WorldWideScience

Sample records for automatizadas primer semestre

  1. Aprendizaje de estocásticos en primer semestre de ingeniería

    OpenAIRE

    Torres, Omar Pablo; Ojeda, Ana María

    2010-01-01

    Este estudio se dirige a la cuestión de si la formación del ingeniero satisface los requerimientos de conocimientos de estocásticos para un desarrollo satisfactorio en su futuro desempeño profesional y/o académico tecnológico. Para ello, se interesa en la comprensión de las ideas fundamentales de estocásticos en los alumnos del primer semestre de ingeniería y en las dificultades que pueden tener para aprender probabilidad y estadística; se enfoca en la propuesta para estocásticos de los insti...

  2. Efectos de una metodología integral en el aprendizaje de la geometría en alumnos de primer semestre de ingenierías

    OpenAIRE

    Rojas, Carlos

    2007-01-01

    El presente estudio tuvo como objetivo determinar el efecto de una metodología, que se denominó integral, sobre el aprendizaje de la geometría en dos grupos de alumnos de primer semestre de ingenierías de la Universidad del Norte. Dicha metodología consistió en: los sistemas de representación de Bruner, como estrategia en el aprendizaje de conceptos y teoremas; los mentefactos, como instrumento en el aprendizaje conceptual; la argumentación deductiva en la respuesta a preguntas, y un heurísti...

  3. MEMORIA DE TRABAJO Y RENDIMIENTO ACADÉMICO EN ESTUDIANTES DE PRIMER SEMESTRE DE UNA UNIVERSIDAD DE LA CIUDAD DE BARRANQUILLA

    OpenAIRE

    Luis Felipe Zapata; Carlos De Los Reyes; Soraya Lewis; Ernesto Barceló

    2009-01-01

    La memoria de trabajo puede ser un componente de gran influencia en el rendimiento académico, aunque no es el único que lo determina. Este artículo muestra los resultados de una investigación en la que se intentó determinar la correlación que existe entre la memoria de trabajo y el rendimiento académico en estudiantes de primer semestre de diferentes programas de una universidad de Barranquilla. No se encontró correlación entre ninguna de las medidas de memoria de trabajo utilizadas y el rend...

  4. MEMORIA DE TRABAJO Y RENDIMIENTO ACADÉMICO EN ESTUDIANTES DE PRIMER SEMESTRE DE UNA UNIVERSIDAD DE LA CIUDAD DE BARRANQUILLA

    Directory of Open Access Journals (Sweden)

    Luis Felipe Zapata

    2009-01-01

    Full Text Available La memoria de trabajo puede ser un componente de gran influencia en el rendimiento académico, aunque no es el único que lo determina. Este artículo muestra los resultados de una investigación en la que se intentó determinar la correlación que existe entre la memoria de trabajo y el rendimiento académico en estudiantes de primer semestre de diferentes programas de una universidad de Barranquilla. No se encontró correlación entre ninguna de las medidas de memoria de trabajo utilizadas y el rendimiento académico de los participantes. Estos resultados pueden ser explicados por los efectos que otras variables tienen en el rendimiento académico, como la cognición, la motivación, el afecto y el contexto.

  5. Algunos factores relevantes en el desempeño académico en Matemáticas de estudiantes de primer semestre de la E.C.I.

    OpenAIRE

    Bernal, Gloria; LLeras, Guiomar

    1995-01-01

    Desde hace ya varios semestres se tiene inquietud entre los profesores de primer semestre de la Escuela Colombiana de Ingeniería (E. C. I.) acerca del bajo rendimiento académico de sus estudiantes en el área de matemáticas. Se ha notado, además, que este sentir no sólo es de la E. C. I. sino del ámbito universitario en general. Esto motivó la realización de este proyecto y la búsqueda de las posibles causas del problema. Cuando el estudiante pasa del colegio a la universidad sufre cambios de ...

  6. Aptitud física relacionada con salud en los estudiantes de primer semestre académico de un programa de fisioterapia, 2007

    Directory of Open Access Journals (Sweden)

    Claudia Lucía Ariza-García

    2016-08-01

    Full Text Available Objetivo: Evaluar la aptitud física relacionada con salud (AFRS de las estudiantes de primer semestre de fisioterapia de una universidad privada de Santander. Metodología: Estudio descriptivo transversal realizado en 20 estudiantes (17,8 ± 1,33 años de sexo femenino de primer semestre, seleccionadas por conveniencia. Se recolectaron las variables edad, sexo, composición corporal, la flexibilidad de la musculatura posterior, la capacidad aeróbica y la resistencia muscular de miembros superiores y abdominales. Se calcularon medidas de tendencia central, de dispersión, frecuencias y porcentajes. Resultados: En promedio el peso fue de 52,8 ± 9,5 kg, la estatura de 1,58 ± 0,05 m, el IMC de 20,9 ± 3,5 kg/m2. La circunferencia de cintura y de cadera fue de 69,3 ± 9,2 cms y 91,3 ± 7,3 cm, respectivamente. El promedio del cuarto cuartil de las mediciones perímetro de cintura, perímetro de cadera, relación cintura-cadera, frecuencia cardiaca después de 30 s y distancia en la prueba de flexibilidad fueron estadísticamente mayores comparado con los demás cuartiles. El 50% de los pacientes realizó entre 0 y 3 repeticiones de la prueba Push-Up y entre 0 y 21 repeticiones en la prueba Cu rl-Up. El 65% fue físicamente apta hasta en cuatro pruebas y el 35% en 5 y 6 pruebas. Ninguna fue apta en todas las pruebas. Conclusiones: Dado que ninguna de las estudiantes posee una aptitud física relacionada con salud óptima, se sugiere que en los programas de fisioterapia se fomente una AFRS adecuada junto con estilos de vida saldables para prevenir enfermedades crónicas no transmisibles.

  7. Asertividad y autoestima en estudiantes de primer semestre de la Facultad de Ciencias de la Salud de una universidad pública de la ciudad de Santa Marta (Colombia)

    OpenAIRE

    Alexander León Camargo; Claudia Rodríguez Angarita; Fernando Robert Ferrel Ortega; Guillermo Augusto Ceballos Ospino

    2009-01-01

    Esta investigación estudió las habilidades sociales en cuanto asertividad y autoestima en estudiantes de primer semestre de todos los programas adscritos a la Facultad de Ciencias de la Salud y se enmarcó en el paradigma positivista, de tipo cuantitativo; el diseño utilizado fue de tipo correlacional. La conducta socialmente habilidosa es ese conjunto de comportamientos emitidos por un individuo en un contexto interpersonal, que expresa sentimientos, actitudes, deseos, opiniones o derechos de...

  8. Efectividad de la funcionalidad en las familias con adolescentes de primer semestre de la Fundación Universitaria San Gil

    Directory of Open Access Journals (Sweden)

    MARÍA LUCENITH CRIADO MORALES

    2009-12-01

    Full Text Available En el presente estudio se determina y analiza la efectividad de la funcionalidad en las familias con adolescentes de primer semestre en la Fundación Universitaria de San Gil en el periodo 2008-1, teniendo como base el " Marco teórico de organización sistémica" de la doctora María Luisa Friedemann. Es un estudio descriptivo transversal, cuya muestra estuvo constituida por 150 familias. A los adolescentes se les aplicó la ficha sociodemográfica y la " Escala de evaluación de la funcionalidad familiar" que permite medir los conceptos de la teoría y refleja el funcionamiento familiar. Los datos se procesaron en SPSS versión 10.0 y se analizaron mediante estadísticas descriptivas. Los resultados indican que el 69,3% de los adolescentes es de género femenino, el 88,7% practica la religión católica, y 58,7% están dedicados exclusivamente a estudiar. Las familias se caracterizan porque 55,3% son de tipo nuclear, 63,3% con un promedio de 4 a 6 miembros, en 60,7% el estado civil de los padres de los adolescentes es casados y 38% de las familias recibe ingresos de 2 salarios mínimos mensuales. Las familias presentan baja efectividad de la funcionalidad familiar en el 65,3% de los casos, el 32,7% es de nivel intermedio y 2% tiene alta efectividad. Se concluye que la efectividad de la funcionalidad familiar es baja porque son " familias que luchan por mantener la estabilidad contraria a las normas externas, impidiendo la entrada de nuevo conocimiento interfiriendo con la morfogénesis" (1 del sistema familiar.

  9. Comunicación y coordinación en el rol interdependiente de enfermería en una IPS con servicios de alta complejidad de Bogotá: en el primer semestre de 2014

    OpenAIRE

    Bejarano Ramirez, Diana Fernanda

    2015-01-01

    Este estudio tuvo como objetivo describir las características de los procesos de comunicación y coordinación como variables del rol interdependiente de enfermería, en una IPS con servicios de alta complejidad de Bogotá en el primer semestre de 2014, mediante las escalas de comunicación y coordinación del instrumento de Shortell y cols. versión en español, el cual fue validado en el contexto colombiano (Parra, 2008), con un alfa de Cronbach de 0.92, para la comunicación y 0.82 para la coordi...

  10. Asertividad y autoestima en estudiantes de primer semestre de la Facultad de Ciencias de la Salud de una universidad pública de la ciudad de Santa Marta (Colombia

    Directory of Open Access Journals (Sweden)

    Alexander León Camargo

    2009-01-01

    Full Text Available Esta investigación estudió las habilidades sociales en cuanto asertividad y autoestima en estudiantes de primer semestre de todos los programas adscritos a la Facultad de Ciencias de la Salud y se enmarcó en el paradigma positivista, de tipo cuantitativo; el diseño utilizado fue de tipo correlacional. La conducta socialmente habilidosa es ese conjunto de comportamientos emitidos por un individuo en un contexto interpersonal, que expresa sentimientos, actitudes, deseos, opiniones o derechos de esa persona de un modo adecuado a la situación, respetando esas conductas en los demás y que, generalmente, resuelve los problemas inmediatos de la situación, mientras minimiza la probabilidad de futuros problemas. Muchasveces se combinan asertividad con autoestima como elementos psicológicos necesarios para que un individuo pueda manejarse en la vida de una manera asertiva aunque no sean los únicos a considerar. La muestra estuvo conformada 200 estudiantes que ingresaron al primer semestre de los programas académicos de Medicina, Psicología, Enfermería y Odontología, durante el periodo 2008-2. No obstante, 47 estudiantes no desearon participar en la investigación por motivos diferentes, por lo cual la muestra final quedó conformada por 153 estudiantes.

  11. Tobin’s Separation Theorem: Information from the Colombian Stock Market for the First Half of 2008 El teorema de la separación de Tobin: información del primer semestre de 2008 del mercado accionario colombiano

    Directory of Open Access Journals (Sweden)

    José Gabriel Astaiza Gómez

    2012-12-01

    Full Text Available This paper shows a special situation where a portfolio created based on Tobin’s separation theorem does not match the Markowitz efficient set. Next a review of Markowitz´s portfolio selection theory is offered, followed by a review of Tobin’s separation theorem. Next, these models are used as tools for the individual investor with data on the Colombian stock market of the first half of 2008. Finally, the conclusions are shown. It is important to emphasize that the objective of this paper is not to make predictions upon expected returns, variances and covariances of these returns, nor to suggest an optimal portfolio for an investor with a particular utility function, but to expose a concrete scenario in which Tobin´s theorem leads to a portfolio located outside Markowitz´s efficient set.El artículo muestra una situación especial en donde el portafolio surgido del teorema de la separación de Tobin no se encuentra en la frontera eficiente de Markowitz. El desarrollo del mismo inicia con una revisión del modelo de selección de carteras de Harry Markowitz seguido del teorema de la separación de Tobin. A continuación, se hace uso de los modelos como herramientas para el inversionista individual, con datos sobre el mercado accionario colombiano del primer semestre de 2008. Finalmente se muestran las conclusiones. Es importante enfatizar que el objetivo del artículo no es hacer predicciones sobre los rendimientos esperados, varianzas o covarianzas de los mismos rendimientos, ni sugerir un portafolio óptimo para un inversionista con una función de utilidad particular, sino mostrar un escenario concreto en el que el teorema de la separación de Tobin conlleva a un portafolio ubicado por fuera de la frontera eficiente.

  12. Efectividad de la funcionalidad en las familias con adolescentes de primer semestre Functional family Effectiveness with first semester freshmen adolescents in the family at the Fundación Universitaria San Gil Efetividade da funcionalidade nas famílias com adolescentes de primeiro semestre da Fundação Universitária San Gil

    Directory of Open Access Journals (Sweden)

    RUBIANO MESA YURIAN

    2009-12-01

    Full Text Available En el presente estudio se determina y analiza la efectividad de la funcionalidad en las familias con adolescentes de primer semestre en la Fundación Universitaria de San Gil en el periodo 2008-1, teniendo como base el “Marco teórico de organización sistémica” de la doctora María Luisa Friedemann. Es un estudio descriptivo transversal, cuya muestra estuvo constituida por 150 familias. A los adolescentes se les aplicó la ficha sociodemográfica y la “Escala de evaluación de la funcionalidad familiar” que permite medir los conceptos de la teoría y refleja el funcionamiento familiar. Los datos se procesaron en SPSS versión 10.0 y se analizaron mediante estadísticas descriptivas. Los resultados indican que el 69,3% de los adolescentes es de género femenino, el 88,7% practica la religión católica, y 58,7% están dedicados exclusivamente a estudiar. Las familias se caracterizan porque 55,3% son de tipo nuclear, 63,3% con un promedio de 4 a 6 miembros, en 60,7% el estado civil de los padres de los adolescentes es casados y 38%de las familias recibe ingresos de 2 salarios mínimos mensuales. Las familias presentan baja efectividad de la funcionalidad familiar en el 65,3% de los casos, el 32,7% es de nivel intermedio y 2% tiene alta efectividad. Se concluye que la efectividad de la funcionalidad familiar es baja porque son “familias que luchan por mantener la estabilidad contraria a las normas externas, impidiendo la entrada de nuevo conocimiento interfiriendo con la morfogénesis” (1 del sistema familiar.This study determines and analyzes functional family effectiveness with first semester freshmen adolescents families at the Fundación Universitaria San Gil in the 2008- first semester, based on the systemic organization theoretical framework” of Dr. María Luisa Friedemann. This is a descriptive cross study; the sample comprised 150 families. Adolescents received the social-demographic card and the “Family adaptability and

  13. Universalization in the first course of Medicine studies: Experience during the first semester of 2004- 2005. Universalización en primer año de Medicina: Experiencia durante el primer semestre del curso 2004-2005.

    Directory of Open Access Journals (Sweden)

    Raúl López Fernández

    Full Text Available Background: The sliding of the basic cycle of teaching in Medicine speciality to the Health Primary care inserted in the in the university process of the higher medical education es quite brand new , whose development in the practical field was accurately unknown. Objective: to explore the course of the teaching learning process of 1st academic year of the medicine speciality as well as to assess the opinion state of its performers, and to identify achievements and difficultiesduring its development. Methods: a qualitative and transversal section study developed from December 2004 to January 2005 in Cienfuegos province. Its general design is part of a national design and the instruments ans techniques used were previously validated for a previous study developed in Havana city and gathered in a Nationa Workshop. These instruments and techniques are based on surveys to students and professors, direct observation and the achievement of focal groups with the performers of the process. Results: this new model is accepted for students and professors who participate and its advantages and intrinsic values are recognized. Achievements and deficiencies related to didactic, organizative, management of the process and preparation of the institute staff among others are identified. The general development of the process is acceptable and the effort of the professors and the workers is recognized in the implementation of this new model.

    Fundamento: El desplazamiento de la enseñanza del ciclo básico de la carrera de Medicina hacia la Atención Primaria de Salud, insertada en el proceso de universalización de la Educación Médica Superior es un proceso absolutamente novedoso, cuyo desarrollo en la práctica no se conocía con exactitud. Objetivo: Explorar la marcha del proceso docente-educativo de primer año de Medicina, valorar el estado de

  14. Oferta y demanda de servicios de salud en Manizales. Primer semestre 1995 al primer semestre 1997.

    Directory of Open Access Journals (Sweden)

    Alba Lucía Vélez Arango

    2009-10-01

    Full Text Available Se analizó el comportamiento de los indicadores de cobertura de afiliación al Sistema de Seguridad Social en Salud (SSSS, capacidad instalada de las instituciones del sector en términos de recursos físicos y humano, extensión e intensidad de uso de la consulta externa médica general, consulta odontológica y consulta de urgencia, al igual que la utilización de los servicios hospitalarios en términos de porcentaje ocupacional y productividad, en el período comprendido entre enero, 1995 y diciembre, 1996. En el período de estudio se observó en Manizales un aumento en la afiliación al SSSS en el régimen contributivo, pasando de 262,858 afiliados en 1995 a 311,901 a diciembre de 1996, lo cual representó un aumento de 18% con una cobertura aproximada de 80% del total de la población objetivo. En relación con la cobertura de afiliación en el Régimen Subsidiado a finales de 1996 se informó un total de 37,177 afiliados al SSSS en la ciudad de Manizales, representando una cobertura de 80% de la población identificada mediante el Sistema de Identificación de Población (SISBEN. En lo que tiene que ver con la extensión de uso se observó un aumento en la consulta odontológica, consulta externa médica general y consulta de urgencias durante el período 1995-1997. En relación con la intensidad de uso no se observó una variación significativa en la consulta externa médica general y de urgencias, mientras que la consulta odontológica presentó un ligero aumento en 1997. En cuanto a la utilización de los servicios de hospitalización se observaron diferencias apreciables entre las distintas Empresas Sociales del Estado existentes en la ciudad. Por último, los resultados encontrados en relación con la utilización de los servicios de hospitalización durante el período 1995-1997 tienen gran importancia para el análisis de la oportunidad y calidad de la atención en salud y en la planeación de la infraestructura de servicios, por lo que se hace indispensable la ejecución de estudios a profundidad que elaboren el diagnóstico y sus factores determinantes, para formular políticas alternativas.

  15. Efectividad de la funcionalidad en las familias con adolescentes de primer semestre de la Fundación Universitaria San Gil Efetividade da funcionalidade nas famílias com adolescentes de primeiro semestre da Fundação Universitária San Gil Functional family Effectiveness with first semester freshmen adolescents in the family at the Fundación Universitaria San Gil

    Directory of Open Access Journals (Sweden)

    MARÍA LUCENITH CRIADO MORALES

    Full Text Available En el presente estudio se determina y analiza la efectividad de la funcionalidad en las familias con adolescentes de primer semestre en la Fundación Universitaria de San Gil en el periodo 2008-1, teniendo como base el " Marco teórico de organización sistémica" de la doctora María Luisa Friedemann. Es un estudio descriptivo transversal, cuya muestra estuvo constituida por 150 familias. A los adolescentes se les aplicó la ficha sociodemográfica y la " Escala de evaluación de la funcionalidad familiar" que permite medir los conceptos de la teoría y refleja el funcionamiento familiar. Los datos se procesaron en SPSS versión 10.0 y se analizaron mediante estadísticas descriptivas. Los resultados indican que el 69,3% de los adolescentes es de género femenino, el 88,7% practica la religión católica, y 58,7% están dedicados exclusivamente a estudiar. Las familias se caracterizan porque 55,3% son de tipo nuclear, 63,3% con un promedio de 4 a 6 miembros, en 60,7% el estado civil de los padres de los adolescentes es casados y 38% de las familias recibe ingresos de 2 salarios mínimos mensuales. Las familias presentan baja efectividad de la funcionalidad familiar en el 65,3% de los casos, el 32,7% es de nivel intermedio y 2% tiene alta efectividad. Se concluye que la efectividad de la funcionalidad familiar es baja porque son " familias que luchan por mantener la estabilidad contraria a las normas externas, impidiendo la entrada de nuevo conocimiento interfiriendo con la morfogénesis" (1 del sistema familiar.O presente levantamento determina e analisa a efetividade da funcionalidade nas famílias com adolescentes de primeiro semestre na Fundação Universitária de San Gil durante o período 2008-1, com base no " marco teórico de organização sistêmica" da doutora María Luisa Friedemann. O levantamento consiste numa descrição transversal com uma amostra constituída por 150 famílias. Todos os adolescentes preencheram um formul

  16. El cambio en el razonamiento bayesiano de estudiantes universitarios durante un semestre académico

    OpenAIRE

    Morgado, Cindy; Yáñez, Gabriel

    2013-01-01

    En este trabajo se presentan los avances de una investigación que estudia el cambio en el razonamiento bayesiano en estudiantes universitarios que toman un primer curso de estadística. Se desarrolla un estudio longitudinal con 102 estudiantes. Se diseñan tres pruebas para evaluar el razonamiento, las cuales se aplican en momentos diferentes durante el semestre. Un análisis descriptivo de los resultados obtenidos muestra que la enseñanza de los conceptos de probabilidad condicional y teorema d...

  17. Séptimo informe semestral sobre política exterior del gobierno argentino : Septiembre-marzo 2007

    OpenAIRE

    Simonoff, Alejandro César

    2007-01-01

    Si bien estos informes tienen por objeto pasar revista de lo ocurrido en el semestre, la decisión del Presidente de realizar en su último mensaje al Parlamento argentino en marzo de 2007 un balance de su gestión, nos parece pertinente aquí hacer algunos comentarios sobre su política exterior, en un brevísimo contrapunto con sus proposiciones iniciales. Para cumplir con este objetivo realizaremos un seguimiento de los cinco problemas identificados por el propio primer mandatario al momento de ...

  18. Traducción automatizada de programas entre lenguajes de operaciones

    Directory of Open Access Journals (Sweden)

    Diego Ordóñez Camacho

    2012-06-01

    Full Text Available Los lenguajes de operaciones se usan para programar, en procedimientos organizados, las instrucciones a ser ejecutadas por una máquina, para realizar distintos tipos de operaciones. Para poder importar procedimientos existentes realizados en un lenguaje de operaciones dado, en frameworks de programación específicos para el diseño de operaciones, es necesario contar con traductores entre el lenguaje en que ha sido programado el procedimiento, y el lenguaje interno utilizado por el framework de diseño. La construcción de estos traductores puede ser automatizada si se establece un mapeo entre producciones equivalentes de las gramáticas de los lenguajes fuente y destino. Las producciones se pueden considerar equivalentes cuando a pesar de tener una sintaxis diferente, tienen la misma intención semántica y pueden ser equiparadas con un árbol de sintaxis abstracta en común. Debido a ciertas diferencias sintácticas, en ocasiones este árbol sintáctico común no puede ser hallado directamente. Esto se vuelve posible, sin embargo, al realizar en primer lugar ciertas transformaciones a los programas. Este artículo presenta un acercamiento específico a la construcción de reglas de transformación para resolver estas diferencias.Abstract:Operations languages are used to program the procedures that instruct machinery to perform specific operations. To import procedures in a given operations language, into a dedicated tool for designing operations, language translators are needed to translate those procedures to the design tool's internal operations language. The construction of these translators can be automated by mapping equivalent productions in the grammar of source and target language. Productions are considered equivalent when, in spite of a differing syntax, they have the same intended semantics and can be matched to a same abstract syntax tree. For some corresponding productions, due to syntactic differences, such a common abstract

  19. Nutrición y desarrollo psicomotor durante el primer semestre de vida

    Directory of Open Access Journals (Sweden)

    CHÁVEZ ADOLFO

    1998-01-01

    Full Text Available Objetivo. Estudiar el desarrollo psicomotor de niños pequeños de una comunidad rural pobre y mal alimentada y relacionarlo con la alimentación y nutrición tanto de su madre como de ellos mismos. Material y métodos. Se estudiaron 82 unidades madre-niño, desde antes del quinto mes de embarazo hasta los seis meses de edad del niño, en antropometría y dieta; en el niño se aplicaron pruebas de Brazelton al nacer, de Bayley a los tres y seis meses de edad y de interacción con su madre. Resultados. Varias de las pruebas psicomotoras del niño se correlacionaron positivamente con el peso de la madre y sus pliegues cutáneos, lo mismo que con su propio peso y talla previos. También con el consumo materno de productos animales y frutas durante el embarazo y negativamente con el consumo de tortillas y frijoles. Las correlaciones de varias de las pruebas del niño a los seis meses fueron positivas con su consumo complementario, de energía total y de varios alimentos, sobre todo de huevo, leche y frutas alrededor de los tres meses de edad. Conclusiones. Es importante que dentro del estrato social rural pobre estudiado, pequeñas variaciones de consumo de alimentos y nutrición de la unidad materno-infantil den lugar a cambios en las diversas pruebas de desarrollo psicomotor del niño pequeño, lo que sugiere la necesidad de impulsar más los programas de nutrición aplicados.

  20. Nutrición y desarrollo psicomotor durante el primer semestre de vida

    OpenAIRE

    CHÁVEZ ADOLFO; MARTÍNEZ HOMERO; GUARNEROS NOÉ; ALLEN LINDSAY; PELTO GRETEL

    1998-01-01

    Objetivo. Estudiar el desarrollo psicomotor de niños pequeños de una comunidad rural pobre y mal alimentada y relacionarlo con la alimentación y nutrición tanto de su madre como de ellos mismos. Material y métodos. Se estudiaron 82 unidades madre-niño, desde antes del quinto mes de embarazo hasta los seis meses de edad del niño, en antropometría y dieta; en el niño se aplicaron pruebas de Brazelton al nacer, de Bayley a los tres y seis meses de edad y de interacción con su madre. Resultados. ...

  1. Phonics Primer

    Science.gov (United States)

    Elam, Sandra

    2007-01-01

    This primer lists the 44 sounds in the English language and then gives steps for teaching those 44 sounds and their most common spelling patterns. In addition to learning sounds and spellings, each day the student must read lists of phonetically related words and spell these words from dictation. Phonics instruction must be reinforced by having…

  2. Arquitectura extensible para la protección automatizada de software: Un caso de estudio

    Directory of Open Access Journals (Sweden)

    Yulier Nuñez Musa

    2015-01-01

    Full Text Available En la actualidad el software comercial es susceptible a la modificación y la observación de su código interno mediante ataques de ingeniería inversa. Estos ataques permiten la piratería del software, siendo billonarias las pérdidas ocasionadas a la industria de software por este concepto. Este trabajo se centra en el desarrollo de una arquitectura extensible para insertar de forma automatizada durante el proceso de compilación, mecanismos de protección en un software dado. La protección se realiza de forma transparente al desarrollador y además, permite diseñar e implementar de forma flexible y modular las diferentes técnicas de protección identificadas. Se implementó la técnica de ofuscación como caso de estudio para validar la arquitectura propuesta. Esta técnica fue probada sobre distintos algoritmos de pruebas, mostrándose los resultados obtenidos.

  3. MAPS-15504 - Uma metodologia automatizada para avaliação de processo de software

    Directory of Open Access Journals (Sweden)

    Itana Maria de Souza Gimenes

    2000-05-01

    Full Text Available Devido às crescentes exigências por qualidade, a comunidade de engenharia de software tem produzido diversas normas e apresentado diversas abordagens sobre a qualidade dos produtos e processos de software. Grande parte dessas normas são aplicadas ao processo de software, dentre os quais se destacam pela larga utilização a ISO 9000-3, a ISO 12207, o CMM e o ISO/IEC TR 15504 (resultado dos trabalhos do projeto SPICE. Outro resultado das pesquisas da comunidade de engenharia de software são os ambientes de engenharia de software centrados em processo (PSEE, os quais visam à automação do processo de software. Este artigo apresenta MAPS-15504, uma metodologia automatizada para avaliação da qualidade do processo de software baseada no ISO/IEC TR 15504. A metodologia de avaliação de processo de software foi aplicada a um estudo de caso e implementada no ambiente do ExPSEE, um ambiente experimental desenvolvido no Departamento de Informática (DIN da Universidade Estadual de Maringá (UEM

  4. Décimo primer informe semestral sobre política exterior del gobierno argentino : Septiembre 2008-marzo 2009

    OpenAIRE

    Simonoff, Alejandro César

    2009-01-01

    En este período (septiembre 2008 a marzo 2009), observamos dos rasgos distintivos con respecto al anterior en materia de política internacional argentina: un incremento de los viajes de la Presidente al exterior y la preocupación por los efectos de la crisis global. Mientras en la anterior etapa analizada, nuestra política exterior estuvo prácticamente paralizada por la puja con el sector agropecuario, aquí la administración de Cristina Fernández ha ganado en visibilidad. Los viajes son indic...

  5. PERFIL PSICOLÓGICO, COGNITIVO Y ESPIRITUAL DE ESTUDIANTES UNIVERSITARIOS DE PSICOLOGÍA DE PRIMER INGRESO

    Directory of Open Access Journals (Sweden)

    María Esther Flores Sosa

    2014-01-01

    Full Text Available Se analizaron los perfiles de personalidad, los esquemas tempranos maladaptativos predominantes , los estilos de aprendizaje y los mecanismos de afrontamiento religioso de estudiantes universitarios de primer semestre de psicología. Con dicha información se pretende ampliar la visión sobre sus necesidades y recursos con el propósito de aportar información relevante para el diseño curricular.

  6. MAGICO : Sistema de mejora automatizada para la gestión de la inteligencia y el conocimiento en la organización

    OpenAIRE

    Montaño Pérez, Juan Antonio

    2014-01-01

    Este trabajo final de grado versa sobre el desarrollo de una aplicación web con funcionalidades de gestión documental, gestión de tareas, red social y gamificación. El objetivo de la aplicación consiste en lograr una mejora automatizada de la gestión de la inteligencia y el conocimiento en la organización.

  7. Organizações automatizadas - desenvolvimento e estrutura da empresa moderna. Nélio Oliveira. Rio de Janeiro: Editora LTC, 2007. 228p. ISBN: 8521614985.

    Directory of Open Access Journals (Sweden)

    Mauro de Paula Freitas Filho

    2007-06-01

    Full Text Available A Editora LTC lançou, em 2007, o livro de Nélio Oliveira, Organizações automatizadas: desenvolvimento e estrutura da empresa moderna. Mestre em Administração pela Universidade Federal de Minas Gerais, atuou durante anos em diversas organizações públicas, privadas e de economia mista. Nélio Oliveira, no momento atual, é conceituado professor dos cursos de Administração e Sistemas de Informações na Pontifícia Universidade Católica de Minas Gerais. No meio de muitas literaturas disponíveis, a obra destaca-se pela simplicidade, pela objetividade e pelo cuidado com os quais ele trata uma nova configuração, as organizações automatizadas. Em linhas gerais, o autor concentra-se em um trabalho descritivo e procura caracterizar um novo formato organizacional, o qual surge em muitas empresas, em substituição às formas anteriores, vinculadas a modelos mecanizados ou mecanísticos. A obra tem como foco o modelo de cinco estruturas de Henry Mintzberg, base para todo o trabalho. O autor tem como propósito retratar uma realidade, na qual se observam as mudanças do mundo organizacional contemporâneo, o qual está cada vez mais adquirindo espaço no mundo empresarial.

  8. Efecto del tipo de lactancia durante el primer año de vida sobre el estado de hierro y el desarrollo físico y psicológico del niño

    OpenAIRE

    Bedmar Carretero, Cristina

    2012-01-01

    L’objectiu d’aquest estudi va ser valorar el desenvolupament del nen durant el primer any de vida en funció del tipus de lactància realitzada durant el primer semestre y de la dosis de ferro administrada durant el segon semestre. Hem observat que el 75,5% dels nens realitzen lactància materna exclusiva al néixer y el 16,5% la mantenen fins als 6 mesos. El 39,5% tenen alguna mutació en el gen HFE. La prevalença de dèficit de ferro y anèmia ferropènica es del 4,5% y 2,5% als 6 mesos y del 9,2% ...

  9. China Energy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  10. Décimo sexto informe semestral sobre política exterior del gobierno argentino : Septiembre 2011-marzo 2012

    OpenAIRE

    Simonoff, Alejandro César

    2012-01-01

    Uno de los primeros interrogantes que nos surgieron para este informe semestral al ubicarse entre la primera y segunda gestión de la Presidente Cristina Fernández de Kirchner, fue si existieron cambios entre ellas. En ese sentido creemos que los lineamientos generales del tercer gobierno kirchnerista continuaron, otros fueron adaptándose sobre todo a partir de la crisis de 2008, como lo veníamos señalando en los trabajos anteriores. Donde encontramos cambios importantes fue en la estructur...

  11. An SAT® Validity Primer

    Science.gov (United States)

    Shaw, Emily J.

    2015-01-01

    This primer should provide the reader with a deeper understanding of the concept of test validity and will present the recent available validity evidence on the relationship between SAT® scores and important college outcomes. In addition, the content examined on the SAT will be discussed as well as the fundamental attention paid to the fairness of…

  12. Primer on Social Economics.

    Science.gov (United States)

    Darcy, Robert L.

    An elaboration of the author's booklet entitled "First Steps Toward Economic Understanding," this primer is designed to help the reader develop a functional understanding of the economic process so that he can make wiser decisions on issues of social policy and on matters affecting his economic well-being. The document is not "economics in one…

  13. Nutrición y desarrollo psicomotor durante el primer semestre de vida Nutrition and psichomotor development during the first six months of life

    Directory of Open Access Journals (Sweden)

    ADOLFO CHÁVEZ

    1998-03-01

    Full Text Available Objetivo. Estudiar el desarrollo psicomotor de niños pequeños de una comunidad rural pobre y mal alimentada y relacionarlo con la alimentación y nutrición tanto de su madre como de ellos mismos. Material y métodos. Se estudiaron 82 unidades madre-niño, desde antes del quinto mes de embarazo hasta los seis meses de edad del niño, en antropometría y dieta; en el niño se aplicaron pruebas de Brazelton al nacer, de Bayley a los tres y seis meses de edad y de interacción con su madre. Resultados. Varias de las pruebas psicomotoras del niño se correlacionaron positivamente con el peso de la madre y sus pliegues cutáneos, lo mismo que con su propio peso y talla previos. También con el consumo materno de productos animales y frutas durante el embarazo y negativamente con el consumo de tortillas y frijoles. Las correlaciones de varias de las pruebas del niño a los seis meses fueron positivas con su consumo complementario, de energía total y de varios alimentos, sobre todo de huevo, leche y frutas alrededor de los tres meses de edad. Conclusiones. Es importante que dentro del estrato social rural pobre estudiado, pequeñas variaciones de consumo de alimentos y nutrición de la unidad materno-infantil den lugar a cambios en las diversas pruebas de desarrollo psicomotor del niño pequeño, lo que sugiere la necesidad de impulsar más los programas de nutrición aplicados.Objective. To study the psychomotor development of young infants from a poor and underfed rural community and to correlate this with the nutritional conditions of the mother during pregnancy and the child itself. Material and methods. We studied 82 mother-child pairs from the 5th month of pregnancy to the 6th month of life of the child as to anthropometry and food consumption. The neonatal Brazelton test and the Bayley test at 3 and 6 months were applied to the child. Results. Several of the neonatal psychomotor tests applied to the child correlate positively with the mother´s weight and skin folds, as well as with the child´s own previous weight and size. This was also true for maternal consumption of animal foods and fruits during pregnancy. A negative correlation was observed with the consumption of corn tortillas and beans. The correlation of several tests applied to the child at six months was positive with its complementary consumption, total energy and several foods, specially egg, milk and fruit around three months of age. Conclusions. Small variations in nutrition of the mother-child pairs from the poor rural community studied had consequences on the psychomotor development of the infant. These findings point to the need for more applied nutrition programs.

  14. Diferencias de las prácticas sexuales entre hombres y mujeres, en estudiantes universitarios durante el primer semestre de 2013

    Directory of Open Access Journals (Sweden)

    Javier Martínez Torres

    2014-03-01

    Full Text Available Title: Sexual practices’s differences between men and women in college students during the first half of 2013El conocimiento de las prácticas sexuales en los adultos jóvenes es necesario para ejecutar acciones preventivas enfocadas a la disminución de enfermedades de transmisión sexual y embarazos no deseados. Materiales y métodos: Se realizó un estudio descriptivo trasversal con análisis de casos y controles, en estudiantes universitarios entre 18 y 26 años de edad, el tamaño de la muestra fue de 589 participantes. Resultados: De los 589 estudiantes se analizaron 502; la edad promedio de inicio de relaciones sexuales se dio a los 16,26 años. El 50,4% eran hombres; la práctica de relaciones sexuales anales fue de 37,9%, mientras que la práctica de relaciones sexuales orales fue del 70,9%. Al realizar asociaciones entre el género y comportamientos sexuales, se encontró que la práctica de sexo oral para los hombres es de O.R. 1,62 (I.C.95% 1,09 – 2,39, similar al sexo anal donde se estimó un O.R. 1,69 (I.C.95% 1,17 – 2,44. Al ajustarse se mostró que no hay diferencias estadísticamente significativas por género para sexo oral O.R.A 1,13 (I.C.95% 0,72 – 1,78 y para sexo anal O.R.A 1,30 (I.C.95% 0,84 – 6,39. Conclusiones: No hay diferencias estadísticamente significativas para las prácticas sexuales entre los dos géneros. (DUAZARY 2013 No. 2, 112 - 118AbstractThe knowledge of sexual practices in young adults is required to run preventive actions aimed at the reduction of transmitted sexual diseases and unwanted pregnancies. Materials and Methods: A descriptive cross-sectional study with case-control analysis was developed by selecting 589 college students between 18 and 26 years of age. Results: 502 of 589 students were analyzed; the average age of their first sexual intercourse occurred at 16.26 years. 50.4% of the sample was men; the practice of anal intercourse was 37.9%, while the practice of oral sex was 70.9%. After making associations in relation to gender and sexual practices, it was found that the practice of oral sex for men has an OR 1.62 (C.I. 95% 1.09 to 2.39, similar to anal sex where we found an OR 1.69 (C.I. 95% 1.17 to 2.44. When adjusted, the outcome was that there were no statistically significant differences by gender for oral sex ORA 1.13 (C.I.95% 0.72 to 1.78 and for anal sex ORA 1.30 (C.I. 95% 0.84 to 6.39. Conclusions: No statistically significant differences were found within sexual practices between the two genders.Keyword: sexual practices; young adult; health behavior.

  15. Percepción de empoderamiento comunitario en las mujeres madre cabeza de familia de la ciudad de cúcuta durante el primer semestre de 2007

    Directory of Open Access Journals (Sweden)

    Luz Marina Bautista-Rodríguez

    2008-01-01

    Full Text Available The primary target of the study was to describe the Perception of communitarian empowerment in the household’s women-mother-head in the Cúcuta’s city during the first semester of the 2007, being a descriptive study, cross-sectional and retrospective type of quantitative cut that was carried out with the use of a empowerment’s scale, instrument created by Gladys Eugenia Canaval,Enf., M.Sc., Ph.D., Professor Titular, School of Infirmary, Faculty of Health, University of the Valle, Cali; which counts with 27 statements that are based on a scale Likert type of five points that go from strongly in agreement (qualification of 5 to strongly in discord (qualification of 1 and that it looks for to measure the perception of communitarian empowerment evaluating four factors: sense of community, involvement, participation and influences. The sample was conform by 315 household’s women-mother-head from the 10 communes of the urban zone of the Cúcuta’s city who the 26 of June of the 2007 began to fill up the instruments. As result could be determined that the communitarian organization and formation of coalitions are an influential condition in the empowerment of the women reflected in which the women of the study show a high perception of communitarian empowerment where of each 100 women 63 presented scores over 70%.

  16. Estrategias de aprendizaje usadas por estudiantes de ingeniería eléctrica e ingeniería electrónica de primer semestre

    OpenAIRE

    Ramírez Echeverry, Jhon Jairo; Olarte Dussan, Fredy Andres; García Carrillo, Àgueda

    2014-01-01

    La utilización de estrategias de aprendizaje le facilita al estudiante su proceso formativo, permite el logro del aprendizaje profundo, está relacionada positivamente con el desempeño académico y es esencial en contextos de aprendizaje autónomo. La baja cantidad de trabajos sobre las estrategias de aprendizaje que usan los estudiantes en contextos de formación en ingeniería motivó la realización de este estudio exploratorio descriptivo. Se investigó el nivel de utilización de estr...

  17. Octavo informe semestral sobre política exterior del gobierno argentino : Marzo-septiembre 2007

    OpenAIRE

    Simonoff, Alejandro César

    2007-01-01

    Este es el último informe sobre la administración de Néstor Kirchner, ya que en el próximo nos ocuparemos de las primeras etapas del nuevo gobierno de Cristina Fernández de Kirchner que asumirá el próximo 10 de diciembre de 2007. Nuevamente aparecen los cinco problemas identificados por el propio Primer Mandatario al momento de su asunción: la política multilateral de seguridad, la política regional y el MERCOSUR, la estrategia de apertura y diversificación de mercados, las negociaciones en t...

  18. Coal Bed Methane Primer

    Energy Technology Data Exchange (ETDEWEB)

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  19. Primer on molecular genetics

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  20. A Quantum Groups Primer

    Science.gov (United States)

    Majid, Shahn

    2002-05-01

    Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

  1. Math primer for engineers

    CERN Document Server

    Cryer, CW

    2014-01-01

    Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

  2. The R primer

    CERN Document Server

    Ekstrom, Claus Thorn

    2011-01-01

    Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

  3. Solarium primer. [Monograph

    Energy Technology Data Exchange (ETDEWEB)

    1981-01-01

    Solaria can be used to collect solar energy for space heating and provide an open environment. This primer introduces the basic concepts of an energy-efficient solarium and provides information on the practical aspects of siting, design, and construction. The horticultural use of a solarium as a greenhouse is not dealt with except in explaining the influence this may have on its design and operation. The book shows the characteristics of different types of solaria, their advantages as well as their limitations. It also explains the prerequisite of a successful addition to an existing home. Design and construction details accompany the text. 73 references, 2 tables.

  4. Una experiencia con QSB+ en Matemáticas de primer curso

    Directory of Open Access Journals (Sweden)

    Ordás Amo, Pilar

    2001-01-01

    Full Text Available Nuestro objetivo con este trabajo es presentar una experiencia que hemos llevado a cabo con los alumnos de primer curso, en la asignatura de Matemáticas, de las Licenciaturas en Ciencias Económicas y Administración y Dirección de Empresas, durante los cursos 1999/2000 y 2000/2001. El propósito de la experiencia es que los alumnos de primer curso vean una parte de la optimización matemática, como es la programación lineal, y el método del Símplex, a través de un software informático sencillo como es el QSB+, en el aula de ordenadores. Para llevar a cabo la experiencia, se añadió una hora lectiva al horario de los alumnos implicados y de los profesores de Matemáticas de primer curso, con plan nuevo (plan 99, durante el segundo semestre, de forma totalmente voluntaria para los alumnos, aunque la materia explicada en estas clases “extras” formaba parte del examen final de la asignatura. El nombre oficial de la experiencia fue Seminario de Programación Lineal, y tuvo una duración aproximada de quince horas lectivas.

  5. Validez del estudio de la tecnología de flujo de trabajo para la organización automatizada del trabajo corporativo

    Directory of Open Access Journals (Sweden)

    González Lorca, Jesús

    2001-06-01

    Full Text Available We try to check whether the joint application office and office automation models is valid as a tool for groupware implementation and whether this technology could give support to the specifications of the joint model. The operation of an office and its technological needs are represented through a joint model, resulting from the combination between a model of three levels of complexity and a model based on functions. We show both models and later we add detailed specifications of the resulting joint model. Finally, we present the main features and functionalities of Groupware and Workflow technologies, in order to show their level of agreement.

    Se pretende comprobar si la conjunción de los modelos de oficina y ofimática es válida para teorizar en la aplicación de los flujos de trabajo a la organización de forma automatizada del trabajo corporativo y si esta tecnología es capaz de dar soporte tecnológico a las especificaciones resultantes del modelo conjunto. El funcionamiento de una oficina y sus necesidades tecnológicas se han representado mediante un modelo conjunto fruto de la combinación de un modelo de tres niveles de complejidad y un modelo basado en funciones. Primero se presentan ambos modelos para, posteriormente, detallar las especificaciones del modelo conjunto resultante. Asimismo, se dan a conocer las principales características y funcionalidades de las tecnologías Groupware y Workflow, con lo que se está en disposición de demostrar su grado de concordancia.

  6. Una herramienta para la selección automatizada de aceros en el contexto de la Ingeniería Mecánica

    Directory of Open Access Journals (Sweden)

    L. Dumitrescu

    2010-01-01

    Full Text Available El diseño de Ingeniería de un producto o componente constituye una actividad difícil, compleja y multidisciplinaria, enfocada a la resolución de problemas. En el presente trabajo se muestra el desarrollo de una herramienta automatizada para la selección de los aceros más utilizados en la construcción de maquinarias. La herramienta constituye una ayuda para la selección de los materiales desde la etapa conceptual del proceso de diseño, donde se identifican las diferentes categorías de materiales a utilizar. La herramienta comprende las características y propiedades más relevantes de los aceros de Ingeniería disponibles en seis normas internacionales: Japonesa (JIS, Alemana (DIN, Vbn, DIN-Vbn, Rusa (GOST, Americana (AISI, SAE, AISI-SAE, ASTM, Inglesa (BS, EN, GB, Francesa (AFNOR y la Norma Cubana (NC vigente.The product or component design constitutes a difficult, complex and multidisciplinary activity, focused to the resolution of problems. Presently work show the development of an automated tool for the selection of the more used steels in the construction of machineries. The tool constitute a help for the selection of the materials from the conceptual stage of the design process, where the different categories of materials are identified to use. The tool analyze the characteristics and more common properties of the available steels in six international standards: JIS (Japan, DIN, Vbn, DIN-Vbn (Germany, GOST (Russia, AISI, SAE, AISI-SAE, ASTM (USA, BS, IN, GB (England, AFNOR (France and NC (Cuba.

  7. Una herramienta para la selección automatizada de aceros en el contexto // A tool for the automated selection of steels in the Mechanical Engineering´s context

    Directory of Open Access Journals (Sweden)

    L. Dumitrescu

    2010-01-01

    Full Text Available ResumenEl diseno de Ingenieria de un producto o componente constituye una actividad dificil, compleja ymultidisciplinaria, enfocada a la resolucion de problemas. En el presente trabajo se muestra eldesarrollo de una herramienta automatizada para la seleccion de los aceros mas utilizados en laconstruccion de maquinarias. La herramienta constituye una ayuda para la seleccion de losmateriales desde la etapa conceptual del proceso de diseno, donde se identifican las diferentescategorias de materiales a utilizar. La herramienta comprende las caracteristicas y propiedades masrelevantes de los aceros de Ingenieria disponibles en seis normas internacionales: Japonesa (JIS,Alemana (DIN, Vbn, DIN-Vbn, Rusa (GOST, Americana (AISI, SAE, AISI-SAE, ASTM, Inglesa (BS, EN,GB, Francesa (AFNOR y la Norma Cubana (NC vigente.Palabras claves: materiales, automatizada, aceros, ingenieria.____________________________________________________________AbstractThe product or component design constitutes a difficult, complex and multidisciplinary activity,focused to the resolution of problems. Presently work show the development of an automated toolfor the selection of the more used steels in the construction of machineries. The tool constitute ahelp for the selection of the materials from the conceptual stage of the design process, where thedifferent categories of materials are identified to use. The tool analyze the characteristics and morecommon properties of the available steels in six international standards: JIS (Japan, DIN, Vbn, DINVbn(Germany, GOST (Russia, AISI, SAE, AISI-SAE, ASTM (USA, BS, IN, GB (England, AFNOR(France and NC (Cuba.Key words: materials, automated, steels, engineering.

  8. INFERENCIAS Y PRÁCTICAS GRAVITACIONALES EN EL NIÑO EN EL SEGUNDO SEMESTRE DE VIDA

    OpenAIRE

    Rebeca Puche Navarro

    2001-01-01

    Este artículo analiza los procesos inferenciales en el niño antes de cumplir su primer año de vida. Para el estudio se utilizan las propiedades gravitacionales dentro de situaciones de resolución de problemas. El propósito de la autora es aportar evidencia empírica sustentada para discutir algunos aspectos sobre las concepciones del desarrollo en el niño.

  9. Vygotsky on Education Primer. Peter Lang Primer. Volume 30

    Science.gov (United States)

    Lake, Robert

    2012-01-01

    The "Vygotsky on Education Primer" serves as an introduction to the life and work of the Russian psychologist Lev Vygotsky. Even though he died almost eighty years ago, his life's work remains both relevant and significant to the field of education today. This book examines Vygotsky's emphasis on the role of cultural and historical context in…

  10. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads;

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  11. A Primer on Multilevel Modeling

    Science.gov (United States)

    Hayes, Andrew F.

    2006-01-01

    Multilevel modeling (MLM) is growing in use throughout the social sciences. Although daunting from a mathematical perspective, MLM is relatively easy to employ once some basic concepts are understood. In this article, I present a primer on MLM, describing some of these principles and applying them to the analysis of a multilevel data set on…

  12. Freshwater Wetlands: A Citizen's Primer.

    Science.gov (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of wetland…

  13. A classical primer for QCD

    International Nuclear Information System (INIS)

    A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)

  14. A Hearing Aid Primer 1

    Science.gov (United States)

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  15. Décimo séptimo informe semestral sobre política exterior del gobierno argentino : Marzo-septiembre 2011

    OpenAIRE

    Simonoff, Alejandro César

    2011-01-01

    En el semestre que va de marzo a septiembre de 2011 la política exterior argentina estuvo determinada por la crisis económica que se originó en 2008 y cuyos efectos continúan sintiéndose en todo el globo. Las excepciones a esta línea general fueron las estrategias hacia la securitización de la agenda internacional y la cuestión de soberanía por las islas Malvinas. (Párrafo extraído del texto a modo de resumen)

  16. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    Directory of Open Access Journals (Sweden)

    Nomin Batnyam

    2012-01-01

    Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

  17. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes.

    Science.gov (United States)

    Batnyam, Nomin; Lee, Jimin; Lee, Jungnam; Hong, Seung Bok; Oh, Sejong; Han, Kyudong

    2012-01-01

    Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR) assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque) and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors. PMID:22693428

  18. Loop Quantum Geometry: A primer

    CERN Document Server

    Corichi, A

    2005-01-01

    This is the written version of a lecture given at the ``VI Mexican School of Gravitation and Mathematical Physics" (Nov 21-27, 2004, Playa del Carmen, Mexico), introducing the basics of Loop Quantum Geometry. The purpose of the written contribution is to provide a Primer version, that is, a first entry into Loop Quantum Gravity and to present at the same time a friendly guide to the existing pedagogical literature on the subject. This account is geared towards graduate students and non-experts interested in learning the basics of the subject.

  19. Sample Return Primer and Handbook

    Science.gov (United States)

    Barrow, Kirk; Cheuvront, Allan; Faris, Grant; Hirst, Edward; Mainland, Nora; McGee, Michael; Szalai, Christine; Vellinga, Joseph; Wahl, Thomas; Williams, Kenneth; Lee, Gentry; Duxbury, Thomas

    2007-01-01

    This three-part Sample Return Primer and Handbook provides a road map for conducting the terminal phase of a sample return mission. The main chapters describe element-by-element analyses and trade studies, as well as required operations plans, procedures, contingencies, interfaces, and corresponding documentation. Based on the experiences of the lead Stardust engineers, the topics include systems engineering (in particular range safety compliance), mission design and navigation, spacecraft hardware and entry, descent, and landing certification, flight and recovery operations, mission assurance and system safety, test and training, and the very important interactions with external support organizations (non-NASA tracking assets, landing site support, and science curation).

  20. A primer of special relativity

    CERN Document Server

    Sardesai, PL

    2004-01-01

    A Primer of Special Relativity1 is an unusually lucid introduction to the subject specifically written for Indian students. It is intended to give the beginner a firm grounding for a more advanced course in relativity. An entire chapter is devoted to applications of the theory to elucidate a large number of topics the students (B.Sc. Physics) come across in Modern Physics. Detailed and well-selected examples are used to illuminate aspects of the theory as well as to show techniques of application. A large number of Illustrative Examples enables the students to gain confidence to solve any problem in relativity normally expected of B.Sc. students.

  1. A primer of multivariate statistics

    CERN Document Server

    Harris, Richard J

    2014-01-01

    Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

  2. Loop Quantum Geometry: A primer

    OpenAIRE

    Corichi, Alejandro

    2005-01-01

    This is the written version of a lecture given at the ``VI Mexican School of Gravitation and Mathematical Physics" (Nov 21-27, 2004, Playa del Carmen, Mexico), introducing the basics of Loop Quantum Geometry. The purpose of the written contribution is to provide a Primer version, that is, a first entry into Loop Quantum Gravity and to present at the same time a friendly guide to the existing pedagogical literature on the subject. This account is geared towards graduate students and non-expert...

  3. A primer of Lebesgue integration

    CERN Document Server

    Bear, H S

    2001-01-01

    The Lebesgue integral is now standard for both applications and advanced mathematics. This books starts with a review of the familiar calculus integral and then constructs the Lebesgue integral from the ground up using the same ideas. A Primer of Lebesgue Integration has been used successfully both in the classroom and for individual study.Bear presents a clear and simple introduction for those intent on further study in higher mathematics. Additionally, this book serves as a refresher providing new insight for those in the field. The author writes with an engaging, commonsense style that appeals to readers at all levels.

  4. INTELIGENCIAS MÚLTIPLES Y ESTILOS DE APRENDIzAJE EN LOS ESTUDIANTES DE PRIMER SEMESTRE DE CONTADURÍA PÚBLICA DE LA UNIVERSIDAD DE LA SALLE -- MULTIPLE INTELIGENCES AND LEARNING STYLES AMONG FIRST SEMESTRE STUDENTS IN PUBLIC ACCOUNTING OF THE UNIVERSITY DE LA SALLE

    Directory of Open Access Journals (Sweden)

    ÉRIKA BUCHELLI AGUIRRE

    2008-06-01

    Full Text Available This article is a result of a research Project in order to get to know the sorts of intelligence and predominant methods of learning among students in Public Accounting of the university de la Salle. A sample of 100 first semester students has been used for a test of 40 items, developed by Argüelles Pabón y Nagles García who evaluates the sorts of predominant intelligences in a subject according to the theory of Gardner. In order to get closer to the types of learning, a test of 14 items was used as well built for the research from the theory of Kolb. The application of collection above mentioned techniques and their analysis is carrying out during the two academic semesters in 2008. The results indicate the presence of multiple intelligences among women and men of evening classes, especially two: interpersonal and emotional. On the one hand, the way of learning is convergent, even though with higher present of men on both classes. The possibilities to realize a second phase of the research focuses on implementing pedagogic strategies and specific didactic for these groups of students, agreeing with the type of learning and intelligence of them.

  5. INTELIGENCIAS MÚLTIPLES Y ESTILOS DE APRENDIzAJE EN LOS ESTUDIANTES DE PRIMER SEMESTRE DE CONTADURÍA PÚBLICA DE LA UNIVERSIDAD DE LA SALLE -- MULTIPLE INTELIGENCES AND LEARNING STYLES AMONG FIRST SEMESTRE STUDENTS IN PUBLIC ACCOUNTING OF THE UNIVERSITY DE LA SALLE

    OpenAIRE

    ÉRIKA BUCHELLI AGUIRRE

    2008-01-01

    This article is a result of a research Project in order to get to know the sorts of intelligence and predominant methods of learning among students in Public Accounting of the university de la Salle. A sample of 100 first semester students has been used for a test of 40 items, developed by Argüelles Pabón y Nagles García who evaluates the sorts of predominant intelligences in a subject according to the theory of Gardner. In order to get closer to the types of learning, a test of 14 items was ...

  6. Algorithms and Software for PCR Primer Design

    OpenAIRE

    Huang, Yu-ting

    2015-01-01

    Polymerase Chain Reaction (PCR) is a widely used technology in molecular bi-ology for DNA amplification. To generate multiple copies of a DNA molecule, a pair ofprimers (two synthesized DNA sequences with a total length of 15-30 bases) are annealedto the boundaries of the targeted DNA molecule. Then, the new replicated DNA fragmentelongates from one primer to the other.Though primers always hybridize to their respective complements within DNAsequences, primer pairs for targeted DNA sequences ...

  7. La atención hospitalaria al paciente con ictus en Cataluña: Resultados del «Primer Audit Clínic de l'Ictus. Catalunya, 2005/2006» In-hospital stroke care in Catalonia [Spain]: Results of the «First Clinical Audit of Stroke. Catalonia, 2005/2006»

    OpenAIRE

    Sònia Abilleira; Aida Ribera; Emília Sánchez; Jaume Roquer; Esther Duarte; Ricard Tresserras; Miquel Gallofré

    2008-01-01

    Objetivo: Analizar la calidad de la atención hospitalaria al paciente con ictus en los hospitales públicos catalanes antes de la difusión de la Guía de Práctica Clínica (GPC) del ictus, estudiando el grado de adhesión a determinadas recomendaciones de la GPC. Métodos: Mediante revisión retrospectiva de historias clínicas de pacientes con ictus definidos mediante los códigos CIE-9 431, 433.x1, 434.x1, 436, e ingresados consecutivamente en 48 hospitales públicos catalanes en el primer semestre ...

  8. URPD: a specific product primer design tool

    Directory of Open Access Journals (Sweden)

    Chuang Li-Yeh

    2012-06-01

    Full Text Available Abstract Background Polymerase chain reaction (PCR plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design, a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq, UCSC In-Silico PCR, memetic algorithm (MA and genetic algorithm (GA primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/.

  9. URPD: a specific product primer design tool

    Science.gov (United States)

    2012-01-01

    Background Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/. PMID:22713312

  10. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection.

    Science.gov (United States)

    O'Halloran, Damien M

    2016-01-01

    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558

  11. A Practical Primer on Geostatistics

    Science.gov (United States)

    Olea, Ricardo A.

    2009-01-01

    significant methodological implications. HISTORICAL REMARKS As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields. PIONEERS Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorology CALCULATIONS Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations. SOFTWARE For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics. ORGANIZATION OF THE PRIMER The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of th

  12. A primer on quantum fluids

    CERN Document Server

    Barenghi, Carlo

    2016-01-01

    The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .

  13. Electrostatic Discharge testing of propellants and primers

    Energy Technology Data Exchange (ETDEWEB)

    Berry, R.B.

    1994-02-01

    This report presents the results of testing of selected propellants and primers to Electrostatic Discharge (ESD) characteristic of the human body. It describes the tests and the fixturing built to accommodate loose material (propellants) and the packed energetic material of the primer. The results indicate that all powders passed and some primers, especially the electric primers, failed to pass established requirements which delineate insensitive energetic components. This report details the testing of components and materials to four ESD environments (Standard ESD, Severe ESD, Modified Standard ESD, and Modified Severe ESD). The purpose of this study was to collect data based on the customer requirements as defined in the Sandia Environmental Safety & Health (ES&H) Manual, Chapter 9, and to define static sensitive and insensitive propellants and primers.

  14. SBE primer : multiplexing minisequencing-based genotyping

    Energy Technology Data Exchange (ETDEWEB)

    Kaderali, L. (Lars); Deshpande, A. (Alina); Uribe-Romeo, F. J. (Francisco J.); Schliep, A.; Torney, D. C. (David C.)

    2002-01-01

    Single-nucleotide polymorphism (SNP) analysis is a powerful tool for mapping and diagnosing disease-related alleles. Most of the known genetic diseases are caused by point mutations, and a growing number of SNPs will be routinely analyzed to diagnose genetic disorders. Mutation analysis by polymerase mediated single-base primer extension (minisequencing) can be massively parallelized using for example DNA microchips or flow cytometry with microspheres as solid support. By adding a unique oligonucleotide tag to the 5-inch end of the minisequencing primer and attaching the complementary anti-tag to the array or bead surface, the assay can be 'demultiplexed'. However, such high-throughput scoring of SNPs requires a high level of primer multiplexing in order to analyze multiple loci in one assay, thus enabling inexpensive and fast polymorphism scoring. Primers can be chosen from either the plus or the minus strand, and primers used in the same experiment must not bind to one another. To genotype a given number of polymorphic sites, the question is which primer to use for each SNP, and which primers to group into the same experiment. Furthermore, a crosshybridization-free tag/anti-tag code is required in order to sort the extended primers to the corresponding microspheres or chip spots. These problems pose challenging algorithmic questions. We present a computer program lo automate the design process for the assay. Oligonucleotide primers for the reaction are automatically selected by the software, a unique DNA tag/anti-tag system is generated, and the pairing of primers and DNA-Tags is automatically done in a way to avoid any crossreactivity. We report first results on a 45-plex genotyping assay, indicating that minisequencing can be adapted to be a powerful tool for high-throughput, massively parallel genotyping.

  15. Detección de hemoglobinopatías en el núcleo familiar de pacientes diagnosticados en el primer semestre del año 2010 en la Clínica Maternidad Rafael Calvo de Cartagena

    Directory of Open Access Journals (Sweden)

    Moneriz -Pretell Carlos

    2011-09-01

    Full Text Available INTRODUCCIÓN: las hemoglobinopatías son desórdenes innatos hereditarios que comprenden un grupo heterogéneo de anemias,son las enfermedades más comunes en los seres humanos afectando aproximadamente el 5% de la población mundial. Los genesanómalos de la hemoglobina se originaron en África, Asia y la cuenca mediterránea, y debido a las migraciones de este grupopoblacional se han esparcido en todo el mundo, especialmente en América Latina. En esta zona geográfica, a la que pertenece elCaribe colombiano, es notorio el predominio de la anemia de células falciformes o drepanocitosis. Este tipo de anemia se caracterizapor la presencia de hematíes en forma de hoz como consecuencia de la presencia de hemoglobina S, con manifestaciones clínicascomo anemia hemolítica y fenómenos vasooclusivos. La alteración en la estructura y función de la hemoglobina causa deficiencias enel transporte de oxígeno por parte de los eritrocitos, con el consiguiente daño tisular con lesiones infartantes que se reflejan enincapacidad parcial o total e incluso en la muerte. La prevención de las complicaciones debidas a las hemoglobinopatías se basa en laidentificación de los individuos en riesgo a través de sus antecedentes familiares o mediante programas de detección de losportadores, y en proveer la información adecuada sobre los riesgos y las posibilidades de minimizarlos. En la ciudad de Cartagena seha iniciado un estudio piloto de programa de tamizaje neonatal en el que se incluyeron más de 1000 neonatos de la E.S.E. Clínica deMaternidad Rafael Calvo de Cartagena (CMRC, en el período de enero a junio de 2010, mediante la utilización de la técnica delisoelectroenfoque. Los resultados obtenidos han permitido obtener información de la situación real epidemiológica y demográficade esta población, lo que justifica a partir de datos reales y contextualizados la realización de un programa de asistencia primaria parael control de la enfermedad, así como la implementación permanente de un programa de tamizaje no solo neonatal sino al núcleofamiliar para hemoglobinopatías a fin de tomar medidas preventivas y de promoción en salud de los pacientes con esta enfermedad.METODOLOGÍA: a través de la aplicación de una encuesta estructurada y de la realización de la técnica de isoelectro enfoque sepretende estimar la incidencia, describir el perfil epidemiológico e iniciar programa de educación en el núcleo familiar de neonatosdiagnosticados con hemoglobinopatías de la Clínica Maternidad Rafael Calvo de Cartagena, en el período de enero a junio del año2010. Este es un estudio descriptivo prospectivo, que toma como base la población del núcleo familiar de 97 neonatos nacidos en laE.S.E. Clínica Maternidad Rafael Calvo de Cartagena en el periodo comprendido de enero a junio de 2010, que fueron diagnosticadoscomo pacientes con hemoglobinopatías, sin tener en cuenta grupo racial, o estrato socioeconómico. La muestra es sangre total de losintegrantes del núcleo familiar, mediante la técnica de isoelectroenfoque, en un gel de agarosa que contiene anfolitos con un pH entre6 y 8, empleando como control un pool de sangre que contiene hemoglobina F, A, S y C, se detectará la enfermedad en estos pacientespara describir la característica hereditaria.RESULTADOS ESPERADOS: permitirá la instauración de un programa completo de tamizaje neonatal y familiar de hemoglobinopatíasen la ciudad de Cartagena, como una forma de disminuir la manifestación tardía y graves secuelas de esta patología.

  16. Prevalencia y Factores de Riesgo Consumo de Cigarrillo para estudiantes universitarios entre 18 a 25 años, durante el primer semestre académico del año 2013

    Directory of Open Access Journals (Sweden)

    Javier Martínez Torres

    2013-05-01

    Full Text Available El consumo de cigarrillo es un problema actual de salud pública, el cual es responsable de una parte importante de la carga de morbilidad y mortalidad en momentos actuales. Objetivo: Determinar la prevalencia de consumo diario, consumo no diario de cigarrillo, en estudiantes universitarios y factores asociados. Materiales y métodos: Se desarrolló un estudio descriptivos transversal, se tomó una muestra de 464 voluntarios adultos sanos entre 18 y 25 años, de ambos géneros. Siendo esta representativa de los estudiantes universitarios. Se establecieron asociaciones mediante la construcción de modelos de regresión simple y múltiples para los factores asociados. Resultados: La prevalencia para el consumo de cigarrillo diario fue de 5,4%, mientras que la de ser fumador esporádico fue de 13%, se encontraron asociación entre el consumo diario de cigarrillo y el género masculino O.R. 4,46 (I.C. 95% 1,5 – 13,27, practicar deporte O.R. 0,29 (I.C. 95% 0,11- 0,76; mientras que para el consumo esporádico de cigarrillo el género masculino presentó O.R. 4,04 (I.C. 95% 2,08 – 7,83 consumo de bebidas alcohólicos O.R. 4,76 (1,13 – 20,05 Conclusiones: El consumo de cigarrillo se asocia como factor de riesgo al género masculino, y como factor protector en las personas que practicas deportes.

  17. Concepciones y tendencias en la evaluación del profesor universitario. el caso de la universidad nacional de colombia, facultad de medicina, departamento de nutrición y terapías, primer semestre de 2005

    OpenAIRE

    Becerra Bulla, Fabiola

    2010-01-01

    Antecedentes. Realizar un análisis de la evaluación que se aplica al profesor universitario teniendo en cuenta los procesos evaluativos institucionales, las políticas educativas de evaluación internacionales y nacionales, las concepciones y tendencias sobre evaluación en los Departamentos de Nutrición y Terapias de la Facultad de Medicina. Material y métodos. La investigación se enmarcó en el modelo cualitativo de investigación y de evaluación, de corte descriptivo e interpretativo. A tr...

  18. Mínimos conocimientos en matemáticas que debe adquirir un estudiante del primer semestre para emprender la carrera de contaduría pública en la Universidad Autónoma Lationamericana

    OpenAIRE

    Valencia Valencia, Gabriel Ernesto

    2011-01-01

    El Contador público debe poseer habilidades y conocimientos para formarse como empresario, analista financiero, buen comunicador, y tener relaciones públicas para ser un buen administrador. Es decir, que la universidad debe preparar contadores públicos con conocimientos generales y específicos, aspectos en los que el aprendizaje matemático adquiere suma relevancia. Para lo cual se realiza un análisis situacional de las matemáticas básicas que se ofrece actualmente en la Facultad de Contadu...

  19. Estilos de vida y nivel de actividad física de los alumnos de kinesiología de la Universidad de las Américas (Chile) durante el primer semestre del año 2008

    OpenAIRE

    Cancino López, Jorge; Urzua DellAnno, R.; Ulloa, D.

    2009-01-01

    El estilo de vida de la población se ha ido modificando hacia conductas más sedentarias y menos saludables. La población joven, en edad universitaria, es una población vulnerable en este aspecto, ya que en esta etapa se adoptan conductas que pueden perdurar el resto de la vida. El consumo de tabaco, drogas y la inactividad física son elementos negativos para los estilos de vida saludable. El propósito de esta investigación fue el investigar sobre los estilos de vida y nivel de actividad físic...

  20. Primer on spontaneous heating and pyrophoricity

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  1. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  2. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads;

    2011-01-01

    are individually analysed in terms of GC content, presence of GC clamp at 3'-end, the risk of primer dimer formation, the risk of intra-primer complementarity (secondary structures) and the presence of polyN stretches. Furthermore, PHUSER offers the option to insert linkers between DNA fragments, as well as highly......Uracil-Specific Exision Reagent (USER) fusion is a recently developed technique that allows for assembly of multiple DNA fragments in a few simple steps. However, designing primers for USER fusion is both tedious and time consuming. Here, we present the Primer Help for USER (PHUSER) software......, a novel tool for designing primers specifically for USER fusion and USER cloning applications. We also present proof-of-concept experimental validation of its functionality. PHUSER offers quick and easy design of PCR optimized primers ensuring directionally correct fusion of fragments into a plasmid...

  3. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    OpenAIRE

    Nomin Batnyam; Jimin Lee; Jungnam Lee; Seung Bok Hong; Sejong Oh; Kyudong Han

    2012-01-01

    Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR) assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR-...

  4. DNA sequencing by synthesis with degenerate primers

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    The degenerate primer-based sequencing Was developed by a synthesis method(DP-SBS)for high-throughput DNA sequencing,in which a set of degenerate primers are hybridized on the arrayed DNA templates and extended by DNA polymerase on microarrays.In this method,adifferent set of degenerate primers containing a give nnumber(n)of degenerate nucleotides at the 3'-ends were annealed to the sequenced templates that were immobilized on the solid surface.The nucleotides(n+1)on the template sequences were determined by detecting the incorporation of fluorescent labeled nucleotides.The fluorescent labeled nucleotide was incorporated into the primer in a base-specific manner after the enzymatic primer extension reactions and nine-base length were read out accurately.The main advanmge of the DP-SBS is that the method only uses very conventional biochemical reagents and avoids the complicated special chemical reagents for removing the labeled nucleotides and reactivating the primer for further extension.From the present study,it is found that the DP-SBS method is reliable,simple,and cost-effective for laboratory-sequencing a large amount of short DNA fragments.

  5. Maestría en administración tesis de los estudiantes graduados

    OpenAIRE

    Innovar Revista

    2011-01-01

    Listados de trabajo de grado por línea de profundización monografías de Administración de Empresas: primer semestre 1997 - primer semestre 2000 / Monografías por línea de profundización Contaduría Pública: primer semestre 1998 - segundo semestre 2000

  6. Maestría en administración tesis de los estudiantes graduados

    Directory of Open Access Journals (Sweden)

    Innovar Revista

    2001-06-01

    Full Text Available Listados de trabajo de grado por línea de profundización monografías de Administración de Empresas: primer semestre 1997 - primer semestre 2000 / Monografías por línea de profundización Contaduría Pública: primer semestre 1998 - segundo semestre 2000

  7. Canadian municipal carbon trading primer

    International Nuclear Information System (INIS)

    The trading of greenhouse gas (GHG) emissions is being suggested as an effective economic way to meet Canada's Kyoto target. Emissions trading is a market-based instrument that can help achieve environmental improvements while using the market to absorb the economical and effective measures to achieve emissions reductions. Placing a value on emissions means that in order to minimize costs, companies will be motivated to apply the lowest-cost emission reductions possible for regulatory approval. The two main types of emissions trading that exist in Canada are the trading of emissions that lead to the formation of smog or acid rain, and the trading of greenhouse gas emissions that lead to climate change. Since carbon dioxide is the most prevalent GHG, making up approximately 75 per cent of Canadian GHG emissions, the trading of units of GHGs is often referred to as carbon trading. The impact that emissions trading will have on municipal operations was the focus of this primer. The trading of GHG involves buying and selling of allowances of GHGs between contracting parties, usually between one party that is short of GHG credits and another that has excess credits. The 3 common approaches to emissions trading include allowance trading (cap and trade), credit trading (baseline and credit), and a hybrid system which combines both credit and allowance trading systems. The issues that impact municipalities include the debate regarding who owns the credits from landfills, particularly if power is generated using landfill gas and the power is sold as green power. Other viable questions were also addressed, including who can claim emission reduction credits if a city implements energy efficiency projects, or fuel substitution programs. Also, will municipalities be allowed to trade internationally, for example, with municipalities in the United States, and how should they spend their money earned from selling credits. This report also presents highlights from 3 emissions

  8. Beam shaping for laser initiated optical primers

    Science.gov (United States)

    Lizotte, Todd E.

    2008-08-01

    Remington was one of the first firearm manufacturing companies to file a patent for laser initiated firearms, in 1969. Nearly 40 years later, the development of laser initiated firearms has not become a mainstream technology in the civilian market. Requiring a battery is definitely a short coming, so it is easy to see how such a concept would be problematic. Having a firearm operate reliably and the delivery of laser energy in an efficient manner to ignite the shock-sensitive explosive primer mixtures is a tall task indeed. There has been considerable research on optical element based methods of transferring or compressing laser energy to ignite primer charges, including windows, laser chip primers and various lens shaped windows to focus the laser energy. The focusing of laser light needs to achieve igniting temperatures upwards of >400°C. Many of the patent filings covering this type of technology discuss simple approaches where a single point of light might be sufficient to perform this task. Alternatively a multi-point method might provide better performance, especially for mission critical applications, such as precision military firearms. This paper covers initial design and performance test of the laser beam shaping optics to create simultaneous multiple point ignition locations and a circumferential intense ring for igniting primer charge compounds. A simple initial test of the ring beam shaping technique was evaluated on a standard large caliber primer to determine its effectiveness on igniting the primer material. Several tests were conducted to gauge the feasibility of laser beam shaping, including optic fabrication and mounting on a cartridge, optic durability and functional ignition performance. Initial data will be presented, including testing of optically elements and empirical primer ignition / burn analysis.

  9. Climate Change, Health, and Communication: A Primer.

    Science.gov (United States)

    Chadwick, Amy E

    2016-06-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects. PMID:26580230

  10. Informe MERCOSUL numero 12 : segundo semestre 2006-primeiro semestre 2007

    OpenAIRE

    Romina Eliana Gayá; Gustavo Svarzman; Ricardo Rozemberg; Alejo Espora; Aníbal Córdoba Sosa; Alejandro Ramos; Ricardo Carciofi; Uziel Nogueira

    2008-01-01

    O Mercado Comum do Sul (MERCOSUL) foi constituído a partir da assinatura do Tratado de Assunçao, em 1991, com o objetivo de avaliar os êxitos e os desafios que encerra o processo de integraçao vigente na América Latina e no Caribe. A intençao do INTAL, mediante a publicaçao do Informe MERCOSUL, é facilitar, para um universo de potenciais leitores interessados nesta regiao, o acesso à informaçao. Trata-se, também, de ultrapassar o interesse que o MERCOSUL desperta no nível sub-regional, facili...

  11. Development of Specific Primer for Tricholoma matsutake

    OpenAIRE

    Kim, Jang-Han; Han, Yeong-Hwan

    2009-01-01

    In this study, in an effort to develop a method for the molecular detection of Tricholoma matsutake in Korea from other closely related Tricholomataceae, a species-specific PCR primer pair, TmF and TmR, was designed using nuclear ribosomal intertranscribed spacer (ITS) sequences. The DTmF and DTmR sequences were 5'-CCTGACGCCAATCTTTTCA-3' and 5'-GGAGAGCAGACTTGTGAGCA-3', respectively. The PCR primers reliably amplified only the ITS sequences of T. matsutake, and not those of other species used ...

  12. Microsatellite primers for fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Gertsch, P J; Boomsma, JJ

    2002-01-01

    developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants.......We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...

  13. Microsatellite Primers for Fungus-Growing Ants

    DEFF Research Database (Denmark)

    Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

    2002-01-01

    developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants.......We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...

  14. Primer Design Assistant (PDA): a web-based primer design tool

    OpenAIRE

    Chen, S. H.; Lin, C. Y.; Cho, C.S.; Lo, C.Z.; Hsiung, C. A.

    2003-01-01

    Primer Design Assistant (PDA) is a web interface primer design service combined with thermodynamic theory to evaluate the fitness of primers. It runs in a Linux–Apache–MySQL–PHP structure on a PC equipped with dual CPU (Intel Pentium III 1.4 GHz) and 512 Mb of RAM. A succinct user interface of PDA is accomplished by built-in parameters setting. Advanced options on 5′ GC content, 3′ GC content, dimer check and hairpin check are available. The option of covered region constrains the PCR product...

  15. Forest Interpreter's Primer on Fire Management.

    Science.gov (United States)

    Zelker, Thomas M.

    Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

  16. Scrimer: designing primers from transcriptome data

    Czech Academy of Sciences Publication Activity Database

    Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

    2015-01-01

    Roč. 15, č. 6 (2015), s. 1415-1420. ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.712, year: 2014

  17. Loop-Mediated Amplification Accelerated by Stem Primers

    Directory of Open Access Journals (Sweden)

    Laurence Tisi

    2011-12-01

    Full Text Available Isothermal nucleic acid amplifications (iNAATs have become an important alternative to PCR for in vitro molecular diagnostics in all fields. Amongst iNAATs Loop-mediated amplification (LAMP has gained much attention over the last decade because of the simplicity of hardware requirements. LAMP demonstrates performance equivalent to that of PCR, but its application has been limited by the challenging primer design. The design of six primers in LAMP requires a selection of eight priming sites with significant restrictions imposed on their respective positioning and orientation. In order to relieve primer design constraints we propose an alternative approach which uses Stem primers instead of Loop primers and demonstrate the application of STEM-LAMP in assaying for Clostridium difficile, Listeria monocytogenes and HIV. Stem primers used in LAMP in combination with loop-generating and displacement primers gave significant benefits in speed and sensitivity, similar to those offered by Loop primers, while offering additional options of forward and reverse orientations, multiplexing, use in conjunction with Loop primers or even omission of one or two displacement primers, where necessary. Stem primers represent a valuable alternative to Loop primers and an additional tool for IVD assay development by offering more choices for primer design at the same time increasing assay speed, sensitivity, and reproducibility.

  18. Loop-mediated amplification accelerated by stem primers.

    Science.gov (United States)

    Gandelman, Olga; Jackson, Rebecca; Kiddle, Guy; Tisi, Laurence

    2011-01-01

    Isothermal nucleic acid amplifications (iNAATs) have become an important alternative to PCR for in vitro molecular diagnostics in all fields. Amongst iNAATs Loop-mediated amplification (LAMP) has gained much attention over the last decade because of the simplicity of hardware requirements. LAMP demonstrates performance equivalent to that of PCR, but its application has been limited by the challenging primer design. The design of six primers in LAMP requires a selection of eight priming sites with significant restrictions imposed on their respective positioning and orientation. In order to relieve primer design constraints we propose an alternative approach which uses Stem primers instead of Loop primers and demonstrate the application of STEM-LAMP in assaying for Clostridium difficile, Listeria monocytogenes and HIV. Stem primers used in LAMP in combination with loop-generating and displacement primers gave significant benefits in speed and sensitivity, similar to those offered by Loop primers, while offering additional options of forward and reverse orientations, multiplexing, use in conjunction with Loop primers or even omission of one or two displacement primers, where necessary. Stem primers represent a valuable alternative to Loop primers and an additional tool for IVD assay development by offering more choices for primer design at the same time increasing assay speed, sensitivity, and reproducibility. PMID:22272122

  19. Criticality calculations with MCNP trademark: A primer

    International Nuclear Information System (INIS)

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

  20. Rust transformation/rust compatible primers

    Science.gov (United States)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  1. Caries inhibition by fluoride-releasing primers.

    Science.gov (United States)

    Kerber, L J; Donly, K J

    1993-10-01

    This study evaluated the caries inhibition of dentin primers with the addition of fluoride. Two standardized Class V preparations were placed in 20 molars, the gingival margin placed below the cementoenamel junction and the occlusal margin placed in enamel. Two dentin primers (Syntac and ScotchPrep) were placed in equal numbers of 20 preparations, according to manufacturer's instructions. Ammonium fluoride (10% by weight) was then added to these primers and they were placed in the remaining 20 preparations, opposing the non-fluoridated primer of the same system. All teeth were then restored with a non-fluoridated resin composite. All teeth were subjected to an artificial caries challenge (pH 4.2) for 5 days. Sections of 100 microns were obtained, photographed under polarized light microscopy, then demineralized areas were quantitated by digitization. Results demonstrated the mean areas (mm2 +/- S.D.) demineralization at 0.25 mm, 0.5 mm and 1.0 mm from the restoration margin to be: Syntac/fluoride (1.44 +/- 0.49, 1.68 +/- 0.54, 3.72 +/- 0.74); Syntac (1.99 +/- 0.58, 1.50 +/- 0.35, 2.98 +/- 1.26); ScotchPrep/fluoride (1.23 +/- 0.68, 1.55 +/- 0.64, 3.08 +/- 1.16); ScotchPrep (1.90 +/- 0.83, 1.71 +/- .038, 3.36 +/- 0.62). A paired t-test indicated primers with fluoride to demonstrate significantly less demineralization 0.25 mm from the restoration margin (P < 0.07). PMID:7880460

  2. Mejoramiento de la comprensión lectora en alumnos de segundo semestre del programa de español y literatura de la Universidad Tecnológica del Chocó “Diego Luis Córdoba”

    OpenAIRE

    Palacios Escobar, Lady Sirley

    2015-01-01

    En este trabajo de investigación se plantea el mejoramiento de la comprensión de textos de los estudiantes de segundo semestre del programa de Español y Literatura de la Universidad Tecnológica de Chocó, desde un análisis cualitativo y cuantitativo. Para ello, se realizó un diagnóstico con el objetivo de conocer las experiencias de los alumnos en relación con la lectura, identificar algunas actitudes de los alumnos frente a la misma, y evaluar el nivel de comprensión de lectura adquirido por ...

  3. Las necesidades de capacitación de empresarios de MIPYMES del Valle de Mexicali, México, y la demanda de capacitación de los mismos, en el semestre 2011-1

    OpenAIRE

    Marcela Reyes Pazos; Óscar Reyes Sánchez

    2012-01-01

    El propósito de la investigación es analizar las necesidades de capacitación de empresarios de MIPYMES (Micro, Pequeñas y Medianas Empresas) del Valle de Mexicali, y la demanda de capacitación de los mismos, durante el semestre 2011-1. Esta investigación la realiza el cedem-uabc (Centro Desarrollo Empresarial) de la Escuela de Ingeniería y Negocios, Guadalupe Victoria, de la Universidad Autónoma de Baja California, campus Mexicali. El método seguido fue investigación cuantitativa, con una mue...

  4. MPprimer: a program for reliable multiplex PCR primer design

    OpenAIRE

    Wang Xiaolei; Hang Xingyi; Li Zhifeng; Wu Yonghong; Lu Yiming; Wang Wen; Qu Wubin; Shen Zhiyong; Zhao Dongsheng; Zhang Chenggang

    2010-01-01

    Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer) in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nons...

  5. Monte Carlo primer for health physicists

    International Nuclear Information System (INIS)

    The basic ideas and principles of Monte Carlo calculations are presented in the form of a primer for health physicists. A simple integral with a known answer is evaluated by two different Monte Carlo approaches. Random number, which underlie Monte Carlo work, are discussed, and a sample table of random numbers generated by a hand calculator is presented. Monte Carlo calculations of dose and linear energy transfer (LET) from 100-keV neutrons incident on a tissue slab are discussed. The random-number table is used in a hand calculation of the initial sequence of events for a 100-keV neutron entering the slab. Some pitfalls in Monte Carlo work are described. While this primer addresses mainly the bare bones of Monte Carlo, a final section briefly describes some of the more sophisticated techniques used in practice to reduce variance and computing time

  6. A primer for criticality calculations with DANTSYS

    Energy Technology Data Exchange (ETDEWEB)

    Busch, R.D. [Univ. of New Mexico, Albuquerque, NM (United States). Nuclear Criticality Safety Group

    1997-08-01

    With the closure of many experimental facilities, the nuclear safety analyst has to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. Although deterministic methods often do not provide exact models of a system, a substantial amount of reliable information on nuclear systems can be obtained using these methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico (UNM) in cooperation with the Radiation Transport Group at Los Alamos National Laboratory (LANL) has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. DANTSYS is the new name of the group of codes formerly known as: ONEDANT, TWODANT, TWOHEX, TWOGQ, and THREEDANT. The primer is designed to teach bu example, with each example illustrating two or three DANTSYS features useful in criticality analyses. Starting with a Quickstart chapter, the primer gives an overview of the basic requirements for DANTSYS input and allows the user to quickly run a simple criticality problem with DANTSYS. Each chapter has a list of basic objectives at the beginning identifying the goal of the chapter and the individual DANTSYS features covered in detail in the chapter example problems. On completion of the primer, it is expected that the user will be comfortable doing criticality calculations with DANTSYS and can handle 60--80% of the situations that normally arise in a facility. The primary provides a set of input files that can be selective modified by the user to fit each particular problem.

  7. A primer for criticality calculations with DANTSYS

    International Nuclear Information System (INIS)

    With the closure of many experimental facilities, the nuclear safety analyst has to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. Although deterministic methods often do not provide exact models of a system, a substantial amount of reliable information on nuclear systems can be obtained using these methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico (UNM) in cooperation with the Radiation Transport Group at Los Alamos National Laboratory (LANL) has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. DANTSYS is the new name of the group of codes formerly known as: ONEDANT, TWODANT, TWOHEX, TWOGQ, and THREEDANT. The primer is designed to teach bu example, with each example illustrating two or three DANTSYS features useful in criticality analyses. Starting with a Quickstart chapter, the primer gives an overview of the basic requirements for DANTSYS input and allows the user to quickly run a simple criticality problem with DANTSYS. Each chapter has a list of basic objectives at the beginning identifying the goal of the chapter and the individual DANTSYS features covered in detail in the chapter example problems. On completion of the primer, it is expected that the user will be comfortable doing criticality calculations with DANTSYS and can handle 60--80% of the situations that normally arise in a facility. The primary provides a set of input files that can be selective modified by the user to fit each particular problem

  8. Book review: feminist research practice: a primer

    OpenAIRE

    Smith, Emma

    2013-01-01

    The fully revised and updated Second Edition of Feminist Research Practice: A Primer, edited by Sharlene Nagy Hesse-Biber, draws on the expertise of a wide group of interdisciplinary scholars who aim to cover cutting-edge research methods and explore research questions related to the complex and diverse issues that deeply impact women’s lives. Emma Smith finds that it will be valuable for academics already working from or looking to develop their understanding and use of feminist research pra...

  9. Primer for the algebraic geometry of sandpiles

    OpenAIRE

    Perkinson, David; Perlman, Jacob; Wilmes, John

    2011-01-01

    The Abelian Sandpile Model (ASM) is a game played on a graph realizing the dynamics implicit in the discrete Laplacian matrix of the graph. The purpose of this primer is to apply the theory of lattice ideals from algebraic geometry to the Laplacian matrix, drawing out connections with the ASM. An extended summary of the ASM and of the required algebraic geometry is provided. New results include a characterization of graphs whose Laplacian lattice ideals are complete intersection ideals; a new...

  10. Weathered Hydrocarbon Wastes: A Risk Management Primer

    OpenAIRE

    Brassington, Kirsty J.; Hough, Rupert L.; Paton, Graeme I.; Semple, Kirk T.; Risdon, Graeme C.; Crossley, Jane; Hay, I; Askari, K.; Pollard, Simon J. T.

    2007-01-01

    We provide a primer and critical review of the characterization, risk assessment, and bioremediation of weathered hydrocarbons. Historically the remediation of soil contaminated with petroleum hydrocarbons has been expressed in terms of reductions in total petroleum hydrocarbon (TPH) load rather than reductions in risk. There are several techniques by which petroleum hydrocarbons in soils can be characterized. Method development is often driven by the objectives of published...

  11. CRISPR Primer Designer:Design primers for knockout and chromosome imaging CRISPR-Cas system

    Institute of Scientific and Technical Information of China (English)

    Meng Yan; Shi-Rong Zhou; Hong-Wei Xue

    2015-01-01

    The clustered regularly interspaced short palin-dromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especial y the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran local y and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were stil no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs local y and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system.

  12. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  13. Signals and systems primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2006-01-01

    Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

  14. Bayesian models a statistical primer for ecologists

    CERN Document Server

    Hobbs, N Thompson

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili

  15. Primer izpeljave analize besedila v kvalitativni raziskavi

    OpenAIRE

    Roblek, Vasja

    2013-01-01

    V članku na podlagi kvalitativne raziskave prikazujemo primer načina analize in razlage besedila. V prvem delu se osredotočimo na teoretično opredelitev analitičnega orodja ter značilnosti analize in interpretacije besedil znotraj kvalitativne raziskave. V nadaljevanju na podlagi izsledkov (polstrukturiranih intervjujev in osebnih zapisov, opazovanja delovanja dveh mrež) prikažemo možnost analize in interpretacije dobljenih podatkov z uporabo analitičnega orodja tematske mreže.

  16. Primer izpeljave analize besedila v kvalitativni raziskavi:

    OpenAIRE

    Roblek, Vasja

    2009-01-01

    V članku na podlagi kvalitativne raziskave prikazujemo primer načina analize in razlage besedila. V prvem delu se osredotočimo na teoretično opredelitev analitičnega orodja ter značilnosti analize in interpretacije besedil znotraj kvalitativne raziskave. V nadaljevanju na podlagi izsledkov (polstrukturiranih intervjujev in osebnih zapisov, opazovanja delovanja dveh mrež) prikažemo možnost analize in interpretacije dobljenih podatkov z uporabo analitičnega orodja tematske mreže.

  17. Primer on CDM programme of activities

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

    2009-07-01

    As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

  18. pmoA Primers for Detection of Anaerobic Methanotrophs▿

    OpenAIRE

    Luesken, F.A.; Zhu, B.; Alen, T.A. van; Butler, M.K.; Diaz, M. R.; Song, B.; Op den Camp, H.J.M.; M. S. M. Jetten; Ettwig, K.F.

    2011-01-01

    Published pmoA primers do not match the pmoA sequence of “Candidatus Methylomirabilis oxyfera,” a bacterium that performs nitrite-dependent anaerobic methane oxidation. Therefore, new pmoA primers for the detection of “Ca. Methylomirabilis oxyfera”-like methanotrophs were developed and successfully tested on freshwater samples from different habitats. These primers expand existing molecular tools for the study of methanotrophs in the environment.

  19. High universality of matK primers for barcoding gymnosperms

    Institute of Scientific and Technical Information of China (English)

    Yan LI; Lian-Ming GAO; RAM C.POUDEL; De-Zhu Li; Alan FORREST

    2011-01-01

    DNA barcoding is a tool to provide rapid and accurate taxonomic identification using a standard DNA region. A two-marker combination of rnatK+rbcL was formally proposed as the core barcode for land plants by the Consortium for the Barcode of Life Plant Working Group. However, there are currently no barcoding primers for matK showing high universality in gymnosperms. We used 57 gymnosperm species representing 40 genera, 11families and four subclasses to evaluate the universality of nine candidate matK primers and one rbcL primer in this study. Primer (1F/724R) of rbcL is proposed here as a universal primer for gymnosperms due to high universality. One of the nine candidate matK primers (Gym_F1A/Gym_R1A) is proposed as the best "universal" matK primer for gynnosperms because of high polymerase chain reaction success and routine generation of high quality bidirectional sequences. A specific matK primer for Ephedra was newly designed in this study, which performed well on the sampled species. The primers proposed here for rbcL and matK can be easily and successfully amplified for most gymnosperms.

  20. High-speed measurement of firearm primer blast waves

    OpenAIRE

    Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy

    2012-01-01

    This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...

  1. Coverage evaluation of universal bacterial primers using the metagenomic datasets

    Directory of Open Access Journals (Sweden)

    Mao Dan-Ping

    2012-05-01

    Full Text Available Abstract Background The coverage of universal primers for the bacterial 16S rRNA gene plays a crucial role in the correct understanding of microbial community structure. However, existing studies on primer coverage are limited by the lack of appropriate databases and are restricted to the domain level. Additionally, most studies do not account for the positional effect of single primer-template mismatches. In this study, we used 7 metagenomic datasets as well as the Ribosomal Database Project (RDP to assess the coverage of 8 widely used bacterial primers. Results The coverage rates for bacterial primers were found to be overestimated by previous studies that only investigated the RDP because of PCR amplification bias in the sequence composition of the dataset. In the RDP, the non-coverage rates for all primers except 27F were ≪6%, while in the metagenomic datasets, most were ≫10%. If one considers that a single mismatch near the 3′ end of the primer might greatly reduce PCR efficiency, then some phylum non-coverage rates would change by more than 20%. Primer binding-site sequence variants that could not pair with their corresponding primers are discussed. Conclusions Our study revealed the potential bias introduced by the use of universal bacterial primers in the assessment of microbial communities. With the development of high-throughput, next-generation sequencing techniques, it will become feasible to sequence more of the hypervariable regions of the bacterial 16S rRNA gene. This, in turn, will lead to the more frequent use of the primers discussed here.

  2. Evaluation of conservation programs: a primer

    Energy Technology Data Exchange (ETDEWEB)

    Soderstrom, E.J.; Berry, L.G.; Hirst, E.; Bronfman, B.H.

    1981-07-01

    This primer is an introduction to the field of program evaluation. A considerable amount of information is included about the actual conduct of an evaluation. No specific activity is addressed, but rather an idea is provided of the issues and constraints characteristic of each phase and activity of an evaluation. Examples of how these issues arise and potential solutions are presented. Chapter 1 provides background on the origins and evolution of evaluation, focusing especially on why evaluation is currently receiving increased emphasis. Chapter 2 is an overview of the field of evaluation, especially as it relates to energy conservation. Chapter 3 is a consideration of the steps involved in conducting an evaluation from the planning stage to data analysis. Chapter 4 discusses managerial considerations in conducting an evaluation. Chapter 5 discusses evaluators as people; both in terms of organizational obstacles likely to be encountered by, and personal characteristics found in, good evaluators. An appendix includes suggested further readings.

  3. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2013-01-01

    Complex system theory is rapidly developing and gaining importance, providing tools and concepts central to our modern understanding of emergent phenomena. This primer offers an introduction to this area together with detailed coverage of the mathematics involved. All calculations are presented step by step and are straightforward to follow. This new third edition comes with new material, figures and exercises. Network theory, dynamical systems and information theory, the core of modern complex system sciences, are developed in the first three chapters, covering basic concepts and phenomena like small-world networks, bifurcation theory and information entropy. Further chapters use a modular approach to address the most important concepts in complex system sciences, with the emergence and self-organization playing a central role. Prominent examples are self-organized criticality in adaptive systems, life at the edge of chaos, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase...

  4. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2007-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  5. Complex and Adaptive Dynamical Systems A Primer

    CERN Document Server

    Gros, Claudius

    2011-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  6. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2015-01-01

    This primer offers readers an introduction to the central concepts that form our modern understanding of complex and emergent behavior, together with detailed coverage of accompanying mathematical methods. All calculations are presented step by step and are easy to follow. This new fourth edition has been fully reorganized and includes new chapters, figures and exercises. The core aspects of modern complex system sciences are presented in the first chapters, covering network theory, dynamical systems, bifurcation and catastrophe theory, chaos and adaptive processes, together with the principle of self-organization in reaction-diffusion systems and social animals. Modern information theoretical principles are treated in further chapters, together with the concept of self-organized criticality, gene regulation networks, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase transitions and the cognitive system approach to the brain. Technical course prerequisites are the standard ...

  7. Primer for criticality calculations with DANTSYS

    International Nuclear Information System (INIS)

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses

  8. Formaldehyde as hypothetical primer of biohomochirality

    Energy Technology Data Exchange (ETDEWEB)

    Goldanskii, V.I. [N. N. Semenov Institute of Chemical Physics of the Russian Academy of Sciences, Kosygin Street 4, Moscow, 117334 (Russia)

    1996-07-01

    One of the most intriguing and crucial problems of the prebiotic evolution and the origin of life is the explanation of the origin of biohomochirality. A scheme of conversions originated by formaldehyde (FA) as hypothetical primer of biohomochirality is proposed. The merit of FA as executor of this function is based -inter alia - on the distinguished role of FA as one of the earliest and simplest molecules in both warm, terrestrial and cold, extraterrestrial scenarios of the origin of life. The confirmation of the role of FA as primer of biohomochirality would support the option of an RNA world as an alternative to the protein world. The suggested hypothesis puts forward for the first time a concrete sequence of chemical reactions which can lead to biohomochirality. The spontaneous breaking of the mirror symmetry is secured by the application of the well-known Frank scheme (combination of autocatalysis and {open_quote}{open_quote}annihilation{close_quote}{close_quote} of L and D enantiomers) to the series of interactions of FA {open_quote}{open_quote}trimers{close_quote}{close_quote} (i.e. C{sub 3}H{sub 6}O{sub 3} compounds) of (aaa), (apa) and (app) types, where the monomeric groups (a) means {open_quote}{open_quote}achirons{close_quote}{close_quote} (a=CH{sub n}, n{ge}2 and C=M, M=C,O) and (p) mean {open_quote}{open_quote}prochirons{close_quote}{close_quote} (p=HC{asterisk}OM, M=H,C). {copyright} {ital 1996 American Institute of Physics.}

  9. MCNPTM criticality primer and training experiences

    International Nuclear Information System (INIS)

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (keff). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple keff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP

  10. Polymerase chain reaction of Au nanoparticle-bound primers

    Institute of Scientific and Technical Information of China (English)

    SHEN Hebai; HU Min; YANG Zhongnan; WANG Chen; ZHU Longzhang

    2005-01-01

    Polymerase chain reaction (PCR) is a useful technique for in vitro amplification of a DNA fragment. In this paper, a PCR procedure using Au nanoparticle (AuNP) -bound primers was systemically studied. The 5′-SH- (CH2)6-modified primers were covalently attached to the AuNP surface via Au-S bonds, and plasmid pBluescript SK was used as a template. The effects of the concentration of AuNP-bound primers, annealing temperature and PCR cycles were evaluated, respectively. The results indicate that PCR can proceed successfully under optimized condition, with either forward or reverse primers bound to the AuNP surface or with both the two primers bound to the AuNP surface. Development of PCR procedure based on AuNPs not only makes the isolation of PCR products very convenient, but also provides novel methods to prepare AuNP-bound ssDNA and nanostructured material.

  11. Uncoupling primer and releaser responses to pheromone in honey bees

    Science.gov (United States)

    Grozinger, Christina M.; Fischer, Patrick; Hampton, Jacob E.

    2007-05-01

    Pheromones produce dramatic behavioral and physiological responses in a wide variety of species. Releaser pheromones elicit rapid responses within seconds or minutes, while primer pheromones produce long-term changes which may take days to manifest. Honeybee queen mandibular pheromone (QMP) elicits multiple distinct behavioral and physiological responses in worker bees, as both a releaser and primer, and thus produces responses on vastly different time scales. In this study, we demonstrate that releaser and primer responses to QMP can be uncoupled. First, treatment with the juvenile hormone analog methoprene leaves a releaser response (attraction to QMP) intact, but modulates QMP’s primer effects on sucrose responsiveness. Secondly, two components of QMP (9-ODA and 9-HDA) do not elicit a releaser response (attraction) but are as effective as QMP at modulating a primer response, downregulation of foraging-related brain gene expression. These results suggest that different responses to a single pheromone may be produced via distinct pathways.

  12. UniFrag and GenomePrimer : selection of primers for genome-wide production of unique amplicons

    NARCIS (Netherlands)

    van Hijum, SAFT; de Jong, A; Buist, G; Kok, J; Kuipers, OP

    2003-01-01

    The complementary programs UniFrag and GenomePrimer were developed to provide a reliable high-throughput method to select the most unique regions within genomic DNA sequence(s) and design primers therein, involving minimal user intervention and maximum flexibility.

  13. PrimerSeq:Design and Visualization of RT-PCR Primers for Alternative Splicing Using RNA-seq Data

    Institute of Scientific and Technical Information of China (English)

    Collin Tokheim; Juw Won Park; Yi Xing

    2014-01-01

    The vast majority of multi-exon genes in higher eukaryotes are alternatively spliced and changes in alternative splicing (AS) can impact gene function or cause disease. High-throughput RNA sequencing (RNA-seq) has become a powerful technology for transcriptome-wide analysis of AS, but RT-PCR still remains the gold-standard approach for quantifying and validating exon splicing levels. We have developed PrimerSeq, a user-friendly software for systematic design and visualization of RT-PCR primers using RNA-seq data. PrimerSeq incorporates user-provided tran-scriptome profiles (i.e., RNA-seq data) in the design process, and is particularly useful for large-scale quantitative analysis of AS events discovered from RNA-seq experiments. PrimerSeq features a graphical user interface (GUI) that displays the RNA-seq data juxtaposed with the expected RT-PCR results. To enable primer design and visualization on user-provided RNA-seq data and transcript annotations, we have developed PrimerSeq as a stand-alone software that runs on local computers. PrimerSeq is freely available for Windows and Mac OS X along with source code at http://primerseq.sourceforge.net/. With the growing popularity of RNA-seq for transcriptome stud-ies, we expect PrimerSeq to help bridge the gap between high-throughput RNA-seq discovery of AS events and molecular analysis of candidate events by RT-PCR.

  14. Relativistic Astrophysics and Cosmology: A Primer

    International Nuclear Information System (INIS)

    'Relativistic Astrophysics and Cosmology: A Primer' by Peter Hoyng, was published last year by Springer. The book is based on lectures given by the author at University of Utrecht to advanced undergraduates. This is a short and scholarly book. In about 300 pages, the author has covered the most interesting and important applications of Albert Einstein's general relativity in present-day astrophysics and cosmology: black holes, neutron stars, gravitational waves, and the cosmic microwave background. The book stresses theory, but also discusses several experimental and observational topics, such as the Gravity Probe B mission, interferometer detectors of gravitational waves and the power spectrum of the cosmic microwave background. The coverage is not uniform. Some topics are discussed in depth, others are only briefly mentioned. The book obviously reflects the author's own research interests and his preferences for specific mathematical methods, and the choice of the original artwork that illustrates the book (and appears on its cover) is a very personal one. I consider this personal touch an advantage, even if I do not always agree with the author's choices. For example, I employ Killing vectors as a very useful mathematical tool not only in my research on black holes, but also in my classes. I find that my students prefer it when discussions of particle, photon and fluid motion in the Schwarzschild and Kerr spacetimes are based explicitly and directly on the Killing vectors rather than on coordinate calculations. The latter approach is, of course, the traditional one, and is used in Peter Hoyng's book. Reading the book is a stimulating experience, because the reader can almost feel the author's presence. The author's opinions, his mathematical taste, his research pleasures, and his pedagogical passion are apparent everywhere. Lecturers contemplating a new course on relativistic astrophysics could adopt Hoyng's book as the text. Their students will be in the author

  15. A primer on climate relevant technology transfer

    International Nuclear Information System (INIS)

    The aim of this primer is to support technology transfer initiatives related to mitigation of emissions of greenhouse gases and adaptation to climate change in developing countries and economies in transition. It is meant to provide guidance to all parties involved in the transfer of climate relevant technologies, micluding government, business organisations and other non-governmental organizations representing all sectors relevant for climate change. The emphasis in this primer is on strategic and organisational issues related to the transfer of climate relevant technologies, in particular with a view to utilise climate-relevant technologies in the development process of developing countries and countries in economic transition. It builds upon insight gained in National Needs Assessments regarding the Transfer of Enviromentally Sound Technologies to developing countries. Chapter 2 deals with the technology transfer process for climate relevant technologies. It provides a framework for co-ordinated action of the stakeholders involved in the technology transfer process, with a view to improve the utilisation of climate relevant technologies in the development process of developing countries. It therefore proposes three main 'pillars' for climate relevant technology transfer, i.e. creating an enabling environment for stakeholders' participation, assessing mitigation and adaptation needs and opportunities, and implementing and evaluating mitigation and adaptation actions. Chapter 3 elaborates on creating an enabling environment for stakeholders' participation. It deals in particular with the selection of priority sectors and obtaining involvement of stakeholders representing these prioritised sectors, in order to start a roundtable process for the preparation of mitigation and adaptation actions. Chapter 4 covers the second pillar 'assessing mitigation and adaptation needs and opportunities'. This encompasses several assessment tasks including: identification and

  16. Análise comparativa entre a refração clínica subjetiva e a automatizada obtida por sensor de frentes de onda Comparative analyses between clinical refraction and automatic refraction obtained through a wave front sensor

    Directory of Open Access Journals (Sweden)

    Wilson de Freitas

    2007-08-01

    Full Text Available OBJETIVO: Avaliar e comparar os resultados obtidos da refração estática clínica com a obtida por sensor de frentes de onda. MÉTODOS: Estudo prospectivo, não seqüencial, de 279 olhos de 147 pacientes. Todos os pacientes foram examinados sob cicloplegia. Primeiro realizamos a refração clínica e a seguir a automatizada por sensor de frentes de onda. Os dados refracionais obtidos foram decompostos para análise vetorial. Foram analisados separadamente os dados de um olho por paciente e dos dois olhos. RESULTADOS: A diferença entre a refração clínica e a automatizada foi de -0,19 DE combinada com -0,06 DC no eixo de 15º para os dados de um olho por paciente e -0,17 DE combinada com -0,05 DC no eixo de 3º para todos os olhos da amostra. CONCLUSÃO: Os dados da refração clínica são comparáveis com os da refração obtida por um sensor de frentes de onda.PURPOSE: To evaluate and compare refractive errors obtained through clinical subjective and automatized wavefront refraction analyses in eyes under cycloplegia. METHODS: Prospective study of 147 patients, 279 eyes, undergoing preoperative examination for refractive surgery. Clinical subjective refraction was performed first followed by wavefront refraction. Results on astigmatism obtained from refraction were decomposed in power vectors for statistical analyses. Data were first analyzed in one eye and then in both eyes. RESULTS: The mean difference between clinical subjective refraction and automatized wavefront refraction on cycloplegic eyes was of -0.19 SD combined with -0.06 CD in the 15º axis for data in one eye, and -0.17 SD combined with -0.05 CD in the 3º axis for data in both eyes of the same patient. CONCLUSION: In the present study clinical subjective refraction and automatized wavefront refraction under cycloplegia had similar numerical values.

  17. Primer on electricity futures and other derivatives

    International Nuclear Information System (INIS)

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area

  18. Primer on electricity futures and other derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  19. Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

    Directory of Open Access Journals (Sweden)

    Alexandre R. Zuntini

    2013-08-01

    Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  20. propósito del primer centenario

    Directory of Open Access Journals (Sweden)

    René Martínez Lemoine

    2007-01-01

    Full Text Available Este trabajo, trata de las apreciaciones públicas y urbanas que se dieron en la ciudad de Santiago a instancias de la celebración del primer Centenario de la República, en el año 1910. Es una rememoranza de aquellas visiones que la ciudad sustrajo a los medios periodísticos, personajes y liderazgos de una sociedad autosatisfecha por el progreso notable alcanzado por el país en las últimas décadas del siglo XIX y los primeros años del siglo XX, pero que ignoró los movimientos obreros y expresiones de disconformidad social que ya comenzaban a ebullir en esos años. La ciudad, como una vasta, compleja y heterogénea construcción en el espacio, erigida a través de las edades por innumerables y, la más de las veces, anónimos constructores, representa la mayor suma de obra humana acumulada en el tiempo, en la que cada generación va dejando una muestra de su aporte en vivienda, espacios, instalaciones y monumentos, vale decir, de su particular cultura y modo de vida en su propio tiempo. Ciertamente, cada ciudad es historia y memoria de sí misma, testimonio permanente de la continuidad del hombre y de la sociedad humana con su propio pasado. En ese sentido, como somos herederos de nuestra historia y de los hombres y mujeres que construyeron y legaron las ciudades en las que vivimos, es importante rescatar esos valores culturales, sociales, arquitectónicos y urbanísticos de modo de visualizar el paso del tiempo, que se materializa, se hace objeto y se torna visible en la ciudad, en la medida que nos “cuenta” algo.

  1. PRIMER FOR FINANCIAL ANALYSIS OF POLLUTION PREVENTION PROJECTS

    Science.gov (United States)

    This primer will serve as a basic guide to pollution prevention investment -- specifically, the preparation of financial comparisons and justifications for such expenditures. he emphasis is on the basic analytical techniques needed to justify pollution prevention investments. onc...

  2. Las necesidades de capacitación de empresarios de MIPYMES del Valle de Mexicali, México, y la demanda de capacitación de los mismos, en el semestre 2011-1

    Directory of Open Access Journals (Sweden)

    Marcela Reyes Pazos

    2012-06-01

    Full Text Available El propósito de la investigación es analizar las necesidades de capacitación de empresarios de MIPYMES (Micro, Pequeñas y Medianas Empresas del Valle de Mexicali, y la demanda de capacitación de los mismos, durante el semestre 2011-1. Esta investigación la realiza el cedem-uabc (Centro Desarrollo Empresarial de la Escuela de Ingeniería y Negocios, Guadalupe Victoria, de la Universidad Autónoma de Baja California, campus Mexicali. El método seguido fue investigación cuantitativa, con una muestra aleatoria no representativa de 469 MIPYMES encuestadas de los distintos ejidos del Valle de Mexicali. Los principales resultados obtenidos manifiestan que existe demanda de capacitación, en áreas como administración, publicidad y mercadotecnia, y ventas. Los resultados del diagnóstico de la investigación indican que sí están presentes las necesidades de capacitación por parte de la mayoría de los empresarios de las MIPYMES del Valle de Mexicali, pero muy pocos la han solicitado. Los objetivos de la investigación se lograron analizando las necesidades de capacitación y la demanda de capacitación de los empresarios.

  3. Las necesidades de capacitación de empresarios de MIPYMES del Valle de Mexicali, México, y la demanda de capacitación de los mismos, en el semestre 2011-1

    Directory of Open Access Journals (Sweden)

    Marcela Reyes Pazos

    2012-07-01

    Full Text Available El propósito de la investigación es analizar las necesidades de capacitación de empresarios de MIPYMES (Micro, Pequeñas y Medianas Empresas del Valle de Mexicali, y la demanda de capacitación de los mismos, durante el semestre 2011-1. Esta investigación la realiza el cedem-uabc (Centro Desarrollo Empresarial de la Escuela de Ingeniería y Negocios, Guadalupe Victoria, de la Universidad Autónoma de Baja California, campus Mexicali. El método seguido fue investigación cuantitativa, con una muestra aleatoria no representativa de 469 MIPYMES encuestadas de los distintos ejidos del Valle de Mexicali. Los principales resultados obtenidos manifiestan que existe demanda de capacitación, en áreas como administración, publicidad y mercadotecnia, y ventas. Los resultados del diagnóstico de la investigación indican que sí están presentes las necesidades de capacitación por parte de la mayoría de los empresarios de las MIPYMES del Valle de Mexicali, pero muy pocos la han solicitado. Los objetivos de la investigación se lograron analizando las necesidades de capacitación y la demanda de capacitación de los empresarios.

  4. Loop-Mediated Amplification Accelerated by Stem Primers

    OpenAIRE

    Laurence Tisi; Guy Kiddle; Olga Gandelman; Rebecca Jackson

    2011-01-01

    Isothermal nucleic acid amplifications (iNAATs) have become an important alternative to PCR for in vitro molecular diagnostics in all fields. Amongst iNAATs Loop-mediated amplification (LAMP) has gained much attention over the last decade because of the simplicity of hardware requirements. LAMP demonstrates performance equivalent to that of PCR, but its application has been limited by the challenging primer design. The design of six primers in LAMP requires a selection of eight priming sites ...

  5. PD5: A General Purpose Library for Primer Design Software

    OpenAIRE

    Riley, Michael C.; Aubrey, Wayne; Young, Michael; Clare, Amanda

    2013-01-01

    Background Complex PCR applications for large genome-scale projects require fast, reliable and often highly sophisticated primer design software applications. Presently, such applications use pipelining methods to utilise many third party applications and this involves file parsing, interfacing and data conversion, which is slow and prone to error. A fully integrated suite of software tools for primer design would considerably improve the development time, the processing speed, and the reliab...

  6. New universal matK primers for DNA barcoding angiosperms

    Institute of Scientific and Technical Information of China (English)

    Jing YU; Jian-Hua XUE; Shi-Liang ZHOU

    2011-01-01

    The chloroplast maturase K gene (matK) is one of the most variable coding genes of angiosperms and has been suggested to be a "barcode" for land plants. However, matK exhibits low amplification and sequencing rates due to low universality of currently available primers and mononucleotide repeats. To resolve these technical problems, we evaluated the entire matK region to find a region of 600-800 bp that is highly variable, represents the best of all matK regions with priming sites conservative enough to design universal primers, and avoids the mononucleotide repeats. After careful evaluation, a region in the middle was chosen and a pair of primers named natK472F and matK1248R was designed to amplify and sequence the matK fragment of approximately 776 bp. This region encompasses the most variable sites, represents the entire matK region best, and also exhibits high amplification rates and quality of sequences. The universality of this primer pair was tested using 58 species from 47 families of angiosperm plants. The primers showed a strong amplification (93.1%) and sequencing (92.6%)successes in the species tested. We propose that the new primers will solve, in part, the problems encountered when using matK and promote the adoption of matK as a DNA barcode for angiosperms.

  7. TSUNAMI Primer: A Primer for Sensitivity/Uncertainty Calculations with SCALE

    Energy Technology Data Exchange (ETDEWEB)

    Rearden, Bradley T [ORNL; Mueller, Don [ORNL; Bowman, Stephen M [ORNL; Busch, Robert D. [University of New Mexico, Albuquerque; Emerson, Scott [University of New Mexico, Albuquerque

    2009-01-01

    This primer presents examples in the application of the SCALE/TSUNAMI tools to generate k{sub eff} sensitivity data for one- and three-dimensional models using TSUNAMI-1D and -3D and to examine uncertainties in the computed k{sub eff} values due to uncertainties in the cross-section data used in their calculation. The proper use of unit cell data and need for confirming the appropriate selection of input parameters through direct perturbations are described. The uses of sensitivity and uncertainty data to identify and rank potential sources of computational bias in an application system and TSUNAMI tools for assessment of system similarity using sensitivity and uncertainty criteria are demonstrated. Uses of these criteria in trending analyses to assess computational biases, bias uncertainties, and gap analyses are also described. Additionally, an application of the data adjustment tool TSURFER is provided, including identification of specific details of sources of computational bias.

  8. Studies on the Primers Screening for AFLP Fingerprints of Rice Cultivars

    Institute of Scientific and Technical Information of China (English)

    ZHANG Chun-qing; JIA Ji-zeng

    2002-01-01

    AFLP(amplified fragment length polymorphism) is a very powerful fingerprinting technology.The key of making variety fingerprints is to select specific powerful primers for each crop. A quick and effective procedure for selecting AFLP primers for rice variety fingerprinting was established as the following: (1)Choose 3 or more group materials that have close genetic relations. (2) Select potential polymorphic primers from primer pairs that are 2 + 2 primer crosses and same at two ends. (3) Recombine the selected potential polymorphic primers and choosing more polymorphic primers. (4) Add one selecting base at one end to become 2 + 3 or 3 + 2primers and further selecting more polymorphic primers. Some primers were selected with this procedure, such as M21Ps7 and M73P17, with which the fingerprints had more polymorphism and high quality.

  9. Mutated primer binding sites interacting with different tRNAs allow efficient murine leukemia virus replication

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J;

    1993-01-01

    Two Akv murine leukemia virus-based retroviral vectors with primer binding sites matching tRNA(Gln-1) and tRNA(Lys-3) were constructed. The transduction efficiency of these mutated vectors was found to be comparable to that of a vector carrying the wild-type primer binding site matching t......RNA(Pro). Polymerase chain reaction amplification and sequence analysis of transduced proviruses confirmed the transfer of vectors with mutated primer binding sites and further showed that tRNA(Gln-2) may act efficiently in conjunction with the tRNA(Gln-1) primer binding site. We conclude that murine leukemia virus...... can replicate by using various tRNA molecules as primers and propose primer binding site-tRNA primer interactions to be of major importance for tRNA primer selection. However, efficient primer selection does not require perfect Watson-Crick base pairing at all 18 positions of the primer binding site....

  10. SOMNOLENCIA DIURNA EXCESIVA EN ESTUDIANTES DE NOVENO SEMESTRE DE MEDICINA DE LA UNIVERSIDAD NACIONAL DE COLOMBIA Excessive daytime drowsiness in ninth-semester medical students attending the Universidad Nacional de Colombia

    Directory of Open Access Journals (Sweden)

    Franklin Escobar-Córdoba

    2011-09-01

    Full Text Available Antecedentes. Tradicionalmente los estudiantes de medicina duermen poco, estudian largas jornadas nocturnas y como consecuencia padecen somnolencia diurna excesiva produciendo disminución en la atención que afecta su calidad de vida y rendimiento académico. Lo anterior se suma a los turnos nocturnos y al pobre conocimiento de higiene del sueño. En Colombia se conoce poco sobre la prevalencia, la gravedad de este síntoma y los efectos en esta población, al igual que en otros grupos como correturnos, vigilantes, personal sanitario, pilotos, militares, etc. Objetivo. Determinar la incidencia de somnolencia diurna excesiva en estudiantes de noveno semestre de medicina de la Universidad Nacional de Colombia, quienes realizan turnos nocturnos en las rotaciones asignadas y evaluar su relación con la calidad e higiene de sueño. Material y métodos. Estudio descriptivo transversal, realizado en una muestra de estudiantes 76,14% (n=83/ 109 de noveno semestre de medicina que aceptaron participar en la investigación mediante consentimiento informado. Se aplicó la escala de somnolencia de Epworth y el índice de calidad de sueño de Pittsburgh validados localmente y el índice de higiene de sueño validado en Perú. Resultados. Los evaluados tuvieron un promedio de edad de 23 años, presentaron somnolencia diurna excesiva el 60,24% (n=50/83. Se halló 79,52% (n=66/83 de sujetos malos dormidores y 44,58% (n=37/83 con mala higiene de sueño. Conclusiones. La prevalencia de somnolencia diurna excesiva en la población estudiada es cuantitativamente importante y superior a la hallada en otros estudios, muestra relación con la mala calidad de sueño y con una mala higiene de sueño considerable.Background. Medical students traditionally sleep very little, study during long nocturnal periods and consequently suffer excessive daytime sleepiness, thereby leading to reduced attention which affects their quality of life and academic performance. The

  11. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    Energy Technology Data Exchange (ETDEWEB)

    Bowman, Stephen M [ORNL

    2008-09-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  12. New cyt b gene universal primer set for forensic analysis.

    Science.gov (United States)

    Lopez-Oceja, A; Gamarra, D; Borragan, S; Jiménez-Moreno, S; de Pancorbo, M M

    2016-07-01

    Analysis of mitochondrial DNA, and in particular the cytochrome b gene (cyt b), has become an essential tool for species identification in routine forensic practice. In cases of degraded samples, where the DNA is fractionated, universal primers that are highly efficient for the amplification of the target region are necessary. Therefore, in the present study a new universal cyt b primer set with high species identification capabilities, even in samples with highly degraded DNA, has been developed. In order to achieve this objective, the primers were designed following the alignment of complete sequences of the cyt b from 751 species from the Class of Mammalia listed in GenBank. A highly variable region of 148bp flanked by highly conserved sequences was chosen for placing the primers. The effectiveness of the new pair of primers was examined in 63 animal species belonging to 38 Families from 14 Orders and 5 Classes (Mammalia, Aves, Reptilia, Actinopterygii, and Malacostraca). Species determination was possible in all cases, which shows that the fragment analyzed provided a high capability for species identification. Furthermore, to ensure the efficiency of the 148bp fragment, the intraspecific variability was analyzed by calculating the concordance between individuals with the BLAST tool from the NCBI (National Center for Biotechnological Information). The intraspecific concordance levels were superior to 97% in all species. Likewise, the phylogenetic information from the selected fragment was confirmed by obtaining the phylogenetic tree from the sequences of the species analyzed. Evidence of the high power of phylogenetic discrimination of the analyzed fragment of the cyt b was obtained, as 93.75% of the species were grouped within their corresponding Orders. Finally, the analysis of 40 degraded samples with small-size DNA fragments showed that the new pair of primers permits identifying the species, even when the DNA is highly degraded as it is very common in

  13. A primer on wavelets and their scientific applications

    CERN Document Server

    Walker, James S

    2008-01-01

    In the first edition of his seminal introduction to wavelets, James S. Walker informed us that the potential applications for wavelets were virtually unlimited. Since that time thousands of published papers have proven him true, while also necessitating the creation of a new edition of his bestselling primer. Updated and fully revised to include the latest developments, this second edition of A Primer on Wavelets and Their Scientific Applications guides readers through the main ideas of wavelet analysis in order to develop a thorough appreciation of wavelet applications. Ingeniously relying o

  14. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J;

    1997-01-01

    Reverse transcription of retroviral genomes is primed by a tRNA annealed to an 18-nucleotide primer binding site. Here, we present a primer complementation system to study molecular interaction of the replication machinery with the primer and primer binding site in vivo. Introduction of eight base...... substitutions into the primer binding site of a murine leukemia virus-based vector allowed efficient RNA encapsidation but resulted in severely reduced vector replication capacity. Replication was restored upon complementation with a synthetic gene designed to encode a complementary tRNA-like primer, but not...... with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather...

  15. FACTORES AMBIENTALES QUE AFECTAN LA EDAD AL PRIMER PARTO Y PRIMER INTERVALO DE PARTOS EN VACAS DEL SISTEMA DOBLE PROPOSITO

    OpenAIRE

    Caty Martínez B; Luz Botero A; Oscar Vergara G

    2009-01-01

    Objetivo. Determinar los factores que influyen en la edad al primer parto (AFC) y primer intervalo de parto (PIDP) en hembras bovinas bajo el sistema de doble propósito, en la finca “El Rodeo”, municipio de Magangué, Bolívar - Colombia. Materiales y métodos. Se analizaron 379 datos provenientes de los registros productivos entre los años 1993 hasta 2002, usando el programa estadístico GLM del Statistical Analysis System, donde se obtuvieron la media y el error estándar de cada fuente de vari...

  16. Criminal Justice in the United States: A Primer

    OpenAIRE

    James B. Jacobs

    2007-01-01

    In this primer on the U.S. criminal justice system, James B. Jacobs, Warren E. Burger Professor of Law at New York University (NYU) and Director of the Center for Research in Crime and Justice at the NYU School of Law, explains the structure and basic jurisprudence of U.S. criminal law and criminal procedure.

  17. Diversity of internal structures in inhibited epoxy primers

    Directory of Open Access Journals (Sweden)

    Anthony E. Hughes

    2015-10-01

    Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.

  18. Criticality calculations with MCNP{sup TM}: A primer

    Energy Technology Data Exchange (ETDEWEB)

    Mendius, P.W. [ed.; Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-08-01

    The purpose of this Primer is to assist the nuclear criticality safety analyst to perform computer calculations using the Monte Carlo code MCNP. Because of the closure of many experimental facilities, reliance on computer simulation is increasing. Often the analyst has little experience with specific codes available at his/her facility. This Primer helps the analyst understand and use the MCNP Monte Carlo code for nuclear criticality analyses. It assumes no knowledge of or particular experience with Monte Carlo codes in general or with MCNP in particular. The document begins with a Quickstart chapter that introduces the basic concepts of using MCNP. The following chapters expand on those ideas, presenting a range of problems from simple cylinders to 3-dimensional lattices for calculating keff confidence intervals. Input files and results for all problems are included. The Primer can be used alone, but its best use is in conjunction with the MCNP4A manual. After completing the Primer, a criticality analyst should be capable of performing and understanding a majority of the calculations that will arise in the field of nuclear criticality safety.

  19. Detecting Lesch-Nyhan syndrome by solid phase primer extension

    Energy Technology Data Exchange (ETDEWEB)

    Shumaker, J.M.; Caskey, C.T. [Baylor College of Medicine, Houston, TX (United States); Metspalu, A.

    1994-09-01

    A mutation detection method based upon the wild type human HPRT sequence is presented for identification of Lesch Nyhan syndrome. The technique consists of performing a biotinlyated PCR amplification of the region of interest, followed by isolation and purification of single stranded template using magnetic separation. Allele-specific primers are annealed adjacent to the potential mutation site on the template. A terminal fluorescent deoxynucleotide addition is performed with a DNA template-dependent polymerase to distinguish between the mutant and wild-type sequence. The products are purified from unincorporated ddNTPs, eluted and finally analyzed on an ABI 373 to identify the mutation. The length of an extension primer is used as a position signature for mutations. The fidelity of nucleotide incorporation provides an excellent signal-to-noise ratio for the detection of nine HPRT mutations within eight cell lines. This method should detect all types of mutations except for repeated sequences that are longer than the primers. Moreover, the method is being extended to a solid support assay, whereby the extension primers are attached to a two-dimensional glass surface. Following extension, the solid support is analyzed for radioactive incorporation. We have shown the sequence determination of a five base region of a wild-type sequence and two different HPRT mutations. As more dense oligonucleotide arrays are produced, this method could be extended to sequence the complete coding region of HPRT.

  20. Characteristics of the population employed in primer sector in Turkey

    Directory of Open Access Journals (Sweden)

    Bayar Rüya

    2006-01-01

    Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

  1. Blood Donation and Transfusion: A Primer for Health Educators.

    Science.gov (United States)

    Felts, W. Michael; Glascoff, Mary A.

    1991-01-01

    Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)

  2. Criticality calculations with MCNP{trademark}: A primer

    Energy Technology Data Exchange (ETDEWEB)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A. [New Mexico Univ., Albuquerque, NM (United States)

    1994-06-06

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand.

  3. Alimentação de crianças no primeiro semestre de vida: enfoque no aleitamento materno exclusivo Children in the first semester of life: focus on exclusive breastfeeding

    Directory of Open Access Journals (Sweden)

    Vera Lúcia Fugita dos Santos

    2005-09-01

    Full Text Available OBJETIVOS: descrever o tipo de alimentação recebida por 205 crianças nos primeiros seis meses de vida. MÉTODOS: estudo descritivo, de caráter exploratório, enfocando-se o aleitamento materno exclusivo. A pesquisa foi realizada na cidade de Votuporanga, interior de São Paulo, durante um dia nacional de multivacinação. As informações foram obtidas por meio de entrevista estruturada com as mães das crianças incluídas no estudo. RESULTADOS: a maioria das mães amamentou, mas menos da metade realizou aleitamento materno exclusivo nos primeiros seis meses de vida do bebê. A maioria das entrevistadas tinham idade entre 15 e 31 anos; eram casadas ou viviam em união consensual; com grau de escolaridade em nível fundamental incompleto e com rendimento familiar de um até seis salários mínimos. 62,6% das mulheres receberam orientação sobre a amamentação durante o pré-natal. CONCLUSÕES: os resultados desta pesquisa apontam para a importância da investigação do tipo de alimento oferecido para a criança durante o primeiro semestre de vida; assim como para a necessidade de orientação das mulheres durante todo o ciclo reprodutivo, a fim de obtermos maior aderência ao aleitamento materno exclusivo.OBJECTIVES: describe the type of diet offered to 205 children in the first six months of life. METHOD: descriptive exploratory study, focusing on exclusive breastfeeding in the first six months of life. Survey was performed in the city of Votuporanga, interior of São Paulo, during the national day of multiple vaccination. RESULTS: the majority of mothers breastfed their children, but less than half of them exclusively in their first six months of life. The majority of respondents were between 15 and 31 years old; were married or lived with their companions; had incomplete elementary education level and family income ranged from one to six minimum salaries. 62.6% of the women were oriented on breastfeeding during prenatal care

  4. PERCEPCIÓN DE SATISFACCIÓN Y NECESIDADES EN EL ASPECTO BIO-PSICO-SOCIAL DE LOS ADULTOS MAYORES DEL BARRIO COLINAS DEL NORTE DE LA PARROQUIA COTOCOLLAO DEL DISTRITO METROPOLITANO DE QUITO DURAQNTE EL PRIMER SEMESTRE DEL AÑO 2015.

    OpenAIRE

    Gubio-Quishpe, Paola Alexandra

    2015-01-01

    Este estudio van en relación a conocer las causas que genera que el adulto mayor no pueda participar en actividades recreativas, físicas y sociales, las cuales en el desarrollo de esta Tesis se van descubriendo y aclarando a través del resultado de esta investigación. La información de este trabajo expone los cambios tanto físicos, psicológicos y sociales que adquiere el Adulto Mayor por entrar a la etapa de la vejez, cómo estos se van convirtiendo en cambios malignos por la falta especial...

  5. CONCEPCIONES Y TENDENCIAS EN LA EVALUACIÓN DEL PROFESOR UNIVERSITARIO. EL CASO DE LA UNIVERSIDAD NACIONAL DE COLOMBIA, FACULTAD DE MEDICINA, DEPARTAMENTO DE NUTRICIÓN Y TERAPIAS, PRIMER SEMESTRE DE 2005 Conceptions and tendences in evaluations to university teacheres. A case study (departament of nutririon National University of Colombia

    Directory of Open Access Journals (Sweden)

    Fabiola Becerra Bulla

    2008-03-01

    Full Text Available Antecedentes. Realizar un análisis de la evaluación que se aplica al profesor universitario teniendo en cuenta los procesos evaluativos institucionales, las políticas educativas de evaluación internacionales y nacionales, las concepciones y tendencias sobre evaluación en los Departamentos de Nutrición y Terapias de la Facultad de Medicina. Material y métodos. La investigación se enmarcó en el modelo cualitativo de investigación y de evaluación, de corte descriptivo e interpretativo. A través de la técnica de investigación denominada análisis de contenidos, se establecieron cuatro categorías que permitieron analizar la información. Resultados. El estudio evidencia que la evaluación del docente en la Universidad Nacional de Colombia se enmarca en una concepción tradicional, la cual da mayor importancia a los resultados, que a los procesos y no facilita la participación de los docentes en su diseño, análisis y toma de decisiones. Conclusiones. La evaluación parece responder a una tendencia de rendición de cuentas, basada principalmente en la medición del cumplimiento de los deberes contractuales del profesor, como son la aplicación de un programa curricular y el logro de objetivos y resultados. A partir de esta investigación es conveniente repensar la evaluación del docente dándole un carácter formativo, de manera que permita enriquecer el proceso de evaluación y más que todo la práctica docente. Al final de este artículo se presentan algunas sugerencias y recomendaciones con el fin de resignificar la evaluación que los estudiantes realizan a los profesores universitarios.Background. To do an analysis of the evaluation that is applied to university teachers taking into account the institutional evaluation processes, the national and international policies on education evaluation, the conceptions and tendencies on evaluation prevailing in the departments of nutrition and different therapies of the school of Medicine. Materials and methods. The research was framed within of qualitative model for research and evaluation, of the descriptive and interpretative type. Using the technique called contents analysis fourth categories were established for the analysis of information. Results. The study showed that the evaluation teachers of carried out in the National University of Colombia is framed within the traditional conception, that is, gave importance to the results than to the processes, without facilitating the teachers participation in its design, neither in the decision taking about why and what for the evaluation process are carried out. Conclusions. The evaluation seems to respond to the tendency to be accountable, it is mainly based in measuring how much the teacher has full filled its duties as a professor, and that much developed a curricular program its objectives and results. Taking into account the results of this research, it is advisable a new professor evaluation of teachers giving to it a formative character, in this way the evaluation process will be improved but, the teaching practices even more. Some suggestions and recommendations are given in order to provide a new meaning to the evaluation of university teachers.

  6. AUTOESTIMA EN ESTUDIANTES DE PRIMER SEMESTRE DEL PROGRAMA DE PSICOLOGÍA DE UNA UNIVERSIDAD PRIVADA DE LA COSTA CARIBE COLOMBIANA -- SELF-ESTEEM OF FIRST-SEMESTER STUDENT FROM THE PSYCHOLOGY PROGRAM AT A PRIVATE UNIVERSITY IN THE COLOMBIAN CARIBBEAN COAST

    OpenAIRE

    LILIA ANGéLICA CAMPO TERNERA; YADIRA MARTÍNEZ DE BIAVA

    2009-01-01

    Studied the level of self-esteem of students entering first semester psychology program, to then determine the effect of an intervention plan, and that self-esteem directly influences then behavior of individuals, will put the question: Which is the level of self-esteem in young people who enter the program in psychology?; for this descriptive study was organized with 128 university students of differents sexes. They were selected intencionally and were applied Coopersmith self esteem invento...

  7. AUTOESTIMA EN ESTUDIANTES DE PRIMER SEMESTRE DEL PROGRAMA DE PSICOLOGÍA DE UNA UNIVERSIDAD PRIVADA DE LA COSTA CARIBE COLOMBIANA -- SELF-ESTEEM OF FIRST-SEMESTER STUDENT FROM THE PSYCHOLOGY PROGRAM AT A PRIVATE UNIVERSITY IN THE COLOMBIAN CARIBBEAN COAST

    Directory of Open Access Journals (Sweden)

    LILIA ANGéLICA CAMPO TERNERA

    2009-06-01

    Full Text Available Studied the level of self-esteem of students entering first semester psychology program, to then determine the effect of an intervention plan, and that self-esteem directly influences then behavior of individuals, will put the question: Which is the level of self-esteem in young people who enter the program in psychology?; for this descriptive study was organized with 128 university students of differents sexes. They were selected intencionally and were applied Coopersmith self esteem inventory (1959 in an adaptation approved J.Prewitt-Diaz (1984. The main results show that men have a better acceptance and valuation of himself that the group of women, while self-esteem in relation to family, social and educational best performance was observed in the group of women, equally although differences are not significant, the group of children has a tendency towards better performance in the areas evaluated.

  8. PriSM: a primer selection and matching tool for amplification and sequencing of viral genomes

    OpenAIRE

    Yu, Qing; Ryan, Elizabeth M; Allen, Todd M.; Birren, Bruce W.; Henn, Matthew R.; Lennon, Niall J.

    2010-01-01

    Summary: PriSM is a set of algorithms designed to select and match degenerate primer pairs for the amplification of viral genomes. The design of panels of hundreds of primer pairs takes just hours using this program, compared with days using a manual approach. PriSM allows for rapid in silico optimization of primers for downstream applications such as sequencing. As a validation, PriSM was used to create an amplification primer panel for human immunodeficiency virus (HIV) Clade B.

  9. Resin bonding of metal brackets to glazed zirconia with a porcelain primer

    OpenAIRE

    Lee, Jung-Hwan; Lee, Milim; Kim, Kyoung-Nam; Hwang, Chung-Ju

    2015-01-01

    Objective The aims of this study were to compare the shear bond strength between orthodontic metal brackets and glazed zirconia using different types of primer before applying resin cement and to determine which primer was more effective. Methods Zirconia blocks were milled and embedded in acrylic resin and randomly assigned to one of four groups: nonglazed zirconia with sandblasting and zirconia primer (NZ); glazed zirconia with sandblasting, etching, and zirconia primer (GZ); glazed zirconi...

  10. SPECT single photon emission computed tomography: A primer

    International Nuclear Information System (INIS)

    This book aims to assist nuclear medicine technologists in expanding their knowledge of nuclear medicine to include SPECT. The text of this primer is written with the assumption that the reader is proficient in most elements of nuclear medicine technology; therefore, the information is limited to data that will answer the basic questions of single-photon emission computed tomography .... The authors' goal is to bring the basics of this material together in a manner that would answer the technologist's fundamental questions. The authors have designed this primer in a generic manner to be used as an extension of the manufacturer's operating manual .... A glossary is included which contains some of the terminology relevant to the specialty, and reading lists are provided at the end of each chapter to direct the reader to more comprehensive text on specific subjects

  11. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders; FINAL

    International Nuclear Information System (INIS)

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums

  12. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Bilyard, Gordon R.; Word, Charlotte J.; Weber, James R.; Harding, Anna K.

    2000-09-27

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  13. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

    1998-12-10

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  14. MERS-CoV PCR/Sequencing Primers

    OpenAIRE

    sprotocols

    2014-01-01

    Authors: Rachel Graham ### Abstract This protocol details the primers and conditions used for forward and reverse PCR amplification and sequencing of MERS-CoV genomes. ### Introduction This protocol details the steps, reagents, and conditions required to sequence MERS-CoV genomes in the forward and reverse directions. The protocol begins with the RT-PCR step, assuming that MERS-CoV RNA purified using a standard procedure (i.e., TRIzol extraction) has already been performed. ...

  15. Primer on Molecular Genetics; DOE Human Genome Program

    Science.gov (United States)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  16. El primer llibre de la Biblioteca de Comunicació

    OpenAIRE

    Moragas Spà, Miquel de,

    2010-01-01

    El primer llibre va ser "El espíritu del tiempo", d'Edgar Morin. Un llibre sobre la cultura de masses i els mitjans de comunicació, mal vist en aquells anys 70 per la sociologia més acadèmica i oficial, però de fet un dels fundadors dels estudis interdisciplinaris de la comunicació

  17. Introduction to Command, Control, and Communications: a primer

    OpenAIRE

    Eidson, Edward H.

    1995-01-01

    This thesis is a primer for students in the Introduction to Command, Control, and Communications Courses at the Naval Postgraduate School. This document provide students a consolidated reference that emphasizes key concepts and ideas presented by the course instructor and required readings. Its organization closely parallels the course outline used for in-class instruction. It supports course objectives by providing an executive overview of a wide variety of C2 topics. These topics include: C...

  18. The Primer for Sports Medicine Professionals on Imaging

    OpenAIRE

    Farshad-Amacker, Nadja A.; Jain Palrecha, Sapna; Farshad, Mazda

    2013-01-01

    Because of its inherent superior soft tissue contrast and lack of ionizing radiation, magnetic resonance imaging (MRI) is highly suited to study the complex anatomy of the shoulder joint, particularly when assessing the relatively high incidence of shoulder injuries in young, athletic patients. This review aims to serve as a primer for understanding shoulder MRI in an algorithmical approach, including MRI protocol and technique, normal anatomy and anatomical variations of the shoulder, pathol...

  19. Small Commercial Building Re-tuning: A Primer

    Energy Technology Data Exchange (ETDEWEB)

    Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas

    2013-09-30

    To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

  20. Primer on molecular genetics. DOE Human Genome Program

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  1. Fundamentals of statistical evidence—a primer for legal professionals

    OpenAIRE

    Aitken, Colin; TARONI, FRANCO

    2008-01-01

    Criminal courts are today frequently confronted with statistical evidence, notably in relation to DNA profiling. Recent experience tends to confirm both widespread perceptions and more systematic research indicating that probability and statistics are not handled confidently, or always competently, by lawyers, judges, jurors or even by forensic scientists. Conceived as a primer for legal professionals, this article reviews basic statistical terminology and its forensic applications, and explo...

  2. Sensory reception of the primer pheromone ethyl oleate

    Science.gov (United States)

    Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

    2012-05-01

    Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

  3. Perbedaan Kadar Superokside Dismutase pada Remaja dengan Dismenore Primer dan Tanpa Dismenore Primer

    Directory of Open Access Journals (Sweden)

    Yanti .

    2016-01-01

    Full Text Available Abstrak             Dismenore didefinisikan sebagai rasa kram saat menstruasi yang menyakitkan tanpa patologi yang jelas. Kram berlangsung selama satu hari atau lebih dan disertai rasa mual, diare, sakit kepala. Masalah yang ditimbulkan oleh dismenore adalah  peningkatan ketidakhadiran di sekolah pada remaja sehingga menyebabkan rendahnya nilai akademik pada pelajar. Superokside dismutase (SOD adalah bahan bioaktif yang diketahui bersifat antioksidan. SOD melindungi sel terhadap gangguan oksidan (radikal bebas. SOD mengubah anion superoksida menjadi hidrogen peroksida dan oksigen, sering disebut juga sebagai pertahanan primer terhadap stress oksidatif. Tujuan penelitian ini adalah mengetahui  perbedaan kadar superokside dismutase pada remaja dengan dismenore dan tanpa dismenore. Penelitian ini adalah observasional desain cross sectional comparative. Data dianalisis menggunakan uji Mann-Withney  dengan nilai p<0.05 dianggap bermakna secara statistik. Rerata kadar SOD pada remaja yang mengalami dismenore yaitu 36,76 u/ml dan rerata kadar SOD pada remaja tanpa dismenore yaitu 32,24 u/ml. Dengan nilai p>0,005 (0,345. Hasil penelitian ini menyimpulkan bahwa tidak terdapat perbedaan yang bermakna  kadar SOD pada remaja dengan dismenore dan tanpa dismenore. Kata kunci: remaja, dismenore, antioksidan, superokside dismutase AbstractPrimary dysmenorrhoe is  a painful menstrual cramps without obvious pathology. Cramps is lasting for one day or more, accaompanied by nausea, diarrhea and headache. Problems cause by dysmenorrhea are an increase in school attendance in adolescents resulting in low academic grades of students. Superokside Dismeutase (SOD is a bioactive ingredient that is known as antioxidants, protecting cells against harmful SOD oxidants (free radicals SOD convert superoxide anion into hydrogen perokxide and oxygen, often call  as primary defense agains oxidative stress. Primary dysmenorrhoe increased uterine activity or

  4. Sequence-related amplified polymorphism primer screening on Chinese fir (Cunninghamia lanceolata (Lamb.) Hook)

    Institute of Scientific and Technical Information of China (English)

    Huiquan Zheng; Hongjing Duan; Dehuo Hu; Ruping Wei; Yun Li

    2015-01-01

    Chinese fir (Cunninghamia lanceolata (Lamb.) Hook) is one of the most important coniferous tree species used for timber production in China. Here, we conducted a sequence-related amplified polymorphism (SRAP) primer screening assay with a total of 594 primer combinations, using 22 forward and 27 reverse primers on four repre-sentative Chinese fir genotypes. The obtained results indicated that Chinese fir genomic DNA has a notable amplification bias on the employed forward or reverse primer nucleotides (3' selection bases). Out of the tested primer sets, 35 primer combinations with clearly distin-guished bands, stable amplification, and rich polymorphism were selected and identified as optimal primer sets. These optimal primer pairs gave a total of 379 scorable bands, including 265 polymorphic bands, with an average of 10.8 bands and 7.6 polymorphic bands per primer combination. The produced band number for each optimal primer set ranged from 7 to 14 with a percentage of polymorphic bands spanning from 33.3 to 100.0%. These primer combinations could facilitate the next SRAP analysis assays in Chinese fir.

  5. Recovery of the mitochondrial COI barcode region in diverse Hexapoda through tRNA-based primers

    Directory of Open Access Journals (Sweden)

    Oh Hyun-Woo

    2010-07-01

    Full Text Available Abstract Background DNA barcoding uses a 650 bp segment of the mitochondrial cytochrome c oxidase I (COI gene as the basis for an identification system for members of the animal kingdom and some other groups of eukaryotes. PCR amplification of the barcode region is a key step in the analytical chain, but it sometimes fails because of a lack of homology between the standard primer sets and target DNA. Results Two forward PCR primers were developed following analysis of all known arthropod mitochondrial genome arrangements and sequence alignment of the tRNA-W gene which was usually located within 200 bp upstream of the COI gene. These two primers were combined with a standard reverse primer (LepR1 to produce a cocktail which generated a barcode amplicon from 125 of 141 species that included representatives of 121 different families of Hexapoda. High quality sequences were recovered from 79% of the species including groups, such as scale insects, that invariably fail to amplify with standard primers. Conclusions A cocktail of two tRNA-W forward primers coupled with a standard reverse primer amplifies COI for most hexapods, allowing characterization of the standard barcode primer binding region in COI 5' as well as the barcode segment. The current results show that primers designed to bind to highly conserved gene regions upstream of COI will aid the amplification of this gene region in species where standard primers fail and provide valuable information to design a primer for problem groups.

  6. Study of HIV-2 primer-template initiation complex using antisense oligonucleotides

    DEFF Research Database (Denmark)

    Boulmé, F; Freund, F; Gryaznov, S;

    2000-01-01

    HIV-2 reverse transcription is initiated by the retroviral DNA polymerase (reverse transcriptase) from a cellular tRNALys3 partially annealed to the primer binding site in the 5'-region of viral RNA. The HIV-2 genome has two A-rich regions upstream of the primer binding site. In contrast to HIV-1...... approach, first validated in our in vitro HIV-1 reverse transcription system. Annealing of the antisense oligonucleotides to the pre-primer binding site (the upstream region contiguous to the HIV-2 primer binding site) was determined in the presence of native tRNALys3 or synthetic primers. Using natural...... and chemically modified antisense oligonucleotides we found that interactions between the anticodon of tRNALys3 and an A-rich loop of viral RNA led to an important destabilization of the pre-primer binding site; this region became accessible to anti-pre-primer binding site oligonucleotides in a...

  7. Evaluation of antibacterial activity of three dentin primers using an in vitro tooth model.

    Science.gov (United States)

    Ohmori, K; Maeda, N; Kohno, A

    1999-01-01

    This study compared the antibacterial activities of three dentin primers and investigated a newly designed experimental system using a bovine tooth model method for evaluating antibacterial activity by comparing this method with a conventional disk diffusion method. The antibacterial activities of SA primer in Clearfil Liner Bond, LB primer in Clearfil Liner Bond II, and ED primer in Panavia 21 were evaluated using the conventional disk diffusion method. The 50 microliters aliquot of each primer was applied to three sterilized paper disks, then placed onto Tryptic Soy agar plates already inoculated with Streptococcus mutans. After anaerobic incubation for 48 hours, the diffusion of antibacterial components was determined using the inhibition zone produced around the paper disk. The diameter of the inhibition zones was measured and the average calculated. Standardized cavities (diameter 5.0 mm, depth 3.0 mm) were prepared on the labial surfaces of bovine teeth and inoculated with S mutans (10(6) CFU/microliter) following sterilization by 60Co gamma rays (50 KGy). The teeth were divided into four groups: SA primer, LB primer, ED primer, and a control group. Except for the control teeth, the cavity preparations were treated with the respective dentin primers, and then firmly sealed with a temporary sealing material. The teeth were placed in bottles containing melted Tryptic Soy agar. Five ml of Tryptic Soy broth was then added to the surface of the hardened Tryptic Soy agar. After 1 week's incubation of the teeth in the bottles at 37 degrees C, the number of bacteria remaining in each cavity was counted, except for eight specimens, which were used for SEM observation. The ED primer showed the widest inhibition zone in the disk diffusion test, which was significantly different from the other primers. Using the bovine tooth model, all dentin primers showed antibacterial activity, with significant differences found among the four groups. The results indicated that ED

  8. Cytotoxic and genotoxic evaluation of orthodontic adhesives with primer and without primer exposed to electron beam irradiation - an in-vitro study

    International Nuclear Information System (INIS)

    To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)

  9. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  10. Environmental DNA sequencing primers for eutardigrades and bdelloid rotifers

    Directory of Open Access Journals (Sweden)

    Martin Andrew P

    2009-12-01

    Full Text Available Abstract Background The time it takes to isolate individuals from environmental samples and then extract DNA from each individual is one of the problems with generating molecular data from meiofauna such as eutardigrades and bdelloid rotifers. The lack of consistent morphological information and the extreme abundance of these classes makes morphological identification of rare, or even common cryptic taxa a large and unwieldy task. This limits the ability to perform large-scale surveys of the diversity of these organisms. Here we demonstrate a culture-independent molecular survey approach that enables the generation of large amounts of eutardigrade and bdelloid rotifer sequence data directly from soil. Our PCR primers, specific to the 18s small-subunit rRNA gene, were developed for both eutardigrades and bdelloid rotifers. Results The developed primers successfully amplified DNA of their target organism from various soil DNA extracts. This was confirmed by both the BLAST similarity searches and phylogenetic analyses. Tardigrades showed much better phylogenetic resolution than bdelloids. Both groups of organisms exhibited varying levels of endemism. Conclusion The development of clade-specific primers for characterizing eutardigrades and bdelloid rotifers from environmental samples should greatly increase our ability to characterize the composition of these taxa in environmental samples. Environmental sequencing as shown here differs from other molecular survey methods in that there is no need to pre-isolate the organisms of interest from soil in order to amplify their DNA. The DNA sequences obtained from methods that do not require culturing can be identified post-hoc and placed phylogenetically as additional closely related sequences are obtained from morphologically identified conspecifics. Our non-cultured environmental sequence based approach will be able to provide a rapid and large-scale screening of the presence, absence and diversity of

  11. Bt-CoV HKU3 PCR/Sequencing Primers

    OpenAIRE

    sprotocols

    2014-01-01

    Authors: Rachel Graham ### Abstract This protocol details the primers and conditions used for forward and reverse PCR amplification and sequencing of Bt-CoV HKU3 genomes. ### Introduction This protocol details the steps, reagents, and conditions required to sequence Bt-CoV HKU3 genomes in the forward and reverse directions. The protocol begins with the RT-PCR step, assuming that BtCoV HKU3 RNA purified using a standard procedure (i.e., TRIzol extraction) has already been perfo...

  12. Bt-CoV HKU5 PCR/Sequencing Primers

    OpenAIRE

    sprotocols

    2014-01-01

    Authors: Rachel Graham ### Abstract This protocol details the primers and conditions used for forward and reverse PCR amplification and sequencing of Bt-CoV HKU5 genomes. ### Introduction This protocol details the steps, reagents, and conditions required to sequence Bt-CoV HKU5 genomes in the forward and reverse directions. The protocol begins with the RT-PCR step, assuming that BtCoV HKU5 RNA purified using a standard procedure (i.e., TRIzol extraction) has already been perfo...

  13. Debate del primer seminario de investigación

    OpenAIRE

    Ortega, Tomás

    2002-01-01

    Una vez concluidas las intervenciones de los tres ponentes del primer Seminario de Investigación (Dr. Moisés Coriat –U. Granada-, Dr. Alejandro Fernández –U. Valencia y José Carrillo -U. Huelva-), la réplica a sus informes, presentada por la Dra. Joana Brocardo, y la contrarréplica de los ponentes que siguió a la exposición de la Dra. Brocardo, comienza el debate propiamente dicho. en el que intervienen los asistentes presentes en la sala

  14. Steel Primer Chamber Assemblies for Dual Initiated Pyrovalves

    Science.gov (United States)

    Guemsey, Carl S.; Mizukami, Masashi; Zenz, Zac; Pender, Adam A.

    2009-01-01

    A solution was developed to mitigate the potential risk of ignition failures and burn-through in aluminum primer chamber assemblies on pyrovalves. This was accomplished by changing the assembly material from aluminum to steel, and reconfiguration of flame channels to provide more direct paths from initiators to boosters. With the geometric configuration of the channels changed, energy is more efficiently transferred from the initiators to the boosters. With the alloy change to steel, the initiator flame channels do not erode upon firing, eliminating the possibility of burn-through. Flight qualification tests have been successfully passed.

  15. The primer for sports medicine professionals on imaging: the shoulder.

    Science.gov (United States)

    Farshad-Amacker, Nadja A; Jain Palrecha, Sapna; Farshad, Mazda

    2013-01-01

    Because of its inherent superior soft tissue contrast and lack of ionizing radiation, magnetic resonance imaging (MRI) is highly suited to study the complex anatomy of the shoulder joint, particularly when assessing the relatively high incidence of shoulder injuries in young, athletic patients. This review aims to serve as a primer for understanding shoulder MRI in an algorithmical approach, including MRI protocol and technique, normal anatomy and anatomical variations of the shoulder, pathologic conditions of the rotator cuff tendons and muscles, the long head of the biceps tendon, shoulder impingement, labral and glenohumeral ligament pathology, MR findings in shoulder instability, adhesive capsulitis, and osteoarthritis. PMID:24381700

  16. A primer on physical-layer network coding

    CERN Document Server

    Liew, Soung Chang; Zhang, Shengli

    2015-01-01

    The concept of physical-layer network coding (PNC) was proposed in 2006 for application in wireless networks. Since then it has developed into a subfield of communications and networking with a wide following. This book is a primer on PNC. It is the outcome of a set of lecture notes for a course for beginning graduate students at The Chinese University of Hong Kong. The target audience is expected to have some prior background knowledge in communication theory and wireless communications, but not working knowledge at the research level. Indeed, a goal of this book/course is to allow the reader

  17. Plan de negocio de una escuela infantil (primer ciclo)

    OpenAIRE

    San Román Gómez, Ana de

    2014-01-01

    El presente documento establece los pasos a seguir para poner en marcha una escuela infantil en el barrio de Butarque, en Madrid. En un primer lugar se han realizado diversos estudios, tanto sobre el sector como sobre el área geográfica, ya que se partía de una situación de absoluto desconocimiento. En el análisis del sector se ha puesto de manifiesto que las competencias en educación en España están reguladas por el Ministerio en primera instancia, pero las Autonomías tienen también una g...

  18. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Weber, James R.; Schell, Charlotte J.; Marino, T; Bilyard, Gordon R.

    2004-02-10

    This version of the communication primer comprises two interlocking parts: Pat 1, a practical section, intended to prepare you for public interactions, and Part 2, a theoretical section that provides social and technical bases for the practices recommended in Part 1. The mutual support of practice and theory is very familiar in science and clearly requires a willingness to observe and revise our prior assumptions--in this document, we invoke both. We hope that is offering will represent a step both towards improving practice and maturing the theory of practical science communication.

  19. Discrete random signal processing and filtering primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2013-01-01

    Engineers in all fields will appreciate a practical guide that combines several new effective MATLAB® problem-solving approaches and the very latest in discrete random signal processing and filtering.Numerous Useful Examples, Problems, and Solutions - An Extensive and Powerful ReviewWritten for practicing engineers seeking to strengthen their practical grasp of random signal processing, Discrete Random Signal Processing and Filtering Primer with MATLAB provides the opportunity to doubly enhance their skills. The author, a leading expert in the field of electrical and computer engineering, offe

  20. Transport phenomena in Newtonian fluids a concise primer

    CERN Document Server

    Olsson, Per

    2013-01-01

    This short primer provides a concise and tutorial-style introduction to transport phenomena in Newtonian fluids , in particular the transport of mass, energy and momentum.  The reader will find detailed derivations of the transport equations for these phenomena, as well as selected analytical solutions to the transport equations in some simple geometries. After a brief introduction to the basic mathematics used in the text, Chapter 2, which deals with momentum transport, presents a derivation of the Navier-Stokes-Duhem equation describing the basic flow in a Newtonian fluid.  Also provided at

  1. Accelerating MATLAB with GPU computing a primer with examples

    CERN Document Server

    Suh, Jung W

    2013-01-01

    Beyond simulation and algorithm development, many developers increasingly use MATLAB even for product deployment in computationally heavy fields. This often demands that MATLAB codes run faster by leveraging the distributed parallelism of Graphics Processing Units (GPUs). While MATLAB successfully provides high-level functions as a simulation tool for rapid prototyping, the underlying details and knowledge needed for utilizing GPUs make MATLAB users hesitate to step into it. Accelerating MATLAB with GPUs offers a primer on bridging this gap. Starting with the basics, setting up MATLAB for

  2. A finite element primer for beginners the basics

    CERN Document Server

    Zohdi, Tarek I

    2014-01-01

    The purpose of this primer is to provide the basics of the Finite Element Method, primarily illustrated through a classical model problem, linearized elasticity. The topics covered are:(1) Weighted residual methods and Galerkin approximations,(2) A model problem for one-dimensional?linear elastostatics,(3) Weak formulations in one dimension,(4) Minimum principles in one dimension,(5) Error estimation in one dimension,(5) Construction of Finite Element basis functions in one dimension,(6) Gaussian Quadrature,(7) Iterative solvers and element by element data structures,(8) A model problem for th

  3. Atmel AVR Microcontroller Primer Programming and Interfacing, Second Edition

    CERN Document Server

    Barrett, Steven F

    2012-01-01

    This textbook provides practicing scientists and engineers a primer on the Atmel AVR microcontroller. In this second edition we highlight the popular ATmega164 microcontroller and other pin-for-pin controllers in the family with a complement of flash memory up to 128 kbytes. The second edition also adds a chapter on embedded system design fundamentals and provides extended examples on two different autonomous robots. Our approach is to provide the fundamental skills to quickly get up and operating with this internationally popular microcontroller. We cover the main subsystems aboard the ATmega

  4. Les primeres locutores de ràdio a Catalunya, dels inicis de l’invent al primer franquisme

    OpenAIRE

    Espinosa i Mirabet, Sílvia

    2009-01-01

    Aquest article posa de manifest el paper preponderant que tingueren les locutores en les emissores de ràdio que operaven a Catalunya sota l’epígraf EAJ durant els anys vint i trenta del segle XX. Les locutores foren les primeres professionals del mitjà que crearen programes (els femenins) amb un format que més endavant es coneixeria com a magazín, en un moment històric (anys vint) en el qual la ràdio estava plena de conferències i xerrades. La segona gran aportació de les dones a la història ...

  5. Primer for evaluating ecological risk at petroleum release sites.

    Science.gov (United States)

    Claff, R

    1999-02-01

    Increasingly, risk-based approaches are being used to guide decision making at sites such as service stations and petroleum product terminals, where petroleum products have been inadvertently released to the soil. For example, the API Decision Support System software, DSS, evaluates site human health risk along six different routes of exposure. The American Society for Testing and Materials' Risk-Based Corrective Action (RBCA) standard, ASTM 1739, establishes a tiered framework for evaluating petroleum release sites on the basis of human health risk. Though much of the risk assessment focus has been on human health risk, regulatory agencies recognize that protection of human health may not fully protect the environment; and EPA has developed guidance on identifying ecological resources to be protected through risk-based decision making. Not every service station or petroleum product terminal site warrants a detailed ecological risk assessment. In some cases, a simple preliminary assessment will provide sufficient information for decision making. Accordingly, the American Petroleum Institute (API) is developing a primer for site managers, to assist them in conducting this preliminary assessment, and in deciding whether more detailed ecological risk assessments are warranted. The primer assists the site manager in identifying relevant ecological receptors and habitats, in identifying chemicals and exposure pathways of concern, in developing a conceptual model of the site to guide subsequent actions, and in identifying conditions that may warrant immediate response. PMID:10189585

  6. Microsatellite Primer Development for Post Oak, Quercus stellata (Fagaceae

    Directory of Open Access Journals (Sweden)

    Warren B. Chatwin

    2014-10-01

    Full Text Available Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata. This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.

  7. De neurocirujano a primer ministro de Salud de la Argentina

    Directory of Open Access Journals (Sweden)

    Karina Inés Ramacciotti

    2008-01-01

    Full Text Available La trayectoria y los vínculos que entabló Ramón Carrillo con anterioridad a ejercer el cargo de primer secretario de Salud Pública en la Argentina (1946 no han sido objeto de estudio pormenorizado. Así pues en este artículo se analizarán en primer lugar, una serie de cartas de lectores publicadas en La Semana Médica en los primeros años de la década del '40 del siglo XX. Estas notas permiten comprender las disputas internas que se produjeron en la Facultad de Ciencias Médicas al producirse el concurso de Titular de Neurocirugía de la Universidad de Buenos Aires. En segundo lugar, se revisará cómo Carrillo pasa de ocupar este prestigioso cargo académico a convertirse en decano interi- no de la Facultad de Ciencias Médicas. Son las relaciones que anuda durante estos años las que lo posicionan en un escenario político privilegiado para alcanzar un relevante puesto en la administración pública.

  8. Performance testing of lead free primers: blast waves, velocity variations, and environmental testing

    CERN Document Server

    Courtney, Elya; Summer, Peter David; Courtney, Michael

    2014-01-01

    Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blast waves, muzzle velocities, and ignition delay are presented after environmental conditioning (150 days) for two lead based and two DDNP based primers under cold and dry (-25 deg C,0% relative humidity), ambient (20 deg C, 50% relative humidity), and hot & humid (50 deg C, 100% relative humidity) conditions in 5.56 mm NATO. Taken together, these results indicate that DDNP based primers are not sufficiently reliable for service use.

  9. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    DEFF Research Database (Denmark)

    Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

    2011-01-01

    settings. RESULTS: We describe a PCR method for quantification of microRNAs based on a single reverse transcription reaction for all microRNAs combined with real-time PCR with two, microRNA-specific DNA primers. Primer annealing temperatures were optimized by adding a DNA tail to the primers and could be...... designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision in...

  10. A sputtered zirconia primer for improved thermal shock resistance of plasma-sprayed ceramic turbine seals

    Science.gov (United States)

    Bill, R. C.; Sovey, J.; Allen, G. P.

    1981-01-01

    It is shown that the application of sputtered Y2O3-stabilized ZrO2 (YSZ) primer in plasma-sprayed YSZ ceramic-coated turbine blades results in an improvement, by a factor of 5-6, in the thermal shock life of specimens with a sprayed, porous, Ni-Cr-Al-Y intermediate layer. Species with and without the primer were found to be able to survive 1000 cycles when the intermediate layer was used, but reduced laminar cracking was observed in the specimen with the primer. It is suggested that the sputtered YZS primer-induced properties are due to (1) more effective wetting and adherence of the plasma-sprayed YZS particles to the primer, and (2) the primer's retardation of impinging, molten plasma sprayed particles solidification rates, which result in a less detrimental residual stress distribution.

  11. Selection of functional tRNA primers and primer binding site sequences from a retroviral combinatorial library: identification of new functional tRNA primers in murine leukemia virus replication

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Pedersen, F S

    2000-01-01

    Retroviral reverse transcription is initiated from a cellular tRNA molecule and all known exogenous isolates of murine leukemia virus utilise a tRNA(Pro)molecule. While several studies suggest flexibility in murine leukemia virus primer utilisation, studies on human immunodeficiency virus and avian...... retro-viruses have revealed evidence of molecular adapt-ation towards the specific tRNA isoacceptor used as replication primer. In this study, murine leukemia virus tRNA utilisation is investigated by in vivo screening of a retroviral vector combinatorial library with randomised primer binding sites....... While most of the selected primer binding sites are complementary to the 3'-end of tRNA((Pro)), we also retrieved PBS sequences matching four other tRNA molecules and demonstrate that Akv murine leukemia virus vectors may efficiently replicate using tRNA(Arg(CCU)), tRNA(Phe(GAA))and a hitherto unknown...

  12. Informe MERCOSUL número 13 : segundo semestre 2007-primeiro semestre 2008

    OpenAIRE

    Ricardo Carciofi; Uziel Nogueira; Romina Eliana Gayá; Rosario Campos; Alejandro Ramos; BID. INTAL

    2009-01-01

    O Mercado Comum do Sul (MERCOSUL) foi constituído a partir da assinatura do Tratado de Assunçao, em 1991, com o objetivo de avaliar os êxitos e os desafios que encerra o processo de integraçao vigente na América Latina e no Caribe. A intençao do INTAL, mediante a publicaçao do Informe MERCOSUL, é facilitar, para um universo de potenciais leitores interessados nesta regiao, o acesso à informaçao. Trata-se, também, de ultrapassar o interesse que o MERCOSUL desperta no nível sub-regional, facili...

  13. A method for predicting service life of zinc rich primers on carbon steel

    Science.gov (United States)

    Hoppesch, C. W.

    1986-01-01

    The service life of zinc rich primers on carbon steel can be estimated by immersing a primer coated glass slide into an aqueous copper sulfate solution and measuring the amount of zinc that reacts with the copper in 15 minutes. This zinc availability test was used to evaluate eleven primers currently available for which marine beach exposure data was available from previous programs. Results were evaluated and a correlation between zinc availability and ASTM rust grade was shown.

  14. Comparison of shear bond strength of orthodontic brackets using various zirconia primers

    OpenAIRE

    Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju

    2015-01-01

    Objective The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. Methods We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). ...

  15. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei

    2008-12-01

    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  16. Predicting the success of primer extension genotyping assays using statistical modeling

    OpenAIRE

    Yuryev, Anton; Huang, Jianping; Pohl, Mark; Patch, Robert; Watson, Felicia; Bell, Peter; Donaldson, Miriam; Phillips, Michael S.; Boyce-Jacino, Michael T.

    2002-01-01

    Using an empirical panel of more than 20 000 single base primer extension (SNP-IT) assays we have developed a set of statistical scores for evaluating and rank ordering various parameters of the SNP-IT reaction to facilitate high-throughput assay primer design with improved likelihood of success. Each score predicts either signal magnitude from primer extension or signal noise caused by mispriming of primers and structure of the PCR product. All scores have been shown to correlate with the su...

  17. An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET

    Energy Technology Data Exchange (ETDEWEB)

    Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)

    2011-01-15

    Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.

  18. The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

    Science.gov (United States)

    Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

    1995-01-01

    The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

  19. An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET

    International Nuclear Information System (INIS)

    Research highlights: → Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. → The solvents of the primer are eco-friendly ones. → The primer adheres on galvanized steel and allows top-coating. → The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.

  20. Selection and development of representative simple sequence repeat primers and multiplex SSR sets for high throughput automated genotyping in maize

    Institute of Scientific and Technical Information of China (English)

    WANG FengGe; ZHAO JiuRan; DAI JingRui; YI HongMei; KUANG Meng; SUN YanMei; YU XinYan; GUO JingLun; WANG Lu

    2007-01-01

    In the current study, 1900 maize simple sequence repeat (SSR) primers published in MaizeGDB were screened utilizing reference literature, 15 representative Chinese maize inbred lines and 15 Chinese maize hybrids from national regional testing. In total, 500 highly polymorphic primers were identified and used to construct a genetic map. 100 evenly distributed primers, 10 primers per chromosome, were further selected as a set of universal SSR core primers, recommended as preferred primers for general studies. These core primers were then redesigned and used to construct a high throughput multiplex PCR system based on a five-color fluorescence capillary detection system. We report here that two sets of ten-plex PCR combinations have been constructed, each consisting of 10 primers, with one primer per chromosome.

  1. Arquitectura automatizada de comercio electrónico

    OpenAIRE

    Borrego, I.; Hernández, M.J.; Francisco José GARCÍA PEÑALVO; Curto Diego, María Belén; Moreno Rodilla, Vidal; Hernández Simón, Juan Andrés

    2001-01-01

    El objetivo de este trabajo es el desarrollo de una arquitectura concreta de comercio electrónico que integre servicios B2B y B2C, facilitando la incorporación de las empresas a este ámbito de negocio. Se pretende proporcionar un entorno automático que permita a una empresa diseñar su propia estrategia de negocio en Internet, minimizando las tareas demantenimiento del sitio de comercio electrónico, reduciendo así los costes de la expansión de la empresa.

  2. HERRAMIENTAS AUTOMATIZADAS PARA LA GESTIÓN DE PROYECTOS

    Directory of Open Access Journals (Sweden)

    Anaisa Hernández González

    2006-12-01

    Full Text Available

    La dirección de proyectos implica la realización de un conjunto de procesos que generan y utilizan información que se usa durante el ciclo de vida del proyecto para controlarlo. En este trabajo se presentan algunas herramientas para la gestión integrada de proyectos, haciendo hincapié en el soporte que brindan a las áreas de conocimiento de la dirección de proyectos.

  3. Lenguaje natural e indización automatizada

    OpenAIRE

    Méndez, Eva; Moreiro González, José A.

    1999-01-01

    This paper reflects a thughful study about the use of natural language in automatic indexing systmes, from Data Bases and the Digital Management of Documents to full-text indexing of scientific electronic publications indexed in the Web. It offers a theoric approach to automatic intexing, pointing out the role that natural language (no controled) has demonstrated throughout its evolution. It also shows the last trends of automatic indexing founded in knowledge bases. The research finishes inc...

  4. Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

    Directory of Open Access Journals (Sweden)

    Li Kelvin

    2012-11-01

    Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

  5. A matter of degrees: A primer on global warming

    International Nuclear Information System (INIS)

    A primer on global warming is presented in order to provide information to Canadians on making environmentally responsible decisions. The fundamentals of natural climate change, the atmospheric environment, factors that influence climate, and the greenhouse effect are explained. Global warming is then discussed with reference to paleoclimatic research, the influence of human activity on increased concentrations of greenhouse gases, and predictions of future climates. The possible impacts of global warming on Canada are described for such sectors as forests, fisheries, agriculture, sea levels, health, energy supply and demand, and the Arctic regions. The actions that citizens and governments can take in order to mitigate or adapt to global warming are then presented. A glossary and index are included. 55 refs., 17 figs

  6. Demystifying eResearch a primer for librarians

    CERN Document Server

    Martin, Victoria

    2014-01-01

    Today's librarians need to be technology-savvy information experts who understand how to manage datasets. Demystifying eResearch: A Primer for Librarians prepares librarians for careers that involve eResearch, clearly defining what it is and how it impacts library services and collections, explaining key terms and concepts, and explaining the importance of the field. You will come to understand exactly how the use of networked computing technologies enhances and supports collaboration and innovative methods particularly in scientific research, learn about eResearch library initiatives and best practices, and recognize the professional development opportunities that eResearch offers. This book takes the broad approach to the complex topic of eResearch and how it pertains to the library community, providing an introduction that will be accessible to readers without a background in electronic research. The author presents a conceptual overview of eResearch with real-world examples of electronic research activit...

  7. El Primer Congreso de la Cultura del Olivo

    Directory of Open Access Journals (Sweden)

    Criado Costa, Joaquín

    2008-06-01

    Full Text Available It is studied the notification, the organization and the development of the First Conference on the Olive Culture as an activity shared by the CECEL, the Institute of Jaen Studies, the Institute of La Mancha Studies and the Royal Academy of Science, Fine Literature and Noble Arts of Cordoba with the support of Jaen Provincial Council.Se estudia la convocatoria, organización y desarrollo del Primer Congreso de la Cultura del Olivo como actividad conjunta de la CECEL, el Instituto de Estudios Jiennenses, el Instituto de Estudios Manchegos y la Real Academia de Ciencias, Bellas Letras y Nobles Artes de Córdoba, con el patrocinio de la Diputación Provincial de Jaén.

  8. Primer Part 1-The building blocks of epilepsy genetics.

    Science.gov (United States)

    Helbig, Ingo; Heinzen, Erin L; Mefford, Heather C

    2016-06-01

    This is the first of a two-part primer on the genetics of the epilepsies within the Genetic Literacy Series of the Genetics Commission of the International League Against Epilepsy. In Part 1, we cover the foundations of epilepsy genetics including genetic epidemiology and the range of genetic variants that can affect the risk for developing epilepsy. We discuss various epidemiologic study designs that have been applied to the genetics of the epilepsies including population studies, which provide compelling evidence for a strong genetic contribution in many epilepsies. We discuss genetic risk factors varying in size, frequency, inheritance pattern, effect size, and phenotypic specificity, and provide examples of how genetic risk factors within the various categories increase the risk for epilepsy. We end by highlighting trends in epilepsy genetics including the increasing use of massive parallel sequencing technologies. PMID:27226047

  9. ParaDiS-FEM dislocation dynamics simulation code primer

    International Nuclear Information System (INIS)

    The ParaDiS code is developed to study bulk systems with periodic boundary conditions. When we try to perform discrete dislocation dynamics simulations for finite systems such as thin films or cylinders, the ParaDiS code must be extended. First, dislocations need to be contained inside the finite simulation box; Second, dislocations inside the finite box experience image stresses due to the free surfaces. We have developed in-house FEM subroutines to couple with the ParaDiS code to deal with free surface related issues in the dislocation dynamics simulations. This primer explains how the coupled code was developed, the main changes from the ParaDiS code, and the functions of the new FEM subroutines.

  10. ParaDiS-FEM dislocation dynamics simulation code primer

    Energy Technology Data Exchange (ETDEWEB)

    Tang, M; Hommes, G; Aubry, S; Arsenlis, A

    2011-09-27

    The ParaDiS code is developed to study bulk systems with periodic boundary conditions. When we try to perform discrete dislocation dynamics simulations for finite systems such as thin films or cylinders, the ParaDiS code must be extended. First, dislocations need to be contained inside the finite simulation box; Second, dislocations inside the finite box experience image stresses due to the free surfaces. We have developed in-house FEM subroutines to couple with the ParaDiS code to deal with free surface related issues in the dislocation dynamics simulations. This primer explains how the coupled code was developed, the main changes from the ParaDiS code, and the functions of the new FEM subroutines.

  11. A health and safety primer for the practicing health physicist

    International Nuclear Information System (INIS)

    Environmental restoration (ER) is the process of removing a facility from service, the demolition of structures the identification and disposal of all hazardous and radioactive wastes, the decontamination of equipment and materials, and the restoration of a site for unrestricted use. The number of ER projects encompassing hazardous, industrial, and radiological conditions is expected to increase in response to various program requirements or mission changes. As a result, the practicing health physicist (HP) may have to address unique health and safety (H and S) issues beyond those of performing routine radiological activities. These unique H and S issues could include, but are not limited to the razing of buildings, the removal of radioactive materials and hazardous chemicals, below-grade excavation, confined space entry, storing flammable or combustible liquids, monitoring exposure to hazardous substances, contacting energized systems (e.g., electricity, hydraulics), noise abatement, the nullification of manufacturer warranties, and the operation and movement of heavy equipment. The purpose of this paper is to educate the practicing HP about these issues by reviewing specific regulations governing all H and S activities, and to provide an example of a site-specific H and S primer (e.g., Health and Safety Plan [HASP]). This primer advices the practicing HP about sound H and S principles, furnishes basic strategies for performing a hazard assessment/job safety analysis (HA/JSA) that can be applied to any ER project, and describes various engineering and administrative controls to mitigate hazardous exposures to ER personnel. In addition, 26 inspection checklist topics are available from the primary author to evaluate the adequacy of the engineering and administrative controls, or to necessitate the use of personal protective equipment (PPE) thereby mitigating the corresponding hazard. (author)

  12. Transfer of primer binding site-mutated simian immunodeficiency virus vectors by genetically engineered artificial and hybrid tRNA-like primers

    DEFF Research Database (Denmark)

    Hansen, A C; Grunwald, T; Lund, Anders Henrik;

    2001-01-01

    Simian immunodeficiency viruses (SIV) harbor primer binding sites (PBS) matching tRNA or tRNA. To study determinants of primer usage in SIV, a SIVmac239-based vector was impaired by mutating the PBS to a sequence (PBS-X2) with no match to any tRNA. By cotransfection of a synthetic gene encoding a t...... could be obtained by cotransfection of a gene for an engineered tRNA(Pro)-tRNA hybrid with a match to PBS-Pro. The importance of tRNA backbone identity was further analyzed by complementing the PBS-X2 vector with a gene for a matching x2 primer with a tRNA backbone, which led to three- to fourfold......-higher titers than those observed for the x2 primer with the tRNA(Pro) backbone. In summary, our results demonstrate flexibility in PBS and primer usage for SIVmac239, with PBS-primer complementarity being the major determinant, in analogy with previous findings for murine leukemia viruses and human...

  13. La Reforma Fiscal Durante el Primer Año de la Administración Bush

    OpenAIRE

    Crane, R

    1991-01-01

    LA REFORMA FISCAL DURANTE EL PRIMER AÑO DE LA ADMINISTRACIÓN BUSH Randall Crane* RESUMEN Este ensayo analiza las reformas de la política económica de Estados Unidos en el primer año de la administración del  ...

  14. The Universal Primer - An open source solution for archiving, organizing and streaming live lectures

    DEFF Research Database (Denmark)

    Christoffersen, Marc Juul; Panton, Hans Christian Hansen; Krajowski-Kukiel, Maciej;

    2011-01-01

    goal of the Universal Primer is to address these problems, and allow anyone, anywhere, to teach or learn anything that can be reasonably taught or learned through a computer. The Universal Primer is 1: A fully open source solution for streaming live lectures. And 2: A Wikipedia-like website for...

  15. Gold nanoparticle-assisted primer walking for closing the human chromosomal gap

    DEFF Research Database (Denmark)

    Li, H; Shi, B; Li, X;

    2013-01-01

    NPs) to improve the efficiency in primer walking amplification. We used this strategy to close a gap in human chromosome 5 containing a DNA stretch composed of the 12SAT repeat. The obtained gap sequence is highly conserved among several mammalian genomes. The demonstrated AuNP-assisted primer walking strategy...

  16. Changes of 5' Terminal Nucleotides of PCR Primers Causing Variable T-A Cloning Efficiency

    Institute of Scientific and Technical Information of China (English)

    Mei-Qin Liu; Xin Shen; Wei-Lun Yin; Cun-Fu Lu

    2007-01-01

    T-A cloning takes advantage of the unpaired adenosyl residue added to the 3' terminus of amplified DNAs by Taq and other thermostable DNA polymerase and uses a linearized plasmid vector with a protruding 3' thymidylate residue at each of its 3' termini to clone polymerase chain reaction (PCR)-derived DNA fragments. It is a simple,reliable, and efficient ligation-dependent cloning method for PCR products, but the drawback of variable cloning efficiency occurs during application. In the present work, the relationship between variable T-A cloning efficiency and the different 5' end nucleotide base of primers used in PCR amplification was studied. The results showed that different cloning efficiency was obtained with different primer pairs containing A, T, C and G at the 5' terminus respectively. The data shows that when the 5' end base of primer pair was adenosyl, more white colonies could be obtained in cloning the corresponding PCR product in comparison with other bases. And the least white colonies were formed when using the primer pair with 5' cytidylate end. The gluanylate end primers resulted in almost the same cloning efficiency in the white colonies amount as the thymidylate end primer did, and this efficiency was much lower than that of adenosyl end primers. This presumably is a consequence of variability in 3'dA addition to PCR products mediated by Taq polymerase. Our results offer instructions for primer design for researchers who choose T-A cloning to clone PCR products.

  17. Taxon-specific PCR primers to detect two inconspicuous arbuscular mycorrhizal fungi from temperate agricultural grassland

    NARCIS (Netherlands)

    Gamper, H.A.; Leuchtmann, A.

    2007-01-01

    Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking region

  18. Composing Effective and Efficient E-mails: A Primer for Pharmacy Practitioners.

    Science.gov (United States)

    Summerfield, Marc R; Feemster, Agnes Ann

    2015-09-01

    This primer describes the purpose and importance of e-mail as a key communication medium in the workplace. It emphasizes clarity as a primary modality to enhance efficiency and effectiveness. Finally, the primer reviews elements of grammar, punctuation, and style that contribute to each e-mail's ability to meet language standards, enhance the writer's image, and successfully transmit information. PMID:26715801

  19. Primer for identifying cold-water refuges to protect and restore thermal diversity in riverine landscapes

    Science.gov (United States)

    EPA recently released a primer that provides guidance to Region 10 Tribes, States, and local watershed community groups to support the identification, protection, and restoration of critical cold water refuges for the protection of salmonids. This primer will assist these entiti...

  20. Demystifying Special Education in Virtual Charter Schools. Special Report. Primers on Special Education in Charter Schools

    Science.gov (United States)

    Rhim, Lauren Morando; Kowal, Julie

    2008-01-01

    This special report is a supplement to a series of special education primers created to inform state officials, authorizers and charter school operators about special education in the charter sector. The primer series also provides tools to help these stakeholders build charter school capacity to provide special education and related services. In…

  1. Degenerative primer design and gene sequencing validation for select turkey genes.

    Science.gov (United States)

    Hutsko, Stephanie L; Lilburn, Michael S; Wick, Macdonald

    2016-06-01

    We successfully designed and validated degenerative primers for turkey genes MUC2, RPS13, TBP and TFF2 based on chicken sequences in order to use gene transcription analysis to evaluate (quantify) the mucin transcription to probiotic supplementation in turkeys. Primers were designed for the genes MUC2, TFF2, RPS13 and TBP using a degenerative primer design method based on the available Gallus gallus sequences. All primer sets, which produced a single PCR amplicon of the expected sizes, were cloned into the TOPO(®) vector and then transformed into TOP 10(®) competent cells. Plasmid DNA isolation was performed on the TOP10(®) cell culture and sent for sequencing. Sequences were analyzed using NCBI BLAST. All genes sequenced had over 90% homology with both the chicken and predicted turkey sequences. The sequences were used to design new 100% homologous primer sets for the genes of interest. PMID:27053625

  2. KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input

    Energy Technology Data Exchange (ETDEWEB)

    Busch, R.D.

    2003-01-17

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a.

  3. Midwestern High-Level Radioactive Waste Transportation Primer

    International Nuclear Information System (INIS)

    The Midwestern High-level Radioactive Waste Transportation Primer was prepared for the purpose of identifying and analyzing regional issues pertaining to the transportation of high-level radioactive waste and to inform Midwestern state officials with respect to technical issues and regulatory concerns related to waste transportation. The report contains an introduction which presents historical information and a discussion of public opinion regarding nuclear power and its economic competitiveness. Section 1 discusses the Civilian Radioactive Waste Management Program including the need for a waste disposal program, requirements of the Nuclear Waste Policy Act (NWPA) as amended, and obstacles to implementing the NWPA. Section 2 presents the technical program with discussions of waste generators, the monitored retrievable storage facility, the geologic repository, and the transportation system. Section 3 discusses the institutional program with respect to the federal government; states, tribes, and other interested parties; and transportation issues including modal mix, highway routing, rail routing, safeguarding shipments, accident reporting, transporting defense wastes, emergency preparedness and response, training, liability, inspection and enforcement, and state, tribal, and local regulation of transportation. 165 refs., 20 figs., 29 tabs. (MB)

  4. The corrosion mechanisms for primer coated 2219-T87 aluminum

    Science.gov (United States)

    Danford, Merlin D.; Knockemus, Ward W.

    1987-01-01

    To investigate metal surface corrosion and the breakdown of metal protective coatings, the ac Impedance Method was applied to zinc chromate primer coated 2219-T87 aluminum. The EG&GPARC Model 368 ac Impedance Measurement System, along with dc measurements with the same system using the Polarization Resistance Method, was used to monitor changing properties of coated aluminum disks immersed in 3.5 percent NaCl solutions buffered at pH 5.5 and pH 8.2 over periods of 40 days each. The corrosion system can be represented by an electronic analog called an equivalent circuit consisting of resistors and capacitors in specific arrangements. This equivalent circuit parallels the impedance behavior of the corrosion system during a frequency scan. Values for resistances and capacitances, that can be assigned in the equivalent circuit following a least squares analysis of the data, describe changes occurring on the corroding metal surface and in the protective coatings. A suitable equivalent circuit has been determined which predicts the correct Bode phase and magnitude for the experimental sample. The dc corrosion current density data are related to equivalent circuit element parameters.

  5. An ASIC Low Power Primer Analysis, Techniques and Specification

    CERN Document Server

    Chadha, Rakesh

    2013-01-01

    This book provides an invaluable primer on the techniques utilized in the design of low power digital semiconductor devices.  Readers will benefit from the hands-on approach which starts form the ground-up, explaining with basic examples what power is, how it is measured and how it impacts on the design process of application-specific integrated circuits (ASICs).  The authors use both the Unified Power Format (UPF) and Common Power Format (CPF) to describe in detail the power intent for an ASIC and then guide readers through a variety of architectural and implementation techniques that will help meet the power intent.  From analyzing system power consumption, to techniques that can employed in a low power design, to a detailed description of two alternate standards for capturing the power directives at various phases of the design, this book is filled with information that will give ASIC designers a competitive edge in low-power design. Starts from the ground-up and explains what power is, how it is measur...

  6. Neurociencia y bilingüismo: efecto del primer idioma

    Directory of Open Access Journals (Sweden)

    Germary Díaz-Sánchez

    2013-08-01

    Full Text Available Desde la perspectiva neurobiológica, en este trabajo abordamos los efectos del idioma materno sobre el aprendizaje de una segunda lengua. Aunque existen investigaciones en diferentes países sobre este problema, pocas tratan el enfoque de la neurobiología y, menos aún, cuando se trata del español como idioma materno. Para la investigación se recopiló literatura descriptiva y experimental, con el fin de obtener los datos necesarios para alcanzar los objetivos; se realizó un metaanálisis cualitativo de los datos obtenidos, utilizando tablas de correlación. Los datos reflejaron que la adquisición de un segundo idioma siempre va a estar mediatizada por los esquemas ya establecidos del primer idioma y que existen aspectos neurobiológicos que subyacen a algunos mecanismos de interferencia y a la adquisición de un segundo lenguaje. Además, encontramos que, mientras más similares sean los idiomas, los mecanismos neurales subyacentes facilitan la transferencia del uno al otro.

  7. Primer reporte de alcaptonuria en el Perú

    Directory of Open Access Journals (Sweden)

    Daniel Guillén-Mendoza

    2014-10-01

    Full Text Available La alcaptonuria es un error innato del metabolismo causado por la deficiencia de la homogentisiato 1,2 dioxidasa (HGD, produciéndose un exceso de ácido homogentísico (HGA. Se presenta el caso de una mujer de 57 años quien, desde que nació, su orina se tornaba de color negro; desde hacía 9 años presentaba una pigmentación verdosa en los lechos ungueales que no mejoró con tratamientos antifúngicos y en los últimos 9 meses presentó artrosis de articulaciones grandes que fue empeorando, forzándola a usar una silla de ruedas por el intenso dolor generado por la artrosis de caderas y columna lumbar. Por la descripción de los síntomas se le solicitó la medición de HGA en orina lo que confirmó el diagnóstico de alcaptonuria. Se sugirieron analgésicos, dieta sin productos que contuvieran tirosina y fue referida para cirugía de reemplazo de cadera. Se trata del primer reporte de caso de alcaptonuria en el Perú.

  8. Primer reporte de alcaptonuria en el Perú

    Directory of Open Access Journals (Sweden)

    Daniel Guillén-Mendoza

    2014-12-01

    Full Text Available La alcaptonuria es un error innato del metabolismo causado por la deficiencia de la homogentisiato 1,2 dioxidasa (HGD, produciéndose un exceso de ácido homogentísico (HGA. Se presenta el caso de una mujer de 57 años quien, desde que nació, su orina se tornaba de color negro; desde hacía 9 años presentaba una pigmentación verdosa en los lechos ungueales que no mejoró con tratamientos antifúngicos y en los últimos 9 meses presentó artrosis de articulaciones grandes que fue empeorando, forzándola a usar una silla de ruedas por el intenso dolor generado por la artrosis de caderas y columna lumbar. Por la descripción de los síntomas se le solicitó la medición de HGA en orina lo que confirmó el diagnóstico de alcaptonuria. Se sugirieron analgésicos, dieta sin productos que contuvieran tirosina y fue referida para cirugía de reemplazo de cadera. Se trata del primer reporte de caso de alcaptonuria en el Perú.

  9. Esteatosis en un burro (Equus asinus. Primer reporte en Colombia

    Directory of Open Access Journals (Sweden)

    José Cardona Á.

    2011-12-01

    Full Text Available Se describe un caso de esteatosis en un burro (Equus asinus, castrado, de 15 años de edad, procedente del municipio de San Antero (Córdoba, Colombia, al cual se le detectó ligamento nucal engrosado, duro y doloroso, dando la impresión de un doble cuello y edemas subcutáneos indurados en pared costal, abdominal y pectoral. Tambiénpresentó masas duras en la unión de músculos semimembranoso y semitendinoso. Por todo lo anterior, mostró dificultad para realizar movimientos coordinados del cuello, nuca y de traslado. Estos hallazgos obedecen principalmente a una deficiencia de selenio y vitamina E, sirviendo como parámetro diagnóstico para la identificación de esta enfermedad en equinos, por lo cual se determinó la actividad eritrocitica de la enzima glutatión peroxidada (GSH-Px, arrojando resultados muy bajos. Este cuadro es también conocido en equinos como enfermedad de la grasa amarilla o esteatitis, que produce degeneración del tejido adiposo, siendo reemplazado por tejido conectivo con depósitos de calcio. Puede estar asociada a miodegeneración nutricional o distrófica (enfermedad del músculo blanco. Es el primer reporte de esta enfermedad en burros(Equus asinus que se hace en Colombia.

  10. Influence of Ortho Primer Morelli adhesion booster on orthodontic brackets shear bond strength

    Directory of Open Access Journals (Sweden)

    Sabrina de Mendonça Invernici

    2012-06-01

    Full Text Available OBJECTIVE: This work aimed at assessing the bond strength (AS, the site of the flaw and the relation between them and Ortho Primer Morelli® (OPM adhesion optimizer. METHODS: Sixty test specimens, made out of bovine permanent lower incisors, were divided into three groups: TXT Primer (control, in which a conventional adhesive system was applied (primer and paste; OPM, in which TXT primer was replaced by OPM; and TXT without Primer, in which only TXT paste was used. A shear force was applied at a speed of 0,5 mm/min. Failure site was assessed by the Remaining Adhesion Index (RAI. RESULTS: Kruskal-Wallis demonstrated that OPM (8.54 ± 1.86 MPa presented a statistically higher AS (p 0.05 between TXT with or without Primer (6.42 ± 2.12 MPa. Regarding the RAI, the K test demonstrated that TXT Primer and OPM (prevailing scores 2 and 3 showed higher values (p 0.05. CONCLUSION: OPM increases AS and presents the same bond failure location if compared to a conventional adhesive system; the use of the TXT adhesive system paste only was shown to have the same AS if compared to conventional systems, except it does not allow to predict the adhesive failure site; there is no correlation between AS and bond failure location, regardless of the use of any adhesion optimizer.

  11. Construction of Specific Primers for Rapid Detection of South African Exportable Vegetable Macergens

    Directory of Open Access Journals (Sweden)

    Bukola Rhoda Aremu

    2015-09-01

    Full Text Available Macergens are bacteria causing great damages to the parenchymatous tissues of vegetable both on the field and in transit. To effectively and rapidly investigate the diversity and distribution of these macergens, four specific primers were designed by retrieving 16S rDNA sequences of pectolytic bacteria from GenBank through the National Center for Biotechnology Information (NCBI. These were aligned using ClusterW via BioEdit and primers were designed using Primer3Plus platform. The size and primer location of each species and PCR product size were accurately defined. For specificity enhancement, DNA template of known macergens (Pectobacterium chrysanthermi and fresh healthy vegetable were used. These primers yielded expected size of approximately 1100 bp product only when tested with known macergens and no amplicon with fresh healthy vegetable was detected. Rapid detection of macergens in rotten vegetable samples was then carried out using these primers. Nucleotide sequences of macergens identified were deposited into the GenBank and were assigned accession numbers. Hence, with these specific primers, macergens can be identified with minimal quantities of the vegetable tissues using molecular techniques, for future use of the quarantine section of the Agricultural Department of the country for quick and rapid detection of macergens before exportation.

  12. Optimization of primer design for the detection of variable genomic lesions in cancer.

    Science.gov (United States)

    Bashir, Ali; Liu, Yu-Tsueng; Raphael, Benjamin J; Carson, Dennis; Bafna, Vineet

    2007-11-01

    Primer approximation multiplex PCR (PAMP) is a new experimental protocol for efficiently assaying structural variation in genomes. PAMP is particularly suited to cancer genomes where the precise breakpoints of alterations such as deletions or translocations vary between patients. The design of PCR primer sets for PAMP is challenging because a large number of primer pairs are required to detect alterations in the hundreds of kilobases range that can occur in cancer. These sets of primers must achieve high coverage of the region of interest, while avoiding primer dimers and satisfying the physico-chemical constraints of good PCR primers. We describe a natural formulation of these constraints as a combinatorial optimization problem. We show that the PAMP primer design problem is NP-hard, and design algorithms based on simulated annealing and integer programming, that provide good solutions to this problem in practice. The algorithms are applied to a test region around the known CDKN2A deletion, which show excellent results even in a 1:49 mixture of mutated:wild-type cells. We use these test results to help set design parameters for larger problems. We can achieve near-optimal designs for regions close to 1 Mb. PMID:17766270

  13. Guidelines for the tetra-primer ARMS-PCR technique development.

    Science.gov (United States)

    Medrano, Ruan Felipe Vieira; de Oliveira, Camila Andréa

    2014-07-01

    The tetra-primer amplification refractory mutation system-polymerase chain (ARMS-PCR) reaction is a simple and economical method to genotype single-nucleotide polymorphisms (SNPs). It uses four primers in a single PCR and is followed just by gel electrophoresis. However, the optimization step can be very hardworking and time-consuming. Hence, we propose to demonstrate and discuss critical steps for its development, in a way to provide useful information. Two SNPs that provided different amplification conditions were selected. DNA extraction methods, annealing temperatures, PCR cycles protocols, reagents, and primers concentration were also analyzed. The use of tetra-primer ARMS-PCR could be impaired for SNPs in DNA regions rich in cytosine and guanine and for samples with DNA not purified. The melting temperature was considered the factor of greater interference. However, small changes in the reagents concentration significantly affect the PCR, especially MgCl2. Balancing the inner primers band is also a key step. So, in order to balance the inner primers band, intensity is important to observe which one has the weakest band and promote its band by increasing its concentration. The use of tetra-primer ARMS-PCR attends the expectations of modern genomic research and allows the study of SNPs in a fast, reliable, and low-cost way. PMID:24519268

  14. A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

    Energy Technology Data Exchange (ETDEWEB)

    Warwick, William M.

    2002-06-03

    This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

  15. Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples 1

    OpenAIRE

    Alexandre R. Zuntini; Fonseca, Luiz Henrique M.; Lúcia G. Lohmann

    2013-01-01

    Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The sta...

  16. Detection of Hepatitis B Virus DNA by Duplex Scorpion Primer-based PCR Assay

    Institute of Scientific and Technical Information of China (English)

    KONG De-Ming孔德明; SHEN Han-Xi沈含熙; MI Huai-Feng宓怀风

    2004-01-01

    The application of a new fiuorogenic probe-based PCR assay (PCR duplex scorpion primer assay) to the detection of Hepatitis B virus (HBV) DNA in human sera was described. Duplex scorpion primer is a modified variant of duplex Amplifluor, and the incorporation of a PCR stopper between probe and primer sequences improve the detection specificity and sensitivity. Combined with PCR amplification, this probe can give unambiguous positive results for the reactions initiated with more than 20 HBV molecules. In addition, the particular unimolecular probing mechanism of this probe makes the use of short target-specific probe sequence possible, which will render this probe applicable in some specific systems.

  17. Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools

    OpenAIRE

    Bruce Shiramizu; David Troelstrup; Melissa Agsalda; Ian Kusao

    2009-01-01

    Assessing molecular persistent or minimal residual disease (PD/MRD) in childhood Burkitt lymphoma (BL) is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs). Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH) genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer p...

  18. THE QUALITY IMPROVEMENT OF PRIMER PACKAGING PROCESS USING SIX SIGMA METHODOLOGY

    Directory of Open Access Journals (Sweden)

    Prima Ditahardiyani

    2008-01-01

    Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.

  19. Profitability primer: a guide to profitability analysis in the electric power industry

    International Nuclear Information System (INIS)

    As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to various functions and how revenues are collected and allocated

  20. Silane primers rather than heat treatment contribute to adhesive bonding between tri-n-butylborane resin and a machinable leucite-reinforced ceramic

    OpenAIRE

    Sakai, Miyuki; Taira, Yohsuke; Sawase, Takashi

    2011-01-01

    The purpose of the present study was to evaluate the effects of silane primers with and without heat treatment on bonding between a resin and a leucite-reinforced ceramic (GN-Ceram). Six dental primers (GC Ceramic Primer, GP; Clearfl Ceramic Primer, CP; RelyX Ceramic Primer, RP; Tokuso Ceramic Primer, TP; Shofu Porcelain Primer, SP; and Porcelain Liner M, PM) and five experimental primers (MDS, MTS, MDES, MTES, and ATS) were evaluated. GN-Ceram specimen was primed, heated at 100°C for 60 min ...

  1. Comparison among amoA Primers Suited for Quantification and Diversity Analyses of Ammonia-Oxidizing Bacteria in Soil

    OpenAIRE

    Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; akiyama, Hiroko; Hayatsu, Masahito

    2011-01-01

    Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental sa...

  2. El menor infractor que comete su primer delito

    Directory of Open Access Journals (Sweden)

    Antonia Luzón García

    2014-10-01

    Full Text Available Existe un consenso social y la sociedad se posiciona al lado del menor maltratado, la cosa cambia cuando el menor es infractor, entonces es declarado culpable y merecedor de castigo. El menor aun siendo infractor es un ser humano con pleno derechos establecidos en la Declaración de Derechos del Niño y en los textos internacionales sobre Derechos Humanos. Mediante la socialización se estrechan los vínculos entre el individuo y el sistema social en el que vive. Por ello, la socialización y sus implicaciones son de nuestro interés para este estudio y conocer qué lleva a un menor a cometer su primer delito. Una correcta socialización, de asunción de normas y valores sociales, pautas, creencias, ritos, etc., posibilita la adaptación y previene de la exclusión social. La combinación de la influencia que ha ejercido los agentes de socialización en el menor y los factores de riesgo como el clima familiar, la adaptación escolar, los rasgos de personalidad y el grupo de iguales nos va a permitir pronosticar la probabilidad de que el menor lleve a cabo comportamientos infractores. En este estudio se intentará demostrar que la mayoría de menores que realizan infracciones penales carecen de un adecuado proceso de socialización con desestructuración familiar, inadaptación escolar y la influencia negativa del grupo de iguales que faciliten una socialización positiva y sana. Este proceso de socialización es importante si queremos comprender el comportamiento humano, entendido como la interiorización de normas y valores que han ido estructurando la personalidad del niño, su manera de pensar, de actuar, en resumidas cuentas su desarrollo mental y social

  3. Melioidosis en Costa Rica: Reporte del primer caso

    Directory of Open Access Journals (Sweden)

    Alfredo Messino Julio

    2000-09-01

    Full Text Available Melioidosis es una enfennedad infecciosa causada por la Burkholderia pseudomallef. Esta enfermedad es endémica en áreas tropicales de Asia y Australia y ha habido reportes aislados en Centro y Sur América. Aquí nosotros informamos del primer caso probado de melioidosis en Costa Rica, correspondiendo a un paciente sin historia de viajes a lugares endémicos. El paciente consultó por una bronconeumonía de adquisición comunitaria y sepsis. El hecho que el aislamiento bacteriano sea tan inusual en nuestro país implicó un retraso subsecuente en el inicio del tratamiento antibiótico específico en este caso, lo cual pudo influir en la evolución tan tórpida del paciente. Esto nos plantea el interrogante de si esta enfermedad debe ser incluida en el diagnóstico diferencial de sepsis de adquisición comunitaria en nuestro país.Melioidosis in an infectious disease caused by Burkholderia pseudomallei. This disease is endemie in areas of tropical Asia and Australia; there have been isolated reports of the disease in Central and South America. Here we report the first documented case of Melioidosis in Costa Rica in a patient without a history of traveling lo endemic areas. The patient was seen at the hospital because of sepsis and a community acquired bronchopneumonia. Due lo the rareness of this bacterial isolation in our country the corroboration of the diagnosis was delayed and subsequently the specific antibiotics were started 5 days later after the admission, this could have influenced the torpid evolution the patient had. This case should alert us and points lo the need of including this rare disease in the differential diagnosis of community acquired sepsis in our country.

  4. Magnetic Helicity and Large Scale Magnetic Fields: A Primer

    Science.gov (United States)

    Blackman, Eric G.

    2015-05-01

    Magnetic fields of laboratory, planetary, stellar, and galactic plasmas commonly exhibit significant order on large temporal or spatial scales compared to the otherwise random motions within the hosting system. Such ordered fields can be measured in the case of planets, stars, and galaxies, or inferred indirectly by the action of their dynamical influence, such as jets. Whether large scale fields are amplified in situ or a remnant from previous stages of an object's history is often debated for objects without a definitive magnetic activity cycle. Magnetic helicity, a measure of twist and linkage of magnetic field lines, is a unifying tool for understanding large scale field evolution for both mechanisms of origin. Its importance stems from its two basic properties: (1) magnetic helicity is typically better conserved than magnetic energy; and (2) the magnetic energy associated with a fixed amount of magnetic helicity is minimized when the system relaxes this helical structure to the largest scale available. Here I discuss how magnetic helicity has come to help us understand the saturation of and sustenance of large scale dynamos, the need for either local or global helicity fluxes to avoid dynamo quenching, and the associated observational consequences. I also discuss how magnetic helicity acts as a hindrance to turbulent diffusion of large scale fields, and thus a helper for fossil remnant large scale field origin models in some contexts. I briefly discuss the connection between large scale fields and accretion disk theory as well. The goal here is to provide a conceptual primer to help the reader efficiently penetrate the literature.

  5. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico

    Science.gov (United States)

    Ramírez-Hernández, Dolores G.; Lara-Padilla, Eleazar; Zárate-Segura, Paola

    2016-01-01

    Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing. PMID:27563666

  6. MALDI-TOF mass spectrometric detection of multiplex single base extended primers

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus;

    2004-01-01

    One of the most promising techniques for typing of multiple single-nucleotide polymorphism (SNP) is detection of single base extension primers (SBE) by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). We present a new MALDI-TOF MS protocol for typing of...... triethylamine purification. The biotin-labeled ddNTPs contained linkers with different masses ensuring a clear separation of the alleles even for SBE primers with a mass of 10 300 Da. Furthermore, only 25-350 fmol of SBE primers were necessary in order to obtain reproducible MALDI-TOF spectra. Similar signal...... intensities were obtained in the 5500-10 300 m/z mass range by increasing the concentration of the longer SBE primers in the reaction. To validate the technique, 17 Y-chromosome SNPs were analyzed in 200 males. The precision and accuracy of the mass determination were analyzed by parametric statistic, and the...

  7. Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

    DEFF Research Database (Denmark)

    Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere;

    2014-01-01

    Protection of steel structures, using so-called intumescent coatings, is an efficient and space saving way to prolong the time before a building, with load bearing steel constructions, collapses in the event of a fire. In addition to the intumescent coating, application of a primer may be required......, either to ensure adhesion of the intumescent coating to the steel or to provide corrosion resistance. It is essential to document the performance of the intumescent coating together with the primer to ensure the overall quality of coating system. In the present work, two epoxy primers were used to...... investigate the potential failure mechanism of a primer applied prior to an intumescent coating. The analysis was carried out using; (1) gas-fired test furnace, (2) a specially designed electrically heated oven, and (3) thermo gravimetric analysis. When tested below an acrylic intumescent coating, exposed to...

  8. Mechanism of Concerted RNA-DNA Primer Synthesis by the Human Primosome.

    Science.gov (United States)

    Baranovskiy, Andrey G; Babayeva, Nigar D; Zhang, Yinbo; Gu, Jianyou; Suwa, Yoshiaki; Pavlov, Youri I; Tahirov, Tahir H

    2016-05-01

    The human primosome, a 340-kilodalton complex of primase and DNA polymerase α (Polα), synthesizes chimeric RNA-DNA primers to be extended by replicative DNA polymerases δ and ϵ. The intricate mechanism of concerted primer synthesis by two catalytic centers was an enigma for over three decades. Here we report the crystal structures of two key complexes, the human primosome and the C-terminal domain of the primase large subunit (p58C) with bound DNA/RNA duplex. These structures, along with analysis of primase/polymerase activities, provide a plausible mechanism for all transactions of the primosome including initiation, elongation, accurate counting of RNA primer length, primer transfer to Polα, and concerted autoregulation of alternate activation/inhibition of the catalytic centers. Our findings reveal a central role of p58C in the coordinated actions of two catalytic domains in the primosome and ultimately could impact the design of anticancer drugs. PMID:26975377

  9. Molecular Detection of Toxoplasmosis Using Specific Primers P30, B1, and rDNA

    Directory of Open Access Journals (Sweden)

    Wisnu Nurcahyo

    2014-04-01

    Full Text Available Study in order to develop molecular techniques using specific primers for the early diagnosis oftoxoplasmosis have been conducted. Detection of Toxoplasma gondii genome was performed usingpolymerase chain reaction (PCR technique. The primers used in this study were rDNA, P30, and B1. ThePCR products were further run using gel electrophoresis (gel 1.5% – 2.0% and the band was documented.Toxoplasma was detected at 500 bp and 600 bp using primer P30 and B1, respectively. Whereas usingprimer rDNA no band was observed. It was assumed that primer rDNA was not sensitive since the targetamplification was 88 bp.

  10. Streamlining DNA barcoding protocols: automated DNA extraction and a new cox1 primer in arachnid systematics.

    Directory of Open Access Journals (Sweden)

    Nina Vidergar

    Full Text Available BACKGROUND: DNA barcoding is a popular tool in taxonomic and phylogenetic studies, but for most animal lineages protocols for obtaining the barcoding sequences--mitochondrial cytochrome C oxidase subunit I (cox1 AKA CO1--are not standardized. Our aim was to explore an optimal strategy for arachnids, focusing on the species-richest lineage, spiders by (1 improving an automated DNA extraction protocol, (2 testing the performance of commonly used primer combinations, and (3 developing a new cox1 primer suitable for more efficient alignment and phylogenetic analyses. METHODOLOGY: We used exemplars of 15 species from all major spider clades, processed a range of spider tissues of varying size and quality, optimized genomic DNA extraction using the MagMAX Express magnetic particle processor-an automated high throughput DNA extraction system-and tested cox1 amplification protocols emphasizing the standard barcoding region using ten routinely employed primer pairs. RESULTS: The best results were obtained with the commonly used Folmer primers (LCO1490/HCO2198 that capture the standard barcode region, and with the C1-J-2183/C1-N-2776 primer pair that amplifies its extension. However, C1-J-2183 is designed too close to HCO2198 for well-interpreted, continuous sequence data, and in practice the resulting sequences from the two primer pairs rarely overlap. We therefore designed a new forward primer C1-J-2123 60 base pairs upstream of the C1-J-2183 binding site. The success rate of this new primer (93% matched that of C1-J-2183. CONCLUSIONS: The use of C1-J-2123 allows full, indel-free overlap of sequences obtained with the standard Folmer primers and with C1-J-2123 primer pair. Our preliminary tests suggest that in addition to spiders, C1-J-2123 will also perform in other arachnids and several other invertebrates. We provide optimal PCR protocols for these primer sets, and recommend using them for systematic efforts beyond DNA barcoding.

  11. Target-cell-derived tRNA-like primers for reverse transcription support retroviral infection at low efficiency

    DEFF Research Database (Denmark)

    Schmitz, Alexander; Lund, Anders H; Hansen, Anette C;

    2002-01-01

    Reverse transcription of a retroviral genome takes place in the cytoplasm of an infected cell by a process primed by a producer-cell-derived tRNA annealed to an 18-nucleotide primer-binding site (PBS). By an assay involving primer complementation of PBS-mutated vectors we analyzed whether t......RNA primers derived from the target cell can sustain reverse transcription during murine leukemia virus (MLV) infection. Transduction efficiencies were 4-5 orders of magnitude below those of comparable producer-cell complementations. However, successful usage of a target-cell-derived tRNA primer was proven by...... cases of correction of single mismatches between Akv-MLV vectors and complementary tRNA primers toward the primer sequence in the integrated vector. Thus, target-cell-derived tRNA-like primers are able to initiate first-strand cDNA synthesis and plus-strand transfer leading to a complete provirus...

  12. POT1–TPP1 enhances telomerase processivity by slowing primer dissociation and aiding translocation

    OpenAIRE

    Latrick, Chrysa M; Cech, Thomas R.

    2010-01-01

    Telomerase contributes to chromosome end replication by synthesizing repeats of telomeric DNA, and the telomeric DNA-binding proteins protection of telomeres (POT1) and TPP1 synergistically increase its repeat addition processivity. To understand the mechanism of increased processivity, we measured the effect of POT1–TPP1 on individual steps in the telomerase reaction cycle. Under conditions where telomerase was actively synthesizing DNA, POT1–TPP1 bound to the primer decreased primer dissoci...

  13. Review of the PCR Primer Eesign Method%PCR引物设计方法综述

    Institute of Scientific and Technical Information of China (English)

    尤超; 赵大球; 梁乘榜; 周春华

    2011-01-01

    In order to obtain an ideal method of PCR primer design, the author completed primer design of target gene, using some databases and software tools for primer design, such as NCBI, Primer Premier 5.0 and so on, combined with the principle of primer design.Then made a research on optimization of conditions for PCR reaction after the designed primer was analyzed through BLAST comparison, comprehensive evaluation and gene retest analysis. The results indicated that primers designed through these databases and softwares could basically meet the requirements of following RTPCR reaction, and could make an in-depth study of molecular biology.%为了获得PCR引物设计的理想方法.笔者运用NCBI等数据库与引物设计软件Primer Premier 5.0等工具,结合引物设计的原则,完成目的基因的引物设计,并对设计后的引物进行BLAST比对、综合评价和基因的重新检测等分析,据此对PCR反应条件进行优化研究。结果表明,通过这些数据库和软件所设计的引物能基本满足后续的RT—PCR反应,可以进行进一步的分子生物学研究。

  14. A Set of 100 Chloroplast DNA Primer Pairs to Study Population Genetics and Phylogeny in Monocotyledons

    OpenAIRE

    Scarcelli, Nora; Barnaud, Adeline; Eiserhardt, Wolf; Treier, Urs A.; Seveno, Marie; d'Anfray, Amélie; Vigouroux, Yves; Pintaud, Jean-Christophe

    2011-01-01

    Chloroplast DNA sequences are of great interest for population genetics and phylogenetic studies. However, only a small set of markers are commonly used. Most of them have been designed for amplification in a large range of Angiosperms and are located in the Large Single Copy (LSC). Here we developed a new set of 100 primer pairs optimized for amplification in Monocotyledons. Primer pairs amplify coding (exon) and non-coding regions (intron and intergenic spacer). They span the different chlo...

  15. PCR primers that allow intergeneric differentiation of ascomycetes and their application to Verticillium spp.

    OpenAIRE

    Li, K N; Rouse, D. I.; German, T L

    1994-01-01

    A pair of conserved PCR primers, designated NMS1 and NMS2, that amplify a region in the mitochondrial small rRNA gene region were designed for fungi belonging to the class Ascomycetes. These primers were tested with members of eight fungal genera (Aspergillus, Fusarium, Magnaporthe, Mycospharella, Neurospora, Saccharomyces, Sclerotinia, Verticillium) and 10 Verticillium species (Verticillium albo-atrum, Verticillium chlamydosporium, Verticillium cinnebarium, Verticillium dahliae, Verticillium...

  16. Replication and pathogenicity of primer binding site mutants of SL3-3 murine leukemia viruses

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Schmidt, J; Luz, A;

    1999-01-01

    Retroviral reverse transcription is primed by a cellular tRNA molecule annealed to an 18-bp primer binding site sequence. The sequence of the primer binding site coincides with that of a negatively acting cis element that mediates transcriptional silencing of murine leukemia virus (MLV) in...... undifferentiated embryonic cells. In this study we test whether SL3-3 MLV can replicate stably using tRNA primers other than the cognate tRNAPro and analyze the effect of altering the primer binding site sequence to match the 3' end of tRNA1Gln, tRNA3Lys, or tRNA1,2Arg in a mouse pathogenicity model. Contrary to...... findings from cell culture studies of primer binding site-modified human immunodeficiency virus type 1 and avian retroviruses, our findings were that SL3-3 MLV may stably and efficiently replicate with tRNA primers other than tRNAPro. Although lymphoma induction of the SL3-3 Lys3 mutant was significantly...

  17. Detection of Luminous Vibrio harveyi in Penaeid Shrimp Through Nested PCR Using Haemolysin Gene Primer

    Directory of Open Access Journals (Sweden)

    Wawan Abdullah Setiawan

    2015-04-01

    Full Text Available Whiteleg shrimp (Litopenaeus vannamei is one of the most important aquaculture commodity in Indonesia. However, the luminous disease primarily caused by Vibrio harveyi bacteria still becomes an obstacle in penaeid shrimp farming, especially in shrimp hatchery. This study was aimed to identify the presence of V. harveyi in L. vannamei through nested PCR using haemolysin gene primer. First, initial primers were designed using V. harveyi VIB 391 haemolysin gene sequence (accession number: DQ640264, flanking the position 133 to 756. This primer pairs were used to identify haemolysin gene in both V. harveyi MR5339 and V. harveyi 275 strain. Sequencing results from each sample showed 99% similarity with haemolysin gene sequence in Genebank. Furthermore, the sequence of V. harveyi MR5339 haemolysin gene was used to design the nested PCR primers. The first primer pairs of nested PCR have successfully amplified the haemolysin gene fragment of all V. harveyi strains samples from position 52 to 405. The second primer pairs of nested PCR have amplified position 204 to 405 where it can detect all of V. harveyi strains used as sample sources in this study. The application of nested PCR technique in this study was able to identify V. harveyi strains at serial dilution of cells density as low as 100 cfu/mL, which is equal to a single cell or at DNA concentration up to 101 fg/µL.

  18. Adhesion and thermal stability enhancement of IZO films by adding a primer layer on polycarbonate substrate

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xuan; Zhang, Xiaofeng; Yan, Yue; Zhong, Yanli; Li, Lei; Zhang, Guanli [Beijing Institute of Aeronautical Materials (BIAM), Haidian District, Beijing, 100095 (China)

    2015-04-01

    A silicone-based primer layer was developed to improve the adhesion and thermal stability of amorphous transparent indium zinc oxide (IZO) films on polycarbonate (PC). The IZO films deposited by direct current magnetron sputtering at room temperature on primer-treated and untreated PCs were evaluated ex situ in terms of surface morphology, adhesion, optical, and electrical properties during annealing at 120 C in air. Nano-scratch tests indicated the adhesion of IZO films on primer-treated substrates was superior to that on untreated PCs. This superior adhesion can be attributed to the strong Si-O-Si inorganic bonds abundant in the primer layer and better matches of the primer layer in the terms of thermal expansion to the IZO. Moreover, the electrical resistivity of IZO films prepared on primer-treated PCs remained stable during the annealing treatment, whereas those of IZO films on untreated PCs presented a continuously increasing trend, which was attributed to the decrease in carrier concentration that resulted from oxygen adsorption. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  19. The sorption of iodine by an inorganic zinc primer

    Energy Technology Data Exchange (ETDEWEB)

    Evans, G.J.; Bekeris, P.A. [Toronto Univ., ON (Canada). Dept. of Chemical Engineering and Applied Chemistry

    1996-12-01

    The purpose of this work was to identify and evaluate significant parameters in the sorption of I{sub 2}(g) onto Carbo Zinc 11 inorganic primer, a paint used in the containment structure of some CANDU reactors. Air containing known amounts of {sup 131}I{sub 2}(g) was passed through 0.64 cm diameter glass tubing coated on the inner surface with paint. The accumulation of iodine on the surface was continuously monitored using two scintillation detectors. The test parameters covered were relative humidity, flow rate, I{sub 2} concentration and paint temperature. Adsorption was rapid at 23{sup o}C and predominantly gas phase mass transfer limited: the deposition velocity of 0.7{+-}0.4 cm/s was similar to the gas phase mass transfer coefficient of 1.2 cm/s estimated for the system. The deposition velocity observed at a higher paint surface temperature was an order of magnitude smaller. A similar deposition velocity was observed at 23{sup o}C for adsorption of I{sub 2}(g) from essentially dry air suggesting that the low deposition velocity observed for high surface temperature was limited by the amount of water on the paint surface. The rate of adsorption on the paint was directly proportional to the I{sub 2}(g) concentration over the range in concentration studied. The majority of the iodine retained by the paint could not be removed by washing with methanol or chloroform, but it was removed by water indicating that it was in an ionic form. Analysis of the speciation of the iodine in the wash water indicated that only a third of it was in the form of I{sup -}; the form of the remaining iodine could not be resolved. Desorption from the paint was negligible at room temperature but was detectable at higher temperatures. These low desorption rates and the ionic nature of the surface iodine indicated that adsorption occurred predominantly through a chemisorption process. A number of possible mechanisms were proposed. (author) 5 figs., 2 tabs., 6 refs.

  20. PRIMER HALLAZGO DE Cyclospora cayetanensis EN CONCEPCION, CHILE 1997

    Directory of Open Access Journals (Sweden)

    NANCY RIVERA

    1997-07-01

    Full Text Available Se describe el hallazgo de Cyclospora cayetanensis en una muestra de deposición, en la cual se observó también formas vacuoladas de Blastocystis hominis y trofozoítos y quistes de Entamoeba coli. La muestra provenía de un paciente de 50 Es importante señalar que la sola observación años de edad, de sexo femenino, quien había visitado Cuba, y que, a los 5 días de regreso a Chile, comenzó con sintomatología. El examen parasitológico seriado de deposición se llevó a cabo 30 días después de su regreso al país. Se realizó observación al fresco de heces preservadas en fijador PAF (fenol, alcohol, formalina con lugol, MIF (merthiolate, lugol, formol, y yodo de D'Antoni; al mismo tiempo se prepararon 3 frotis del sedimento fecal los que fueron teñidos mediante tinción de Ziehl Neelsen modificada, Kinyou y Safranina. Una proporción de los O quistes encontrados fueron medidos. La identificación de C. cayetanensis fue confirmada en esta muestra por el Center for Disease Control and Prevention (CDC Atlanta, Georgia, USA y por el Departamento de Parasitología del Hospital for Tropical Diseases (London UK. Este constituye el primer hallazgo de C. cayetanensis informado en Concepción, ChileThe finding of Cyclospora cayetanensis in a stool sample from a 50 year old Chilean female patient is reported. The patient had recently returned from a visit to Cuba and exhibited diarrhoeal symptons in the fifth day after arriving to Chile. The stool sample was obtained 30 days after her return to the country. Direct microscopic abservation were made in preparations of the stool sample preserved in phenol, alcohol, fonmalin (PAF with iodine, merthiolate, iodine-fonmalin (MIF and iodine de D'Antoni. In addition, three smears of the faecal sedimenl were stained with madified Ziehl-Neelsen, Kinyou, and Safranin. The oocyst sizes were measured. The identification of C. cayetanensis was confinmed in this sample by the Center for Disease control and

  1. A Primer on Population Health Management and Its Perioperative Application.

    Science.gov (United States)

    Boudreaux, Arthur M; Vetter, Thomas R

    2016-07-01

    The movement toward value-based payment models, driven by governmental policies, federal statutes, and market forces, is propelling the importance of effectively managing the health of populations to the forefront in the United States and other developed countries. However, for many anesthesiologists, population health management is a new or even foreign concept. A primer on population health management and its potential perioperative application is thus presented here. Although it certainly continues to evolve, population health management can be broadly defined as the specific policies, programs, and interventions directed at optimizing population health. The Population Health Alliance has created a particularly cogent conceptual framework and interconnected and very useful population health process model, which together identify the key components of population health and its management. Population health management provides a useful rationale for patients, providers, payers, and policymakers to move collectively away from the traditional system of individual, siloed providers to a more integrated, coordinated, team-based approach, thus creating a holistic view of the patient population. The goal of population health management is to keep the targeted patient population as healthy as possible, thus minimizing the need for costly interventions such as emergency department visits, acute hospitalizations, laboratory testing and imaging, and diagnostic and therapeutic procedures. Population health management strategies are increasingly more important to leaders of health care systems as the health of populations for which they care, especially in a strong cost risk-sharing environment, must be optimized. Most population health management efforts rely on a patient-centric team approach, coordination of care, effective communication, robust outcomes data analysis, and continuous quality improvement. Anesthesiologists have an opportunity to help lead these efforts in

  2. Influence of acid-etching and ceramic primers on the repair of a glass ceramic.

    Science.gov (United States)

    Queiroz, J R C; Souza, Rodrigo O A; Nogueira Junior, L; Ozcan, M; Bottino, M A

    2012-01-01

    The objective of this study was to evaluate the influence of different primers on the microtensile bond strength (μTBS) between a feldspathic ceramic and two composites. Forty blocks (6.0 x 6.0 x 5.0 mm³) were prepared from Vita Mark II . After polishing, they were randomly divided into 10 groups according to the surface treatment: Group 1, hydrofluoric acid 10% (HF) + silane; Group 2, CoJet + silane; Group 3, HF + Metal/Zirconia Primer; Group 4, HF + Clearfil Primer; Group 5, HF + Alloy Primer; Group 6, HF + V-Primer; Group 7, Metal/Zirconia Primer; Group 8, Clearfil Primer; Group 9, Alloy Primer; Group 10, V-Primer. After each surface treatment, an adhesive was applied and one of two composite resins was incrementally built up. The sticks obtained from each block (bonded area: 1.0 mm² ± 0.2 mm) were stored in distilled water at 37 degrees C for 30 days and submitted to thermocycling (7,000 cycles; 5 degrees C/55 degrees C ± 1 degree C). The μTBS test was carried out using a universal testing machine (1.0 mm/min). Data were analyzed using ANOVA and a Tukey test (a = 0.05). The surface treatments significantly affected the results (P 0.05). The bond strength means (MPa) were as follows: Group 1a = 29.6; Group 1b = 33.7; Group 2a = 28.9; Group 2b = 27.1; Group 3a = 13.8; Group 3b = 14.9; Group 4a = 18.6; Group 4b = 19.4; Group 5a = 15.3; Group 5b = 16.5; Group 6a = 11; Group 6b = 18; Groups 7a to 10b = 0. While the use of primers alone was not sufficient for adequate bond strengths to feldspathic ceramic, HF etching followed by any silane delivered higher bond strength. PMID:22414522

  3. Specific primers for PCR amplification of the ITS1 (ribosomal DNA) of Trypanosoma lewisi.

    Science.gov (United States)

    Desquesnes, Marc; Marc, Desquesnes; Kamyingkird, Ketsarin; Ketsarin, Kamyingkird; Yangtara, Sarawut; Sarawut, Yangtara; Milocco, Cristina; Cristina, Milocco; Ravel, Sophie; Sophie, Ravel; Wang, Ming-Hui; Ming-Hui, Wang; Lun, Zhao-Rong; Zhao-Rong, Lun; Morand, Serge; Serge, Morand; Jittapalapong, Sathaporn; Sathaporn, Jittapalapong

    2011-08-01

    Trypanosoma lewisi is a mild or non-pathogenic parasite of the sub-genus Herpetosoma transmitted by fleas to rats. In a previous study we described pan-trypanosome specific primers TRYP1 which amplify the ITS1 of ribosomal DNA by hybridizing in highly conserved regions of 18S and 5.8S genes. These primers proved to be useful for detecting T. lewisi DNA in laboratory rats, but a recent large scale survey in wild rodents demonstrated a lack of specificity. In the present study, we designed and evaluated mono-specific primers LEW1S and LEW1R, for the detection and identification of T. lewisi by a single-step PCR. These primers were designed inside the highly variable region of the ITS1 sequence of T. lewisi ribosomal DNA. The product size of 220 bp is specific to T. lewisi. The sensitivity limit was estimated between 0.055 and 0.55 pg of DNA per reaction, equivalent to 1-10 organisms per reaction. All the PCR products obtained from 6 different T. lewisi isolates were more than 98% similar with each other and similar to the sequences of T. lewisi already published in Genbank. All DNA of 7 T. lewisi stocks from China gave the specific 220 bp product. We showed that LEW1S and LEW1R primers enabled sensitive detection and identification of T. lewisi infection in laboratory and wild rats. This assay is recommended for monitoring T. lewisi infections in rat colonies or for studying infections in the wild fauna. An absence of cross reaction with human DNA means that these primers can be used to investigate atypical trypanosome infections in humans. Given the risk of T. lewisi infection in human, we believe that these primers will be beneficial for public health diagnosis and rodents investigation programmes. PMID:21570489

  4. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  5. New primers for detecting and quantifying denitrifying anaerobic methane oxidation archaea in different ecological niches.

    Science.gov (United States)

    Ding, Jing; Ding, Zhao-Wei; Fu, Liang; Lu, Yong-Ze; Cheng, Shuk H; Zeng, Raymond J

    2015-11-01

    The significance of ANME-2d in methane sink in the environment has been overlooked, and there was no any study evaluating the distribution of ANME-2d in the environment. New primers were thus needed to be designed for following research. In this paper, a pair of primers (DP397F and DP569R) was designed to quantify ANME-2d. The specificity and amplification efficiency of this primer pair were acceptable. PCR amplification of another pair of primers (DP142F and DP779R) generated a single, bright targeted band from the enrichment sample, but yielded faint, multiple bands from the environmental samples. Nested PCR was conducted using the primers DP142F/DP779R in the first round and DP142F/DP569R in the second round, which generated a bright targeted band. Further phylogenetic analysis showed that these targeted bands were ANME-2d-related sequences. Real-time PCR showed that the copies of the 16s ribosomal RNA gene of ANME-2d in these samples ranged from 3.72 × 10(4) to 2.30 × 10(5) copies μg(-1) DNA, indicating that the percentage of ANME-2d was greatest in a polluted river sample and least in a rice paddy sample. These results demonstrate that the newly developed real-time PCR primers could sufficiently quantify ANME-2d and that nested PCR with an appropriate combination of the new primers could successfully detect ANME-2d in environmental samples; the latter finding suggests that ANME-2d may spread in environments. PMID:26300291

  6. Evaluating primers for profiling anaerobic ammonia oxidizing bacteria within freshwater environments.

    Directory of Open Access Journals (Sweden)

    Puntipar Sonthiphand

    Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library

  7. The effect of various primers on shear bond strength of zirconia ceramic and resin composite

    Directory of Open Access Journals (Sweden)

    Sasiwimol Sanohkan

    2013-01-01

    Full Text Available Aims: To determine the in vitro shear bond strengths (SBS of zirconia ceramic to resin composite after various primer treatments. Materials and Methods: Forty zirconia ceramic (Zeno, Wieland Dental specimens (10 mm in diameter and 2 mm thick were prepared, sandblasted with 50 μm alumina, and divided into four groups (n = 10. Three experimental groups were surface treated with three primers; CP (RelyX Ceramic Primer, 3M ESPE, AP (Alloy Primer, Kuraray Medical, and MP (Monobond Plus, Ivoclar Vivadent AG. One group was not treated and served as the control. All specimens were bonded to a resin composite (Filtek Supreme XT, 3M ESPE cylinder with an adhesive system (Adper Scotchbond Multi-Purpose Plus Adhesive, 3M ESPE and then stored in 100% humidity at 37°C for 24 h before SBS testing in a universal testing machine. Mean SBS (MPa were analyzed with one-way analysis of variance (ANOVA and the Tukey′s Honestly Significant Difference (HSD test (α = 0.05. Results: Group AP yielded the highest mean and standard deviation (SD value of SBS (16.8 ± 2.5 MPa and Group C presented the lowest mean and SD value (15.4 ± 1.6 MPa. The SBS did not differ significantly among the groups (P = 0.079. Conclusions: Within the limitations of this study, the SBS values between zirconia ceramic to resin composite using various primers and untreated surface were not significantly different.

  8. A new tetra-primer ARMS-PCR for genotyping bovine kappa-casein polymorphisms.

    Science.gov (United States)

    Fonseca, P A S; Rosse, I C; Demiranda, M; Machado, M A; Verneque, R S; Peixoto, M G C D; Carvalho, M R S

    2013-01-01

    Kappa-casein (κ-casein) is one of the most abundant milk proteins. Its main function is to avoid the aggregation of casein micelles, keeping them, and therefore calcium phosphate, in pockets in solution. In bovines, a κ-casein functional polymorphism has been associated with fat, calcium, and protein milk contents and faster curd contraction in cheese production. Quicker curd contraction reduces the loss of milk solids, enhancing cheese yield. This polymorphism induces a double amino acid substitution (Thr136Ile and Ala148Asp). The polymorphism is normally detected by PCR-RFLP, which is a laborious method. An interesting methodological alternative is the tetra-primer amplification refractory mutation system PCR (tetra-primer ARMS-PCR). A tetra-primer ARMS-PCR for the detection of this κ-casein polymorphism has been described. However, specificity was not achieved, probably due to problems with primer design. We developed a new tetra-primer ARMS-PCR for the detection of the κ-casein polymorphism. This new method was validated in a double-blind test, by comparison with the results obtained for 50 Guzerá bulls formerly genotyped by PCR-RFLP. This new method achieved 100% sensitivity and specificity. We conclude that this method is a useful, cost-efficient alternative for the detection of functional κ-casein polymorphisms. PMID:24390998

  9. Primer Screening for Dyera costulata (Miq Hook.f Random Amplified Polymorphic DNA Analyses

    Directory of Open Access Journals (Sweden)

    YUYU SURYASARI POERBA

    2009-01-01

    Full Text Available Dyera costulata (Miq. Hook.f (Apocynaceae is a large tree of the lowland tropical rain forest of Southeast Asia, Thailand, Malay Peninsula and Indonesia, especially in Sumatra and Kalimantan (Borneo islands. Its economic value was in its copious latex, used as gum in the manufacture of chewing gum. Today the timber of this species is much sought after for the manufacture of pencils and picture frames. Information on genetic diversity of the species is very limited. Hence studies were initiated to screen primers for RAPD analyses of Dyera costulata for use in genetic variation studies. Seventy one Operon primers (10 mer were used to generate a total of 864 consistent and ambiguous amplification products ranging from 200 bp to 2.0 kb. Rare and genotype specific bands were identified which could be effectively used to distinguish the genotypes. 34 highly polymorphic primers (100% are recorded from 71 primers used. Three primers (OPA-04, OPU-06, and OPU-07 produced highest variable RAPD profiles. The dendrogram separated the 8 genotypes into 2 groups. Genetic dissimilarity ranged from 0.07 to 0.71 %.

  10. Real-time PCR (qPCR) primer design using free online software.

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. PMID:21445907

  11. A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics

    DEFF Research Database (Denmark)

    Busk, Peter Kamp

    2014-01-01

    a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for...... automatic design of primers for the method miR-specific RT-qPCR, which is one of the best performing microRNA qPCR methods available. The algorithm is based on an implementation of the previously published rules for manual design of miR-specific primers with the additional feature of evaluating the...... propensity of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore...

  12. Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

    Directory of Open Access Journals (Sweden)

    Zuiter Afnan

    2012-08-01

    Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

  13. New primers for promising single-copy genes in fungal phylogenetics and systematics.

    Science.gov (United States)

    Schmitt, I; Crespo, A; Divakar, P K; Fankhauser, J D; Herman-Sackett, E; Kalb, K; Nelsen, M P; Nelson, N A; Rivas-Plata, E; Shimp, A D; Widhelm, T; Lumbsch, H T

    2009-12-01

    Developing powerful phylogenetic markers is a key concern in fungal phylogenetics. Here we report degenerate primers that amplify the single-copy genes Mcm7 (MS456) and Tsr1 (MS277) across a wide range of Pezizomycotina (Ascomycota). Phylogenetic analyses of 59 taxa belonging to the Eurotiomycetes, Lecanoromycetes, Leotiomycetes, Lichinomycetes and Sordariomycetes, indicate the utility of these loci for fungal phylogenetics at taxonomic levels ranging from genus to class. We also tested the new primers in silico using sequences of Saccharomycotina, Taphrinomycotina and Basidiomycota to predict their potential of amplifying widely across the Fungi. The analyses suggest that the new primers will need no, or only minor sequence modifications to amplify Saccharomycotina, Taphrinomycotina and Basidiomycota. PMID:20198159

  14. A set of 100 chloroplast DNA primer pairs to study population genetics and phylogeny in monocotylenons

    DEFF Research Database (Denmark)

    Scarcelli, Nora; Bernaud, Adeline; Eiserhardt, Wolf L.;

    2011-01-01

    developed a new set of 100 primer pairs optimized for amplification in Monocotyledons. Primer pairs amplify coding (exon) and non-coding regions (intron and intergenic spacer). They span the different chloroplast regions: 72 are located in the LSC, 13 in the Small Single Copy (SSC) and 15 in the Inverted...... most variable loci (rps15-ycf1, rpl32-ccsA, ndhF-rpl32, ndhG-ndhI and ccsA) are located in the SSC. Through the analysis of the genetic structure of a wild-cultivated species complex in Dioscorea, we demonstrated that this new set of primers is of great interest for population genetics and we...

  15. Analysis of Two Chinese Yak(Bos grunniens) Population Using Bovine Microsatellite Primers

    Institute of Scientific and Technical Information of China (English)

    Wang Minqiang; S.Weigend; A.Barre-Dirie; J.W.Carnwath; Lou Zhonglin; H.Niemann

    2005-01-01

    Two Chinese domestic yak populations representing the Plateau type and the Huanhu Alpine type were analysed with 12 bovine microsatellite primers. All primer pairs functioned in the yak genome and polymorphism was found at all loci. The allele size ranges and frequencies of the two yak populations were similar and there was considerable overlap with the allele size ranges observed in cattle. Data for European cattle breeds was obtained from the Cattle Diversity Database(CaDBase)to interpret the heterozygosity and genetic distance estimates in yak populations. Heterozygosity estimated for the two yak populations was comparable to that of European cattle while Nei's Genetic Distance DA between the two yak populations was less than distances between the most closely related German cattle breeds. Bovine microsatellite primers proved to be a valuable tool for characterization of yak populations.

  16. Microsatellite primers in the weedy annual herb Anacyclus clavatus (Asteraceae) and four closely related species1

    Science.gov (United States)

    Agudo, Alicia; Picó, F. Xavier; Álvarez, Inés

    2013-01-01

    • Premise of the study: Nuclear microsatellite primers were developed for the weedy herb Anacyclus clavatus to study the genetic structure of hybrid zones with closely related taxa in the western Mediterranean Basin, where different floral phenotypes are present. • Methods and Results: We obtained two microsatellite libraries using next-generation sequencing and Sanger sequencing of cloned restriction fragments. A total of 13 polymorphic and 11 monomorphic loci were identified in three Iberian populations of A. clavatus. The primers amplified di- and trinucleotide repeats with 1–8 alleles per locus. Most primers also amplified in A. homogamos, A. monanthos, A. radiatus, and A. valentinus. • Conclusions: These results indicate the utility of these markers in A. clavatus for population genetic and hybridization studies as well as their applicability across the genus. PMID:25202498

  17. Single primer-mediated circular polymerase chain reaction for hairpin DNA cloning and plasmid editing.

    Science.gov (United States)

    Huang, Jiansheng; Khan, Inamullah; Liu, Rui; Yang, Yan; Zhu, Naishuo

    2016-05-01

    We developed and validated a universal polymerase chain reaction (PCR) method, single primer circular (SPC)-PCR, using single primer to simultaneously insert and amplify a short hairpin sequence into a vector with a high success rate. In this method, the hairpin structure is divided into two parts and fused into a vector by PCR. Then, a single primer is used to cyclize the chimera into a mature short hairpin RNA (shRNA) expression vector. It is not biased by loop length or palindromic structures. Six hairpin DNAs with short 4-nucleotide loops were successfully cloned. Moreover, SPC-PCR was also applied to plasmid editing within 3 h with a success rate higher than 95%. PMID:26792375

  18. Microsatellite Primers in the Weedy Annual Herb Anacyclus clavatus (Asteraceae and Four Closely Related Species

    Directory of Open Access Journals (Sweden)

    Alicia Agudo

    2013-10-01

    Full Text Available Premise of the study: Nuclear microsatellite primers were developed for the weedy herb Anacyclus clavatus to study the genetic structure of hybrid zones with closely related taxa in the western Mediterranean Basin, where different floral phenotypes are present. Methods and Results: We obtained two microsatellite libraries using next-generation sequencing and Sanger sequencing of cloned restriction fragments. A total of 13 polymorphic and 11 monomorphic loci were identified in three Iberian populations of A. clavatus. The primers amplified di- and trinucleotide repeats with 1–8 alleles per locus. Most primers also amplified in A. homogamos, A. monanthos, A. radiatus, and A. valentinus. Conclusions: These results indicate the utility of these markers in A. clavatus for population genetic and hybridization studies as well as their applicability across the genus.

  19. The effect of dentin primer on the shear bond strength between composite resin and enamel.

    Science.gov (United States)

    Hadavi, F; Hey, J H; Ambrose, E R; Louie, P W; Shinkewski, D J

    1993-01-01

    The purpose of this study was to determine the effect of accidental dentin primer contact with etched enamel on shear bond strength of composite resin to enamel. Four dentin bonding systems were included in this study: GLUMA Dentin Bond, Scotchbond, and Prisma Universal Bond 2 and 3. Eighty extracted human permanent anterior teeth were used and divided in eight test groups. The vestibular surfaces were ground and acid etched. For each dentin bonding system 10 samples were treated with dentin primer prior to placement of resin. Shear bond testing showed that enamel contact with dentin primer in the above two systems decreased the shear bond strength between composite and enamel by 31 to 44%. PMID:8337183

  20. Oligonucleotide primers for targeted amplification of single-copy nuclear genes in apocritan Hymenoptera.

    Directory of Open Access Journals (Sweden)

    Gerrit Hartig

    Full Text Available BACKGROUND: Published nucleotide sequence data from the mega-diverse insect order Hymenoptera (sawflies, bees, wasps, and ants are taxonomically scattered and still inadequate for reconstructing a well-supported phylogenetic tree for the order. The analysis of comprehensive multiple gene data sets obtained via targeted PCR could provide a cost-effective solution to this problem. However, oligonucleotide primers for PCR amplification of nuclear genes across a wide range of hymenopteran species are still scarce. FINDINGS: Here we present a suite of degenerate oligonucleotide primer pairs for PCR amplification of 154 single-copy nuclear protein-coding genes from Hymenoptera. These primers were inferred from genome sequence data from nine Hymenoptera (seven species of ants, the honeybee, and the parasitoid wasp Nasonia vitripennis. We empirically tested a randomly chosen subset of these primer pairs for amplifying target genes from six Hymenoptera, representing the families Chrysididae, Crabronidae, Gasteruptiidae, Leucospidae, Pompilidae, and Stephanidae. Based on our results, we estimate that these primers are suitable for studying a large number of nuclear genes across a wide range of apocritan Hymenoptera (i.e., all hymenopterans with a wasp-waist and of aculeate Hymenoptera in particular (i.e., apocritan wasps with stingers. CONCLUSIONS: The amplified nucleotide sequences are (a with high probability from single-copy genes, (b easily generated at low financial costs, especially when compared to phylogenomic approaches, (c easily sequenced by means of an additionally provided set of sequencing primers, and (d suitable to address a wide range of phylogenetic questions and to aid rapid species identification via barcoding, as many amplicons contain both exonic and fast-evolving intronic nucleotides.

  1. Design and implementation of degenerate microsatellite primers for the mammalian clade.

    Directory of Open Access Journals (Sweden)

    Emmanuel Buschiazzo

    Full Text Available Microsatellites are popular genetic markers in molecular ecology, genetic mapping and forensics. Unfortunately, despite recent advances, the isolation of de novo polymorphic microsatellite loci often requires expensive and intensive groundwork. Primers developed for a focal species are commonly tested in a related, non-focal species of interest for the amplification of orthologous polymorphic loci; when successful, this approach significantly reduces cost and time of microsatellite development. However, transferability of polymorphic microsatellite loci decreases rapidly with increasing evolutionary distance, and this approach has shown its limits. Whole genome sequences represent an under-exploited resource to develop cross-species primers for microsatellites. Here we describe a three-step method that combines a novel in silico pipeline that we use to (1 identify conserved microsatellite loci from a multiple genome alignments, (2 design degenerate primer pairs, with (3 a simple PCR protocol used to implement these primers across species. Using this approach we developed a set of primers for the mammalian clade. We found 126,306 human microsatellites conserved in mammalian aligned sequences, and isolated 5,596 loci using criteria based on wide conservation. From a random subset of ~1000 dinucleotide repeats, we designed degenerate primer pairs for 19 loci, of which five produced polymorphic fragments in up to 18 mammalian species, including the distinctly related marsupials and monotremes, groups that diverged from other mammals 120-160 million years ago. Using our method, many more cross-clade microsatellite loci can be harvested from the currently available genomic data, and this ability is set to improve exponentially as further genomes are sequenced.

  2. Establishment of Quantitative Analysis Method for Genetically Modified Maize Using a Reference Plasmid and Novel Primers

    Science.gov (United States)

    Moon, Gi-Seong; Shin, Weon-Sun

    2012-01-01

    For the quantitative analysis of genetically modified (GM) maize in processed foods, primer sets and probes based on the 35S promoter (p35S), nopaline synthase terminator (tNOS), p35S-hsp70 intron, and zSSIIb gene encoding starch synthase II for intrinsic control were designed. Polymerase chain reaction (PCR) products (80~101 bp) were specifically amplified and the primer sets targeting the smaller regions (80 or 81 bp) were more sensitive than those targeting the larger regions (94 or 101 bp). Particularly, the primer set 35F1-R1 for p35S targeting 81 bp of sequence was even more sensitive than that targeting 101 bp of sequence by a 3-log scale. The target DNA fragments were also specifically amplified from all GM labeled food samples except for one item we tested when 35F1-R1 primer set was applied. A reference plasmid pGMmaize (3 kb) including the smaller PCR products for p35S, tNOS, p35S-hsp70 intron, and the zSSIIb gene was constructed for real-time PCR (RT-PCR). The linearity of standard curves was confirmed by using diluents ranging from 2×101~105 copies of pGMmaize and the R2 values ranged from 0.999~1.000. In the RT-PCR, the detection limit using the novel primer/probe sets was 5 pg of genomic DNA from MON810 line indicating that the primer sets targeting the smaller regions (80 or 81 bp) could be used for highly sensitive detection of foreign DNA fragments from GM maize in processed foods. PMID:24471096

  3. Teaching Thermal Hydraulics and Numerical Methods: An Introductory Control Volume Primer

    International Nuclear Information System (INIS)

    This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation

  4. PCR primers for 30 novel gene regions in the nuclear genomes of Lepidoptera

    OpenAIRE

    Wahlberg, Niklas; Peña, Carlos; Ahola,Milla; Wheat, Christopher W; Rota, Jadranka

    2016-01-01

    We report primer pairs for 30 new gene regions in the nuclear genomes of Lepidoptera that can be amplified using a standard PCR protocol. The new primers were tested across diverse Lepidoptera, including nonditrysians and a wide selection of ditrysians. These new gene regions give a total of 11,043 bp of DNA sequence data and they show similar variability to traditionally used nuclear gene regions in studies of Lepidoptera. We feel that a PCR-based approach still has its place in molecular sy...

  5. El arte de cozina de Diego Granado (1599), primer libro de cocina en lengua castellana

    OpenAIRE

    Redondo Buey, Patricia

    2014-01-01

    El Siglo de Oro es un periodo histórico que abarca desde el Renacimiento del siglo XVI hasta el Barroco del siglo XVII, durante el cual se publicó el primer tratado gastronómico de España. En este trabajo científico haremos un estudio meticuloso y minucioso sobre lo que se considera el primer recetario del Siglo de Oro español y así analizar las fuentes primarias de la cocina española, cosa que nunca se había hecho.

  6. Human DNA polymerase α in binary complex with a DNA:DNA template-primer

    OpenAIRE

    Javier Coloma; Johnson, Robert E.; Louise Prakash; Satya Prakash; Aggarwal, Aneel K.

    2016-01-01

    The Polα/primase complex assembles the short RNA-DNA fragments for priming of lagging and leading strand DNA replication in eukaryotes. As such, the Polα polymerase subunit encounters two types of substrates during primer synthesis: an RNA:DNA helix and a DNA:DNA helix. The engagement of the polymerase subunit with the DNA:DNA helix has been suggested as the of basis for primer termination in eukaryotes. However, there is no structural information on how the Polα polymerase subunit actually e...

  7. Minimal sequence requirements of a functional human immunodeficiency virus type 1 primer binding site.

    OpenAIRE

    Wakefield, J K; Rhim, H; Morrow, C D

    1994-01-01

    The initiation of human immunodeficiency virus type 1 (HIV-1) reverse transcription occurs by the extension of a tRNA(3Lys) primer bound near the 5' end of the genomic RNA at a position termed the primer binding site (PBS). The PBS is an 18-nucleotide sequence of the HIV-1 genome which is complementary to the 3'-terminal 18 nucleotides of the tRNA(3Lys). To investigate the sequence specificity of the interaction between tRNA(3Lys) and the PBS, we have constructed proviral genomes containing m...

  8. The Astrobiology Primer - an Early Career Scientist Education, Outreach and Professional Development Project

    Science.gov (United States)

    Wright, K. E.; Domagal-Goldman, S. D.

    2011-12-01

    We are early-career scientists jointly leading a project to write 'The Astrobiology Primer', a brief but comprehensive introduction to astrobiology, and we are using the process of producing the document as an innovative way of strengthening the international community of early-career astrobiologists. Astrobiology is the study of the origin, evolution, distribution and future of life in our universe. It includes not just study of life on Earth, but also the potential for life to exist beyond Earth, and the development of techniques to search for such life. It therefore incorporates geological and earth sciences, life sciences, chemistry, astronomy and planetary sciences. This requires astrobiologists to integrate these different disciplines in order to address questions such as 'How did Earth and its biosphere originate?', 'How do life and the physical, chemical and geological cycles on Earth interact, and affect each other?' and so 'What does life on Earth tell us about the habitability of environments outside Earth?'. The primer will provide a brief but comprehensive introduction to the field; it will be significantly more comprehensive than a normal review paper but much shorter than a textbook. This project is an initiative run entirely by early-career scientists, for the benefit of other early-career scientists and others. All the writers and editors of the primer are graduate/post-graduate students or post-doctoral fellows, and our primary target group for the primer is other early-career scientists, although we hope and expect that the primer will also be useful far more broadly in education and outreach work. An Astrobiology Primer was first published in 2006(Ref1), written and edited by a small group of early-career astrobiologists to provide an introduction to astrobiology for other early-career scientists new to the field. It has been used not only by the target group for private study, but in formal education and outreach settings at universities and

  9. LOMA: A fast method to generate efficient tagged-random primers despite amplification bias of random PCR on pathogens

    Directory of Open Access Journals (Sweden)

    Lee Wah

    2008-09-01

    Full Text Available Abstract Background Pathogen detection using DNA microarrays has the potential to become a fast and comprehensive diagnostics tool. However, since pathogen detection chips currently utilize random primers rather than specific primers for the RT-PCR step, bias inherent in random PCR amplification becomes a serious problem that causes large inaccuracies in hybridization signals. Results In this paper, we study how the efficiency of random PCR amplification affects hybridization signals. We describe a model that predicts the amplification efficiency of a given random primer on a target viral genome. The prediction allows us to filter false-negative probes of the genome that lie in regions of poor random PCR amplification and improves the accuracy of pathogen detection. Subsequently, we propose LOMA, an algorithm to generate random primers that have good amplification efficiency. Wet-lab validation showed that the generated random primers improve the amplification efficiency significantly. Conclusion The blind use of a random primer with attached universal tag (random-tagged primer in a PCR reaction on a pathogen sample may not lead to a successful amplification. Thus, the design of random-tagged primers is an important consideration when performing PCR.

  10. Effect of clearfil protect bond and transbond plus self-etch primer on shear bond strength of orthodontic brackets

    Directory of Open Access Journals (Sweden)

    S Hamid Raji

    2011-01-01

    Conclusion: The shear bond strength of clearfil protect bond and transbond plus self-etch primer was enough for bonding the orthodontic brackets. The mode of failure of bonded brackets with these two self-etch primers is safe for enamel.

  11. Virus detection and identification using random multiplex (RT-PCR with 3'-locked random primers

    Directory of Open Access Journals (Sweden)

    Eaton John W

    2007-06-01

    Full Text Available Abstract Background PCR-based detection and identification of viruses assumes a known, relatively stable genome. Unfortunately, high mutation rates may lead to extensive changes in viral nucleic acid sequences making dedicated PCR primer use problematic. Furthermore, in bioterrorism, viral consensus sequences can be genetically modified as a countermeasure to RT-PCR and DNA chip detection. Accordingly, there is a great need for the development of rapid and universal virus detection and identification technologies. Results We report herein that viral genomic DNA or RNA can be separated from host nucleic acids in plasma by filtration and nuclease digestion, and randomly amplified in a single PCR using a mixture of primers designed to be resistant to primer-dimer amplification (5'-VVVVVVVVAA-3', V = A, G or C; 38 or 6561 primers. We have termed this novel PCR method Random Multiplex (RT-PCR since hundreds of overlapping PCR amplifications occur simultaneously. Using this method, we have successfullydetected and partially sequenced 3 separate viruses in human plasma without using virus-specific reagents (i.e., Adenovirus Type 17, Coxsackievirus A7, and Respiratory Syncytial Virus B. The method is sensitive to ~1000 genome equivalents/ml and may represent the fastest means of detection of unknown viruses. Conclusion These studies suggest that the further development of random multiplex (RT-PCR may lead to a diagnostic assay that can universally detect viruses in donated blood products as well as in patients suffering with idiopathic disease states of possible viral etiology.

  12. Magnesium-Based Sacrificial Anode Cathodic Protection Coatings (Mg-Rich Primers for Aluminum Alloys

    Directory of Open Access Journals (Sweden)

    Michael D. Blanton

    2012-09-01

    Full Text Available Magnesium is electrochemically the most active metal employed in common structural alloys of iron and aluminum. Mg is widely used as a sacrificial anode to provide cathodic protection of underground and undersea metallic structures, ships, submarines, bridges, decks, aircraft and ground transportation systems. Following the same principle of utilizing Mg characteristics in engineering advantages in a decade-long successful R&D effort, Mg powder is now employed in organic coatings (termed as Mg-rich primers as a sacrificial anode pigment to protect aerospace grade aluminum alloys against corrosion. Mg-rich primers have performed very well on aluminum alloys when compared against the current chromate standard, but the carcinogenic chromate-based coatings/pretreatments are being widely used by the Department of Defense (DoD to protect its infrastructure and fleets against corrosion damage. Factors such as reactivity of Mg particles in the coating matrix during exposure to aggressive corrosion environments, interaction of atmospheric gases with Mg particles and the impact of Mg dissolution, increases in pH and hydrogen gas liberation at coating-metal interface, and primer adhesion need to be considered for further development of Mg-rich primer technology.

  13. A new fungal large subunit ribosomal RNA primer for high-throughput sequencing surveys.

    Science.gov (United States)

    Mueller, Rebecca C; Gallegos-Graves, La Verne; Kuske, Cheryl R

    2016-02-01

    The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300-400 bp region of the D2 hypervariable region of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R-LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Together, these findings show that the LR22R-LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods. PMID:26656064

  14. Historia del primer templo mayor de Tunja, nombrado de Nuestra Señora de Guadalupe

    Directory of Open Access Journals (Sweden)

    Ernesto Porras Collantes

    2004-01-01

    Full Text Available Gonzalo Suárez Rendón Sarmiento, fundador de Tunja, bautizó con el nombrede Nuestra Señora de Guadalupe al primer templo mayor de la ciudad. Elcarpintero Gregorio López estuvo a cargo de la construcción de la obra, desdefebrero hasta la navidad del año de

  15. Comparison of nine PCR primer sets designed to detect Pantoea stewartii subsp. stewartii in maize

    Science.gov (United States)

    Pantoea stewartii subsp. stewartii, the causal agent of Stewart's bacterial wilt of maize, is a major quarantine pest in maize seed. Verifying freedom from P. stewartii remains a significant hurdle in exporting corn seed from the U.S. Several PCR primer sets have been developed and suggested as bein...

  16. New primers for promising single-copy genes in fungal phylogenetics and systematics

    NARCIS (Netherlands)

    Schmitt, I.; Crespo, A.; Divakar, P.K.; Fankhauser, J.D.; Herman-Sackett, E.; Kalb, K.; Nelsen, M.P.; Nelson, N.A.; Rivas-Plata, E.; Shimp, A.D.; Widhelm, T.; Lumbsch, H.T.

    2009-01-01

    Developing powerful phylogenetic markers is a key concern in fungal phylogenetics. Here we report degenerate primers that amplify the single-copy genes Mcm7 (MS456) and Tsr1 (MS277) across a wide range of Pezizomycotina (Ascomycota). Phylogenetic analyses of 59 taxa belonging to the Eurotiomycetes,

  17. Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools

    Directory of Open Access Journals (Sweden)

    Melissa Agsalda

    2009-01-01

    Full Text Available Assessing molecular persistent or minimal residual disease (PD/MRD in childhood Burkitt lymphoma (BL is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs. Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgVH primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

  18. Reverse transcription using random pentadecamer primers increases yield and quality of resulting cDNA

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Dufva, I.H.; Dufva, Hans Martin

    2006-01-01

    Reverse transcription of RNA is an invaluable method for gene expression analysis by real-time PCR or microarray methods. Random primers of varying lengths were compared with respect to their efficiency of priming reverse transcription reactions. The results showed that l5-nucleotide-long random...

  19. Primer Dependent and Independent Forms of Soluble Starch Synthetase from Developing Barley Endosperms

    DEFF Research Database (Denmark)

    Kreis, M.

    1980-01-01

    purified by ammonium sulfate precipitation and DEAE-cellulose chromatography and separated into four fractions. In the absence of an added carbohydrate primer two of the four fractions catalized the synthesis of a methanol-precipitable agr-glucan when high concentrations of sodium citrate and bovine serum...

  20. Screening for the familial defective apolipoprotein B-100 R3500W by mutagenic primers PCR

    Institute of Scientific and Technical Information of China (English)

    冯纪安; 冯铮

    2002-01-01

    Objective A method combining the mutagenic primers PCR and restriction enzyme digestion was designed to facilitate the detection of gene mutation in familial defective apolipoprotein B-1O0 R3500W. Methods A pair of primer was designed and a mismatch nucleotide was introduced in its upstream primer. A segment of target DNA including the possibly mutated nucleotide was amplified by PCR and the products were digested by restriction enzyme Nco 1. To overcome the potential false negative results due to improper digestion conditions, a segment of DNA with Ncol cut size was added as reference.Results The target sequence was successfully amplified by PCR, producing a 144 bp DNA fragment as expected. When incubated with Ncol, the enzyme could digest the DNA, producing a 114 bp segment,only if it was amplified from the mutated gene, but not from the normal allele. This difference in length of DNA could be separated by electrophoresis on a 2 %agarose gel. Thus we successfully detected two carriers of heterozygous FDB R3500W in 162 hypercholesterolemic patients. Conclusions Mutagenic primers PCR can be used to detect the gene mutation of apo B-100 R3500W, two cases were detected among 162patients with hypercholesterolemia. It suggests that this mutation is not rare in mainland China.

  1. Detection of three porcine vesicular viruses using multiplex real-time primer-probe energy transfer

    DEFF Research Database (Denmark)

    Rasmussen, Thomas Bruun; Uttenthal, Åse; Aguero, M.

    2006-01-01

    Rapid identification of the etiologic agent in infected animals is important for the control of an outbreak of vesicular disease in livestock. We have in the present study developed a multiplex real-time reverse transcription-PCR, based on primer-probe energy transfer (PriProET), for simultaneous...

  2. Lives Intertwined: A Primer on the History and Emergence of Minority Serving Institutions

    Science.gov (United States)

    Gasman, Marybeth; Nguyen, Thai-Huy; Conrad, Clifton F.

    2015-01-01

    In this article, we provide an overview--a primer--of the rise of Minority Serving Institutions (MSIs) as context for understanding the contemporary place of these institutions in our broader system of higher education. We also demonstrate how the emergence and the evolution of MSIs stem from our nation's struggle to provide equal educational…

  3. Applicability of random primer R143 for determination of Aspergillus fumigatus DNA

    NARCIS (Netherlands)

    Erjavec, Z; Brinker, M; Apperloo-Renkema, HZ; Arends, Jan P; De Vries-Hospers, HG; Ruiters, MHJ

    1997-01-01

    The specificity of random primer R143 for Aspergillus fumigatus DNA was determined in order to test its usefulness in establishing the presence of A. fumigatus DNA in fungal cultures. When PCR reaction products of these cultures were compared with those of 21 other bacterial and fungal DNA samples,

  4. A Web-Based Adaptive Tutor to Teach PCR Primer Design

    Science.gov (United States)

    van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…

  5. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    Science.gov (United States)

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  6. PERMANENT PRIMER/REPLACEABLE TOPCOAT AIRCRAFT COATING SYSTEM WITH MINIMUM VOC AND CHROMIUM EXPOSURE - PHASE I

    Science.gov (United States)

    In Phase I, Foster-Miller, Inc., will develop the permanent primer replacement topcoat (PPRT), produce coated test panels, and analyze test panels for key performance properties. Topcoat stripping also will be demonstrated. The team includes coating experts and an aircraft ...

  7. Primer concurso y exposición interamericana de fotografía digital

    OpenAIRE

    Banco Interamericano de Desarrollo (BID)

    2004-01-01

    Da a conocer el Acta del Jurado del Primer Concurso y Exposición Interamericana de Fotografía Digital organizado por el Centro Cultural del BID y copatrocinado por la División de Tecnología de la Información y Comunicación para el Desarrollo del BID.

  8. A Primer on Energy Efficiency for Municipal Water and Wastewater Utilities

    OpenAIRE

    Liu, Feng; Ouedraogo, Alain; Manghee, Seema; Danilenko, Alexander

    2012-01-01

    This primer is concerned with energy use and efficiency of network-based water supply and wastewater treatment in urban areas. It focuses on the supply side of the municipal water cycle, including the extraction, treatment, and distribution of water, and collection and treatment of wastewater-activities which are directly managed by Water and Wastewater Utilities (WWUs). The main challenge...

  9. Detection of summer truffle (Tuber aestivum Vittad.) in ectomycorrhizae and in soil using specific primers

    Czech Academy of Sciences Publication Activity Database

    Gryndler, Milan; Hršelová, Hana; Soukupová, Lucie; Streiblová, Eva; Valda, S.; Borovička, Jan; Gažo, J.; Miko, M.

    2011-01-01

    Roč. 318, č. 1 (2011), s. 84-91. ISSN 0378-1097 R&D Projects: GA ČR GAP504/10/0382 Institutional research plan: CEZ:AV0Z50200510; CEZ:AV0Z30130516 Keywords : nested PCR * ITS primers * Tuber mesentericum Subject RIV: EE - Microbiology, Virology Impact factor: 2.044, year: 2011

  10. Producció de matèries primeres. Curs 2007-2008

    OpenAIRE

    Universitat de Barcelona. Facultat de Farmàcia

    2007-01-01

    Pla docent de l'assignatura Producció de matèries primeres de l'Ensenyament de Ciència i Tecnologia dels Aliments. Curs acadèmic 2007-2008. Departament de Productes Naturals, Biologia Vegetal i Edafologia.

  11. Producció de matèries primeres. Curs 2008-2009

    OpenAIRE

    Universitat de Barcelona. Facultat de Farmàcia

    2008-01-01

    Pla docent de l'assignatura Producció de matèries primeres de l'Ensenyament de Ciència i Tecnologia dels Aliments. Curs acadèmic 2008-2009. Departament Productes Naturals, Biologia Vegetal i Edafologia.

  12. Producció de matèries primeres. Curs 2006-2007

    OpenAIRE

    Universitat de Barcelona. Facultat de Farmàcia

    2006-01-01

    Pla docent de l'assignatura Producció de matèries primeres de l'Ensenyament de Ciència i Tecnologia dels Aliments. Curs acadèmic 2006-2007. Departaments de Productes Naturals, Biologia Vegetal i Edafologia (UB)/ Ciència animal i dels Aliments (UAB)

  13. Producció de matèries primeres. Curs 2005-2006

    OpenAIRE

    Universitat de Barcelona. Facultat de Farmàcia

    2005-01-01

    Pla docent de l'assignatura Producció de matèries primeres de l'Ensenyament de Ciència i Tecnologia dels Aliments. Curs acadèmic 2005-2006. Departament de Productes Naturals, Biologia Vegetal i Edafologia.

  14. A sputtered zirconia primer for improved thermal shock resistance of plasma sprayed ceramic turbine seals

    Science.gov (United States)

    Bill, R. C.; Sovey, J.; Allen, G. P.

    1981-01-01

    The development of plasma-sprayed yttria stabilized zirconia (YSZ) ceramic turbine blade tip seal components is discussed. The YSZ layers are quite thick (0.040 to 0.090 in.). The service potential of seal components with such thick ceramic layers is cyclic thermal shock limited. The most usual failure mode is ceramic layer delamination at or very near the interface between the plasma sprayed YSZ layer and the NiCrAlY bondcoat. Deposition of a thin RF sputtered YSZ primer to the bondcoat prior to deposition of the thick plasma sprayed YSZ layer was found to reduce laminar cracking in cyclic thermal shock testing. The cyclic thermal shock life of one ceramic seal design was increased by a factor of 5 to 6 when the sputtered YSZ primer was incorporated. A model based on thermal response of plasma sprayed YSZ particles impinging on the bondcoat surface with and without the sputtered YSZ primer provides a basis for understanding the function of the primer.

  15. Primer registro de Serratospiculum tendo (Nematoda: Diplotriaenidae) para el Perú

    OpenAIRE

    Gomez-Puerta, Luis A.; Pedro A. Ospina; Ramirez, Mercy G.; Nelly G. Cribillero

    2014-01-01

    Reportamos por primera vez la presencia del nematodo, Serratospiculum tendo Nitzsch, 1819, parasitando los sacos aéreos de un halcón peregrino (Falco peregrinus Tunstall, 1771). Seis nematodos (2 machos y 4 hembras) fueron colectados e identificados como S. tendo. El hallazgo de este nematodo constituye el primer registro en el Perú.

  16. Primer registro de Serratospiculum tendo (Nematoda: Diplotriaenidae para el Perú

    Directory of Open Access Journals (Sweden)

    Luis A. Gomez-Puerta

    2014-05-01

    Full Text Available Reportamos por primera vez la presencia del nematodo, Serratospiculum tendo Nitzsch, 1819, parasitando los sacos aéreos de un halcón peregrino (Falco peregrinus Tunstall, 1771. Seis nematodos (2 machos y 4 hembras fueron colectados e identificados como S. tendo. El hallazgo de este nematodo constituye el primer registro en el Perú.

  17. Assessment of fungal diversity in deep-sea sediments by multiple primer approach

    Digital Repository Service at National Institute of Oceanography (India)

    Singh, P.; Raghukumar, C.; Verma, P.; Shouche, Y.

    Increasing evidence of the fungal diversity in deep-sea sediments has come from amplification of environmental DNA with fungal specific or eukaryote primer sets. In order to assess the fungal diversity in deep-sea sediments of the Central Indian...

  18. Evaluation of genetic diversity in open pollinated guava by iPBS primers

    International Nuclear Information System (INIS)

    DNA markers are important tools for assessing genetic diversity and relationships among species, cultivars and breeding materials. Many horticultural species are lacking genomic information. DNA markers that do not require prior knowledge of DNA sequences are therefore appealing for horticultural research. A retrotransposon-based DNA marker system, iPBS (inter primer binding sites) developed from conserved primer binding sites within retrotransposons, was used to study the genetic variation and relationships in ornamental guava. PCR from 6 iPBS primers (dominant markers) produced a total of 113 bands (52.38-100% polymorphic) ranging from 150 bp to 3000 bp, and the mean PIC value for each primer ranging from 0.1245 to 0.3698. Molecular information generated from both iPBS was separately scored in a matrix for phylogenetic dendrogram construction. The phylogenetic dendrogram based on iPBS markers reflected morphologic classifications of the accessions that were studied. The iPBS PCR-based genome fingerprinting technology in this study is low-cost and provides another effective alternative in differentiation of accessions in guava (Psidium guajava Linn.) and related species or genera. (author)

  19. What Are the Odds of that? A Primer on Understanding Logistic Regression

    Science.gov (United States)

    Huang, Francis L.; Moon, Tonya R.

    2013-01-01

    The purpose of this Methodological Brief is to present a brief primer on logistic regression, a commonly used technique when modeling dichotomous outcomes. Using data from the National Education Longitudinal Study of 1988 (NELS:88), logistic regression techniques were used to investigate student-level variables in eighth grade (i.e., enrolled in a…

  20. Novel oligonucleotide primers reveal a high diversity of microbes which drive phosphorous turnover in soil.

    Science.gov (United States)

    Bergkemper, Fabian; Kublik, Susanne; Lang, Friederike; Krüger, Jaane; Vestergaard, Gisle; Schloter, Michael; Schulz, Stefanie

    2016-06-01

    Phosphorus (P) is of central importance for cellular life but likewise a limiting macronutrient in numerous environments. Certainly microorganisms have proven their ability to increase the phosphorus bioavailability by mineralization of organic-P and solubilization of inorganic-P. On the other hand they efficiently take up P and compete with other biota for phosphorus. However the actual microbial community that is associated to the turnover of this crucial macronutrient in different ecosystems remains largely anonymous especially taking effects of seasonality and spatial heterogeneity into account. In this study seven oligonucleotide primers are presented which target genes coding for microbial acid and alkaline phosphatases (phoN, phoD), phytases (appA), phosphonatases (phnX) as well as the quinoprotein glucose dehydrogenase (gcd) and different P transporters (pitA, pstS). Illumina amplicon sequencing of soil genomic DNA underlined the high rate of primer specificity towards the respective target gene which usually ranged between 98% and 100% (phoN: 87%). As expected the primers amplified genes from a broad diversity of distinct microorganisms. Using DNA from a beech dominated forest soil, the highest microbial diversity was detected for the alkaline phosphatase (phoD) gene which was amplified from 15 distinct phyla respectively 81 families. Noteworthy the primers also allowed amplification of phoD from 6 fungal orders. The genes coding for acid phosphatase (phoN) and the quinoprotein glucose dehydrogenase (gcd) were amplified from 20 respectively 17 different microbial orders. In comparison the phytase and phosphonatase (appA, phnX) primers covered 13 bacterial orders from 2 different phyla respectively. Although the amplified microbial diversity was apparently limited both primers reliably detected all orders that contributed to the P turnover in the investigated soil as revealed by a previous metagenomic approach. Genes that code for microbial P transporter

  1. A method for automatically extracting infectious disease-related primers and probes from the literature

    Directory of Open Access Journals (Sweden)

    Pérez-Rey David

    2010-08-01

    Full Text Available Abstract Background Primer and probe sequences are the main components of nucleic acid-based detection systems. Biologists use primers and probes for different tasks, some related to the diagnosis and prescription of infectious diseases. The biological literature is the main information source for empirically validated primer and probe sequences. Therefore, it is becoming increasingly important for researchers to navigate this important information. In this paper, we present a four-phase method for extracting and annotating primer/probe sequences from the literature. These phases are: (1 convert each document into a tree of paper sections, (2 detect the candidate sequences using a set of finite state machine-based recognizers, (3 refine problem sequences using a rule-based expert system, and (4 annotate the extracted sequences with their related organism/gene information. Results We tested our approach using a test set composed of 297 manuscripts. The extracted sequences and their organism/gene annotations were manually evaluated by a panel of molecular biologists. The results of the evaluation show that our approach is suitable for automatically extracting DNA sequences, achieving precision/recall rates of 97.98% and 95.77%, respectively. In addition, 76.66% of the detected sequences were correctly annotated with their organism name. The system also provided correct gene-related information for 46.18% of the sequences assigned a correct organism name. Conclusions We believe that the proposed method can facilitate routine tasks for biomedical researchers using molecular methods to diagnose and prescribe different infectious diseases. In addition, the proposed method can be expanded to detect and extract other biological sequences from the literature. The extracted information can also be used to readily update available primer/probe databases or to create new databases from scratch.

  2. First half 2005 financial results; Resultats du 1. semestre 2005

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2005-07-01

    With manufacturing facilities in over 40 countries and a sales network in over 100, AREVA offers customers technological solutions for nuclear power generation and electricity transmission and distribution. The group also provides interconnect systems to the telecommunications, computer and automotive markets. This document presents the first half 2005 financial results of the group: 1 - overall performance: sales revenue, operating income, consolidated net income, operating cash flow, balance sheet; 2 - outlook; 3 - performance by business division: front-end division, reactors and services division, back end division, transmission and distribution division, connectors division.

  3. The effect of multiple primer-template mismatches on quantitative PCR accuracy and development of a multi-primer set assay for accurate quantification of pcrA gene sequence variants.

    Science.gov (United States)

    Ledeker, Brett M; De Long, Susan K

    2013-09-01

    Quantitative PCR (qPCR) is a critical tool for quantifying the abundance of specific organisms and the level or expression of target genes in medically and environmentally relevant systems. However, often the power of this tool has been limited because primer-template mismatches, due to sequence variations of targeted genes, can lead to inaccuracies in measured gene quantities, detection failures, and spurious conclusions. Currently available primer design guidelines for qPCR were developed for pure culture applications, and available primer design strategies for mixed cultures were developed for detection rather than accurate quantification. Furthermore, past studies examining the impact of mismatches have focused only on single mismatches while instances of multiple mismatches are common. There are currently no appropriate solutions to overcome the challenges posed by sequence variations. Here, we report results that provide a comprehensive, quantitative understanding of the impact of multiple primer-template mismatches on qPCR accuracy and demonstrate a multi-primer set approach to accurately quantify a model gene pcrA (encoding perchlorate reductase) that has substantial sequence variation. Results showed that for multiple mismatches (up to 3 mismatches) in primer regions where mismatches were previously considered tolerable (middle and 5' end), quantification accuracies could be as low as ~0.1%. Furthermore, tests were run using a published pcrA primer set with mixtures of genomic DNA from strains known to harbor the target gene, and for some mixtures quantification accuracy was as low as ~0.8% or was non-detect. To overcome these limitations, a multiple primer set assay including minimal degeneracies was developed for pcrA genes. This assay resulted in nearly 100% accurate detection for all mixed microbial communities tested. The multi-primer set approach demonstrated herein can be broadly applied to other genes with known sequences. PMID:23806694

  4. In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River

    Science.gov (United States)

    Cannon, M. V.; Hester, J.; Shalkhauser, A.; Chan, E. R.; Logue, K.; Small, S. T.; Serre, D.

    2016-03-01

    Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity.

  5. PriFi - Using a Multiple Alignment of Related Sequences to Find Primers for  Amplification of Homologs

    DEFF Research Database (Denmark)

    Fredslund, Jakob; Schauser, Leif; Madsen, Lene Heegaard;

    2005-01-01

    Using a comparative approach, the web program PriFi (http://cgi-www.daimi.au.dk/cgi-chili/PriFi/main) designs pairs of primers useful for PCR amplification of genomic DNA in species where prior sequence information is not available. The program works with an alignment of DNA sequences from...... phylogenetically related species and outputs a list of possibly degenerate primer pairs fulfilling a number of criteria, such that the primers have a maximal probability of amplifying orthologous sequences in other phylogenetically related species. Operating on a genome-wide scale, PriFi automates the first steps...

  6. Mineralogical Transformation and Electrochemical Nature of Magnesium-Rich Primers during Natural Weathering

    Directory of Open Access Journals (Sweden)

    Shashi S. Pathak

    2014-07-01

    Full Text Available Magnesium-rich primers (MgRP have generated great interest as a promising alternative to chromium-based primers for the protection of aluminum substrates but their performance during exterior exposure has not been well documented. This paper focuses on the evaluation of MgRP during natural weathering to gain insight into its mineralogical phase transformation and electrochemical nature. Control studies were conducted on Mg and AA2024-T3 coupons. The results indicate that Mg particles in MgRP transform into a variety of hydroxide, carbonate, and hydroxy carbonates. During natural weathering, CO2 inhibited the dissolution of both Mg and AA2024-T3 as a result of protective carbonate layer formation in the coating.

  7. Una experiencia con QSB+ en Matemáticas de primer curso

    OpenAIRE

    Ordás Amo, Pilar; Ibar Alonso, Raquel; García Centeno, Mª Carmen; Gabriela M. Fernández Barberis; Escribano Ródenas, Mª Carmen; Calvo Martín, M.E.

    2001-01-01

    Nuestro objetivo con este trabajo es presentar una experiencia que hemos llevado a cabo con los alumnos de primer curso, en la asignatura de Matemáticas, de las Licenciaturas en Ciencias Económicas y Administración y Dirección de Empresas, durante los cursos 1999/2000 y 2000/2001. El propósito de la experiencia es que los alumnos de primer curso vean una parte de la optimización matemática, como es la programación lineal, y el método del Símplex, a través de un software informático senc...

  8. Detection of genetic variability in Chrysanthemum (Dendranthema grandiflora T. using ISSR primers

    Directory of Open Access Journals (Sweden)

    P. Lalitha Kameswari, Hameedunnisabegum, M. Pratap, and G.Anuradha

    2015-03-01

    Full Text Available The genetic diversity of 37 genotypes of Chrysanthemum was characterized using inter simple sequence repeats (ISSR technique. A total of 46 primers were screened, of which 10 polymorphic and informative patterns were selected to determine genetic relationships. Among 114 amplified DNA fragments obtained, 107 bands were polymorphic, accounting for 93.86% polymorphism. The percentage of polymorphism exhibited by different ISSR primers ranged from 71.43% (ISSR-825 to 100% (ISSR-808, 810, 812, 840 and 842. The similarity coefficient values ranged from 0.275 to 0.775 with a mean similarity matrix of 0.525. Among the 37 genotypes studied, the closest relationship was scored between Geetanjali and Red Stone with similarity level of 77.5% while, the most distantly related genotypes were Autumn Joy and Flirtation with the lowest similarity index of 0.275. The UPGMA dendrogram revealed that the chrysanthemum genotypes were grouped into ten clusters.

  9. Universal primer PCR with DGGE for rapid detection of bacterial pathogens.

    Science.gov (United States)

    Ji, Niannian; Peng, Bo; Wang, Guizhong; Wang, Sanying; Peng, Xuanxian

    2004-06-01

    A universal primer PCR (UPPCR) combined with denaturing gradient gel electrophoresis (DGGE) was evaluated as a method permitting the rapid detection of pathogens. The results show that this method is efficient at amplifying the conserved regions of bacterial 16S rRNA genes with universal primers and can detect causative bacterial pathogens rapidly. Six species of bacteria from fisheries (Pseudomonas fluorescens, Vibrio anguillarum, Aeromonas hydrophila, Vibrio fluvialis, Providencia rettgeri and Aeromonas sobria) were examined. Our results indicate that the approach we undertook can be adopted not only for axenic bacterial populations but also for mixed communities as well. Furthermore, we were able to achieve the rapid detection of multiple bacteria a single in sample. In addition, UPPCR-DGGE was shown to be better than previously reported UPPCR-single-stranded conformation polymorphism (SSCP)-based methods for the rapid detection of bacterial pathogens. PMID:15134888

  10. The Astrobiology Primer: An Outline of General Knowledge - Version 1, 2006

    CERN Document Server

    Mix, L J; Mandell, A M; Mosier, A C; Raymond, J; Raymond, S N; Stewart, F J; Von Braun, K; Zhaxybayeva, O; Billings, L; Cameron, V; Claire, M; Dick, G J; Domagal-Goldman, S D; Javaux, E J; Johnson, O J; Laws, C; Race, M S; Rask, J; Rummel, J D; Schelble, R T; Vance, S

    2006-01-01

    Astrobiology, the study of life as a planetary phenomenon, aims to understand the fundamental nature of life on earth and the possibility of life elsewhere. To achieve this goal, astrobiologists have initiated unprecedented communication between the disciplines of astronomy, biology, chemistry, and geology. The Astrobiology Primer has been created as a reference tool for those who are interested in the interdisciplinary field of astrobiology. The field incorporates many diverse research endeavors, but it is our hope that this slim volume will present the reader with all he or she needs to know to become involved and to understand, at least at a fundamental level, the state of the art. Because of the great diversity of material, each section was written by a different author with a different expertise. The Primer was constructed collaboratively. Ninety researchers from around the world contributed information with regard to what they expected from other astrobiologists and what they would like to know themselv...

  11. Differentiation of five tuna species by a multiplex primer-extension assay.

    Science.gov (United States)

    Bottero, Maria Teresa; Dalmasso, Alessandra; Cappelletti, Marco; Secchi, Camillo; Civera, Tiziana

    2007-05-01

    A novel methodology based on analysis of mtDNA-cytb diagnostic sites was performed to discriminate four closely related species of Thunnus (Thunnus alalunga, Thunnus albacares, Thunnus obesus and Thunnus thynnus) and one species of Euthynnus (Katsuwonus pelamis) genus in raw and canned tuna. The primers used in the preliminary PCR designed in well conserved region upstream and downstream of the diagnosis sites successfully amplified a 132bp region from the cytb gene of all the species taken into consideration. The sites of diagnosis have been interrogate simultaneously using a multiplex primer-extension assay (PER) and the results were confirmed by fragment sequencing. The applicability of the multiplex PER assay to commercial canned tuna samples was also demonstrated. The proposed test could be useful for detection of fraud and for seafood traceability. PMID:17353060

  12. Development and characterization of 11 microsatellite primers for the sedge Trichophorum planifolium (Cyperaceae)1

    Science.gov (United States)

    Nowell, Victoria J.; Wang, Song; Smith, Tyler W.

    2015-01-01

    Premise of the study: Microsatellite loci were developed for Trichophorum planifolium (Cyperaceae), an endangered woodland sedge protected under federal and provincial legislation in Canada, to explore patterns of population genetic diversity and differentiation in the species. Methods and Results: Sixty-three primer pairs were evaluated for amplification consistency and screened for polymorphisms in 96 samples collected from 12 populations of T. planifolium distributed through the range of the species. Of these, 11 loci were shown to be polymorphic, displaying two to six alleles. Mean observed heterozygosity across loci ranged from 0.00 to 0.06 among populations tested. Conclusions: The results suggest that the 11 primer pairs developed in this study will be useful for future studies of broad-scale genetic variation in T. planifolium and in guiding management protocols for the species in Canada. PMID:26421254

  13. INFLUENCIA DE LA GUARDERÍA EN EL PRIMER AÑO DE ED. INFANTIL

    OpenAIRE

    Fernández-Galán, Rebeca

    2012-01-01

    En este trabajo se aborda el tema referente a la influencia que tiene la guardería en la incorporación y la evolución del niño en el primer curso de educación infantil. Se pretende analizar en este proyecto cómo influye la guardería en el primer año escolar del niño y las diferencias que existen en el aprendizaje de distintos conceptos entre los niños que han asistido a la guardería y los que no. Para ello se han empleado fichas y cuestionarios, en una muestra realizada en un centro esc...

  14. Anticorrosion characteristics of a Zn-primer coating in a ballast tank under various chloride concentrations

    International Nuclear Information System (INIS)

    At an open-circuit potential, the anodic polarization curves had very similar values, and no significant differences were observed among the conditions. In the cathodic polarization curves, total residual chloride (TRC) reacted with the Zn-primer coating and created a film that had anticorrosion properties. Therefore, the anticorrosion property improved. With an increase in applied potential in the potentiostatic experiment, the observed surface corrosion occurred due to the dissolution reaction. From Tafel analysis, the corrosion current density had the highest value in natural seawater and the lowest value in the 2 ppm solution. Generally, metals corrode faster with increasing TRC concentration, but with the formation of Zn(OH)2, which has anticorrosion properties, the corrosion resistance of a Zn-primer-coated specimen in seawater can be improved.

  15. A primer on Return on Investment and real options for portfolio optimization

    OpenAIRE

    Mun, Johnathan; Housel, Thomas

    2006-01-01

    In this quick primer, advanced quantitative risk-based concepts will be introduced, namely, the hands-on application of Monte Carlo simulation, real options analysis, stochastic forecasting and portfolio optimization, and knowledge value added. These methodologies rely on common metrics and existing techniques (e.g., return on investment, discounted cash flow, cost-based analysis, and so forth), and complements these traditional techniques by pushing the envelope of analytics, and not to rep...

  16. Avulsión de canino y subluxación del primer premolar superiores derechos

    OpenAIRE

    Berástegui, Esther

    1996-01-01

    Se presenta un caso clínico de avulsión de canino y subluxación del primer remolar, superiores derechos, secundario a traumatismo por piedra lanzada al aire. El tiempo extraoral fue de cuatro horas en medio seco. Se trató con reimplante, ferulización y tratamiento endodóncico. Los controles posteriores a los cuatro años del tratamiento mostraron la evolución favorable del caso.

  17. Applied Ecosystem Analysis - - a Primer : EDT the Ecosystem Diagnosis and Treatment Method.

    Energy Technology Data Exchange (ETDEWEB)

    Lestelle, Lawrence C.; Mobrand, Lars E.

    1996-05-01

    The aim of this document is to inform and instruct the reader about an approach to ecosystem management that is based upon salmon as an indicator species. It is intended to provide natural resource management professionals with the background information needed to answer questions about why and how to apply the approach. The methods and tools the authors describe are continually updated and refined, so this primer should be treated as a first iteration of a sequentially revised manual.

  18. An improved allele-specific PCR primer design method for SNP marker analysis and its application

    OpenAIRE

    Liu Jing; Huang Shunmou; Sun Meiyu; Liu Shengyi; Liu Yumei; Wang Wanxing; Zhang Xiurong; Wang Hanzhong; Hua Wei

    2012-01-01

    Abstract Background Although Single Nucleotide Polymorphism (SNP) marker is an invaluable tool for positional cloning, association study and evolutionary analysis, low SNP detection efficiency by Allele-Specific PCR (AS-PCR) still restricts its application as molecular marker like other markers such as Simple Sequence Repeat (SSR). To overcome this problem, primers with a single nucleotide artificial mismatch introduced within the three bases closest to the 3’end (SNP site) have been used in ...

  19. The Astrobiology Primer: An Outline of General Knowledge - Version 1, 2006

    OpenAIRE

    Mix, Lucas J; Armstrong, John C; Mandell, Avi M.; Mosier, Annika C.; Raymond, Jason; Raymond, Sean N.; Stewart, Frank J; von Braun, Kaspar; Zhaxybayeva, Olga; Billings, Linda; Cameron, Vyllinniskii; Claire, Mark; Dick, Greg J; Domagal-Goldman, Shawn D.; Javaux, Emmanuelle

    2006-01-01

    Astrobiology, the study of life as a planetary phenomenon, aims to understand the fundamental nature of life on earth and the possibility of life elsewhere. To achieve this goal, astrobiologists have initiated unprecedented communication between the disciplines of astronomy, biology, chemistry, and geology. The Astrobiology Primer has been created as a reference tool for those who are interested in the interdisciplinary field of astrobiology. The field incorporates many diverse research endea...

  20. Applied ecosystem analysis - a primer; the ecosystem diagnosis and treatment method

    International Nuclear Information System (INIS)

    The aim of this document is to inform and instruct the reader about an approach to ecosystem management that is based upon salmon as an indicator species. It is intended to provide natural resource management professionals with the background information needed to answer questions about why and how to apply the approach. The methods and tools the authors describe are continually updated and refined, so this primer should be treated as a first iteration of a sequentially revised manual

  1. A historical primer on consumer credit reporting systems: A lesson for EU policy makers?

    OpenAIRE

    Ferretti, F

    2007-01-01

    This work investigates the cultural framework through the lens of history of consumer credit reporting in the lender-borrower relationship in order to inform European legislators when setting a future legal framework. It provides an historical primer of consumer credit reporting in the US where it first originated and how the system was transplanted in Europe without following that process of legitimisation and legislative procedure that was so crucial over more than 100 years of American hi...

  2. Detection and Identification of Probiotic Lactobacillus plantarum Strains by Multiplex PCR Using RAPD-Derived Primers

    OpenAIRE

    Alex Galanis; Yiannis Kourkoutas; Chrysoula C. Tassou; Nikos Chorianopoulos

    2015-01-01

    Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB) strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers de...

  3. Hot Start PCR with heat-activatable primers: a novel approach for improved PCR performance

    OpenAIRE

    Lebedev, Alexandre V.; Paul, Natasha; Yee, Joyclyn; Timoshchuk, Victor A.; Shum, Jonathan; Miyagi, Kei; Kellum, Jack; Hogrefe, Richard I.; Zon, Gerald

    2008-01-01

    The polymerase chain reaction (PCR) is widely used for applications which require a high level of specificity and reliability, such as genetic testing, clinical diagnostics, blood screening, forensics and biodefense. Great improvements to PCR performance have been achieved by the use of Hot Start activation strategies that aim to prevent DNA polymerase extension until more stringent, higher temperatures are reached. Herein we present a novel Hot Start activation approach in PCR where primers ...

  4. Sequence diversity in haloalkane dehalogenases, as revealed by PCR using family-specific primers

    Czech Academy of Sciences Publication Activity Database

    Kotík, Michael; Faměrová, Veronika

    2012-01-01

    Roč. 88, č. 2 (2012), s. 212-217. ISSN 0167-7012 R&D Projects: GA ČR GAP504/10/0137; GA ČR GAP207/10/0135 Institutional research plan: CEZ:AV0Z50200510 Keywords : Dehalogenation * Consensus sequence * Degenerate PCR primer Subject RIV: EE - Microbiology, Virology Impact factor: 2.161, year: 2012

  5. Characterizing contrasting soils and sediments with semispecific actinomycete r-DNA PCR primers

    Czech Academy of Sciences Publication Activity Database

    Hill, P.; Krištůfek, Václav; Caballero, S.; Kroetsch, D. J.; Rauch, Ota

    České Budějovice: Institute of Soil Biology AS CR, 2004, s. 88-92. ISBN 80-86525-03-1. [Present methods for investigation of microbial community biodiversity in soils and substrates. Methodological workshop /9./. České Budějovice (CZ), 02.03.2004-03.03.2004] Institutional research plan: CEZ:AV0Z6066911 Keywords : contrasting soils * sediments * semispecific actinomycete r-DNA PCR primers Subject RIV: EH - Ecology, Behaviour

  6. Single primer amplification reaction methods reveal exotic and indigenous mulberry varieties are similarly diverse

    Indian Academy of Sciences (India)

    Esha Bhattacharya; S B Dandin; Shirish Anand Ranade

    2005-12-01

    Mulberry is the sole food source for mulberry silkworm and a number of indigenous and exotic varieties are used in sericulture. Studies on assessment of genetic diversity have been done amongst a few mulberry varieties using one or at the most two methods. However, no comprehensive study on a large number of varieties has been carried out. In present study, single primer amplification reaction (SPAR) methods have been used for determination of diversity in 27 mulberry varieties (exotic as well as indigenous), using four minisatellite core sequence primers for directed amplification of minisatellite DNA (DAMD), three simple sequence repeat (SSR) motifs as primers for inter simple sequence repeat (ISSR) and 20 arbitrary sequence decamer primers for random amplified polymorphic DNA (RAPD) reactions. The Jaccard coefficients were determined for the DAMD, ISSR and RAPD band data (total of 58, 39 and 235 bands respectively). All three methods revealed wide range of distances supporting a wide range of mulberry genetic diversity. A cumulative analysis of the data generated by three methods resulted in a neighbour-joining (NJ) tree that gave a better reflection of the relatedness and affinities of the varieties to each other. Comparison of the three methods by marker indices and the Mantel test of correlation indicated that though all methods were useful for the assessment of diversity in mulberry, the DAMD method was better. When considered as two groups (10 exotic and 17 indigenous varieties), the mulberry varieties in the exotic group were found to have slightly greater diversity than the indigenous ones. These results support the concept of naturalization of mulberry varieties at locales distant from their origins.

  7. Evaluation of polymeric coatings and primers against chloride ingress in concrete

    OpenAIRE

    Aguiar, J. L. Barroso de; Schueremans, Luc; Moreira, Pedro M.; Camões, Aires; Van Gemert, D.

    2007-01-01

    Nowadays, it is common knowledge that the biggest degradation of concrete is caused by outside to inside actions. Penetration of moisture, active gases and aggressive ions, as well as mechanical, physical and chemical causes frequently act together. A low porosity and low permeability of concrete to penetration of moisture and gases are the first lines of defence against several deterioration mechanisms. One of the possible ways to protect the concrete is using coatings and primers that act a...

  8. PCR differentiation of commercial yeast strains using intron splice site primers.

    OpenAIRE

    de Barros Lopes, M; Soden, A; Henschke, P. A.; Langridge, P

    1996-01-01

    The increased use of pure starter cultures in the wine industry has made it necessary to develop a rapid and simple identification system for yeast strains. A method based upon the PCR using oligonucleotide primers that are complementary to intron splice sites has been developed. Since most introns are not essential for gene function, introns have evolved with minimal constraint. By targeting these highly variable sequences, the PCR has proved to be very effective in uncovering polymorphisms ...

  9. FONZIE: An optimized pipeline for minisatellite marker discovery and primer design from large sequence data sets

    Directory of Open Access Journals (Sweden)

    Balesdent Marie-Hélène

    2010-11-01

    Full Text Available Abstract Background Micro-and minisatellites are among the most powerful genetic markers known to date. They have been used as tools for a large number of applications ranging from gene mapping to phylogenetic studies and isolate typing. However, identifying micro-and minisatellite markers on large sequence data sets is often a laborious process. Results FONZIE was designed to successively 1 perform a search for markers via the external software Tandem Repeat Finder, 2 exclude user-defined specific genomic regions, 3 screen for the size and the percent matches of each relevant marker found by Tandem Repeat Finder, 4 evaluate marker specificity (i.e., occurrence of the marker as a single copy in the genome using BLAST2.0, 5 design minisatellite primer pairs via the external software Primer3, and 6 check the specificity of each final PCR product by BLAST. A final file returns to users all the results required to amplify markers. A biological validation of the approach was performed using the whole genome sequence of the phytopathogenic fungus Leptosphaeria maculans, showing that more than 90% of the minisatellite primer pairs generated by the pipeline amplified a PCR product, 44.8% of which showed agarose-gel resolvable polymorphism between isolates. Segregation analyses confirmed that the polymorphic minisatellites corresponded to single-locus markers. Conclusion FONZIE is a stand-alone and user-friendly application developed to minimize tedious manual operations, reduce errors, and speed up the search for efficient minisatellite and microsatellite markers departing from whole-genome sequence data. This pipeline facilitates the integration of data and provides a set of specific primer sequences for PCR amplification of single-locus markers. FONZIE is freely downloadable at: http://www.versailles-grignon.inra.fr/bioger/equipes/leptosphaeria_maculans/outils_d_analyses/fonzie

  10. Primer System for Single Cell Detection of Double Mutation for Tay-Sachs Disease

    OpenAIRE

    Liu, Ming Cheng; Drury, Kenneth C.; Kipersztok, Simon; Zheng, Wenrong; Williams, R. Stan

    2000-01-01

    Purpose: Nearly 100% of infantile Tay-Sachs disease isproduced by two mutations occurring in the alpha chain ofthe lysosomal enzyme beta-N-acetylhexosaminidase (HEXA)in the Ashkenazi Jewish population. Although others havedescribed primer systems used to amplify both sitessimultaneously, few discuss the allele dropout problems inherent inthis test. Our goal was to construct a more robust testenabling stronger signal generation for single cellpreimplantation genetic diagnosis and to investigat...

  11. Optimization of Annealing Temperature To Reduce Bias Caused by a Primer Mismatch in Multitemplate PCR

    OpenAIRE

    Ishii, Kousuke; Fukui, Manabu

    2001-01-01

    To reduce PCR bias derived from a primer mismatch, the effect of the annealing temperature on the product ratio was investigated by denaturing gradient gel electrophoresis analysis of PCR products from a mixture of perfect-match and one-mismatch templates. These templates were generated by PCR from Pediococcus acidilactici for one mismatch and Micrococcus luteus for the perfect match. PCRs showed that the bias was reduced at lower temperatures. An environmental sample was also examined.

  12. Effect of retaining preconsruction primer (PCP) on the quality of high performance protective coatings systems

    International Nuclear Information System (INIS)

    In construction of new ships and large steel bridges in Korea, pre-construction primers (PCP), also known as shop primer, are routinely used and retained as an integral part of the protective coating system. Retention of PCP's can significantly reduce building schedule and cost. Retaining PCP through the so-called 'sweep blasting' procedure eliminates or minimizes the necessity of a second blast operation, thus shortening overall schedule as well as reducing labor cost and hazardous waste disposal cost. This study evaluates the feasibility of retaining PCP as the part of primer for high performance protective coating systems applied to ships' hull, bottom and ballast tanks. Upon proving that the retention of the PCP is a viable option, the process of coating application can be improved significantly in terms of cost and working schedule of new ships and large steel bridges. Results indicate that use of the PCP via sweeping blasting in conjunction with standard high performance protective coating systems does not degrade the overall performance of the coating systems. At the same time, it is also highly recommended that the secondary surface preparation should consist of grit blasting of weld burnt and other damaged areas to SSPC SP-10 grade (Sa 2.5 Gr.), Near White Blast Cleaning with proper application and attention to detail

  13. DNA TYPING FOR HLA - DR ALLELES BY PCR - AMPLIFICATION WITH SEQUENCE- SPECIFIC PRIMERS

    Institute of Scientific and Technical Information of China (English)

    谭建明; 谢桐; 徐琴君

    1999-01-01

    Ohjective To establish a rapid genetyping for HLA- DR alleles by polymerase chain reaction wiht sequence - specifie primers (PCR - SSP) for clinical application. Material and Methods The subjects of study included 69 recipients, 43 unrelated donors and 5 cell lines, Genomic DNA was prepared from peripheral blood leukoeytes by a salting- out method, Thirty primers designed according to the HLA- DRB nucleotide sequences, and synthesized on a 391 DNN synthesizer,Twenty separate PCR reactions were perfomed for each sample, The amplification was accomplished by 34 cycles consisting of denaturation at 94℃ for 30 seconds, annealing at 60℃ for 50 seconds and extension at 72℃ for 40 seconds The specificity of matching was determined by standard DNAs and Southem hybeidization using DIG labeling probes. Results All 112 samples and 5 cell lines were able to be typed by PCR-SSP,No false positive or false negative typing results were obtained. The reproducibility was 100 %,The size of the .specific product was in cnoccrdance with the size of the designed primers. The overall time for genotyping was 4 bours. The typing results were confirned by Southem hybridization.Conelusions Genotyping for HLA- DR by PCR- SSP is a rapid and accurate matching technique suited for clinical application.

  14. Development and characterization of DNA microsatellite primers for buriti (Mauritia flexuosa L.f.).

    Science.gov (United States)

    Menezes, E V; Souto, W F S; Ciampi, A Y; Azevedo, V C R; Valério, H M; Pimenta, M A S

    2012-01-01

    Mauritia flexuosa L. (Arecaceae) is a palm tree species known as buriti that occurs in the Cerrado biome. It is characteristic of the vereda, a typical ecosystem of central Brazil. In this phytophysiognomy, M. flexuosa and other groups of arboreal-herbaceous species develop in open fields with very humid soils. M. flexuosa can be found in forest borders and is a palm tree with a wide distribution in South America (Brazil, Colombia, Venezuela, French Guyana Ecuador, Peru, and Bolivia). The main objectives of this study were to develop simple sequence repeat marker-enriched libraries and to characterize these loci in buriti palm to facilitate future population studies. A total of 40 sequences derived from the microsatellite-enriched libraries were selected for primer design. The optimization results showed that 9 primer pairs could successfully amplify polymorphic target fragments of the expected sizes. The data also show that the described primers can be used in population genetic studies in M. flexuosa to obtain information that will inform conservation and management strategies. PMID:23079977

  15. A set of 100 chloroplast DNA primer pairs to study population genetics and phylogeny in monocotyledons.

    Science.gov (United States)

    Scarcelli, Nora; Barnaud, Adeline; Eiserhardt, Wolf; Treier, Urs A; Seveno, Marie; d'Anfray, Amélie; Vigouroux, Yves; Pintaud, Jean-Christophe

    2011-01-01

    Chloroplast DNA sequences are of great interest for population genetics and phylogenetic studies. However, only a small set of markers are commonly used. Most of them have been designed for amplification in a large range of Angiosperms and are located in the Large Single Copy (LSC). Here we developed a new set of 100 primer pairs optimized for amplification in Monocotyledons. Primer pairs amplify coding (exon) and non-coding regions (intron and intergenic spacer). They span the different chloroplast regions: 72 are located in the LSC, 13 in the Small Single Copy (SSC) and 15 in the Inverted Repeat region (IR). Amplification and sequencing were tested in 13 species of Monocotyledons: Dioscorea abyssinica, D. praehensilis, D. rotundata, D. dumetorum, D. bulbifera, Trichopus sempervirens (Dioscoreaceae), Phoenix canariensis, P. dactylifera, Astrocaryum scopatum, A. murumuru, Ceroxylon echinulatum (Arecaceae), Digitaria excilis and Pennisetum glaucum (Poaceae). The diversity found in Dioscorea, Digitaria and Pennisetum mainly corresponded to Single Nucleotide Polymorphism (SNP) while the diversity found in Arecaceae also comprises Variable Number Tandem Repeat (VNTR). We observed that the most variable loci (rps15-ycf1, rpl32-ccsA, ndhF-rpl32, ndhG-ndhI and ccsA) are located in the SSC. Through the analysis of the genetic structure of a wild-cultivated species complex in Dioscorea, we demonstrated that this new set of primers is of great interest for population genetics and we anticipate that it will also be useful for phylogeny and bar-coding studies. PMID:21637837

  16. Primer effect in the detection of mtDNA heteroplasmy: insights from horse Cytochrome b gene.

    Science.gov (United States)

    Zhao, Qianjun; Kang, Ye; Pu, Yabin; Niu, Lili; Guan, Weijun; He, Xiaohong; Zhang, Hongping; Lim, Hyuntae; Ma, Yuehui; Zhong, Tao

    2015-04-01

    Heteroplasmy, the presence of bi-allelic mtDNA types within an individual, has been previously detected in the D-loop region and Cytochrome b gene (Cytb) of mitochondrial DNA using PCR-RFLP. However, heteroplasmy was absent in thousands of equine mtDNA sequences deposited in GenBank. To address whether heteroplasmy widely exists in mitochondria of Chinese indigenous horses, we generated the data set of the target sites in Cytb region with Sanger sequencing and PCR-RFLP method as well. In this study, 23 heteroplasmic individuals were detected in 430 Chinese local horses. Both site and length heteroplasmy were identified in horse Cytb, especially in Xinihe and Ujumqin breeds. Our data provide evidence that the forward and reverse primers seem to produce a similar approximation to the proportion of mutation base call. However, locations of primers affected the proper detection of mtDNA heteroplasmy. The data obtained in this study highlight the importance of the primers in the accurate detection of heteroplasmy. PMID:24409928

  17. Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA

    Energy Technology Data Exchange (ETDEWEB)

    Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J. (Pharmasset); (Emerald)

    2012-08-01

    The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.

  18. New primers for sex identification in the Chinese egret and other ardeid species.

    Science.gov (United States)

    Wang, Zeng; Zhou, Xiaoping; Lin, Qingxian; Fang, Wenzhen; Chen, Xiaolin

    2011-01-01

    Using the universal P2/P8 primers, we were able to obtain the gene segments of chromo-helicase-DNA binding protein (CHD)-Z and CHD-W from ten species of ardeid birds including Chinese egret (Egretta eulophotes), little egret (E. garzetta), eastern reef egret (E. sacra), great egret (Ardea alba), grey heron (A. cinerea), Chinese pond-heron (Ardeola bacchus), cattle egret (Bubulcus ibis), black-crowned night-heron (Nycticorax nycticorax), cinnamon bittern (Ixobrychus cinnamomeus) and yellow bittern (I. sinensis). Based on conserved regions inside the P2/P8-derived sequences, we designed new PCR primers for sex identification in these ardeid species. Using agarose gel electrophoresis, the PCR products showed two bands for females (140 bp derived from CHD-W and the other 250 bp from CHD-ZW), whereas the males showed only the 250 bp band. The results indicated that our new primers could be used for accurate and convenient sex identification in ardeid species. PMID:21429119

  19. Tea stains-inspired initiator primer for surface grafting of antifouling and antimicrobial polymer brush coatings.

    Science.gov (United States)

    Pranantyo, Dicky; Xu, Li Qun; Neoh, Koon-Gee; Kang, En-Tang; Ng, Ying Xian; Teo, Serena Lay-Ming

    2015-03-01

    Inspired by tea stains, plant polyphenolic tannic acid (TA) was beneficially employed as the primer anchor for functional polymer brushes. The brominated TA (TABr) initiator primer was synthesized by partial modification of TA with alkyl bromide functionalities. TABr with trihydroxyphenyl moieties can readily anchor on a wide range of substrates, including metal, metal oxide, polymer, glass, and silicon. Concomitantly, the alkyl bromide terminals serve as initiation sites for atom transfer radical polymerization (ATRP). Cationic [2-(methacryloyloxy)ethyl]trimethylammonium chloride (META) and zwitterionic 2-methacryloyloxyethyl phosphorylcholine (MPC) and N-(3-sulfopropyl)-N-(methacryloxyethyl)-N,N-dimethylammonium betaine (SBMA) were graft-polymerized from the TABr-anchored stainless steel (SS) surface. The cationic polymer brushes on the modified surfaces are bactericidal, while the zwitterionic coatings exhibit resistance against bacterial adhesion. In addition, microalgal attachment (microfouling) and barnacle cyprid settlement (macrofouling) on the functional polymer-grafted surfaces were significantly reduced, in comparison to the pristine SS surface. Thus, the bifunctional TABr initiator primer provides a unique surface anchor for the preparation of functional polymer brushes for inhibiting both microfouling and macrofouling. PMID:25650890

  20. Single-Copy Nuclear Gene Primers for Streptanthus and Other Brassicaceae from Genomic Scans, Published Data, and ESTs

    Directory of Open Access Journals (Sweden)

    N. Ivalú Cacho

    2013-07-01

    Full Text Available Premise of the study: We report 11 primer sets for nine single-copy nuclear genes in Streptanthus and other Thelypodieae (Brassicaceae and their utility at tribal-level and species-level phylogenetics in this poorly resolved group. Methods and Results: We selected regions based on a cross-referenced matrix of previous studies and public Brassica expressed sequence tags. To design primers, we used alignments of low-depth-coverage Illumina sequencing of genomic DNA for two species of Brassica mapped onto Arabidopsis thaliana. We report several primer combinations for five regions that consistently amplified a single band and yielded high-quality sequences for at least 70% of the species assayed, and for four additional regions whose utility might be clade specific. Conclusions: Our primers will be useful in improving resolution at shallow depths across the Thelypodieae, and likely in other Brassicaceae.

  1. The use of coded PCR primers enables high-throughput sequencing of multiple homolog amplification products by 454 parallel sequencing

    DEFF Research Database (Denmark)

    Binladen, Jonas; Gilbert, M Thomas P; Bollback, Jonathan P;

    2007-01-01

    template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to their original sources. METHODOLOGY: We use conventional PCR with 5'-nucleotide tagged primers to generate homologous DNA amplification products from multiple specimens, followed by sequencing through the...... differently tagged primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the...... distribution of the sequences as sorted by the second nucleotide of the dinucleotide tags. As the results are based on a single GS20 run, the general applicability of the approach requires confirmation. However, our experiments demonstrate that 5'primer tagging is a useful method in which the sequencing power...

  2. Application of microsatellite primers developed for Polistes in the independent-founding wasp Polists satan Bequaert (Hymenoptera: Vespidae).

    Science.gov (United States)

    Komatsu, K; Mateus, S; Zucchi, R; Nascimento, F; Kudô, K

    2012-06-01

    Microsatellite primers developed for a given species are sometimes useful for another in the same genus and in other genera within the same family, making possible to search for pre-existing suitable primers in the databanks such as GenBank. We examined whether existing primers developed for Polistes could be used for Polistes satan Bequaert. We tested 50 microsatellite primers from three Polistes species and found that six microsatellite loci show polymorphism in size in P. satan. These six loci were highly polymorphic, having four to 15 alleles in P. satan with an expected heterozygosity of 0.525-0.832. These loci can be used to study parameters concerning genetic relatedness such as social interactions in colonies and genetic conflicts of interest among nestmate individuals. PMID:23950044

  3. Comparison of commonly used primer sets for evaluating arbuscular mycorrhizal fungal communities: Is there a universal solution?

    Czech Academy of Sciences Publication Activity Database

    Kohout, P.; Sudová, R.; Janoušková, M.; Čtvrtlíková, Martina; Hejda, M.; Pánková, H.; Slavíková, R.; Štajerová, K.; Vosátka, M.; Sýkorová, Z.

    2014-01-01

    Roč. 68, January (2014), s. 482-493. ISSN 0038-0717 Institutional support: RVO:60077344 Keywords : arbuscular mycorrhizal fungi * primers * diversity Subject RIV: EF - Botanics Impact factor: 3.932, year: 2014

  4. Improved Bacterial 16S rRNA Gene (V4 and V4-5) and Fungal Internal Transcribed Spacer Marker Gene Primers for Microbial Community Surveys

    Energy Technology Data Exchange (ETDEWEB)

    Walters , William; Hyde, Embriette R.; Berg-Lyons, Donna; Ackermann, Gail; Humphrey, Greg; Parada , Alma; Gilbert, Jack A.; Jansson, Janet K.; Caporaso, Greg; Fuhrman, Jed A.; Apprill, Amy; Knight, Rob

    2015-12-22

    Designing primers for PCR-based taxonomic surveys that amplify a broad range of phylotypes in varied community samples is a difficult challenge, and the comparability of datasets amplified with varied primers requires attention. Here we examine the performance of modified 16S rRNA gene and ITS primers for archaea/bacteria and fungi, respectively, with non-aquatic samples. We moved primer barcodes to the 5’-end, allowing for a range of different 3’ primer pairings, such as the 515f/926r primer pair, which amplifies variable regions 4-5 of the 16S rRNA gene. We additionally demonstrate that modifications to the 515f/806r (variable region 4) 16S primer pair, which improves detection of Thaumarchaeota and SAR11 in marine samples, do not degrade performance on taxa already amplified effectively by the original primer set. Alterations to the fungal ITS primers did result in differential but overall improved performance compared to the original primers. In both cases, the improved primers should be widely adopted for amplicon studies.

  5. The effect of resin cements and primer on retentive force of zirconia copings bonded to zirconia abutments with insufficient retention

    OpenAIRE

    Kim, Seung-Mi; Yoon, Ji-Young; Lee, Myung-Hyun; Oh, Nam-Sik

    2013-01-01

    PURPOSE The purpose of this study was to investigate the effect of resin cements and primer on the retentive force of zirconia copings bonded to zirconia abutments with insufficient retention. MATERIALS AND METHODS Zirconia blocks (Lava, 3M ESPE, St. Paul, MN, USA) were obtained and forty sets of zirconia abutments and copings were fabricated using CAD/CAM technology. They were grouped into 4 categories as follows, depending on the types of resin cements used, and whether the primer is applie...

  6. Determination of the species specificity of the primers for the detection of chicken and turkey meat by realtime PCR method

    Directory of Open Access Journals (Sweden)

    Lenka Maršálková

    2014-07-01

    Full Text Available The aim of this work was to use TaqMan Real-Time PCR for quantitative authentication of chicken and turkey meat. To meet this purpose, a specific pair of primers and TaqMan probe was used. The test was aimed at identifying the reaction cycle of turkey and chicken meat using by two sets of primers. With first set of primer designed for chicken we obtained the following results: Cp = 16.18 for 100% chicken DNA Cp = 29, 18 100% turkey DNA It was also amplified DNA of pig that exceeded the detection threshold fluorescence intensities in the 31.07 cycle (Cp = 31.07. Using primers designed for turkey we obtained the following results Cp = 31.16 for 100% CHDNA, Cp =16.18 100% TDNA. It was also amplified the 100% DNA of rabbit in 31.63 cycle (Cp = 31.63 and deer in cycle 32 (Cp = 32. The DNA of all other animal species was amplificated after more than 35 cycles (Cp >35. It follows that the second detection primer pair is specific enough to unrelated species of animals by 30 cycles of the reaction. Species authentication based on DNA analysis from this perspective overcomes all the shortcomings of proteins. At present, DNA analysis use different types of PCR. Is the most progressive Real-time PCR, which is suitable for the specific use of detection (primers and TaqMan probe. The TaqMan Real-time PCR is within the sensitivity and specificity, clearly one of the best methods for identifying the species of chicken and turkey meat. The specificity of this method, however, depends primarily on the specificity of the primers and TaqMan probe. The 30 cycle reaction was chosen by us as the threshold for specificity using primers for authentication chicken and turkey meat.

  7. Hyperelasticity primer

    CERN Document Server

    Hackett, Robert M

    2016-01-01

    This book introduces the subject of hyperelasticity in a concise manner mainly directed to students of solid mechanics who have a familiarity with continuum mechanics.  It focuses on important introductory topics in the field of nonlinear material behavior and presents a number of example problems and solutions to greatly aid the student in mastering the difficulty of the subject and gaining necessary insight.  Professor Hackett delineates the concepts and applications of hyperelasticity in such a way that a new student of the subject can absorb the intricate details without having to wade through excessively complicated formulations.  The book further presents significant review material on intricately related subjects such as tensor calculus and introduces some new formulations.

  8. MATLAB Primer

    CERN Document Server

    Davis, Timothy A

    2010-01-01

    The eighth edition of this popular book provides a hands-on introduction to MATLAB[registered] that can be used at the undergraduate level. The new edition features the use of MATLAB 8.0, which will be introduced to the market in March 2010. It covers object-oriented programming in MATLAB and the improvements that have been made to the MATLAB desktop and programming tools. There is a new chapter that discusses MATLAB Central, a supporting website where users can exchange files, blogs, and links. In addition, the appendix of help topics has been updated to reflect only the most frequently used

  9. VGRAF primer

    Energy Technology Data Exchange (ETDEWEB)

    Padilla, G.C.; Thompson, S.L.

    1980-10-01

    VGRAF is a powerful FORTRAN program which is designed to produce professional-quality color slides, viewgraphs, posters, and data plots for presentations or reports. The program is easy to use and requires no a priori knowledge of a programming language and little or no previous programming experience. This report describes a subset of the VGRAF commands which will enable the user to make very simple plots. For enhanced plotting, the user is referred to SAND79-2147.

  10. Elimination of intracanal infection in dogs' teeth with induced periapical lesions after rotary instrumentation: influence of different calcium hydroxide pastes Eliminação da infecção intracanal em dentes de cães com lesões periapicais induzidas após instrumentação automatizada: influência de diferentes pastas de hidróxido de cálcio

    Directory of Open Access Journals (Sweden)

    Janir Alves Soares

    2006-06-01

    radiculares vazios e 96 horas após obteve-se a segunda amostragem microbiológica (A2. O número de unidades formadoras de colônias de microrganismos (ufc e a incidência de culturas positivas antes e após cada tratamento foram analisados pelo teste de Wilcoxon enquanto a influência dos diferentes tratamentos na infecção intracanal foi avaliada pelo teste de Kruskal-Wallis com nível de signficância de 5,0%. Verificaram-se nas amostras A1 elevadas quantidades de anaeróbios obrigatórios, facultativos e estreptococos do grupo viridans em 100% dos canais radiculares. Nas amostras A2, todos os tratamentos proporcionaram significativa redução do número de ufc e de culturas positivas (p<0.05, mas somente os grupos 3 e 4 proveram 100,0% dos canais radiculares livres de microrganismos. Portanto, a instrumentação automatizada coadjuvada pela solução de hipoclorito de sódio a 5,25% associada à medicação intracanal proporcionaram drástica redução ou eliminação da microbiota intracanal, cuja performance não foi influenciada pela natureza do veículo ou do anti-séptico acrescido ao hidróxido de cálcio p.a..

  11. Histomicrobiologic aspects of the root canal system and periapical lesions in dogs' teeth after rotary instrumentation and intracanal dressing with Ca(OH2 pastes Aspectos histomicrobiológicos do sistema de canais radiculares e das lesões periapicais em dentes de cães após instrumentação automatizada e medicação intracanal com pastas de Ca(OH2

    Directory of Open Access Journals (Sweden)

    Janir Alves Soares

    2006-10-01

    Full Text Available OBJECTIVE: The purpose of this study was to evaluate the distribution of microorganisms in the root canal system (RCS and periapical lesions of dogs' teeth after rotary instrumentation and placement of different calcium hydroxide [Ca(OH2]-based intracanal dressings. MATERIALS AND METHODS: Chronic periapical lesions were experimentally induced in 80 premolar roots of four dogs. Instrumentation was undertaken using the ProFile rotary system and irrigation with 5.25% sodium hypochlorite. The following Ca(OH2-based pastes were applied for 21 days: group 1 - Calen (n=18; group 2 - Calen+CPMC (n=20; group 3 - Ca(OH2 p.a. + anaesthetic solution (n=16 and group 4 - Ca(OH2 p.a.+ 2% chlorhexidine digluconate (n=18. Eight root canals without endodontic treatment constituted the control group. Histological sections were obtained and stained with Brown & Brenn staining technique to evaluate the presence of microorganisms in the main root canal, ramifications of the apical delta and secondary canals, apical cementoplasts, dentinal tubules, areas of cemental resorption and periapical lesions. The results were analyzed statistically by the Mann-Whitney U test (p0.05. The percentage of RCS sites containing microorganisms in groups 1, 2, 3, 4 and control were: 67.6%, 62.5%, 78.2%, 62.0% and 87.6%, respectively. CONCLUSION: In conclusion, the histomicrobiological analysis showed that the rotary instrumentation and the different calcium hydroxide pastes employed did not effectively eliminate the infection from the RCS and periapical lesions. However, several bacteria seen in the histological sections were probably dead or were inactivated by the biomechanical preparation and calcium hydroxide-based intracanal dressing.OBJETIVO: Neste estudo avaliou-se a distribuição dos microrganismos no sistema de canais radiculares (SCR e região periapical (RP de cães após instrumentação automatizada e utilização de pastas à base de hidróxido de cálcio CaO(H2

  12. High-coverage ITS primers for the DNA-based identification of ascomycetes and basidiomycetes in environmental samples.

    Directory of Open Access Journals (Sweden)

    Hirokazu Toju

    Full Text Available The kingdom Fungi is estimated to include 1.5 million or more species, playing key roles as decomposers, mutualists, and parasites in every biome on the earth. To comprehensively understand the diversity and ecology of this huge kingdom, DNA barcoding targeting the internal transcribed spacer (ITS region of the nuclear ribosomal repeat has been regarded as a prerequisite procedure. By extensively surveying ITS sequences in public databases, we designed new ITS primers with improved coverage across diverse taxonomic groups of fungi compared to existing primers. An in silico analysis based on public sequence databases indicated that the newly designed primers matched 99% of ascomycete and basidiomycete ITS taxa (species, subspecies or varieties, causing little taxonomic bias toward either fungal group. Two of the newly designed primers could inhibit the amplification of plant sequences and would enable the selective investigation of fungal communities in mycorrhizal associations, soil, and other types of environmental samples. Optimal PCR conditions for the primers were explored in an in vitro investigation. The new primers developed in this study will provide a basis for ecological studies on the diversity and community structures of fungi in the era of massive DNA sequencing.

  13. Validation of a primer optimisation matrix to improve the performance of reverse transcription – quantitative real-time PCR assays

    Directory of Open Access Journals (Sweden)

    Dobrovic Alexander

    2009-06-01

    Full Text Available Abstract Background The development of reverse transcription – quantitative real-time PCR (RT-qPCR platforms that can simultaneously measure the expression of multiple genes is dependent on robust assays that function under identical thermal cycling conditions. The use of a primer optimisation matrix to improve the performance of RT-qPCR assays is often recommended in technical bulletins and manuals. Despite this recommendation, a comprehensive introduction to and evaluation of this approach has been absent from the literature. Therefore, we investigated the impact of varying the primer concentration, leaving all the other reaction conditions unchanged, on a large number of RT-qPCR assays which in this case were designed to be monitored using hydrolysis probes from the Universal Probe Library (UPL library. Findings Optimal RT-qPCR conditions were determined for 60 newly designed assays. The calculated Cq (Quantification Cycle difference, non-specific amplification, and primer dimer formation for a given assay was often dependent on primer concentration. The chosen conditions were further optimised by testing two different probe concentrations. Varying the primer concentrations had a greater effect on the performance of a RT-qPCR assay than varying the probe concentrations. Conclusion Primer optimisation is important for improving the performance of RT-qPCR assays monitored by UPL probes. This approach would also be beneficial to the performance of other RT-qPCR assays such as those using other types of probes or fluorescent intercalating dyes.

  14. Effect of Saliva Contamination on Shear Bond Strength of Orthodontic Brackets When Using a Self-Etch Primer

    Institute of Scientific and Technical Information of China (English)

    MAO Jing; QI Juan

    2005-01-01

    The effect of saliva contamination on the shear bond strength of orthodontic brackets, at various stages of the bonding procedure using a new self-etch primer was studied. The samples were divided into 4 groups according to 4 different enamel surface conditions: Group A: dry; Group B: saliva contamination before priming; Group C: saliva contamination after priming, and Group D: saliva contamination before and after priming. Stainless steel brackets were bonded in each test group with a light-cured composite resin (TransbondXT 3M). The shear bond strength was determined in the first 30 min after bonding. The analysis of variance indicated that the shear bond strengths of the 4 groups were significantly different (F= 11.89, P<0.05). Tukey HSD tests indicated that contamination both before and after the application of the acid-etch primer resulted in a significantly lower (=4.6± 1.7 MPa) shear bond strength than either the control group (= 8.8±1.9 MPa) or the groups where contamination occurred either before ( = 7.9± 2.0 MPa) or after (=6.9±1.5 MPa) the application of the primer. It was concluded that the new acid-etch primer could maintain adequate shear bond strength if contamination occurred either before or after the application of the primer. On the other hand, contamination both before and after the application of the primer could significantly reduce the shear bond strength of orthodontic brackets.

  15. A Pair of Novel Primers for Universal Detection of the NS1 Gene from Various Bluetongue Virus Serotypes

    Institute of Scientific and Technical Information of China (English)

    Hui-qiong YIN; Gai-ping ZHANG; Hong ZHANG; Jin-gang ZHANG

    2008-01-01

    Twenty five serotypes of Bluetongue virus (BTV) have been identified worldwide. Rapid and reliable methods of virus universal detection are essential for fighting against bluetongue (BT). We have therefore developed and evaluated a pair of primers which can detect various serotypes of BTV by RT-PCR. Analysis of the viral protein 7 (VP7) and the non-structural protein (NS1) gene from different serotypes of BTV by DNAstar showed that the 5' end of the NS1 gene is the most conserved region. The primer pairs (P1 and P2) were designed based on the highly conserved region of NS1. The novel primers were evaluated by detecting BTV serotypes 1, 3, 5, 8, 10, 11, 21 and 22. The specificity of the primers was estimated by comparing to gene sequences of viruses published in GenBank, and further assessed by detecting BTV serotype 1-12 and Epizootic hemorrhagic disease virus (EHDV) serotype 1-4. The sensitivity and repeatability of PCR with the novel primers were evaluated by successfully detecting the recombinant plasmid pGEM-T121 containing the diagnosed nucleotide sequence. Our results suggest that these unique primers can be used in high throughout and universal detection of the NS1 gene from various BTV serotypes.

  16. Detection of YMDD mutation using mutant-specific primers in chronic hepatitis B patients before and after lamivudine treatment

    Institute of Scientific and Technical Information of China (English)

    Cha-Ze Lee; Hsuan-Shu Lee; Guan-Tarn Huang; Pei-Ming Yang; Jin-Chuan Sheu

    2006-01-01

    AIM: To develop a PCR assay using mutant-specific primers to detect mutation of tyrosine-methionineaspartate-aspartate (YMDD) motif of HBV to tyrosinevaline-aspartate-aspartate (YVDD) or tyrosine-isoleucineaspartate-aspartate (YIDD).METHODS: Cloned wild-type and mutant HBV sequences were used as templates to test the sensitivity and specificity of the assay. A variety of primer construction, primer concentration, dNTP concentration,and annealing temperature of primers were systematically examined. Pair primers specific to rtL180M and rtM204V were selected for YVDD detection. Primer specific to rtM204I with an additional 3'-penultimate base mismatched to both the mutant and wild-type sequence was selected for YIDD detection. We applied this assay to study YMDD mutants in 28 chronic hepatitis B patients before and after lamivudine treatment.RESULTS: We could detect as little as 0.001%-0.00001%of mutant viruses coexisting in 108-109 copies of wildtype HBV using this assay. YMDD mutants were detected in 8 of 12 HBeAg-positive patients and 8 of 16 HBeAgnegative patients before lamivudine treatment. After treatment, two more patients in HBeAg-positive patients and seven more patients in HBeAg-negative patients developed YMDD mutations.CONCLUSION: We developed a highly sensitive and specific assay for detecting YMDD mutants. This assay can be applied to monitor chronic hepatitis B patients before and during lamivudine treatment.

  17. Práticas alimentares e estado nutricional de crianças no segundo semestre de vida atendidas na rede pública de saúde Feeding practices and nutritional status of children in the second semester of life who receive care in public health facilities

    Directory of Open Access Journals (Sweden)

    Simone Paula Modesto

    2007-08-01

    Full Text Available OBJETIVO: Avaliar o estado nutricional e as práticas alimentares de crianças no segundo semestre de vida atendidas na rede pública de saúde do município de Taboão da Serra, SP. MÉTODOS: Estudo de corte transversal conduzido em Unidades Básicas de Saúde, classificadas em dois agrupamentos (região central e região periférica. A amostra foi constituída por 180 crianças, sendo 90 de cada agrupamento. O consumo alimentar foi registrado pelo método recordatório de 24 horas. Foram tomadas medidas de peso e dosagem de hemoglobina por punção capilar. RESULTADOS: A prevalência de anemia encontrada foi de 30,5% sem diferença entre os grupos. Os valores das medianas do escore-Z (peso/idade foram: 0,02 e 0,03, para os agrupamentos central e periférico, respectivamente. A utilização de suplemento de ferro apresentou diferença entre os grupos (p=0,001, sendo mais presente no agrupamento periférico, enquanto que para a vitamina A, a suplementação foi significantemente maior no agrupamento central (p=0,044. Verificou-se introdução precoce de alimentos distintos do leite materno na dieta infantil e diferença significante entre os grupos na idade de introdução de chá, suco de fruta, sopa e sopa com carne no esquema alimentar. Em relação à ingestão de nutrientes verificou-se consumo adequado de energia e proteínas, mas quanto aos micronutrientes estudados, há grande probabilidade de inadequação do consumo de ferro e vitamina C. CONCLUSÃO: A prevalência de anemia é relativamente reduzida, comparada com os dados obtidos em outros locais, e o esquema de introdução de alimentos complementares é inadequado, frente às recomendações atuais. A utilização de suplementos de nutrientes deve ser revista.OBJECTIVE: To assess the nutritional status and feeding practices of children in the second semester of life who receive care in public health facilities of the city of Taboão da Serra, SP. METHODS: This is a cross

  18. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    International Nuclear Information System (INIS)

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  19. Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)

    2013-01-25

    Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection

  20. Comprension de los conceptos de los enlaces ionico y covalente en estudiantes universitarios del primer curso de quimica general

    Science.gov (United States)

    Ballesteros Benavides, Maria Elvira

    Para este trabajo utilizamos el estudio de casos cualitativo que se llevo a cabo en una universidad privada de Puerto Rico. Empleamos como unidad de analisis el concepto de enlace quimico, ionico y covalente. Los participantes fueron los estudiantes de la seccion nocturna del curso de Quimica General I. La investigacion se desarrollo por medio de dos entrevistas de persona a persona, observaciones de las expresiones no verbales y la hoja de identificacion de conceptos. Para la triangulacion tomamos en consideracion las preconcepciones erroneas, las concepciones alternativas y el mapa de conceptos de cada participante. Preparamos un mapa de conceptos para el enlace quimico validado por un comite de expertos. Tambien, elaboramos los mapas de conceptos de los participantes que sirvieron para varios propositos: conocer la estructura conceptual, expresar los logros, hacer comparaciones e identificar la presencia de concepciones alternativas. Entre los hallazgos encontramos que todos los participantes poseen conocimiento previo de los enlaces quimicos ionico y covalente y dentro de ese conocimiento existen preconcepciones erroneas mas numerosas para el enlace ionico. Al principio del semestre el 50% de los participantes demostraron tener "carencia fuerte de conceptos" tanto para el enlace ionico como para el covalente. Al finalizar el semestre encontramos en el 40% de los participantes concepciones alternativas tanto para el enlace ionico como para el covalente y el 90% no lograron distinguir un enlace del otro. Nuestras conclusiones fueron que los participantes sin distincion del aprovechamiento academico demostraron tener la tendencia de "carencia fuerte de conceptos" tanto para el enlace ionico como para el covalente, presentaron dificultad al integrar los conceptos de los enlaces quimicos ionico y covalente que se pusieron de manifiesto al dar los ejemplos. Las preconcepciones erroneas contribuyen en el desarrollo de las concepciones alternativas. Ademas, los

  1. Streptococcus salivarius ATCC 25975 possesses at least two genes coding for primer-independent glucosyltransferases.

    Science.gov (United States)

    Simpson, C L; Giffard, P M; Jacques, N A

    1995-01-01

    Fractionation of the culture medium showed that Streptococcus salivarius ATCC 25975 secreted a glucosyltransferase (Gtf) that was primer independent. On the basis of this observation, a gene library of S. salivarius chromosomal DNA cloned into lambda L47.1 was screened for a gene(s) coding for such an activity. As a result of this screening process, two new gtf genes, gtfL and gtfM, both of which coded for primer-independent Gtf activities, were isolated. GtfL produced an insoluble glucan that was refractory to digestion by the endo-(1-->6)-alpha-D-glucanase. of Chaetonium gracile, while GtfM produced a soluble glucan that was readily degraded by the glucanase. Comparison of the deduced amino acid sequences of gtfL and gtfM with 10 other available Gtf sequences allowed the relatedness of the conserved catalytic regions to be assessed. This analysis showed that the 12 enzymes did not form clusters based on their primer dependencies or on their product solubilities. Further analysis of the YG repeats in the C-terminal glucan-binding domains of GtfJ, GtfK, GtfL, and GtfM from S. salivarius showed that there was strong homology between a block of contiguous triplet YG repeats present in the four alleles. These blocks of YG repeats were coded for by a region of each gene that appeared to have arisen as a result of a recent duplication event(s). PMID:7822030

  2. Application of PCR fingerprinting using (GACA 4 primer in the rapid discrimination of dermatophytes

    Directory of Open Access Journals (Sweden)

    E Elavarashi

    2014-01-01

    Full Text Available Background: Superficial fungal infections have a major impact on cosmetic health, affecting more than 20-25% of the global population, which is predominantly caused by dermatophytes. As per literature search, molecular strain typing of dermatophytes has not been investigated in India. Therefore, the present study was carried out to characterise the dermatophyte species and strains by molecular methods. Objective: To analyse the genotype variability by applying polymerase chain reaction (PCR fingerprinting using a simple sequence repetitive oligonucleotide (GACA 4 primer to identify the species and strain variations among the dermatophytes isolated from a tertiary care centre in Chennai. Materials and Methods: From January 2010 to December 2010, 81 dermatophytes were isolated and included for the present study. A simple sequence repetitive oligonucleotide (GACA 4 was used as a single primer in the amplification process. Results: The (GACA 4 -based PCR successfully amplified all the clinical isolates. Trichophyton rubrum and T. rubrum var. raubitschekii produced identical band profiles, where the latter could not be differentiated from the T. rubrum, which are being reported for the first time from south India. Epidermophyton floccosum produced species-specific band profiles. Intra-species variability was not observed among the T. rubrum and E. floccosum isolates. T. mentagrophytes produced three simple, distinct band patterns, which are surprisingly different from the earlier studies. Conclusion: The PCR-based genotype using the short primer is rapid and precise in direct identification of dermatophyte isolates by one-step PCR to the species level and strain discrimination of the T. mentagrophytes variants.

  3. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong

    2009-10-09

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

  4. Constructing the ecstasy of MDMA from its component mental organs: Proposing the primer/probe method.

    Science.gov (United States)

    Ray, Thomas S

    2016-02-01

    The drug MDMA, commonly known as ecstasy, produces a specific and distinct open hearted mental state, which led to the creation of a new pharmacological class, "entactogens". Extensive literature on its mechanisms of action has come to characterize MDMA as a "messy" drug with multiple mechanisms, but the consensus is that the distinctive entactogenic effects arise from the release of neurotransmitters, primarily serotonin. I propose an alternative hypothesis: The entactogenic mental state is due to the simultaneous direct activation of imidazoline-1 (I1) and serotonin-2 (5-HT2) receptors by MDMA. This hypothesis emerges from "mental organ" theory, which embodies many hypotheses, the most relevant of which are: "Mental organs" are populations of neurons that all express their defining metabotropic receptor, and each mental organ plays a distinct role in the mind, a role shaped by evolution as mental organs evolve by duplication and divergence. Mental organs are the mechanism by which evolution sculpts the mind. Mental organs can be in or out of consciousness. In order for a mental organ to enter consciousness, three things must happen: The mental organ must be activated directly at its defining receptor. 5-HT2 must be simultaneously activated. One of the functions of activated 5-HT2 is to load other simultaneously activated mental organs fully into consciousness. In some cases THC must be introduced to remove long-term blocks mediated by the cannabinoid system. I propose the "primer/probe" method to test these hypotheses. A "primer" is a drug that selectively activates 5-HT2 (e.g. DOB or MEM) or serotonin-1 (5-HT1) and 5-HT2 (e.g. DOET or 2C-B-fly). A "probe" is a drug that activates a receptor whose corresponding mental organ we wish to load into consciousness in order to understand its role in the mind. The mental organ is loaded into consciousness when the primer and probe are taken together, but not when taken separately. For example, the blood pressure

  5. Optimal time of soybean seed priming and primer effect under salt stress conditions

    OpenAIRE

    Miladinov Zlatica J.; Balešević-Tubić Svetlana N.; Đorđević Vuk B.; Đukić Vojin H.; Ilić Aleksandar D.; Čobanović Lazar M.

    2015-01-01

    The aim of this study was to examine optimal time of soybean seed priming and effect of primers under salt stress conditions. Testing was performed at the Institute of Field and Vegetable Crops, Novi Sad, on Galina seed variety. Optimal priming time was determined by immersing seed into: KNO3 (1%), H2O2 (0.1%), and H2O with the duration of 6 h, 12 h, 18 h, and 24 h. After drying until the initial moisture, the seed was placed for germination and after eight...

  6. El primer tractat de gravat calcogràfic a España

    OpenAIRE

    Figueras Ferrer, Eva

    1992-01-01

    Els estudis sobre la història del gravat coincideixen a designar l'obra de Manuel de Rueda 'Instrucción para gravar en cobre', publicada l'any 1791, com el primer manual calcogràfic escrit a Espanya. Es tracta, bàsicament, d'una traducció de les fonts bibliogràfiques franceses, entre les quals cal destacar la d'Abraham Bosse. En aquest article tenim la satisfacció de publicar un manuscrit espanyol, inèdit fins ara, que precedeix un segle l'obra de Manuel de Rueda. Es titula 'Método para grava...

  7. Primer reporte de nidos depredados por la chachalaca vetula (Ortalis vetula)

    OpenAIRE

    Ángel A. Molina-García; César R. Maldonado Hernández; Adán Oliveras de Ita; Octavio R. Rojas-Soto

    2008-01-01

    Reportamos el primer registro de depredación de nidos realizada por la chachalaca vetula (Ortalis vetula) en La Mancha, Actopan, Veracruz; tal comportamiento se observó sobre tres nidos artificiales durante un estudio de supervivencia de nidos y se sustentó en tres evidencias: las marcas del pico, la presencia de plumas y mediante una observación directa de depredación. Discutimos la importancia de esta conducta originada probablemente en la necesidad que tienen las aves de fuentes alternas d...

  8. Primer registro de oso negro americano (Ursus americanus) para el estado de Hidalgo, México

    OpenAIRE

    Alberto Enrique Rojas-Martínez; Luis Antonio Juárez-Casillas

    2013-01-01

    Se documenta el primer registro del oso negro americano (Ursus americanus) para el estado de Hidalgo, México, mismo que representa el punto más sureño de la distribución de esta especie. El ejemplar se encontró muerto cerca del poblado El Aguaje de Cerro Prieto en un lugar conocido como La Joya, municipio de La Misión, en el norte del estado, a una altitud de 1 481 m, probablemente correspondía a un individuo errante proveniente del estado de Querétaro.

  9. Species-specific polymerase chain reaction primer sets for the diagnosis of Tenacibaculum maritimum infection.

    Science.gov (United States)

    Avendaño-Herrera, Rubén; Magariños, Beatriz; Toranzo, Alicia E; Beaz, Roxana; Romalde, Jesús L

    2004-11-23

    In this study the specificity and sensitivity of 2 primer pairs, MAR1-MAR2 and Mar1-Mar2, for the detection of Tenacibaculum maritimum were evaluated in parallel using 79 T. maritimum strains isolated from different fish species, as well as 53 representatives of related and unrelated bacterial species. Both primer pairs were species-specific for T. maritimum, since no amplification products were obtained from chromosomal DNA of the non-T. maritimum bacteria tested. However, whereas MAR1-MAR2 identified all the T. maritimum strains studied, producing a unique and clear PCR band of the expected 1088 bp length, the Marl-Mar2 primer pair failed to amplify the 400 bp specific band in 3 sole isolates. To verify if these strains belonged to T. maritimum species, 2 endonucleases (PvuI and SacII) were selected as the most adequate enzymes to confirm the specificity of the MAR1-MAR2 amplified fragment. The digestion patterns obtained with both endonucleases supported the assignation of all the strains to T. maritimum. The sensitivity of both PCR detection methods was also different, showing a reduction of sensitivity in at least one order of magnitude of the Marl-Mar2 primer pair in comparison with MAR1-MAR2. When the MAR-MAR2 PCR protocol was applied to different seeded turbot tissues, the detection limit was 10(2) to 10(4) T. maritimum cells per reaction. In addition, a nested PCR protocol for detection of this pathogens based on MAR1-MAR2 was developed, which increased the sensitivity by approximately 2 orders of magnitude, ranging from 1 to 250 T. maritimum cells per reaction depending on the tissue employed. The tissues that allowed the most easy detection of T. maritimum were the skin and mucus. Based on the findings reported here, we propose the nested PCR protocol as the most adequate for an accurate detection of T. maritimum in diagnostic pathology as well as in epidemiological studies of gliding bacterial disease of marine fish. PMID:15648833

  10. Luis López-Ballesteros: primer traductor de las obras completas de Freud al castellano

    OpenAIRE

    Juan Manuel Martín Arias; Lorenzo Gallego Borghini

    2011-01-01

    El castellano fue el primer idioma al que se tradujeron las obras completas de Sigmund Freud. A ello contribuyeron diversos factores, entre los que se destaca la figura de Luis López-Ballesteros, a quien le encargó la traducción la editorial Biblioteca Nueva. En este artículo se esbozan someramente la recepción del psicoanálisis en España y las traducciones de Freud al español y se ofrece una breve semblanza de Luis López-Ballesteros. --------------------------------------------- Luis López-B...

  11. Primer caso de hemoglobina Köln (codon98 GTG>ATG en Costa Rica

    Directory of Open Access Journals (Sweden)

    Walter Cartín

    2010-03-01

    Full Text Available La exposición a ciertos medicamentos puede provocar anemia hemolítica con presencia de cuerpos de Heinz en sangre periférica. Esta anemia puede presentarse por sobredosis de medicamentos, tanto en individuos sanos como en personas con deficiencias enzimáticas como la glucosa-6-fosfato deshidrogenasa, o en presencia de hemoglobinas inestables. Este reporte muestra un caso de anemia hemolítica con cuerpos de Heinz, debido a la presencia de una hemoglobina inestable, cuyos estudios moleculares y HPLC confirmaron el primer caso descrito de hemoglobina Köln (Val98Met en Costa Rica.

  12. State Bioenergy Primer: Information and Resources for States on Issues, Opportunities, and Options for Advancing Bioenergy

    Energy Technology Data Exchange (ETDEWEB)

    Byrnett, D. S.; Mulholland, D.; Zinsmeister, E.; Doris, E.; Milbrandt, A.; Robichaud. R.; Stanley, R.; Vimmerstedt, L.

    2009-09-01

    One renewable energy option that states frequently consider to meet their clean energy goals is the use of biomass resources to develop bioenergy. Bioenergy includes bioheat, biopower, biofuels, and bioproducts. This document provides an overview of biomass feedstocks, basic information about biomass conversion technologies, and a discussion of benefits and challenges of bioenergy options. The Primer includes a step-wise framework, resources, and tools for determining the availability of feedstocks, assessing potential markets for biomass, and identifying opportunities for action at the state level. Each chapter contains a list of selected resources and tools that states can use to explore topics in further detail.

  13. El primer caso de herejía en el Nuevo Mundo

    OpenAIRE

    Szászdi, István

    2001-01-01

    This article tries to identify the self-styled heretic from among the 39 Spaniards that remained in Fortress of Nativity when Christopher Columbus came back to Spain after his first journey to the New World.

    Intento de identificar al supuesto hereje entre los 39 españoles que se quedan en el Fuerte de la Navidad cuando Cristóbal Colón vuelve a España después de su primer viaje al Nuevo Mundo.

  14. El primer caso de herejía en el Nuevo Mundo

    Directory of Open Access Journals (Sweden)

    Szászdi, István

    2001-12-01

    Full Text Available This article tries to identify the self-styled heretic from among the 39 Spaniards that remained in Fortress of Nativity when Christopher Columbus came back to Spain after his first journey to the New World.

    Intento de identificar al supuesto hereje entre los 39 españoles que se quedan en el Fuerte de la Navidad cuando Cristóbal Colón vuelve a España después de su primer viaje al Nuevo Mundo.

  15. PRIPOVEDNE TRADICIJE VISOKEGA IN POZNEGA SREDNJEGA VEKA IZ MEDKULTURNE PERSPEKTIVE. PRIMER: PESEM O RONALDU.

    OpenAIRE

    Lebar, Robert

    2015-01-01

    Cilj magistrskega dela z naslovom Pripovedne tradicije visokega in poznega srednjega veka iz medkulturne perspektive. Primer: Pesem o Rolandu je priskrbeti vpogled v medkulturnost srednjeveške družbe in literature na nemškem govornem področju s pomočjo sodobnih kulturno in literarnozgodovinskih konceptov. V uvodnem delu so obravnavani temelji srednjeveške literature v kontekstu sočasnih družbenih struktur. V nadaljevanju je ta problematika razširjena z vprašanjem o vplivu francoske kulture na...

  16. Empresas nanotecnológicas en México: hacia un primer inventario

    OpenAIRE

    Edgar Záyago Lau; Guillermo Foladori; Richard P. Appelbaum; Edgar Ramón Arteaga Figueroa

    2013-01-01

    En este artículo presentamos un inventario inicial de compañías mexicanas que venden productos que son manufacturados a partir de nanotecnología, o que utilizan nanotecnología en sus operaciones. El inventario permite a los interesados identificar el número de empresas, su ubicación geográfica y los sectores industriales en los que se insertan. Esto es, de hecho, un primer acercamiento para el análisis los vínculos productivos de la nanotecnología en México. Los resultados muestran una alta c...

  17. Incidencia de los Movimientos Oculares en el proceso lector de alumnos de Primer ciclo de Primaria.

    OpenAIRE

    Alejo-Ramos, Cristina

    2013-01-01

    Los movimientos oculares en la lectura son importantes para el proceso de aprendizaje de los niños. Este trabajo de investigación tiene como objetivo, conocer la influencia de los movimientos oculares en la lectura. Para ello se llevó a cabo un estudio, con una muestra de 30 alumnos del Primer ciclo de Primaria, es decir, Primero y Segundo, del mismo centro educativo. Una vez que se realizaron las pruebas oportunas, se pudo comprobar cómo estaban relacionadas motricidad ocular y lectura...

  18. Effect of metal primers and tarnish treatment on bonding between dental alloys and veneer resin

    OpenAIRE

    Choo, Seung-Sik; Huh, Yoon-Hyuk; Cho, Lee-Ra; Park, Chan-Jin

    2015-01-01

    PURPOSE The aim of this study was to evaluate the effect of metal primers on the bonding of dental alloys and veneer resin. Polyvinylpyrrolidone solution's tarnish effect on bonding strength was also investigated. MATERIALS AND METHODS Disk-shape metal specimens (diameter 8 mm, thickness 1.5 mm) were made from 3 kinds of alloy (Co-Cr, Ti and Au-Ag-Pd alloy) and divided into 4 groups per each alloy. Half specimens (n=12 per group) in tarnished group were immersed into polyvinylpyrrolidone solu...

  19. Las bibliotecas públicas durante el primer franquismo: entre la continuidad y la ruptura

    OpenAIRE

    Rodrigo Echalecu, Ana María

    2009-01-01

    En esta Memoria se analiza el concepto de biblioteca pública durante el primer franquismo, así como la organización bibliotecaria, los Centros Coordinadores de Bibliotecas, los diferentes tipos de bibliotecas públicas, así como el personal que las gestionó y sus instalaciones. Especial atención han recibido las bibliotecas municipales al estudiar el marco jurídico y su localización a través de una cartografía inédita.

  20. Reporte del primer hallazgo de puma (Puma concolor puma) infectado con Trichinella sp. en Chile

    OpenAIRE

    Hidalgo, A.; CA Oberg; F Fonseca-Salamanca; Vidal MF

    2013-01-01

    En la actualidad, Trichinella spiralis es la única especie que ha sido identificada en Chile como agente de la trichinellosis, tanto en hospedadores domésticos como silvestres. Estudios preliminares no han identificado aún la infección por Trichinella en animales nativos de Chile. La presente comunicación, informa del primer hallazgo de Trichinella sp. aislado en musculatura diafragmática e intercostales de un ejemplar de Puma (Puma concolor puma) encontrado muerto mediante seguimiento por te...

  1. Cota superior para el primer valor propio del problema de Steklov

    OpenAIRE

    Óscar Andrés Montaño Carreño

    2013-01-01

    Sea Br una bola n-dimensional dotada con una métrica rotacionalmente invariante y con curvaturas seccionales radiales no positivas. Si ν es el primer valor propio de Steklov y h es la curvatura media sobre el borde de la bola, nosotros demostramos que ν ≤ h con igualdad si y solo si Br es la bola con la métrica usual de R ^n . Abstract.Let Br be an n-dimensional ball endowed with a rotationally invariant metric and with non-positive radial sectional curvatures. If ν i...

  2. Potasssium chloride as a nutrient seed primer to enhance salt‑tolerance in maize

    OpenAIRE

    Badar‑uz‑Zaman; Arshad Ali; Syed Ishtiaq Hyder; Muhammad Arshadullah; Saqib Umar Bhatti

    2012-01-01

    The objective of this work was to determine if KCl could be a useful nutrient primer for safe seed germination in maize crop under salt stress conditions. Seed priming was done using 50 mmol L‑1 of muriate of potash, and germination and seedling growth were evaluated after salt stress with NaCl up to 50 mmol L‑1. Another set of seeds was tested under the same salt stress conditions without priming. Under salinity stress, germination percentage, germination rate index, germination coefficient,...

  3. The compleat strategyst being a primer on the theory of games of strategy

    CERN Document Server

    Williams, J D

    1986-01-01

    When J. D. Williams wrote this entertaining, witty introduction for the nonscientist, Game Theory was still a somewhat mysterious subject familiar to very few scientists beyond those researchers, like himself, working for the military. Now, over thirty years after its original publication as a Rand Corporation research study, his light-hearted though thoroughly effective primer is the recognized classic introduction to an increasingly applicable discipline. Used by amateurs, professionals, and students throughout the world in the classroom, on the job, and for personal amusement, the book has

  4. Christiaan Barnard: 40 años del primer transplante de corazón humano

    OpenAIRE

    Jorge Reynolds; Juan Fernando Cediel; César Payán

    2007-01-01

    Fueron éstas las palabras pronunciadas por Christiaan Neethling Barnard para referirse al domingo 3 de diciembre de 1967 cuando, en el Hospital Groote Schuur de Cape Town, Sudáfrica, dirigió al equipo que realizó el primer transplante cardíaco efectuado en un ser humano1. Después de 40 años, se recuerda al doctor Barnard, no sólo como cirujano excepcional, sino como un luchador incansable que revolucionó conceptos tan trascendentales en la ciencia médica como el de la muerte cerebral1,2.Chris...

  5. La impulsividad en el primer ciclo de educación infantil

    OpenAIRE

    González, María Soledad

    2011-01-01

    Este trabajo trata sobre las relaciones sociales en el primer ciclo de Educación Infantil, centrándonos en las conductas impulsivas, las causas que las provocan y la forma de evitarlas. Tiene como finalidad mejorar las relaciones sociales en el aula, evitando y modificando las conductas impulsivas desde las edades más tempranas, ya que es en esta etapa cuando los niños y niñas están formando su personalidad. Por ello, es muy importante ayudar a los pequeños a modificar el comportamiento...

  6. Christiaan Barnard: 40 años del primer transplante de corazón humano.

    Directory of Open Access Journals (Sweden)

    Jorge Reynolds

    2009-11-01

    Full Text Available «El sábado, yo era un cirujano en Sudáfrica, poco conocido.El lunes, yo era una celebridad mundial» Fueron éstas las palabras pronunciadas por Christiaan Neethling Barnard para referirse al domingo 3 de diciembre de 1967 cuando, en el Hospital Groote Schuur de Cape Town, Sudáfrica, dirigió al equipo que realizó el primer transplante cardíaco efectuado en un ser humano.

  7. Adventitious match probability for autosomal profiles when primer binding site mutation is possible.

    Science.gov (United States)

    Pope, Susan; Evett, Ian; Puch-Solis, Roberto

    2016-09-01

    This paper considers the situation where two DNA systems with differing primers have been used to produce DNA profiles for loading and searching of a DNA Database. With any profiling system there exists the possibility of a "primer binding site mutation" (PBSM). When such a mutation occurs at one of the loci in a profile, it has the effect that the associated allele is not visible in the profile. In the case where a person has two different alleles at a given locus (heterozygous) the effect of a PBSM would be that the profile would appear to be that of an individual with only one allele at that locus (homozygous). The paper investigates the potential for an adventitious match as a result of a PBSM when, for example, a crime profile and person profile that have originated from two different individuals are found to be the same as a result of a PBSM in one of the profiles. It is demonstrated, both by theory and using simulations, that the effect of PBSMs is to slightly decrease the adventitious match probability from what it would had the same DNA system been used. PMID:27420391

  8. Removal of PCR error products and unincorporated primers by metal-chelate affinity chromatography.

    Directory of Open Access Journals (Sweden)

    Indhu Kanakaraj

    Full Text Available Immobilized Metal Affinity Chromatography (IMAC has been used for decades to purify proteins on the basis of amino acid content, especially surface-exposed histidines and "histidine tags" genetically added to recombinant proteins. We and others have extended the use of IMAC to purification of nucleic acids via interactions with the nucleotide bases, especially purines, of single-stranded RNA and DNA. We also have demonstrated the purification of plasmid DNA from contaminating genomic DNA by IMAC capture of selectively-denatured genomic DNA. Here we describe an efficient method of purifying PCR products by specifically removing error products, excess primers, and unincorporated dNTPs from PCR product mixtures using flow-through metal-chelate affinity adsorption. By flowing a PCR product mixture through a Cu(2+-iminodiacetic acid (IDA agarose spin column, 94-99% of the dNTPs and nearly all the primers can be removed. Many of the error products commonly formed by Taq polymerase also are removed. Sequencing of the IMAC-processed PCR product gave base-calling accuracy comparable to that obtained with a commercial PCR product purification method. The results show that IMAC matrices (specifically Cu(2+-IDA agarose can be used for the purification of PCR products. Due to the generality of the base-specific mechanism of adsorption, IMAC matrices may also be used in the purification of oligonucleotides, cDNA, mRNA and micro RNAs.

  9. Moisés Ochoa Campos (1917-1985. El primer politólogo mexicano

    Directory of Open Access Journals (Sweden)

    Víctor Alarcón Olguín

    2016-01-01

    Full Text Available En décadas recientes se vive un segundo gran ciclo de análisis que pretende valorar e investigar sobre los orígenes y características evolutivas que han conformado a la ciencia política mexicana. El presente artículo aborda los elementos biográficos y la obra de Moisés Ochoa Campos (1917-1985, quien en 1955 fue el primer graduado de la carrera de ciencias políticas en México por la entonces Escuela Nacional de Ciencias Políticas y Sociales de la Universidad Nacional Autónoma de México. Se analiza tanto el contenido de la tesis que fuera presentada para la obtención del primer grado académico en ciencia política en nuestro país (la que lo sitúa como uno de los analistas pioneros en materia municipal, así como otros aspectos de su vasta obra escrita. Se destaca que la realización de este tipo de ejercicios biográficos son sustantivos para la preservación de la historia intelectual de la disciplina politológica tanto en México como en la región latinoamericana.

  10. Cuidado popular de familias con un adulto mayor sobreviviente del primer accidente cerebrovascular

    Directory of Open Access Journals (Sweden)

    Lucero López-Díaz

    2016-01-01

    Full Text Available Introducción: el accidente cerebrovascular afecta a numerosas personas en el mundo y se constituye en la principal causa de muer- te. Los sobrevivientes pueden padecer discapacidad y sufrir modificaciones en las actividades cotidianas. La familia es el principal apoyo del sobreviviente y al ser parte de una misma cultura, construye acciones de cuidado en búsqueda del bienestar. Objetivo: describir las acciones del cuidado popular de las familias con un adulto mayor sobreviviente del primer accidente cerebrovascular. Método: estudio etnográfico, con observación participante y entrevistas en profundidad. Participaron siete familias bogotanas (siete adultos mayores entre los dos y diez meses posteriores al primer accidente cerebrovascular y los siete cuidadores principales respectivos. Resultados: cuidadores y adulto mayor comparten acciones de cuidado para la recuperación, relacionadas con la alimentación, el cuidado personal y la ingesta de medicamentos permeadas por la creencia religiosa, fuente de soporte y vínculo afectivo. Conclusión: conocer el cuidado popular de esta población posibilita proponer acciones culturalmente congruentes con sus valores y creencias para potencializar las ca- pacidades familiares e intermediar en los procesos de tratamiento.

  11. Por mano propia. La justicia policial de la provincia de Buenos Aires en el primer peronismo

    Directory of Open Access Journals (Sweden)

    Osvaldo Barreneche

    2009-11-01

    Full Text Available La sanción del Código Penal Policial fue una pieza importante en el andamiaje jurídico por el cual el primer gobierno peronista procuró afianzar la profesionalización y disciplinamiento de las fuerzas de seguridad en las distintas jurisdicciones del país. Así, se organizó y se puso en marcha una nueva rama de la justicia bonaerense, paralela a la ordinaria, integrada completamente por policías retirados y en actividad, que se ocupó de los casos penales donde estuviesen implicados uno o más policías. Este trabajo analiza dicha experiencia, basándose en los casos sumariados y resueltos por la Justicia Policial mientras existió. En primer lugar se pone en contexto los fundamentos y propósitos que guiaron al peronismo para impulsar una justicia 'uniformada' que se ocupase de los excesos y falta a los deberes de los funcionarios policiales a nivel penal y administrativo. Luego se estudia su aplicación concreta en la provincia de Buenos Aires, indagando sobre los casos juzgados, su tratamiento, los actores, los fallos y los fines políticos perseguidos por esta justicia por y para policías

  12. An electrochemical study of corrosion protection by primer-topcoat systems on 4130 steel with ac impedance and dc methods

    Science.gov (United States)

    Mendrek, M. J.; Higgins, R. H.; Danford, M. D.

    1988-01-01

    To investigate metal surface corrosion and the breakdown of metal protective coatings, the ac impedance method is applied to six systems of primer coated and primer topcoated 4130 steel. Two primers were used: a zinc-rich epoxy primer and a red lead oxide epoxy primer. The epoxy-polyamine topcoat was used in four of the systems. The EG and G-PARC Model 368 ac impedance measurement system, along with dc measurements with the same system using the polarization resistance method, were used to monitor changing properties of coated 4230 steel disks immersed in 3.5 percent NaCl solutions buffered at pH 5.4 over periods of 40 to 60 days. The corrosion system can be represented by an electronic analog called an equivalent circuit consisting of resistors and capacitors in specific arrangements. This equivalent circuit parallels the impedance behavior of the corrosion system during a frequency scan. Values for the resistors and capacitors, that can be assigned in the equivalent circuit following a least-squares analysis of the data, describe changes that occur on the corroding metal surface and in the protective coatings. Two equivalent circuits have been determined that predict the correct Bode phase and magnitude of the experimental sample at different immersion times. The dc corrosion current density data are related to equivalent circuit element parameters. Methods for determining corrosion rate with ac impedance parameters are verified by the dc method.

  13. Comparison of pectin-degrading fungal communities in temperate forests using glycosyl hydrolase family 28 pectinase primers targeting Ascomycete fungi.

    Science.gov (United States)

    Gacura, Matthew D; Sprockett, Daniel D; Heidenreich, Bess; Blackwood, Christopher B

    2016-04-01

    Fungi have developed a wide assortment of enzymes to break down pectin, a prevalent polymer in plant cell walls that is important in plant defense and structure. One enzyme family used to degrade pectin is the glycosyl hydrolase family 28 (GH28). In this study we developed primers for the amplification of GH28 coding genes from a database of 293 GH28 sequences from 40 fungal genomes. The primers were used to successfully amplify GH28 pectinases from all Ascomycota cultures tested, but only three out of seven Basidiomycota cultures. In addition, we further tested the primers in PCRs on metagenomic DNA extracted from senesced tree leaves from different forest ecosystems, followed by cloning and sequencing. Taxonomic specificity for Ascomycota GH28 genes was tested by comparing GH28 composition in leaves to internal transcribed spacer (ITS) amplicon composition using pyrosequencing. All sequences obtained from GH28 primers were classified as Ascomycota; in contrast, ITS sequences indicated that fungal communities were up to 39% Basidiomycetes. Analysis of leaf samples indicated that both forest stand and ecosystem type were important in structuring fungal communities. However, site played the prominent role in explaining GH28 composition, whereas ecosystem type was more important for ITS composition, indicating possible genetic drift between populations of fungi. Overall, these primers will have utility in understanding relationships between fungal community composition and ecosystem processes, as well as detection of potentially pathogenic Ascomycetes. PMID:26899925

  14. Application of Single—labelled Probe—primer in PCR Amplification to the Detection of Hepatitis B Virus DNA

    Institute of Scientific and Technical Information of China (English)

    KONG,De-Ming; SHEN,Han-Xi

    2003-01-01

    A new method based on the incorporation of a single-lablled probe-primer into polymerase chain reaction(PCR) for the detection of PCR-amplified DNA in a closed system is reported.The probeprimerc consists of a specific probe sequence on the 5''''''''-end and a primer sequence on the 3''''''''-end.A flurophore is located at the 5''''''''end.The primeR-quencher is an oligonucleotide,which is complementary to the probe sequence of probe-primer and labelled with a quencher at the 3''''''''-end.In the duplex formed by probe-primer and primer-quencher.the fluorophore and quencher are kept in close proximity to each other.Therefore the fluorescence is quenched.During PCR amplificatio,the specific probe sequence of probeprimer binds to its complement within the same strand of DNA,and is cleaved by Taq DNA polymerase,resulting in the restoration of fluorescence.This system has the same energy transfer mechanism as molecular beacons,and a good quenching effciency can be ensured.Following optimization of PCR conditions,this method was used to detect hepatitis b virus(HBV) dna in patient sera.This technology eliminates the risk of carry-over contamination,simplifies the amplification assay and opens up new possibilities for the real-time detection of the amplified DNA.

  15. Designing, optimization and validation of tetra-primer ARMS PCR protocol for genotyping mutations in caprine Fec genes

    Directory of Open Access Journals (Sweden)

    Sonika Ahlawat

    2014-12-01

    Full Text Available New, quick, and inexpensive methods for genotyping novel caprine Fec gene polymorphisms through tetra-primer ARMS PCR were developed in the present investigation. Single nucleotide polymorphism (SNP genotyping needs to be attempted to establish association between the identified mutations and traits of economic importance. In the current study, we have successfully genotyped three new SNPs identified in caprine fecundity genes viz. T(-242C (BMPR1B, G1189A (GDF9 and G735A (BMP15. Tetra-primer ARMS PCR protocol was optimized and validated for these SNPs with short turn-around time and costs. The optimized techniques were tested on 158 random samples of Black Bengal goat breed. Samples with known genotypes for the described genes, previously tested in duplicate using the sequencing methods, were employed for validation of the assay. Upon validation, complete concordance was observed between the tetra-primer ARMS PCR assays and the sequencing results. These results highlight the ability of tetra-primer ARMS PCR in genotyping of mutations in Fec genes. Any associated SNP could be used to accelerate the improvement of goat reproductive traits by identifying high prolific animals at an early stage of life. Our results provide direct evidence that tetra-primer ARMS-PCR is a rapid, reliable, and cost-effective method for SNP genotyping of mutations in caprine Fec genes.

  16. BARCRAWL and BARTAB: software tools for the design and implementation of barcoded primers for highly multiplexed DNA sequencing

    Science.gov (United States)

    Frank, Daniel N

    2009-01-01

    Background Advances in automated DNA sequencing technology have greatly increased the scale of genomic and metagenomic studies. An increasingly popular means of increasing project throughput is by multiplexing samples during the sequencing phase. This can be achieved by covalently linking short, unique "barcode" DNA segments to genomic DNA samples, for instance through incorporation of barcode sequences in PCR primers. Although several strategies have been described to insure that barcode sequences are unique and robust to sequencing errors, these have not been integrated into the overall primer design process, thus potentially introducing bias into PCR amplification and/or sequencing steps. Results Barcrawl is a software program that facilitates the design of barcoded primers, for multiplexed high-throughput sequencing. The program bartab can be used to deconvolute DNA sequence datasets produced by the use of multiple barcoded primers. This paper describes the functions implemented by barcrawl and bartab and presents a proof-of-concept case study of both programs in which barcoded rRNA primers were designed and validated by high-throughput sequencing. Conclusion Barcrawl and bartab can benefit researchers who are engaged in metagenomic projects that employ multiplexed specimen processing. The source code is released under the GNU general public license and can be accessed at . PMID:19874596

  17. BARCRAWL and BARTAB: software tools for the design and implementation of barcoded primers for highly multiplexed DNA sequencing

    Directory of Open Access Journals (Sweden)

    Frank Daniel N

    2009-10-01

    Full Text Available Abstract Background Advances in automated DNA sequencing technology have greatly increased the scale of genomic and metagenomic studies. An increasingly popular means of increasing project throughput is by multiplexing samples during the sequencing phase. This can be achieved by covalently linking short, unique "barcode" DNA segments to genomic DNA samples, for instance through incorporation of barcode sequences in PCR primers. Although several strategies have been described to insure that barcode sequences are unique and robust to sequencing errors, these have not been integrated into the overall primer design process, thus potentially introducing bias into PCR amplification and/or sequencing steps. Results Barcrawl is a software program that facilitates the design of barcoded primers, for multiplexed high-throughput sequencing. The program bartab can be used to deconvolute DNA sequence datasets produced by the use of multiple barcoded primers. This paper describes the functions implemented by barcrawl and bartab and presents a proof-of-concept case study of both programs in which barcoded rRNA primers were designed and validated by high-throughput sequencing. Conclusion Barcrawl and bartab can benefit researchers who are engaged in metagenomic projects that employ multiplexed specimen processing. The source code is released under the GNU general public license and can be accessed at http://www.phyloware.com.

  18. Sensitive PCR diagnosis of Infections by Enterocytozoon bieneusi (microsporidia) using primers based on the region coding for small-subunit rRNA.

    OpenAIRE

    DA SILVA, A. J.; Schwartz, D A; Visvesvara, G S; De Moura, H; Slemenda, S B; Pieniazek, N J

    1996-01-01

    Enterocytozoon bieneusi is the most common microsporidian infecting patients with AIDS. We have developed a PCR primer pair, named EBIEF1/EBIER1, based on the small-subunit rRNA sequence of this microsporidian. Compared with other PCR-based methods, this primer pair shows a higher efficiency of detection in diagnostic applications than does another previously described primer pair, V1/EB450.

  19. Sistemas de información en el primer nivel de atención: su contribución a la estrategia de APS

    OpenAIRE

    Arrondo Costanzo, Fernanda

    2011-01-01

    Los objetivos de la tesis son: evaluar la calidad de los sistemas de información en salud en el primer nivel de atención, con un enfoque sistémico; describir la estructura que sustenta el sistema de información en el primer nivel de atención; describir el proceso de captura y procesamiento de datos en los centros de primer nivel de atención; describir los resultados que produce el sistema de información del primer nivel de atención; comparar las características de cada uno de los componentes ...

  20. Back to basics – the influence of DNA extraction and primer choice on phylogenetic analysis in activated sludge communities

    DEFF Research Database (Denmark)

    Albertsen, Mads; Karst, Søren Michael; Ziegler, Anja Sloth;

    DNA extraction and primer choice have a large effect on the observed community structure in all phylogenetic analyses. Although the biases are well known, no comprehensive analysis have been conducted in activated sludge communities. In this study we investigated the effect of bead beating...... intensity and primer choice on the observed community using 16S rDNA amplicon sequencing. Quantitative fluorescence in situ hybridization (qFISH) was used as a DNA extraction independent method to evaluate the results. The bead beating intensity correlated with cell-wall strength and showed that the...... manufacture recommended settings were insufficient to retrieve a large part of the community. In addition, the in silico “best” primer set was found to greatly underestimate a number of important phyla when compared to qFISH results. The findings underline the need for sample specific and DNA extraction...

  1. Cloning murine antibody V-genes with non-degenerate primers and conversion to a recombinant antibody format.

    Science.gov (United States)

    Bialon, Magdalena; Schellenberg, Ludmila; Herzog, Nicolas; Kraus, Stefan; Jörißen, Hannah; Fischer, Rainer; Stein, Christoph; Nähring, Jörg; Barth, Stefan; Püttmann, Christiane

    2014-12-01

    Monoclonal antibodies are produced in cultured hybridoma cell lines, but these cells tend to be unstable; it is therefore necessary to rescue the corresponding genetic information. Here we describe an improved method for the amplification of antibody variable gene (V-gene) information from murine hybridoma cells using a panel of specific, non-degenerate primers. This primer set allows sequences to be rescued from all murine V-genes, except the lambda light chain genes, which rarely contribute to murine immune diversity. We tested the primers against a range of antibodies and recovered specific amplification products in all cases. The heavy and light chain variable regions were subsequently joined by a two-step cloning strategy or by splice overlap extension PCR. PMID:25545205

  2. Influence of commonly used primer systems on automated ribosomal intergenic spacer analysis of bacterial communities in environmental samples.

    Science.gov (United States)

    Purahong, Witoon; Stempfhuber, Barbara; Lentendu, Guillaume; Francioli, Davide; Reitz, Thomas; Buscot, François; Schloter, Michael; Krüger, Dirk

    2015-01-01

    Due to the high diversity of bacteria in many ecosystems, their slow generation times, specific but mostly unknown nutrient requirements and syntrophic interactions, isolation based approaches in microbial ecology mostly fail to describe microbial community structure. Thus, cultivation independent techniques, which rely on directly extracted nucleic acids from the environment, are a well-used alternative. For example, bacterial automated ribosomal intergenic spacer analysis (B-ARISA) is one of the widely used methods for fingerprinting bacterial communities after PCR-based amplification of selected regions of the operon coding for rRNA genes using community DNA. However, B-ARISA alone does not provide any taxonomic information and the results may be severely biased in relation to the primer set selection. Furthermore, amplified DNA stemming from mitochondrial or chloroplast templates might strongly bias the obtained fingerprints. In this study, we determined the applicability of three different B-ARISA primer sets to the study of bacterial communities. The results from in silico analysis harnessing publicly available sequence databases showed that all three primer sets tested are specific to bacteria but only two primers sets assure high bacterial taxa coverage (1406f/23Sr and ITSF/ITSReub). Considering the study of bacteria in a plant interface, the primer set ITSF/ITSReub was found to amplify (in silico) sequences of some important crop species such as Sorghum bicolor and Zea mays. Bacterial genera and plant species potentially amplified by different primer sets are given. These data were confirmed when DNA extracted from soil and plant samples were analyzed. The presented information could be useful when interpreting existing B-ARISA results and planning B-ARISA experiments, especially when plant DNA can be expected. PMID:25749323

  3. Influence of commonly used primer systems on automated ribosomal intergenic spacer analysis of bacterial communities in environmental samples.

    Directory of Open Access Journals (Sweden)

    Witoon Purahong

    Full Text Available Due to the high diversity of bacteria in many ecosystems, their slow generation times, specific but mostly unknown nutrient requirements and syntrophic interactions, isolation based approaches in microbial ecology mostly fail to describe microbial community structure. Thus, cultivation independent techniques, which rely on directly extracted nucleic acids from the environment, are a well-used alternative. For example, bacterial automated ribosomal intergenic spacer analysis (B-ARISA is one of the widely used methods for fingerprinting bacterial communities after PCR-based amplification of selected regions of the operon coding for rRNA genes using community DNA. However, B-ARISA alone does not provide any taxonomic information and the results may be severely biased in relation to the primer set selection. Furthermore, amplified DNA stemming from mitochondrial or chloroplast templates might strongly bias the obtained fingerprints. In this study, we determined the applicability of three different B-ARISA primer sets to the study of bacterial communities. The results from in silico analysis harnessing publicly available sequence databases showed that all three primer sets tested are specific to bacteria but only two primers sets assure high bacterial taxa coverage (1406f/23Sr and ITSF/ITSReub. Considering the study of bacteria in a plant interface, the primer set ITSF/ITSReub was found to amplify (in silico sequences of some important crop species such as Sorghum bicolor and Zea mays. Bacterial genera and plant species potentially amplified by different primer sets are given. These data were confirmed when DNA extracted from soil and plant samples were analyzed. The presented information could be useful when interpreting existing B-ARISA results and planning B-ARISA experiments, especially when plant DNA can be expected.

  4. PCR primers to study the diversity of expressed fungal genes encoding lignocellulolytic enzymes in soils using high-throughput sequencing.

    Science.gov (United States)

    Barbi, Florian; Bragalini, Claudia; Vallon, Laurent; Prudent, Elsa; Dubost, Audrey; Fraissinet-Tachet, Laurence; Marmeisse, Roland; Luis, Patricia

    2014-01-01

    Plant biomass degradation in soil is one of the key steps of carbon cycling in terrestrial ecosystems. Fungal saprotrophic communities play an essential role in this process by producing hydrolytic enzymes active on the main components of plant organic matter. Open questions in this field regard the diversity of the species involved, the major biochemical pathways implicated and how these are affected by external factors such as litter quality or climate changes. This can be tackled by environmental genomic approaches involving the systematic sequencing of key enzyme-coding gene families using soil-extracted RNA as material. Such an approach necessitates the design and evaluation of gene family-specific PCR primers producing sequence fragments compatible with high-throughput sequencing approaches. In the present study, we developed and evaluated PCR primers for the specific amplification of fungal CAZy Glycoside Hydrolase gene families GH5 (subfamily 5) and GH11 encoding endo-β-1,4-glucanases and endo-β-1,4-xylanases respectively as well as Basidiomycota class II peroxidases, corresponding to the CAZy Auxiliary Activity family 2 (AA2), active on lignin. These primers were experimentally validated using DNA extracted from a wide range of Ascomycota and Basidiomycota species including 27 with sequenced genomes. Along with the published primers for Glycoside Hydrolase GH7 encoding enzymes active on cellulose, the newly design primers were shown to be compatible with the Illumina MiSeq sequencing technology. Sequences obtained from RNA extracted from beech or spruce forest soils showed a high diversity and were uniformly distributed in gene trees featuring the global diversity of these gene families. This high-throughput sequencing approach using several degenerate primers constitutes a robust method, which allows the simultaneous characterization of the diversity of different fungal transcripts involved in plant organic matter degradation and may lead to the

  5. PCR primers to study the diversity of expressed fungal genes encoding lignocellulolytic enzymes in soils using high-throughput sequencing.

    Directory of Open Access Journals (Sweden)

    Florian Barbi

    Full Text Available Plant biomass degradation in soil is one of the key steps of carbon cycling in terrestrial ecosystems. Fungal saprotrophic communities play an essential role in this process by producing hydrolytic enzymes active on the main components of plant organic matter. Open questions in this field regard the diversity of the species involved, the major biochemical pathways implicated and how these are affected by external factors such as litter quality or climate changes. This can be tackled by environmental genomic approaches involving the systematic sequencing of key enzyme-coding gene families using soil-extracted RNA as material. Such an approach necessitates the design and evaluation of gene family-specific PCR primers producing sequence fragments compatible with high-throughput sequencing approaches. In the present study, we developed and evaluated PCR primers for the specific amplification of fungal CAZy Glycoside Hydrolase gene families GH5 (subfamily 5 and GH11 encoding endo-β-1,4-glucanases and endo-β-1,4-xylanases respectively as well as Basidiomycota class II peroxidases, corresponding to the CAZy Auxiliary Activity family 2 (AA2, active on lignin. These primers were experimentally validated using DNA extracted from a wide range of Ascomycota and Basidiomycota species including 27 with sequenced genomes. Along with the published primers for Glycoside Hydrolase GH7 encoding enzymes active on cellulose, the newly design primers were shown to be compatible with the Illumina MiSeq sequencing technology. Sequences obtained from RNA extracted from beech or spruce forest soils showed a high diversity and were uniformly distributed in gene trees featuring the global diversity of these gene families. This high-throughput sequencing approach using several degenerate primers constitutes a robust method, which allows the simultaneous characterization of the diversity of different fungal transcripts involved in plant organic matter degradation and may

  6. Bridging PCR and partially overlapping primers for novel allergen gene cloning and expression insert decoration

    Institute of Scientific and Technical Information of China (English)

    Ai-Lin Tao; Shao-Heng He

    2004-01-01

    AIM: To obtain the entire gene open reading frame (ORF)and to construct the expression vectors for recombinant allergen production.METHODS: Gene fragments corresponding to the gene specific region and the cDNA ends of pollen allergens of short ragweed (Rg, Ambrosia artemisiifolia L.) were obtained by pan-degenerate primer-based PCR and rapid amplification of the cDNA ends (RACE), and the products were mixed to serve as the bridging PCR (BPCR) template. The full-length gene was then obtained. Partially overlapping primer-based PCR (POP-PCR) method was developed to overcome the other problem, i.e., the non-specific amplification of the ORF with routine long primers for expression insert decoration.Northern blot was conducted to confirm pollen sources of the gene. The full-length coding region was evaluated for its gene function by homologue search in GenBank database and Western blotting of the recombinant protein Amb a 8 (D106) expressed in Escherichia colipET-44 system.RESULTS: The full-length cDNA sequence of Amb a 8(D106)was obtained by using the above procedure and deduced to encode a 131 amino acid polypeptide. Multiple sequence alignment exhibited the gene D106sharing a homology as high as 54-89% and 79-89% to profilin from pollen and food sources, respectively. The expression vector of the allergen gene D106was successfully constructed by employing the combined method of BPCR and POP-PCR. Recombinant allergen rAmb a 8(D106) was then successfully generated.The allergenicity was hallmarked by immunoblotting with the allergic serum samples and its RNA source was confirmed by Northern blot.CONCLUSION: The combined procedure of POP-PCR and BPCR is a powerful method for full-length allergen gene retrieval and expression insert decoration, which would be useful for recombinant allergen production and subsequent diagnosis and immunotherapy of pollen and food allergy.

  7. Complejidad del sistema de conductos en la raíz distal de un primer molar mandibular

    OpenAIRE

    Sierra Lorenzo, Alberto; Valencia de Pablo, Oliver

    2012-01-01

    El primer molar inferior es una pieza clave dentro de la arcada dental; sin embargo, de forma frecuente se ve sometido a un tratamiento endodóntico. En tal caso, la apertura cameral ha de tener una forma rectangular, para no omitir la presencia de un posible segundo conducto distal, hecho que ha sido asociado en numerosas ocasiones al fracaso de dicho tratamiento. Pero como bien describió Hess1, ya en 1921, cuando el primer molar mandibular termina la maduración de sus raíces, ...

  8. Detection of Clostridium tetani in human clinical samples using tetX specific primers targeting the neurotoxin.

    Science.gov (United States)

    Ganesh, Madhu; Sheikh, Nasira K; Shah, Pooja; Mehetre, Gajanan; Dharne, Mahesh S; Nagoba, Basavraj S

    2016-01-01

    Tetanus resulting from ear injury remains an important health problem, particularly in the developing world. We report the successful detection of Clostridium tetani using tetX specific primers targeting the Cl. tetani neurotoxin. The sample was obtained from an ear discharge of a case of otogenic tetanus in a 2-year-old male child. Based on the culture results of the ear discharge, Gram staining and virulence testing by genotyping, a diagnosis of tetanus was confirmed. This is the first report from India on the successful detection of Cl. tetani in a human clinical sample using tetX specific primers targeting the Cl. tetani neurotoxin. PMID:26220795

  9. Design of 16S rRNA gene primers for 454 pyrosequencing of the human foregut microbiome

    Institute of Scientific and Technical Information of China (English)

    Carlos; W; Nossa; William; E; Oberdorf; Jφrn; A; Aas; Bruce; J; Paster; Todd; Z; DeSantis; Eoin; L; Brodie; Daniel; Malamud; Michael; A; Poles

    2010-01-01

    AIM:To design and validate broad-range 16S rRNA primers for use in high throughput sequencing to classify bacteria isolated from the human foregut microbiome.METHODS:A foregut microbiome dataset was constructed using 16S rRNA gene sequences obtained from oral,esophageal,and gastric microbiomes produced by Sanger sequencing in previous studies represented by 219 bacterial species.Candidate primers evaluated were from the European rRNA database.To assess the effect of sequence length on accuracy of classifica...

  10. A novel three primers PCR (TP-PCR) method to obtain recombinant DNA molecule independent of restriction enzyme

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    In this note, we report a novel and efficient three primers PCR (TP-PCR) method to rapidly generate recombinant DNA molecule at precise junction between two arbitrary DNA fragments. TP-PCR method is characterized by its reaction system with two templates and three primers, which can produce a recombinant DNA molecule in one PCR reaction. The main advantages of this method are the independence of sequences at the recombination site, the rapidness, and the easy establishment of adequate conditions. This method has been successfully applied to constructing a fusion protein gene, sck gene.

  11. Influência do "primer" sobre o esmalte na resistência ao cisalhamento de sistemas adesivos

    OpenAIRE

    RUSSO Eliza Maria Agueda; Garone NETTO Narciso; Rubens Corte Real de CARVALHO; Márcio Garcia dos SANTOS

    1998-01-01

    A proposta deste estudo foi comparar a adesão ao esmalte de dois sistemas adesivos de frasco único com sistemas que usam "primer" e "bond" separadamente, com o objetivo de verificar se a força de adesão da resina composta ao esmalte é influenciada pela presença do "primer" de dentina sobre o esmalte. Foram avaliados quatro sistemas adesivos: ONE STEP (Bisco), PRIME & BOND (Dentsply), SCOTCHBOND MULTI-PURPOSE PLUS (3M) e PROBOND (Dentsply). Molares humanos foram seccionados no sentido ocluso-c...

  12. Data in support of qPCR primer design and verification in a Pink1 -/- rat model of Parkinson disease.

    Science.gov (United States)

    Kelm-Nelson, Cynthia A; Stevenson, Sharon A; Ciucci, Michelle R

    2016-09-01

    Datasets provided in this article represent the Rattus norvegicus primer design and verification used in Pink1 -/- and wildtype Long Evans brain tissue. Accessible tables include relevant information, accession numbers, sequences, temperatures and product length, describing primer design specific to the transcript amplification use. Additionally, results of Sanger sequencing of qPCR reaction products (FASTA aligned sequences) are presented for genes of interest. Results and further interpretation and discussion can be found in the original research article "Atp13a2 expression in the periaqueductal gray is decreased in the Pink1 -/- rat model of Parkinson disease" [1]. PMID:27331115

  13. Hypervariable spacer regions are good sites for developing specific PCR-RFLP markers and PCR primers for screening actinorhizal symbionts

    Indian Academy of Sciences (India)

    Rajani Varghese; Vineeta S Chauhan; Arvind K Misra

    2003-06-01

    While the ribosomal RNA like highly conserved genes are good molecular chronometers for establishing phylogenetic relationships, they can also be useful in securing the amplification of adjoining hyper-variable regions. These regions can then be used for developing specific PCR primers or PCR-RFL profiles to be used as molecular markers. We report here the use of ITS region of rrn operon of Frankia for developing PCR-RFL profiles capable of discriminating between closely related frankiae. We have also made use of the ITS1 region of the nuclear rrn operon of Alnus nepalensis (D Don) for designing a PCR primer for specific amplification of nuclear DNA of this tree.

  14. The Structure of the RNA-Dependent RNA Polymerase of a Permutotetravirus Suggests a Link between Primer-Dependent and Primer-Independent Polymerases.

    Science.gov (United States)

    Ferrero, Diego S; Buxaderas, Mònica; Rodríguez, José F; Verdaguer, Núria

    2015-12-01

    Thosea asigna virus (TaV), an insect virus belonging to the Permutatetraviridae family, has a positive-sense single-stranded RNA (ssRNA) genome with two overlapping open reading frames, encoding for the replicase and capsid proteins. The particular TaV replicase includes a structurally unique RNA-dependent RNA polymerase (RdRP) with a sequence permutation in the palm sub-domain, where the active site is anchored. This non-canonical arrangement of the RdRP palm is also found in double-stranded RNA viruses of the Birnaviridae family. Both virus families also share a conserved VPg sequence motif at the polymerase N-terminus which in birnaviruses appears to be used to covalently link a fraction of the replicase molecules to the 5'-end of the genomic segments. Birnavirus VPgs are presumed to be used as primers for replication initiation. Here we have solved the crystal structure of the TaV RdRP, the first non-canonical RdRP of a ssRNA virus, in its apo- form and bound to different substrates. The enzyme arranges as a stable dimer maintained by mutual interactions between the active site cleft of one molecule and the flexible N-terminal tail of the symmetrically related RdRP. The latter, partially mimicking the RNA template backbone, is involved in regulating the polymerization activity. As expected from previous sequence-based bioinformatics predictions, the overall architecture of the TaV enzyme shows important resemblances with birnavirus polymerases. In addition, structural comparisons and biochemical analyses reveal unexpected similarities between the TaV RdRP and those of Flaviviruses. In particular, a long loop protruding from the thumb domain towards the central enzyme cavity appears to act as a platform for de novo initiation of RNA replication. Our findings strongly suggest an unexpected evolutionary relationship between the RdRPs encoded by these distant ssRNA virus groups. PMID:26625123

  15. La liga de Cálculo I: una experiencia pedagógica y significativa en la Universidad Tecnológica de Bolívar

    OpenAIRE

    Barrios, Eder

    2012-01-01

    El siguiente trabajo tiene como propósito describir el proyecto “La liga de Cálculo I”, una experiencia pedagógica y significativa aplicada a estudiantes del primer semestre de la Universidad Tecnológica de Bolívar (Cartagena). La estrategia se viene aplicando desde el primer periodo de 2009 a los estudiantes de las carreras de Ingenierías, Ciencias Económicas y Negocios. El estudio también muestra los resultados obtenidos semestre tras semestre hasta el 2º período de 2011. El proyecto ...

  16. EL PRIMER TEXTO DE NEFTALÍ REYES Y EL ÚLTIMO POEMA DE PABLO NERUDA

    OpenAIRE

    Manuel Jofré

    2004-01-01

    Uno de los aspectos menos estudiados de la escritura nerudiana es la producción primera del joven Neruda, quien en esos años se llamaba Neftalí Reyes17. Sus primeros escritos son decisivos para la conformación del ser americano y para la constitución del sistema de referencias míticas de la escritura nerudiana, como asi mismo del proceso de nominación de la madrasta como madre y del yo como sujeto poético. Pablo Neruda publicó más de seis mil páginas en verso y en prosa. El primerísimo texto ...

  17. Antonio Roalas. Un pintor del primer tercio del siglo XVII en Madrid

    Directory of Open Access Journals (Sweden)

    Rodríguez Rebollo, Ángel

    2004-03-01

    Full Text Available El conocimiento que actualmente se tiene sobre los pintores del barroco madrileño ha avanzado mucho desde que Ángulo y Pérez Sánchez publicaran los dos volúmenes dedicados al primer y segundo tercio del siglo XVII. Posteriormente han ido viendo la luz estudios más pormenorizados, a veces en forma de exposiciones, que han clarificado aún más la importancia de los artistas que trabajaron en torno a la Corte de los llamados «los Austrias menores»; sin embargo, existen aún hoy un buen número de pintores sólo conocidos a través de contratos o inventarios de la época. La absoluta desinformación que tenemos de ellos, acrecentada por la inexistencia de obras firmadas, no permite a los historiadores dedicarles al menos un estudio parcial de su arte…

  18. Review of The Atheist’s Primer and Atheism for Beginners

    Directory of Open Access Journals (Sweden)

    Andrew J Bissette

    2014-05-01

    Full Text Available The New Atheists are occasionally accused of lacking nuance and sophistication, or of existing in an intellectual vacuum. To some it may seem that Dawkins 'et al'. are naïve logical positivists; this perspective may be reinforced by recent authors’ explicit rejection of the value of philosophy and other non-scientific approaches to knowledge (cf. Lawrence Krauss, Stephen Hawking. Into the fray steps Michael Palmer, offering his attempt to popularise a version of atheism that is underpinned by a long tradition of philosophical inquiry. 'The Atheist’s Primer', a condensed version of Palmer’s previous work, is aptly named: it is a crash course on the history and major arguments of atheism from a firmly philosophical angle. Its companion text, 'Atheism For Beginners', is a coursebook aimed at tutors seeking to teach this material.

  19. Review of The Atheist’s Primer and Atheism for Beginners

    Directory of Open Access Journals (Sweden)

    Andrew J Bissette

    2014-05-01

    Full Text Available The New Atheists are occasionally accused of lacking nuance and sophistication, or of existing in an intellectual vacuum. To some it may seem that Dawkins. are naïve logical positivists; this perspective may be reinforced by recent authors’ explicit rejection of the value of philosophy and other non-scientific approaches to knowledge (cf. Lawrence Krauss, Stephen Hawking. Into the fray steps Michael Palmer, offering his attempt to popularise a version of atheism that is underpinned by a long tradition of philosophical inquiry. The Atheist’s Primer, a condensed version of Palmer’s previous work, is aptly named: it is a crash course on the history and major arguments of atheism from a firmly philosophical angle. Its companion text, Atheism For Beginners, is a coursebook aimed at tutors seeking to teach this material.

  20. Using social media to facilitate knowledge transfer in complex engineering environments: a primer for educators

    Science.gov (United States)

    Murphy, Glen; Salomone, Sonia

    2013-03-01

    While highly cohesive groups are potentially advantageous they are also often correlated with the emergence of knowledge and information silos based around those same functional or occupational clusters. Consequently, an essential challenge for engineering organisations wishing to overcome informational silos is to implement mechanisms that facilitate, encourage and sustain interactions between otherwise disconnected groups. This paper acts as a primer for those seeking to gain an understanding of the design, functionality and utility of a suite of software tools generically termed social media technologies in the context of optimising the management of tacit engineering knowledge. Underpinned by knowledge management theory and using detailed case examples, this paper explores how social media technologies achieve such goals, allowing for the transfer of knowledge by tapping into the tacit and explicit knowledge of disparate groups in complex engineering environments.

  1. Shewanella algae en un paciente con diarrea crónica. Primer caso en Costa Rica

    Directory of Open Access Journals (Sweden)

    Erick Molina- Guevara

    2009-09-01

    Full Text Available Se presenta el caso de un paciente masculino, vecino de Pavas-San José, con historia de diarrea crónica. En el coprocultivo se identificó Shewanella algae. Casos de infección en humanos por esta bacteria son raros y se han encontrado, predominantemente localizadas, en piel, oídos y tejidos blandos con o sin bacteremia, en la mayoría de los cuales existe el antecedente de contacto con ambientes marinos. Shewanella algae es sensible a aminoglicósidos, carbapenemes, eritromicina y quinolonas, pero resistente a penicilinas. La sensibilidad a ampicilina y cefalosporinas es variable. Nuestro paciente fue tratado con cefalexina y tuvo una respuesta satisfactoria al mismo, con cese de los síntomas. De acuerdo con nuestro conocimiento este el primer caso documentado, en Costa Rica, de infección gastrointestinal por esta bacteria.

  2. "YFlag"--a single-base extension primer based method for gender determination.

    Science.gov (United States)

    Allwood, Julia S; Harbison, Sally Ann

    2015-01-01

    Assigning the gender of a DNA contributor in forensic analysis is typically achieved using the amelogenin test. Occasionally, this test produces false-positive results due to deletions occurring on the Y chromosome. Here, a four-marker "YFlag" method is presented to infer gender using single-base extension primers to flag the presence (or absence) of Y-chromosome DNA within a sample to supplement forensic STR profiling. This method offers built-in redundancy, with a single marker being sufficient to detect the presence of male DNA. In a study using 30 male and 30 female individuals, detection of male DNA was achieved with c. 0.03 ng of male DNA. All four markers were present in male/female mixture samples despite the presence of excessive female DNA. In summary, the YFlag system offers a method that is reproducible, specific, and sensitive, making it suitable for forensic use to detect male DNA. PMID:25354446

  3. Beyond research: a primer for considerations on using viral metagenomics in the field and clinic

    Directory of Open Access Journals (Sweden)

    Richard J Hall

    2015-03-01

    Full Text Available Powered by recent advances in next-generation sequencing technologies, metagenomics has already unveiled vast microbial biodiversity in a range of environments, and is increasingly being applied in clinics for difficult-to-diagnose cases. It can be tempting to suggest that metagenomics could be used as a universal test for all pathogens without the need to conduct lengthy serial testing using specific assays. While this is an exciting prospect, there are issues that need to be addressed before metagenomic methods can be applied with rigour as a diagnostic tool, including the potential for incidental findings, unforeseen consequences for trade and regulatory authorities, privacy and cultural issues, data sharing, and appropriate reporting of results to end-users. These issues will require consideration and discussion across a range of disciplines, including scientists, ethicists, clinicians, diagnosticians, health practitioners, and ultimately the public. Here, we provide a primer for consideration on some of these issues.

  4. Tuberculosis extrapulmonar en embarazada: Primer caso en el Área de Salud de Pavas

    Directory of Open Access Journals (Sweden)

    Adriana González- Vizcaíno

    2009-04-01

    Full Text Available La tuberculosis es la segunda causa de muerte por enfermedades infecciosas en el mundo, precedida solo por el Virus de Inmunodeficiencia Humana y Síndrome de Inmunodeficiencia Adquirida (sida, y es la primera causa de muerte por enfermedades infecciosas en las mujeres. La presentación de la tuberculosis en la mujer embarazada es similar a la de la no embarazada, pero el diagnóstico puede retardarse por la naturaleza no específica de los primeros síntomas y la frecuencia de malestar y fatiga en el embarazo. Este es el primer caso de tuberculosis en una embarazada documentado en el Área de Salud de Pavas.

  5. Genome fingerprinting of the silkworm, Bombyx mori, using random arbitrary primers.

    Science.gov (United States)

    Nagaraja, G M; Nagaraju, J

    1995-09-01

    The random amplified polymorphic DNA (RAPD) technique was used to study DNA profiling of thirteen silkworm genotypes. The genotypes included six diapausing and seven nondiapausing varieties that represent a high degree of divergence with respect to geographic origin, and morphological, qualitative, quantitative and biochemical characters. Two hundred sixteen amplified products were generated using 40 random primers. Genotype-specific amplification products were identified. Amplification products specific to diapausing genotypes were also identified. Segregation of the RAPD marker was analyzed in a backcross population and found to be inherited as dominant Mendelian traits. Based on pairwise comparison of amplified products, the genetic similarity was performed by a hierarchical clustering technique. Silkworm genotypes were clustered into two groups, one consisting of six diapausing and the other of seven nondiapausing genotypes. The results of our study suggest that the RAPD technique could be used as a powerful tool to generate genetic markers that are linked to traits of interest in the silkworm. PMID:8582347

  6. Robert Serber's 1943 Los Alamos Primer Analysis of Fission Bomb Efficiency

    Science.gov (United States)

    Reed, Cameron

    2013-04-01

    In an analysis of the expected efficiency of a fission bomb presented in his 1943 Los Alamos Primer, Robert Serber remarked that ``it is just possible for the reaction to occur to an interesting extent before it is stopped by the spreading of the active material.'' Due to the exponential nature of the time-dependence of a chain reaction, the efficiency of the explosion can be very sensitive to parameters such as the number of neutrons liberated per fission, the fission cross-section, and the number of critical masses of material used. In this paper I examine efficiency predictions for both uranium and plutonium bombs. Had some parameter values proven only modestly different from their true values, history may well have been very different.

  7. An electrochemical study of the corrosion behavior of primer coated 2219-T87 aluminum

    Science.gov (United States)

    Danford, M. D.; Higgins, R. H.

    1985-01-01

    The corrosion behavior for 2219-T87 aluminum coated with various primers, including those used for the external tank and solid rocket boosters of the Space Shuttle Transportation System, were investigated using electrochemical techniques. Corrosion potential time, polarization resistance time, electrical resistance time, and corrosion rate time measurements were all investigated. It was found that electrical resistance time and corrosion rate time measurement were most useful for studying the corrosion behavior of painted aluminum. Electrical resistance time determination give useful information concerning the porosity of paint films, while corrosion rate time curves give important information concerning overall corrosion rates and corrosion mechanisms. In general, the corrosion rate time curves all exhibited at least one peak during the 30 day test period, which was attributed, according to the proposed mechanisms, to the onset of the hydrogen evolution reaction and the beginning of destruction of the protective properties of the paint film.

  8. Reporte del primer hallazgo de puma (Puma concolor puma infectado con Trichinella sp. en Chile

    Directory of Open Access Journals (Sweden)

    A Hidalgo

    2013-01-01

    Full Text Available En la actualidad, Trichinella spiralis es la única especie que ha sido identificada en Chile como agente de la trichinellosis, tanto en hospedadores domésticos como silvestres. Estudios preliminares no han identificado aún la infección por Trichinella en animales nativos de Chile. La presente comunicación, informa del primer hallazgo de Trichinella sp. aislado en musculatura diafragmática e intercostales de un ejemplar de Puma (Puma concolor puma encontrado muerto mediante seguimiento por telemetría en el sector cordillerano de la Región de La Araucanía, Chile. El diagnóstico se realizó mediante triquinoscopía y digestión artificial. Este hallazgo confirma la existencia de Trichinella sp. en carnívoros nativos de Chile.

  9. Potasssium chloride as a nutrient seed primer to enhance salt‑tolerance in maize

    Directory of Open Access Journals (Sweden)

    Badar‑uz‑Zaman

    2012-08-01

    Full Text Available The objective of this work was to determine if KCl could be a useful nutrient primer for safe seed germination in maize crop under salt stress conditions. Seed priming was done using 50 mmol L‑1 of muriate of potash, and germination and seedling growth were evaluated after salt stress with NaCl up to 50 mmol L‑1. Another set of seeds was tested under the same salt stress conditions without priming. Under salinity stress, germination percentage, germination rate index, germination coefficient, and seedling vigor indexes were higher in primed seeds. In unprimed seeds, mean germination time increased, while the germination rate index and the fresh and dry matter mass decreased more sharply with salinity stress. The Na/K ratio was higher in unprimed seeds.

  10. Learning to Fish with Genetics: A Primer on the Vertebrate Model Danio rerio.

    Science.gov (United States)

    Holtzman, Nathalia G; Iovine, M Kathryn; Liang, Jennifer O; Morris, Jacqueline

    2016-07-01

    In the last 30 years, the zebrafish has become a widely used model organism for research on vertebrate development and disease. Through a powerful combination of genetics and experimental embryology, significant inroads have been made into the regulation of embryonic axis formation, organogenesis, and the development of neural networks. Research with this model has also expanded into other areas, including the genetic regulation of aging, regeneration, and animal behavior. Zebrafish are a popular model because of the ease with which they can be maintained, their small size and low cost, the ability to obtain hundreds of embryos on a daily basis, and the accessibility, translucency, and rapidity of early developmental stages. This primer describes the swift progress of genetic approaches in zebrafish and highlights recent advances that have led to new insights into vertebrate biology. PMID:27384027

  11. From Newton to Mandelbrot a primer in theoretical physics with fractals for the Macintosh

    CERN Document Server

    Stauffer, Dietrich

    1996-01-01

    From Newton to Mandelbrot A Primer in Theoretical Physics with Fractals for the Macintosh ( ) takes the student on a tour of the most important landmarks of theoretical physics classical, quantum, and statistical mechanics, relativity, electrodynamics, and, the most modern and exciting of all, the physics of fractals The treatment is confined to the essentials of each area, and short computer programs, numerous problems, and beautiful color illustrations round off this unusual textbook Ideally suited for a one-year course in theoretical physics it will also prove useful in preparing and revising for exams This edition is corrected and includes a new appendix on elementary particle physics, answers to all short questions, and a Macintosh diskette where a selection of executable programs exploring the fractal concept can be found The Diskette The program FRACTAL DIMENSION can be used on any 68030-, 68040,- or PowerPC-based Macintosh with 4 Mb RAM and 256 color display running System 67 - 75 - Sierpinski gasket ...

  12. INFORMACIÓN EN EL PRIMER NIVEL DE ATENCIÓN

    Directory of Open Access Journals (Sweden)

    Orzuza, Gloria Beatriz

    2013-01-01

    Full Text Available En América Latina y el Caribe existen algunos limitantes al acceso de la atención médica como la escasez de recursos, la distancia física y cultural entre la oferta pública y la población demandante. En este sentido, en la definición de políticas de salud formuladas por los Estados no podrá estar ausente la incorporación de tecnologías de información y comunicación, ya que el concepto de salud electrónica engloba las aplicaciones de registros médicos electrónicos, servicios de telemedicina, portales de salud y sistemas de gestión hospitalaria.En Argentina existía un gran interés de los profesionales médicos por la telemedicina e informática en salud, así en 1992 se realiza el Primer Congreso Mundial. Comienzan entonces muchas iniciativas en telemedicina, educación a distancia, portales de salud y en registros médicos electrónico.Las investigaciones en salud a nivel nacional, concluyen que Misiones pertenece al grupo de provincias argentinas que se encuentra en una situación más desfavorable respecto a las otras provincias. En este marco, se contribuirá con lineamientos estratégicos generales para un sistema de información a ser desarrollado en el primer nivel de atención, con el propósito de obtener la información necesaria para la toma de decisión y favorecer en la optimización de la gestión.

  13. Primer Certamen Frenopático Español (1883: estructura asistencial y aspectos administrativos

    Directory of Open Access Journals (Sweden)

    Villasante Armas, Olga

    1997-06-01

    Full Text Available In the latter part of the XIX century, an important group of physicians worked in Nueva Belén, a Mental Hospital located near Barcelona. Juan Giné y Partagás, the Director of Nueva Belén and his colleagues undertook investigation, clinical and academic work. This group organized the most important scientific meeting on Psychiatry in the last century in Spain, although Psychiatry had not yet been recognized as an independent science. The present article describes the organization and contents of the "Primer Certamen Frenopático Español" using the original records. It is mainly focused on the Congress communications which deal with administrative and asistencial aspects of that time.

    En el último tercio del siglo XIX un grupo de profesionales de la Medicina trabajaba en Nueva-Belén, hospital psiquiátrico localizado en las proximidades de Barcelona. Juan Giné y Partagás, director de este manicomio, y sus colaboradores, realizaban una labor clínica, académica y de investigación. Fue este grupo el que organizó la reunión más importante sobre Psiquiatría que tuvo lugar en el pasado siglo en España, en un momento en el que la especialidad no era, aún, reconocida como una disciplina científica independiente del resto de la Medicina. El presente artículo describe la organización y contenidos del "Primer Certamen Frenopático Español" utilizando como material las actas originales del Congreso. Se centra en el análisis de las comunicaciones presentadas, cuyos contenidos temáticos son los aspectos administrativos y asistenciales de la frenopatología de la época.

  14. Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6

    DEFF Research Database (Denmark)

    Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine;

    2015-01-01

    RNA) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer......-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer-independent and...... primer-dependent RNA polymerase activities with different efficiencies. We further show that RDR2 and RDR6 can initiate dsRNA synthesis either by elongation of 21- to 24- nucleotides RNAs hybridized to complementary RNA template or by elongation of self-primed RNA template. These findings provide new...

  15. Design and evaluation of universal 16S rRNA gene primers for high-throughput sequencing to simultaneously detect DAMO microbes and anammox bacteria.

    Science.gov (United States)

    Lu, Yong-Ze; Ding, Zhao-Wei; Ding, Jing; Fu, Liang; Zeng, Raymond J

    2015-12-15

    To develop universal 16S rRNA gene primers for high-throughput sequencing for the simultaneous detection of denitrifying anaerobic methane oxidation (DAMO) archaea, DAMO bacteria, and anaerobic ammonium oxidation (anammox) bacteria, four published primer sets (PS2-PS5) were modified. The overall coverage of the four primer pairs was evaluated in silico with the Silva SSU r119 dataset. Based on the virtual evaluation, the two best primer pairs (PS4 and PS5) were selected for further verification. Illumina MiSeq sequencing of a freshwater sediment and a culture from a DAMO-anammox reactor using these two primer pairs revealed that PS5 (341b4F-806R) was the most promising universal primer pair. This pair of primers detected both archaea and bacteria with less bias than PS4. Furthermore, an anaerobic fermentation culture and a wastewater treatment plant culture were used to verify the accuracy of PS5. More importantly, it detected DAMO archaea, DAMO bacteria, and anammox bacteria simultaneously with no false positives appeared. This universal 16S rRNA gene primer pair extends the existing molecular tools for studying the community structures and distributions of DAMO microbes and their potential interactions with anammox bacteria in different environments. PMID:26454634

  16. Analysis of bacterial communities in soil by use of denaturing gradient gel electrophoresis and clone libraries, as influenced by different reverse primers

    NARCIS (Netherlands)

    Brons, Jolanda; van Elsas, J.D.

    2008-01-01

    To assess soil bacterial diversity, PCR systems consisting of several slightly different reverse primers together with forward primer F968-GC were used along with subsequent denaturing gradient gel electrophoresis (DGGE) or clone library analyses. In this study, a set of 13 previously used and novel

  17. 40 CFR 63.3092 - How must I control emissions from my electrodeposition primer system if I want to comply with the...

    Science.gov (United States)

    2010-07-01

    ... carcinogen as specified in 29 CFR 1910.1200(d)(4). (b) Emissions from all bake ovens used to cure... electrodeposition primer system if I want to comply with the combined primer-surfacer, topcoat, final repair, glass... Pollutants: Surface Coating of Automobiles and Light-Duty Trucks Emission Limitations § 63.3092 How must...

  18. Role of the primer activation signal in tRNA annealing onto the HIV-1 genome studied by single-molecule FRET microscopy

    NARCIS (Netherlands)

    N. Beerens (Nancy); M.D.E. Jepsen (Mette); V. Nechyporuk-Zloy (Volodymyr); A.C. Krüger (Asger); J.-L. Darlix (Jean-Luc); J. Kjems (Jørgen); V. Birkedal (Victoria)

    2013-01-01

    textabstractHIV-1 reverse transcription is primed by a cellular tRNAlys3 molecule that binds to the primer binding site (PBS) in the genomic RNA. An additional interaction between the tRNA molecule and the primer activation signal (PAS) is thought to regulate the initiation of reverse transcription.

  19. Invading stacking primer: A trigger for high-efficiency isothermal amplification reaction with superior selectivity for detecting microRNA variants.

    Science.gov (United States)

    Liu, Weipeng; Zhu, Minjun; Liu, Hongxing; Wei, Jitao; Zhou, Xiaoming; Xing, Da

    2016-07-15

    Searching for a strategy to enhance the efficiency of nucleic acid amplification and achieve exquisite discrimination of nucleic acids at the single-base level for biological detection has become an exciting research direction in recent years. Here, we have developed a simple and universal primer design strategy which produces a fascinating effect on isothermal strand displacement amplification (iSDA). We refer to the resultant primer as "invading stacking primer (IS-Primer)" which is based on contiguous stacking hybridization and toehold-mediated exchange reaction and function by merely changing the hybridization location of the primer. Using the IS-Primer, the sensitivity in detecting the target miR-21 is improved approximately five fold compared with the traditional iSDA reaction. It was further demonstrated that the IS-Primer acts as an invading strand to initiate branch migration which can increase the efficiency of the untwisting of the hairpin probe. This effect is equivalent to reducing the free energy of the stem, and the technique shows superior selectivity for single-base mismatches. By demonstrating the enhanced effect of the IS-Primer in the iSDA reaction, this work may provide a potentially new avenue for developing more sensitive and selective nucleic acids assays. PMID:26985583

  20. Primer for identifying cold-water refuges to protect and restore thermal diversity in riverine landscapes - EPA 910-C-12-001

    Science.gov (United States)

    This primer provides guidance to Region 10 Tribes, States, and local watershed community groups to support the identification, protection, and restoration of critical cold water refuges for the protection of salmonids. This primer will assist these entities in implementing the E...

  1. Design of primers for pertussis diagnosis by Real Time PCR and determination of its sensitivity and specificity in comparison with commercial kits.

    Directory of Open Access Journals (Sweden)

    Hamidreza Monavari

    2013-12-01

    Results: Performance of our home made primers for detecting pertussis using Real Time PCR in comparison with those by commercial kit was acceptable based on diagnostic classical guidance (WHO and the (CDC. Conclusions: Real time PCR test with new primers in comparison with culture techniques is more suitable, high sensitivity and can provide more informative values for pertussis detection.

  2. El primer encuentro del padre con el bebé prematuro en la Unidad de Cuidados Intensivos Neonatales

    Directory of Open Access Journals (Sweden)

    Fernanda Martins Castro

    2015-06-01

    Full Text Available Objetivo: Describir el primer encuentro del padre con el hijo en la Unidad de Cuidados Intensivos Neonatales (UCIN y analizar el significado de este momento en la perspectiva de los padres. Método: estudio cualitativo, con ocho padres de niños prematuros, a través de entrevistas semi-estructuradas. Los datos se analizaron a través del análisis temático. Resultados: Surgieron tres núcleos temáticos: "primer encuentro con hijo prematuro: sentimientos paternales y emociones", "construcción de la relación entre los profesionales y los padres de los recién nacidos a partir del primer encuentro" y reconocimiento de la paternidad en el contexto de la UCIN. Conclusión: El primer encuentro del padre con su hijo en la UCIN provoca sentimientos y sorpresa, dolor, incertidumbre, alegría y esperanza. El equipo de salud debe estar preparado para brindar apoyo emocional, información y establecer una comunicación efectiva desde la primera visita.

  3. Heterologous primer transferability and access to microsatellite loci polymorphism in ‘somnus’ passion fruit tree (Passiflora setacea DC

    Directory of Open Access Journals (Sweden)

    Douglas de Almeida Pereira

    2015-09-01

    Full Text Available Primer pairs that access microsatellite loci, initially constructed through the genome of Passiflora edulis Sims flavicarpa and P. alata, were tested concerning their ability to access microsatellite loci in ‘somnus’ passion fruit tree (P. setacea individuals. Seven out of the thirty one primer pairs tested were able to access DNA polymorphism in the genome of this wild Passiflora species, by evaluating six natural populations, located in a transition area between the biomes Caatinga and Cerrado, in the state of Bahia, Brazil. The number of alleles/loci was small, oscillating from 1 to 4. The average heterozygosity observed per locus in all populations ranged from 0.13 to 0.40. There was transference of heterologous microsatellite primer pairs from the Passiflora genus to ‘somnus’ passion fruit tree, constituting a new set of primers that access random co-dominant locus in this species, useful for conservationist purposes and pre-improvement of ‘somnus’ passion fruit tree.

  4. Simple and reliable procedure for PCR amplification of genomic DNA from yeast cells using short sequencing primers

    DEFF Research Database (Denmark)

    Haaning, J; Oxvig, C; Overgaard, Michael Toft;

    1997-01-01

    means of PCR without any prior DNA purification steps. This method involves a simple boiling step of whole yeast cells in the presence of detergent, and subsequent amplification of genomic DNA using short sequencing primers in a polymerase chain reaction assay with a decreasing annealing temperature...

  5. Arrayed primer extension in the "array of arrays" format: a rational approach for microarray-based SNP genotyping

    DEFF Research Database (Denmark)

    Klitø, Niels G F; Tan, Qihua; Nyegaard, Mette;

    2007-01-01

    This study provides a new version of the arrayed primer extension (APEX) protocol adapted to the 'array of arrays' platform using an instrumental setup for microarray processing not previously described. The primary aim of the study is to implement a system for rational cost-efficient genotyping...

  6. Development of a primer-probe energy transfer based real-time PCR for detection of Marek's disease virus

    DEFF Research Database (Denmark)

    Barfoed, Annette Malene; Østergaard, E.; Frandsen, P.L.;

    2010-01-01

    A real-time PCR assay, which enables simultaneous detection and differentiation of all three serotypes of Marek's disease virus, without the need for post-PCR sequencing, has been developed. The assay is based on the primer-probe energy transfer real-time PCR, which has a relatively high tolerance...

  7. Preliminary Study on Applicability of Microsatellite DNA Primers from Parasite Protozoa Trypanosoma cruzi in Free-living Protozoa

    Institute of Scientific and Technical Information of China (English)

    ZHANG Wenjing; YU Yuhe; SHEN Yunfen; MIAO Wei; FENG Weisong

    2004-01-01

    In this paper, we took the lead in studying on specificity of the microsatellite DNA loci and applicability of microsatellite DNA primers in protozoa. In order to study characters of microsatellites in free-living protozoa, eight microsatellite loci primers developed from Trypanosoma cruzi (MCLE01, SCLE10, MCLE08, SCLE11, MCLF10, MCLG10,MCL03, MCL05) were employed to amplify microsatellite in four free-living protozoa, including Bodo designis, Euglena gracilis FACHB848, Paramecium bruzise and Tetrahymena thermophila BF1. In the amplification systems of P. bruzise, four loci (SCLE10, SCLE1 1, MCLF10, MCL03) were amplified successfully, and four amplification fragments were in proper size. In genome of E. gracilis FACHB848, five of eight primers brought five clear amplification bands. In B. designis, three (No.4, 5 and 7) of eight loci produced clear and sharp products without stutter bands, whereas no bands appeared in T.thermophila BF1. Further, eight 300-500bp amplification fragments were cloned and sequenced. Nevertheless, all sequenced products did not contain corresponding microsatellite sequence, although Bodo is in the same order and has the nearest phylogenetic relation with Trypanosoma among these four species. Thus, the microsatellite DNA primers can not be applied among order or more far taxa, and the specificity of microsatellite DNA is very high in protozoa. The results of this study will contribute to our understanding of microsatellite DNA in protozoa.

  8. Inhibition of human immunodeficiency virus type 1 replication with artificial transcription factors targeting the highly conserved primer-binding site

    NARCIS (Netherlands)

    S.R. Eberhardy; J. Goncalves; S. Coelho; D.J. Segal; B. Berkhout; C.F. Barbas

    2006-01-01

    The human immunodeficiency virus type 1 (HIV-1) primer-binding site (PBS) is a highly conserved region in the HIV genome and represents an attractive target for the development of new anti-HIV therapies. In this study, we designed four artificial zinc finger transcription factors to bind at or adjac

  9. Isolation of novel repetitive sequences in two moths and a butterfly by means of PCR with TRAS primers

    Czech Academy of Sciences Publication Activity Database

    Vítková, Magda

    Kolympari, Crete: Orthodox Academy of Crete, 2009 - (Iatrou, K.; Gordon, K.). s. 87-87 [International Workshop on the Molecular Biology and Genetics of the Lepidoptera /8./. 23.08.2009-29.08.2009, Kolympari, Crete] Institutional research plan: CEZ:AV0Z50070508 Keywords : TRAS primers Subject RIV: EB - Genetics ; Molecular Biology

  10. Massive Open Online Courses (MOOCs): A Primer for University and College Board Members. An AGB White Paper

    Science.gov (United States)

    Voss, Brian D.

    2013-01-01

    The environment in which MOOCs and other forms of online education operate is changing virtually every day. Based upon a presentation given to the board of directors of AGB, this white paper is an effort to give board chairs, presidents, and others some context to help guide discussions on their own campuses. It provides a primer on MOOCs,…

  11. Inhibition of non-templated nucleotide addition by DNA polymerases in primer extension using twisted intercalating nucleic acid modified templates

    Czech Academy of Sciences Publication Activity Database

    Güixens Gallardo, Pedro; Hocek, Michal; Perlíková, Pavla

    2016-01-01

    Roč. 26, č. 2 (2016), s. 288-291. ISSN 0960-894X R&D Projects: GA ČR GBP206/12/G151 Institutional support: RVO:61388963 Keywords : DNA polymerases * nucleotide addition * primer extension * oligonucleotides * twisted intercalating nucleic acid Subject RIV: CC - Organic Chemistry Impact factor: 2.420, year: 2014

  12. Enlightenment from The Three Character Primer on Building a Democrat-ic and Harmonious Family Education Means

    Institute of Scientific and Technical Information of China (English)

    高泽峰

    2014-01-01

    At present, there are unharmonious factors existing in Chinese family education, which particular manifest in the means of family education. The Three Character Primer, as an epitome of the essence of Chinese traditional culture, can provide enlightenment on building a democratic and harmonious family education means.

  13. SDM-Assist software to design site-directed mutagenesis primers introducing “silent” restriction sites

    Science.gov (United States)

    2013-01-01

    Background Over the past decades site-directed mutagenesis (SDM) has become an indispensable tool for biological structure-function studies. In principle, SDM uses modified primer pairs in a PCR reaction to introduce a mutation in a cDNA insert. DpnI digestion of the reaction mixture is used to eliminate template copies before amplification in E. coli; however, this process is inefficient resulting in un-mutated clones which can only be distinguished from mutant clones by sequencing. Results We have developed a program – ‘SDM-Assist’ which creates SDM primers adding a specific identifier: through additional silent mutations a restriction site is included or a previous one removed which allows for highly efficient identification of ‘mutated clones’ by a simple restriction digest. Conclusions The direct identification of SDM clones will save time and money for researchers. SDM-Assist also scores the primers based on factors such as Tm, GC content and secondary structure allowing for simplified selection of optimal primer pairs. PMID:23522286

  14. Can previous acid etching increase the bond strength of a self-etching primer adhesive to enamel?

    Directory of Open Access Journals (Sweden)

    Ana Paula Morales Cobra Carvalho

    2009-06-01

    Full Text Available Because a greater research effort has been directed to analyzing the adhesive effectiveness of self etch primers to dentin, the aim of this study was to evaluate, by microtensile testing, the bond strength to enamel of a composite resin combined with a conventional adhesive system or with a self-etching primer adhesive, used according to its original prescription or used with previous acid etching. Thirty bovine teeth were divided into 3 groups with 10 teeth each (n= 10. In one of the groups, a self-etching primer (Clearfil SE Bond - Kuraray was applied in accordance with the manufacturer's instructions and, in the other, it was applied after previous acid etching. In the third group, a conventional adhesive system (Scotchbond Multipurpose Plus - 3M-ESPE was applied in accordance with the manufacturer's instructions. The results obtained by analysis of variance revealed significant differences between the adhesive systems (F = 22.31. The self-etching primer (Clearfil SE Bond presented lower enamel bond strength values than the conventional adhesive system (Scotchbond Multipurpose Plus (m = 39.70 ± 7.07 MPa both when used according to the original prescription (m = 27.81 ± 2.64 MPa and with previous acid etching (m = 25.08 ± 4.92 MPa.

  15. Back to Basics – The Influence of DNA Extraction and Primer Choice on Phylogenetic Analysis of Activated Sludge Communities

    DEFF Research Database (Denmark)

    Albertsen, Mads; Karst, Søren Michael; Ziegler, Anja Sloth;

    2015-01-01

    DNA extraction and primer choice have a large effect on the observed community structure in allmicrobial amplicon sequencing analyses. Although the biases are well known, no com- prehensive analysis has been conducted in activated sludge communities. In this study we systematically explored the i...

  16. The Structure of the RNA-Dependent RNA Polymerase of a Permutotetravirus Suggests a Link between Primer-Dependent and Primer-Independent Polymerases.

    Directory of Open Access Journals (Sweden)

    Diego S Ferrero

    2015-12-01

    Full Text Available Thosea asigna virus (TaV, an insect virus belonging to the Permutatetraviridae family, has a positive-sense single-stranded RNA (ssRNA genome with two overlapping open reading frames, encoding for the replicase and capsid proteins. The particular TaV replicase includes a structurally unique RNA-dependent RNA polymerase (RdRP with a sequence permutation in the palm sub-domain, where the active site is anchored. This non-canonical arrangement of the RdRP palm is also found in double-stranded RNA viruses of the Birnaviridae family. Both virus families also share a conserved VPg sequence motif at the polymerase N-terminus which in birnaviruses appears to be used to covalently link a fraction of the replicase molecules to the 5'-end of the genomic segments. Birnavirus VPgs are presumed to be used as primers for replication initiation. Here we have solved the crystal structure of the TaV RdRP, the first non-canonical RdRP of a ssRNA virus, in its apo- form and bound to different substrates. The enzyme arranges as a stable dimer maintained by mutual interactions between the active site cleft of one molecule and the flexible N-terminal tail of the symmetrically related RdRP. The latter, partially mimicking the RNA template backbone, is involved in regulating the polymerization activity. As expected from previous sequence-based bioinformatics predictions, the overall architecture of the TaV enzyme shows important resemblances with birnavirus polymerases. In addition, structural comparisons and biochemical analyses reveal unexpected similarities between the TaV RdRP and those of Flaviviruses. In particular, a long loop protruding from the thumb domain towards the central enzyme cavity appears to act as a platform for de novo initiation of RNA replication. Our findings strongly suggest an unexpected evolutionary relationship between the RdRPs encoded by these distant ssRNA virus groups.

  17. Shotgun metagenomes and multiple primer pair-barcode combinations of amplicons reveal biases in metabarcoding analyses of fungi

    Directory of Open Access Journals (Sweden)

    Leho Tedersoo

    2015-05-01

    Full Text Available Rapid development of high-throughput (HTS molecular identification methods has revolutionized our knowledge about taxonomic diversity and ecology of fungi. However, PCR-based methods exhibit multiple technical shortcomings that may bias our understanding of the fungal kingdom. This study was initiated to quantify potential biases in fungal community ecology by comparing the relative performance of amplicon-free shotgun metagenomics and amplicons of nine primer pairs over seven nuclear ribosomal DNA (rDNA regions often used in metabarcoding analyses. The internal transcribed spacer (ITS barcodes ITS1 and ITS2 provided greater taxonomic and functional resolution and richness of operational taxonomic units (OTUs at the 97% similarity threshold compared to barcodes located within the ribosomal small subunit (SSU and large subunit (LSU genes. All barcode-primer pair combinations provided consistent results in ranking taxonomic richness and recovering the importance of floristic variables in driving fungal community composition in soils of Papua New Guinea. The choice of forward primer explained up to 2.0% of the variation in OTU-level analysis of the ITS1 and ITS2 barcode data sets. Across the whole data set, barcode-primer pair combination explained 37.6–38.1% of the variation, which surpassed any environmental signal. Overall, the metagenomics data set recovered a similar taxonomic overview, but resulted in much lower fungal rDNA sequencing depth, inability to infer OTUs, and high uncertainty in identification. We recommend the use of ITS2 or the whole ITS region for metabarcoding and we advocate careful choice of primer pairs in consideration of the relative proportion of fungal DNA and expected dominant groups.

  18. An evaluation of corrosion protection by two epoxy primers on 2219-T87 and 7075-T73 aluminum

    Science.gov (United States)

    Mendrek, M. J.

    1992-01-01

    A comparison of the corrosion protection provided by two amine epoxy primers was made using salt fog, alternate immersion, and total immersion as exposure media. The study is the result of a request to use an unqualified low volatile organic carbon (VOC) primer (AKZO 463-6-78) in place of the current primer (AKZO 463-6-3) because environmental regulations have eliminated use of the current primer in many states. Primed, scribed samples of 2219-T87 and 7075-T73 aluminum were exposed to 5-percent NaCl salt fog and 3.5-percent NaCl alternate immersion for a period of 90 days. In addition, electrode samples immersed in 3.5-percent NaCl were tested using electrochemical impedance spectroscopy (EIS). The EG&G model 368 ac impedance measurement system was used to monitor changing properties of AKZO 463-6-78 and AKZO 463-6-3 primed 2219-T87 aluminum for a period of 30 days. The response of the corroding system of a frequency scan can be modeled in terms of an equivalent circuit consisting of resistors and capacitors in a specific arrangement. Each resistor/capacitor combination represents physical processes taking place within the electrolyte, at the electrolyte/primer surface, within the coating, and at the coating/substrate surface. Values for the resistors and capacitors are assigned following a nonlinear least squares fit of the data to the equivalent circuit. Changes in the values of equivalent circuit parameters during the 30-day exposure allow assessment of the time to and mechanism of coating breakdown.

  19. Quality assurance and quality control of geochemical data—A primer for the research scientist

    Science.gov (United States)

    Geboy, Nicholas J.; Engle, Mark A.

    2011-01-01

    interpreting results. This primer has been developed to provide basic information and guidance about developing QA/QC protocols for geochemical studies. It is not intended to be a comprehensive guide but rather an introduction to key concepts tied to a list of relevant references for further reading. The guidelines are presented in stepwise order beginning with presampling considerations and continuing through final data interpretation. The goal of this primer is to outline basic QA/QC practices that scientists can use before, during, and after chemical analysis to ensure the validity of the data they collect with the goal of providing defendable results and conclusions.

  20. The development of miniplex primer sets for the analysis of degraded DNA

    Science.gov (United States)

    McCord, Bruce; Opel, Kerry; Chung, Denise; Drabek, Jiri; Tatarek, Nancy; Meadows Jantz, Lee; Butler, John

    2005-05-01

    In this project, a new set of multiplexed PCR reactions has been developed for the analysis of degraded DNA. These DNA markers, known as Miniplexes, utilize primers that have shorter amplicons for use in short tandem repeat (STR) analysis of degraded DNA. In our work we have defined six of these new STR multiplexes, each of which consists of 3 to 4 reduced size STR loci, and each labeled with a different fluorescent dye. When compared to commercially available STR systems, reductions in size of up to 300 basepairs are possible. In addition, these newly designed amplicons consist of loci that are fully compatible with the the national computer DNA database known as CODIS. To demonstrate compatibility with commercial STR kits, a concordance study of 532 DNA samples of Caucasian, African American, and Hispanic origin was undertaken There was 99.77% concordance between allele calls with the two methods. Of these 532 samples, only 15 samples showed discrepancies at one of 12 loci. These occurred predominantly at 2 loci, vWA and D13S317. DNA sequencing revealed that these locations had deletions between the two primer binding sites. Uncommon deletions like these can be expected in certain samples and will not affect the utility of the Miniplexes as tools for degraded DNA analysis. The Miniplexes were also applied to enzymatically digested DNA to assess their potential in degraded DNA analysis. The results demonstrated a greatly improved efficiency in the analysis of degraded DNA when compared to commercial STR genotyping kits. A series of human skeletal remains that had been exposed to a variety of environmental conditions were also examined. Sixty-four percent of the samples generated full profiles when amplified with the Miniplexes, while only sixteen percent of the samples tested generated full profiles with a commercial kit. In addition, complete profiles were obtained for eleven of the twelve Miniplex loci which had amplicon size ranges less than 200 base pairs