system

    Energy Technology Data Exchange (ETDEWEB)

    Trebotich, D; Miller, G H

    2005-01-31

    We present simulation results from a new computational model of DNA flow in microfluidic devices. This work is important because computational models are needed to design miniaturized biomedical devices that are becoming the state-of-the-art in many significant applications including pathogen detection as well as continuous monitoring and drug delivery. Currently advanced algorithms in design tools are non-existent but necessary to understand the complex fluid and polymer dynamics involved in biological flow at small scales. Our model is based on a fully coupled fluid-particle numerical algorithm with both stochastic and deterministic components in a bead-rod polymer representation. We have applied this work to DNA extraction configurations in a microfluidic PCR chamber used in a pathogen detection system. We demonstrate our method on the test problem of flow of a single DNA molecule in a 2D packed array microchannel. We are also investigating mechanisms for molecular ''sticking'' using short range forces.

  16. Molecular detection of tick-borne pathogens in Ixodes ricinus from Moldova collected in 1960.

    Science.gov (United States)

    Movila, Alexandru; Toderas, Ion; Uspenskaia, Inga; Conovalov, Jurii

    2013-06-01

    This study is the first report about the prevalence of tick-borne pathogens, as well as their (co-)infection rates, in the museum-archived I. ricinus female ticks collected in Moldova in 1960. A total of 16.7% (21/126) ticks was mono-infected. Borrelia burgdorferi sensu stricto was revealed as the most abundant species (4.8%) followed by B. garinii (1.6%), B. afzelii (0.8%), B. valaisiana (0.8%), and B. lusitaniae (0.8%). DNA of Rickettsia helvetica (2.4%), R. monacensis (2.4%), Anaplasma phagocytophilum (2.4%), 'Candidatus Neoehrlichia mikurensis' (0.8%), and Babesia microti (0.8%) were also detected, indicating the occurrence of these emerging tick-borne microorganisms in Moldova since 1960 at least. In this study, we detected a co-infection (0.8%; 1/126 tested ticks) between B. microti and R. helvetica. Additional investigations are warranted to further characterize a historical snapshot of the distribution of tick-borne pathogens in Europe.

  17. 16S rRNA-based detection of oral pathogens in coronary atherosclerotic plaque

    Directory of Open Access Journals (Sweden)

    Mahendra Jaideep

    2010-01-01

    Full Text Available Background: Atherosclerosis develops as a response of the vessel wall to injury. Chronic bacterial infections have been associated with an increased risk for atherosclerosis and coronary artery disease. The ability of oral pathogens to colonize in coronary atheromatous plaque is well known. Aim: The aim of this study was to detect the presence of Treponema denticola, Porphyromonas gingivalis and Campylobacter rectus in the subgingival and atherosclerotic plaques of patients with coronary artery disease. Materials and Methods: Fifty-one patients in the age group of 40-80 years with coronary artery disease were selected for the study. DNA was extracted from the plaque samples. The specific primers for T. denticola, C. rectus and P. gingivalis were used to amplify a part of the 16S rRNA gene by polymerase chain reaction. Statistical Analysis Used: Chi-square analysis, correlation coefficient and prevalence percentage of the microorganisms were carried out for the analysis. Results: Of the 51 patients, T. denticola, C. rectus and P. gingivalis were detected in 49.01%, 21.51% and 45.10% of the atherosclerotic plaque samples. Conclusions: Our study revealed the presence of bacterial DNA of the oral pathogenic microorganisms in coronary atherosclerotic plaques. The presence of the bacterial DNA in the coronary atherosclerotic plaques in significant proportion may suggest the possible relationship between periodontal bacterial infection and genesis of coronary atherosclerosis.

  18. Development of a nested PCR assay to detect the pathogenic free-living amoeba Naegleria fowleri.

    Science.gov (United States)

    Réveiller, Fabienne L; Cabanes, Pierre-André; Marciano-Cabral, Francine

    2002-05-01

    Naegleria fowleri is the causative agent of primary amoebic meningoencephalitis, a fatal disease of the central nervous system that is acquired while swimming or diving in freshwater. A cDNA clone designated Mp2C15 obtained from N. fowleri was used as a probe to distinguish N. fowleri from other free-living amoebae. The Mp2C15 probe hybridized to genomic DNA from pathogenic N. fowleri and antigenically related non-pathogenic N. lovaniensis. Mp2C15 was digested with the restriction enzyme XbaI, resulting in two fragments, Mp2C15.G and Mp2C15.P. Four species of Naegleria and four species of Acanthamoeba were examined for reactivity with Mp2C15.P. Mp2C15.P was specific for N. fowleri and was used in the development of a nested PCR assay which is capable of detecting as little as 5 pg of N. fowleri DNA or five intact N. fowleri amoebae. In summary, a rapid, sensitive, and specific assay for the detection of N. fowleri was developed.

  19. Differential efficiency among DNA extraction methods influences detection of the amphibian pathogen Batrachochytrium dendrobatidis.

    Science.gov (United States)

    Bletz, M C; Rebollar, E A; Harris, R N

    2015-02-10

    Chytridiomycosis, caused by the fungal pathogen Batrachochytrium dendrobatidis (Bd), is responsible for massive declines and extinctions of amphibians worldwide. The most common method for detecting Bd is quantitative polymerase chain reaction (qPCR). qPCR is a highly sensitive detection technique, but its ability to determine the presence and accurately quantify the amount of Bd is also contingent on the efficiency of the DNA extraction method used prior to PCR. Using qPCR, we compared the extraction efficiency of 3 different extraction methods commonly used for Bd detection across a range of zoospore quantities: PrepMan Ultra Reagent, Qiagen DNeasy Blood and Tissue Kit, and Mobio PowerSoil DNA Isolation Kit. We show that not all extraction methods led to successful detection of Bd for the low zoospore quantities and that there was variation in the estimated zoospore equivalents among the methods, which demonstrates that these methods have different extraction efficiencies. These results highlight the importance of considering the extraction method when comparing across studies. The Qiagen DNeasy kit had the highest efficiency. We also show that replicated estimates of less than 1 zoospore can result from known zoospore concentrations; therefore, such results should be considered when obtained from field data. Additionally, we discuss the implications of our findings for interpreting previous studies and for conducting future Bd surveys. It is imperative to use the most efficient DNA extraction method in tandem with the highly sensitive qPCR technique in order to accurately diagnose the presence of Bd as well as other pathogens.

  20. Method for detection of a few pathogenic bacteria and determination of live versus dead cells

    Science.gov (United States)

    Horikawa, Shin; Chen, I.-Hsuan; Du, Songtao; Liu, Yuzhe; Wikle, Howard C.; Suh, Sang-Jin; Barbaree, James M.; Chin, Bryan A.

    2016-05-01

    This paper presents a method for detection of a few pathogenic bacteria and determination of live versus dead cells. The method combines wireless phage-coated magnetoelastic (ME) biosensors and a surface-scanning dectector, enabling real-time monitoring of the growth of specific bacteria in a nutrient broth. The ME biosensor used in this investigation is composed of a strip-shaped ME resonator upon which an engineered bacteriophage is coated to capture a pathogen of interest. E2 phage with high binding affinity for Salmonella Typhimurium was used as a model study. The specificity of E2 phage has been reported to be 1 in 105 background bacteria. The phage-coated ME biosensors were first exposed to a low-concentration Salmonella suspension to capture roughly 300 cells on the sensor surface. When the growth of Salmonella in the broth occurs, the mass of the biosensor increases, which results in a decrease in the biosensor's resonant frequency. Monitoring of this mass- induced resonant frequency change allows for real-time detection of the presence of Salmonella. Detection of a few bacteria is also possible by growing them to a sufficient number. The surface-scanning detector was used to measure resonant frequency changes of 25 biosensors sequentially in an automated manner as a function of time. This methodology offers direct, real-time detection, quantification, and viability determination of specific bacteria. The rate of the sensor's resonant frequency change was found to be largely dependent on the number of initially bound cells and the efficiency of cell growth.

  1. Molecular detection of bacterial and parasitic pathogens in hard ticks from Portugal.

    Science.gov (United States)

    Maia, Carla; Ferreira, Andreia; Nunes, Mónica; Vieira, Maria Luísa; Campino, Lenea; Cardoso, Luís

    2014-06-01

    Ticks are important vector arthropods of human and animal pathogens. As information about agents of disease circulating in vectors in Portugal is limited, the aim of the present study was to detect bacteria and parasites with veterinary and zoonotic importance in ticks collected from dogs, cats, and field vegetation. A total of 925 ticks, comprising 888 (96.0%) adults, 8 (0.9%) nymphs, and 29 (3.1%) larvae, were collected in 4 geographic areas (districts) of Portugal. Among those, 620 (67.0%) were removed from naturally infested dogs, 42 (4.5%) from cats, and 263 (28.4%) were questing ticks obtained from field vegetation. Rhipicephalus sanguineus was the predominant tick species, and the only one collected from dogs and vegetation, while all Ixodes ricinus specimens (n=6) were recovered from cats. Rickettsia massiliae and Rickettsia conorii were identified in 35 ticks collected from cats and dogs and in 3 ticks collected from dogs. Among ticks collected from cats or dogs, 4 Rh. sanguineus specimens were detected with Hepatozoon felis, 3 with Anaplasma platys, 2 with Hepatozoon canis, one with Anaplasma phagocytophilum, one with Babesia vogeli, one with Borrelia burgdorferi sensu lato and one with Cercopithifilaria spp. Rickettsia helvetica was detected in one I. ricinus tick collected from a cat. To the best of our knowledge, this was the first time that Cercopithifilaria spp., Ba. vogeli, H. canis, and H. felis have been detected in ticks from Portugal. The wide range of tick-borne pathogens identified, some of zoonotic concern, suggests a risk for the emergence of tick-borne diseases in domestic animals and humans in Portugal. Further studies on these and other tick-borne agents should be performed to better understand their epidemiological and clinical importance, and to support the implementation of effective control measures.

  2. Identification of pathogenic microbial cells and spores by electrochemical detection on a biochip

    Directory of Open Access Journals (Sweden)

    Andresen Heiko

    2004-04-01

    Full Text Available Abstract Background Bacillus cereus constitutes a significant cause of acute food poisoning in humans. Despite the recent development of different detection methods, new effective control measures and better diagnostic tools are required for quick and reliable detection of pathogenic micro-organisms. Thus, the objective of this study was to determine a simple method for rapid identification of enterotoxic Bacillus strains. Here, a special attention is given to an electrochemical biosensor since it meets the requirements of minimal size, lower costs and decreased power consumption. Results A bead-based sandwich hybridization system was employed in conjugation with electric chips for detection of vegetative cells and spores of Bacillus strains based on their toxin-encoding genes. The system consists of a silicon chip based potentiometric cell, and utilizes paramagnetic beads as solid carriers of the DNA probes. The specific signals from 20 amol of bacterial cell or spore DNA were achieved in less than 4 h. The method was also successful when applied directly to unpurified spore and cell extract samples. The assay for the haemolytic enterotoxin genes resulted in reproducible signals from B. cereus and B. thuringiensis while haemolysin-negative B. subtilis strain did not yield any signal. Conclusions The sensitivity, convenience and specificity of the system have shown its potential. In this respect an electrochemical detection on a chip enabling a fast characterization and monitoring of pathogens in food is of interest. This system can offer a contribution in the rapid identification of bacteria based on the presence of specific genes without preceding nucleic acid amplification.

  3. Rapid Detection of Pathogenic Bacteria from Fresh Produce by Filtration and Surface-Enhanced Raman Spectroscopy

    Science.gov (United States)

    Wu, Xiaomeng; Han, Caiqin; Chen, Jing; Huang, Yao-Wen; Zhao, Yiping

    2016-04-01

    The detection of Salmonella Poona from cantaloupe cubes and E. coli O157:H7 from lettuce has been explored by using a filtration method and surface-enhanced Raman spectroscopy (SERS) based on vancomycin-functionalized silver nanorod array substrates. It is found that with a two-step filtration process, the limit of detection (LOD) of Salmonella Poona from cantaloupe cubes can be as low as 100 CFU/mL in less than 4 h, whereas the chlorophyll in the lettuce causes severe SERS spectral interference. To improve the LOD of lettuce, a three-step filtration method with a hydrophobic filter is proposed. The hydrophobic filter can effectively eliminate the interferences from chlorophyll and achieve a LOD of 1000 CFU/mL detection of E. coli O157:H7 from lettuce samples within 5 h. With the low LODs and rapid detection time, the SERS biosensing platform has demonstrated its potential as a rapid, simple, and inexpensive means for pathogenic bacteria detection from fresh produce.

  4. A Machine Learning Approach to Pedestrian Detection for Autonomous Vehicles Using High-Definition 3D Range Data.

    Science.gov (United States)

    Navarro, Pedro J; Fernández, Carlos; Borraz, Raúl; Alonso, Diego

    2016-12-23

    This article describes an automated sensor-based system to detect pedestrians in an autonomous vehicle application. Although the vehicle is equipped with a broad set of sensors, the article focuses on the processing of the information generated by a Velodyne HDL-64E LIDAR sensor. The cloud of points generated by the sensor (more than 1 million points per revolution) is processed to detect pedestrians, by selecting cubic shapes and applying machine vision and machine learning algorithms to the XY, XZ, and YZ projections of the points contained in the cube. The work relates an exhaustive analysis of the performance of three different machine learning algorithms: k-Nearest Neighbours (kNN), Naïve Bayes classifier (NBC), and Support Vector Machine (SVM). These algorithms have been trained with 1931 samples. The final performance of the method, measured a real traffic scenery, which contained 16 pedestrians and 469 samples of non-pedestrians, shows sensitivity (81.2%), accuracy (96.2%) and specificity (96.8%).

  5. Development of a real-time PCR for the detection of pathogenic Leptospira spp. in California sea lions

    Science.gov (United States)

    Rapid detection of pathogenic Leptospira spp. in marine mammals is challenging: microbiological culture can take 3-6 months and has low sensitivity, immunohistochemical staining of kidney to detect leptospires is invasive and time consuming, and serological methods, such as the microscopic agglutina...

  6. Preponderance of toxigenic Escherichia coli in stool pathogens correlates with toxin detection in accessible drinking-water sources.

    Science.gov (United States)

    Igbokwe, H; Bhattacharyya, S; Gradus, S; Khubbar, M; Griswold, D; Navidad, J; Igwilo, C; Masson-Meyers, D; Azenabor, A A

    2015-02-01

    Since early detection of pathogens and their virulence factors contribute to intervention and control strategies, we assessed the enteropathogens in diarrhoea disease and investigated the link between toxigenic strains of Escherichia coli from stool and drinking-water sources; and determined the expression of toxin genes by antibiotic-resistant E. coli in Lagos, Nigeria. This was compared with isolates from diarrhoeal stool and water from Wisconsin, USA. The new Luminex xTAG GPP (Gastroplex) technique and conventional real-time PCR were used to profile enteric pathogens and E. coli toxin gene isolates, respectively. Results showed the pathogen profile of stool and indicated a relationship between E. coli toxin genes in water and stool from Lagos which was absent in Wisconsin isolates. The Gastroplex technique was efficient for multiple enteric pathogens and toxin gene detection. The co-existence of antibiotic resistance with enteroinvasive E. coli toxin genes suggests an additional prognostic burden on patients.

  7. A Comparison between Transcriptome Sequencing and 16S Metagenomics for Detection of Bacterial Pathogens in Wildlife.

    Directory of Open Access Journals (Sweden)

    Maria Razzauti

    Full Text Available Rodents are major reservoirs of pathogens responsible for numerous zoonotic diseases in humans and livestock. Assessing their microbial diversity at both the individual and population level is crucial for monitoring endemic infections and revealing microbial association patterns within reservoirs. Recently, NGS approaches have been employed to characterize microbial communities of different ecosystems. Yet, their relative efficacy has not been assessed. Here, we compared two NGS approaches, RNA-Sequencing (RNA-Seq and 16S-metagenomics, assessing their ability to survey neglected zoonotic bacteria in rodent populations.We first extracted nucleic acids from the spleens of 190 voles collected in France. RNA extracts were pooled, randomly retro-transcribed, then RNA-Seq was performed using HiSeq. Assembled bacterial sequences were assigned to the closest taxon registered in GenBank. DNA extracts were analyzed via a 16S-metagenomics approach using two sequencers: the 454 GS-FLX and the MiSeq. The V4 region of the gene coding for 16S rRNA was amplified for each sample using barcoded universal primers. Amplicons were multiplexed and processed on the distinct sequencers. The resulting datasets were de-multiplexed, and each read was processed through a pipeline to be taxonomically classified using the Ribosomal Database Project. Altogether, 45 pathogenic bacterial genera were detected. The bacteria identified by RNA-Seq were comparable to those detected by 16S-metagenomics approach processed with MiSeq (16S-MiSeq. In contrast, 21 of these pathogens went unnoticed when the 16S-metagenomics approach was processed via 454-pyrosequencing (16S-454. In addition, the 16S-metagenomics approaches revealed a high level of coinfection in bank voles.We concluded that RNA-Seq and 16S-MiSeq are equally sensitive in detecting bacteria. Although only the 16S-MiSeq method enabled identification of bacteria in each individual reservoir, with subsequent derivation of

  8. Molecular techniques for detecting and typing of bacteria, advantages and application to foodborne pathogens isolated from ducks.

    Science.gov (United States)

    Adzitey, Frederick; Huda, Nurul; Ali, Gulam Rusul Rahmat

    2013-04-01

    In recent times, several foodborne pathogens have become important and a threat to public health. Surveillance studies have provided data and a better understanding into the existence and spread of foodborne pathogens. The application of molecular techniques for detecting and typing of foodborne pathogens in surveillance studies provide reliable epidemiological data for tracing the source of human infections. A wide range of molecular techniques (including pulsed field gel electrophoresis, multilocus sequence typing, random amplified polymorphism deoxyribonucleic acid, repetitive extragenic palindromic, deoxyribonucleic acid sequencing, multiplex polymerase chain reaction and many more) have been used for detecting, speciating, typing, classifying and/or characterizing foodborne pathogens of great significance to humans. Farm animals including chickens, cattle, sheep, goats and pigs, and others (such as domestic and wild animals) have been reported to be primary reservoirs for foodborne pathogens. The consumption of contaminated poultry meats or products has been considered to be the leading source of human foodborne infections. Ducks like other farm animals are important source of foodborne pathogens and have been implicated in some human foodborne illnesses and deaths. Nonetheless, few studies have been conducted to explore the potential of ducks in causing foodborne outbreaks, diseases and its consequences. This review highlights some common molecular techniques, their advantages and those that have been applied to pathogens isolated from ducks and their related sources.

  9. The application of loop-mediated isothermal amplification for detection of common pathogenic bacteria in lower respiratory tract infections

    Institute of Scientific and Technical Information of China (English)

    陈愉生

    2014-01-01

    Objective To investigate the spectrum of common pathogenic bacteria of low respiratory tract infection by loop-mediated isothermal amplification(LAMP)of nucleic acid test and to prove the clinical significance of this method.Methods A total of 289 qualified sputum samples from patients with lower respiratory tract infections in Fujian Province were detected by LAMP technique,and then the distribution of pathogenic bacteria was analyzed.The positive cases(the patients whose specific3

  10. Single walled carbon nanotube-based electrical biosensor for the label-free detection of pathogenic bacteria

    DEFF Research Database (Denmark)

    Yoo, S. M.; Baek, Y. K.; Shin, S.

    2016-01-01

    We herein describe the development of a single-walled carbon nanotube (SWNT)-based electrical biosensor consisting of a two-terminal resistor, and report its use for the specific, label-free detection of pathogenic bacteria via changes in conductance. The ability of this biosensor to recognize....... This SWNT-based electrical biosensor will prove useful for the development of highly sensitive and specific handheld pathogen detectors....

  11. CT-Guided Biopsy in Suspected Spondylodiscitis--The Association of Paravertebral Inflammation with Microbial Pathogen Detection.

    Directory of Open Access Journals (Sweden)

    Daniel Spira

    Full Text Available To search for imaging characteristics distinguishing patients with successful from those with futile microbiological pathogen detection by CT-guided biopsy in suspected spondylodiscitis.34 consecutive patients with suspected spondylodiscitis underwent CT-guided biopsy for pathogen detection. MR-images were assessed for inflammatory infiltration of disks, adjacent vertebrae, epidural and paravertebral space. CT-images were reviewed for arrosion of adjacent end plates and reduced disk height. Biopsy samples were sent for microbiological examination in 34/34 patients, and for additional histological analysis in 28/34 patients.Paravertebral infiltration was present in all 10/10 patients with positive microbiology and occurred in only 12/24 patients with negative microbiology, resulting in a sensitivity of 100% and a specificity of 50% for pathogen detection. Despite its limited sensitivities, epidural infiltration and paravertebral abscesses showed considerably higher specificities of 83.3% and 90.9%, respectively. Paravertebral infiltration was more extensive in patients with positive as compared to negative microbiology (p = 0.002. Even though sensitivities for pathogen detection were also high in case of vertebral and disk infiltration, or end plate arrosion, specificities remained below 10%.Inflammatory infiltration of the paravertebral space indicated successful pathogen detection by CT-guided biopsy. Specificity was increased by the additional occurrence of epidural infiltration or paravertebral abscesses.

  12. 3D model-based detection and tracking for space autonomous and uncooperative rendezvous

    Science.gov (United States)

    Shang, Yang; Zhang, Yueqiang; Liu, Haibo

    2015-10-01

    In order to fully navigate using a vision sensor, a 3D edge model based detection and tracking technique was developed. Firstly, we proposed a target detection strategy over a sequence of several images from the 3D model to initialize the tracking. The overall purpose of such approach is to robustly match each image with the model views of the target. Thus we designed a line segment detection and matching method based on the multi-scale space technology. Experiments on real images showed that our method is highly robust under various image changes. Secondly, we proposed a method based on 3D particle filter (PF) coupled with M-estimation to track and estimate the pose of the target efficiently. In the proposed approach, a similarity observation model was designed according to a new distance function of line segments. Then, based on the tracking results of PF, the pose was optimized using M-estimation. Experiments indicated that the proposed method can effectively track and accurately estimate the pose of freely moving target in unconstrained environment.

  13. The design of a microfluidic biochip for the rapid, multiplexed detection of foodborne pathogens by surface plasmon resonance imaging

    Science.gov (United States)

    Zordan, Michael D.; Grafton, Meggie M. G.; Park, Kinam; Leary, James F.

    2010-02-01

    The rapid detection of foodborne pathogens is increasingly important due to the rising occurrence of contaminated food supplies. We have previously demonstrated the design of a hybrid optical device that has the capability to perform realtime surface plasmon resonance (SPR) and epi-fluorescence imaging. We now present the design of a microfluidic biochip consisting of a two-dimensional array of functionalized gold spots. The spots on the array have been functionalized with capture peptides that specifically bind E. coli O157:H7 or Salmonella enterica. This array is enclosed by a PDMS microfluidic flow cell. A magnetically pre-concentrated sample is injected into the biochip, and whole pathogens will bind to the capture array. The previously constructed optical device is being used to detect the presence and identity of captured pathogens using SPR imaging. This detection occurs in a label-free manner, and does not require the culture of bacterial samples. Molecular imaging can also be performed using the epi-fluorescence capabilities of the device to determine pathogen state, or to validate the identity of the captured pathogens using fluorescently labeled antibodies. We demonstrate the real-time screening of a sample for the presence of E. coli O157:H7 and Salmonella enterica. Additionally the mechanical properties of the microfluidic flow cell will be assessed. The effect of these properties on pathogen capture will be examined.

  14. First molecular detection of tick-borne pathogens in dogs from Jiangxi, China

    Science.gov (United States)

    ZHENG, Weiqing; LIU, Mingming; MOUMOUNI, Paul Franck Adjou; LIU, Xiaoqing; EFSTRATIOU, Artemis; LIU, Zhanbin; LIU, Yangqing; TAO, Huiying; GUO, Huanping; WANG, Guanbo; GAO, Yang; LI, Zifen; RINGO, Aaron Edmund; JIRAPATTHARASATE, Charoonluk; CHEN, Haiying; XUAN, Xuenan

    2016-01-01

    In this study, blood samples obtained from 162 dogs in Jiangxi, China, were employed in molecular screening of canine tick-borne pathogens by PCR and sequencing. Babesia spp. gene fragment was detected in 12 (7.41%) dogs. All samples were negative for Hepatozoon spp., Ehrlichia canis, Coxiella spp., Borrelia spp., Rickettsia spp. and Anaplasma platys. Species-specific PCR analysis further confirmed that 8 (4.94%) and 4 (2.47%) dogs were infected by Babesia canis vogeli and Babesia gibsoni, respectively. Based on our analyses, Babesia spp. infection in Jiangxi appeared not related to age, gender, breed, usage, activity and health status or tick infestation history of the dogs. This is the first molecular report of Babesia canis vogeli and Babesia gibsoni in dogs from Jiangxi, China. PMID:27890889

  15. Quantitative polymerase chain reaction (PCR) for detection of aquatic animal pathogens in a diagnostic laboratory setting

    Science.gov (United States)

    Purcell, Maureen K.; Getchell, Rodman G.; McClure, Carol A.; Weber, S.E.; Garver, Kyle A.

    2011-01-01

    Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.

  16. Optimization of PMA-PCR Protocol for Viability Detection of Pathogens

    Science.gov (United States)

    Mikkelson, Brian J.; Lee, Christine M.; Ponce, Adrian

    2011-01-01

    This presented study demonstrates the need that PMA-PCR can be used to capture the loss of viability of a sample that is much more specific and time-efficient than alternative methods. This protocol is particularly useful in scenarios in which sterilization treatments may inactivate organisms but not degrade their DNA. The use of a PCR-based method of pathogen detection without first inactivating the DNA of nonviable cells will potentially lead to false positives. The loss of culturability, by heat-killing, did not prevent amplified PCR products, which supports the use of PMA to prevent amplification and differentiate between viable and dead cells. PMA was shown to inhibit the amplification of DNA by PCR in vegetative cells that had been heat-killed.

  17. Detection and characterization of potentially pathogenic Aeromonas sobria isolated from fish Hypophthalmichthys molitrix (Cypriniformes: Cyprinidae).

    Science.gov (United States)

    Dar, Gowhar H; Dar, Shoaib A; Kamili, Azra N; Chishti, Mohammad Z; Ahmad, Fayaz

    2016-02-01

    The current study focuses on the detection and characterization of potentially pathogenic Aeromonas sobria from fish silver carp (Hypophthalmichthys molitrix). Assessment of clinical, microbiological, pathological and biochemical characteristics of A. sobria were taken into account in order to understand the epidemiology, frequency and occurrence of this infection. Clinically the infected fish (H. molitrix) was observed for various types of symptoms. A total of 33 colonies of A. sobria strain were isolated from 20 cultured H. molitrix, collected from controlled fish pond. Microscopic examination revealed that the strains were rod-shaped, Gram negative bacteria. The revealed percent probability identification of A. sobria from the biochemical characterization in VITEK system was 93% with gram negative (GN) card. The histopathology of Gills caused by this bacterium, A. sobria indicate haemorrhagic gill epithelia and epithelial hyperplasia. Lamelar epithelial hypertrophy and hyperplasia with degenerative changes of the epithelium and hypertrophic epitheliocystis infected cells on gills of H. molitrix were observed during the present study.

  18. Dual Enlargement of Gold Nanoparticles: From Mechanism to Scanometric Detection of Pathogenic Bacteria

    DEFF Research Database (Denmark)

    Cao, Cuong; Gontard, Lionel Cervera; Le Ly, Tram Thuy

    2011-01-01

    A mechanism of dual enlargement of gold nanoparticles (AuNPs) comprising two steps is described. In the first step, the AuNPs are enlarged by depositing Au atoms on their crystalline faces. In this process, the particles are not only enlarged but they are also observed to multiply: new Au nuclei...... the electron density of the nanostructures, leading to a stronger intensity for colorimetric discrimination as well as better sensitivity for quantitative measurement. Based on this, a simple scanometric assay for the on‐slide detection of the food‐born pathogen Campylobacter jejuni is developed. After...... capturing the target bacteria, gold‐tagged immunoprobes are added to create a signal on a solid substrate. The signal is then amplified by the dual enlargement process, resulting in a strong color intensity that can easily be recognized by the unaided eye, or measured by an inexpensive flatbed scanner...

  19. Polymerase chain reaction detection of potentially pathogenic free-living amoebae in dental units.

    Science.gov (United States)

    Leduc, Annie; Gravel, Sabrina; Abikhzer, Jérémie; Roy, Stéphane; Barbeau, Jean

    2012-07-01

    Several genera of amoebae can be found in water from dental units and on the inner surface of waterlines. The presence of bacterial biofilms on these surfaces is thought to favor the proliferation of amoebae. Potentially pathogenic Acanthamoeba and Naegleria spp. may be an infection risk for patients through contact with open surgical sites or aerosolization. A polymerase chain reaction of DNA extracted from pelleted samples showed that Acanthamoeba spp. and Naegleria spp. were present in water from dental units, suction lines, and suction filters at the dental clinic of the Université de Montréal. Acanthamoeba spp. were detected in 24.2% of 66 samples and Naegleria spp. in 3.0%. We discuss the infection risk associated with these results.

  20. An autonomous image based approach for detecting glacial lake outburst floods

    Science.gov (United States)

    Koschitzki, R.; Schwalbe, E.; Maas, H.-G.

    2014-06-01

    The potential danger caused by glacier margin lakes and the related risk of glacier lake outburst floods (GLOF) increases constantly due to glaciers retreating in many parts of the world. Reasons for this development are on the one hand the new formation and enlargement of glacier margin lakes due to melt water. On the other hand, retreating and thinning glacier tongues lead to a decrease of the back pressure against the dammed glacier lakes. The paper describes the design of a photogrammetric GLOF monitoring system, based on monoscopic image sequence analysis for automatic detection of water level changes. The presented approach for measuring the water line in an image sequence is based on directional edge detection in LoG-filtered image data. After that, the water level is determined by a transformation of image measurements into object space based on orientation parameters of the camera and a geo-referenced lake basin model. The model can for instance be determined by photogrammetric methods after a GLOF; it may also be determined portion-wise by analysing shore lines at various water levels. Camera orientation parameters are determined by a local GPS-supported photogrammetric network. Comparing the determined water level changes with reference data provided by a water gauge, the precision is estimated in the order of one decimetre. A major challenge is the automatic detection of the water line in image sequences under varying light and visibility conditions. The paper will also discuss promising approaches such as multispectral images as well as a statistical analysis of grey value changes over short image sequences to eliminate disturbing reflections on the rough water surface.

  1. Real-Time PCR Methods for Detection of Foodborne Bacterial Pathogens in Meat and Meat Products

    Science.gov (United States)

    Hernández, Marta; Hansen, Flemming; Cook, Nigel; Rodríguez-Lázaro, David

    As a consequence of the potential hazards posed by the presence of microbial pathogens, microbiological quality control programmes are being increasingly applied throughout the meat production chain in order to minimize the risk of infection for the consumer. Classical microbiological methods to detect the presence of microorganisms, involving enrichment and isolation of presumptive colonies of bacteria on solid media, and final confirmation by biochemical and/or serological identification, although remaining the approach of choice in routine analytical laboratories, can be laborious and time consuming. The adoption of molecular techniques in microbial diagnostics has become a promising alternative approach, as they possess inherent advantages such as shorter time to results, excellent detection limits, specificity and potential for automation. Several molecular detection techniques have been devised in the last two decades, such as nucleic acid sequence-based amplification (NASBA) (Cook, 2003; Rodriguez-Lazaro, Hernandez, D’Agostino, & Cook, 2006) and loop-mediated isothermal amplification (Notomi et al., 2000), but the one which has undergone the most extensive development as a practical food analytical tool is the polymerase chain reaction (PCR) (Hoorfar & Cook, 2003; Malorny, Tassios, et al., 2003).

  2. Hyperspectral image reconstruction using RGB color for foodborne pathogen detection on agar plates

    Science.gov (United States)

    Yoon, Seung-Chul; Shin, Tae-Sung; Park, Bosoon; Lawrence, Kurt C.; Heitschmidt, Gerald W.

    2014-03-01

    This paper reports the latest development of a color vision technique for detecting colonies of foodborne pathogens grown on agar plates with a hyperspectral image classification model that was developed using full hyperspectral data. The hyperspectral classification model depended on reflectance spectra measured in the visible and near-infrared spectral range from 400 and 1,000 nm (473 narrow spectral bands). Multivariate regression methods were used to estimate and predict hyperspectral data from RGB color values. The six representative non-O157 Shiga-toxin producing Eschetichia coli (STEC) serogroups (O26, O45, O103, O111, O121, and O145) were grown on Rainbow agar plates. A line-scan pushbroom hyperspectral image sensor was used to scan 36 agar plates grown with pure STEC colonies at each plate. The 36 hyperspectral images of the agar plates were divided in half to create training and test sets. The mean Rsquared value for hyperspectral image estimation was about 0.98 in the spectral range between 400 and 700 nm for linear, quadratic and cubic polynomial regression models and the detection accuracy of the hyperspectral image classification model with the principal component analysis and k-nearest neighbors for the test set was up to 92% (99% with the original hyperspectral images). Thus, the results of the study suggested that color-based detection may be viable as a multispectral imaging solution without much loss of prediction accuracy compared to hyperspectral imaging.

  3. Surface enhanced Raman scattering (SERS) with biopolymer encapsulated silver nanosubstrates for rapid detection of foodborne pathogens.

    Science.gov (United States)

    Sundaram, Jaya; Park, Bosoon; Kwon, Yongkuk; Lawrence, Kurt C

    2013-10-01

    A biopolymer encapsulated with silver nanoparticles was prepared using silver nitrate, polyvinyl alcohol (PVA) solution, and trisodium citrate. It was deposited on a mica sheet to use as SERS substrate. Fresh cultures of Salmonella Typhimurium, Escherichia coli, Staphylococcus aureus and Listeria innocua were washed from chicken rinse and suspended in 10 ml of sterile deionized water. Approximately 5 μl of the bacterial suspensions was placed on the substrate individually and exposed to 785 nm HeNe laser excitation. SERS spectral data were recorded over the Raman shift between 400 and 1800 cm(-1) from 15 different spots on the substrate for each sample; and three replicates were done on each bacteria type. Principal component analysis (PCA) model was developed to classify foodborne bacteria types. PC1 identified 96% of the variation among the given bacteria specimen, and PC2 identified 3%, resulted in a total of 99% classification accuracy. Soft Independent Modeling of Class Analogies (SIMCA) of validation set gave an overall correct classification of 97%. Comparison of the SERS spectra of different types of gram-negative and gram-positive bacteria indicated that all of them have similar cell walls and cell membrane structures. Conversely, major differences were noted around the nucleic acid and amino acid structure information between 1200 cm(-1) and 1700 cm(-1) and at the finger print region between 400 cm(-1) and 700 cm(-1). Silver biopolymer nanoparticle substrate could be a promising SERS tool for pathogen detection. Also this study indicates that SERS technology could be used for reliable and rapid detection and classification of food borne pathogens.

  4. Comparison of individual and pooled sampling methods for detecting bacterial pathogens of fish

    Science.gov (United States)

    Mumford, Sonia; Patterson, Chris; Evered, J.; Brunson, Ray; Levine, J.; Winton, J.

    2005-01-01

    Examination of finfish populations for viral and bacterial pathogens is an important component of fish disease control programs worldwide. Two methods are commonly used for collecting tissue samples for bacteriological culture, the currently accepted standards for detection of bacterial fish pathogens. The method specified in the Office International des Epizooties Manual of Diagnostic Tests for Aquatic Animals permits combining renal and splenic tissues from as many as 5 fish into pooled samples. The American Fisheries Society (AFS) Blue Book/US Fish and Wildlife Service (USFWS) Inspection Manual specifies the use of a bacteriological loop for collecting samples from the kidney of individual fish. An alternative would be to more fully utilize the pooled samples taken for virology. If implemented, this approach would provide substantial savings in labor and materials. To compare the relative performance of the AFS/USFWS method and this alternative approach, cultures of Yersinia ruckeri were used to establish low-level infections in groups of rainbow trout (Oncorhynchus mykiss) that were sampled by both methods. Yersinia ruckeri was cultured from 22 of 37 groups by at least 1 method. The loop method yielded 18 positive groups, with 1 group positive in the loop samples but negative in the pooled samples. The pooled samples produced 21 positive groups, with 4 groups positive in the pooled samples but negative in the loop samples. There was statistically significant agreement (Spearman coefficient 0.80, P < 0.001) in the relative ability of the 2 sampling methods to permit detection of low-level bacterial infections of rainbow trout.

  5. Implementation of microfluidic sandwich ELISA for superior detection of plant pathogens.

    Directory of Open Access Journals (Sweden)

    Numrin Thaitrong

    Full Text Available Rapid and economical screening of plant pathogens is a high-priority need in the seed industry. Crop quality control and disease surveillance demand early and accurate detection in addition to robustness, scalability, and cost efficiency typically required for selective breeding and certification programs. Compared to conventional bench-top detection techniques routinely employed, a microfluidic-based approach offers unique benefits to address these needs simultaneously. To our knowledge, this work reports the first attempt to perform microfluidic sandwich ELISA for Acidovorax citrulli (Ac, watermelon silver mottle virus (WSMoV, and melon yellow spot virus (MYSV screening. The immunoassay occurs on the surface of a reaction chamber represented by a microfluidic channel. The capillary force within the microchannel draws a reagent into the reaction chamber as well as facilitates assay incubation. Because the underlying pad automatically absorbs excess fluid, the only operation required is sequential loading of buffers/reagents. Buffer selection, antibody concentrations, and sample loading scheme were optimized for each pathogen. Assay optimization reveals that the 20-folds lower sample volume demanded by the microchannel structure outweighs the 2- to 4-folds higher antibody concentrations required, resulting in overall 5-10 folds of reagent savings. In addition to cutting the assay time by more than 50%, the new platform offers 65% cost savings from less reagent consumption and labor cost. Our study also shows 12.5-, 2-, and 4-fold improvement in assay sensitivity for Ac, WSMoV, and MYSV, respectively. Practical feasibility is demonstrated using 19 real plant samples. Given a standard 96-well plate format, the developed assay is compatible with commercial fluorescent plate readers and readily amendable to robotic liquid handling systems for completely hand-free assay automation.

  6. Fast and sensitive detection of foodborne pathogen using electrochemical impedance analysis, urease catalysis and microfluidics.

    Science.gov (United States)

    Chen, Qi; Wang, Dan; Cai, Gaozhe; Xiong, Yonghua; Li, Yuntao; Wang, Maohua; Huo, Huiling; Lin, Jianhan

    2016-12-15

    Early screening of pathogenic bacteria is a key to prevent and control of foodborne diseases. In this study, we developed a fast and sensitive bacteria detection method integrating electrochemical impedance analysis, urease catalysis with microfluidics and using Listeria as model. The Listeria cells, the anti-Listeria monoclonal antibodies modified magnetic nanoparticles (MNPs), and the anti-Listeria polyclonal antibodies and urease modified gold nanoparticles (AuNPs) were incubated in a fluidic separation chip with active mixing to form the MNP-Listeria-AuNP-urease sandwich complexes. The complexes were captured in the separation chip by applying a high gradient magnetic field, and the urea was injected to resuspend the complexes and hydrolyzed under the catalysis of the urease on the complexes into ammonium ions and carbonate ions, which were transported into a microfluidic detection chip with an interdigitated microelectrode for impedance measurement to determine the amount of the Listeria cells. The capture efficiency of the Listeria cells in the separation chip was ∼93% with a shorter time of 30min due to the faster immuno-reaction using the active magnetic mixing. The changes on both impedance magnitude and phase angle were demonstrated to be able to detect the Listeria cells as low as 1.6×10(2)CFU/mL. The detection time was reduced from original ∼2h to current ∼1h. The recoveries of the spiked lettuce samples ranged from 82.1% to 89.6%, indicating the applicability of this proposed biosensor. This microfluidic impedance biosensor has shown the potential for online, automatic and sensitive bacteria separation and detection.

  7. Auto Landing Process for Autonomous Flying Robot by Using Image Processing Based on Edge Detection

    Directory of Open Access Journals (Sweden)

    Bahram Lavi Sefidgari

    2014-01-01

    Full Text Available In today’s technological life, everyone is quite familiar with the importance of security measures in our lives. So in this regard, many attempts have been made by researchers and one of them is flying robots technology. One well-known usage of flying robot, perhaps, is its capability in security and care measurements which made this device extremely practical, not only for its unmanned movement, but also for the unique manoeuvre during flight over the arbitrary areas. In this research, the automatic landing of a flying robot is discussed. The system is based on the frequent interruptions that is sent from main microcontroller to camera module in order to take images; these images have been distinguished by image processing system based on edge detection, after analysing the image the system can tell whether or not to land on the ground. This method shows better performance in terms of precision as well as experimentally.

  8. A species independent universal bio-detection microarray for pathogen forensics and phylogenetic classification of unknown microorganisms

    Directory of Open Access Journals (Sweden)

    McCormick John

    2011-06-01

    Full Text Available Abstract Background The ability to differentiate a bioterrorist attack or an accidental release of a research pathogen from a naturally occurring pandemic or disease event is crucial to the safety and security of this nation by enabling an appropriate and rapid response. It is critical in samples from an infected patient, the environment, or a laboratory to quickly and accurately identify the precise pathogen including natural or engineered variants and to classify new pathogens in relation to those that are known. Current approaches for pathogen detection rely on prior genomic sequence information. Given the enormous spectrum of genetic possibilities, a field deployable, robust technology, such as a universal (any species microarray has near-term potential to address these needs. Results A new and comprehensive sequence-independent array (Universal Bio-Signature Detection Array was designed with approximately 373,000 probes. The main feature of this array is that the probes are computationally derived and sequence independent. There is one probe for each possible 9-mer sequence, thus 49 (262,144 probes. Each genome hybridized on this array has a unique pattern of signal intensities corresponding to each of these probes. These signal intensities were used to generate an un-biased cluster analysis of signal intensity hybridization patterns that can easily distinguish species into accepted and known phylogenomic relationships. Within limits, the array is highly sensitive and is able to detect synthetically mixed pathogens. Examples of unique hybridization signal intensity patterns are presented for different Brucella species as well as relevant host species and other pathogens. These results demonstrate the utility of the UBDA array as a diagnostic tool in pathogen forensics. Conclusions This pathogen detection system is fast, accurate and can be applied to any species. Hybridization patterns are unique to a specific genome and these can be used

  9. Molecular-based detection of the gastrointestinal pathogen Campylobacter ureolyticus in unpasteurized milk samples from two cattle farms in Ireland

    Directory of Open Access Journals (Sweden)

    Koziel Monika

    2012-11-01

    Full Text Available Abstract Campylobacter jejuni and coli are collectively regarded as the most prevalent cause of bacterial foodborne illness worldwide. An emerging species, Campylobacter ureolyticus has recently been detected in patients with gastroenteritis, however, the source of this organism has, until now, remained unclear. Herein, we describe the molecular-based detection of this pathogen in bovine faeces (1/20 and unpasteurized milk (6/47 but not in poultry (chicken wings and caeca. This is, to the best of our knowledge, the first report of the presence of this potential gastrointestinal pathogen in an animal source, possibly suggesting a route for its transmission to humans.

  10. Impedance Biosensing to detect food allergens, endocrine disrupting chemicals, and food pathogens

    Science.gov (United States)

    Radhakrishnan, Rajeswaran

    Electrochemical impedance biosensors can be viewed as an AC electroanalytical method for the analyte detection in the fields of biomedicine, environmental monitoring, and food and agriculture, amongst others. The most common format for AC impedance biosensing involves surface immobilization of an antibody, receptor protein, DNA strand, or other species capable of bio-recognition, and AC impedance detection of the binding event. Technological application of AC impedance biosensors has been hindered by several obstacles, including the more complex circuitry required for AC relative to DC electrochemistry, chemical and physical interference arising from non-specific adsorption, and the stability and reproducibility of protein immobilization. One focus of these PhD studies is on methods to reduce or compensate for non-specific adsorption, including sample dilution, site blocking with BSA, and the use of control electrodes onto which reference antibodies are immobilized. Examples that will be presented include impedance detection of food pathogens, such as Listeria monocytogenes, using a mouse monoclonal antibody immobilized onto an Au electrode. This yields detection limits of 5 CFU/ml and 4 CFU/ml for ideal solutions and filtered tomato extract, respectively. Control experiments with an Au electrode onto which a mouse monoclonal antibody to GAPDH is immobilized demonstrate that non-specific adsorption is insignificant for the system and methodology studied here. Control experiments with Salmonella enterica demonstrate no cross-reactivity to this food pathogen. In addition, Detection of two endocrine-disrupting chemicals (EDC), norfluoxetine and BDE-47, is reported here by impedance biosensing, with a detection limit of 8.5 and 1.3 ng/ml for norfluoxetine and BDE-47, respectively. Additional research has focused on alternative substrates and linker chemistries for protein immobilization, including the use of degenerate (highly doped) Si and bidendate thiol monolayer

  11. Detection of hepatitis E virus and other livestock-related pathogens in Iowa streams

    Science.gov (United States)

    Manure application is a major source of pathogens to the environment. Through overland runoff and tile drainage, these pathogens contaminate surface water and stream bed sediment. Some of these pathogens are zoonotic that can potentially affect both animal and human health. This study examined the p...

  12. Rapid detection and identification of bacterial pathogens by using an ATP bioluminescence immunoassay.

    Science.gov (United States)

    Hunter, Dawn M; Lim, Daniel V

    2010-04-01

    Rapid identification of viable bacterial contaminants in food products is important because of their potential to cause disease. This study examined a method for microbial detection by using a combined ATP bioluminescence immunoassay. Escherichia coli O157:H7 and Salmonella enterica serovar Typhimurium were selected as target organisms because of their implication in foodborne illness. Various matrices containing the target cells were examined, including ground beef homogenate, apple juice, milk, and phosphate-buffered saline. Specific antibodies were immobilized on the surface of 96-well plates, and then the sample matrices containing target cells in the wells were incubated. Sample matrix (no cells) was used to establish background. The plates were washed, and the wells were incubated with BacTiter-Glo reagent in Mueller-Hinton II broth. Bioluminescent output was measured with the GloMax 96 luminometer. Signal-to-noise ratios were calculated, resulting in a limit of detection of 10(4) CFU/ml for both E. coli O157:H7 and Salmonella Typhimurium. The limit of detection for both species was not affected by the presence of nontarget cells. The various sample matrices did not affect signal-to-noise ratios when E. coli O157:H7 was the target. A weak matrix effect was observed when Salmonella Typhimurium was the target. A strong linear correlation was observed between the number of cells and luminescent output over 4 orders of magnitude for both species. This method provides a means of simultaneously detecting and identifying viable pathogens in complex matrices, and could have wider application in food microbiology.

  13. Comparison of the detection of periodontal pathogens in bacteraemia after tooth brushing by culture and molecular techniques

    Science.gov (United States)

    Figuero, Elena; González, Itziar; O´Connor, Ana; Diz, Pedro; Álvarez, Maximiliano; Herrera, David; Sanz, Mariano

    2016-01-01

    Background The prevalence and amounts of periodontal pathogens detected in bacteraemia samples after tooth brushing-induced by means of four diagnostic technique, three based on culture and one in a molecular-based technique, have been compared in this study. Material and Methods Blood samples were collected from thirty-six subjects with different periodontal status (17 were healthy, 10 with gingivitis and 9 with periodontitis) at baseline and 2 minutes after tooth brushing. Each sample was analyzed by three culture-based methods [direct anaerobic culturing (DAC), hemo-culture (BACTEC), and lysis-centrifugation (LC)] and one molecular-based technique [quantitative polymerase chain reaction (qPCR)]. With culture any bacterial isolate was detected and quantified, while with qPCR only Porphyromonas gingivalis and Aggregatibacter actinomycetemcomitans were detected and quantified. Descriptive analyses, ANOVA and Chi-squared tests, were performed. Results Neither BACTEC nor qPCR detected any type of bacteria in the blood samples. Only LC (2.7%) and DAC (8.3%) detected bacteraemia, although not in the same patients. Fusobacterium nucleatum was the most frequently detected bacterial species. Conclusions The disparity in the results when the same samples were analyzed with four different microbiological detection methods highlights the need for a proper validation of the methodology to detect periodontal pathogens in bacteraemia samples, mainly when the presence of periodontal pathogens in blood samples after tooth brushing was very seldom. Key words:Bacteraemia, periodontitis, culture, PCR, tooth brushing. PMID:26946197

  14. Modular microfluidic system fabricated in thermoplastics for the strain-specific detection of bacterial pathogens.

    Science.gov (United States)

    Chen, Yi-Wen; Wang, Hong; Hupert, Mateusz; Witek, Makgorzata; Dharmasiri, Udara; Pingle, Maneesh R; Barany, Francis; Soper, Steven A

    2012-09-21

    The recent outbreaks of a lethal E. coli strain in Germany have aroused renewed interest in developing rapid, specific and accurate systems for detecting and characterizing bacterial pathogens in suspected contaminated food and/or water supplies. To address this need, we have designed, fabricated and tested an integrated modular-based microfluidic system and the accompanying assay for the strain-specific identification of bacterial pathogens. The system can carry out the entire molecular processing pipeline in a single disposable fluidic cartridge and detect single nucleotide variations in selected genes to allow for the identification of the bacterial species, even its strain with high specificity. The unique aspect of this fluidic cartridge is its modular format with task-specific modules interconnected to a fluidic motherboard to permit the selection of the target material. In addition, to minimize the amount of finishing steps for assembling the fluidic cartridge, many of the functional components were produced during the polymer molding step used to create the fluidic network. The operation of the cartridge was provided by electronic, mechanical, optical and hydraulic controls located off-chip and packaged into a small footprint instrument (1 ft(3)). The fluidic cartridge was capable of performing cell enrichment, cell lysis, solid-phase extraction (SPE) of genomic DNA, continuous flow (CF) PCR, CF ligase detection reaction (LDR) and universal DNA array readout. The cartridge was comprised of modules situated on a fluidic motherboard; the motherboard was made from polycarbonate, PC, and used for cell lysis, SPE, CF PCR and CF LDR. The modules were task-specific units and performed universal zip-code array readout or affinity enrichment of the target cells with both made from poly(methylmethacrylate), PMMA. Two genes, uidA and sipB/C, were used to discriminate between E. coli and Salmonella, and evaluated as a model system. Results showed that the fluidic

  15. Vaginal microbicides: detecting toxicities in vivo that paradoxically increase pathogen transmission

    Directory of Open Access Journals (Sweden)

    Abusuwwa Raed

    2006-06-01

    Full Text Available Abstract Background Microbicides must protect against STD pathogens without causing unacceptable toxic effects. Microbicides based on nonoxynol-9 (N9 and other detergents disrupt sperm, HSV and HIV membranes, and these agents are effective contraceptives. But paradoxically N9 fails to protect women against HIV and other STD pathogens, most likely because it causes toxic effects that increase susceptibility. The mouse HSV-2 vaginal transmission model reported here: (a Directly tests for toxic effects that increase susceptibility to HSV-2, (b Determines in vivo whether a microbicide can protect against HSV-2 transmission without causing toxicities that increase susceptibility, and (c Identifies those toxic effects that best correlate with the increased HSV susceptibility. Methods Susceptibility was evaluated in progestin-treated mice by delivering a low-dose viral inoculum (0.1 ID50 at various times after delivering the candidate microbicide to detect whether the candidate increased the fraction of mice infected. Ten agents were tested – five detergents: nonionic (N9, cationic (benzalkonium chloride, BZK, anionic (sodium dodecylsulfate, SDS, the pair of detergents in C31G (C14AO and C16B; one surface active agent (chlorhexidine; two non-detergents (BufferGel®, and sulfonated polystyrene, SPS; and HEC placebo gel (hydroxyethylcellulose. Toxic effects were evaluated by histology, uptake of a 'dead cell' dye, colposcopy, enumeration of vaginal macrophages, and measurement of inflammatory cytokines. Results A single dose of N9 protected against HSV-2 for a few minutes but then rapidly increased susceptibility, which reached maximum at 12 hours. When applied at the minimal concentration needed for brief partial protection, all five detergents caused a subsequent increase in susceptibility at 12 hours of ~20–30-fold. Surprisingly, colposcopy failed to detect visible signs of the N9 toxic effect that increased susceptibility at 12 hours. Toxic

  16. SERS based immuno-microwell arrays for multiplexed detection of foodborne pathogenic bacteria

    Science.gov (United States)

    Sun, Jian; Hankus, Mikella E.; Cullum, Brian M.

    2009-05-01

    A novel surface enhanced Raman scattering (SERS)-based immuno-microwell array has been developed for multiplexed detection of foodborne pathogenic bacteria. The immuno-microwell array was prepared by immobilizing the optical addressable immunomagnetic beads (IMB) into the microwell array on one end of a fiber optic bundle. The IMBs, magnetic beads coated with specific antibody to specific bacteria, were used for immunomagnetic separation (IMS) of corresponding bacteria. The magnetic separation by the homemade magnetic separation system was evaluated in terms of the influences of several important parameters including the beads concentration, the sample volume and the separation time. IMS separation efficiency of the model bacteria E.coli O157:H7 was 63% in 3 minutes. The microwell array was fabricated on hydrofluoric acid etched end of a fiber optic bundle containing 30,000 fiber elements. After being coated with silver, the microwell array was used as a uniform SERS substrate with the relative standard deviation of the SERS enhancement across the microwell array < 2% and the enhancement factor as high as 2.18 x 107. The antibody modified microwell array was prepared for bacteria immobilization into the microwell array, which was characterized by a sandwich immunoassay. To demonstrate the potential of multiplexed SERS detection with the immuno-microwell array, the SERS spectra of different Raman dye labeled magnetic beads as well as mixtures were measured on the mircrowell array. In bead mixture, different beads were identified by the characteristic SERS bands of the corresponding Raman label.

  17. Prevalence and Characteristics of Enteric Pathogens Detected in Diarrhoeic and Non-Diarrhoeic Foals in Trinidad

    Directory of Open Access Journals (Sweden)

    Robin Harris

    2012-01-01

    Full Text Available The study determined the relative importance of Escherichia coli, E. coli O157, Salmonella spp., Clostridium spp., rotavirus, Cryptosporidium spp., and Strongyloides westeri in foal (diarrhoeic and non-diarrhoeic available for sampling during the foaling season of 2010 and determined their sensitivity to antimicrobial agents. A cross-sectional study was conducted on 164 foals (9 diarrhoeic and 155 non-diarrhoeic from 15 farms in Trinidad. Isolation and detection of enteric pathogens followed standard methods, and the antibiograms of E. coli and Salmonella spp. were determined using the disc diffusion method. All organisms investigated were detected except E. coli O157. A high prevalence of E. coli (85.0%, Cryptosporidium spp. (64.8%, Strongyloides westeri (35.7% was seen, but the prevalence was comparatively low for Clostridium spp. (12.9%, Salmonella spp. (4.4% and rotavirus (2.1%. Only Salmonella spp. was isolated at a statistically significantly (<0.05; 2 higher frequency from diarrhoeic (25.0% than non-diarrhoeic (4.0% foals. Amongst E. coli isolates, the frequency of resistance was higher in isolates from diarrhoeic compared with non-diarrhoeic foals but the difference was only statistically significant (<0.05; 2 for tetracycline. All isolates of Salmonella spp. were sensitive to streptomycin and sulphamethoxazole/trimethoprim, a finding that may have therapeutic significance.

  18. Molecular detection of multiple emerging pathogens in sputa from cystic fibrosis patients.

    Directory of Open Access Journals (Sweden)

    Fadi Bittar

    Full Text Available BACKGROUND: There is strong evidence that culture-based methods detect only a small proportion of bacteria present in the respiratory tracts of cystic fibrosis (CF patients. METHODOLOGY/PRINCIPAL FINDINGS: Standard microbiological culture and phenotypic identification of bacteria in sputa from CF patients have been compared to molecular methods by the use of 16S rDNA amplification, cloning and sequencing. Twenty-five sputa from CF patients were cultured that yield 33 isolates (13 species known to be pathogens during CF. For molecular cloning, 760 clones were sequenced (7.2+/-3.9 species/sputum, and 53 different bacterial species were identified including 16 species of anaerobes (30%. Discrepancies between culture and molecular data were numerous and demonstrate that accurate identification remains challenging. New or emerging bacteria not or rarely reported in CF patients were detected including Dolosigranulum pigrum, Dialister pneumosintes, and Inquilinus limosus. CONCLUSIONS/SIGNIFICANCE: Our results demonstrate the complex microbial community in sputa from CF patients, especially anaerobic bacteria that are probably an underestimated cause of CF lung pathology. Metagenomic analysis is urgently needed to better understand those complex communities in CF pulmonary infections.

  19. Detection of Foodborne Pathogens and Mycotoxins in Eggs and Chicken Feeds from Farms to Retail Markets

    Science.gov (United States)

    Lee, Minhwa; Seo, Dong Joo; Jeon, Su Been; Ok, Hyun Ee; Jung, Hyelee; Choi, Changsun; Chun, Hyang Sook

    2016-01-01

    Contamination by foodborne pathogens and mycotoxins was examined in 475 eggs and 20 feed samples collected from three egg layer farms, three egg-processing units, and five retail markets in Korea. Microbial contamination with Salmonella species, Escherichia coli, and Arcobacter species was examined by bacterial culture and multiplex polymerase chain reaction (PCR). The contamination levels of aflatoxins, ochratoxins, and zearalenone in eggs and chicken feeds were simultaneously analyzed with high-performance liquid chromatography coupled with fluorescence detection after the post-derivatization. While E. coli was isolated from 9.1% of eggs, Salmonella species were not isolated. Arcobacter species were detected in 0.8% of eggs collected from egg layers by PCR only. While aflatoxins, ochratoxins, and zearalenone were found in 100%, 100%, and 85% of chicken feeds, their contamination levels were below the maximum acceptable levels (1.86, 2.24, and 147.53 μg/kg, respectively). However, no eggs were contaminated with aflatoxins, ochratoxins, or zearalenone. Therefore, the risk of contamination by mycotoxins and microbes in eggs and chicken feeds is considered negligible and unlikely to pose a threat to human health. PMID:27621686

  20. Surface Generated Acoustic Wave Biosensors for the Detection of Pathogens: A Review

    Directory of Open Access Journals (Sweden)

    Antonio Arnau-Vives

    2009-07-01

    Full Text Available This review presents a deep insight into the Surface Generated Acoustic Wave (SGAW technology for biosensing applications, based on more than 40 years of technological and scientific developments. In the last 20 years, SGAWs have been attracting the attention of the biochemical scientific community, due to the fact that some of these devices - Shear Horizontal Surface Acoustic Wave (SH-SAW, Surface Transverse Wave (STW, Love Wave (LW, Flexural Plate Wave (FPW, Shear Horizontal Acoustic Plate Mode (SH-APM and Layered Guided Acoustic Plate Mode (LG-APM - have demonstrated a high sensitivity in the detection of biorelevant molecules in liquid media. In addition, complementary efforts to improve the sensing films have been done during these years. All these developments have been made with the aim of achieving, in a future, a highly sensitive, low cost, small size, multi-channel, portable, reliable and commercially established SGAW biosensor. A setup with these features could significantly contribute to future developments in the health, food and environmental industries. The second purpose of this work is to describe the state-of-the-art of SGAW biosensors for the detection of pathogens, being this topic an issue of extremely importance for the human health. Finally, the review discuses the commercial availability, trends and future challenges of the SGAW biosensors for such applications.

  1. Validation of high-throughput real time polymerase chain reaction assays for simultaneous detection of invasive citrus pathogens.

    Science.gov (United States)

    Saponari, Maria; Loconsole, Giuliana; Liao, Hui-Hong; Jiang, Bo; Savino, Vito; Yokomi, Raymond K

    2013-11-01

    A number of important citrus pathogens are spread by graft propagation, arthropod vector transmission and inadvertent import and dissemination of infected plants. For these reasons, citrus disease management and clean stock programs require pathogen detection systems which are economical and sensitive to maintain a healthy industry. To this end, multiplex quantitative real-time PCR (qPCR) assays were developed allowing high-throughput and simultaneous detection of some major invasive citrus pathogens. Automated high-throughput extraction comparing several bead-based commercial extraction kits were tested and compared with tissue print and manual extraction to obtain nucleic acids from healthy and pathogen-infected citrus trees from greenhouse in planta collections and field. Total nucleic acids were used as templates for pathogen detection. Multiplex reverse transcription-qPCR (RT-qPCR) assays were developed for simultaneous detection of six targets including a virus, two viroids, a bacterium associated with huanglongbing and a citrus RNA internal control. Specifically, two one-step TaqMan-based multiplex RT-qPCR assays were developed and tested with target templates to determine sensitivity and detection efficiency. The first assay included primers and probes for 'Candidatus Liberibacter asiaticus' (CLas) and Citrus tristeza virus (CTV) broad spectrum detection and genotype differentiation (VT- and T3-like genotypes). The second assay contained primers and probes for Hop stunt viroid (HSVd), Citrus exocortis viroid (CEVd) and the mitochondrial NADH dehydrogenase (nad5) mRNA as an internal citrus host control. Primers and TaqMan probes for the viroids were designed in this work; whereas those for the other pathogens were from reports of others. Based on quantitation cycle values, automated high-throughput extraction of samples proved to be as suitable as manual extraction. The multiplex RT-qPCR assays detected both RNA and DNA pathogens in the same dilution series

  2. Detection, fate and inactivation of pathogenic norovirus employing settlement and UV treatment in wastewater treatment facilities.

    Science.gov (United States)

    Barrett, M; Fitzhenry, K; O'Flaherty, V; Dore, W; Keaveney, S; Cormican, M; Rowan, N; Clifford, E

    2016-10-15

    It is accepted that discharged wastewaters can be a significant source of pathogenic viruses in receiving water bodies contributing to pollution and may in turn enter the human food chain and pose a risk to human health, thus norovirus (NoV) is often a predominant cause of gastroenteritis globally. Working with NoV poses particular challenges as it cannot be readily identified and detection by molecular methods does not assess infectivity. It has been proposed that the infectivity of NoV may be modelled through the use of an alternative virus; F-specific RNA (FRNA) bacteriophages; GA genotype and other FRNA bacteriophages have been used as a surrogate in studies of NoV inactivation. This study investigated the efficiency of novel pulsed ultraviolet irradiation and low pressure ultraviolet irradiation as a potential pathogen inactivation system for NoV and FRNA bacteriophage (GA) in secondary treated wastewaters. The role of UV dose and the impact of suspended solids concentration on removal efficiency were also examined. The study also investigated the role of settlement processes in wastewater treatment plants in removing NoV. While NoV inactivation could not be determined it was found that at a maximum UV dose of 6.9J/cm(2) (6900mJ/cm(2)) an average 2.4 log removal of FRNA bacteriophage (GA) was observed; indicating the potential need for high UV doses to remove NoV if FRNA bacteriophage prove a suitable indicator for NoV. The study found that increasing concentrations of suspended solids impacted on PUV efficiency however, it appears the extent of the impact may be site specific. Furthermore, the study found that settlement processes can play a significant role in the removal of FRNA bacteriophage, thus potentially NoV.

  3. Use of Metagenomic Shotgun Sequencing Technology To Detect Foodborne Pathogens within the Microbiome of the Beef Production Chain.

    Science.gov (United States)

    Yang, Xiang; Noyes, Noelle R; Doster, Enrique; Martin, Jennifer N; Linke, Lyndsey M; Magnuson, Roberta J; Yang, Hua; Geornaras, Ifigenia; Woerner, Dale R; Jones, Kenneth L; Ruiz, Jaime; Boucher, Christina; Morley, Paul S; Belk, Keith E

    2016-04-01

    Foodborne illnesses associated with pathogenic bacteria are a global public health and economic challenge. The diversity of microorganisms (pathogenic and nonpathogenic) that exists within the food and meat industries complicates efforts to understand pathogen ecology. Further, little is known about the interaction of pathogens within the microbiome throughout the meat production chain. Here, a metagenomic approach and shotgun sequencing technology were used as tools to detect pathogenic bacteria in environmental samples collected from the same groups of cattle at different longitudinal processing steps of the beef production chain: cattle entry to feedlot, exit from feedlot, cattle transport trucks, abattoir holding pens, and the end of the fabrication system. The log read counts classified as pathogens per million reads for Salmonella enterica,Listeria monocytogenes,Escherichia coli,Staphylococcus aureus, Clostridium spp. (C. botulinum and C. perfringens), and Campylobacter spp. (C. jejuni,C. coli, and C. fetus) decreased over subsequential processing steps. Furthermore, the normalized read counts for S. enterica,E. coli, and C. botulinumwere greater in the final product than at the feedlots, indicating that the proportion of these bacteria increased (the effect on absolute numbers was unknown) within the remaining microbiome. From an ecological perspective, data indicated that shotgun metagenomics can be used to evaluate not only the microbiome but also shifts in pathogen populations during beef production. Nonetheless, there were several challenges in this analysis approach, one of the main ones being the identification of the specific pathogen from which the sequence reads originated, which makes this approach impractical for use in pathogen identification for regulatory and confirmation purposes.

  4. Specific and Sensitive Isothermal Electrochemical Biosensor for Plant Pathogen DNA Detection with Colloidal Gold Nanoparticles as Probes

    Science.gov (United States)

    Lau, Han Yih; Wu, Haoqi; Wee, Eugene J. H.; Trau, Matt; Wang, Yuling; Botella, Jose R.

    2017-01-01

    Developing quick and sensitive molecular diagnostics for plant pathogen detection is challenging. Herein, a nanoparticle based electrochemical biosensor was developed for rapid and sensitive detection of plant pathogen DNA on disposable screen-printed carbon electrodes. This 60 min assay relied on the rapid isothermal amplification of target pathogen DNA sequences by recombinase polymerase amplification (RPA) followed by gold nanoparticle-based electrochemical assessment with differential pulse voltammetry (DPV). Our method was 10,000 times more sensitive than conventional polymerase chain reaction (PCR)/gel electrophoresis and could readily identify P. syringae infected plant samples even before the disease symptoms were visible. On the basis of the speed, sensitivity, simplicity and portability of the approach, we believe the method has potential as a rapid disease management solution for applications in agriculture diagnostics.

  5. Nodeomics: Pathogen Detection in Vertebrate Lymph Nodes Using Meta-Transcriptomics

    Science.gov (United States)

    Wittekindt, Nicola E.; Padhi, Abinash; Schuster, Stephan C.; Qi, Ji; Zhao, Fangqing; Tomsho, Lynn P.; Kasson, Lindsay R.; Packard, Michael; Cross, Paul C.; Poss, Mary

    2010-01-01

    The ongoing emergence of human infections originating from wildlife highlights the need for better knowledge of the microbial community in wildlife species where traditional diagnostic approaches are limited. Here we evaluate the microbial biota in healthy mule deer (Odocoileus hemionus) by analyses of lymph node meta-transcriptomes. cDNA libraries from five individuals and two pools of samples were prepared from retropharyngeal lymph node RNA enriched for polyadenylated RNA and sequenced using Roche-454 Life Sciences technology. Protein-coding and 16S ribosomal RNA (rRNA) sequences were taxonomically profiled using protein and rRNA specific databases. Representatives of all bacterial phyla were detected in the seven libraries based on protein-coding transcripts indicating that viable microbiota were present in lymph nodes. Residents of skin and rumen, and those ubiquitous in mule deer habitat dominated classifiable bacterial species. Based on detection of both rRNA and protein-coding transcripts, we identified two new proteobacterial species; a Helicobacter closely related to Helicobacter cetorum in the Helicobacter pylori/Helicobacter acinonychis complex and an Acinetobacter related to Acinetobacter schindleri. Among viruses, a novel gamma retrovirus and other members of the Poxviridae and Retroviridae were identified. We additionally evaluated bacterial diversity by amplicon sequencing the hypervariable V6 region of 16S rRNA and demonstrate that overall taxonomic diversity is higher with the meta-transcriptomic approach. These data provide the most complete picture to date of the microbial diversity within a wildlife host. Our research advances the use of meta-transcriptomics to study microbiota in wildlife tissues, which will facilitate detection of novel organisms with pathogenic potential to human and animals.

  6. Recent Advances in Molecular Technologies and Their Application in Pathogen Detection in Foods with Particular Reference to Yersinia

    Directory of Open Access Journals (Sweden)

    Jin Gui

    2011-01-01

    Full Text Available Yersinia enterocolitica is an important zoonotic pathogen that can cause yersiniosis in humans and animals. Food has been suggested to be the main source of yersiniosis. It is critical for the researchers to be able to detect Yersinia or any other foodborne pathogen with increased sensitivity and specificity, as well as in real-time, in the case of a foodborne disease outbreak. Conventional detection methods are known to be labor intensive, time consuming, or expensive. On the other hand, more sensitive molecular-based detection methods like next generation sequencing, microarray, and many others are capable of providing faster results. DNA testing is now possible on a single molecule, and high-throughput analysis allows multiple detection reactions to be performed at once, thus allowing a range of characteristics to be rapidly and simultaneously determined. Despite better detection efficiencies, results derived using molecular biology methods can be affected by the various food matrixes. With the improvements in sample preparation, data analysis, and testing procedures, molecular detection techniques will likely continue to simplify and increase the speed of detection while simultaneously improving the sensitivity and specificity for tracking pathogens in food matrices.

  7. Host-Seeking Behavior and Arbovirus Detection in Mosquitoes of Habahe County, Xinjiang Uigur Autonomous Region, China.

    Science.gov (United States)

    Guo, Xiao-Xia; Zhang, Ying-Mei; Li, Chun-Xiao; Zhang, Gui-Lin; Zheng, Zhong; Dong, Yan-De; Xue, Rui-De; Xing, Dan; Zhao, Tong-Yan

    2015-12-01

    Mosquitoes in Habahe County of Xinjiang Uigur Autonomous Region in China are considered a serious nuisance problem to local residents, but little is known of their role in enzootic disease. Therefore, host-seeking behavior and virus detection in mosquitoes were investigated in this study. Adult host-seeking mosquitoes were sampled using the Centers for Disease Control and Prevention (CDC) light traps operated at three locations in June through August 2008. Nine traps were used at each location at 3 different heights (1 m, 3 m, and 5 m). Seven mosquito species from 4 genera were collected by CDC light traps in different habitats. In total, 90,055 mosquitoes were captured, of which Aedes vexans was the most abundant species, comprising 88.02% of all mosquitoes collected. The second most abundant species was Anopheles messese, which comprised about 5.86%. Other species caught were Culex modestus (2.89%), Aedes caspius (1.11%), Coquillettidia richiardii (0.61%), Ae. dorsalis (1.36%), and An. hyrcanus (0.14%). About 93.5% of Ae. vexans individuals were caught in CO2-baited CDC light traps at 1 m above the ground. The highest numbers of Cx. modestus were caught at the highest trap level, 5 m above ground. Overall, significantly more mosquitoes of all species were collected at dusk than at dawn. Based on blood-meal analyses, Ae. vexans and An. messese fed on various vertebrate hosts, whereas Cx. modestus fed on ducks only. From a total of 335 mosquito pools tested, 10 pools of Ae. vexans were found positive for alphavirus. Comparison with the gene database revealed that the alphavirus deoxyribonucleic acid fragment obtained (GenBank accession no. HM160530) was 100% homologous at the nucleotide level to chikungunya virus isolate LK (PB) chik3408, chikungunya virus isolate SGEHICHD122508, and chikungunya virus strain FD080231. The results of this study suggest that ongoing, integrated mosquito and arbovirus surveillance is necessary in this river wetland.

  8. Phage-based surface plasmon resonance strategies for the detection of pathogens

    Science.gov (United States)

    Tawil, Nancy

    We start by reviewing the basic principles and recent advances in biosensing technologies using optical, electrochemical and acoustic platforms for phage-based diagnostics. Although much notable work has been done, a low cost, specific, sensitive optical method for detecting low concentrations of pathogens, in a few minutes, has not been established. We conclude from the limited body of work on the subject that improving immobilization strategies and finding more suitable phage recognition elements would allow for a more sensitive approach. Our aim was to better describe the attachment process of MRSA specific phages on gold surfaces, and the subsequent biodetection of their bacterial hosts by surface plasmon resonance (SPR). With the knowledge that the adsorption characteristics of thiol-containing molecules are necessary for applications involving the attachment of recognition elements to a functionalized surface, we start by providing comparative details on the kinetics of self-assembly of L-cysteine and 11-mercaptoundecanoic acid (MUA) monolayers on gold using SPR[1]. Our purpose, in carrying out these measurements was to establish each molecule's validity and applicability as a linker element for use in biosensing. We find that monolayer formation, for both L-cysteine and MUA, is described by the Langmuir isotherm at low concentrations only. For L-cysteine, both the amine and thiol groups contribute to the initial attachment of the molecule, followed by the replacement of the amine-gold complexes initially formed with more stable thiol-gold complexes. The reorganization of L-cysteine creates more space on the gold surface, and the zwitterionic form of the molecule permits the physisorption of a second layer through electrostatic interactions. On the other hand, MUA deposits randomly onto the surface of gold as a SAM and slowly reorganizes into a denser, vertical state. Surface plasmon resonance was then used for the real-time monitoring of the attachment of

  9. Microfluidic biosensor array with integrated poly(2,7-carbazole)/fullerene-based photodiodes for rapid multiplexed detection of pathogens.

    Science.gov (United States)

    Matos Pires, Nuno Miguel; Dong, Tao

    2013-11-25

    A multiplexed microfluidic biosensor made of poly(methylmethacrylate) (PMMA) was integrated into an array of organic blend heterojunction photodiodes (OPDs) for chemiluminescent detection of pathogens. Waterborne Escherichia coli O157:H7, Campylobacter jejuni and adenovirus were targeted in the PMMA chip, and detection of captured pathogens was conducted by poly(2,7-carbazole)/fullerene OPDs which showed a responsivity over 0.20 A/W at 425 nm. The limits of chemiluminescent detection were 5 × 10(5) cells/mL for E. coli, 1 × 10(5) cells/mL for C. jejuni, and 1 × 10(-8) mg/mL for adenovirus. Parallel analysis for all three analytes in less than 35 min was demonstrated. Further recovery tests illustrated the potential of the integrated biosensor for detecting bacteria in real water samples.

  10. Rapid detection and identification of viral and bacterial fish pathogens using a DNA array‐based multiplex assay

    DEFF Research Database (Denmark)

    Lievens, B.; Frans, I.; Heusdens, C.

    2011-01-01

    for the simultaneous detection and identification of all cyprinid herpesviruses (CyHV‐1, CyHV‐2 and CyHV‐3) and some of the most important fish pathogenic Flavobacterium species, including F. branchiophilum, F. columnare and F. psychrophilum. For virus identification, the DNA polymerase and helicase genes were...

  11. The application of flow cytometry and fluorescent probe technology for detection and assessment of viability of plant pathogenic bacteria

    NARCIS (Netherlands)

    Chitarra, L.G.; Bulk, van den R.W.

    2003-01-01

    Conventional methods to detect and assess the viability of plant pathogenic bacteria are usually based on plating assays or serological techniques. Plating assays provide information about the number of viable cells, expressed as colony-forming units, but are time-consuming and laborious. Serologica

  12. Development of a nested PCR for environmental detection of the pathogenic free-living amoeba Balamuthia mandrillaris.

    Science.gov (United States)

    Ahmad, Arine F; Andrew, Peter W; Kilvington, Simon

    2011-01-01

    A DNA extraction and nested PCR method for detecting the pathogenic amoeba Balamuthia mandrillaris from the environment was developed. Sixteen of 17 Californian soil samples were positive compared with 0/44 from the United Kingdom. This approach will enable a greater understanding of B. mandrillaris ecology, geographic distribution, and public health risk.

  13. Point of care nucleic acid detection of viable pathogenic bacteria with isothermal RNA amplification based paper biosensor

    Science.gov (United States)

    Liu, Hongxing; Xing, Da; Zhou, Xiaoming

    2014-09-01

    Food-borne pathogens such as Listeria monocytogenes have been recognized as a major cause of human infections worldwide, leading to substantial health problems. Food-borne pathogen identification needs to be simpler, cheaper and more reliable than the current traditional methods. Here, we have constructed a low-cost paper biosensor for the detection of viable pathogenic bacteria with the naked eye. In this study, an effective isothermal amplification method was used to amplify the hlyA mRNA gene, a specific RNA marker in Listeria monocytogenes. The amplification products were applied to the paper biosensor to perform a visual test, in which endpoint detection was performed using sandwich hybridization assays. When the RNA products migrated along the paper biosensor by capillary action, the gold nanoparticles accumulated at the designated Test line and Control line. Under optimized experimental conditions, as little as 0.5 pg/μL genomic RNA from Listeria monocytogenes could be detected. The whole assay process, including RNA extraction, amplification, and visualization, can be completed within several hours. The developed method is suitable for point-of-care applications to detect food-borne pathogens, as it can effectively overcome the false-positive results caused by amplifying nonviable Listeria monocytogenes.

  14. PaPrBaG: A machine learning approach for the detection of novel pathogens from NGS data

    Science.gov (United States)

    Deneke, Carlus; Rentzsch, Robert; Renard, Bernhard Y.

    2017-01-01

    The reliable detection of novel bacterial pathogens from next-generation sequencing data is a key challenge for microbial diagnostics. Current computational tools usually rely on sequence similarity and often fail to detect novel species when closely related genomes are unavailable or missing from the reference database. Here we present the machine learning based approach PaPrBaG (Pathogenicity Prediction for Bacterial Genomes). PaPrBaG overcomes genetic divergence by training on a wide range of species with known pathogenicity phenotype. To that end we compiled a comprehensive list of pathogenic and non-pathogenic bacteria with human host, using various genome metadata in conjunction with a rule-based protocol. A detailed comparative study reveals that PaPrBaG has several advantages over sequence similarity approaches. Most importantly, it always provides a prediction whereas other approaches discard a large number of sequencing reads with low similarity to currently known reference genomes. Furthermore, PaPrBaG remains reliable even at very low genomic coverages. CombiningPaPrBaG with existing approaches further improves prediction results.

  15. PaPrBaG: A machine learning approach for the detection of novel pathogens from NGS data

    Science.gov (United States)

    Deneke, Carlus; Rentzsch, Robert; Renard, Bernhard Y.

    2017-01-01

    The reliable detection of novel bacterial pathogens from next-generation sequencing data is a key challenge for microbial diagnostics. Current computational tools usually rely on sequence similarity and often fail to detect novel species when closely related genomes are unavailable or missing from the reference database. Here we present the machine learning based approach PaPrBaG (Pathogenicity Prediction for Bacterial Genomes). PaPrBaG overcomes genetic divergence by training on a wide range of species with known pathogenicity phenotype. To that end we compiled a comprehensive list of pathogenic and non-pathogenic bacteria with human host, using various genome metadata in conjunction with a rule-based protocol. A detailed comparative study reveals that PaPrBaG has several advantages over sequence similarity approaches. Most importantly, it always provides a prediction whereas other approaches discard a large number of sequencing reads with low similarity to currently known reference genomes. Furthermore, PaPrBaG remains reliable even at very low genomic coverages. CombiningPaPrBaG with existing approaches further improves prediction results. PMID:28051068

  16. A model system for pathogen detection using a two-component bacteriophage/bioluminescent signal amplification assay

    Science.gov (United States)

    Bright, Nathan G.; Carroll, Richard J.; Applegate, Bruce M.

    2004-03-01

    Microbial contamination has become a mounting concern the last decade due to an increased emphasis of minimally processed food products specifically produce, and the recognition of foodborne pathogens such as Campylobacter jejuni, Escherichia coli O157:H7, and Listeria monocytogenes. This research investigates a detection approach utilizing bacteriophage pathogen specificity coupled with a bacterial bioluminescent bioreporter utilizing the quorum sensing molecule from Vibrio fischeri, N-(3-oxohexanoyl)-homoserine lactone (3-oxo-C6-HSL). The 3-oxo-C6-HSL molecules diffuse out of the target cell after infection and induce bioluminescence from a population of 3-oxo-C6-HSL bioreporters (ROLux). E. coli phage M13, a well-characterized bacteriophage, offers a model system testing the use of bacteriophage for pathogen detection through cell-to-cell communication via a LuxR/3-oxo-C6-HSL system. Simulated temperate phage assays tested functionality of the ROLux reporter and production of 3-oxo-C6-HSL by various test strains. These assays showed detection limits of 102cfu after 24 hours in a varietry of detection formats. Assays incorporating the bacteriophage M13-luxI with the ROLux reporter and a known population of target cells were subsequently developed and have shown consistent detection limits of 105cfu target organisms. Measurable light response from high concentrations of target cells was almost immediate, suggesting an enrichment step to further improve detection limits and reduce assay time.

  17. Integrated microfluidic system with automatic sampling for permanent molecular and antigen-based detection of CBRNE-related pathogens

    Science.gov (United States)

    Becker, Holger; Schattschneider, Sebastian; Klemm, Richard; Hlawatsch, Nadine; Gärtner, Claudia

    2015-03-01

    The continuous monitoring of the environment for lethal pathogens is a central task in the field of biothreat detection. Typical scenarios involve air-sampling in locations such as public transport systems or large public events and a subsequent analysis of the samples by a portable instrument. Lab-on-a-chip technologies are one of the promising technological candidates for such a system. We have developed an integrated microfluidic system with automatic sampling for the detection of CBRNE-related pathogens. The chip contains a two-pronged analysis strategy, on the one hand an immunological track using antibodies immobilized on a frit and a subsequent photometric detection, on the other hand a molecular biology approach using continuous-flow PCR with a fluorescence end-point detection. The cartridge contains two-component molded rotary valve to allow active fluid control and switching between channels. The accompanying instrument contains all elements for fluidic and valve actuation, thermal control, as well as the two detection modalities. Reagents are stored in dedicated reagent packs which are connected directly to the cartridge. With this system, we have been able to demonstrate the detection of a variety of pathogen species.

  18. Autonomic neuropathy

    DEFF Research Database (Denmark)

    Hilsted, J

    1983-01-01

    The diagnosis of autonomic neuropathy is often difficult to establish, since clinical symptoms generally appear late in the course of the disease, and may be non-specific. A number of recently developed quantifiable and reproducible autonomic nerve function tests are reviewed, with emphasis on th...

  19. Development and evaluation of a panel of filovirus sequence capture probes for pathogen detection by next-generation sequencing.

    Directory of Open Access Journals (Sweden)

    Jeffrey W Koehler

    Full Text Available A detailed understanding of the circulating pathogens in a particular geographic location aids in effectively utilizing targeted, rapid diagnostic assays, thus allowing for appropriate therapeutic and containment procedures. This is especially important in regions prevalent for highly pathogenic viruses co-circulating with other endemic pathogens such as the malaria parasite. The importance of biosurveillance is highlighted by the ongoing Ebola virus disease outbreak in West Africa. For example, a more comprehensive assessment of the regional pathogens could have identified the risk of a filovirus disease outbreak earlier and led to an improved diagnostic and response capacity in the region. In this context, being able to rapidly screen a single sample for multiple pathogens in a single tube reaction could improve both diagnostics as well as pathogen surveillance. Here, probes were designed to capture identifying filovirus sequence for the ebolaviruses Sudan, Ebola, Reston, Taï Forest, and Bundibugyo and the Marburg virus variants Musoke, Ci67, and Angola. These probes were combined into a single probe panel, and the captured filovirus sequence was successfully identified using the MiSeq next-generation sequencing platform. This panel was then used to identify the specific filovirus from nonhuman primates experimentally infected with Ebola virus as well as Bundibugyo virus in human sera samples from the Democratic Republic of the Congo, thus demonstrating the utility for pathogen detection using clinical samples. While not as sensitive and rapid as real-time PCR, this panel, along with incorporating additional sequence capture probe panels, could be used for broad pathogen screening and biosurveillance.

  20. Autonomic neuropathy

    DEFF Research Database (Denmark)

    Hilsted, J

    1980-01-01

    In order to elucidate the physiological significance of autonomic neuropathy in juvenile diabetics, cardiovascular, hormonal and metabolic functions have been investigated in three groups of juvenile diabetics: One group had no signs of neuropathy, one group had presumably slight autonomic...... neuropathy (reduced beat-to-beat variation in heart rate during hyperventilation) and one group had clinically severe autonomic neuropathy, defined by presence of orthostatic hypotension. In all three experimental situations we found sympathetic dysfunction causing cardiovascular and/or hormonal...... maladjustments in patients with autonomic neuropathy. Regarding metabolic functions we found normal responses to graded exercise and insulin-induced hypoglycemia in patients with autonomic neuropathy in spite of blunted catecholamine responses, suggesting increased sensitivity of glycogen stores and adipose...

  1. DNA Extraction Method Affects the Detection of a Fungal Pathogen in Formalin-Fixed Specimens Using qPCR.

    Directory of Open Access Journals (Sweden)

    Andrea J Adams

    Full Text Available Museum collections provide indispensable repositories for obtaining information about the historical presence of disease in wildlife populations. The pathogenic amphibian chytrid fungus Batrachochytrium dendrobatidis (Bd has played a significant role in global amphibian declines, and examining preserved specimens for Bd can improve our understanding of its emergence and spread. Quantitative PCR (qPCR enables Bd detection with minimal disturbance to amphibian skin and is significantly more sensitive to detecting Bd than histology; therefore, developing effective qPCR methodologies for detecting Bd DNA in formalin-fixed specimens can provide an efficient and effective approach to examining historical Bd emergence and prevalence. Techniques for detecting Bd in museum specimens have not been evaluated for their effectiveness in control specimens that mimic the conditions of animals most likely to be encountered in museums, including those with low pathogen loads. We used American bullfrogs (Lithobates catesbeianus of known infection status to evaluate the success of qPCR to detect Bd in formalin-fixed specimens after three years of ethanol storage. Our objectives were to compare the most commonly used DNA extraction method for Bd (PrepMan, PM to Macherey-Nagel DNA FFPE (MN, test optimizations for Bd detection with PM, and provide recommendations for maximizing Bd detection. We found that successful detection is relatively high (80-90% when Bd loads before formalin fixation are high, regardless of the extraction method used; however, at lower infection levels, detection probabilities were significantly reduced. The MN DNA extraction method increased Bd detection by as much as 50% at moderate infection levels. Our results indicate that, for animals characterized by lower pathogen loads (i.e., those most commonly encountered in museum collections, current methods may underestimate the proportion of Bd-infected amphibians. Those extracting DNA from

  2. DNA Extraction Method Affects the Detection of a Fungal Pathogen in Formalin-Fixed Specimens Using qPCR.

    Science.gov (United States)

    Adams, Andrea J; LaBonte, John P; Ball, Morgan L; Richards-Hrdlicka, Kathryn L; Toothman, Mary H; Briggs, Cheryl J

    2015-01-01

    Museum collections provide indispensable repositories for obtaining information about the historical presence of disease in wildlife populations. The pathogenic amphibian chytrid fungus Batrachochytrium dendrobatidis (Bd) has played a significant role in global amphibian declines, and examining preserved specimens for Bd can improve our understanding of its emergence and spread. Quantitative PCR (qPCR) enables Bd detection with minimal disturbance to amphibian skin and is significantly more sensitive to detecting Bd than histology; therefore, developing effective qPCR methodologies for detecting Bd DNA in formalin-fixed specimens can provide an efficient and effective approach to examining historical Bd emergence and prevalence. Techniques for detecting Bd in museum specimens have not been evaluated for their effectiveness in control specimens that mimic the conditions of animals most likely to be encountered in museums, including those with low pathogen loads. We used American bullfrogs (Lithobates catesbeianus) of known infection status to evaluate the success of qPCR to detect Bd in formalin-fixed specimens after three years of ethanol storage. Our objectives were to compare the most commonly used DNA extraction method for Bd (PrepMan, PM) to Macherey-Nagel DNA FFPE (MN), test optimizations for Bd detection with PM, and provide recommendations for maximizing Bd detection. We found that successful detection is relatively high (80-90%) when Bd loads before formalin fixation are high, regardless of the extraction method used; however, at lower infection levels, detection probabilities were significantly reduced. The MN DNA extraction method increased Bd detection by as much as 50% at moderate infection levels. Our results indicate that, for animals characterized by lower pathogen loads (i.e., those most commonly encountered in museum collections), current methods may underestimate the proportion of Bd-infected amphibians. Those extracting DNA from archived museum

  3. [Studies on rapid detection of food-borne pathogenic bacteria by nucleic acid testing and related technology].

    Science.gov (United States)

    Cao, Wei; Wang, Mingzhong; Wang, Xiaoying; Liu, Xiumei

    2008-03-01

    The traditional methods of bacteria isolation, cultivation and identification are time-consuming, which can't meet the needs of the control and prevention of food-borne diseases. Recently, various kinds of rapid methods for food-borne pathogenic bacteria detection have emerged with the prompt development of nucleic acid testing technology. The application studies on polymerase chain reaction and the techniques derived from it, nucleic acid isothermal amplification, oligonucleotide microarray, immunomagnetic separation and DNA biosensing on food-borne pathogenic bacteria including Salmonella, Staphylococcus aureus and Enterohemorrhagic Escherchia coli, etc. were reviewed.

  4. Molecular Detection of Tick-Borne Pathogens in Humans with Tick Bites and Erythema Migrans, in the Netherlands

    Science.gov (United States)

    Jahfari, Setareh; Hofhuis, Agnetha; Fonville, Manoj; van der Giessen, Joke; van Pelt, Wilfrid; Sprong, Hein

    2016-01-01

    Background Tick-borne diseases are the most prevalent vector-borne diseases in Europe. Knowledge on the incidence and clinical presentation of other tick-borne diseases than Lyme borreliosis and tick-borne encephalitis is minimal, despite the high human exposure to these pathogens through tick bites. Using molecular detection techniques, the frequency of tick-borne infections after exposure through tick bites was estimated. Methods Ticks, blood samples and questionnaires on health status were collected from patients that visited their general practitioner with a tick bite or erythema migrans in 2007 and 2008. The presence of several tick-borne pathogens in 314 ticks and 626 blood samples of this cohort were analyzed using PCR-based methods. Using multivariate logistic regression, associations were explored between pathogens detected in blood and self-reported symptoms at enrolment and during a three-month follow-up period. Results Half of the ticks removed from humans tested positive for Borrelia burgdorferi sensu lato, Anaplasma phagocytophilum, Candidatus Neoehrlichia mikurensis, Rickettsia helvetica, Rickettsia monacensis, Borrelia miyamotoi and several Babesia species. Among 92 Borrelia burgdorferi s. l. positive ticks, 33% carried another pathogen from a different genus. In blood of sixteen out of 626 persons with tick bites or erythema migrans, DNA was detected from Candidatus Neoehrlichia mikurensis (n = 7), Anaplasma phagocytophilum (n = 5), Babesia divergens (n = 3), Borrelia miyamotoi (n = 1) and Borrelia burgdorferi s. l. (n = 1). None of these sixteen individuals reported any overt symptoms that would indicate a corresponding illness during the three-month follow-up period. No associations were found between the presence of pathogen DNA in blood and; self-reported symptoms, with pathogen DNA in the corresponding ticks (n = 8), reported tick attachment duration, tick engorgement, or antibiotic treatment at enrolment. Conclusions Based on molecular

  5. Clinical impact of a commercially available multiplex PCR system for rapid detection of pathogens in patients with presumed sepsis

    Directory of Open Access Journals (Sweden)

    Linde Hans-Jörg

    2009-08-01

    Full Text Available Abstract Background Timely identification of pathogens is crucial to minimize mortality in patients with severe infections. Detection of bacterial and fungal pathogens in blood by nucleic acid amplification promises to yield results faster than blood cultures (BC. We analyzed the clinical impact of a commercially available multiplex PCR system in patients with suspected sepsis. Methods Blood samples from patients with presumed sepsis were cultured with the Bactec 9240™ system (Becton Dickinson, Heidelberg, Germany and aliquots subjected to analysis with the LightCycler® SeptiFast® (SF Test (Roche Diagnostics, Mannheim, Germany at a tertiary care centre. For samples with PCR-detected pathogens, the actual impact on clinical management was determined by chart review. Furthermore a comparison between the time to a positive blood culture result and the SF result, based on a fictive assumption that it was done either on a once or twice daily basis, was made. Results Of 101 blood samples from 77 patients, 63 (62% yielded concordant negative results, 14 (13% concordant positive and 9 (9% were BC positive only. In 14 (13% samples pathogens were detected by SF only, resulting in adjustment of antibiotic therapy in 5 patients (7,7% of patients. In 3 samples a treatment adjustment would have been made earlier resulting in a total of 8 adjustments in all 101 samples (8%. Conclusion The addition of multiplex PCR to conventional blood cultures had a relevant impact on clinical management for a subset of patients with presumed sepsis.

  6. Widespread detection of highly pathogenic H5 influenza viruses in wild birds from the Pacific Flyway of the United States

    Science.gov (United States)

    Bevins, S.N.; Dusek, Robert J.; White, C. LeAnn; Gidlewski, Thomas; Bodenstein, B.; Mansfield, Kristin G.; DeBruyn, Paul; Kraege, Donald K.; Rowan, E.L.; Gillin, Colin; Thomas, B.; Chandler, S.; Baroch, J.; Schmit, B.; Grady, M. J.; Miller, R. S.; Drew, M.L.; Stopak, S.; Zscheile, B.; Bennett, J.; Sengl, J.; Brady, Caroline; Ip, Hon S.; Spackman, Erica; Killian, M. L.; Torchetti, Mia Kim; Sleeman, Jonathan M.; DeLiberto, T.J.

    2016-01-01

    A novel highly pathogenic avian influenza virus belonging to the H5 clade 2.3.4.4 variant viruses was detected in North America in late 2014. Motivated by the identification of these viruses in domestic poultry in Canada, an intensive study was initiated to conduct highly pathogenic avian influenza surveillance in wild birds in the Pacific Flyway of the United States. A total of 4,729 hunter-harvested wild birds were sampled and highly pathogenic avian influenza virus was detected in 1.3% (n = 63). Three H5 clade 2.3.4.4 subtypes were isolated from wild birds, H5N2, H5N8, and H5N1, representing the wholly Eurasian lineage H5N8 and two novel reassortant viruses. Testing of 150 additional wild birds during avian morbidity and mortality investigations in Washington yielded 10 (6.7%) additional highly pathogenic avian influenza isolates (H5N8 = 3 and H5N2 = 7). The geographically widespread detection of these viruses in apparently healthy wild waterfowl suggest that the H5 clade 2.3.4.4 variant viruses may behave similarly in this taxonomic group whereby many waterfowl species are susceptible to infection but do not demonstrate obvious clinical disease. Despite these findings in wild waterfowl, mortality has been documented for some wild bird species and losses in US domestic poultry during the first half of 2015 were unprecedented.

  7. Molecular approaches to detecting and discriminating among prions, a class of pathogenic molecules(Abstract)

    Science.gov (United States)

    Prions (PrPSc)are the pathogens that cause a set of fatal neurological diseases that include scrapie and chronic wasting disease (CWD). They are composed solely of protein and unlike viral, bacterial, or fungal pathogens, the information necessary to convert the normal cellular prion protein (PrPC) ...

  8. Methods for detecting pathogens in the food chain for beef: from farm to slaughter

    Science.gov (United States)

    The main food-borne pathogens of concern in the beef chain are Shiga toxin-producing Escherichia coli (STEC) and Salmonella. Other pathogens, including Listeria monocytogenes and Campylobacter spp. may also be present and pose contamination concerns in both the cattle production environment and bee...

  9. Multiplex and quantitative pathogen detection with high-resolution capillary electrophoresis-based single-strand conformation polymorphism.

    Science.gov (United States)

    Hwang, Hee Sung; Shin, Gi Won; Chung, Boram; Na, Jeongkyeong; Jung, Gyoo Yeol

    2013-01-01

    Among the molecular diagnostic methods for bacteria-induced diseases, capillary electrophoresis-based single-strand conformation polymorphism (CE-SSCP) combined with 16S rRNA gene-specific PCR has enormous potential because it can separate sequence variants using a simple procedure. However, conventional CE-SSCP systems have limited resolution and cannot separate most 16S rRNA gene-specific markers into separate peaks. A high-resolution CE-SSCP system that uses a poly(ethyleneoxide)-poly(propyleneoxide)-poly(ethyleneoxide) triblock copolymer matrix was recently developed and shown to effectively separate highly similar PCR products. In this report, a protocol for the detection of 12 pathogenic bacteria is provided. Pathogen markers were amplified by PCR using universal primers and separated by CE-SSCP; each marker peak was well separated at baseline and showed a characteristic mobility, allowing the easy identification of the pathogens.

  10. Detection and Comparison of Pathogen of Virus Disease in Pumpkin by RT-PCR and IC-PCR

    Institute of Scientific and Technical Information of China (English)

    YANG Guohui; ZHANG Zhongkai; CUI Chongshi

    2006-01-01

    Two kinds of methods RT-PCR and IC-PCR were used to detect pathogen of virus disease of pumpkin and the sensitivity of the two methods was compared. The results showed that PRSV-W and CMV were detected in diseased samples gathered in Yunnan Province, while WMV and CMV were detected in diseased samples gathered in Heilongjiang Province. The sensitivity of RT-PCR is higher than that of IC-PCR, but the effect of IC-PCR in the specialization of bonding reaction and requisition for experiment material is better than that of RT-PCR.

  11. Binding-induced and label-free colorimetric method for protein detection based on autonomous assembly of hemin/G-quadruplex DNAzyme amplification strategy.

    Science.gov (United States)

    Wu, Hao; Zhang, Kai; Liu, Yaling; Wang, Hongyong; Wu, Jun; Zhu, Feifan; Zou, Pei

    2015-02-15

    In this work, a new binding-induced and label-free colorimetric method for protein detection has been developed on the basis of an autonomous assembly of hemin/G-quadruplex DNAzyme amplification strategy. The system consists of two proximity probes carrying two aptamer sequences as recognition elements for target, and two hairpin structures include three-fourths and one-fourth of the G-quadruplex sequences in inactive configuration as functional elements. In the presence of target protein, two proximity probes bind to the protein simultaneously, forming a stable DNA-protein complex. Then the complex triggers an autonomous cross-opening of the two functional hairpin structures, leading to the formation of numerous hemin/G-quadruplex DNAzymes. The resulting DNAzymes catalyze the oxidation of colorless 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS(2-)) to the green-colored ABTS(•-) with the presence of H2O2, thus providing the amplified colorimetric detection of target. Using human α-thrombin as the protein target, this binding-induced DNAzyme amplification colorimetric method affords high sensitivity with a detection limit of 1.9 pM. Furthermore, this method might be further extended to sensitive detection of other proteins by simply replacing recognition elements of proximity probes.

  12. Quantitative molecular detection of putative periodontal pathogens in clinically healthy and periodontally diseased subjects.

    Directory of Open Access Journals (Sweden)

    André Göhler

    Full Text Available Periodontitis is a multi-microbial oral infection with high prevalence among adults. Putative oral pathogens are commonly found in periodontally diseased individuals. However, these organisms can be also detected in the oral cavity of healthy subjects. This leads to the hypothesis, that alterations in the proportion of these organisms relative to the total amount of oral microorganisms, namely their abundance, rather than their simple presence might be important in the transition from health to disease. Therefore, we developed a quantitative molecular method to determine the abundance of various oral microorganisms and the portion of bacterial and archaeal nucleic acid relative to the total nucleic acid extracted from individual samples. We applied quantitative real-time PCRs targeting single-copy genes of periodontal bacteria and 16S-rRNA genes of Bacteria and Archaea. Testing tongue scrapings of 88 matched pairs of periodontally diseased and healthy subjects revealed a significantly higher abundance of P. gingivalis and a higher total bacterial abundance in diseased subjects. In fully adjusted models the risk of being periodontally diseased was significantly higher in subjects with high P. gingivalis and total bacterial abundance. Interestingly, we found that moderate abundances of A. actinomycetemcomitans were associated with reduced risk for periodontal disease compared to subjects with low abundances, whereas for high abundances, this protective effect leveled off. Moderate archaeal abundances were health associated compared to subjects with low abundances. In conclusion, our methodological approach unraveled associations of the oral flora with periodontal disease, which would have gone undetected if only qualitative data had been determined.

  13. One-day workflow scheme for bacterial pathogen detection and antimicrobial resistance testing from blood cultures.

    Science.gov (United States)

    Hansen, Wendy L J; Beuving, Judith; Verbon, Annelies; Wolffs, Petra F G

    2012-07-09

    Bloodstream infections are associated with high mortality rates because of the probable manifestation of sepsis, severe sepsis and septic shock(1). Therefore, rapid administration of adequate antibiotic therapy is of foremost importance in the treatment of bloodstream infections. The critical element in this process is timing, heavily dependent on the results of bacterial identification and antibiotic susceptibility testing. Both of these parameters are routinely obtained by culture-based testing, which is time-consuming and takes on average 24-48 hours(2, 4). The aim of the study was to develop DNA-based assays for rapid identification of bloodstream infections, as well as rapid antimicrobial susceptibility testing. The first assay is a eubacterial 16S rDNA-based real-time PCR assay complemented with species- or genus-specific probes(5). Using these probes, Gram-negative bacteria including Pseudomonas spp., Pseudomonas aeruginosa and Escherichia coli as well as Gram-positive bacteria including Staphylococcus spp., Staphylococcus aureus, Enterococcus spp., Streptococcus spp., and Streptococcus pneumoniae could be distinguished. Using this multiprobe assay, a first identification of the causative micro-organism was given after 2 h. Secondly, we developed a semi-molecular assay for antibiotic susceptibility testing of S. aureus, Enterococcus spp. and (facultative) aerobe Gram-negative rods(6). This assay was based on a study in which PCR was used to measure the growth of bacteria(7). Bacteria harvested directly from blood cultures are incubated for 6 h with a selection of antibiotics, and following a Sybr Green-based real-time PCR assay determines inhibition of growth. The combination of these two methods could direct the choice of a suitable antibiotic therapy on the same day (Figure 1). In conclusion, molecular analysis of both identification and antibiotic susceptibility offers a faster alternative for pathogen detection and could improve the diagnosis of

  14. Autonomous software: Myth or magic?

    CERN Document Server

    Allan, Alasdair; Saunders, Eric S

    2008-01-01

    We discuss work by the eSTAR project which demonstrates a fully closed loop autonomous system for the follow up of possible micro-lensing anomalies. Not only are the initial micro-lensing detections followed up in real time, but ongoing events are prioritised and continually monitored, with the returned data being analysed automatically. If the ``smart software'' running the observing campaign detects a planet-like anomaly, further follow-up will be scheduled autonomously and other telescopes and telescope networks alerted to the possible planetary detection. We further discuss the implications of this, and how such projects can be used to build more general autonomous observing and control systems.

  15. Acceptance Criteria Framework for Autonomous Biological Detectors

    Energy Technology Data Exchange (ETDEWEB)

    Dzenitis, J M

    2006-12-12

    The purpose of this study was to examine a set of user acceptance criteria for autonomous biological detection systems for application in high-traffic, public facilities. The test case for the acceptance criteria was the Autonomous Pathogen Detection System (APDS) operating in high-traffic facilities in New York City (NYC). However, the acceptance criteria were designed to be generally applicable to other biological detection systems in other locations. For such detection systems, ''users'' will include local authorities (e.g., facility operators, public health officials, and law enforcement personnel) and national authorities [including personnel from the Department of Homeland Security (DHS), the BioWatch Program, the Centers for Disease Control and Prevention (CDC), and the Federal Bureau of Investigation (FBI)]. The panel members brought expertise from a broad range of backgrounds to complete this picture. The goals of this document are: (1) To serve as informal guidance for users in considering the benefits and costs of these systems. (2) To serve as informal guidance for developers in understanding the needs of users. In follow-up work, this framework will be used to systematically document the APDS for appropriateness and readiness for use in NYC.

  16. Binding-induced autonomous disassembly of aptamer-DNAzyme supersandwich nanostructures for sensitive electrochemiluminescence turn-on detection of ochratoxin A

    Science.gov (United States)

    Chen, Ying; Yang, Mengli; Xiang, Yun; Yuan, Ruo; Chai, Yaqin

    2013-12-01

    The self-assembled DNA nanostructure has been one of the most interesting research areas in the field of nanoscience, and the application of the DNA self-assembled nanostructures in biosensing is still in the early stage. In this work, based on the target-induced autonomous disassembly of the aptamer-DNAzyme supersandwich nanostructures, we demonstrated a highly sensitive strategy for electrochemiluminescent (ECL) detection of ochratoxin A (OTA). The aptamer-DNAzyme supersandwich nanostructures, which exhibited significant ECL quenching effect toward the oxygen/persulfate (O2/S2O82-) system, were self-assembled on the gold electrode surface. The presence of the target OTA and the exonuclease (RecJf) resulted in autonomous disassembly of the nanostructures and cyclic reuse of OTA, leading to efficient recovery of the ECL emission and highly sensitive detection of OTA. Our developed method also showed high selectivity against other interference molecules and can be applied for the detection of OTA in real red wine samples, which offers the proposed method opportunities for designing new DNA-based nanostructures for biosensing applications.

  17. A system for detection and identification of foodborne pathogenic bacteria based on a “Combinatory qPCR” technology

    OpenAIRE

    2014-01-01

    Foodborne outbreaks are important issues worldwide. Two of the most important foodborne pathogens are Salmonella spp. and Listeria monocytogenes. The reference methods to detect foodborne bacteria are international standard operating procedures, ISO methods, which are recognized in the whole world. These methods are mostly culture-based methods that are time consuming (several days) and labor intensive. In order to identify faster the source of foodborne outbreaks, to better manage food-relat...

  18. A multiplex quantitative real-time polymerase chain reaction panel for detecting neurologic pathogens in dogs with meningoencephalitis

    OpenAIRE

    Han, Jae-Ik; Chang, Dong-Woo; Na, Ki-Jeong

    2015-01-01

    Meningoencephalitis (ME) is a common inflammatory disorder of the central nervous system in dogs. Clinically, ME has both infectious and non-infectious causes. In the present study, a multiplex quantitative real-time polymerase chain reaction (mqPCR) panel was optimized for the detection of eight canine neurologic pathogens (Blastomyces dermatitidis, Cryptococcus spp., Neospora caninum, Borrelia burgdorferi, Bartonella spp., Toxoplasma gondii, Ehrlichia canis, and canine distemper virus [CDV]...

  19. Impact of early detection and treatment of diabetes on the 6-year prevalence of cardiac autonomic neuropathy in people with screen-detected diabetes

    DEFF Research Database (Denmark)

    Charles, Morten; Fleischer, J; Witte, Daniel Rinse

    2013-01-01

    Baggrund: Der er begrænset viden om hvordan tidlig multifaktoriel behandling forbedrer konsekvenser af diabetes. Kardiel autonom neuropati (KAN) hos personer med diabetes indikerer omfattende skade på det autonome nervesystem og er relateret til mortalitet og livskvalitet. I dette studie fra...... ADDITION Danmark undersøgte vi effekten af tidlig opsporing og efterfølgende intensive behandling af type 2 diabetes i almen praksis på hyppigheden af kardiel autonom neuropati 6 år efter diagnose. Resultater: Prævalensen af tidlig KAN var 15,1% i rutine behandlingsgruppen (RG) og 15.5% i intensive...... kardiovaskulære risikofaktorer er således ikke nok til at forebygge at mange diabetes patienter udvikler KAN....

  20. Application of real-time quantitative PCR for the detection of selected bacterial pathogens during municipal wastewater treatment.

    Science.gov (United States)

    Shannon, K E; Lee, D-Y; Trevors, J T; Beaudette, L A

    2007-08-15

    Bacteria were detected at five stages of municipal wastewater treatment using TaqMan(R) real-time quantitative PCR (qPCR). Thirteen probe and primer sets were tested for diverse pathogens that may be present in wastewater, including Aeromonas hydrophila, Bacillus cereus, Clostridium perfringens, Enterococcus faecalis, Escherichia coli, E. coli O157:H7, Helicobacter pylori, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Pseudomonas aeruginosa, Salmonella sp., and Staphylococcus aureus. The sensitivity of the assay was 100 fg of genomic DNA (=22 gene copies), based on a standard curve generated using A. hydrophila purified DNA. Samples from five stages of wastewater treatment were collected, including raw wastewater, primary effluents, mixed liquor, waste activated sludge and final effluents. In duplicate samples, E. coli, K. pneumoniae, C. perfringens and E. faecalis were detected throughout the wastewater process, and their numbers decreased by 3.52-3.98, 4.23-4.33, 3.15-3.39, and 3.24 orders of magnitude respectively, between the raw wastewater and final effluent stage. This qPCR method was effective for the detection of pathogens in wastewater and confirmed that the risk of exposure to pathogens in the wastewater discharge was well within the Environment Canada guidelines.

  1. A Comparison of In-House Real-Time LAMP Assays with a Commercial Assay for the Detection of Pathogenic Bacteria

    OpenAIRE

    Deguo Wang; Yongzhen Wang; Fugang Xiao; Weiyun Guo; Yongqing Zhang; Aiping Wang; Yanhong Liu

    2015-01-01

    Molecular detection of bacterial pathogens based on LAMP methods is a faster and simpler approach than conventional culture methods. Although different LAMP-based methods for pathogenic bacterial detection are available, a systematic comparison of these different LAMP assays has not been performed. In this paper, we compared 12 in-house real-time LAMP assays with a commercialized kit (Isothermal Master Mix) for the detection of Listeria monocytogenes, Salmonella spp, Staphylococcus aureus, E...

  2. RNA sensors of the innate immune system and their detection of pathogens.

    Science.gov (United States)

    Chen, Nanhua; Xia, Pengpeng; Li, Shuangjie; Zhang, Tangjie; Wang, Tony T; Zhu, Jianzhong

    2017-04-04

    The innate immune system plays a critical role in pathogen recognition and initiation of protective immune response through the recognition of pathogen associated molecular patterns (PAMPs) by its pattern recognition receptors (PRRs). Nucleic acids including RNA and DNA have been recognized as very important PAMPs of pathogens especially for viruses. RNA are the major PAMPs of RNA viruses, to which most severe disease causing viruses belong thus posing a tougher challenge to human and animal health. Therefore, the understanding of the immune biology of RNA PRRs is critical for control of pathogen infections especially for RNA virus infections. RNA PRRs are comprised of TLR3, TLR7, TLR8, RIG-I, MDA5, NLRP3, NOD2, and some other minorities. This review introduces these RNA PRRs by describing the cellular localizations, ligand recognitions, activation mechanisms, cell signaling pathways, and recognition of pathogens; the cross-talks between various RNA PRRs are also reviewed. The deep insights of these RNA PRRs can be utilized to improve anti-viral immune response. © 2017 IUBMB Life, 2017.

  3. Characterization of ISR region and development of a PCR assay for rapid detection of the fish pathogen Tenacibaculum soleae.

    Science.gov (United States)

    López, Jose R; Hamman-Khalifa, Abdel M; Navas, José I; de la Herran, Roberto

    2011-11-01

    The aims of this work were to characterize the 16S-23S internal spacer region of the fish pathogen Tenacibaculum soleae and to develop a PCR assay for its identification and detection. All T. soleae strains tested displayed a single internal spacer region class, containing tRNA(I) (le) and tRNA(A) (la) genes; nevertheless, a considerable intraspecific heterogeneity was observed. However, this region proved to be useful for differentiation of T. soleae from related and non-related species. Species-specific primers were designed targeting the 16S rRNA gene and the internal spacer region region, yielding a 1555-bp fragment. Detection limit was of 1 pg DNA per reaction (< 30 bacterial cells) when using pure cultures. The detection level in the presence of DNA from fish or other bacteria was lower; however, 10 pg were detected at a target/background ratio of 1 : 10(5) . The PCR assay proved to be more sensitive than agar cultivation for the detection of T. soleae from naturally diseased fish, offering a useful tool for diagnosis and for understanding the epidemiology of this pathogen.

  4. Development of a versatile lab-on-a-chip enzyme assay platform for pathogen detection in CBRNE scenarios

    Science.gov (United States)

    Klemm, Richard; Schattschneider, Sebastian; Jahn, Tobias; Hlawatsch, Nadine; Julich, Sandra; Becker, Holger; Gärtner, Claudia

    2013-05-01

    The ability to integrate complete assays on a microfluidic chip helps to greatly simplify instrument requirements and allows the use of lab-on-a-chip technology in the field. A core application for such field-portable systems is the detection of pathogens in a CBRNE scenario such as permanent monitoring of airborne pathogens, e.g. in metro stations or hospitals etc. As one assay methodology for the pathogen identification, enzymatic assays were chosen. In order evaluate different detection strategies, the realized on-chip enzyme assay module has been designed as a general platform chip. In all application cases, the assays are based on immobilized probes located in microfluidic channels. Therefore a microfluidic chip was realized containing a set of three individually addressable channels, not only for detection of the sample itself also to have a set of references for a quantitative analysis. It furthermore includes two turning valves and a waste container for clear and sealed storage of potential pathogenic liquids to avoid contamination of the environment. All liquids remain in the chip and can be disposed of in proper way subsequently to the analysis. The chip design includes four inlet ports consisting of one sample port (Luer interface) and three mini Luer interfaces for fluidic support of e.g. washing buffer, substrate and enzyme solution. The sample can be applied via a special, sealable sampling vessel with integrated female Luer interface. Thereby also pre-anaytical contamination of the environment can be provided. Other reagents that are required for analysis will be stored off chip.

  5. A reliable and inexpensive method of nucleic acid extraction for the PCR-based detection of diverse plant pathogens.

    Science.gov (United States)

    Li, R; Mock, R; Huang, Q; Abad, J; Hartung, J; Kinard, G

    2008-12-01

    A reliable extraction method is described for the preparation of total nucleic acids from at least ten plant genera for subsequent detection of plant pathogens by PCR-based techniques. The method combined a modified CTAB (cetyltrimethylammonium bromide) extraction protocol with a semi-automatic homogenizer (FastPrep) instrument) for rapid sample processing and low potential of cross contamination. The method was applied to sample preparation for PCR-based detection of 28 different RNA and DNA viruses, six viroids, two phytoplasmas and two bacterial pathogens from a range of infected host plants including sweet potato, small fruits and fruit trees. The procedure is cost-effective and the qualities of the nucleic acid preparations are comparable to those prepared by commonly used commercial kits. The efficiency of the procedure permits processing of numerous samples and the use of a single nucleic acid preparation for testing both RNA and DNA genomes by PCR, making this an appealing method for testing multiple pathogens in certification and quarantine programs.

  6. The potential for early and rapid pathogen detection within poultry processing through hyperspectral microscopy

    Science.gov (United States)

    The acquisition of hyperspectral microscopic images containing both spatial and spectral data has shown potential for the early and rapid optical classification of foodborne pathogens. A hyperspectral microscope with a metal halide light source and acousto-optical tunable filter (AOTF) collects 89 ...

  7. Detecting single nucleotide polymorphisms using DNA arrays for plant pathogen diagnosis

    NARCIS (Netherlands)

    Lievens, B.; Claes, L.; Vanachter, A.C.R.C.; Cammue, B.P.A.; Thomma, B.P.H.J.

    2006-01-01

    The lack of a rapid and reliable means for routine pathogen identification has been one of the main limitations in plant disease management, and has pushed the development of culture-independent, molecular approaches. Currently, DNA array technology is the most suitable technique for high-throughput

  8. The development and application of the two real-time RT-PCR assays to detect the pathogen of HFMD.

    Directory of Open Access Journals (Sweden)

    Aili Cui

    Full Text Available Large-scale Hand, Foot, and Mouth Disease (HFMD outbreaks have frequently occurred in China since 2008, affecting more than one million children and causing several hundred children deaths every year. The pathogens of HFMD are mainly human enteroviruses (HEVs. Among them, human enterovirus 71 (HEV71 and coxsackievirus A16 (CVA16 are the most common pathogens of HFMD. However, other HEVs could also cause HFMD. To rapidly detect HEV71 and CVA16, and ensure detection of all HEVs causing HFMD, two real-time hybridization probe-based RT-PCR assays were developed in this study. One is a multiplex real-time RT-PCR assay, which was developed to detect and differentiate HEV71 specifically from CVA16 directly from clinical specimens within 1-2 h, and the other is a broad-spectrum real-time RT-PCR assay, which targeted almost all HEVs. The experiments confirmed that the two assays have high sensitivity and specificity, and the sensitivity was up to 0.1 TCID50/ml for detection of HEVs, HEV71, and CVA16, respectively. A total of 213 clinical specimens were simultaneously detected by three kinds of assays, including the two real-time RT-PCR assays, direct conventional RT-PCR assay, and virus isolation assay on human rhabdomyosarcoma cells (RD cells. The total positive rate of both HEV71 and CVA16 was 69.48% with real-time RT-PCR assay, 47.42% with RT-PCR assay, and 34.58% with virus isolation assay. One HFMD clinical specimen was positive for HEV, but negative for HEV71 or CVA16, which was identified as Echovirus 11 (Echo11 by virus isolation, RT-PCR, and sequencing for the VP1 gene. The two real-time RT-PCR assays had been applied in 31 provincial HFMD labs to detect the pathogens of HFMD, which has contributed to the rapid identification of the pathogens in the early stages of HFMD outbreaks, and helped to clarify the etiologic agents of HFMD in China.

  9. Efficient detection of pathogen virus in sand dabs,Paralichthys olivaceus using loop-mediated isothermal amplification (LAMP)

    Institute of Scientific and Technical Information of China (English)

    HWANG Jinik; PARK So Yun; SUH Sung-Suk; PARK Mirye; LEE Sukchan; LEE Taek-Kyun

    2016-01-01

    Viral hemorrhagic septicemia virus (VHSV) and marine birnavirus (MABV) are the causative pathogens for some of the most explosive epidemics of emerging viral diseases in many Asian countries, leading to huge economic losses in aquaculture. Rapid molecular detection for surveillance or diagnosis has been a critical component in reducing the prevalence of pathogen infection. The loop-mediated isothermal amplification (LAMP) of DNA is currently one of the most commonly used molecular diagnostic tools, as it is simple, quick, and easy to amplify target DNA under isothermal conditions. In the present study, a novel and highly specific LAMP assay for the sensitive and rapid detection of VHSV and MABV infection in fish was developed. Using a set of synthesized primers matching a specific region of the genome, the efficiency and specificity of the LAMP assay were optimized in terms of the reaction temperature and DNA polymerase concentration, as they are the main determinants of the sensitivity and specificity of the LAMP assay. In particular, we demonstrated that our assay could be applied to efficient detection of VHSV and MABV infection in the wild fish,Paralichthys olivaceus. Our results demonstrate the simplicity and convenience of this method for the detection of viral infection in aquatic organisms.

  10. Determining the 95% limit of detection for waterborne pathogen analyses from primary concentration to qPCR

    Science.gov (United States)

    Stokdyk, Joel P.; Firnstahl, Aaron; Spencer, Susan K.; Burch, Tucker R; Borchardt, Mark A.

    2016-01-01

    The limit of detection (LOD) for qPCR-based analyses is not consistently defined or determined in studies on waterborne pathogens. Moreover, the LODs reported often reflect the qPCR assay alone rather than the entire sample process. Our objective was to develop an approach to determine the 95% LOD (lowest concentration at which 95% of positive samples are detected) for the entire process of waterborne pathogen detection. We began by spiking the lowest concentration that was consistently positive at the qPCR step (based on its standard curve) into each procedural step working backwards (i.e., extraction, secondary concentration, primary concentration), which established a concentration that was detectable following losses of the pathogen from processing. Using the fraction of positive replicates (n = 10) at this concentration, we selected and analyzed a second, and then third, concentration. If the fraction of positive replicates equaled 1 or 0 for two concentrations, we selected another. We calculated the LOD using probit analysis. To demonstrate our approach we determined the 95% LOD for Salmonella enterica serovar Typhimurium, adenovirus 41, and vaccine-derived poliovirus Sabin 3, which were 11, 12, and 6 genomic copies (gc) per reaction (rxn), respectively (equivalent to 1.3, 1.5, and 4.0 gc L−1 assuming the 1500 L tap-water sample volume prescribed in EPA Method 1615). This approach limited the number of analyses required and was amenable to testing multiple genetic targets simultaneously (i.e., spiking a single sample with multiple microorganisms). An LOD determined this way can facilitate study design, guide the number of required technical replicates, aid method evaluation, and inform data interpretation.

  11. Development of real-time PCR array for simultaneous detection of eight human blood-borne viral pathogens.

    Directory of Open Access Journals (Sweden)

    Natalia Pripuzova

    Full Text Available BACKGROUND: Real-time PCR array for rapid detection of multiple viral pathogens should be highly useful in cases where the sample volume and the time of testing are limited, i.e. in the eligibility testing of tissue and organ donors. FINDINGS: We developed a real-time PCR array capable of simultaneously detecting eight human viral pathogens: human immunodeficiency virus types 1 and 2 (HIV-1 and -2, hepatitis B virus (HBV, hepatitis C virus (HCV, human T-cell leukemia virus-1 and -2 (HTLV-1 and -2, vaccinia virus (VACV and West Nile virus (WNV. One hundred twenty (120 primers were designed using a combination of bioinformatics approaches, and, after experimental testing, 24 primer sets targeting eight viral pathogens were selected to set up the array with SYBR Green chemistry. The specificity and sensitivity of the virus-specific primer sets selected for the array were evaluated using analytical panels with known amounts of viruses spiked into human plasma. The array detected: 10 genome equivalents (geq/ml of HIV-2 and HCV, 50 geq of HIV-1 (subtype B, HBV (genotype A and WNV. It detected 100-1,000 geq/ml of plasma of HIV-1 subtypes (A - G, group N and CRF (AE and AG isolates. Further evaluation with a panel consisting of 28 HIV-1 and HIV-2 clinical isolates revealed no cross-reactivity of HIV-1 or HIV-2 specific primers with another type of HIV. All 28 viral isolates were identified with specific primer sets targeting the most conserved genome areas. The PCR array correctly identified viral infections in a panel of 17 previously quantified clinical plasma samples positive for HIV-1, HCV or HBV at as low as several geq per PCR reaction. CONCLUSIONS: The viral array described here demonstrated adequate performance in the testing of donors' clinical samples. Further improvement in its sensitivity for the broad spectrum of HIV-1 subtypes is under development.

  12. Detection and prevalence of pathogenic Yersinia enterocolitica in refrigerated and frozen dairy products by duplex PCR and dot hybridization targeting the virF and ail genes.

    Science.gov (United States)

    Ye, Y W; Ling, N; Han, Y J; Wu, Q P

    2014-11-01

    Pathogenic Yersinia enterocolitica is involved in yersiniosis through expression of chromosome-borne or plasmid-borne virulence factors. Yersinia enterocolitica is a cold-tolerant pathogen frequently isolated from refrigerated or frozen foods. However, little attention has been focused on the prevalence of pathogenic Y. enterocolitica in refrigerated or frozen dairy samples in China. In this study, we developed a new duplex PCR targeting the plasmid-borne virF gene and chromosome-borne ail gene for detection of pathogenic Y. enterocolitica isolates. We established a detection limit for the duplex PCR of 6.5 × 10(2)cfu/mL in artificially contaminated dairy samples. In addition, the duplex PCR could detect directly 4.5 to 5.7 cfu of Y. enterocolitica in 5 mL of brain heart infusion broth after 6 h of enrichment at 28 °C. A newly developed dot hybridization assay further confirmed specificity of the duplex PCR for detection of virulent Y. enterocolitica. Furthermore, 13 Y. enterocolitica and 5 pathogenic strains, from 88 commercial frozen or refrigerated dairy products, were detected successfully by the China National Standard method (GB/T4789.8-2008) and the duplex PCR, respectively. Finally, biotypes and serotypes of pathogenic Y. enterocolitica strains were further characterized. The duplex PCR developed here is reliable for large-scale screening, routine monitoring, and risk assessment of pathogenic Y. enterocolitica in refrigerated or frozen dairy products.

  13. Cell Biosensors: Rapid Detection and Identification of Pathogens Using FTIR Microspectroscopic Spectra

    Science.gov (United States)

    2010-04-01

    camera , which allows capture of visible microscopic images from the same region that is interrogated via FTIR. Analysis was performed at 2 cm -1...and coxsackie virus (b) triggered significant transient upregulation of TNF, and IL8 genes, however HSV-1 delayed IL8 mRNA expression. The IL8...Pathogens Using FTIR Microspectroscopic Spectra RTO-MP-HFM-182 29 - 11 REFERENCES [1] Juckem LK, Boehme KW, Feire AL, Compton T (2008) Differential

  14. Rapid Method for Detection, Identification, and Susceptibility Testing of Enteric Pathogens

    OpenAIRE

    Stager, Charles E.; Erikson, Eric; Davis, James R.

    1983-01-01

    Three hundred and seven colonies believed to be enteric pathogens were selected from primary plates of MacConkey, xylose desoxycholate, or salmonella-shigella agar for inoculation to lactose-sucrose broth, urea-41 motility medium, modified Andrade glucose broth with inverted Durham tube, pregrowth broth, triple sugar iron agar, lysine iron agar (LIA), and Christensen urea agar. The rapid screen consisted of interpreting the lactose-sucrose, urea-41 motility, and modified Andrade glucose broth...

  15. Rapid multiplex detection of 10 foodborne pathogens with an up-converting phosphor technology-based 10-channel lateral flow assay.

    Science.gov (United States)

    Zhao, Yong; Wang, Haoran; Zhang, Pingping; Sun, Chongyun; Wang, Xiaochen; Wang, Xinrui; Yang, Ruifu; Wang, Chengbin; Zhou, Lei

    2016-02-17

    The rapid high-throughput detection of foodborne pathogens is essential in controlling food safety. In this study, a 10-channel up-converting phosphor technology-based lateral flow (TC-UPT-LF) assay was established for the rapid and simultaneous detection of 10 epidemic foodborne pathogens. Ten different single-target UPT-LF strips were developed and integrated into one TC-UPT-LF disc with optimization. Without enrichment the TC-UPT-LF assay had a detection sensitivity of 10(4) CFU mL(-1) or 10(5) CFU mL(-1) for each pathogen, and after sample enrichment it was 10 CFU/0.6 mg. The assay also showed good linearity, allowing quantitative detection, with a linear fitting coefficient of determination (R(2)) of 0.916-0.998. The 10 detection channels did not cross-react, so multiple targets could be specifically detected. When 279 real food samples were tested, the assay was highly consistent (100%) with culture-based methods. The results for 110 food samples artificially contaminated with single or multiple targets showed a high detection rate (≥ 80%) for most target bacteria. Overall, the TC-UPT-LF assay allows the rapid, quantitative, and simultaneous detection of 10 kinds of foodborne pathogens within 20 min, and is especially suitable for the rapid detection and surveillance of foodborne pathogens in food and water.

  16. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

    Directory of Open Access Journals (Sweden)

    J.A. Khan

    2013-09-01

    Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

  17. Detection of pathogenic bacteria in skin lesions of patients with chiclero's ulcer: reluctant response to antimonial treatment

    Directory of Open Access Journals (Sweden)

    Isaac-Márquez Angélica Patricia

    2003-01-01

    Full Text Available We investigated the bacterial flora present in skin lesions of patients with chiclero's ulcer from the Yucatan peninsula of Mexico using conventional culture methods (11 patients, and an immunocolorimetric detection of pathogenic Streptococcus pyogenes (15 patients. Prevalence of bacteria isolated by culture methods was 90.9% (10/11. We cultured, from chiclero's ulcers (60%, pathogenic bacterial such as Staphylococcus aureus (20%, S. pyogenes (1.6%, Pseudomonas aeruginosa (1.6%, Morganella morganii (1.6%, and opportunist pathogenic bacteria such as Klebsiella spp. (20.0%, Enterobacter spp. (20%, and Enterococcus spp. (20%. We also cultured coagulase-negative staphylococci in 40% (4/10 of the remaining patients. Micrococcus spp. and coagulase-negative staphylococci constituted the bacterial genuses more frequently isolated in the normal skin of patients with chiclero's ulcer and healthy individuals used as controls. We also undertook another study to find out the presence of S. pyogenes by an immunocolorimetric assay. This study indicated that 60% (9/15 of the ulcerated lesions, but not normal controls, were contaminated with S. pyogenes. Importantly, individuals with purulent secretion and holding concomitant infections with S. pyogenes, S. aureus, P. aeruginosa, M. morganii, and E. durans took longer to heal Leishmania (L. mexicana infections treated with antimonial drugs. Our results suggest the need to eliminate bacterial purulent infections, by antibiotic treatment, before starting antimonial administration to patients with chiclero's ulcer.

  18. Simulation of laser detection and ranging (LADAR) and forward-looking infrared (FLIR) data for autonomous tracking of airborne objects

    Science.gov (United States)

    Powell, Gavin; Markham, Keith C.; Marshall, David

    2000-06-01

    This paper presents the results of an investigation leading into an implementation of FLIR and LADAR data simulation for use in a multi sensor data fusion automated target recognition system. At present the main areas of application are in military environments but systems can easily be adapted to other areas such as security applications, robotics and autonomous cars. Recent developments have been away from traditional sensor modeling and toward modeling of features that are external to the system, such as atmosphere and part occlusion, to create a more realistic and rounded system. We have implemented such techniques and introduced a means of inserting these models into a highly detailed scene model to provide a rich data set for later processing. From our study and implementation we are able to embed sensor model components into a commercial graphics and animation package, along with object and terrain models, which can be easily used to create a more realistic sequence of images.

  19. A novel electrochemical aptasensor for highly sensitive detection of thrombin based on the autonomous assembly of hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme nanowires.

    Science.gov (United States)

    Xie, Shunbi; Chai, Yaqin; Yuan, Yali; Bai, Lijuan; Yuan, Ruo

    2014-06-17

    In this work, a new signal amplified strategy was constructed based on isothermal exponential amplification reaction (EXPAR) and hybridization chain reaction (HCR) generating the hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme (HRP-mimicking DNAzyme) nanowires as signal output component for the sensitive detection of thrombin (TB). We employed EXPAR's ultra-high amplification efficiency to produce a large amount of two hairpin helper DNAs within a minutes. And then the resultant two hairpin helper DNAs could autonomously assemble the hemin/G-quadruplex HRP-mimicking DNAzymes nanowires as the redox-active reporter units on the electrode surface via hybridization chain reaction (HCR). The hemin/G-quadruplex structures simultaneously served as electron transfer medium and electrocatalyst to amplify the signal in the presence of H2O2. Specifically, only when the EXPAR reaction process has occurred, the HCR could be achieved and the hemin/G-quadruplex complexes could be formed on the surface of an electrode to give a detectable signal. The proposed strategy combines the amplification power of the EXPAR, HCR, and the inherent high sensitivity of the electrochemical detection. With such design, the proposed assay showed a good linear relationship within the range of 0.1 pM-50 nM with a detection limit of 33 fM (defined as S/N=3) for TB.

  20. Detection of respiratory viral and bacterial pathogens causing pediatric community-acquired pneumonia in Beijing using real-time PCR

    Institute of Scientific and Technical Information of China (English)

    Tie-Gang Zhang; Ai-Hua Li; Min Lyu; Meng Chen; Fang Huang; Jiang Wu

    2015-01-01

    Objective: The aim of this study was to determine the etiology and prevalence of pediatric CAP in Beijing using a real-time polymerase chain reaction (PCR) technique. Methods: Between February 15, 2011 and January 18, 2012, 371 pediatric patients with CAP were enrolled at Beijing Children's Hospital. Sixteen respiratory viruses and two bacteria were detected from tracheal aspirate specimens using commercially available multiplex real-time reverse transcription PCR (RT-PCR) kits. Results: A single viral pathogen was detected in 35.3%of enrolled patients, multiple viruses in 11.6%, and virus/bacteria co-infection in 17.8%. In contrast, only 6.5%of patients had a single bacterial pathogen and 2.2%were infected with multiple bacteria. The etiological agent was unknown for 26.7% of patients. The most common viruses were respiratory syncytial virus (RSV) (43.9%), rhinovirus (14.8%), parainfluenza virus (9.4%), and adenovirus (8.6%). In patients under three years of age, RSV (44.6%), rhinovirus (12.8%), and Streptococcus pneumoniae (9.9%) were the most frequent pathogens. In children aged 3e7 years, S. pneumoniae (38.9%), RSV (30.6%), Haemophilus influenzae (19.4%), and adenovirus (19.4%) were most prevalent. Finally in children over seven years, RSV (47.3%), S. pneumoniae (41.9%), and rhinovirus (21.5%) infections were most frequent. Conclusions: Viral pathogens, specifically RSV, were responsible for the majority of CAP in pediatric patients. However, both S. pneumoniae and H. influenzae contributed as major causes of disease. Commercially available multiplexing real-time PCR allowed for rapid detection of the etiological agent. Copyright © 2015, Chinese Medical Association Production. Production and hosting by Elsevier B.V. on behalf of KeAi Communications Co., Ltd. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

  1. Insufficiency of the Kanagawa hemolytic test for detecting pathogenic Vibrio parahaemolyticus in Shanghai, China.

    Science.gov (United States)

    Hongping, Wang; Jilun, Zhang; Ting, Jiang; Yixi, Bao; Xiaoming, Zhou

    2011-01-01

    We evaluated the Kanagawa hemolytic test and tdh gene test for accuracy in identifying pathogenic Vibrio parahaemolyticus isolates in Shanghai. One hundred and seventy-two V. parahaemolyticus isolates were collected from diarrhea patients, freshly harvested sea fish, or fresh water samples. Statistical data for the Kanagawa hemolytic test and tdh gene test were compared. There were 83.51% isolates (81/97) from patients and 22.22% isolates (10/45) from sea-fish positive for the tdh gene. However, none of 30 isolates from fresh water samples were tdh-positive. Positive Kanagawa hemolytic tests were obtained in 88.66%, 46.67%, and 76.67% of isolates, which were from patients, sea fish, and fresh water samples, respectively. Positive rates of the Kanagawa hemolytic tests and the tdh gene tests were significantly different in isolates from those 3 sources (P tdh gene test showed higher specificity than the Kanagawa hemolytic test on identifying pathogenic V. parahaemolyticus isolates in Shanghai, China.

  2. Detection, Identification, and Prevalence of Pathogenic Vibrio parahaemolyticus in Fish and Coastal Environment in Jordan.

    Science.gov (United States)

    Alaboudi, Akram R; Ababneh, Mustafa; Osaili, Tareq M; Al Shloul, Khalaf

    2016-01-01

    Vibrio parahaemolyticus is widely distributed in the marine environments and considered the leading cause of human gastroenteritis in Asian countries. A total of 150 marketed fish and 50 water and sediment samples from the Gulf of Aqaba were examined for the prevalence of pathogenic strains of V. parahaemolyticus. A total of 132 typical isolates obtained from the primary selective medium (thiosulfate-citrate bile salt sucrose agar) and showed positive biochemical properties were subjected to confirmation by polymerase chain reaction targeting the gyrB and toxR genes. These genes were confirmed at rates of 82% (108 isolates) and 72% (95 isolates), respectively. The toxR positive isolates were tested for the presence of thermolabile hemolysin (tlh), thermostable direct hemolysin (tdh), and tdh-related hemolysin (trh) virulence genes. Accordingly, the prevalence rates of pathogenic V. parahaemolyticus were 4%, 8%, and 12% in sediment, water, and fish samples, respectively. The 16S rRNA amplification and sequences were conducted for confirmation of the isolates and showing the relatedness among these isolates. The results showed that both 16S rRNA and toxR assays had same sensitivity and tested isolates had high nucleotide similarity irrespective of their sources.

  3. Impedance based detection of pathogenic E. coli O157:H7 using a ferrocene-antimicrobial peptide modified biosensor.

    Science.gov (United States)

    Li, Yongxin; Afrasiabi, Rouzbeh; Fathi, Farkhondeh; Wang, Nan; Xiang, Cuili; Love, Ryan; She, Zhe; Kraatz, Heinz-Bernhard

    2014-08-15

    Escherichia coli O157:H7 can cause life-threatening gastrointestinal diseases and has been a severe public health problem worldwide in recent years. A novel biosensor for the detection of E. coli O157:H7 is described here using a film composed of ferrocene-peptide conjugates, in which the antimicrobial peptide magainin I has been incorporated as the biorecognition element. Electrochemical impedance spectroscopy was employed to investigate the surface characteristics of the newly developed biosensor and to monitor the interactions between the peptide film and the pathogenic bacteria. X-ray photoelectron spectroscopy and time-of-flight secondary ion mass spectrometry (ToF-SIMS) were employed to confirm the immobilization of ferrocene-conjugate onto the gold surface. Non-pathogenic E. coli K12, Staphylococcus epidermidis and Bacillus subtilis were used in this study to evaluate the selectivity of the proposed biosensor. The results have shown the order of the preferential selectivity of the method is E. coli O157:H7>non-pathogenic E. coli>gram positive species. The detection of E. coli O157:H7 with a sensitivity of 10(3)cfu/mL is enabled by the biosensor. The experimental conditions have been optimized and the plot of changes of charge transfer resistance (ΔRCT) and the logarithm of the cell concentration of E. coli O157:H7 shows a linear correlation in the range of 10(3)-10(7)cfu/mL with a correlation coefficient of 0.983.

  4. Autonomous Undersea Observations

    Science.gov (United States)

    2016-06-13

    less expensive sensor systems for a variety of applications, including measurement of physical characteristics of the ocean, threat detection, and...multiple autonomous environmental sensors within an acoustic modem-based infrastructure capable of communicating to and from the sensors and to and...networks, and telesonar with high speed platforms. This effort is concentrating on the development and demonstration of the two modem- based sensors . We

  5. Molecular characterization of canine parvovirus strains in Argentina: Detection of the pathogenic variant CPV2c in vaccinated dogs.

    Science.gov (United States)

    Calderon, Marina Gallo; Mattion, Nora; Bucafusco, Danilo; Fogel, Fernando; Remorini, Patricia; La Torre, Jose

    2009-08-01

    PCR amplification with sequence-specific primers was used to detect canine parvovirus (CPV) DNA in 38 rectal swabs from Argentine domestic dogs with symptoms compatible with parvovirus disease. Twenty-seven out of 38 samples analyzed were CPV positive. The classical CPV2 strain was not detected in any of the samples, but nine samples were identified as CPV2a variant and 18 samples as CPV2b variant. Further sequence analysis revealed a mutation at amino acid 426 of the VP2 gene (Asp426Glu), characteristic of the CPV2c variant, in 14 out of 18 of the samples identified initially by PCR as CPV2b. The appearance of CPV2c variant in Argentina might be dated at least to the year 2003. Three different pathogenic CPV variants circulating currently in the Argentine domestic dog population were identified, with CPV2c being the only variant affecting vaccinated and unvaccinated dogs during the year 2008.

  6. Segmented continuous-flow multiplex polymerase chain reaction microfluidics for high-throughput and rapid foodborne pathogen detection.

    Science.gov (United States)

    Shu, Bowen; Zhang, Chunsun; Xing, Da

    2014-05-15

    High-throughput and rapid identification of multiple foodborne bacterial pathogens is vital in global public health and food industry. To fulfill this need, we propose a segmented continuous-flow multiplex polymerase chain reaction (SCF-MPCR) on a spiral-channel microfluidic device. The device consists of a disposable polytetrafluoroethylene (PTFE) capillary microchannel coiled on three isothermal blocks. Within the channel, n segmented flow regimes are sequentially generated, and m-plex PCR is individually performed in each regime when each mixture is driven to pass three temperature zones, thus providing a rapid analysis throughput of m×n. To characterize the performance of the microfluidic device, continuous-flow multiplex PCR in a single segmented flow has been evaluated by investigating the effect of key reaction parameters, including annealing temperatures, flow rates, polymerase concentration and amount of input DNA. With the optimized parameters, the genomic DNAs from Salmonella enterica, Listeria monocytogenes, Escherichia coli O157:H7 and Staphylococcus aureus could be amplified simultaneously in 19min, and the limit of detection was low, down to 10(2) copiesμL(-1). As proof of principle, the spiral-channel SCF-MPCR was applied to sequentially amplify four different bacterial pathogens from banana, milk, and sausage, displaying a throughput of 4×3 with no detectable cross-contamination.

  7. Detection of food-borne pathogens by nanoparticle technology coupled to a low-cost cell reader

    Science.gov (United States)

    Noiseux, Isabelle; Bouchard, Jean-Pierre; Gallant, Pascal; Bourqui, Pascal; Cao, Honghe; Vernon, Marci; Johnson, Roger; Chen, Shu; Mermut, Ozzy

    2010-02-01

    The detection, identification and quantification of pathogenic microorganisms at low cost are of great interest to the agro-food industry. We have developed a simple, rapid, sensitive, and specific method for detection of food-borne pathogens based on use of nanoparticles alongside a low cost fluorescence cell reader for the bioassay. The nanoparticles are coupled with antibodies that allow specific recognition of the targeted Listeria in either a liquid or food matrix. The bioconjugated nanoparticles (FNP) contain thousands of dye molecules enabling significant amplification of the fluorescent signal emitted from each bacterium. The developed fluorescence Cell Reader is an LED-based reader coupled with suitable optics and a camera that acquires high resolution images. The dedicated algorithm allowed the counting of each individual nanoparticles-fluorescent bacterial cells thus enabling highly sensitive reading. The system allows, within 1 hour, the recovery and counting of 104 to 108 cfu/mL of Listeria in pure culture. However, neither the Cell Reader nor the algorithm can differentiate between the FNPs specifically-bound to the target and the residual unbound FNPs limiting sensitivity of the system. Since FNPs are too small to be washed in the bioassay, a dual tagging approach was implemented to allow online optical separation of the fluorescent background caused by free FNPs.

  8. Cis phosphorylated tau as the earliest detectable pathogenic conformation in Alzheimer disease, offering novel diagnostic and therapeutic strategies.

    Science.gov (United States)

    Nakamura, Kazuhiro; Zhen Zhou, Xiao; Ping Lu, Kun

    2013-01-01

    After protein phosphorylation on certain serine or threonine residues preceding a proline (pSer/Thr-Pro), the function of certain phosphorylated protein is further regulated by cis-trans conformational change. Due to the lack of any tool to detect such two conformations in cells, however, it is not even known whether any cis or trans conformation exists in vivo, not to mention their conformation-specific functions or regulation. We developed a novel peptide chemistry technology to generate the first pair of antibodies that can distinguish cis from trans pThr231-Pro tau. Cis, but not trans, pThr231-tau appears early in mild cognitive impairment (MCI) neurons and further accumulates in only degenerating neurons as Alzheimer disease (AD) progresses, localizing to dystrophic neurites, which are known to correlate well with memory loss. Unlike trans p-tau, the cis cannot promote microtubule assembly, and is more resistant to dephosphorylation and degradation and more prone to aggregation. Pin1 accelerates cis to trans isomerization to prevent tau pathology in AD. Thus, during MCI and AD development, cis pThr231-Pro tau is the earliest detectable pathogenic tau conformation and antibodies and vaccines against the pathogenic cis p-tau may be used for the early diagnosis and treatment of AD. These findings offer in vivo approach to study conformational regulation of Pro-directed phosphorylation signaling.

  9. Cationic polyelectrolyte functionalized magnetic particles assisted highly sensitive pathogens detection in combination with polymerase chain reaction and capillary electrophoresis.

    Science.gov (United States)

    Chen, Jia; Lin, Yuexin; Wang, Yu; Jia, Li

    2015-06-01

    Pathogenic bacteria cause significant morbidity and mortality to humans. There is a pressing need to establish a simple and reliable method to detect them. Herein, we show that magnetic particles (MPs) can be functionalized by poly(diallyl dimethylammonium chloride) (PDDA), and the particles (PDDA-MPs) can be utilized as adsorbents for capture of pathogenic bacteria from aqueous solution based on electrostatic interaction. The as-prepared PDDA-MPs were characterized by Fourier-transform infrared spectroscopy, zeta potential, vibrating sample magnetometry, X-ray diffraction spectrometry, scanning electron microscopy, and transmission electron microscopy. The adsorption equilibrium time can be achieved in 3min. According to the Langmuir adsorption isotherm, the maximum adsorption capacities for E. coli O157:H7 (Gram-negative bacteria) and L. monocytogenes (Gram-positive bacteria) were calculated to be 1.8×10(9) and 3.1×10(9)cfumg(-1), respectively. The bacteria in spiked mineral water (1000mL) can be completely captured when applying 50mg of PDDA-MPs and an adsorption time of 5min. In addition, PDDA-MPs-based magnetic separation method in combination with polymerase chain reaction and capillary electrophoresis allows for rapid detection of 10(1)cfumL(-1) bacteria.

  10. SeptiFast real-time PCR for detection of bloodborne pathogens in patients with severe sepsis or septic shock.

    Science.gov (United States)

    Markota, Andrej; Seme, Katja; Golle, Andrej; Poljak, Mario; Sinkovič, Andreja

    2014-09-01

    Several studies have been performed investigating the role of a real-time multiplex polymerase chain reaction assay LightCycler SeptiFast with inconsistent results. In prospective evaluation of adult patients with severe sepsis or septic shock SeptiFast assay and blood culture results were compared regarding concordance, the impact of SeptiFast assay on antimicrobial therapy adjustment, time to results and the role of SeptiFast assay as a marker of disease severity. 63 blood sample sets were collected from 57 patients. 51 (80.9%) results were concordant negative and 7 (11.1%) concordant posi- tive. In one (1.6%) sample set blood culture was positive and SeptiFast assay negative, in three (4.8%) sample sets with negative blood cultures pathogens were detected by SeptiFast assay and in one (1.6%)patient an additional pathogen was detected by SeptiFast assay. If blood culture is considered as "gold standard", 1 (1.6%) SeptiFast false negative and 4 (6.3%) false positive results were identified (sensitivity 87.5%, specificity 92.6%, negative predictive value 97.8%). Antibiotic treatment was adjusted according to SeptiFast assay in 4 (6.3%) cases. Time to final results was significantly shorter with SeptiFast assay (32 +/- 23 h vs. 97 +/- 28 h, p sepsis and septic shock but it cannot replace the blood culture.

  11. Loop-mediated isothermal amplification (LAMP) assays for detection and identification of aquaculture pathogens: current state and perspectives.

    Science.gov (United States)

    Biswas, Gouranga; Sakai, Masahiro

    2014-04-01

    Since its invention in 2000, loop-mediated isothermal amplification (LAMP) assay has been one of the most extensively used molecular diagnostic tools in bio-medical fields due to the rapidity, accuracy, and cost-effectiveness of the technique. This technique has also earned popularity in aquaculture disease diagnosis. Aquaculture, as a result of its rapid intensification and expansion, experiences increased infectious disease occurrences. For maintenance of economic viability, rapid, sensitive and efficient diagnosis of disease causing agents is an important step prior to undertaking effective prevention and control measures in aquaculture. Constraints on time and expertise required for conventional biochemical, serological and polymerase chain reaction (PCR)-based techniques offer avenues in adoption of the LAMP by the aquaculturists at field conditions. This assay has been successfully applied in detection of several bacterial, viral and parasitic pathogens causing serious diseases in aquaculture. In this review, we endeavored to accommodate the LAMP methodology with its different recent improvements and an overview of its application for the detection of aquaculture-associated pathogens.

  12. A multiplex quantitative real-time polymerase chain reaction panel for detecting neurologic pathogens in dogs with meningoencephalitis.

    Science.gov (United States)

    Han, Jae-Ik; Chang, Dong-Woo; Na, Ki-Jeong

    2015-01-01

    Meningoencephalitis (ME) is a common inflammatory disorder of the central nervous system in dogs. Clinically, ME has both infectious and non-infectious causes. In the present study, a multiplex quantitative real-time polymerase chain reaction (mqPCR) panel was optimized for the detection of eight canine neurologic pathogens (Blastomyces dermatitidis, Cryptococcus spp., Neospora caninum, Borrelia burgdorferi, Bartonella spp., Toxoplasma gondii, Ehrlichia canis, and canine distemper virus [CDV]). The mqPCR panel was subsequently applied to 53 cerebrospinal fluid (CSF) samples collected from dogs with ME. The analytic sensitivity (i.e., limit of detection, expressed as molecules per 1 mL of recombinant vector) was 3.8 for CDV, 3.7 for Ehrlichia canis, 3.7 for Bartonella spp., 3.8 for Borrelia burgdorferi, 3.7 for Blastomyces dermatitidis, 3.7 for Cryptococcus spp., 38 for Neospora caninum, and 3.7 for Toxoplasma gondii. Among the tested CSF samples, seven (15%) were positive for the following pathogens in decreasing order of frequency: Cryptococcus spp. (3/7), Blastomyces dermatitidis (2/7), and Borrelia burgdorferi (2/7). In summary, use of an mqPCR panel with high analytic sensitivity as an initial screen for infectious agents in dogs with ME could facilitate the selection of early treatment strategies and improve outcomes.

  13. Oxidative stress and pathogenic attack in plants, studied by laser based photoacoustic trace gas detection

    NARCIS (Netherlands)

    Santosa, Ignatius Edi

    2002-01-01

    Photoacoustic detection has proven to be a sensitive method, which is suitable for trace gas measurement. In this thesis, we improved the photoacoustic detection system to measure new biologically interesting gases, ethane (C2H6) and nitric oxide (NO). A new design of grating holder is incorporated

  14. Simultaneous detection of major blackleg and soft rot bacterial pathogens in potato by multiplex polymerase chain reaction.

    Science.gov (United States)

    Potrykus, M; Sledz, W; Golanowska, M; Slawiak, M; Binek, A; Motyka, A; Zoledowska, S; Czajkowski, R; Lojkowska, E

    2014-11-01

    A multiplex polymerase chain reaction (PCR) assay for simultaneous, fast and reliable detection of the main soft rot and blackleg potato pathogens in Europe has been developed. It utilises three pairs of primers and enables detection of three groups of pectinolytic bacteria frequently found in potato, namely: Pectobacterium atrosepticum, Pectobacterium carotovorum subsp. carotovorum together with Pectobacterium wasabiae and Dickeya spp. in a multiplex PCR assay. In studies with axenic cultures of bacteria, the multiplex assay was specific as it gave positive results only with strains of the target species and negative results with 18 non-target species of bacteria that can possibly coexist with pectinolytic bacteria in a potato ecosystem. The developed assay could detect as little as 0.01 ng µL(-1) of Dickeya sp. genomic DNA, and down to 0.1 ng µL(-1) of P. atrosepticum and P. carotovorum subsp. carotovorum genomic DNA in vitro. In the presence of competitor genomic DNA, isolated from Pseudomonas fluorescens cells, the sensitivity of the multiplex PCR decreased tenfold for P. atrosepticum and Dickeya sp., while no change was observed for P. carotovorum subsp. carotovorum and P. wasabiae. In spiked potato haulm and tuber samples, the threshold level for target bacteria was 10(1) cfu mL(-1) plant extract (10(2) cfu g(-1) plant tissue), 10(2) cfu mL(-1) plant extract (10(3) cfu g(-1) plant tissue), 10(3) cfu mL(-1) plant extract (10(4) cfu g(-1) plant tissue), for Dickeya spp., P. atrosepticum and P. carotovorum subsp. carotovorum/P. wasabiae, respectively. Most of all, this assay allowed reliable detection and identification of soft rot and blackleg pathogens in naturally infected symptomatic and asymptomatic potato stem and progeny tuber samples collected from potato fields all over Poland.

  15. Interferon-inducible GTPases in cell autonomous and innate immunity.

    Science.gov (United States)

    Meunier, Etienne; Broz, Petr

    2016-02-01

    Detection and clearance of invading pathogens requires a coordinated response of the adaptive and innate immune system. Host cell, however, also features different mechanisms that restrict pathogen replication in a cell-intrinsic manner, collectively referred to as cell-autonomous immunity. In immune cells, the ability to unleash those mechanisms strongly depends on the activation state of the cell, which is controlled by cytokines or the detection of pathogen-associated molecular patterns by pattern-recognition receptors. The interferon (IFN) class of cytokines is one of the strongest inducers of antimicrobial effector mechanisms and acts against viral, bacterial and parasitic intracellular pathogens. This has been linked to the upregulation of several hundreds of IFN-stimulated genes, among them the so-called IFN-inducible GTPases. Two subfamilies of IFN-inducible GTPases, the immunity-related GTPases (IRGs) and the guanylate-binding proteins (GBPs), have gained attention due to their exceptional ability to specifically target intracellular vacuolar pathogens and restrict their replication by destroying their vacuolar compartment. Their repertoire has recently been expanded to the regulation of inflammasome complexes, which are cytosolic multi-protein complexes that control an inflammatory cell death called pyroptosis and the release of cytokines like interleukin-1β and interleukin-18. Here we discuss recent advances in understanding the function, the targeting and regulation of IRG and GBP proteins during microbial infections.

  16. Vascular Streak Dieback of cacao in Southeast Asia and Melanesia: in planta detection of the pathogen and a new taxonomy.

    Science.gov (United States)

    Samuels, Gary J; Ismaiel, Adnan; Rosmana, Ade; Junaid, Muhammad; Guest, David; McMahon, Peter; Keane, Philip; Purwantara, Agus; Lambert, Smilja; Rodriguez-Carres, Marianela; Cubeta, Marc A

    2012-01-01

    Vascular Streak Dieback (VSD) disease of cacao (Theobroma cacao) in Southeast Asia and Melanesia is caused by a basidiomycete (Ceratobasidiales) fungus Oncobasidium theobromae (syn. =Thanatephorus theobromae). The most characteristic symptoms of the disease are green-spotted leaf chlorosis or, commonly since about 2004, necrotic blotches, followed by senescence of leaves beginning on the second or third flush behind the shoot apex, and blackening of infected xylem in the vascular traces at the leaf scars resulting from the abscission of infected leaves. Eventually the shoot apex is killed and infected branches die. In susceptible cacao the fungus may grow through the xylem down into the main stem and kill a mature cacao tree. Infections in the stem of young plants prior to the formation of the first 3-4 lateral branches usually kill the plant. Basidiospores released from corticioid basidiomata developed on leaf scars or along cracks in the main vein of infected leaves infect young leaves. The pathogen commonly infects cacao but there are rare reports from avocado. As both crops are introduced to the region, the pathogen is suspected to occur asymptomatically in native vegetation. The pathogen is readily isolated but cultures cannot be maintained. In this study, DNA was extracted from pure cultures of O. theobromae obtained from infected cacao plants sampled from Indonesia. The internal transcribed spacer region (ITS), consisting of ITS1, 5.8S ribosomal RNA and ITS2, and a portion of nuclear large subunit (LSU) were sequenced. Phylogenetic analysis of ITS sequences placed O. theobromae sister to Ceratobasidium anastomosis groups AG-A, AG-Bo, and AG-K with high posterior probability. Therefore the new combination Ceratobasidium theobromae is proposed. A PCR-based protocol was developed to detect and identify C. theobromae in plant tissue of cacao enabling early detection of the pathogen in plants. A second species of Ceratobasidium, Ceratobasidium ramicola

  17. Label-Free 3D Ag Nanoflower-Based Electrochemical Immunosensor for the Detection of Escherichia coli O157:H7 Pathogens

    Science.gov (United States)

    Huang, He; Liu, Minghuan; Wang, Xiangsheng; Zhang, Wenjie; Yang, Da-Peng; Cui, Lianhua; Wang, Xiansong

    2016-11-01

    It is highly desirable to develop a rapid and simple method to detect pathogens. Combining nanomaterials with electrochemical techniques is an efficient way for pathogen detection. Herein, a novel 3D Ag nanoflower was prepared via a biomineralization method by using bovine serum albumin (BSA) as a template. It was adopted as a sensing interface to construct an electrochemical bacteria immunosensor for the rapid detection of foodborne pathogens Escherichia coli ( E. coli) O157:H7. Bacterial antibody was immobilized onto the surface of Ag nanoflowers through covalent conjugation. Electrochemical impedance spectroscopy (EIS) was used to detect and validate the resistance changes, where [Fe(CN)6]3-/4- acted as the redox probe. A linear relation between R et and E. coli concentration was obtained in the E. coli concentration range of 3.0 × 102-3.0 × 108 cfu mL-1. The as-prepared biosensor gave rise to an obvious response to E. coli but had no distinct response to Cronobacter sakazakii, methicillin-resistant Staphylococcus aureus (MRSA), Staphylococcus albus, Lactobacillus easei, and Shigella flexneri, revealing a high selectivity for the detection of the pathogens down to 100 cfu mL-1 in a short time. We believe that this BSA-conjugated 3D Ag nanoflowers could be used as a powerful interface material with good conductivity and biocompatibility for improving pathogen detection and treatment in the field of medicine, environment, and food safety.

  18. Fluorescence In Situ Hybridization for the Tissue Detection of Bacterial Pathogens Associated with Porcine Infections

    DEFF Research Database (Denmark)

    Elvang Jensen, Henrik; Jensen, Louise Kruse; Barington, Kristiane;

    2015-01-01

    Fluorescence in situ hybridization (FISH) is an efficient technique for the identification of specific bacteria in tissue of both experimental and spontaneous infections. The method detects specific sequences of nucleic acids by hybridization of fluorescently labeled probes to complementary targe...

  19. [Detection of viral infection pathogens in medicinal plants grown in Ukraine].

    Science.gov (United States)

    Mishchenko, L T; Korenieva, A A; Molchanets', O V; Boĭko, A L

    2009-01-01

    Monitoring of viral infection on medicinal plant plantations is carried out. Panax ginseng C.A. Meyer, Valeriana officinalis L., Plantago major L. with symptoms of viral infection were revealed. Viral nature of symptoms was proved with biotesting method. Morphology and sizes of virus particles, detected in Panax ginseng method. Morphology and sizes of virus particles, detected in Panax ginseng C.A. Meyer, Valeriana officinalis L., Plantago major L., were determined with electron microscopy method. The paper is presented in Ukrainian.

  20. Development and applications of Ray's fluid thioglycollate media for detection and manipulation of Perkinsus spp. pathogens of marine molluscs.

    Science.gov (United States)

    Dungan, Christopher F; Bushek, David

    2015-10-01

    During the early 1950s, Sammy M. Ray discovered that his high-salt modification of fluid thioglycollate sterility test medium caused dramatic in vitro enlargement of Perkinsus marinus (=Dermocystidium marinum) cells that coincidentally infected several experimentally cultured oyster gill tissue explants. Subsequent testing confirmed that the enlarged cells among some oyster tissues incubated in Ray's fluid thioglycollate medium (RFTM) were those of that newly described oyster pathogen. Non-proliferative in vitro enlargement, cell wall thickening, and subsequent blue-black iodine-staining of hypertrophied trophozoites (=hypnospores=prezoosporangia) following incubation in RFTM are unique characteristics of confirmed members of the protistan genus Perkinsus. A number of in vitro assays and manipulations with RFTM have been developed for selective detection and enumeration of Perkinsus sp. cells in tissues of infected molluscs, and in environmental samples. RFTM-enlarged Perkinsus sp. cells from tissues of infected molluscs also serve as useful inocula for initiating in vitro isolate cultures, and cells of several Perkinsus spp. from both in vitro cultures and infected mollusc tissues may be induced to zoosporulate by brief incubations in RFTM. DNAs from RFTM-enlarged Perkinsus sp. cells provide useful templates for PCR amplifications, and for sequencing and other assays to differentiate and identify the detected Perkinsus species. We review the history and components of fluid thioglycollate and RFTM media, and the characteristics of numerous RFTM-based diagnostic assays that have been developed and used worldwide since 1952 for detection and identification of Perkinsus spp. in host mollusc tissues and environmental samples. We also review applications of RFTM for in vitro manipulations and purifications of Perkinsus sp. pathogen cells.

  1. Pathogen detection in complex samples by quartz crystal microbalance sensor coupled to aptamer functionalized core-shell type magnetic separation.

    Science.gov (United States)

    Ozalp, Veli C; Bayramoglu, Gulay; Erdem, Zehra; Arica, M Yakup

    2015-01-01

    A quartz crystal microbalance sensor (QCM) was developed for sensitive and specific detection of Salmonella enterica serovar typhimurium cells in food samples by integrating a magnetic bead purification system. Although many sensor formats based on bioaffinity agents have been developed for sensitive and specific detection of bacterial cells, the development of robust sensor applications for food samples remained a challenging issue. A viable strategy would be to integrate QCM to a pre-purification system. Here, we report a novel and sensitive high throughput strategy which combines an aptamer-based magnetic separation system for rapid enrichment of target pathogens and a QCM analysis for specific and real-time monitoring. As a proof-of-concept study, the integration of Salmonella binding aptamer immobilized magnetic beads to the aptamer-based QCM system was reported in order to develop a method for selective detection of Salmonella. Since our magnetic separation system can efficiently capture cells in a relatively short processing time (less than 10 min), feeding captured bacteria to a QCM flow cell system showed specific detection of Salmonella cells at 100 CFU mL(-1) from model food sample (i.e., milk). Subsequent treatment of the QCM crystal surface with NaOH solution regenerated the aptamer-sensor allowing each crystal to be used several times.

  2. Detection and typing of highly pathogenic porcine reproductive and respiratory syndrome virus by multiplex real-time rt-PCR.

    Directory of Open Access Journals (Sweden)

    Kerstin Wernike

    Full Text Available Porcine reproductive and respiratory syndrome (PRRS causes economic losses in the pig industry worldwide, and PRRS viruses (PRRSV are classified into the two distinct genotypes "North American (NA, type 2" and "European (EU, type 1". In 2006, a highly pathogenic NA strain of PRRSV (HP-PRRSV, characterized by high fever as well as high morbidity and mortality, emerged in swine farms in China. Therefore, a real-time reverse transcription polymerase chain reaction (RT-qPCR assay specific for HP-PRRSV was developed and combined with type 1- and type 2-specific RT-qPCR systems. Furthermore, an internal control, based on a heterologous RNA, was successfully introduced. This final multiplex PRRSV RT-qPCR, detecting and typing PRRSV, had an analytical sensitivity of less than 200 copies per µl for the type 1-assay and 20 copies per µl for the type 2- and HP assays and a high diagnostic sensitivity. A panel of reference strains and field isolates was reliably detected and samples from an animal trial with a Chinese HP-PRRS strain were used for test validation. The new multiplex PRRSV RT-qPCR system allows for the first time the highly sensitive detection and rapid differentiation of PRRSV of both genotypes as well as the direct detection of HP-PRRSV.

  3. Use of sensitive, broad-spectrum molecular assays and human airway epithelium cultures for detection of respiratory pathogens.

    Directory of Open Access Journals (Sweden)

    Krzysztof Pyrc

    Full Text Available Rapid and accurate detection and identification of viruses causing respiratory tract infections is important for patient care and disease control. Despite the fact that several assays are available, identification of an etiological agent is not possible in ~30% of patients suffering from respiratory tract diseases. Therefore, the aim of the current study was to develop a diagnostic set for the detection of respiratory viruses with sensitivity as low as 1-10 copies per reaction. Evaluation of the assay using a training clinical sample set showed that viral nucleic acids were identified in ~76% of cases. To improve assay performance and facilitate the identification of novel species or emerging strains, cultures of fully differentiated human airway epithelium were used to pre-amplify infectious viruses. This additional step resulted in the detection of pathogens in all samples tested. Based on these results it can be hypothesized that the lack of an etiological agent in some clinical samples, both reported previously and observed in the present study, may result not only from the presence of unknown viral species, but also from imperfections in the detection methods used.

  4. Use of Sensitive, Broad-Spectrum Molecular Assays and Human Airway Epithelium Cultures for Detection of Respiratory Pathogens

    Science.gov (United States)

    Wojcik, Krzysztof; Gawron, Katarzyna; Zeglen, Slawomir; Karolak, Wojciech; Wojarski, Jacek; Ochman, Marek; Hubalewska-Mazgaj, Magdalena; Bochenek, Grazyna; Sanak, Marek; Zembala, Marian; Szczeklik, Andrzej; Potempa, Jan

    2012-01-01

    Rapid and accurate detection and identification of viruses causing respiratory tract infections is important for patient care and disease control. Despite the fact that several assays are available, identification of an etiological agent is not possible in ∼30% of patients suffering from respiratory tract diseases. Therefore, the aim of the current study was to develop a diagnostic set for the detection of respiratory viruses with sensitivity as low as 1–10 copies per reaction. Evaluation of the assay using a training clinical sample set showed that viral nucleic acids were identified in ∼76% of cases. To improve assay performance and facilitate the identification of novel species or emerging strains, cultures of fully differentiated human airway epithelium were used to pre-amplify infectious viruses. This additional step resulted in the detection of pathogens in all samples tested. Based on these results it can be hypothesized that the lack of an etiological agent in some clinical samples, both reported previously and observed in the present study, may result not only from the presence of unknown viral species, but also from imperfections in the detection methods used. PMID:22403676

  5. Multiplex detection of pathogen biomarkers in human blood, serum, and saliva using silicon photonic microring resonators

    Science.gov (United States)

    Estrada, I. A.; Burlingame, R. W.; Wang, A. P.; Chawla, K.; Grove, T.; Wang, J.; Southern, S. O.; Iqbal, M.; Gunn, L. C.; Gleeson, M. A.

    2015-05-01

    Genalyte has developed a multiplex silicon photonic chip diagnostics platform (MaverickTM) for rapid detection of up to 32 biological analytes from a drop of sample in just 10 to 20 minutes. The chips are manufactured with waveguides adjacent to ring resonators, and probed with a continuously variable wavelength laser. A shift in the resonant wavelength as mass binds above the ring resonators is measured and is directly proportional to the amount of bound macromolecules. We present here the ability to multiplex the detection of hemorrhagic fever antigens in whole blood, serum, and saliva in a 16 minute assay. Our proof of concept testing of a multiplex antigencapture chip has the ability to detect Zaire Ebola (ZEBOV) recombinant soluble glycoprotein (rsGP), Marburg virus (MARV) Angola recombinant glycoprotein (rGP) and dengue nonstructural protein I (NS1). In parallel, detection of 2 malaria antigens has proven successful, but has yet to be incorporated into multiplex with the others. Each assay performs with sensitivity ranging from 1.6 ng/ml to 39 ng/ml depending on the antigen detected, and with minimal cross-reactivity.

  6. Autonomous Search

    CERN Document Server

    Hamadi, Youssef; Saubion, Frédéric

    2012-01-01

    Decades of innovations in combinatorial problem solving have produced better and more complex algorithms. These new methods are better since they can solve larger problems and address new application domains. They are also more complex which means that they are hard to reproduce and often harder to fine-tune to the peculiarities of a given problem. This last point has created a paradox where efficient tools are out of reach of practitioners. Autonomous search (AS) represents a new research field defined to precisely address the above challenge. Its major strength and originality consist in the

  7. A novel electrochemical aptasensor for highly sensitive detection of thrombin based on the autonomous assembly of hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme nanowires

    Energy Technology Data Exchange (ETDEWEB)

    Xie, Shunbi, E-mail: xieshunbi@163.com; Chai, Yaqin, E-mail: yaqinchai@swu.edu.cn; Yuan, Yali; Bai, Lijuan; Yuan, Ruo, E-mail: yuanruo@swu.edu.cn

    2014-06-01

    Highlights: • This assay is label-free, the signal can be read out by measuring the electrochemical signal of hemin. • The hemin/G-quadruplex HRP-DNAzyme nanowires were formed via EXPAR reaction and HCR. • The prepared aptasensor exhibited low detection limit and wide linear range to TB. - Abstract: In this work, a new signal amplified strategy was constructed based on isothermal exponential amplification reaction (EXPAR) and hybridization chain reaction (HCR) generating the hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme (HRP-mimicking DNAzyme) nanowires as signal output component for the sensitive detection of thrombin (TB). We employed EXPAR’s ultra-high amplification efficiency to produce a large amount of two hairpin helper DNAs within a minutes. And then the resultant two hairpin helper DNAs could autonomously assemble the hemin/G-quadruplex HRP-mimicking DNAzymes nanowires as the redox-active reporter units on the electrode surface via hybridization chain reaction (HCR). The hemin/G-quadruplex structures simultaneously served as electron transfer medium and electrocatalyst to amplify the signal in the presence of H{sub 2}O{sub 2}. Specifically, only when the EXPAR reaction process has occurred, the HCR could be achieved and the hemin/G-quadruplex complexes could be formed on the surface of an electrode to give a detectable signal. The proposed strategy combines the amplification power of the EXPAR, HCR, and the inherent high sensitivity of the electrochemical detection. With such design, the proposed assay showed a good linear relationship within the range of 0.1 pM–50 nM with a detection limit of 33 fM (defined as S/N = 3) for TB.

  8. Rapid Detection and Statistical Differentiation of KPC Gene Variants in Gram-Negative Pathogens by Use of High-Resolution Melting and ScreenClust Analyses

    OpenAIRE

    Roth, Amanda L.; Hanson, Nancy D.

    2013-01-01

    In the United States, the production of the Klebsiella pneumoniae carbapenemase (KPC) is an important mechanism of carbapenem resistance in Gram-negative pathogens. Infections with KPC-producing organisms are associated with increased morbidity and mortality; therefore, the rapid detection of KPC-producing pathogens is critical in patient care and infection control. We developed a real-time PCR assay complemented with traditional high-resolution melting (HRM) analysis, as well as statisticall...

  9. Detection of pathogens in simulated food poisoning samples%模拟食物中毒样品中致病菌的检测

    Institute of Scientific and Technical Information of China (English)

    林吉年

    2012-01-01

    [Objective]To understand the ability of pathogenic bacteria detection in the laboratory of Danyang Center for Disease Control and Prevention (CDC) , and constantly improve the ability of pathogens detection. [Methods]The laboratory comparison test was performed between 5 CDC of Yang Tong Xu Zhen Tai City. The simulated food poisoning samples were detected for pathogenic bacteria. [Results] Two kinds of pathogenic bacteria (Yersinia enterocolitica and Proteus ) were detected in simulated samples. [Conclusion]The laboratory has the ability of pathogens detection.%目的 为了解丹阳市疾病预防控制中心实验室检测致病菌的能力,不断提高检测致病菌的能力.方法 参加了扬通徐镇泰五市疾病预防控制机构实验室间比对试验,对发放的模拟食物中毒样品进行了致病菌检测.结果 在模拟样品中检出2种致病菌:小肠结肠炎耶尔森菌和变形杆菌.结论 该实验室具备检测致病菌的能力.

  10. Graphene-interfaced electrical biosensor for label-free and sensitive detection of foodborne pathogenic E. coli O157:H7.

    Science.gov (United States)

    Pandey, Ashish; Gurbuz, Yasar; Ozguz, Volkan; Niazi, Javed H; Qureshi, Anjum

    2017-05-15

    E. coli O157:H7 is an enterohemorrhagic bacteria responsible for serious foodborne outbreaks that causes diarrhoea, fever and vomiting in humans. Recent foodborne E. coli outbreaks has left a serious concern to public health. Therefore, there is an increasing demand for a simple, rapid and sensitive method for pathogen detection in contaminated foods. In this study, we developed a label-free electrical biosensor interfaced with graphene for sensitive detection of pathogenic bacteria. This biosensor was fabricated by interfacing graphene with interdigitated microelectrodes of capacitors that were biofunctionalized with E. coli O157:H7 specific antibodies for sensitive pathogenic bacteria detection. Here, graphene nanostructures on the sensor surface provided superior chemical properties such as high carrier mobility and biocompatibility with antibodies and bacteria. The sensors transduced the signal based on changes in dielectric properties (capacitance) through (i) polarization of captured cell-surface charges, (ii) cells' internal bioactivity, (iii) cell-wall's electronegativity or dipole moment and their relaxation and (iv) charge carrier mobility of graphene that modulated the electrical properties once the pathogenic E. coli O157:H7 captured on the sensor surface. Sensitive capacitance changes thus observed with graphene based capacitors were specific to E. coli O157:H7 strain with a sensitivity as low as 10-100 cells/ml. The proposed graphene based electrical biosensor provided advantages of speed, sensitivity, specificity and in-situ bacterial detection with no chemical mediators, represents a versatile approach for detection of a wide variety of other pathogens.

  11. Detection of pathogenic protozoa in the diagnostic laboratory: result reproducibility, specimen pooling, and competency assessment.

    Science.gov (United States)

    Libman, M D; Gyorkos, T W; Kokoskin, E; Maclean, J D

    2008-07-01

    Stool microscopy as performed in clinical parasitology laboratories is a complex procedure with subjective interpretation. Quality assurance (QA) programs often emphasize proficiency testing as an assessment tool. We describe a result reproducibility assessment tool, which can form part of a broader QA program, and which is based on the blinded resubmission of selected clinical samples, using concordance between the reports of the initial and resubmitted specimen as an indicator. Specimens preserved in sodium acetate-acetic acid-formalin can be stored for several months for use in such a program. The presence of multiple protozoa in one specimen does not affect concordance. Some dilution of specimens occurs in this process, and this may explain poor concordance when specimens with low protozoal concentrations are resubmitted. Evaluation of this tool in a large parasitology laboratory revealed concordance rates for pathogenic protozoa (Entamoeba histolytica/Entamoeba dispar, Giardia lamblia, and Dientamoeba fragilis) of about 80%, which may be considered for use as a benchmark value. We also used this tool to demonstrate that when pairs of specimens from one patient are pooled to create a single specimen, concordance between the results of the individual and pooled specimens is high.

  12. Detection of pathogenic Campylobacter, E. coli O157:H7 and Salmonella spp. in wastewater by PCR assay.

    Science.gov (United States)

    Bonetta, Si; Pignata, C; Lorenzi, E; De Ceglia, M; Meucci, L; Bonetta, Sa; Gilli, G; Carraro, E

    2016-08-01

    The aim of this study was the evaluation of the occurrence of pathogenic Campylobacter, Escherichia coli O157:H7, E. coli virulence genes and Salmonella spp. in different wastewater treatment plants (WWTPs) using a method based on an enrichment step and PCR. This method was sensitive enough to detect low levels (∼2 CFU100 ml(-1) of raw sewage) of all the investigated pathogens. In the WWTP samples, E. coli O157:H7 DNA and the eae gene were never found, but 33 % of influents and effluents exhibited amplicons corresponding to Shiga-like toxin I. Twenty-five percent of the influent and 8 % of the effluent exhibited the presence of Shiga-like toxin II. Campylobacter jejuni and C. coli DNA were identified in 50 and 25 % of the influents and in 8 and 25 % of the effluents, respectively. Salmonella spp. DNA was present in all the samples. Considering the results obtained, the method tested here offers a reliable and expeditious tool for evaluating the efficiency of the effluent treatment in order to mitigate contamination risk. Influent contamination by Salmonella spp. and Campylobacter spp. provides indirect information about their circulation; moreover, their presence in effluents underlines the role of WWTPs in the contamination of the receiving surface waters, which affects public health directly or indirectly.

  13. Epitope specificity determines pathogenicity and detectability in ANCA-associated vasculitis

    Science.gov (United States)

    ABSTRACT BACKGROUND Anti-neutrophil cytoplasmic autoantibodies (ANCA) specific for myeloperoxidase (MPO) or proteinase 3 (PR3) are detectable in >90% of patients with ANCA-associated vasculitis (AAV). ANCA titers do not correlate well with disease activity. In vivo and in vi...

  14. Multiplex surface plasmon resonance imaging platform for label-free detection of foodborne pathogens

    Science.gov (United States)

    Salmonellae are among the leading causes of foodborne outbreaks in the United States, and more rapid and efficient detection methods are needed. Surface plasmon resonance imaging (SPRi) is an emerging optical technique, which allows for rapid and label-free screening of multiple targets simultaneous...

  15. Target-specific capture enhances sensitivity of electrochemical detection of bacterial pathogens.

    Science.gov (United States)

    Patel, Mayank; Gonzalez, Rodrigo; Halford, Colin; Lewinski, Michael A; Landaw, Elliot M; Churchill, Bernard M; Haake, David A

    2011-12-01

    We report the concentration and purification of bacterial 16S rRNA by the use of a biotinylated DNA target-specific capture (TSC) probe. For both cultivated bacterial and urine specimens from urinary tract infection patients, TSC resulted in a 5- to 8-fold improvement in the sensitivity of bacterial detection in a 16S rRNA electrochemical sensor assay.

  16. Au/Si nanorod-based biosensor for food pathogen detection

    Science.gov (United States)

    Technical Abstract Among several potentials of nanotechnology applications for food industry, development of nanoscale sensors for food safety and quality measurement are emerging. A novel biosensor for Salmonella detection was developed using Au/Si nanorods. The Si nanorods were fabricated by gla...

  17. International Standardisation of a Method for Detection of Human Pathogenic Viruses in Molluscan Shellfish

    DEFF Research Database (Denmark)

    Lees, David; Schultz, Anna Charlotte

    2010-01-01

    no standard harmonised procedures have been published. Standardisation is necessary before virus methods can be considered for adoption within a regulatory framework. A European standardisation working group is developing a two-part (quantitative and qualitative) standard method for virus detection...

  18. Rapid colorimetric sensing platform for the detection of Listeria monocytogenes foodborne pathogen.

    Science.gov (United States)

    Alhogail, Sahar; Suaifan, Ghadeer A R Y; Zourob, Mohammed

    2016-12-15

    Listeria monocytogenes is a serious cause of human foodborne infections worldwide, which needs spending billions of dollars for inspection of bacterial contamination in food every year. Therefore, there is an urgent need for rapid, in-field and cost effective detection techniques. In this study, rapid, low-cost and simple colorimetric assay was developed using magnetic nanoparticles for the detection of listeria bacteria. The protease from the listeria bacteria was detected using D-amino acid substrate. D-amino acid substrate was linked to the carboxylic acid on the magnetic nanoparticles using EDC/NHS chemistry. The cysteine residue at the C-terminal of the substrate was used for the self-assembled monolayer formation on the gold sensor surface, which in turn the black magnetic nanobeads will mask the golden color. The color will change from black to golden color upon the cleavage of the specific peptide sequence by the Listeria protease. The sensor was tested with serial dilutions of Listeria bacteria. It was found that the appearance of the gold surface area is proportional to the bacterial concentrations in CFU/ml. The lowest detection limit of the developed sensor for Listeria was found to be 2.17×10(2) colony forming unit/ml (CFU/ml). The specificity of the biosensor was tested against four different foodborne associated bacteria (Escherichia coli, Salmonella, Shigella flexnerii and Staphylococcus aureus). Finally, the sensor was tested with artificially spiked whole milk and ground meat spiked with listeria.

  19. Experiment on Synchronous Timing Signal Detection from ISDB-T Terrestrial Digital TV Signal with Application to Autonomous Distributed ITS-IVC Network

    Science.gov (United States)

    Karasawa, Yoshio; Kumagai, Taichi; Takemoto, Atsushi; Fujii, Takeo; Ito, Kenji; Suzuki, Noriyoshi

    A novel timing synchronizing scheme is proposed for use in inter-vehicle communication (IVC) with an autonomous distributed intelligent transport system (ITS). The scheme determines the timing of packet signal transmission in the IVC network and employs the guard interval (GI) timing in the orthogonal frequency divisional multiplexing (OFDM) signal currently used for terrestrial broadcasts in the Japanese digital television system (ISDB-T). This signal is used because it is expected that the automotive market will demand the capability for cars to receive terrestrial digital TV broadcasts in the near future. The use of broadcasts by automobiles presupposes that the on-board receivers are capable of accurately detecting the GI timing data in an extremely low carrier-to-noise ratio (CNR) condition regardless of a severe multipath environment which will introduce broad scatter in signal arrival times. Therefore, we analyzed actual broadcast signals received in a moving vehicle in a field experiment and showed that the GI timing signal is detected with the desired accuracy even in the case of extremely low-CNR environments. Some considerations were also given about how to use these findings.

  20. A Two-Tube Multiplex Reverse Transcription PCR Assay for Simultaneous Detection of Viral and Bacterial Pathogens of Infectious Diarrhea

    Directory of Open Access Journals (Sweden)

    Ji Wang

    2014-01-01

    Full Text Available Diarrhea caused by viral and bacterial infections is a major health problem in developing countries. The purpose of this study is to develop a two-tube multiplex PCR assay using automatic electrophoresis for simultaneous detection of 13 diarrhea-causative viruses or bacteria, with an intended application in provincial Centers for Diseases Control and Prevention, China. The assay was designed to detect rotavirus A, norovirus genogroups GI and GII, human astrovirus, enteric adenoviruses, and human bocavirus (tube 1, and Salmonella, Vibrio parahaemolyticus, diarrheagenic Escherichia coli, Campylobacter jejuni, Shigella, Yersinia, and Vibrio cholera (tube 2. The analytical specificity was examined with positive controls for each pathogen. The analytical sensitivity was evaluated by performing the assay on serial tenfold dilutions of in vitro transcribed RNA, recombinant plasmids, or bacterial culture. A total of 122 stool samples were tested by this two-tube assay and the results were compared with those obtained from reference methods. The two-tube assay achieved a sensitivity of 20–200 copies for a single virus and 102-103 CFU/mL for bacteria. The clinical performance demonstrated that the two-tube assay had comparable sensitivity and specificity to those of reference methods. In conclusion, the two-tube assay is a rapid, cost-effective, sensitive, specific, and high throughput method for the simultaneous detection of enteric bacteria and virus.

  1. Quantitative detection and biological propagation of scrapie seeding activity in vitro facilitate use of prions as model pathogens for disinfection.

    Directory of Open Access Journals (Sweden)

    Sandra Pritzkow

    Full Text Available Prions are pathogens with an unusually high tolerance to inactivation and constitute a complex challenge to the re-processing of surgical instruments. On the other hand, however, they provide an informative paradigm which has been exploited successfully for the development of novel broad-range disinfectants simultaneously active also against bacteria, viruses and fungi. Here we report on the development of a methodological platform that further facilitates the use of scrapie prions as model pathogens for disinfection. We used specifically adapted serial protein misfolding cyclic amplification (PMCA for the quantitative detection, on steel wires providing model carriers for decontamination, of 263K scrapie seeding activity converting normal protease-sensitive into abnormal protease-resistant prion protein. Reference steel wires carrying defined amounts of scrapie infectivity were used for assay calibration, while scrapie-contaminated test steel wires were subjected to fifteen different procedures for disinfection that yielded scrapie titre reductions of ≤10(1- to ≥10(5.5-fold. As confirmed by titration in hamsters the residual scrapie infectivity on test wires could be reliably deduced for all examined disinfection procedures, from our quantitative seeding activity assay. Furthermore, we found that scrapie seeding activity present in 263K hamster brain homogenate or multiplied by PMCA of scrapie-contaminated steel wires both triggered accumulation of protease-resistant prion protein and was further propagated in a novel cell assay for 263K scrapie prions, i.e., cerebral glial cell cultures from hamsters. The findings from our PMCA- and glial cell culture assays revealed scrapie seeding activity as a biochemically and biologically replicative principle in vitro, with the former being quantitatively linked to prion infectivity detected on steel wires in vivo. When combined, our in vitro assays provide an alternative to titrations of biological

  2. Quantitative detection and biological propagation of scrapie seeding activity in vitro facilitate use of prions as model pathogens for disinfection.

    Science.gov (United States)

    Pritzkow, Sandra; Wagenführ, Katja; Daus, Martin L; Boerner, Susann; Lemmer, Karin; Thomzig, Achim; Mielke, Martin; Beekes, Michael

    2011-01-01

    Prions are pathogens with an unusually high tolerance to inactivation and constitute a complex challenge to the re-processing of surgical instruments. On the other hand, however, they provide an informative paradigm which has been exploited successfully for the development of novel broad-range disinfectants simultaneously active also against bacteria, viruses and fungi. Here we report on the development of a methodological platform that further facilitates the use of scrapie prions as model pathogens for disinfection. We used specifically adapted serial protein misfolding cyclic amplification (PMCA) for the quantitative detection, on steel wires providing model carriers for decontamination, of 263K scrapie seeding activity converting normal protease-sensitive into abnormal protease-resistant prion protein. Reference steel wires carrying defined amounts of scrapie infectivity were used for assay calibration, while scrapie-contaminated test steel wires were subjected to fifteen different procedures for disinfection that yielded scrapie titre reductions of ≤10(1)- to ≥10(5.5)-fold. As confirmed by titration in hamsters the residual scrapie infectivity on test wires could be reliably deduced for all examined disinfection procedures, from our quantitative seeding activity assay. Furthermore, we found that scrapie seeding activity present in 263K hamster brain homogenate or multiplied by PMCA of scrapie-contaminated steel wires both triggered accumulation of protease-resistant prion protein and was further propagated in a novel cell assay for 263K scrapie prions, i.e., cerebral glial cell cultures from hamsters. The findings from our PMCA- and glial cell culture assays revealed scrapie seeding activity as a biochemically and biologically replicative principle in vitro, with the former being quantitatively linked to prion infectivity detected on steel wires in vivo. When combined, our in vitro assays provide an alternative to titrations of biological scrapie

  3. Detection of pathogenic Yersinia enterocolitica in slaughtered pigs by cultural methods and real-time polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Rina Mazzette

    2015-05-01

    Full Text Available Healthy pigs carrying pathogenic to human Yersinia enterocolitica strains are the main source of entry into slaughterhouse, where cross-contamination of carcasses can happen. The aim of this work was to determine Y. enterocolitica prevalence in slaughtered pigs, investigating the presence of carriers in relation to carcass contamination. A total of 132 pig samples (tonsils, mesenteric lymph nodes, colon content, carcass surface were collected from 4 Sardinian slaughterhouses. All the samples were examined by the ISO 10273:2003 method, and the prevalence was also determined by direct plating on CIN Agar. Moreover, to detect the ail positive Y. enterocolitica strains in enrichment broths and isolates a real-time polymerase chain reaction (PCR was applied. Y. enterocolitica prevalence was 19% with direct plating and 12% with enrichment methods. Carcass surfaces and tonsils prevalence was 5.30% by direct plating, and 5.3% and 2.2%, respectively, by enrichment method. Tonsil samples showed an average contamination level of 3.2×103 CFU/g, while the mean value on carcass was 8.7×102 CFU/g. An overall prevalence of 9.8% of ail positive Y. enterocolitica broths was detected by RT-PCR, that found a higher prevalence in tonsils (7.5% with respect to cultural methods, confirming the greater sensitivity of this technique when applied for tonsils and faeces samples. The results show a relatively low pathogenic Y. enterocolitica prevalence in pigs slaughtered in Sardinia. Good hygiene measures should be applied at slaughterhouse in order to prevent the entry of carriers and control carcass contamination.

  4. Detection of Pathogenic Yersinia Enterocolitica in Slaughtered Pigs by Cultural Methods and Real-Time Polymerase Chain Reaction.

    Science.gov (United States)

    Mazzette, Rina; Fois, Federica; Consolati, Simonetta Gianna; Salza, Sara; Tedde, Tiziana; Soro, Paolo; Collu, Carlo; Ladu, Daniela; Virgilio, Sebastiano; Piras, Francesca

    2015-05-28

    Healthy pigs carrying pathogenic to human Yersinia enterocolitica strains are the main source of entry into slaughterhouse, where cross-contamination of carcasses can happen. The aim of this work was to determine Y. enterocolitica prevalence in slaughtered pigs, investigating the presence of carriers in relation to carcass contamination. A total of 132 pig samples (tonsils, mesenteric lymph nodes, colon content, carcass surface) were collected from 4 Sardinian slaughterhouses. All the samples were examined by the ISO 10273:2003 method, and the prevalence was also determined by direct plating on CIN Agar. Moreover, to detect the ail positive Y. enterocolitica strains in enrichment broths and isolates a real-time polymerase chain reaction (PCR) was applied. Y. enterocolitica prevalence was 19% with direct plating and 12% with enrichment methods. Carcass surfaces and tonsils prevalence was 5.30% by direct plating, and 5.3% and 2.2%, respectively, by enrichment method. Tonsil samples showed an average contamination level of 3.2×103 CFU/g, while the mean value on carcass was 8.7×102 CFU/g. An overall prevalence of 9.8% of ail positive Y. enterocolitica broths was detected by RT-PCR, that found a higher prevalence in tonsils (7.5%) with respect to cultural methods, confirming the greater sensitivity of this technique when applied for tonsils and faeces samples. The results show a relatively low pathogenic Y. enterocolitica prevalence in pigs slaughtered in Sardinia. Good hygiene measures should be applied at slaughterhouse in order to prevent the entry of carriers and control carcass contamination.

  5. Real-time PCR Detection of Food-borne Pathogenic Salmonella spp

    DEFF Research Database (Denmark)

    Malorny, B.; Mäde, D.; Löfström, Charlotta

    2013-01-01

    Infections by Salmonella enterica are a significant public health concern worldwide. Salmonellae form a complex group of bacteria consisting of two species, six subspecies and more than 2500 serovars (serotypes). Mainly through ingestion of contaminated food or feed, they cause self......-limiting gastrointestinal disease in a wide range of mammalian hosts. Within the last decade, numerous real-time PCR assays have been developed for rapid detection of salmonellae in potentially contaminated food or feed. Some of them were extensively validated and are useful for diagnostic laboratories. Furthermore...... for the detection of Salmonella and give a state-of-the-art summary what targets are used and how valid the assays are to apply as diagnostic tool. Furthermore, recommendations for selection of an appropriate real-time PCR method are presented....

  6. Comparison of the EntericBio multiplex PCR system with routine culture for detection of bacterial enteric pathogens.

    LENUS (Irish Health Repository)

    O'Leary, James

    2009-11-01

    The EntericBio system uses a multiplex PCR assay for the simultaneous detection of Campylobacter spp., Salmonella enterica, Shigella spp., and Escherichia coli O157 from feces. It combines overnight broth enrichment with PCR amplification and detection by hybridization. An evaluation of this system was conducted by comparing the results obtained with the system with those obtained by routine culture, supplemented with alternative PCR detection methods. In a study of 773 samples, routine culture and the EntericBio system yielded 94.6 and 92.4% negative results, respectively. Forty-two samples had positive results by culture, and all of these were positive with the EntericBio system. This system detected an additional 17 positive samples (Campylobacter spp., n = 12; Shigella spp., n = 1; E. coli O157, n = 4), but the results for 5 samples (Campylobacter spp., n = 2; Shigella spp., n = 1; E. coli O157, n = 2) could not be confirmed. The target for Shigella spp. detected by the EntericBio system is the ipaH gene, and the molecular indication of the presence of Shigella spp. was investigated by sequence analysis, which confirmed that the ipaH gene was present in a Klebsiella pneumoniae isolate from the patient. The sensitivity, specificity, positive predictive value, and negative predictive value were 100%, 99.3%, 91.5%, and 100%, respectively. Turnaround times were significantly reduced with the EntericBio system, and a result was available between 24 and 32 h after receipt of the sample in the laboratory. In addition, the amount of laboratory waste was significantly reduced by use of this system. In summary, the EntericBio system proved convenient to use, more sensitive than the conventional culture used in this study, and highly specific; and it generated results significantly faster than routine culture for the pathogens tested.

  7. Diabetic autonomic neuropathy.

    Science.gov (United States)

    Freeman, Roy

    2014-01-01

    Diabetes mellitus is the commonest cause of an autonomic neuropathy in the developed world. Diabetic autonomic neuropathy causes a constellation of symptoms and signs affecting cardiovascular, urogenital, gastrointestinal, pupillomotor, thermoregulatory, and sudomotor systems. Several discrete syndromes associated with diabetes cause autonomic dysfunction. The most prevalent of these are: generalized diabetic autonomic neuropathy, autonomic neuropathy associated with the prediabetic state, treatment-induced painful and autonomic neuropathy, and transient hypoglycemia-associated autonomic neuropathy. These autonomic manifestations of diabetes are responsible for the most troublesome and disabling features of diabetic peripheral neuropathy and result in a significant proportion of the mortality and morbidity associated with the disease.

  8. On-chip SERS analysis for single mimic pathogen detection using Raman-labeled nanoaggregate-embedded beads with a dielectrophoretic chip

    Science.gov (United States)

    Huang, Chen-Han; Lin, Hsing-Ying; Kuo, I.-Ting; Hsieh, Wen-Hsin; Huang, Ping-Ji; Yang, Tzyy-Schiuan; Chau, Lai-Kwan

    2012-02-01

    The integration of Raman-labeled nanoaggregate-embedded beads (NAEBs) for high performance SERS analysis of single mimic pathogen on a self-designed dielectrophoretic chip is demonstrated. The Raman tags called NAEBs are silica-coated, dye-induced aggregates of a small number of gold nanoparticles (AuNPs). In this work, NAEBs consisting of a Raman dye tetramethyl-rhodamine-5-isothiosyanate (TRITC) are chemically functionalized with streptavidin to detect biotin-functionalized polystyrene (PS) microspheres which mimic as pathogens. The sample solution of completely mixed streptavidin-functionalized NAEBs and biotin-functionalized PS microspheres is pumped into the microfluidic channel of a dielectrophoretic chip. By giving an AC voltage on the embedded electrodes, a single mimic pathogen can be caught via the non-contact dielectrophoretic force and suspended at the central cross of four aluminum electrodes for subsequent Raman spectroscopic detection. The SERS signal of TRITC is used as a spectral signature of specific mimic pathogen recognition, otherwise only the background Raman signal of a PS microsphere is observed. A pathogen-specific biosensor based on the dielectrophoresis-Raman spectroscopy system is developed, and the proof-ofconcept is confirmed by the specific molecular interaction model of streptavidin with biotin. Therefore, the on-chip multiplex SERS analysis of pathogens can be anticipated by employing different dye-tagged NAEBs simultaneously in a sample solution. We believe this bioassay has the ability to screen and detect multiple pathogens with minimal sample processing and handling even a small number of pathogens is present.

  9. Development of a new resequencing pathogen microarray based assay for detection of broad-spectrum respiratory tract viruses in patients with community-acquired pneumonia.

    Directory of Open Access Journals (Sweden)

    Hongwei Shen

    Full Text Available A Resequencing Pathogen Microarray (RPM is a single, highly multiplexed assay for detecting and differentiating similarly related pathogens by using closely overlapping probe sets to determine a target organism's nucleotide sequence. In this study, a new RPM (RPM-IVDC1 that consisted of 224-bp detector tiles corresponding to 9 influenza A subtypes, 11 rhinoviruses, 28 enteroviruses and 38 other respiratory viruses was developed and optimized to provide individual and simultaneous detection sensitivities ranging from 15 to 750 genomic copies for 16 common respiratory pathogens. A total of 110 consecutive patients with community-acquired pneumonia (CAP admitted to 5 district general hospitals in Beijing during a 1-year period were assessed using the new assay. Among the children (under age 5 and adult patients (above age 18, respiratory syncytial virus (RSV and rhinovirus (RV were the most common etiological agents, respectively, which is consistent with reference assays. Atypical pathogens that may cause CAP-like illness, including rubella virus, measles virus, influenza type C virus, human herpesvirus (HHV were also detected. The results show the capability of RPM-IVDC1 for the accurate detection and identification of multiple virus types, which may be of significant use in epidemic surveillance and outbreak investigations of atypical pathogens.

  10. Meta-analysis diagnostic accuracy of SNP-based pathogenicity detection tools: a case of UTG1A1 gene mutations.

    Science.gov (United States)

    Galehdari, Hamid; Saki, Najmaldin; Mohammadi-Asl, Javad; Rahim, Fakher

    2013-01-01

    Crigler-Najjar syndrome (CNS) type I and type II are usually inherited as autosomal recessive conditions that result from mutations in the UGT1A1 gene. The main objective of the present review is to summarize results of all available evidence on the accuracy of SNP-based pathogenicity detection tools compared to published clinical result for the prediction of in nsSNPs that leads to disease using prediction performance method. A comprehensive search was performed to find all mutations related to CNS. Database searches included dbSNP, SNPdbe, HGMD, Swissvar, ensemble, and OMIM. All the mutation related to CNS was extracted. The pathogenicity prediction was done using SNP-based pathogenicity detection tools include SIFT, PHD-SNP, PolyPhen2, fathmm, Provean, and Mutpred. Overall, 59 different SNPs related to missense mutations in the UGT1A1 gene, were reviewed. Comparing the diagnostic OR, PolyPhen2 and Mutpred have the highest detection 4.983 (95% CI: 1.24 - 20.02) in both, following by SIFT (diagnostic OR: 3.25, 95% CI: 1.07 - 9.83). The highest MCC of SNP-based pathogenicity detection tools, was belong to SIFT (34.19%) followed by Provean, PolyPhen2, and Mutpred (29.99%, 29.89%, and 29.89%, respectively). Hence the highest SNP-based pathogenicity detection tools ACC, was fit to SIFT (62.71%) followed by PolyPhen2, and Mutpred (61.02%, in both). Our results suggest that some of the well-established SNP-based pathogenicity detection tools can appropriately reflect the role of a disease-associated SNP in both local and global structures.

  11. Detection of Food Spoilage and Pathogenic Bacteria Based on Ligation Detection Reaction Coupled to Flow-Through Hybridization on Membranes

    Directory of Open Access Journals (Sweden)

    K. Böhme

    2014-01-01

    Full Text Available Traditional culturing methods are still commonly applied for bacterial identification in the food control sector, despite being time and labor intensive. Microarray technologies represent an interesting alternative. However, they require higher costs and technical expertise, making them still inappropriate for microbial routine analysis. The present study describes the development of an efficient method for bacterial identification based on flow-through reverse dot-blot (FT-RDB hybridization on membranes, coupled to the high specific ligation detection reaction (LDR. First, the methodology was optimized by testing different types of ligase enzymes, labeling, and membranes. Furthermore, specific oligonucleotide probes were designed based on the 16S rRNA gene, using the bioinformatic tool Oligonucleotide Retrieving for Molecular Applications (ORMA. Four probes were selected and synthesized, being specific for Aeromonas spp., Pseudomonas spp., Shewanella spp., and Morganella morganii, respectively. For the validation of the probes, 16 reference strains from type culture collections were tested by LDR and FT-RDB hybridization using universal arrays spotted onto membranes. In conclusion, the described methodology could be applied for the rapid, accurate, and cost-effective identification of bacterial species, exhibiting special relevance in food safety and quality.

  12. A molecular assay for sensitive detection of pathogen-specific T-cells.

    Directory of Open Access Journals (Sweden)

    Victoria O Kasprowicz

    Full Text Available Here we describe the development and validation of a highly sensitive assay of antigen-specific IFN-γ production using real time quantitative PCR (qPCR for two reporters--monokine-induced by IFN-γ (MIG and the IFN-γ inducible protein-10 (IP10. We developed and validated the assay and applied it to the detection of CMV, HIV and Mycobacterium tuberculosis (MTB specific responses, in a cohort of HIV co-infected patients. We compared the sensitivity of this assay to that of the ex vivo RD1 (ESAT-6 and CFP-10-specific IFN-γ Elispot assay. We observed a clear quantitative correlation between the two assays (P<0.001. Our assay proved to be a sensitive assay for the detection of MTB-specific T cells, could be performed on whole blood samples of fingerprick (50 uL volumes, and was not affected by HIV-mediated immunosuppression. This assay platform is potentially of utility in diagnosis of infection in this and other clinical settings.

  13. Detection of biomarkers of pathogenic Naegleria fowleri through mass spectrometry and proteomics.

    Science.gov (United States)

    Moura, Hercules; Izquierdo, Fernando; Woolfitt, Adrian R; Wagner, Glauber; Pinto, Tatiana; del Aguila, Carmen; Barr, John R

    2015-01-01

    Emerging methods based on mass spectrometry (MS) can be used in the rapid identification of microorganisms. Thus far, these practical and rapidly evolving methods have mainly been applied to characterize prokaryotes. We applied matrix-assisted laser-desorption-ionization-time-of-flight mass spectrometry MALDI-TOF MS in the analysis of whole cells of 18 N. fowleri isolates belonging to three genotypes. Fourteen originated from the cerebrospinal fluid or brain tissue of primary amoebic meningoencephalitis patients and four originated from water samples of hot springs, rivers, lakes or municipal water supplies. Whole Naegleria trophozoites grown in axenic cultures were washed and mixed with MALDI matrix. Mass spectra were acquired with a 4700 TOF-TOF instrument. MALDI-TOF MS yielded consistent patterns for all isolates examined. Using a combination of novel data processing methods for visual peak comparison, statistical analysis and proteomics database searching we were able to detect several biomarkers that can differentiate all species and isolates studied, along with common biomarkers for all N. fowleri isolates. Naegleria fowleri could be easily separated from other species within the genus Naegleria. A number of peaks detected were tentatively identified. MALDI-TOF MS fingerprinting is a rapid, reproducible, high-throughput alternative method for identifying Naegleria isolates. This method has potential for studying eukaryotic agents.

  14. Step and curb detection for autonomous vehicles with an algebraic derivative-based approach applied on laser rangefinder data

    OpenAIRE

    POLLARD, Evangeline; Pérez Rastelli, Joshué; Fawzi NASHASHIBI

    2013-01-01

    International audience; Personal Mobility Vehicles (PMV) is is an important part of the Intelligent Transportation System (ITS) domain. These new transport systems have been designed for urban traffic areas, pedestrian streets, green zones and private parks. In these areas, steps and curbs make the movement of disable or mobility reduced people with PMV, and with standard chair wheels difficult. In this paper, we present a step and curb detection system based on laser sensors. This system is ...

  15. Comparison of PCR,DIA and Pathogenicity Assay for Detection of Xanthomonas axonopodis pv.citri,the Causal Agent of Citrus Bacterial Canker Disease

    Institute of Scientific and Technical Information of China (English)

    WANG Zhong-kang; SUN Xian-yun; YIN You-ping; ZHOU Chang-yong; XIA Yu-xian

    2004-01-01

    Polymerase chain reaction (PCR) approach based on newly designed primers, JYF5/JYR5, was applied for specific detection of Xanthomonas axonopodis pv.citri(Xac). The efficiency and reliability of PCR method were compared with dot immunobinding assay (DIA) and classical pathogenicity test techniques for detecting suspensions of pure cells of Xac and soaking sap of citrus tissues. Detection sensitivity of PCR was about 4.5 cells or 1.56 pg target DNA per reaction which was higher than that of DIA (ca. 450 cells per dot).These three techniques (PCR assay, DIA and Pathogenecity test) could always detect Xac from symptomatic citrus samples. Different performances were obtained from citrus materials without symptoms, and the positive detection frequency was PCR, DIA and pathogenicity test.

  16. Behavior-Based Approach for the Detection of Land Mines Utilizing off the Shelf Low Cost Autonomous Robot

    Directory of Open Access Journals (Sweden)

    Abdel Ilah Nour Alshbatat

    2013-03-01

    Full Text Available Several countries all of the world are affected by landmines. The presence of mines represents a major threat to lives and causes economic problems. Currently, detecting and clearing mines demand specific expertise with special equipment. In this context, this paper offers the design and development of an intelligent controller which can control and enable the robot to detect mines by means of sensors and of processing the fused information to guide soldiers when passing landmines.  This is accomplished by broken down the overall system into two subsystems: sensor technologies and robotic device. Sensors devices include infrared distance sensor, metal detector, ultrasonic range finder, accelerometer sensor, while the structure of the robot in our case consists mainly  of a commercial  off-the-shelf  parts which  are  available  at  low  costs. The proposed controller is mainly based on creating fuzzy rules that reflect the behaviors of soldier beings in controlling a robot in a well known landmine. Simulation and experimental results are presented her to prove the efficiency of the proposed approach. The results show that the system is able to detect landmines and guide soldiers while crossing mines area.

  17. A microfluidic laser scattering sensor for label-free detection of waterborne pathogens

    Science.gov (United States)

    Wei, Huang; Yang, Limei; Li, Feng

    2016-10-01

    A microfluidic-based multi-angle laser scattering (MALS) sensor capable of acquiring scattering pattern of single particle is demonstrated. The size and relative refractive index (RI) of polystyrene (PS) microspheres were deduced with accuracies of 60 nm and 0.001 by analyzing the scattering patterns. We measured scattering patterns of waterborne parasites i.e., cryptosporidium parvum (c.parvum) and giardia lamblia (g.lamblia), and some other representative species in 1 L water within 1 hour, and the waterborne parasites were identified with accuracy better than 96% by classification of distinctive scattering patterns with a support-vector-machine (SVM) algorithm. The system provides a promising tool for label-free and rapid detection of waterborne parasites.

  18. Sensitive and direct detection of receptor binding specificity of highly pathogenic avian influenza A virus in clinical samples.

    Directory of Open Access Journals (Sweden)

    Tadanobu Takahashi

    Full Text Available Influenza A virus (IAV recognizes two types of N-acetylneuraminic acid (Neu5Ac by galactose (Gal linkages, Neu5Acα2,3Gal and Neu5Acα2,6Gal. Avian IAV preferentially binds to Neu5Acα2,3Gal linkage, while human IAV preferentially binds to Neu5Acα2,6Gal linkage, as a virus receptor. Shift in receptor binding specificity of avian IAV from Neu5Acα2,3Gal linkage to Neu5Acα2,6Gal linkage is generally believed to be a critical factor for its transmission ability among humans. Surveillance of this shift of highly pathogenic H5N1 avian IAV (HPAI is thought to be a very important for prediction and prevention of a catastrophic pandemic of HPAI among humans. In this study, we demonstrated that receptor binding specificity of IAV bound to sialo-glycoconjugates was sensitively detected by quantifying the HA gene with real-time reverse-transcription-PCR. The new assay enabled direct detection of receptor binding specificity of HPAIs in chicken clinical samples including trachea and cloaca swabs in only less than 4 h.

  19. Universal Probe Library based real-time PCR for rapid detection of bacterial pathogens from positive blood culture bottles.

    Science.gov (United States)

    Zhu, Lingxiang; Shen, Ding-Xia; Zhou, Qiming; Liu, Chao-Jun; Li, Zexia; Fang, Xiangdong; Li, Quan-Zhen

    2014-03-01

    A set of real-time PCR based assays using the locked nucleic acid probes from Roche Universal ProbeLibrary were developed for rapid detection of eight bacterial species from positive blood culture bottles. Four duplex real-time PCR reactions targeting to one Gram-positive bacterium and one Gram-negative bacterium were optimized for species identification according to Gram stain results. We also included mecA-specific primers and probes in the assays to indicate the presence of methicillin resistance in the bacterial species. The analytical sensitivity was in the range of 1-10 CFU per PCR reaction mixture. The specificity and cross reactivity of the assay was validated by 28 ATCC reference strains and 77 negative blood culture specimens. No cross-reactivity was observed in these samples thus demonstrating 100 % specificity. 72 previously characterized clinical isolates were tested by the real-time PCR assay and validated the accuracy and feasibility of the real-time PCR assay. Furthermore, 55 positive blood culture samples were tested using real-time PCR and 50 (90.9 %) of them were identified as the same species as judged by biochemical analysis. In total, real-time PCR showed 98.2 % consistent to that of traditional methods. Real-time PCR can be used as a supplement for early detection of the frequently-occurred pathogens from the positive blood cultures.

  20. Detection and Molecular Characterization of Potentially Pathogenic Free-living Amoebae from Water Sources in Kish Island, Southern Iran.

    Science.gov (United States)

    Niyyati, Maryam; Lasgerdi, Zohreh; Lorenzo-Morales, Jacob

    2015-01-01

    Amoebic keratitis, a sight-threatening corneal infection, mainly occurs in contact lens wearers who wash their eyes with tap water. The present research was conducted to identify the occurrence of potentially pathogenic free-living amoebae (FLA) in tap water sources on Kish Island, a tourist region in Iran. Amoebae were detected using a culture-enriched method and by polymerase chain reaction (PCR)/sequencing of the diagnostic fragment 3 region of the 18S rRNA gene of Acanthamoeba. In the case of other free-living amoebae species, PCR/sequencing analysis of the 18S rDNA was conducted. Results of this study showed the presence of Acanthamoeba belonging to T3, T4, T5, and T11 genotypes in tap water sources. Additionally, Vermamoebae vermiformis was detected in three water samples. This is the first report of the Acanthamoeba genotypes T3, T4, T5, and T11 and V. vermiformis species in tap water sources in a tourist region in Iran.

  1. Harmonizing methods for wildlife abundance estimation and pathogen detection in Europe-a questionnaire survey on three selected host-pathogen combinations

    DEFF Research Database (Denmark)

    Schulz, Jana; Ryser-Degiorgis, Marie-Pierre; Kuiken, Thijs

    2017-01-01

    , resulting in a patchwork of data that are difficult to merge and compare. This survey aimed at evaluating the need and potential for data harmonization in wildlife health in Europe. The specific objective was to collect information on methods currently used to estimate host abundance and pathogen prevalence....... For small rodents, trapping is the method of choice, but practical applications vary among study sites. Laboratory procedures are already largely harmonized but information on the sampled animals is not systematically collected.Conclusions: The answers revealed that a large amount of information...... is available for the selected host-pathogen pairs and that in theory methods are already largely harmonized. However, the comparability of the data remains strongly compromised by local differences in the way, the methods are applied in practice. While these issues may easily be overcome for prevalence...

  2. Specific detection of common pathogens of acute bacterial meningitis using an internally controlled tetraplex-PCR assay.

    Science.gov (United States)

    Farahani, Hamidreza; Ghaznavi-Rad, Ehsanollah; Mondanizadeh, Mahdieh; MirabSamiee, Siamak; Khansarinejad, Behzad

    2016-08-01

    Accurate and timely diagnosis of acute bacterial meningitis is critical for antimicrobial treatment of patients. Although PCR-based methods have been widely used for the diagnosis of acute meningitis caused by bacterial pathogens, the main disadvantage of these methods is their high cost. This disadvantage has hampered the widespread use of molecular assays in many developing countries. The application of multiplex assays and "in-house" protocols are two main approaches that can reduce the overall cost of a molecular test. In the present study, an internally controlled tetraplex-PCR was developed and validated for the specific detection of Streptococcus pneumoniae, Neisseria meningitidis and Haemophilus influenzae in cerebrospinal fluid (CSF) samples. The analysis of a panel of other human pathogens showed no cross-reactivity in the assay. The analytical sensitivity of the in-house assay was 792.3 copies/ml, when all three bacteria were presentin the specimens. This value was calculated as 444.5, 283.7, 127.8 copies/ml when only S. pneumoniae, N. meningitidis and H. influenzae, respectively, were present. To demonstrate the diagnostic performance of the assay, a total of 150 archival CSF samples were tested and compared with a commercial multiplex real-time PCR kit. A diagnostic sensitivity of 92.8% and a specificity of 95.1% were determined for the present tetraplex-PCR assay. The results indicate that the established method is sensitive, specific and cost-effective, and can be used particularly in situations where the high cost of commercial kits prevents the use of molecular methods for the diagnosis of bacterial meningitis.

  3. Autonomous underwater riser inspection tool

    Energy Technology Data Exchange (ETDEWEB)

    Camerini, Claudio; Marnet, Robson [Petrobras SA, (Brazil); Freitas, Miguel; Von der Weid, Jean Pierre [CPTI/PUC-Rio, Rio de Janeiro, (Brazil); Artigas Lander, Ricardo [EngeMOVI, Curitiba, (Brazil)

    2010-07-01

    The detection of damage on the riser is a serious concern for pipeline companies. Visual examinations by remotely operated vehicle (ROV) are presently carried out to detect the defects but this process has limitations and is expensive. This paper presents the development of a new tool to ensure autonomous underwater riser inspection (AURI) that uses the riser itself for guidance. The AURI, which is autonomous in terms of control and power supply, is equipped with several cameras that perform a complete visual inspection of the riser with 100 % coverage of the external surface of the riser. The paper presents the detailed characteristics of the first AURI prototype, describes its launching procedure and provides the preliminary test results from pool testing. The results showed that the AURI is a viable system for autonomous riser inspection. Offshore tests on riser pipelines are scheduled to be performed shortly.

  4. Autonomous in situ analysis and real-time chemical detection using a backpack miniature mass spectrometer: concept, instrumentation development, and performance.

    Science.gov (United States)

    Hendricks, Paul I; Dalgleish, Jon K; Shelley, Jacob T; Kirleis, Matthew A; McNicholas, Matthew T; Li, Linfan; Chen, Tsung-Chi; Chen, Chien-Hsun; Duncan, Jason S; Boudreau, Frank; Noll, Robert J; Denton, John P; Roach, Timothy A; Ouyang, Zheng; Cooks, R Graham

    2014-03-18

    A major design objective of portable mass spectrometers is the ability to perform in situ chemical analysis on target samples in their native states in the undisturbed environment. The miniature instrument described here is fully contained in a wearable backpack (10 kg) with a geometry-independent low-temperature plasma (LTP) ion source integrated into a hand-held head unit (2 kg) to allow direct surface sampling and analysis. Detection of chemical warfare agent (CWA) simulants, illicit drugs, and explosives is demonstrated at nanogram levels directly from surfaces in near real time including those that have complex geometries, those that are heat-sensitive, and those bearing complex sample matrices. The instrument consumes an average of 65 W of power and can be operated autonomously under battery power for ca. 1.5 h, including the initial pump-down of the manifold. The maximum mass-to-charge ratio is 925 Th with mass resolution of 1-2 amu full width at half-maximun (fwhm) across the mass range. Multiple stages of tandem analysis can be performed to identify individual compounds in complex mixtures. Both positive and negative ion modes are available. A graphical user interface (GUI) is available for novice users to facilitate data acquisition and real-time spectral matching.

  5. Assessment of molecular methods as a tool for detecting pathogenic protozoa isolated from water bodies.

    Science.gov (United States)

    Adamska, M; Sawczuk, M; Kolodziejczyk, L; Skotarczak, B

    2015-12-01

    Several species belong to the Cryptosporidium and Giardia genus, the main parasitic protozoa occurring in water, but only some of them are infectious to humans. We investigated the occurrence of Cryptosporidium and Giardia and identified their species in the water samples collected from natural water bodies in north-western Poland. A total of 600 samples from water bodies used for bathing, sewage discharge, as drinking water sources and watering places for animals were screened. The samples were collected during a 3-year period in each of the four seasons and filtered using Filta-Max (IDEXX Laboratories, USA). Genomic DNA was extracted from all samples and used as a target sequence for polymerase chain reaction (PCR) and TaqMan real-time PCR, as well as for reverse line blotting (RLB) methods. PCR methods seem to be more sensitive to detect Giardia and Cryptosporidium DNA in water samples than RLB methods. All PCR products were sequenced and three were identified as C. parvum and four as G. intestinalis. The overall prevalence of C. parvum (0.5%) and G. intestinalis (0.6%) in the samples suggests that the risk of Cryptosporidium and Giardia infections in north-western Poland is minimal.

  6. Affinity reagent technology development and application to rapid immunochromatographic pathogen detection

    Science.gov (United States)

    Sooter, Letha J.; Stratis-Cullum, Dimitra N.; Zhang, Yanting; Daugherty, Patrick S.; Soh, H. Tom; Pellegrino, Paul; Stagliano, Nancy

    2007-09-01

    Immunochromatography is a rapid, reliable, and cost effective method of detecting biowarfare agents. The format is similar to that of an over-the-counter pregnancy test. A sample is applied to one end of a cassette and then a control line, and possibly a sample line, are visualized at the other end of the cassette. The test is based upon a sandwich assay. For the control, a line of Protein A is immobilized on the membrane. Gold nanoparticle bound IgG flows through the membrane and binds the Protein A, creating a visible line on the membrane. For the sample, one epitope is immobilized on the membrane and another epitope is attached to gold nanoparticles. The sample binds gold bound epitope, travels through the membrane, and binds membrane bound epitope. The two epitopes are not cross-reactive, therefore a sample line is only visible if the sample is present. In order to efficiently screen for binders to a sample target, a novel, Continuous Magnetic Activated Cell Sorter (CMACS) has been developed on a disposable, microfluidic platform. The CMACS chip quickly sorts E. coli peptide libraries for target binders with high affinity. Peptide libraries, are composed of approximately ten million bacteria, each displaying a different peptide on their surface. The target of interest is conjugated to a micrometer sized magnetic particle. After the library and the target are incubated together to allow binding, the mixture is applied to the CMACS chip. In the presence of patterned nickel and an external magnet, separation occurs of the bead-bound bacteria from the bulk material. The bead fraction is added to bacterial growth media where any attached E. coli grow and divide. These cells are cloned, sequenced, and the peptides are assayed for target binding affinity. As a proof-of-principle, assays were developed for human C-reactive protein. More defense relevant targets are currently being pursued.

  7. Pathogen Sensors

    Directory of Open Access Journals (Sweden)

    Joseph Irudayaraj

    2009-10-01

    Full Text Available The development of sensors for detecting foodborne pathogens has been motivated by the need to produce safe foods and to provide better healthcare. However, in the more recent times, these needs have been expanded to encompass issues relating to biosecurity, detection of plant and soil pathogens, microbial communities, and the environment. The range of technologies that currently flood the sensor market encompass PCR and microarray-based methods, an assortment of optical sensors (including bioluminescence and fluorescence, in addition to biosensor-based approaches that include piezoelectric, potentiometric, amperometric, and conductometric sensors to name a few. More recently, nanosensors have come into limelight, as a more sensitive and portable alternative, with some commercial success. However, key issues affecting the sensor community is the lack of standardization of the testing protocols and portability, among other desirable elements, which include timeliness, cost-effectiveness, user-friendliness, sensitivity and specificity. [...

  8. Multiplex PCR system for rapid detection of pathogens in patients with presumed sepsis - a systemic review and meta-analysis.

    Directory of Open Access Journals (Sweden)

    Shy-Shin Chang

    Full Text Available BACKGROUND: Blood culture is viewed as the golden standard for the diagnosis of sepsis but suffers from low sensitivity and long turnaround time. LightCycler SeptiFast (LC-SF is a real-time multiplex polymerase chain reaction test able to detect 25 common pathogens responsible for bloodstream infections within hours. We aim to assess the accuracy of LC-SF by systematically reviewing the published studies. METHOD: Related literature on Medline, Embase, and Cochrane databases was searched up to October 2012 for studies utilizing LC-SF to diagnose suspected sepsis and that provided sufficient data to construct two-by-two tables. RESULTS: A total of 34 studies enrolling 6012 patients of suspected sepsis were included. The overall sensitivity and specificity for LC-SF to detect bacteremia or fungemia was 0·75 (95% CI: 0·65-0·83 and 0·92 (95%CI:0·90-0·95, respectively. LC-SF had a high positive likelihood ratio (10·10 and a moderate negative likelihood ratio (0·27. Specifically, LC-SF had a sensitivity of 0·80 (95%CI: 0·70-0·88 and a specificity of 0·95(95%CI: 0·93-0·97 for the bacteremia outcome, and a sensitivity of 0·61 (95%CI: 0·48-0·72 and a specificity of 0·99 (95%CI: 0·99-0·99 for the fungemia outcome. High heterogeneity was found in the bacteremia outcome subgroup but not in the fungemia outcome subgroup. CONCLUSION: LC-SF is of high rule-in value for early detection of septic patients. In a population with low pretest probability, LC-SF test can still provide valuable information for ruling out bacteremia or fungemia.

  9. Evaluation of a new multiplex polymerase chain reaction assay STDFinder for the simultaneous detection of 7 sexually transmitted disease pathogens.

    Science.gov (United States)

    Muvunyi, Claude Mambo; Dhont, Nathalie; Verhelst, Rita; Crucitti, Tania; Reijans, Martin; Mulders, Brit; Simons, Guus; Temmerman, Marleen; Claeys, Geert; Padalko, Elizaveta

    2011-09-01

    We evaluated a new multiplex polymerase chain reaction (mPCR), "STDFinder assay", a novel multiplex ligation-dependent probe amplification (MLPA) assay for the simultaneous detection of 7 clinically relevant pathogens of STDs, i.e., Neisseria gonorrhoeae, Chlamydia trachomatis, Trichomonas vaginalis, Mycoplasma genitalium, Treponema pallidum, and herpes simplex virus type 1 and 2 (HSV-1 and HSV-2). An internal amplification control was included in the mPCR reaction. The limits of detection for the STDFinder assay varied among the 7 target organisms from 1 to 20 copies per MLPA assay. There were no cross-reactions among any of the probes. Two hundred and forty-two vaginal swabs and an additional 80 specimens with known results for N. gonorrhoeae and C. trachomatis, obtained from infertile women seen at an infertility research clinic at the Kigali Teaching Hospital in Rwanda, were tested by STDFinder assay and the results were confirmed by single real-time PCR using different species-specific targets. Compared to the reference standard, the STDFinder assay showed specificities and sensitivities of 100% and 100%, respectively, for N. gonorrhoeae, C. trachomatis, and M. genitalium; 90.2% and 100%, respectively, for Trichomonas vaginalis; and 96.1% and 100%, respectively, for HSV-2. No specimen was found to be positive for HSV-1 by either the STDFinder assay or the comparator method. Similarly, the sensitivity for Treponema pallidum could not be calculated due to the absence of any Treponema pallidum-positive samples. In conclusion, the STDFinder assays have comparable clinical sensitivity to the conventional mono and duplex real-time PCR assay and are suitable for the routine detection of a broad spectrum of these STDs at relatively low cost due to multiplexing.

  10. Development of Real-Time PCR Methods for the Detection of Bacterial Meningitis Pathogens without DNA Extraction.

    Directory of Open Access Journals (Sweden)

    Jeni Vuong

    Full Text Available Neisseria meningitidis (Nm, Haemophilus influenzae (Hi, and Streptococcus pneumoniae (Sp are the lead causes of bacterial meningitis. Detection of these pathogens from clinical specimens using traditional real-time PCR (rt-PCR requires DNA extraction to remove the PCR inhibitors prior to testing, which is time consuming and labor intensive. In this study, five species-specific (Nm-sodC and -ctrA, Hi-hpd#1 and -hpd#3 and Sp-lytA and six serogroup-specific rt-PCR tests (A, B, C, W, X, Y targeting Nm capsular genes were evaluated in the two direct rt-PCR methods using PerfeCTa and 5x Omni that do not require DNA extraction. The sensitivity and specify of the two direct rt-PCR methods were compared to TaqMan traditional rt-PCR, the current standard rt-PCR method for the detection of meningitis pathogens. The LLD for all 11 rt-PCR tests ranged from 6,227 to 272,229 CFU/ml for TaqMan, 1,824-135,982 for 5x Omni, and 168-6,836 CFU/ml for PerfeCTa. The diagnostic sensitivity using TaqMan ranged from 89.2%-99.6%, except for NmB-csb, which was 69.7%. For 5x Omni, the sensitivity varied from 67.1% to 99.8%, with three tests below 90%. The sensitivity of these tests using PerfeCTa varied from 89.4% to 99.8%. The specificity ranges of the 11 tests were 98.0-99.9%, 97.5-99.9%, and 92.9-99.9% for TaqMan, 5x Omni, and PerfeCTa, respectively. PerfeCTa direct rt-PCR demonstrated similar or better sensitivity compared to 5x Omni direct rt-PCR or TaqMan traditional rt-PCR. Since the direct rt-PCR method does not require DNA extraction, it reduces the time and cost for processing CSF specimens, increases testing throughput, decreases the risk of cross-contamination, and conserves precious CSF. The direct rt-PCR method will be beneficial to laboratories with high testing volume.

  11. Development of Real-Time PCR Methods for the Detection of Bacterial Meningitis Pathogens without DNA Extraction

    Science.gov (United States)

    Vuong, Jeni; Collard, Jean-Marc; Whaley, Melissa J.; Bassira, Issaka; Seidou, Issaka; Diarra, Seydou; Ouédraogo, Rasmata T.; Kambiré, Dinanibè; Taylor, Thomas H.; Sacchi, Claudio; Mayer, Leonard W.; Wang, Xin

    2016-01-01

    Neisseria meningitidis (Nm), Haemophilus influenzae (Hi), and Streptococcus pneumoniae (Sp) are the lead causes of bacterial meningitis. Detection of these pathogens from clinical specimens using traditional real-time PCR (rt-PCR) requires DNA extraction to remove the PCR inhibitors prior to testing, which is time consuming and labor intensive. In this study, five species-specific (Nm-sodC and -ctrA, Hi-hpd#1 and -hpd#3 and Sp-lytA) and six serogroup-specific rt-PCR tests (A, B, C, W, X, Y) targeting Nm capsular genes were evaluated in the two direct rt-PCR methods using PerfeCTa and 5x Omni that do not require DNA extraction. The sensitivity and specify of the two direct rt-PCR methods were compared to TaqMan traditional rt-PCR, the current standard rt-PCR method for the detection of meningitis pathogens. The LLD for all 11 rt-PCR tests ranged from 6,227 to 272,229 CFU/ml for TaqMan, 1,824–135,982 for 5x Omni, and 168–6,836 CFU/ml for PerfeCTa. The diagnostic sensitivity using TaqMan ranged from 89.2%-99.6%, except for NmB-csb, which was 69.7%. For 5x Omni, the sensitivity varied from 67.1% to 99.8%, with three tests below 90%. The sensitivity of these tests using PerfeCTa varied from 89.4% to 99.8%. The specificity ranges of the 11 tests were 98.0–99.9%, 97.5–99.9%, and 92.9–99.9% for TaqMan, 5x Omni, and PerfeCTa, respectively. PerfeCTa direct rt-PCR demonstrated similar or better sensitivity compared to 5x Omni direct rt-PCR or TaqMan traditional rt-PCR. Since the direct rt-PCR method does not require DNA extraction, it reduces the time and cost for processing CSF specimens, increases testing throughput, decreases the risk of cross-contamination, and conserves precious CSF. The direct rt-PCR method will be beneficial to laboratories with high testing volume. PMID:26829233

  12. Detection of infectious bursal disease virus in various lymphoid tissues of experimentally infected specific pathogen free chickens by different reverse transcription polymerase chain reaction assays

    DEFF Research Database (Denmark)

    Kabell, Susanne; Handberg, Kurt; Kusk, Mette;

    2005-01-01

    transcription polymerase chain reaction (RT-PCR) assays, including two recently developed strain-specific assays, were employed for detection of ribonucleic acid (RNA) from three different IBDV strains in bursa tissue samples from experimentally infected specific pathogen free chickens. The virus strains...

  13. Evaluation of a loop-mediated isothermal amplification method for rapid detection of channel catfish Ictalurus punctatus important bacterial pathogen Edwardsiella ictaluri.

    Science.gov (United States)

    Channel catfish Ictalurus punctatus infected with Edwardsiella ictaluri results in $40 - 50 million annual losses in profits to catfish producers. Early detection of this pathogen is necessary for disease control and reduction of economic loss. In this communication, the loop-mediated isothermal a...

  14. Bioinspired Synthesis of All-in-One Organic-Inorganic Hybrid Nanoflowers Combined with a Handheld pH Meter for On-Site Detection of Food Pathogen.

    Science.gov (United States)

    Ye, Ranfeng; Zhu, Chengzhou; Song, Yang; Lu, Qian; Ge, Xiaoxiao; Yang, Xu; Zhu, Mei-Jun; Du, Dan; Li, He; Lin, Yuehe

    2016-06-01

    With a mild elaborately bioinspired one-pot process, Con A-GOx-CaHPO4 nanoflowers are prepared. Employing the as-prepared all-in-one hybrid nanoflowers as signal tags, a simple but potentially powerful amplification biosensing technology for the detection of food pathogen with excellent simplicity, portability, sensitivity, and adaptability is achieved.

  15. Evaluation of yield of currently available diagnostics by sample type to optimize detection of respiratory pathogens in patients with a community-acquired pneumonia

    NARCIS (Netherlands)

    E. Huijskens (Elisabeth); J.W. Rossen (John); J.A.J.W. Kluytmans (Jan); A.G.M. van der Zanden (Adri); M.P.G. Koopmans D.V.M. (Marion)

    2014-01-01

    textabstractBackground: For the detection of respiratory pathogens, the sampling strategy may influence the diagnostic yield. Ideally, samples from the lower respiratory tract are collected, but they are difficult to obtain. Objectives: In this study, we compared the diagnostic yield in sputum and o

  16. Evaluation of yield of currently available diagnostics by sample type to optimize detection of respiratory pathogens in patients with a community-acquired pneumonia

    NARCIS (Netherlands)

    Huijskens, Elisabeth G. W.; Rossen, John W. A.; Kluytmans, Jan A. J. W.; van der Zanden, Adri G. M.; Koopmans, Marion

    2014-01-01

    BACKGROUND: For the detection of respiratory pathogens, the sampling strategy may influence the diagnostic yield. Ideally, samples from the lower respiratory tract are collected, but they are difficult to obtain. OBJECTIVES: In this study, we compared the diagnostic yield in sputum and oropharyngeal

  17. A modified molecular beacons-based multiplex real-time PCR assay for simultaneous detection of eight foodborne pathogens in a single reaction and its application.

    Science.gov (United States)

    Hu, Qinghua; Lyu, Dongyue; Shi, Xiaolu; Jiang, Yixiang; Lin, Yiman; Li, Yinghui; Qiu, Yaqun; He, Lianhua; Zhang, Ran; Li, Qingge

    2014-03-01

    Foodborne disease outbreaks are often caused by one of the major pathogens. Early identification of the causal pathogen is crucial for disease control and prevention. We describe a real-time polymerase chain reaction (rtPCR) assay that can identify, in a single reaction, up to eight common foodborne bacterial pathogens, including Salmonella enterica subsp. enterica, Listeria monocytogenes, Escherichia coli O157, Vibrio parahaemolyticus, V. vulnificus, Campylobacter jejuni, Enterobacter sakazakii, and Shigella spp. This multiplex rtPCR assay takes advantage of modified molecular beacons and the multicolor combinational probe coding strategy to discriminate each pathogen and the homo-tag assisted non-dimer (HAND) system to prevent dimer formation. The detection limits of the assay ranged from 1.3×10(3) colony-forming units (CFU)/g stool (L. monocytogenes) to 1.6×10(4) CFU/g stool (Shigella spp.). The target genes were 100% specific as assessed on 986 reference strains covering 41 species since no cross-reactions were observed. The assay was applied to the detection of foodborne pathogens in 11,167 clinical samples and the results were compared with culture methods for further validation. The sensitivity and specificity of the rtPCR were 100% and 99%, respectively. When performed in a 96-well rtPCR system, more than 90 samples could be analyzed within 3 h. Given the high accuracy, sensitivity, specificity, and short turn-around time, the established assay could be used for the rapid and reliable identification of the causative pathogens responsible for a certain foodborne disease outbreak and rapid screening of these major foodborne pathogens in laboratory-based surveillance of outpatient clinical samples or even food samples.

  18. Nucleic Acid Sandwich Hybridization Assay with Quantum Dot-Induced Fluorescence Resonance Energy Transfer for Pathogen Detection

    Directory of Open Access Journals (Sweden)

    Cheng-Chung Chou

    2012-12-01

    Full Text Available This paper reports a nucleic acid sandwich hybridization assay with a quantum dot (QD-induced fluorescence resonance energy transfer (FRET reporter system. Two label-free hemagglutinin H5 sequences (60-mer DNA and 630-nt cDNA fragment of avian influenza viruses were used as the targets in this work. Two oligonucleotides (16 mers and 18 mers that specifically recognize two separate but neighboring regions of the H5 sequences were served as the capturing and reporter probes, respectively. The capturing probe was conjugated to QD655 (donor in a molar ratio of 10:1 (probe-to-QD, and the reporter probe was labeled with Alexa Fluor 660 dye (acceptor during synthesis. The sandwich hybridization assay was done in a 20 μL transparent, adhesive frame-confined microchamber on a disposable, temperature-adjustable indium tin oxide (ITO glass slide. The FRET signal in response to the sandwich hybridization was monitored by a homemade optical sensor comprising a single 400 nm UV light-emitting diode (LED, optical fibers, and a miniature 16-bit spectrophotometer. The target with a concentration ranging from 0.5 nM to 1 μM was successfully correlated with both QD emission decrease at 653 nm and dye emission increase at 690 nm. To sum up, this work is beneficial for developing a portable QD-based nucleic acid sensor for on-site pathogen detection.

  19. [A Case of Leptospirosis in which the Causative Pathogen was Detected Using Cerebrospinal Fluid PCR Eight Days after Onset].

    Science.gov (United States)

    Arita, Yuki; Tono, Toshihiro; Hosoda, Tomohiro; Taguchi, Hiroaki; Sakamoto, Mitsuo; Osone, Yasuo; Nozaki, Hiroyuki

    2016-05-01

    We report a patient with leptospirosis caused by infection with Leptospira interrogans serovar Rachmati. A 30-year-old Japanese man took part in a survival camp on Iriomote Island, Okinawa, from July 9 to July 15, 2014. During the camp, he swam in the river and kayaked. He developed a high fever and fatigue 7 days after completing his trip and was admitted to our hospital on July 22. On admission, he complained of a posterior cervical pain and a loss of appetite. Laboratory findings revealed granulocytosis, mildly elevated AST and ALT levels, elevated BUN and Cr levels, and a significantly elevated CRP level. No pathogenic bacteria were isolated from blood, urine, or cerebrospinal fluid cultures. We included leptospirosis in the differential diagnosis because of the patient's history of participating in a survival camp on Iriomote Island. Minocycline 200 mg, p.o. showed an excellent efficacy. The Leptospira flagellar gene FlaB was detected using a cerebrospinal fluid PCR. A microscopic agglutination test (MAT) during the convalescent stage demonstrated significant increases in antibodies against L. interrogans serovar Rachmati, confirming the diagnosis of leptospirosis. A medical history including occupation and recent travel history, and an adequate specimen sampling are crucial for the accurate and early diagnosis of leptospirosis.

  20. Detection of protozoan and bacterial pathogens of public health importance in faeces of Corvus spp. (large-billed crow).

    Science.gov (United States)

    Lee, H Y; Stephen, A; Sushela, D; Mala, M

    2008-08-01

    Parasites and bacteria are reported in the faeces of birds in the current study. Fresh faecal samples of the large-billed crow (Corvus spp.) were collected from the study site at Bangsar, an urban setting in Kuala Lumpur, Malaysia. These samples were transported to laboratory and analysed for parasites and bacteria. Pre-prepared XLD agar plates were used for culturing the bacteria in the laboratory. Using the API 20ETM Test Strips, 9 different species of bacteria were identified belonging to the family Enterobacteriacea. They were Citrobacter freundii, Enterobacter cloacae, Proteus mirabilis, Klebsiella pneumoniae, Kluyvera ascorbata, Salmonella arizonae, Salmonella typhi, Shigella flexneri and Shigella sonnei. The protozoan parasites detected include Cryptosporidium spp., Cyclospora spp., Blastocystis spp., and Capillaria hepatica and Ascaris lumbricoidus ova. Environmental air samples collected on agar plates using an air sampler in the area only produced fungal colonies. Some of these pathogens found in the crows are of zoonotic importance, especially Cryptosporidium, Blastocystis, Cyclopsora, Salmonella, Shigella and Kluyvera. The finding of Kluyvera spp. in crows in our current study highlights its zoonotic potential in an urban setting.

  1. Skin lesion-associated pathogens from Octopus vulgaris: first detection of Photobacterium swingsii, Lactococcus garvieae and betanodavirus.

    Science.gov (United States)

    Fichi, G; Cardeti, G; Perrucci, S; Vanni, A; Cersini, A; Lenzi, C; De Wolf, T; Fronte, B; Guarducci, M; Susini, F

    2015-07-23

    The common octopus Octopus vulgaris Cuvier, 1798 is extremely important in fisheries and is a useful protein source in most Mediterranean countries. Here we investigated pathogens associated with skin lesions in 9 naturally deceased specimens that included both cultured and wild common octopus. Within 30 min after death, each octopus was stored at 4°C and microbiologically examined within 24 h. Bacterial colonies, cultured from swabs taken from the lesions, were examined using taxonomical and biochemical analyses. Vibrio alginolyticus and V. parahaemolyticus were only isolated from cultured animals. A conventional PCR targeting the 16S ribosomal RNA (rRNA) gene and sequencing were performed on 2 bacterial isolates that remained unidentified after taxonomical and biochemical analysis. The sequence results indicated that the bacteria had a 99% identity with Lactococcus garvieae and Photobacterium swingsii. L. garvieae was confirmed using a specific PCR based on the 16S-23S rRNA internal transcribed spacer region, while P. swingsii was confirmed by phylogenetic analyses. Although all animals examined were found to be infected by the protozoan species Aggregata octopiana localised in the intestines, it was also present in skin lesions of 2 of the animals. Betanodavirus was detected in both cultured and wild individuals by cell culture, PCR and electron microscopy. These findings are the first report of L. garvieae and betanodavirus from skin lesions of common octopus and the first identification of P. swingsii both in octopus skin lesions and in marine invertebrates in Italy.

  2. The blind nasotracheal aspiration method is not a useful tool for pathogen detection of pneumonia in children.

    Directory of Open Access Journals (Sweden)

    Tao Zhang

    Full Text Available BACKGROUND: Acute lower respiratory infection (ALRI is a major cause of hospitalization for children in China, while the etiological diagnosis of ALRI remains a challenge. This study was performed to evaluate the utility of the blind Nasotracheal aspiration (NTA in the pathogen detection in ALRI through an evaluation of the test's specificity. METHODOLOGY/PRINCIPAL FINDINGS: A hospital-based study of children ≤3 years was carried out from March 2006 through March 2007 in Suzhou University Affiliated Children's Hospital, including 379 cases with ALRI from the respiratory wards, and 394 controls receiving elective surgery. Nasopharyngeal swabs (NPS and NTA specimens were taken on admission. S. pneumoniae was isolated from 10.3% of NTA samples from ALRI children, H. influenzae from 15.3%, and M. catarrhalis from 4.7%. The false positive rate--the strains from NTA in control group children--was 8.4% (95% CI: 5.8%-11.4% for S. pneumoniae, 27.2% (95% CI: 22.7-31.5% for H. influenzae, and 22.1% (95% CI: 18.0%-26.2% for M. catarrhalis. The agreement between NPS and NTA in the control group was over 70%. CONCLUSION/SIGNIFICANCE: The blind NTA test is not a useful test for etiologic diagnosis of ALRI.

  3. Loop-mediated isothermal amplification of specific endoglucanase gene sequence for detection of the bacterial wilt pathogen Ralstonia solanacearum.

    Directory of Open Access Journals (Sweden)

    Rok Lenarčič

    Full Text Available The increased globalization of crops production and processing industries also promotes the side-effects of more rapid and efficient spread of plant pathogens. To prevent the associated economic losses, and particularly those related to bacterial diseases where their management relies on removal of the infected material from production, simple, easy-to-perform, rapid and cost-effective tests are needed. Loop-mediated isothermal amplification (LAMP assays that target 16S rRNA, fliC and egl genes were compared and evaluated as on-site applications. The assay with the best performance was that targeted to the egl gene, which shows high analytical specificity for diverse strains of the betaproteobacterium Ralstonia solanacearum, including its non-European and non-race 3 biovar 2 strains. The additional melting curve analysis provides confirmation of the test results. According to our extensive assessment, the egl LAMP assay requires minimum sample preparation (a few minutes of boiling for the identification of pure cultures and ooze from symptomatic material, and it can also be used in a high-throughput format in the laboratory. This provides sensitive and reliable detection of R. solanacearum strains of different phylotypes.

  4. Development of a high-throughput resequencing array for the detection of pathogenic mutations in osteogenesis imperfecta.

    Directory of Open Access Journals (Sweden)

    Yao Wang

    Full Text Available Osteogenesis imperfecta (OI is a rare inherited skeletal disease, characterized by bone fragility and low bone density. The mutations in this disorder have been widely reported to be on various exonal hotspots of the candidate genes, including COL1A1, COL1A2, CRTAP, LEPRE1, and FKBP10, thus creating a great demand for precise genetic tests. However, large genome sizes make the process daunting and the analyses, inefficient and expensive. Therefore, we aimed at developing a fast, accurate, efficient, and cheaper sequencing platform for OI diagnosis; and to this end, use of an advanced array-based technique was proposed.A CustomSeq Affymetrix Resequencing Array was established for high-throughput sequencing of five genes simultaneously. Genomic DNA extraction from 13 OI patients and 85 normal controls and amplification using long-range PCR (LR-PCR were followed by DNA fragmentation and chip hybridization, according to standard Affymetrix protocols. Hybridization signals were determined using GeneChip Sequence Analysis Software (GSEQ. To examine the feasibility, the outcome from new resequencing approach was validated by conventional capillary sequencing method.Overall call rates using resequencing array was 96-98% and the agreement between microarray and capillary sequencing was 99.99%. 11 out of 13 OI patients with pathogenic mutations were successfully detected by the chip analysis without adjustment, and one mutation could also be identified using manual visual inspection.A high-throughput resequencing array was developed that detects the disease-associated mutations in OI, providing a potential tool to facilitate large-scale genetic screening for OI patients. Through this method, a novel mutation was also found.

  5. Heteropolymeric triplex-based genomic assay to detect pathogens or single-nucleotide polymorphisms in human genomic samples.

    Directory of Open Access Journals (Sweden)

    Jasmine I Daksis

    Full Text Available Human genomic samples are complex and are considered difficult to assay directly without denaturation or PCR amplification. We report the use of a base-specific heteropolymeric triplex, formed by native duplex genomic target and an oligonucleotide third strand probe, to assay for low copy pathogen genomes present in a sample also containing human genomic duplex DNA, or to assay human genomic duplex DNA for Single Nucleotide Polymorphisms (SNP, without PCR amplification. Wild-type and mutant probes are used to identify triplexes containing FVL G1691A, MTHFR C677T and CFTR mutations. The specific triplex structure forms rapidly at room temperature in solution and may be detected without a separation step. YOYO-1, a fluorescent bis-intercalator, promotes and signals the formation of the specific triplex. Genomic duplexes may be assayed homogeneously with single base pair resolution. The specific triple-stranded structures of the assay may approximate homologous recombination intermediates, which various models suggest may form in either the major or minor groove of the duplex. The bases of the stable duplex target are rendered specifically reactive to the bases of the probe because of the activity of intercalated YOYO-1, which is known to decondense duplex locally 1.3 fold. This may approximate the local decondensation effected by recombination proteins such as RecA in vivo. Our assay, while involving triplex formation, is sui generis, as it is not homopurine sequence-dependent, as are "canonical triplexes". Rather, the base pair-specific heteropolymeric triplex of the assay is conformation-dependent. The highly sensitive diagnostic assay we present allows for the direct detection of base sequence in genomic duplex samples, including those containing human genomic duplex DNA, thereby bypassing the inherent problems and cost associated with conventional PCR based diagnostic assays.

  6. Prevalence of pathogenic Yersinia enterocolitica in minced meat, pig tongues and hearts at the retail level in the Czech Republic detected by real time PCR

    Directory of Open Access Journals (Sweden)

    Alena Lorencova

    2016-06-01

    Full Text Available Yersiniosis is the third most frequently reported zoonosis in the European Union and Yersinia enterocolitica is the most common species causing human infections. Pigs are assumed to be the main reservoir of human pathogenic Y. enterocolitica with the presence of bacteria mainly in the tonsils and intestinal content. Undercooked pork and pork products have been suggested as the primary source of human yersiniosis. Nevertheless, data on the prevalence of pathogenic Y. enterocolitica in foodstuffs including pork products are very limited. A molecular based method (real time PCR targeting the ompF gene (detection of Yersinia genus and the ail gene (a chromosomally located virulence marker of Y. enterocolitica was used to determine the prevalence of pathogenic Y. enterocolitica in minced meat and edible pork offal at the retail level in the Czech Republic. A total of 50 pig tongues, 50 pig hearts, and 93 samples of minced meat containing pork were purchased at nine retail outlets in Brno. High detection rates of Yersinia spp. were found in all types of samples (pig tongues, 80.0%; pig hearts, 40.0%; and minced meat, 55.9%. The highest prevalence of pathogenic Y. enterocolitica was found in pig tongues (40.0%, followed by pig hearts (18.0% and minced meat samples (17.2%. Although from the point of view of food safety the merely molecular detection of DNA of the pathogenic bacteria could represent a false positive result, our results indicate the presence of pathogenic Y. enterocolitica in raw pork products at the retail level in the Czech Republic, which may pose a risk of consumer infection. Sufficient heat treatment and prevention of cross-contamination during preparation of food in the kitchen should be recommended.

  7. Gas House Autonomous System Monitoring

    Science.gov (United States)

    Miller, Luke; Edsall, Ashley

    2015-01-01

    Gas House Autonomous System Monitoring (GHASM) will employ Integrated System Health Monitoring (ISHM) of cryogenic fluids in the High Pressure Gas Facility at Stennis Space Center. The preliminary focus of development incorporates the passive monitoring and eventual commanding of the Nitrogen System. ISHM offers generic system awareness, adept at using concepts rather than specific error cases. As an enabler for autonomy, ISHM provides capabilities inclusive of anomaly detection, diagnosis, and abnormality prediction. Advancing ISHM and Autonomous Operation functional capabilities enhances quality of data, optimizes safety, improves cost effectiveness, and has direct benefits to a wide spectrum of aerospace applications.

  8. Development of a visual loop-mediated isothermal amplification method for rapid detection of the bacterial pathogen Pseudomonas putida of the large yellow croaker (Pseudosciaena crocea).

    Science.gov (United States)

    Mao, Zhijuan; Qiu, Yangyu; Zheng, Lei; Chen, Jigang; Yang, Jifang

    2012-06-01

    In recent years, the large yellow croaker (Pseudosciaena crocea), an important marine fish farmed in the coastal areas of Zhejiang province, east China, has become severely endangered as a result of the bacterial pathogen Pseudomonas putida. This paper reports the development of a visual loop-mediated isothermal amplification (LAMP) assay for rapid detection of the pathogen. Four primers, F3, B3, FIP and BIP, were designed on the basis of DNA sequence of the rpoN gene of P. putida. After optimization of the reaction conditions, the detection limit of LAMP assay was 4.8cfu per reaction, 10-fold higher than that of conventional PCR. The assay showed high specificity to discriminate all P. putida isolates from nine other Gram-negative bacteria. The assay also successfully detected the pathogen DNA in the tissues of infected fish. For visual LAMP without cross-contamination, SYBR Green I was embedded in a microcrystalline wax capsule and preset in the reaction tubes; after the reaction the wax was melted at 85°C to release the dye and allow intercalation with the amplicons. The simple, highly sensitive, highly specific and cost-effective characteristics of visual LAMP may encourage its application in the rapid diagnosis of this pathogen.

  9. A Multiplex PCR/LDR Assay for Simultaneous Detection and Identification of the NIAID Category B Bacterial Food and Water-borne Pathogens

    Science.gov (United States)

    Rundell, Mark S.; Pingle, Maneesh; Das, Sanchita; Hussain, Aashiq; Ocheretina, Oksana; Charles, Macarthur; Larone, Davise H.; Spitzer, Eric D.; Golightly, Linnie; Barany, Francis

    2014-01-01

    Enteric pathogens that cause gastroenteritis remain a major global health concern. The goal of this study was to develop a multiplex PCR/LDR assay for the detection of all NIAID category B bacterial food and water-borne pathogens directly from stool specimens. To validate the PCR/LDR assay, clinical isolates of Campylobacter spp., Vibrio spp., Shigella spp., Salmonella spp., Listeria monocytogenes, Yersinia enterocolitica, and diarrheagenic Escherichia coli were tested. The sensitivity and specificity of the assay was assessed using a large number of seeded culture-negative stool specimens and a smaller set of clinical specimens from Haiti. The overall sensitivity ranged from 91 to 100% (median 100%) depending on the species. For the majority of organisms the sensitivity was 100%. The overall specificity based on initial testing ranged from 98% to 100% depending on the species. After additional testing of discordant samples the lowest specificity was 99.4%. PCR/LDR detected additional category B agents (particularly diarrheagenic E. coli) in 11/40 specimens from Haiti that were culture-positive for V. cholerae and in approximately 1% of routine culture-negative stool specimens from a hospital in New York. This study demonstrated the ability of the PCR/LDR assay to detect a large comprehensive panel of category B enteric bacterial pathogens as well as mixed infections. This type of assay has the potential to provide earlier warnings of possible public health threats and more accurate surveillance of food and water-borne pathogens. PMID:24709368

  10. Rapid detection of virulence-associated genes in avian pathogenic Escherichia coli by multiplex polymerase chain reaction.

    Science.gov (United States)

    Ewers, Christa; Janssen, Traute; Kiessling, Sabine; Philipp, Hans-C; Wieler, Lothar H

    2005-06-01

    the protocol was concluded to be a useful, sensitive, and rapid assay system to detect avian pathogenic E. coli and differentiate them from nonpathogenic strains and those belonging to other pathotypes.

  11. 屠宰生猪胸膜炎的病原检测%Detection of Pleurisy Pathogens in Slaughter Swine

    Institute of Scientific and Technical Information of China (English)

    邱渊皓; 魏江华; 任娟娟; 唐攀; 刘万华; 武宁; 李涛; 伍成奇; 王晶钰

    2014-01-01

    Different degree of pleuritis lesions could usually be found in slaughter pigs.These pleural in-flammatory lesions are often persistent due to pneumonia.The study investigated pleuritis in slaughter pigs in order to determine the prevalence of pleuritis and identify respiratory pathogens involved in pleuro-pneumonia-infected lungs.Two hundreds of lungs from each herd were evaluated using the Slaughterhouse Pleuritis Evaluation System (SPES)from 9 slaughter herds,and the pathogenic bacteria in pleuropneumo-nia-affected lungs were detected.In the present study,52.1% of lungs were found to have different degree of pleuritis.24.0% of the lungs had a SPES score >1,and 26 Actinobacillus pleuropneumonia strains,9 Haemophilus parasuis strains,11 Pasteurella multocida strains,and 15 Streptococcus suis strains were i-dentified in pleuropneumonia-affected lungs.%在屠宰场内,经常可以看到屠宰生猪存在不同程度的胸膜炎病变。这些胸膜上的炎症往往由胸膜肺炎病变持续感染发展而来。试验从宏观角度上统计屠宰生猪出现胸膜炎病变的发生情况,并对胸膜肺炎病变肺脏进行病原菌的分离鉴定。采用屠宰场胸膜炎评估系统(SPES),选取某集约化生猪养殖场的9个畜群,每个畜群随机抽取200份肺脏样品,进行胸膜炎的评价,并随后检测胸膜肺炎的病原菌。其中不同程度的胸膜炎病例占调查肺脏总数的52.1%。打分 SPES>1的病变肺脏比例为24.0%。从胸膜肺炎病变肺脏中分离出胸膜肺炎放线杆菌26株,副猪嗜血杆菌9株,多杀性巴氏杆菌11株和猪链球菌15株。

  12. Real-time PCR and spore trap-based detection of the downy mildew pathogen, Peronospora effusa

    Science.gov (United States)

    Peronospora effusa is an obligate pathogen and the causal agent of downy mildew on spinach. The pathogen can be dispersed by splashing rain and wind, and may overwinter as oospores. Outbreaks of downy mildew on spinach are common in the cool climate of central coastal California, including the Sal...

  13. Potentiometric Detection of Pathogens

    Science.gov (United States)

    2012-01-01

    complex between polyaniline and macromolecular counter ions and the entanglements involved with the macromolecules). Sulfonated polystyrene ...electrolyte. Similarly hydrophobic counter ions such as dinonylnapthalene and dibenzyl sulfonic acids, prevented the effect of a strong base

  14. Design and Elementary Evaluation of a Highly-Automated Fluorescence-Based Instrument System for On-Site Detection of Food-Borne Pathogens

    Directory of Open Access Journals (Sweden)

    Zhan Lu

    2017-02-01

    Full Text Available A simple, highly-automated instrument system used for on-site detection of foodborne pathogens based on fluorescence was designed, fabricated, and preliminarily tested in this paper. A corresponding method has been proved effective in our previous studies. This system utilizes a light-emitting diode (LED to excite fluorescent labels and a spectrometer to record the fluorescence signal from samples. A rotation stage for positioning and switching samples was innovatively designed for high-throughput detection, ten at most in one single run. We also developed software based on LabVIEW for data receiving, processing, and the control of the whole system. In the test of using a pure quantum dot (QD solution as a standard sample, detection results from this home-made system were highly-relevant with that from a well-commercialized product and even slightly better reproducibility was found. And in the test of three typical kinds of food-borne pathogens, fluorescence signals recorded by this system are highly proportional to the variation of the sample concentration, with a satisfied limit of detection (LOD (nearly 102–103 CFU·mL−1 in food samples. Additionally, this instrument system is low-cost and easy-to-use, showing a promising potential for on-site rapid detection of food-borne pathogens.

  15. Design and Elementary Evaluation of a Highly-Automated Fluorescence-Based Instrument System for On-Site Detection of Food-Borne Pathogens.

    Science.gov (United States)

    Lu, Zhan; Zhang, Jianyi; Xu, Lizhou; Li, Yanbin; Chen, Siyu; Ye, Zunzhong; Wang, Jianping

    2017-02-23

    A simple, highly-automated instrument system used for on-site detection of foodborne pathogens based on fluorescence was designed, fabricated, and preliminarily tested in this paper. A corresponding method has been proved effective in our previous studies. This system utilizes a light-emitting diode (LED) to excite fluorescent labels and a spectrometer to record the fluorescence signal from samples. A rotation stage for positioning and switching samples was innovatively designed for high-throughput detection, ten at most in one single run. We also developed software based on LabVIEW for data receiving, processing, and the control of the whole system. In the test of using a pure quantum dot (QD) solution as a standard sample, detection results from this home-made system were highly-relevant with that from a well-commercialized product and even slightly better reproducibility was found. And in the test of three typical kinds of food-borne pathogens, fluorescence signals recorded by this system are highly proportional to the variation of the sample concentration, with a satisfied limit of detection (LOD) (nearly 10²-10³ CFU·mL(-1) in food samples). Additionally, this instrument system is low-cost and easy-to-use, showing a promising potential for on-site rapid detection of food-borne pathogens.

  16. A Comparison of In-House Real-Time LAMP Assays with a Commercial Assay for the Detection of Pathogenic Bacteria.

    Science.gov (United States)

    Wang, Deguo; Wang, Yongzhen; Xiao, Fugang; Guo, Weiyun; Zhang, Yongqing; Wang, Aiping; Liu, Yanhong

    2015-05-25

    Molecular detection of bacterial pathogens based on LAMP methods is a faster and simpler approach than conventional culture methods. Although different LAMP-based methods for pathogenic bacterial detection are available, a systematic comparison of these different LAMP assays has not been performed. In this paper, we compared 12 in-house real-time LAMP assays with a commercialized kit (Isothermal Master Mix) for the detection of Listeria monocytogenes, Salmonella spp, Staphylococcus aureus, Escherichia coli O157, E. coli O26, E. coli O45, E. coli O103, E. coli O111, E. coli O121, E. coli O145 and Streptococcus agalactiae. False-positive results were observed in all 12 in-house real-time LAMP assays, while all the negative controls of Isothermal Master Mix remained negative after amplification. The detection limit of Isothermal Master Mix for Listeria monocytogenes, Salmonella spp, Staphylococcus aureus, Escherichia coli O157, E. coli O26, E. coli O45, E. coli O103, E. coli O111, E. coli O121 and Streptococcus agalactiae was 1 pg, whereas the sensitivity of the commercialized kit for E. coli O145 was 100 pg. In conclusion, the 12 in-house real-time LAMP assays were impractical to use, while the commercialized kit Isothermal Master Mix was useful for the detection of most bacterial pathogens.

  17. Molecular detection of the human pathogenic Rickettsia sp. strain Atlantic rainforest in Amblyomma dubitatum ticks from Argentina.

    Science.gov (United States)

    Monje, Lucas D; Nava, Santiago; Eberhardt, Ayelen T; Correa, Ana I; Guglielmone, Alberto A; Beldomenico, Pablo M

    2015-02-01

    To date, three tick-borne pathogenic Rickettsia species have been reported in different regions of Argentina, namely, R. rickettsii, R. parkeri, and R. massiliae. However, there are no reports available for the presence of tick-borne pathogens from the northeastern region of Argentina. This study evaluated the infection with Rickettsia species of Amblyomma dubitatum ticks collected from vegetation and feeding from capybaras (Hydrochoerus hydrochaeris) in northeastern Argentina. From a total of 374 A. dubitatum ticks collected and evaluated by PCR for the presence of rickettsial DNA, 19 were positive for the presence of Rickettsia bellii DNA, two were positive for Rickettsia sp. strain COOPERI, and one was positive for the pathogenic Rickettsia sp. strain Atlantic rainforest. To our knowledge, this study is the first report of the presence of the human pathogen Rickettsia sp. strain Atlantic rainforest and Rickettsia sp. strain COOPERI in Argentina. Moreover, our findings posit A. dubitatum as a potential vector for this pathogenic strain of Rickettsia.

  18. Development of multiplex loop mediated isothermal amplification (m-LAMP) label-based gold nanoparticles lateral flow dipstick biosensor for detection of pathogenic Leptospira

    Energy Technology Data Exchange (ETDEWEB)

    Nurul Najian, A.B.; Engku Nur Syafirah, E.A.R.; Ismail, Nabilah [Department of Medical Microbiology & Parasitology, School of Medical Sciences, Health Campus, Universiti Sains Malaysia, 16150 Kubang Kerian, Kelantan (Malaysia); Mohamed, Maizan [Faculty of Veterinary Medicine, Universiti Malaysia Kelantan, City Campus, Pengkalan Chepa, Locked Bag 36, 16100 Kota Bharu, Kelantan (Malaysia); Yean, Chan Yean, E-mail: yeancyn@yahoo.com [Department of Medical Microbiology & Parasitology, School of Medical Sciences, Health Campus, Universiti Sains Malaysia, 16150 Kubang Kerian, Kelantan (Malaysia); Institute for Research in Molecular Medicine (INFORMM), Health Campus, Universiti Sains Malaysia, 16150 Kubang Kerian, Kelantan (Malaysia)

    2016-01-15

    In recent years extensive numbers of molecular diagnostic methods have been developed to meet the need of point-of-care devices. Efforts have been made towards producing rapid, simple and inexpensive DNA tests, especially in the diagnostics field. We report on the development of a label-based lateral flow dipstick for the rapid and simple detection of multiplex loop-mediated isothermal amplification (m-LAMP) amplicons. A label-based m-LAMP lateral flow dipstick assay was developed for the simultaneous detection of target DNA template and a LAMP internal control. This biosensor operates through a label based system, in which probe-hybridization and the additional incubation step are eliminated. We demonstrated this m-LAMP assay by detecting pathogenic Leptospira, which causes the re-emerging disease Leptospirosis. The lateral flow dipstick was developed to detect of three targets, the LAMP target amplicon, the LAMP internal control amplicon and a chromatography control. Three lines appeared on the dipstick, indicating positive results for all representative pathogenic Leptospira species, whereas two lines appeared, indicating negative results, for other bacterial species. The specificity of this biosensor assay was 100% when it was tested with 13 representative pathogenic Leptospira species, 2 intermediate Leptospira species, 1 non-pathogenic Leptospira species and 28 other bacteria species. This study found that this DNA biosensor was able to detect DNA at concentrations as low as 3.95 × 10{sup −1} genomic equivalent ml{sup −1}. An integrated m-LAMP and label-based lateral flow dipstick was successfully developed, promising simple and rapid visual detection in clinical diagnostics and serving as a point-of-care device. - Highlights: • We develop multiplex LAMP label-based lateral flow dipstick biosensor for detection of pathogenic Leptospira. • We design primers for multiplex LAMP targeting the conserved LipL32 gene of pathogenic Leptospira and LAMP

  19. Development of multiplex loop mediated isothermal amplification (m-LAMP) label-based gold nanoparticles lateral flow dipstick biosensor for detection of pathogenic Leptospira.

    Science.gov (United States)

    Nurul Najian, A B; Engku Nur Syafirah, E A R; Ismail, Nabilah; Mohamed, Maizan; Yean, Chan Yean

    2016-01-15

    In recent years extensive numbers of molecular diagnostic methods have been developed to meet the need of point-of-care devices. Efforts have been made towards producing rapid, simple and inexpensive DNA tests, especially in the diagnostics field. We report on the development of a label-based lateral flow dipstick for the rapid and simple detection of multiplex loop-mediated isothermal amplification (m-LAMP) amplicons. A label-based m-LAMP lateral flow dipstick assay was developed for the simultaneous detection of target DNA template and a LAMP internal control. This biosensor operates through a label based system, in which probe-hybridization and the additional incubation step are eliminated. We demonstrated this m-LAMP assay by detecting pathogenic Leptospira, which causes the re-emerging disease Leptospirosis. The lateral flow dipstick was developed to detect of three targets, the LAMP target amplicon, the LAMP internal control amplicon and a chromatography control. Three lines appeared on the dipstick, indicating positive results for all representative pathogenic Leptospira species, whereas two lines appeared, indicating negative results, for other bacterial species. The specificity of this biosensor assay was 100% when it was tested with 13 representative pathogenic Leptospira species, 2 intermediate Leptospira species, 1 non-pathogenic Leptospira species and 28 other bacteria species. This study found that this DNA biosensor was able to detect DNA at concentrations as low as 3.95 × 10(-1) genomic equivalent ml(-1). An integrated m-LAMP and label-based lateral flow dipstick was successfully developed, promising simple and rapid visual detection in clinical diagnostics and serving as a point-of-care device.

  20. Novel technologies for foodborne pathogenic microorganism detection%食源性致病微生物的检测新技术

    Institute of Scientific and Technical Information of China (English)

    陈玉婷; 程楠; 许文涛

    2015-01-01

    研究和建立食源性致病微生物的有效检测方法对于食品安全风险控制及人们的身体健康具有重要意义。本文在简要介绍微生物传统检测技术的基础上,系统地介绍了各类食源性致病微生物检测新方法,包括微生物试纸片检测技术、微生物代谢物检测技术、微生物免疫学检测技术、微生物DNA检测技术、微生物传感器检测技术等,分析了各类食源性微生物检测方法的基本原理、优缺点和应用,并对食源性致病微生物的检测新技术的发展提出了设想。%It is very important to establish an effective detection method of foodborne pathogenic microorganism for food safety risk control and people's health. Based on a brief introduction to traditional microbial detection technology, some novel methods to detect foodborne pathogenic microorganism were introduced in this paper, including microbial test paper detection technology, microbial metabolites detection technology, microbial immunological detection technology, microbial DNA detection technology, microbial sensor detection technology, etc. Then the basic principle, advantages and disadvantages and application were analyzed, respectively. Finally, the trends of novel detection technologies for foodborne pathogenic microorganism were proposed.

  1. A detailed protocol to enable safe-handling, preemptive detection, and systematic surveillance of rat-vectored pathogens in the urban environment

    Directory of Open Access Journals (Sweden)

    Michael H Parsons

    2016-07-01

    Full Text Available We detail a five-stage protocol to address physical barriers and experimental limitations that have hindered routine pathogen monitoring of wild rats in urban settings. New York City potentially harbors from 2 to 32 million rats among its 8 million people. However, at a time when people are most vulnerable to disease from over-crowdedness brought on by increased urbanization of society, the difficulty of studying wild rats has led to a paucity of ecological and epidemiological research. Challenges of safely handling animals and the difficulties of identifying individual animals and the emergence of their respective pathogen loads (timing of infection, has impeded progress. We previously reported a method using radio frequency identification (RFID paired with load-cell and camera-traps to enable the identification of individual animals and subsequent monitoring of the animals’ weights (an indicator of health. However, efficient pathogen surveillance requires repeated captures of the same individual in order to isolate and document the emergence of new pathogens, or variations in pathogen load, over time. Most of these barriers are now addressed in our protocol, which is aided by the use of a mobile, outdoor laboratory, followed by incorporation of pheromone-based lures to attract individuals back to active sensors within a camera-trap. This approach allows for the assessment of individual animal health, behaviors under camera, and changing pathogen loads and weights in most urban environments (e.g., financial district, docks, sewers, residential. Five phases are described and presented: 1 site selection and urban trapping; 2 anesthetization; 3 serological and ectoparasite collection; 4 microchip implantation; and 5 re-trapping and luring animals back to active remote sensors. In order to fulfill the unmet call for preemptive pathogen surveillance, public health officials and researchers may wish to adapt, or modify, similar protocols to ensure

  2. A Detailed Protocol to Enable Safe-Handling, Preemptive Detection, and Systematic Surveillance of Rat-Vectored Pathogens in the Urban Environment.

    Science.gov (United States)

    Parsons, Michael H; Sarno, Ronald J; Deutsch, Michael A

    2016-01-01

    We detail a five-stage protocol to address physical barriers and experimental limitations that have hindered routine pathogen monitoring of wild rats in urban settings. New York City potentially harbors from 2 to 32 million rats among its 8-million people. However, at a time, when people are most vulnerable to disease from over-crowdedness brought on by increased urbanization of society, the difficulty of studying wild rats has led to a paucity of ecological and epidemiological research. Challenges of safely handling animals and the difficulties of identifying individual animals and the emergence of their respective pathogen loads (timing of infection) have impeded progress. We previously reported a method using radio frequency identification paired with load cell and camera traps to enable the identification of individual animals and subsequent monitoring of the animals' weights (an indicator of health). However, efficient pathogen surveillance requires repeated captures of the same individual in order to isolate and document the emergence of new pathogens, or variations in pathogen load, over time. Most of these barriers are now addressed in our protocol, which is aided by the use of a mobile, outdoor laboratory, followed by incorporation of pheromone-based lures to attract individuals back to active sensors, within a camera trap. This approach allows for the assessment of individual animal health, behaviors under camera, and changing pathogen loads and weights in most urban environments (e.g., financial district, docks, sewers, and residential). Five phases are described and presented: (1) site selection and urban trapping, (2) anesthetization, (3) serological and ectoparasite collection, (4) microchip implantation, and (5) retrapping and luring animals back to active remote sensors. In order to fulfill the unmet call for preemptive pathogen surveillance, public health officials and researchers may wish to adapt, or modify, similar protocols to ensure early

  3. Autonomic Nervous System Disorders

    Science.gov (United States)

    Your autonomic nervous system is the part of your nervous system that controls involuntary actions, such as the beating of your heart ... breathing and swallowing Erectile dysfunction in men Autonomic nervous system disorders can occur alone or as the result ...

  4. Nanomaterial-based sensors for detection of foodborne bacterial pathogens and toxins as well as pork adulteration in meat products

    Directory of Open Access Journals (Sweden)

    B. Stephen Inbaraj

    2016-01-01

    Full Text Available Food safety draws considerable attention in the modern pace of the world owing to rapid-changing food recipes and food habits. Foodborne illnesses associated with pathogens, toxins, and other contaminants pose serious threat to human health. Besides, a large amount of money is spent on both analyses and control measures, which causes significant loss to the food industry. Conventional detection methods for bacterial pathogens and toxins are time consuming and laborious, requiring certain sophisticated instruments and trained personnel. In recent years, nanotechnology has emerged as a promising field for solving food safety issues in terms of detecting contaminants, enabling controlled release of preservatives to extend the shelf life of foods, and improving food-packaging strategies. Nanomaterials including metal oxide and metal nanoparticles, carbon nanotubes, and quantum dots are gaining a prominent role in the design of sensors and biosensors for food analysis. In this review, various nanomaterial-based sensors reported in the literature for detection of several foodborne bacterial pathogens and toxins are summarized highlighting their principles, advantages, and limitations in terms of simplicity, sensitivity, and multiplexing capability. In addition, the application through a noncross-linking method without the need for any surface modification is also presented for detection of pork adulteration in meat products.

  5. [Trigeminal autonomic cephalgias].

    Science.gov (United States)

    Maximova, M Yu; Piradov, M A; Suanova, E T; Sineva, N A

    2015-01-01

    Review of literature on the trigeminal autonomic cephalgias are presented. Trigeminal autonomic cephalgias are primary headaches with phenotype consisting of trigeminal pain with autonomic sign including