WorldWideScience

Sample records for automatizadas primer semestre

  1. Aprendizaje de estocásticos en primer semestre de ingeniería

    OpenAIRE

    Torres, Omar Pablo; Ojeda, Ana María

    2010-01-01

    Este estudio se dirige a la cuestión de si la formación del ingeniero satisface los requerimientos de conocimientos de estocásticos para un desarrollo satisfactorio en su futuro desempeño profesional y/o académico tecnológico. Para ello, se interesa en la comprensión de las ideas fundamentales de estocásticos en los alumnos del primer semestre de ingeniería y en las dificultades que pueden tener para aprender probabilidad y estadística; se enfoca en la propuesta para estocásticos de los insti...

  2. Recolectores, verificadores y reflexivos: perfiles de la competencia informacional en estudiantes universitarios de primer semestre

    Directory of Open Access Journals (Sweden)

    Harold Castañeda-Peña

    2010-01-01

    Full Text Available Artículo de investigación que explora perfiles de la competencia informacional en estudiantes universitarios de primer semestre, a partir de un concepto renovado de competencia informacional desde la perspectiva sociocultural, donde se entiende perfil como una práctica habitual que es situada y variada. Se analiza el caso de 285 estudiantes provenientes de dos universidades colombianas, por medio de un instrumento observacional (cuestionario de perfil, protocolos en voz alta y entrevistas. Se encuentra que el 55% de los estudiantes de primer año de una universidad con carreras profesionales tiende a recolectar información y que el 78% de los estudiantes de primer año de una universidad con carreras tecnológicas tiende a contrastar y verificar información, en tanto que sólo entre 3% y 4% tiende a manejar la información críticamente. Se discute que, al asumir una tarea académica, estos estudiantes vinculan sus prácticas de competencia informacional a sus propias historias de vida y escolares, y que la edad y los antecedentes académicos parecen influir en tales prácticas. Los casos analizados se ubican dentro de perfiles de competencia informacional: recolectores, verificadores y reflexivos. Estos perfiles no son fijos, sino más bien fluidos, y se concretan de manera diferente según la tarea académica. Se recomienda realizar estudios de perfiles informacionales en estudiantes tanto de secundaria como universitarios, para diseñar políticas educativas sobre competencia informacional.

  3. Aptitud física relacionada con salud en los estudiantes de primer semestre académico de un programa de fisioterapia, 2007

    OpenAIRE

    Claudia Lucía Ariza-García; Milena del Carmen Boneth-Collante; Javier Parra-Patiño

    2014-01-01

    Objetivo: Evaluar la aptitud física relacionada con salud (AFRS) de las estudiantes de primer semestre de fisioterapia de una universidad privada de Santander. Metodología: Estudio descriptivo transversal realizado en 20 estudiantes (17,8 ± 1,33 años) de sexo femenino de primer semestre, seleccionadas por conveniencia. Se recolectaron las variables edad, sexo, composición corporal, la flexibilidad de la musculatura posterior, la capacidad aeróbica y la resistencia muscular de miembros superio...

  4. Efectividad de la funcionalidad en las familias con adolescentes de primer semestre de la Fundación Universitaria San Gil

    OpenAIRE

    MARÍA LUCENITH CRIADO MORALES; YURIAN RUBIANO MESA

    2009-01-01

    En el presente estudio se determina y analiza la efectividad de la funcionalidad en las familias con adolescentes de primer semestre en la Fundación Universitaria de San Gil en el periodo 2008-1, teniendo como base el " Marco teórico de organización sistémica" de la doctora María Luisa Friedemann. Es un estudio descriptivo transversal, cuya muestra estuvo constituida por 150 familias. A los adolescentes se les aplicó la ficha sociodemográfica y la " Escala de evaluación de la funcionalidad fa...

  5. Probabilidad y estadística en el primer semestre de ingeniería en institutos tecnológicos

    OpenAIRE

    Ojeda, Ana María; Torres, Omar Pablo

    2009-01-01

    Este estudio se interesa en las limitaciones que puedan tener los alumnos del primer semestre de ingeniería para aprender probabilidad y estadística; se enfoca en la propuesta para estocásticos de los institutos tecnológicos y la cuestión de si satisface las necesidades del futuro ingeniero en el campo profesional. En la primera etapa de la investigación, el objeto de análisis fue el programa de estudio y los medios que recomienda el sistema de institutos tecnológicos, así como su corresponde...

  6. MEMORIA DE TRABAJO Y RENDIMIENTO ACADÉMICO EN ESTUDIANTES DE PRIMER SEMESTRE DE UNA UNIVERSIDAD DE LA CIUDAD DE BARRANQUILLA

    Directory of Open Access Journals (Sweden)

    Luis Felipe Zapata

    2009-01-01

    Full Text Available La memoria de trabajo puede ser un componente de gran influencia en el rendimiento académico, aunque no es el único que lo determina. Este artículo muestra los resultados de una investigación en la que se intentó determinar la correlación que existe entre la memoria de trabajo y el rendimiento académico en estudiantes de primer semestre de diferentes programas de una universidad de Barranquilla. No se encontró correlación entre ninguna de las medidas de memoria de trabajo utilizadas y el rendimiento académico de los participantes. Estos resultados pueden ser explicados por los efectos que otras variables tienen en el rendimiento académico, como la cognición, la motivación, el afecto y el contexto.

  7. Aptitud física relacionada con salud en los estudiantes de primer semestre académico de un programa de fisioterapia, 2007

    Directory of Open Access Journals (Sweden)

    Claudia Lucía Ariza-García

    2016-08-01

    Full Text Available Objetivo: Evaluar la aptitud física relacionada con salud (AFRS de las estudiantes de primer semestre de fisioterapia de una universidad privada de Santander. Metodología: Estudio descriptivo transversal realizado en 20 estudiantes (17,8 ± 1,33 años de sexo femenino de primer semestre, seleccionadas por conveniencia. Se recolectaron las variables edad, sexo, composición corporal, la flexibilidad de la musculatura posterior, la capacidad aeróbica y la resistencia muscular de miembros superiores y abdominales. Se calcularon medidas de tendencia central, de dispersión, frecuencias y porcentajes. Resultados: En promedio el peso fue de 52,8 ± 9,5 kg, la estatura de 1,58 ± 0,05 m, el IMC de 20,9 ± 3,5 kg/m2. La circunferencia de cintura y de cadera fue de 69,3 ± 9,2 cms y 91,3 ± 7,3 cm, respectivamente. El promedio del cuarto cuartil de las mediciones perímetro de cintura, perímetro de cadera, relación cintura-cadera, frecuencia cardiaca después de 30 s y distancia en la prueba de flexibilidad fueron estadísticamente mayores comparado con los demás cuartiles. El 50% de los pacientes realizó entre 0 y 3 repeticiones de la prueba Push-Up y entre 0 y 21 repeticiones en la prueba Cu rl-Up. El 65% fue físicamente apta hasta en cuatro pruebas y el 35% en 5 y 6 pruebas. Ninguna fue apta en todas las pruebas. Conclusiones: Dado que ninguna de las estudiantes posee una aptitud física relacionada con salud óptima, se sugiere que en los programas de fisioterapia se fomente una AFRS adecuada junto con estilos de vida saldables para prevenir enfermedades crónicas no transmisibles.

  8. El Sentido de vida en Estudiantes de Primer Semestre de la Universidad de la Salle Bajío

    Directory of Open Access Journals (Sweden)

    Laura Magaña Valladares

    2004-01-01

    Full Text Available En la visión humanista de la educación destaca la importancia de ayudar a los alumnos para que decidan lo que son y lo que pueden llegar a ser, a partir de la comprensión de los motivos que los impulsan para lograr “algo” o para ser de una manera determinada. Desde esta perspectiva, en la investigación se propusieron los siguientes objetivos: 1 valorar el “Sentido de Vida” de estudiantes de nuevo ingreso de la Universidad De La Salle Bajío; 2 explorar las relaciones de los resultados obtenidos con variables personales y familiares; y, 3 analizar las características psicométricas del instrumento utilizado. El estudio descriptivo se trabajó con una muestra estratificada, al azar de 723 estudiantes universitarios de primer ingreso, de 16 a 27 años, pertenecientes a 23 carreras. Se aplicó el test, Purpose in Live (PIL de Crumbaugh y Maholick. En los resultados se encontró que el 55.5% de los estudiantes muestran una definición adecuada del Sentido de Vida; el 33.3% se ubica en la zona de indefinición; y, el 11.2% muestra falta de Sentido. La distribución del total de puntajes obtenidos en la muestra de estudiantes fue superior a la de los baremos disponibles. La proporción de alumnos que mostró indefinición es un foco de atención primordial; asimismo, la carencia de Sentido de Vida que mostró el 11.2% puede considerarse como posible indicador de desajuste emocional.

  9. Efectos de un programa heurístico sobre el pensamiento hipotéticodeductivo en estudiantes de primer semestre de ingenierías

    Directory of Open Access Journals (Sweden)

    Fernando Iriarte Diazgranados

    2004-01-01

    Full Text Available En este artículo se presentan los resultados de un estudio que se realizó con estudiantes de primer semestre de ingenierías de la Universidad del Norte, cuyo objetivo se centró en determinar los efectos de un programa de enfoque heurístico sobre el pensamiento hipotético-deductivo de los estudiantes; para ello se utilizó un diseño cuasiexperimental, antes y después, con grupo control no equivalente. 20 alumnos, que conformaron la muestra del grupo experimental, fueron sometidos a un programa de enfoque heurística en la asignatura de geometría durante 10 semanas de clases, con una intensidad de 3 horas semanales; mientras que 15 alumnos, que integraron la muestra del grupo control, no fueron sometidos a este programa, sino que se les impartió la asignatura de manera tradicional. El programa de enfoque heurístico se basó en la teoría cognitiva de Bruner, especificamente en los modos de representación enactiva y simbólico, y en los heurísticos del matemático Alan Schoenfeld. Se tomó como modelo de decisión estadística la distribución t de Student, con el fin de determinar si habla variaciones significativas en el nivel de pensamiento hipotético-deductivo. Los resultados del estudio apoyan la hipótesis de trabajo.

  10. Efectividad de la funcionalidad en las familias con adolescentes de primer semestre de la Fundación Universitaria San Gil

    Directory of Open Access Journals (Sweden)

    MARÍA LUCENITH CRIADO MORALES

    2009-12-01

    Full Text Available En el presente estudio se determina y analiza la efectividad de la funcionalidad en las familias con adolescentes de primer semestre en la Fundación Universitaria de San Gil en el periodo 2008-1, teniendo como base el " Marco teórico de organización sistémica" de la doctora María Luisa Friedemann. Es un estudio descriptivo transversal, cuya muestra estuvo constituida por 150 familias. A los adolescentes se les aplicó la ficha sociodemográfica y la " Escala de evaluación de la funcionalidad familiar" que permite medir los conceptos de la teoría y refleja el funcionamiento familiar. Los datos se procesaron en SPSS versión 10.0 y se analizaron mediante estadísticas descriptivas. Los resultados indican que el 69,3% de los adolescentes es de género femenino, el 88,7% practica la religión católica, y 58,7% están dedicados exclusivamente a estudiar. Las familias se caracterizan porque 55,3% son de tipo nuclear, 63,3% con un promedio de 4 a 6 miembros, en 60,7% el estado civil de los padres de los adolescentes es casados y 38% de las familias recibe ingresos de 2 salarios mínimos mensuales. Las familias presentan baja efectividad de la funcionalidad familiar en el 65,3% de los casos, el 32,7% es de nivel intermedio y 2% tiene alta efectividad. Se concluye que la efectividad de la funcionalidad familiar es baja porque son " familias que luchan por mantener la estabilidad contraria a las normas externas, impidiendo la entrada de nuevo conocimiento interfiriendo con la morfogénesis" (1 del sistema familiar.

  11. La coma: un signo en conflicto. Las fallas e inconsistencias más frecuentes en los usos de la coma en la estructuración de textos de opinión de estudiantes universitarios de primer semestre

    OpenAIRE

    Pérez Mora, Elmira del Carmen

    2006-01-01

    El presente estudio examina el manejo de la coma en 18 textos de opinión escritos en español por estudiantes de primer semestre de una universidad pública mexicana. El propósito fue identificar las fallas e inconsistencias más frecuentes en los usos de este signo de puntuación y cómo incide en dicha problemática la falta de claridad con que algunos libros y manuales especializados de redacción y ortografía en español presentan sus diferentes casos. Para tal efecto, se eli...

  12. Diseño de una prueba diagnóstica en matemáticas para estudiantes que ingresan a primer semestre a la Corporación Universitaria Minuto de Dios-Sede Bogotá

    OpenAIRE

    Ramírez, Marco Antonio; Rodríguez, Frey

    2012-01-01

    El presente artículo da cuenta del proceso investigativo generado frente a la construcción e implementación de una prueba diagnóstica dirigida a los estudiantes que ingresan a primer semestre a UNIMINUTO con el ánimo de establecer su nivel de desempeño en el campo del pensamiento geométrico y variacional. El instrumento se construyó teniendo en cuenta otras pruebas ya validadas y soportadas en los niveles de Van Hiele, y en el manejo de la variable real, se aplicó con el apoyo de un ambien...

  13. Asertividad y autoestima en estudiantes de primer semestre de la Facultad de Ciencias de la Salud de una universidad pública de la ciudad de Santa Marta (Colombia

    Directory of Open Access Journals (Sweden)

    Alexander León Camargo

    2009-01-01

    Full Text Available Esta investigación estudió las habilidades sociales en cuanto asertividad y autoestima en estudiantes de primer semestre de todos los programas adscritos a la Facultad de Ciencias de la Salud y se enmarcó en el paradigma positivista, de tipo cuantitativo; el diseño utilizado fue de tipo correlacional. La conducta socialmente habilidosa es ese conjunto de comportamientos emitidos por un individuo en un contexto interpersonal, que expresa sentimientos, actitudes, deseos, opiniones o derechos de esa persona de un modo adecuado a la situación, respetando esas conductas en los demás y que, generalmente, resuelve los problemas inmediatos de la situación, mientras minimiza la probabilidad de futuros problemas. Muchasveces se combinan asertividad con autoestima como elementos psicológicos necesarios para que un individuo pueda manejarse en la vida de una manera asertiva aunque no sean los únicos a considerar. La muestra estuvo conformada 200 estudiantes que ingresaron al primer semestre de los programas académicos de Medicina, Psicología, Enfermería y Odontología, durante el periodo 2008-2. No obstante, 47 estudiantes no desearon participar en la investigación por motivos diferentes, por lo cual la muestra final quedó conformada por 153 estudiantes.

  14. Los indicadores de selección para el ingreso a la universidad y su valor para estimar el rendimiento académico en el primer semestre

    OpenAIRE

    Luis Alfonso Díaz-Martínez; Claudia Rocío Toloza-González

    2007-01-01

    Objetivo: establecer si los antecedentes académicos, la evaluación psicológica y los resultados de la entrevista de admisión son; indicadores del desempeño académico en el primer nivel de un programa de medicina. Diseño: cohorte prospectiva. Lugar:; Universidad Autónoma de Bucaramanga, Colombia. Participantes: estudiantes matriculados en el primer nivel de Medicina durante; 2001 y 2002. Intervenciones: se evaluaron distintas variables y se correlacionaron con haber aprobado o no ínte...

  15. Tobin’s Separation Theorem: Information from the Colombian Stock Market for the First Half of 2008 El teorema de la separación de Tobin: información del primer semestre de 2008 del mercado accionario colombiano

    Directory of Open Access Journals (Sweden)

    José Gabriel Astaiza Gómez

    2012-12-01

    Full Text Available This paper shows a special situation where a portfolio created based on Tobin’s separation theorem does not match the Markowitz efficient set. Next a review of Markowitz´s portfolio selection theory is offered, followed by a review of Tobin’s separation theorem. Next, these models are used as tools for the individual investor with data on the Colombian stock market of the first half of 2008. Finally, the conclusions are shown. It is important to emphasize that the objective of this paper is not to make predictions upon expected returns, variances and covariances of these returns, nor to suggest an optimal portfolio for an investor with a particular utility function, but to expose a concrete scenario in which Tobin´s theorem leads to a portfolio located outside Markowitz´s efficient set.El artículo muestra una situación especial en donde el portafolio surgido del teorema de la separación de Tobin no se encuentra en la frontera eficiente de Markowitz. El desarrollo del mismo inicia con una revisión del modelo de selección de carteras de Harry Markowitz seguido del teorema de la separación de Tobin. A continuación, se hace uso de los modelos como herramientas para el inversionista individual, con datos sobre el mercado accionario colombiano del primer semestre de 2008. Finalmente se muestran las conclusiones. Es importante enfatizar que el objetivo del artículo no es hacer predicciones sobre los rendimientos esperados, varianzas o covarianzas de los mismos rendimientos, ni sugerir un portafolio óptimo para un inversionista con una función de utilidad particular, sino mostrar un escenario concreto en el que el teorema de la separación de Tobin conlleva a un portafolio ubicado por fuera de la frontera eficiente.

  16. Efectividad de la funcionalidad en las familias con adolescentes de primer semestre Functional family Effectiveness with first semester freshmen adolescents in the family at the Fundación Universitaria San Gil Efetividade da funcionalidade nas famílias com adolescentes de primeiro semestre da Fundação Universitária San Gil

    Directory of Open Access Journals (Sweden)

    RUBIANO MESA YURIAN

    2009-12-01

    Full Text Available En el presente estudio se determina y analiza la efectividad de la funcionalidad en las familias con adolescentes de primer semestre en la Fundación Universitaria de San Gil en el periodo 2008-1, teniendo como base el “Marco teórico de organización sistémica” de la doctora María Luisa Friedemann. Es un estudio descriptivo transversal, cuya muestra estuvo constituida por 150 familias. A los adolescentes se les aplicó la ficha sociodemográfica y la “Escala de evaluación de la funcionalidad familiar” que permite medir los conceptos de la teoría y refleja el funcionamiento familiar. Los datos se procesaron en SPSS versión 10.0 y se analizaron mediante estadísticas descriptivas. Los resultados indican que el 69,3% de los adolescentes es de género femenino, el 88,7% practica la religión católica, y 58,7% están dedicados exclusivamente a estudiar. Las familias se caracterizan porque 55,3% son de tipo nuclear, 63,3% con un promedio de 4 a 6 miembros, en 60,7% el estado civil de los padres de los adolescentes es casados y 38%de las familias recibe ingresos de 2 salarios mínimos mensuales. Las familias presentan baja efectividad de la funcionalidad familiar en el 65,3% de los casos, el 32,7% es de nivel intermedio y 2% tiene alta efectividad. Se concluye que la efectividad de la funcionalidad familiar es baja porque son “familias que luchan por mantener la estabilidad contraria a las normas externas, impidiendo la entrada de nuevo conocimiento interfiriendo con la morfogénesis” (1 del sistema familiar.This study determines and analyzes functional family effectiveness with first semester freshmen adolescents families at the Fundación Universitaria San Gil in the 2008- first semester, based on the systemic organization theoretical framework” of Dr. María Luisa Friedemann. This is a descriptive cross study; the sample comprised 150 families. Adolescents received the social-demographic card and the “Family adaptability and

  17. La resolución de problemas una estrategia didáctica para implementar el modelo pedagógico integrado Universidad Pontificia Bolivariana en la asignatura cálculo diferencial con estudiantes de primer semestre de Ingeniería Civil

    OpenAIRE

    Acevedo, Yoana

    2012-01-01

    En esta comunicación se aborda el diseño, implementación y evaluación de una estrategia didáctica, en la asignatura Cálculo Diferencial con estudiantes de primer semestre de Ingeniería Civil. Se considera la resolución de problemas como una estrategia didáctica con la participación activa de los estudiantes. El problema formulado a los estudiantes se caracteriza por sus múltiples soluciones y proceso a largo plazo. La propuesta tiene como objetivo la aplicación de los conocimientos que deben ...

  18. Universalization in the first course of Medicine studies: Experience during the first semester of 2004- 2005. Universalización en primer año de Medicina: Experiencia durante el primer semestre del curso 2004-2005.

    Directory of Open Access Journals (Sweden)

    Raúl López Fernández

    2005-12-01

    Full Text Available Background: The sliding of the basic cycle of teaching in Medicine speciality to the Health Primary care inserted in the in the university process of the higher medical education es quite brand new , whose development in the practical field was accurately unknown. Objective: to explore the course of the teaching learning process of 1st academic year of the medicine speciality as well as to assess the opinion state of its performers, and to identify achievements and difficultiesduring its development. Methods: a qualitative and transversal section study developed from December 2004 to January 2005 in Cienfuegos province. Its general design is part of a national design and the instruments ans techniques used were previously validated for a previous study developed in Havana city and gathered in a Nationa Workshop. These instruments and techniques are based on surveys to students and professors, direct observation and the achievement of focal groups with the performers of the process. Results: this new model is accepted for students and professors who participate and its advantages and intrinsic values are recognized. Achievements and deficiencies related to didactic, organizative, management of the process and preparation of the institute staff among others are identified. The general development of the process is acceptable and the effort of the professors and the workers is recognized in the implementation of this new model.

    Fundamento: El desplazamiento de la enseñanza del ciclo básico de la carrera de Medicina hacia la Atención Primaria de Salud, insertada en el proceso de universalización de la Educación Médica Superior es un proceso absolutamente novedoso, cuyo desarrollo en la práctica no se conocía con exactitud. Objetivo: Explorar la marcha del proceso docente-educativo de primer año de Medicina, valorar el estado

  19. Non-useful Papanicolaou smears. Analysis of their causes in the first semester 2005 in Cienfuegos city, Cuba Pruebas citológicas no útiles. Análisis de sus causas en el primer semestre de 2005 en Cienfuegos.

    Directory of Open Access Journals (Sweden)

    Miryam Magalys González González del Pino

    Full Text Available Background: Cervicouterine cancer is a common type of cancer in women. It is one of the three main death causes in women after breast and colon cancer. It is the first cause of mortality among malignant neoplasias in the female reproductive apparatus. Objective: to determine the causes of non-useful Papanicolaou smear in Cienfuegos’ province. Method: a retrospective study which had the non-useful Papanicolaou smear of the 1st semester of the year 2005 as samples the following variable were analyzed; age, health area and cause. Results: the main cause was the absence of the endocervical cells in the samples (91,1 %. The most affected health area were Palmira (8,83 %, Health area III (8,08 % and Juraguá (7,14 %. The higher quantity of non-useful Papanicolaou smear was found in the 30-39 year-old group. Conclusions: Although, the majority of health areas have an index below the 5% of non-useful Papanicolaou smear, there are still difficulties to fulfill adequately the program of early detection of Cervicouterine cancer, due to the issues faced when taking the samples.Fundamento: El cáncer cérvico uterino es una clase común de cáncer en la mujer, que se encuentra entre las 3 primeras causas de muerte después del cáncer de mama y del colon y es la primera causa de mortalidad entre las neoplasias malignas del aparato reproductor femenino. Objetivo: Determinar las causas de las citologías no útiles en la provincia de Cienfuegos. Método: Estudio retrospectivo, que tuvo como muestra las pruebas citológicas no útiles del primer semestre de 2005, con respecto a las cuales se analizaron variables como: edad de la mujer, área de salud y causas. Resultados: La causa principal fue la ausencia de células endocervicales en los extendidos (91,1 %; las tres áreas de salud más afectadas fueron

  20. Oferta y demanda de servicios de salud en Manizales. Primer semestre 1995 al primer semestre 1997.

    Directory of Open Access Journals (Sweden)

    Alba Lucía Vélez Arango

    2009-10-01

    Full Text Available Se analizó el comportamiento de los indicadores de cobertura de afiliación al Sistema de Seguridad Social en Salud (SSSS, capacidad instalada de las instituciones del sector en términos de recursos físicos y humano, extensión e intensidad de uso de la consulta externa médica general, consulta odontológica y consulta de urgencia, al igual que la utilización de los servicios hospitalarios en términos de porcentaje ocupacional y productividad, en el período comprendido entre enero, 1995 y diciembre, 1996. En el período de estudio se observó en Manizales un aumento en la afiliación al SSSS en el régimen contributivo, pasando de 262,858 afiliados en 1995 a 311,901 a diciembre de 1996, lo cual representó un aumento de 18% con una cobertura aproximada de 80% del total de la población objetivo. En relación con la cobertura de afiliación en el Régimen Subsidiado a finales de 1996 se informó un total de 37,177 afiliados al SSSS en la ciudad de Manizales, representando una cobertura de 80% de la población identificada mediante el Sistema de Identificación de Población (SISBEN. En lo que tiene que ver con la extensión de uso se observó un aumento en la consulta odontológica, consulta externa médica general y consulta de urgencias durante el período 1995-1997. En relación con la intensidad de uso no se observó una variación significativa en la consulta externa médica general y de urgencias, mientras que la consulta odontológica presentó un ligero aumento en 1997. En cuanto a la utilización de los servicios de hospitalización se observaron diferencias apreciables entre las distintas Empresas Sociales del Estado existentes en la ciudad. Por último, los resultados encontrados en relación con la utilización de los servicios de hospitalización durante el período 1995-1997 tienen gran importancia para el análisis de la oportunidad y calidad de la atención en salud y en la planeación de la infraestructura de servicios, por lo que se hace indispensable la ejecución de estudios a profundidad que elaboren el diagnóstico y sus factores determinantes, para formular políticas alternativas.

  1. Efectividad de la funcionalidad en las familias con adolescentes de primer semestre de la Fundación Universitaria San Gil Efetividade da funcionalidade nas famílias com adolescentes de primeiro semestre da Fundação Universitária San Gil Functional family Effectiveness with first semester freshmen adolescents in the family at the Fundación Universitaria San Gil

    Directory of Open Access Journals (Sweden)

    MARÍA LUCENITH CRIADO MORALES

    Full Text Available En el presente estudio se determina y analiza la efectividad de la funcionalidad en las familias con adolescentes de primer semestre en la Fundación Universitaria de San Gil en el periodo 2008-1, teniendo como base el " Marco teórico de organización sistémica" de la doctora María Luisa Friedemann. Es un estudio descriptivo transversal, cuya muestra estuvo constituida por 150 familias. A los adolescentes se les aplicó la ficha sociodemográfica y la " Escala de evaluación de la funcionalidad familiar" que permite medir los conceptos de la teoría y refleja el funcionamiento familiar. Los datos se procesaron en SPSS versión 10.0 y se analizaron mediante estadísticas descriptivas. Los resultados indican que el 69,3% de los adolescentes es de género femenino, el 88,7% practica la religión católica, y 58,7% están dedicados exclusivamente a estudiar. Las familias se caracterizan porque 55,3% son de tipo nuclear, 63,3% con un promedio de 4 a 6 miembros, en 60,7% el estado civil de los padres de los adolescentes es casados y 38% de las familias recibe ingresos de 2 salarios mínimos mensuales. Las familias presentan baja efectividad de la funcionalidad familiar en el 65,3% de los casos, el 32,7% es de nivel intermedio y 2% tiene alta efectividad. Se concluye que la efectividad de la funcionalidad familiar es baja porque son " familias que luchan por mantener la estabilidad contraria a las normas externas, impidiendo la entrada de nuevo conocimiento interfiriendo con la morfogénesis" (1 del sistema familiar.O presente levantamento determina e analisa a efetividade da funcionalidade nas famílias com adolescentes de primeiro semestre na Fundação Universitária de San Gil durante o período 2008-1, com base no " marco teórico de organização sistêmica" da doutora María Luisa Friedemann. O levantamento consiste numa descrição transversal com uma amostra constituída por 150 famílias. Todos os adolescentes preencheram um formul

  2. Evaluación de una propuesta educativa en prevención de hipertensión arterial y sus factores de riesgo en los estudiantes de primer semestre de la Universidad de Manizales durante el primer periodo académico de 2004

    OpenAIRE

    Acosta, José Luis; Aris, Jorge Andrés; Bonilla, John Edward; Correal, Daniel A.; Escudero, Jairo Alejandro; Hincapié, Germán Alonso; Ibarra, Wilson Hernando; Ocampo, Juliana; Rudas, Edisson; Valencia, John David; Aristizábal, José Fernando; Castaño Castrillón, José Jaime

    2004-01-01

    Objetivo. Evaluar la efectividad de un proceso educativo en factores de riesgo para hipertensión arterial. Materiales y métodos. El proceso educativo en los factores de alcoholismo, diabetes mellitus, dislipidemias, estrés, obesidad, tabaquismo, dieta y sedentarismo, se realizó en 190 es-tudiantes con edades entre 18-25 años, que cursaban los primeros semestres de las facultades de Educación, Ingeniería de sistemas y telecomunicaciones, Psicología y Medicina de la Universi-dad de Manizales. L...

  3. El cambio en el razonamiento bayesiano de estudiantes universitarios durante un semestre académico

    OpenAIRE

    Morgado, Cindy; Yáñez, Gabriel

    2013-01-01

    En este trabajo se presentan los avances de una investigación que estudia el cambio en el razonamiento bayesiano en estudiantes universitarios que toman un primer curso de estadística. Se desarrolla un estudio longitudinal con 102 estudiantes. Se diseñan tres pruebas para evaluar el razonamiento, las cuales se aplican en momentos diferentes durante el semestre. Un análisis descriptivo de los resultados obtenidos muestra que la enseñanza de los conceptos de probabilidad condicional y teorema d...

  4. NIVEL DE COMPRENSIÓN LECTORA EN ESTUDIANTES DE PRIMER SEMESTRE DE COMPUTACIÓN E INFORMÁTICA DE LOS INSTITUTOS SUPERIORES, PÚBLICO “MANUEL NÚÑEZ BUTRÓN” Y PRIVADO “NAZARET” DE JULIACA, PUNO 2014

    OpenAIRE

    CONDORI LUQUE, ROSA YOLANDA

    2016-01-01

    SISTEMA EDUCATIVO PERUANO LA EDUCACIÓN LA EDUCACIÓN SECUNDARIA COMO BASE DE LA EDUCACIÓN SUPERIOR DESCRIPCIÓN DE LA EDUCACIÓN BÁSICA REGULAR PRIMER CICLO DE EDUCACIÓN SUPERIOR COMPRENSIÓN DE LECTURA LA LECTURA Y SU COMPRENSIÓN COMPRENSIÓN LECTORA: SUS MODELOS EXPLICATIVOS VARIABLES QUE INTERVIENEN EN LA COMPRENSIÓN DE TEXTOS LECTURA POR PASOS NIVELES DE COMPRENSIÓN DE LECTURA ESTRATEGIAS PARA LA COMPRENSIÓN DE LECTURA COMPRENSIÓN LECTORA DIFICULTADES DE APRENDIZAJE

  5. Traducción automatizada de programas entre lenguajes de operaciones

    Directory of Open Access Journals (Sweden)

    Diego Ordóñez Camacho

    2012-06-01

    Full Text Available Los lenguajes de operaciones se usan para programar, en procedimientos organizados, las instrucciones a ser ejecutadas por una máquina, para realizar distintos tipos de operaciones. Para poder importar procedimientos existentes realizados en un lenguaje de operaciones dado, en frameworks de programación específicos para el diseño de operaciones, es necesario contar con traductores entre el lenguaje en que ha sido programado el procedimiento, y el lenguaje interno utilizado por el framework de diseño. La construcción de estos traductores puede ser automatizada si se establece un mapeo entre producciones equivalentes de las gramáticas de los lenguajes fuente y destino. Las producciones se pueden considerar equivalentes cuando a pesar de tener una sintaxis diferente, tienen la misma intención semántica y pueden ser equiparadas con un árbol de sintaxis abstracta en común. Debido a ciertas diferencias sintácticas, en ocasiones este árbol sintáctico común no puede ser hallado directamente. Esto se vuelve posible, sin embargo, al realizar en primer lugar ciertas transformaciones a los programas. Este artículo presenta un acercamiento específico a la construcción de reglas de transformación para resolver estas diferencias.Abstract:Operations languages are used to program the procedures that instruct machinery to perform specific operations. To import procedures in a given operations language, into a dedicated tool for designing operations, language translators are needed to translate those procedures to the design tool's internal operations language. The construction of these translators can be automated by mapping equivalent productions in the grammar of source and target language. Productions are considered equivalent when, in spite of a differing syntax, they have the same intended semantics and can be matched to a same abstract syntax tree. For some corresponding productions, due to syntactic differences, such a common abstract

  6. Nutrición y desarrollo psicomotor durante el primer semestre de vida

    OpenAIRE

    CHÁVEZ ADOLFO; MARTÍNEZ HOMERO; GUARNEROS NOÉ; ALLEN LINDSAY; PELTO GRETEL

    1998-01-01

    Objetivo. Estudiar el desarrollo psicomotor de niños pequeños de una comunidad rural pobre y mal alimentada y relacionarlo con la alimentación y nutrición tanto de su madre como de ellos mismos. Material y métodos. Se estudiaron 82 unidades madre-niño, desde antes del quinto mes de embarazo hasta los seis meses de edad del niño, en antropometría y dieta; en el niño se aplicaron pruebas de Brazelton al nacer, de Bayley a los tres y seis meses de edad y de interacción con su madre. Resultados. ...

  7. Nutrición y desarrollo psicomotor durante el primer semestre de vida

    Directory of Open Access Journals (Sweden)

    CHÁVEZ ADOLFO

    1998-01-01

    Full Text Available Objetivo. Estudiar el desarrollo psicomotor de niños pequeños de una comunidad rural pobre y mal alimentada y relacionarlo con la alimentación y nutrición tanto de su madre como de ellos mismos. Material y métodos. Se estudiaron 82 unidades madre-niño, desde antes del quinto mes de embarazo hasta los seis meses de edad del niño, en antropometría y dieta; en el niño se aplicaron pruebas de Brazelton al nacer, de Bayley a los tres y seis meses de edad y de interacción con su madre. Resultados. Varias de las pruebas psicomotoras del niño se correlacionaron positivamente con el peso de la madre y sus pliegues cutáneos, lo mismo que con su propio peso y talla previos. También con el consumo materno de productos animales y frutas durante el embarazo y negativamente con el consumo de tortillas y frijoles. Las correlaciones de varias de las pruebas del niño a los seis meses fueron positivas con su consumo complementario, de energía total y de varios alimentos, sobre todo de huevo, leche y frutas alrededor de los tres meses de edad. Conclusiones. Es importante que dentro del estrato social rural pobre estudiado, pequeñas variaciones de consumo de alimentos y nutrición de la unidad materno-infantil den lugar a cambios en las diversas pruebas de desarrollo psicomotor del niño pequeño, lo que sugiere la necesidad de impulsar más los programas de nutrición aplicados.

  8. Calidad de vida en pacientes con hemodiálisis, diálisis peritoneal continua ambulatoria y automatizada

    OpenAIRE

    S. Caballero-Morales; J. U. Trujillo-García; U. Welsh-Orozco; S. T. Hernández-Cruz; J. Martínez-Torres

    2006-01-01

    Objetivo: Comparar calidad de vida en pacientes manejados con hemodiálisis versus diálisis peritoneal continua ambulatoria y diálisis peritoneal automatizada. Material y Métodos: Estudio transversal, comparativo, de mayo a octubre 2003, al total de los pacientes con enfermedad renal crónica terminal en tratamiento sustitutivo (101) manejados con hemodiálisis, diálisis peritoneal continua ambulatoria y diálisis peritoneal automatizada. Se les aplicaron dos instrumentos uno que mide variables s...

  9. Perimetria automatizada em pacientes com glaucoma congênito primário

    OpenAIRE

    Lopes Filho,José Garone Gonçalves; Betinjane,Alberto Jorge; Carvalho,Celso Antônio de

    2007-01-01

    OBJETIVO: Identificar e caracterizar os defeitos nos exames de perimetria automatizada encontrados nos pacientes com diagnóstico de glaucoma congênito primário. MÉTODOS: Foram avaliados retrospectivamente os campos visuais automatizados de 81 olhos (48 pacientes), sendo 15 olhos sem glaucoma (grupo N) e 66 olhos com glaucoma (grupo G). Os olhos com glaucoma foram divididos em olhos com alterações campimétricas incipientes, caracterizadas pelo MD> -6 dB (grupo G I= 41 olhos) e olhos com altera...

  10. Efetividade da funcionalidade nas famílias com adolescentes de primeiro semestre da fundação universitária san gil

    OpenAIRE

    CRIADO MORALES, MARÍA LUCENITH; RUBIANO MESA, YURIAN

    2010-01-01

    En el presente estudio se determina y analiza la efectividad de la funcionalidad en las familias con adolescentes de primer semestre en la Fundación Universitaria de San Gil en el periodo 2008-1, teniendo como base el “Marco teórico de organización sistémica” de la doctora María Luisa Friedemann. Es un estudio descriptivo transversal, cuya muestra estuvo constituida por 150 familias. A los adolescentes se les aplicó la ficha sociodemográfica y la “Escala de evaluación de la funcionalidad fami...

  11. MAPS-15504 - Uma metodologia automatizada para avaliação de processo de software

    Directory of Open Access Journals (Sweden)

    Itana Maria de Souza Gimenes

    2000-05-01

    Full Text Available Devido às crescentes exigências por qualidade, a comunidade de engenharia de software tem produzido diversas normas e apresentado diversas abordagens sobre a qualidade dos produtos e processos de software. Grande parte dessas normas são aplicadas ao processo de software, dentre os quais se destacam pela larga utilização a ISO 9000-3, a ISO 12207, o CMM e o ISO/IEC TR 15504 (resultado dos trabalhos do projeto SPICE. Outro resultado das pesquisas da comunidade de engenharia de software são os ambientes de engenharia de software centrados em processo (PSEE, os quais visam à automação do processo de software. Este artigo apresenta MAPS-15504, uma metodologia automatizada para avaliação da qualidade do processo de software baseada no ISO/IEC TR 15504. A metodologia de avaliação de processo de software foi aplicada a um estudo de caso e implementada no ambiente do ExPSEE, um ambiente experimental desenvolvido no Departamento de Informática (DIN da Universidade Estadual de Maringá (UEM

  12. Arquitectura extensible para la protección automatizada de software: Un caso de estudio

    Directory of Open Access Journals (Sweden)

    Yulier Nuñez Musa

    2015-01-01

    Full Text Available En la actualidad el software comercial es susceptible a la modificación y la observación de su código interno mediante ataques de ingeniería inversa. Estos ataques permiten la piratería del software, siendo billonarias las pérdidas ocasionadas a la industria de software por este concepto. Este trabajo se centra en el desarrollo de una arquitectura extensible para insertar de forma automatizada durante el proceso de compilación, mecanismos de protección en un software dado. La protección se realiza de forma transparente al desarrollador y además, permite diseñar e implementar de forma flexible y modular las diferentes técnicas de protección identificadas. Se implementó la técnica de ofuscación como caso de estudio para validar la arquitectura propuesta. Esta técnica fue probada sobre distintos algoritmos de pruebas, mostrándose los resultados obtenidos.

  13. RATMAC PRIMER

    Energy Technology Data Exchange (ETDEWEB)

    Munn, R. J.; Stewart, J. M.; Norden, A. P.; Pagoaga, M. Katherine

    1980-10-01

    The language RATMAC is a direct descendant of one of the most successful structured FORTRAN languages, rational FORTRAN, RATFOR. RATMAC has all of the characteristics of RATFOR, but is augmented by a powerful recursive macro processor which is extremely useful in generating transportable FORTRAN programs. A macro is a collection of programming steps which are associated with a keyword. This keyword uniquely identifies the macro, and whenever it appears in a RATMAC program it is replaced by the collection of steps. This primer covers the language's control and decision structures, macros, file inclusion, symbolic constants, and error messages.

  14. Selección automatizada de electrodos para la soldadura manual de los aceros al carbono

    Directory of Open Access Journals (Sweden)

    Alexander Velázquez Font

    2008-01-01

    Full Text Available Se aborda lo relativo a un sistema para la selección automatizada de electrodos en la soldadura de los aceros al carbono. Se inicia con una breve revisión de los problemas que presentan estos en su soldabilidad y los factores concernientes a la selección correcta del electrodo en los mismos. En el mismo se expone el fundamento teórico sobre el diseño del sistema el cual da solución a lo anteriormente expuesto. En la elaboración del software se tiene en cuenta los siguientes principios: propiedades mecánicas de la unión soldada, tipo de revestimiento, posición de la soldadura, etc. Se tienen en cuenta en el trabajo diferentes firmas y normas de fabricantes de electrodos y países que mas se utilizan en la industria mecánica en Cuba. El software tiene la ventaja de ser sencillo, rápido y seguro, garantizando la selección correcta de los electrodos para cada caso y situación. El software supone que el usuario no tenga que tener conocimientos profundos de soldadura, debido a que el sistema se encarga de la mayor parte de las decisiones para la selección del electrodo, procedimiento que con métodos convencionales, exigen del usuario una determinada experiencia en la selección de estos materiales para la soldadura de los aceros al carbono.

  15. CONSUMO DE DROGAS LICITAS E ILÍCITAS EN LOS ESTUDIANTES DE 1ero y 2do SEMESTRE DE LA FACULTAD DE ODONTOLOGÍA DE LA UNIVERSIDAD DE LAS AMERICAS

    OpenAIRE

    Vinueza-Jara, Janneth del Rocío

    2015-01-01

    Propósito y método de estudio: el objetivo de este estudio es determinar el consumo de drogas lícitas e ilícitas en los estudiantes del primer y segundo semestre de la Universidad de Las Américas, de la ciudad de Quito, provincia de Pichincha, de septiembre a febrero del 2015, además de identificar el número de estudiantes que consumen algún tipo de droga por edad y sexo, determinar las principales drogas que consumen los estudiantes de la Universidad y su frecuencia, relacionar el consumo de...

  16. PERFIL PSICOLÓGICO, COGNITIVO Y ESPIRITUAL DE ESTUDIANTES UNIVERSITARIOS DE PSICOLOGÍA DE PRIMER INGRESO

    Directory of Open Access Journals (Sweden)

    María Esther Flores Sosa

    2014-01-01

    Full Text Available Se analizaron los perfiles de personalidad, los esquemas tempranos maladaptativos predominantes , los estilos de aprendizaje y los mecanismos de afrontamiento religioso de estudiantes universitarios de primer semestre de psicología. Con dicha información se pretende ampliar la visión sobre sus necesidades y recursos con el propósito de aportar información relevante para el diseño curricular.

  17. Organizações automatizadas - desenvolvimento e estrutura da empresa moderna. Nélio Oliveira. Rio de Janeiro: Editora LTC, 2007. 228p. ISBN: 8521614985.

    Directory of Open Access Journals (Sweden)

    Mauro de Paula Freitas Filho

    2007-06-01

    Full Text Available A Editora LTC lançou, em 2007, o livro de Nélio Oliveira, Organizações automatizadas: desenvolvimento e estrutura da empresa moderna. Mestre em Administração pela Universidade Federal de Minas Gerais, atuou durante anos em diversas organizações públicas, privadas e de economia mista. Nélio Oliveira, no momento atual, é conceituado professor dos cursos de Administração e Sistemas de Informações na Pontifícia Universidade Católica de Minas Gerais. No meio de muitas literaturas disponíveis, a obra destaca-se pela simplicidade, pela objetividade e pelo cuidado com os quais ele trata uma nova configuração, as organizações automatizadas. Em linhas gerais, o autor concentra-se em um trabalho descritivo e procura caracterizar um novo formato organizacional, o qual surge em muitas empresas, em substituição às formas anteriores, vinculadas a modelos mecanizados ou mecanísticos. A obra tem como foco o modelo de cinco estruturas de Henry Mintzberg, base para todo o trabalho. O autor tem como propósito retratar uma realidade, na qual se observam as mudanças do mundo organizacional contemporâneo, o qual está cada vez mais adquirindo espaço no mundo empresarial.

  18. China Energy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  19. An SAT® Validity Primer

    Science.gov (United States)

    Shaw, Emily J.

    2015-01-01

    This primer should provide the reader with a deeper understanding of the concept of test validity and will present the recent available validity evidence on the relationship between SAT® scores and important college outcomes. In addition, the content examined on the SAT will be discussed as well as the fundamental attention paid to the fairness of…

  20. Nutrición y desarrollo psicomotor durante el primer semestre de vida Nutrition and psichomotor development during the first six months of life

    OpenAIRE

    ADOLFO CHÁVEZ; HOMERO MARTÍNEZ; NOÉ GUARNEROS; LINDSAY ALLEN; GRETEL PELTO

    1998-01-01

    Objetivo. Estudiar el desarrollo psicomotor de niños pequeños de una comunidad rural pobre y mal alimentada y relacionarlo con la alimentación y nutrición tanto de su madre como de ellos mismos. Material y métodos. Se estudiaron 82 unidades madre-niño, desde antes del quinto mes de embarazo hasta los seis meses de edad del niño, en antropometría y dieta; en el niño se aplicaron pruebas de Brazelton al nacer, de Bayley a los tres y seis meses de edad y de interacción con su madre. Resultados. ...

  1. Diferencias de las prácticas sexuales entre hombres y mujeres, en estudiantes universitarios durante el primer semestre de 2013

    Directory of Open Access Journals (Sweden)

    Javier Martínez Torres

    2014-03-01

    Full Text Available Title: Sexual practices’s differences between men and women in college students during the first half of 2013El conocimiento de las prácticas sexuales en los adultos jóvenes es necesario para ejecutar acciones preventivas enfocadas a la disminución de enfermedades de transmisión sexual y embarazos no deseados. Materiales y métodos: Se realizó un estudio descriptivo trasversal con análisis de casos y controles, en estudiantes universitarios entre 18 y 26 años de edad, el tamaño de la muestra fue de 589 participantes. Resultados: De los 589 estudiantes se analizaron 502; la edad promedio de inicio de relaciones sexuales se dio a los 16,26 años. El 50,4% eran hombres; la práctica de relaciones sexuales anales fue de 37,9%, mientras que la práctica de relaciones sexuales orales fue del 70,9%. Al realizar asociaciones entre el género y comportamientos sexuales, se encontró que la práctica de sexo oral para los hombres es de O.R. 1,62 (I.C.95% 1,09 – 2,39, similar al sexo anal donde se estimó un O.R. 1,69 (I.C.95% 1,17 – 2,44. Al ajustarse se mostró que no hay diferencias estadísticamente significativas por género para sexo oral O.R.A 1,13 (I.C.95% 0,72 – 1,78 y para sexo anal O.R.A 1,30 (I.C.95% 0,84 – 6,39. Conclusiones: No hay diferencias estadísticamente significativas para las prácticas sexuales entre los dos géneros. (DUAZARY 2013 No. 2, 112 - 118AbstractThe knowledge of sexual practices in young adults is required to run preventive actions aimed at the reduction of transmitted sexual diseases and unwanted pregnancies. Materials and Methods: A descriptive cross-sectional study with case-control analysis was developed by selecting 589 college students between 18 and 26 years of age. Results: 502 of 589 students were analyzed; the average age of their first sexual intercourse occurred at 16.26 years. 50.4% of the sample was men; the practice of anal intercourse was 37.9%, while the practice of oral sex was 70.9%. After making associations in relation to gender and sexual practices, it was found that the practice of oral sex for men has an OR 1.62 (C.I. 95% 1.09 to 2.39, similar to anal sex where we found an OR 1.69 (C.I. 95% 1.17 to 2.44. When adjusted, the outcome was that there were no statistically significant differences by gender for oral sex ORA 1.13 (C.I.95% 0.72 to 1.78 and for anal sex ORA 1.30 (C.I. 95% 0.84 to 6.39. Conclusions: No statistically significant differences were found within sexual practices between the two genders.Keyword: sexual practices; young adult; health behavior.

  2. Causas de embarazos no deseados en las gestantes en el municipio de Cajamarca (Tolima) durante el año 2010 y primer semestre del 2011

    OpenAIRE

    2011-01-01

    Tesis (Especialista en Administración en Salud). Universidad Católica de Manizales, Facultad de Salud, 2011 La gestación es una etapa trascendental en la vida de una mujer que implica cambios físicos, hormonales y emocionales. Para asumir esta etapa adecuadamente la mujer debe en lo posible poseer ciertas características que hagan de esta una etapa de plenitud y tranquilidad, dichas características son la edad, la madurez emocional y física y un entorno económico y familiar definidos, entr...

  3. Nutrición y desarrollo psicomotor durante el primer semestre de vida Nutrition and psichomotor development during the first six months of life

    Directory of Open Access Journals (Sweden)

    ADOLFO CHÁVEZ

    1998-03-01

    Full Text Available Objetivo. Estudiar el desarrollo psicomotor de niños pequeños de una comunidad rural pobre y mal alimentada y relacionarlo con la alimentación y nutrición tanto de su madre como de ellos mismos. Material y métodos. Se estudiaron 82 unidades madre-niño, desde antes del quinto mes de embarazo hasta los seis meses de edad del niño, en antropometría y dieta; en el niño se aplicaron pruebas de Brazelton al nacer, de Bayley a los tres y seis meses de edad y de interacción con su madre. Resultados. Varias de las pruebas psicomotoras del niño se correlacionaron positivamente con el peso de la madre y sus pliegues cutáneos, lo mismo que con su propio peso y talla previos. También con el consumo materno de productos animales y frutas durante el embarazo y negativamente con el consumo de tortillas y frijoles. Las correlaciones de varias de las pruebas del niño a los seis meses fueron positivas con su consumo complementario, de energía total y de varios alimentos, sobre todo de huevo, leche y frutas alrededor de los tres meses de edad. Conclusiones. Es importante que dentro del estrato social rural pobre estudiado, pequeñas variaciones de consumo de alimentos y nutrición de la unidad materno-infantil den lugar a cambios en las diversas pruebas de desarrollo psicomotor del niño pequeño, lo que sugiere la necesidad de impulsar más los programas de nutrición aplicados.Objective. To study the psychomotor development of young infants from a poor and underfed rural community and to correlate this with the nutritional conditions of the mother during pregnancy and the child itself. Material and methods. We studied 82 mother-child pairs from the 5th month of pregnancy to the 6th month of life of the child as to anthropometry and food consumption. The neonatal Brazelton test and the Bayley test at 3 and 6 months were applied to the child. Results. Several of the neonatal psychomotor tests applied to the child correlate positively with the mother´s weight and skin folds, as well as with the child´s own previous weight and size. This was also true for maternal consumption of animal foods and fruits during pregnancy. A negative correlation was observed with the consumption of corn tortillas and beans. The correlation of several tests applied to the child at six months was positive with its complementary consumption, total energy and several foods, specially egg, milk and fruit around three months of age. Conclusions. Small variations in nutrition of the mother-child pairs from the poor rural community studied had consequences on the psychomotor development of the infant. These findings point to the need for more applied nutrition programs.

  4. Coal Bed Methane Primer

    Energy Technology Data Exchange (ETDEWEB)

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  5. Primer on molecular genetics

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  6. Detección Automatizada de Cáncer de Mama Basada en Espectroscopía Raman y el Clasificador de Mahalanobis

    Directory of Open Access Journals (Sweden)

    Francisco Javier Luna Rosas

    2015-01-01

    Full Text Available 19 Conciencia Tecnológica No. 49, Enero-Junio 2015 Dr. Francisco Javier Luna Rosas 1 , Dr. Julio Cesar Martínez Rom o 1 , Dr. Carlos Alejandro de Luna Ortega 2 , MC. Gricelda Medina Veloz 3 , MC. Valentín López Rivas 1 , 1 Instituto Tecnológico de Aguascalientes, Departamento de Sistemas y Computación Avenida Adolfo López Mateos 1801 Oriente, C.P. 20256, Fraccionamiento Bona Gens, Aguascalientes, Ags., México. Tel (01-449 9105002, Ext. 152, E-mail: fcoluna2000@yahoo.cpm.mx 2 Universidad Politécnica de Aguascalientes, Departamento de Ingeniería Mecatrónica Calle Paseo San Gerardo No. 207, C.P. 20342, Fraccionamiento San Gerardo, Aguascalientes, Ags., México. Tel. (01-449442-1400 3 Universidad Tecnológica del Norte de Aguascalientes, Departamento de Tecnologías de Información Av. Universidad 1001, C.P. 20400, Estación Rincón, Rincón de Romos, Aguascalientes, México. Tel. (01-465965-0030 Detección Automatizada de Cáncer de Mama Basada en Espectroscopía Raman y el Clasificador de Mahalanobis Automatic Detection of Breast Cancer Based on Raman Spectroscopy and the Mahalanobis C lassifier Resumen En este artículo presentamos un método para la detección automatizada de cáncer de mama, en el cual una señal Raman es clasificada viniendo de una biopsia de tejido sano (clase 1 o una biopsia de tejido dañado (clase 2 ; para este fin, creamos patrones de las clases 1 y 2 que representan picos Raman (marcadores de tejido sano y enfermo. Para llevar a cabo la detección aplicamos un clasificador de distancia mínima con métrica de Mahalanobis y a partir de este método se obtuvieron altas tasas de detección, corroborado al comparar los resultados del clasificador contra las clasificaciones previas del tejido realizadas por un patólogo experto. Esto provee a los especialistas con herramientas clínicas importantes para una rápida y eficiente detección automatizada de cáncer de mama. Consideramos que nuestro enfoque puede ser

  7. The R primer

    CERN Document Server

    Ekstrom, Claus Thorn

    2011-01-01

    Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

  8. Math primer for engineers

    CERN Document Server

    Cryer, CW

    2014-01-01

    Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

  9. El primer virreinato americano

    Directory of Open Access Journals (Sweden)

    Cassá, Roberto

    2006-12-01

    Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

    El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

  10. Una experiencia con QSB+ en Matemáticas de primer curso

    Directory of Open Access Journals (Sweden)

    Ordás Amo, Pilar

    2001-01-01

    Full Text Available Nuestro objetivo con este trabajo es presentar una experiencia que hemos llevado a cabo con los alumnos de primer curso, en la asignatura de Matemáticas, de las Licenciaturas en Ciencias Económicas y Administración y Dirección de Empresas, durante los cursos 1999/2000 y 2000/2001. El propósito de la experiencia es que los alumnos de primer curso vean una parte de la optimización matemática, como es la programación lineal, y el método del Símplex, a través de un software informático sencillo como es el QSB+, en el aula de ordenadores. Para llevar a cabo la experiencia, se añadió una hora lectiva al horario de los alumnos implicados y de los profesores de Matemáticas de primer curso, con plan nuevo (plan 99, durante el segundo semestre, de forma totalmente voluntaria para los alumnos, aunque la materia explicada en estas clases “extras” formaba parte del examen final de la asignatura. El nombre oficial de la experiencia fue Seminario de Programación Lineal, y tuvo una duración aproximada de quince horas lectivas.

  11. Una herramienta para la selección automatizada de aceros en el contexto de la Ingeniería Mecánica

    Directory of Open Access Journals (Sweden)

    L. Dumitrescu

    2010-01-01

    Full Text Available El diseño de Ingeniería de un producto o componente constituye una actividad difícil, compleja y multidisciplinaria, enfocada a la resolución de problemas. En el presente trabajo se muestra el desarrollo de una herramienta automatizada para la selección de los aceros más utilizados en la construcción de maquinarias. La herramienta constituye una ayuda para la selección de los materiales desde la etapa conceptual del proceso de diseño, donde se identifican las diferentes categorías de materiales a utilizar. La herramienta comprende las características y propiedades más relevantes de los aceros de Ingeniería disponibles en seis normas internacionales: Japonesa (JIS, Alemana (DIN, Vbn, DIN-Vbn, Rusa (GOST, Americana (AISI, SAE, AISI-SAE, ASTM, Inglesa (BS, EN, GB, Francesa (AFNOR y la Norma Cubana (NC vigente.The product or component design constitutes a difficult, complex and multidisciplinary activity, focused to the resolution of problems. Presently work show the development of an automated tool for the selection of the more used steels in the construction of machineries. The tool constitute a help for the selection of the materials from the conceptual stage of the design process, where the different categories of materials are identified to use. The tool analyze the characteristics and more common properties of the available steels in six international standards: JIS (Japan, DIN, Vbn, DIN-Vbn (Germany, GOST (Russia, AISI, SAE, AISI-SAE, ASTM (USA, BS, IN, GB (England, AFNOR (France and NC (Cuba.

  12. Qualidade de Vida: comparação entre diálise peritoneal automatizada e hemodiálise Calidad de vida: comparación entre diálisis peritoneal automatizada y hemodiálisis Quality of Life: comparison between patients on automated peritoneal dialysis and patients on hemodialysis

    Directory of Open Access Journals (Sweden)

    Valquiria Greco Arenas

    2009-01-01

    Full Text Available OBJETIVO: Avaliar a Qualidade de Vida relacionada à saúde em pacientes submetidos à Diálise Peritoneal Automatizada (DPA e Hemodiálise em um centro de diálise satélite no Município de São Paulo. MÉTODOS: Este estudo observacional transversal, incluiu 101 pacientes com idade entre 18-75 anos, em terapia há mais de 90 dias e que compreenderam o questionário. RESULTADOS: O grupo em Hemodiálise (n=79 estava em terapia há mais tempo (p=0.001 e tinha albumina sérica maior (pOBJETIVO: Evaluar la Calidad de Vida relacionada a la salud de pacientes sometidos a Diálisis Peritoneal Automatizada (DPA y Hemodiálisis en un centro de diálisis del Municipio de Sao Paulo. MÉTODOS: Este estudio observacional transversal, incluyó a 101 pacientes con edades comprendidas entre los 18 y 75 años, que se encontraban en terapia hace más de 90 días y que comprendieran el cuestionario. RESULTADOS: El grupo en Hemodiálisis (n=79 estaba en terapia hace más de un tiempo (p=0.001 y tenía albúmina sérica mayor (pOBJECTIVE: To evaluate the health-related quality of life in patients from a satellite dialysis center in São Paulo city undergoing Automated Peritoneal Dialysis (APD or Hemodialysis. METHODS: This cross-sectional descriptive study included 101 patients with ages ranging from 18 to 75 years-old, who were in dialysis treatment over 90 days and able to understand the items of the SF-36 questionnaire in Portuguese. RESULTS: The Hemodialysis group (n=79 had been in dialysis treatment longer (p=0.001 and had higher serum albumin level (p<0.001 than the APD group (n=22. The SF-36 scores of the two groups were similar in all dimensions, except for the physical functioning dimension, on which the hemodialysis group had higher scores than the APD group (p=0.03. There were no statistically significant interactions between the SF-36 score and the other variables of the study. CONCLUSION: There were no differences in quality of life between patients on

  13. Una herramienta para la selección automatizada de aceros en el contexto // A tool for the automated selection of steels in the Mechanical Engineering´s context

    Directory of Open Access Journals (Sweden)

    L. Dumitrescu

    2010-01-01

    Full Text Available ResumenEl diseno de Ingenieria de un producto o componente constituye una actividad dificil, compleja ymultidisciplinaria, enfocada a la resolucion de problemas. En el presente trabajo se muestra eldesarrollo de una herramienta automatizada para la seleccion de los aceros mas utilizados en laconstruccion de maquinarias. La herramienta constituye una ayuda para la seleccion de losmateriales desde la etapa conceptual del proceso de diseno, donde se identifican las diferentescategorias de materiales a utilizar. La herramienta comprende las caracteristicas y propiedades masrelevantes de los aceros de Ingenieria disponibles en seis normas internacionales: Japonesa (JIS,Alemana (DIN, Vbn, DIN-Vbn, Rusa (GOST, Americana (AISI, SAE, AISI-SAE, ASTM, Inglesa (BS, EN,GB, Francesa (AFNOR y la Norma Cubana (NC vigente.Palabras claves: materiales, automatizada, aceros, ingenieria.____________________________________________________________AbstractThe product or component design constitutes a difficult, complex and multidisciplinary activity,focused to the resolution of problems. Presently work show the development of an automated toolfor the selection of the more used steels in the construction of machineries. The tool constitute ahelp for the selection of the materials from the conceptual stage of the design process, where thedifferent categories of materials are identified to use. The tool analyze the characteristics and morecommon properties of the available steels in six international standards: JIS (Japan, DIN, Vbn, DINVbn(Germany, GOST (Russia, AISI, SAE, AISI-SAE, ASTM (USA, BS, IN, GB (England, AFNOR(France and NC (Cuba.Key words: materials, automated, steels, engineering.

  14. Vygotsky on Education Primer. Peter Lang Primer. Volume 30

    Science.gov (United States)

    Lake, Robert

    2012-01-01

    The "Vygotsky on Education Primer" serves as an introduction to the life and work of the Russian psychologist Lev Vygotsky. Even though he died almost eighty years ago, his life's work remains both relevant and significant to the field of education today. This book examines Vygotsky's emphasis on the role of cultural and historical context in…

  15. INFERENCIAS Y PRÁCTICAS GRAVITACIONALES EN EL NIÑO EN EL SEGUNDO SEMESTRE DE VIDA

    Directory of Open Access Journals (Sweden)

    Rebeca Puche Navarro

    2001-01-01

    Full Text Available Este artículo analiza los procesos inferenciales en el niño antes de cumplir su primer año de vida. Para el estudio se utilizan las propiedades gravitacionales dentro de situaciones de resolución de problemas. El propósito de la autora es aportar evidencia empírica sustentada para discutir algunos aspectos sobre las concepciones del desarrollo en el niño.

  16. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  17. Freshwater Wetlands: A Citizen's Primer.

    Science.gov (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of wetland…

  18. A Hearing Aid Primer 1

    Science.gov (United States)

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  19. Alternative Teacher Compensation: A Primer

    Science.gov (United States)

    Koppich, Julia E.; Rigby, Jessica

    2009-01-01

    This policy primer is designed to provide base-line information about new forms of teacher pay that are emerging around the country, to support the local conversations and negotiations that will lead to the development of innovative compensation systems. It identifies reasons why teacher compensation is high on local, state, and federal policy…

  20. Freshwater Wetlands: A Citizen's Primer.

    Science.gov (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

  1. El primer congreso constituyente mexicano

    OpenAIRE

    José Luis Soberanes Fernández

    2012-01-01

    En el presente trabajo se describe uno de los momentos más difíciles de la historia constitucional de México, por no decir el más difícil, que va desde la Consumación de la Independencia Nacional del 27 de septiembre de 1821 al 30 de noviembre de 1823 en que clausuró sus sesiones el Primer Congreso Constituyente. Fue cuando se erigió el Imperio de Iturbide y su ocaso, en consecuencia triunfó la república y se planteó seriamente el federalismo. Se eligió ese primer constituyente, se clausuró, ...

  2. Environmental Acceptable Medium Caliber Ammunition Percussion Primers

    Science.gov (United States)

    2008-05-01

    percussion primers typically consist of lead styphnate and antimony sulfide. Although highly effective, these heavy material compounds were identified under...Percussion primers, including those used in medium caliber ammunition, typically contain lead styphnate and antimony sulfide along with other constituents...Furthermore, current percussion primer compositions also contain barium nitrate. Although not negatively categorized by the Environmental Protection

  3. A primer of multivariate statistics

    CERN Document Server

    Harris, Richard J

    2014-01-01

    Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

  4. A primer of special relativity

    CERN Document Server

    Sardesai, PL

    2004-01-01

    A Primer of Special Relativity1 is an unusually lucid introduction to the subject specifically written for Indian students. It is intended to give the beginner a firm grounding for a more advanced course in relativity. An entire chapter is devoted to applications of the theory to elucidate a large number of topics the students (B.Sc. Physics) come across in Modern Physics. Detailed and well-selected examples are used to illuminate aspects of the theory as well as to show techniques of application. A large number of Illustrative Examples enables the students to gain confidence to solve any problem in relativity normally expected of B.Sc. students.

  5. Loop quantum geometry: a primer

    Energy Technology Data Exchange (ETDEWEB)

    Corichi, Alejandro [Instituto de Ciencias Nucleares, Universidad Nacional Autonoma de Mexico, A. Postal 70-543, Mexico D.F. 04510 (Mexico)

    2005-01-15

    This is the written version of a lecture given at the 'VI Mexican School of Gravitation and Mathematical Physics' (Nov 21-27, 2004, Playa del Carmen, Mexico), introducing the basics of Loop Quantum Geometry. The purpose of the written contribution is to provide a Primer version, that is, a first entry into Loop Quantum Gravity and to present at the same time a friendly guide to the existing pedagogical literature on the subject. This account is geared towards graduate students and non-experts interested in learning the basics of the subject.

  6. A primer of Lebesgue integration

    CERN Document Server

    Bear, H S

    2001-01-01

    The Lebesgue integral is now standard for both applications and advanced mathematics. This books starts with a review of the familiar calculus integral and then constructs the Lebesgue integral from the ground up using the same ideas. A Primer of Lebesgue Integration has been used successfully both in the classroom and for individual study.Bear presents a clear and simple introduction for those intent on further study in higher mathematics. Additionally, this book serves as a refresher providing new insight for those in the field. The author writes with an engaging, commonsense style that appeals to readers at all levels.

  7. Conocimientos, actitudes y prácticas en salud sexual entre estudiantes de los primeros semestres de enfermería

    Directory of Open Access Journals (Sweden)

    Mirith Vásquez Munive

    2013-10-01

    Full Text Available ResumenLa forma de ejercer la sexualidad tiene grandes repercusiones en la vida personal, gran peso en la aceptación social y es determinante en la imagen que proyecta la persona. Considerando que el ejercicio de la sexualidad puede llevar a un embarazo indeseado, que cada vez en esta sociedad es más temprana la edad de inicio de las relaciones sexuales, que la educación sexual en la primaria y bachillerato no ha generado el fruto deseado, y que frecuentemente las estudiantes universitarias se embarazan cuando no lo planearon, se hace necesario evaluar cuáles son las circunstancias que rodean esta situación. Se realizó un estudio descriptivo de corte transversal, entre 67 estudiantes de los primeros cinco semestres de enfermería, porque aún no han cursado la materia que dentro del currículo aborda la sexualidad. Para recoger la información se llevó a cabo una encuesta que abarca los aspectos más relevantes en cuanto a conocimientos, las actitudes con las que enfrentan la sexualidad y la forma cómo la ejercen. Entre las encuestadas predominan los buenos conocimientos sin grandes diferencias de un semestre a otro, la actitud hacia el sexo es mayoritariamente mala en todos los semestres y las prácticas están viciadas por hábitos poco saludables. (DUAZARY 2010, 211 - 218 AbstractThe form of exercise of sexuality has a great impact on the personal life, strong in the social acceptance and is crucial in the image projected by the person Whereas the exercise of sexuality can lead to an unwanted pregnancy, each time in this society is the earlier age of onset of sexual relations, that sex education in primary and secondary school has not produced the desired result and university students often do not become pregnant as planned, it is necessary to evaluate what are the circumstances surrounding this situation. It was a descriptive cross-sectional study among 67 students from the first five semesters of nursing, because they have not yet

  8. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    Directory of Open Access Journals (Sweden)

    Nomin Batnyam

    2012-01-01

    Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

  9. Single-primer fluorescent sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Ruth, J.L.; Morgan, C.A.; Middendorf, L.R.; Grone, D.L.; Brumbaugh, J.A.

    1987-05-01

    Modified linker arm oligonucleotides complementary to standard M13 priming sites were synthesized, labelled with either one, two, or three fluoresceins, and purified by reverse-phase HPLC. When used as primers in standard dideoxy M13 sequencing with /sup 32/P-dNTPs, normal autoradiographic patterns were obtained. To eliminate the radioactivity, direct on-line fluorescence detection was achieved by the use of a scanning 10 mW Argon laser emitting 488 nm light. Fluorescent bands were detected directly in standard 0.2 or 0.35 mm thick polyacrylamide gels at a distance of 24 cm from the loading wells by a photomultiplier tube filtered at 520 nm. Horizontal and temporal location of each band was displayed by computer as a band in real time, providing visual appearance similar to normal 4-lane autoradiograms. Using a single primer labelled with two fluoresceins, sequences of between 500 and 600 bases have been read in a single loading with better than 98% accuracy; up to 400 bases can be read reproducibly with no errors. More than 50 sequences have been determined by this method. This approach requires only 1-2 ug of cloned template, and produces continuous sequence data at about one band per minute.

  10. INTELIGENCIAS MÚLTIPLES Y ESTILOS DE APRENDIzAJE EN LOS ESTUDIANTES DE PRIMER SEMESTRE DE CONTADURÍA PÚBLICA DE LA UNIVERSIDAD DE LA SALLE -- MULTIPLE INTELIGENCES AND LEARNING STYLES AMONG FIRST SEMESTRE STUDENTS IN PUBLIC ACCOUNTING OF THE UNIVERSITY DE LA SALLE

    Directory of Open Access Journals (Sweden)

    ÉRIKA BUCHELLI AGUIRRE

    2008-06-01

    Full Text Available This article is a result of a research Project in order to get to know the sorts of intelligence and predominant methods of learning among students in Public Accounting of the university de la Salle. A sample of 100 first semester students has been used for a test of 40 items, developed by Argüelles Pabón y Nagles García who evaluates the sorts of predominant intelligences in a subject according to the theory of Gardner. In order to get closer to the types of learning, a test of 14 items was used as well built for the research from the theory of Kolb. The application of collection above mentioned techniques and their analysis is carrying out during the two academic semesters in 2008. The results indicate the presence of multiple intelligences among women and men of evening classes, especially two: interpersonal and emotional. On the one hand, the way of learning is convergent, even though with higher present of men on both classes. The possibilities to realize a second phase of the research focuses on implementing pedagogic strategies and specific didactic for these groups of students, agreeing with the type of learning and intelligence of them.

  11. A primer on quantum fluids

    CERN Document Server

    Barenghi, Carlo

    2016-01-01

    The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .

  12. A Practical Primer on Geostatistics

    Science.gov (United States)

    Olea, Ricardo A.

    2009-01-01

    significant methodological implications. HISTORICAL REMARKS As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields. PIONEERS Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorology CALCULATIONS Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations. SOFTWARE For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics. ORGANIZATION OF THE PRIMER The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of th

  13. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection.

    Science.gov (United States)

    O'Halloran, Damien M

    2016-02-08

    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction.

  14. Percepciones sobre educación ambiental de estudiantes de primer semestre de Ingenierías de la Fundación Universitaria los Libertadores de Bogotá

    OpenAIRE

    Ángel Torres, Luz Dary; Ríos Romero, Marcela

    2014-01-01

    Tesis (Maestría en Desarrollo Sostenible y Medio Ambiente). Universidad de Manziales. Facultad de Ciencias Contables, Económicas y Administrativas, 2014 La Educación Ambiental es un amplio campo de la Ecología y la Biología, si se piensa en los fundamentos de las modernas ciencias ambientales, preocupadas desde recientes décadas por la gestión y sostenibilidad del medio ambiente. Desde este saber se cree que la formación ambiental puede ser educable y transformada si se parte de la per...

  15. Prevalencia y Factores de Riesgo Consumo de Cigarrillo para estudiantes universitarios entre 18 a 25 años, durante el primer semestre académico del año 2013

    Directory of Open Access Journals (Sweden)

    Javier Martínez Torres

    2013-05-01

    Full Text Available El consumo de cigarrillo es un problema actual de salud pública, el cual es responsable de una parte importante de la carga de morbilidad y mortalidad en momentos actuales. Objetivo: Determinar la prevalencia de consumo diario, consumo no diario de cigarrillo, en estudiantes universitarios y factores asociados. Materiales y métodos: Se desarrolló un estudio descriptivos transversal, se tomó una muestra de 464 voluntarios adultos sanos entre 18 y 25 años, de ambos géneros. Siendo esta representativa de los estudiantes universitarios. Se establecieron asociaciones mediante la construcción de modelos de regresión simple y múltiples para los factores asociados. Resultados: La prevalencia para el consumo de cigarrillo diario fue de 5,4%, mientras que la de ser fumador esporádico fue de 13%, se encontraron asociación entre el consumo diario de cigarrillo y el género masculino O.R. 4,46 (I.C. 95% 1,5 – 13,27, practicar deporte O.R. 0,29 (I.C. 95% 0,11- 0,76; mientras que para el consumo esporádico de cigarrillo el género masculino presentó O.R. 4,04 (I.C. 95% 2,08 – 7,83 consumo de bebidas alcohólicos O.R. 4,76 (1,13 – 20,05 Conclusiones: El consumo de cigarrillo se asocia como factor de riesgo al género masculino, y como factor protector en las personas que practicas deportes.

  16. Estrategias cognitivas utilizadas en la resolución de problemas de Química por los estudiantes de primer semestre del Programa de Química de la Universidad del Quindío

    OpenAIRE

    García de Ossa, John Jairo; González Gutiérrez, José Alberto

    2002-01-01

    Tesis (Maestría en Educación y Desarrollo Humano). Universidad de Manizales. Facultad de Ciencias Sociales y Humanas. CINDE, 2002 Este trabajo investigativo presenta el reporte de una investigación empírico analítica que aborda el estudio de las estrategias cognitivas utilizados por los alumnos al resolver los problemas de Química en las sesiones de clase, con el objetivo de plantear una estrategia metodológica enmarcada dentro de las pedagogías activas para la resolución de problemas. ...

  17. La pregunta como mediadora en el desarrollo del pensamiento crítico en estudiantes de primer semestre de la Licenciatura en Biología y Educación Ambiental de la Universidad del Quindío

    OpenAIRE

    2006-01-01

    Tesis (Maestría en Educación. Docencia).Universidad de Manizales. Facultad de Ciencias Sociales y Humanas, 2006 Esta investigación explora la importancia del uso de la pregunta formulada por los estudiantes para el desarrollo del pensamiento crítico, a través de los indicadores personales – actitiudinales. Metodológicamente se aplicó un diseño cuasiexperimental con preprueba, postprueba y grupos intactos- experimental y de control- para establecer los niveles inicial y final de lo...

  18. Electrostatic Discharge testing of propellants and primers

    Energy Technology Data Exchange (ETDEWEB)

    Berry, R.B.

    1994-02-01

    This report presents the results of testing of selected propellants and primers to Electrostatic Discharge (ESD) characteristic of the human body. It describes the tests and the fixturing built to accommodate loose material (propellants) and the packed energetic material of the primer. The results indicate that all powders passed and some primers, especially the electric primers, failed to pass established requirements which delineate insensitive energetic components. This report details the testing of components and materials to four ESD environments (Standard ESD, Severe ESD, Modified Standard ESD, and Modified Severe ESD). The purpose of this study was to collect data based on the customer requirements as defined in the Sandia Environmental Safety & Health (ES&H) Manual, Chapter 9, and to define static sensitive and insensitive propellants and primers.

  19. SBE primer : multiplexing minisequencing-based genotyping

    Energy Technology Data Exchange (ETDEWEB)

    Kaderali, L. (Lars); Deshpande, A. (Alina); Uribe-Romeo, F. J. (Francisco J.); Schliep, A.; Torney, D. C. (David C.)

    2002-01-01

    Single-nucleotide polymorphism (SNP) analysis is a powerful tool for mapping and diagnosing disease-related alleles. Most of the known genetic diseases are caused by point mutations, and a growing number of SNPs will be routinely analyzed to diagnose genetic disorders. Mutation analysis by polymerase mediated single-base primer extension (minisequencing) can be massively parallelized using for example DNA microchips or flow cytometry with microspheres as solid support. By adding a unique oligonucleotide tag to the 5-inch end of the minisequencing primer and attaching the complementary anti-tag to the array or bead surface, the assay can be 'demultiplexed'. However, such high-throughput scoring of SNPs requires a high level of primer multiplexing in order to analyze multiple loci in one assay, thus enabling inexpensive and fast polymorphism scoring. Primers can be chosen from either the plus or the minus strand, and primers used in the same experiment must not bind to one another. To genotype a given number of polymorphic sites, the question is which primer to use for each SNP, and which primers to group into the same experiment. Furthermore, a crosshybridization-free tag/anti-tag code is required in order to sort the extended primers to the corresponding microspheres or chip spots. These problems pose challenging algorithmic questions. We present a computer program lo automate the design process for the assay. Oligonucleotide primers for the reaction are automatically selected by the software, a unique DNA tag/anti-tag system is generated, and the pairing of primers and DNA-Tags is automatically done in a way to avoid any crossreactivity. We report first results on a 45-plex genotyping assay, indicating that minisequencing can be adapted to be a powerful tool for high-throughput, massively parallel genotyping.

  20. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads;

    2011-01-01

    Uracil-Specific Exision Reagent (USER) fusion is a recently developed technique that allows for assembly of multiple DNA fragments in a few simple steps. However, designing primers for USER fusion is both tedious and time consuming. Here, we present the Primer Help for USER (PHUSER) software......, a novel tool for designing primers specifically for USER fusion and USER cloning applications. We also present proof-of-concept experimental validation of its functionality. PHUSER offers quick and easy design of PCR optimized primers ensuring directionally correct fusion of fragments into a plasmid...... containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

  1. Primer on spontaneous heating and pyrophoricity

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  2. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

    Science.gov (United States)

    Yofe, Ido; Schuldiner, Maya

    2014-02-01

    The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast

  3. Prevalencia de consumo de drogas en alumnos del último semestre de la carrera de medicina y su repercusión académica

    Directory of Open Access Journals (Sweden)

    Elías Fuentes Aguilar

    2016-06-01

    Full Text Available El uso de drogas en las escuelas ha ido en aumento; en el nivel secundaria ya se ha detectado este problema, pero en el nivel superior no se han realizado suficientes estudios. Para el presente estudio se aplicó una encuesta a 108 alumnos del último semestre de la carrera de medicina del Centro Interdisciplinario de Ciencias de la Salud, Unidad Milpa Alta del Instituto Politécnico Nacional. Los resultados son los siguientes: 40 alumnos (37 % son del sexo masculino y 68 (63 % del sexo femenino, en total 97 alumnos consumen alcohol (89.8 %, de los cuales 58 son mujeres y 39 hombres. Con respecto al consumo de tabaco, 52 consumen tabaco (48 %, 27 son mujeres y 25 hombres. En cuanto al consumo de otras drogas, 16 alumnos (14% admitieron que las han probado (siempre en fiestas, de los cuales 8 son hombres y 8 son mujeres, mientras que los 16 alumnos restantes solo han probado marihuana. Por otro lado, 15 alumnos aceptaron tener algún problema debido al consumo de alguna droga, siendo el de mayor frecuencia el escolar; de entre estos alumnos, 3 bajaron su promedio y 2 consideran que el consumo de drogas les quita demasiado tiempo. Las campañas de prevención de la drogadicción deberían realizarse también en alumnos de nivel superior y no solo de nivel medio.

  4. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  5. Menopause 101: A Primer for the Perimenopausal

    Science.gov (United States)

    ... in the News Press Room Assistance Society Overview Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

  6. DNA sequencing by synthesis with degenerate primers

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    The degenerate primer-based sequencing Was developed by a synthesis method(DP-SBS)for high-throughput DNA sequencing,in which a set of degenerate primers are hybridized on the arrayed DNA templates and extended by DNA polymerase on microarrays.In this method,adifferent set of degenerate primers containing a give nnumber(n)of degenerate nucleotides at the 3'-ends were annealed to the sequenced templates that were immobilized on the solid surface.The nucleotides(n+1)on the template sequences were determined by detecting the incorporation of fluorescent labeled nucleotides.The fluorescent labeled nucleotide was incorporated into the primer in a base-specific manner after the enzymatic primer extension reactions and nine-base length were read out accurately.The main advanmge of the DP-SBS is that the method only uses very conventional biochemical reagents and avoids the complicated special chemical reagents for removing the labeled nucleotides and reactivating the primer for further extension.From the present study,it is found that the DP-SBS method is reliable,simple,and cost-effective for laboratory-sequencing a large amount of short DNA fragments.

  7. Aplicación de la experiencia de aprendizaje mediado a la estrategia de aprendizaje basado en problemas en estudiantes del tercer semestre de medicina, Universidad Autónoma de Bucaramanga, Colombia = Application of Mediated Learning Experience to the Problem Based Learning strategy on third semester medical students at a Colombian university

    Directory of Open Access Journals (Sweden)

    González Olaya, Hilda Leonor

    2011-12-01

    Full Text Available Introducción: el Aprendizaje Basado en Problemas (ABP, ha mostrado logros importantes en la enseñanza de la medicina. La Experiencia del Aprendizaje Mediado (EAM, derivada de la Teoría de la Modificabilidad Cognitiva, podría aumentar los alcances de la estrategia ABP y contribuir al logro de aprendizajes significativos en estudiantes de medicina. En el presente estudio se evaluaron los beneficios sobre el aprendizaje significativo de incorporar la EAM al ABP en estudiantes de medicina. Materiales y métodos: se hizo un estudio controlado y con asignación aleatoria con los estudiantes del tercer semestre de medicina de la Universidad Autónoma de Bucaramanga, Colombia. El primer grupo recibió solamente la metodología ABP y el segundo, dicha metodología articulada con la EAM. En subgrupos de ocho estudiantes asistieron a 16 sesiones (2 horas/semana para desarrollar problemas relacionados con el propósito homeostático ''mantener un adecuado aporte de oxígeno a los tejidos''. Se utilizaron dos pruebas de conocimiento: selección múltiple y resolución de problemas. Se describieron cualitativamente los resultados de la observación del desempeño cognitivo y de las autoevaluaciones, coevaluaciones y heteroevaluaciones. Resultados y conclusiones: los promedios y porcentajes de aprobación de las pruebas de conocimiento fueron mayores en el grupo de intervención, pero estas diferencias solo fueron estadísticamente significativas en la prueba de selección múltiple. Es posible que la estrategia ABP por sí misma potencie el aprendizaje significativo, pero las observaciones cualitativas demuestran que la EAM favorece la motivación y un ambiente propicio para potenciar las funciones cognitivas por lo que podría aumentar los beneficios del ABP.

  8. Beam shaping for laser initiated optical primers

    Science.gov (United States)

    Lizotte, Todd E.

    2008-08-01

    Remington was one of the first firearm manufacturing companies to file a patent for laser initiated firearms, in 1969. Nearly 40 years later, the development of laser initiated firearms has not become a mainstream technology in the civilian market. Requiring a battery is definitely a short coming, so it is easy to see how such a concept would be problematic. Having a firearm operate reliably and the delivery of laser energy in an efficient manner to ignite the shock-sensitive explosive primer mixtures is a tall task indeed. There has been considerable research on optical element based methods of transferring or compressing laser energy to ignite primer charges, including windows, laser chip primers and various lens shaped windows to focus the laser energy. The focusing of laser light needs to achieve igniting temperatures upwards of >400°C. Many of the patent filings covering this type of technology discuss simple approaches where a single point of light might be sufficient to perform this task. Alternatively a multi-point method might provide better performance, especially for mission critical applications, such as precision military firearms. This paper covers initial design and performance test of the laser beam shaping optics to create simultaneous multiple point ignition locations and a circumferential intense ring for igniting primer charge compounds. A simple initial test of the ring beam shaping technique was evaluated on a standard large caliber primer to determine its effectiveness on igniting the primer material. Several tests were conducted to gauge the feasibility of laser beam shaping, including optic fabrication and mounting on a cartridge, optic durability and functional ignition performance. Initial data will be presented, including testing of optically elements and empirical primer ignition / burn analysis.

  9. Climate Change, Health, and Communication: A Primer.

    Science.gov (United States)

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  10. Microsatellite Primers for Fungus-Growing Ants

    DEFF Research Database (Denmark)

    Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  11. Microsatellite primers for fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Gertsch, P J; Boomsma, JJ

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  12. Maestría en administración tesis de los estudiantes graduados

    Directory of Open Access Journals (Sweden)

    Innovar Revista

    2001-06-01

    Full Text Available Listados de trabajo de grado por línea de profundización monografías de Administración de Empresas: primer semestre 1997 - primer semestre 2000 / Monografías por línea de profundización Contaduría Pública: primer semestre 1998 - segundo semestre 2000

  13. Maestría en administración tesis de los estudiantes graduados

    OpenAIRE

    Innovar Revista

    2011-01-01

    Listados de trabajo de grado por línea de profundización monografías de Administración de Empresas: primer semestre 1997 - primer semestre 2000 / Monografías por línea de profundización Contaduría Pública: primer semestre 1998 - segundo semestre 2000

  14. Issues Primer. EEE708 Negotiated Study Program.

    Science.gov (United States)

    Jennings, Leonie

    This issues primer is structured around a series of 20 contemporary concerns in the changing world of work and training in Australia in the early 1990s. It is part of the study materials for the one-semester distance education unit, Negotiated Study Program, in the Open Campus Program at Deakin University (Australia). Information on each issue is…

  15. Environmentally Acceptable Medium Caliber Ammunition Percussion Primers

    Science.gov (United States)

    2007-10-31

    typically contain lead styphnate and antimony sulfide along with other constituents. Although highly effective, these heavy metal compounds have been...contain barium nitrate. Although not negatively categorized by the EPA itself, barium compounds are generally regarded as toxic and likewise should...contains the lead styphnate based FA956 composition2 which is a typical formulation of conventional military ammunition percussion primers. The

  16. A Primer on Policies for Jobs

    OpenAIRE

    Nallari, Raj; Griffith, Breda; Wang, Yidan; Andriamananjara, Soamiely; Derek H. C. Chen; Bhattacharya, Rwitwika

    2012-01-01

    A primer on policies for jobs is based on materials and input provided during the labor market courses conducted during the past 10 years. Its objective is to provide government policy makers, researchers, and labor market practitioners and other specialists with a practical guide on how to strengthen labor market institutions, especially in light of the global financial crisis. This prime...

  17. Primer design using Primer Express® for SYBR Green-based quantitative PCR.

    Science.gov (United States)

    Singh, Amarjeet; Pandey, Girdhar K

    2015-01-01

    To quantitate the gene expression, real-time RT-PCR or quantitative PCR (qPCR) is one of the most sensitive, reliable, and commonly used methods in molecular biology. The reliability and success of a real-time PCR assay depend on the optimal experiment design. Primers are the most important constituents of real-time PCR experiments such as in SYBR Green-based detection assays. Designing of an appropriate and specific primer pair is extremely crucial for correct estimation of transcript abundance of any gene in a given sample. Here, we are presenting a quick, easy, and reliable method for designing target-specific primers using Primer Express(®) software for real-time PCR (qPCR) experiments.

  18. Ambientes de aprendizaje para el desarrollo de habilidades metacognitivas durante la resolución de problemas: estudio longitudinal en estudiantes de los últimos semestres de ingeniería química de la UDLAP

    OpenAIRE

    Ramírez Apud López, Zaira

    2013-01-01

    En la actualidad, se ha demostrado que los profesionistas del área de las ingenierías, son contratados, retenidos y remunerados por la capacidad que muestran en la resolución de problemas del área laboral (Jonassen et al, 2006) Con base en lo anterior, el presente trabajo propone el desarrollo de Ambientes de Aprendizaje Basados en la Solución de Problemas, en estudiantes1 de la Licenciatura en Ingeniería Química durante sus últimos tres semestres de la Carrera, aplicando los procesos de s...

  19. Las necesidades de capacitación de empresarios de MIPYMES del Valle de Mexicali, México, y la demanda de capacitación de los mismos, en el semestre 2011-1

    OpenAIRE

    Marcela Reyes Pazos; Óscar Reyes Sánchez

    2012-01-01

    El propósito de la investigación es analizar las necesidades de capacitación de empresarios de MIPYMES (Micro, Pequeñas y Medianas Empresas) del Valle de Mexicali, y la demanda de capacitación de los mismos, durante el semestre 2011-1. Esta investigación la realiza el cedem-uabc (Centro Desarrollo Empresarial) de la Escuela de Ingeniería y Negocios, Guadalupe Victoria, de la Universidad Autónoma de Baja California, campus Mexicali. El método seguido fue investigación cuantitativa, con una mue...

  20. PrimerSuite: A High-Throughput Web-Based Primer Design Program for Multiplex Bisulfite PCR

    Science.gov (United States)

    Lu, Jennifer; Johnston, Andrew; Berichon, Philippe; Ru, Ke-lin; Korbie, Darren; Trau, Matt

    2017-01-01

    The analysis of DNA methylation at CpG dinucleotides has become a major research focus due to its regulatory role in numerous biological processes, but the requisite need for assays which amplify bisulfite-converted DNA represents a major bottleneck due to the unique design constraints imposed on bisulfite-PCR primers. Moreover, a review of the literature indicated no available software solutions which accommodated both high-throughput primer design, support for multiplex amplification assays, and primer-dimer prediction. In response, the tri-modular software package PrimerSuite was developed to support bisulfite multiplex PCR applications. This software was constructed to (i) design bisulfite primers against multiple regions simultaneously (PrimerSuite), (ii) screen for primer-primer dimerizing artefacts (PrimerDimer), and (iii) support multiplex PCR assays (PrimerPlex). Moreover, a major focus in the development of this software package was the emphasis on extensive empirical validation, and over 1300 unique primer pairs have been successfully designed and screened, with over 94% of them producing amplicons of the expected size, and an average mapping efficiency of 93% when screened using bisulfite multiplex resequencing. The potential use of the software in other bisulfite-based applications such as methylation-specific PCR is under consideration for future updates. This resource is freely available for use at PrimerSuite website (www.primer-suite.com). PMID:28117430

  1. PrimerSuite: A High-Throughput Web-Based Primer Design Program for Multiplex Bisulfite PCR.

    Science.gov (United States)

    Lu, Jennifer; Johnston, Andrew; Berichon, Philippe; Ru, Ke-Lin; Korbie, Darren; Trau, Matt

    2017-01-24

    The analysis of DNA methylation at CpG dinucleotides has become a major research focus due to its regulatory role in numerous biological processes, but the requisite need for assays which amplify bisulfite-converted DNA represents a major bottleneck due to the unique design constraints imposed on bisulfite-PCR primers. Moreover, a review of the literature indicated no available software solutions which accommodated both high-throughput primer design, support for multiplex amplification assays, and primer-dimer prediction. In response, the tri-modular software package PrimerSuite was developed to support bisulfite multiplex PCR applications. This software was constructed to (i) design bisulfite primers against multiple regions simultaneously (PrimerSuite), (ii) screen for primer-primer dimerizing artefacts (PrimerDimer), and (iii) support multiplex PCR assays (PrimerPlex). Moreover, a major focus in the development of this software package was the emphasis on extensive empirical validation, and over 1300 unique primer pairs have been successfully designed and screened, with over 94% of them producing amplicons of the expected size, and an average mapping efficiency of 93% when screened using bisulfite multiplex resequencing. The potential use of the software in other bisulfite-based applications such as methylation-specific PCR is under consideration for future updates. This resource is freely available for use at PrimerSuite website (www.primer-suite.com).

  2. Genetics and health communication: a primer.

    Science.gov (United States)

    Greenberg, Marisa S

    2015-01-01

    The progress of genetic knowledge has been swift and steadfast. As we move forward in the genomic era, post Human Genome Project, and continue to explore how one's genes interact with one's environment, it becomes increasingly important for all audiences to have a firm grasp of the vocabulary used in this health context. This primer is intended to be used as a reference and to introduce and/or make more clear concepts related to genetics to increase understanding.

  3. Status of NC Primer Demonstration & Transition

    Science.gov (United States)

    2014-11-20

    skid coating – Navy facilities- plan to assess as alternative to zinc -rich primers – General: internal funding in place through at least 2019 to...anodized aluminum, magnesium, high-strength steel with cadmium, aluminum and zinc - nickel , composites • Stress corrosion cracking and corrosion...this data, NAVAIR authorizes the use of PPG, Inc. – Deft 02-GN-084 over conversion coatings qualified to MIL-DTL-81706, Type I, Class 1A when used

  4. Universal COI primers for DNA barcoding amphibians.

    Science.gov (United States)

    Che, Jing; Chen, Hong-Man; Yang, Jun-Xiao; Jin, Jie-Qiong; Jiang, Ke; Yuan, Zhi-Yong; Murphy, Robert W; Zhang, Ya-Ping

    2012-03-01

    DNA barcoding is a proven tool for the rapid and unambiguous identification of species, which is essential for many activities including the vouchering tissue samples in the genome 10K initiative, genealogical reconstructions, forensics and biodiversity surveys, among many other applications. A large-scale effort is underway to barcode all amphibian species using the universally sequenced DNA region, a partial fragment of mitochondrial cytochrome oxidase subunit I COI. This fragment is desirable because it appears to be superior to 16S for barcoding, at least for some groups of salamanders. The barcoding of amphibians is essential in part because many species are now endangered. Unfortunately, existing primers for COI often fail to achieve this goal. Herein, we report two new pairs of primers (➀, ➁) that in combination serve to universally amplify and sequence all three orders of Chinese amphibians as represented by 36 genera. This taxonomic diversity, which includes caecilians, salamanders and frogs, suggests that the new primer pairs will universally amplify COI for the vast majority species of amphibians.

  5. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

    Science.gov (United States)

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

    2015-07-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system.

  6. CRISPR Primer Designer:Design primers for knockout and chromosome imaging CRISPR-Cas system

    Institute of Scientific and Technical Information of China (English)

    Meng Yan; Shi-Rong Zhou; Hong-Wei Xue

    2015-01-01

    The clustered regularly interspaced short palin-dromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especial y the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran local y and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were stil no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs local y and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system.

  7. Análisis de la captación tardía de las gestantes al primer control prenatal de la Empresa social del estado Hospital Regional Noroccidental IPS Abrego, en el primer semestre del año 2014

    OpenAIRE

    2014-01-01

    Tesis (Especialista en Administración de la salud). Universidad Católica de Manizales, Facultad de Salud, 2014 La situación actual en relación a los controles prenatales, se considera de gran importancia debido a que; es un conjunto de acciones médicas y asistenciales que se concretan en entrevistas o visitas programadas con el equipo de salud, a fin de controlar la evolución del embarazo y obtener una adecuada preparación para el nacimiento y la crianza del recién nacido con la finalidad ...

  8. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  9. Spectrophotometric determination of tetrazene in primers and primer mixes by use of resorcinol.

    Science.gov (United States)

    Norwitz, G; Keliher, P N

    1979-06-01

    A spectrophotometric method is proposed for the determination of tetrazene (tetracene) in primers and primer mixes that involves treatment of the tetrazene with resorcinol solution and measurement of the intensity of the yellow colour of the diazo-dye produced. In the application of the method, lead styphnate and barium nitrate are first removed by extraction with ammonium acetate solution and then nitrocellulose and PETN are removed by extraction with acetone. The insoluble matter containing the tetrazene is boiled with resorcinol reagent, the solution filtered, and the absorbance measured at 400 nm. Conditions for optimum colour development are studied and the nature of the reaction is considered.

  10. Signals and systems primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2006-01-01

    Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

  11. Emulsion primers, their contribution to bonding

    OpenAIRE

    González Sburlati, Rubén Osmar; Sapei, José

    2014-01-01

    Asphalt irrigation in its various types, performs specific functions in the structure of a road during the construction phase or their service life. In particular, the so-called "Irrigation Primer " is used in underlying layers, in order to generate a transition surface with the new asphalt layer; thus the tack or prime coat will be placed on a surface to ensure a good bond with the overlying layer. For a long time Diluted Asphalts (Cut Back mediums) where used, but have been discontinued for...

  12. Bayesian models a statistical primer for ecologists

    CERN Document Server

    Hobbs, N Thompson

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili

  13. An engineering primer on extreme value statistics

    Energy Technology Data Exchange (ETDEWEB)

    Novog, D.R.; Hoppe, F. [McMaster Univ., Hamilton, Ontario (Canada); Nainer, O. [Bruce Power, Tiverton, Ontario (Canada); Phan, B. [Ontario Power Generation, Toronto, Ontario (Canada)

    2009-07-01

    This primer is intended for individuals interested in gaining an understanding of Extreme Value Statistics (EVS). This work provides an explanation of EVS at a level that can be accessible to most people with an engineering or science background. While this work represents a simplification of the discussions from Reference 1, it is hoped that the authors will forgive any liberties taken in this paper. Some of the simplifications presented here may not be rigorous in all aspects, but the sacrifice in rigour is intended to aid the fundamental understanding of the EVS formulation and basic application. (author)

  14. Primer Concilio Provincial del Nuevo Reino

    Directory of Open Access Journals (Sweden)

    Manuel Lucena Salmoral

    1963-01-01

    Full Text Available El acontecimiento más sobresaliente del patriarcado de don Fernando Arias de Ugarte, en el que hubo muchos notables, fue el Primer Concilio Provincial del Nuevo Reino de Granada, celebrado en el año 1623. Cumplió así una vieja aspiración de los arzobispos santafereños y la obligación impuesta en el Concilio de Trento, por lo que resulta incomprensible lo historiado por don José Antonio Plaza quien, al referirse a este hecho, dice lo siguiente...

  15. Precedentes musulmanes y primer arte cristiano

    OpenAIRE

    Cabañero Subiza, Bernabé

    2006-01-01

    La comarca de las Cinco Villas en la que en los siglos X y XI no existió ningún centro artístico de primer orden en el que se crearan concepciones espaciales y soluciones formales propias. Por eso los monumentos de esta comarca pertenecientes a dichas centurias constituyen en casi todos los casos manifestaciones periféricas de corrientes artísticas creadas y desarrolladas fuera de sus confines. Esta llegada de soluciones formales foráneas a las Cinco Villas es tanto más explicable si...

  16. Primer on CDM programme of activities

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

    2009-07-01

    As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

  17. FORMACIÓN EN INVESTIGACIÓN EN FUTUROS PROFESORES. EL CASO DE SEXTO SEMESTRE DE LICENCIATURA EN BIOLOGÍA DE LA UNIVERSIDAD PEDAGÓGICA NACIONAL. PLANTEAMIENTO DEL PROBLEMA

    Directory of Open Access Journals (Sweden)

    Natalia Valencia

    2014-05-01

    Full Text Available A continuación se presenta una propuesta investigativa  que se encuentra en el marco del proyecto de investigación denominado ‘’Formación en investigación en futuros profesores de Biología’’ de la línea de investigación Conocimiento Profesional del Profesor de Ciencias; este proyecto tiene como objetivo caracterizar  la formación investigativa en futuros profesores de biología  (sexto semestre   de la Licenciatura en biología de la Universidad Pedagógica Nacional. Específicamente, se describe el problema,  los fundamentos teóricos centrados en la formación investigativa de profesores y la metodología propuesta.

  18. Great Lakes rivermouths: a primer for managers

    Science.gov (United States)

    Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul

    2013-01-01

    Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described

  19. GENOMEMASKER package for designing unique genomic PCR primers

    Directory of Open Access Journals (Sweden)

    Kaplinski Lauris

    2006-03-01

    Full Text Available Abstract Background The design of oligonucleotides and PCR primers for studying large genomes is complicated by the redundancy of sequences. The eukaryotic genomes are particularly difficult to study due to abundant repeats. The speed of most existing primer evaluation programs is not sufficient for large-scale experiments. Results In order to improve the efficiency and success rate of automatic primer/oligo design, we created a novel method which allows rapid masking of repeats in large sequence files, for example in eukaryotic genomes. It also allows the detection of all alternative binding sites of PCR primers and the prediction of PCR products. The new method was implemented in a collection of efficient programs, the GENOMEMASKER package. The performance of the programs was compared to other similar programs. We also modified the PRIMER3 program, to be able to design primers from lowercase-masked sequences. Conclusion The GENOMEMASKER package is able to mask the entire human genome for non-unique primers within 6 hours and find locations of all binding sites for 10 000 designed primer pairs within 10 minutes. Additionally, it predicts all alternative PCR products from large genomes for given primer pairs.

  20. High universality of matK primers for barcoding gymnosperms

    Institute of Scientific and Technical Information of China (English)

    Yan LI; Lian-Ming GAO; RAM C.POUDEL; De-Zhu Li; Alan FORREST

    2011-01-01

    DNA barcoding is a tool to provide rapid and accurate taxonomic identification using a standard DNA region. A two-marker combination of rnatK+rbcL was formally proposed as the core barcode for land plants by the Consortium for the Barcode of Life Plant Working Group. However, there are currently no barcoding primers for matK showing high universality in gymnosperms. We used 57 gymnosperm species representing 40 genera, 11families and four subclasses to evaluate the universality of nine candidate matK primers and one rbcL primer in this study. Primer (1F/724R) of rbcL is proposed here as a universal primer for gymnosperms due to high universality. One of the nine candidate matK primers (Gym_F1A/Gym_R1A) is proposed as the best "universal" matK primer for gynnosperms because of high polymerase chain reaction success and routine generation of high quality bidirectional sequences. A specific matK primer for Ephedra was newly designed in this study, which performed well on the sampled species. The primers proposed here for rbcL and matK can be easily and successfully amplified for most gymnosperms.

  1. Complex and Adaptive Dynamical Systems A Primer

    CERN Document Server

    Gros, Claudius

    2011-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  2. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2007-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  3. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2015-01-01

    This primer offers readers an introduction to the central concepts that form our modern understanding of complex and emergent behavior, together with detailed coverage of accompanying mathematical methods. All calculations are presented step by step and are easy to follow. This new fourth edition has been fully reorganized and includes new chapters, figures and exercises. The core aspects of modern complex system sciences are presented in the first chapters, covering network theory, dynamical systems, bifurcation and catastrophe theory, chaos and adaptive processes, together with the principle of self-organization in reaction-diffusion systems and social animals. Modern information theoretical principles are treated in further chapters, together with the concept of self-organized criticality, gene regulation networks, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase transitions and the cognitive system approach to the brain. Technical course prerequisites are the standard ...

  4. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2013-01-01

    Complex system theory is rapidly developing and gaining importance, providing tools and concepts central to our modern understanding of emergent phenomena. This primer offers an introduction to this area together with detailed coverage of the mathematics involved. All calculations are presented step by step and are straightforward to follow. This new third edition comes with new material, figures and exercises. Network theory, dynamical systems and information theory, the core of modern complex system sciences, are developed in the first three chapters, covering basic concepts and phenomena like small-world networks, bifurcation theory and information entropy. Further chapters use a modular approach to address the most important concepts in complex system sciences, with the emergence and self-organization playing a central role. Prominent examples are self-organized criticality in adaptive systems, life at the edge of chaos, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase...

  5. [Analysis of effectiveness of cDNA synthesis, induced using complementary primers and primers containing a noncomplementary base matrix].

    Science.gov (United States)

    D'iachenko, L B; Chenchik, A A; Khaspekov, G L; Tatarenko, A O; Bibilashvili, R Sh

    1994-01-01

    We have studied the efficiency of DNA synthesis catalyzed by M-MLV reverse transcriptase or Thermus aquaticus DNA polymerase for primers (4-17 nucleotides long) either completely matched or possessing a single mismatched base pair at all possible positions in the primer. It has been shown that DNA synthesis efficiency depends not only on the position of mismatched base pair but on the length and primary structure of the primer. The enzyme, template, and primer concentrations determine the relative level of mismatched DNA synthesis.

  6. The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.

    Science.gov (United States)

    Zellweger, Polle T.; Mackinlay, Jock D.

    A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

  7. Polymerase chain reaction of Au nanoparticle-bound primers

    Institute of Scientific and Technical Information of China (English)

    SHEN Hebai; HU Min; YANG Zhongnan; WANG Chen; ZHU Longzhang

    2005-01-01

    Polymerase chain reaction (PCR) is a useful technique for in vitro amplification of a DNA fragment. In this paper, a PCR procedure using Au nanoparticle (AuNP) -bound primers was systemically studied. The 5′-SH- (CH2)6-modified primers were covalently attached to the AuNP surface via Au-S bonds, and plasmid pBluescript SK was used as a template. The effects of the concentration of AuNP-bound primers, annealing temperature and PCR cycles were evaluated, respectively. The results indicate that PCR can proceed successfully under optimized condition, with either forward or reverse primers bound to the AuNP surface or with both the two primers bound to the AuNP surface. Development of PCR procedure based on AuNPs not only makes the isolation of PCR products very convenient, but also provides novel methods to prepare AuNP-bound ssDNA and nanostructured material.

  8. Uncoupling primer and releaser responses to pheromone in honey bees

    Science.gov (United States)

    Grozinger, Christina M.; Fischer, Patrick; Hampton, Jacob E.

    2007-05-01

    Pheromones produce dramatic behavioral and physiological responses in a wide variety of species. Releaser pheromones elicit rapid responses within seconds or minutes, while primer pheromones produce long-term changes which may take days to manifest. Honeybee queen mandibular pheromone (QMP) elicits multiple distinct behavioral and physiological responses in worker bees, as both a releaser and primer, and thus produces responses on vastly different time scales. In this study, we demonstrate that releaser and primer responses to QMP can be uncoupled. First, treatment with the juvenile hormone analog methoprene leaves a releaser response (attraction to QMP) intact, but modulates QMP’s primer effects on sucrose responsiveness. Secondly, two components of QMP (9-ODA and 9-HDA) do not elicit a releaser response (attraction) but are as effective as QMP at modulating a primer response, downregulation of foraging-related brain gene expression. These results suggest that different responses to a single pheromone may be produced via distinct pathways.

  9. High-speed measurement of firearm primer blast waves

    CERN Document Server

    Courtney, Michael; Eng, Jonathan; Courtney, Amy

    2012-01-01

    This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast pressure of 8.2-25.0%. 3) Combined with smaller blast waves, these large variations in peak blast pressure of DDNP-based primers led to delayed ignition and failure to fire in brief field tests.

  10. DNA sequencing technology, walking with modular primers. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Ulanovsky, L.

    1996-12-31

    The success of the Human Genome Project depends on the development of adequate technology for rapid and inexpensive DNA sequencing, which will also benefit biomedical research in general. The authors are working on DNA technologies that eliminate primer synthesis, the main bottleneck in sequencing by primer walking. They have developed modular primers that are assembled from three 5-mer, 6-mer or 7-mer modules selected from a presynthesized library of as few as 1,000 oligonucleotides ({double_bond}4, {double_bond}5, {double_bond}7). The three modules anneal contiguously at the selected template site and prime there uniquely, even though each is not unique for the most part when used alone. This technique is expected to speed up primer walking 30 to 50 fold, and reduce the sequencing cost by a factor of 5 to 15. Time and expensive will be saved on primer synthesis itself and even more so due to closed-loop automation of primer walking, made possible by the instant availability of primers. Apart from saving time and cost, closed-loop automation would also minimize the errors and complications associated with human intervention between the walks. The author has also developed two additional approaches to primer-library based sequencing. One involves a branched structure of modular primers which has a distinctly different mechanism of achieving priming specificity. The other introduces the concept of ``Differential Extension with Nucleotide Subsets`` as an approach increasing priming specificity, priming strength and allowing cycle sequencing. These approaches are expected to be more robust than the original version of the modular primer technique.

  11. PrimerSeq:Design and Visualization of RT-PCR Primers for Alternative Splicing Using RNA-seq Data

    Institute of Scientific and Technical Information of China (English)

    Collin Tokheim; Juw Won Park; Yi Xing

    2014-01-01

    The vast majority of multi-exon genes in higher eukaryotes are alternatively spliced and changes in alternative splicing (AS) can impact gene function or cause disease. High-throughput RNA sequencing (RNA-seq) has become a powerful technology for transcriptome-wide analysis of AS, but RT-PCR still remains the gold-standard approach for quantifying and validating exon splicing levels. We have developed PrimerSeq, a user-friendly software for systematic design and visualization of RT-PCR primers using RNA-seq data. PrimerSeq incorporates user-provided tran-scriptome profiles (i.e., RNA-seq data) in the design process, and is particularly useful for large-scale quantitative analysis of AS events discovered from RNA-seq experiments. PrimerSeq features a graphical user interface (GUI) that displays the RNA-seq data juxtaposed with the expected RT-PCR results. To enable primer design and visualization on user-provided RNA-seq data and transcript annotations, we have developed PrimerSeq as a stand-alone software that runs on local computers. PrimerSeq is freely available for Windows and Mac OS X along with source code at http://primerseq.sourceforge.net/. With the growing popularity of RNA-seq for transcriptome stud-ies, we expect PrimerSeq to help bridge the gap between high-throughput RNA-seq discovery of AS events and molecular analysis of candidate events by RT-PCR.

  12. Primer on electricity futures and other derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  13. Análise comparativa entre a refração clínica subjetiva e a automatizada obtida por sensor de frentes de onda Comparative analyses between clinical refraction and automatic refraction obtained through a wave front sensor

    Directory of Open Access Journals (Sweden)

    Wilson de Freitas

    2007-08-01

    Full Text Available OBJETIVO: Avaliar e comparar os resultados obtidos da refração estática clínica com a obtida por sensor de frentes de onda. MÉTODOS: Estudo prospectivo, não seqüencial, de 279 olhos de 147 pacientes. Todos os pacientes foram examinados sob cicloplegia. Primeiro realizamos a refração clínica e a seguir a automatizada por sensor de frentes de onda. Os dados refracionais obtidos foram decompostos para análise vetorial. Foram analisados separadamente os dados de um olho por paciente e dos dois olhos. RESULTADOS: A diferença entre a refração clínica e a automatizada foi de -0,19 DE combinada com -0,06 DC no eixo de 15º para os dados de um olho por paciente e -0,17 DE combinada com -0,05 DC no eixo de 3º para todos os olhos da amostra. CONCLUSÃO: Os dados da refração clínica são comparáveis com os da refração obtida por um sensor de frentes de onda.PURPOSE: To evaluate and compare refractive errors obtained through clinical subjective and automatized wavefront refraction analyses in eyes under cycloplegia. METHODS: Prospective study of 147 patients, 279 eyes, undergoing preoperative examination for refractive surgery. Clinical subjective refraction was performed first followed by wavefront refraction. Results on astigmatism obtained from refraction were decomposed in power vectors for statistical analyses. Data were first analyzed in one eye and then in both eyes. RESULTS: The mean difference between clinical subjective refraction and automatized wavefront refraction on cycloplegic eyes was of -0.19 SD combined with -0.06 CD in the 15º axis for data in one eye, and -0.17 SD combined with -0.05 CD in the 3º axis for data in both eyes of the same patient. CONCLUSION: In the present study clinical subjective refraction and automatized wavefront refraction under cycloplegia had similar numerical values.

  14. SOMNOLENCIA DIURNA EXCESIVA EN ESTUDIANTES DE TERCER SEMESTRE DE MEDICINA DE LA UNIVERSIDAD NACIONAL DE COLOMBIA Disorders of excessive somnolence in students of medicine school of the National University of Colombia

    Directory of Open Access Journals (Sweden)

    Franklin Escobar-Córdoba

    2008-03-01

    Full Text Available Antecedentes. Tradicionalmente los estudiantes de medicina duermen poco, estudian largas jornadas nocturnas y como consecuencia padecen somnolencia diurna excesiva que produce disminución en la atención y afecta su calidad de vida. En nuestro país se conoce poco sobre la prevalencia y gravedad de este síntoma en esta población, al igual que sus efectos en grupos de correturnos en general como vigilantes, personal de salud, pilotos, militares, entre otros. Objetivo. Determinar la prevalencia de somnolencia diurna excesiva en estudiantes de tercer semestre de medicina de la Universidad Nacional de Colombia. Material y métodos. Estudio descriptivo transversal, realizado en 2006, en una muestra de estudiantes (79.2%, n=99/125 de tercer semestre de medicina de la Universidad Nacional de Colombia que aceptaron participar en la investigación mediante consentimiento informado. Se aplicó la escala de somnolencia de Epworth validada localmente. Resultados. Los participantes evaluados fueron jóvenes, estudiantes universitarios de tercer semestre de medicina, en quienes se encontró somnolencia diurna excesiva en el 59.6% (n=59/99, siendo más frecuente en jóvenes de género masculino con promedio de edad de 21 años. Datos más elevados comparativamente con los informados en otros estudios para la población general. Conclusiones. La prevalencia de somnolencia diurna excesiva en la población estudiada es cuantitativamente importante y superior a la encontrada en otros estudios.Background. Traditionally the medicine students sleep little, study long nocturnal days and as consequence suffers hypersomnolence that produces diminution in the attention and affects its quality of life. In our country little is known on the prevalence and gravity of this symptom in this population, like its effects in groups of shift workers in general like watchmen, personnel of health, pilots, the military, among others. Objective. To determine the prevalence of daily

  15. propósito del primer centenario

    Directory of Open Access Journals (Sweden)

    René Martínez Lemoine

    2007-01-01

    Full Text Available Este trabajo, trata de las apreciaciones públicas y urbanas que se dieron en la ciudad de Santiago a instancias de la celebración del primer Centenario de la República, en el año 1910. Es una rememoranza de aquellas visiones que la ciudad sustrajo a los medios periodísticos, personajes y liderazgos de una sociedad autosatisfecha por el progreso notable alcanzado por el país en las últimas décadas del siglo XIX y los primeros años del siglo XX, pero que ignoró los movimientos obreros y expresiones de disconformidad social que ya comenzaban a ebullir en esos años. La ciudad, como una vasta, compleja y heterogénea construcción en el espacio, erigida a través de las edades por innumerables y, la más de las veces, anónimos constructores, representa la mayor suma de obra humana acumulada en el tiempo, en la que cada generación va dejando una muestra de su aporte en vivienda, espacios, instalaciones y monumentos, vale decir, de su particular cultura y modo de vida en su propio tiempo. Ciertamente, cada ciudad es historia y memoria de sí misma, testimonio permanente de la continuidad del hombre y de la sociedad humana con su propio pasado. En ese sentido, como somos herederos de nuestra historia y de los hombres y mujeres que construyeron y legaron las ciudades en las que vivimos, es importante rescatar esos valores culturales, sociales, arquitectónicos y urbanísticos de modo de visualizar el paso del tiempo, que se materializa, se hace objeto y se torna visible en la ciudad, en la medida que nos “cuenta” algo.

  16. Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

    Directory of Open Access Journals (Sweden)

    Alexandre R. Zuntini

    2013-08-01

    Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  17. PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets

    Energy Technology Data Exchange (ETDEWEB)

    2013-08-08

    Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether there are also TaqMan/Luminex probe matches within predicted amplicons.

  18. A physicists guide to The Los Alamos Primer

    Science.gov (United States)

    Reed, B. Cameron

    2016-11-01

    In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer, which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons.

  19. Study on gene sensor based on primer extension

    Institute of Scientific and Technical Information of China (English)

    陈誉华; 宋今丹; 李大为

    1997-01-01

    Based on the fact that the resonant frequency of a piezoelectric crystal is the function of its surface deposit, and that the primer extends after it hybridizes with the template, the primer extension gene sensor technique was developed. The prominent feature of the technique is that fast and sensitive frequency signals are used as the monitoring system of gene hybridization and primer strand extension. Results show that this technique may be used in homologous analysis of nucleic acid, trace DNA detection, and determining the integration of DNA. It may also be used for isolation of target gene, gene mutation analysis, and predicting the location of a gene in its genome.

  20. Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

    Directory of Open Access Journals (Sweden)

    Francesco Dal Grande

    2013-03-01

    Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

  1. MultiPLX: automatic grouping and evaluation of PCR primers.

    Science.gov (United States)

    Kaplinski, Lauris; Remm, Maido

    2015-01-01

    In this chapter we describe MultiPLX-a tool for automatic grouping of PCR primers for multiplexed PCR. Both generic working principle and step-by-step practical procedures with examples are presented. MultiPLX performs grouping by calculating many important interaction levels between the different primer pairs and then distributes primer pairs to groups so that the strength of unwanted interactions is kept below user-defined compatibility level. In addition it can be used to select optimal primer pairs for multiplexing from list of candidates. MultiPLX can be downloaded from http://bioinfo.ut.ee/?page_id=167. Graphical web-based interface to most functions of MultiPLX is available at http://bioinfo.ut.ee/multiplx/.

  2. Electrocoat Process for Non-Chromate Primers in DOD Manufacturing

    Science.gov (United States)

    2012-08-29

    Performance Benefits of Electrocoat Environmental, Health, and Safety Considerations • Aqueous based • Minimal waste discharge- closed loop...Electrocoat has larger area of blistering ; all surface corrosion • Spray primers have more localized, but deeper corrosion Scribe near fastener

  3. A Pollen Primer | NIH MedlinePlus the Magazine

    Science.gov (United States)

    ... please turn Javascript on. Feature: Managing Allergies A Pollen Primer Past Issues / Summer 2011 Table of Contents ... National Institute of Environmental Health Sciences (NIEHS) . Plant Pollen Ragweed and other weeds, such as curly dock, ...

  4. Medium Caliber Lead-Free Electric Primer. Version 2

    Science.gov (United States)

    2012-09-01

    eliminate the lead styphnate and barium nitrate components in the current 20mm electric primer for the purposes of protecting our troops, production...Lead nitrate is added to the magnesium bis(trinitroresorcinol) to form lead styphnate and magnesium nitrate. The additional ingredient, barium ...conventional lead styphnate primers. On small scale samples, outstanding all-up round action times (AUR-ATs) were obtained for ambient (2.92 ms) and

  5. Las necesidades de capacitación de empresarios de MIPYMES del Valle de Mexicali, México, y la demanda de capacitación de los mismos, en el semestre 2011-1

    Directory of Open Access Journals (Sweden)

    Marcela Reyes Pazos

    2012-07-01

    Full Text Available El propósito de la investigación es analizar las necesidades de capacitación de empresarios de MIPYMES (Micro, Pequeñas y Medianas Empresas del Valle de Mexicali, y la demanda de capacitación de los mismos, durante el semestre 2011-1. Esta investigación la realiza el cedem-uabc (Centro Desarrollo Empresarial de la Escuela de Ingeniería y Negocios, Guadalupe Victoria, de la Universidad Autónoma de Baja California, campus Mexicali. El método seguido fue investigación cuantitativa, con una muestra aleatoria no representativa de 469 MIPYMES encuestadas de los distintos ejidos del Valle de Mexicali. Los principales resultados obtenidos manifiestan que existe demanda de capacitación, en áreas como administración, publicidad y mercadotecnia, y ventas. Los resultados del diagnóstico de la investigación indican que sí están presentes las necesidades de capacitación por parte de la mayoría de los empresarios de las MIPYMES del Valle de Mexicali, pero muy pocos la han solicitado. Los objetivos de la investigación se lograron analizando las necesidades de capacitación y la demanda de capacitación de los empresarios.

  6. Las necesidades de capacitación de empresarios de MIPYMES del Valle de Mexicali, México, y la demanda de capacitación de los mismos, en el semestre 2011-1

    Directory of Open Access Journals (Sweden)

    Marcela Reyes Pazos

    2012-06-01

    Full Text Available El propósito de la investigación es analizar las necesidades de capacitación de empresarios de MIPYMES (Micro, Pequeñas y Medianas Empresas del Valle de Mexicali, y la demanda de capacitación de los mismos, durante el semestre 2011-1. Esta investigación la realiza el cedem-uabc (Centro Desarrollo Empresarial de la Escuela de Ingeniería y Negocios, Guadalupe Victoria, de la Universidad Autónoma de Baja California, campus Mexicali. El método seguido fue investigación cuantitativa, con una muestra aleatoria no representativa de 469 MIPYMES encuestadas de los distintos ejidos del Valle de Mexicali. Los principales resultados obtenidos manifiestan que existe demanda de capacitación, en áreas como administración, publicidad y mercadotecnia, y ventas. Los resultados del diagnóstico de la investigación indican que sí están presentes las necesidades de capacitación por parte de la mayoría de los empresarios de las MIPYMES del Valle de Mexicali, pero muy pocos la han solicitado. Los objetivos de la investigación se lograron analizando las necesidades de capacitación y la demanda de capacitación de los empresarios.

  7. New universal matK primers for DNA barcoding angiosperms

    Institute of Scientific and Technical Information of China (English)

    Jing YU; Jian-Hua XUE; Shi-Liang ZHOU

    2011-01-01

    The chloroplast maturase K gene (matK) is one of the most variable coding genes of angiosperms and has been suggested to be a "barcode" for land plants. However, matK exhibits low amplification and sequencing rates due to low universality of currently available primers and mononucleotide repeats. To resolve these technical problems, we evaluated the entire matK region to find a region of 600-800 bp that is highly variable, represents the best of all matK regions with priming sites conservative enough to design universal primers, and avoids the mononucleotide repeats. After careful evaluation, a region in the middle was chosen and a pair of primers named natK472F and matK1248R was designed to amplify and sequence the matK fragment of approximately 776 bp. This region encompasses the most variable sites, represents the entire matK region best, and also exhibits high amplification rates and quality of sequences. The universality of this primer pair was tested using 58 species from 47 families of angiosperm plants. The primers showed a strong amplification (93.1%) and sequencing (92.6%)successes in the species tested. We propose that the new primers will solve, in part, the problems encountered when using matK and promote the adoption of matK as a DNA barcode for angiosperms.

  8. Universal primers that amplify RNA from all three flavivirus subgroups

    Directory of Open Access Journals (Sweden)

    Barnard Ross T

    2008-01-01

    Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.

  9. Novel multiple 5'-amino-modified primer for DNA microarrays.

    Science.gov (United States)

    Han, Jing; Lee, Hin; Nguyen, Nga Yen; Beaucage, Serge L; Puri, Raj K

    2005-08-01

    For DNA microarray analysis, total RNA is reverse-transcribed, labeled by incorporating fluorescent dye into the cDNA, and used to hybridize microarray. This protocol requires a minimum of 20 microg of total RNA. To overcome the sample limitation, an RNA amplification technique has been developed. Although it needs less RNA, this amplification technique is relatively expensive, time consuming, and, unfortunately, has been found to introduce bias. In this study, we designed a novel 5'-amino-modified primer and used it for priming cDNA synthesis. The novel primer has a special structure that contains four Uni-Link molecules with two nucleotide (thymine) residues inserted between them as spacers. This novel primer is used in the reverse-transcription reaction for cDNA synthesis. Using the novel 5'-modified primer combined with indirect labeling method, cDNA probes can be prepared with much less total RNA (5 microg or less) without amplification producing optimal results after hybridization of arrays. This primer can also be used to label nucleotides for other purposes.

  10. Friction Stir Welding of Shipbuilding Steel with Primer

    Directory of Open Access Journals (Sweden)

    José Azevedo

    2016-03-01

    Full Text Available Abstract Friction Stir Welding has proven its merits for welding of aluminium alloys and is focused in expanding its material database to steel and titanium and also to assess new joint configurations. The use of welded structures in shipbuilding industry has a long tradition and continuously seeks for innovation in terms of materials and processes maintaining, or even, reducing costs. Several studies have been performed in the past years on FSW of steel. However, just recently were reported defect-free welds, free of martensite with stable parameters in steel without Primer. FSW of steel with primer has not been addressed. This work aims to fulfil a knowledge gap related to the use of friction stir for welding shipbuilding steel by analysing the effect of welding parameters on the metallurgical characteristics and mechanical properties of welds obtained with an innovative FSW tool in joining steel plates with a primer. Welds were performed in 4mm thick GL-A36 steel plates painted with a zinc based primer followed by a detailed microscopic, chemical and mechanical analysis. The results that matching fatigue properties are obtained using this technique, in FSW of shipbuilding steel with Primer.

  11. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J;

    1997-01-01

    Reverse transcription of retroviral genomes is primed by a tRNA annealed to an 18-nucleotide primer binding site. Here, we present a primer complementation system to study molecular interaction of the replication machinery with the primer and primer binding site in vivo. Introduction of eight base......, but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... substitutions into the primer binding site of a murine leukemia virus-based vector allowed efficient RNA encapsidation but resulted in severely reduced vector replication capacity. Replication was restored upon complementation with a synthetic gene designed to encode a complementary tRNA-like primer...

  12. Studies on the Primers Screening for AFLP Fingerprints of Rice Cultivars

    Institute of Scientific and Technical Information of China (English)

    ZHANG Chun-qing; JIA Ji-zeng

    2002-01-01

    AFLP(amplified fragment length polymorphism) is a very powerful fingerprinting technology.The key of making variety fingerprints is to select specific powerful primers for each crop. A quick and effective procedure for selecting AFLP primers for rice variety fingerprinting was established as the following: (1)Choose 3 or more group materials that have close genetic relations. (2) Select potential polymorphic primers from primer pairs that are 2 + 2 primer crosses and same at two ends. (3) Recombine the selected potential polymorphic primers and choosing more polymorphic primers. (4) Add one selecting base at one end to become 2 + 3 or 3 + 2primers and further selecting more polymorphic primers. Some primers were selected with this procedure, such as M21Ps7 and M73P17, with which the fingerprints had more polymorphism and high quality.

  13. Mutated primer binding sites interacting with different tRNAs allow efficient murine leukemia virus replication

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J;

    1993-01-01

    can replicate by using various tRNA molecules as primers and propose primer binding site-tRNA primer interactions to be of major importance for tRNA primer selection. However, efficient primer selection does not require perfect Watson-Crick base pairing at all 18 positions of the primer binding site.......(Pro). Polymerase chain reaction amplification and sequence analysis of transduced proviruses confirmed the transfer of vectors with mutated primer binding sites and further showed that tRNA(Gln-2) may act efficiently in conjunction with the tRNA(Gln-1) primer binding site. We conclude that murine leukemia virus......Two Akv murine leukemia virus-based retroviral vectors with primer binding sites matching tRNA(Gln-1) and tRNA(Lys-3) were constructed. The transduction efficiency of these mutated vectors was found to be comparable to that of a vector carrying the wild-type primer binding site matching tRNA...

  14. SOMNOLENCIA DIURNA EXCESIVA EN ESTUDIANTES DE NOVENO SEMESTRE DE MEDICINA DE LA UNIVERSIDAD NACIONAL DE COLOMBIA Excessive daytime drowsiness in ninth-semester medical students attending the Universidad Nacional de Colombia

    Directory of Open Access Journals (Sweden)

    Franklin Escobar-Córdoba

    2011-09-01

    Full Text Available Antecedentes. Tradicionalmente los estudiantes de medicina duermen poco, estudian largas jornadas nocturnas y como consecuencia padecen somnolencia diurna excesiva produciendo disminución en la atención que afecta su calidad de vida y rendimiento académico. Lo anterior se suma a los turnos nocturnos y al pobre conocimiento de higiene del sueño. En Colombia se conoce poco sobre la prevalencia, la gravedad de este síntoma y los efectos en esta población, al igual que en otros grupos como correturnos, vigilantes, personal sanitario, pilotos, militares, etc. Objetivo. Determinar la incidencia de somnolencia diurna excesiva en estudiantes de noveno semestre de medicina de la Universidad Nacional de Colombia, quienes realizan turnos nocturnos en las rotaciones asignadas y evaluar su relación con la calidad e higiene de sueño. Material y métodos. Estudio descriptivo transversal, realizado en una muestra de estudiantes 76,14% (n=83/ 109 de noveno semestre de medicina que aceptaron participar en la investigación mediante consentimiento informado. Se aplicó la escala de somnolencia de Epworth y el índice de calidad de sueño de Pittsburgh validados localmente y el índice de higiene de sueño validado en Perú. Resultados. Los evaluados tuvieron un promedio de edad de 23 años, presentaron somnolencia diurna excesiva el 60,24% (n=50/83. Se halló 79,52% (n=66/83 de sujetos malos dormidores y 44,58% (n=37/83 con mala higiene de sueño. Conclusiones. La prevalencia de somnolencia diurna excesiva en la población estudiada es cuantitativamente importante y superior a la hallada en otros estudios, muestra relación con la mala calidad de sueño y con una mala higiene de sueño considerable.Background. Medical students traditionally sleep very little, study during long nocturnal periods and consequently suffer excessive daytime sleepiness, thereby leading to reduced attention which affects their quality of life and academic performance. The

  15. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    Energy Technology Data Exchange (ETDEWEB)

    Bowman, Stephen M [ORNL

    2008-09-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  16. A High Temperature Hermetic Primer and a Variable Spring Tester

    Energy Technology Data Exchange (ETDEWEB)

    Begeal, D.R.

    1994-05-01

    Percussion primers are used at Sandia to ignite energetic components such as pyrotechnic actuators and thermal batteries. This report describes a High Temperature Hermetic Primer (HTHP) that was developed to replace a previous G16 Percussion Primer Subassembly (Gl6PPS). The ignition mix in these primers is the same as in the discontinued Remington 44G16 (KC1O{sub 3}, SbS{sub 3}, and Ca{sub 2}Si). The HTHP has nearly the same sensitivity as the 44G16 and a significantly lower sensitivity than the G16PPS. In parallel with the HTHP development, we also designed a Variable Spring Tester (VST) to determine percussion primer ignition sensitivity with firing pins that have the same mass as those used in field applications. The tester is capable of accelerating firing pins over a velocity range of 100 to 600 inches per second for pins weighing up to 6 grams. The desired impulse can be preselected with an accuracy of better than {plus_minus}1%. The actual impulse is measured on every shot. The VST was characterized using the WW42Cl primer, as well as with the G16PPS and the HTHP. Compared to data from conventional ball drop testers, we found that ignition sensitivities were lower and there was less scatter in the sensitivity data. Our experiments indicate that ignition sensitivity is not strictly energy dependent, but also depends on the rate of deposition, or firing pin velocity in this case. Development results for the HTHP and Variable Spring Tester are discussed and design details are shown.

  17. New cyt b gene universal primer set for forensic analysis.

    Science.gov (United States)

    Lopez-Oceja, A; Gamarra, D; Borragan, S; Jiménez-Moreno, S; de Pancorbo, M M

    2016-07-01

    Analysis of mitochondrial DNA, and in particular the cytochrome b gene (cyt b), has become an essential tool for species identification in routine forensic practice. In cases of degraded samples, where the DNA is fractionated, universal primers that are highly efficient for the amplification of the target region are necessary. Therefore, in the present study a new universal cyt b primer set with high species identification capabilities, even in samples with highly degraded DNA, has been developed. In order to achieve this objective, the primers were designed following the alignment of complete sequences of the cyt b from 751 species from the Class of Mammalia listed in GenBank. A highly variable region of 148bp flanked by highly conserved sequences was chosen for placing the primers. The effectiveness of the new pair of primers was examined in 63 animal species belonging to 38 Families from 14 Orders and 5 Classes (Mammalia, Aves, Reptilia, Actinopterygii, and Malacostraca). Species determination was possible in all cases, which shows that the fragment analyzed provided a high capability for species identification. Furthermore, to ensure the efficiency of the 148bp fragment, the intraspecific variability was analyzed by calculating the concordance between individuals with the BLAST tool from the NCBI (National Center for Biotechnological Information). The intraspecific concordance levels were superior to 97% in all species. Likewise, the phylogenetic information from the selected fragment was confirmed by obtaining the phylogenetic tree from the sequences of the species analyzed. Evidence of the high power of phylogenetic discrimination of the analyzed fragment of the cyt b was obtained, as 93.75% of the species were grouped within their corresponding Orders. Finally, the analysis of 40 degraded samples with small-size DNA fragments showed that the new pair of primers permits identifying the species, even when the DNA is highly degraded as it is very common in

  18. Effect of rotary instrumentation and of the association of calcium hydroxide and chlorhexidine on the antisepsis of the root canal system in dogs Efeito da instrumentação automatizada e da associação hidróxido de cálcio e clorexidina na anti-sepsia de canais radiculares de cães

    Directory of Open Access Journals (Sweden)

    Janir Alves Soares

    2006-04-01

    Full Text Available This study aimed at evaluating the antisepsis of the root canal system (RCS and periapical region (PR provided by rotary instrumentation associated with chlorhexidine + calcium hydroxide as intracanal medicament. Chronic periapical lesions were induced in 26 pre-molar roots in two dogs. After microbiological sampling, automatic instrumentation using the Profile system and irrigation with 5.25% sodium hypochlorite solution, with a final rinse of 14.3% EDTA followed by profuse irrigation with physiological saline were carried out in 18 root canals. After drying the canals, a paste based on calcium hydroxide associated with a 2% chlorhexidine digluconate solution was placed inside them. After 21 days, the medication was removed, leaving the root canals empty and coronally sealed. After 96 hours, a final microbiological sample was obtained, followed by histomicrobiological processing by the Brown & Brenn method. Eight untreated root canals represented the control group (C-G. Based on the Mann-Whitney test at a confidence level of 5% (p Este estudo objetivou avaliar a anti-sepsia do sistema de canais radiculares (SCR e da região periapical (RP proporcionada pela instrumentação automatizada associada a medicação intracanal à base de hidróxido de cálcio + clorexidina. Lesões periapicais crônicas foram induzidas em 26 raízes de pré-molares de dois cães. Após amostragem microbiológica, procedeu-se à instrumentação automatizada de 18 canais radiculares (CR utilizando-se o sistema Profile e a solução de hipoclorito de sódio a 5,25%, com irrigação final com EDTA a 14,3%, seguida de irrigação profusa com soro fisiológico. Após se secarem os canais, foi colocada em seu interior uma pasta à base de hidróxido de cálcio P.A. associada à solução de digluconato de clorexidina a 2%. Transcorridos 21 dias, removeu-se a medicação, deixando-se os CR vazios e selados coronariamente. Após 96 horas, obteve-se a amostra microbiol

  19. Novel nuclear intron-spanning primers for Arecaceae evolutionary biology.

    Science.gov (United States)

    Bacon, Christine D; Feltus, F Alex; Paterson, Andrew H; Bailey, C Donovan

    2008-01-01

    In this study, 96 nuclear 'conserved intron-scanning primers' were screened across subfamilies the Arecaceae (palms) for potential use in research focused on palm evolutionary biology. Primers were evaluated based on their ability to amplify single polymerase chain reaction products in Arecaceae, the clarity of sequencing reads, and the interspecific variability observed. Ultimately, the results suggest that: (i) seven of the loci are likely to be suitable when comparing non-Arecaceae outgroups and Arecaceae ingroups; (ii) seven loci may be of use when comparing subfamilies of Arecaceae; and (iii) four of the loci may be of use when comparing closely related genera.

  20. A primer on wavelets and their scientific applications

    CERN Document Server

    Walker, James S

    2008-01-01

    In the first edition of his seminal introduction to wavelets, James S. Walker informed us that the potential applications for wavelets were virtually unlimited. Since that time thousands of published papers have proven him true, while also necessitating the creation of a new edition of his bestselling primer. Updated and fully revised to include the latest developments, this second edition of A Primer on Wavelets and Their Scientific Applications guides readers through the main ideas of wavelet analysis in order to develop a thorough appreciation of wavelet applications. Ingeniously relying o

  1. Criticality calculations with MCNP{sup TM}: A primer

    Energy Technology Data Exchange (ETDEWEB)

    Mendius, P.W. [ed.; Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-08-01

    The purpose of this Primer is to assist the nuclear criticality safety analyst to perform computer calculations using the Monte Carlo code MCNP. Because of the closure of many experimental facilities, reliance on computer simulation is increasing. Often the analyst has little experience with specific codes available at his/her facility. This Primer helps the analyst understand and use the MCNP Monte Carlo code for nuclear criticality analyses. It assumes no knowledge of or particular experience with Monte Carlo codes in general or with MCNP in particular. The document begins with a Quickstart chapter that introduces the basic concepts of using MCNP. The following chapters expand on those ideas, presenting a range of problems from simple cylinders to 3-dimensional lattices for calculating keff confidence intervals. Input files and results for all problems are included. The Primer can be used alone, but its best use is in conjunction with the MCNP4A manual. After completing the Primer, a criticality analyst should be capable of performing and understanding a majority of the calculations that will arise in the field of nuclear criticality safety.

  2. The development, characterization and testing of magnesium-rich primers

    Science.gov (United States)

    Battocchi, Dante

    Aluminum alloys are widely used in aircraft industry for their strength and light weight. Those alloys that are hardened by precipitation, especially the Copper-rich of the 2000 series, are prone to corrosion and are protected against it using chromate containing coatings. The primary component of these coating systems is Chromium 6+ (CrVI) that has been found to be very toxic in the environment and carcinogenic, toxic and mutagenic in humans. The Mg-rich primer development is the result of a successful multi-year project funded by the US Air-force with its objective the replacement of coatings based on CrVI with a class of coatings less toxic and with comparable protective performances. The Mg rich primer fulfilled the USAF requirements and it is currently undergoing commercial and military qualifications testing. The use of Mg as one of the active pigments in coatings allows the primer to protect the underlying Al sacrificially, not considered possible for this substrate until now. Mg is anodic to most of the other structural metals and when particulate Mg became available commercially, the concept of the primer was first developed by analogy to Zn-rich coatings for steel. When Mg and Al are in contact and immersed in a corrosive environment, magnesium corrodes preferentially and protects the aluminum.

  3. Barcoded Primers Used in Multiplex Amplicon Pyrosequencing Bias Amplification

    OpenAIRE

    2012-01-01

    “Barcode-tagged” PCR primers used for multiplex amplicon sequencing generate a thus-far-overlooked amplification bias that produces variable terminal restriction fragment length polymorphism (T-RFLP) and pyrosequencing data from the same environmental DNA template. We propose a simple two-step PCR approach that increases reproducibility and consistently recovers higher genetic diversity in pyrosequencing libraries.

  4. Characteristics of the population employed in primer sector in Turkey

    Directory of Open Access Journals (Sweden)

    Bayar Rüya

    2006-01-01

    Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

  5. Diversity of internal structures in inhibited epoxy primers

    Directory of Open Access Journals (Sweden)

    Anthony E. Hughes

    2015-10-01

    Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.

  6. STITCHER 2.0: primer design for overlapping PCR applications.

    Science.gov (United States)

    O'Halloran, Damien M; Uriagereka-Herburger, Isabel; Bode, Katrin

    2017-03-30

    Overlapping polymerase chain reaction (PCR) is a common technique used by researchers in very diverse fields that enables the user to 'stitch' individual pieces of DNA together. Previously, we have reported a web based tool called STITCHER that provides a platform for researchers to automate the design of primers for overlapping PCR applications. Here we present STITCHER 2.0, which represents a substantial update to STITCHER. STITCHER 2.0 is a newly designed web tool that automates the design of primers for overlapping PCR. Unlike STITCHER, STITCHER 2.0 considers diverse algorithmic parameters, and returns multiple result files that include a facility for the user to draw their own primers as well as comprehensive visual guides to the user's input, output, and designed primers. These result files provide greater control and insight during experimental design and troubleshooting. STITCHER 2.0 is freely available to all users without signup or login requirements and can be accessed at the following webpage: www.ohalloranlab.net/STITCHER2.html.

  7. STITCHER 2.0: primer design for overlapping PCR applications

    Science.gov (United States)

    O’Halloran, Damien M.; Uriagereka-Herburger, Isabel; Bode, Katrin

    2017-01-01

    Overlapping polymerase chain reaction (PCR) is a common technique used by researchers in very diverse fields that enables the user to ‘stitch’ individual pieces of DNA together. Previously, we have reported a web based tool called STITCHER that provides a platform for researchers to automate the design of primers for overlapping PCR applications. Here we present STITCHER 2.0, which represents a substantial update to STITCHER. STITCHER 2.0 is a newly designed web tool that automates the design of primers for overlapping PCR. Unlike STITCHER, STITCHER 2.0 considers diverse algorithmic parameters, and returns multiple result files that include a facility for the user to draw their own primers as well as comprehensive visual guides to the user’s input, output, and designed primers. These result files provide greater control and insight during experimental design and troubleshooting. STITCHER 2.0 is freely available to all users without signup or login requirements and can be accessed at the following webpage: www.ohalloranlab.net/STITCHER2.html. PMID:28358011

  8. Criticality calculations with MCNP{trademark}: A primer

    Energy Technology Data Exchange (ETDEWEB)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A. [New Mexico Univ., Albuquerque, NM (United States)

    1994-06-06

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand.

  9. CONCEPCIONES Y TENDENCIAS EN LA EVALUACIÓN DEL PROFESOR UNIVERSITARIO. EL CASO DE LA UNIVERSIDAD NACIONAL DE COLOMBIA, FACULTAD DE MEDICINA, DEPARTAMENTO DE NUTRICIÓN Y TERAPIAS, PRIMER SEMESTRE DE 2005 Conceptions and tendences in evaluations to university teacheres. A case study (departament of nutririon National University of Colombia

    Directory of Open Access Journals (Sweden)

    Fabiola Becerra Bulla

    2008-03-01

    Full Text Available Antecedentes. Realizar un análisis de la evaluación que se aplica al profesor universitario teniendo en cuenta los procesos evaluativos institucionales, las políticas educativas de evaluación internacionales y nacionales, las concepciones y tendencias sobre evaluación en los Departamentos de Nutrición y Terapias de la Facultad de Medicina. Material y métodos. La investigación se enmarcó en el modelo cualitativo de investigación y de evaluación, de corte descriptivo e interpretativo. A través de la técnica de investigación denominada análisis de contenidos, se establecieron cuatro categorías que permitieron analizar la información. Resultados. El estudio evidencia que la evaluación del docente en la Universidad Nacional de Colombia se enmarca en una concepción tradicional, la cual da mayor importancia a los resultados, que a los procesos y no facilita la participación de los docentes en su diseño, análisis y toma de decisiones. Conclusiones. La evaluación parece responder a una tendencia de rendición de cuentas, basada principalmente en la medición del cumplimiento de los deberes contractuales del profesor, como son la aplicación de un programa curricular y el logro de objetivos y resultados. A partir de esta investigación es conveniente repensar la evaluación del docente dándole un carácter formativo, de manera que permita enriquecer el proceso de evaluación y más que todo la práctica docente. Al final de este artículo se presentan algunas sugerencias y recomendaciones con el fin de resignificar la evaluación que los estudiantes realizan a los profesores universitarios.Background. To do an analysis of the evaluation that is applied to university teachers taking into account the institutional evaluation processes, the national and international policies on education evaluation, the conceptions and tendencies on evaluation prevailing in the departments of nutrition and different therapies of the school of Medicine. Materials and methods. The research was framed within of qualitative model for research and evaluation, of the descriptive and interpretative type. Using the technique called contents analysis fourth categories were established for the analysis of information. Results. The study showed that the evaluation teachers of carried out in the National University of Colombia is framed within the traditional conception, that is, gave importance to the results than to the processes, without facilitating the teachers participation in its design, neither in the decision taking about why and what for the evaluation process are carried out. Conclusions. The evaluation seems to respond to the tendency to be accountable, it is mainly based in measuring how much the teacher has full filled its duties as a professor, and that much developed a curricular program its objectives and results. Taking into account the results of this research, it is advisable a new professor evaluation of teachers giving to it a formative character, in this way the evaluation process will be improved but, the teaching practices even more. Some suggestions and recommendations are given in order to provide a new meaning to the evaluation of university teachers.

  10. PERCEPCIÓN DE SATISFACCIÓN Y NECESIDADES EN EL ASPECTO BIO-PSICO-SOCIAL DE LOS ADULTOS MAYORES DEL BARRIO COLINAS DEL NORTE DE LA PARROQUIA COTOCOLLAO DEL DISTRITO METROPOLITANO DE QUITO DURAQNTE EL PRIMER SEMESTRE DEL AÑO 2015.

    OpenAIRE

    Gubio-Quishpe, Paola Alexandra

    2015-01-01

    Este estudio van en relación a conocer las causas que genera que el adulto mayor no pueda participar en actividades recreativas, físicas y sociales, las cuales en el desarrollo de esta Tesis se van descubriendo y aclarando a través del resultado de esta investigación. La información de este trabajo expone los cambios tanto físicos, psicológicos y sociales que adquiere el Adulto Mayor por entrar a la etapa de la vejez, cómo estos se van convirtiendo en cambios malignos por la falta especial...

  11. AUTOESTIMA EN ESTUDIANTES DE PRIMER SEMESTRE DEL PROGRAMA DE PSICOLOGÍA DE UNA UNIVERSIDAD PRIVADA DE LA COSTA CARIBE COLOMBIANA -- SELF-ESTEEM OF FIRST-SEMESTER STUDENT FROM THE PSYCHOLOGY PROGRAM AT A PRIVATE UNIVERSITY IN THE COLOMBIAN CARIBBEAN COAST

    Directory of Open Access Journals (Sweden)

    LILIA ANGéLICA CAMPO TERNERA

    2009-06-01

    Full Text Available Studied the level of self-esteem of students entering first semester psychology program, to then determine the effect of an intervention plan, and that self-esteem directly influences then behavior of individuals, will put the question: Which is the level of self-esteem in young people who enter the program in psychology?; for this descriptive study was organized with 128 university students of differents sexes. They were selected intencionally and were applied Coopersmith self esteem inventory (1959 in an adaptation approved J.Prewitt-Diaz (1984. The main results show that men have a better acceptance and valuation of himself that the group of women, while self-esteem in relation to family, social and educational best performance was observed in the group of women, equally although differences are not significant, the group of children has a tendency towards better performance in the areas evaluated.

  12. White primer permits a corrosion-resistant coating of minimum weight

    Science.gov (United States)

    Albrecht, R. H.; Jensen, D. P.; Schnake, P.

    1966-01-01

    White primer for coating 2219 aluminum alloy supplies a base for a top coating of enamel. A formulation of pigments and vehicle results in a primer with high corrosion resistance and minimum film thickness.

  13. Generation of polymerase chain reaction-specific probes for library screening using single degenerate primers.

    Science.gov (United States)

    Hommes, N G; Arp, D J; Sayavedra-Soto, L A

    1995-03-01

    Degenerate oligonucleotide primers were made to peptide sequences from hydroxylamine oxidoreductase (HAO) from Nitrosomonas europaea. The primers were used singly in PCR reactions to amplify portions of the gene for HAO from genomic DNA. Southern hybridizations using fragments amplified with each primer showed that they labeled the same genomic DNA fragments. The PCR-amplified fragments were successfully used to screen a gene library for clones containing the HAO gene. The method of isolating genes by PCR with single primers has general utility.

  14. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

    1998-12-10

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  15. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-09-27

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  16. Microsatellite Primers for the Pacific Northwest Conifer Callitropsis nootkatensis (Cupressaceae

    Directory of Open Access Journals (Sweden)

    Tara N. Jennings

    2013-09-01

    Full Text Available Premise of the study: Microsatellite primers were developed for Nootka cypress (Callitropsis nootkatensis to provide quantitative measures for gene conservation that can assist in guiding management decisions for a species experiencing climate-induced decline. Methods and Results: Using multiplexed massively parallel sequencing, we identified 136,785 microsatellite-containing sequences from 489,625 Illumina paired-end 80-bp reads. After stringent filtering, we selected 144 primer pairs and screened variation at these loci in five populations of C. nootkatensis. Loci show between three and 36 dinucleotide repeats per locus, with an average of 13. Screening of these markers in the Pacific Northwest relative Chamaecyparis lawsoniana demonstrated no marker transferability. This finding highlights the narrow taxonomic utility of microsatellite markers in Callitropsis. Conclusions: These microsatellites show high polymorphism and can be used for routine screening of natural variation in Callitropsis nootkatensis, and will be particularly helpful in identifying clones and inbred relatives at the stand-level.

  17. Perbedaan Kadar Superokside Dismutase pada Remaja dengan Dismenore Primer dan Tanpa Dismenore Primer

    Directory of Open Access Journals (Sweden)

    Yanti .

    2016-01-01

    Full Text Available Abstrak             Dismenore didefinisikan sebagai rasa kram saat menstruasi yang menyakitkan tanpa patologi yang jelas. Kram berlangsung selama satu hari atau lebih dan disertai rasa mual, diare, sakit kepala. Masalah yang ditimbulkan oleh dismenore adalah  peningkatan ketidakhadiran di sekolah pada remaja sehingga menyebabkan rendahnya nilai akademik pada pelajar. Superokside dismutase (SOD adalah bahan bioaktif yang diketahui bersifat antioksidan. SOD melindungi sel terhadap gangguan oksidan (radikal bebas. SOD mengubah anion superoksida menjadi hidrogen peroksida dan oksigen, sering disebut juga sebagai pertahanan primer terhadap stress oksidatif. Tujuan penelitian ini adalah mengetahui  perbedaan kadar superokside dismutase pada remaja dengan dismenore dan tanpa dismenore. Penelitian ini adalah observasional desain cross sectional comparative. Data dianalisis menggunakan uji Mann-Withney  dengan nilai p<0.05 dianggap bermakna secara statistik. Rerata kadar SOD pada remaja yang mengalami dismenore yaitu 36,76 u/ml dan rerata kadar SOD pada remaja tanpa dismenore yaitu 32,24 u/ml. Dengan nilai p>0,005 (0,345. Hasil penelitian ini menyimpulkan bahwa tidak terdapat perbedaan yang bermakna  kadar SOD pada remaja dengan dismenore dan tanpa dismenore. Kata kunci: remaja, dismenore, antioksidan, superokside dismutase AbstractPrimary dysmenorrhoe is  a painful menstrual cramps without obvious pathology. Cramps is lasting for one day or more, accaompanied by nausea, diarrhea and headache. Problems cause by dysmenorrhea are an increase in school attendance in adolescents resulting in low academic grades of students. Superokside Dismeutase (SOD is a bioactive ingredient that is known as antioxidants, protecting cells against harmful SOD oxidants (free radicals SOD convert superoxide anion into hydrogen perokxide and oxygen, often call  as primary defense agains oxidative stress. Primary dysmenorrhoe increased uterine activity or

  18. Primer on Molecular Genetics; DOE Human Genome Program

    Science.gov (United States)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  19. Small Commercial Building Re-tuning: A Primer

    Energy Technology Data Exchange (ETDEWEB)

    Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas

    2013-09-30

    To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

  20. Development of a Nonchromate Structural Adhesive Bond Primer

    Science.gov (United States)

    2014-11-01

    Prevent corrosion of base metal • Applied to porous anodized surface • Overcoated with non- inhibited epoxy adhesive • High adhesive bond strength...primers •Long-running surveillance of chromate-free alternatives by UTC companies shows weak corrosion inhibition • (A) strontium chromate... corrosion inhibiter achieved Electrokinetic Confirmation of Active Inhibition in Coatings 7 Schematic of defect production and samples for salt

  1. Primer on molecular genetics. DOE Human Genome Program

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  2. Two generic PCR primer sets for the detection of members of the genus Torradovirus

    NARCIS (Netherlands)

    Verbeek, M.; Tang, J.; Ward, L.

    2012-01-01

    Two degenerate primer pairs were designed for the universal detection of members of the genus Torradovirus. Primer pair Torrado-1F/Torrado-1R was designed based on the RNA-dependent RNA polymerase region located in RNA1 and primer pair Torrado-2F/Torrado-2R based on a region overlapping the two firs

  3. Design of primers and probes for quantitative real-time PCR methods.

    Science.gov (United States)

    Rodríguez, Alicia; Rodríguez, Mar; Córdoba, Juan J; Andrade, María J

    2015-01-01

    Design of primers and probes is one of the most crucial factors affecting the success and quality of quantitative real-time PCR (qPCR) analyses, since an accurate and reliable quantification depends on using efficient primers and probes. Design of primers and probes should meet several criteria to find potential primers and probes for specific qPCR assays. The formation of primer-dimers and other non-specific products should be avoided or reduced. This factor is especially important when designing primers for SYBR(®) Green protocols but also in designing probes to ensure specificity of the developed qPCR protocol. To design primers and probes for qPCR, multiple software programs and websites are available being numerous of them free. These tools often consider the default requirements for primers and probes, although new research advances in primer and probe design should be progressively added to different algorithm programs. After a proper design, a precise validation of the primers and probes is necessary. Specific consideration should be taken into account when designing primers and probes for multiplex qPCR and reverse transcription qPCR (RT-qPCR). This chapter provides guidelines for the design of suitable primers and probes and their subsequent validation through the development of singlex qPCR, multiplex qPCR, and RT-qPCR protocols.

  4. Wash Primer Replacement Based on the Superprimer Technology

    Science.gov (United States)

    2011-09-01

    DoD­P­15328D wash primer. Figure 51. FTIR  spectra  of ECO­008 and ECO5­1. viii Figure 52. FTIR  spectra  of ECO5­1 with different drying conditions. Figure 53...MIL­ PRF­85582 primers, in which  strontium  chromate is used as the major corrosion inhibitor.  The MIL­DTL­53030B primer contains zinc phosphate as...is obtained through the use of the silane. 5.2.5. FTIR characterization FTIR  spectra  of DoD­P­15328D, ECO­008 and ECO5­1 are shown in Figures 50­52

  5. Sensory reception of the primer pheromone ethyl oleate

    Science.gov (United States)

    Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

    2012-05-01

    Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

  6. Effect of oligonucleotide primers in determining viral variability within hosts

    Directory of Open Access Journals (Sweden)

    Moya Andrés

    2004-12-01

    Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  7. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    D. S. Lucas

    2004-10-01

    A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com.

  8. Preliminary Evaluation of the Acute Toxicity of Desensitized Primer Compounds and Primer Waste Effluents to Representative Aquatic Organisims

    Science.gov (United States)

    1975-11-01

    daphnids, with 48-hour LC50 values for these two materials being several orders of magnitude lower than those observed for lead styphnate , PETN and... styphnate (PoTNR), tetracene (= tetrazene), pentaerythritol tetranitrate (PETN), .and FA 956 priming mixture. The FA 956 mixture is composed of: 37...PbTNR, 4% tetracene, 5% PETN, 32% barium nitrate, 15% antimony sulfide and 7% aluminum (Small and Rosenblatt, 1974). Each of these primer components was

  9. Recovery of the mitochondrial COI barcode region in diverse Hexapoda through tRNA-based primers

    Directory of Open Access Journals (Sweden)

    Oh Hyun-Woo

    2010-07-01

    Full Text Available Abstract Background DNA barcoding uses a 650 bp segment of the mitochondrial cytochrome c oxidase I (COI gene as the basis for an identification system for members of the animal kingdom and some other groups of eukaryotes. PCR amplification of the barcode region is a key step in the analytical chain, but it sometimes fails because of a lack of homology between the standard primer sets and target DNA. Results Two forward PCR primers were developed following analysis of all known arthropod mitochondrial genome arrangements and sequence alignment of the tRNA-W gene which was usually located within 200 bp upstream of the COI gene. These two primers were combined with a standard reverse primer (LepR1 to produce a cocktail which generated a barcode amplicon from 125 of 141 species that included representatives of 121 different families of Hexapoda. High quality sequences were recovered from 79% of the species including groups, such as scale insects, that invariably fail to amplify with standard primers. Conclusions A cocktail of two tRNA-W forward primers coupled with a standard reverse primer amplifies COI for most hexapods, allowing characterization of the standard barcode primer binding region in COI 5' as well as the barcode segment. The current results show that primers designed to bind to highly conserved gene regions upstream of COI will aid the amplification of this gene region in species where standard primers fail and provide valuable information to design a primer for problem groups.

  10. Comparison and validation of some ITS primer pairs useful for fungal metabarcoding studies.

    Directory of Open Access Journals (Sweden)

    Michiel Op De Beeck

    Full Text Available Current metabarcoding studies aiming to characterize microbial communities generally rely on the amplification and sequencing of relatively short DNA regions. For fungi, the internal transcribed spacer (ITS region in the ribosomal RNA (rRNA operon has been accepted as the formal fungal barcode. Despite an increasing number of fungal metabarcoding studies, the amplification efficiency of primers is generally not tested prior to their application in metabarcoding studies. Some of the challenges that metabarcoding primers should overcome efficiently are the amplification of target DNA strands in samples rich in non-target DNA and environmental pollutants, such as humic acids, that may have been co-extracted with DNA. In the current study, three selected primer pairs were tested for their suitability as fungal metabarcoding primers. The selected primer pairs include two primer pairs that have been frequently used in fungal metabarcoding studies (ITS1F/ITS2 and ITS3/ITS4 and a primer pair (ITS86F/ITS4 that has been shown to efficiently amplify the ITS2 region of a broad range of fungal taxa in environmental soil samples. The selected primer pairs were evaluated in a 454 amplicon pyrosequencing experiment, real-time PCR (qPCR experiments and in silico analyses. Results indicate that experimental evaluation of primers provides valuable information that could aid in the selection of suitable primers for fungal metabarcoding studies. Furthermore, we show that the ITS86F/ITS4 primer pair outperforms other primer pairs tested in terms of in silico primer efficiency, PCR efficiency, coverage, number of reads and number of species-level operational taxonomic units (OTUs obtained. These traits push the ITS86F/ITS4 primer pair forward as highly suitable for studying fungal diversity and community structures using DNA metabarcoding.

  11. Environmental DNA sequencing primers for eutardigrades and bdelloid rotifers

    Directory of Open Access Journals (Sweden)

    Martin Andrew P

    2009-12-01

    Full Text Available Abstract Background The time it takes to isolate individuals from environmental samples and then extract DNA from each individual is one of the problems with generating molecular data from meiofauna such as eutardigrades and bdelloid rotifers. The lack of consistent morphological information and the extreme abundance of these classes makes morphological identification of rare, or even common cryptic taxa a large and unwieldy task. This limits the ability to perform large-scale surveys of the diversity of these organisms. Here we demonstrate a culture-independent molecular survey approach that enables the generation of large amounts of eutardigrade and bdelloid rotifer sequence data directly from soil. Our PCR primers, specific to the 18s small-subunit rRNA gene, were developed for both eutardigrades and bdelloid rotifers. Results The developed primers successfully amplified DNA of their target organism from various soil DNA extracts. This was confirmed by both the BLAST similarity searches and phylogenetic analyses. Tardigrades showed much better phylogenetic resolution than bdelloids. Both groups of organisms exhibited varying levels of endemism. Conclusion The development of clade-specific primers for characterizing eutardigrades and bdelloid rotifers from environmental samples should greatly increase our ability to characterize the composition of these taxa in environmental samples. Environmental sequencing as shown here differs from other molecular survey methods in that there is no need to pre-isolate the organisms of interest from soil in order to amplify their DNA. The DNA sequences obtained from methods that do not require culturing can be identified post-hoc and placed phylogenetically as additional closely related sequences are obtained from morphologically identified conspecifics. Our non-cultured environmental sequence based approach will be able to provide a rapid and large-scale screening of the presence, absence and diversity of

  12. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Weber, James R.; Schell, Charlotte J.; Marino, T; Bilyard, Gordon R.

    2004-02-10

    This version of the communication primer comprises two interlocking parts: Pat 1, a practical section, intended to prepare you for public interactions, and Part 2, a theoretical section that provides social and technical bases for the practices recommended in Part 1. The mutual support of practice and theory is very familiar in science and clearly requires a willingness to observe and revise our prior assumptions--in this document, we invoke both. We hope that is offering will represent a step both towards improving practice and maturing the theory of practical science communication.

  13. Transport phenomena in Newtonian fluids a concise primer

    CERN Document Server

    Olsson, Per

    2013-01-01

    This short primer provides a concise and tutorial-style introduction to transport phenomena in Newtonian fluids , in particular the transport of mass, energy and momentum.  The reader will find detailed derivations of the transport equations for these phenomena, as well as selected analytical solutions to the transport equations in some simple geometries. After a brief introduction to the basic mathematics used in the text, Chapter 2, which deals with momentum transport, presents a derivation of the Navier-Stokes-Duhem equation describing the basic flow in a Newtonian fluid.  Also provided at

  14. Steel Primer Chamber Assemblies for Dual Initiated Pyrovalves

    Science.gov (United States)

    Guemsey, Carl S.; Mizukami, Masashi; Zenz, Zac; Pender, Adam A.

    2009-01-01

    A solution was developed to mitigate the potential risk of ignition failures and burn-through in aluminum primer chamber assemblies on pyrovalves. This was accomplished by changing the assembly material from aluminum to steel, and reconfiguration of flame channels to provide more direct paths from initiators to boosters. With the geometric configuration of the channels changed, energy is more efficiently transferred from the initiators to the boosters. With the alloy change to steel, the initiator flame channels do not erode upon firing, eliminating the possibility of burn-through. Flight qualification tests have been successfully passed.

  15. Accelerating MATLAB with GPU computing a primer with examples

    CERN Document Server

    Suh, Jung W

    2013-01-01

    Beyond simulation and algorithm development, many developers increasingly use MATLAB even for product deployment in computationally heavy fields. This often demands that MATLAB codes run faster by leveraging the distributed parallelism of Graphics Processing Units (GPUs). While MATLAB successfully provides high-level functions as a simulation tool for rapid prototyping, the underlying details and knowledge needed for utilizing GPUs make MATLAB users hesitate to step into it. Accelerating MATLAB with GPUs offers a primer on bridging this gap. Starting with the basics, setting up MATLAB for

  16. PRIMER REPORTE DE LA FAMILIA CHEIRIDIIDAE (ARACHNIDA: PSEUDOSCORPIONIDA EN COLOMBIA

    Directory of Open Access Journals (Sweden)

    Jorge Alexander QUIRÓS-RODRÍGUEZ

    2015-01-01

    Full Text Available Durante un estudio de la fauna de artrópodos asociada a montículos de detritos de hormigas de la especie Atta colombica Guérin- Méneville, 1844 (Hymenoptera: Formicidae en la hacienda Santa Isabel, corregimiento de Patio Bonito, Córdoba, se encontraron representantes de la familia Cheiridiidae. Por tanto, estos pseudoescorpiones se convierten en el primer reporte de la familia para Colombia y por primera vez se registra su presencia en detritus de hormigas. Así mismo, este reporte, amplía su distribución conocida para Suramérica.

  17. Automated guided vehicle systems a primer with practical applications

    CERN Document Server

    Ullrich, Günter

    2015-01-01

    This primer is directed at experts and practitioners in intralogistics who are concerned with optimizing material flows. The presentation is comprehensive covering both, practical and theoretical aspects with a moderate degree of specialization, using clear and concise language. Areas of operation as well as technical standards of all relevant components and functions are described. Recent developments in technology and in the markets are taken into account. The goal of this book is to further stronger use of automated guided transport systems and the enhancement of their future performance.

  18. Discrete random signal processing and filtering primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2013-01-01

    Engineers in all fields will appreciate a practical guide that combines several new effective MATLAB® problem-solving approaches and the very latest in discrete random signal processing and filtering.Numerous Useful Examples, Problems, and Solutions - An Extensive and Powerful ReviewWritten for practicing engineers seeking to strengthen their practical grasp of random signal processing, Discrete Random Signal Processing and Filtering Primer with MATLAB provides the opportunity to doubly enhance their skills. The author, a leading expert in the field of electrical and computer engineering, offe

  19. Cribado de aneuploidias de primer trimestre en las gestaciones gemelares

    OpenAIRE

    Prats Rodríguez, Pilar

    2013-01-01

    Esta tesis está basada en dos artículos: Articulo 1: Early first-trimester free-β-hCG and PAPP-A serum distributions in monochorionic and dichorionic twins Objetivo: Examinar la distritución en primer trimestre de los marcadores bioquímicos de aneuploidias en gestaciones gemelares dependiendo de su corionicidad. Métodos: La free-β-human chorionic gonadotropin (hCG) en sangre materna y la pregnancy-associated plasma protein A (PAPP-A) fueron analizadas entre las semanas 8–13 + de ...

  20. Shining On: A primer on solar radiation data

    Energy Technology Data Exchange (ETDEWEB)

    Dunlap, M.A.; Cook, G. (eds.); Marion, B.; Riordan, C.; Renne, D.

    1992-05-01

    This document is a primer on solar radiation data. General uses of solar energy are presented. The manner in which solar radiation data is used to aid engineers in optimizing the use of solar thermal conversion and photovoltaic conversion is discussed. Methods for acquiring and assimilating the solar radiation data are illustrated. This would include the design and use of pyranometers and pyrheliometers. Seasonal and geographical variations in solar flux reaching the earth are evaluated. Other uses of compiled data include the determination of meteorological impacts of atmospheric disturbances such as volcano eruptions.

  1. A finite element primer for beginners the basics

    CERN Document Server

    Zohdi, Tarek I

    2014-01-01

    The purpose of this primer is to provide the basics of the Finite Element Method, primarily illustrated through a classical model problem, linearized elasticity. The topics covered are:(1) Weighted residual methods and Galerkin approximations,(2) A model problem for one-dimensional?linear elastostatics,(3) Weak formulations in one dimension,(4) Minimum principles in one dimension,(5) Error estimation in one dimension,(5) Construction of Finite Element basis functions in one dimension,(6) Gaussian Quadrature,(7) Iterative solvers and element by element data structures,(8) A model problem for th

  2. Plan de negocio de una escuela infantil (primer ciclo)

    OpenAIRE

    San Román Gómez, Ana de

    2014-01-01

    El presente documento establece los pasos a seguir para poner en marcha una escuela infantil en el barrio de Butarque, en Madrid. En un primer lugar se han realizado diversos estudios, tanto sobre el sector como sobre el área geográfica, ya que se partía de una situación de absoluto desconocimiento. En el análisis del sector se ha puesto de manifiesto que las competencias en educación en España están reguladas por el Ministerio en primera instancia, pero las Autonomías tienen también una g...

  3. Atmel AVR Microcontroller Primer Programming and Interfacing, Second Edition

    CERN Document Server

    Barrett, Steven F

    2012-01-01

    This textbook provides practicing scientists and engineers a primer on the Atmel AVR microcontroller. In this second edition we highlight the popular ATmega164 microcontroller and other pin-for-pin controllers in the family with a complement of flash memory up to 128 kbytes. The second edition also adds a chapter on embedded system design fundamentals and provides extended examples on two different autonomous robots. Our approach is to provide the fundamental skills to quickly get up and operating with this internationally popular microcontroller. We cover the main subsystems aboard the ATmega

  4. A primer on physical-layer network coding

    CERN Document Server

    Liew, Soung Chang; Zhang, Shengli

    2015-01-01

    The concept of physical-layer network coding (PNC) was proposed in 2006 for application in wireless networks. Since then it has developed into a subfield of communications and networking with a wide following. This book is a primer on PNC. It is the outcome of a set of lecture notes for a course for beginning graduate students at The Chinese University of Hong Kong. The target audience is expected to have some prior background knowledge in communication theory and wireless communications, but not working knowledge at the research level. Indeed, a goal of this book/course is to allow the reader

  5. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  6. De neurocirujano a primer ministro de Salud de la Argentina

    Directory of Open Access Journals (Sweden)

    Karina Inés Ramacciotti

    2008-01-01

    Full Text Available La trayectoria y los vínculos que entabló Ramón Carrillo con anterioridad a ejercer el cargo de primer secretario de Salud Pública en la Argentina (1946 no han sido objeto de estudio pormenorizado. Así pues en este artículo se analizarán en primer lugar, una serie de cartas de lectores publicadas en La Semana Médica en los primeros años de la década del '40 del siglo XX. Estas notas permiten comprender las disputas internas que se produjeron en la Facultad de Ciencias Médicas al producirse el concurso de Titular de Neurocirugía de la Universidad de Buenos Aires. En segundo lugar, se revisará cómo Carrillo pasa de ocupar este prestigioso cargo académico a convertirse en decano interi- no de la Facultad de Ciencias Médicas. Son las relaciones que anuda durante estos años las que lo posicionan en un escenario político privilegiado para alcanzar un relevante puesto en la administración pública.

  7. Microsatellite Primer Development for Post Oak, Quercus stellata (Fagaceae

    Directory of Open Access Journals (Sweden)

    Warren B. Chatwin

    2014-10-01

    Full Text Available Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata. This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.

  8. FullSSR: Microsatellite Finder and Primer Designer

    Directory of Open Access Journals (Sweden)

    Sebastián Metz

    2016-01-01

    Full Text Available Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.

  9. FullSSR: Microsatellite Finder and Primer Designer

    Science.gov (United States)

    Metz, Sebastián; Cabrera, Juan Manuel; Rueda, Eva; Giri, Federico; Amavet, Patricia

    2016-01-01

    Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR) loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user. PMID:27366148

  10. Variables que influyen en la deserción de estudiantes universitarios de primer año. Construcción de índices de riesgo de abandono

    Directory of Open Access Journals (Sweden)

    Aldo Merlino

    2011-01-01

    Full Text Available El presente artículo se enfoca en analizar la relación que existe entre la deserción de los estudios universitarios (durante el primer año cursado y el comportamiento de ciertas variables específicas, medidas en los ingresantes a la Universidad Siglo 21 en Córdoba, Argentina. La investigación permitió desarrollar dos modelos de predicción del riesgo de abandono entre los estudiantes que ingresan a la universidad. Dichos modelos se denominan IRAP (Índice de Riesgo de Abandono Provisorio e IRAD (Índice de Riesgo de Abandono Definitivo. Ambos se expresan en escalas de 5 categorías (desde riesgo muy bajo a muy alto. Los dos índices de riesgo se obtienen a partir de la aplicación de una serie de cuestionarios que miden diferentes variables con las cuales se construyen el IRAP y el IRAD. Ambos índices han sido desarrollados con el propósito de contar con herramientas de predicción de la deserción, lo cual permite trabajar sobre la prevención de la misma de modo anticipado. Entre las principales conclusiones que se obtuvieron en la investigación pueden señalarse la relación del rendimiento académico con la deserción y la capacidad predictiva del índice IRAD, dado que se observa que el 44% de los alumnos con riesgo alto y muy alto, no se reinscribieron en el segundo semestre de cursado.

  11. Selection of functional tRNA primers and primer binding site sequences from a retroviral combinatorial library: identification of new functional tRNA primers in murine leukemia virus replication

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Pedersen, F S

    2000-01-01

    . While most of the selected primer binding sites are complementary to the 3'-end of tRNA((Pro)), we also retrieved PBS sequences matching four other tRNA molecules and demonstrate that Akv murine leukemia virus vectors may efficiently replicate using tRNA(Arg(CCU)), tRNA(Phe(GAA))and a hitherto unknown......Retroviral reverse transcription is initiated from a cellular tRNA molecule and all known exogenous isolates of murine leukemia virus utilise a tRNA(Pro)molecule. While several studies suggest flexibility in murine leukemia virus primer utilisation, studies on human immunodeficiency virus and avian...... retro-viruses have revealed evidence of molecular adapt-ation towards the specific tRNA isoacceptor used as replication primer. In this study, murine leukemia virus tRNA utilisation is investigated by in vivo screening of a retroviral vector combinatorial library with randomised primer binding sites...

  12. Performance testing of lead free primers: blast waves, velocity variations, and environmental testing

    CERN Document Server

    Courtney, Elya; Summer, Peter David; Courtney, Michael

    2014-01-01

    Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blast waves, muzzle velocities, and ignition delay are presented after environmental conditioning (150 days) for two lead based and two DDNP based primers under cold and dry (-25 deg C,0% relative humidity), ambient (20 deg C, 50% relative humidity), and hot & humid (50 deg C, 100% relative humidity) conditions in 5.56 mm NATO. Taken together, these results indicate that DDNP based primers are not sufficiently reliable for service use.

  13. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    DEFF Research Database (Denmark)

    Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

    2011-01-01

    be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...... settings. RESULTS: We describe a PCR method for quantification of microRNAs based on a single reverse transcription reaction for all microRNAs combined with real-time PCR with two, microRNA-specific DNA primers. Primer annealing temperatures were optimized by adding a DNA tail to the primers and could...

  14. Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

    Science.gov (United States)

    Galkiewicz, J.P.; Kellogg, C.A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

  15. Design of a Percussion and Electric Primer Gun Firing Power Supply

    Science.gov (United States)

    2014-07-01

    to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...gun, percussion, electric primer, capacitor 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT UU 18. NUMBER OF PAGES 30 19a. NAME...initial pull of the solenoid, which can be over 50 A. The old linear power supply has large filter capacitors on its output, which does provide the surge

  16. Genus-specific primers for study of Fusarium communities in field samples

    OpenAIRE

    2016-01-01

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium- specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+...

  17. Use of self-quenched, fluorogenic LUX primers for gene expression profiling.

    Science.gov (United States)

    Kusser, Wolfgang

    2006-01-01

    Application of a real-time detection system based on a novel primer design in gene expression profiling is described. In this system, called LUX (Light Upon eXtension), the generation of signal is based on a single fluorescent dye molecule that is attached to an oligonucleotide close to the 3'-end. A primer design software is available that identifies LUX primer pairs based on a set of rules for optimum signal development. The use of LUX fluorogenic primers to determine the expression patterns of various transcripts during differentiation in the P-19 mouse neuronal model is described.

  18. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei

    2008-12-01

    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  19. Aplicación del Texto - Guía y Atlas de Histología y Embriología Humana y el Rendimiento Académico de los Estudiantes de la Escuela de Estomatología de la Universidad Alas Peruanas - Filial Huacho, Semestre 2012-I

    OpenAIRE

    2016-01-01

    La presente investigación tuvo por objetivo, determinar si el uso del Texto - Guía y Atlas de Histología y Embriología Humana mejora el rendimiento académico de los estudiantes de la Escuela de Estomatología de la Universidad Alas Peruanas Filial Huacho semestre 2012- I. Corresponde a una investigación de tipo aplicada; con un diseño pre experimental con un solo grupo, y su propósito fue describir el efecto que ocasiona la aplicación del Texto - Guía y Atlas en la unidad de análisis, la muest...

  20. El Primer Congreso de la Cultura del Olivo

    Directory of Open Access Journals (Sweden)

    Criado Costa, Joaquín

    2008-06-01

    Full Text Available It is studied the notification, the organization and the development of the First Conference on the Olive Culture as an activity shared by the CECEL, the Institute of Jaen Studies, the Institute of La Mancha Studies and the Royal Academy of Science, Fine Literature and Noble Arts of Cordoba with the support of Jaen Provincial Council.Se estudia la convocatoria, organización y desarrollo del Primer Congreso de la Cultura del Olivo como actividad conjunta de la CECEL, el Instituto de Estudios Jiennenses, el Instituto de Estudios Manchegos y la Real Academia de Ciencias, Bellas Letras y Nobles Artes de Córdoba, con el patrocinio de la Diputación Provincial de Jaén.

  1. Antibiotic resistance: a primer and call to action.

    Science.gov (United States)

    Smith, Rachel A; M'ikanatha, Nkuchia M; Read, Andrew F

    2015-01-01

    During the past century, discoveries of microorganisms as causes of infections and antibiotics as effective therapeutic agents have contributed to significant gains in public health in many parts of the world. Health agencies worldwide are galvanizing attention toward antibiotic resistance, which is a major threat to public health (Centers for Disease Control and Prevention, 2013; World Health Organization, 2014). Some life scientists believe that we are approaching the post-antibiotic age (Davies & Davies, 2010). The growing threat of antimicrobial resistance is fueled by complex factors with biological, behavioral, and societal aspects. This primer provides an overview of antibiotic resistance and its growing burden on public health, the biological and behavioral mechanisms that increase antibiotic resistance, and examples of where health communication scholars can contribute to efforts to make our current antibiotic drugs last as long as possible. In addition, we identify compelling challenges for current communication theories and practices.

  2. Demystifying eResearch a primer for librarians

    CERN Document Server

    Martin, Victoria

    2014-01-01

    Today's librarians need to be technology-savvy information experts who understand how to manage datasets. Demystifying eResearch: A Primer for Librarians prepares librarians for careers that involve eResearch, clearly defining what it is and how it impacts library services and collections, explaining key terms and concepts, and explaining the importance of the field. You will come to understand exactly how the use of networked computing technologies enhances and supports collaboration and innovative methods particularly in scientific research, learn about eResearch library initiatives and best practices, and recognize the professional development opportunities that eResearch offers. This book takes the broad approach to the complex topic of eResearch and how it pertains to the library community, providing an introduction that will be accessible to readers without a background in electronic research. The author presents a conceptual overview of eResearch with real-world examples of electronic research activit...

  3. Microsatellite primers for the rare sedge Lepidosperma bungalbin (Cyperaceae)1

    Science.gov (United States)

    Nevill, Paul G.; Wardell-Johnson, Grant

    2016-01-01

    Premise of the study: Microsatellite markers were developed for the rare sedge Lepidosperma bungalbin (Cyperaceae) to assess genetic variation and its spatial structuring. Methods and Results: We conducted shotgun sequencing on an Illumina MiSeq and produced 6,215,872 sequence reads. The QDD pipeline was used to design 60 primer pairs that were screened using PCR. We developed 17 loci, of which 12 loci were identified that were polymorphic, amplified reliably, and could be consistently scored. We then screened these loci for variation in individuals from three populations. The number of alleles observed for these 12 loci across the three populations ranged from nine to 19 and expected heterozygosity ranged from 0.41 to 0.89. Conclusions: These markers will enable the quantification of the potential impact of mining on genetic variation within L. bungalbin and establish a baseline for future management of genetic variation of the rare sedge. PMID:27843727

  4. Postpositivism and Accounting Research : A (Personal Primer on Critical Realism

    Directory of Open Access Journals (Sweden)

    Jayne Bisman

    2010-12-01

    Full Text Available This paper presents an overview and primer on the postpositivist philosophy of critical realism. Theexamination of this research paradigm commences with the identification of the underlying motivations thatprompted a personal exploration of critical realism. A brief review of ontology, epistemology andmethodology and the research philosophies and methods popularly applied in accounting is then provided.The meta-theoretical basis of critical realism and the ontological and epistemological assumptions that gotowards establishing the ‘truth’ and validity criteria underpinning this paradigm are detailed, and therelevance and potential applications of critical realism to accounting research are also discussed. The purposeof this discussion is to make a call to diversify the approaches to accounting research, and – specifically – toassist researchers to realise the potential for postpositivist multiple method research designs in accounting.This is aided through an illustration that functions to highlight how and why this approach was applied in areal-world accounting research study.

  5. Soft solids a primer to the theoretical mechanics of materials

    CERN Document Server

    Freed, Alan D

    2014-01-01

    This textbook presents the physical principles pertinent to the mathematical modeling of soft materials used in engineering practice, including both man-made materials and biological tissues. It is intended for seniors and masters-level graduate students in engineering, physics, or applied mathematics. It will also be a valuable resource for researchers working in mechanics, biomechanics, and other fields where the mechanical response of soft solids is relevant.   Soft Solids: A Primer to the Theoretical Mechanics of Materials is divided into two parts. Part I introduces the basic concepts needed to give both Eulerian and Lagrangian descriptions of the mechanical response of soft solids. Part II presents two distinct theories of elasticity and their associated theories of viscoelasticity. Seven boundary-value problems are studied over the course of the book, each pertaining to an experiment used to characterize materials. These problems are discussed at the end of each chapter, giving students the opportunit...

  6. La integración curricular: Una experiencia en el primer nivel de diplomado de la carrera de Licenciatura en Pedagogía con énfasis en Educación Preescolar / Curriculum Integration: An Experience in the First Year of the Two-year Program Conducive to a Licenciatura in Pedagogy with a Specialization in Preschool Education

    Directory of Open Access Journals (Sweden)

    Ana Lucía Chaves Álvarez

    2011-11-01

    Full Text Available Recibido 28 de setiembre de 2011 • Aceptado 24 de octubre de 2011 • Corregido 06 de noviembre de 2011 Resumen. Se plantea una reflexión acerca de la experiencia de integración curricular realizada por académicos y académicas universitarias, del primer nivel de diplomado de la carrera de Licenciatura en Pedagogía con énfasis en Educación Preescolar, de la División de Educación Básica de la Universidad Nacional, durante el primer semestre del año 2011. La integración ha sido concebida por el equipo del nivel como un proceso de crecimiento personal y profesional, para generar oportunidades que permitan el fortalecimiento de equipos docentes y de los cursos del nivel, en procura de brindar mayores oportunidades para el desarrollo estudiantil. Abstract. This paper is a reflection on the curriculum integration experience of faculty members in the first year of the two-year program conducive to a Licenciatura(* in Pedagogy with a specialization in Preschool Education of the Division of Basic Education, Universidad Nacional, Costa Rica, during the first half of 2011. The integration has been designed by the faculty members as a process of personal and professional growth, which will help to generate opportunities for team building, student development and integration of courses. (* Translator’s Note: “Licenciatura” or “Licentiate’s Degree” is a two year post-graduate study program, usually including thesis.

  7. Arquitectura automatizada de comercio electrónico

    OpenAIRE

    Borrego, I.; Hernández, M.J.; Francisco José GARCÍA-PEÑALVO; Curto Diego, María Belén; Moreno Rodilla, Vidal; Hernández Simón, Juan Andrés

    2001-01-01

    El objetivo de este trabajo es el desarrollo de una arquitectura concreta de comercio electrónico que integre servicios B2B y B2C, facilitando la incorporación de las empresas a este ámbito de negocio. Se pretende proporcionar un entorno automático que permita a una empresa diseñar su propia estrategia de negocio en Internet, minimizando las tareas demantenimiento del sitio de comercio electrónico, reduciendo así los costes de la expansión de la empresa.

  8. HERRAMIENTAS AUTOMATIZADAS PARA LA GESTIÓN DE PROYECTOS

    Directory of Open Access Journals (Sweden)

    Anaisa Hernández González

    2006-12-01

    Full Text Available

    La dirección de proyectos implica la realización de un conjunto de procesos que generan y utilizan información que se usa durante el ciclo de vida del proyecto para controlarlo. En este trabajo se presentan algunas herramientas para la gestión integrada de proyectos, haciendo hincapié en el soporte que brindan a las áreas de conocimiento de la dirección de proyectos.

  9. Development of a ceramic primer with higher bond durability for resin cement.

    Science.gov (United States)

    Li, Rui

    2010-07-01

    To increase the bond durability of resin to the CAD/CAM ceramic surface, two types of two-bottle type ceramic primers, consisting of Primer A1 or A2 and Primer B, were designed. Primer A1 was prepared by dissolving 25, 50, or 100 mg of gamma-methacryloxypropyltrimethoxysilane in 1 mL of ethanol. Primer A2 was prepared by dissolving 50 mg of mixed silanes, consisting of 1,2-bis(trimethoxysilyl)ethane to gamma-methacryloxypropyltrimethoxysilane, in 1 mL of ethanol. Mole fractions of 1,2-bis(trimethoxysilyl)ethane to gamma-methacryloxypropyltrimethoxysilane were 0, 10, 20, 30, 40 and 50 mol%. Primer B was prepared after dissolving 0.01, 0.05 or 0.1 mol L(-1) hydrochloric acid in ethanol by 50 vol%. Ceramic surface was silanated with a mixture of Primers A1 and B or Primers A2 and B for 1 min, and then air-dried. Commercial GC ceramic primer and Porcelain Liner M were utilized. Thereafter, dual-curing type resin cement was bonded to silanated ceramic surface through visible-light irradiation. Shear bond strength of resin to the ceramic surface was measured, before and after thermo-cycling. Addition of 0.01 or 0.05 mol L(-1) hydrochloric acid to the gamma-methacryloxypropyltrimethoxysilane allowed for significant increases in the bond strength. However, thermo-cycling resulted in significant decreases of approximately 5 MPa in the bond strength. Conversely, when the mixed silane, where 30 mol% of 1,2-bis(trimethoxysilyl)ethane dissolved in gamma-methacryloxypropyltrimethoxysilane, was utilized with 0.05 mol L(-1) hydrochloric acid, the reduction in the bond strength decreased to approximately 2 MPa. The designed ceramic primers exhibited higher ceramic bond durability than commercial ceramic primers.

  10. Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

    Directory of Open Access Journals (Sweden)

    Li Kelvin

    2012-11-01

    Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

  11. Selection and development of representative simple sequence repeat primers and multiplex SSR sets for high throughput automated genotyping in maize

    Institute of Scientific and Technical Information of China (English)

    WANG FengGe; ZHAO JiuRan; DAI JingRui; YI HongMei; KUANG Meng; SUN YanMei; YU XinYan; GUO JingLun; WANG Lu

    2007-01-01

    In the current study, 1900 maize simple sequence repeat (SSR) primers published in MaizeGDB were screened utilizing reference literature, 15 representative Chinese maize inbred lines and 15 Chinese maize hybrids from national regional testing. In total, 500 highly polymorphic primers were identified and used to construct a genetic map. 100 evenly distributed primers, 10 primers per chromosome, were further selected as a set of universal SSR core primers, recommended as preferred primers for general studies. These core primers were then redesigned and used to construct a high throughput multiplex PCR system based on a five-color fluorescence capillary detection system. We report here that two sets of ten-plex PCR combinations have been constructed, each consisting of 10 primers, with one primer per chromosome.

  12. A Primer on Brain Imaging in Developmental Psychopathology: What Is It Good For?

    Science.gov (United States)

    Pine, Daniel S.

    2006-01-01

    This primer introduces a Special Section on brain imaging, which includes a commentary and 10 data papers presenting applications of brain imaging to questions on developmental psychopathology. This primer serves two purposes. First, the article summarizes the strength and weaknesses of various brain-imaging techniques typically employed in…

  13. Study of HIV-2 primer-template initiation complex using antisense oligonucleotides

    DEFF Research Database (Denmark)

    Boulmé, F; Freund, F; Gryaznov, S;

    2000-01-01

    HIV-2 reverse transcription is initiated by the retroviral DNA polymerase (reverse transcriptase) from a cellular tRNALys3 partially annealed to the primer binding site in the 5'-region of viral RNA. The HIV-2 genome has two A-rich regions upstream of the primer binding site. In contrast to HIV-1...

  14. Changes of 5' Terminal Nucleotides of PCR Primers Causing Variable T-A Cloning Efficiency

    Institute of Scientific and Technical Information of China (English)

    Mei-Qin Liu; Xin Shen; Wei-Lun Yin; Cun-Fu Lu

    2007-01-01

    T-A cloning takes advantage of the unpaired adenosyl residue added to the 3' terminus of amplified DNAs by Taq and other thermostable DNA polymerase and uses a linearized plasmid vector with a protruding 3' thymidylate residue at each of its 3' termini to clone polymerase chain reaction (PCR)-derived DNA fragments. It is a simple,reliable, and efficient ligation-dependent cloning method for PCR products, but the drawback of variable cloning efficiency occurs during application. In the present work, the relationship between variable T-A cloning efficiency and the different 5' end nucleotide base of primers used in PCR amplification was studied. The results showed that different cloning efficiency was obtained with different primer pairs containing A, T, C and G at the 5' terminus respectively. The data shows that when the 5' end base of primer pair was adenosyl, more white colonies could be obtained in cloning the corresponding PCR product in comparison with other bases. And the least white colonies were formed when using the primer pair with 5' cytidylate end. The gluanylate end primers resulted in almost the same cloning efficiency in the white colonies amount as the thymidylate end primer did, and this efficiency was much lower than that of adenosyl end primers. This presumably is a consequence of variability in 3'dA addition to PCR products mediated by Taq polymerase. Our results offer instructions for primer design for researchers who choose T-A cloning to clone PCR products.

  15. Composing Effective and Efficient E-mails: A Primer for Pharmacy Practitioners.

    Science.gov (United States)

    Summerfield, Marc R; Feemster, Agnes Ann

    2015-09-01

    This primer describes the purpose and importance of e-mail as a key communication medium in the workplace. It emphasizes clarity as a primary modality to enhance efficiency and effectiveness. Finally, the primer reviews elements of grammar, punctuation, and style that contribute to each e-mail's ability to meet language standards, enhance the writer's image, and successfully transmit information.

  16. The Universal Primer - An open source solution for archiving, organizing and streaming live lectures

    DEFF Research Database (Denmark)

    Christoffersen, Marc Juul; Panton, Hans Christian Hansen; Krajowski-Kukiel, Maciej;

    2011-01-01

    . The goal of the Universal Primer is to address these problems, and allow anyone, anywhere, to teach or learn anything that can be reasonably taught or learned through a computer. The Universal Primer is 1: A fully open source solution for streaming live lectures. And 2: A Wikipedia-like website...

  17. Novel computational methods for increasing PCR primer design effectiveness in directed sequencing

    Directory of Open Access Journals (Sweden)

    Busam Dana

    2008-04-01

    Full Text Available Abstract Background Polymerase chain reaction (PCR is used in directed sequencing for the discovery of novel polymorphisms. As the first step in PCR directed sequencing, effective PCR primer design is crucial for obtaining high-quality sequence data for target regions. Since current computational primer design tools are not fully tuned with stable underlying laboratory protocols, researchers may still be forced to iteratively optimize protocols for failed amplifications after the primers have been ordered. Furthermore, potentially identifiable factors which contribute to PCR failures have yet to be elucidated. This inefficient approach to primer design is further intensified in a high-throughput laboratory, where hundreds of genes may be targeted in one experiment. Results We have developed a fully integrated computational PCR primer design pipeline that plays a key role in our high-throughput directed sequencing pipeline. Investigators may specify target regions defined through a rich set of descriptors, such as Ensembl accessions and arbitrary genomic coordinates. Primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the specified target regions. As part of the tiling process, primer pairs are computationally screened to meet the criteria for success with one of two PCR amplification protocols. In the process of improving our sequencing success rate, which currently exceeds 95% for exons, we have discovered novel and accurate computational methods capable of identifying primers that may lead to PCR failures. We reveal the laboratory protocols and their associated, empirically determined computational parameters, as well as describe the novel computational methods which may benefit others in future primer design research. Conclusion The high-throughput PCR primer design pipeline has been very successful in providing the basis for high-quality directed sequencing results and for minimizing

  18. Multi-primer target PCR for rapid identification of bovine DRB3 alleles.

    Science.gov (United States)

    Ledwidge, S A; Mallard, B A; Gibson, J P; Jansen, G B; Jiang, Z H

    2001-08-01

    Multi-primer target polymerase chain reaction (MPT-PCR) is a rapid method for the identification of specific BoLA-DRB3 alleles. In a single PCR reaction, the presence of two alleles associated with increased risk, DRB3.2*23 (DRB3*2701-2703, 2705-2707) and decreased risk, DRB3.2*16 (DRB3*1501, 1502), of mastitis in Canadian Holstein can be detected. Two outer primers amplify exon 2 of DRB3. Simultaneously, two inner, allele-specific primers amplify individual alleles. Initially, 40 cows previously typed by PCR-restriction fragment length polymorphism (PCR-RFLP) were genotyped using the multi-primer approach. An additional 30 cows were first genotyped by multi-primer target PCR, then by PCR-RFLP. All animals were correctly identified and there were no false positives. This technique can readily be modified to identify other BoLA alleles of interest.

  19. Characterization of the 18S rRNA gene for designing universal eukaryote specific primers.

    Science.gov (United States)

    Hadziavdic, Kenan; Lekang, Katrine; Lanzen, Anders; Jonassen, Inge; Thompson, Eric M; Troedsson, Christofer

    2014-01-01

    High throughput sequencing technology has great promise for biodiversity studies. However, an underlying assumption is that the primers used in these studies are universal for the prokaryotic or eukaryotic groups of interest. Full primer universality is difficult or impossible to achieve and studies using different primer sets make biodiversity comparisons problematic. The aim of this study was to design and optimize universal eukaryotic primers that could be used as a standard in future biodiversity studies. Using the alignment of all eukaryotic sequences from the publicly available SILVA database, we generated a full characterization of variable versus conserved regions in the 18S rRNA gene. All variable regions within this gene were analyzed and our results suggested that the V2, V4 and V9 regions were best suited for biodiversity assessments. Previously published universal eukaryotic primers as well as a number of self-designed primers were mapped to the alignment. Primer selection will depend on sequencing technology used, and this study focused on the 454 pyrosequencing GS FLX Titanium platform. The results generated a primer pair yielding theoretical matches to 80% of the eukaryotic and 0% of the prokaryotic sequences in the SILVA database. An empirical test of marine sediments using the AmpliconNoise pipeline for analysis of the high throughput sequencing data yielded amplification of sequences for 71% of all eukaryotic phyla with no isolation of prokaryotic sequences. To our knowledge this is the first characterization of the complete 18S rRNA gene using all eukaryotes present in the SILVA database, providing a robust test for universal eukaryotic primers. Since both in silico and empirical tests using high throughput sequencing retained high inclusion of eukaryotic phyla and exclusion of prokaryotes, we conclude that these primers are well suited for assessing eukaryote diversity, and can be used as a standard in biodiversity studies.

  20. Characterization of the 18S rRNA gene for designing universal eukaryote specific primers.

    Directory of Open Access Journals (Sweden)

    Kenan Hadziavdic

    Full Text Available High throughput sequencing technology has great promise for biodiversity studies. However, an underlying assumption is that the primers used in these studies are universal for the prokaryotic or eukaryotic groups of interest. Full primer universality is difficult or impossible to achieve and studies using different primer sets make biodiversity comparisons problematic. The aim of this study was to design and optimize universal eukaryotic primers that could be used as a standard in future biodiversity studies. Using the alignment of all eukaryotic sequences from the publicly available SILVA database, we generated a full characterization of variable versus conserved regions in the 18S rRNA gene. All variable regions within this gene were analyzed and our results suggested that the V2, V4 and V9 regions were best suited for biodiversity assessments. Previously published universal eukaryotic primers as well as a number of self-designed primers were mapped to the alignment. Primer selection will depend on sequencing technology used, and this study focused on the 454 pyrosequencing GS FLX Titanium platform. The results generated a primer pair yielding theoretical matches to 80% of the eukaryotic and 0% of the prokaryotic sequences in the SILVA database. An empirical test of marine sediments using the AmpliconNoise pipeline for analysis of the high throughput sequencing data yielded amplification of sequences for 71% of all eukaryotic phyla with no isolation of prokaryotic sequences. To our knowledge this is the first characterization of the complete 18S rRNA gene using all eukaryotes present in the SILVA database, providing a robust test for universal eukaryotic primers. Since both in silico and empirical tests using high throughput sequencing retained high inclusion of eukaryotic phyla and exclusion of prokaryotes, we conclude that these primers are well suited for assessing eukaryote diversity, and can be used as a standard in biodiversity studies.

  1. Collider physics within the standard model a primer

    CERN Document Server

    Altarelli, Guido

    2017-01-01

    With this graduate-level primer, the principles of the standard model of particle physics receive a particular skillful, personal and enduring exposition by one of the great contributors to the field. In 2013 the late Prof. Altarelli wrote: The discovery of the Higgs boson and the non-observation of new particles or exotic phenomena have made a big step towards completing the experimental confirmation of the standard model of fundamental particle interactions. It is thus a good moment for me to collect, update and improve my graduate lecture notes on quantum chromodynamics and the theory of electroweak interactions, with main focus on collider physics. I hope that these lectures can provide an introduction to the subject for the interested reader, assumed to be already familiar with quantum field theory and some basic facts in elementary particle physics as taught in undergraduate courses. “These lecture notes are a beautiful example of Guido’s unique pedagogical abilities and scientific vision”. From...

  2. Neurociencia y bilingüismo: efecto del primer idioma

    Directory of Open Access Journals (Sweden)

    Germary Díaz-Sánchez

    2013-08-01

    Full Text Available Desde la perspectiva neurobiológica, en este trabajo abordamos los efectos del idioma materno sobre el aprendizaje de una segunda lengua. Aunque existen investigaciones en diferentes países sobre este problema, pocas tratan el enfoque de la neurobiología y, menos aún, cuando se trata del español como idioma materno. Para la investigación se recopiló literatura descriptiva y experimental, con el fin de obtener los datos necesarios para alcanzar los objetivos; se realizó un metaanálisis cualitativo de los datos obtenidos, utilizando tablas de correlación. Los datos reflejaron que la adquisición de un segundo idioma siempre va a estar mediatizada por los esquemas ya establecidos del primer idioma y que existen aspectos neurobiológicos que subyacen a algunos mecanismos de interferencia y a la adquisición de un segundo lenguaje. Además, encontramos que, mientras más similares sean los idiomas, los mecanismos neurales subyacentes facilitan la transferencia del uno al otro.

  3. Genetic analysis of presbycusis by arrayed primer extension.

    Science.gov (United States)

    Rodriguez-Paris, Juan; Ballay, Charles; Inserra, Michelle; Stidham, Katrina; Colen, Tahl; Roberson, Joseph; Gardner, Phyllis; Schrijver, Iris

    2008-01-01

    Using the Hereditary Hearing Loss arrayed primer extension (APEX) array, which contains 198 mutations across 8 hearing loss-associated genes (GJB2, GJB6, GJB3, GJA1, SLC26A4, SLC26A5, 12S-rRNA, and tRNA Ser), we compared the frequency of sequence variants in 94 individuals with early presbycusis to 50 unaffected controls and aimed to identify possible genetic contributors. This cross-sectional study was performed at Stanford University with presbycusis samples from the California Ear Institute. The patients were between ages 20 and 65 yr, with adult-onset sensorineural hearing loss of unknown etiology, and carried a clinical diagnosis of early presbycusis. Exclusion criteria comprised known causes of hearing loss such as significant noise exposure, trauma, ototoxic medication, neoplasm, and congenital infection or syndrome, as well as congenital or pediatric onset. Sequence changes were identified in 11.7% and 10% of presbycusis and control alleles, respectively. Among the presbycusis group, these solely occurred within the GJB2 and SLC26A4 genes. Homozygous and compound heterozygous pathogenic mutations were exclusively seen in affected individuals. We were unable to detect a statistically significant difference between our control and affected populations regarding the frequency of sequence variants detected with the APEX array. Individuals who carry two mild mutations in the GJB2 gene possibly have an increased risk of developing early presbycusis.

  4. Primer reporte de alcaptonuria en el Perú

    Directory of Open Access Journals (Sweden)

    Daniel Guillén-Mendoza

    2014-12-01

    Full Text Available La alcaptonuria es un error innato del metabolismo causado por la deficiencia de la homogentisiato 1,2 dioxidasa (HGD, produciéndose un exceso de ácido homogentísico (HGA. Se presenta el caso de una mujer de 57 años quien, desde que nació, su orina se tornaba de color negro; desde hacía 9 años presentaba una pigmentación verdosa en los lechos ungueales que no mejoró con tratamientos antifúngicos y en los últimos 9 meses presentó artrosis de articulaciones grandes que fue empeorando, forzándola a usar una silla de ruedas por el intenso dolor generado por la artrosis de caderas y columna lumbar. Por la descripción de los síntomas se le solicitó la medición de HGA en orina lo que confirmó el diagnóstico de alcaptonuria. Se sugirieron analgésicos, dieta sin productos que contuvieran tirosina y fue referida para cirugía de reemplazo de cadera. Se trata del primer reporte de caso de alcaptonuria en el Perú.

  5. PRIMER REPORTE DE LA FAMILIA CHEIRIDIIDAE (ARACHNIDA: PSEUDOSCORPIONIDA EN COLOMBIA

    Directory of Open Access Journals (Sweden)

    Jorge Alexander QUIROZ-RODRÍGUEZ

    2015-07-01

    Full Text Available Durante un estudio de la fauna de artrópodos asociada a montículos de detritos de hormigas de la especie Atta colombica Guérin-Méneville, 1844 (Hymenoptera: Formicidae en la hacienda Santa Isabel, corregimiento de Patio Bonito en el departamento de Córdoba, se encontraron representantes de la familia Cheiridiidae. Por tanto, estos pseudoescorpiones se convierten en el primer reporte de la familia para Colombia y por primera vez se registra su presencia en detritus de hormigas. Así mismo, este reporte, amplía su distribución conocida para Suramérica.First Report of Family Cheiridiidae (Arachnida: Pseudoscorpionida in ColombiaDuring a study of the arthropod fauna associated with mounds of detritus produced by Atta colombica (Hymenoptera: Formicidae in the Santa Isabel estate, locality of Patio Bonito, Department of Córdoba, were found representatives of the family Cheiridiidae. Therefore, these pseudoscorpions becomes in the first report of the family to Colombia and for the first time is recorded its presence in ant detritus. Also, this report extends its known distribution range in South America.   

  6. Primer of statistics in dental research: Part II.

    Science.gov (United States)

    Shintani, Ayumi

    2014-04-01

    The Part I of Primer of Statistics in Dental Research covered five topics that are often mentioned in statistical check list of many peer-review journals including (1) statistical graph, (2) how to deal with outliers, (3) p-value and confidence interval, (4) testing equivalence, and (5) multiplicity Adjustment. The Part II of the series covers another set of important topics in dental statistics including (1) selecting the proper statistical tests, (2) repeated measures analysis, (3) epidemiological consideration for causal association, and (4) analysis of agreement. First, a guide in selecting the proper statistical tests based on the research question will be laid out in text and with a table so that researchers choose the univariable statistical test by answering five simple questions. Second, the importance of utilizing repeated measures analysis will be illustrated. This is a key component of data analysis as in many dental studies, observations are considered repeated in a single patient (several teeth are measured in a single patient). Third, concepts of confounding and the use of regression analysis are explained by going over a famous observational cohort study. Lastly, the use of proper agreement analysis vs. correlation for study of agreement will be discussed to avoid a common pitfall in dental research.

  7. Esteatosis en un burro (Equus asinus. Primer reporte en Colombia

    Directory of Open Access Journals (Sweden)

    José Cardona Á.

    2011-12-01

    Full Text Available Se describe un caso de esteatosis en un burro (Equus asinus, castrado, de 15 años de edad, procedente del municipio de San Antero (Córdoba, Colombia, al cual se le detectó ligamento nucal engrosado, duro y doloroso, dando la impresión de un doble cuello y edemas subcutáneos indurados en pared costal, abdominal y pectoral. Tambiénpresentó masas duras en la unión de músculos semimembranoso y semitendinoso. Por todo lo anterior, mostró dificultad para realizar movimientos coordinados del cuello, nuca y de traslado. Estos hallazgos obedecen principalmente a una deficiencia de selenio y vitamina E, sirviendo como parámetro diagnóstico para la identificación de esta enfermedad en equinos, por lo cual se determinó la actividad eritrocitica de la enzima glutatión peroxidada (GSH-Px, arrojando resultados muy bajos. Este cuadro es también conocido en equinos como enfermedad de la grasa amarilla o esteatitis, que produce degeneración del tejido adiposo, siendo reemplazado por tejido conectivo con depósitos de calcio. Puede estar asociada a miodegeneración nutricional o distrófica (enfermedad del músculo blanco. Es el primer reporte de esta enfermedad en burros(Equus asinus que se hace en Colombia.

  8. Primer reporte de alcaptonuria en el Perú

    Directory of Open Access Journals (Sweden)

    Daniel Guillén-Mendoza

    Full Text Available La alcaptonuria es un error innato del metabolismo causado por la deficiencia de la homogentisiato 1,2 dioxidasa (HGD, produciéndose un exceso de ácido homogentísico (HGA. Se presenta el caso de una mujer de 57 años quien, desde que nació, su orina se tornaba de color negro; desde hacía 9 años presentaba una pigmentación verdosa en los lechos ungueales que no mejoró con tratamientos antifúngicos y en los últimos 9 meses presentó artrosis de articulaciones grandes que fue empeorando, forzándola a usar una silla de ruedas por el intenso dolor generado por la artrosis de caderas y columna lumbar. Por la descripción de los síntomas se le solicitó la medición de HGA en orina lo que confirmó el diagnóstico de alcaptonuria. Se sugirieron analgésicos, dieta sin productos que contuvieran tirosina y fue referida para cirugía de reemplazo de cadera. Se trata del primer reporte de caso de alcaptonuria en el Perú.

  9. Fungal-specific PCR primers developed for analysis of the ITS region of environmental DNA extracts

    Directory of Open Access Journals (Sweden)

    Rygiewicz Paul T

    2005-05-01

    Full Text Available Abstract Background The Internal Transcribed Spacer (ITS regions of fungal ribosomal DNA (rDNA are highly variable sequences of great importance in distinguishing fungal species by PCR analysis. Previously published PCR primers available for amplifying these sequences from environmental samples provide varying degrees of success at discriminating against plant DNA while maintaining a broad range of compatibility. Typically, it has been necessary to use multiple primer sets to accommodate the range of fungi under study, potentially creating artificial distinctions for fungal sequences that amplify with more than one primer set. Results Numerous sequences for PCR primers were tested to develop PCR assays with a wide range of fungal compatibility and high discrimination from plant DNA. A nested set of 4 primers was developed that reflected these criteria and performed well amplifying ITS regions of fungal rDNA. Primers in the 5.8S sequence were also developed that would permit separate amplifications of ITS1 and ITS2. A range of basidiomycete fruiting bodies and ascomycete cultures were analyzed with the nested set of primers and Restriction Fragment Length Polymorphism (RFLP fingerprinting to demonstrate the specificity of the assay. Single ectomycorrhizal root tips were similarly analyzed. These primers have also been successfully applied to Quantitative PCR (QPCR, Length Heterogeneity PCR (LH-PCR and Terminal Restriction Fragment Length Polymorphism (T-RFLP analyses of fungi. A set of wide-range plant-specific primers were developed at positions corresponding to one pair of the fungal primers. These were used to verify that the host plant DNA was not being amplified with the fungal primers. Conclusion These plant primers have been successfully applied to PCR-RFLP analyses of forest plant tissues from above- and below-ground samples and work well at distinguishing a selection of plants to the species level. The complete set of primers was

  10. Annealing to sequences within the primer binding site loop promotes an HIV-1 RNA conformation favoring RNA dimerization and packaging

    OpenAIRE

    Seif, Elias; Niu, Meijuan; Kleiman, Lawrence

    2013-01-01

    Experiments are presented which suggest that the binding of the primer tRNA to the primer binding site of the HIV-1 5′ UTR is involved in the dimerization of the genome, as part of the packaging process.

  11. Impacto de la elaboración y aplicación del Spftware de Razonamiento Lógico, para el desarrollo de la inteligencia Lógica Matemática, en los estudiantes del Segundo Semestre de la Escuela de Ingeniería en Sistemas y Computación, de la Universidad Nacional de Chimborazo en el período 2013-2014

    OpenAIRE

    Mazón Fierro, Guido Javier

    2015-01-01

    Los problemas evidenciados en los jóvenes del segundo semestre de la Carrera de Ingeniería en Sistemas y Computación de la Universidad Nacional de Chimborazo son: que les cuesta resolver ejercicios de razonamiento con agilidad, bajo rendimiento en la materia de matemáticas y poseen un nivel básico de lógica deductiva, es por esto que el objetivo del presente estudio es facilitar un recurso didáctico asistido por computador como es el software educativo Chakana, para desarrollar la inteligenci...

  12. In vitro short-term bonding performance of zirconia treated with hot acid etching and primer conditioning etching and primer conditioning.

    Science.gov (United States)

    Xie, Haifeng; Chen, Chen; Dai, Wenyong; Chen, Gang; Zhang, Feimin

    2013-01-01

    This study aimed to investigate and compare the resin bond strengths of zirconia conditioned as follows: alumina sandblasting; alumina sandblasting+application of 10-MDP-containing primer; alumina sandblasting+application of Z-Prime Plus or Metal/Zirconia Primer (new zirconia primers); tribochemical silica coating+silanization; hot acid etching in three different combinations [H2SO4/(NH4)2SO4, HF/HNO3, H2SO4/HF/HNO3]+application of 10-MDP-containing primer. Shear bond strengths (SBS) after water storage for 24 h and 40 days were measured to assess resin bonding performance. Surface and chemical properties of conditioned zirconia surfaces and primers were characterized using scanning electron microscopy, energy dispersive X-ray spectrometry, Fourier transform infrared spectroscopy, and atomic force microscopy. Surface roughness ranked in descending order was: hot acid etching > tribochemical silica coating > alumina sandblasting. Combination of tribochemical silica coating and silanization showed the highest initial SBS (12.46±2.13 MPa) (P<0.01). Etching with H2SO4/(NH4)2SO4 (13.15±3.24 MPa) and HF/HNO3 (13.48±2.15 MPa) showed significantly better bond durability (P<0.01). Hot acid etching seemed to be a promising surface roughening treatment to improve resin-zirconia bonding.

  13. Comprehensive primer design for analysis of population genetics in non-sequenced organisms.

    Directory of Open Access Journals (Sweden)

    Ayumi Tezuka

    Full Text Available Nuclear sequence markers are useful tool for the study of the history of populations and adaptation. However, it is not easy to obtain multiple nuclear primers for organisms with poor or no genomic sequence information. Here we used the genomes of organisms that have been fully sequenced to design comprehensive sets of primers to amplify polymorphic genomic fragments of multiple nuclear genes in non-sequenced organisms. First, we identified a large number of candidate polymorphic regions that were flanked on each side by conserved regions in the reference genomes. We then designed primers based on these conserved sequences and examined whether the primers could be used to amplify sequences in target species, montane brown frog (Rana ornativentris, anole lizard (Anolis sagrei, guppy (Poecilia reticulata, and fruit fly (Drosophila melanogaster, for population genetic analysis. We successfully obtained polymorphic markers for all target species studied. In addition, we found that sequence identities of the regions between the primer sites in the reference genomes affected the experimental success of DNA amplification and identification of polymorphic loci in the target genomes, and that exonic primers had a higher success rate than intronic primers in amplifying readable sequences. We conclude that this comparative genomic approach is a time- and cost-effective way to obtain polymorphic markers for non-sequenced organisms, and that it will contribute to the further development of evolutionary ecology and population genetics for non-sequenced organisms, aiding in the understanding of the genetic basis of adaptation.

  14. RNA Primer Extension Hinders DNA Synthesis by Escherichia coli Mutagenic DNA Polymerase IV

    Science.gov (United States)

    Tashjian, Tommy F.; Lin, Ida; Belt, Verena; Cafarelli, Tiziana M.; Godoy, Veronica G.

    2017-01-01

    In Escherichia coli the highly conserved DNA damage regulated dinB gene encodes DNA Polymerase IV (DinB), an error prone specialized DNA polymerase with a central role in stress-induced mutagenesis. Since DinB is the DNA polymerase with the highest intracellular concentrations upon induction of the SOS response, further regulation must exist to maintain genomic stability. Remarkably, we find that DinB DNA synthesis is inherently poor when using an RNA primer compared to a DNA primer, while high fidelity DNA polymerases are known to have no primer preference. Moreover, we show that the poor DNA synthesis from an RNA primer is conserved in DNA polymerase Kappa, the human DinB homolog. The activity of DinB is modulated by interactions with several other proteins, one of which is the equally evolutionarily conserved recombinase RecA. This interaction is known to positively affect DinB’s fidelity on damaged templates. We find that upon interaction with RecA, DinB shows a significant reduction in DNA synthesis when using an RNA primer. Furthermore, with DinB or DinB:RecA a robust pause, sequence and lesion independent, occurs only when RNA is used as a primer. The robust pause is likely to result in abortive DNA synthesis when RNA is the primer. These data suggest a novel mechanism to prevent DinB synthesis when it is not needed despite its high concentrations, thus protecting genome stability.

  15. Design and evaluation of reverse transcription nested PCR primers for the detection of betanodavirus in finfish.

    Science.gov (United States)

    Rajan, J Joseph Sahaya; Praveena, P Ezhil; Bhuvaneswari, T; Jithendran, K P

    2016-06-01

    Viral encephalopathy and retinopathy otherwise known as viral nervous necrosis (VNN) is a neuropathological condition affecting more than 50 fish species worldwide, mostly marine. Different PCR protocols with specific primers were reported from many countries for confirmation of VNN in fishes. In the present study, two pairs of primers were designed and evaluated for the diagnosis of clinical and subclinical cases of infections from field. These primers designated as BARL-F1/BARL-R1 amplified a 902 bp product in the variable region (T4) of the coat protein gene by first step PCR. Nested PCR primers BARL-F2/BARL-R2 amplified a fragment of 313 bp. The results were comparable with other commonly used primer sets such as F2/R3 and RG668f/RG919r primers. These new primers could detect betanodavirus in standard reference samples containing low, moderate and high viral load. Known positive and negative control samples of fish also revealed a predictive value of 100 % by RT-PCR diagnosis.

  16. Construction of Specific Primers for Rapid Detection of South African Exportable Vegetable Macergens

    Directory of Open Access Journals (Sweden)

    Bukola Rhoda Aremu

    2015-09-01

    Full Text Available Macergens are bacteria causing great damages to the parenchymatous tissues of vegetable both on the field and in transit. To effectively and rapidly investigate the diversity and distribution of these macergens, four specific primers were designed by retrieving 16S rDNA sequences of pectolytic bacteria from GenBank through the National Center for Biotechnology Information (NCBI. These were aligned using ClusterW via BioEdit and primers were designed using Primer3Plus platform. The size and primer location of each species and PCR product size were accurately defined. For specificity enhancement, DNA template of known macergens (Pectobacterium chrysanthermi and fresh healthy vegetable were used. These primers yielded expected size of approximately 1100 bp product only when tested with known macergens and no amplicon with fresh healthy vegetable was detected. Rapid detection of macergens in rotten vegetable samples was then carried out using these primers. Nucleotide sequences of macergens identified were deposited into the GenBank and were assigned accession numbers. Hence, with these specific primers, macergens can be identified with minimal quantities of the vegetable tissues using molecular techniques, for future use of the quarantine section of the Agricultural Department of the country for quick and rapid detection of macergens before exportation.

  17. MRPrimerV: a database of PCR primers for RNA virus detection

    Science.gov (United States)

    Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Kim, Doyun; Koo, JaeHyung; Kim, Min-Soo

    2017-01-01

    Many infectious diseases are caused by viral infections, and in particular by RNA viruses such as MERS, Ebola and Zika. To understand viral disease, detection and identification of these viruses are essential. Although PCR is widely used for rapid virus identification due to its low cost and high sensitivity and specificity, very few online database resources have compiled PCR primers for RNA viruses. To effectively detect viruses, the MRPrimerV database (http://MRPrimerV.com) contains 152 380 247 PCR primer pairs for detection of 1818 viruses, covering 7144 coding sequences (CDSs), representing 100% of the RNA viruses in the most up-to-date NCBI RefSeq database. Due to rigorous similarity testing against all human and viral sequences, every primer in MRPrimerV is highly target-specific. Because MRPrimerV ranks CDSs by the penalty scores of their best primer, users need only use the first primer pair for a single-phase PCR or the first two primer pairs for two-phase PCR. Moreover, MRPrimerV provides the list of genome neighbors that can be detected using each primer pair, covering 22 192 variants of 532 RefSeq RNA viruses. We believe that the public availability of MRPrimerV will facilitate viral metagenomics studies aimed at evaluating the variability of viruses, as well as other scientific tasks. PMID:27899620

  18. Primer effect in the detection of mitochondrial DNA point heteroplasmy by automated sequencing.

    Science.gov (United States)

    Calatayud, Marta; Ramos, Amanda; Santos, Cristina; Aluja, Maria Pilar

    2013-06-01

    The correct detection of mitochondrial DNA (mtDNA) heteroplasmy by automated sequencing presents methodological constraints. The main goals of this study are to investigate the effect of sense and distance of primers in heteroplasmy detection and to test if there are differences in the accurate determination of heteroplasmy involving transitions or transversions. A gradient of the heteroplasmy levels was generated for mtDNA positions 9477 (transition G/A) and 15,452 (transversion C/A). Amplification and subsequent sequencing with forward and reverse primers, situated at 550 and 150 bp from the heteroplasmic positions, were performed. Our data provide evidence that there is a significant difference between the use of forward and reverse primers. The forward primer is the primer that seems to give a better approximation to the real proportion of the variants. No significant differences were found concerning the distance at which the sequencing primers were placed neither between the analysis of transitions and transversions. The data collected in this study are a starting point that allows to glimpse the importance of the sequencing primers in the accurate detection of point heteroplasmy, providing additional insight into the overall automated sequencing strategy.

  19. Selective control of primer usage in multiplex one-step reverse transcription PCR

    Directory of Open Access Journals (Sweden)

    Paul Natasha

    2009-12-01

    Full Text Available Abstract Background Multiplex RT-PCR is a valuable technique used for pathogen identification, disease detection and relative quantification of gene expression. The simplification of this protocol into a one-step procedure saves time and reagents. However, intensive PCR optimization is often required to overcome competing undesired PCR primer extension during the RT step. Results Herein, we report multiplex one-step RT-PCR experiments in which the PCR primers contain thermolabile phosphotriester modification groups. The presence of these groups minimizes PCR primer extension during the RT step and allows for control of PCR primer extension until the more stringent, elevated temperatures of PCR are reached. Results reveal that the use of primers whose extension can be controlled in a temperature-mediated way provides improved one-step RT-PCR specificity in both singleplex and multiplex reaction formats. Conclusions The need for an accurate and sensitive technique to quantify mRNA expression levels makes the described modified primer technology a promising tool for use in multiplex one-step RT-PCR. A more accurate representation of the abundances in initial template sample is feasible with modified primers, as artifacts of biased PCR are reduced because of greater improvements in reaction specificity.

  20. Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes

    Directory of Open Access Journals (Sweden)

    Shea N. Gardner

    2014-01-01

    Full Text Available Background. Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results. A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Each group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions. This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.

  1. Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.

    Directory of Open Access Journals (Sweden)

    Andrea Fuso

    Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.

  2. Noncontinuously binding loop-out primers for avoiding problematic DNA sequences in PCR and sanger sequencing.

    Science.gov (United States)

    Sumner, Kelli; Swensen, Jeffrey J; Procter, Melinda; Jama, Mohamed; Wooderchak-Donahue, Whitney; Lewis, Tracey; Fong, Michael; Hubley, Lindsey; Schwarz, Monica; Ha, Youna; Paul, Eleri; Brulotte, Benjamin; Lyon, Elaine; Bayrak-Toydemir, Pinar; Mao, Rong; Pont-Kingdon, Genevieve; Best, D Hunter

    2014-09-01

    We present a method in which noncontinuously binding (loop-out) primers are used to exclude regions of DNA that typically interfere with PCR amplification and/or analysis by Sanger sequencing. Several scenarios were tested using this design principle, including M13-tagged PCR primers, non-M13-tagged PCR primers, and sequencing primers. With this technique, a single oligonucleotide is designed in two segments that flank, but do not include, a short region of problematic DNA sequence. During PCR amplification or sequencing, the problematic region is looped-out from the primer binding site, where it does not interfere with the reaction. Using this method, we successfully excluded regions of up to 46 nucleotides. Loop-out primers were longer than traditional primers (27 to 40 nucleotides) and had higher melting temperatures. This method allows the use of a standardized PCR protocol throughout an assay, keeps the number of PCRs to a minimum, reduces the chance for laboratory error, and, above all, does not interrupt the clinical laboratory workflow.

  3. Primer containing dimethylaminododecyl methacrylate kills bacteria impregnated in human dentin blocks

    Science.gov (United States)

    Chen, Chen; Cheng, Lei; Weir, Michael D; Lin, Nancy J; Lin-Gibson, Sheng; Zhou, Xue-Dong; Xu, Hockin HK

    2016-01-01

    Antibacterial dimethylaminododecyl methacrylate (DMADDM) was recently synthesized. The objectives of this study were to: (1) investigate antibacterial activity of DMADDM-containing primer on Streptococcus mutans impregnated into dentin blocks for the first time, and (2) compare the antibacterial efficacy of DMADDM with a previous quaternary ammonium dimethacrylate (QADM). Scotchbond Multi-Purpose (SBMP) bonding agent was used. DMADDM and QADM were mixed into SBMP primer. Six primers were tested: SBMP control primer P, P+2.5% DMADDM, P+5% DMADDM, P+7.5% DMADDM, P+10% DMADDM, and P+10% QADM. S. mutans were impregnated into human dentin blocks, and each primer was applied to dentin to test its ability to kill bacteria in dentinal tubules. Bacteria in dentin were collected via a sonication method, and the colony-forming units (CFU) and inhibition zones were measured. The bacterial inhibition zone of P+10% DMADDM was 10 times that of control primer (P0.1). In conclusion, antibacterial DMADDM-containing primer was validated to kill bacteria inside dentin blocks, possessing a much stronger antibacterial potency than the previous QADM. DMADDM-containing bonding agent was effective in eradicating bacteria in dentin, and its efficacy was directly proportional to DMADDM mass fraction. Therefore, DMADDM may be promising for use in bonding agents as well as in other restorative and preventive materials to inhibit bacteria. PMID:27811846

  4. PCR primers for metazoan nuclear 18S and 28S ribosomal DNA sequences.

    Directory of Open Access Journals (Sweden)

    Ryuji J Machida

    Full Text Available BACKGROUND: Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. METHODOLOGY/PRINCIPAL FINDINGS: Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. CONCLUSIONS/SIGNIFICANCE: The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other

  5. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    Science.gov (United States)

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  6. Robust SNP genotyping by multiplex PCR and arrayed primer extension

    Directory of Open Access Journals (Sweden)

    Podder Mohua

    2008-01-01

    Full Text Available Abstract Background Arrayed primer extension (APEX is a microarray-based rapid minisequencing methodology that may have utility in 'personalized medicine' applications that involve genetic diagnostics of single nucleotide polymorphisms (SNPs. However, to date there have been few reports that objectively evaluate the assay completion rate, call rate and accuracy of APEX. We have further developed robust assay design, chemistry and analysis methodologies, and have sought to determine how effective APEX is in comparison to leading 'gold-standard' genotyping platforms. Our methods have been tested against industry-leading technologies in two blinded experiments based on Coriell DNA samples and SNP genotype data from the International HapMap Project. Results In the first experiment, we genotyped 50 SNPs across the entire 270 HapMap Coriell DNA sample set. For each Coriell sample, DNA template was amplified in a total of 7 multiplex PCRs prior to genotyping. We obtained good results for 41 of the SNPs, with 99.8% genotype concordance with HapMap data, at an automated call rate of 94.9% (not including the 9 failed SNPs. In the second experiment, involving modifications to the initial DNA amplification so that a single 50-plex PCR could be achieved, genotyping of the same 50 SNPs across each of 49 randomly chosen Coriell DNA samples allowed extremely robust 50-plex genotyping from as little as 5 ng of DNA, with 100% assay completion rate, 100% call rate and >99.9% accuracy. Conclusion We have shown our methods to be effective for robust multiplex SNP genotyping using APEX, with 100% call rate and >99.9% accuracy. We believe that such methodology may be useful in future point-of-care clinical diagnostic applications where accuracy and call rate are both paramount.

  7. A primer on incentive regulation for electric utilities

    Energy Technology Data Exchange (ETDEWEB)

    Hill, L.J.

    1995-10-01

    In contemplating a regulatory approach, the challenge for regulators is to develop a model that provides incentives for utilities to engage in socially desirable behavior. In this primer, we provide guidance on this process by discussing (1) various models of economic regulation, (2) problems implementing these models, and (3) the types of incentives that various models of regulation provide electric utilities. We address five regulatory models in depth. They include cost-of-service regulation in which prudently incurred costs are reflected dollar-for-dollar in rates and four performance-based models: (1) price-cap regulation, in which ceilings are placed on the average price that a utility can charge its customers; (2) revenue-cap regulation, in which a ceiling is placed on revenues; (3) rate-of-return bandwidth regulation, in which a utility`s rates are adjusted if earnings fall outside a {open_quotes}band{close_quotes} around equity returns; and (4) targeted incentives, in which a utility is given incentives to improve specific components of its operations. The primary difference between cost-of-service and performance-based approaches is the latter sever the tie between costs and prices. A sixth, {open_quotes}mixed approach{close_quotes} combines two or more of the five basic ones. In the recent past, a common mixed approach has been to combine targeted incentives with cost-of-service regulation. A common example is utilities that are subject to cost-of-service regulation are given added incentives to increase the efficiency of troubled electric-generating units.

  8. Binary electrokinetic separation of target DNA from background DNA primers.

    Energy Technology Data Exchange (ETDEWEB)

    James, Conrad D.; Derzon, Mark Steven

    2005-10-01

    This report contains the summary of LDRD project 91312, titled ''Binary Electrokinetic Separation of Target DNA from Background DNA Primers''. This work is the first product of a collaboration with Columbia University and the Northeast BioDefense Center of Excellence. In conjunction with Ian Lipkin's lab, we are developing a technique to reduce false positive events, due to the detection of unhybridized reporter molecules, in a sensitive and multiplexed detection scheme for nucleic acids developed by the Lipkin lab. This is the most significant problem in the operation of their capability. As they are developing the tools for rapidly detecting the entire panel of hemorrhagic fevers this technology will immediately serve an important national need. The goal of this work was to attempt to separate nucleic acid from a preprocessed sample. We demonstrated the preconcentration of kilobase-pair length double-stranded DNA targets, and observed little preconcentration of 60 base-pair length single-stranded DNA probes. These objectives were accomplished in microdevice formats that are compatible with larger detection systems for sample pre-processing. Combined with Columbia's expertise, this technology would enable a unique, fast, and potentially compact method for detecting/identifying genetically-modified organisms and multiplexed rapid nucleic acid identification. Another competing approach is the DARPA funded IRIS Pharmaceutical TIGER platform which requires many hours for operation, and an 800k$ piece of equipment that fills a room. The Columbia/SNL system could provide a result in 30 minutes, at the cost of a few thousand dollars for the platform, and would be the size of a shoebox or smaller.

  9. El menor infractor que comete su primer delito

    Directory of Open Access Journals (Sweden)

    Antonia Luzón García

    2014-10-01

    Full Text Available Existe un consenso social y la sociedad se posiciona al lado del menor maltratado, la cosa cambia cuando el menor es infractor, entonces es declarado culpable y merecedor de castigo. El menor aun siendo infractor es un ser humano con pleno derechos establecidos en la Declaración de Derechos del Niño y en los textos internacionales sobre Derechos Humanos. Mediante la socialización se estrechan los vínculos entre el individuo y el sistema social en el que vive. Por ello, la socialización y sus implicaciones son de nuestro interés para este estudio y conocer qué lleva a un menor a cometer su primer delito. Una correcta socialización, de asunción de normas y valores sociales, pautas, creencias, ritos, etc., posibilita la adaptación y previene de la exclusión social. La combinación de la influencia que ha ejercido los agentes de socialización en el menor y los factores de riesgo como el clima familiar, la adaptación escolar, los rasgos de personalidad y el grupo de iguales nos va a permitir pronosticar la probabilidad de que el menor lleve a cabo comportamientos infractores. En este estudio se intentará demostrar que la mayoría de menores que realizan infracciones penales carecen de un adecuado proceso de socialización con desestructuración familiar, inadaptación escolar y la influencia negativa del grupo de iguales que faciliten una socialización positiva y sana. Este proceso de socialización es importante si queremos comprender el comportamiento humano, entendido como la interiorización de normas y valores que han ido estructurando la personalidad del niño, su manera de pensar, de actuar, en resumidas cuentas su desarrollo mental y social

  10. THE QUALITY IMPROVEMENT OF PRIMER PACKAGING PROCESS USING SIX SIGMA METHODOLOGY

    Directory of Open Access Journals (Sweden)

    Prima Ditahardiyani

    2008-01-01

    Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.

  11. Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

    DEFF Research Database (Denmark)

    Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere

    2014-01-01

    to investigate the potential failure mechanism of a primer applied prior to an intumescent coating. The analysis was carried out using; (1) gas-fired test furnace, (2) a specially designed electrically heated oven, and (3) thermo gravimetric analysis. When tested below an acrylic intumescent coating, exposed...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen...

  12. Design and evaluation of a specific primer pair for the diagnosis and identification of Acanthamoeba polyphaga.

    Science.gov (United States)

    Ortega-Rivas, Antonio; Lorenzo-Morales, Jacob; Martinez-Carretero, Enrique; Villa Lloberas, Mercedes; Valladares Hernández, Basilio; del Castillo-Remiro, Antonio

    2004-05-01

    Random amplified polymorphism DNA (RAPD) is a useful tool for species identification. The obtained band patterns can be used for specific primer pair design that may be useful for species diagnosis. In this study, a distinctive a 962-bp band in A. polyphaga band patterns was found, by using the OPC20 primer (ACTTCGCCAC). The DNA fragment was used to design a specific primer pair that was useful for the identification of different isolates as A. polyphaga species. A case of A. polyphaga in disseminated acanthamoebiasis affecting mesenteric nodes is also reported.

  13. Improved COI barcoding primers for Southeast Asian perching birds (Aves: Passeriformes).

    Science.gov (United States)

    Lohman, David J; Prawiradilaga, Dewi M; Meier, Rudolf

    2009-01-01

    The All Birds Barcoding Initiative aims to assemble a DNA barcode database for all bird species, but the 648-bp 'barcoding' region of cytochrome c oxidase subunit I (COI) can be difficult to amplify in Southeast Asian perching birds (Aves: Passeriformes). Using COI sequences from complete mitochondrial genomes, we designed a primer pair that more reliably amplifies and sequences the COI barcoding region of Southeast Asian passerine birds. The 655-bp region amplified with these primers overlaps the COI region amplified with other barcoding primer pairs, enabling direct comparison of sequences with previously published DNA barcodes.

  14. Detection of Hepatitis B Virus DNA by Duplex Scorpion Primer-based PCR Assay

    Institute of Scientific and Technical Information of China (English)

    KONG De-Ming孔德明; SHEN Han-Xi沈含熙; MI Huai-Feng宓怀风

    2004-01-01

    The application of a new fiuorogenic probe-based PCR assay (PCR duplex scorpion primer assay) to the detection of Hepatitis B virus (HBV) DNA in human sera was described. Duplex scorpion primer is a modified variant of duplex Amplifluor, and the incorporation of a PCR stopper between probe and primer sequences improve the detection specificity and sensitivity. Combined with PCR amplification, this probe can give unambiguous positive results for the reactions initiated with more than 20 HBV molecules. In addition, the particular unimolecular probing mechanism of this probe makes the use of short target-specific probe sequence possible, which will render this probe applicable in some specific systems.

  15. A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

    Energy Technology Data Exchange (ETDEWEB)

    Warwick, William M.

    2002-06-03

    This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

  16. Mega primer-mediated molecular cloning strategy for chimaeragenesis and long DNA fragment insertion.

    Science.gov (United States)

    Zhang, Hui; Liu, Chang-Jun; Jiang, Hui; Zhou, Lu; Li, Wen-Ying; Zhu, Ling-Yun; Wu, Lei; Meng, Er; Zhang, Dong-Yi

    2017-04-30

    Molecular cloning methods based on primer and overlap-extension PCR are widely used due to their simplicity, reliability, low cost and high efficiency. In this article, an efficient mega primer-mediated (MP) cloning strategy for chimaeragenesis and long DNA fragment insertion is presented. MP cloning is a seamless, restriction/ligation-independent method that requires only three steps: (i) the first PCR for mega primer generation; (ii) the second PCR for exponential amplification mediated by the mega primers and (iii) DpnI digestion and transformation. Most importantly, for chimaeragenesis, genes can be assembled and constructed into the plasmid vector in a single PCR step. By employing this strategy, we successfully inserted four DNA fragments (approximately 500 bp each) into the same vector simultaneously. In conclusion, the strategy proved to be a simple and efficient tool for seamless cloning.

  17. The UVM primer a step-by-step introduction to the universal verification methodology

    CERN Document Server

    Salemi, Ray

    2013-01-01

    The UVM Primer uses simple, runnable code examples, accessible analogies, and an easy-to-read style to introduce you to the foundation of the Universal Verification Methodology. You will learn the basics of object-oriented programming with SystemVerilog and build upon that foundation to learn how to design testbenches using the UVM. Use the UVM Primer to brush up on your UVM knowledge before a job interview to be able to confidently answer questions such as "What is a uvm_agent?" , "How do you use uvm_sequences?", and "When do you use the UVM's factory." The UVM Primer's downloadable code examples give you hands-on experience with real UVM code. Ray Salemi uses online videos (on www.uvmprimer.com) to walk through the code from each chapter and build your confidence. Read The UVM Primer today and start down the path to the UVM.

  18. New Primers for Denaturing Gradient Gel Electrophoresis Analysis of Nitrate-Reducing Bacterial Community in Soil

    Institute of Scientific and Technical Information of China (English)

    R.PASTORELLI; R.PICCOLO; S.SIMONCINI; S.LANDI

    2013-01-01

    The narG gene is frequently used as a molecular marker for bacterial nitrate-reducing community analysis.In this study,a new set of primers targeting the narG gene was designed and applied to semi-nested polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE) assay.The potential of the new primers was verified on DNA directly extracted from soils from five different experimental sites distributed in Central and Southern Italy.Specificity of the primers was determined by excision,amplification,and sequencing of bands resolved by DGGE.A phylogenetic analysis showed the correlation between the sequences retrieved from the soils studied and the narG sequences from β and γ-Proteobacteria.These primers expanded the existing molecular tools for ecological study on the size and diversity of nitrate-reducing bacterial community in soil.

  19. Influence of RT-qPCR primer position on EGFR interference efficacy in lung cancer cells

    Directory of Open Access Journals (Sweden)

    Chen Gang

    2011-01-01

    Full Text Available Abstract Background Real-time quantitative RT-PCR (RT-qPCR is a "gold" standard for measuring steady state mRNA levels in RNA interference assays. The knockdown of the epidermal growth factor receptor (EGFR gene with eight individual EGFR small interfering RNAs (siRNAs was estimated by RT-qPCR using three different RT-qPCR primer sets. Results Our results indicate that accurate measurement of siRNA efficacy by RT-qPCR requires careful attention for the selection of the primers used to amplify the target EGFR mRNA. Conclusions We conclude that when assessing siRNA efficacy with RT-qPCR, more than one primer set targeting different regions of the mRNA should be evaluated and at least one of these primer sets should amplify a region encompassing the siRNA recognition sequence.

  20. Primer retention owing to the absence of RNase H1 is catastrophic for mitochondrial DNA replication.

    Science.gov (United States)

    Holmes, J Bradley; Akman, Gokhan; Wood, Stuart R; Sakhuja, Kiran; Cerritelli, Susana M; Moss, Chloe; Bowmaker, Mark R; Jacobs, Howard T; Crouch, Robert J; Holt, Ian J

    2015-07-28

    Encoding ribonuclease H1 (RNase H1) degrades RNA hybridized to DNA, and its function is essential for mitochondrial DNA maintenance in the developing mouse. Here we define the role of RNase H1 in mitochondrial DNA replication. Analysis of replicating mitochondrial DNA in embryonic fibroblasts lacking RNase H1 reveals retention of three primers in the major noncoding region (NCR) and one at the prominent lagging-strand initiation site termed Ori-L. Primer retention does not lead immediately to depletion, as the persistent RNA is fully incorporated in mitochondrial DNA. However, the retained primers present an obstacle to the mitochondrial DNA polymerase γ in subsequent rounds of replication and lead to the catastrophic generation of a double-strand break at the origin when the resulting gapped molecules are copied. Hence, the essential role of RNase H1 in mitochondrial DNA replication is the removal of primers at the origin of replication.

  1. Abridged adapter primers increase the target scope of Hi-Plex.

    Science.gov (United States)

    Nguyen-Dumont, Tú; Hammet, Fleur; Mahmoodi, Maryam; Pope, Bernard J; Giles, Graham G; Hopper, John L; Southey, Melissa C; Park, Daniel J

    2015-01-01

    Previously, we reported Hi-Plex, an amplicon-based method for targeted massively parallel sequencing capable of generating 60 amplicons simultaneously. In further experiments, however, we found our approach did not scale to higher amplicon numbers. Here, we report a modification to the original Hi-Plex protocol that includes the use of abridged adapter oligonucleotides as universal primers (bridge primers) in the initial PCR mixture. Full-length adapter primers (indexing primers) are included only during latter stages of thermal cycling with concomitant application of elevated annealing temperatures. Using this approach, we demonstrate the application of Hi-Plex across a broad range of amplicon numbers (16-plex, 62-plex, 250-plex, and 1003-plex) while preserving the low amount (25 ng) of input DNA required.

  2. Paralog-specific primers for the amplification of nuclear Loci in tetraploid barbels (barbus: cypriniformes).

    Science.gov (United States)

    Gante, Hugo F; Alves, Maria Judite; Dowling, Thomas E

    2011-01-01

    Thirty paralog-specific primers were developed, following an intron-primed exon-crossing strategy, for S7 and growth hormone genes in Barbus (subgenera Barbus and Luciobarbus). We found that paralog-specific amplification requires the use of only one paralog-specific primer, allowing their simultaneous use with universal exon-primed intron-crossing primers of broad taxonomic applicability. This hybrid annealing strategy guarantees both specificity and generality of amplification reactions and represents a step forward in the amplification of duplicated nuclear loci in polyploid organisms and members of multigene families. Assays of several representative taxa identified high levels of segregating single nucleotide polymorphisms (SNPs) and nucleotide diversity within each of these subgenera. Additionally, several insertions-deletions (indels) that are diagnostic across species are found in intronic regions. Therefore, these primers provide a reliable source of valuable nuclear SNP and indel data for population and species level studies of barbels, such as applied conservation and basic evolutionary studies.

  3. Mechanism of Concerted RNA-DNA Primer Synthesis by the Human Primosome.

    Science.gov (United States)

    Baranovskiy, Andrey G; Babayeva, Nigar D; Zhang, Yinbo; Gu, Jianyou; Suwa, Yoshiaki; Pavlov, Youri I; Tahirov, Tahir H

    2016-05-06

    The human primosome, a 340-kilodalton complex of primase and DNA polymerase α (Polα), synthesizes chimeric RNA-DNA primers to be extended by replicative DNA polymerases δ and ϵ. The intricate mechanism of concerted primer synthesis by two catalytic centers was an enigma for over three decades. Here we report the crystal structures of two key complexes, the human primosome and the C-terminal domain of the primase large subunit (p58C) with bound DNA/RNA duplex. These structures, along with analysis of primase/polymerase activities, provide a plausible mechanism for all transactions of the primosome including initiation, elongation, accurate counting of RNA primer length, primer transfer to Polα, and concerted autoregulation of alternate activation/inhibition of the catalytic centers. Our findings reveal a central role of p58C in the coordinated actions of two catalytic domains in the primosome and ultimately could impact the design of anticancer drugs.

  4. Rapid DNA extraction methods and new primers for randomly amplified polymorphic DNA analysis of Giardia duodenalis.

    Science.gov (United States)

    Deng, M Q; Cliver, D O

    1999-08-01

    A randomly amplified polymorphic DNA (RAPD) procedure using simple genomic DNA preparation methods and newly designed primers was optimized for analyzing Giardia duodenalis strains. Genomic DNA was extracted from in vitro cultivated trophozoites by five freezing-thawing cycles or by sonic treatment. Compared to a conventional method involving proteinase K digestion and phenol extraction, both freezing-thawing and sonication were equally efficient, yet with the advantage of being much less time- and labor-intensive. Five of the 10 tested RAPD primers produced reproducible polymorphisms among five human origin G. duodenalis strains, and grouping of these strains based on RAPD profiles was in agreement among these primers. The consistent classification of two standard laboratory reference strains, Portland-1 and WB, in the same group confirmed previous results using other fingerprinting methods, indicating that the reported simple DNA extraction methods and the selected primers are useful in RAPD for molecular characterization of G. duodenalis strains.

  5. Molecular Detection of Toxoplasmosis Using Specific Primers P30, B1, and rDNA

    Directory of Open Access Journals (Sweden)

    Wisnu Nurcahyo

    2014-04-01

    Full Text Available Study in order to develop molecular techniques using specific primers for the early diagnosis oftoxoplasmosis have been conducted. Detection of Toxoplasma gondii genome was performed usingpolymerase chain reaction (PCR technique. The primers used in this study were rDNA, P30, and B1. ThePCR products were further run using gel electrophoresis (gel 1.5% – 2.0% and the band was documented.Toxoplasma was detected at 500 bp and 600 bp using primer P30 and B1, respectively. Whereas usingprimer rDNA no band was observed. It was assumed that primer rDNA was not sensitive since the targetamplification was 88 bp.

  6. Use of tannin anticorrosive reaction primer to improve traditional coating systems

    Energy Technology Data Exchange (ETDEWEB)

    Matamala, G.; Droguett, G. (Universidad de Concepcion (Chile)); Smeltzer, W. (McMaster Univ., Hamilton, Ontario (Canada). Inst. for Materials Research)

    1994-04-01

    Different anticorrosive schemes applied over plain or previously shot-blasted surfaces of AISI 1010 (UNS G10100) steel plates were compared. Plates were painted with alkydic, vinylic, and epoxy anticorrosive schemes over metal treated previously with pine tannin reaction primer and over its own schemes without previous primer treatment. Anticorrosive tests were conducted in a salt fog chamber according to ASTM B 117-73. Rusting, blistering, and adhesion were assessed over time. The survey was complemented with potentiodynamic scanning tests in sodium chloride (NaCl) solution with a concentration equivalent to seawater. Corrosion currents were determined using Tafel and polarization resistance techniques. Results showed the reaction primer inhibited corrosion by improving adherence. Advantages over traditional conversion primers formulated in a base of zinc chromate in phosphoric medium were evident.

  7. ¡Ipapeltaiñ Mapudungu Meo! Un Primer Ensayo de Ortografía Práctica en Mapudungu

    Directory of Open Access Journals (Sweden)

    Arturo Hernández

    Full Text Available Durante el segundo semestre del año 1980, la Sección de Lingülstica de la Pontificia Universidad Católica de Chile, Sede Temuco,constituida en aquella época por el doctor Adalberto Salas y los profesores Nelly Ramos,Raúl Caamaño y quien habla, trabajó en un proyecto pionero en el país, con el objeto de probar emplricamente una proposición de alfabeto para la lengua de los mapuches que habia sido elaborada por el jefe del equipo, Dr. Adalberto Salas.

  8. Streamlining DNA barcoding protocols: automated DNA extraction and a new cox1 primer in arachnid systematics.

    Directory of Open Access Journals (Sweden)

    Nina Vidergar

    Full Text Available BACKGROUND: DNA barcoding is a popular tool in taxonomic and phylogenetic studies, but for most animal lineages protocols for obtaining the barcoding sequences--mitochondrial cytochrome C oxidase subunit I (cox1 AKA CO1--are not standardized. Our aim was to explore an optimal strategy for arachnids, focusing on the species-richest lineage, spiders by (1 improving an automated DNA extraction protocol, (2 testing the performance of commonly used primer combinations, and (3 developing a new cox1 primer suitable for more efficient alignment and phylogenetic analyses. METHODOLOGY: We used exemplars of 15 species from all major spider clades, processed a range of spider tissues of varying size and quality, optimized genomic DNA extraction using the MagMAX Express magnetic particle processor-an automated high throughput DNA extraction system-and tested cox1 amplification protocols emphasizing the standard barcoding region using ten routinely employed primer pairs. RESULTS: The best results were obtained with the commonly used Folmer primers (LCO1490/HCO2198 that capture the standard barcode region, and with the C1-J-2183/C1-N-2776 primer pair that amplifies its extension. However, C1-J-2183 is designed too close to HCO2198 for well-interpreted, continuous sequence data, and in practice the resulting sequences from the two primer pairs rarely overlap. We therefore designed a new forward primer C1-J-2123 60 base pairs upstream of the C1-J-2183 binding site. The success rate of this new primer (93% matched that of C1-J-2183. CONCLUSIONS: The use of C1-J-2123 allows full, indel-free overlap of sequences obtained with the standard Folmer primers and with C1-J-2123 primer pair. Our preliminary tests suggest that in addition to spiders, C1-J-2123 will also perform in other arachnids and several other invertebrates. We provide optimal PCR protocols for these primer sets, and recommend using them for systematic efforts beyond DNA barcoding.

  9. MIPE: A metagenome-based community structure explorer and SSU primer evaluation tool

    Science.gov (United States)

    Zhou, Quan

    2017-01-01

    An understanding of microbial community structure is an important issue in the field of molecular ecology. The traditional molecular method involves amplification of small subunit ribosomal RNA (SSU rRNA) genes by polymerase chain reaction (PCR). However, PCR-based amplicon approaches are affected by primer bias and chimeras. With the development of high-throughput sequencing technology, unbiased SSU rRNA gene sequences can be mined from shotgun sequencing-based metagenomic or metatranscriptomic datasets to obtain a reflection of the microbial community structure in specific types of environment and to evaluate SSU primers. However, the use of short reads obtained through next-generation sequencing for primer evaluation has not been well resolved. The software MIPE (MIcrobiota metagenome Primer Explorer) was developed to adapt numerous short reads from metagenomes and metatranscriptomes. Using metagenomic or metatranscriptomic datasets as input, MIPE extracts and aligns rRNA to reveal detailed information on microbial composition and evaluate SSU rRNA primers. A mock dataset, a real Metagenomics Rapid Annotation using Subsystem Technology (MG-RAST) test dataset, two PrimerProspector test datasets and a real metatranscriptomic dataset were used to validate MIPE. The software calls Mothur (v1.33.3) and the SILVA database (v119) for the alignment and classification of rRNA genes from a metagenome or metatranscriptome. MIPE can effectively extract shotgun rRNA reads from a metagenome or metatranscriptome and is capable of classifying these sequences and exhibiting sensitivity to different SSU rRNA PCR primers. Therefore, MIPE can be used to guide primer design for specific environmental samples. PMID:28350876

  10. Effects of acidic primer/adhesives on primary and permanent dentin

    OpenAIRE

    2009-01-01

    Purpose: To evaluate the quality of primary and permanent dentin by Fourier transformed Raman spectroscopy (FT-Raman), and scanning electron microscopy/energy-dispersive spectroscopy (SEM/EDS). Methods: The middle dentin of crowns was reached by carbide bur abrading providing a uniform smear layer. Self-etching primers were applied in order to simulate the etching of self-etching adhesive systems. The groups were (n = 6): G1 (primary dentin smear layer); G2 (primary dentin etched by primer of...

  11. Detection of Luminous Vibrio harveyi in Penaeid Shrimp Through Nested PCR Using Haemolysin Gene Primer

    OpenAIRE

    Wawan Abdullah Setiawan; Utut Widyastuti; Munti Yuhana

    2015-01-01

    Whiteleg shrimp (Litopenaeus vannamei) is one of the most important aquaculture commodity in Indonesia. However, the luminous disease primarily caused by Vibrio harveyi bacteria still becomes an obstacle in penaeid shrimp farming, especially in shrimp hatchery. This study was aimed to identify the presence of V. harveyi in L. vannamei through nested PCR using haemolysin gene primer. First, initial primers were designed using V. harveyi VIB 391 haemolysin gene sequence (accession number: DQ64...

  12. Design of a Combined Ballistic Simulator and Primer Force Experimental Fixture

    Science.gov (United States)

    2015-08-01

    ARL-MR-0896 ●AUG 2015 US Army Research Laboratory Design of a Combined Ballistic Simulator and Primer Force Experimental Fixture...SUBTITLE Design of a Combined Ballistic Simulator and Primer Force Experimental Fixture 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT...Contents List of Figures iv Acknowledgments v 1. Introduction 1 2. Background 1 3. Technical Approach 4 3.1 Hardware Design 4 3.2 Experimental Setup

  13. Eighteen SSR-primers for tetraploid Adansonia digitata and its relatives

    OpenAIRE

    Larsen, Anders Søndergaard; Vaillant, Alexandre; Verhaegen, Daniel; Kjær, Erik Dahl

    2009-01-01

    International audience; Co-dominant markers suitable for molecular ecological studies in the genus Adansonia are highly desirable in order to be able to address a number of interesting research questions related to the special life history traits, gene flow, and distribution dynamics of the Adansonia species. This note presents a set of 18 SSR- primers developed for Adansonia digitata, and tested for cross-amplification on all members of the Adansonia genus. All reported primers were found to a...

  14. Chrome-Free Paint Primer for Zn/Ni Plated High-Strength Steel (Briefing Charts)

    Science.gov (United States)

    2014-11-19

    Approach Primer technology development steps:  Corrosion inhibitor chemistries modeling and high-throughput screening in solution  Promising inhibitor ...95% CI Effectiveness of Corrosion Inhibitors SrCrO4 Low(-) High(+) High(+) High(+) Low(-) Low(-) Ce3+ MoO4 2- WO4 2-B A C Approved for Public Release...Chrome-free Primer TCP LHE= Low Hydrogen Embrittlement CCC= Chromate (Cr6+) Conversion Coating TCP= Trivalent (Cr3+) Chromium Process  Regulatory EHS

  15. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates.

    Science.gov (United States)

    Folmer, O; Black, M; Hoeh, W; Lutz, R; Vrijenhoek, R

    1994-10-01

    We describe "universal" DNA primers for polymerase chain reaction (PCR) amplification of a 710-bp fragment of the mitochondrial cytochrome c oxidase subunit I gene (COI) from 11 invertebrate phyla: Echinodermata, Mollusca, Annelida, Pogonophora, Arthropoda, Nemertinea, Echiura, Sipuncula, Platyhelminthes, Tardigrada, and Coelenterata, as well as the putative phylum Vestimentifera. Preliminary comparisons revealed that these COI primers generate informative sequences for phylogenetic analyses at the species and higher taxonomic levels.

  16. The sorption of iodine by an inorganic zinc primer

    Energy Technology Data Exchange (ETDEWEB)

    Evans, G.J.; Bekeris, P.A. [Toronto Univ., ON (Canada). Dept. of Chemical Engineering and Applied Chemistry

    1996-12-01

    The purpose of this work was to identify and evaluate significant parameters in the sorption of I{sub 2}(g) onto Carbo Zinc 11 inorganic primer, a paint used in the containment structure of some CANDU reactors. Air containing known amounts of {sup 131}I{sub 2}(g) was passed through 0.64 cm diameter glass tubing coated on the inner surface with paint. The accumulation of iodine on the surface was continuously monitored using two scintillation detectors. The test parameters covered were relative humidity, flow rate, I{sub 2} concentration and paint temperature. Adsorption was rapid at 23{sup o}C and predominantly gas phase mass transfer limited: the deposition velocity of 0.7{+-}0.4 cm/s was similar to the gas phase mass transfer coefficient of 1.2 cm/s estimated for the system. The deposition velocity observed at a higher paint surface temperature was an order of magnitude smaller. A similar deposition velocity was observed at 23{sup o}C for adsorption of I{sub 2}(g) from essentially dry air suggesting that the low deposition velocity observed for high surface temperature was limited by the amount of water on the paint surface. The rate of adsorption on the paint was directly proportional to the I{sub 2}(g) concentration over the range in concentration studied. The majority of the iodine retained by the paint could not be removed by washing with methanol or chloroform, but it was removed by water indicating that it was in an ionic form. Analysis of the speciation of the iodine in the wash water indicated that only a third of it was in the form of I{sup -}; the form of the remaining iodine could not be resolved. Desorption from the paint was negligible at room temperature but was detectable at higher temperatures. These low desorption rates and the ionic nature of the surface iodine indicated that adsorption occurred predominantly through a chemisorption process. A number of possible mechanisms were proposed. (author) 5 figs., 2 tabs., 6 refs.

  17. Replication and pathogenicity of primer binding site mutants of SL3-3 murine leukemia viruses

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Schmidt, J; Luz, A;

    1999-01-01

    Retroviral reverse transcription is primed by a cellular tRNA molecule annealed to an 18-bp primer binding site sequence. The sequence of the primer binding site coincides with that of a negatively acting cis element that mediates transcriptional silencing of murine leukemia virus (MLV......) in undifferentiated embryonic cells. In this study we test whether SL3-3 MLV can replicate stably using tRNA primers other than the cognate tRNAPro and analyze the effect of altering the primer binding site sequence to match the 3' end of tRNA1Gln, tRNA3Lys, or tRNA1,2Arg in a mouse pathogenicity model. Contrary...... to findings from cell culture studies of primer binding site-modified human immunodeficiency virus type 1 and avian retroviruses, our findings were that SL3-3 MLV may stably and efficiently replicate with tRNA primers other than tRNAPro. Although lymphoma induction of the SL3-3 Lys3 mutant was significantly...

  18. Detection of Luminous Vibrio harveyi in Penaeid Shrimp Through Nested PCR Using Haemolysin Gene Primer

    Directory of Open Access Journals (Sweden)

    Wawan Abdullah Setiawan

    2015-04-01

    Full Text Available Whiteleg shrimp (Litopenaeus vannamei is one of the most important aquaculture commodity in Indonesia. However, the luminous disease primarily caused by Vibrio harveyi bacteria still becomes an obstacle in penaeid shrimp farming, especially in shrimp hatchery. This study was aimed to identify the presence of V. harveyi in L. vannamei through nested PCR using haemolysin gene primer. First, initial primers were designed using V. harveyi VIB 391 haemolysin gene sequence (accession number: DQ640264, flanking the position 133 to 756. This primer pairs were used to identify haemolysin gene in both V. harveyi MR5339 and V. harveyi 275 strain. Sequencing results from each sample showed 99% similarity with haemolysin gene sequence in Genebank. Furthermore, the sequence of V. harveyi MR5339 haemolysin gene was used to design the nested PCR primers. The first primer pairs of nested PCR have successfully amplified the haemolysin gene fragment of all V. harveyi strains samples from position 52 to 405. The second primer pairs of nested PCR have amplified position 204 to 405 where it can detect all of V. harveyi strains used as sample sources in this study. The application of nested PCR technique in this study was able to identify V. harveyi strains at serial dilution of cells density as low as 100 cfu/mL, which is equal to a single cell or at DNA concentration up to 101 fg/µL.

  19. PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.

    Science.gov (United States)

    Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong

    2015-01-01

    Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.

  20. Target-cell-derived tRNA-like primers for reverse transcription support retroviral infection at low efficiency

    DEFF Research Database (Denmark)

    Schmitz, Alexander; Lund, Anders H; Hansen, Anette C;

    2002-01-01

    by cases of correction of single mismatches between Akv-MLV vectors and complementary tRNA primers toward the primer sequence in the integrated vector. Thus, target-cell-derived tRNA-like primers are able to initiate first-strand cDNA synthesis and plus-strand transfer leading to a complete provirus......Reverse transcription of a retroviral genome takes place in the cytoplasm of an infected cell by a process primed by a producer-cell-derived tRNA annealed to an 18-nucleotide primer-binding site (PBS). By an assay involving primer complementation of PBS-mutated vectors we analyzed whether tRNA...... primers derived from the target cell can sustain reverse transcription during murine leukemia virus (MLV) infection. Transduction efficiencies were 4-5 orders of magnitude below those of comparable producer-cell complementations. However, successful usage of a target-cell-derived tRNA primer was proven...

  1. A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics

    DEFF Research Database (Denmark)

    Busk, Peter Kamp

    2014-01-01

    Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come...... design of primers for the method miR-specific RT-qPCR, which is one of the best performing microRNA qPCR methods available. The algorithm is based on an implementation of the previously published rules for manual design of miR-specific primers with the additional feature of evaluating the propensity...... of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed...

  2. Primer-Dependent and Primer-Independent Initiation of Double Stranded RNA Synthesis by Purified Arabidopsis RNA-Dependent RNA Polymerases RDR2 and RDR6

    Science.gov (United States)

    Devert, Anthony; Fabre, Nicolas; Floris, Maïna; Canard, Bruno; Robaglia, Christophe; Crété, Patrice

    2015-01-01

    Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer-independent and primer-dependent RNA polymerase activities with different efficiencies. We further show that RDR2 and RDR6 can initiate dsRNA synthesis either by elongation of 21- to 24- nucleotides RNAs hybridized to complementary RNA template or by elongation of self-primed RNA template. These findings provide new insights into our understanding of the molecular mechanisms of RNA silencing in plants. PMID:25793874

  3. Influence of acid-etching and ceramic primers on the repair of a glass ceramic.

    Science.gov (United States)

    Queiroz, J R C; Souza, Rodrigo O A; Nogueira Junior, L; Ozcan, M; Bottino, M A

    2012-01-01

    The objective of this study was to evaluate the influence of different primers on the microtensile bond strength (μTBS) between a feldspathic ceramic and two composites. Forty blocks (6.0 x 6.0 x 5.0 mm³) were prepared from Vita Mark II . After polishing, they were randomly divided into 10 groups according to the surface treatment: Group 1, hydrofluoric acid 10% (HF) + silane; Group 2, CoJet + silane; Group 3, HF + Metal/Zirconia Primer; Group 4, HF + Clearfil Primer; Group 5, HF + Alloy Primer; Group 6, HF + V-Primer; Group 7, Metal/Zirconia Primer; Group 8, Clearfil Primer; Group 9, Alloy Primer; Group 10, V-Primer. After each surface treatment, an adhesive was applied and one of two composite resins was incrementally built up. The sticks obtained from each block (bonded area: 1.0 mm² ± 0.2 mm) were stored in distilled water at 37 degrees C for 30 days and submitted to thermocycling (7,000 cycles; 5 degrees C/55 degrees C ± 1 degree C). The μTBS test was carried out using a universal testing machine (1.0 mm/min). Data were analyzed using ANOVA and a Tukey test (a = 0.05). The surface treatments significantly affected the results (P 0.05). The bond strength means (MPa) were as follows: Group 1a = 29.6; Group 1b = 33.7; Group 2a = 28.9; Group 2b = 27.1; Group 3a = 13.8; Group 3b = 14.9; Group 4a = 18.6; Group 4b = 19.4; Group 5a = 15.3; Group 5b = 16.5; Group 6a = 11; Group 6b = 18; Groups 7a to 10b = 0. While the use of primers alone was not sufficient for adequate bond strengths to feldspathic ceramic, HF etching followed by any silane delivered higher bond strength.

  4. Primer containing dimethylaminododecyl methacrylate kills bacteria impregnated in human dentin blocks

    Institute of Scientific and Technical Information of China (English)

    Chen Chen; Lei Cheng; Michael D Weir; Nancy J Lin; Sheng Lin-Gibson; Xue-Dong Zhou; Hockin HK Xu

    2016-01-01

    Antibacterial dimethylaminododecyl methacrylate (DMADDM) was recently synthesized. The objectives of this study were to:(1) investigate antibacterial activity of DMADDM-containing primer on Streptococcus mutans impregnated into dentin blocks for the first time, and (2) compare the antibacterial efficacy of DMADDM with a previous quaternary ammonium dimethacrylate (QADM). Scotchbond Multi-Purpose (SBMP) bonding agent was used. DMADDM and QADM were mixed into SBMP primer. Six primers were tested:SBMP control primer P, P+2.5%DMADDM, P+5%DMADDM, P+7.5%DMADDM, P+10%DMADDM, and P+10%QADM. S. mutans were impregnated into human dentin blocks, and each primer was applied to dentin to test its ability to kill bacteria in dentinal tubules. Bacteria in dentin were collected via a sonication method, and the colony-forming units (CFU) and inhibition zones were measured. The bacterial inhibition zone of P+10%DMADDM was 10 times that of control primer (Po0.05). CFU in dentin with P+10%DMADDM was reduced by three orders of magnitude, compared with control. DMADDM had a much stronger antibacterial effect than QADM, and antibacterial efficacy increased with increasing DMADDM concentration. Dentin shear bond strengths were similar among all groups (P40.1). In conclusion, antibacterial DMADDM-containing primer was validated to kill bacteria inside dentin blocks, possessing a much stronger antibacterial potency than the previous QADM. DMADDM-containing bonding agent was effective in eradicating bacteria in dentin, and its efficacy was directly proportional to DMADDM mass fraction. Therefore, DMADDM may be promising for use in bonding agents as well as in other restorative and preventive materials to inhibit bacteria.

  5. Functional genes to assess nitrogen cycling and aromatic hydrocarbon degradation: primers and processing matter

    Directory of Open Access Journals (Sweden)

    Christopher Ryan Penton

    2013-09-01

    Full Text Available Targeting sequencing to genes involved in key environmental processes, i.e. ecofunctional genes, provides an opportunity to sample nature’s gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in-silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature’s related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification.

  6. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  7. Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants

    Directory of Open Access Journals (Sweden)

    Aleksić Jelena M.

    2016-01-01

    Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005

  8. MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR.

    Science.gov (United States)

    Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo

    2015-11-16

    Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR.

  9. Typing of multiple single-nucleotide polymorphisms using ribonuclease cleavage of DNA/RNA chimeric single-base extension primers and detection by MALDI-TOF mass spectrometry

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus;

    2005-01-01

    A novel single-base extension (SBE) assay using cleavable and noncleavable SBE primers in the same reaction mix is described. The cleavable SBE primers consisted of deoxyribonucleotides and one ribonucleotide (hereafter denoted chimeric primers), whereas the noncleavable SBE primers consisted of ...

  10. Evaluating primers for profiling anaerobic ammonia oxidizing bacteria within freshwater environments.

    Directory of Open Access Journals (Sweden)

    Puntipar Sonthiphand

    Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library

  11. Evaluating primers for profiling anaerobic ammonia oxidizing bacteria within freshwater environments.

    Science.gov (United States)

    Sonthiphand, Puntipar; Neufeld, Josh D

    2013-01-01

    Anaerobic ammonia oxidizing (anammox) bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE) fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r) for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r) was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library analysis, A438f/A684r

  12. Multiplex PCR based on a universal biotinylated primer to generate templates for pyrosequencing.

    Science.gov (United States)

    Chen, Zhiyao; Liu, Yunlong; Duan, Wenbang; Ye, Hui; Wu, Haiping; Li, Jinheng; Zhou, Guohua

    2014-06-01

    Pyrosequencing is a powerful tool widely used in genetic analysis, however template preparation prior to pyrosequencing is still costly and time-consuming. To achieve an inexpensive and labor-saving template preparation for pyrosequencing, we have successfully developed a single-tube multiplex PCR including a pre-amplification and a universal amplification. In the process of pre-amplification, a low concentration of target-specific primers tagged with universal ends introduced universal priming regions into amplicons. In the process of universal amplification, a high concentration of universal primers was used for yielding amplicons with various SNPs of interest. As only a universal biotinylated primer and one step of single-stranded DNA preparation were required for typing multiple SNPs located on different sequences, pyrosequencing-based genotyping became time-saving, labor-saving, sample-saving, and cost-saving. By a simple optimization of multiplex PCR condition, only a 4-plex and a 3-plex PCR were required for typing 7 SNPs related to tamoxifen metabolism. Further study showed that pyrosequencing coupled with an improved multiplex PCR protocol allowed around 30% decrease of either typing cost or typing labor. Considering the biotinylated primer and the optimized condition of the multiplex PCR are independent of SNP locus, it is easy to use the same condition and the identical biotinylated primer for typing other SNPs. The preliminary typing results of the 7 SNPs in 11 samples demonstrated that multiplex PCR-based pyrosequencing could be promising in personalized medicine at a low cost.

  13. Genus-Specific Primers for Study of Fusarium Communities in Field Samples.

    Science.gov (United States)

    Karlsson, Ida; Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-10-30

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology.

  14. The effect of various primers on shear bond strength of zirconia ceramic and resin composite

    Directory of Open Access Journals (Sweden)

    Sasiwimol Sanohkan

    2013-01-01

    Full Text Available Aims: To determine the in vitro shear bond strengths (SBS of zirconia ceramic to resin composite after various primer treatments. Materials and Methods: Forty zirconia ceramic (Zeno, Wieland Dental specimens (10 mm in diameter and 2 mm thick were prepared, sandblasted with 50 μm alumina, and divided into four groups (n = 10. Three experimental groups were surface treated with three primers; CP (RelyX Ceramic Primer, 3M ESPE, AP (Alloy Primer, Kuraray Medical, and MP (Monobond Plus, Ivoclar Vivadent AG. One group was not treated and served as the control. All specimens were bonded to a resin composite (Filtek Supreme XT, 3M ESPE cylinder with an adhesive system (Adper Scotchbond Multi-Purpose Plus Adhesive, 3M ESPE and then stored in 100% humidity at 37°C for 24 h before SBS testing in a universal testing machine. Mean SBS (MPa were analyzed with one-way analysis of variance (ANOVA and the Tukey′s Honestly Significant Difference (HSD test (α = 0.05. Results: Group AP yielded the highest mean and standard deviation (SD value of SBS (16.8 ± 2.5 MPa and Group C presented the lowest mean and SD value (15.4 ± 1.6 MPa. The SBS did not differ significantly among the groups (P = 0.079. Conclusions: Within the limitations of this study, the SBS values between zirconia ceramic to resin composite using various primers and untreated surface were not significantly different.

  15. Summary of the primer on tumor immunology and the biological therapy of cancer

    Directory of Open Access Journals (Sweden)

    Margolin Kim

    2009-01-01

    Full Text Available Abstract The International Society for Biological Therapy of Cancer (iSBTc is one of the "premier destinations for interaction and innovation in the cancer biologics community". It provides a primer course each year during the annual meeting to address the most important areas of tumor immunology and immunotherapy. The course has been given by prominent investigators in the area of interest, covering the core principles of cancer immunology and immunotherapy. The target audience for this program includes investigators from academic, regulatory, and biopharmaceutical venues. The program goal is to enable the attendees to learn the current status and the most recent advances in biologic therapies, and to leverage this knowledge towards the improvement of cancer therapy. The 2008 immunologic primer course was held on October 30 at the 23rd Annual meeting of iSBTc in San Diego, CA. Nine internationally renowned investigators gave excellent presentations on different topics. The topics covered in this primer included: (1 cytokines in cancer immunology; (2 anti-angiogenic therapy; (3 end stage: immune killing of tumors; (4 blocking T cell checkpoints; (5 approach to identification and therapeutic exploitation of tumor antigens; (6 T regulatory cells; (7 adoptive T cell therapy; (8 immune monitoring of cancer immunotherapy; and (9 immune adjuvants. We summarized the topics in this primer for public education. The related topic slides and schedule can be accessed online http://www.isbtc.org/meetings/am08/primer08.

  16. PCR primers for an aldolase-B intron in acanthopterygian fishes

    Directory of Open Access Journals (Sweden)

    Jones William J

    2001-11-01

    Full Text Available Abstract Background Nuclear DNA sequences provide genetic information that complements studies using mitochondrial DNA. Some 'universal' primer sets have been developed that target introns within protein-coding loci, but many simultaneously amplify introns from paralogous loci. Refining existing primer sets to target a single locus could circumvent this problem. Results Aldolase intron 'G' was amplified from four fish species using previously described primer sets that target several loci indiscriminately. Phylogenetic analyses were used to group these fragments and other full-length aldolase proteins from teleost fishes into orthologous clades and a primer set was designed to target specifically an intron within the aldolase-B locus in acanthopterygian fishes. DNA amplifications were tried in a variety of acanthopterygian fishes and amplification products, identifiable as aldolase-B intron 'G', were observed in all atherinomorph and percomorph taxa examined. Sequence variation within this locus was found within and among several species examined. Conclusions Using 'universal' primer sets coupled with phylogenetic analyses it was possible to develop a genetic assay to target a specific locus in a variety of fish taxa. Sequence variation was observed within and among species suggesting that this targeted assay might facilitate interspecific and intraspecific comparisons.

  17. Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

    Science.gov (United States)

    Françoso, E; Arias, M C

    2013-09-01

    Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode.

  18. Effect of 4-MET- and 10-MDP-based primers on resin bonding to titanium.

    Science.gov (United States)

    Tsuchimoto, Youhei; Yoshida, Yasuhiro; Mine, Atsushi; Nakamura, Mariko; Nishiyama, Norihiro; Van Meerbeek, Bart; Suzuki, Kazuomi; Kuboki, Takuo

    2006-03-01

    The purpose of this study was to investigate the effect of a 4-MET- and 10-MDP-based primer on the bond strength of two resin cements (SuperBond C&B, Sun Medical; Panavia Fluoro Cement, Kuraray) to titanium (Ti). Ti plates were treated with six experimental primers consisting of, respectively, 10-MDP and 4-MET in concentrations of 0.1, 1 and 10wt%, or were kept untreated (control). The highest tensile bond strength of Panavia Fluoro Cement to Ti was obtained when the Ti surface was pre-treated with 10wt% 10-MDP and was significantly higher than that when a lower concentrated 10-MDP-based primer or any 4-MET-based primer was used. On the contrary, no significant difference in tensile bond strength of SuperBond C&B was found for the untreated and six pre-treated Ti surfaces, although pre-treatment with each 10-MDP-based primer resulted in a higher tensile bond strength as compared to any 4-MET pre-treatment. Altogether, the data obtained strongly suggest that 10-MDP is effective to improve the adhesive performance of resin to titanium.

  19. Evaluation of genotypic diversity of Streptococcus mutans using distinct arbitrary primers

    Directory of Open Access Journals (Sweden)

    Cínthia Pereira Machado Tabchoury

    2008-12-01

    Full Text Available Streptococcus mutans has been considered one of the main etiological agents of dental caries and the genotypic diversity rather than its salivary counts may be considered as a virulence factor of this bacterium. For genotyping with polymerase chain reaction (PCR with arbitrary primers, several primers have been used in order to improve complexity and specificity of amplicon patterns. Thus, the aim of this study was to evaluate the degree of agreement of genotypic identification among AP-PCR reactions performed with 5 distinct arbitrary primers of S. mutans isolated from saliva. Stimulated saliva was collected from 11 adult volunteers for isolation of S. mutans, and a total of 88 isolates were genotyped with arbitrary primers OPA 02, 03, 05, 13 and 18. Fourteen distinct genotypes were identified in the saliva samples. Most volunteers (9 out of 11 presented only one genotype. The results of the present study suggest that primers OPA 02, 03, 05 and 13 were suitable for genotypic identification of S. mutans isolates of saliva from adult volunteers.

  20. Effect of metal primers and tarnish treatment on bonding between dental alloys and veneer resin

    Science.gov (United States)

    Choo, Seung-Sik; Huh, Yoon-Hyuk; Cho, Lee-Ra

    2015-01-01

    PURPOSE The aim of this study was to evaluate the effect of metal primers on the bonding of dental alloys and veneer resin. Polyvinylpyrrolidone solution's tarnish effect on bonding strength was also investigated. MATERIALS AND METHODS Disk-shape metal specimens (diameter 8 mm, thickness 1.5 mm) were made from 3 kinds of alloy (Co-Cr, Ti and Au-Ag-Pd alloy) and divided into 4 groups per each alloy. Half specimens (n=12 per group) in tarnished group were immersed into polyvinylpyrrolidone solution for 24 hours. In Co-Cr and Ti-alloy, Alloy Primer (MDP + VBATDT) and MAC-Bond II (MAC-10) were applied, while Alloy Primer and V-Primer (VBATDT) were applied to Au-Ag-Pd alloys. After surface treatment, veneering composite resin were applied and shear bond strength test were conducted. RESULTS Alloy Primer showed higher shear bond strength than MAC-Bond II in Co-Cr alloys and Au-Ag-Pd alloy (Pveneer resin to Co-Cr and Au-Ag-Pd alloys. PMID:26576256

  1. Sequence-specific "gene signatures" can be obtained by PCR with single specific primers at low stringency.

    OpenAIRE

    Pena, S D; Barreto, G.; Vago, A. R.; De Marco, L; Reinach,F. C.; Dias Neto, E; Simpson, A J

    1994-01-01

    Low-stringency single specific primer PCR (LSSP-PCR) is an extremely simple PCR-based technique that detects single or multiple mutations in gene-sized DNA fragments. A purified DNA fragment is subjected to PCR using high concentrations of a single specific oligonucleotide primer, large amounts of Taq polymerase, and a very low annealing temperature. Under these conditions the primer hybridizes specifically to its complementary region and nonspecifically to multiple sites wi...

  2. Demonstration and Validation of a Replacement Alternative to the Chromate Wash Primer DOD-P-15328D

    Science.gov (United States)

    2006-04-01

    system. The current wash primer is a low-solids, solvent-based polyvinyl butyral that contains phosphoric acid and zinc chromate that promotes adhesion...prior to the application of an epoxy primer/polyurethane topcoat CARC system. The current wash primer is a low-solids, solvent-based polyvinyl ... butyral that contains phosphoric acid and zinc chromate that promotes adhesion and minimizes corrosion. This coating contains large amounts of volatile

  3. Temas de Física para Ingeniería: Primer principio de la termodinámica

    OpenAIRE

    Beléndez Vázquez, Augusto

    1992-01-01

    Acústica, fluidos y termodinámica: "Primer principio de la termodinámica". Objetivos y caracteres generales de la termodinámica. Conceptos fundamentales de la termodinámica. Capacidad calorífica, calor específico y calor latente. Trabajo. Primer principio de la termodinámica: energía interna. Algunas aplicaciones del primer principio.

  4. Effect of primers containing copper salts on bonding of TBB resin to enamel.

    Science.gov (United States)

    Taira, Y; Imai, Y

    1994-12-01

    The effect of primers containing copper salts on adhesion between enamel and stainless steel was studied in a trial to improve durability of TBB type resin cements. Bovine enamel surfaces were treated with 10% phosphoric acid, then with acetone primers containing copper salts, and finally bonded with TBB resins. Tensile strengths of the bonded specimens were measured after thermocycling testing in water and compared with those obtained for commercial composite type resin cements. A combination of a primer containing copper (II) methacryloyloxyethyl succinate and 4-META/MMA-TBB resin was most effective in improving the durability, and superior to the commercial resin cements. The mean and lowest bond strength values of 21 MPa and about 12 MPa, respectively, were retained after 2,000 thermocycles.

  5. Analysis of Two Chinese Yak(Bos grunniens) Population Using Bovine Microsatellite Primers

    Institute of Scientific and Technical Information of China (English)

    Wang Minqiang; S.Weigend; A.Barre-Dirie; J.W.Carnwath; Lou Zhonglin; H.Niemann

    2005-01-01

    Two Chinese domestic yak populations representing the Plateau type and the Huanhu Alpine type were analysed with 12 bovine microsatellite primers. All primer pairs functioned in the yak genome and polymorphism was found at all loci. The allele size ranges and frequencies of the two yak populations were similar and there was considerable overlap with the allele size ranges observed in cattle. Data for European cattle breeds was obtained from the Cattle Diversity Database(CaDBase)to interpret the heterozygosity and genetic distance estimates in yak populations. Heterozygosity estimated for the two yak populations was comparable to that of European cattle while Nei's Genetic Distance DA between the two yak populations was less than distances between the most closely related German cattle breeds. Bovine microsatellite primers proved to be a valuable tool for characterization of yak populations.

  6. Single primer-mediated circular polymerase chain reaction for hairpin DNA cloning and plasmid editing.

    Science.gov (United States)

    Huang, Jiansheng; Khan, Inamullah; Liu, Rui; Yang, Yan; Zhu, Naishuo

    2016-05-01

    We developed and validated a universal polymerase chain reaction (PCR) method, single primer circular (SPC)-PCR, using single primer to simultaneously insert and amplify a short hairpin sequence into a vector with a high success rate. In this method, the hairpin structure is divided into two parts and fused into a vector by PCR. Then, a single primer is used to cyclize the chimera into a mature short hairpin RNA (shRNA) expression vector. It is not biased by loop length or palindromic structures. Six hairpin DNAs with short 4-nucleotide loops were successfully cloned. Moreover, SPC-PCR was also applied to plasmid editing within 3 h with a success rate higher than 95%.

  7. Efficient newly designed primers for the amplification and sequencing of bird mitochondrial genomes.

    Science.gov (United States)

    Amer, Sayed A M; Ahmed, Mohamed Mohamed; Shobrak, Mohammed

    2013-01-01

    In the present study, 27 mitochondrial genomes of diverse avian supra-orders were collected from the Genbank database and their genes were aligned separately. From the alignments, the conserved sequences were selected to design novel conserved primers for amplification and sequencing of the different mitochondrial genes. The reproducibility of these primers was tested in the amplification and sequencing of diverse avian supra-order mitochondrial genomes and was confirmed. This method helped in designing a new set of primers to accelerate both the amplification and the sequencing of bird mitogenomes. It also aids in building mitogenome markers in studying the genetic framework of endemic birds as a preliminary strategy for conservation management of them.

  8. Kisspeptin: a new neuronal target of primer pheromones in the control of reproductive function in mammals.

    Science.gov (United States)

    Jouhanneau, Mélanie; Szymanski, Laura; Martini, Mariangela; Ella, Arsène; Keller, Matthieu

    2013-07-01

    Pheromones are known to trigger either short-term behavioral responses, usually referred to as "releaser effects", or more long-term physiological changes, known as "primer effects", which especially affect reproductive function at the level of the gonadotrope axis. The precise mechanisms through which pheromones interact with the gonadotrope axis in the hypothalamus is not fully known. We propose that the neuropeptide Kisspeptin, could be a specific target of primer pheromones, allowing these pheromones to modulate the gonadotrope axis and GnRH activity. This emerging hypothesis is discussed in the context of puberty acceleration in female mice and the male effect in female ungulates (sheep or goat). These examples have been chosen to illustrate the diversity of the reproductive contexts in mammals and potential mechanisms affected by primer effects at the level of the gonadotrope axis.

  9. Novel Primers From Informative Nuclear Loci for Louse Molecular Phylogenetics (Insecta: Phthiraptera).

    Science.gov (United States)

    Sweet, Andrew D; Allen, Julie M; Johnson, Kevin P

    2014-11-01

    While parasitic lice (Insecta: Phthiraptera) have historically been an important model taxon for understanding host-parasite coevolution, very few molecular markers have been developed for phylogenetic analysis. The current markers are insufficient to resolve many of the deeper nodes in this group; therefore, sequences from additional genetic loci are necessary. Here, we design primers targeting several nuclear protein coding genes based on a complete genome and transcriptome of Pediculus humanus L. plus transcriptomes and modest coverage genomic data from five genera of avian feather lice. These primers were tested on 32 genera of avian feather lice (Ischnocera), including multiple species within some genera. All of the new primer combinations produced sequences for the majority of the genera and had similar or higher divergences than the most widely used nuclear protein-coding gene in lice, EF-1α. These results indicate that these new loci will be useful in resolving phylogenetic relationships among parasitic lice.

  10. MALDI-TOF mass spectrometric detection of multiplex single base extended primers

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus;

    2004-01-01

    One of the most promising techniques for typing of multiple single-nucleotide polymorphism (SNP) is detection of single base extension primers (SBE) by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). We present a new MALDI-TOF MS protocol for typing...... triethylamine purification. The biotin-labeled ddNTPs contained linkers with different masses ensuring a clear separation of the alleles even for SBE primers with a mass of 10 300 Da. Furthermore, only 25-350 fmol of SBE primers were necessary in order to obtain reproducible MALDI-TOF spectra. Similar signal......, and the potential use of MALDI-TOF MS for SNP typing is discussed....

  11. Searching for Beta-Haemolysin hlb Gene in Staphylococcus pseudintermedius with Species-Specific Primers.

    Science.gov (United States)

    Kmieciak, Wioletta; Szewczyk, Eligia M; Ciszewski, Marcin

    2016-07-01

    The paper presents an analysis of 51 Staphylococcus pseudintermedius clinically isolated strains from humans and from animals. Staphylococcus pseudintermedius strains' ability to produce β-haemolysin was evaluated with phenotypic methods (hot-cold effect, reverse CAMP test). In order to determine the hlb gene presence (coding for β-haemolysin) in a genomic DNA, PCR reactions were conducted with two different pairs of primers: one described in the literature for Staphylococcus aureus and recommended for analysing SIG group staphylococci and newly designed one in CLC Main Workbench software. Only reactions with newly designed primers resulted in product amplification, the presence of which was fully compatible with the results of phenotypic β-haemolysin test. Negative results for S. aureus and S. intermedius reference ATCC strains suggest that after further analysis the fragment of hlb gene amplified with primers described in this study might be included in the process of S. pseudintermedius strains identification.

  12. Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

    Directory of Open Access Journals (Sweden)

    Zuiter Afnan

    2012-08-01

    Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

  13. Descripción de factores sociodemográficos y socioafectivos y su relación con el desempeño académico de los estudiantes de cuarto semestre de psicología de una institución de educación superior

    Directory of Open Access Journals (Sweden)

    Ernesto L. Ravelo C

    2013-01-01

    Full Text Available Abstract This research paper has two purposes: a To describe the demographic features, family history, social affective factors and academic performance in fourth-semester students enrolled in day and night courses in the department of Psychology at the university, in order to define the Psychology students’ profiles and b To understand students’ relationships between demographic and social affective aspects compared with their academic performance. This research aims to establish the relationship between academic performance and students’ affective factors. There is no evidence of prior studies of these affective factors. A questionnaire about associated factors is designed and given to 122 fourth-semester students. The answers, factors, and indices are designed using statistical Winsteps and Rasch models in order to establish the relationship between factors and academic performance. AMOS, which allows the analysis of the relationship between factors and academic performance, is used as a tool to understand the impact of such relationships. The questionnaire given to the psychology students in this study supplied useful information using indices and factors to create psychology students’ profiles. The explanation of these factors about student performance is useful when the information is analyzed and takes into account sex and socio-economical levels, and not the whole group in general. Resumen El presente trabajo de investigación tuvo como objetivos: a Describir las características demográficas, la historia familiar, los factores socioafectivos y los factores académicos de los estudiantes de cuarto semestre de las jornadas diurna y nocturna de la facultad de Psicología de una institución de educación superior, con miras a definir una caracterización del estudiante de Psicología; y b Establecer la relación entre los factores demográficos y socioafectivos y el desempeño académico de los estudiantes. Se buscó establecer la

  14. Transfer of primer binding site-mutated simian immunodeficiency virus vectors by genetically engineered artificial and hybrid tRNA-like primers

    DEFF Research Database (Denmark)

    Hansen, A C; Grunwald, T; Lund, Anders Henrik;

    2001-01-01

    Simian immunodeficiency viruses (SIV) harbor primer binding sites (PBS) matching tRNA or tRNA. To study determinants of primer usage in SIV, a SIVmac239-based vector was impaired by mutating the PBS to a sequence (PBS-X2) with no match to any tRNA. By cotransfection of a synthetic gene encoding a tRNA...... could be obtained by cotransfection of a gene for an engineered tRNA(Pro)-tRNA hybrid with a match to PBS-Pro. The importance of tRNA backbone identity was further analyzed by complementing the PBS-X2 vector with a gene for a matching x2 primer with a tRNA backbone, which led to three- to fourfold......(Pro)-like RNA with a match to PBS-X2, the activity of this vector could be restored to a transduction efficiency slightly lower than that of the wild-type vector. A vector with a PBS matching tRNA(Pro) was functional at a level slightly below that of the wild-type vector, but higher transduction efficiency...

  15. Oligonucleotide primers for targeted amplification of single-copy nuclear genes in apocritan Hymenoptera.

    Directory of Open Access Journals (Sweden)

    Gerrit Hartig

    Full Text Available BACKGROUND: Published nucleotide sequence data from the mega-diverse insect order Hymenoptera (sawflies, bees, wasps, and ants are taxonomically scattered and still inadequate for reconstructing a well-supported phylogenetic tree for the order. The analysis of comprehensive multiple gene data sets obtained via targeted PCR could provide a cost-effective solution to this problem. However, oligonucleotide primers for PCR amplification of nuclear genes across a wide range of hymenopteran species are still scarce. FINDINGS: Here we present a suite of degenerate oligonucleotide primer pairs for PCR amplification of 154 single-copy nuclear protein-coding genes from Hymenoptera. These primers were inferred from genome sequence data from nine Hymenoptera (seven species of ants, the honeybee, and the parasitoid wasp Nasonia vitripennis. We empirically tested a randomly chosen subset of these primer pairs for amplifying target genes from six Hymenoptera, representing the families Chrysididae, Crabronidae, Gasteruptiidae, Leucospidae, Pompilidae, and Stephanidae. Based on our results, we estimate that these primers are suitable for studying a large number of nuclear genes across a wide range of apocritan Hymenoptera (i.e., all hymenopterans with a wasp-waist and of aculeate Hymenoptera in particular (i.e., apocritan wasps with stingers. CONCLUSIONS: The amplified nucleotide sequences are (a with high probability from single-copy genes, (b easily generated at low financial costs, especially when compared to phylogenomic approaches, (c easily sequenced by means of an additionally provided set of sequencing primers, and (d suitable to address a wide range of phylogenetic questions and to aid rapid species identification via barcoding, as many amplicons contain both exonic and fast-evolving intronic nucleotides.

  16. Design and implementation of degenerate microsatellite primers for the mammalian clade.

    Directory of Open Access Journals (Sweden)

    Emmanuel Buschiazzo

    Full Text Available Microsatellites are popular genetic markers in molecular ecology, genetic mapping and forensics. Unfortunately, despite recent advances, the isolation of de novo polymorphic microsatellite loci often requires expensive and intensive groundwork. Primers developed for a focal species are commonly tested in a related, non-focal species of interest for the amplification of orthologous polymorphic loci; when successful, this approach significantly reduces cost and time of microsatellite development. However, transferability of polymorphic microsatellite loci decreases rapidly with increasing evolutionary distance, and this approach has shown its limits. Whole genome sequences represent an under-exploited resource to develop cross-species primers for microsatellites. Here we describe a three-step method that combines a novel in silico pipeline that we use to (1 identify conserved microsatellite loci from a multiple genome alignments, (2 design degenerate primer pairs, with (3 a simple PCR protocol used to implement these primers across species. Using this approach we developed a set of primers for the mammalian clade. We found 126,306 human microsatellites conserved in mammalian aligned sequences, and isolated 5,596 loci using criteria based on wide conservation. From a random subset of ~1000 dinucleotide repeats, we designed degenerate primer pairs for 19 loci, of which five produced polymorphic fragments in up to 18 mammalian species, including the distinctly related marsupials and monotremes, groups that diverged from other mammals 120-160 million years ago. Using our method, many more cross-clade microsatellite loci can be harvested from the currently available genomic data, and this ability is set to improve exponentially as further genomes are sequenced.

  17. The corrosion protection of AISI(TM) 1010 steel by organic and inorganic zinc-rich primers

    Science.gov (United States)

    Danford, M. D.; Mendrek, M. J.

    1995-01-01

    The behavior of zinc-rich primer-coated AISI 1010 steel in 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR), were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electromechanical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 1010 steel cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high current between the steel cathode and both zinc-rich primer anodes (38.8 and 135.2 microns A/sq cm for the organic and inorganic primers, respectively). The results of corrosion rate determinations demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. EIS equivalent circuit parameters confirmed this conclusion. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application on solid rocket booster steel hardware.

  18. Phosphatizing of Mg particles to improve the protective performance of Mg-rich primer on A2024 Al alloy

    Science.gov (United States)

    Wang, Jianguo; Zuo, Yu; Tang, Yuming; Lu, Xiangyu

    2014-02-01

    Mg-rich primer as a new type protective coating provides cathodic protection for Al alloy. In this paper, a kind of phosphatizing surface treatment on Mg particles was studied in order to improve the protective performance of Mg-rich primer. After treated with phosphoric acid, a protective magnesium phosphate layer was formed on the surface of Mg particles, which had no negative influence on the cathodic protection of the Mg-rich primer for Al alloy. The coating resistance of the treated Mg-rich primer was bigger than that of untreated primer, meanwhile the coating capacitance of the treated Mg-rich primer was smaller than that of untreated primer, suggesting that the barrier effect of the primer was improved and the lifetime was extended. The magnesium phosphate layer could reduce the consumption rate of Mg particles. Meanwhile, the phosphate radicals transported to Al alloy substrate to form a product layer composed of magnesium phosphate and aluminum phosphate on the substrate surface, which decreased the corrosion rate of Al alloy and improved the protective performance of the primer.

  19. PCR primers for 30 novel gene regions in the nuclear genomes of Lepidoptera

    OpenAIRE

    Wahlberg, Niklas; Peña, Carlos; Ahola, Milla; Wheat, Christopher W.; Rota, Jadranka

    2016-01-01

    Abstract We report primer pairs for 30 new gene regions in the nuclear genomes of Lepidoptera that can be amplified using a standard PCR protocol. The new primers were tested across diverse Lepidoptera , including nonditrysians and a wide selection of ditrysians. These new gene regions give a total of 11,043 bp of DNA sequence data and they show similar variability to traditionally used nuclear gene regions in studies of Lepidoptera . We feel that a PCR-based approach still has its place in m...

  20. Joint DoD Demonstration And Validation Of Magnesium-Rich Primer Coating Technology

    Science.gov (United States)

    2012-01-01

    AAC-K16 .. K18 896-AAC-D19 .. D21 896-AAC-X22 .. X24 Deft 02-Y-40 ANAC Aerodur 5000 MEK Wipe Brulin GD815 Butyl Alcohol 35% IPA 25% Phosphoric Acid ...Joint DoD Demonstration and Validation of Magnesium -Rich Primer Coating Technology ESTCP Project WP-0731 Dr. Craig J. Price Rachel M...Validation of Magnesium -Rich Primer Coating Technology 5a. CONTRACT NUMBER 5b. GRANT NUMBER WP-0731 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S

  1. Gold nanoparticle-assisted primer walking for closing the human chromosomal gap

    DEFF Research Database (Denmark)

    Li, H; Shi, B; Li, X;

    2013-01-01

    NPs) to improve the efficiency in primer walking amplification. We used this strategy to close a gap in human chromosome 5 containing a DNA stretch composed of the 12SAT repeat. The obtained gap sequence is highly conserved among several mammalian genomes. The demonstrated AuNP-assisted primer walking strategy......The finished sequence of the human genome still contains 260 euchromatic gaps. All the PCR-based genome walking techniques used to close gaps have common limitations, such as low efficiency and low specificity. We herein describe a strategy to solve this problem by employing gold nanoparticles (Au...

  2. A set of 100 chloroplast DNA primer pairs to study population genetics and phylogeny in monocotylenons

    DEFF Research Database (Denmark)

    Scarcelli, Nora; Bernaud, Adeline; Eiserhardt, Wolf L.;

    2011-01-01

    Chloroplast DNA sequences are of great interest for population genetics and phylogenetic studies. However, only a small set of markers are commonly used. Most of them have been designed for amplification in a large range of Angiosperms and are located in the Large Single Copy (LSC). Here we...... developed a new set of 100 primer pairs optimized for amplification in Monocotyledons. Primer pairs amplify coding (exon) and non-coding regions (intron and intergenic spacer). They span the different chloroplast regions: 72 are located in the LSC, 13 in the Small Single Copy (SSC) and 15 in the Inverted...

  3. Alteraciones del primer radio en el plano sagital. Tratamiento ortopodológico

    OpenAIRE

    Prats Climent, Baldiri; Alcorisa Rodero, Olga; Verdaguer Sanmartí, Josefina; Vázquez Amela, F. Xavier (Francesc Xavier); Vergés Salas, Carles; Vila Espinalt, Rosa M.

    2004-01-01

    Las alteraciones posicionales del primer radio en un plano sagital, dorsiflexionado o plantarflexionado, son causas de alteraciones en el funcionamiento de la articulación subastragalina y en consecuencia de la posición resultado del retropié. Esta relación causa-efecto depende de la movilidad (flexible, semiflexible o rígido) y de la adaptación del primer radio al suelo en la fase de apoyo total durante la marcha. Dependiendo de ello el tratamiento ortopodólogico será diferente, ...

  4. El arte de cozina de Diego Granado (1599), primer libro de cocina en lengua castellana

    OpenAIRE

    Redondo Buey, Patricia

    2014-01-01

    El Siglo de Oro es un periodo histórico que abarca desde el Renacimiento del siglo XVI hasta el Barroco del siglo XVII, durante el cual se publicó el primer tratado gastronómico de España. En este trabajo científico haremos un estudio meticuloso y minucioso sobre lo que se considera el primer recetario del Siglo de Oro español y así analizar las fuentes primarias de la cocina española, cosa que nunca se había hecho.

  5. Development of species-specific primers for detection of Streptococcus mutans in mixed bacterial samples

    OpenAIRE

    Chen, Zhou; Saxena, Deepak; Caufield, Page W.; Ge, Yao; Wang, Minqi; Li, Yihong

    2007-01-01

    Streptococcus mutans is the major microbial pathogen associated with dental caries in children. The objectives of this study were to design and evaluate species-specific primers for the identification of S. mutans. Validation of the best primer set, Sm479F/R, was performed using 7 S. mutans reference strains, 48 ATCC non-S. mutans strains, 92 S. mutans clinical isolates, DNA samples of S. mutans-S. sobrinus or S. mutans-S. sanguinis, and mixed bacterial DNA of saliva samples from 33 18-month-...

  6. What Are the Odds of that? A Primer on Understanding Logistic Regression

    Science.gov (United States)

    Huang, Francis L.; Moon, Tonya R.

    2013-01-01

    The purpose of this Methodological Brief is to present a brief primer on logistic regression, a commonly used technique when modeling dichotomous outcomes. Using data from the National Education Longitudinal Study of 1988 (NELS:88), logistic regression techniques were used to investigate student-level variables in eighth grade (i.e., enrolled in a…

  7. ANALISIS PRODUCT MAPPING DAYA SAING EKSPOR PRODUK PRIMER INDONESIA DAN CHINA

    Directory of Open Access Journals (Sweden)

    Sulthon Sjahril Sabaruddin

    2015-11-01

    Full Text Available This research attempts to analyze the mapping competition of the Indonesian and Chinese primary products in order to identify and map the strengths and weaknesses of Indonesian products vis-à-vis China. To examine this, the study uses tools such as the SMART Model (Software for Market Analysis and Restrictions on Trade, Social Accounting Matrix 2008 (SAM 2008, Normalized Revealed Comparative Advantage (NRCA and the Product Mapping. The results of the competition analysis found that Indonesia which rely on the export of primary products, in overall it is predicted to win the competition against China as the Indonesian primary products have better competitiveness than China. However, in the future, the competition will be fiercer, therefore, Indonesia should make efforts to improve further the competitiveness of Indonesian exports. Penelitian ini dimaksudkan untuk mengevaluasi peta persaingan produk primer Indonesia dan China guna mengidentifikasi dan memetakan kekuatan dan kelemahan produk Indonesia dalam persaingan dengan produk-produk primer asal China. Guna menelaah studi ini, beberapa perangkat dimanfaatkan yakni SMART Model (Software for Market Analysis and Restrictions on Trade, Sistem Neraca Sosial Ekonomi 2008 (SNSE 2008, Normalized Revealed Comparative Advantage (NRCA dan Product Mapping. Hasil analisis peta persaingan kedua negara, Indonesia yang mengandalkan ekspor produk primer diperkirakan secara keseluruhan unggul dibandingkan produk primer dari China karena Indonesia memiliki daya saing yang lebih baik dibandingkan China. Namun demikian, perlu diperhatikan bahwa persaingan ke depan akan berlangsung semakin ketat, oleh karena itu Indonesia perlu melakukan upaya untuk meningkatkan daya saing ekspor Indonesia.

  8. Hemorragias obstétricas en el primer y segundo trimestre del embarazo

    OpenAIRE

    García Rodríguez, Blanca

    2013-01-01

    Se aborda el tema de las hemorragias obstétricas en el primer y segundo trimestre del embarazo. Diagnóstico precoz de las mismas, la identificación de factores de riesgo, las causas y el tratamiento terapéutico

  9. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    Science.gov (United States)

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  10. PCR Conditions for 16S Primers for Analysis of Microbes in the Colon of Rats.

    Science.gov (United States)

    Guillen, I A; Camacho, H; Tuero, A D; Bacardí, D; Palenzuela, D O; Aguilera, A; Silva, J A; Estrada, R; Gell, O; Suárez, J; Ancizar, J; Brown, E; Colarte, A B; Castro, J; Novoa, L I

    2016-09-01

    The study of the composition of the intestinal flora is important to the health of the host, playing a key role in maintaining intestinal homeostasis and the evolution of the immune system. For these studies, various universal primers of the 16S rDNA gene are used in microbial taxonomy. Here, we report an evaluation of 5 universal primers to explore the presence of microbial DNA in colon biopsies preserved in RNAlater solution. The DNA extracted was used for the amplification of PCR products containing the variable (V) regions of the microbial 16S rDNA gene. The PCR products were studied by restriction fragment length polymorphism (RFLP) analysis and DNA sequence, whose percent of homology with microbial sequences reported in GenBank was verified using bioinformatics tools. The presence of microbes in the colon of rats was quantified by the quantitative PCR (qPCR) technique. We obtained microbial DNA from rat, useful for PCR analysis with the universal primers for the bacteria 16S rDNA. The sequences of PCR products obtained from a colon biopsy of the animal showed homology with the classes bacilli (Lactobacillus spp) and proteobacteria, normally represented in the colon of rats. The proposed methodology allowed the attainment of DNA of bacteria with the quality and integrity for use in qPCR, sequencing, and PCR-RFLP analysis. The selected universal primers provided knowledge of the abundance of microorganisms and the formation of a preliminary test of bacterial diversity in rat colon biopsies.

  11. Primer registro de Serratospiculum tendo (Nematoda: Diplotriaenidae para el Perú

    Directory of Open Access Journals (Sweden)

    Luis A. Gomez-Puerta

    2014-05-01

    Full Text Available Reportamos por primera vez la presencia del nematodo, Serratospiculum tendo Nitzsch, 1819, parasitando los sacos aéreos de un halcón peregrino (Falco peregrinus Tunstall, 1771. Seis nematodos (2 machos y 4 hembras fueron colectados e identificados como S. tendo. El hallazgo de este nematodo constituye el primer registro en el Perú.

  12. Primer registro de Tiaris fuliginosa (Wied, 1830) para la Argentina

    OpenAIRE

    Mazar Barnett, Juan; Herrera, Justo

    1996-01-01

    El primer registro de Argentina de Tiaris fuliginosa , basado en dos pájaros encontrados en el Parque Nacional Iguazú. The first record for Argentina of the Sooty Grassquit ( Tiaris fuliginosa ) is given, based on two birds notted at Iguazú National Park.

  13. A web-based adaptive tutor to teach PCR primer design

    NARCIS (Netherlands)

    van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used par

  14. A Web-Based Adaptive Tutor to Teach PCR Primer Design

    Science.gov (United States)

    van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…

  15. Towards a global antibiotic resistance surveillance system : a primer for a roadmap

    NARCIS (Netherlands)

    Grundmann, Hajo

    2014-01-01

    The need for global data about the scale of antibiotic resistance (ABR) in a geographical explicit and timely manner has been identified by many stakeholders, including the World Health Organization. This primer should help defining the objectives, scale, scope, and structure of possible future effo

  16. Primer Sets Developed for Functional Genes Reveal Shifts in Functionality of Fungal Community in Soils

    NARCIS (Netherlands)

    Hannula, S.E.; van Veen, J.A.

    2016-01-01

    Phylogenetic diversity of soil microbes is a hot topic at the moment. However, the molecular tools for the assessment of functional diversity in the fungal community are less developed than tools based on genes encoding the ribosomal operon. Here 20 sets of primers targeting genes involved mainly in

  17. Shortening distance of forward and reverse primers for nucleic acid isothermal amplification.

    Science.gov (United States)

    Haitao, Qu; Wenchao, Zhang; Xiaohui, Zhang; Xiujun, Wang; Sulong, Li

    2014-06-01

    Existent nucleic acid isothermal detection techniques for clinical diseases are difficult to promote greatly due to limitations in such aspects as methodology, costs of detection, amplification efficiency and conditions for operation. There is therefore an urgent need for a new isothermal amplification method with the characteristics of high accuracy, easy operation, short time of detection and low costs. We have devised a new method of nucleic acid isothermal amplification using Bst DNA polymerase under isothermal conditions (60-65°C). We call this method of amplification by shortening the distance between forward and reverse primers for nucleic acid isothermal amplification SDAMP. The results demonstrated that this technique is highly sensitive, specific and has short reaction times (40-60 min). Results of sequencing show that the products of SDAMP amplification are mainly polymers formed by series connection of monomers formed through linkage of forward primer and complementary sequences in reverse primer via a few bases. The method is different from current methods of nucleic acid amplification. Our study shows, however, that it is a specific method of nucleic acid isothermal amplification depending on interactions between primers and DNA template.

  18. Ecophysiological, ecological, and soil processes in terrestrial ecosystems: a primer on general concepts and relationships

    NARCIS (Netherlands)

    Kirschbaum, M.U.F.; Bullock, P.; Evans, J.R.; Goulding, K.; Jarvis, P.G.; Noble, I.R.; Rounsevell, M.; Sharkey, T.D.; Austin, M.P.; Brookes, P.; Brown, S.; Bugmann, H.K.M.; Cramer, W.P.; Diaz, S.; Gitay, H.; Hamburg, S.P.; Harris, J.

    1996-01-01

    This ecophysiological primer serves as an introductory chapter on the concepts applied in subsequent chapters reviewing the state of knowledge concerning the effects of climate change on ecological processes that affect impacts on terrestrial ecosystems and some socio-economic systems. Because many

  19. Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools

    Directory of Open Access Journals (Sweden)

    Melissa Agsalda

    2009-01-01

    Full Text Available Assessing molecular persistent or minimal residual disease (PD/MRD in childhood Burkitt lymphoma (BL is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs. Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgVH primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

  20. Development of Species-specific Primers for Rapid Detection of Phellinus linteus and P. baumii.

    Science.gov (United States)

    Kim, Mun-Ok; Kim, Gi-Young; Nam, Byung-Hyouk; Jin, Cheng-Yun; Lee, Ki-Won; Park, Jae-Min; Lee, Sang-Joon; Lee, Jae-Dong

    2005-06-01

    Genus Phellinus taxonomically belongs to Aphyllophorales and some species of this genus have been used as a medicinal ingredients and Indian folk medicines. Especially, P. linteus and morphological-related species are well-known medicinal fungi that have various biological activities such as humoral and cell-mediated, anti-mutagenic, and anti-cancer activities. However, little is known about the rapid detection for complex Phellinus species. Therefore, this study was carried out to develop specific primers for the rapid detection of P. linteus and other related species. Designing the species-specific primers was done based on internal transcribed spacer sequence data. Each primer set detected specifically P. linteus (PL2/PL5R) and P. baumii (PB1/PB4R). These primer sets could be useful for the rapid detection of specific-species among unidentified Phellinus species. Moreover, restriction fragment length polymorphism analysis of the ITS region with HaeIII was also useful for clarifying the relationship between each 5 Phellinus species.

  1. TM7 detection in human microbiome: are PCR primers and FISH probes specific enough?

    Science.gov (United States)

    Sizova, Maria V.; Doerfert, Sebastian N.; Gavrish, Ekaterina; Epstein, Slava S.

    2015-01-01

    TM7 appears important and omnipresent because it is repeatedly detected by molecular techniques in diverse environments. Here we report that most of primers and FISH probes thought to be TM7-specific do hybridize with multiple species from oral and vaginal cavity. This calls for re-examination of TM7 distribution and abundance. PMID:25957511

  2. Experimental Studies of the Number 41 Primer and Ignition 5.56-mm Ammunition

    Science.gov (United States)

    2006-09-01

    caliber primers are lead styphnate , barium nitrate, and antimony sulfide, Sb2S3. Lesser amounts of aluminum powder, tetracene, and...this particle, which apparently did not melt, consists primarily of Barium . ...........................................................14 Figure 17...15 Figure 21. Reference spectrum of barium nitrate (top) compared to a spectrum representative (**splat) of many residual particles from

  3. Sequence alignment status and amplicon size difference affecting EST-SSR primer performance and polymorphism

    Science.gov (United States)

    Little attention has been given to failed, poorly-performing, and non-polymorphic expressed sequence tag (EST) simple sequence repeat (SSR) primers. This is due in part to a lack of interest and value in reporting them but also because of the difficulty in addressing the causes of failure on a prime...

  4. Magnesium-Based Sacrificial Anode Cathodic Protection Coatings (Mg-Rich Primers for Aluminum Alloys

    Directory of Open Access Journals (Sweden)

    Michael D. Blanton

    2012-09-01

    Full Text Available Magnesium is electrochemically the most active metal employed in common structural alloys of iron and aluminum. Mg is widely used as a sacrificial anode to provide cathodic protection of underground and undersea metallic structures, ships, submarines, bridges, decks, aircraft and ground transportation systems. Following the same principle of utilizing Mg characteristics in engineering advantages in a decade-long successful R&D effort, Mg powder is now employed in organic coatings (termed as Mg-rich primers as a sacrificial anode pigment to protect aerospace grade aluminum alloys against corrosion. Mg-rich primers have performed very well on aluminum alloys when compared against the current chromate standard, but the carcinogenic chromate-based coatings/pretreatments are being widely used by the Department of Defense (DoD to protect its infrastructure and fleets against corrosion damage. Factors such as reactivity of Mg particles in the coating matrix during exposure to aggressive corrosion environments, interaction of atmospheric gases with Mg particles and the impact of Mg dissolution, increases in pH and hydrogen gas liberation at coating-metal interface, and primer adhesion need to be considered for further development of Mg-rich primer technology.

  5. Facebook targeted advertisement for research recruitment: A primer for nurse researchers.

    Science.gov (United States)

    Carter-Harris, Lisa

    2016-11-01

    Recruiting participants for research studies can be challenging and costly. Innovative recruitment methods are needed. Facebook targeted advertisement offers a low-cost alternative to traditional methods that has been successfully used in research study recruitment. This primer offers nurse researchers a method utilizing social media as a recruitment tool and details Facebook targeted advertisement for research recruitment.

  6. Screening for the familial defective apolipoprotein B-100 R3500W by mutagenic primers PCR

    Institute of Scientific and Technical Information of China (English)

    冯纪安; 冯铮

    2002-01-01

    Objective A method combining the mutagenic primers PCR and restriction enzyme digestion was designed to facilitate the detection of gene mutation in familial defective apolipoprotein B-1O0 R3500W. Methods A pair of primer was designed and a mismatch nucleotide was introduced in its upstream primer. A segment of target DNA including the possibly mutated nucleotide was amplified by PCR and the products were digested by restriction enzyme Nco 1. To overcome the potential false negative results due to improper digestion conditions, a segment of DNA with Ncol cut size was added as reference.Results The target sequence was successfully amplified by PCR, producing a 144 bp DNA fragment as expected. When incubated with Ncol, the enzyme could digest the DNA, producing a 114 bp segment,only if it was amplified from the mutated gene, but not from the normal allele. This difference in length of DNA could be separated by electrophoresis on a 2 %agarose gel. Thus we successfully detected two carriers of heterozygous FDB R3500W in 162 hypercholesterolemic patients. Conclusions Mutagenic primers PCR can be used to detect the gene mutation of apo B-100 R3500W, two cases were detected among 162patients with hypercholesterolemia. It suggests that this mutation is not rare in mainland China.

  7. Primer Output and Initial Projectile Motion for 5.56- and 7.62-mm Ammunition

    Science.gov (United States)

    2015-09-01

    ARL-TR-7479 ● SEP 2015 US Army Research Laboratory Primer Output and Initial Projectile Motion for 5.56- and 7.62-mm Ammunition...Output and Initial Projectile Motion for 5.56- and 7.62-mm Ammunition by John J Ritter and Richard A Beyer Weapons and Materials Research...

  8. Detection of three porcine vesicular viruses using multiplex real-time primer-probe energy transfer

    DEFF Research Database (Denmark)

    Rasmussen, Thomas Bruun; Uttenthal, Åse; Aguero, M.

    2006-01-01

    Rapid identification of the etiologic agent in infected animals is important for the control of an outbreak of vesicular disease in livestock. We have in the present study developed a multiplex real-time reverse transcription-PCR, based on primer-probe energy transfer (PriProET), for simultaneous...

  9. Historia del primer templo mayor de Tunja, nombrado de Nuestra Señora de Guadalupe

    Directory of Open Access Journals (Sweden)

    Ernesto Porras Collantes

    2004-01-01

    Full Text Available Gonzalo Suárez Rendón Sarmiento, fundador de Tunja, bautizó con el nombrede Nuestra Señora de Guadalupe al primer templo mayor de la ciudad. Elcarpintero Gregorio López estuvo a cargo de la construcción de la obra, desdefebrero hasta la navidad del año de

  10. The astrobiology primer: an outline of general knowledge--version 1, 2006.

    Science.gov (United States)

    Billings, L; Cameron, V; Claire, M; Dick, G J; Domagal-Goldman, S D; Javaux, E J; Johnson, O J; Laws, C; Race, M S; Rask, J; Rummel, J D; Schelble, R T; Vance, S

    2006-10-01

    The Astrobiology Primer has been created as a reference tool for those who are interested in the interdisciplinary field of astrobiology. The field incorporates many diverse research endeavors, but it is our hope that this slim volume will present the reader with all he or she needs to know to become involved and to understand, at least at a fundamental level, the state of the art. Each section includes a brief overview of a topic and a short list of readable and important literature for those interested in deeper knowledge. Because of the great diversity of material, each section was written by a different author with a different expertise. Contributors, authors, and editors are listed at the beginning, along with a list of those chapters and sections for which they were responsible. We are deeply indebted to the NASA Astrobiology Institute (NAI), in particular to Estelle Dodson, David Morrison, Ed Goolish, Krisstina Wilmoth, and Rose Grymes for their continued enthusiasm and support. The Primer came about in large part because of NAI support for graduate student research, collaboration, and inclusion as well as direct funding. We have entitled the Primer version 1 in hope that it will be only the first in a series, whose future volumes will be produced every 3-5 years. This way we can insure that the Primer keeps up with the current state of research. We hope that it will be a great resource for anyone trying to stay abreast of an ever-changing field.

  11. Novel oligonucleotide primers reveal a high diversity of microbes which drive phosphorous turnover in soil.

    Science.gov (United States)

    Bergkemper, Fabian; Kublik, Susanne; Lang, Friederike; Krüger, Jaane; Vestergaard, Gisle; Schloter, Michael; Schulz, Stefanie

    2016-06-01

    Phosphorus (P) is of central importance for cellular life but likewise a limiting macronutrient in numerous environments. Certainly microorganisms have proven their ability to increase the phosphorus bioavailability by mineralization of organic-P and solubilization of inorganic-P. On the other hand they efficiently take up P and compete with other biota for phosphorus. However the actual microbial community that is associated to the turnover of this crucial macronutrient in different ecosystems remains largely anonymous especially taking effects of seasonality and spatial heterogeneity into account. In this study seven oligonucleotide primers are presented which target genes coding for microbial acid and alkaline phosphatases (phoN, phoD), phytases (appA), phosphonatases (phnX) as well as the quinoprotein glucose dehydrogenase (gcd) and different P transporters (pitA, pstS). Illumina amplicon sequencing of soil genomic DNA underlined the high rate of primer specificity towards the respective target gene which usually ranged between 98% and 100% (phoN: 87%). As expected the primers amplified genes from a broad diversity of distinct microorganisms. Using DNA from a beech dominated forest soil, the highest microbial diversity was detected for the alkaline phosphatase (phoD) gene which was amplified from 15 distinct phyla respectively 81 families. Noteworthy the primers also allowed amplification of phoD from 6 fungal orders. The genes coding for acid phosphatase (phoN) and the quinoprotein glucose dehydrogenase (gcd) were amplified from 20 respectively 17 different microbial orders. In comparison the phytase and phosphonatase (appA, phnX) primers covered 13 bacterial orders from 2 different phyla respectively. Although the amplified microbial diversity was apparently limited both primers reliably detected all orders that contributed to the P turnover in the investigated soil as revealed by a previous metagenomic approach. Genes that code for microbial P transporter

  12. LOMA: A fast method to generate efficient tagged-random primers despite amplification bias of random PCR on pathogens

    Directory of Open Access Journals (Sweden)

    Lee Wah

    2008-09-01

    Full Text Available Abstract Background Pathogen detection using DNA microarrays has the potential to become a fast and comprehensive diagnostics tool. However, since pathogen detection chips currently utilize random primers rather than specific primers for the RT-PCR step, bias inherent in random PCR amplification becomes a serious problem that causes large inaccuracies in hybridization signals. Results In this paper, we study how the efficiency of random PCR amplification affects hybridization signals. We describe a model that predicts the amplification efficiency of a given random primer on a target viral genome. The prediction allows us to filter false-negative probes of the genome that lie in regions of poor random PCR amplification and improves the accuracy of pathogen detection. Subsequently, we propose LOMA, an algorithm to generate random primers that have good amplification efficiency. Wet-lab validation showed that the generated random primers improve the amplification efficiency significantly. Conclusion The blind use of a random primer with attached universal tag (random-tagged primer in a PCR reaction on a pathogen sample may not lead to a successful amplification. Thus, the design of random-tagged primers is an important consideration when performing PCR.

  13. Design of phylum-specific hybrid primers for DNA barcoding: addressing the need for efficient COI amplification in the Echinodermata.

    Science.gov (United States)

    Hoareau, T B; Boissin, E

    2010-11-01

    Recent research has shown the usefulness of the Folmer region of the cytochrome oxidase I (COI) as a genetic barcode to assist in species delimitation of echinoderms. However, amplification of COI is often challenging in echinoderms (low success or pseudogenes). We present a method that allows the design of phylum-specific hybrid primers, and use this to develop COI primers for the Echinodermata. We aligned COI sequences from 310 echinoderm species and designed all possible primers along the consensus sequence with two methods (standard degenerate and hybrid). We found much lower degeneracy for hybrid primers (4-fold degeneracy) than for standard degenerate primers (≥48-fold degeneracy). We then designed the most conserved hybrid primers to amplify a >500-bp region within COI. These primers successfully amplified this gene region in all tested taxa (123 species across all echinoderm classes). Sequencing of 30 species among these confirmed both the quality of the sequences (>500 bp, no pseudogenes) and their utility as a DNA barcode. This method should be useful for developing primers for other mitochondrial genes and other phyla. The method will also be of interest for the development of future projects involving both community-based genetic assessments on macroorganisms and biodiversity assessment of environmental samples using high-throughput sequencing.

  14. Effect of clearfil protect bond and transbond plus self-etch primer on shear bond strength of orthodontic brackets

    Directory of Open Access Journals (Sweden)

    S Hamid Raji

    2011-01-01

    Conclusion: The shear bond strength of clearfil protect bond and transbond plus self-etch primer was enough for bonding the orthodontic brackets. The mode of failure of bonded brackets with these two self-etch primers is safe for enamel.

  15. Evaluation of 16S rRNA Gene Primer Pairs for Monitoring Microbial Community Structures Showed High Reproducibility within and Low Comparability between Datasets Generated with Multiple Archaeal and Bacterial Primer Pairs.

    Science.gov (United States)

    Fischer, Martin A; Güllert, Simon; Neulinger, Sven C; Streit, Wolfgang R; Schmitz, Ruth A

    2016-01-01

    The application of next-generation sequencing technology in microbial community analysis increased our knowledge and understanding of the complexity and diversity of a variety of ecosystems. In contrast to Bacteria, the archaeal domain was often not particularly addressed in the analysis of microbial communities. Consequently, established primers specifically amplifying the archaeal 16S ribosomal gene region are scarce compared to the variety of primers targeting bacterial sequences. In this study, we aimed to validate archaeal primers suitable for high throughput next generation sequencing. Three archaeal 16S primer pairs as well as two bacterial and one general microbial 16S primer pairs were comprehensively tested by in-silico evaluation and performing an experimental analysis of a complex microbial community of a biogas reactor. The results obtained clearly demonstrate that comparability of community profiles established using different primer pairs is difficult. 16S rRNA gene data derived from a shotgun metagenome of the same reactor sample added an additional perspective on the community structure. Furthermore, in-silico evaluation of primers, especially those for amplification of archaeal 16S rRNA gene regions, does not necessarily reflect the results obtained in experimental approaches. In the latter, archaeal primer pair ArchV34 showed the highest similarity to the archaeal community structure compared to observed by the metagenomic approach and thus appears to be the appropriate for analyzing archaeal communities in biogas reactors. However, a disadvantage of this primer pair was its low specificity for the archaeal domain in the experimental application leading to high amounts of bacterial sequences within the dataset. Overall our results indicate a rather limited comparability between community structures investigated and determined using different primer pairs as well as between metagenome and 16S rRNA gene amplicon based community structure analysis

  16. A method for automatically extracting infectious disease-related primers and probes from the literature

    Directory of Open Access Journals (Sweden)

    Pérez-Rey David

    2010-08-01

    Full Text Available Abstract Background Primer and probe sequences are the main components of nucleic acid-based detection systems. Biologists use primers and probes for different tasks, some related to the diagnosis and prescription of infectious diseases. The biological literature is the main information source for empirically validated primer and probe sequences. Therefore, it is becoming increasingly important for researchers to navigate this important information. In this paper, we present a four-phase method for extracting and annotating primer/probe sequences from the literature. These phases are: (1 convert each document into a tree of paper sections, (2 detect the candidate sequences using a set of finite state machine-based recognizers, (3 refine problem sequences using a rule-based expert system, and (4 annotate the extracted sequences with their related organism/gene information. Results We tested our approach using a test set composed of 297 manuscripts. The extracted sequences and their organism/gene annotations were manually evaluated by a panel of molecular biologists. The results of the evaluation show that our approach is suitable for automatically extracting DNA sequences, achieving precision/recall rates of 97.98% and 95.77%, respectively. In addition, 76.66% of the detected sequences were correctly annotated with their organism name. The system also provided correct gene-related information for 46.18% of the sequences assigned a correct organism name. Conclusions We believe that the proposed method can facilitate routine tasks for biomedical researchers using molecular methods to diagnose and prescribe different infectious diseases. In addition, the proposed method can be expanded to detect and extract other biological sequences from the literature. The extracted information can also be used to readily update available primer/probe databases or to create new databases from scratch.

  17. A degenerate pair of primers for simultaneous detection of four alpha- and betanecroviruses.

    Science.gov (United States)

    Varanda, C M R; Cardoso, J M S; Oliveira, M D M; Oliveira, S; Clara, M I E; Félix, M R F

    2014-11-01

    The high infection levels due to Olive latent virus 1 (OLV-1), Olive mild mosaic virus (OMMV) (alphanecrovirus) and Tobacco necrosis virus D (TNV-D) (betanecrovirus) in Portuguese olive orchards prompted us to develop a rapid PCR-based assay for the simultaneous detection of these viruses aimed at the sanitary selection and marketing of plant material in compliance with European Union regulations. A pair of degenerate oligonucleotide primers, parRdRp5' and parCoat3' was designed based on conserved regions located in the RNA-dependent RNA polymerase (RdRp) and coat protein (CP) genes of these viruses and one other alphanecrovirus, Tobacco necrosis virus A. Its use in RT-PCR assays generated a product of ca. 2000 bp for the 4 viral species tested. These primers were compared with virus specific primers in multiplex RT-PCR, and identical results were obtained. Its application to dsRNA extracted from 54 olive field growing trees originated the expected ca. 2000 bp amplicon in 17 trees. The virus identity was determined by sequencing the cloned RT-PCR products. No TNV-A was found. The RT-PCR assay using the degenerate primers described in this study were shown to be reliable in detecting any of the above-mentioned alpha- and betanecroviruses, and it is as sensitive as that which uses virus specific primers in multiplex assays. Therefore, this assay is well suited for the rapid screen of virus-free plant material in selection and improvement crop programmes. Additionally, it has the potential to reveal virus diversity and the presence of new viruses, provided the RT-PCR generated amplicon is further sequenced.

  18. Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

    Institute of Scientific and Technical Information of China (English)

    Jun-Wen Li; Xin-Wei Wang; Chang-Qing Yuan; Jin-Lai Zheng; Min Jin; Nong Song; Xiu-Quan Shi; Fu-Huan Chao

    2002-01-01

    AIM: To develop a rapid detection method ofenteroviruses and Hepatitis A virus (HAV).METHODS: A one-step, single-tube consensus primersmultiplex RT-PCR was developed to simultaneouslydetect Poliovirus, Coxsackie virus, Echovirus and HAV.A general upstream primer and a HAV primer and fourdifferent sets of primers (5 primers) specific forPoliovirus, Coxsacki evirus, Echovirus and HAV cDNAwere mixed in the PCR mixture to reverse transcriptand amplify the target DNA.Four distinct amplified DNAsegments representing Poliovirus, Coxsackie virus,Echovirus and HAV were identified by gelelectrophoresis as 589-,671-, 1084-, and 1128bpsequences, respectively. Semi-nested PCR was used toconfirm the amplified products for each enterovirus andHAV.RESULTS: All four kinds of viral genome RNA weredetected, and producing four bands which could bedifferentiated by the band size on the gel.To confirmthe specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strainstested gave positive results .The detection sensitivityof multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU forCoxsackie virus,60 PFU for Echovirus and 105 TCID50for HAV. The minimum amount of enteric viral RNAdetected by semi-nested PCR was equivalent to 2.4 PFUfor Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU forEchovirus and 10.5 TCID50 for HAV.CONCLUSION: The consensus primers multiplex RT-PCRhas more advantages over monoplex RT-PCR for entericviruses detection, namely, the rapid turnaround timeand cost effectiveness.

  19. First half 2005 financial results; Resultats du 1. semestre 2005

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2005-07-01

    With manufacturing facilities in over 40 countries and a sales network in over 100, AREVA offers customers technological solutions for nuclear power generation and electricity transmission and distribution. The group also provides interconnect systems to the telecommunications, computer and automotive markets. This document presents the first half 2005 financial results of the group: 1 - overall performance: sales revenue, operating income, consolidated net income, operating cash flow, balance sheet; 2 - outlook; 3 - performance by business division: front-end division, reactors and services division, back end division, transmission and distribution division, connectors division.

  20. Presupuesto Maestro para el Segundo Semestre de la Empresa MADERAS

    OpenAIRE

    Soliz Arias, Erika Viviana

    2014-01-01

    Toda empresa necesita conocer su futuro inmediato y poder anticipar lo que habrá de ocurrir en los próximos meses. En la presente tesis se encontrara la elaboración de un presupuesto Maestro para la empresa Maderas, que se dedica a la fabricación de muebles para acabados de la construcción, en la cual analizaremos sus aspectos generales, el marco teórico relativo a los presupuesto y desarrollaremos todos los pronósticos necesarios, emitiremos conclusiones y recomendaciones como resultado de l...

  1. Biofunctionalization of Polyoxometalates with DNA Primers, Their Use in the Polymerase Chain Reaction (PCR) and Electrochemical Detection of PCR Products.

    Science.gov (United States)

    Debela, Ahmed M; Ortiz, Mayreli; Beni, Valerio; Thorimbert, Serge; Lesage, Denis; Cole, Richard B; O'Sullivan, Ciara K; Hasenknopf, Bernold

    2015-12-01

    The bioconjugation of polyoxometalates (POMs), which are inorganic metal oxido clusters, to DNA strands to obtain functional labeled DNA primers and their potential use in electrochemical detection have been investigated. Activated monooxoacylated polyoxotungstates [SiW11 O39 {Sn(CH2 )2 CO}](8-) and [P2 W17 O61 {Sn(CH2 )2 CO}](6-) have been used to link to a 5'-NH2 terminated 21-mer DNA forward primer through amide coupling. The functionalized primer was characterized by using a battery of techniques, including electrophoresis, mass spectrometry, as well as IR and Raman spectroscopy. The functionality of the POM-labeled primers was demonstrated through hybridization with a surface-immobilized probe. Finally, the labeled primers were successfully used in the polymerase chain reaction (PCR) and the PCR products were characterized by using electrophoresis.

  2. Evaluation of single liquid primers with organic sulfur compound for bonding between indirect composite material and silver-palladium-copper-gold alloy.

    Science.gov (United States)

    Shimoe, Saiji; Tanoue, Naomi; Satoda, Takahiro; Murayama, Takeshi; Nikawa, Hiroki; Matsumura, Hideo

    2010-01-01

    The purpose of this study was to evaluate the effect of primers on bonding between a silver-palladium-copper-gold alloy and an indirect composite material. Cast disks were air-abraded with alumina, conditioned with one of five primers (Alloy Primer, Luna-Wing Primer, Metal Primer II, Metaltite, M.L. Primer), and bonded with a light-activated indirect composite. Shear bond strengths were determined after 20,000 times of thermocycling. The results showed that four of the primers, except the Luna-Wing Primer, were effective in enhancing the bond strength as compared with the unprimed control group. Of these four primers, Alloy Primer, Metal Primer II, and M.L. Primer exhibited significantly greater bond strengths. It can be concluded that the effectiveness of primers varies considerably according to the organic sulfur compounds added to the solvent, and that care must be taken in selecting priming agents for bonding the composite material and the silver-palladium-copper-gold alloy.

  3. Política exterior de Japón durante el primer año de gobierno del primer ministro Junichiro Koizumi

    Directory of Open Access Journals (Sweden)

    Mario Antolinez

    2013-11-01

    Full Text Available El artículo examina la política exterior de Japón durante el primer año de gobierno del primer ministro Junichiro Koizumi. Para tal fin utiliza como marco conceptual los modelos de análisis de política exterior formulados por Robert Putnam y Kenneth Waltz. La premisa principal es que al inicio de su gobierno Koizumi intentó revitalizar las relaciones exteriores de su país imprimiendo una nueva dinámica en la toma de decisiones que se ajustaba a su estilo personal de hacer política y que, al mismo tiempo, se distanciaba de manera sustancial del proceso tradicional imperante durante años. Esta iniciativa se vio entorpecida, sin embargo, no solo por los problemas en Gaimusho –la entidad encargada de llevar a la práctica la diplomacia nipona–, sino también por el escenario geopolítico externo y por factores de política interna propios del momento histórico en consideración.

  4. In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River

    Science.gov (United States)

    Cannon, M. V.; Hester, J.; Shalkhauser, A.; Chan, E. R.; Logue, K.; Small, S. T.; Serre, D.

    2016-03-01

    Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity.

  5. Evaluation of revised polymerase chain reaction primers for more inclusive quantification of ammonia-oxidizing archaea and bacteria.

    Science.gov (United States)

    Meinhardt, Kelley A; Bertagnolli, Anthony; Pannu, Manmeet W; Strand, Stuart E; Brown, Sally L; Stahl, David A

    2015-04-01

    Ammonia-oxidizing archaea (AOA) and bacteria (AOB) fill key roles in the nitrogen cycle. Thus, well-vetted methods for characterizing their distribution are essential for framing studies of their significance in natural and managed systems. Quantification of the gene coding for one subunit of the ammonia monooxygenase (amoA) by polymerase chain reaction is frequently employed to enumerate the two groups. However, variable amplification of sequence variants comprising this conserved genetic marker for ammonia oxidizers potentially compromises within- and between-system comparisons. We compared the performance of newly designed non-degenerate quantitative polymerase chain reaction primer sets to existing primer sets commonly used to quantify the amoA of AOA and AOB using a collection of plasmids and soil DNA samples. The new AOA primer set provided improved quantification of model mixtures of different amoA sequence variants and increased detection of amoA in DNA recovered from soils. Although both primer sets for the AOB provided similar results for many comparisons, the new primers demonstrated increased detection in environmental application. Thus, the new primer sets should provide a useful complement to primers now commonly used to characterize the environmental distribution of AOA and AOB.

  6. Improved efficiency and robustness in qPCR and multiplex end-point PCR by twisted intercalating nucleic acid modified primers.

    Directory of Open Access Journals (Sweden)

    Uffe Vest Schneider

    Full Text Available We introduce quantitative polymerase chain reaction (qPCR primers and multiplex end-point PCR primers modified by the addition of a single ortho-Twisted Intercalating Nucleic Acid (o-TINA molecule at the 5'-end. In qPCR, the 5'-o-TINA modified primers allow for a qPCR efficiency of 100% at significantly stressed reaction conditions, increasing the robustness of qPCR assays compared to unmodified primers. In samples spiked with genomic DNA, 5'-o-TINA modified primers improve the robustness by increased sensitivity and specificity compared to unmodified DNA primers. In unspiked samples, replacement of unmodified DNA primers with 5'-o-TINA modified primers permits an increased qPCR stringency. Compared to unmodified DNA primers, this allows for a qPCR efficiency of 100% at lowered primer concentrations and at increased annealing temperatures with unaltered cross-reactivity for primers with single nucleobase mismatches. In a previously published octaplex end-point PCR targeting diarrheagenic Escherichia coli, application of 5'-o-TINA modified primers allows for a further reduction (>45% or approximately one hour in overall PCR program length, while sustaining the amplification and analytical sensitivity for all targets in crude bacterial lysates. For all crude bacterial lysates, 5'-o-TINA modified primers permit a substantial increase in PCR stringency in terms of lower primer concentrations and higher annealing temperatures for all eight targets. Additionally, crude bacterial lysates spiked with human genomic DNA show lesser formation of non-target amplicons implying increased robustness. Thus, 5'-o-TINA modified primers are advantageous in PCR assays, where one or more primer pairs are required to perform at stressed reaction conditions.

  7. Mineralogical Transformation and Electrochemical Nature of Magnesium-Rich Primers during Natural Weathering

    Directory of Open Access Journals (Sweden)

    Shashi S. Pathak

    2014-07-01

    Full Text Available Magnesium-rich primers (MgRP have generated great interest as a promising alternative to chromium-based primers for the protection of aluminum substrates but their performance during exterior exposure has not been well documented. This paper focuses on the evaluation of MgRP during natural weathering to gain insight into its mineralogical phase transformation and electrochemical nature. Control studies were conducted on Mg and AA2024-T3 coupons. The results indicate that Mg particles in MgRP transform into a variety of hydroxide, carbonate, and hydroxy carbonates. During natural weathering, CO2 inhibited the dissolution of both Mg and AA2024-T3 as a result of protective carbonate layer formation in the coating.

  8. Book Review: The Basics of Digital Forensics: The Primer for Getting Started in Digital Forensics

    Directory of Open Access Journals (Sweden)

    Stephen Larson

    2014-03-01

    Full Text Available Sammons, John. (2012. The Basics of Digital Forensics: The Primer for Getting Started in Digital Forensics. Waltham, MA: Syngress, 208 pages, Print Book ISBN: 9781597496612.eBook ISBN : 9781597496629. Print: US $29.95. eBook: US$20.97. Includes exercises, case studies, references, and index.Reviewed by Stephen Larson, PhD. Assistant Professor, Slippery Rock University of PAThe Basics of Digital Forensics: The Primer for Getting Started in Digital Forensics is well-named–it really is very basic. And it should be, as the book’s intended audience includes entry-level digital forensics professionals and complimentary fields such as law enforcement, legal, and general information security. Though the copyright is 2012, some of the data is from 2009, and there is mention of estimates for 2010.(see PDF for full review

  9. The Astrobiology Primer: An Outline of General Knowledge - Version 1, 2006

    CERN Document Server

    Mix, L J; Mandell, A M; Mosier, A C; Raymond, J; Raymond, S N; Stewart, F J; Von Braun, K; Zhaxybayeva, O; Billings, L; Cameron, V; Claire, M; Dick, G J; Domagal-Goldman, S D; Javaux, E J; Johnson, O J; Laws, C; Race, M S; Rask, J; Rummel, J D; Schelble, R T; Vance, S

    2006-01-01

    Astrobiology, the study of life as a planetary phenomenon, aims to understand the fundamental nature of life on earth and the possibility of life elsewhere. To achieve this goal, astrobiologists have initiated unprecedented communication between the disciplines of astronomy, biology, chemistry, and geology. The Astrobiology Primer has been created as a reference tool for those who are interested in the interdisciplinary field of astrobiology. The field incorporates many diverse research endeavors, but it is our hope that this slim volume will present the reader with all he or she needs to know to become involved and to understand, at least at a fundamental level, the state of the art. Because of the great diversity of material, each section was written by a different author with a different expertise. The Primer was constructed collaboratively. Ninety researchers from around the world contributed information with regard to what they expected from other astrobiologists and what they would like to know themselv...

  10. STITCHER: A web resource for high-throughput design of primers for overlapping PCR applications.

    Science.gov (United States)

    O'Halloran, Damien M

    2015-06-01

    Overlapping PCR is routinely used in a wide number of molecular applications. These include stitching PCR fragments together, generating fluorescent transcriptional and translational fusions, inserting mutations, making deletions, and PCR cloning. Overlapping PCR is also used for genotyping by traditional PCR techniques and in detection experiments using techniques such as loop-mediated isothermal amplification (LAMP). STITCHER is a web tool providing a central resource for researchers conducting all types of overlapping PCR experiments with an intuitive interface for automated primer design that's fast, easy to use, and freely available online (http://ohalloranlab.net/STITCHER.html). STITCHER can handle both single sequence and multi-sequence input, and specific features facilitate numerous other PCR applications, including assembly PCR, adapter PCR, and primer walking. Field PCR, and in particular, LAMP, offers promise as an on site tool for pathogen detection in underdeveloped areas, and STITCHER includes off-target detection features for pathogens commonly targeted using LAMP technology.

  11. Effect of dentin primer on shear bond strength of composite resin to moist and dry enamel.

    Science.gov (United States)

    Jain, P; Stewart, G P

    2000-01-01

    The etched enamel-composite resin bond is the most reliable bond known to us. Moisture and dentin primers are the two most important variables that can interfere with this bond. This study investigated the effect of dentin primer on bond strengths of composite resin to moist and dry enamel. One hundred freshly extracted molar teeth were used for shear bond strength testing. The teeth were mounted in phenolic rings with an approximal enamel surface exposed. The exposed enamel surface on each tooth was flattened using 320- 400- and 600-grit silicon carbide papers and etched using 34-38% phosphoric acid gel. The teeth were then divided into 10 groups (n = 10). Four groups were assigned to each of the two dentin bonding systems, Scotchbond Multi-Purpose and OptiBond FL. Two groups were assigned to the single-bottle bonding agent (Single Bond). Each bonding system was tested on moist and dry enamel. OptiBond FL and Scotchbond MP were tested with and without the use of primer. All samples were thermocycled and tested in shear. Fracture analysis was performed using a binocular microscope. For scanning electron microscopy, approximal samples of enamel (1 mm thick) were flattened, etched, and bonded with and without primer on moist and dry enamel. A 1 mm-thick layer of Z100 was bonded to the specimens, which were then immersed in 10% HCl for 24 hours to dissolve the enamel. The specimens were viewed under a scanning electron microscope. Results indicated that the use of primer on dry enamel did not significantly affect (P > 0.05) shear bond strengths for the two bonding systems, Scotchbond MP (primed 24.10 +/- 4.83 MPa, unprimed 29.57 +/- 7.49 MPa) and OptiBond FL (primed 26.82 +/- 4.44, unprimed 25.66 +/- 2.95). However, the use of primer was found to be essential on moist enamel to obtain acceptable bond strengths with both Scotchbond MP (primed 25.61 +/- 10.29 MPa, unprimed 3.26 +/- 0.95 MPa) and OptiBond FL (primed 30.28 +/- 3.49 MPa, unprimed 8.37 +/- 3.31 MPa

  12. Barcoding the kingdom Plantae: new PCR primers for ITS regions of plants with improved universality and specificity.

    Science.gov (United States)

    Cheng, Tao; Xu, Chao; Lei, Li; Li, Changhao; Zhang, Yu; Zhou, Shiliang

    2016-01-01

    The internal transcribed spacer (ITS) of nuclear ribosomal DNA is one of the most commonly used DNA markers in plant phylogenetic and DNA barcoding analyses, and it has been recommended as a core plant DNA barcode. Despite this popularity, the universality and specificity of PCR primers for the ITS region are not satisfactory, resulting in amplification and sequencing difficulties. By thoroughly surveying and analysing the 18S, 5.8S and 26S sequences of Plantae and Fungi from GenBank, we designed new universal and plant-specific PCR primers for amplifying the whole ITS region and a part of it (ITS1 or ITS2) of plants. In silico analyses of the new and the existing ITS primers based on these highly representative data sets indicated that (i) the newly designed universal primers are suitable for over 95% of plants in most groups; and (ii) the plant-specific primers are suitable for over 85% of plants in most groups without amplification of fungi. A total of 335 samples from 219 angiosperm families, 11 gymnosperm families, 24 fern and lycophyte families, 16 moss families and 17 fungus families were used to test the performances of these primers. In vitro PCR produced similar results to those from the in silico analyses. Our new primer pairs gave PCR improvements up to 30% compared with common-used ones. The new universal ITS primers will find wide application in both plant and fungal biology, and the new plant-specific ITS primers will, by eliminating PCR amplification of nonplant templates, significantly improve the quality of ITS sequence information collections in plant molecular systematics and DNA barcoding.

  13. Summary of the primer on tumor immunology and the biological therapy of cancer

    OpenAIRE

    Margolin Kim; Liu Shujuan; Li Yufeng; Hwu Patrick

    2009-01-01

    Abstract The International Society for Biological Therapy of Cancer (iSBTc) is one of the "premier destinations for interaction and innovation in the cancer biologics community". It provides a primer course each year during the annual meeting to address the most important areas of tumor immunology and immunotherapy. The course has been given by prominent investigators in the area of interest, covering the core principles of cancer immunology and immunotherapy. The target audience for this pro...

  14. An anti-steroidogenic inhibitory primer pheromone in male sea lamprey (Petromyzon marinus)

    Science.gov (United States)

    Chung-Davidson, Yu-Wen; Wang, Huiyong; Bryan, Mara B.; Wu, Hong; Johnson, Nicholas S.; Li, Weiming

    2013-01-01

    Reproductive functions can be modulated by both stimulatory and inhibitory primer pheromones released by conspecifics. Many stimulatory primer pheromones have been documented, but relatively few inhibitory primer pheromones have been reported in vertebrates. The sea lamprey male sex pheromone system presents an advantageous model to explore the stimulatory and inhibitory primer pheromone functions in vertebrates since several pheromone components have been identified. We hypothesized that a candidate sex pheromone component, 7α, 12α-dihydroxy-5α-cholan-3-one-24-oic acid (3 keto-allocholic acid or 3kACA), exerts priming effects through the hypothalamic-pituitary-gonadal (HPG) axis. To test this hypothesis, we measured the peptide concentrations and gene expressions of lamprey gonadotropin releasing hormones (lGnRH) and the HPG output in immature male sea lamprey exposed to waterborne 3kACA. Exposure to waterborne 3kACA altered neuronal activation markers such as jun and jun N-terminal kinase (JNK), and lGnRH mRNA levels in the brain. Waterborne 3kACA also increased lGnRH-III, but not lGnRH-I or -II, in the forebrain. In the plasma, 3kACA exposure decreased all three lGnRH peptide concentrations after 1 h exposure. After 2 h exposure, 3kACA increased lGnRHI and -III, but decreased lGnRH-II peptide concentrations in the plasma. Plasma lGnRH peptide concentrations showed differential phasic patterns. Group housing condition appeared to increase the averaged plasma lGnRH levels in male sea lamprey compared to isolated males. Interestingly, 15α-hydroxyprogesterone (15α-P) concentrations decreased after prolonged 3kACA exposure (at least 24 h). To our knowledge, this is the only known synthetic vertebrate pheromone component that inhibits steroidogenesis in males.

  15. An in silico approach to design T-arms primers for VDR locus to detect osteoporosis

    OpenAIRE

    Maheswari, C.; Sheebanancy, K.; Kavitha, V. J.

    2017-01-01

    Osteoporosis is a skeletal disorder characterized by an increased risk of fractures. Studies have shown that BMD and bone turnover are under strong genetic control. The polymorphisms in the Vitamin D receptor (VDR) have been implicated in many studies as a cause of osteoporosis. We aimed at developing a molecular diagnostic kit to detect osteoporosis. We started with designing multiplex primers and finally designed T-ARMS PCR Kit for the VDR locus. We used the currently available softwares fo...

  16. An anti-steroidogenic inhibitory primer pheromone in male sea lamprey (Petromyzon marinus).

    Science.gov (United States)

    Chung-Davidson, Yu-Wen; Wang, Huiyong; Bryan, Mara B; Wu, Hong; Johnson, Nicholas S; Li, Weiming

    2013-08-01

    Reproductive functions can be modulated by both stimulatory and inhibitory primer pheromones released by conspecifics. Many stimulatory primer pheromones have been documented, but relatively few inhibitory primer pheromones have been reported in vertebrates. The sea lamprey male sex pheromone system presents an advantageous model to explore the stimulatory and inhibitory primer pheromone functions in vertebrates since several pheromone components have been identified. We hypothesized that a candidate sex pheromone component, 7α, 12α-dihydroxy-5α-cholan-3-one-24-oic acid (3 keto-allocholic acid or 3kACA), exerts priming effects through the hypothalamic-pituitary-gonadal (HPG) axis. To test this hypothesis, we measured the peptide concentrations and gene expressions of lamprey gonadotropin releasing hormones (lGnRH) and the HPG output in immature male sea lamprey exposed to waterborne 3kACA. Exposure to waterborne 3kACA altered neuronal activation markers such as jun and jun N-terminal kinase (JNK), and lGnRH mRNA levels in the brain. Waterborne 3kACA also increased lGnRH-III, but not lGnRH-I or -II, in the forebrain. In the plasma, 3kACA exposure decreased all three lGnRH peptide concentrations after 1h exposure. After 2h exposure, 3kACA increased lGnRH-I and -III, but decreased lGnRH-II peptide concentrations in the plasma. Plasma lGnRH peptide concentrations showed differential phasic patterns. Group housing condition appeared to increase the averaged plasma lGnRH levels in male sea lamprey compared to isolated males. Interestingly, 15α-hydroxyprogesterone (15α-P) concentrations decreased after prolonged 3kACA exposure (at least 24h). To our knowledge, this is the only known synthetic vertebrate pheromone component that inhibits steroidogenesis in males.

  17. FONZIE: An optimized pipeline for minisatellite marker discovery and primer design from large sequence data sets

    Directory of Open Access Journals (Sweden)

    Balesdent Marie-Hélène

    2010-11-01

    Full Text Available Abstract Background Micro-and minisatellites are among the most powerful genetic markers known to date. They have been used as tools for a large number of applications ranging from gene mapping to phylogenetic studies and isolate typing. However, identifying micro-and minisatellite markers on large sequence data sets is often a laborious process. Results FONZIE was designed to successively 1 perform a search for markers via the external software Tandem Repeat Finder, 2 exclude user-defined specific genomic regions, 3 screen for the size and the percent matches of each relevant marker found by Tandem Repeat Finder, 4 evaluate marker specificity (i.e., occurrence of the marker as a single copy in the genome using BLAST2.0, 5 design minisatellite primer pairs via the external software Primer3, and 6 check the specificity of each final PCR product by BLAST. A final file returns to users all the results required to amplify markers. A biological validation of the approach was performed using the whole genome sequence of the phytopathogenic fungus Leptosphaeria maculans, showing that more than 90% of the minisatellite primer pairs generated by the pipeline amplified a PCR product, 44.8% of which showed agarose-gel resolvable polymorphism between isolates. Segregation analyses confirmed that the polymorphic minisatellites corresponded to single-locus markers. Conclusion FONZIE is a stand-alone and user-friendly application developed to minimize tedious manual operations, reduce errors, and speed up the search for efficient minisatellite and microsatellite markers departing from whole-genome sequence data. This pipeline facilitates the integration of data and provides a set of specific primer sequences for PCR amplification of single-locus markers. FONZIE is freely downloadable at: http://www.versailles-grignon.inra.fr/bioger/equipes/leptosphaeria_maculans/outils_d_analyses/fonzie

  18. Combination Primer Polymerase Chain Reaction for Multi-Site Mutagenesis of Close Proximity Sites

    OpenAIRE

    Jensen, Pia Hønnerup; Weilguny, Dietmar

    2005-01-01

    We describe a rapid and efficient polymerase chain reaction procedure for multi-site-directed mutagenesis for cases in which the sites to be mutated are in close proximity. The combination primer polymer chain reaction method is based on a multi-site directed mutagenesis protocol together with a splicing by overlapping extension polymerase chain reaction protocol. several different combinations of multiple mutations were successfully performed with this method and are reported in this study.

  19. Perfil del alumnado normalista castellano-leonés del primer tercio del siglo XX

    Directory of Open Access Journals (Sweden)

    Juan Francisco CEREZO MANRIQUE

    2009-11-01

    Full Text Available Nos proponemos en este trabajo dibujar el perfil del alumnado que acudió a los establecimientos normalistas castellano-leoneses durante el primer tercio del siglo XX. El análisis cuantitativo de una serie de variables de tipo clasificatorio nos ayudará a explicitar las características de entrada de un colectivo sobre el que la acción institucional de las Escuelas Normales habría de incidir.

  20. Avulsión de canino y subluxación del primer premolar superiores derechos

    OpenAIRE

    1996-01-01

    Se presenta un caso clínico de avulsión de canino y subluxación del primer remolar, superiores derechos, secundario a traumatismo por piedra lanzada al aire. El tiempo extraoral fue de cuatro horas en medio seco. Se trató con reimplante, ferulización y tratamiento endodóncico. Los controles posteriores a los cuatro años del tratamiento mostraron la evolución favorable del caso.

  1. Demonstration of Metastable Intermolecular Composites (MIC) on Small Caliber Cartridges and CAD/PAD Percussion Primers

    Science.gov (United States)

    2009-07-01

    Tetracene 4.0 Barium Nitrate 32.0 Antimony Sulfide 15.0 Aluminum Powder 7.0 PETN 5.0 Ingredient Weight % Normal Lead Styphnate 26.0 Barium Nitrate...Current Process Application Current Specification Affected Programs Candidate Parts/Substrate Lead Styphnate , Barium Nitrate, & Antimony...FA-956 and 5086 primer formulations which are based on lead styphnate , barium nitrate and antimony sulfide. The MIC mixture is an environmentally

  2. Comprehensive Evaluation and Transition of Non-Chromate Primers within DoD

    Science.gov (United States)

    2012-01-01

    Materials Engineering Division ASETS Defense 2012 NAVAIR Distribution Statement – Distribution A Report Documentation Page Form...Primers : Akzo Nobel MgO 2111 PPG CA 7236 PPG CA 7211 PPG CA 7222 PPG CA 7233 Topcoat Deft ELT Corrosion tests: ASTM B117 (x2) ASTM...control. • Compare & correlate NAVAIR and AFRL galvanic panel test methods 10 NAVAIR/USAF Statement of Need 0 . 5 1.5 3 0 .5 1

  3. Applied Ecosystem Analysis - - a Primer : EDT the Ecosystem Diagnosis and Treatment Method.

    Energy Technology Data Exchange (ETDEWEB)

    Lestelle, Lawrence C.; Mobrand, Lars E.

    1996-05-01

    The aim of this document is to inform and instruct the reader about an approach to ecosystem management that is based upon salmon as an indicator species. It is intended to provide natural resource management professionals with the background information needed to answer questions about why and how to apply the approach. The methods and tools the authors describe are continually updated and refined, so this primer should be treated as a first iteration of a sequentially revised manual.

  4. Single primer amplification reaction methods reveal exotic and indigenous mulberry varieties are similarly diverse

    Indian Academy of Sciences (India)

    Esha Bhattacharya; S B Dandin; Shirish Anand Ranade

    2005-12-01

    Mulberry is the sole food source for mulberry silkworm and a number of indigenous and exotic varieties are used in sericulture. Studies on assessment of genetic diversity have been done amongst a few mulberry varieties using one or at the most two methods. However, no comprehensive study on a large number of varieties has been carried out. In present study, single primer amplification reaction (SPAR) methods have been used for determination of diversity in 27 mulberry varieties (exotic as well as indigenous), using four minisatellite core sequence primers for directed amplification of minisatellite DNA (DAMD), three simple sequence repeat (SSR) motifs as primers for inter simple sequence repeat (ISSR) and 20 arbitrary sequence decamer primers for random amplified polymorphic DNA (RAPD) reactions. The Jaccard coefficients were determined for the DAMD, ISSR and RAPD band data (total of 58, 39 and 235 bands respectively). All three methods revealed wide range of distances supporting a wide range of mulberry genetic diversity. A cumulative analysis of the data generated by three methods resulted in a neighbour-joining (NJ) tree that gave a better reflection of the relatedness and affinities of the varieties to each other. Comparison of the three methods by marker indices and the Mantel test of correlation indicated that though all methods were useful for the assessment of diversity in mulberry, the DAMD method was better. When considered as two groups (10 exotic and 17 indigenous varieties), the mulberry varieties in the exotic group were found to have slightly greater diversity than the indigenous ones. These results support the concept of naturalization of mulberry varieties at locales distant from their origins.

  5. Edesign: Primer and Enhanced Internal Probe Design Tool for Quantitative PCR Experiments and Genotyping Assays.

    Science.gov (United States)

    Kimura, Yasumasa; Soma, Takahiro; Kasahara, Naoko; Delobel, Diane; Hanami, Takeshi; Tanaka, Yuki; de Hoon, Michiel J L; Hayashizaki, Yoshihide; Usui, Kengo; Harbers, Matthias

    2016-01-01

    Analytical PCR experiments preferably use internal probes for monitoring the amplification reaction and specific detection of the amplicon. Such internal probes have to be designed in close context with the amplification primers, and may require additional considerations for the detection of genetic variations. Here we describe Edesign, a new online and stand-alone tool for designing sets of PCR primers together with an internal probe for conducting quantitative real-time PCR (qPCR) and genotypic experiments. Edesign can be used for selecting standard DNA oligonucleotides like for instance TaqMan probes, but has been further extended with new functions and enhanced design features for Eprobes. Eprobes, with their single thiazole orange-labelled nucleotide, allow for highly sensitive genotypic assays because of their higher DNA binding affinity as compared to standard DNA oligonucleotides. Using new thermodynamic parameters, Edesign considers unique features of Eprobes during primer and probe design for establishing qPCR experiments and genotyping by melting curve analysis. Additional functions in Edesign allow probe design for effective discrimination between wild-type sequences and genetic variations either using standard DNA oligonucleotides or Eprobes. Edesign can be freely accessed online at http://www.dnaform.com/edesign2/, and the source code is available for download.

  6. A universal primer multiplex PCR method for typing of toxinogenic Pseudomonas aeruginosa.

    Science.gov (United States)

    Shi, Hui; Trinh, Quoclinh; Xu, Wentao; Zhai, Baiqiang; Luo, Yunbo; Huang, Kunlun

    2012-09-01

    Pseudomonas aeruginosa is a well-known opportunistic pathogen that can cause acute nosocomial necrotizing pneumonia and genetic disorder cystic fibrosis of lung patients. Pathogenic interactions between P. aeruginosa and hosts are often guided by the secreted virulence determinants that interact with specific host targets. Exotoxin A, pyocyanin, elastase, and type III secretion system are the most significant virulence determinants and cause great concern. However, P. aeruginosa in various environments has high genotypic diversity, leading to deficiency of exotoxin genes for some P. aeruginosa strains. In current study, a universal primer-multiplex PCR method (UP-MPCR) was employed for the detection of five significant enterotoxin genes (toxA, phzM, lasB, ExoU, and ExoS) and one internal control gene ecfX in P. aeruginosa. Owing to the application of universal primer (UP), different targeted products have identical amplified efficiency and the sensitivity of multiplex PCR is improved. In addition, the complexity of multiplex PCR system is reduced and the compatibility of primers in a reaction is greatly increased. This UP-MPCR method can detect the presence of five P. aeruginosa enterotoxin genes in a single assay more rapidly and sensitively than conventional methods. In 214 drinking water and environmental isolates, the ExoU, ExoS, phzM, toxA, and lasB genes were detected in 20 (9 %), 180 (84 %), 179 (84 %), 196 (92 %), and 171 (80 %) isolates, respectively.

  7. Degenerate PCR primer design for the specific identification of rhinovirus C.

    Science.gov (United States)

    Nam, Young Ran; Lee, Uk; Choi, Han Seok; Lee, Kyoung Jin; Kim, Nari; Jang, Yong Ju; Joo, Chul Hyun

    2015-03-01

    Human rhinovirus (HRV)-A and -B is a common cause of upper respiratory tract infections. Recently, a third species, HRV-C, was categorized based on molecular typing studies. The results showed that the HRV-C genome had diverged from that of HRV-A and -B. Despite its late identification, increasing evidence suggests that HRV-C causes more severe pathogenic infections than HRV-A or -B; however, a large amount of epidemiological data is required to confirm this association in different clinical settings. Consequently, a simple and rapid method for identifying HRV-C is required to expedite such epidemiological studies. Here, two degenerate primer sets (HEV and HRVC) were designed based on bioinformatic analyses. The HEV set targeting the fifth IRES domain sequence within the 5'-UTR, which is highly conserved among enteroviruses, was designed to detect all enteroviruses, whereas the HRVC set, which targeted the VP2 coding region, was designed to detect HRV-C alone. Both primer sets were tested against a panel of standard enteroviruses and clinical lavage samples. HEV detected all enteroviruses tested whereas HRVC was specific for HRV-C. Although the primer design strategy was confirmed with a limited number of samples, extensive tests are required to be applied in clinical settings.

  8. Crystal structure of complete rhinovirus RNA polymerase suggests front loading of protein primer.

    Science.gov (United States)

    Appleby, Todd C; Luecke, Hartmut; Shim, Jae Hoon; Wu, Jim Z; Cheney, I Wayne; Zhong, Weidong; Vogeley, Lutz; Hong, Zhi; Yao, Nanhua

    2005-01-01

    Picornaviruses utilize virally encoded RNA polymerase and a uridylylated protein primer to ensure replication of the entire viral genome. The molecular details of this mechanism are not well understood due to the lack of structural information. We report the crystal structure of human rhinovirus 16 3D RNA-dependent RNA polymerase (HRV16 3Dpol) at a 2.4-A resolution, representing the first complete polymerase structure from the Picornaviridae family. HRV16 3Dpol shares the canonical features of other known polymerase structures and contains an N-terminal region that tethers the fingers and thumb subdomains, forming a completely encircled active site cavity which is accessible through a small tunnel on the backside of the molecule. The small thumb subdomain contributes to the formation of a large cleft on the front face of the polymerase which also leads to the active site. The cleft appears large enough to accommodate a template:primer duplex during RNA elongation or a protein primer during the uridylylation stage of replication initiation. Based on the structural features of HRV16 3Dpo1 and the catalytic mechanism known for all polymerases, a front-loading model for uridylylation is proposed.

  9. Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA

    Energy Technology Data Exchange (ETDEWEB)

    Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J. (Pharmasset); (Emerald)

    2012-08-01

    The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.

  10. A set of 100 chloroplast DNA primer pairs to study population genetics and phylogeny in monocotyledons.

    Directory of Open Access Journals (Sweden)

    Nora Scarcelli

    Full Text Available Chloroplast DNA sequences are of great interest for population genetics and phylogenetic studies. However, only a small set of markers are commonly used. Most of them have been designed for amplification in a large range of Angiosperms and are located in the Large Single Copy (LSC. Here we developed a new set of 100 primer pairs optimized for amplification in Monocotyledons. Primer pairs amplify coding (exon and non-coding regions (intron and intergenic spacer. They span the different chloroplast regions: 72 are located in the LSC, 13 in the Small Single Copy (SSC and 15 in the Inverted Repeat region (IR. Amplification and sequencing were tested in 13 species of Monocotyledons: Dioscorea abyssinica, D. praehensilis, D. rotundata, D. dumetorum, D. bulbifera, Trichopus sempervirens (Dioscoreaceae, Phoenix canariensis, P. dactylifera, Astrocaryum scopatum, A. murumuru, Ceroxylon echinulatum (Arecaceae, Digitaria excilis and Pennisetum glaucum (Poaceae. The diversity found in Dioscorea, Digitaria and Pennisetum mainly corresponded to Single Nucleotide Polymorphism (SNP while the diversity found in Arecaceae also comprises Variable Number Tandem Repeat (VNTR. We observed that the most variable loci (rps15-ycf1, rpl32-ccsA, ndhF-rpl32, ndhG-ndhI and ccsA are located in the SSC. Through the analysis of the genetic structure of a wild-cultivated species complex in Dioscorea, we demonstrated that this new set of primers is of great interest for population genetics and we anticipate that it will also be useful for phylogeny and bar-coding studies.

  11. In situ DNA amplification with magnetic primers for the electrochemical detection of food pathogens.

    Science.gov (United States)

    Lermo, A; Campoy, S; Barbé, J; Hernández, S; Alegret, S; Pividori, M I

    2007-04-15

    A sensitive and selective genomagnetic assay for the electrochemical detection of food pathogens based on in situ DNA amplification with magnetic primers has been designed. The performance of the genomagnetic assay was firstly demonstrated for a DNA synthetic target by its double-hybridization with both a digoxigenin probe and a biotinylated capture probe, and further binding to streptavidin-modified magnetic beads. The DNA sandwiched target bound on the magnetic beads is then separated by using a magneto electrode based on graphite-epoxy composite. The electrochemical detection is finally achieved by an enzyme marker, anti-digoxigenin horseradish peroxidase (HRP). The novel strategy was used for the rapid and sensitive detection of polymerase chain reaction (PCR) amplified samples. Promising resultants were also achieved for the DNA amplification directly performed on magnetic beads by using a novel magnetic primer, i.e., the up PCR primer bound to magnetic beads. Moreover, the magneto DNA biosensing assay was able to detect changes at single nucleotide polymorphism (SNP) level, when stringent hybridization conditions were used. The reliability of the assay was tested for Salmonella spp., the most important pathogen affecting food safety.

  12. Detection of HCV-RNA by Reverse Transcription Polymerase Chain Reaction Using Biotinylated and Radioiodinated Primers

    Energy Technology Data Exchange (ETDEWEB)

    Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang [Asan Medical Center, University of Ulsan, Seoul (Korea, Republic of)

    1994-07-15

    This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.

  13. Analysis of telomerase activity based on a spired DNA tetrahedron TS primer.

    Science.gov (United States)

    Li, Yan; Wen, Yanli; Wang, Lele; Liang, Wen; Xu, Li; Ren, Shuzhen; Zou, Ziying; Zuo, Xiaolei; Fan, Chunhai; Huang, Qing; Liu, Gang; Jia, Nengqin

    2015-05-15

    The development of sensitive telomerase biosensors is hindered by the restricted accessibility of telomere strand (TS) primer and the limited enzyme reaction space, which is mainly confined by the vertical distance. In this work, we designed an electrochemical telomerase biosensor based on a spired DNA tetrahedron TS primer (STTS). By adding a rigid dsDNA spire onto the top of the DNA tetrahedron, we successfully regulated the distance between the TS primer and the surface, and thus greatly facilitated the telomerase elongation on surface. The signal-to-noise ratio was 2 times higher than TSP without the spire structure. The limit of detection was calculated to be lower than 10 HeLa cells, which is at least 2 magnitudes lower than other surface extension-based electrochemical telomerase sensors without amplification. The practicability of STTS sensor was also demonstrated by analysing various other cell lines including cancer cells, stem cells of high telomerase activity and somatic cells of low telomerase activity.

  14. DNA TYPING FOR HLA - DR ALLELES BY PCR - AMPLIFICATION WITH SEQUENCE- SPECIFIC PRIMERS

    Institute of Scientific and Technical Information of China (English)

    谭建明; 谢桐; 徐琴君

    1999-01-01

    Ohjective To establish a rapid genetyping for HLA- DR alleles by polymerase chain reaction wiht sequence - specifie primers (PCR - SSP) for clinical application. Material and Methods The subjects of study included 69 recipients, 43 unrelated donors and 5 cell lines, Genomic DNA was prepared from peripheral blood leukoeytes by a salting- out method, Thirty primers designed according to the HLA- DRB nucleotide sequences, and synthesized on a 391 DNN synthesizer,Twenty separate PCR reactions were perfomed for each sample, The amplification was accomplished by 34 cycles consisting of denaturation at 94℃ for 30 seconds, annealing at 60℃ for 50 seconds and extension at 72℃ for 40 seconds The specificity of matching was determined by standard DNAs and Southem hybeidization using DIG labeling probes. Results All 112 samples and 5 cell lines were able to be typed by PCR-SSP,No false positive or false negative typing results were obtained. The reproducibility was 100 %,The size of the .specific product was in cnoccrdance with the size of the designed primers. The overall time for genotyping was 4 bours. The typing results were confirned by Southem hybridization.Conelusions Genotyping for HLA- DR by PCR- SSP is a rapid and accurate matching technique suited for clinical application.

  15. Telecommunications Primer

    Directory of Open Access Journals (Sweden)

    Joseph Becker

    2013-05-01

    Full Text Available A description of modern telecommunications devices which can be useful in inter-library communications, including their capacities, types of signals and carriers. Described are telephone lines, radio broadcasting, coaxial cable, microwave and communications satellites. This article, and the one following, were presented as tutorials by the author's to participants at the American Library Association's Atlantic City Convention on June 25, 1969.

  16. VGRAF primer

    Energy Technology Data Exchange (ETDEWEB)

    Padilla, G.C.; Thompson, S.L.

    1980-10-01

    VGRAF is a powerful FORTRAN program which is designed to produce professional-quality color slides, viewgraphs, posters, and data plots for presentations or reports. The program is easy to use and requires no a priori knowledge of a programming language and little or no previous programming experience. This report describes a subset of the VGRAF commands which will enable the user to make very simple plots. For enhanced plotting, the user is referred to SAND79-2147.

  17. MATLAB Primer

    CERN Document Server

    Davis, Timothy A

    2010-01-01

    The eighth edition of this popular book provides a hands-on introduction to MATLAB[registered] that can be used at the undergraduate level. The new edition features the use of MATLAB 8.0, which will be introduced to the market in March 2010. It covers object-oriented programming in MATLAB and the improvements that have been made to the MATLAB desktop and programming tools. There is a new chapter that discusses MATLAB Central, a supporting website where users can exchange files, blogs, and links. In addition, the appendix of help topics has been updated to reflect only the most frequently used

  18. Hyperelasticity primer

    CERN Document Server

    Hackett, Robert M

    2016-01-01

    This book introduces the subject of hyperelasticity in a concise manner mainly directed to students of solid mechanics who have a familiarity with continuum mechanics.  It focuses on important introductory topics in the field of nonlinear material behavior and presents a number of example problems and solutions to greatly aid the student in mastering the difficulty of the subject and gaining necessary insight.  Professor Hackett delineates the concepts and applications of hyperelasticity in such a way that a new student of the subject can absorb the intricate details without having to wade through excessively complicated formulations.  The book further presents significant review material on intricately related subjects such as tensor calculus and introduces some new formulations.

  19. Comparison of Self-Etch Primers with Conventional Acid Etching System on Orthodontic Brackets

    Science.gov (United States)

    Zope, Amit; Zope-Khalekar, Yogita; Chitko, Shrikant S.; Kerudi, Veerendra V.; Patil, Harshal Ashok; Jaltare, Pratik; Dolas, Siddhesh G

    2016-01-01

    Introduction The self-etching primer system consists of etchant and primer dispersed in a single unit. The etching and priming are merged as a single step leading to fewer stages in bonding procedure and reduction in the number of steps that also reduces the chance of introduction of error, resulting in saving time for the clinician. It also results in smaller extent of enamel decalcification. Aim To compare the Shear Bond Strength (SBS) of orthodontic bracket bonded with Self-Etch Primers (SEP) and conventional acid etching system and to study the surface appearance of teeth after debonding; etching with conventional acid etch and self-etch priming, using stereomicroscope. Materials and Methods Five Groups (n=20) were created randomly from a total of 100 extracted premolars. In a control Group A, etching of enamel was done with 37% phosphoric acid and bonding of stainless steel brackets with Transbond XT (3M Unitek, Monrovia, California). Enamel conditioning in left over four Groups was done with self-etching primers and adhesives as follows: Group B-Transbond Plus (3M Unitek), Group C Xeno V+ (Dentsply), Group D-G-Bond (GC), Group E-One-Coat (Coltene). The Adhesive Remnant Index (ARI) score was also evaluated. Additionally, the surface roughness using profilometer were observed. Results Mean SBS of Group A was 18.26±7.5MPa, Group B was 10.93±4.02MPa, Group C was 6.88±2.91MPa while of Group D was 7.78±4.13MPa and Group E was 10.39±5.22MPa respectively. In conventional group ARI scores shows that over half of the adhesive was remaining on the surface of tooth (score 1 to 3). In self-etching primer groups ARI scores show that there was no or minor amount of adhesive remaining on the surface of tooth (score 4 and 5). SEP produces a lesser surface roughness on the enamel than conventional etching. However, statistical analysis shows significant correlation (p<0.001) of bond strength with surface roughness of enamel. Conclusion All groups might show clinically

  20. Crecimiento longitudinal posnatal del primer metatarsiano. [Longitudinal postnatal growth of the first metatarsal bone

    Directory of Open Access Journals (Sweden)

    Julio J. Masquijo

    2014-10-01

    Full Text Available Introducción: si bien el crecimiento prenatal y posnatal del pie ha sido documentado hace varios años, el crecimiento longitudinal del primer metatarsiano en particular no ha sido estudiado previamente. El objetivo del estudio es determinar el patrón de crecimiento longitudinal posnatal de este hueso y compararlo con el del pie y los huesos largos del miembro inferior. Materiales y Métodos: mediante una búsqueda informatizada, se identificaron pacientes <18 años de edad con radiografías informadas como “normal” por el radiólogo. Se analizó una muestra de 886 pacientes divididos en 18 grupos según la edad (0-11 meses, 1 año, 2 años, etc. y el sexo. El análisis de las imágenes se realizó con un software de imágenes Kodak Carestream PACS. Resultados: el largo promedio en el primer grupo fue de 19,91 mm (3,20; 15,22-25,62. El largo promedio en el último grupo fue de 66,13 mm (5,33; 52,50-77,18. La tasa de crecimiento anual fue de 2,71 mm. La edad promedio al momento del cierre de la fisis fue de 14.85 años (± 1.64 para los varones y 14.77 años (± 3.63 para las niñas. Conclusión: el crecimiento del primer metatarsiano acompaña el crecimiento longitudinal del pie, pero no el de los huesos largos del miembro inferior. Las curvas de crecimiento del primer metatarsiano descritas en este artículo pueden ser aplicadas en patologías que afectan el desarrollo del pie o que requieren cirugía de corrección sobre el primer metatarsiano, o se las puede emplear como estándar de referencia en futuros estudios.

  1. Qualitative Analysis of Primers, Tracers, Igniters, Incendiaries, Boosters, and Delay Compositions on a Micro Scale by Use of Infrared Spectroscopy

    Science.gov (United States)

    ingredients of primers, tracers, igniters, incendiaries, boosters, and delay compositions are given over the range 2.5 to 50 microns. The qualitative analysis of seven typical compositions is demonstrated.

  2. Comparison of Different Denaturing Gradient Gel Electrophoresis Primer Sets for the Study of Marine Bacterioplankton Communities▿ †

    Science.gov (United States)

    Sánchez, Olga; Gasol, Josep M.; Massana, Ramon; Mas, Jordi; Pedrós-Alió, Carlos

    2007-01-01

    An annual seasonal cycle of composition of a bacterioplankton community in an oligotrophic coastal system was studied by denaturing gradient gel electrophoresis (DGGE) using five different primer sets. Analysis of DGGE fingerprints showed that primer set 357fGC-907rM grouped samples according to seasons. Additionally, we used the set of 16S rRNA genes archived in the RDPII database to check the percentage of perfect matches of each primer for the most abundant bacterial groups inhabiting coastal plankton communities. Overall, primer set 357fGC-907rM was the most suitable for the routine use of PCR-DGGE analyses in this environment. PMID:17660308

  3. Primer registro de Coccidae (Hemiptera: Coccoidea sobre Duchesnea indica (Rosaceae “frutilla silvestre” en Tucumán, Argentina

    Directory of Open Access Journals (Sweden)

    Patri GONZÁLEZ

    2015-01-01

    Full Text Available Se da a conocer el primer registro de la Argentina y el mundo del Coccidae Saissetia coffeae (Walker sobre Duchesnea indica (Andrews Focke, frutilla silvestre relacionada con frutilla cultivada (Fragaria x ananassa Duch.

  4. A Novel Teaching-Learning-Based Optimization for Improved Mutagenic Primer Design in Mismatch PCR-RFLP SNP Genotyping.

    Science.gov (United States)

    Cheng, Yu-Huei

    2016-01-01

    Many single nucleotide polymorphisms (SNPs) for complex genetic diseases are genotyped by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) in small-scale basic research studies. It is an essential work to design feasible PCR-RFLP primer pair and find out available restriction enzymes to recognize the target SNP for PCR experiments. However, many SNPs are incapable of performing PCR-RFLP makes SNP genotyping become unpractical. A genetic algorithm (GA) had been proposed for designing mutagenic primer and get available restriction enzymes, but it gives an unrefined solution in mutagenic primers. In order to improve the mutagenic primer design, we propose TLBOMPD (TLBO-based Mutagenic Primer Design) a novel computational intelligence-based method that uses the notion of "teaching and learning" to search for more feasible mutagenic primers and provide the latest available restriction enzymes. The original Wallace's formula for the calculation of melting temperature is maintained, and more accurate calculation formulas of GC-based melting temperature and thermodynamic melting temperature are introduced into the proposed method. Mutagenic matrix is also reserved to increase the efficiency of judging a hypothetical mutagenic primer if involve available restriction enzymes for recognizing the target SNP. Furthermore, the core of SNP-RFLPing version 2 is used to enhance the mining work for restriction enzymes based on the latest REBASE. Twenty-five SNPs with mismatch PCR-RFLP screened from 288 SNPs in human SLC6A4 gene are used to appraise the TLBOMPD. Also, the computational results are compared with those of the GAMPD. In the future, the usage of the mutagenic primers in the wet lab needs to been validated carefully to increase the reliability of the method. The TLBOMPD is implemented in JAVA and it is freely available at http://tlbompd.googlecode.com/.

  5. Histomicrobiologic aspects of the root canal system and periapical lesions in dogs' teeth after rotary instrumentation and intracanal dressing with Ca(OH2 pastes Aspectos histomicrobiológicos do sistema de canais radiculares e das lesões periapicais em dentes de cães após instrumentação automatizada e medicação intracanal com pastas de Ca(OH2

    Directory of Open Access Journals (Sweden)

    Janir Alves Soares

    2006-10-01

    Full Text Available OBJECTIVE: The purpose of this study was to evaluate the distribution of microorganisms in the root canal system (RCS and periapical lesions of dogs' teeth after rotary instrumentation and placement of different calcium hydroxide [Ca(OH2]-based intracanal dressings. MATERIALS AND METHODS: Chronic periapical lesions were experimentally induced in 80 premolar roots of four dogs. Instrumentation was undertaken using the ProFile rotary system and irrigation with 5.25% sodium hypochlorite. The following Ca(OH2-based pastes were applied for 21 days: group 1 - Calen (n=18; group 2 - Calen+CPMC (n=20; group 3 - Ca(OH2 p.a. + anaesthetic solution (n=16 and group 4 - Ca(OH2 p.a.+ 2% chlorhexidine digluconate (n=18. Eight root canals without endodontic treatment constituted the control group. Histological sections were obtained and stained with Brown & Brenn staining technique to evaluate the presence of microorganisms in the main root canal, ramifications of the apical delta and secondary canals, apical cementoplasts, dentinal tubules, areas of cemental resorption and periapical lesions. The results were analyzed statistically by the Mann-Whitney U test (p0.05. The percentage of RCS sites containing microorganisms in groups 1, 2, 3, 4 and control were: 67.6%, 62.5%, 78.2%, 62.0% and 87.6%, respectively. CONCLUSION: In conclusion, the histomicrobiological analysis showed that the rotary instrumentation and the different calcium hydroxide pastes employed did not effectively eliminate the infection from the RCS and periapical lesions. However, several bacteria seen in the histological sections were probably dead or were inactivated by the biomechanical preparation and calcium hydroxide-based intracanal dressing.OBJETIVO: Neste estudo avaliou-se a distribuição dos microrganismos no sistema de canais radiculares (SCR e região periapical (RP de cães após instrumentação automatizada e utilização de pastas à base de hidróxido de cálcio CaO(H2

  6. Elimination of intracanal infection in dogs' teeth with induced periapical lesions after rotary instrumentation: influence of different calcium hydroxide pastes Eliminação da infecção intracanal em dentes de cães com lesões periapicais induzidas após instrumentação automatizada: influência de diferentes pastas de hidróxido de cálcio

    Directory of Open Access Journals (Sweden)

    Janir Alves Soares

    2006-06-01

    radiculares vazios e 96 horas após obteve-se a segunda amostragem microbiológica (A2. O número de unidades formadoras de colônias de microrganismos (ufc e a incidência de culturas positivas antes e após cada tratamento foram analisados pelo teste de Wilcoxon enquanto a influência dos diferentes tratamentos na infecção intracanal foi avaliada pelo teste de Kruskal-Wallis com nível de signficância de 5,0%. Verificaram-se nas amostras A1 elevadas quantidades de anaeróbios obrigatórios, facultativos e estreptococos do grupo viridans em 100% dos canais radiculares. Nas amostras A2, todos os tratamentos proporcionaram significativa redução do número de ufc e de culturas positivas (p<0.05, mas somente os grupos 3 e 4 proveram 100,0% dos canais radiculares livres de microrganismos. Portanto, a instrumentação automatizada coadjuvada pela solução de hipoclorito de sódio a 5,25% associada à medicação intracanal proporcionaram drástica redução ou eliminação da microbiota intracanal, cuja performance não foi influenciada pela natureza do veículo ou do anti-séptico acrescido ao hidróxido de cálcio p.a..

  7. Effects of sandblasting, H2SO4/HCl etching, and phosphate primer application on bond strength of veneering resin composite to commercially pure titanium grade 4.

    Science.gov (United States)

    Egoshi, Takafumi; Taira, Yohsuke; Soeno, Kohyoh; Sawase, Takashi

    2013-01-01

    This study investigated the effects of surface treatments on the bond strength of a resin composite to a commercially pure titanium. The bonding surfaces of all titanium specimens were ground with 1,000-grit silicon carbide paper and then subjected to one or more of these surface treatments: sandblasting with alumina (sand), etching with 45wt% H2SO4 and 15wt% HCl (SH-etchant) at 70°C for 10 min, and/or phosphate primer (MDP-primer) application. Specimens not subjected to any surface treatment were used as controls. After resin composite veneer placement and 24-h water immersion, the shear bond strengths of the specimens in descending order were: sand/SH-etchant/MDP-primer, sand/SH-etchant/no primer, no sand/SH-etchant/MDP-primer, sand/no etch/MDP-primer, no sand/SH-etchant/no primer, sand/no etch/no primer, no sand/no etch/MDP-primer, no sand/no etch/no primer. Scanning electron microscope observations revealed that sandblasting and SH-etchant created many micro- and nanoscale cavities on the titanium surface. Results showed that a combined use of sandblasting, SH-etchant, and MDP-primer application had a cooperative effect on titanium bonding.

  8. Systematic design of 18S rRNA gene primers for determining eukaryotic diversity in microbial consortia.

    Science.gov (United States)

    Hugerth, Luisa W; Muller, Emilie E L; Hu, Yue O O; Lebrun, Laura A M; Roume, Hugo; Lundin, Daniel; Wilmes, Paul; Andersson, Anders F

    2014-01-01

    High-throughput sequencing of ribosomal RNA gene (rDNA) amplicons has opened up the door to large-scale comparative studies of microbial community structures. The short reads currently produced by massively parallel sequencing technologies make the choice of sequencing region crucial for accurate phylogenetic assignments. While for 16S rDNA, relevant regions have been well described, no truly systematic design of 18S rDNA primers aimed at resolving eukaryotic diversity has yet been reported. Here we used 31,862 18S rDNA sequences to design a set of broad-taxonomic range degenerate PCR primers. We simulated the phylogenetic information that each candidate primer pair would retrieve using paired- or single-end reads of various lengths, representing different sequencing technologies. Primer pairs targeting the V4 region performed best, allowing discrimination with paired-end reads as short as 150 bp (with 75% accuracy at genus level). The conditions for PCR amplification were optimised for one of these primer pairs and this was used to amplify 18S rDNA sequences from isolates as well as from a range of environmental samples which were then Illumina sequenced and analysed, revealing good concordance between expected and observed results. In summary, the reported primer sets will allow minimally biased assessment of eukaryotic diversity in different microbial ecosystems.

  9. Systematic design of 18S rRNA gene primers for determining eukaryotic diversity in microbial consortia.

    Directory of Open Access Journals (Sweden)

    Luisa W Hugerth

    Full Text Available High-throughput sequencing of ribosomal RNA gene (rDNA amplicons has opened up the door to large-scale comparative studies of microbial community structures. The short reads currently produced by massively parallel sequencing technologies make the choice of sequencing region crucial for accurate phylogenetic assignments. While for 16S rDNA, relevant regions have been well described, no truly systematic design of 18S rDNA primers aimed at resolving eukaryotic diversity has yet been reported. Here we used 31,862 18S rDNA sequences to design a set of broad-taxonomic range degenerate PCR primers. We simulated the phylogenetic information that each candidate primer pair would retrieve using paired- or single-end reads of various lengths, representing different sequencing technologies. Primer pairs targeting the V4 region performed best, allowing discrimination with paired-end reads as short as 150 bp (with 75% accuracy at genus level. The conditions for PCR amplification were optimised for one of these primer pairs and this was used to amplify 18S rDNA sequences from isolates as well as from a range of environmental samples which were then Illumina sequenced and analysed, revealing good concordance between expected and observed results. In summary, the reported primer sets will allow minimally biased assessment of eukaryotic diversity in different microbial ecosystems.

  10. Effect of Saliva Contamination on Shear Bond Strength of Orthodontic Brackets When Using a Self-Etch Primer

    Institute of Scientific and Technical Information of China (English)

    MAO Jing; QI Juan

    2005-01-01

    The effect of saliva contamination on the shear bond strength of orthodontic brackets, at various stages of the bonding procedure using a new self-etch primer was studied. The samples were divided into 4 groups according to 4 different enamel surface conditions: Group A: dry; Group B: saliva contamination before priming; Group C: saliva contamination after priming, and Group D: saliva contamination before and after priming. Stainless steel brackets were bonded in each test group with a light-cured composite resin (TransbondXT 3M). The shear bond strength was determined in the first 30 min after bonding. The analysis of variance indicated that the shear bond strengths of the 4 groups were significantly different (F= 11.89, P<0.05). Tukey HSD tests indicated that contamination both before and after the application of the acid-etch primer resulted in a significantly lower (=4.6± 1.7 MPa) shear bond strength than either the control group (= 8.8±1.9 MPa) or the groups where contamination occurred either before ( = 7.9± 2.0 MPa) or after (=6.9±1.5 MPa) the application of the primer. It was concluded that the new acid-etch primer could maintain adequate shear bond strength if contamination occurred either before or after the application of the primer. On the other hand, contamination both before and after the application of the primer could significantly reduce the shear bond strength of orthodontic brackets.

  11. Assessment of primer/template mismatch effects on real-time PCR amplification of target taxa for GMO quantification.

    Science.gov (United States)

    Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc

    2009-10-28

    GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree.

  12. Detection of YMDD mutation using mutant-specific primers in chronic hepatitis B patients before and after lamivudine treatment

    Institute of Scientific and Technical Information of China (English)

    Cha-Ze Lee; Hsuan-Shu Lee; Guan-Tarn Huang; Pei-Ming Yang; Jin-Chuan Sheu

    2006-01-01

    AIM: To develop a PCR assay using mutant-specific primers to detect mutation of tyrosine-methionineaspartate-aspartate (YMDD) motif of HBV to tyrosinevaline-aspartate-aspartate (YVDD) or tyrosine-isoleucineaspartate-aspartate (YIDD).METHODS: Cloned wild-type and mutant HBV sequences were used as templates to test the sensitivity and specificity of the assay. A variety of primer construction, primer concentration, dNTP concentration,and annealing temperature of primers were systematically examined. Pair primers specific to rtL180M and rtM204V were selected for YVDD detection. Primer specific to rtM204I with an additional 3'-penultimate base mismatched to both the mutant and wild-type sequence was selected for YIDD detection. We applied this assay to study YMDD mutants in 28 chronic hepatitis B patients before and after lamivudine treatment.RESULTS: We could detect as little as 0.001%-0.00001%of mutant viruses coexisting in 108-109 copies of wildtype HBV using this assay. YMDD mutants were detected in 8 of 12 HBeAg-positive patients and 8 of 16 HBeAgnegative patients before lamivudine treatment. After treatment, two more patients in HBeAg-positive patients and seven more patients in HBeAg-negative patients developed YMDD mutations.CONCLUSION: We developed a highly sensitive and specific assay for detecting YMDD mutants. This assay can be applied to monitor chronic hepatitis B patients before and during lamivudine treatment.

  13. High-coverage ITS primers for the DNA-based identification of ascomycetes and basidiomycetes in environmental samples.

    Directory of Open Access Journals (Sweden)

    Hirokazu Toju

    Full Text Available The kingdom Fungi is estimated to include 1.5 million or more species, playing key roles as decomposers, mutualists, and parasites in every biome on the earth. To comprehensively understand the diversity and ecology of this huge kingdom, DNA barcoding targeting the internal transcribed spacer (ITS region of the nuclear ribosomal repeat has been regarded as a prerequisite procedure. By extensively surveying ITS sequences in public databases, we designed new ITS primers with improved coverage across diverse taxonomic groups of fungi compared to existing primers. An in silico analysis based on public sequence databases indicated that the newly designed primers matched 99% of ascomycete and basidiomycete ITS taxa (species, subspecies or varieties, causing little taxonomic bias toward either fungal group. Two of the newly designed primers could inhibit the amplification of plant sequences and would enable the selective investigation of fungal communities in mycorrhizal associations, soil, and other types of environmental samples. Optimal PCR conditions for the primers were explored in an in vitro investigation. The new primers developed in this study will provide a basis for ecological studies on the diversity and community structures of fungi in the era of massive DNA sequencing.

  14. A preferred region for recombinational patch repair in the 5' untranslated region of primer binding site-impaired murine leukemia virus vectors

    DEFF Research Database (Denmark)

    Mikkelsen, J G; Lund, Anders Henrik; Kristensen, K D;

    1996-01-01

    with that of the wild-type vector. Thirty-two of 60 transduced proviruses analyzed harbored a primer binding site sequence matching a glutamine tRNA primer. Sequence analysis of the regions flanking the glutamine tRNA primer binding site revealed a distinct pattern of nucleotide differences from the Akv-based vector...... at or around the glutamine tRNA primer binding site. We propose that the forced recombination of primer binding site mutants involves initial priming on endogenous viral sequences and requires template switching during minus-strand synthesis in the region between the neo gene and the mutated primer binding......, suggesting the involvement of a specific endogenous virus-like sequence in patch repair rescue of the primer binding site mutants. The putative recombination partner RNA was found in virions from psi-2 cells as detected by analysis of glutamine tRNA-initiated cDNA and by sequence analysis of regions...

  15. Práticas alimentares e estado nutricional de crianças no segundo semestre de vida atendidas na rede pública de saúde Feeding practices and nutritional status of children in the second semester of life who receive care in public health facilities

    Directory of Open Access Journals (Sweden)

    Simone Paula Modesto

    2007-08-01

    Full Text Available OBJETIVO: Avaliar o estado nutricional e as práticas alimentares de crianças no segundo semestre de vida atendidas na rede pública de saúde do município de Taboão da Serra, SP. MÉTODOS: Estudo de corte transversal conduzido em Unidades Básicas de Saúde, classificadas em dois agrupamentos (região central e região periférica. A amostra foi constituída por 180 crianças, sendo 90 de cada agrupamento. O consumo alimentar foi registrado pelo método recordatório de 24 horas. Foram tomadas medidas de peso e dosagem de hemoglobina por punção capilar. RESULTADOS: A prevalência de anemia encontrada foi de 30,5% sem diferença entre os grupos. Os valores das medianas do escore-Z (peso/idade foram: 0,02 e 0,03, para os agrupamentos central e periférico, respectivamente. A utilização de suplemento de ferro apresentou diferença entre os grupos (p=0,001, sendo mais presente no agrupamento periférico, enquanto que para a vitamina A, a suplementação foi significantemente maior no agrupamento central (p=0,044. Verificou-se introdução precoce de alimentos distintos do leite materno na dieta infantil e diferença significante entre os grupos na idade de introdução de chá, suco de fruta, sopa e sopa com carne no esquema alimentar. Em relação à ingestão de nutrientes verificou-se consumo adequado de energia e proteínas, mas quanto aos micronutrientes estudados, há grande probabilidade de inadequação do consumo de ferro e vitamina C. CONCLUSÃO: A prevalência de anemia é relativamente reduzida, comparada com os dados obtidos em outros locais, e o esquema de introdução de alimentos complementares é inadequado, frente às recomendações atuais. A utilização de suplementos de nutrientes deve ser revista.OBJECTIVE: To assess the nutritional status and feeding practices of children in the second semester of life who receive care in public health facilities of the city of Taboão da Serra, SP. METHODS: This is a cross

  16. LA PALABRA DIBUJADA. ANTONIO FERNÁNDEZ-ALBA, PRIMER Y ÚLTIMO MAESTRO / The drawn word. Antonio Fernández-Alba, first and last master

    Directory of Open Access Journals (Sweden)

    Juan Luis Trillo de Leyva

    2015-05-01

    Full Text Available Távora y Fernández-Alba son figuras de referencia ineludible para quienes quieran hoy investigar el origen contemporáneo de la arquitectura peninsular y, sobre todo, de sus escuelas. Alba fue siempre una guía para los que abordamos una enseñanza alejados del aura que acompañaba a los grandes arquitectos madrileños y barceloneses. Su experimentación didáctica alteró la trayectoria de las escuelas de arquitectura españolas. Introdujo la cultura contemporánea en la universidad como si se tratara de una segunda naturaleza, de un nuevo estrato territorial de los proyectos, manteniendo al hombre como objeto central y destinatario de todo proceso proyectual. En época de virtualidad y representación automatizada, nada más adecuado que la revisión de los dibujos del maestro Fernández-Alba. Dibujos que requieren ser proyectados, pensados, antes que ejecutados, “proyectos de proyectos”, una especie de tautología que rige la mente del poeta en su continua reducción, compresión o destilación, gota a gota, del mundo real, del universo y la palabra.

  17. Detection of Brucella abortus by alkB and IS711 based primers

    Directory of Open Access Journals (Sweden)

    Seyed Reza Hosseini Doust

    2007-06-01

    Full Text Available

    BACKGROUND: Brucellosis is a zoonotic disease, which involves both animals and human. Although the conventional methods have been widely used for its laboratory diagnosis, the PCR techniques have proved to be useful due to specificity, sensitivity and the rapidness. Various target sequences of brucella bacterium such as OMP2, 16s RNA and IS711 have been used for the primer designing.. All primer sets have shown different sensitivities and specificities. In present investigation, PCR protocol and primer designated based on IS711 and a fragment of chromosomal DNA all were optimized with standard genome and clinical samples.

    METHODS: Numerous tissue samples (liver, kidney, lymph node, and uterus were prepared and were cultured by the bacteriological standard methods along with the serology positive human samples. PCR protocol was optimized and the primer's sensitivity and the specificity were checked using pure genome of B. abortus. All samples were tested by the standard bacteriological methods. The samples were then subject to PCR amplification and the PCR product was confirmed using the RFLP technique.

    RESULTS: The culture results indicated a poor sensitivity as it was previously reported. The PCR product 157 bp was observed on the agarose gel indicating that significant number of clinical samples (human brucellosis cases were positive by PCR but not by the

  18. 甜瓜种质鉴定的高效引物(引物组合)适用性分析%Suitability Analysis on Highly Active Primers ( Primer Combinations) of Germplasm Identification in Cucumis melo L.

    Institute of Scientific and Technical Information of China (English)

    王掌军; 王建设; 刘生祥; 蒋全熊; 张晓岗; 马宏玮

    2012-01-01

    以30份甜瓜种质资源为材料,采用RAPD(random amplified polymorphic DNA)、DAMD(directed amplification of minisatellite-region DNA)和SRAP(sequence-related amplified polymorphism)3 种分子标记构建各自的DNA指纹图谱.针对图谱上扩增的条带分子量大小和分布,用统计软件逐一聚类,根据不同引物(引物组合)所得聚类图鉴别的品种数目,筛选出高分辨率的4个RAPD引物、3个DAMD引物和6个SRAP引物组合.同时,利用高效引物(引物组合)评价了甜瓜遗传多样性,将30份甜瓜分为薄皮和厚皮两类,厚皮甜瓜包括网纹和无网纹两种类型.%The study constructed each DNA fingerprint map by RAPD, DAMD and SRAP molecular markers in 30 melon germplasms. Statistical software was used to cluster one by one in collection with the dimension and distribution of the molecular weight in the map amplified. Based on the cultivar numbers identified by the clustering map from different primers (primer combinations) , four RAPD primers, three DAMD primers and six SRAP primer combinations with highly distinguished rate were screened. At the same time,the genetic diversity of melons were evaluated by these high active primers (primer combinations) ,30 melons were divided to two kinds, ie,C. melo sp. cono-mom and C. melo sp. melo, C. melo sp. melo included C. melo cantalupo and C. melo reticulatus.

  19. Comprension de los conceptos de los enlaces ionico y covalente en estudiantes universitarios del primer curso de quimica general

    Science.gov (United States)

    Ballesteros Benavides, Maria Elvira

    Para este trabajo utilizamos el estudio de casos cualitativo que se llevo a cabo en una universidad privada de Puerto Rico. Empleamos como unidad de analisis el concepto de enlace quimico, ionico y covalente. Los participantes fueron los estudiantes de la seccion nocturna del curso de Quimica General I. La investigacion se desarrollo por medio de dos entrevistas de persona a persona, observaciones de las expresiones no verbales y la hoja de identificacion de conceptos. Para la triangulacion tomamos en consideracion las preconcepciones erroneas, las concepciones alternativas y el mapa de conceptos de cada participante. Preparamos un mapa de conceptos para el enlace quimico validado por un comite de expertos. Tambien, elaboramos los mapas de conceptos de los participantes que sirvieron para varios propositos: conocer la estructura conceptual, expresar los logros, hacer comparaciones e identificar la presencia de concepciones alternativas. Entre los hallazgos encontramos que todos los participantes poseen conocimiento previo de los enlaces quimicos ionico y covalente y dentro de ese conocimiento existen preconcepciones erroneas mas numerosas para el enlace ionico. Al principio del semestre el 50% de los participantes demostraron tener "carencia fuerte de conceptos" tanto para el enlace ionico como para el covalente. Al finalizar el semestre encontramos en el 40% de los participantes concepciones alternativas tanto para el enlace ionico como para el covalente y el 90% no lograron distinguir un enlace del otro. Nuestras conclusiones fueron que los participantes sin distincion del aprovechamiento academico demostraron tener la tendencia de "carencia fuerte de conceptos" tanto para el enlace ionico como para el covalente, presentaron dificultad al integrar los conceptos de los enlaces quimicos ionico y covalente que se pusieron de manifiesto al dar los ejemplos. Las preconcepciones erroneas contribuyen en el desarrollo de las concepciones alternativas. Ademas, los

  20. Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)

    2013-01-25

    Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection

  1. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    Energy Technology Data Exchange (ETDEWEB)

    Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

    2013-06-28

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  2. Incidencia de los Movimientos Oculares en el proceso lector de alumnos de Primer ciclo de Primaria.

    OpenAIRE

    Alejo-Ramos, Cristina

    2013-01-01

    Los movimientos oculares en la lectura son importantes para el proceso de aprendizaje de los niños. Este trabajo de investigación tiene como objetivo, conocer la influencia de los movimientos oculares en la lectura. Para ello se llevó a cabo un estudio, con una muestra de 30 alumnos del Primer ciclo de Primaria, es decir, Primero y Segundo, del mismo centro educativo. Una vez que se realizaron las pruebas oportunas, se pudo comprobar cómo estaban relacionadas motricidad ocular y lectura...

  3. ANÁLISIS TRANSITORIO DE CIRCUITOS DE PRIMER ORDEN USANDO EL OPERADOR D

    OpenAIRE

    Retana R., Ismael

    2011-01-01

    Este trabajo describe cómo usar las ecuaciones diferenciales para resolver problemas relativos a circuitos eléctircos que operan en régimen transitorio. Se ocupa de la respuesta de circuitos de primer orden tanto bajo excitación variable como bajo excitación constante. Se usa el operador D con el fin de obtener el modelo matemñatico del sistema. Se presenta además el fenómeno del dualismo en los circuitos. el artículo también introduce al estudiante en la terminología y los conceptos propios ...

  4. Primer caso de hemoglobina Köln (codon98 GTG>ATG en Costa Rica

    Directory of Open Access Journals (Sweden)

    Walter Cartín

    2010-03-01

    Full Text Available La exposición a ciertos medicamentos puede provocar anemia hemolítica con presencia de cuerpos de Heinz en sangre periférica. Esta anemia puede presentarse por sobredosis de medicamentos, tanto en individuos sanos como en personas con deficiencias enzimáticas como la glucosa-6-fosfato deshidrogenasa, o en presencia de hemoglobinas inestables. Este reporte muestra un caso de anemia hemolítica con cuerpos de Heinz, debido a la presencia de una hemoglobina inestable, cuyos estudios moleculares y HPLC confirmaron el primer caso descrito de hemoglobina Köln (Val98Met en Costa Rica.

  5. Christiaan Barnard: 40 años del primer transplante de corazón humano.

    Directory of Open Access Journals (Sweden)

    Jorge Reynolds

    2009-11-01

    Full Text Available «El sábado, yo era un cirujano en Sudáfrica, poco conocido.El lunes, yo era una celebridad mundial» Fueron éstas las palabras pronunciadas por Christiaan Neethling Barnard para referirse al domingo 3 de diciembre de 1967 cuando, en el Hospital Groote Schuur de Cape Town, Sudáfrica, dirigió al equipo que realizó el primer transplante cardíaco efectuado en un ser humano.

  6. Community-Based Supports and Services for Older Adults: A Primer for Clinicians

    Directory of Open Access Journals (Sweden)

    Eugenia L. Siegler

    2015-01-01

    Full Text Available Although 20% of adults 60 years and older receive community-based supports and services (CBSS, clinicians may have little more than a vague awareness of what is available and which services may benefit their patients. As health care shifts toward more creative and holistic models of care, there are opportunities for CBSS staff and primary care clinicians to collaborate toward the goal of maintaining patients’ health and enabling them to remain safely in the community. This primer reviews the half-century history of these organizations in the United States, describes the most commonly used services, and explains how to access them.

  7. Christiaan Barnard: 40 años del primer transplante de corazón humano

    OpenAIRE

    Jorge Reynolds; Juan Fernando Cediel; César Payán

    2007-01-01

    Fueron éstas las palabras pronunciadas por Christiaan Neethling Barnard para referirse al domingo 3 de diciembre de 1967 cuando, en el Hospital Groote Schuur de Cape Town, Sudáfrica, dirigió al equipo que realizó el primer transplante cardíaco efectuado en un ser humano1. Después de 40 años, se recuerda al doctor Barnard, no sólo como cirujano excepcional, sino como un luchador incansable que revolucionó conceptos tan trascendentales en la ciencia médica como el de la muerte cerebral1,2.Chris...

  8. Un estudio interpretativo de una clase bilingüe hispana de primer grado

    OpenAIRE

    Poveda, David

    1998-01-01

    El propósito de este estudio es analizar desde una perspectiva ecológico-interpretativa la enseñanza de la lecto-escritura en una clase bilingüe de primer grado. Todos los estudiantes y la profesora eran de origen hispano en una escuela pública y urbana de Chicago, la población estudiantil era mayoritariamente de status socio-económico bajo. Se hicieron observaciones y grabaciones en el aula durante un período de cinco meses, también se entrevistó a la profesora y se recogieron materiales doc...

  9. KIR typing by non-sequencing methods: polymerase-chain reaction with sequence-specific primers.

    Science.gov (United States)

    Ordóñez, David; Moraru, Manuela; Gómez-Lozano, Natalia; Cisneros, Elisa; Vilches, Carlos

    2012-01-01

    The killer-cell immunoglobulin-like receptors (KIR), which enable NK cells to detect allogeneic target cells and abnormalities in the expression of self-HLA molecules, are encoded by genes that display extensive copy number variation. These variations in the KIR genotype are relevant for multiple aspects of human health, including therapy of cancer. PCR with sequence-specific primers (SSP) is simplest and most widely used among techniques for studying KIR genotypes. Here, we present a protocol that details the critical steps of a method for KIR genotyping by PCR-SSP.

  10. Las bibliotecas públicas durante el primer franquismo: entre la continuidad y la ruptura

    OpenAIRE

    Rodrigo Echalecu, Ana María

    2009-01-01

    En esta Memoria se analiza el concepto de biblioteca pública durante el primer franquismo, así como la organización bibliotecaria, los Centros Coordinadores de Bibliotecas, los diferentes tipos de bibliotecas públicas, así como el personal que las gestionó y sus instalaciones. Especial atención han recibido las bibliotecas municipales al estudiar el marco jurídico y su localización a través de una cartografía inédita.

  11. Constructing the ecstasy of MDMA from its component mental organs: Proposing the primer/probe method.

    Science.gov (United States)

    Ray, Thomas S

    2016-02-01

    The drug MDMA, commonly known as ecstasy, produces a specific and distinct open hearted mental state, which led to the creation of a new pharmacological class, "entactogens". Extensive literature on its mechanisms of action has come to characterize MDMA as a "messy" drug with multiple mechanisms, but the consensus is that the distinctive entactogenic effects arise from the release of neurotransmitters, primarily serotonin. I propose an alternative hypothesis: The entactogenic mental state is due to the simultaneous direct activation of imidazoline-1 (I1) and serotonin-2 (5-HT2) receptors by MDMA. This hypothesis emerges from "mental organ" theory, which embodies many hypotheses, the most relevant of which are: "Mental organs" are populations of neurons that all express their defining metabotropic receptor, and each mental organ plays a distinct role in the mind, a role shaped by evolution as mental organs evolve by duplication and divergence. Mental organs are the mechanism by which evolution sculpts the mind. Mental organs can be in or out of consciousness. In order for a mental organ to enter consciousness, three things must happen: The mental organ must be activated directly at its defining receptor. 5-HT2 must be simultaneously activated. One of the functions of activated 5-HT2 is to load other simultaneously activated mental organs fully into consciousness. In some cases THC must be introduced to remove long-term blocks mediated by the cannabinoid system. I propose the "primer/probe" method to test these hypotheses. A "primer" is a drug that selectively activates 5-HT2 (e.g. DOB or MEM) or serotonin-1 (5-HT1) and 5-HT2 (e.g. DOET or 2C-B-fly). A "probe" is a drug that activates a receptor whose corresponding mental organ we wish to load into consciousness in order to understand its role in the mind. The mental organ is loaded into consciousness when the primer and probe are taken together, but not when taken separately. For example, the blood pressure

  12. Apuntes sobre el Primer Congreso Internacional de Economía Social

    OpenAIRE

    Acosta, María Cristina

    2009-01-01

    El Primer Congreso Internacional de Economía Social, organizado por el Museo Social Argentino, fue auspiciado por el Superior Gobierno de la Nación y tuvo lugar en la Ciudad de Buenos Aires entre el 26 de octubre y el 4 de noviembre de 1924. En un principio la convocatoria al Congreso proponía discutir cuestiones fundamentales de la política social aunque finalmente, externdió los contenidos de la proyectada reunión a fin de abarcar las diferentes ramas de la economía social. En el Congreso p...

  13. Effect of metal primers and tarnish treatment on bonding between dental alloys and veneer resin

    OpenAIRE

    Choo, Seung-Sik; Huh, Yoon-Hyuk; Cho, Lee-Ra; Park, Chan-Jin

    2015-01-01

    PURPOSE The aim of this study was to evaluate the effect of metal primers on the bonding of dental alloys and veneer resin. Polyvinylpyrrolidone solution's tarnish effect on bonding strength was also investigated. MATERIALS AND METHODS Disk-shape metal specimens (diameter 8 mm, thickness 1.5 mm) were made from 3 kinds of alloy (Co-Cr, Ti and Au-Ag-Pd alloy) and divided into 4 groups per each alloy. Half specimens (n=12 per group) in tarnished group were immersed into polyvinylpyrrolidone solu...

  14. La arquitectura tardía de Frank Lloyd Wright, el primer maestro moderno

    OpenAIRE

    González Capitel, Antón

    1996-01-01

    1. La arquitectura tardía de Frank Lloyd Wright, el primer maestro moderno l. l. Un Wright renovado. Talleres y residencias l. l. l. Nuevas casas de Wright en su segunda «edad de oro»: un neoplasticismo orgánico en la casa de la Cascada l. l. 2. Geometrías y disposiciones alternativas l. 2. Arquitectura y ciudad orgánicas 1. 2. 1. El desarrollo de la arquitectura orgánica 1. 3. Arquitecturas relacionadas con la de Frank Lloyd Wright entre los emigrados europeos: Schindler y...

  15. Primer registro de Tityus trivittatus (Scorpiones: Buthidae en la provincia de Mendoza (Argentina

    Directory of Open Access Journals (Sweden)

    Florencia FERNÁNDEZ CAMPÓN

    2009-01-01

    Full Text Available En la siguiente nota se informa sobre el primer registro delescorpión Tityus trivittatus Kraepelin en la provincia de Mendoza en el Barrio Campo Papa, departamento de Godoy Cruz. T. trivittatus es dentro de nuestro país una de las especies de escorpiones con importancia médica, debido a que su veneno neurotóxico puede causar lesiones en el sistema nervioso y en algunos casos la muerte, particularmente en niños.

  16. State Bioenergy Primer: Information and Resources for States on Issues, Opportunities, and Options for Advancing Bioenergy

    Energy Technology Data Exchange (ETDEWEB)

    Byrnett, D. S.; Mulholland, D.; Zinsmeister, E.; Doris, E.; Milbrandt, A.; Robichaud. R.; Stanley, R.; Vimmerstedt, L.

    2009-09-01

    One renewable energy option that states frequently consider to meet their clean energy goals is the use of biomass resources to develop bioenergy. Bioenergy includes bioheat, biopower, biofuels, and bioproducts. This document provides an overview of biomass feedstocks, basic information about biomass conversion technologies, and a discussion of benefits and challenges of bioenergy options. The Primer includes a step-wise framework, resources, and tools for determining the availability of feedstocks, assessing potential markets for biomass, and identifying opportunities for action at the state level. Each chapter contains a list of selected resources and tools that states can use to explore topics in further detail.

  17. The compleat strategyst being a primer on the theory of games of strategy

    CERN Document Server

    Williams, J D

    1986-01-01

    When J. D. Williams wrote this entertaining, witty introduction for the nonscientist, Game Theory was still a somewhat mysterious subject familiar to very few scientists beyond those researchers, like himself, working for the military. Now, over thirty years after its original publication as a Rand Corporation research study, his light-hearted though thoroughly effective primer is the recognized classic introduction to an increasingly applicable discipline. Used by amateurs, professionals, and students throughout the world in the classroom, on the job, and for personal amusement, the book has

  18. Enhanced adhesion over aluminum solid substrates by controlled atmospheric plasma deposition of amine-rich primers.

    Science.gov (United States)

    Petersen, Julien; Fouquet, Thierry; Michel, Marc; Toniazzo, Valérie; Dinia, Aziz; Ruch, David; Bomfim, João A S

    2012-02-01

    Controlled chemical modification of aluminum surface is carried by atmospheric plasma polymerization of allylamine. The amine-rich coatings are characterized and tested for their behavior as adhesion promoter. The adhesion strength of aluminum-epoxy assemblies is shown to increase according to primary amino group content and coating thickness, which in turn can be regulated by plasma power parameters, allowing tailoring the coating chemical properties. The increase in adherence can be correlated to the total and primary amino group contents in the film, indicating covalent bonding of epoxy groups to the primer as the basis of the mechanical improvement.

  19. New PCR primers targeting hydrazine synthase and cytochrome c biogenesis proteins in anammox bacteria.

    Science.gov (United States)

    Zhou, Zhichao; Chen, Jing; Meng, Han; Dvornyk, Volodymyr; Gu, Ji-Dong

    2017-02-01

    PCR primers targeting genes encoding the two proteins of anammox bacteria, hydrazine synthase and cytochrome c biogenesis protein, were designed and tested in this study. Three different ecotypes of samples, namely ocean sediments, coastal wetland sediments, and wastewater treatment plant (WWTP) samples, were used to assess the primer efficiency and the community structures of anammox bacteria retrieved by 16S ribosomal RNA (rRNA) and the functional genes. Abundances of hzsB gene of anammox bacteria in South China Sea (SCS) samples were significantly correlated with 16S rRNA gene by qPCR method. And hzsB and hzsC gene primer pair hzsB364f-hzsB640r and hzsC745f-hzsC862r in combination with anammox bacterial 16S rRNA gene primers were recommended for quantifying anammox bacteria. Congruent with 16S rRNA gene-based community study, functional gene hzsB could also delineate the coastal-ocean distributing pattern, and seawater depth was positively associated with the diversity and abundance of anammox bacteria from shallow- to deep-sea. Both hzsC and ccsA genes could differentiate marine samples between deep and shallow groups of the Scalindua sp. clades. As for WWTP samples, non-Scalindua anammox bacteria reflected by hzsB, hzsC, ccsA, and ccsB gene-based libraries showed a similar distribution pattern with that by 16S rRNA gene. NH4(+) and NH4(+)/Σ(NO3(-) + NO2(-)) positively correlated with anammox bacteria gene diversity, but organic matter contents correlated negatively with anammox bacteria gene diversity in SCS. Salinity was positively associated with diversity indices of hzsC and ccsB gene-harboring anammox bacteria communities and could potentially differentiate the distribution patterns between shallow- and deep-sea sediment samples. SCS surface sediments harbored considerably diverse community of Scalindua. A new Mai Po clade representing coastal estuary wetland anammox bacteria group based on 16S rRNA gene phylogeny is proposed. Existence of anammox

  20. Enzyme Treatment-Free and Ligation-Independent Cloning Using Caged Primers in Polymerase Chain Reactions

    Directory of Open Access Journals (Sweden)

    Akinori Kuzuya

    2011-12-01

    Full Text Available A new simple scheme for constructing recombinant vectors that does not require any restriction enzyme, ligase, or any other special enzyme treatment has been developed. By using caged primers in PCR, unnatural sticky-ends of any sequence, which are sufficiently long for ligation-independent cloning (LIC, are directly prepared on the product after a brief UVA irradiation. Target genes and vectors amplified by this light-assisted cohesive-ending (LACE PCR join together in the desired arrangement in a simple mixture of them, tightly enough to be repaired and ligated in competent cells.

  1. Luis López-Ballesteros: primer traductor de las obras completas de Freud al castellano

    OpenAIRE

    Juan Manuel Martín Arias; Lorenzo Gallego Borghini

    2011-01-01

    El castellano fue el primer idioma al que se tradujeron las obras completas de Sigmund Freud. A ello contribuyeron diversos factores, entre los que se destaca la figura de Luis López-Ballesteros, a quien le encargó la traducción la editorial Biblioteca Nueva. En este artículo se esbozan someramente la recepción del psicoanálisis en España y las traducciones de Freud al español y se ofrece una breve semblanza de Luis López-Ballesteros. --------------------------------------------- Luis López-B...

  2. El primer caso de herejía en el Nuevo Mundo

    Directory of Open Access Journals (Sweden)

    Szászdi, István

    2001-12-01

    Full Text Available This article tries to identify the self-styled heretic from among the 39 Spaniards that remained in Fortress of Nativity when Christopher Columbus came back to Spain after his first journey to the New World.

    Intento de identificar al supuesto hereje entre los 39 españoles que se quedan en el Fuerte de la Navidad cuando Cristóbal Colón vuelve a España después de su primer viaje al Nuevo Mundo.

  3. The Use of a Combination of alkB Primers to Better Characterize the Distribution of Alkane-Degrading Bacteria.

    Directory of Open Access Journals (Sweden)

    Diogo Jurelevicius

    Full Text Available The alkane monooxygenase AlkB, which is encoded by the alkB gene, is a key enzyme involved in bacterial alkane degradation. To study the alkB gene within bacterial communities, researchers need to be aware of the variations in alkB nucleotide sequences; a failure to consider the sequence variations results in the low representation of the diversity and richness of alkane-degrading bacteria. To minimize this shortcoming, the use of a combination of three alkB-targeting primers to enhance the detection of the alkB gene in previously isolated alkane-degrading bacteria was proposed. Using this approach, alkB-related PCR products were detected in 79% of the strains tested. Furthermore, the chosen set of primers was used to study alkB richness and diversity in different soils sampled in Carmópolis, Brazil and King George Island, Antarctica. The DNA extracted from the different soils was PCR amplified with each set of alkB-targeting primers, and clone libraries were constructed, sequenced and analyzed. A total of 255 alkB phylotypes were detected. Venn diagram analyses revealed that only low numbers of alkB phylotypes were shared among the different libraries derived from each primer pair. Therefore, the combination of three alkB-targeting primers enhanced the richness of alkB phylotypes detected in the different soils by 45% to 139%, when compared to the use of a single alkB-targeting primer. In addition, a dendrogram analysis and beta diversity comparison of the alkB composition showed that each of the sampling sites studied had a particular set of alkane-degrading bacteria. The use of a combination of alkB primers was an efficient strategy for enhancing the detection of the alkB gene in cultivable bacteria and for better characterizing the distribution of alkane-degrading bacteria in different soil environments.

  4. The Use of a Combination of alkB Primers to Better Characterize the Distribution of Alkane-Degrading Bacteria

    Science.gov (United States)

    Jurelevicius, Diogo; Alvarez, Vanessa Marques; Peixoto, Raquel; Rosado, Alexandre S.; Seldin, Lucy

    2013-01-01

    The alkane monooxygenase AlkB, which is encoded by the alkB gene, is a key enzyme involved in bacterial alkane degradation. To study the alkB gene within bacterial communities, researchers need to be aware of the variations in alkB nucleotide sequences; a failure to consider the sequence variations results in the low representation of the diversity and richness of alkane-degrading bacteria. To minimize this shortcoming, the use of a combination of three alkB-targeting primers to enhance the detection of the alkB gene in previously isolated alkane-degrading bacteria was proposed. Using this approach, alkB-related PCR products were detected in 79% of the strains tested. Furthermore, the chosen set of primers was used to study alkB richness and diversity in different soils sampled in Carmópolis, Brazil and King George Island, Antarctica. The DNA extracted from the different soils was PCR amplified with each set of alkB-targeting primers, and clone libraries were constructed, sequenced and analyzed. A total of 255 alkB phylotypes were detected. Venn diagram analyses revealed that only low numbers of alkB phylotypes were shared among the different libraries derived from each primer pair. Therefore, the combination of three alkB-targeting primers enhanced the richness of alkB phylotypes detected in the different soils by 45% to 139%, when compared to the use of a single alkB-targeting primer. In addition, a dendrogram analysis and beta diversity comparison of the alkB composition showed that each of the sampling sites studied had a particular set of alkane-degrading bacteria. The use of a combination of alkB primers was an efficient strategy for enhancing the detection of the alkB gene in cultivable bacteria and for better characterizing the distribution of alkane-degrading bacteria in different soil environments. PMID:23825163

  5. Effect of silica coating combined to a MDP-based primer on the resin bond to Y-TZP ceramic.

    Science.gov (United States)

    May, Liliana Gressler; Passos, Sheila Pestana; Capelli, Diana Barca; Ozcan, Mutlu; Bottino, Marco Antonio; Valandro, Luiz Felipe

    2010-10-01

    The aim of this study was to evaluate the influence of silica coating and 10-methacryloyloxydecyl dihydrogen phosphate (MDP)-based primer applications upon the bonding durability of a MDP-based resin cement to a yttrium stabilized tetragonal zirconia (Y-TZP) ceramic. Ninety-six Y-TZP tabs were embedded in an acrylic resin (free surface for adhesion: 5 × 5 mm(2)), ground finished and randomly divided into four groups (N = 24) according to the ceramic surface conditioning: (1) cleaning with isopropanol (ALC); (2) ALC + phosphoric acid etching + MDP-based primer application (MDP-primer); (3) silica coating + 3-methacryloyloxypropyl trimethoxysilane (MPS)-based coupling agent application (SiO2 + MPS-Sil); and (4) SiO2 + MDP-primer. The MDP-based resin cement was applied on the treated surface using a cylindrical mold (diameter= 3 mm). Half of the specimens from each surface conditioning were stored in distilled water (37 °C, 24 h) before testing. Another half of the specimens were stored (90 days) and thermo-cycled (12,000 x) during this period (90 d/TC) before testing. A shear bond strength (SBS) test was performed at a crosshead speed of 0.5 mm/min. Two factors composed the experimental design: ceramic conditioning strategy (in four levels) and storage condition (in two levels), totaling eight groups. After 90 d/TC (Tukey; p MDP-primer (24.40 MPa) promoted the highest SBS. The ALC and MDP-primer groups debonded spontaneously during 90 d/TC. Bonding values were higher and more stable in the SiO2 groups. The use of MDP-primer after silica coating increased the bond strength.

  6. Design and validation of four new primers for next-generation sequencing to target the 18S rRNA genes of gastrointestinal ciliate protozoa.

    Science.gov (United States)

    Ishaq, Suzanne L; Wright, André-Denis G

    2014-09-01

    Four new primers and one published primer were used to PCR amplify hypervariable regions within the protozoal 18S rRNA gene to determine which primer pair provided the best identification and statistical analysis. PCR amplicons of 394 to 498 bases were generated from three primer sets, sequenced using Roche 454 pyrosequencing with Titanium, and analyzed using the BLAST database (NCBI) and MOTHUR version 1.29. The protozoal diversity of rumen contents from moose in Alaska was assessed. In the present study, primer set 1, P-SSU-316F and GIC758R (amplicon of 482 bases), gave the best representation of diversity using BLAST classification, and the set amplified Entodinium simplex and Ostracodinium spp., which were not amplified by the other two primer sets. Primer set 2, GIC1080F and GIC1578R (amplicon of 498 bases), had similar BLAST results and a slightly higher percentage of sequences that were identified with a higher sequence identity. Primer sets 1 and 2 are recommended for use in ruminants. However, primer set 1 may be inadequate to determine protozoal diversity in nonruminants. The amplicons created by primer set 1 were indistinguishable for certain species within the genera Bandia, Blepharocorys, Polycosta, and Tetratoxum and between Hemiprorodon gymnoprosthium and Prorodonopsis coli, none of which are normally found in the rumen.

  7. MRPrimerW: a tool for rapid design of valid high-quality primers for multiple target qPCR experiments.

    Science.gov (United States)

    Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo

    2016-07-08

    Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com.

  8. Evaluation of PCR primer selectivity and phylogenetic specificity by using amplification of 16S rRNA genes from betaproteobacterial ammonia-oxidizing bacteria in environmental samples.

    Science.gov (United States)

    Junier, Pilar; Kim, Ok-Sun; Hadas, Ora; Imhoff, Johannes F; Witzel, Karl-Paul

    2008-08-01

    The effect of primer specificity for studying the diversity of ammonia-oxidizing betaproteobacteria (betaAOB) was evaluated. betaAOB represent a group of phylogenetically related organisms for which the 16S rRNA gene approach is especially suitable. We used experimental comparisons of primer performance with water samples, together with an in silico analysis of published sequences and a literature review of clone libraries made with four specific PCR primers for the betaAOB 16S rRNA gene. With four aquatic samples, the primers NitA/NitB produced the highest frequency of ammonia-oxidizing-bacterium-like sequences compared to clone libraries with products amplified with the primer combinations betaAMOf/betaAMOr, betaAMOf/Nso1255g, and NitA/Nso1225g. Both the experimental examination of ammonia-oxidizing-bacterium-specific 16S rRNA gene primers and the literature search showed that neither specificity nor sensitivity of primer combinations can be evaluated reliably only by sequence comparison. Apparently, the combination of sequence comparison and experimental data is the best approach to detect possible biases of PCR primers. Although this study focused on betaAOB, the results presented here more generally exemplify the importance of primer selection and potential primer bias when analyzing microbial communities in environmental samples.

  9. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong

    2009-10-09

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

  10. Conserved PCR primer set designing for closely-related species to complete mitochondrial genome sequencing using a sliding window-based PSO algorithm.

    Directory of Open Access Journals (Sweden)

    Cheng-Hong Yang

    Full Text Available BACKGROUND: Complete mitochondrial (mt genome sequencing is becoming increasingly common for phylogenetic reconstruction and as a model for genome evolution. For long template sequencing, i.e., like the entire mtDNA, it is essential to design primers for Polymerase Chain Reaction (PCR amplicons which are partly overlapping each other. The presented chromosome walking strategy provides the overlapping design to solve the problem for unreliable sequencing data at the 5' end and provides the effective sequencing. However, current algorithms and tools are mostly focused on the primer design for a local region in the genomic sequence. Accordingly, it is still challenging to provide the primer sets for the entire mtDNA. METHODOLOGY/PRINCIPAL FINDINGS: The purpose of this study is to develop an integrated primer design algorithm for entire mt genome in general, and for the common primer sets for closely-related species in particular. We introduce ClustalW to generate the multiple sequence alignment needed to find the conserved sequences in closely-related species. These conserved sequences are suitable for designing the common primers for the entire mtDNA. Using a heuristic algorithm particle swarm optimization (PSO, all the designed primers were computationally validated to fit the common primer design constraints, such as the melting temperature, primer length and GC content, PCR product length, secondary structure, specificity, and terminal limitation. The overlap requirement for PCR amplicons in the entire mtDNA is satisfied by defining the overlapping region with the sliding window technology. Finally, primer sets were designed within the overlapping region. The primer sets for the entire mtDNA sequences were successfully demonstrated in the example of two closely-related fish species. The pseudo code for the primer design algorithm is provided. CONCLUSIONS/SIGNIFICANCE: In conclusion, it can be said that our proposed sliding window-based PSO

  11. Alanylated lipoteichoic acid primer in Bacillus subtilis [version 2; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Yu Luo

    2016-04-01

    Full Text Available Lipoteichoic acid is a major lipid-anchored polymer in Gram-positive bacteria such as Bacillus subtilis. This polymer typically consists of repeating phosphate-containing units and therefore has a predominant negative charge. The repeating units are attached to a glycolipid anchor which has a diacylglycerol (DAG moiety attached to a dihexopyranose head group. D-alanylation is known as the major modification of type I and type IV lipoteichoic acids, which partially neutralizes the polymer and plays important roles in bacterial survival and resistance to the host immune system. The biosynthesis pathways of the glycolipid anchor and lipoteichoic acid have been fully characterized. However, the exact mechanism of D-alanyl transfer from the cytosol to cell surface lipoteichoic acid remains unclear. Here I report the use of mass spectrometry in the identification of possible intermediate species in the biosynthesis and D-alanylation of lipoteichoic acid: the glycolipid anchor, nascent lipoteichoic acid primer with one phosphoglycerol unit, as well as mono- and di-alanylated forms of the lipoteichoic acid primer. Monitoring these species as well as the recently reported D-alanyl-phosphatidyl glycerol should aid in shedding light on the mechanism of the D-alanylation pathway of lipoteichoic acid.

  12. Primer hallazgo de Aedes albopictus Skuse en el Gran Área Metropolitana de Costa Rica

    Directory of Open Access Journals (Sweden)

    Rodrigo Marín Rodríguez

    2014-06-01

    Full Text Available Objetivo: Informar sobre el primer hallazgo de Aedes albopictus en el Gran Área Metropolitana de Costa Rica. Métodos: Formas inmaduras de mosquitos colectadas en la Ciudadela La Carpio, Distrito Uruca, San José, como parte de una barrida epidemiológica fueron diagnosticadas preliminarmente como Ae. albopictus. Dicho material se fijó en alcohol al 70 %, se aclaró en lactofenol y se evaluó taxonómicamente mediante claves dicotómicas especializadas. Resultados: Las formas inmaduras evaluadas procedieron de dos criaderos, un tarro y un balde. Las características de las larvas y pupas permitieron identificarlas taxonómicamente como Ae. albopictus. Este es el primer reporte sobre la presencia de dicho vector en Costa Rica. Discusión: La presencia de Ae. albopictus en la Gran Área Metropolitana ocurre como parte del proceso de expansión que está teniendo dicho vector por el territorio nacional. Su presencia debe ser motivo de estudio para determinar su eventual papel en la transmisión del dengue. Por otro lado la presencia de este vector complica la gestión de la vigilancia entomológica de dengue que ha estado dirigida fundamentalmente a la identificación y control del Aedes aegypti.

  13. Optimal time of soybean seed priming and primer effect under salt stress conditions

    Directory of Open Access Journals (Sweden)

    Miladinov Zlatica J.

    2015-01-01

    Full Text Available The aim of this study was to examine optimal time of soybean seed priming and effect of primers under salt stress conditions. Testing was performed at the Institute of Field and Vegetable Crops, Novi Sad, on Galina seed variety. Optimal priming time was determined by immersing seed into: KNO3 (1%, H2O2 (0.1%, and H2O with the duration of 6 h, 12 h, 18 h, and 24 h. After drying until the initial moisture, the seed was placed for germination and after eight days germination was determined. In the second part of the experiment, the seed was immersed into: KNO3 (1%, H2O2 (0,1%, and H2O after which their effect on germination energy and seed germination under simulated salinity conditions was examined. Simulated salinity conditions represented substrate for germination to which NaCl in different concentrations was added (0, 50, 100, 150, 200 mM. Results of the research showed that the six-hour priming of seed was the best with all primers. The percentage of seed germination linearly reduced with the increase of priming time. The research has shown that seed priming represents a favorable technique for the reduction of a negative effect of NaCl on germination energy and soybean seed germination, and the best effect is accomplished with the use of KNO3.

  14. Removal of PCR error products and unincorporated primers by metal-chelate affinity chromatography.

    Directory of Open Access Journals (Sweden)

    Indhu Kanakaraj

    Full Text Available Immobilized Metal Affinity Chromatography (IMAC has been used for decades to purify proteins on the basis of amino acid content, especially surface-exposed histidines and "histidine tags" genetically added to recombinant proteins. We and others have extended the use of IMAC to purification of nucleic acids via interactions with the nucleotide bases, especially purines, of single-stranded RNA and DNA. We also have demonstrated the purification of plasmid DNA from contaminating genomic DNA by IMAC capture of selectively-denatured genomic DNA. Here we describe an efficient method of purifying PCR products by specifically removing error products, excess primers, and unincorporated dNTPs from PCR product mixtures using flow-through metal-chelate affinity adsorption. By flowing a PCR product mixture through a Cu(2+-iminodiacetic acid (IDA agarose spin column, 94-99% of the dNTPs and nearly all the primers can be removed. Many of the error products commonly formed by Taq polymerase also are removed. Sequencing of the IMAC-processed PCR product gave base-calling accuracy comparable to that obtained with a commercial PCR product purification method. The results show that IMAC matrices (specifically Cu(2+-IDA agarose can be used for the purification of PCR products. Due to the generality of the base-specific mechanism of adsorption, IMAC matrices may also be used in the purification of oligonucleotides, cDNA, mRNA and micro RNAs.

  15. THE PRIMER EXTENSION TECHNIQUE FOR THE POLYMORPHISM DETECTION AT OVINE PRN-P LOCUS

    Directory of Open Access Journals (Sweden)

    COSIER VIORICA

    2008-01-01

    Full Text Available Scrapie is a prionic illness with endemic character in many parts of the glob, and the control measuresis difficult to apply because of the long incubation period, the lack of the preclinical manifestation andthe existing tests for diagnostic in living animals. The Ppn-p locus is polymorphic with knownvariability at codon 136, 154, 171, which are associated with different sensibility in experimental andnatural spongiform encephalopaties. General the possible combinations of the 5 amino acids encodedby the 3 different codons will determine the existence of 15 possible genotypes. To put in evidencethose polymorphisms at the ovine Prn-p locus, several methods are developed but the most accurateassay is the direct sequencing of the gene and the primer extension technique. The purpose of thisstudy was to determine the genotypes at Prp locus in 123 male of Tsurcana breed, Hateg ecotype,using primer extension technique (ABI 3130xl Genetic Analyzer and to establish the risk groups of thesusceptibility at scrapie disease.

  16. Cuidado popular de familias con un adulto mayor sobreviviente del primer accidente cerebrovascular

    Directory of Open Access Journals (Sweden)

    Lucero López-Díaz

    2016-01-01

    Full Text Available Introducción: el accidente cerebrovascular afecta a numerosas personas en el mundo y se constituye en la principal causa de muer- te. Los sobrevivientes pueden padecer discapacidad y sufrir modificaciones en las actividades cotidianas. La familia es el principal apoyo del sobreviviente y al ser parte de una misma cultura, construye acciones de cuidado en búsqueda del bienestar. Objetivo: describir las acciones del cuidado popular de las familias con un adulto mayor sobreviviente del primer accidente cerebrovascular. Método: estudio etnográfico, con observación participante y entrevistas en profundidad. Participaron siete familias bogotanas (siete adultos mayores entre los dos y diez meses posteriores al primer accidente cerebrovascular y los siete cuidadores principales respectivos. Resultados: cuidadores y adulto mayor comparten acciones de cuidado para la recuperación, relacionadas con la alimentación, el cuidado personal y la ingesta de medicamentos permeadas por la creencia religiosa, fuente de soporte y vínculo afectivo. Conclusión: conocer el cuidado popular de esta población posibilita proponer acciones culturalmente congruentes con sus valores y creencias para potencializar las ca- pacidades familiares e intermediar en los procesos de tratamiento.

  17. THE PRIMER EXTENSION TECHNIQUE FOR THE POLYMORPHISM DETECTION AT OVINE PRN-P LOCUS

    Directory of Open Access Journals (Sweden)

    VIORICA COSIER

    2013-12-01

    Full Text Available Scrapie is a prionic illness with endemic character in many parts of the glob, and the control measures is difficult to apply because of the long incubation period, the lack of the preclinical manifestation and the existing tests for diagnostic in living animals. The Ppn-p locus is polymorphic with known variability at codon 136, 154, 171, which are associated with different sensibility in experimental and natural spongiform encephalopaties. General the possible combinations of the 5 amino acids encoded by the 3 different codons will determine the existence of 15 possible genotypes. To put in evidence those polymorphisms at the ovine Prn-p locus, several methods are developed but the most accurate assay is the direct sequencing of the gene and the primer extension technique. The purpose of this study was to determine the genotypes at Prp locus in 123 male of Tsurcana breed, Hateg ecotype, using primer extension technique (ABI 3130xl Genetic Analyzer and to establish the risk groups of the susceptibility at scrapie disease.

  18. Simple Heat Treatment of Zirconia Ceramic Pre-Treated with Silane Primer to Improve Resin Bonding.

    Science.gov (United States)

    Ha, Jung-Yun; Son, Jun Sik; Kim, Kyo-Han; Kwon, Tae-Yub

    2015-01-01

    Establishing a strong resin bond to dental zirconia ceramic remains difficult. Previous studies have shown that the conventional application of silane does not work well with zirconia. This paper reports that a silane pre-treatment of dental zirconia ceramic combined with subsequent heat treatment has potential as an adhesive cementation protocol for improving zirconia-resin bonding. Among the various concentrations (0.1 to 16 vol%) of experimental γ-methacryloxypropyltrimethoxysilane (γ-MPTS) primers assessed, the 1% solution was found to be the most effective in terms of the shear bond strength of the resin cement to dental zirconia ceramic. A high shear bond strength (approx. 30 MPa) was obtained when zirconia specimens were pre-treated with this primer and then heat-treated in a furnace for 60 min at 150 degrees C. Heat treatment appeared to remove the hydrophilic constituents from the silane film formed on the zirconia ceramic surface and accelerate the condensation reactions between the silanol groups of the hydrolyzed silane molecules at the zirconia/resin interface, finally making a more desirable surface for bonding with resin. This estimation was supported by Fourier transform infrared spectroscopy of the silanes prepared in this study.

  19. Por mano propia. La justicia policial de la provincia de Buenos Aires en el primer peronismo

    Directory of Open Access Journals (Sweden)

    Osvaldo Barreneche

    2009-11-01

    Full Text Available La sanción del Código Penal Policial fue una pieza importante en el andamiaje jurídico por el cual el primer gobierno peronista procuró afianzar la profesionalización y disciplinamiento de las fuerzas de seguridad en las distintas jurisdicciones del país. Así, se organizó y se puso en marcha una nueva rama de la justicia bonaerense, paralela a la ordinaria, integrada completamente por policías retirados y en actividad, que se ocupó de los casos penales donde estuviesen implicados uno o más policías. Este trabajo analiza dicha experiencia, basándose en los casos sumariados y resueltos por la Justicia Policial mientras existió. En primer lugar se pone en contexto los fundamentos y propósitos que guiaron al peronismo para impulsar una justicia 'uniformada' que se ocupase de los excesos y falta a los deberes de los funcionarios policiales a nivel penal y administrativo. Luego se estudia su aplicación concreta en la provincia de Buenos Aires, indagando sobre los casos juzgados, su tratamiento, los actores, los fallos y los fines políticos perseguidos por esta justicia por y para policías

  20. Evaluation of Different Primers for Detection of Brucella by Using PCR Method

    Science.gov (United States)

    Moulana, Zahra; Roushan, Mohammad Reza Hasanjani; Marashi, Seyed Mahmoud Amin

    2016-01-01

    Introduction Brucellosis is a worldwide zoonosis and a significant cause of loss of health in humans and animals. Traditionally, classic diagnosis is carried out by isolation of Brucella, which is time-consuming, technically challenging and potentially dangerous. The aim of this study was to expand a molecular test that would be used for the develop detection of Brucella in a single reaction with high sensitivity and specificity, by targeting IS711element. Methods This study was carried out from 2015 to 2016 at the Ayatolla Rohani hospital in Babol, Iran. The present study was designed to develop PCR assay, based on IS711 gene for rapid diagnosis of Brucella spp. and immediate detection of Brucella, with high sensitivity and specificity. Four pairs of oligo-nucleotide primers with sizes of 547, 403, 291 and 127bp respectively, were planned to exclusively amplify the targeted genes of Brucella species. Results Our results show that, five PCR primers set up, would be helpful in amplifying the DNAs from the genus Brucella with high specificity and sensitivity so it can be 12 fg, for Brucella species to provide a valuable tool for diagnosis. Conclusion This method can be more useful than serological and biochemical tests and in addition, this reduces the number of required tests more rapidly and economically. PMID:28070255

  1. El Primer Congreso Interamericano de Psicología (1953: su acontecer histórico

    Directory of Open Access Journals (Sweden)

    Miguel Gallegos

    2012-01-01

    Full Text Available Este trabajo presenta una revisión histórica del Primer Congreso Interamericano de Psicología, realizado en República Dominicana, en 1953. Tal congreso fue organizado por la Sociedad Interamericana de Psicología, constituida en 1951. Desde su creación, esta institución ha promovido innumerables congresos científicos, así como diversas publicaciones y acciones de difusión y acercamiento entre los psicólogos de las Américas. El objetivo de este trabajo es recuperar el acontecer histórico de aquella primera organización científica concretada por la Sociedad Interamericana de Psicología. Metodológicamente se plantea un análisis bibliométrico de las Actas del Primer Congreso Interamericano de Psicología y se recuperan diversas fuentes documentales de primera y segunda mano. Básicamente se ofrece un panorama de las gestiones antecedentes a la realización del evento, las motivaciones que llevaron a la organización del mismo, la elección de la sede del congreso, el temario sugerido originalmente y el efectivamente desarrollado, la nómina de invitados, las actividades académicas y recreativas desarrolladas, entre otras cosas.

  2. New primer for specific amplification of the CAG repeat in Huntington disease alleles

    Energy Technology Data Exchange (ETDEWEB)

    Bond, C.E.; Hodes, M.E. [Indiana Univ. School of Medicine, Indianapolis (United States)

    1994-09-01

    Huntington disease is an autosomal dominant neurodegenerative disorder caused by an expansion of a CAG trinucleotide repeat near the 5{prime} end of the gene for Huntington disease (IT15). The CAG repeat is flanked by a variable-length CCG repeat that is included in the amplification product obtained with most currently used primer sets and PCR protocols. Inclusion of this adjacent CCG repeat complicates the accurate assessment of CAG repeat length and interferes with the genotype determination of those individuals carrying alleles in the intermediate range between normal and expanded sized. Due to the GC-rich nature of this region, attempts at designing a protocol for amplification of only the CAG repeat have proved unreliable and difficult to execute. We report here the development of a compatible primer set and PCR protocol that yields consistent amplification of the CAG-repeat region. PCR products can be visualized in ethidium bromide-stained agarose gels for rapid screening or in 6% polyacrylamide gels for determination of exact repeat length. This assay produces bands that can be sized accurately, while eliminating most nonspecific products. Fifty-five specimens examined showed consistency with another well-known method, but one that amplifies the CCG repeats as well. The results we obtained also matched the known carrier status of the donors.

  3. Electrochemical performance of a localized repair. Effect of applying a primer and a bonding membrane

    Directory of Open Access Journals (Sweden)

    Castro-Borges, P.

    2003-12-01

    Full Text Available It is customary, in the constructions at the North of Yucatán, to employ primers to the rebars as a repair method in reinforced concrete, it has been observed in the literature that using primers alone presents an electrochemical behaviour still under discussion. Under these circumstances, several investigations have focused on the evaluation of the factor against or in favour of using primers as a repair method in a tropical marine environment. In this paper, the effects of applying a bonding membrane and the galvanic effect generated by the repair are also discussed. Small reinforced concrete columns were prepared and exposed under accelerated degradation cycles. After the activation of the rebars, the columns were repaired applying three types of primers, leaving one bar as control. After curing, the columns were exposed again to the same environment and their electrochemical behaviour was monitored. Corrosion potentials, polarization resistance, carbonation and chloride content were measured as a function of time. Conclusions suggest that the bonding membrane reduces the corrosion rates for the conditions and exposure time studied. The galvanic effect was observed after repairing the columns with and without bonding membrane, but with a tendency to reduce with time. The primers applied helped to reduce the galvanic effect of the repair, and to increase the polarization resistance.

    En las construcciones del norte de Yucatán se emplean, por costumbre, las imprimaciones al refuerzo como método de reparación al hormigón armado. Se ha observado en la literatura que la utilización sólo de imprimaciones presenta un comportamiento electroquímico, motivo éste, aún, de amplia discusión. Ante estas situaciones se llevaron a cabo varias investigaciones que tienen como objetivo la evaluación de las situaciones que favorezcan o no la utilización de las imprimaciones como método de reparación en un ambiente tropical marino. En este

  4. PERKEMBANGAN KOLONI PRIMER EMBRYONIC STEM CELL (ESC MENCIT PASCA VITRIFIKASI INNER CELL MASS (ICM

    Directory of Open Access Journals (Sweden)

    Ratih Rinendyaputri

    2013-11-01

    Full Text Available Abstract Application or the basic research of the stem cells is continously conducted to explore their potential, particularly the use of stem cells in health. Cryopreservation technology is needed to maintain availability of stem cell. This study was  aimed to observe the development of murine embryonic stem cell (ESC primary colonies post-vitrified inner cell mass (ICM. Inner cell mass (ICM was derived from blastocysts of murine embryos of female Swiss webster mice using pregnant mare’s serum gonadotropin (PMSG and human chorionic gonadotropin (hCG. Inner Cell Mass (ICM was isolated  from blastocysts by immunosurgery. Inner Cell Mass (ICM were divided into two groups: the control and vitrified ICM. Both groups were cultured and observed on the ICM attachment (attachment rate/AR, the primary formation of ESC colonies (primary colony/PC and  diameter of primary colony ESC which grouped into small, medium and large. The results showed that AR and medium diameter’s group of primary colony ESC were lower (p<0.05 in vitrified ICM than control ICM. However the percentage of PC and diameter of primary colonies ESC in small and large groups were not different compared with control (p>0.05. This study shows that vitrification for cryopreserving ICM can be used as an alternative source of ESC. Key words: blastocyst, inner cell mass, ICM, vitrification Abstrak  Submit : 30-01-2013  Review : 08-02-2013 Review : 11-03-2013 revisi : 26–03-2013 Aplikasi maupun penelitian dasar untuk menggali potensi sel punca khususnya pemanfaatan sel punca di bidang kesehatan terus dilakukan. Teknologi kriopreservasi dibutuhkan untuk menjaga ketersediaan sel punca. Penelitian ini bertujuan mengamati perkembangan koloni primer embryonic stem cell (ESC mencit pasca vitrifikasi inner cell mass (ICM. Inner Cell Mass (ICM diperoleh dari embrio blastosis mencit betina Swis webster menggunakan pregnant mare’s serum gonadotropin (PMSG dan human chorionic gonadotropin (h

  5. GPUDePiCt: A Parallel Implementation of a Clustering Algorithm for Computing Degenerate Primers on Graphics Processing Units.

    Science.gov (United States)

    Cickovski, Trevor; Flor, Tiffany; Irving-Sachs, Galen; Novikov, Philip; Parda, James; Narasimhan, Giri

    2015-01-01

    In order to make multiple copies of a target sequence in the laboratory, the technique of Polymerase Chain Reaction (PCR) requires the design of "primers", which are short fragments of nucleotides complementary to the flanking regions of the target sequence. If the same primer is to amplify multiple closely related target sequences, then it is necessary to make the primers "degenerate", which would allow it to hybridize to target sequences with a limited amount of variability that may have been caused by mutations. However, the PCR technique can only allow a limited amount of degeneracy, and therefore the design of degenerate primers requires the identification of reasonably well-conserved regions in the input sequences. We take an existing algorithm for designing degenerate primers that is based on clustering and parallelize it in a web-accessible software package GPUDePiCt, using a shared memory model and the computing power of Graphics Processing Units (GPUs). We test our implementation on large sets of aligned sequences from the human genome and show a multi-fold speedup for clustering using our hybrid GPU/CPU implementation over a pure CPU approach for these sequences, which consist of more than 7,500 nucleotides. We also demonstrate that this speedup is consistent over larger numbers and longer lengths of aligned sequences.

  6. An electrochemical study of corrosion protection by primer-topcoat systems on 4130 steel with ac impedance and dc methods

    Science.gov (United States)

    Mendrek, M. J.; Higgins, R. H.; Danford, M. D.

    1988-01-01

    To investigate metal surface corrosion and the breakdown of metal protective coatings, the ac impedance method is applied to six systems of primer coated and primer topcoated 4130 steel. Two primers were used: a zinc-rich epoxy primer and a red lead oxide epoxy primer. The epoxy-polyamine topcoat was used in four of the systems. The EG and G-PARC Model 368 ac impedance measurement system, along with dc measurements with the same system using the polarization resistance method, were used to monitor changing properties of coated 4230 steel disks immersed in 3.5 percent NaCl solutions buffered at pH 5.4 over periods of 40 to 60 days. The corrosion system can be represented by an electronic analog called an equivalent circuit consisting of resistors and capacitors in specific arrangements. This equivalent circuit parallels the impedance behavior of the corrosion system during a frequency scan. Values for the resistors and capacitors, that can be assigned in the equivalent circuit following a least-squares analysis of the data, describe changes that occur on the corroding metal surface and in the protective coatings. Two equivalent circuits have been determined that predict the correct Bode phase and magnitude of the experimental sample at different immersion times. The dc corrosion current density data are related to equivalent circuit element parameters. Methods for determining corrosion rate with ac impedance parameters are verified by the dc method.

  7. Effect of thione primers on adhesive bonding between an indirect composite material and Ag-Pd-Cu-Au alloy.

    Science.gov (United States)

    Imai, Hideyuki; Koizumi, Hiroyasu; Shimoe, Saiji; Hirata, Isao; Matsumura, Hideo; Nikawa, Hiroki

    2014-01-01

    The current study evaluated the effect of primers on the shear bond strength of an indirect composite material joined to a silverpalladium-copper-gold (Ag-Pd-Cu-Au) alloy (Castwell). Disk specimens were cast from the alloy and were air-abraded with alumina. Eight metal primers were applied to the alloy surface. A light-polymerized indirect composite material (Solidex) was bonded to the alloy. Shear bond strength was determined both before and after the application of thermocycling. Two groups primed with Metaltite (thione) and M. L. Primer (sulfide) showed the greatest post-thermocycling bond strength (8.8 and 6.5 MPa). The results of the X-ray photoelectron spectroscopic (XPS) analysis suggested that the thione monomer (MTU-6) in the Metaltite primer was strongly adsorbed onto the Ag-Pd-Cu-Au alloy surface even after repeated cleaning with acetone. The application of either the thione (MTU-6) or sulfide primer is effective for enhancing the bonding between a composite material and Ag-Pd-Cu-Au alloy.

  8. Molecular Basis for DNA Double-Strand Break Annealing and Primer Extension by an NHEJ DNA Polymerase

    Directory of Open Access Journals (Sweden)

    Nigel C. Brissett

    2013-11-01

    Full Text Available Nonhomologous end-joining (NHEJ is one of the major DNA double-strand break (DSB repair pathways. The mechanisms by which breaks are competently brought together and extended during NHEJ is poorly understood. As polymerases extend DNA in a 5′-3′ direction by nucleotide addition to a primer, it is unclear how NHEJ polymerases fill in break termini containing 3′ overhangs that lack a primer strand. Here, we describe, at the molecular level, how prokaryotic NHEJ polymerases configure a primer-template substrate by annealing the 3′ overhanging strands from opposing breaks, forming a gapped intermediate that can be extended in trans. We identify structural elements that facilitate docking of the 3′ ends in the active sites of adjacent polymerases and reveal how the termini act as primers for extension of the annealed break, thus explaining how such DSBs are extended in trans. This study clarifies how polymerases couple break-synapsis to catalysis, providing a molecular mechanism to explain how primer extension is achieved on DNA breaks.

  9. Research on Pump Primers for Friction Reduction of Wet-Mix Shotcrete Based on Precreating Lubricating Layer

    Directory of Open Access Journals (Sweden)

    Guoming Liu

    2017-01-01

    Full Text Available Wet-mix shotcrete has lower water content even though looking wet which is generally less than 8% of total content. The inner surface of pipes will absorb water from fresh concrete to wet itself if concrete pump primers is not pumped early; meanwhile, the saturated concrete is transformed into the unsaturated concrete, and pipe blockage often occurs. In order to minimize the loss of water and wet pipes, a new type of pump primers was developed to precreate the lubricating layer that is one of the most dominant factors in determining the pumping capability, which would provide a cost-effective replacement for premium priced cement-based primers. Experiments were conducted to measure the viscosity, stability, and strength of mix solution during development stage. The optimal formula was obtained by orthogonal matching tests with 0.5% sodium stearate, 0.75% xanthan gum, 0.3% polyacrylamide, and 0.4% blender (mass ratio related to mix water. The pressure drop reduction of new primers was larger than that of common primers.

  10. Application of Single—labelled Probe—primer in PCR Amplification to the Detection of Hepatitis B Virus DNA

    Institute of Scientific and Technical Information of China (English)

    KONG,De-Ming; SHEN,Han-Xi

    2003-01-01

    A new method based on the incorporation of a single-lablled probe-primer into polymerase chain reaction(PCR) for the detection of PCR-amplified DNA in a closed system is reported.The probeprimerc consists of a specific probe sequence on the 5''''''''-end and a primer sequence on the 3''''''''-end.A flurophore is located at the 5''''''''end.The primeR-quencher is an oligonucleotide,which is complementary to the probe sequence of probe-primer and labelled with a quencher at the 3''''''''-end.In the duplex formed by probe-primer and primer-quencher.the fluorophore and quencher are kept in close proximity to each other.Therefore the fluorescence is quenched.During PCR amplificatio,the specific probe sequence of probeprimer binds to its complement within the same strand of DNA,and is cleaved by Taq DNA polymerase,resulting in the restoration of fluorescence.This system has the same energy transfer mechanism as molecular beacons,and a good quenching effciency can be ensured.Following optimization of PCR conditions,this method was used to detect hepatitis b virus(HBV) dna in patient sera.This technology eliminates the risk of carry-over contamination,simplifies the amplification assay and opens up new possibilities for the real-time detection of the amplified DNA.

  11. Designing, optimization and validation of tetra-primer ARMS PCR protocol for genotyping mutations in caprine Fec genes.

    Science.gov (United States)

    Ahlawat, Sonika; Sharma, Rekha; Maitra, A; Roy, Manoranjan; Tantia, M S

    2014-12-01

    New, quick, and inexpensive methods for genotyping novel caprine Fec gene polymorphisms through tetra-primer ARMS PCR were developed in the present investigation. Single nucleotide polymorphism (SNP) genotyping needs to be attempted to establish association between the identified mutations and traits of economic importance. In the current study, we have successfully genotyped three new SNPs identified in caprine fecundity genes viz. T(-242)C (BMPR1B), G1189A (GDF9) and G735A (BMP15). Tetra-primer ARMS PCR protocol was optimized and validated for these SNPs with short turn-around time and costs. The optimized techniques were tested on 158 random samples of Black Bengal goat breed. Samples with known genotypes for the described genes, previously tested in duplicate using the sequencing methods, were employed for validation of the assay. Upon validation, complete concordance was observed between the tetra-primer ARMS PCR assays and the sequencing results. These results highlight the ability of tetra-primer ARMS PCR in genotyping of mutations in Fec genes. Any associated SNP could be used to accelerate the improvement of goat reproductive traits by identifying high prolific animals at an early stage of life. Our results provide direct evidence that tetra-primer ARMS-PCR is a rapid, reliable, and cost-effective method for SNP genotyping of mutations in caprine Fec genes.

  12. Designing, optimization and validation of tetra-primer ARMS PCR protocol for genotyping mutations in caprine Fec genes

    Directory of Open Access Journals (Sweden)

    Sonika Ahlawat

    2014-12-01

    Full Text Available New, quick, and inexpensive methods for genotyping novel caprine Fec gene polymorphisms through tetra-primer ARMS PCR were developed in the present investigation. Single nucleotide polymorphism (SNP genotyping needs to be attempted to establish association between the identified mutations and traits of economic importance. In the current study, we have successfully genotyped three new SNPs identified in caprine fecundity genes viz. T(-242C (BMPR1B, G1189A (GDF9 and G735A (BMP15. Tetra-primer ARMS PCR protocol was optimized and validated for these SNPs with short turn-around time and costs. The optimized techniques were tested on 158 random samples of Black Bengal goat breed. Samples with known genotypes for the described genes, previously tested in duplicate using the sequencing methods, were employed for validation of the assay. Upon validation, complete concordance was observed between the tetra-primer ARMS PCR assays and the sequencing results. These results highlight the ability of tetra-primer ARMS PCR in genotyping of mutations in Fec genes. Any associated SNP could be used to accelerate the improvement of goat reproductive traits by identifying high prolific animals at an early stage of life. Our results provide direct evidence that tetra-primer ARMS-PCR is a rapid, reliable, and cost-effective method for SNP genotyping of mutations in caprine Fec genes.

  13. Multiplex PCR using conserved and species-specific 16S rRNA gene primers for simultaneous detection of Actinobacillus actinomycetemcomitans and Porphyromonas gingivalis.

    OpenAIRE

    Tran, S D; Rudney, J. D.

    1996-01-01

    Actinobacillus actinomycetemcomitans and Porphyromonas gingivalis are strongly associated with periodontitis. However, little is known about their distribution in periodontally healthy individuals, because culturing techniques are not sufficiently sensitive. A modified multiplex PCR was developed to address that question. Our method uses two species-specific forward primers in combination with a single reverse primer. These primers target variable and conserved regions of the 16S rRNA gene. S...

  14. Quantification of Porphyromonas gingivalis by real time PCR : new primers targeting the rgpA and rgpB gene encoding RGP

    OpenAIRE

    KAMAGUCHI,Arihide/NAKAMURA,Reiko/WATANABE,Toshihiro/OHYAMA,Tohru/BABA,Hisae

    2003-01-01

    We designed new primers for the quantification of Porphyromonas gingivalis by real time PCR. The new primer set targeted the rgpA and rgpB genes that encode arginine specific cysteine proteinase (Arggingipain or Rgp), one of the putative pathogenic factors of P. gingivalis. The PCR product obtained using our primers showed no by-products by melting curve analysis. The PCR product sequence showed no significant matches to other sequences by BLAST searching of genetic databases except for match...

  15. Mitochondrial D-loop "signatures" produced by low-stringency single specific primer PCR constitute a simple comparative human identity test.

    OpenAIRE

    Barreto, G.; Vago, A. R.; Ginther, C; Simpson, A J; Pena, S D

    1996-01-01

    We have developed a technique called "LSSP-PCR" (low-stringency single specific primer PCR) that detects single or multiple mutations in DNA. A purified DNA fragment is submitted to PCR by using a single primer specific for one of the extremities of the fragment, under conditions of very low stringency. The primer hybridizes specifically to its complementary extremity and nonspecifically to multiple sites within the fragment, in a sequence-dependent manner. A complex set of reaction products ...

  16. Back to Basics – The Influence of DNA Extraction and Primer Choice on Phylogenetic Analysis of Activated Sludge Communities

    DEFF Research Database (Denmark)

    Albertsen, Mads; Karst, Søren Michael; Ziegler, Anja Sloth

    2015-01-01

    DNA extraction and primer choice have a large effect on the observed community structure in allmicrobial amplicon sequencing analyses. Although the biases are well known, no com- prehensive analysis has been conducted in activated sludge communities. In this study we systematically explored...... and metatranscriptomics. Quantitative fluorescence in situ hybridization was used as a DNA extraction-independent method for qualitative comparison. In general, an effect on the observed community was found on all parameters tested, although bead beating and primer choice had the largest effect. The effect of bead...... the impact of a number of parameters on the observed microbial community: bead beating intensity, primer choice, extracellular DNA removal, and various PCR settings. In total, 176 samples were subjected to 16S rRNA amplicon sequencing, and selected samples were investigated throughmetagenomics...

  17. Back to basics – the influence of DNA extraction and primer choice on phylogenetic analysis in activated sludge communities

    DEFF Research Database (Denmark)

    Albertsen, Mads; Karst, Søren Michael; Ziegler, Anja Sloth

    DNA extraction and primer choice have a large effect on the observed community structure in all phylogenetic analyses. Although the biases are well known, no comprehensive analysis have been conducted in activated sludge communities. In this study we investigated the effect of bead beating...... intensity and primer choice on the observed community using 16S rDNA amplicon sequencing. Quantitative fluorescence in situ hybridization (qFISH) was used as a DNA extraction independent method to evaluate the results. The bead beating intensity correlated with cell-wall strength and showed...... that the manufacture recommended settings were insufficient to retrieve a large part of the community. In addition, the in silico “best” primer set was found to greatly underestimate a number of important phyla when compared to qFISH results. The findings underline the need for sample specific and DNA extraction...

  18. Nuclear microsatellite primers for the endangered relict fir, Abies pinsapo (Pinaceae) and cross-amplification in related Mediterranean Species.

    Science.gov (United States)

    Sánchez-Robles, Jose M; Balao, Francisco; García-Castaño, Juan L; Terrab, Anass; Navarro-Sampedro, Laura; Talavera, Salvador

    2012-11-05

    Twelve nuclear microsatellite primers (nSSR) were developed for the endangered species Abies pinsapo Boiss. to enable the study of gene flow and genetic structure in the remaining distribution areas. Microsatellite primers were developed using next-generation sequencing (454) data from a single Abies pinsapo individual. Primers were applied to thirty individuals from the three extant localities. The number of alleles per locus ranged from one to four. Cross-amplification was tested for other Abies species from the Mediterranean Basin, and most of the loci showed higher polymorphisms in the Mediterranean species than in A. pinsapo. These microsatellite markers provide tools for conservation genetic studies in Abies pinsapo as well other Abies species from the Mediterranean Basin.

  19. Nuclear Microsatellite Primers for the Endangered Relict Fir, Abies pinsapo (Pinaceae and Cross-Amplification in Related Mediterranean Species

    Directory of Open Access Journals (Sweden)

    Laura Navarro-Sampedro

    2012-11-01

    Full Text Available Twelve nuclear microsatellite primers (nSSR were developed for the endangered species Abies pinsapo Boiss. to enable the study of gene flow and genetic structure in the remaining distribution areas. Microsatellite primers were developed using next-generation sequencing (454 data from a single Abies pinsapo individual. Primers were applied to thirty individuals from the three extant localities. The number of alleles per locus ranged from one to four. Cross-amplification was tested for other Abies species from the Mediterranean Basin, and most of the loci showed higher polymorphisms in the Mediterranean species than in A. pinsapo. These microsatellite markers provide tools for conservation genetic studies in Abies pinsapo as well other Abies species from the Mediterranean Basin.

  20. A species-specific primer pair for distinguishing between Paramisgurnus dabryanus and Misgurnus anguillicaudatus based on mitochondrial DNA polymorphisms.

    Science.gov (United States)

    Liu, Yongfu; Hou, Jilun; Wang, Guixing; Zhang, Xiaoyan; Liu, Haijin

    2016-07-01

    Paramisgurnus dabryanus and Misgurnus anguillicaudatus (family Cobitidae) are loaches with high morphological similarity. In this study, we designed primers to distinguish between Paramisgurnus dabryanus and Misgurnus anguillicaudatus based on the length differences in the mitochondrial COXII to tRNA(Lys) gene region. Samples of P. dabryanus and M. anguillicaudatus from different geographical locations were collected and amplified to verify primer specificity. The results of electrophoresis revealed the successful amplification of all P. dabryanus and M. anguillicaudatus DNA samples, which had distinct, specific-specific sizes (214 bp for P. dabryanus and 285 bp for M. anguillicaudatus). In conclusion, the new primers provide fast, reliable, and accurate identification between P. dabryanus and M. anguillicaudatus.