WorldWideScience

Sample records for australian drosophila buzzatii

  1. A BAC-based physical map of the Drosophila buzzatii genome

    Energy Technology Data Exchange (ETDEWEB)

    Gonzalez, Josefa; Nefedov, Michael; Bosdet, Ian; Casals, Ferran; Calvete, Oriol; Delprat, Alejandra; Shin, Heesun; Chiu, Readman; Mathewson, Carrie; Wye, Natasja; Hoskins, Roger A.; Schein, JacquelineE.; de Jong, Pieter; Ruiz, Alfredo

    2005-03-18

    Large-insert genomic libraries facilitate cloning of large genomic regions, allow the construction of clone-based physical maps and provide useful resources for sequencing entire genomes. Drosophilabuzzatii is a representative species of the repleta group in the Drosophila subgenus, which is being widely used as a model in studies of genome evolution, ecological adaptation and speciation. We constructed a Bacterial Artificial Chromosome (BAC) genomic library of D. buzzatii using the shuttle vector pTARBAC2.1. The library comprises 18,353 clones with an average insert size of 152 kb and a {approx}18X expected representation of the D. buzzatii euchromatic genome. We screened the entire library with six euchromatic gene probes and estimated the actual genome representation to be {approx}23X. In addition, we fingerprinted by restriction digestion and agarose gel electrophoresis a sample of 9,555 clones, and assembled them using Finger Printed Contigs (FPC) software and manual editing into 345 contigs (mean of 26 clones per contig) and 670singletons. Finally, we anchored 181 large contigs (containing 7,788clones) to the D. buzzatii salivary gland polytene chromosomes by in situ hybridization of 427 representative clones. The BAC library and a database with all the information regarding the high coverage BAC-based physical map described in this paper are available to the research community.

  2. Chromosomal inversions effect body size and shape in different breeding resources in Drosophila buzzatii.

    Science.gov (United States)

    Fernández Iriarte, P J; Norry, F M; Hasson, E R

    2003-07-01

    The cactophilic Drosophila buzzatii provides an excellent model for the study of reaction norms across discrete environments because it breeds on rotting tissues (rots) of very different cactus species. Here we test the possible effects of second chromosome inversions on body size and shape (wing loading) across suitable natural breeding substrates. Using homokaryotypic stocks derived from several lines homozygous for four naturally occurring chromosomal inversions, we show that arrangements significantly affect size-related traits and wing loading. In addition, karyotypes show differing effects, across natural breeding resources, for wing loading. The 2st and 2jz(3) arrangements decrease and the 2j arrangement increases wing loading. For thorax length and wing loading, karyotypic correlations across host plants are slightly lower in females than in males. These results support the hypothesis that these traits have a genetic basis associated with the inversion polymorphism.

  3. Differences in wing melanization and pigmentation pattern in Drosophila buzzatii (Diptera: Drosophilidae under chemical stress

    Directory of Open Access Journals (Sweden)

    Nicolás MONGIARDINO KOCH

    2012-01-01

    Full Text Available Recientemente, hemos avanzado en nuestra comprensión de las bases genéticas y los mecanismos subyacentes al proceso de melanización durante el desarrollo, lo que permite el estudio de los procesos evolutivos que gobiernan la variabilidad de pigmentación presente en la naturaleza. Sin embargo, los factores ambientales que contribuyen a dicha variabilidad han recibido poca atención, aún cuando pueden conllevar profundas consecuencias a nivel ecológico. En este trabajo, presentamos un método para analizar los patrones de melanización alar de drosofílidos, de forma cualitativa y cuantitativa. Ponemos a prueba esta metodología comparando las alas de Drosophila buzzatii Patterson & Wheeler, criadas en medio control y con el agregado de alcaloides. Los alcaloides fueron extraídos del huésped secundario de estas moscas, Echinopsis terscheckii (Parm. ex Pfeiff. Friedrich & Rowley, los cuales, se sabe, presentan efectos negativos en el desarrollo de D. buzzatii. Las moscas criadas en un medio enriquecido con alcaloides mostraron una mayor melanización alar, junto con diferencias en la distribución espacial del pigmento. Planteamos modificaciones a nivel metabólico y de expresión génica para explicar los cambios que las condiciones de estrés inducen sobre el carácter. Proponemos la utilización de este procedimiento para el estudio de la dependencia ambiental de la melanización.

  4. INVERSION POLYMORPHISM, LONGEVITY, AND BODY SIZE IN A NATURAL POPULATION OF DROSOPHILA BUZZATII.

    Science.gov (United States)

    Rodriguez, Constantina; Fanara, Juan J; Hasson, Esteban

    1999-04-01

    In this study we present the results of an analysis of differential longevity associated with Drosophila buzzatii second chromosome inversion karyotypes based on the assessment of more than 1000 individuals collected in a natural population. Comparisons of inversion frequencies between emerged and bait-collected flies showed not only that inversion arrangements were associated with differential longevity, but also that selection was sex specific. Because each individual fly was scored for thorax length and karyotype, we were able to show that longevity selection favoring larger flies coupled with the average effect of inversions on thorax length can account for the change of inversion frequencies due to longevity in females. The observed genotypic-by-sex interaction could be an important mechanism involved in the maintenance of the polymorphism. Arrangement 2Jz 3 , which was shown to impaired fecundity in two independent previous studies, exhibited a positive effect on longevity. This pattern of negative pleiotropy may be another plausible mechanism accounting for the maintenance of the polymorphism. © 1999 The Society for the Study of Evolution.

  5. Divergence at neutral and non-neutral loci in Drosophila buzzatii populations and their hybrids

    DEFF Research Database (Denmark)

    Andersen, Ditte Holm; Pertoldi, C.; Loeschcke, Volker

    2008-01-01

    The impact of intraspecific hybridisation on fitness and morphological traits depends on the history of natural selection and genetic drift, which may have led to differently coadapted gene-complexes in the parental populations. The divergence at neutral and non-neutral loci between populations can...... populations of Drosophila buzzatii, one between populations from Argentina and the Canary Islands (separated for 200 years), and the other between populations from Argentina and Australia (separated for 80 years). We observed the highest divergence at neutral loci between the Argentinean and Canary Island...

  6. Evaluation of the courtship and of the hybrid male sterility among Drosophila buzzatii cluster species (Diptera, Drosophilidae

    Directory of Open Access Journals (Sweden)

    MACHADO L. P. de B.

    2002-01-01

    Full Text Available In the Drosophila repleta group the establishment of subgroups and complexes made on the basis of morphological and cytological evidences is supported by tests of reproductive isolation. Among species in the repleta group, the buzzatii cluster, due to its polymorphism and polytipism, is an excellent material for ecological and speciation studies. Some interspecific crosses involving Drosophila seriema, Drosophila sp. B, D. koepferae and D. buzzatii strains were completely sterile while others involving strains from these species produced F1 hybrids that did not yield F2. In the present work, data on courtship duration and copula occurrence obtained in the analysis of flies from parental sterile crosses and on spermatozoon mobility observed in F1 hybrids that did not yield F2 are presented. Copula did not occur during one hour of observation and the spermatozoon also did not show mobility at any of the analyzed stages (3, 7, 9 and 10 days old. There was a high variation in courtship average duration and in the percentage of males that courted the females. The reproductive isolation mechanisms indicated by these observations were pre and post-zygotic, as supported by the absence of copula and male sterility. Data obtained also showed the occurrence of different degrees of reproductive compatibility among the strains classified as the same species but from distinct geographic localities.

  7. Differences in wing melanization and pigmentation pattern in Drosophila buzzatii (Diptera: Drosophilidae under chemical stress Diferencias en la melanización y el patrón de pigmentación alar en Drosophila buzzatii (Diptera: Drosophilidae bajo estrés químico

    Directory of Open Access Journals (Sweden)

    Nicolás Mongiardino Koch

    2012-06-01

    Full Text Available Recently, the genetic basis and developmental mechanisms underlying the process of melanization have become progressively elucidated, allowing us to study the evolutionary processes that govern the huge variability of pigmentation observed in nature. However, environmental factors contributing to such variability have received little attention, even though they might have profound ecological consequences. Here we describe a method for analyzing the wing melanization patterns of drosophilids in both qualitative and quantitative ways. We test this method on wings of Drosophila buzzatii Patterson & Wheeler individuals, reared in control and alkaloid-enriched mediums. The alkaloids were extracted from the secondary host of these flies, Echinopsis terscheckii (Parm. ex Pfeiff. Friedrich & Rowley, and their effect on wing pigmentation is analyzed, bearing in mind the adverse effects that these compounds have on the development of D. buzzatii. Alkaloid-reared flies were shown to attain a higher degree of wing melanization, accompanied with differences in the spatial distribution of the pigment. Modifications at both metabolic and gene regulatory levels are proposed to explain the changes that chemical stressful conditions are shown to induce in this character. We propose the utilization of this procedure in studies of environmental dependence of pigmentation.Recientemente, hemos avanzado en nuestra comprensión de las bases genéticas y los mecanismos subyacentes al proceso de melanización durante el desarrollo, lo que permite el estudio de los procesos evolutivos que gobiernan la variabilidad de pigmentación presente en la naturaleza. Sin embargo, los factores ambientales que contribuyen a dicha variabilidad han recibido poca atención, aún cuando pueden conllevar profundas consecuencias a nivel ecológico. En este trabajo, presentamos un método para analizar los patrones de melanización alar de drosofílidos, de forma cualitativa y cuantitativa

  8. Bottlenecks, population differentiation and apparent selection at microsatellite loci in Australian Drosophila buzzatii

    DEFF Research Database (Denmark)

    Barker, J.S.F.; Frydenberg, Jane; González, J.

    2009-01-01

    Species colonizing new areas disjunct from their original habitat may be subject to novel selection pressures, and exhibit adaptive genetic changes. However, if colonization occurs through a small number of founders, the genetic composition of the colonized population may differ from that of the ...

  9. Experimental Support That Natural Selection Has Shaped the Latitudinal Distribution of Mitochondrial Haplotypes in Australian Drosophila melanogaster.

    Science.gov (United States)

    Camus, M Florencia; Wolff, Jonci N; Sgrò, Carla M; Dowling, Damian K

    2017-10-01

    Cellular metabolism is regulated by enzyme complexes within the mitochondrion, the function of which are sensitive to the prevailing temperature. Such thermal sensitivity, coupled with the observation that population frequencies of mitochondrial haplotypes tend to associate with latitude, altitude, or climatic regions across species distributions, led to the hypothesis that thermal selection has played a role in shaping standing variation in the mitochondrial DNA (mtDNA) sequence. This hypothesis, however, remains controversial, and requires evidence that the distribution of haplotypes observed in nature corresponds with the capacity of these haplotypes to confer differences in thermal tolerance. Specifically, haplotypes predominating in tropical climates are predicted to encode increased tolerance to heat stress, but decreased tolerance to cold stress. We present direct evidence for these predictions, using mtDNA haplotypes sampled from the Australian distribution of Drosophila melanogaster. We show that the ability of flies to tolerate extreme thermal challenges is affected by sequence variation across mtDNA haplotypes, and that the thermal performance associated with each haplotype corresponds with its latitudinal prevalence. The haplotype that predominates at low (subtropical) latitudes confers greater resilience to heat stress, but lower resilience to cold stress, than haplotypes predominating at higher (temperate) latitudes. We explore molecular mechanisms that might underlie these responses, presenting evidence that the effects are in part regulated by SNPs that do not change the protein sequence. Our findings suggest that standing variation in the mitochondrial genome can be shaped by thermal selection, and could therefore contribute to evolutionary adaptation under climatic stress. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e

  10. Contrasting Plasticity in Ovariole Number Induced by A Dietary Effect of the Host Plants between Cactophilic Drosophila Species

    Directory of Open Access Journals (Sweden)

    Daniela Peluso

    2016-05-01

    Full Text Available Under the preference-performance hypothesis, natural selection will favor females that choose oviposition sites that optimize the fitness of their offspring. Such a preference-performance relationship may entail important consequences mainly on fitness-related traits. We used the well-characterized cactus-Drosophila system to investigate the reproductive capacity in the pair of sibling species D. buzzatii and D. koepferae reared in two alternative host plants. According to our hypothesis, ovariole number (as a proxy of reproductive capacity depends on host plant selection. Our results indicate that the capacity of D. buzzatii showed to be mild, only increasing the number of ovarioles by as much as 10% when reared in its preferred host. In contrast, D. koepferae exhibited a similar reproductive capacity across host cacti, even though it showed a preference for its primary host cactus. Our study also revealed that D. buzzatii has a larger genetic variation for phenotypic plasticity than its sibling, although ovariole number did not show clear-cut differences between species. We will discuss the weak preference-performance pattern observed in these cactophilic species in the light of nutritional and toxicological differences found between the natural host plants.

  11. Phenotypic plasticity in Drosophila cactophilic species: the effect of competition, density, and breeding sites.

    Science.gov (United States)

    Fanara, Juan Jose; Werenkraut, Victoria

    2017-08-01

    Changes in the environmental conditions experienced by naturally occurring populations are frequently accompanied by changes in adaptive traits allowing the organism to cope with environmental unpredictability. Phenotypic plasticity is a major aspect of adaptation and it has been involved in population dynamics of interacting species. In this study, phenotypic plasticity (i.e., environmental sensitivity) of morphological adaptive traits were analyzed in the cactophilic species Drosophila buzzatii and Drosophila koepferae (Diptera: Drosophilidae) considering the effect of crowding conditions (low and high density), type of competition (intraspecific and interspecific competition) and cacti hosts (Opuntia and Columnar cacti). All traits (wing length, wing width, thorax length, wing loading and wing aspect) showed significant variation for each environmental factor considered in both Drosophila species. The phenotypic plasticity pattern observed for each trait was different within and between these cactophilic Drosophila species depending on the environmental factor analyzed suggesting that body size-related traits respond almost independently to environmental heterogeneity. The effects of ecological factors analyzed in this study are discussed in order to elucidate the causal factors investigated (type of competition, crowding conditions and alternative host) affecting the election of the breeding site and/or the range of distribution of these cactophilic species. © 2016 Institute of Zoology, Chinese Academy of Sciences.

  12. Transposable Element Misregulation Is Linked to the Divergence between Parental piRNA Pathways in Drosophila Hybrids.

    Science.gov (United States)

    Romero-Soriano, Valèria; Modolo, Laurent; Lopez-Maestre, Hélène; Mugat, Bruno; Pessia, Eugénie; Chambeyron, Séverine; Vieira, Cristina; Garcia Guerreiro, Maria Pilar

    2017-06-01

    Interspecific hybridization is a genomic stress condition that leads to the activation of transposable elements (TEs) in both animals and plants. In hybrids between Drosophila buzzatii and Drosophila koepferae, mobilization of at least 28 TEs has been described. However, the molecular mechanisms underlying this TE release remain poorly understood. To give insight on the causes of this TE activation, we performed a TE transcriptomic analysis in ovaries (notorious for playing a major role in TE silencing) of parental species and their F1 and backcrossed (BC) hybrids. We find that 15.2% and 10.6% of the expressed TEs are deregulated in F1 and BC1 ovaries, respectively, with a bias toward overexpression in both cases. Although differences between parental piRNA (Piwi-interacting RNA) populations explain only partially these results, we demonstrate that piRNA pathway proteins have divergent sequences and are differentially expressed between parental species. Thus, a functional divergence of the piRNA pathway between parental species, together with some differences between their piRNA pools, might be at the origin of hybrid instabilities and ultimately cause TE misregulation in ovaries. These analyses were complemented with the study of F1 testes, where TEs tend to be less expressed than in D. buzzatii. This can be explained by an increase in piRNA production, which probably acts as a defence mechanism against TE instability in the male germline. Hence, we describe a differential impact of interspecific hybridization in testes and ovaries, which reveals that TE expression and regulation are sex-biased. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  13. Sensitivity to thermal extremes in Australian Drosophila implies similar impacts of climate change on the distribution of widespread and tropical species.

    Science.gov (United States)

    Overgaard, Johannes; Kearney, Michael R; Hoffmann, Ary A

    2014-06-01

    Climatic factors influence the distribution of ectotherms, raising the possibility that distributions of many species will shift rapidly under climate change and/or that species will become locally extinct. Recent studies have compared performance curves of species from different climate zones and suggested that tropical species may be more susceptible to climate change than those from temperate environments. However, in other comparisons involving responses to thermal extremes it has been suggested that mid-latitude populations are more susceptible. Using a group of 10 closely related Drosophila species with known tropical or widespread distribution, we undertake a detailed investigation of their growth performance curves and their tolerance to thermal extremes. Thermal sensitivity of life history traits (fecundity, developmental success, and developmental time) and adult heat resistance were similar in tropical and widespread species groups, while widespread species had higher adult cold tolerance under all acclimation regimes. Laboratory measurements of either population growth capacity or acute tolerance to heat and cold extremes were compared to daily air temperature under current (2002-2007) and future (2100) conditions to investigate if these traits could explain current distributions and, therefore, also forecast future effects of climate change. Life history traits examining the thermal sensitivity of population growth proved to be a poor predictor of current species distributions. In contrast, we validate that adult tolerance to thermal extremes provides a good correlate of current distributions. Thus, in their current distribution range, most of the examined species experience heat exposure close to, but rarely above, the functional heat resistance limit. Similarly, adult functional cold resistance proved a good predictor of species distribution in cooler climates. When using the species' functional tolerance limits under a global warming scenario, we

  14. Evolución morfológica asociada al proceso de divergencia entre especies: el cluster Drosophila buzzatii (Diptera, Drosophilidae)

    OpenAIRE

    Soto, Ignacio M.

    2008-01-01

    ¿Porqué hay especies morfológicamente crípticas sólo diferenciables por su genitalia? ¿Qué procesos están involucrados en la diferenciación morfológica de las especies y cuál es la importancia relativa de cada uno de ellos? ¿Qué patrones determinan estos procesos cuando se analizan en escalas micro y macroevolutivas? Muchos de los mecanismos por los que se producen los cambios morfo-fisiológicos que acompañan a la especiación permanecen largamente desconocidos por la biología. Más aún, las ba...

  15. Genetic architecture of autosome-mediated hybrid male sterility in Drosophila

    Energy Technology Data Exchange (ETDEWEB)

    Marin, I. [Stanford Univ., CA (United States)

    1996-04-01

    Several estimators have been developed for assesing the number of sterility factors in a chromosome based on the sizes of fertile and sterile introgressed fragments. Assuming that two factors are required for producing sterility, simulations show that one of these, twice the inverse of the relative size of the largest fertile fragment, provides good average approximations when as few as five fertile fragments are analyzed. The estimators have been used for deducing the number of factors from previous data on several pairs of species. A particular result contrasts with the authors` interpretations: instead of the high number of sterility factors suggested, only a few per autosome are estimated in both reciprocal crosses involving Drosophila buzzatii and D. koepferae. It has been possible to map these factors, between three and six per chromosome, in the autosomes 3 and 4 of these species. Out of 203 introgressions of different fragments or combinations of fragments, the outcome of at least 192 is explained by the mapped zones. These results suggest that autosome-mediated sterility in the male hybrids of these species is mediated by a few epistatic factors, similarly to X-mediated sterility in the hybrids of other Drosophila species. 48 refs., 5 tabs.

  16. Australian Government Information Resources

    OpenAIRE

    Chapman, Bert

    2017-01-01

    Provides an overview of Australian Government information resources. Features content from Australian Government agency websites such as the Department of Environment and Energy, Department of Defence, Australian National Maritime Museum, ANZAC Memorial in Sydney, Department of Immigration & Border Protection, Australian Bureau of Statistics, Australian Dept. of Agriculture and Water Resources, Australian Parliament, Australian Treasury, Australian Transport Safety Board, and Australian Parl...

  17. Variations on a theme: diversification of cuticular hydrocarbons in a clade of cactophilic Drosophila

    Directory of Open Access Journals (Sweden)

    Jackson Larry L

    2011-06-01

    Full Text Available Abstract Background We characterized variation and chemical composition of epicuticular hydrocarbons (CHCs in the seven species of the Drosophila buzzatii cluster with gas chromatography/mass spectrometry. Despite the critical role of CHCs in providing resistance to desiccation and involvement in communication, such as courtship behavior, mating, and aggregation, few studies have investigated how CHC profiles evolve within and between species in a phylogenetic context. We analyzed quantitative differences in CHC profiles in populations of the D. buzzatii species cluster in order to assess the concordance of CHC differentiation with species divergence. Results Thirty-six CHC components were scored in single fly extracts with carbon chain lengths ranging from C29 to C39, including methyl-branched alkanes, n-alkenes, and alkadienes. Multivariate analysis of variance revealed that CHC amounts were significantly different among all species and canonical discriminant function (CDF analysis resolved all species into distinct, non-overlapping groups. Significant intraspecific variation was found in different populations of D. serido suggesting that this taxon is comprised of at least two species. We summarized CHC variation using CDF analysis and mapped the first five CHC canonical variates (CVs onto an independently derived period (per gene + chromosome inversion + mtDNA COI gene for each sex. We found that the COI sequences were not phylogenetically informative due to introgression between some species, so only per + inversion data were used. Positive phylogenetic signal was observed mainly for CV1 when parsimony methods and the test for serial independence (TFSI were used. These results changed when no outgroup species were included in the analysis and phylogenetic signal was then observed for female CV3 and/or CV4 and male CV4 and CV5. Finally, removal of divergent populations of D. serido significantly increased the amount of phylogenetic signal as

  18. Glia in Drosophila behavior.

    Science.gov (United States)

    Zwarts, L; Van Eijs, F; Callaerts, P

    2015-09-01

    Glial cells constitute about 10 % of the Drosophila nervous system. The development of genetic and molecular tools has helped greatly in defining different types of glia. Furthermore, considerable progress has been made in unraveling the mechanisms that control the development and differentiation of Drosophila glia. By contrast, the role of glia in adult Drosophila behavior is not well understood. We here summarize recent work describing the role of glia in normal behavior and in Drosophila models for neurological and behavioral disorders.

  19. Metabolomic Studies in Drosophila.

    Science.gov (United States)

    Cox, James E; Thummel, Carl S; Tennessen, Jason M

    2017-07-01

    Metabolomic analysis provides a powerful new tool for studies of Drosophila physiology. This approach allows investigators to detect thousands of chemical compounds in a single sample, representing the combined contributions of gene expression, enzyme activity, and environmental context. Metabolomics has been used for a wide range of studies in Drosophila , often providing new insights into gene function and metabolic state that could not be obtained using any other approach. In this review, we survey the uses of metabolomic analysis since its entry into the field. We also cover the major methods used for metabolomic studies in Drosophila and highlight new directions for future research. Copyright © 2017 by the Genetics Society of America.

  20. Hearing regulates Drosophila aggression.

    Science.gov (United States)

    Versteven, Marijke; Vanden Broeck, Lies; Geurten, Bart; Zwarts, Liesbeth; Decraecker, Lisse; Beelen, Melissa; Göpfert, Martin C; Heinrich, Ralf; Callaerts, Patrick

    2017-02-21

    Aggression is a universal social behavior important for the acquisition of food, mates, territory, and social status. Aggression in Drosophila is context-dependent and can thus be expected to involve inputs from multiple sensory modalities. Here, we use mechanical disruption and genetic approaches in Drosophila melanogaster to identify hearing as an important sensory modality in the context of intermale aggressive behavior. We demonstrate that neuronal silencing and targeted knockdown of hearing genes in the fly's auditory organ elicit abnormal aggression. Further, we show that exposure to courtship or aggression song has opposite effects on aggression. Our data define the importance of hearing in the control of Drosophila intermale aggression and open perspectives to decipher how hearing and other sensory modalities are integrated at the neural circuit level.

  1. Cancer in Drosophila

    DEFF Research Database (Denmark)

    Herranz, Héctor; Eichenlaub, Teresa; Cohen, Stephen M

    2016-01-01

    Cancer genomics has greatly increased our understanding of the complexity of the genetic and epigenetic changes found in human tumors. Understanding the functional relationships among these elements calls for the use of flexible genetic models. We discuss the use of Drosophila models to study...

  2. BMAA neurotoxicity in Drosophila.

    Science.gov (United States)

    Zhou, Xianchong; Escala, Wilfredo; Papapetropoulos, Spyridon; Bradley, Walter G; Zhai, R Grace

    2009-01-01

    We report the establishment of an in vivo model using the fruit fly Drosophila melanogaster to investigate the toxic effects of L-BMAA. We found that dietary intake of BMAA reduced the lifespan as well as the neurological functions of flies. Furthermore, we have developed an HPLC method to reliably detect both free and protein-bound BMAA in fly tissue extracts.

  3. Modeling Human Cancers in Drosophila.

    Science.gov (United States)

    Sonoshita, M; Cagan, R L

    2017-01-01

    Cancer is a complex disease that affects multiple organs. Whole-body animal models provide important insights into oncology that can lead to clinical impact. Here, we review novel concepts that Drosophila studies have established for cancer biology, drug discovery, and patient therapy. Genetic studies using Drosophila have explored the roles of oncogenes and tumor-suppressor genes that when dysregulated promote cancer formation, making Drosophila a useful model to study multiple aspects of transformation. Not limited to mechanism analyses, Drosophila has recently been showing its value in facilitating drug development. Flies offer rapid, efficient platforms by which novel classes of drugs can be identified as candidate anticancer leads. Further, we discuss the use of Drosophila as a platform to develop therapies for individual patients by modeling the tumor's genetic complexity. Drosophila provides both a classical and a novel tool to identify new therapeutics, complementing other more traditional cancer tools. © 2017 Elsevier Inc. All rights reserved.

  4. Transgenesis in Drosophila melanogaster.

    Science.gov (United States)

    Ringrose, Leonie

    2009-01-01

    Transgenesis in Drosophila melanogaster relies upon direct microinjection of embryos and subsequent crossing of surviving adults. The necessity of crossing single flies to screen for transgenic events limits the range of useful transgenesis techniques to those that have a very high frequency of integration, so that about 1 in 10 to 1 in 100 surviving adult flies carry a transgene. Until recently, only random P-element transgenesis fulfilled these criteria. However, recent advances have brought homologous recombination and site-directed integration up to and beyond this level of efficiency. For all transgenesis techniques in Drosophila melanogaster, microinjection of embryos is the central procedure. This chapter gives a detailed protocol for microinjection, and aims to enable the reader to use it for both site-directed integration and for P-element transgenesis.

  5. Drosophila by the dozen

    Energy Technology Data Exchange (ETDEWEB)

    Celniker, Susan E.; Hoskins, Roger A.

    2007-07-13

    This year's conference on Drosophila research illustratedwell the current focus of Drosophila genomics on the comprehensiveidentification of functional elements in the genome sequence, includingmRNA transcripts arising from multiple alternative start sites and splicesites, a multiplicity of noncoding transcripts and small RNAs,identification of binding sites for transcription factors, sequenceconservation in related species and sequence variation within species.Resources and technologies for genetics and functional genomics aresteadily being improved, including the building of collections oftransposon insertion mutants and hairpin constructs for RNA interference(RNAi). The conference also highlighted progress in the use of genomicinformation by many laboratories to study diverse aspects of biology andmodels of human disease. Here we will review a few highlights of especialinterest to readers of Genome Biology.

  6. The genus Drosophila is characterized by a large number of sibling ...

    Indian Academy of Sciences (India)

    2016-12-07

    Dec 7, 2016 ... Journal of Genetics, DOI 10.1007/s12041-016-0699-x, Vol. 95, No. 4, December 2016. 1053 ..... the basis of mtDNA analysis: one consisting of D. buzzatii and D. koepferae and the other consists remaining .... Financial assistance in the form of UGC-BSR Faculty Fellowship. Award to the author is gratefully ...

  7. The Drosophila melanogaster host model

    Science.gov (United States)

    Igboin, Christina O.; Griffen, Ann L.; Leys, Eugene J.

    2012-01-01

    The deleterious and sometimes fatal outcomes of bacterial infectious diseases are the net result of the interactions between the pathogen and the host, and the genetically tractable fruit fly, Drosophila melanogaster, has emerged as a valuable tool for modeling the pathogen–host interactions of a wide variety of bacteria. These studies have revealed that there is a remarkable conservation of bacterial pathogenesis and host defence mechanisms between higher host organisms and Drosophila. This review presents an in-depth discussion of the Drosophila immune response, the Drosophila killing model, and the use of the model to examine bacterial–host interactions. The recent introduction of the Drosophila model into the oral microbiology field is discussed, specifically the use of the model to examine Porphyromonas gingivalis–host interactions, and finally the potential uses of this powerful model system to further elucidate oral bacterial-host interactions are addressed. PMID:22368770

  8. Australian uranium mining policy

    International Nuclear Information System (INIS)

    Fisk, B.

    1985-01-01

    Australian government policy is explained in terms of adherence to the Non-Proliferation Treaty. Two alleged uncertainties are discussed: the future of Australian mining industry as a whole -on which it is said that Australian uranium mines will continue to be developed; and detailed commercial policy of the Australian government - on which it is suggested that the three-mines policy of limited expansion of the industry would continue. Various aspects of policy, applying the principles of the NPT, are listed. (U.K.)

  9. Myoblast fusion in Drosophila

    International Nuclear Information System (INIS)

    Haralalka, Shruti; Abmayr, Susan M.

    2010-01-01

    The body wall musculature of a Drosophila larva is composed of an intricate pattern of 30 segmentally repeated muscle fibers in each abdominal hemisegment. Each muscle fiber has unique spatial and behavioral characteristics that include its location, orientation, epidermal attachment, size and pattern of innervation. Many, if not all, of these properties are dictated by founder cells, which determine the muscle pattern and seed the fusion process. Myofibers are then derived from fusion between a specific founder cell and several fusion competent myoblasts (FCMs) fusing with as few as 3-5 FCMs in the small muscles on the most ventral side of the embryo and as many as 30 FCMs in the larger muscles on the dorsal side of the embryo. The focus of the present review is the formation of the larval muscles in the developing embryo, summarizing the major issues and players in this process. We have attempted to emphasize experimentally-validated details of the mechanism of myoblast fusion and distinguish these from the theoretically possible details that have not yet been confirmed experimentally. We also direct the interested reader to other recent reviews that discuss myoblast fusion in Drosophila, each with their own perspective on the process . With apologies, we use gene nomenclature as specified by Flybase (http://flybase.org) but provide Table 1 with alternative names and references.

  10. SUMOylation in Drosophila Development

    Directory of Open Access Journals (Sweden)

    Albert J. Courey

    2012-07-01

    Full Text Available Small ubiquitin-related modifier (SUMO, an ~90 amino acid ubiquitin-like protein, is highly conserved throughout the eukaryotic domain. Like ubiquitin, SUMO is covalently attached to lysine side chains in a large number of target proteins. In contrast to ubiquitin, SUMO does not have a direct role in targeting proteins for proteasomal degradation. However, like ubiquitin, SUMO does modulate protein function in a variety of other ways. This includes effects on protein conformation, subcellular localization, and protein–protein interactions. Significant insight into the in vivo role of SUMOylation has been provided by studies in Drosophila that combine genetic manipulation, proteomic, and biochemical analysis. Such studies have revealed that the SUMO conjugation pathway regulates a wide variety of critical cellular and developmental processes, including chromatin/chromosome function, eggshell patterning, embryonic pattern formation, metamorphosis, larval and pupal development, neurogenesis, development of the innate immune system, and apoptosis. This review discusses our current understanding of the diverse roles for SUMO in Drosophila development.

  11. Early Australian Pronunciation.

    Science.gov (United States)

    Gunn, John S.

    Comparative research indicates that almost without exception, late eighteenth century non-standard English pronunciation was very close to what is called Broad Australian. Present Australian English is closely akin to the blended, popular colloquial London English, spoken by the largest group of Australia's first settlers. This pronunciation…

  12. Australian Asian Options

    OpenAIRE

    Manuel Moreno; Javier F. Navas

    2003-01-01

    We study European options on the ratio of the stock price to its average and viceversa. Some of these options are traded in the Australian Stock Exchange since 1992, thus we call them Australian Asian options. For geometric averages, we obtain closed-form expressions for option prices. For arithmetic means, we use different approximations that produce very similar results.

  13. Cytokines in Drosophila immunity.

    Science.gov (United States)

    Vanha-Aho, Leena-Maija; Valanne, Susanna; Rämet, Mika

    2016-02-01

    Cytokines are a large and diverse group of small proteins that can affect many biological processes, but most commonly cytokines are known as mediators of the immune response. In the event of an infection, cytokines are produced in response to an immune stimulus, and they function as key regulators of the immune response. Cytokines come in many shapes and sizes, and although they vary greatly in structure, their functions have been well conserved in evolution. The immune signaling pathways that respond to cytokines are remarkably conserved from fly to man. Therefore, Drosophila melanogaster, provides an excellent platform for studying the biology and function of cytokines. In this review, we will describe the cytokines and cytokine-like molecules found in the fly and discuss their roles in host immunity. Copyright © 2015 European Federation of Immunological Societies. Published by Elsevier B.V. All rights reserved.

  14. Humidity Sensing in Drosophila.

    Science.gov (United States)

    Enjin, Anders; Zaharieva, Emanuela E; Frank, Dominic D; Mansourian, Suzan; Suh, Greg S B; Gallio, Marco; Stensmyr, Marcus C

    2016-05-23

    Environmental humidity influences the fitness and geographic distribution of all animals [1]. Insects in particular use humidity cues to navigate the environment, and previous work suggests the existence of specific sensory mechanisms to detect favorable humidity ranges [2-5]. Yet, the molecular and cellular basis of humidity sensing (hygrosensation) remains poorly understood. Here we describe genes and neurons necessary for hygrosensation in the vinegar fly Drosophila melanogaster. We find that members of the Drosophila genus display species-specific humidity preferences related to conditions in their native habitats. Using a simple behavioral assay, we find that the ionotropic receptors IR40a, IR93a, and IR25a are all required for humidity preference in D. melanogaster. Yet, whereas IR40a is selectively required for hygrosensory responses, IR93a and IR25a mediate both humidity and temperature preference. Consistent with this, the expression of IR93a and IR25a includes thermosensory neurons of the arista. In contrast, IR40a is excluded from the arista but is expressed (and required) in specialized neurons innervating pore-less sensilla of the sacculus, a unique invagination of the third antennal segment. Indeed, calcium imaging showed that IR40a neurons directly respond to changes in humidity, and IR40a knockdown or IR93a mutation reduced their responses to stimuli. Taken together, our results suggest that the preference for a specific humidity range depends on specialized sacculus neurons, and that the processing of environmental humidity can happen largely in parallel to that of temperature. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. The Australian National Seismograph Network

    OpenAIRE

    Jepsen, D.

    1994-01-01

    The Australian Seismological Centre of the Australian Geological Survey Organisation, operates and co-operates a national seismograph network consisting of 24 analogue and 8 digitally telemetred (3 broadband) stations (see fig. 1 and table 1). The network covers the Australian continent and the Australian Antarctic Territory.

  16. The Australian National Seismograph Network

    Directory of Open Access Journals (Sweden)

    D. Jepsen

    1994-06-01

    Full Text Available The Australian Seismological Centre of the Australian Geological Survey Organisation, operates and co-operates a national seismograph network consisting of 24 analogue and 8 digitally telemetred (3 broadband stations (see fig. 1 and table 1. The network covers the Australian continent and the Australian Antarctic Territory.

  17. Use of Drosophila to study DNA repair

    International Nuclear Information System (INIS)

    Boyd, J.B.; Harris, P.V.; Sakaguchi, K.

    1988-01-01

    This paper discusses Drosophila, the premier metazoan organism for analyzing many fundamental features of eukaryotic gene regulation. The authors present adaptations of several approaches for studying DNA repair to an analysis of repair-defective mutants in Drosophila. A current understanding of Drosophila DNA repair is described

  18. Australianness as fairness

    DEFF Research Database (Denmark)

    Plage, Stefanie; Willing, Indigo; Skrbis, Zlatko

    2017-01-01

    This article provides an account of interwoven and often competing repertoires of cosmopolitanism and nationalism on which Australians draw when encountering diversity. Using interview and focus group data the article first explores how the notion of Australianness grounded in civic virtues such ......-go’ principle at times conceptually overlaps with cosmopolitan ethics. However, it also bears the potential to hinder cosmopolitan practices. Ultimately national and cosmopolitan ethical frameworks have to be interrogated simultaneously when applied to micro-level interactions.......This article provides an account of interwoven and often competing repertoires of cosmopolitanism and nationalism on which Australians draw when encountering diversity. Using interview and focus group data the article first explores how the notion of Australianness grounded in civic virtues...

  19. Modelling Cooperative Tumorigenesis in Drosophila

    Science.gov (United States)

    2018-01-01

    The development of human metastatic cancer is a multistep process, involving the acquisition of several genetic mutations, tumour heterogeneity, and interactions with the surrounding microenvironment. Due to the complexity of cancer development in mammals, simpler model organisms, such as the vinegar fly, Drosophila melanogaster, are being utilized to provide novel insights into the molecular mechanisms involved. In this review, we highlight recent advances in modelling tumorigenesis using the Drosophila model, focusing on the cooperation of oncogenes or tumour suppressors, and the interaction of mutant cells with the surrounding tissue in epithelial tumour initiation and progression. PMID:29693007

  20. Semi-automated quantitative Drosophila wings measurements.

    Science.gov (United States)

    Loh, Sheng Yang Michael; Ogawa, Yoshitaka; Kawana, Sara; Tamura, Koichiro; Lee, Hwee Kuan

    2017-06-28

    Drosophila melanogaster is an important organism used in many fields of biological research such as genetics and developmental biology. Drosophila wings have been widely used to study the genetics of development, morphometrics and evolution. Therefore there is much interest in quantifying wing structures of Drosophila. Advancement in technology has increased the ease in which images of Drosophila can be acquired. However such studies have been limited by the slow and tedious process of acquiring phenotypic data. We have developed a system that automatically detects and measures key points and vein segments on a Drosophila wing. Key points are detected by performing image transformations and template matching on Drosophila wing images while vein segments are detected using an Active Contour algorithm. The accuracy of our key point detection was compared against key point annotations of users. We also performed key point detection using different training data sets of Drosophila wing images. We compared our software with an existing automated image analysis system for Drosophila wings and showed that our system performs better than the state of the art. Vein segments were manually measured and compared against the measurements obtained from our system. Our system was able to detect specific key points and vein segments from Drosophila wing images with high accuracy.

  1. Australian uranium today

    International Nuclear Information System (INIS)

    Fisk, B.

    1978-01-01

    The subject is covered in sections, entitled: Australia's resources; Northern Territory uranium in perspective; the government's decision [on August 25, 1977, that there should be further development of uranium under strictly controlled conditions]; Government legislation; outlook [for the Australian uranium mining industry]. (U.K.)

  2. A Drosophila wing spot test

    International Nuclear Information System (INIS)

    Ayaki, Toshikazu; Yoshikawa, Isao; Niikawa, Norio; Hoshi, Masaharu.

    1986-01-01

    A Drosophila wing spot test system was used to investigate the effects of low doses of X-rays, gamma rays, and both 2.3 and 14.1 MeV neutrons on somatic chromosome mutation (SCM) induction. The incidence of SCM was significantly increased with any type of radiation, with evident linear dose-response relationship within the range of 3 to 20 cGy. It was estimated that relative biological effectiveness value for SCM induction of 2.3 MeV neutrons to X-rays and gamma rays is much higher than that of 14.1 MeV neutrons to those photons (2.4 vs 8.0). The Drosophila wing spot test system seems to become a promising in vivo experimental method for higher animals in terms of the lack of necessity for a marvelously large number of materials required in conventional test system. (Namekawa, K.)

  3. Limited taste discrimination in Drosophila.

    Science.gov (United States)

    Masek, Pavel; Scott, Kristin

    2010-08-17

    In the gustatory systems of mammals and flies, different populations of sensory cells recognize different taste modalities, such that there are cells that respond selectively to sugars and others to bitter compounds. This organization readily allows animals to distinguish compounds of different modalities but may limit the ability to distinguish compounds within one taste modality. Here, we developed a behavioral paradigm in Drosophila melanogaster to evaluate directly the tastes that a fly distinguishes. These studies reveal that flies do not discriminate among different sugars, or among different bitter compounds, based on chemical identity. Instead, flies show a limited ability to distinguish compounds within a modality based on intensity or palatability. Taste associative learning, similar to olfactory learning, requires the mushroom bodies, suggesting fundamental similarities in brain mechanisms underlying behavioral plasticity. Overall, these studies provide insight into the discriminative capacity of the Drosophila gustatory system and the modulation of taste behavior.

  4. Studies on Drosophila radiosensitive strains

    International Nuclear Information System (INIS)

    Varentsova, E.P.; Zakharov, I.A.

    1976-01-01

    45 of radiosensitive strains of Drosophila melanogaster were isolated by Curly/Lobe technique after EMS treatment of Livadia population males. The lethality of non-Curly late larvae after gamma-irradiation (4000r) characterized radiosensitivity strains. Most of them exhibited higher frequency of the spontaneous dominant lethals (up to 69%). The males of 6 strains were semi-sterile. 5 of these strains exhibited higher frequency of X-chromosome non-disjunction

  5. Drosophila: Retrotransposons Making up Telomeres.

    Science.gov (United States)

    Casacuberta, Elena

    2017-07-19

    Drosophila and extant species are the best-studied telomerase exception. In this organism, telomere elongation is coupled with targeted retrotransposition of Healing Transposon (HeT-A) and Telomere Associated Retrotransposon (TART) with sporadic additions of Telomere Associated and HeT-A Related (TAHRE), all three specialized non-Long Terminal Repeat (non-LTR) retrotransposons. These three very special retroelements transpose in head to tail arrays, always in the same orientation at the end of the chromosomes but never in interior locations. Apparently, retrotransposon and telomerase telomeres might seem very different, but a detailed view of their mechanisms reveals similarities explaining how the loss of telomerase in a Drosophila ancestor could successfully have been replaced by the telomere retrotransposons. In this review, we will discover that although HeT-A, TART, and TAHRE are still the only examples to date where their targeted transposition is perfectly tamed into the telomere biology of Drosophila, there are other examples of retrotransposons that manage to successfully integrate inside and at the end of telomeres. Because the aim of this special issue is viral integration at telomeres, understanding the base of the telomerase exceptions will help to obtain clues on similar strategies that mobile elements and viruses could have acquired in order to ensure their survival in the host genome.

  6. Insulin receptor in Drosophila melanogaster

    International Nuclear Information System (INIS)

    Petruzzelli, L.; Herrera, R.; Rosen, O.

    1986-01-01

    A specific, high affinity insulin receptor is present in both adult Drosophila and in Drosophila embryos. Wheat germ lectin-enriched extracts of detergent-solubilized membranes from embryos and adults bind insulin with a K/sub d/ of 15 nM. Binding is specific for insulin; micromolar concentrations of proinsulin, IGFI, and IGFII are required to displace bound 125 I-insulin. Insulin-dependent protein tyrosine kinase activity appears during embryogenesis. It is evident between 6 and 12 hours of development, peaks between 12 and 18 hours and falls in the adult. During 0-6 hours of embryogenesis, and in the adult, a specific protein band (Mr = 135,000) is crosslinked to 125 I-insulin. During 6-12 and 12-18 hours of embryogenesis stages in which insulin-dependent protein tyrosine kinase is high, an additional band (Mr = 100,000) becomes crosslinked to 125 I-insulin. Isolation and DNA sequence analysis of genomic clones encoding the Drosophila insulin receptor will be presented as will the characterization of insulin receptor mRNA's during development

  7. 'Peer pressure' in larval Drosophila?

    Science.gov (United States)

    Niewalda, Thomas; Jeske, Ines; Michels, Birgit; Gerber, Bertram

    2014-06-06

    Understanding social behaviour requires a study case that is simple enough to be tractable, yet complex enough to remain interesting. Do larval Drosophila meet these requirements? In a broad sense, this question can refer to effects of the mere presence of other larvae on the behaviour of a target individual. Here we focused in a more strict sense on 'peer pressure', that is on the question of whether the behaviour of a target individual larva is affected by what a surrounding group of larvae is doing. We found that innate olfactory preference of a target individual was neither affected (i) by the level of innate olfactory preference in the surrounding group nor (ii) by the expression of learned olfactory preference in the group. Likewise, learned olfactory preference of a target individual was neither affected (iii) by the level of innate olfactory preference of the surrounding group nor (iv) by the learned olfactory preference the group was expressing. We conclude that larval Drosophila thus do not take note of specifically what surrounding larvae are doing. This implies that in a strict sense, and to the extent tested, there is no social interaction between larvae. These results validate widely used en mass approaches to the behaviour of larval Drosophila. © 2014. Published by The Company of Biologists Ltd.

  8. Quantification of Drosophila Grooming Behavior.

    Science.gov (United States)

    Barradale, Francesca; Sinha, Kairav; Lebestky, Tim

    2017-07-19

    Drosophila grooming behavior is a complex multi-step locomotor program that requires coordinated movement of both forelegs and hindlegs. Here we present a grooming assay protocol and novel chamber design that is cost-efficient and scalable for either small or large-scale studies of Drosophila grooming. Flies are dusted all over their body with Brilliant Yellow dye and given time to remove the dye from their bodies within the chamber. Flies are then deposited in a set volume of ethanol to solubilize the dye. The relative spectral absorbance of dye-ethanol samples for groomed versus ungroomed animals are measured and recorded. The protocol yields quantitative data of dye accumulation for individual flies, which can be easily averaged and compared across samples. This allows experimental designs to easily evaluate grooming ability for mutant animal studies or circuit manipulations. This efficient procedure is both versatile and scalable. We show work-flow of the protocol and comparative data between WT animals and mutant animals for the Drosophila type I Dopamine Receptor (DopR).

  9. Radioresistance and radiosensitivity in Drosophila melanogaster

    International Nuclear Information System (INIS)

    Reguly, M.L.

    1983-01-01

    Studying the mechanisms controlling radioresistant in Drosophila the sensibility of four strains of Drosophila melanogaster to sex-linked recessive lethal mutations induced by 5kR Cobalt-60 gamma radiation and 0,006 M EMS or 0,25% of caffeine was determined. (M.A.C.) [pt

  10. Size control in development: lessons from Drosophila

    Indian Academy of Sciences (India)

    which mediates dosage compensation in Drosophila; Mol. Cell 4 117–122. Kelley R L, Meller V H, Gordadze P R, Roman G, Davis R L and Kuroda M I 1999 Epigenetic spreading of the Drosophila dosage compensation complex from rox RNA genes into flanking chromatin; Cell 98. 513–522. Lucchesi J C 1998 Dosage ...

  11. Australian Hackers and Ethics

    Directory of Open Access Journals (Sweden)

    M.J. Warren

    2003-05-01

    Full Text Available The aim of the paper is to look at the way hackers act and ways in which society can protect itself. The paper will show the current views and attitudes of hackers in an Australian context. The paper will also include a case study to show how a hacking incident can develop and how technology can be used to protect against hacking.

  12. Australian synchrotron radiation science

    International Nuclear Information System (INIS)

    White, J.W.

    1996-01-01

    Full text: The Australian Synchrotron Radiation Program, ASRP, has been set up as a major national research facility to provide facilities for scientists and technologists in physics, chemistry, biology and materials science who need access to synchrotron radiation. Australia has a strong tradition in crystallography and structure determination covering small molecule crystallography, biological and protein crystallography, diffraction science and materials science and several strong groups are working in x-ray optics, soft x-ray and vacuum ultra-violet physics. A number of groups whose primary interest is in the structure and dynamics of surfaces, catalysts, polymer and surfactant science and colloid science are hoping to use scattering methods and, if experience in Europe, Japan and USA can be taken as a guide, many of these groups will need third generation synchrotron access. To provide for this growing community, the Australian National Beamline at the Photon Factory, Tsukuba, Japan, has been established since 1990 through a generous collaboration with Japanese colleagues, the beamline equipment being largely produced in Australia. This will be supplemented in 1997 with access to the world's most powerful synchrotron x-ray source at the Advanced Photon Source, Argonne National Laboratory, USA. Some recent experiments in surface science using neutrons as well as x-rays from the Australian National Beamline will be used to illustrate one of the challenges that synchrotron x-rays may meet

  13. Conditions for Australian consent to reprocessing

    International Nuclear Information System (INIS)

    Anon.

    1980-01-01

    This article contains the text of the statement by the Australian Minister for Foreign Affairs to the House of Representatives, Noember 1980, on conditions for Australian consent to the reprocessing of nuclear material of Australian origin

  14. Review of Australian Higher Education: An Australian Policy Perspective

    Science.gov (United States)

    Montague, Alan

    2013-01-01

    Higher education is one of the key foundations that economic prosperity is founded upon. Government policies, funding and strategic planning require a fine balance to stimulate growth, prosperity health and well-being. The key Australian government policies influenced by a Review of Australian Higher Education report include attracting many more…

  15. Adaptive genic evolution in the Drosophila genomes

    DEFF Research Database (Denmark)

    Shapiro, Joshua A; Huang, Wei; Zhang, Chenhui

    2007-01-01

    and stable population. In this study, we sequenced 419 genes from 24 lines of Drosophila melanogaster and its close relatives. Together with data from Drosophila simulans, these data reveal the following. (i) Approximately 10% of the loci in regions of normal recombination are much less polymorphic at silent...... sites than expected, hinting at the action of selective sweeps. (ii) The level of polymorphism is negatively correlated with the rate of nonsynonymous divergence across loci. Thus, even under strict neutrality, the ratio of amino acid to silent nucleotide changes (A:S) between Drosophila species...

  16. Detection of cell death in Drosophila.

    Science.gov (United States)

    McCall, Kimberly; Peterson, Jeanne S; Pritchett, Tracy L

    2009-01-01

    Drosophila is a powerful model system for the identification of cell death genes and understanding the role of cell death in development. In this chapter, we describe three methods typically used for the detection of cell death in Drosophila. The TUNEL and acridine orange methods are used to detect dead or dying cells in a variety of tissues. We focus on methods for the embryo and the ovary, but these techniques can be used on other tissues as well. The third method is the detection of genetic interactions by expressing cell death genes in the Drosophila eye.

  17. Australian methane fluxes

    International Nuclear Information System (INIS)

    Williams, D.J.

    1990-01-01

    Estimates are provided for the amount of methane emitted annually into the atmosphere in Australia for a variety of sources. The sources considered are coal mining, landfill, motor vehicles, natural gas suply system, rice paddies, bushfires, termites, wetland and animals. This assessment indicates that the major sources of methane are natural or agricultural in nature and therefore offer little scope for reduction. Nevertheless the remainder are not trival and reduction of these fluxes could play a significant part in any Australian action on the greenhouse problem. 19 refs., 7 tabs., 1 fig

  18. Studies on Drosophila radiosensitivity strains

    International Nuclear Information System (INIS)

    Varentsova, E.R.; Sharygin, V.I.; Khromykh, Yu.U.

    1985-01-01

    Fertility of radiosensitive mutant drosophila female strain rad (2) 201 61 after irradiation and frequency of dominant lethal mutations (DLM), induced by γ-radiation for 0-5 h and 5-7 days, are investigated. It is shown, that oocytes of the mutant strain are more radiosensitive as compared with cells of mongrel flies as to criterion of DLM appearance over the period of maturing. Early oocytes of stages 2-7 are the most sensitive, i.e. at the stages, corresponding to the manifestation of previously established recombination-defective properties of mutations rad (2) 201 61 . It is also sown, that doses of γ-rays, exceeding 10 Gy produce a strong sterilizing effect on mutant females due to destruction and resorption of egg chambers, irradiated at the stages of previtellogenetic growth of oocytes. In females, carrying mutation of radiosensitivity there is no direct correlation betwen sensitivity of oocytes proper to DLM induction and sensitivity of egg folleicles to resorbing effect of γ-rays. The ways of possible involvement of mutant locus studied into genetic processes in various specialized cells of drosophila

  19. Differentiation of Drosophila glial cells.

    Science.gov (United States)

    Sasse, Sofia; Neuert, Helen; Klämbt, Christian

    2015-01-01

    Glial cells are important constituents of the nervous system and a hallmark of these cells are their pronounced migratory abilities. In Drosophila, glial lineages have been well described and some of the molecular mechanisms necessary to guide migrating glial cells to their final target sites have been identified. With the onset of migration, glial cells are already specified into one of five main glial cell types. The perineurial and subperineurial glial cells are eventually located at the outer surface of the Drosophila nervous system and constitute the blood-brain barrier. The cortex glial cells ensheath all neuroblasts and their progeny and reside within the central nervous system. Astrocyte-like cells invade the neuropil to control synaptic function and ensheathing glial cells encase the entire neuropil. Within the peripheral nervous system, wrapping glial cells ensheath individual axons or axon fascicles. Here, we summarize the current knowledge on how differentiation of glial cells into the specific subtypes is orchestrated. Furthermore, we discuss sequencing data that will facilitate further analyses of glial differentiation in the fly nervous system. © 2015 Wiley Periodicals, Inc.

  20. Functional Analysis of Drosophila NF1

    National Research Council Canada - National Science Library

    Bernards, Andre

    2005-01-01

    ...) for Ras, yet homozygous loss of a highly conserved Drosophila NF1 ortholog results in several phenotypes that are insensitive to manipulating Ras signal transduction, but rescued by increasing...

  1. Drosophila melanogaster gene expression changes after spaceflight.

    Data.gov (United States)

    National Aeronautics and Space Administration — Gene expression levels were determined in 3rd instar and adult Drosophila melanogaster reared during spaceflight to elucidate the genetic and molecular mechanisms...

  2. Modeling tumor invasion and metastasis in Drosophila

    Directory of Open Access Journals (Sweden)

    Wayne O. Miles

    2011-11-01

    Full Text Available Conservation of major signaling pathways between humans and flies has made Drosophila a useful model organism for cancer research. Our understanding of the mechanisms regulating cell growth, differentiation and development has been considerably advanced by studies in Drosophila. Several recent high profile studies have examined the processes constraining the metastatic growth of tumor cells in fruit fly models. Cell invasion can be studied in the context of an in vivo setting in flies, enabling the genetic requirements of the microenvironment of tumor cells undergoing metastasis to be analyzed. This Perspective discusses the strengths and limitations of Drosophila models of cancer invasion and the unique tools that have enabled these studies. It also highlights several recent reports that together make a strong case for Drosophila as a system with the potential for both testing novel concepts in tumor progression and cell invasion, and for uncovering players in metastasis.

  3. BM2(reinverted) of Drosophila melanogaster is

    Indian Academy of Sciences (India)

    -chromosome (Lucchesi et al. 2005). Dosage compensation and the phenomenon of. Keywords. dosage compensation; histone acetylation; chromatin remodelling; H4K16; MOF; Drosophila. Journal of Genetics, Vol. 87, No. 3, December 2008.

  4. The Drosophila bipectinata species complex: phylogenetic ...

    Indian Academy of Sciences (India)

    PARUL BANERJEE

    c Indian Academy of Sciences. RESEARCH ARTICLE. The Drosophila bipectinata species complex: phylogenetic relationship among different members based on chromosomal variations. PARUL BANERJEE and BASHISTH N. SINGH. ∗. Genetics Laboratory, Department of Zoology, Banaras Hindu University, Varanasi ...

  5. Ecdysteroid receptors in Drosophila melanogaster adult females

    Science.gov (United States)

    Ecdysteroid receptors were identified and partially characterized from total cell extracts of whole animals and dissected tissues from Drosophila melanogaster adult females. Binding studies indicated the presence of two ecdysteroid binding components having high affinity and specificity consistent w...

  6. On the Morphology of the Drosophila Heart

    Directory of Open Access Journals (Sweden)

    Barbara Rotstein

    2016-04-01

    Full Text Available The circulatory system of Drosophila melanogaster represents an easily amenable genetic model whose analysis at different levels, i.e., from single molecules up to functional anatomy, has provided new insights into general aspects of cardiogenesis, heart physiology and cardiac aging, to name a few examples. In recent years, the Drosophila heart has also attracted the attention of researchers in the field of biomedicine. This development is mainly due to the fact that several genes causing human heart disease are also present in Drosophila, where they play the same or similar roles in heart development, maintenance or physiology as their respective counterparts in humans. This review will attempt to briefly introduce the anatomy of the Drosophila circulatory system and then focus on the different cell types and non-cellular tissue that constitute the heart.

  7. Die induzierbare antivirale Immunantwort von Drosophila melanogaster

    OpenAIRE

    Kemp, Cordula

    2010-01-01

    In der vorliegenden Arbeit wurde Drosophila melanogaster als Modell ge- nutzt, um die angeborene Immunantwort gegen virale Infektionen zu studie- ren. Wir untersuchten mit Hilfe von genomweiten microarrays das Transkriptom von Fliegen, welche entweder mit dem Drosophila C Virus (DCV), dem Flock- house Virus (FHV) oder dem Sindbis Virus (SINV) infiziert waren. Infektion mit diesen drei positiv orientierten Einzelstrang RNS Viren führte zu einer starken transkriptionellen Antwort, welche deutlic...

  8. Mapping of gene mutations in drosophila melanogaster

    OpenAIRE

    Halvorsen, Charlotte Marie

    2004-01-01

    In this experiment, mutant genes of a given unknown mutant strain of Drosophila melanogaster were mapped to specific chromosomes. Drosophila melanogaster, commonly known as the fruit fly, was the appropriate choice for the organism to use in this specific experiment because of its relatively rapid life cycle of 10-14 days and because of the small amount of space and food neccessary for maintaining thousands of flies. The D. Melanogaster unknown strain specifically used in this experiment wa...

  9. A Drosophila Model for Screening Antiobesity Agents

    Directory of Open Access Journals (Sweden)

    Tran Thanh Men

    2016-01-01

    Full Text Available Although triacylglycerol, the major component for lipid storage, is essential for normal physiology, its excessive accumulation causes obesity in adipose tissue and is associated with organ dysfunction in nonadipose tissue. Here, we focused on the Drosophila model to develop therapeutics for preventing obesity. The brummer (bmm gene in Drosophila melanogaster is known to be homologous with human adipocyte triglyceride lipase, which is related to the regulation of lipid storage. We established a Drosophila model for monitoring bmm expression by introducing the green fluorescent protein (GFP gene as a downstream reporter of the bmm promoter. The third-instar larvae of Drosophila showed the GFP signal in all tissues observed and specifically in the salivary gland nucleus. To confirm the relationship between bmm expression and obesity, the effect of oral administration of glucose diets on bmm promoter activity was analyzed. The Drosophila flies given high-glucose diets showed higher lipid contents, indicating the obesity phenotype; this was suggested by a weaker intensity of the GFP signal as well as reduced bmm mRNA expression. These results demonstrated that the transgenic Drosophila model established in this study is useful for screening antiobesity agents. We also report the effects of oral administration of histone deacetylase inhibitors and some vegetables on the bmm promoter activity.

  10. Characterization of Autophagic Responses in Drosophila melanogaster.

    Science.gov (United States)

    Xu, T; Kumar, S; Denton, D

    2017-01-01

    Drosophila is an excellent model system for studying autophagy during animal development due to the availability of genetic reagents and opportunity for in vivo cell biological analysis. The regulation and mechanism of autophagy are highly evolutionarily conserved and the role of autophagy has been characterized during various stages of Drosophila development as well as following starvation. Studies in Drosophila have revealed novel insights into the role of distinct components of the autophagy machinery. This chapter describes protocols for examining autophagy during Drosophila development. A crucial step in the induction of autophagy is the incorporation of Atg8a into the autophagosome. This can be measured as autophagic puncta using live fluorescent imaging, immunostaining, or immunoblot analysis of LC3/Atg8a processing. The level of autophagy can also be examined using other specific components of the autophagy pathway as markers detected by immunofluorescent imaging. Based on the distinct morphology of autophagy, it can also be examined by transmission electron microscopy. In addition, one of the advantages of using Drosophila as a model is the ability to undertake genetic analysis of individual components of the autophagy machinery. Current approaches that can be used to monitor autophagy, including the overall flux and individual steps in Drosophila melanogaster, will be discussed. © 2017 Elsevier Inc. All rights reserved.

  11. New record for the invasive Spotted Wing Drosophila, Drosophila suzukii Matsumura (Diptera: Drosophilidae) in Anillaco, Argentina

    Science.gov (United States)

    The invasive Spotted Wing Drosophila (SWD), Drosophila suzukii Matsumura, is reported for the first time in La Rioja, Argentina. This represents a major range expansion for this species. The natural enemies of SWD, Leptopilina clavipes and Ganaspis hookeri were also collected with the SWD at the s...

  12. Effect of non-nutritive sugars to decrease the survivorship of spotted wing drosophila, Drosophila suzukii

    Science.gov (United States)

    In this study, we investigated the effects of non-nutritive sugars and sugar alcohols on the survivorship of spotted wing drosophila, Drosophila suzukii, and found erythritol and erythrose as potentially toxic to the fly. In a dose-dependent study, erythritol and erythrose significantly reduced fly ...

  13. Identification of four Drosophila allatostatins as the cognate ligands for the Drosophila orphan receptor DAR-2

    DEFF Research Database (Denmark)

    Lenz, C; Williamson, M; Hansen, G N

    2001-01-01

    to be the receptor for an intrinsic Drosophila A-type (cockroach-type) allatostatin. Here, we have permanently expressed DAR-2 in CHO cells and found that it is the cognate receptor for four Drosophila A-type allatostatins, the drostatins-A1 to -A4. Of all the drostatins, drostatin-A4 (Thr...

  14. The Australian synchrotron research program

    International Nuclear Information System (INIS)

    Garrett, R.F.

    1998-01-01

    Full text: The Australian Synchrotron Research Program (ASRP) was established in 1996 under a 5 year grant from the Australian Government, and is managed by ANSTO on behalf of a consortium of Australian universities and research organisations. It has taken over the operation of the Australian National Beamline Facility (ANBF) at the Photon Factory, and has joined two CATS at the Advanced Photon Source: the Synchrotron Radiation Instrumentation CAT (SRI-CAT) and the Consortium for Advanced Radiation Sources (CARS). The ASRP thus manages a comprehensive range of synchrotron radiation research facilities for Australian science. The ANBF is a general purpose hard X-ray beamline which has been in operation at the Photon Factory since 1993. It currently caters for about 35 Australian research teams per year. The facilities available at the ANBF will be presented and the research program will be summarised. The ASRP facilities at the APS comprise the 5 sectors operated by SRI-CAT, BioCARS and ChemMatCARS. A brief description will be given of the ASRP research programs at the APS, which will considerably broaden the scope of Australian synchrotron science

  15. Identification of four Drosophila allatostatins as the cognate ligands for the Drosophila orphan receptor DAR-2

    DEFF Research Database (Denmark)

    Lenz, C; Williamson, M; Hansen, G N

    2001-01-01

    The allatostatins are generally inhibitory insect neuropeptides. The Drosophila orphan receptor DAR-2 is a G-protein-coupled receptor, having 47% amino acid residue identity with another Drosophila receptor, DAR-1 (which is also called dros. GPCR, or DGR) that was previously shown...... to be the receptor for an intrinsic Drosophila A-type (cockroach-type) allatostatin. Here, we have permanently expressed DAR-2 in CHO cells and found that it is the cognate receptor for four Drosophila A-type allatostatins, the drostatins-A1 to -A4. Of all the drostatins, drostatin-A4 (Thr...... weakly in the brain. The Drosophila larval gut also contains about 20-30 endocrine cells, expressing the gene for the drostatins-A1 to -A4. We suggest, therefore, that DAR-2 mediates an allatostatin (drostatin)-induced inhibition of gut motility. This is the first report on the permanent and functional...

  16. Molecular neurobiology of Drosophila taste.

    Science.gov (United States)

    Freeman, Erica Gene; Dahanukar, Anupama

    2015-10-01

    Drosophila is a powerful model in which to study the molecular and cellular basis of taste coding. Flies sense tastants via populations of taste neurons that are activated by compounds of distinct categories. The past few years have borne witness to studies that define the properties of taste neurons, identifying functionally distinct classes of sweet and bitter taste neurons that express unique subsets of gustatory receptor (Gr) genes, as well as water, salt, and pheromone sensing neurons that express members of the pickpocket (ppk) or ionotropic receptor (Ir) families. There has also been significant progress in terms of understanding how tastant information is processed and conveyed to higher brain centers, and modulated by prior dietary experience or starvation. Copyright © 2015. Published by Elsevier Ltd.

  17. Gustatory Processing in Drosophila melanogaster.

    Science.gov (United States)

    Scott, Kristin

    2018-01-07

    The ability to identify nutrient-rich food and avoid toxic substances is essential for an animal's survival. Although olfaction and vision contribute to food detection, the gustatory system acts as a final checkpoint control for food acceptance or rejection. The vinegar fly Drosophila melanogaster tastes many of the same stimuli as mammals and provides an excellent model system for comparative studies of taste detection. The relative simplicity of the fly brain and behaviors, along with the molecular genetic and functional approaches available in this system, allow the examination of gustatory neural circuits from sensory input to motor output. This review discusses the molecules and cells that detect taste compounds in the periphery and the circuits that process taste information in the brain. These studies are providing insight into how the detection of taste compounds regulates feeding decisions.

  18. Australian coal industry continues expansion

    International Nuclear Information System (INIS)

    Edwards, G.E.

    1991-01-01

    Recent saleable Australian black coal production figures are given along with trends in development of new operations and new technology aiming to provide a sound basis for the continuing expansion of the Australian coal industry. Export prices from 1982 to 1991 to Japan (Australia's major export market) are provided, together with Australian dollar return to exporters at the exchange rate prevailing at the start of each contract year. An increased demand for steaming coal is expected, thus maintaining Australia's position as the world's larger exporter. 4 tabs

  19. Single Nucleotide Polymorphism Markers for Genetic Mapping in Drosophila melanogaster

    OpenAIRE

    Hoskins, Roger A.; Phan, Alexander C.; Naeemuddin, Mohammed; Mapa, Felipa A.; Ruddy, David A.; Ryan, Jessica J.; Young, Lynn M.; Wells, Trent; Kopczynski, Casey; Ellis, Michael C.

    2001-01-01

    For nearly a century, genetic analysis in Drosophila melanogaster has been a powerful tool for analyzing gene function, yet Drosophila lacks the molecular genetic mapping tools that recently have revolutionized human, mouse, and plant genetics. Here, we describe the systematic characterization of a dense set of molecular markers in Drosophila by using a sequence tagged site-based physical map of the genome. We identify 474 biallelic markers in standard laboratory strains of Drosophila that sp...

  20. Effect of Hawthorn on Drosophila Melanogaster Antioxidant-Related ...

    African Journals Online (AJOL)

    Purpose: To study the effects of various doses of hawthorn extract on Drosophila lifespan, antioxidant enzyme activity and expression of antioxidant-related regulation genes. Methods: Experiments with Drosophila as an animal model were conducted. The effects of hawthorn on Drosophila melanogaster antioxidant related ...

  1. Gut-associated microbes of Drosophila melanogaster

    Science.gov (United States)

    Broderick, Nichole; Lemaitre, Bruno

    2012-01-01

    There is growing interest in using Drosophila melanogaster to elucidate mechanisms that underlie the complex relationships between a host and its microbiota. In addition to the many genetic resources and tools Drosophila provides, its associated microbiota is relatively simple (1–30 taxa), in contrast to the complex diversity associated with vertebrates (> 500 taxa). These attributes highlight the potential of this system to dissect the complex cellular and molecular interactions that occur between a host and its microbiota. In this review, we summarize what is known regarding the composition of gut-associated microbes of Drosophila and their impact on host physiology. We also discuss these interactions in the context of their natural history and ecology and describe some recent insights into mechanisms by which Drosophila and its gut microbiota interact. “Workers with Drosophila have been considered fortunate in that they deal with the first multicellular invertebrate to be cultured monoxenically (Delcourt and Guyenot, 1910); the first to be handled axenically on a semisynthetic diet (Guyenot, 1917); and the first to be grown on a defined diet (Schultz et al., 1946). This list of advantages is somewhat embarrassing, since it implies an interest in nutrition that, in reality, was only secondary. The very first studies were concerned with the reduction of variability in genetic experiments (Delcourt and Guyenot, 1910) and standardization of the nutritional environment.” -James Sang, 1959 Ann NY Acad 1 PMID:22572876

  2. Receptor Tyrosine Kinases in Drosophila Development

    Science.gov (United States)

    Sopko, Richelle; Perrimon, Norbert

    2013-01-01

    Tyrosine phosphorylation plays a significant role in a wide range of cellular processes. The Drosophila genome encodes more than 20 receptor tyrosine kinases and extensive studies in the past 20 years have illustrated their diverse roles and complex signaling mechanisms. Although some receptor tyrosine kinases have highly specific functions, others strikingly are used in rather ubiquitous manners. Receptor tyrosine kinases regulate a broad expanse of processes, ranging from cell survival and proliferation to differentiation and patterning. Remarkably, different receptor tyrosine kinases share many of the same effectors and their hierarchical organization is retained in disparate biological contexts. In this comprehensive review, we summarize what is known regarding each receptor tyrosine kinase during Drosophila development. Astonishingly, very little is known for approximately half of all Drosophila receptor tyrosine kinases. PMID:23732470

  3. Viruses and Antiviral Immunity in Drosophila

    Science.gov (United States)

    Xu, Jie; Cherry, Sara

    2013-01-01

    Viral pathogens present many challenges to organisms, driving the evolution of a myriad of antiviral strategies to combat infections. A wide variety of viruses infect invertebrates, including both natural pathogens that are insect-restricted, and viruses that are transmitted to vertebrates. Studies using the powerful tools available in the model organism Drosophila have expanded our understanding of antiviral defenses against diverse viruses. In this review, we will cover three major areas. First, we will describe the tools used to study viruses in Drosophila. Second, we will survey the major viruses that have been studied in Drosophila. And lastly, we will discuss the well-characterized mechanisms that are active against these diverse pathogens, focusing on non-RNAi mediated antiviral mechanisms. Antiviral RNAi is discussed in another paper in this issue. PMID:23680639

  4. Apoptosis in Drosophila: which role for mitochondria?

    Science.gov (United States)

    Clavier, Amandine; Rincheval-Arnold, Aurore; Colin, Jessie; Mignotte, Bernard; Guénal, Isabelle

    2016-03-01

    It is now well established that the mitochondrion is a central regulator of mammalian cell apoptosis. However, the importance of this organelle in non-mammalian apoptosis has long been regarded as minor, mainly because of the absence of a crucial role for cytochrome c in caspase activation. Recent results indicate that the control of caspase activation and cell death in Drosophila occurs at the mitochondrial level. Numerous proteins, including RHG proteins and proteins of the Bcl-2 family that are key regulators of Drosophila apoptosis, constitutively or transiently localize in mitochondria. These proteins participate in the cell death process at different levels such as degradation of Diap1, a Drosophila IAP, production of mitochondrial reactive oxygen species or stimulation of the mitochondrial fission machinery. Here, we review these mitochondrial events that might have their counterpart in human.

  5. REDfly: a Regulatory Element Database for Drosophila.

    Science.gov (United States)

    Gallo, Steven M; Li, Long; Hu, Zihua; Halfon, Marc S

    2006-02-01

    Bioinformatics studies of transcriptional regulation in the metazoa are significantly hindered by the absence of readily available data on large numbers of transcriptional cis-regulatory modules (CRMs). Even the richly annotated Drosophila melanogaster genome lacks extensive CRM information. We therefore present here a database of Drosophila CRMs curated from the literature complete with both DNA sequence and a searchable description of the gene expression pattern regulated by each CRM. This resource should greatly facilitate the development of computational approaches to CRM discovery as well as bioinformatics analyses of regulatory sequence properties and evolution.

  6. An Australian view of the uranium market

    International Nuclear Information System (INIS)

    Lloyd, B.

    1978-01-01

    The subject is covered in sections, entitled as shown. Numerical data are indicated in parenthesis. Introduction (principal Australian uranium deposits, possible Australian production, estimates of world-wide uranium resources and production, estimates of world-wide uranium requirements); Australian marketing policy; commercial considerations; uncertainties affecting the industry, including unnecessary and undesirable government involvement, and supply and demand. (U.K.)

  7. Australian Journalists' Professional and Ethical Values.

    Science.gov (United States)

    Henningham, John

    1996-01-01

    Reports on the first comprehensive national study of Australian journalists. Finds that Australian journalists are similar to their United States colleagues in distributions of age, sex, and socioeconomic background, but have less formal education. Shows that Australians have mixed professional and ethical values and are committed both to…

  8. Genetic changeover in Drosophila populations

    International Nuclear Information System (INIS)

    Wallace, B.

    1986-01-01

    Three populations of Drosophila melanogaster that were daughter populations of two others with histories of high, continuous radiation exposure [population 5 (irradiated, small population size) gave rise to populations 17 (small) and 18 (large); population 6 (irradiated, large population size) gave rise to population 19 (large)] were maintained for 1 year with no radiation exposure. The frequency with which random combinations of second chromosomes taken from population 19 proved to be lethal changed abruptly after about 8 months, thus revealing the origin of a selectively favored element in that population. (This element may or may not have been the cause of the lethality.) A comparison of the loss of lethals in populations 17 and 18 with a loss that occurred concurrently in the still-irradiated population 5 suggests that a second, selectively favored element had arisen in that population just before populations 17 and 18 were split off. This element was on a nonlethal chromosome. The result in population 5 was the elimination of many lethals from that population, followed by a subsequent increase as mutations occurred in the favored nonlethal chromosome. Populations 17 and 18, with no radiation exposure, underwent a loss of lethals with no subsequent increase. The events described here, as well as others to be described elsewhere, suggest that populations may be subject to episodic periods of rapid gene frequency changes that occur under intense selection pressure. In the instances in which the changeover was revealed by the elimination of preexisting lethals, earlier lethal frequencies were reduced by approximately one-half; the selectively favored elements appear, then, to be favored in the heterozygous--not homozygous--condition

  9. The Australian solar scene

    Energy Technology Data Exchange (ETDEWEB)

    Cowley, Paul [IT Power Australia (Australia)

    2007-06-15

    This presentation mainly talks about the actions taken by the Australian country concerning the use of renewable energy and the reduction of the peak load in some areas. In the first part, there are found both the geographical aspects as well as the major political, e.g. Asia-Pacific Partnership on Clean development and Climate. There are also explained the issues related to peak load growth and it is shown a comparison graphic having information about the most used photovoltaic systems. Then, there are mentioned the communities that are testing one of the model photovoltaic systems in order to: reduce the peak load, use the energy in a properly way, reduce the energy cost, among others. Finally, it is succinctly explained the photovoltaic rebate program as well as the use of the off-grid systems, besides, it is given relevant information about those remote communities of Australia and the benefits of the implementation of Bushlight. [Spanish] Esta presentacion trata primordialmente de las acciones, referentes al uso de energia renovable, tomadas por Australia y creadas con el fin de reducir la maxima demanda en algunas regiones de este pais. En la primera parte, se encuentran tanto los aspectos geograficos como los principales aspectos politicos; por ejemplo, la Sociedad Asia-Pacifico para el Desarrollo no Contaminante y el Clima. Asimismo, se da una explicacion acerca de las cuestiones relacionadas al crecimiento de la maxima demanda; ademas, se muestra un cuadro comparativo, que contiene informacion relacionada con los sistemas fotovoltaicos mas utilizados. Despues, se mencionan aquellas comunidades que tienen en periodo de prueba alguno de los modelos fotovoltaicos con el fin de: reducir la maxima demanda, utilizar eficientemente la energia, reducir el costo de la misma, entre otros aspectos mas. Finalmente, se explica escuetamente el programa de reembolso centrado en el uso de sistemas fotovoltaicos, asi como el uso de sistemas asilados de la red; ademas, se

  10. Chromosomal localization of autosomal mutations in Drosophila ...

    Indian Academy of Sciences (India)

    Unknown

    1Drosophila Stock Centre, Department of Studies in Zoology, University of Mysore,. Manasagangotri, Mysore 570 006, ... of genetic markers. In the present study, we have exploited the differences in karyotypic composition between these two subspecies, and their cross-fertility, in order to localize some autosomal genes.

  11. Lamin C and chromatin organization in Drosophila

    Indian Academy of Sciences (India)

    wm4h; Su(var)205/lamCEX187 had nearly normal red eye colour with little evidence of variegation, in contrast to the variegated eyes of the PEV strains crossed to w1118 strains. (figure 5,A&B). Precise excisions of ..... 2003 A P- element insertion screen identified mutations in. 455 novel essential genes in Drosophila.

  12. Second-Order Conditioning in "Drosophila"

    Science.gov (United States)

    Tabone, Christopher J.; de Belle, J. Steven

    2011-01-01

    Associative conditioning in "Drosophila melanogaster" has been well documented for several decades. However, most studies report only simple associations of conditioned stimuli (CS, e.g., odor) with unconditioned stimuli (US, e.g., electric shock) to measure learning or establish memory. Here we describe a straightforward second-order conditioning…

  13. Behavioural reproductive isolation and speciation in Drosophila

    Indian Academy of Sciences (India)

    In the genus Drosophila, the phenomenon of behavioural reproductive isolation, which is an important type of premating (prezygotic) reproductive isolating mechanisms, has been extensively studied and interesting data have been documented. In many cases incomplete sexual isolation has been observed and the pattern ...

  14. The Drosophila melanogaster circadian pacemaker circuit

    Indian Academy of Sciences (India)

    2016-08-26

    Aug 26, 2016 ... As an experimental model system, the fruit fly Drosophila melanogaster has been seminal in shaping our understanding of the circadian clockwork. The wealth of genetic tools at our disposal over the past four decades has enabled discovery of the genetic and molecular bases of circadian rhythmicity.

  15. Functional Neuroanatomy of "Drosophila" Olfactory Memory Formation

    Science.gov (United States)

    Guven-Ozkan, Tugba; Davis, Ronald L.

    2014-01-01

    New approaches, techniques and tools invented over the last decade and a half have revolutionized the functional dissection of neural circuitry underlying "Drosophila" learning. The new methodologies have been used aggressively by researchers attempting to answer three critical questions about olfactory memories formed with appetitive…

  16. Biological effects of radon in Drosophila

    International Nuclear Information System (INIS)

    Pimentel P, A.E.; Tavera D, L.; Cruces M, M.P.; Arceo M, C.; Rosa D, M.E. de la

    1992-04-01

    The main objective of this investigation, is to study the biological effects of the Radon-222 at low dose in 'Drosophila melanogaster'. It is necessary to mention that these effects will analyze from the genetic point of view for: 1) To evaluate in which form the Radon-222 to low dose it influences in some genetic components of the adaptation in Drosophila, such as: fecundity, viability egg-adult and sex proportion. 2) To evaluate which is the genetic effect that induces the Radon to low dose by means of the SMART technique in Drosophila melanogaster, and this way to try of to identify which is the possible mechanism that causes the genetic damage to somatic level. The carried out investigation was divided in three stages: 1. Tests to the vacuum resistance. 2. Test of somatic mutation, and 3. Determination of the presence of radon daughters on the adult of Drosophila. It is necessary to point out that all the experiments were made by triplicate and in each one of them was placed detectors in preset places. Those obtained results are presented inside the 4 charts included in the present work. (Author)

  17. Egg-laying rhythm in Drosophila melanogaster

    Indian Academy of Sciences (India)

    Extensive research has been carried out to understand how circadian clocks regulate various physiological processes in organisms. The discovery of clock genes and the molecular clockwork has helped researchers to understand the possible role of these genes in regulating various metabolic processes. In Drosophila ...

  18. Radiation effects on the drosophila melanogaster genoma

    International Nuclear Information System (INIS)

    Arceo-Maldonado, C.

    1989-01-01

    When DNA of living beings has been damaged, the cells show different responses depending on their physiological state. Repair mechanisms can be classified into two groups: constitutive which are always present in the cells and inductible, which must be stimulated to show themselves. It is suggested that a repair mechanism exists in the drosophila ovules which act upon the damage present in mature spermatozoids. Our aim is to verify whether or not a radiation dosis applied to the female drosophila will modify the frequency of individuals which have lost the paternal sex chromosomes. YW/YW virgin females and XEZ males and fbb-/bS Y y + y were mated for two days in order to collect radiation treated spermatozoids. The results were consistent as to the parameters being evaluated and lead one to suppose that the radiation applied to the female drosophila produced some changes in the ovule metabolism which reduced the frequency of individuals with lost chromosomes. It is believed that ionizing radiation interferes with the repair mechanisms that are existent and constitutive, retarding and hindering the restoration of chromosome fragments and this brings about death of the zygote or death of the eggs which lessens the frequencies of individuals carriers of chromosomic aberrations. Ionizing radiations applied to the female drosophila modifies the frequency of loss of patternal chromosomes and comes about when the radiation dose to the female is 700 rad. (Author)

  19. Analysis of Phagocytosis in the Drosophila Ovary.

    Science.gov (United States)

    Meehan, Tracy L; Serizier, Sandy B; Kleinsorge, Sarah E; McCall, Kimberly

    2016-01-01

    Programmed cell death (PCD) is essential for health and development. Generally, the last step of PCD is clearance, or engulfment, by phagocytes. Engulfment can be broken down into five basic steps: attraction of the phagocyte, recognition of the dying cell, internalization, phagosome maturation, and acidification of the engulfed material. The Drosophila melanogaster ovary serves as an excellent model to study diverse types of PCD and engulfment by epithelial cells. Here, we describe several methods to detect and analyze multiple steps of engulfment in the Drosophila ovary: recognition, vesicle uptake, phagosome maturation, and acidification. Annexin V detects phosphatidylserine, which is flipped to the outer leaflet of the plasma membrane of apoptotic cells, serving as an "eat me" signal. Several germline markers including tral-GFP, Orb, and cleaved Dcp-1 can all be used to label the germline and visualize its uptake into engulfing follicle cells. Drosophila strains expressing GFP and mCherry protein fusions can enable a detailed analysis of phagosome maturation. LysoTracker labels highly acidified compartments, marking phagolysosomes. Together these labels can be used to mark the progression of engulfment in Drosophila follicle cells.

  20. The Drosophila melanogaster circadian pacemaker circuit

    Indian Academy of Sciences (India)

    2008-12-07

    Dec 7, 2008 ... large variety of tissues in the fly such as the eye, brain, pro- boscis, antennae, wings, abdomen, Malpighian tubules and testes (Plautz et al. 1997; Giebultowicz 2001). Although cell-autonomous circadian function is attributed to several tissues in Drosophila, circadian pacemaker neurons located in the brain ...

  1. Lamin C and chromatin organization in Drosophila

    Indian Academy of Sciences (India)

    Drosophila lamin C (LamC) is a developmentally regulated component of the nuclear lamina. The lamC gene is situated in the fifth intron of the essential gene tout velu (ttv). We carried out genetic analysis of lamC during development. Phenotypic analyses of RNAi-mediated downregulation of lamC expression as well as ...

  2. The Drosophila bipectinata species complex: phylogenetic ...

    Indian Academy of Sciences (India)

    Navya

    Acad. Sci India 82, 99-115. Tomimura Y., Matsuda, M. and Tobari, Y. N. 2005 Chromosomal phylogeny and geographical divergence in the Drosophila bipectinata complex. Genome 48, 487–502. White M. J. D. 1958 Restriction and recombination in grasshopper populations and species. Cold Spr. Harb. Symp. Quant. Biol.

  3. Sex determining signal in Drosophila melanogaster

    Indian Academy of Sciences (India)

    Administrator

    Drosophila; sex determination; X/A ratio; Sex-lethal. Sexual dimorphism is the most striking naturally occurring phenotypic variation that is a direct outcome of a simple. Mendelian segregation. Molecular genetic dissection of mechanisms underlying sexual development in organisms ranging from flies to humans has been a ...

  4. Radioresistance and radiosensitivity in Drosophila melanogaster

    International Nuclear Information System (INIS)

    Reguly, M.L.; Marques, E.K.

    1987-01-01

    The mechanisms of radioresistance in Drosophila are studied. The mutagenic effects of 5KR of 60 Cobalt gamma radiation and of 0,006M dose of ethyl methanesulfonate (EMS) on four D. Melanogaster strains (RC 1 , CO 3 , BUE and LEN) are investigated. (M.A.C.) [pt

  5. Drosophila Melanogaster as an Experimental Organism.

    Science.gov (United States)

    Rubin, Gerald M.

    1988-01-01

    Discusses the role of the fruit fly in genetics research requiring a multidisciplinary approach. Describes embryological and genetic methods used in the experimental analysis of this organism. Outlines the use of Drosophila in the study of the development and function of the nervous system. (RT)

  6. Drosophila melanogaster deoxyribonucleoside kinase activates gemcitabine

    DEFF Research Database (Denmark)

    Knecht, Wolfgang; Mikkelsen, N.E.; Clausen, A.R.

    2009-01-01

    Drosophila melanogaster multisubstrate deoxyribonucleoside kinase (Dm-dNK) can additionally sensitize human cancer cell lines towards the anti-cancer drug gemcitabine. We show that this property is based on the Dm-dNK ability to efficiently phosphorylate gemcitabine. The 2.2 angstrom resolution...

  7. Intersex (ix) mutations of Drosophila melanogaster cause ...

    Indian Academy of Sciences (India)

    In Drosophila, a hierarchy of regulatory genes control somatic sexual differences (Baker 1989; Burtis and ... also function independently of dsx to regulate other aspects of sexual differentiation in tissue-specific manner. .... bination, for facilitating the analysis of single and double mutant genotypes. Double homozygote males ...

  8. Mapping selection within Drosophila melanogaster embryo's anatomy

    DEFF Research Database (Denmark)

    Salvador-Martínez, Irepan; Coronado-Zamora, Marta; Castellano, David

    2018-01-01

    We present a survey of selection across Drosophila melanogaster embryonic anatomy. Our approach integrates genomic variation, spatial gene expression patterns and development, with the aim of mapping adaptation over the entire embryo's anatomy. Our adaptation map is based on analyzing spatial gen...

  9. Developing a Drosophila Model of Schwannomatosis

    Science.gov (United States)

    2013-02-01

    General Hospital Cancer Center, Harvard Medical School, Charlestown, Massachusetts 02129, USA; 2Computer Science and Artificial Intelligence Laboratory...1384–1387. 61. Petersen UM, Kadalayil L, Rehorn KP, Hoshizaki DK, Reuter R, et al. (1999) Serpent regulates Drosophila immunity genes in the larval

  10. Intersex (ix) mutations of Drosophila melanogaster cause ...

    Indian Academy of Sciences (India)

    In Drosophila melanogaster, the intersex (ix) is a terminally positioned gene in somatic sex determination hierarchy and function with the female specific product of double sex (DSXF) to implement female sexual differentiation. The null phenotype of ix is to transform diplo-X individuals into intersexes while leaving haplo-X ...

  11. The Drosophila bipectinata species complex: phylogenetic ...

    Indian Academy of Sciences (India)

    [Banerjee P. and Singh B. N. 2017 The Drosophila bipectinata species complex: phylogenetic relationship among different members based on chromosomal variations. J. Genet. 96, 97–107]. Introduction ..... loops touch the chromocenter and in our microphotograph. (depicting both the arms) too, the involvement of chromo-.

  12. Drosophila increase exploration after visually detecting predators.

    Directory of Open Access Journals (Sweden)

    Miguel de la Flor

    Full Text Available Novel stimuli elicit behaviors that are collectively known as specific exploration. These behaviors allow the animal to become more familiar with the novel objects within its environment. Specific exploration is frequently suppressed by defensive reactions to predator cues. Herein, we examine if this suppression occurs in Drosophila melanogaster by measuring the response of these flies to wild harvested predators. The flies used in our experiments have been cultured and had not lived under predator threat for multiple decades. In a circular arena with centrally-caged predators, wild type Drosophila actively avoided the pantropical jumping spider, Plexippus paykulli, and the Texas unicorn mantis, Phyllovates chlorophaena, indicating an innate defensive reaction to these predators. Interestingly, wild type Drosophila males also avoided a centrally-caged mock spider, and the avoidance of the mock spider became exaggerated when it was made to move within the cage. Visually impaired Drosophila failed to detect and avoid the Plexippus paykulli and the moving mock spider, while the broadly anosmic orco2 mutants were fully capable of detecting and avoiding Plexippus paykulli, indicating that these flies principally relied upon vison to perceive the predator stimuli. During early exploration of the arena, exploratory activity increased in the presence of Plexippus paykulli and the moving mock spider. The elevated activity induced by Plexippus paykulli disappeared after the fly had finished exploring, suggesting the flies were capable of habituating the predator cues. Taken together, these results indicate that despite being isolated from predators for decades Drosophila will visually detect these predators, retain innate defensive behaviors, respond by increasing exploratory activity in the arena rather than suppressing activity, and may habituate to normal predator cues.

  13. Optogenetic pacing in Drosophila melanogaster (Conference Presentation)

    Science.gov (United States)

    Alex, Aneesh; Li, Airong; Men, Jing; Jerwick, Jason; Tanzi, Rudolph E.; Zhou, Chao

    2016-03-01

    A non-invasive, contact-less cardiac pacing technology can be a powerful tool in basic cardiac research and in clinics. Currently, electrical pacing is the gold standard for cardiac pacing. Although highly effective in controlling the cardiac function, the invasive nature, non-specificity to cardiac tissues and possible tissue damage limits its capabilities. Optical pacing of heart is a promising alternative, which is non-invasive and more specific, has high spatial and temporal precision, and avoids shortcomings in electrical stimulation. Optical coherence tomography has been proved to be an effective technique in non-invasive imaging in vivo with ultrahigh resolution and imaging speed. In the last several years, non-invasive specific optical pacing in animal hearts has been reported in quail, zebrafish, and rabbit models. However, Drosophila Melanogaster, which is a significant model with orthologs of 75% of human disease genes, has rarely been studied concerning their optical pacing in heart. Here, we combined optogenetic control of Drosophila heartbeat with optical coherence microscopy (OCM) technique for the first time. The light-gated cation channel, channelrhodopsin-2 (ChR2) was specifically expressed by transgene as a pacemaker in drosophila heart. By stimulating the pacemaker with 472 nm pulsed laser light at different frequencies, we achieved non-invasive and more specific optical control of the Drosophila heart rhythm, which demonstrates the wide potential of optical pacing for studying cardiac dynamics and development. Imaging capability of our customized OCM system was also involved to observe the pacing effect visually. No tissue damage was found after long exposure to laser pulses, which proved the safety of optogenetic control of Drosophila heart.

  14. Australian Queer Science Fiction Fans.

    Science.gov (United States)

    Kerry, Stephen Craig

    2017-10-23

    Science fiction (sf) does more than provide a fleeting moment of entertainment; it has many personal and social functions. In addition to offering audiences "romantic escapism" (Gerrold, 1996, pp. 5-6), sf also enables the "postulation of an alternative reality from which to contemplate this one" (Gerrold, 1996, pp. 5-6); as such, it is especially important "for groups which have had limited stakes in the status quo" (Jenkins, 1995, p. 242). To date, no research has been undertaken on the relationship between Australian queers and sf fandom. This article reports the findings of an online survey and explores the psycho-social features of Australian queer sf fans and why they like the genre. While the characteristics of this sample mirror those of Australian queers generally, they also have slightly higher rates of mental illness and are far more likely to state they have "no religion." Furthermore, while enjoying the "sciency" (P10, bisexual woman) aspects of sf, Australian queers also like the "poignant metaphors for our own civilization" (P45, asexual man).

  15. The 2005 Australian Informatics Competition

    Science.gov (United States)

    Clark, David

    2006-01-01

    This article describes the Australian Informatics Competition (AIC), a non-programming competition aimed at identifying students with potential in programming and algorithmic design. It is the first step in identifying students to represent Australia at the International Olympiad in Informatics. The main aim of the AIC is to increase awareness of…

  16. Energy and the Australian economy

    International Nuclear Information System (INIS)

    Brain, P.; Schuyers, G.

    1981-01-01

    The economic consequences of developing, and of failing to develop, potential sources of energy in Australia are examined. The analysis is preceded by a review of the past and present structure and performance of the Australian energy sector and a survey of the prospective world demand for energy in its various forms

  17. Australian Naturalism and Its Critics.

    Science.gov (United States)

    Hyung, Park Sun

    1997-01-01

    Details the ongoing debate between Australian naturalists and their critics since the publication of C.W. Evers and G. Lakomski's seminal book "Knowing Educational Administration." Examines critics' views in several categories: the coherence concept, coherentism criteria, the naturalistic fallacy, and questions concerning foundations and…

  18. Organization and evolution of Drosophila terminin: similarities and differences between Drosophila and human telomeres

    Directory of Open Access Journals (Sweden)

    Grazia Daniela Raffa

    2013-05-01

    Full Text Available Drosophila lacks telomerase and fly telomeres are elongated by occasional transposition of three specialized retroelements. Drosophila telomeres do not terminate with GC-rich repeats and are assembled independently of the sequence of chromosome ends. Recent work has shown that Drosophila telomeres are capped by the terminin complex, which includes the fast-evolving proteins HOAP, HipHop, Moi and Ver. These proteins are not conserves outside Drosophilidae and localize and function exclusively at telomeres, protecting them from fusion events. Other proteins required to prevent end-to-end fusion in flies include HP1, Eff/UbcD1, ATM, the components of the Mre11-Rad50-Nbs (MRN complex, and the Woc transcription factor. These proteins do not share the terminin properties; they are evolutionarily conserved non-fast-evolving proteins that do not accumulate only telomeres and do not serve telomere-specific functions. We propose that following telomerase loss, Drosophila rapidly evolved terminin to bind chromosome ends in a sequence-independent manner. This hypothesis suggests that terminin is the functional analog of the shelterin complex that protects human telomeres. The non-terminin proteins are instead likely to correspond to ancestral telomere-associated proteins that did not evolve as rapidly as terminin because of the functional constraints imposed by their involvement in diverse cellular processes. Thus, it appears that the main difference between Drosophila and human telomeres is in the protective complexes that specifically associate with the DNA termini. We believe that Drosophila telomeres offer excellent opportunities for investigations on human telomere biology. The identification of additional Drosophila genes encoding non-terminin proteins involved in telomere protection might lead to the discovery of novel components of human telomeres.

  19. Boomerang - the Australian light source

    International Nuclear Information System (INIS)

    Boldeman, J.W.; Garrett, R.F.

    2000-01-01

    Full text: The Australian Synchrotron Research Program (ASRP) was one of seven major national research facilities funded by the Federal Government in December 1995. The program provides guaranteed access and travel funds for Australian scientists to conduct synchrotron radiation-based research at two overseas facilities - the Photon Factory at Tsukuba in Japan and the Advanced Photon Source at the Argonne National Laboratory in the US. The Federal Government also provided funding of $100K to carry out a Feasibility Study for an Australian-based facility. This has been completed and included a mission to a number of laboratories overseas that were or had recently constructed a facility that could be considered for Australia. Following the mission, consensus was achieved within the community for the specifications of a proposed Australian facility. The proposed facility, Boomerang, has an energy of 3 GeV, an emittance of 16 nm rad and will be equipped in the first phase with 9 instrument stations. Boomerang will be competitive in performance with other facilities currently under construction overseas. A detailed proposal has been submitted to the Federal Government for funding. No site has been specified in the proposal. The proposal was prepared within the Australian Synchrotron Research Program (ASRP) following extensive consultation with industrial and scientific groups in all Australian states. Valuable contributions have been made by members of all the committees of the ASRP, the Australian synchrotron research community that works through the ASRP and the National Synchrotron Steering Committee. Important contributions have also been made by many industrial groups including consortia in Victoria, Queensland and New South Wales. The input from the ANKA staff at Forschungszentrum Karlsruhe and, in particular. Professor Einfeld has been a critical component. The estimated capital cost of a no frills laboratory has been estimated to be $100M in 1999 dollars. The

  20. FlyTED: the Drosophila Testis Gene Expression Database

    OpenAIRE

    Zhao, Jun; Klyne, Graham; Benson, Elizabeth; Gudmannsdottir, Elin; White-Cooper, Helen; Shotton, David

    2009-01-01

    FlyTED, the Drosophila Testis Gene Expression Database, is a biological research database for gene expression images from the testis of the fruit fly Drosophila melanogaster. It currently contains 2762 mRNA in situ hybridization images and ancillary metadata revealing the patterns of gene expression of 817 Drosophila genes in testes of wild type flies and of seven meiotic arrest mutant strains in which spermatogenesis is defective. This database has been built by adapting a widely used digita...

  1. Early Olfactory Processing in Drosophila: Mechanisms and Principles

    OpenAIRE

    Wilson, Rachel I.

    2013-01-01

    In the olfactory system of Drosophila melanogaster, it is relatively straightforward to make in vivo measurements of activity in neurons corresponding to targeted processing. This, together with the numerical simplicity of the Drosophila olfactory system, has produced rapid gains in our understanding of Drosophila olfaction. This review summarizes the neurophysiology of the first two layers of this system: the peripheral olfactory receptor neurons and their postsynaptic targets in the antenna...

  2. Molecular cloning, functional expression, and gene silencing of two Drosophila receptors for the Drosophila neuropeptide pyrokinin-2

    DEFF Research Database (Denmark)

    Rosenkilde, Carina; Cazzamali, Giuseppe; Williamson, Michael

    2003-01-01

    The database of the Drosophila Genome Project contains the sequences of two genes, CG8784 and CG8795, predicted to code for two structurally related G protein-coupled receptors. We have cloned these genes and expressed their coding parts in Chinese hamster ovary cells. We found that both receptors...... can be activated by low concentrations of the Drosophila neuropeptide pyrokinin-2 (CG8784, EC(50) for pyrokinin-2, 1x10(-9)M; CG8795, EC(50) for pyrokinin-2, 5 x 10(-10)M). The precise role of Drosophila pyrokinin-2 (SVPFKPRLamide) in Drosophila is unknown, but in other insects, pyrokinins have...... embryos and first instar larvae. In addition to the two Drosophila receptors, we also identified two probable pyrokinin receptors in the genomic database from the malaria mosquito Anopheles gambiae. The two Drosophila pyrokinin receptors are, to our knowledge, the first invertebrate pyrokinin receptors...

  3. Origin and Evolution of Y chromosomes: Drosophila tales

    Science.gov (United States)

    Carvalho, A. Bernardo; Koerich, Leonardo B.; Clark, Andrew G.

    2010-01-01

    Classically Y chromosomes are thought to originate from X chromosomes through a process of degeneration and gene loss. Now, the availability of 12 Drosophila genomes provides the opportunity to study the origin and evolution of Y chromosomes in an informative phylogenetic context. Surprisingly, the majority of Drosophila Y-linked genes are recent acquisitions from autosomes, and Y chromosome gene gains are more frequent than gene losses. Moreover, the D. pseudoobscura Y chromosome lacks homology with the Y of most Drosophila species. Thus the Drosophila Y has a different evolutionary history from canonical Y chromosomes (such as the mammalian Y), and it also might have a different origin. PMID:19443075

  4. Mutants dissecting development and behaviour in drosophila

    International Nuclear Information System (INIS)

    Joshi, Adita; Chandrashekaran, Shanti; Sharma, R.P.

    2005-01-01

    We have traced in this paper the progress in Drosophila genetics research from the 1960s, at the IARI, spearheaded by the visionary insight of M. S. Swaminathan. The work started with the study of indirect effect of radiation and the synergistic interaction of physical and chemical mutagens on chromosomal and genetic changes. This paved the way for the study of single gene mutants in dissecting developmental and behavioural processes. New genes discovered by us have been shown to encode conserved cell signalling molecules controlling developmental and behavioural pathways. With the complete sequencing of the Drosophila genome, in the year 2000, mounting evidence for the homology between Drosophila and human genes controlling genetic disorders became available. This has led to the fly becoming an indispensable tool for studying human diseases as well as a model to test for drugs and pharmaceuticals against human diseases and complex behavioural processes. For example wingless in Drosophila belongs to the conserved Wnt gene family and aberrant WNT signalling is linked to a range of human diseases, most notably cancer. Inhibition as well as activation of WNT signalling form the basis of an effective therapy for some cancers as well as several other clinical conditions. Recent experiments have shown that WNTs might also normally participate in self-renewal, proliferation or differentiation of stem cells and altering WNT signalling might be beneficial to the use of stem cells for therapeutic means. Likewise, the stambhA mutant of Drosophila which was discovered for its temperature-dependent paralytic behaviour is the fly homologue of Phospholipase Cβ. Phospholipase C mediated G protein signalling plays a central role in vital processes controlling epilepsy, vision, taste, and olfaction in animals. Proteins of the G-signalling pathway are of intense research interest since many human diseases involve defects in G-protein signalling pathways. In fact, approximately 50

  5. Transcriptome analysis of Drosophila neural stem cells.

    Science.gov (United States)

    Gold, Katrina S; Brand, Andrea H

    2012-01-01

    In Drosophila, the central nervous system is populated by a set of asymmetrically dividing neural stem cells called neuroblasts. Neuroblasts are derived from epithelial or neuroepithelial precursors, and divide along their apico-basal axes to produce a large apical neuroblast and a smaller basal ganglion mother cell. The ganglion mother cell will divide once again to produce two post-mitotic neurons or glia. In this chapter we outline a method for labeling different types of neural precursors in the Drosophila central nervous system, followed by their extraction and processing for transcriptome analysis. This technique has allowed us to capture and compare the expression profiles of neuroblasts and neuroepithelial cells, resulting in the identification of key genes required for the regulation of self-renewal and differentiation.

  6. Drosophila VAMP7 regulates Wingless intracellular trafficking.

    Science.gov (United States)

    Gao, Han; He, Fang; Lin, Xinhua; Wu, Yihui

    2017-01-01

    Drosophila Wingless (Wg) is a morphogen that determines cell fate during development. Previous studies have shown that endocytic pathways regulate Wg trafficking and signaling. Here, we showed that loss of vamp7, a gene required for vesicle fusion, dramatically increased Wg levels and decreased Wg signaling. Interestingly, we found that levels of Dally-like (Dlp), a glypican that can interact with Wg to suppress Wg signaling at the dorsoventral boundary of the Drosophila wing, were also increased in vamp7 mutant cells. Moreover, Wg puncta in Rab4-dependent recycling endosomes were Dlp positive. We hypothesize that VAMP7 is required for Wg intracellular trafficking and the accumulation of Wg in Rab4-dependent recycling endosomes might affect Wg signaling.

  7. Maintenance of a Drosophila melanogaster Population Cage.

    Science.gov (United States)

    Caravaca, Juan Manuel; Lei, Elissa P

    2016-03-15

    Large quantities of DNA, RNA, proteins and other cellular components are often required for biochemistry and molecular biology experiments. The short life cycle of Drosophila enables collection of large quantities of material from embryos, larvae, pupae and adult flies, in a synchronized way, at a low economic cost. A major strategy for propagating large numbers of flies is the use of a fly population cage. This useful and common tool in the Drososphila community is an efficient way to regularly produce milligrams to tens of grams of embryos, depending on uniformity of developmental stage desired. While a population cage can be time consuming to set up, maintaining a cage over months takes much less time and enables rapid collection of biological material in a short period. This paper describes a detailed and flexible protocol for the maintenance of a Drosophila melanogaster population cage, starting with 1.5 g of harvested material from the previous cycle.

  8. Adaptive Evolution of Gene Expression in Drosophila

    Directory of Open Access Journals (Sweden)

    Armita Nourmohammad

    2017-08-01

    Full Text Available Gene expression levels are important quantitative traits that link genotypes to molecular functions and fitness. In Drosophila, population-genetic studies have revealed substantial adaptive evolution at the genomic level, but the evolutionary modes of gene expression remain controversial. Here, we present evidence that adaptation dominates the evolution of gene expression levels in flies. We show that 64% of the observed expression divergence across seven Drosophila species are adaptive changes driven by directional selection. Our results are derived from time-resolved data of gene expression divergence across a family of related species, using a probabilistic inference method for gene-specific selection. Adaptive gene expression is stronger in specific functional classes, including regulation, sensory perception, sexual behavior, and morphology. Moreover, we identify a large group of genes with sex-specific adaptation of expression, which predominantly occurs in males. Our analysis opens an avenue to map system-wide selection on molecular quantitative traits independently of their genetic basis.

  9. Neural control of aggression in Drosophila.

    Science.gov (United States)

    Hoopfer, Eric D

    2016-06-01

    Like most animal species, fruit flies fight to obtain and defend resources essential to survival and reproduction. Aggressive behavior in Drosophila is genetically specified and also strongly influenced by the fly's social context, past experiences and internal states, making it an excellent framework for investigating the neural mechanisms that regulate complex social behaviors. Here, I summarize our current knowledge of the neural control of aggression in Drosophila and discuss recent advances in understanding the sensory pathways that influence the decision to fight or court, the neuromodulatory control of aggression, the neural basis by which internal states can influence both fighting and courtship, and how social experience modifies aggressive behavior. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Counting Calories in Drosophila Diet Restriction

    Science.gov (United States)

    Min, Kyung-Jin; Flatt, Thomas; Kulaots, Indrek; Tatar, Marc

    2007-01-01

    The extension of life span by diet restriction in Drosophila has been argued to occur without limiting calories. Here we directly measure the calories assimilated by flies when maintained on full- and restricted-diets. We find that caloric intake is reduced on all diets that extend life span. Flies on low-yeast diet are long-lived and consume about half the calories of flies on high yeast diets, regardless of the energetic content of the diet itself. Since caloric intake correlates with yeast concentration and thus with the intake of every metabolite in this dietary component, it is premature to conclude for Drosophila that calories do not explain extension of life span. PMID:17125951

  11. The fabulous destiny of the Drosophila heart.

    Science.gov (United States)

    Medioni, Caroline; Sénatore, Sébastien; Salmand, Pierre-Adrien; Lalevée, Nathalie; Perrin, Laurent; Sémériva, Michel

    2009-10-01

    For the last 15 years the fly cardiovascular system has attracted developmental geneticists for its potential as a model system of organogenesis. Heart development in Drosophila indeed provides a remarkable system for elucidating the basic molecular and cellular mechanisms of morphogenesis and, more recently, for understanding the genetic control of cardiac physiology. The success of these studies can in part be attributed to multidisciplinary approaches, the multiplicity of existing genetic tools, and a detailed knowledge of the system. Striking similarities with vertebrate cardiogenesis have long been stressed, in particular concerning the conservation of key molecular regulators of cardiogenesis and the new data presented here confirm Drosophila cardiogenesis as a model not only for organogenesis but also for the study of molecular mechanisms of human cardiac disease.

  12. Remembering components of food in Drosophila

    Directory of Open Access Journals (Sweden)

    Gaurav eDas

    2016-02-01

    Full Text Available Remembering features of past feeding experience can refine foraging and food choice. Insects can learn to associate sensory cues with components of food, such as sugars, amino acids, water, salt, alcohol, toxins and pathogens. In the fruit fly Drosophila some food components activate unique subsets of dopaminergic neurons that innervate distinct functional zones on the mushroom bodies. This architecture suggests that the overall dopaminergic neuron population could provide a potential cellular substrate through which the fly might learn to value a variety of food components. In addition, such an arrangement predicts that individual component memories reside in unique locations. Dopaminergic neurons are also critical for food memory consolidation and deprivation-state dependent motivational control of the expression of food-relevant memories. Here we review our current knowledge of how nutrient-specific memories are formed, consolidated and specifically retrieved in insects, with a particular emphasis on Drosophila.

  13. Development of larval motor circuits in Drosophila.

    Science.gov (United States)

    Kohsaka, Hiroshi; Okusawa, Satoko; Itakura, Yuki; Fushiki, Akira; Nose, Akinao

    2012-04-01

    How are functional neural circuits formed during development? Despite recent advances in our understanding of the development of individual neurons, little is known about how complex circuits are assembled to generate specific behaviors. Here, we describe the ways in which Drosophila motor circuits serve as an excellent model system to tackle this problem. We first summarize what has been learned during the past decades on the connectivity and development of component neurons, in particular motor neurons and sensory feedback neurons. We then review recent progress in our understanding of the development of the circuits as well as studies that apply optogenetics and other innovative techniques to dissect the circuit diagram. New approaches using Drosophila as a model system are now making it possible to search for developmental rules that regulate the construction of neural circuits. © 2012 The Authors Development, Growth & Differentiation © 2012 Japanese Society of Developmental Biologists.

  14. The translation factors of Drosophila melanogaster.

    Science.gov (United States)

    Marygold, Steven J; Attrill, Helen; Lasko, Paul

    2017-01-02

    Synthesis of polypeptides from mRNA (translation) is a fundamental cellular process that is coordinated and catalyzed by a set of canonical 'translation factors'. Surprisingly, the translation factors of Drosophila melanogaster have not yet been systematically identified, leading to inconsistencies in their nomenclature and shortcomings in functional (Gene Ontology, GO) annotations. Here, we describe the complete set of translation factors in D. melanogaster, applying nomenclature already in widespread use in other species, and revising their functional annotation. The collection comprises 43 initiation factors, 12 elongation factors, 3 release factors and 6 recycling factors, totaling 64 of which 55 are cytoplasmic and 9 are mitochondrial. We also provide an overview of notable findings and particular insights derived from Drosophila about these factors. This catalog, together with the incorporation of the improved nomenclature and GO annotation into FlyBase, will greatly facilitate access to information about the functional roles of these important proteins.

  15. Exquisite light sensitivity of Drosophila melanogaster cryptochrome.

    Directory of Open Access Journals (Sweden)

    Pooja Vinayak

    Full Text Available Drosophila melanogaster shows exquisite light sensitivity for modulation of circadian functions in vivo, yet the activities of the Drosophila circadian photopigment cryptochrome (CRY have only been observed at high light levels. We studied intensity/duration parameters for light pulse induced circadian phase shifts under dim light conditions in vivo. Flies show far greater light sensitivity than previously appreciated, and show a surprising sensitivity increase with pulse duration, implying a process of photic integration active up to at least 6 hours. The CRY target timeless (TIM shows dim light dependent degradation in circadian pacemaker neurons that parallels phase shift amplitude, indicating that integration occurs at this step, with the strongest effect in a single identified pacemaker neuron. Our findings indicate that CRY compensates for limited light sensitivity in vivo by photon integration over extraordinarily long times, and point to select circadian pacemaker neurons as having important roles.

  16. Motor Control of Drosophila Courtship Song

    Directory of Open Access Journals (Sweden)

    Troy R. Shirangi

    2013-11-01

    Full Text Available Many animals utilize acoustic signals—or songs—to attract mates. During courtship, Drosophila melanogaster males vibrate a wing to produce trains of pulses and extended tone, called pulse and sine song, respectively. Courtship songs in the genus Drosophila are exceedingly diverse, and different song features appear to have evolved independently of each other. How the nervous system allows such diversity to evolve is not understood. Here, we identify a wing muscle in D. melanogaster (hg1 that is uniquely male-enlarged. The hg1 motoneuron and the sexually dimorphic development of the hg1 muscle are required specifically for the sine component of the male song. In contrast, the motoneuron innervating a sexually monomorphic wing muscle, ps1, is required specifically for a feature of pulse song. Thus, individual wing motor pathways can control separate aspects of courtship song and may provide a “modular” anatomical substrate for the evolution of diverse songs.

  17. Plasticity in the Drosophila larval visual System

    Directory of Open Access Journals (Sweden)

    Abud J Farca-Luna

    2013-07-01

    Full Text Available The remarkable ability of the nervous system to modify its structure and function is mostly experience and activity modulated. The molecular basis of neuronal plasticity has been studied in higher behavioral processes, such as learning and memory formation. However, neuronal plasticity is not restricted to higher brain functions, but may provide a basic feature of adaptation of all neural circuits. The fruit fly Drosophila melanogaster provides a powerful genetic model to gain insight into the molecular basis of nervous system development and function. The nervous system of the larvae is again a magnitude simpler than its adult counter part, allowing the genetic assessment of a number of individual genetically identifiable neurons. We review here recent progress on the genetic basis of neuronal plasticity in developing and functioning neural circuits focusing on the simple visual system of the Drosophila larva.

  18. Rapid matching in Drosophila place learning

    Science.gov (United States)

    Zars, Melissa; Zars, Troy

    2009-08-01

    The level of conditioned behavior in animals is proportional to the intensity, amount, frequency, or probability of reinforcement. Interestingly, this matching can be dynamic, with performance levels following, for example, a switch in the probability of reinforcement with a short delay. We previously found that conditioned performance levels in Drosophila match reinforcement intensity in a place conditioning paradigm. Whether Drosophila can match conditioned behavior to a change in reinforcement intensity was an open question. In this study, we found that both conditioned behavior and memory levels match reinforcement intensity after a switch, and this rapid matching occurs within 2 min. Thus, fruit flies can dynamically match conditioned behavior and memory levels to a change in reinforcement intensity.

  19. Genetics and neurobiology of aggression in Drosophila

    OpenAIRE

    Zwarts, Liesbeth; Versteven, Marijke; Callaerts, Patrick

    2012-01-01

    Aggressive behavior is widely present throughout the animal kingdom and is crucial to ensure survival and reproduction. Aggressive actions serve to acquire territory, food, or mates and in defense against predators or rivals; while in some species these behaviors are involved in establishing a social hierarchy. Aggression is a complex behavior, influenced by a broad range of genetic and environmental factors. Recent studies in Drosophila provide insight into the genetic basis and control of a...

  20. Structure and Development of Glia in Drosophila

    OpenAIRE

    Hartenstein, Volker

    2011-01-01

    Insect glia represents a conspicuous and diverse population of cells and plays a role in controlling neuronal progenitor proliferation, axonal growth, neuronal differentiation and maintenance, and neuronal function. Genetic studies in Drosophila have elucidated many aspects of glial structure, function and development. Just as in vertebrates, it appears as if different classes of glial cells are specialized for different functions. Based on topology and cell shape, glial cells of the central ...

  1. Ultrastructural Analysis of Myoblast Fusion in Drosophila

    OpenAIRE

    Zhang, Shiliang; Chen, Elizabeth H.

    2008-01-01

    Myoblast fusion in Drosophila has become a powerful genetic system with which to unravel the mechanisms underlying cell fusion. The identification of important components of myoblast fusion by genetic analysis has led to a molecular pathway toward our understanding of this cellular process. In addition to the application of immunohistochemistry and live imaging techniques to visualize myoblast fusion at the light microscopic level, ultrastructural analysis using electron microscopy remains an...

  2. Organization Of The Drosophila Larval Visual Circuit

    OpenAIRE

    Fritsch, Pauline; Gendre, Nanae; Maier, Larisa; Fetter, Rick; Schneider-Mizell, Casey; Truman, James; Zlatic, Marta; Cardona, Albert; Larderet, Ivan; Sprecher, Simon

    2017-01-01

    Visual systems transduce, process and transmit light-dependent environmental cues. Computation of visual features depends on the types of photoreceptor neurons (PR) present, the organization of the eye and the wiring of the underlying neural circuit. Here, we describe the circuit architecture of the visual system of Drosophila larvae by mapping the synaptic wiring diagram and neurotransmitters. By contacting different targets, the two larval PR-subtypes create parallel circuits potentially un...

  3. A Drosophila Model to Image Phagosome Maturation

    Directory of Open Access Journals (Sweden)

    Douglas A. Brooks

    2013-03-01

    Full Text Available Phagocytosis involves the internalization of extracellular material by invagination of the plasma membrane to form intracellular vesicles called phagosomes, which have functions that include pathogen degradation. The degradative properties of phagosomes are thought to be conferred by sequential fusion with endosomes and lysosomes; however, this maturation process has not been studied in vivo. We employed Drosophila hemocytes, which are similar to mammalian professional macrophages, to establish a model of phagosome maturation. Adult Drosophila females, carrying transgenic Rab7-GFP endosome and Lamp1-GFP lysosome markers, were injected with E. coli DH5α and the hemocytes were collected at 15, 30, 45 and 60 minutes after infection. In wild-type females, E. coli were detected within enlarged Rab7-GFP positive phagosomes at 15 to 45 minutes after infection; and were also observed in enlarged Lamp1-GFP positive phagolysosomes at 45 minutes. Two-photon imaging of hemocytes in vivo confirmed this vesicle morphology, including enlargement of Rab7-GFP and Lamp1-GFP structures that often appeared to protrude from hemocytes. The interaction of endosomes and lysosomes with E. coli phagosomes observed in Drosophila hemocytes was consistent with that previously described for phagosome maturation in human ex vivo macrophages. We also tested our model as a tool for genetic analysis using 14-3-3e mutants, and demonstrated altered phagosome maturation with delayed E. coli internalization, trafficking and/or degradation. These findings demonstrate that Drosophila hemocytes provide an appropriate, genetically amenable, model for analyzing phagosome maturation ex vivo and in vivo.

  4. Adaptive dynamics of cuticular hydrocarbons in Drosophila

    Czech Academy of Sciences Publication Activity Database

    Rajpurohit, S.; Hanus, Robert; Vrkoslav, Vladimír; Behrman, E. L.; Bergland, A. O.; Petrov, D.; Cvačka, Josef; Schmidt, P. S.

    2017-01-01

    Roč. 30, č. 1 (2017), s. 66-80 ISSN 1010-061X R&D Projects: GA ČR GAP206/12/1093 Institutional support: RVO:61388963 Keywords : cuticular hydrocarbons * Drosophila * experimental evolution * spatiotemporal variation * thermal plasticity Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Biology (theoretical, mathematical, thermal, cryobiology, biological rhythm), Evolutionary biology Impact factor: 2.792, year: 2016 http://onlinelibrary.wiley.com/doi/10.1111/jeb.12988/full

  5. Neurophysiology of Drosophila Models of Parkinson's Disease

    OpenAIRE

    West, Ryan J. H.; Furmston, Rebecca; Williams, Charles A. C.; Elliott, Christopher J. H.

    2015-01-01

    We provide an insight into the role Drosophila has played in elucidating neurophysiological perturbations associated with Parkinson's disease- (PD-) related genes. Synaptic signalling deficits are observed in motor, central, and sensory systems. Given the neurological impact of disease causing mutations within these same genes in humans the phenotypes observed in fly are of significant interest. As such we observe four unique opportunities provided by fly nervous system models of Parkinson's ...

  6. Three-dimensional imaging of Drosophila melanogaster.

    Directory of Open Access Journals (Sweden)

    Leeanne McGurk

    2007-09-01

    Full Text Available The major hindrance to imaging the intact adult Drosophila is that the dark exoskeleton makes it impossible to image through the cuticle. We have overcome this obstacle and describe a method whereby the internal organs of adult Drosophila can be imaged in 3D by bleaching and clearing the adult and then imaging using a technique called optical projection tomography (OPT. The data is displayed as 2D optical sections and also in 3D to provide detail on the shape and structure of the adult anatomy.We have used OPT to visualize in 2D and 3D the detailed internal anatomy of the intact adult Drosophila. In addition this clearing method used for OPT was tested for imaging with confocal microscopy. Using OPT we have visualized the size and shape of neurodegenerative vacuoles from within the head capsule of flies that suffer from age-related neurodegeneration due to a lack of ADAR mediated RNA-editing. In addition we have visualized tau-lacZ expression in 2D and 3D. This shows that the wholemount adult can be stained without any manipulation and that this stain penetrates well as we have mapped the localization pattern with respect to the internal anatomy.We show for the first time that the intact adult Drosophila can be imaged in 3D using OPT, also we show that this method of clearing is also suitable for confocal microscopy to image the brain from within the intact head. The major advantage of this is that organs can be represented in 3D in their natural surroundings. Furthermore optical sections are generated in each of the three planes and are not prone to the technical limitations that are associated with manual sectioning. OPT can be used to dissect mutant phenotypes and to globally map gene expression in both 2D and 3D.

  7. Studies on maternal repair in Drosophila melanogaster

    International Nuclear Information System (INIS)

    Mendelson, D.

    1976-01-01

    The work reported in this thesis is mainly concerned with studies on the nature of the repair mechanism(s) operating in Drosophila oocytes, and which act on chromosome damage induced by X-irradiation of post-meiotic male germ-cells. Caffeine treatment of the females has been used as an analytical tool to gain an insight into the nature of this repair mechanism and its genetic basis

  8. Australian synchrotron light source - (boomerang)

    International Nuclear Information System (INIS)

    Boldeman, J.

    2001-01-01

    The Australian National Synchrotron Light Source - (Boomerang) is to be installed at the Monash University in Victoria. This report provides some background to the proposed facility and discusses aspects of a prospective design. Recently, significant effort was devoted to refining the in principle design and a lattice providing an emittance od 18 nm rad was obtained with a distributed dispersion in the straight section of 0.29m. Exhaustive studies have been made of the economic benefits that would accrue to Australia to Australia following the installation of this facility. This design is a refinement of the design concept presented to the SRI -2000, Berlin (Boldeman, Einfeld et al), to the meeting of the 4th Asian Forum and the Preliminary Design Study presented to the Australian Synchrotron Research Program

  9. Curators and Australian art history

    OpenAIRE

    Andrew Sayers

    2011-01-01

    Most Australians do not read art history, but they do look at art in museums. There, visitors experience displays that embody art histories. The enthusiasms and research interests of curators combine with collection strengths to create these art histories. In this process, particular artists, ideas and mediums are privileged. Drawing on personal experience this talk looked at some examples of influential curators, displays, exhibitions and collecting programs over the last thirty years. In th...

  10. Meteors in Australian Aboriginal Dreamings

    Science.gov (United States)

    Hamacher, Duane W.; Norris, Ray P.

    2010-06-01

    We present a comprehensive analysis of Australian Aboriginal accounts of meteors. The data used were taken from anthropological and ethnographic literature describing oral traditions, ceremonies, and Dreamings of 97 Aboriginal groups representing all states of modern Australia. This revealed common themes in the way meteors were viewed between Aboriginal groups, focusing on supernatural events, death, omens, and war. The presence of such themes around Australia was probably due to the unpredictable nature of meteors in an otherwise well-ordered cosmos.

  11. ‘Peer pressure’ in larval Drosophila?

    Directory of Open Access Journals (Sweden)

    Thomas Niewalda

    2014-06-01

    Full Text Available Understanding social behaviour requires a study case that is simple enough to be tractable, yet complex enough to remain interesting. Do larval Drosophila meet these requirements? In a broad sense, this question can refer to effects of the mere presence of other larvae on the behaviour of a target individual. Here we focused in a more strict sense on ‘peer pressure’, that is on the question of whether the behaviour of a target individual larva is affected by what a surrounding group of larvae is doing. We found that innate olfactory preference of a target individual was neither affected (i by the level of innate olfactory preference in the surrounding group nor (ii by the expression of learned olfactory preference in the group. Likewise, learned olfactory preference of a target individual was neither affected (iii by the level of innate olfactory preference of the surrounding group nor (iv by the learned olfactory preference the group was expressing. We conclude that larval Drosophila thus do not take note of specifically what surrounding larvae are doing. This implies that in a strict sense, and to the extent tested, there is no social interaction between larvae. These results validate widely used en mass approaches to the behaviour of larval Drosophila.

  12. An automated paradigm for Drosophila visual psychophysics.

    Science.gov (United States)

    Evans, Oliver; Paulk, Angelique C; van Swinderen, Bruno

    2011-01-01

    Mutations that cause learning and memory defects in Drosophila melanogaster have been found to also compromise visual responsiveness and attention. A better understanding of attention-like defects in such Drosophila mutants therefore requires a more detailed characterization of visual responsiveness across a range of visual parameters. We designed an automated behavioral paradigm for efficiently dissecting visual responsiveness in Drosophila. Populations of flies walk through multiplexed serial choice mazes while being exposed to moving visuals displayed on computer monitors, and infra-red fly counters at the end of each maze automatically score the responsiveness of a strain. To test our new design, we performed a detailed comparison between wild-type flies and a learning and memory mutant, dunce(1). We first confirmed that the learning mutant dunce(1) displays increased responsiveness to a black/green moving grating compared to wild type in this new design. We then extended this result to explore responses to a wide range of psychophysical parameters for moving gratings (e.g., luminosity, contrast, spatial frequency, velocity) as well as to a different stimulus, moving dots. Finally, we combined these visuals (gratings versus dots) in competition to investigate how dunce(1) and wild-type flies respond to more complex and conflicting motion effects. We found that dunce(1) responds more strongly than wild type to high contrast and highly structured motion. This effect was found for simple gratings, dots, and combinations of both stimuli presented in competition.

  13. An automated paradigm for Drosophila visual psychophysics.

    Directory of Open Access Journals (Sweden)

    Oliver Evans

    Full Text Available BACKGROUND: Mutations that cause learning and memory defects in Drosophila melanogaster have been found to also compromise visual responsiveness and attention. A better understanding of attention-like defects in such Drosophila mutants therefore requires a more detailed characterization of visual responsiveness across a range of visual parameters. METHODOLOGY/PRINCIPAL FINDINGS: We designed an automated behavioral paradigm for efficiently dissecting visual responsiveness in Drosophila. Populations of flies walk through multiplexed serial choice mazes while being exposed to moving visuals displayed on computer monitors, and infra-red fly counters at the end of each maze automatically score the responsiveness of a strain. To test our new design, we performed a detailed comparison between wild-type flies and a learning and memory mutant, dunce(1. We first confirmed that the learning mutant dunce(1 displays increased responsiveness to a black/green moving grating compared to wild type in this new design. We then extended this result to explore responses to a wide range of psychophysical parameters for moving gratings (e.g., luminosity, contrast, spatial frequency, velocity as well as to a different stimulus, moving dots. Finally, we combined these visuals (gratings versus dots in competition to investigate how dunce(1 and wild-type flies respond to more complex and conflicting motion effects. CONCLUSIONS/SIGNIFICANCE: We found that dunce(1 responds more strongly than wild type to high contrast and highly structured motion. This effect was found for simple gratings, dots, and combinations of both stimuli presented in competition.

  14. Neurophysiology of Drosophila models of Parkinson's disease.

    Science.gov (United States)

    West, Ryan J H; Furmston, Rebecca; Williams, Charles A C; Elliott, Christopher J H

    2015-01-01

    We provide an insight into the role Drosophila has played in elucidating neurophysiological perturbations associated with Parkinson's disease- (PD-) related genes. Synaptic signalling deficits are observed in motor, central, and sensory systems. Given the neurological impact of disease causing mutations within these same genes in humans the phenotypes observed in fly are of significant interest. As such we observe four unique opportunities provided by fly nervous system models of Parkinson's disease. Firstly, Drosophila models are instrumental in exploring the mechanisms of neurodegeneration, with several PD-related mutations eliciting related phenotypes including sensitivity to energy supply and vesicular deformities. These are leading to the identification of plausible cellular mechanisms, which may be specific to (dopaminergic) neurons and synapses rather than general cellular phenotypes. Secondly, models show noncell autonomous signalling within the nervous system, offering the opportunity to develop our understanding of the way pathogenic signalling propagates, resembling Braak's scheme of spreading pathology in PD. Thirdly, the models link physiological deficits to changes in synaptic structure. While the structure-function relationship is complex, the genetic tractability of Drosophila offers the chance to separate fundamental changes from downstream consequences. Finally, the strong neuronal phenotypes permit relevant first in vivo drug testing.

  15. Transcriptional regulation of xenobiotic detoxification in Drosophila

    Science.gov (United States)

    Misra, Jyoti R.; Horner, Michael A.; Lam, Geanette; Thummel, Carl S.

    2011-01-01

    Living organisms, from bacteria to humans, display a coordinated transcriptional response to xenobiotic exposure, inducing enzymes and transporters that facilitate detoxification. Several transcription factors have been identified in vertebrates that contribute to this regulatory response. In contrast, little is known about this pathway in insects. Here we show that the Drosophila Nrf2 (NF-E2-related factor 2) ortholog CncC (cap ‘n’ collar isoform-C) is a central regulator of xenobiotic detoxification responses. A binding site for CncC and its heterodimer partner Maf (muscle aponeurosis fibromatosis) is sufficient and necessary for robust transcriptional responses to three xenobiotic compounds: phenobarbital (PB), chlorpromazine, and caffeine. Genetic manipulations that alter the levels of CncC or its negative regulator, Keap1 (Kelch-like ECH-associated protein 1), lead to predictable changes in xenobiotic-inducible gene expression. Transcriptional profiling studies reveal that more than half of the genes regulated by PB are also controlled by CncC. Consistent with these effects on detoxification gene expression, activation of the CncC/Keap1 pathway in Drosophila is sufficient to confer resistance to the lethal effects of the pesticide malathion. These studies establish a molecular mechanism for the regulation of xenobiotic detoxification in Drosophila and have implications for controlling insect populations and the spread of insect-borne human diseases. PMID:21896655

  16. The Ran pathway in Drosophila melanogaster mitosis

    Directory of Open Access Journals (Sweden)

    James G Wakefield

    2015-11-01

    Full Text Available Over the last two decades, the small GTPase Ran has emerged as a central regulator of both mitosis and meiosis, particularly in the generation, maintenance and regulation of the microtubule (MT-based bipolar spindle. Ran-regulated pathways in mitosis bear many similarities to the well-characterized functions of Ran in nuclear transport and, as with transport, the majority of these mitotic effects are mediated through affecting the physical interaction between karyopherins and Spindle Assembly Factors (SAFs - a loose term describing proteins or protein complexes involved in spindle assembly through promoting nucleation, stabilization, and/or depolymerization of MTs, through anchoring MTs to specific structures such as centrosomes, chromatin or kinetochores, or through sliding MTs along each other to generate the force required to achieve bipolarity. As such, the Ran-mediated pathway represents a crucial functional module within the wider spindle assembly landscape. Research into mitosis using the model organism Drosophila melanogaster has contributed substantially to our understanding of centrosome and spindle function. However, in comparison to mammalian systems, very little is known about the contribution of Ran-mediated pathways in Drosophila mitosis. This article sets out to summarize our understanding of the roles of the Ran pathway components in Drosophila mitosis, focusing on the syncytial blastoderm embryo, arguing that, far from being superfluous, it can provide important insights into the conserved functions on Ran during spindle formation.

  17. Pervasive natural selection in the Drosophila genome?

    Directory of Open Access Journals (Sweden)

    Guy Sella

    2009-06-01

    Full Text Available Over the past four decades, the predominant view of molecular evolution saw little connection between natural selection and genome evolution, assuming that the functionally constrained fraction of the genome is relatively small and that adaptation is sufficiently infrequent to play little role in shaping patterns of variation within and even between species. Recent evidence from Drosophila, reviewed here, suggests that this view may be invalid. Analyses of genetic variation within and between species reveal that much of the Drosophila genome is under purifying selection, and thus of functional importance, and that a large fraction of coding and noncoding differences between species are adaptive. The findings further indicate that, in Drosophila, adaptations may be both common and strong enough that the fate of neutral mutations depends on their chance linkage to adaptive mutations as much as on the vagaries of genetic drift. The emerging evidence has implications for a wide variety of fields, from conservation genetics to bioinformatics, and presents challenges to modelers and experimentalists alike.

  18. Tet protein function during Drosophila development.

    Directory of Open Access Journals (Sweden)

    Fei Wang

    Full Text Available The TET (Ten-eleven translocation 1, 2 and 3 proteins have been shown to function as DNA hydroxymethylases in vertebrates and their requirements have been documented extensively. Recently, the Tet proteins have been shown to also hydroxylate 5-methylcytosine in RNA. 5-hydroxymethylcytosine (5hmrC is enriched in messenger RNA but the function of this modification has yet to be elucidated. Because Cytosine methylation in DNA is barely detectable in Drosophila, it serves as an ideal model to study the biological function of 5hmrC. Here, we characterized the temporal and spatial expression and requirement of Tet throughout Drosophila development. We show that Tet is essential for viability as Tet complete loss-of-function animals die at the late pupal stage. Tet is highly expressed in neuronal tissues and at more moderate levels in somatic muscle precursors in embryos and larvae. Depletion of Tet in muscle precursors at early embryonic stages leads to defects in larval locomotion and late pupal lethality. Although Tet knock-down in neuronal tissue does not cause lethality, it is essential for neuronal function during development through its affects upon locomotion in larvae and the circadian rhythm of adult flies. Further, we report the function of Tet in ovarian morphogenesis. Together, our findings provide basic insights into the biological function of Tet in Drosophila, and may illuminate observed neuronal and muscle phenotypes observed in vertebrates.

  19. Home advantage in Australian soccer.

    Science.gov (United States)

    Goumas, Chris

    2014-01-01

    The aims of this study were to quantify the magnitude of home advantage (HA) in Australian soccer and to investigate how home-team crowd support and away-team travel may contribute to it. A paired design was used wherein each match contributed two observations, one for the home team and one for the away team. The data used in this study were all matches from the first seven seasons (2005/06-2011/12) of the Australian A-League - the major soccer league in Australia. Repeated measures Poisson regression analysis was used to investigate the effect that crowd size and density, distance and direction travelled by away teams, and crossing time zones may have on HA. HA in terms of the percentage of competition points gained by home teams in the A-League averaged 58% over the study period. HA increased significantly with increasing number of time zones crossed by away teams (pteam crowd support. Travel management programs aimed at reducing the effects of jet lag could significantly improve away team performance in Australian soccer. Copyright © 2013 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

  20. Nazi medical experiments on Australian prisoners of war: Commentary on the testimony of an Australian soldier.

    Science.gov (United States)

    Weisz, George M

    2015-12-01

    Archival research reveals that Australian prisoners of war were exposed to non-consensual medical experiments during World War II. This article discusses the first known case of an Australian soldier exposed to German medical experiments.

  1. Genetic monitoring of irradiated Drosophila populations treated with antimutagen melanine

    International Nuclear Information System (INIS)

    Mosseh, I.B.; Savchenko, V.K.; Lyakh, I.P.

    1986-01-01

    It was shown that viability of irradiated Drosophila is, on an average, lower than in intact populations. The fertility first decreases then increases exceeding the control level. Melanine added to the diet increases fertility and viability of both exposed and intact Drosophila populations

  2. Drosophila suzukii population response to environment and management strategies

    Science.gov (United States)

    Spotted wing drosophila, Drosophila suzukii, quickly emerged as a devastating invasive pest of small and stone fruits in the Americas and Europe. To better understand the population dynamics of D. suzukii, we reviewed recent work on juvenile development, adult reproduction, and seasonal variation in...

  3. First foreign exploration for asian parasitoids of Drosophila suzukii

    Science.gov (United States)

    The invasive spotted wing drosophila, Drosophila suzukii Matsumura (Dipt.: Drosophilidae), is a native of East Asia and is now widely established in North America and Europe, where it is a serious pest of small and stone fruit crops. The lack of effective indigenous parasitoids of D. suzukii in the ...

  4. Drosophila Courtship Conditioning As a Measure of Learning and Memory

    NARCIS (Netherlands)

    Koemans, T.S.; Oppitz, C.; Donders, R.; Bokhoven, H. van; Schenck, A.; Keleman, K.; Kramer, J.M.

    2017-01-01

    Many insights into the molecular mechanisms underlying learning and memory have been elucidated through the use of simple behavioral assays in model organisms such as the fruit fly, Drosophila melanogaster. Drosophila is useful for understanding the basic neurobiology underlying cognitive deficits

  5. Medium-term changes in Drosophila subobscura chromosomal ...

    Indian Academy of Sciences (India)

    2015-06-02

    Jun 2, 2015 ... [Zivanovic G., Arenas C. and Mestres F. 2015 Medium-term changes in Drosophila subobscura chromosomal inversion polymorphism: a possible relation with global warming? J. Genet. 94, 343–346]. Introduction. Drosophila subobscura is a species with a rich chromosomal polymorphism for inversions.

  6. Ultradian rhythm unmasked in the Pdf clock mutant of Drosophila

    Indian Academy of Sciences (India)

    2014-07-20

    Jul 20, 2014 ... temperature compensated. Our results suggest that Drosophila has an endogenous ultradian oscillator that is masked by circadian rhythmic behaviours. [Seki Y and Tanimura T 2014 Ultradian rhythm unmasked in the Pdf clock mutant of Drosophila. J. Biosci. 39 585-594]. DOI 10.1007/s12038-014-9450-z.

  7. Ionizing radiation causes the stress response in Drosophila melanogaster

    International Nuclear Information System (INIS)

    Gruntenko, N.E.; Zakharenko, L.P.; Raushenbakh, I.Yu.

    1998-01-01

    Potentiality of the stress-reaction arising in Drosophila melanogaster under gamma-irradiation of the source with 137 Cs (irradiation dose is 10 Gy , radiation dose rate amounts 180 c Gy/min) is studied. It is shown that radiation induces the stress-reaction in Drosophila resulting in alterations in energetic metabolism (biogenic amines metabolic system) and in reproductive function [ru

  8. Status of research on Drosophila ananassae at global level

    Indian Academy of Sciences (India)

    Abstract. Drosophila, a dipteran insect, has been found to be the best biological model for different kinds of studies. D melanogaster was first described by Meigen in 1830, is most extensively studied species of the genus Drosophila and a number of investigations employing this species have been documented in areas ...

  9. The Politics Are Personal: "The Australian" vs the Australian Curriculum in History

    Science.gov (United States)

    Taylor, Tony; Collins, Sue

    2012-01-01

    This article reviews the relationship between the conservative newspaper "The Australian" and the development of a national history curriculum in Australia. The lead author surveyed the major Australian press in the five-year period between 2007 and 2012 and found clear patterns of difference between "The Australian" and other…

  10. The developmental transcriptome of Drosophila melanogaster

    Energy Technology Data Exchange (ETDEWEB)

    University of Connecticut; Graveley, Brenton R.; Brooks, Angela N.; Carlson, Joseph W.; Duff, Michael O.; Landolin, Jane M.; Yang, Li; Artieri, Carlo G.; van Baren, Marijke J.; Boley, Nathan; Booth, Benjamin W.; Brown, James B.; Cherbas, Lucy; Davis, Carrie A.; Dobin, Alex; Li, Renhua; Lin, Wei; Malone, John H.; Mattiuzzo, Nicolas R.; Miller, David; Sturgill, David; Tuch, Brian B.; Zaleski, Chris; Zhang, Dayu; Blanchette, Marco; Dudoit, Sandrine; Eads, Brian; Green, Richard E.; Hammonds, Ann; Jiang, Lichun; Kapranov, Phil; Langton, Laura; Perrimon, Norbert; Sandler, Jeremy E.; Wan, Kenneth H.; Willingham, Aarron; Zhang, Yu; Zou, Yi; Andrews, Justen; Bicke, Peter J.; Brenner, Steven E.; Brent, Michael R.; Cherbas, Peter; Gingeras, Thomas R.; Hoskins, Roger A.; Kaufman, Thomas C.; Oliver, Brian; Celniker, Susan E.

    2010-12-02

    Drosophila melanogaster is one of the most well studied genetic model organisms; nonetheless, its genome still contains unannotated coding and non-coding genes, transcripts, exons and RNA editing sites. Full discovery and annotation are pre-requisites for understanding how the regulation of transcription, splicing and RNA editing directs the development of this complex organism. Here we used RNA-Seq, tiling microarrays and cDNA sequencing to explore the transcriptome in 30 distinct developmental stages. We identified 111,195 new elements, including thousands of genes, coding and non-coding transcripts, exons, splicing and editing events, and inferred protein isoforms that previously eluded discovery using established experimental, prediction and conservation-based approaches. These data substantially expand the number of known transcribed elements in the Drosophila genome and provide a high-resolution view of transcriptome dynamics throughout development. Drosophila melanogaster is an important non-mammalian model system that has had a critical role in basic biological discoveries, such as identifying chromosomes as the carriers of genetic information and uncovering the role of genes in development. Because it shares a substantial genic content with humans, Drosophila is increasingly used as a translational model for human development, homeostasis and disease. High-quality maps are needed for all functional genomic elements. Previous studies demonstrated that a rich collection of genes is deployed during the life cycle of the fly. Although expression profiling using microarrays has revealed the expression of, 13,000 annotated genes, it is difficult to map splice junctions and individual base modifications generated by RNA editing using such approaches. Single-base resolution is essential to define precisely the elements that comprise the Drosophila transcriptome. Estimates of the number of transcript isoforms are less accurate than estimates of the number of genes

  11. Rhodopsin 7–The unusual Rhodopsin in Drosophila

    Directory of Open Access Journals (Sweden)

    Pingkalai R. Senthilan

    2016-09-01

    Full Text Available Rhodopsins are the major photopigments in the fruit fly Drosophila melanogaster. Drosophila express six well-characterized Rhodopsins (Rh1–Rh6 with distinct absorption maxima and expression pattern. In 2000, when the Drosophila genome was published, a novel Rhodopsin gene was discovered: Rhodopsin 7 (Rh7. Rh7 is highly conserved among the Drosophila genus and is also found in other arthropods. Phylogenetic trees based on protein sequences suggest that the seven Drosophila Rhodopsins cluster in three different groups. While Rh1, Rh2 and Rh6 form a “vertebrate-melanopsin-type”–cluster, and Rh3, Rh4 and Rh5 form an “insect-type”-Rhodopsin cluster, Rh7 seem to form its own cluster. Although Rh7 has nearly all important features of a functional Rhodopsin, it differs from other Rhodopsins in its genomic and structural properties, suggesting it might have an overall different role than other known Rhodopsins.

  12. Intestinal stem cells in the adult Drosophila midgut

    International Nuclear Information System (INIS)

    Jiang, Huaqi; Edgar, Bruce A.

    2011-01-01

    Drosophila has long been an excellent model organism for studying stem cell biology. Notably, studies of Drosophila's germline stem cells have been instrumental in developing the stem cell niche concept. The recent discovery of somatic stem cells in adult Drosophila, particularly the intestinal stem cells (ISCs) of the midgut, has established Drosophila as an exciting model to study stem cell-mediated adult tissue homeostasis and regeneration. Here, we review the major signaling pathways that regulate the self-renewal, proliferation and differentiation of Drosophila ISCs, discussing how this regulation maintains midgut homeostasis and mediates regeneration of the intestinal epithelium after injury. -- Highlights: ► The homeostasis and regeneration of adult fly midguts are mediated by ISCs. ► Damaged enterocytes induce the proliferation of intestinal stem cells (ISC). ► EGFR and Jak/Stat signalings mediate compensatory ISC proliferation. ► Notch signaling regulates ISC self-renewal and differentiation.

  13. Drosophila melanogaster as a model organism to study nanotoxicity.

    Science.gov (United States)

    Ong, Cynthia; Yung, Lin-Yue Lanry; Cai, Yu; Bay, Boon-Huat; Baeg, Gyeong-Hun

    2015-05-01

    Drosophila melanogaster has been used as an in vivo model organism for the study of genetics and development since 100 years ago. Recently, the fruit fly Drosophila was also developed as an in vivo model organism for toxicology studies, in particular, the field of nanotoxicity. The incorporation of nanomaterials into consumer and biomedical products is a cause for concern as nanomaterials are often associated with toxicity in many in vitro studies. In vivo animal studies of the toxicity of nanomaterials with rodents and other mammals are, however, limited due to high operational cost and ethical objections. Hence, Drosophila, a genetically tractable organism with distinct developmental stages and short life cycle, serves as an ideal organism to study nanomaterial-mediated toxicity. This review discusses the basic biology of Drosophila, the toxicity of nanomaterials, as well as how the Drosophila model can be used to study the toxicity of various types of nanomaterials.

  14. Detecting novel low-abundant transcripts in Drosophila

    DEFF Research Database (Denmark)

    Lee, Sanggyu; Bao, Jingyue; Zhou, Guolin

    2005-01-01

    Increasing evidence suggests that low-abundant transcripts may play fundamental roles in biological processes. In an attempt to estimate the prevalence of low-abundant transcripts in eukaryotic genomes, we performed a transcriptome analysis in Drosophila using the SAGE technique. We collected 244......,313 SAGE tags from transcripts expressed in Drosophila embryonic, larval, pupae, adult, and testicular tissue. From these SAGE tags, we identified 40,823 unique SAGE tags. Our analysis showed that 55% of the 40,823 unique SAGE tags are novel without matches in currently known Drosophila transcripts...... in the Drosophila genome. Our study reveals the presence of a significant number of novel low-abundant transcripts in Drosophila, and highlights the need to isolate these novel low-abundant transcripts for further biological studies. Udgivelsesdato: 2005-Jun...

  15. Rapid and highly accurate detection of Drosophila suzukii, spotted wing Drosophila (Diptera: Drosophilidae) by loop-mediated isothermal amplification assays

    Science.gov (United States)

    Drosophila suzukii, the spotted wing drosophila (SWD), is currently a major pest that causes severe economic losses to thin-skinned, small fruit growers in North America and Europe. The monitoring and early detection of SWD in the field is of the utmost importance for its proper management. Althou...

  16. Isolation of protease-free alcohol dehydrogenase (ADH) from Drosophila simulans and several homozygous and heterozygous Drosophila melanogaster variants

    NARCIS (Netherlands)

    Smilda, T; Lamme, DA; Collu, G; Jekel, PA; Reinders, P; Beintema, JJ

    The enzyme alcohol dehydrogenase (ADH) from several naturally occurring ADH variants of Drosophila melanogaster and Drosophila simulans Lc,as isolated. Affinity chromatography with the ligand Cibacron Blue and elution with NAD(+) showed similar behavior for D. melanogaster ADH-FF, ADH-71k, and D.

  17. Peptidergic control of a fruit crop pest: the spotted-wing drosophila, Drosophila suzukii

    Science.gov (United States)

    Neuropeptides play an important role in the regulation of feeding in insects and offer potential targets for the development of new chemicals to control insect pests. A pest that has attracted much recent attention is the highly invasive Drosophila suzukii, a polyphagous pest that can cause serious...

  18. Biological effects of radon in Drosophila; Efectos biologicos del radon en Drosophila

    Energy Technology Data Exchange (ETDEWEB)

    Pimentel P, A.E.; Tavera D, L.; Cruces M, M.P.; Arceo M, C.; Rosa D, M.E. de la

    1992-04-15

    The main objective of this investigation, is to study the biological effects of the Radon-222 at low dose in 'Drosophila melanogaster'. It is necessary to mention that these effects will analyze from the genetic point of view for: 1) To evaluate in which form the Radon-222 to low dose it influences in some genetic components of the adaptation in Drosophila, such as: fecundity, viability egg-adult and sex proportion. 2) To evaluate which is the genetic effect that induces the Radon to low dose by means of the SMART technique in Drosophila melanogaster, and this way to try of to identify which is the possible mechanism that causes the genetic damage to somatic level. The carried out investigation was divided in three stages: 1. Tests to the vacuum resistance. 2. Test of somatic mutation, and 3. Determination of the presence of radon daughters on the adult of Drosophila. It is necessary to point out that all the experiments were made by triplicate and in each one of them was placed detectors in preset places. Those obtained results are presented inside the 4 charts included in the present work. (Author)

  19. First record of spotted wing drosophila Drosophila suzukii (Diptera: Drosophilidae in Montenegro

    Directory of Open Access Journals (Sweden)

    Snježana Hrnčić

    2015-01-01

    Full Text Available The spotted wing drosophila Drosophila suzukii Matsumura (Diptera: Drosophilidae is an invasive pest originating from Southeast Asia. It was detected for the first time in Europe in 2008 (Spain and Italy and subsequently in other European countries. It is a highly polyphagous pest that infests healthy, ripening fruit and presents a serious threat to fruit production, particularly of soft skinned fruit. In the first half of October 2013, a new fruit fly species was unexpectedly detected in Tephri traps baited with the three-component female-biased attractant BioLure that is regularly used for monitoring the Mediterranean fruit fly Ceratitis capitata Wiedem. (Diptera: Tephritidae in Montenegro. Brief visual inspection identified the new species as the spotted wing drosophila D. suzukii. The pest was first recorded in several localities on the Montenegrin seacoast around Boka Kotor Bay. After the finding, all Drosophila specimens were collected from traps for further laboratory observation. A quick follow-up monitoring of other Tephri traps was carried out within the next few days on the rest of the seacoast (localities from Tivat to Ulcinj. Additionally, Tephri traps were set up around Lake Skadar and in the city of Podgorica, as well as on fresh fruit markets in Podgorica. The results of this preliminary study showed that D. suzukii was present in all surveyed locations and adults were captured until late December. Both sexes were found in traps with BioLure. Our data show that D. suzukii is present in southern parts of Montenegro and there is a serious threat of its further spreading, particularly towards northern parts of the country where the main raspberry and blueberry production is placed. The results also show that Tephri traps baited with BioLure can be used for detection and monitoring of spotted wing drosophila.

  20. Nematocytes: Discovery and characterization of a novel anculeate hemocyte in Drosophila falleni and Drosophila phalerata.

    Directory of Open Access Journals (Sweden)

    Julianna Bozler

    Full Text Available Immune challenges, such as parasitism, can be so pervasive and deleterious that they constitute an existential threat to a species' survival. In response to these ecological pressures, organisms have developed a wide array of novel behavioral, cellular, and molecular adaptations. Research into these immune defenses in model systems has resulted in a revolutionary understanding of evolution and functional biology. As the field has expanded beyond the limited number of model organisms our appreciation of evolutionary innovation and unique biology has widened as well. With this in mind, we have surveyed the hemolymph of several non-model species of Drosophila. Here we identify and describe a novel hemocyte, type-II nematocytes, found in larval stages of numerous Drosophila species. Examined in detail in Drosophila falleni and Drosophila phalerata, we find that these remarkable cells are distinct from previously described hemocytes due to their anucleate state (lacking a nucleus and unusual morphology. Type-II nematocytes are long, narrow cells with spindle-like projections extending from a cell body with high densities of mitochondria and microtubules, and exhibit the ability to synthesize proteins. These properties are unexpected for enucleated cells, and together with our additional characterization, we demonstrate that these type-II nematocytes represent a biological novelty. Surprisingly, despite the absence of a nucleus, we observe through live cell imaging that these cells remain motile with a highly dynamic cellular shape. Furthermore, these cells demonstrate the ability to form multicellular structures, which we suggest may be a component of the innate immune response to macro-parasites. In addition, live cell imaging points to a large nucleated hemocyte, type-I nematocyte, as the progenitor cell, leading to enucleation through a budding or asymmetrical division process rather than nuclear ejection: This study is the first to report such a

  1. Aurorae in Australian Aboriginal Traditions

    Science.gov (United States)

    Hamacher, Duane W.

    2013-07-01

    Transient celestial phenomena feature prominently in the astronomical knowledge and traditions of Aboriginal Australians. In this paper, I collect accounts of the Aurora Australis from the literature regarding Aboriginal culture. Using previous studies of meteors, eclipses, and comets in Aboriginal traditions, I anticipate that the physical properties of aurora, such as their generally red colour as seen from southern Australia, will be associated with fire, death, blood, and evil spirits. The survey reveals this to be the case and also explores historical auroral events in Aboriginal cultures, aurorae in rock art, and briefly compares Aboriginal auroral traditions with other global indigenous groups, including the Maori of New Zealand.

  2. Succession Planning in Australian Farming

    Directory of Open Access Journals (Sweden)

    John Hicks

    2012-11-01

    Full Text Available The theme of this paper is that succession planning in Australian farming is under-developed.It may be linked to economic and social change which suggests that farmers need to adapt togenerational change but this is being resisted or ignored. The implications of this are the slowdecline of family farming, a poor transfer of skills and knowledge to subsequent generationsof farmers in some parts of the agricultural sector and the potential for an extension of thefinancial services industry to develop a more effective raft of succession planning measuresto mitigate the effects of a traditional approach to succession in agriculture.

  3. Comets in Australian Aboriginal Astronomy

    Science.gov (United States)

    Hamacher, Duane W.; Norris, Ray P.

    2011-03-01

    We present 25 accounts of comets from 40 Australian Aboriginal communities, citing both supernatural perceptions of comets and historical accounts of historically bright comets. Historical and ethnographic descriptions include the Great Comets of 1843, 1861, 1901, 1910, and 1927. We describe the perceptions of comets in Aboriginal societies and show that they are typically associated with fear, death, omens, malevolent spirits, and evil magic, consistent with many cultures around the world. We also provide a list of words for comets in 16 different Aboriginal languages.

  4. Characteristics of Religious Knowledge among Australian Students

    Science.gov (United States)

    Hughes, Philip

    2007-01-01

    Drawing on the Spirit of Generation Y project and extensions of that project undertaken in 25 Australian schools by the Christian Research Association, it is argued that the approach to religious knowledge by Australian students can be contrasted with their approach to other forms of knowledge by four features. These are diversity of opinion in…

  5. Australian International Food Security Research Centre | IDRC ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Australian International Food Security Research Centre. Australian International Food Security Research Centre. http://aciar.gov.au/AIFSC. Cultivate Africa's Future. The Cultivate Africa's Future research partnership is designed to support applied research to combat hunger in sub-Saharan Africa by harnessing the potential ...

  6. The sociology of the Australian agricultural environment

    NARCIS (Netherlands)

    Vanclay, F.

    1994-01-01

    Australian agriculture is in crisis, the terms of trade for agriculture are falling, many farmers have negative incomes, and there is massive structural adjustment with government policy assisting the exit of marginal farmers out of agriculture. Australian governments are gripped with the

  7. Australian International Food Security Research Centre | IDRC ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Australian International Food Security Research Centre. Australian International Food Security Research Centre. http://aciar.gov.au/aifsc/ · What we do · Funding · Resources · About IDRC. Knowledge. Innovation. Solutions. Careers · Contact Us · Site map. Sign up now for IDRC news and views sent directly to your inbox ...

  8. Four Management Agendas for Australian Universities

    Science.gov (United States)

    Sharrock, Geoff

    2012-01-01

    In a new mixed economy of higher learning, Australian universities require more strategic management to compete and collaborate sustainably. However, many scholars argue that new modes of university management are at odds with scholarly aims and values. This article examines how Australian universities frame their missions and communicate their…

  9. Whole genome phylogenies for multiple Drosophila species

    Directory of Open Access Journals (Sweden)

    Seetharam Arun

    2012-12-01

    Full Text Available Abstract Background Reconstructing the evolutionary history of organisms using traditional phylogenetic methods may suffer from inaccurate sequence alignment. An alternative approach, particularly effective when whole genome sequences are available, is to employ methods that don’t use explicit sequence alignments. We extend a novel phylogenetic method based on Singular Value Decomposition (SVD to reconstruct the phylogeny of 12 sequenced Drosophila species. SVD analysis provides accurate comparisons for a high fraction of sequences within whole genomes without the prior identification of orthologs or homologous sites. With this method all protein sequences are converted to peptide frequency vectors within a matrix that is decomposed to provide simplified vector representations for each protein of the genome in a reduced dimensional space. These vectors are summed together to provide a vector representation for each species, and the angle between these vectors provides distance measures that are used to construct species trees. Results An unfiltered whole genome analysis (193,622 predicted proteins strongly supports the currently accepted phylogeny for 12 Drosophila species at higher dimensions except for the generally accepted but difficult to discern sister relationship between D. erecta and D. yakuba. Also, in accordance with previous studies, many sequences appear to support alternative phylogenies. In this case, we observed grouping of D. erecta with D. sechellia when approximately 55% to 95% of the proteins were removed using a filter based on projection values or by reducing resolution by using fewer dimensions. Similar results were obtained when just the melanogaster subgroup was analyzed. Conclusions These results indicate that using our novel phylogenetic method, it is possible to consult and interpret all predicted protein sequences within multiple whole genomes to produce accurate phylogenetic estimations of relatedness between

  10. The intimate genetics of Drosophila fertilization

    Science.gov (United States)

    Loppin, Benjamin; Dubruille, Raphaëlle; Horard, Béatrice

    2015-01-01

    The union of haploid gametes at fertilization initiates the formation of the diploid zygote in sexually reproducing animals. This founding event of embryogenesis includes several fascinating cellular and nuclear processes, such as sperm–egg cellular interactions, sperm chromatin remodelling, centrosome formation or pronuclear migration. In comparison with other aspects of development, the exploration of animal fertilization at the functional level has remained so far relatively limited, even in classical model organisms. Here, we have reviewed our current knowledge of fertilization in Drosophila melanogaster, with a special emphasis on the genes involved in the complex transformation of the fertilizing sperm nucleus into a replicated set of paternal chromosomes. PMID:26246493

  11. Drosophila melanogaster deoxyribonucleoside kinase activates gemcitabine

    Energy Technology Data Exchange (ETDEWEB)

    Knecht, Wolfgang [BioCentrum-DTU, Technical University of Denmark, DK-2800 Lyngby (Denmark); Mikkelsen, Nils Egil [Department of Molecular Biology, Swedish University of Agricultural Sciences, Biomedical Centre, SE-751 24 Uppsala (Sweden); Clausen, Anders Ranegaard [Cell and Organism Biology, Lund University, Soelvegatan 35, SE-22362 Lund (Sweden); Willer, Mette [ZGene A/S, Agern Alle 7, DK-2970 Horsholm (Denmark); Eklund, Hans [Department of Molecular Biology, Swedish University of Agricultural Sciences, Biomedical Centre, SE-751 24 Uppsala (Sweden); Gojkovic, Zoran [ZGene A/S, Agern Alle 7, DK-2970 Horsholm (Denmark); Piskur, Jure, E-mail: Jure.Piskur@cob.lu.se [BioCentrum-DTU, Technical University of Denmark, DK-2800 Lyngby (Denmark); Cell and Organism Biology, Lund University, Soelvegatan 35, SE-22362 Lund (Sweden)

    2009-05-01

    Drosophila melanogaster multisubstrate deoxyribonucleoside kinase (Dm-dNK) can additionally sensitize human cancer cell lines towards the anti-cancer drug gemcitabine. We show that this property is based on the Dm-dNK ability to efficiently phosphorylate gemcitabine. The 2.2 A resolution structure of Dm-dNK in complex with gemcitabine shows that the residues Tyr70 and Arg105 play a crucial role in the firm positioning of gemcitabine by extra interactions made by the fluoride atoms. This explains why gemcitabine is a good substrate for Dm-dNK.

  12. Crystal structure of enolase from Drosophila melanogaster.

    Science.gov (United States)

    Sun, Congcong; Xu, Baokui; Liu, Xueyan; Zhang, Zhen; Su, Zhongliang

    2017-04-01

    Enolase is an important enzyme in glycolysis and various biological processes. Its dysfunction is closely associated with diseases. Here, the enolase from Drosophila melanogaster (DmENO) was purified and crystallized. A crystal of DmENO diffracted to 2.0 Å resolution and belonged to space group R32. The structure was solved by molecular replacement. Like most enolases, DmENO forms a homodimer with conserved residues in the dimer interface. DmENO possesses an open conformation in this structure and contains conserved elements for catalytic activity. This work provides a structural basis for further functional and evolutionary studies of enolase.

  13. Genome, evolution, Drosophila and beyond: the new dimensions.

    Science.gov (United States)

    Prigent, Stéphane R; Rajpurohit, Subhash

    2007-01-01

    A century ago a little fly with red eyes was first used for genetic studies. That insignificant fly, called at that time Drosophila ampelophila, revolutionized biology while becoming the model we know today under the name of Drosophila melanogaster. Since then its study has never ceased, but the field of interest has somewhat changed during the century. To caricature a little, today we essentially learn from Drosophila meetings that the fly has a brain! It is true that the fly is a tremendous model organism for neurobiology. But this fly is, in fact, an appropriate and recognized model for the whole of biology. Indeed, Drosophila meetings are exceptional opportunities to gather biologists of diverse backgrounds together. There we not only learn about the latest improvements in our field of interest, but surely appreciate learning another bit of biology. From this biological melting pot has emerged a culture very specific to the fly community. Thus besides neurobiology, cell biology and development, a diversity of other research fields exist; they all have their own place in the cultural and historical dimension of the "drosophila" model. Several communications from those diverse research fields were presented at the 8th Japanese Drosophila Research Conference (JDRC8) and are briefly covered here. We believe it more judicious to call the model "drosophila" without a capital initial, as the model has never really been limited to only the Drosophila genus. The vernacular name "drosophila" is currently used to designate any fly of the Drosophilidae family and we believe the term more appropriate than "small fruit fly" or "vinegar fly" to better include the species and ecological diversity of the model.

  14. Learner discipline: An Australian perspective

    Directory of Open Access Journals (Sweden)

    D. Stewart

    2004-07-01

    Full Text Available Australian schools by and large are safe schools. Nonetheless discipline problems do exist – including bullying behaviour. For this kind of problem schools should have management policies in place. As traditional behaviour-management practices – including corporal punishment – are largely prohibited in Australian schools, contemporary practices centre on management through supportive school programmes, including appropriate curricula and school-support structures. This article supports the belief that measures such as the exclusion of misbehaving learners should be treated with caution. Measures such as this might not reflect accepted international principles and practices and should only be exercised in the most extreme circumstances. The article also supports the view that it is part of the school’s role to ensure that all learners are aware of the reality that while they have rights, they also have corresponding responsibilities. This awareness is more likely to be achieved in a supportive school culture where each learner is recognised as having unique qualities that can mature and grow in an appropriate learning environment.

  15. Australian Expatriates: Who are They?

    Directory of Open Access Journals (Sweden)

    David Calderón Prada

    2007-01-01

    Full Text Available Australia is made up of 20 million people and, interestingly enough, over one million of the total population live overseas. Australians living abroad are known as `expatriates´ and they have a particular profile: highly educated and better skilled than their counterparts at home. Thus, on the one hand, a general division may be established between expatriates and Australians living at home; on the other, a particular division between expatriates themselves, which depends on the individual reasons that push them to leave Australia. At this point, it is important to outline the general reasons that lead expatriates to go overseas. To begin with, in terms of migration, Australia is both historically and contemporarily linked to other countries. Secondly, Australia is geographically isolated and, therefore, far away from the main global markets. Finally, it is quite right to conclude that although the logical assumption of expatriation is distance, expatriates are mentally, and often emotionally, linked to Australia and, therefore, the understanding of their situation is more positive than negative

  16. Sigma virus and mutation in Drosophila melanogaster

    International Nuclear Information System (INIS)

    Paquin, S.L.A.

    1977-01-01

    - The objectives of these experiments have been (1) to verify and evidence more fully the action of sigma in causing recessive lethal mutation on the X chromosome of Drosophila, both in the male and the female germ line; (2) to extend the study of sigma-induced recessive lethal mutation to the Drosophila autosomes; (3) to explore the possibility that this mutagenesis is site-directed; (4) to study the effects of sigma virus in conjunction with radiation in increasing non-disjunction and dominant lethality. The virus increases the rate of radiation-induced nondisjunction by altering meiotic chromosomal behavior. Percentage of non-disjunction with 500 rads of x-rays in the virus-free flies was 0.176, while in sigma-containing lines it was 0.333. With high doses of either x or neutron radiation, the presence of the virus enhances the frequency of dominant lethality. The difference is especially significant with the fast neutrons. The results indicate that sigma, and presumably other viruses, are indeed environmental mutagens and are, therefore, factors in the rate of background or spontaneous mutation

  17. Modeling Fragile X Syndrome in Drosophila

    Science.gov (United States)

    Drozd, Małgorzata; Bardoni, Barbara; Capovilla, Maria

    2018-01-01

    Intellectual disability (ID) and autism are hallmarks of Fragile X Syndrome (FXS), a hereditary neurodevelopmental disorder. The gene responsible for FXS is Fragile X Mental Retardation gene 1 (FMR1) encoding the Fragile X Mental Retardation Protein (FMRP), an RNA-binding protein involved in RNA metabolism and modulating the expression level of many targets. Most cases of FXS are caused by silencing of FMR1 due to CGG expansions in the 5′-UTR of the gene. Humans also carry the FXR1 and FXR2 paralogs of FMR1 while flies have only one FMR1 gene, here called dFMR1, sharing the same level of sequence homology with all three human genes, but functionally most similar to FMR1. This enables a much easier approach for FMR1 genetic studies. Drosophila has been widely used to investigate FMR1 functions at genetic, cellular, and molecular levels since dFMR1 mutants have many phenotypes in common with the wide spectrum of FMR1 functions that underlay the disease. In this review, we present very recent Drosophila studies investigating FMRP functions at genetic, cellular, molecular, and electrophysiological levels in addition to research on pharmacological treatments in the fly model. These studies have the potential to aid the discovery of pharmacological therapies for FXS.

  18. Imaging fictive locomotor patterns in larval Drosophila

    Science.gov (United States)

    Bayley, Timothy G.; Taylor, Adam L.; Berni, Jimena; Bate, Michael; Hedwig, Berthold

    2015-01-01

    We have established a preparation in larval Drosophila to monitor fictive locomotion simultaneously across abdominal and thoracic segments of the isolated CNS with genetically encoded Ca2+ indicators. The Ca2+ signals closely followed spiking activity measured electrophysiologically in nerve roots. Three motor patterns are analyzed. Two comprise waves of Ca2+ signals that progress along the longitudinal body axis in a posterior-to-anterior or anterior-to-posterior direction. These waves had statistically indistinguishable intersegmental phase delays compared with segmental contractions during forward and backward crawling behavior, despite being ∼10 times slower. During these waves, motor neurons of the dorsal longitudinal and transverse muscles were active in the same order as the muscle groups are recruited during crawling behavior. A third fictive motor pattern exhibits a left-right asymmetry across segments and bears similarities with turning behavior in intact larvae, occurring equally frequently and involving asymmetry in the same segments. Ablation of the segments in which forward and backward waves of Ca2+ signals were normally initiated did not eliminate production of Ca2+ waves. When the brain and subesophageal ganglion (SOG) were removed, the remaining ganglia retained the ability to produce both forward and backward waves of motor activity, although the speed and frequency of waves changed. Bilateral asymmetry of activity was reduced when the brain was removed and abolished when the SOG was removed. This work paves the way to studying the neural and genetic underpinnings of segmentally coordinated motor pattern generation in Drosophila with imaging techniques. PMID:26311188

  19. Structure of PCNA from Drosophila melanogaster

    International Nuclear Information System (INIS)

    Wang, Ke; Shi, Zhubing; Zhang, Min; Cheng, Dianlin

    2013-01-01

    Proliferating cell nuclear antigen (PCNA) plays essential roles in DNA replication, DNA repair, cell-cycle regulation and chromatin metabolism. The PCNA from Drosophila melanogaster (DmPCNA) has been purified and crystallized. Proliferating cell nuclear antigen (PCNA) plays essential roles in DNA replication, DNA repair, cell-cycle regulation and chromatin metabolism. The PCNA from Drosophila melanogaster (DmPCNA) was purified and crystallized. The crystal of DmPCNA diffracted to 2.0 Å resolution and belonged to space group H3, with unit-cell parameters a = b = 151.16, c = 38.28 Å. The structure of DmPCNA was determined by molecular replacement. DmPCNA forms a symmetric homotrimer in a head-to-tail manner. An interdomain connector loop (IDCL) links the N- and C-terminal domains. Additionally, the N-terminal and C-terminal domains contact each other through hydrophobic associations. Compared with human PCNA, the IDCL of DmPCNA has conformational changes, which may explain their difference in function. This work provides a structural basis for further functional and evolutionary studies of PCNA

  20. Adaptive Evolution of Gene Expression in Drosophila.

    Science.gov (United States)

    Nourmohammad, Armita; Rambeau, Joachim; Held, Torsten; Kovacova, Viera; Berg, Johannes; Lässig, Michael

    2017-08-08

    Gene expression levels are important quantitative traits that link genotypes to molecular functions and fitness. In Drosophila, population-genetic studies have revealed substantial adaptive evolution at the genomic level, but the evolutionary modes of gene expression remain controversial. Here, we present evidence that adaptation dominates the evolution of gene expression levels in flies. We show that 64% of the observed expression divergence across seven Drosophila species are adaptive changes driven by directional selection. Our results are derived from time-resolved data of gene expression divergence across a family of related species, using a probabilistic inference method for gene-specific selection. Adaptive gene expression is stronger in specific functional classes, including regulation, sensory perception, sexual behavior, and morphology. Moreover, we identify a large group of genes with sex-specific adaptation of expression, which predominantly occurs in males. Our analysis opens an avenue to map system-wide selection on molecular quantitative traits independently of their genetic basis. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  1. Quantification of food intake in Drosophila.

    Directory of Open Access Journals (Sweden)

    Richard Wong

    2009-06-01

    Full Text Available Measurement of food intake in the fruit fly Drosophila melanogaster is often necessary for studies of behaviour, nutrition and drug administration. There is no reliable and agreed method for measuring food intake of flies in undisturbed, steady state, and normal culture conditions. We report such a method, based on measurement of feeding frequency by proboscis-extension, validated by short-term measurements of food dye intake. We used the method to demonstrate that (a female flies feed more frequently than males, (b flies feed more often when housed in larger groups and (c fly feeding varies at different times of the day. We also show that alterations in food intake are not induced by dietary restriction or by a null mutation of the fly insulin receptor substrate chico. In contrast, mutation of takeout increases food intake by increasing feeding frequency while mutation of ovo(D increases food intake by increasing the volume of food consumed per proboscis-extension. This approach provides a practical and reliable method for quantification of food intake in Drosophila under normal, undisturbed culture conditions.

  2. The smell of love in Drosophila

    Directory of Open Access Journals (Sweden)

    Anna B. eZiegler

    2013-04-01

    Full Text Available Odors are key sensory signals for social communication and food search in animals including insects. Drosophila melanogaster, is a powerful neurogenetic model commonly used to reveal molecular and cellular mechanisms involved in odorant detection. Males use olfaction together with other sensory modalities to find their mates. Here, we review known olfactory signals, their related olfactory receptors, and the corresponding neuronal architecture impacting courtship. OR67d receptor detects 11-cis-Vaccenyl Acetate (cVA, a male specific pheromone transferred to the female during copulation. Transferred cVA is able to reduce female attractiveness for other males after mating, and is also suspected to decrease male-male courtship. cVA can also serve as an aggregation signal, maybe through another OR. OR47b was shown to be activated by fly odors, and to enhance courtship depending on taste pheromones. IR84a detects phenylacetic acid (PAA and phenylacetaldehyde. These two odors are not pheromones produced by flies, but are present in various fly food sources. PAA enhances male courtship, acting as a food aphrodisiac. Drosophila males have thus developed complementary olfactory strategies to help them to select their mates.

  3. Odd-Paired: The Drosophila Zic Gene.

    Science.gov (United States)

    Hursh, Deborah A; Stultz, Brian G

    2018-01-01

    Zinc finger in the cerebellum (Zic) proteins are a family of transcription factors with multiple roles during development, particularly in neural tissues. The founding member of the Zic family is the Drosophila odd-paired (opa) gene. The Opa protein has a DNA binding domain containing five Cys2His2-type zinc fingers and has been shown to act as a sequence-specific DNA binding protein. Opa has significant homology to mammalian Zic1, Zic2, and Zic3 within the zinc finger domain and in two other conserved regions outside that domain. opa was initially identified as a pair-rule gene, part of the hierarchy of genes that establish the segmental body plan of the early Drosophila embryo. However, its wide expression pattern during embryogenesis indicates it plays additional roles. Embryos deficient in opa die before hatching with aberrant segmentation but also with defects in larval midgut formation. Post-embryonically, opa plays important roles in adult head development and circadian rhythm. Based on extensive neural expression, opa is predicted to be involved in many aspects of neural development and behavior, like other proteins of the Zic family. Consensus DNA binding sites have been identified for Opa and have been shown to activate transcription in vivo. However, there is evidence Opa may serve as a transcriptional regulator in the absence of direct DNA binding, as has been seen for other Zic proteins.

  4. Genetic variation for cardiac dysfunction in Drosophila.

    Directory of Open Access Journals (Sweden)

    Karen A Ocorr

    Full Text Available BACKGROUND: Common diseases may be attributed to combinations of variant alleles, but there are few model systems where the interactions among such variants can be studied in controlled genetic crosses. While association studies are designed to detect common polymorphisms of moderate effect, new approaches are required to characterize the impact on disease of interactions among rare alleles. METHODOLOGY/PRINCIPAL FINDINGS: We show that wild populations of Drosophila melanogaster harbor rare polymorphisms of major effect (RAME that predispose flies to a specific disease phenotype, age-dependent cardiac dysfunction. A screen of fifty inbred wild-type lines revealed a continuous spectrum of pacing-induced heart failure that generally increases in frequency with age. High-speed video analysis of the inbred lines with high rates of inducible heart failure indicates specific defects in cardiac function, including arrhythmias and contractile disorders ('cardiomyopathies'. A combination of bulked segregant analysis and single feature polymorphism (SFP detection localizes one of the cardiac susceptibility loci to the 97C interval on the fly genome. CONCLUSIONS/SIGNIFICANCE: Wild-type Drosophila, like humans, are predisposed to cardiac dysfunction. Identification of factors associated with these naturally occurring cardiac traits promises to provide important insights into the epidemiology of cardiac disease.

  5. Australian natural gas market outlook

    International Nuclear Information System (INIS)

    Anon.

    2004-01-01

    A new study of the Australian natural gas industry by leading Australian economics and policy consultancy ACIL Tasman highlights the significant supply and demand side uncertainties currently facing the industry. The ACIL Tasman 'Australian Gas Market Review and Outlook 2004' study presents modelling results for three supply/demand scenarios in Eastern Australia and two in Western Australia. The results show that, even under moderate assumptions about future levels of gas demand growth, major supply-side investment is likely to be needed over the next ten to fifteen years. The base supply/demand scenario for Eastern Australia and Northern Territory, illustrated in Figure 1, shows that even allowing for substantial new discoveries in existing production basins and major expansion of coal seam methane production, in the absence of a northern gas connection to the eastern states (Timor Sea or PNG Highlands) a significant supply gap will begin to emerge from around 2013. The study identifies several supply-side options for Eastern Australia - new discoveries in the established production provinces in Bass Strait and Central Australia; greenfield developments such as the Otway Basin offshore from Victoria and South Australia; continuing expansion of coal seam methane production in Queensland and New South Wales; and gas from Papua New Guinea, Timor Sea or from the North West Shelf region delivered via a trans-continental pipeline. The study concludes that it is unlikely that any single option will suffice to meet future demand. Almost inevitably, a combination of these sources will be needed if anticipated growth opportunities are to be met. With regard to prices, the study shows that in the short to medium term the outlook is for some real reductions in wholesale prices in most regional markets. This reflects increasing levels of upstream competition and declining real costs of pipeline transportation. However in the longer term, supply-side constraints will tend to

  6. Molecular Cloning and Genomic Organization of a Novel Receptor from Drosophila melanogaster Structurally Related to Mammalian Galanin Receptors

    DEFF Research Database (Denmark)

    Lenz, Camilla; Søndergaard, L.; Grimmelikhuijzen, Cornelis J.P.

    2000-01-01

    neurobiologi, molekylærbiologi, zoologi, neurohormonereceptor, allatostatin, galanin, insekt, Drosophila......neurobiologi, molekylærbiologi, zoologi, neurohormonereceptor, allatostatin, galanin, insekt, Drosophila...

  7. Genome-wide comparative analysis of four Indian Drosophila species.

    Science.gov (United States)

    Mohanty, Sujata; Khanna, Radhika

    2017-12-01

    Comparative analysis of multiple genomes of closely or distantly related Drosophila species undoubtedly creates excitement among evolutionary biologists in exploring the genomic changes with an ecology and evolutionary perspective. We present herewith the de novo assembled whole genome sequences of four Drosophila species, D. bipectinata, D. takahashii, D. biarmipes and D. nasuta of Indian origin using Next Generation Sequencing technology on an Illumina platform along with their detailed assembly statistics. The comparative genomics analysis, e.g. gene predictions and annotations, functional and orthogroup analysis of coding sequences and genome wide SNP distribution were performed. The whole genome of Zaprionus indianus of Indian origin published earlier by us and the genome sequences of previously sequenced 12 Drosophila species available in the NCBI database were included in the analysis. The present work is a part of our ongoing genomics project of Indian Drosophila species.

  8. Neurogenetics of female reproductive behaviors in Drosophila melanogaster

    NARCIS (Netherlands)

    Laturney, Meghan; Billeter, Jean-Christophe; Friedmann, T; Dunlap, JC; Goodwin, SF

    2014-01-01

    We follow an adult Drosophila melanogaster female through the major reproductive decisions she makes during her lifetime, including habitat selection, precopulatory mate choice, postcopulatory physiological changes, polyandry, and egg-laying site selection. In the process, we review the molecular

  9. Neuromodulation and Strategic Action Choice in Drosophila Aggression.

    Science.gov (United States)

    Asahina, Kenta

    2017-07-25

    In this review, I discuss current knowledge and outstanding questions on the neuromodulators that influence aggressive behavior of the fruit fly Drosophila melanogaster. I first present evidence that Drosophila exchange information during an agonistic interaction and choose appropriate actions based on this information. I then discuss the influence of several biogenic amines and neuropeptides on aggressive behavior. One striking characteristic of neuromodulation is that it can configure a neural circuit dynamically, enabling one circuit to generate multiple outcomes. I suggest a consensus effect of each neuromodulatory molecule on Drosophila aggression, as well as effects of receptor proteins where relevant data are available. Lastly, I consider neuromodulation in the context of strategic action choices during agonistic interactions. Genetic components of neuromodulatory systems are highly conserved across animals, suggesting that molecular and cellular mechanisms controlling Drosophila aggression can shed light on neural principles governing action choice during social interactions.

  10. NF-1 Dependent Gene Regulation in Drosophila Melanogaster

    National Research Council Canada - National Science Library

    Zhong, Yi

    2004-01-01

    .... We have used an Affymetrix whole genome chip, containing all 13,500 genes of the fruit fly Drosophila, to identify 93 genes with altered expression patterns in flies that have no NF1 protein compared...

  11. Induction of morphological aberrations by enzyme inhibition in Drosophila melanogaster

    NARCIS (Netherlands)

    Bos, M.; Scharloo, W.; Bijlsma, R.; de Boer, I.M.; den Hollander, J.

    1969-01-01

    Zusatz zum Futter vonDrosophila melanogaster von 5-Fluoro-2-deoxyuridin oder Aminopterin induziert überzählige Skutellar- und Dorsozentralborsten sowie gekerbte Flügel. Diese Modifikationen wurden als Konsequenz von Enzymhemmung interpretiert.

  12. A new opportunity for Australian uranium

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1994-07-01

    This study analyses the outlook for the world uranium industry and includes projections of uranium demand, supply and prices over the next decade and a comparison with other forecasts. The potential increases in Australian output are quantified, under both continuation of the three mine policy and an open mine policy, as well as the potential impact on the world uranium market, using the well known ORANI model of the Australian economy. It is estimated that Australian output could almost double by 2004 if the three mine policy were abolished. 53 refs., 20 tabs., 6 figs.

  13. Preventing proliferation : the role of Australian uranium

    International Nuclear Information System (INIS)

    Falk, J.

    1987-01-01

    The uranium debate has polarised Australian society for almost a decade. From 1977 until just before it achieved office in 1983 the Australia Labor Party took a position of strong opposition to uranium exports. The Australian Council of Trade Unions, the Australian Democrats, the Nuclear Disarmament Party, and many other organisations and sections of the community continue to oppose uranium mining and exports. Australia's uranium is currently exported for use in the commercial nuclear fuel cycle. But as the nuclear plants which are part of this cycle spread across the world, the risk rises that they will provide the cover and facilities for increasing numbers of countries to move towards nuclear weapons capability

  14. Compliance with Corporate Governance Principles: Australian Evidence

    Directory of Open Access Journals (Sweden)

    Maryam Safari

    2015-12-01

    Full Text Available This study investigates the association between the level of compliance of Australian listed companies with Australian corporate governance principles, in aggregate, and the level of discretionary accruals using the modified Jones model. It is hypothesised that higher levels of compliance would be associated with lower levels of discretionary accruals. Data from a random sample of 214 Australian listed companies for the years 2009 and 2010 were used to test the hypothesis. The results demonstrate a significant negative relationship indicating that companies with higher levels of compliance engage in lower levels of earnings management via discretionary accruals.

  15. A new opportunity for Australian uranium

    International Nuclear Information System (INIS)

    1994-07-01

    This study analyses the outlook for the world uranium industry and includes projections of uranium demand, supply and prices over the next decade and a comparison with other forecasts. The potential increases in Australian output are quantified, under both continuation of the three mine policy and an open mine policy, as well as the potential impact on the world uranium market, using the well known ORANI model of the Australian economy. It is estimated that Australian output could almost double by 2004 if the three mine policy were abolished. 53 refs., 20 tabs., 6 figs

  16. Australians' attitudes to nuclear disarmament

    International Nuclear Information System (INIS)

    Clark, A.W.; Trahair, R.C.S.; Powell, R.J.; Walker, R.M.

    1985-08-01

    The results of a series of surveys of 2900 Australians show that some 80 per cent favour nuclear disarmament. The nuclear disarmament view is broad-based, for example it cuts across differences in age, sex and education. However the view is more common among people towards the left of the political spectrum who view the world as benign rather than hostile and who consider stockpiles can be reduced by small, reciprocated and supervised reductions. Between 2.5 per cent and 5.5 per cent of respondents act to bring about nuclear disarmament. The findings support and extend results from studies outside Australia showing that attitudes favouring nuclear disarmament are distributing themselves widely

  17. EQA from an Australian perspective.

    Science.gov (United States)

    Bais, Renze

    2007-11-01

    Enrolment in external quality assurance programs is part of the accreditation process for medical laboratories in Australia, with the majority of Australian laboratories being enrolled in programs from RCPA Quality Assurance Programs Pty Limited, a company owned by the Royal College of Pathologists of Australasia. An important feature of these programs is that they have been developed with the involvement and contribution of the profession. For example, the Chemical Pathology programs are a joint venture between the company and the Australasian Association of Clinical Biochemists (AACB). Some of the unique features of the programs are the composition of the material, the use of target values, the structure and information in the reports and the use of the internet for data entry and data review. Over the past thirty years, the development of these programs has made a significant contribution to the quality of laboratories in Australia.

  18. The Australian terrestrial carbon budget

    Science.gov (United States)

    Haverd, V.; Raupach, M. R.; Briggs, P. R.; Canadell, J. G.; Davis, S. J.; Law, R. M.; Meyer, C. P.; Peters, G. P.; Pickett-Heaps, C.; Sherman, B.

    2013-02-01

    This paper reports a study of the full carbon (C-CO2) budget of the Australian continent, focussing on 1990-2011 in the context of estimates over two centuries. The work is a contribution to the RECCAP (REgional Carbon Cycle Assessment and Processes) project, as one of numerous regional studies. In constructing the budget, we estimate the following component carbon fluxes: net primary production (NPP); net ecosystem production (NEP); fire; land use change (LUC); riverine export; dust export; harvest (wood, crop and livestock) and fossil fuel emissions (both territorial and non-territorial). Major biospheric fluxes were derived using BIOS2 (Haverd et al., 2012), a fine-spatial-resolution (0.05°) offline modelling environment in which predictions of CABLE (Wang et al., 2011), a sophisticated land surface model with carbon cycle, are constrained by multiple observation types. The mean NEP reveals that climate variability and rising CO2 contributed 12 ± 24 (1σ error on mean) and 68 ± 15 TgC yr-1, respectively. However these gains were partially offset by fire and LUC (along with other minor fluxes), which caused net losses of 26 ± 4 TgC yr-1 and 18 ± 7 TgC yr-1, respectively. The resultant net biome production (NBP) is 36 ± 29 TgC yr-1, in which the largest contributions to uncertainty are NEP, fire and LUC. This NBP offset fossil fuel emissions (95 ± 6 TgC yr-1) by 38 ± 30%. The interannual variability (IAV) in the Australian carbon budget exceeds Australia's total carbon emissions by fossil fuel combustion and is dominated by IAV in NEP. Territorial fossil fuel emissions are significantly smaller than the rapidly growing fossil fuel exports: in 2009-2010, Australia exported 2.5 times more carbon in fossil fuels than it emitted by burning fossil fuels.

  19. Drosophila C Virus Systemic Infection Leads to Intestinal Obstruction

    OpenAIRE

    Chtarbanova, Stanislava; Lamiable, Olivier; Lee, Kwang-Zin; Galiana, Delphine; Troxler, Laurent; Meignin, Carine; Hetru, Charles; Hoffmann, Jules A.; Daeffler, Laurent; Imler, Jean-Luc

    2014-01-01

    Drosophila C virus (DCV) is a positive-sense RNA virus belonging to the Dicistroviridae family. This natural pathogen of the model organism Drosophila melanogaster is commonly used to investigate antiviral host defense in flies, which involves both RNA interference and inducible responses. Although lethality is used routinely as a readout for the efficiency of the antiviral immune response in these studies, virus-induced pathologies in flies still are poorly understood. Here, we characterize ...

  20. The Persistence of Facultative Parthenogenesis in Drosophila albomicans

    OpenAIRE

    Chang, Chia-chen; Ting, Chau-Ti; Chang, Ching-Ho; Fang, Shu; Chang, Hwei-yu

    2014-01-01

    Parthenogenesis has evolved independently in more than 10 Drosophila species. Most cases are tychoparthenogenesis, which is occasional or accidental parthenogenesis in normally bisexual species with a low hatching rate of eggs produced by virgin females; this form is presumed to be an early stage of parthenogenesis. To address how parthenogenesis and sexual reproduction coexist in Drosophila populations, we investigated several reproductive traits, including the fertility, parthenogenetic cap...

  1. Dietary glucose regulates yeast consumption in adult Drosophila males

    OpenAIRE

    Lebreton, S?bastien; Witzgall, Peter; Olsson, Marie; Becher, Paul G.

    2014-01-01

    The adjustment of feeding behavior in response to hunger and satiety contributes to homeostatic regulation in animals. The fruit fly Drosophila melanogaster feeds on yeasts growing on overripe fruit, providing nutrients required for adult survival, reproduction and larval growth. Here, we present data on how the nutritional value of food affects subsequent yeast consumption in Drosophila adult males. After a period of starvation, flies showed intensive yeast consumption. In comparison, flies ...

  2. Molecular characterization of the Drosophila responses towards nematodes

    OpenAIRE

    Arefin, Md. Badrul

    2016-01-01

    A sophisticated evolutionary conserved innate immune system has evolved in insects to fight pathogens and to restrict damage in harmful (danger) situations including cancer. A significant amount of knowledge about different infection models in Drosophila has been generated in past decades, which revealed functional resemblances and implications for vertebrate systems. However, how Drosophila responds towards multicellular parasitic nematodes and in danger situations is still little understood...

  3. Genomic and karyotypic variation in Drosophila parasitoids (Hymenoptera, Cynipoidea, Figitidae

    Directory of Open Access Journals (Sweden)

    Vladimir Gokhman

    2011-08-01

    Full Text Available Drosophila melanogaster Meigen, 1830 has served as a model insect for over a century. Sequencing of the 11 additional Drosophila Fallen, 1823 species marks substantial progress in comparative genomics of this genus. By comparison, practically nothing is known about the genome size or genome sequences of parasitic wasps of Drosophila. Here, we present the first comparative analysis of genome size and karyotype structures of Drosophila parasitoids of the Leptopilina Förster, 1869 and Ganaspis Förster, 1869 species. The gametic genome size of Ganaspis xanthopoda (Ashmead, 1896 is larger than those of the three Leptopilina species studied. The genome sizes of all parasitic wasps studied here are also larger than those known for all Drosophila species. Surprisingly, genome sizes of these Drosophila parasitoids exceed the average value known for all previously studied Hymenoptera. The haploid chromosome number of both Leptopilina heterotoma (Thomson, 1862 and L. victoriae Nordlander, 1980 is ten. A chromosomal fusion appears to have produced a distinct karyotype for L. boulardi (Barbotin, Carton et Keiner-Pillault, 1979 (n = 9, whose genome size is smaller than that of wasps of the L. heterotoma clade. Like L. boulardi, the haploid chromosome number for G. xanthopoda is also nine. Our studies reveal a positive, but non linear, correlation between the genome size and total chromosome length in Drosophila parasitoids. These Drosophila parasitoids differ widely in their host range, and utilize different infection strategies to overcome host defense. Their comparative genomics, in relation to their exceptionally well-characterized hosts, will prove to be valuable for understanding the molecular basis of the host-parasite arms race and how such mechanisms shape the genetic structures of insect communities.

  4. Reassignment of Drosophila willistoni Genome Scaffolds to Chromosome II Arms

    OpenAIRE

    Garcia, Carolina; Delprat, Alejandra; Ruiz, Alfredo; Valente, Vera L. S.

    2015-01-01

    Drosophila willistoni is a geographically widespread Neotropical species. The genome of strain Gd-H4-1 from Guadeloupe Island (Caribbean) was sequenced in 2007 as part of the 12 Drosophila Genomes Project. The assembled scaffolds were joined based on conserved linkage and assigned to polytene chromosomes based on a handful of genetic and physical markers. This paucity of markers was particularly striking in the metacentric chromosome II, comprised two similarly sized arms, IIL and IIR, tradit...

  5. The influence of sterol metabolism upon radiation-induced aneuploidy of Drosophila melanogaster in the yeast-drosophila system

    International Nuclear Information System (INIS)

    Savitsij, V.V.; Luchnikova, E.M.; Inge-Vechtomov, S.I.

    1985-01-01

    The influence of sterol metabolism upon induced Drosophila melanogaster mutagenesis in an ecology-genetic yeast-drosophila system has been studied. The sterol deficit in fly organism has been created for account of using as food substrate for fremales of biomass of saccharomyces cerevisiae living cells of 9-2-PZ12 train with nyssup(r1) locus mutation which blocks the ergosterol synthesis. It has been found that the Drosophila females content on mutant yeast increases the frequency of losses and non discrepancy of X-chromosomes induced by X-radiation (1000 R). Addition into yeast biomass of 0.1 % cholesterol solution in 10 %-ethanol reduces the oocytes resistance to X-radiation up to control level. Possible hormonal and membrane mechanisms of increasing radiation-induced aneuploidy of Drosophila and the role of sterol metabolism in organism resistance to damaging factors are discussed

  6. The Size and Organisation of the Australian Army in the Near Future Given the Australian Defence Force White Paper 2000

    Science.gov (United States)

    2002-01-01

    over the past ten years are Defending Australia : Defence White Paper 1994, Australian Strategic Policy 1997, and Defence 2000 Our Future Defence Force...Australian Army. Commonwealth of Australia , 1994. Defending Australia : Defence White Paper 1994, Canberra, A.C.T: Australian Government Publishing Service. de...THE SIZE AND ORGANISATION OF THE AUSTRALIAN ARMY IN THE NEAR FUTURE GIVEN THE AUSTRALIAN DEFENCE FORCE WHITE PAPER 2000 A thesis presented to the

  7. Australian Vocational Education: Learning from Past Mistakes?

    Science.gov (United States)

    Stevenson, John

    1992-01-01

    Competing pressures on Australian educational managers include pressure to implement competency-based training, to manage using the industrial model, and to husband resources, conflicting with traditional educational goals, government policies, and demands for accountability. (SK)

  8. Healthier times?: revisiting Indigenous Australian health history.

    Science.gov (United States)

    Blyton, Greg

    2009-01-01

    The perception that Indigenous Australians were primitive hunters and gatherers who lived in a nomadic 'Stone Age' culture resonates through most narratives found on Indigenous people in pre-colonial times. This narrative is better placed in the realm of myth; I contest claims that the life expectancy of Indigenous Australians was only forty years in pre-colonial times, by providing suggestive evidence that there is a strong probability that longevity favoured Indigenous Australians in comparison to many poorer sectors of the European population living in slum habitats. As well, I will challenge notions that Indigenous Australians were more violent than supposedly 'civilised' nations. Finally I express the hope that future researchers will revisit archival sources to develop a more nuanced perspective on the past.

  9. Linguistic aspects of Australian Aboriginal English.

    Science.gov (United States)

    Butcher, Andrew

    2008-08-01

    It is probable that the majority of the 455 000 strong Aboriginal population of Australia speak some form of Australian Aboriginal English (AAE) at least some of the time and that it is the first (and only) language of many Aboriginal children. This means their language is somewhere on a continuum ranging from something very close to Standard Australian English (SAE) at one end, through to something very close to creole at the other. The phonetics and phonology, grammar, and lexicon of AAE are influenced to varying degrees by the Australian Aboriginal language substrate. There are also some features typical of non-standard Englishes in general, and some which have been retained from earlier forms of the colonial language. Many teachers still see this variety as an uneducated or corrupted form of Standard Australian English, rather than as a different dialect of English that is just as efficient a medium of communication.

  10. The Australian synchrotron; Le synchrotron australien

    Energy Technology Data Exchange (ETDEWEB)

    Farhi, R

    2005-06-15

    This document recalls the historical aspects of the Australian Synchrotron which will be implemented in 2007. It presents then the objectives of this program, the specifications of the ring and the light lines. (A.L.B.)

  11. ANSTO: Australian Nuclear Science and Technology Organization

    International Nuclear Information System (INIS)

    1989-01-01

    The Australian Nuclear Science and Technology Organization conducts or is engaged in collaborative research and development in the application of nuclear science and associated technology. Through its Australian radio-isotopes unit, it markets radioisotopes, their products and other services for nuclear medicine industry and research. It also operates national nuclear facilities ( HIFAR and Moata research reactors), promote training, provide advice and disseminates information on nuclear science and technology. The booklet briefly outlines these activities. ills

  12. Japanese wives in Japanese-Australian intermarriages

    OpenAIRE

    Jared Denman

    2009-01-01

    The diasporic experiences of Japanese partners married to Australians and living in Australia are largely unexamined. This article is based on a study, conducted for an honours thesis, which invited four Japanese wives living in South East Queensland to describe, together with their Australian husbands, their family’s interactions with Japan, its language and culture, and the local Japanese community. It was recognised that the extensive social networks these wives had established and maintai...

  13. Cytoplasmic Streaming in the Drosophila Oocyte.

    Science.gov (United States)

    Quinlan, Margot E

    2016-10-06

    Objects are commonly moved within the cell by either passive diffusion or active directed transport. A third possibility is advection, in which objects within the cytoplasm are moved with the flow of the cytoplasm. Bulk movement of the cytoplasm, or streaming, as required for advection, is more common in large cells than in small cells. For example, streaming is observed in elongated plant cells and the oocytes of several species. In the Drosophila oocyte, two stages of streaming are observed: relatively slow streaming during mid-oogenesis and streaming that is approximately ten times faster during late oogenesis. These flows are implicated in two processes: polarity establishment and mixing. In this review, I discuss the underlying mechanism of streaming, how slow and fast streaming are differentiated, and what we know about the physiological roles of the two types of streaming.

  14. [Ulysses retrotransposon aspartate proteinase (Drosophila virilis)].

    Science.gov (United States)

    Volkov, D A; Savvateeva, L V; Dergousova, N I; Rumsh, L D

    2002-01-01

    Retrotransposones are mobile genetic elements occurring in genomes of bacteria, plants or animals. Retrotransposones were found to contain nucleotide sequences encoding proteins which are homological to retroviral aspartic proteinases. Our research has been focused on Ulysses which is mobile genetic element found in Drosophila virilis. We suggested a primary structure of Ulysses proteinase using comparative analysis of amino acid sequences of retroviral proteinases and proteinases from retrotransposones. The appropriate cDNA fragment has been cloned and expressed in E. coli. The purification of recombinant protein (12 kD) has been carried out by affinity chromatography using pepstatine-agarose. The obtained protein has proteolytic activity at optimum pH 5.5 like the majority of aspartic proteinases.

  15. Organization of the Drosophila larval visual circuit

    Science.gov (United States)

    Gendre, Nanae; Neagu-Maier, G Larisa; Fetter, Richard D; Schneider-Mizell, Casey M; Truman, James W; Zlatic, Marta; Cardona, Albert

    2017-01-01

    Visual systems transduce, process and transmit light-dependent environmental cues. Computation of visual features depends on photoreceptor neuron types (PR) present, organization of the eye and wiring of the underlying neural circuit. Here, we describe the circuit architecture of the visual system of Drosophila larvae by mapping the synaptic wiring diagram and neurotransmitters. By contacting different targets, the two larval PR-subtypes create two converging pathways potentially underlying the computation of ambient light intensity and temporal light changes already within this first visual processing center. Locally processed visual information then signals via dedicated projection interneurons to higher brain areas including the lateral horn and mushroom body. The stratified structure of the larval optic neuropil (LON) suggests common organizational principles with the adult fly and vertebrate visual systems. The complete synaptic wiring diagram of the LON paves the way to understanding how circuits with reduced numerical complexity control wide ranges of behaviors.

  16. Phenotypic plasticity of the Drosophila transcriptome.

    Directory of Open Access Journals (Sweden)

    Shanshan Zhou

    Full Text Available Phenotypic plasticity is the ability of a single genotype to produce different phenotypes in response to changing environments. We assessed variation in genome-wide gene expression and four fitness-related phenotypes of an outbred Drosophila melanogaster population under 20 different physiological, social, nutritional, chemical, and physical environments; and we compared the phenotypically plastic transcripts to genetically variable transcripts in a single environment. The environmentally sensitive transcriptome consists of two transcript categories, which comprise ∼15% of expressed transcripts. Class I transcripts are genetically variable and associated with detoxification, metabolism, proteolysis, heat shock proteins, and transcriptional regulation. Class II transcripts have low genetic variance and show sexually dimorphic expression enriched for reproductive functions. Clustering analysis of Class I transcripts reveals a fragmented modular organization and distinct environmentally responsive transcriptional signatures for the four fitness-related traits. Our analysis suggests that a restricted environmentally responsive segment of the transcriptome preserves the balance between phenotypic plasticity and environmental canalization.

  17. Studying cytokinesis in Drosophila epithelial tissues.

    Science.gov (United States)

    Pinheiro, D; Bellaïche, Y

    2017-01-01

    Epithelial tissue cohesiveness is ensured through cell-cell junctions that maintain both adhesion and mechanical coupling between neighboring cells. During development, epithelial tissues undergo intensive cell proliferation. Cell division, and particularly cytokinesis, is coupled to the formation of new adhesive contacts, thereby preserving tissue integrity and propagating cell polarity. Remarkably, the geometry of the new interfaces is determined by the combined action of the dividing cell and its neighbors. To further understand the interplay between the dividing cell and its neighbors, as well as the role of cell division for tissue morphogenesis, it is important to analyze cytokinesis in vivo. Here we present methods to perform live imaging of cell division in Drosophila epithelial tissues and discuss some aspects of image processing and analysis. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Longevity and the stress response in Drosophila

    DEFF Research Database (Denmark)

    Vermeulen, Corneel J.; Loeschcke, Volker

    2007-01-01

    to affect lifespan. The progress in modern genetic techniques has allowed researchers to test this idea. The general stress response involves the expression of stress proteins, such as chaperones and antioxidative proteins, downregulation of genes involved in energy metabolism and the release of protective......The concept that lifespan is a function of the capacity to withstand extrinsic stress is very old. In concordance with this, long-lived individuals often have increased resistance against a variety of stresses throughout life. Genes underlying the stress response may therefore have the ability...... briefly review the state of the art of research on ageing and longevity in the model organism Drosophila, with focus on the role of the general stress response. We will conclude by contemplating some of the implications of the findings in this research and will suggest several directions for future...

  19. Taste Preference Assay for Adult Drosophila.

    Science.gov (United States)

    Bantel, Andrew P; Tessier, Charles R

    2016-09-08

    Olfactory and gustatory perception of the environment is vital for animal survival. The most obvious application of these chemosenses is to be able to distinguish good food sources from potentially dangerous food sources. Gustation requires physical contact with a chemical compound which is able to signal through taste receptors that are expressed on the surface of neurons. In insects, these gustatory neurons can be located across the animal's body allowing taste to play an important role in many different behaviors. Insects typically prefer compounds containing sugars, while compounds that are considered bitter tasting are avoided. Given the basic biological importance of taste, there is intense interest in understanding the molecular mechanisms underlying this sensory modality. We describe an adult Drosophila taste assay which reflects the preference of the animals for a given tastant compound. This assay may be applied to animals of any genetic background to examine the taste preference for a desired soluble compound.

  20. MicroRNA function in Drosophila melanogaster.

    Science.gov (United States)

    Carthew, Richard W; Agbu, Pamela; Giri, Ritika

    2017-05-01

    Over the last decade, microRNAs have emerged as critical regulators in the expression and function of animal genomes. This review article discusses the relationship between microRNA-mediated regulation and the biology of the fruit fly Drosophila melanogaster. We focus on the roles that microRNAs play in tissue growth, germ cell development, hormone action, and the development and activity of the central nervous system. We also discuss the ways in which microRNAs affect robustness. Many gene regulatory networks are robust; they are relatively insensitive to the precise values of reaction constants and concentrations of molecules acting within the networks. MicroRNAs involved in robustness appear to be nonessential under uniform conditions used in conventional laboratory experiments. However, the robust functions of microRNAs can be revealed when environmental or genetic variation otherwise has an impact on developmental outcomes. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Proteome reference map of Drosophila melanogaster head.

    Science.gov (United States)

    Lee, Tian-Ren; Huang, Shun-Hong; Lee, Chi-Ching; Lee, Hsiao-Yun; Chan, Hsin-Tzu; Lin, Kuo-Sen; Chan, Hong-Lin; Lyu, Ping-Chiang

    2012-06-01

    Drosophila melanogaster has been used as a genetic model organism to understand the fundamental molecular mechanisms in human biology including memory formation that has been reported involving protein synthesis and/or post-translational modification. In this study, we employed a proteomic platform based on fluorescent 2DE and MALDI-TOF MS to build a standard D. melanogaster head proteome map for proteome-proteome comparison. In order to facilitate the comparison, an interactive database has been constructed for systematically integrating and analyzing the proteomes from different conditions and further implicated to study human diseases related to D. melanogaster model. In summary, the fundamental head proteomic database and bioinformatic analysis will be useful for further elucidating the biological mechanisms such as memory formation and neurodegenerative diseases. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Origin of meiotic nondisjunction in Drosophila females

    International Nuclear Information System (INIS)

    Grell, R.F.

    1978-01-01

    Meiotic nondisjunction can be induced by external agents, such as heat, radiation, and chemicals, and by internal genotypic alterations, namely, point mutations and chromosomal rearrangements. In many cases nondisjunction arises from a reduction or elimination of crossing-over, leading to the production of homologous univalents which fail to co-orient on the metaphase plate and to disjoin properly. In some organisms, e.g., Drosophila and perhaps man, distributive pairing [i.e., a post-exchange, size-dependent pairing] ensures the regular segregation of such homologous univalents. When a nonhomologous univalent is present, which falls within a size range permitting nonhomologous recognition and pairing, distributive nondisjunction of the homologues may follow. Examples of nondisjunction induced by inversion heterozygosity, translocation heterozygosity, chromosome fragments, radiation, heat, and recombination-defective mutants are presented

  3. A microsatellite linkage map of Drosophila mojavensis

    Directory of Open Access Journals (Sweden)

    Schully Sheri

    2004-05-01

    Full Text Available Abstract Background Drosophila mojavensis has been a model system for genetic studies of ecological adaptation and speciation. However, despite its use for over half a century, no linkage map has been produced for this species or its close relatives. Results We have developed and mapped 90 microsatellites in D. mojavensis, and we present a detailed recombinational linkage map of 34 of these microsatellites. A slight excess of repetitive sequence was observed on the X-chromosome relative to the autosomes, and the linkage groups have a greater recombinational length than the homologous D. melanogaster chromosome arms. We also confirmed the conservation of Muller's elements in 23 sequences between D. melanogaster and D. mojavensis. Conclusions The microsatellite primer sequences and localizations are presented here and made available to the public. This map will facilitate future quantitative trait locus mapping studies of phenotypes involved in adaptation or reproductive isolation using this species.

  4. Genetic control of Drosophila nerve cord development

    Science.gov (United States)

    Skeath, James B.; Thor, Stefan

    2003-01-01

    The Drosophila ventral nerve cord has been a central model system for studying the molecular genetic mechanisms that control CNS development. Studies show that the generation of neural diversity is a multistep process initiated by the patterning and segmentation of the neuroectoderm. These events act together with the process of lateral inhibition to generate precursor cells (neuroblasts) with specific identities, distinguished by the expression of unique combinations of regulatory genes. The expression of these genes in a given neuroblast restricts the fate of its progeny, by activating specific combinations of downstream genes. These genes in turn specify the identity of any given postmitotic cell, which is evident by its cellular morphology and choice of neurotransmitter.

  5. Transcription profiling of Drosophila exposed to a levitation magnet for different lengths of time

    Data.gov (United States)

    National Aeronautics and Space Administration — Drosophila samples were exposed to the levitation magnet inside a 25mm diameter tubes with 3 ml of yeast-based Drosophila food in the bottom and a chamber of only 5...

  6. Chloride channels in the plasma membrane of a foetal Drosophila cell line, S2

    DEFF Research Database (Denmark)

    Asmild, Margit; Willumsen, Niels J.

    2000-01-01

    S2 cells, Cl- Channels, Expression system, Drosophila, Inward rectifier, Outward rectifier, Patch clamp......S2 cells, Cl- Channels, Expression system, Drosophila, Inward rectifier, Outward rectifier, Patch clamp...

  7. Structure and Development of Glia in Drosophila

    Science.gov (United States)

    Hartenstein, Volker

    2014-01-01

    Insect glia represents a conspicuous and diverse population of cells and plays a role in controlling neuronal progenitor proliferation, axonal growth, neuronal differentiation and maintenance, and neuronal function. Genetic studies in Drosophila have elucidated many aspects of glial structure, function and development. Just as in vertebrates, it appears as if different classes of glial cells are specialized for different functions. Based on topology and cell shape, glial cells of the central nervous system fall into three classes (Fig. 1A–C): (i) surface glia that extend sheath-like processes to wrap around the entire brain; (ii) cortex glia (also called cell body-associated glia) that encapsulate neuronal somata and neuroblasts which form the outer layer (cortex) of the central nervous system; (iii) neuropile glia that are located at the interface between the cortex and the neuropile, the central domain of the nervous system formed by the highly branched neuronal processes and their synaptic contacts. Surface glia is further subdivided into an outer, perineurial layer, and an inner, subperineurial layer. Likewise, neuropile glia comprises a class of cells that remain at the surface of the neuropile (ensheathing glia), and a second class that forms profuse lamellar processes around nerve fibers within the neuropile (astrocyte-like or reticular glia). Glia also surrounds the peripheral nerves and sensory organs; here, one also recognizes perineurial and subperineurial glia, and a third type called “wrapping glia” that most likely corresponds to the ensheathing glia of the central nervous system. Much more experimental work is needed to determine how fundamental these differences between classes of glial cells are, or how and when during development they are specified. To aid in this work the following review will briefly summarize our knowledge of the classes of glial cells encountered in the Drosophila nervous system, and then survey their development from

  8. Unique properties of Drosophila spermatocyte primary cilia

    Directory of Open Access Journals (Sweden)

    Maria Giovanna Riparbelli

    2013-09-01

    The primary cilium is an essential organelle required for animal development and adult homeostasis that is found on most animal cells. The primary cilium contains a microtubule-based axoneme cytoskeleton that typically grows from the mother centriole in G0/G1 phase of the cell cycle as a membrane-bound compartment that protrudes from the cell surface. A unique system of bidirectional transport, intraflagellar transport (IFT, maintains the structure and function of cilia. While the axoneme is dynamic, growing and shrinking at its tip, at the same time it is very stable to the effects of microtubule-targeting drugs. The primary cilia found on Drosophila spermatocytes diverge from the general rules of primary cilium biology in several respects. Among these unique attributes, spermatocyte cilia assemble from all four centrioles in an IFT-independent manner in G2 phase, and persist continuously through two cell divisions. Here, we show that Drosophila spermatocyte primary cilia are extremely sensitive to microtubule-targeting drugs, unlike their mammalian counterparts. Spermatocyte cilia and their axonemes fail to assemble or be maintained upon nocodazole treatment, while centriole replication appears unperturbed. On the other hand, paclitaxel (Taxol, a microtubule-stabilizing drug, disrupted transition zone assembly and anchoring to the plasma membrane while causing spermatocyte primary cilia to grow extensively long during the assembly/elongation phase, but did not overtly affect the centrioles. However, once assembled to their mature length, spermatocyte cilia appeared unaffected by Taxol. The effects of these drugs on axoneme dynamics further demonstrate that spermatocyte primary cilia are endowed with unique assembly properties.

  9. Publishing and Australian Literature: Crisis, Decline or Transformation?

    Directory of Open Access Journals (Sweden)

    Katherine Bode

    2010-09-01

    Full Text Available The globalisation and consolidation of book publishing is widely seen as having negative consequences for Australian literature. Some commentators argue that this shift is detrimental to Australian literature as a whole; others identify the growth of multinational publishing conglomerates with a specific decline in Australian literary fiction. This article explores both positions, first identifying and investigating trends in Australian novel publication and comparing these to trends in the publication of novels from other countries as well as other Australian-originated literature (specifically, poetry and auto/biography. It then considers the specific case of Australian literary fiction, before looking in detail at the output of large publishers of Australian novels. This analysis reveals a recent decline in Australian novel and poetry titles, but offers a more complex picture of this trend than dominant expressions of nostalgia and alarm about the fate of Australian literature and publishing would suggest.

  10. Publishing and Australian literature : crisis, decline or transformation?

    Directory of Open Access Journals (Sweden)

    Bode, Katherine

    2010-01-01

    Full Text Available The globalisation and consolidation of book publishing is widely seen as having negative consequences for Australian literature. Some commentators argue that this shift is detrimental to Australian literature as a whole; others identify the growth of multinational publishing conglomerates with a specific decline in Australian literary fiction. This article explores both positions, first identifying and investigating trends in Australian novel publication and comparing these to trends in the publication of novels from other countries as well as other Australian-originated literature (specifically, poetry and auto/biography. It then considers the specific case of Australian literary fiction, before looking in detail at the output of large publishers of Australian novels. This analysis reveals a recent decline in Australian novel and poetry titles, but offers a more complex picture of this trend than dominant expressions of nostalgia and alarm about the fate of Australian literature and publishing would suggest.

  11. The Australian terrestrial carbon budget

    Directory of Open Access Journals (Sweden)

    V. Haverd

    2013-02-01

    Full Text Available This paper reports a study of the full carbon (C-CO2 budget of the Australian continent, focussing on 1990–2011 in the context of estimates over two centuries. The work is a contribution to the RECCAP (REgional Carbon Cycle Assessment and Processes project, as one of numerous regional studies. In constructing the budget, we estimate the following component carbon fluxes: net primary production (NPP; net ecosystem production (NEP; fire; land use change (LUC; riverine export; dust export; harvest (wood, crop and livestock and fossil fuel emissions (both territorial and non-territorial. Major biospheric fluxes were derived using BIOS2 (Haverd et al., 2012, a fine-spatial-resolution (0.05° offline modelling environment in which predictions of CABLE (Wang et al., 2011, a sophisticated land surface model with carbon cycle, are constrained by multiple observation types. The mean NEP reveals that climate variability and rising CO2 contributed 12 ± 24 (1σ error on mean and 68 ± 15 TgC yr−1, respectively. However these gains were partially offset by fire and LUC (along with other minor fluxes, which caused net losses of 26 ± 4 TgC yr−1 and 18 ± 7 TgC yr−1, respectively. The resultant net biome production (NBP is 36 ± 29 TgC yr−1, in which the largest contributions to uncertainty are NEP, fire and LUC. This NBP offset fossil fuel emissions (95 ± 6 TgC yr−1 by 38 ± 30%. The interannual variability (IAV in the Australian carbon budget exceeds Australia's total carbon emissions by fossil fuel combustion and is dominated by IAV in NEP. Territorial fossil fuel emissions are significantly smaller than the rapidly growing fossil fuel exports: in 2009–2010, Australia exported 2.5 times more carbon in fossil fuels than it emitted by burning fossil fuels.

  12. Why Do Chinese-Australian Students Outperform Their Australian Peers in Mathematics: A Comparative Case Study

    Science.gov (United States)

    Zhao, Dacheng; Singh, Michael

    2011-01-01

    International comparative studies and cross-cultural studies of mathematics achievement indicate that Chinese students (whether living in or outside China) consistently outperform their Western counterparts. This study shows that the gap between Chinese-Australian and other Australian students is best explained by differences in motivation to…

  13. NOVEL ASPECTS OF SPOTTED WING DROSOPHILA BIOLOGY AND IMPROVED METHODS OF REARING

    Science.gov (United States)

    Drosophila suzukii (Mats.) or the spotted wing Drosophila (SWD), is a global pest of soft fruits that can now be reared on a standard Drosophila diet containing the fly's own natural food: soft-skinned berries. The techniques tested here can thwart bacterial and fungal disease that can destroy more ...

  14. Maximum likelihood estimation of ancestral codon usage bias parameters in Drosophila

    DEFF Research Database (Denmark)

    Nielsen, Rasmus; Bauer DuMont, Vanessa L; Hubisz, Melissa J

    2007-01-01

    : the selection coefficient for optimal codon usage (S), allowing joint maximum likelihood estimation of S and the dN/dS ratio. We apply the method to previously published data from Drosophila melanogaster, Drosophila simulans, and Drosophila yakuba and show, in accordance with previous results, that the D...

  15. Drosophila-based in vivo assay for the validation of inhibitors of the ...

    Indian Academy of Sciences (India)

    Photoshop 7.0. 3. Results. In order to identify the suitability of the Drosophila model system for screening TKIs, sequence similarity of the. TK domain of EGFR between humans and Drosophila melanogaster was compared. In silico docking results of the. TKIs to the modelled Drosophila TK domain of EGFR were.

  16. Study of radioadaptive response in Drosophila melanogaster at different oogenesis stages

    International Nuclear Information System (INIS)

    Glushkova, I.V.; Aksyutik, T.V.

    2005-01-01

    We study radioadaptive response in the Canton-S strain of Drosophila melanogaster at different oogenesis stages using the test of dominant lethal mutations (DLM). AR was not revealed at the stages of 14-7 and 7--1 oocytes in the studied Drosophila stock. It is likely to be associated with a genetic constitution of the Drosophila strain under study. (authors)

  17. 40 CFR 798.5955 - Heritable translocation test in drosophila melanogaster.

    Science.gov (United States)

    2010-07-01

    ... drosophila melanogaster. 798.5955 Section 798.5955 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY....5955 Heritable translocation test in drosophila melanogaster. (a) Purpose. The heritable translocation test in Drosophila measures the induction of chromosomal translocations in germ cells of insects...

  18. The dopaminergic system in the aging brain of Drosophila

    Directory of Open Access Journals (Sweden)

    Katherine E White

    2010-12-01

    Full Text Available Drosophila models of Parkinson’s disease are characterised by two principal phenotypes: the specific loss of dopaminergic neurons in the aging brain and defects in motor behavior. However, an age-related analysis of these baseline parameters in wildtype Drosophila is lacking. Here we analysed the dopaminergic system and motor behavior in aging Drosophila. Dopaminergic neurons in the adult brain can be grouped into bilateral symmetric clusters, each comprising a stereotypical number of cells. Analysis of TH>mCD8::GFP and cell type-specific MARCM clones revealed that dopaminergic neurons show cluster-specific, stereotypical projection patterns with terminal arborization in target regions that represent distinct functional areas of the adult brain. Target areas include the mushroom bodies, involved in memory formation and motivation, and the central complex, involved in the control of motor behavior, indicating that similar to the mammalian brain, dopaminergic neurons in the fly brain are involved in the regulation of specific behaviors. Behavioral analysis revealed that Drosophila show an age-related decline in startle-induced locomotion and negative geotaxis. Motion tracking however, revealed that walking activity and exploration behavior, but not centrophobism increase at late stages of life. Analysis of TH>Dcr2, mCD8::GFP revealed a specific effect of Dcr2 expression on walking activity but not on exploratory or centrophobic behavior, indicating that the siRNA pathway may modulate distinct dopaminergic behaviors in Drosophila. Moreover, dopaminergic neurons were maintained between early- and late life, as quantified by TH>mCD8::GFP and anti-TH labelling, indicating that adult onset, age-related degeneration of dopaminergic neurons does not occur in the aging brain of Drosophila. Taken together, our data establish baseline parameters in Drosophila for the study of Parkinson’s disease as well as other disorders affecting dopaminergic neurons

  19. The dopaminergic system in the aging brain of Drosophila.

    Science.gov (United States)

    White, Katherine E; Humphrey, Dickon M; Hirth, Frank

    2010-01-01

    Drosophila models of Parkinson's disease are characterized by two principal phenotypes: the specific loss of dopaminergic (DA) neurons in the aging brain and defects in motor behavior. However, an age-related analysis of these baseline parameters in wildtype Drosophila is lacking. Here we analyzed the DA system and motor behavior in aging Drosophila. DA neurons in the adult brain can be grouped into bilateral symmetric clusters, each comprising a stereotypical number of cells. Analysis of TH > mCD8::GFP and cell type-specific MARCM clones revealed that DA neurons show cluster-specific, stereotypical projection patterns with terminal arborization in target regions that represent distinct functional areas of the adult brain. Target areas include the mushroom bodies, involved in memory formation and motivation, and the central complex, involved in the control of motor behavior, indicating that similar to the mammalian brain, DA neurons in the fly brain are involved in the regulation of specific behaviors. Behavioral analysis revealed that Drosophila show an age-related decline in startle-induced locomotion and negative geotaxis. Motion tracking however, revealed that walking activity, and exploration behavior, but not centrophobism increase at late stages of life. Analysis of TH > Dcr2, mCD8::GFP revealed a specific effect of Dcr2 expression on walking activity but not on exploratory or centrophobic behavior, indicating that the siRNA pathway may modulate distinct DA behaviors in Drosophila. Moreover, DA neurons were maintained between early- and late life, as quantified by TH > mCD8::GFP and anti-TH labeling, indicating that adult onset, age-related degeneration of DA neurons does not occur in the aging brain of Drosophila. Taken together, our data establish baseline parameters in Drosophila for the study of Parkinson's disease as well as other disorders affecting DA neurons and movement control.

  20. Substance misuse in Aboriginal Australians.

    Science.gov (United States)

    Gracey, M

    1998-01-01

    Australia's Aborigines lived in isolation from the rest of humanity as successful hunter-gatherers for tens of thousands of years. That isolation ended abruptly with British colonization in the late 18th century and was followed by a traumatic 200 years for Aborigines who are now seriously disadvantaged, socio-economically and in terms of their health standards. It has often been assumed that the Aborigines had no access to psychotropic substances before permanent European contact but several pieces of evidence dispute this view. The history of Aboriginal contact with and usage of intoxicating substances, including alcohol, is extremely complex and affected by a maze of restrictive government policies. These interact with a wide range of other Federal and State policies which have changed rapidly since the late 1960s when Aborigines were first granted the franchise; access to unrestricted drinking followed soon afterwards. Today Aborigines suffer disproportionately to other Australians from the physical and social consequences of excess alcohol consumption, tobacco usage, petrol and other solvent sniffing, usage of marijuana, amphetamines, cocaine and heroin, as well as other drugs. The Aboriginal population is dispersed in cities, towns, fringe settlements, rural and remote areas over this vast continent and there are different patterns of drug usage from place to place. This review attempts to synthesize some of this information in order to give an overview to the history, background, current status of substance misuse by Aborigines as well as some strategies being used to try to overcome this serious problem.

  1. Biogeographic patterns in the Australian chondrichthyan fauna.

    Science.gov (United States)

    Last, P R; White, W T

    2011-11-01

    The major biogeographic structure and affinities of the Australian chondrichthyan fauna were investigated at both interregional and intraregional scales and comparisons made with adjacent bioregions. Faunal lists were compiled from six geographical regions with species from these regions assigned to distributional classes and broad habitat categories. Australian species were further classified on provincial and bathomic structure following bioregionalization outputs from regional marine planning. About 40% of the world's chondrichthyan fauna occurs in Indo-Australasia (482 species) of which 323 species are found in Australian seas. The tropical Australian component, of which c. 46% of taxa are regional endemics, is most similar to faunas of Indonesia, New Guinea and New Caledonia. The temperate Australian component is most similar to New Zealand and Antarctica with about half of its species endemic. Highest levels of Australian endemism exist in bathomes of the outer continental shelf and upper slope. A relatively high proportion of regional endemism (57% of species) on the slope in the poorly surveyed but species-rich Solanderian unit is probably due to high levels of large-scale habitat complexity in the Coral Sea. The richness of demersal assemblages on the continental shelf and slope appears to be largely related to the spatial complexity of the region and the level of exploration. Much lower diversity off Antarctica is consistent with the pattern in teleosts. The complex chondrichthyan fauna of Australia is confirmed as being amongst the richest of the mega-diverse Indo-West Pacific Ocean. Species-level compositions of regional faunas across Indo-Australasia differ markedly because of moderate to high levels of intraregional speciation. Faunal assemblages in Australian marine provinces and bathomes differ from each other, supporting a broader pattern for fishes that underpins a marine planning framework for the region. © 2011 CSIRO. Journal of Fish Biology

  2. Marine biodiversity in the Australian region.

    Science.gov (United States)

    Butler, Alan J; Rees, Tony; Beesley, Pam; Bax, Nicholas J

    2010-08-02

    The entire Australian marine jurisdictional area, including offshore and sub-Antarctic islands, is considered in this paper. Most records, however, come from the Exclusive Economic Zone (EEZ) around the continent of Australia itself. The counts of species have been obtained from four primary databases (the Australian Faunal Directory, Codes for Australian Aquatic Biota, Online Zoological Collections of Australian Museums, and the Australian node of the Ocean Biogeographic Information System), but even these are an underestimate of described species. In addition, some partially completed databases for particular taxonomic groups, and specialized databases (for introduced and threatened species) have been used. Experts also provided estimates of the number of known species not yet in the major databases. For only some groups could we obtain an (expert opinion) estimate of undiscovered species. The databases provide patchy information about endemism, levels of threat, and introductions. We conclude that there are about 33,000 marine species (mainly animals) in the major databases, of which 130 are introduced, 58 listed as threatened and an unknown percentage endemic. An estimated 17,000 more named species are either known from the Australian EEZ but not in the present databases, or potentially occur there. It is crudely estimated that there may be as many as 250,000 species (known and yet to be discovered) in the Australian EEZ. For 17 higher taxa, there is sufficient detail for subdivision by Large Marine Domains, for comparison with other National and Regional Implementation Committees of the Census of Marine Life. Taxonomic expertise in Australia is unevenly distributed across taxa, and declining. Comments are given briefly on biodiversity management measures in Australia, including but not limited to marine protected areas.

  3. Evaluation of Off-season Potential Breeding Sources for Spotted Wing Drosophila (Drosophila suzukii Matsumura) in Michigan.

    Science.gov (United States)

    Bal, Harit K; Adams, Christopher; Grieshop, Matthew

    2017-12-05

    It has been suggested that fruit wastes including dropped and unharvested fruits, and fruit byproducts (i.e., pomace) found in fruit plantings and cideries or wine-making facilities could serve as potential off-season breeding sites for spotted wing Drosophila (Drosophila suzukii Matsumura (Diptera: Drosophilidae)). This idea, however, has yet to be widely tested. The goal of our study was to determine the potential of dropped fruit and fruit wastes as Fall spotted wing Drosophila breeding resources in Michigan, USA. Fruit waste samples were collected from 15 farms across the lower peninsula of Michigan and were evaluated for spotted wing Drosophila and other drosophilid emergence and used in host suitability bioassays. All of the dropped apples, pears, grapes, and raspberries and 40% of apple and 100% of grape fruit pomace evaluated were found to contain spotted wing Drosophila with the highest numbers collected from dropped grapes and pears. Greater spotted wing Drosophila recovery was found in fruit wastes at sites attached with cideries and wine-making facilities and with multiple cultivated fruit crops than sites with no cideries and only one crop. Females oviposited in raspberry, pear, apple, grape, apple pomace and grape pomace samples with the highest rates of reproduction in raspberries. Our results demonstrate that fruit wastes including dropped berry, pomme and stone fruits, as well as fruit compost may be important late season reproductive resources for spotted wing Drosophila. © The Author(s) 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  4. Bioimage Informatics in the context of Drosophila research.

    Science.gov (United States)

    Jug, Florian; Pietzsch, Tobias; Preibisch, Stephan; Tomancak, Pavel

    2014-06-15

    Modern biological research relies heavily on microscopic imaging. The advanced genetic toolkit of Drosophila makes it possible to label molecular and cellular components with unprecedented level of specificity necessitating the application of the most sophisticated imaging technologies. Imaging in Drosophila spans all scales from single molecules to the entire populations of adult organisms, from electron microscopy to live imaging of developmental processes. As the imaging approaches become more complex and ambitious, there is an increasing need for quantitative, computer-mediated image processing and analysis to make sense of the imagery. Bioimage Informatics is an emerging research field that covers all aspects of biological image analysis from data handling, through processing, to quantitative measurements, analysis and data presentation. Some of the most advanced, large scale projects, combining cutting edge imaging with complex bioimage informatics pipelines, are realized in the Drosophila research community. In this review, we discuss the current research in biological image analysis specifically relevant to the type of systems level image datasets that are uniquely available for the Drosophila model system. We focus on how state-of-the-art computer vision algorithms are impacting the ability of Drosophila researchers to analyze biological systems in space and time. We pay particular attention to how these algorithmic advances from computer science are made usable to practicing biologists through open source platforms and how biologists can themselves participate in their further development. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  5. big bang gene modulates gut immune tolerance in Drosophila.

    Science.gov (United States)

    Bonnay, François; Cohen-Berros, Eva; Hoffmann, Martine; Kim, Sabrina Y; Boulianne, Gabrielle L; Hoffmann, Jules A; Matt, Nicolas; Reichhart, Jean-Marc

    2013-02-19

    Chronic inflammation of the intestine is detrimental to mammals. Similarly, constant activation of the immune response in the gut by the endogenous flora is suspected to be harmful to Drosophila. Therefore, the innate immune response in the gut of Drosophila melanogaster is tightly balanced to simultaneously prevent infections by pathogenic microorganisms and tolerate the endogenous flora. Here we describe the role of the big bang (bbg) gene, encoding multiple membrane-associated PDZ (PSD-95, Discs-large, ZO-1) domain-containing protein isoforms, in the modulation of the gut immune response. We show that in the adult Drosophila midgut, BBG is present at the level of the septate junctions, on the apical side of the enterocytes. In the absence of BBG, these junctions become loose, enabling the intestinal flora to trigger a constitutive activation of the anterior midgut immune response. This chronic epithelial inflammation leads to a reduced lifespan of bbg mutant flies. Clearing the commensal flora by antibiotics prevents the abnormal activation of the gut immune response and restores a normal lifespan. We now provide genetic evidence that Drosophila septate junctions are part of the gut immune barrier, a function that is evolutionarily conserved in mammals. Collectively, our data suggest that septate junctions are required to maintain the subtle balance between immune tolerance and immune response in the Drosophila gut, which represents a powerful model to study inflammatory bowel diseases.

  6. Transmembrane channel-like (tmc) gene regulates Drosophila larval locomotion.

    Science.gov (United States)

    Guo, Yanmeng; Wang, Yuping; Zhang, Wei; Meltzer, Shan; Zanini, Damiano; Yu, Yue; Li, Jiefu; Cheng, Tong; Guo, Zhenhao; Wang, Qingxiu; Jacobs, Julie S; Sharma, Yashoda; Eberl, Daniel F; Göpfert, Martin C; Jan, Lily Yeh; Jan, Yuh Nung; Wang, Zuoren

    2016-06-28

    Drosophila larval locomotion, which entails rhythmic body contractions, is controlled by sensory feedback from proprioceptors. The molecular mechanisms mediating this feedback are little understood. By using genetic knock-in and immunostaining, we found that the Drosophila melanogaster transmembrane channel-like (tmc) gene is expressed in the larval class I and class II dendritic arborization (da) neurons and bipolar dendrite (bd) neurons, both of which are known to provide sensory feedback for larval locomotion. Larvae with knockdown or loss of tmc function displayed reduced crawling speeds, increased head cast frequencies, and enhanced backward locomotion. Expressing Drosophila TMC or mammalian TMC1 and/or TMC2 in the tmc-positive neurons rescued these mutant phenotypes. Bending of the larval body activated the tmc-positive neurons, and in tmc mutants this bending response was impaired. This implicates TMC's roles in Drosophila proprioception and the sensory control of larval locomotion. It also provides evidence for a functional conservation between Drosophila and mammalian TMCs.

  7. Rubella antibodies in Australian immunoglobulin products.

    Science.gov (United States)

    Young, Megan K; Bertolini, Joseph; Kotharu, Pushpa; Maher, Darryl; Cripps, Allan W

    2017-08-03

    Rubella antibodies are not routinely measured in immunoglobulin products and there is a lack of information on the titer in Australian products. To facilitate future studies of the effectiveness of passive immunisation for preventing rubella and congenital rubella syndrome, this study measured the concentration of rubella-specific antibodies in Australian intramuscular (IM) and intravenous (IV) human immunoglobulin products suitable for post-exposure prophylaxis using a chemiluminescent immunoassay. The GMT ± GSD for the IM product was 19 ± 1.2 IU/mg (2980 ± 1.2 IU/mL). The GMT ± GSD for the IV product was 12 ± 1.5 IU/mg (729 ± 1.5 IU/mL). At present, Australian guidelines recommend offering non-immune pregnant women exposed to rubella 20 mL of intramuscular immunoglobulin within 72 hours of exposure. This equates to 42,160 IU of rubella antibodies if the lowest titer obtained for the Australian IM product is considered. The same dose would be delivered by 176 mL of the Australian IV product at the lowest measured rubella-specific antibody titer.

  8. Molecular cloning and genomic organization of a second probable allatostatin receptor from Drosophila melanogaster

    DEFF Research Database (Denmark)

    Lenz, C; Williamson, M; Grimmelikhuijzen, C J

    2000-01-01

    We (C. Lenz et al. (2000) Biochem. Biophys. Res. Commun. 269, 91-96) and others (N. Birgül et al. (1999) EMBO J. 18, 5892-5900) have recently cloned a Drosophila receptor that was structurally related to the mammalian galanin receptors, but turned out to be a receptor for a Drosophila peptide...... with a Drosophila genomic database clone that contained a DNA sequence coding for a protein having, again, structural similarities with the rat galanin receptors. Using PCR with primers coding for the presumed exons of this second Drosophila receptor gene, 5'- and 3'-RACE, and Drosophila cDNA as template, we...

  9. Biological radiation effects of Radon in Drosophila

    International Nuclear Information System (INIS)

    Pimentel P, A.E.

    1995-01-01

    In order to contribute to the knowledge on the effects of radon and its decay products, the aim of this investigation is to study the biological effects of radon using Drosophila melanogaster throught the somatic mutation and recombination test (SMART) and the analysis of some adaptative factors exposing larvaes to controlled radon atmosphers, considering that this insect could be used as biological monitor. Using the somatic mutation test a mutagenic effect was observed proportional to radon concentration, into an interval of 1 ± 0.3 to 111 ± 7.4 KBq/m 3 equivalent to doses under 0.0106 Gy. The correlation analysis gives a linear (r=0.80) relationship with a positive slope of 0.2217. The same happens when gamma rays are used in the interval of 1 to 20 Gy, given a linear dose-dependent effect (r=0.878) is obtained; nevetheless the slop is smaller (m=0.003) than for radon. Analysing the results of adaptative factors of the nine exposed generations, it was found that probably radon exposition induced dominant lethals during gametogenesis or/and a selection of the more component gamets of the treated individuals in larval state. It was reflected in the significant decrease on fecundity of the generation exposed. Nevertheless the laying eggs had an increase in egg-to-adult viability and the develop velocity was higher than in control for 3 KBq/m 3 , this suggest that radon concentrations used were able to induce repair mechanisms. These data agree with the Hormesis hypothesis that says: low doses have positive effects on health. It was not possible to obtain a dose-effect relationship except with the develop velocity where it was found a dose-effect inverse proportion. In conclusion, Drosophila melanogaster could be a good system to obtain in vivo damaged induction concentration dependent of radon and its decay products, as well as to study the effects in an exposed population by the analysis of adaptative factors. (Author)

  10. The Australian National Proton Facility

    International Nuclear Information System (INIS)

    Jackson, M.; Rozenfeld, A.; Bishop, J.

    2002-01-01

    Full text: Protons have been used in the treatment of cancer since 1954 and over 30,000 patients have been treated around the world. Their precise dose distribution allows the treatment of small tumours in critical locations such as the base of skull and orbit and is an alternative to stereotactic radiotherapy in other sites. With the development of hospital-based systems in the 1990's, common tumours such as prostate, breast and lung cancer can now also be treated using simple techniques. The therapeutic ratio is improved as the dose to the tumour can be increased while sparing normal tissues. The well defined high dose region and low integral dose compared with photon treatments is a particular advantage in children and other situations where long-term survival is expected and when used in combination with chemotherapy. In January 2002, the NSW Health Department initiated a Feasibility Study for an Australian National Proton Facility. This Study will address the complex medical, scientific, engineering, commercial and legal issues required to design and build a proton facility in Australia. The Facility will be mainly designed for patient treatment but will also provide facilities for biological, physical and engineering research. The proposed facility will have a combination of fixed and rotating beams with an energy range of 70-250 MeV. Such a centre will enable the conduct of randomised clinical trials and a comparison with other radiotherapy techniques such as Intensity Modulated Radiation Therapy. Cost-utility comparisons with other medical treatments will also be made and further facilities developed if the expected benefit is confirmed. When patients are not being treated, the beam will be available for commercial and research purposes. This presentation will summarize the progress of the Study and discuss the important issues that need to be resolved before the Facility is approved and constructed

  11. Quantifying host potentials: indexing postharvest fresh fruits for spotted wing Drosophila, Drosophila suzukii.

    Directory of Open Access Journals (Sweden)

    David E Bellamy

    Full Text Available Novel methodology is presented for indexing the relative potential of hosts to function as resources. A Host Potential Index (HPI was developed as a practical framework to express relative host potential based on combining results from one or more independent studies, such as those examining host selection, utilization, and physiological development of the organism resourcing the host. Several aspects of the HPI are addressed including: 1 model derivation; 2 influence of experimental design on establishing host rankings for a study type (no choice, two-choice, and multiple-choice; and, 3 variable selection and weighting associated with combining multiple studies. To demonstrate application of the HPI, results from the interactions of spotted wing drosophila (SWD, Drosophila suzukii Matsumura (Diptera: Drosophilidae, with seven "reported" hosts (blackberries, blueberries, sweet cherries, table grapes, peaches, raspberries, and strawberries in a postharvest scenario were analyzed. Four aspects of SWD-host interaction were examined: attraction to host volatiles; population-level oviposition performance; individual-level oviposition performance; and key developmental factors. Application of HPI methodology indicated that raspberries ( (meanHPIvaried  = 301.9±8.39; rank 1 of 7 have the greatest potential to serve as a postharvest host for SWD relative to the other fruit hosts, with grapes ( (meanHPIvaried  = 232.4±3.21; rank 7 of 7 having the least potential.

  12. Identification and characterization of novel natural pathogen of Drosophila melanogaster isolated from wild captured Drosophila spp.

    Science.gov (United States)

    Singh, Karan; Zulkifli, Mohammad; Prasad, N G

    2016-12-01

    Drosophila melanogaster is an emerging model system for the study of evolutionary ecology of immunity. However, a large number of studies have used non natural pathogens as very few natural pathogens have been isolated and identified. Our aim was to isolate and characterize natural pathogen/s of D. melanogaster. A bacterial pathogen was isolated from wild caught Drosophila spp., identified as a new strain of Staphylococcus succinus subsp. succinus and named PK-1. This strain induced substantial mortality (36-62%) in adults of several laboratory populations of D. melanogaster. PK-1 grew rapidly within the body of the flies post infection and both males and females had roughly same number of colony forming units. Mortality was affected by mode of infection and dosage of the pathogen. However mating status of the host had no effect on mortality post infection. Given that there are very few known natural bacterial pathogens of D. melanogaster and that PK-1 can establish a sustained infection across various outbred and inbred populations of D. melanogaster this new isolate is a potential resource for future studies on immunity. Copyright © 2016 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  13. Comparative population genomics of latitudinal variation in Drosophila simulans and Drosophila melanogaster.

    Science.gov (United States)

    Machado, Heather E; Bergland, Alan O; O'Brien, Katherine R; Behrman, Emily L; Schmidt, Paul S; Petrov, Dmitri A

    2016-02-01

    Examples of clinal variation in phenotypes and genotypes across latitudinal transects have served as important models for understanding how spatially varying selection and demographic forces shape variation within species. Here, we examine the selective and demographic contributions to latitudinal variation through the largest comparative genomic study to date of Drosophila simulans and Drosophila melanogaster, with genomic sequence data from 382 individual fruit flies, collected across a spatial transect of 19 degrees latitude and at multiple time points over 2 years. Consistent with phenotypic studies, we find less clinal variation in D. simulans than D. melanogaster, particularly for the autosomes. Moreover, we find that clinally varying loci in D. simulans are less stable over multiple years than comparable clines in D. melanogaster. D. simulans shows a significantly weaker pattern of isolation by distance than D. melanogaster and we find evidence for a stronger contribution of migration to D. simulans population genetic structure. While population bottlenecks and migration can plausibly explain the differences in stability of clinal variation between the two species, we also observe a significant enrichment of shared clinal genes, suggesting that the selective forces associated with climate are acting on the same genes and phenotypes in D. simulans and D. melanogaster. © 2015 John Wiley & Sons Ltd.

  14. Autophagy in Drosophila: From Historical Studies to Current Knowledge

    Science.gov (United States)

    Mulakkal, Nitha C.; Nagy, Peter; Takats, Szabolcs; Tusco, Radu; Juhász, Gábor; Nezis, Ioannis P.

    2014-01-01

    The discovery of evolutionarily conserved Atg genes required for autophagy in yeast truly revolutionized this research field and made it possible to carry out functional studies on model organisms. Insects including Drosophila are classical and still popular models to study autophagy, starting from the 1960s. This review aims to summarize past achievements and our current knowledge about the role and regulation of autophagy in Drosophila, with an outlook to yeast and mammals. The basic mechanisms of autophagy in fruit fly cells appear to be quite similar to other eukaryotes, and the role that this lysosomal self-degradation process plays in Drosophila models of various diseases already made it possible to recognize certain aspects of human pathologies. Future studies in this complete animal hold great promise for the better understanding of such processes and may also help finding new research avenues for the treatment of disorders with misregulated autophagy. PMID:24949430

  15. Localized expression pattern of miR-184 in Drosophila.

    Science.gov (United States)

    Li, Ping; Peng, Jianjian; Hu, Jiangbo; Xu, Zhongxin; Xie, Wei; Yuan, Liudi

    2011-01-01

    MicroRNAs (miRNAs) are a kind of endogenous non-coding small RNAs whose specific functions in animals are generally important. Although functions of some miRNAs have been identified, the role of miR-184 remains unknown. Here, we determined the temporal and spatial expression pattern of miR-184 during the different development stages and tissues in Drosophila. Strikingly, miR-184 is expressed ubiquitously in Drosophila embryos, larvae and adults, its expression pattern shows a dynamic changes during the development of embryo, especially in the central nervous system. This expression profile suggests that miR-184 may act important function in Drosophila development.

  16. Analysis of Cell Cycle Switches in Drosophila Oogenesis.

    Science.gov (United States)

    Jia, Dongyu; Huang, Yi-Chun; Deng, Wu-Min

    2015-01-01

    The study of Drosophila oogenesis provides invaluable information about signaling pathway regulation and cell cycle programming. During Drosophila oogenesis, a string of egg chambers in each ovariole progressively develops toward maturity. Egg chamber development consists of 14 stages. From stage 1 to stage 6 (mitotic cycle), main-body follicle cells undergo mitotic divisions. From stage 7 to stage 10a (endocycle), follicle cells cease mitosis but continue three rounds of endoreduplication. From stage 10b to stage 13 (gene amplification), instead of whole genome duplication, follicle cells selectively amplify specific genomic regions, mostly for chorion production. So far, Drosophila oogenesis is one of the most well studied model systems used to understand cell cycle switches, which furthers our knowledge about cell cycle control machinery and sheds new light on potential cancer treatments. Here, we give a brief summary of cell cycle switches, the associated signaling pathways and factors, and the detailed experimental procedures used to study the cell cycle switches.

  17. Evolution of genes and genomes on the Drosophila phylogeny.

    Science.gov (United States)

    Clark, Andrew G; Eisen, Michael B; Smith, Douglas R; Bergman, Casey M; Oliver, Brian; Markow, Therese A; Kaufman, Thomas C; Kellis, Manolis; Gelbart, William; Iyer, Venky N; Pollard, Daniel A; Sackton, Timothy B; Larracuente, Amanda M; Singh, Nadia D; Abad, Jose P; Abt, Dawn N; Adryan, Boris; Aguade, Montserrat; Akashi, Hiroshi; Anderson, Wyatt W; Aquadro, Charles F; Ardell, David H; Arguello, Roman; Artieri, Carlo G; Barbash, Daniel A; Barker, Daniel; Barsanti, Paolo; Batterham, Phil; Batzoglou, Serafim; Begun, Dave; Bhutkar, Arjun; Blanco, Enrico; Bosak, Stephanie A; Bradley, Robert K; Brand, Adrianne D; Brent, Michael R; Brooks, Angela N; Brown, Randall H; Butlin, Roger K; Caggese, Corrado; Calvi, Brian R; Bernardo de Carvalho, A; Caspi, Anat; Castrezana, Sergio; Celniker, Susan E; Chang, Jean L; Chapple, Charles; Chatterji, Sourav; Chinwalla, Asif; Civetta, Alberto; Clifton, Sandra W; Comeron, Josep M; Costello, James C; Coyne, Jerry A; Daub, Jennifer; David, Robert G; Delcher, Arthur L; Delehaunty, Kim; Do, Chuong B; Ebling, Heather; Edwards, Kevin; Eickbush, Thomas; Evans, Jay D; Filipski, Alan; Findeiss, Sven; Freyhult, Eva; Fulton, Lucinda; Fulton, Robert; Garcia, Ana C L; Gardiner, Anastasia; Garfield, David A; Garvin, Barry E; Gibson, Greg; Gilbert, Don; Gnerre, Sante; Godfrey, Jennifer; Good, Robert; Gotea, Valer; Gravely, Brenton; Greenberg, Anthony J; Griffiths-Jones, Sam; Gross, Samuel; Guigo, Roderic; Gustafson, Erik A; Haerty, Wilfried; Hahn, Matthew W; Halligan, Daniel L; Halpern, Aaron L; Halter, Gillian M; Han, Mira V; Heger, Andreas; Hillier, LaDeana; Hinrichs, Angie S; Holmes, Ian; Hoskins, Roger A; Hubisz, Melissa J; Hultmark, Dan; Huntley, Melanie A; Jaffe, David B; Jagadeeshan, Santosh; Jeck, William R; Johnson, Justin; Jones, Corbin D; Jordan, William C; Karpen, Gary H; Kataoka, Eiko; Keightley, Peter D; Kheradpour, Pouya; Kirkness, Ewen F; Koerich, Leonardo B; Kristiansen, Karsten; Kudrna, Dave; Kulathinal, Rob J; Kumar, Sudhir; Kwok, Roberta; Lander, Eric; Langley, Charles H; Lapoint, Richard; Lazzaro, Brian P; Lee, So-Jeong; Levesque, Lisa; Li, Ruiqiang; Lin, Chiao-Feng; Lin, Michael F; Lindblad-Toh, Kerstin; Llopart, Ana; Long, Manyuan; Low, Lloyd; Lozovsky, Elena; Lu, Jian; Luo, Meizhong; Machado, Carlos A; Makalowski, Wojciech; Marzo, Mar; Matsuda, Muneo; Matzkin, Luciano; McAllister, Bryant; McBride, Carolyn S; McKernan, Brendan; McKernan, Kevin; Mendez-Lago, Maria; Minx, Patrick; Mollenhauer, Michael U; Montooth, Kristi; Mount, Stephen M; Mu, Xu; Myers, Eugene; Negre, Barbara; Newfeld, Stuart; Nielsen, Rasmus; Noor, Mohamed A F; O'Grady, Patrick; Pachter, Lior; Papaceit, Montserrat; Parisi, Matthew J; Parisi, Michael; Parts, Leopold; Pedersen, Jakob S; Pesole, Graziano; Phillippy, Adam M; Ponting, Chris P; Pop, Mihai; Porcelli, Damiano; Powell, Jeffrey R; Prohaska, Sonja; Pruitt, Kim; Puig, Marta; Quesneville, Hadi; Ram, Kristipati Ravi; Rand, David; Rasmussen, Matthew D; Reed, Laura K; Reenan, Robert; Reily, Amy; Remington, Karin A; Rieger, Tania T; Ritchie, Michael G; Robin, Charles; Rogers, Yu-Hui; Rohde, Claudia; Rozas, Julio; Rubenfield, Marc J; Ruiz, Alfredo; Russo, Susan; Salzberg, Steven L; Sanchez-Gracia, Alejandro; Saranga, David J; Sato, Hajime; Schaeffer, Stephen W; Schatz, Michael C; Schlenke, Todd; Schwartz, Russell; Segarra, Carmen; Singh, Rama S; Sirot, Laura; Sirota, Marina; Sisneros, Nicholas B; Smith, Chris D; Smith, Temple F; Spieth, John; Stage, Deborah E; Stark, Alexander; Stephan, Wolfgang; Strausberg, Robert L; Strempel, Sebastian; Sturgill, David; Sutton, Granger; Sutton, Granger G; Tao, Wei; Teichmann, Sarah; Tobari, Yoshiko N; Tomimura, Yoshihiko; Tsolas, Jason M; Valente, Vera L S; Venter, Eli; Venter, J Craig; Vicario, Saverio; Vieira, Filipe G; Vilella, Albert J; Villasante, Alfredo; Walenz, Brian; Wang, Jun; Wasserman, Marvin; Watts, Thomas; Wilson, Derek; Wilson, Richard K; Wing, Rod A; Wolfner, Mariana F; Wong, Alex; Wong, Gane Ka-Shu; Wu, Chung-I; Wu, Gabriel; Yamamoto, Daisuke; Yang, Hsiao-Pei; Yang, Shiaw-Pyng; Yorke, James A; Yoshida, Kiyohito; Zdobnov, Evgeny; Zhang, Peili; Zhang, Yu; Zimin, Aleksey V; Baldwin, Jennifer; Abdouelleil, Amr; Abdulkadir, Jamal; Abebe, Adal; Abera, Brikti; Abreu, Justin; Acer, St Christophe; Aftuck, Lynne; Alexander, Allen; An, Peter; Anderson, Erica; Anderson, Scott; Arachi, Harindra; Azer, Marc; Bachantsang, Pasang; Barry, Andrew; Bayul, Tashi; Berlin, Aaron; Bessette, Daniel; Bloom, Toby; Blye, Jason; Boguslavskiy, Leonid; Bonnet, Claude; Boukhgalter, Boris; Bourzgui, Imane; Brown, Adam; Cahill, Patrick; Channer, Sheridon; Cheshatsang, Yama; Chuda, Lisa; Citroen, Mieke; Collymore, Alville; Cooke, Patrick; Costello, Maura; D'Aco, Katie; Daza, Riza; De Haan, Georgius; DeGray, Stuart; DeMaso, Christina; Dhargay, Norbu; Dooley, Kimberly; Dooley, Erin; Doricent, Missole; Dorje, Passang; Dorjee, Kunsang; Dupes, Alan; Elong, Richard; Falk, Jill; Farina, Abderrahim; Faro, Susan; Ferguson, Diallo; Fisher, Sheila; Foley, Chelsea D; Franke, Alicia; Friedrich, Dennis; Gadbois, Loryn; Gearin, Gary; Gearin, Christina R; Giannoukos, Georgia; Goode, Tina; Graham, Joseph; Grandbois, Edward; Grewal, Sharleen; Gyaltsen, Kunsang; Hafez, Nabil; Hagos, Birhane; Hall, Jennifer; Henson, Charlotte; Hollinger, Andrew; Honan, Tracey; Huard, Monika D; Hughes, Leanne; Hurhula, Brian; Husby, M Erii; Kamat, Asha; Kanga, Ben; Kashin, Seva; Khazanovich, Dmitry; Kisner, Peter; Lance, Krista; Lara, Marcia; Lee, William; Lennon, Niall; Letendre, Frances; LeVine, Rosie; Lipovsky, Alex; Liu, Xiaohong; Liu, Jinlei; Liu, Shangtao; Lokyitsang, Tashi; Lokyitsang, Yeshi; Lubonja, Rakela; Lui, Annie; MacDonald, Pen; Magnisalis, Vasilia; Maru, Kebede; Matthews, Charles; McCusker, William; McDonough, Susan; Mehta, Teena; Meldrim, James; Meneus, Louis; Mihai, Oana; Mihalev, Atanas; Mihova, Tanya; Mittelman, Rachel; Mlenga, Valentine; Montmayeur, Anna; Mulrain, Leonidas; Navidi, Adam; Naylor, Jerome; Negash, Tamrat; Nguyen, Thu; Nguyen, Nga; Nicol, Robert; Norbu, Choe; Norbu, Nyima; Novod, Nathaniel; O'Neill, Barry; Osman, Sahal; Markiewicz, Eva; Oyono, Otero L; Patti, Christopher; Phunkhang, Pema; Pierre, Fritz; Priest, Margaret; Raghuraman, Sujaa; Rege, Filip; Reyes, Rebecca; Rise, Cecil; Rogov, Peter; Ross, Keenan; Ryan, Elizabeth; Settipalli, Sampath; Shea, Terry; Sherpa, Ngawang; Shi, Lu; Shih, Diana; Sparrow, Todd; Spaulding, Jessica; Stalker, John; Stange-Thomann, Nicole; Stavropoulos, Sharon; Stone, Catherine; Strader, Christopher; Tesfaye, Senait; Thomson, Talene; Thoulutsang, Yama; Thoulutsang, Dawa; Topham, Kerri; Topping, Ira; Tsamla, Tsamla; Vassiliev, Helen; Vo, Andy; Wangchuk, Tsering; Wangdi, Tsering; Weiand, Michael; Wilkinson, Jane; Wilson, Adam; Yadav, Shailendra; Young, Geneva; Yu, Qing; Zembek, Lisa; Zhong, Danni; Zimmer, Andrew; Zwirko, Zac; Jaffe, David B; Alvarez, Pablo; Brockman, Will; Butler, Jonathan; Chin, CheeWhye; Gnerre, Sante; Grabherr, Manfred; Kleber, Michael; Mauceli, Evan; MacCallum, Iain

    2007-11-08

    Comparative analysis of multiple genomes in a phylogenetic framework dramatically improves the precision and sensitivity of evolutionary inference, producing more robust results than single-genome analyses can provide. The genomes of 12 Drosophila species, ten of which are presented here for the first time (sechellia, simulans, yakuba, erecta, ananassae, persimilis, willistoni, mojavensis, virilis and grimshawi), illustrate how rates and patterns of sequence divergence across taxa can illuminate evolutionary processes on a genomic scale. These genome sequences augment the formidable genetic tools that have made Drosophila melanogaster a pre-eminent model for animal genetics, and will further catalyse fundamental research on mechanisms of development, cell biology, genetics, disease, neurobiology, behaviour, physiology and evolution. Despite remarkable similarities among these Drosophila species, we identified many putatively non-neutral changes in protein-coding genes, non-coding RNA genes, and cis-regulatory regions. These may prove to underlie differences in the ecology and behaviour of these diverse species.

  18. Evolution of Drosophila ribosomal protein gene core promoters.

    Science.gov (United States)

    Ma, Xiaotu; Zhang, Kangyu; Li, Xiaoman

    2009-03-01

    The coordinated expression of ribosomal protein genes (RPGs) has been well documented in many species. Previous analyses of RPG promoters focus only on Fungi and mammals. Recognizing this gap and using a comparative genomics approach, we utilize a motif-finding algorithm that incorporates cross-species conservation to identify several significant motifs in Drosophila RPG promoters. As a result, significant differences of the enriched motifs in RPG promoter are found among Drosophila, Fungi, and mammals, demonstrating the evolutionary dynamics of the ribosomal gene regulatory network. We also report a motif present in similar numbers of RPGs among Drosophila species which does not appear to be conserved at the individual RPG gene level. A module-wise stabilizing selection theory is proposed to explain this observation. Overall, our results provide significant insight into the fast-evolving nature of transcriptional regulation in the RPG module.

  19. Drosophila as a genetic model for studying pathogenic human viruses.

    Science.gov (United States)

    Hughes, Tamara T; Allen, Amanda L; Bardin, Joseph E; Christian, Megan N; Daimon, Kansei; Dozier, Kelsey D; Hansen, Caom L; Holcomb, Lisa M; Ahlander, Joseph

    2012-02-05

    Viruses are infectious particles whose viability is dependent on the cells of living organisms, such as bacteria, plants, and animals. It is of great interest to discover how viruses function inside host cells in order to develop therapies to treat virally infected organisms. The fruit fly Drosophila melanogaster is an excellent model system for studying the molecular mechanisms of replication, amplification, and cellular consequences of human viruses. In this review, we describe the advantages of using Drosophila as a model system to study human viruses, and highlight how Drosophila has been used to provide unique insight into the gene function of several pathogenic viruses. We also propose possible directions for future research in this area. Copyright © 2011 Elsevier Inc. All rights reserved.

  20. Patterns of mutation and selection at synonymous sites in Drosophila

    DEFF Research Database (Denmark)

    Singh, Nadia D; Bauer DuMont, Vanessa L; Hubisz, Melissa J

    2007-01-01

    That natural selection affects molecular evolution at synonymous sites in protein-coding sequences is well established and is thought to predominantly reflect selection for translational efficiency/accuracy mediated through codon bias. However, a recently developed maximum likelihood framework......, when applied to 18 coding sequences in 3 species of Drosophila, confirmed an earlier report that the Notch gene in Drosophila melanogaster was evolving under selection in favor of those codons defined as unpreferred in this species. This finding opened the possibility that synonymous sites may...... be subject to a variety of selective pressures beyond weak selection for increased frequencies of the codons currently defined as "preferred" in D. melanogaster. To further explore patterns of synonymous site evolution in Drosophila in a lineage-specific manner, we expanded the application of the maximum...

  1. RNA editing in Drosophila melanogaster: new targets and functionalconsequences

    Energy Technology Data Exchange (ETDEWEB)

    Stapleton, Mark; Carlson, Joseph W.; Celniker, Susan E.

    2006-09-05

    Adenosine deaminases that act on RNA (ADARs) catalyze the site-specific conversion of adenosine to inosine in primary mRNA transcripts. These re-coding events affect coding potential, splice-sites, and stability of mature mRNAs. ADAR is an essential gene and studies in mouse, C. elegans, and Drosophila suggest its primary function is to modify adult behavior by altering signaling components in the nervous system. By comparing the sequence of isogenic cDNAs to genomic DNA, we have identified and experimentally verified 27 new targets of Drosophila ADAR. Our analyses lead us to identify new classes of genes whose transcripts are targets of ADAR including components of the actin cytoskeleton, and genes involved in ion homeostasis and signal transduction. Our results indicate that editing in Drosophila increases the diversity of the proteome, and does so in a manner that has direct functional consequences on protein function.

  2. Aboriginal Agency and Marginalisation in Australian Society

    Directory of Open Access Journals (Sweden)

    Terry Moore

    2014-09-01

    Full Text Available It is often argued that while state rhetoric may be inclusionary, policies and practices may be exclusionary. This can imply that the power to include rests only with the state. In some ways, the implication is valid in respect of Aboriginal Australians. For instance, the Australian state has gained control of Aboriginal inclusion via a singular, bounded category and Aboriginal ideal type. However, the implication is also limited in their respect. Aborigines are abject but also agents in their relationship with the wider society. Their politics contributes to the construction of the very category and type that governs them, and presses individuals to resist state inclusionary efforts. Aboriginal political elites police the performance of an Aboriginality dominated by notions of difference and resistance. The combined processes of governance act to deny Aborigines the potential of being both Aboriginal and Australian, being different and belonging. They maintain Aborigines’ marginality.

  3. Australian regulatory changes open crudes to export

    Energy Technology Data Exchange (ETDEWEB)

    Corbett, R.A.

    1988-01-18

    Since the price collapse of 1986, the Australian Government has been deregulating its domestic crude oils, which since the late 1960s, have been allocated solely to Australian refiners at set prices, and where no crude oil was exported. This arrangement is now being dismantled, and has allowed export since 1983, with modest free-market sales since 1985. Much of the exported crude is currently from older, established fields, but with a number of new fields that have come into production recently, some of the newer streams are beginning to find their way to many distant parts of the refining world. There are five important Australian crude oils either now being, or likely to be, exported: Barrow Island and Gippsland crudes, which are produced from fields discovered in 1960s; and Jabiru, Jackson blend, and Northwest Shelf condensate, all coming to production during the last 5 years. This article discusses each of these oils.

  4. Topics from Australian Conferences on Teaching Statistics

    CERN Document Server

    Phillips, Brian; Martin, Michael

    2014-01-01

    The first OZCOTS conference in 1998 was inspired by papers contributed by Australians to the 5th International Conference on Teaching Statistics. In 2008, as part of the program of one of the first National Senior Teaching Fellowships, the 6th OZCOTS was held in conjunction with the Australian Statistical Conference, with Fellowship keynotes and contributed papers, optional refereeing and proceedings. This venture was so successful that the 7th and 8th OZCOTS were similarly run, conjoined with Australian Statistical Conferences in 2010 and 2012. Authors of papers from these OZCOTS conferences were invited to develop chapters for refereeing and inclusion in this volume. There are sections on keynote topics, undergraduate curriculum and learning, professional development, postgraduate learning, and papers from OZCOTS 2012. Because OZCOTS aim to unite statisticians and statistics educators, the approaches this volume takes are immediately relevant to all who have a vested interest in good teaching practices. Glo...

  5. Suicide of Australians during the Vietnam War.

    Science.gov (United States)

    Pridmore, Saxby; Ahmadi, Jamshid; Pridmore, William

    2018-04-01

    National suicide rates fall during times of war. This fits with the notion of the population coming together against a common foe. But, what happens in the case of a war which is not fully supported, which draws the population and families apart? We consider this question by examining the Australian suicide rates during the divisive Vietnam War. We graphed and examined the Australian suicide figures for 1921-2010. We found clear evidence of a decrease in the suicide rate for World War II (consistent with other studies), but a marked elevation of suicide during the Vietnam War. The elevation of the Australian suicide rate during the Vietnam War is consistent with Durkheim's social integration model - when social integration is lessened, either by individual characteristics or societal characteristics, the risk of suicide rises.

  6. Crossing borders: extraterritorial application of Australian directors’ duties

    OpenAIRE

    McKeown, Peter Julian Joseph

    2017-01-01

    Australian corporations operate in an increasingly international environment. It has intuitive appeal that Australian law should regulate the conduct of directors of Australian corporations even if it occurs outside Australia. This however can create tension with the competing rights of the foreign state in whose territory this conduct occurs to regulate such conduct. This thesis examines two questions. Firstly, does Australian law governing directors’ duties in fact apply to activities of a ...

  7. Potential for Australian involvement in ITER

    International Nuclear Information System (INIS)

    O'Connor, D. J.; Collins, G. A.; Hole, M. J.

    2006-01-01

    Full text: Full text: Fusion, the process that powers the sun and stars, offers a solution to the world's long-term energy needs: providing large scale energy production with zero greenhouse gas emissions, short-lived radio-active waste compared to conventional nuclear fission cycles, and a virtually limitless supply of fuel. Almost three decades of fusion research has produced spectacular progress. Present-day experiments have a power gain ratio of approximately 1 (ratio of power out to power in), with a power output in the 10's of megawatts. The world's next major fusion experiment, the International Thermonuclear Experimental Reactor (ITER), will be a pre-prototype power plant. Since announcement of the ITER site in June 2005, the ITER project, has gained momentum and political support. Despite Australia's foundation role in the field of fusion science, through the pioneering work of Sir Mark Oliphant, and significant contributions to the international fusion program over the succeeding years, Australia is not involved in the ITER project. In this talk, the activities of a recently formed consortium of scientists and engineers, the Australian ITER Forum will be outlined. The Forum is drawn from five Universities, ANSTO (the Australian Nuclear Science and Technology Organisation) and AINSE (the Australian Institute for Nuclear Science and Engineering), and seeks to promote fusion energy in the Australian community and negotiate a role for Australia in the ITER project. As part of this activity, the Australian government recently funded a workshop that discussed the ways and means of engaging Australia in ITER. The workshop brought the research, industrial, government and general public communities, together with the ITER partners, and forged an opportunity for ITER engagement; with scientific, industrial, and energy security rewards for Australia. We will report on the emerging scope for Australian involvement

  8. Defects and Disorder in the Drosophila Eye

    Science.gov (United States)

    Kim, Sangwoo; Carthew, Richard; Hilgenfeldt, Sascha

    Cell division and differentiation tightly control the regular pattern in the normal eye of the Drosophila fruit fly while certain genetic mutations introduce disorder in the form of topological defects. Analyzing data from pupal retinas, we develop a model based on Voronoi construction that explains the defect statistics as a consequence of area variation of individual facets (ommatidia). The analysis reveals a previously unknown systematic long-range area variation that spans the entire eye, with distinct effects on topological disorder compared to local fluctuations. The internal structure of the ommatidia and the stiffness of their interior cells also plays a crucial role in the defect generation. Accurate predictions of the correlation between the area variation and the defect density in both normal and mutant animals are obtained without free parameters. This approach can potentially be applied to cellular systems in many other contexts to identify size-topology correlations near the onset of symmetry breaking. This work has been supported by the NIH (GM098077) and the NSF (Grant No. 1504301).

  9. Healthy aging – insights from Drosophila

    Directory of Open Access Journals (Sweden)

    Konstantin G Iliadi

    2012-04-01

    Full Text Available Human life expectancy has nearly doubled in the past century due, in part, to social and economic development, and a wide range of new medical technologies and treatments. As the number of elderly increase it becomes of vital importance to understand what factors contribute to healthy aging. Human longevity is a complex process that is affected by both environmental and genetic factors and interactions between them. Unfortunately, it is currently difficult to identify the role of genetic components in human longevity. In contrast, model organisms such as C. elegans, Drosophila and rodents have facilitated the search for specific genes that affect lifespan. Experimental evidence obtained from studies in model organisms suggests that mutations in a single gene may increase longevity and delay the onset of age-related symptoms including motor impairments, sexual and reproductive and immune dysfunction, cardiovascular disease and cognitive decline. Furthermore, the high degree of conservation between diverse species in the genes and pathways that regulate longevity suggests that work in model organisms can both expand our theoretical knowledge of aging and perhaps provide new therapeutic targets for the treatment of age-related disorders.

  10. Active forgetting of olfactory memories in Drosophila.

    Science.gov (United States)

    Berry, Jacob A; Davis, Ronald L

    2014-01-01

    Failure to remember, or forgetting, is a phenomenon familiar to everyone and despite more than a century of scientific inquiry, why we forget what we once knew remains unclear. If the brain marshals significant resources to form and store memories, why is it that these memories become lost? In the last century, psychological studies have divided forgetting into decay theory, in which memory simply dissipates with time, and interference theory, in which additional learning or mental activity hinders memory by reducing its stability or retrieval (for review, Dewar et al., 2007; Wixted, 2004). Importantly, these psychological models of forgetting posit that forgetting is a passive property of the brain and thus a failure of the brain to retain memories. However, recent neuroscience research on olfactory memory in Drosophila has offered evidence for an alternative conclusion that forgetting is an "active" process, with specific, biologically regulated mechanisms that remove existing memories (Berry et al., 2012; Shuai et al., 2010). Similar to the bidirectional regulation of cell number by mitosis and apoptosis, protein concentration by translation and lysosomal or proteomal degradation, and protein phosphate modification by kinases and phosphatases, biologically regulated memory formation and removal would be yet another example in biological systems where distinct and separate pathways regulate the creation and destruction of biological substrates. © 2014 Elsevier B.V. All rights reserved.

  11. Functional neuroanatomy of Drosophila olfactory memory formation.

    Science.gov (United States)

    Guven-Ozkan, Tugba; Davis, Ronald L

    2014-10-01

    New approaches, techniques and tools invented over the last decade and a half have revolutionized the functional dissection of neural circuitry underlying Drosophila learning. The new methodologies have been used aggressively by researchers attempting to answer three critical questions about olfactory memories formed with appetitive and aversive reinforcers: (1) Which neurons within the olfactory nervous system mediate the acquisition of memory? (2) What is the complete neural circuitry extending from the site(s) of acquisition to the site(s) controlling memory expression? (3) How is information processed across this circuit to consolidate early-forming, disruptable memories to stable, late memories? Much progress has been made and a few strong conclusions have emerged: (1) Acquisition occurs at multiple sites within the olfactory nervous system but is mediated predominantly by the γ mushroom body neurons. (2) The expression of long-term memory is completely dependent on the synaptic output of α/β mushroom body neurons. (3) Consolidation occurs, in part, through circuit interactions between mushroom body and dorsal paired medial neurons. Despite this progress, a complete and unified model that details the pathway from acquisition to memory expression remains elusive. © 2014 Guven-Ozkan and Davis; Published by Cold Spring Harbor Laboratory Press.

  12. Host plant adaptation in Drosophila mettleri populations.

    Directory of Open Access Journals (Sweden)

    Sergio Castrezana

    Full Text Available The process of local adaptation creates diversity among allopatric populations, and may eventually lead to speciation. Plant-feeding insect populations that specialize on different host species provide an excellent opportunity to evaluate the causes of ecological specialization and the subsequent consequences for diversity. In this study, we used geographically separated Drosophila mettleri populations that specialize on different host cacti to examine oviposition preference for and larval performance on an array of natural and non-natural hosts (eight total. We found evidence of local adaptation in performance on saguaro cactus (Carnegiea gigantea for populations that are typically associated with this host, and to chemically divergent prickly pear species (Opuntia spp. in a genetically isolated population on Santa Catalina Island. Moreover, each population exhibited reduced performance on the alternative host. This finding is consistent with trade-offs associated with adaptation to these chemically divergent hosts, although we also discuss alternative explanations for this pattern. For oviposition preference, Santa Catalina Island flies were more likely to oviposit on some prickly pear species, but all populations readily laid eggs on saguaro. Experiments with non-natural hosts suggest that factors such as ecological opportunity may play a more important role than host plant chemistry in explaining the lack of natural associations with some hosts.

  13. Exploring strategies for protein trapping in Drosophila

    Energy Technology Data Exchange (ETDEWEB)

    Quinones-Coello, Ana T.; Petrella, Lisa N.; Ayers, Kathleen; Melillo, Anthony; Mazzalupo, Stacy; Hudson, Andrew M.; Wang, Shu; Castiblanco, Claudia; Buszczak, Michael; Hoskins, Roger A.; Cooley, Lynn

    2006-12-18

    The use of fluorescent protein tags has had a huge impact oncell biological studies in virtually every experimental system.Incorporation of coding sequence for fluorescent proteins such as greenfluorescent protein (GFP) into genes at their endogenous chromosomalposition is especially useful for generating GFP-fusion proteins thatprovide accurate cellular and subcellular expression data. We testedmodifications of a transposon-based protein trap screening procedure inDrosophila to optimize the rate of recovering useful protein traps andtheir analysis. Transposons carrying the GFP-coding sequence flanked bysplice acceptor and donor sequences were mobilized, and new insertionsthat resulted in production of GFP were captured using an automatedembryo sorter. Individual stocks were established, GFP expression wasanalyzed during oogenesis, and insertion sites were determined bysequencing genomic DNA flanking the insertions. The resulting collectionincludes lines with protein traps in which GFP was spliced into mRNAs andembedded within endogenous proteins or enhancer traps in which GFPexpression depended on splicing into transposon-derived RNA. We report atotal of 335 genes associated with protein or enhancer traps and aweb-accessible database for viewing molecular information and expressiondata for these genes.

  14. The sexually antagonistic genes of Drosophila melanogaster.

    Directory of Open Access Journals (Sweden)

    Paolo Innocenti

    2010-03-01

    Full Text Available When selective pressures differ between males and females, the genes experiencing these conflicting evolutionary forces are said to be sexually antagonistic. Although the phenotypic effect of these genes has been documented in both wild and laboratory populations, their identity, number, and location remains unknown. Here, by combining data on sex-specific fitness and genome-wide transcript abundance in a quantitative genetic framework, we identified a group of candidate genes experiencing sexually antagonistic selection in the adult, which correspond to 8% of Drosophila melanogaster genes. As predicted, the X chromosome is enriched for these genes, but surprisingly they represent only a small proportion of the total number of sex-biased transcripts, indicating that the latter is a poor predictor of sexual antagonism. Furthermore, the majority of genes whose expression profiles showed a significant relationship with either male or female adult fitness are also sexually antagonistic. These results provide a first insight into the genetic basis of intralocus sexual conflict and indicate that genetic variation for fitness is dominated and maintained by sexual antagonism, potentially neutralizing any indirect genetic benefits of sexual selection.

  15. Structure of full-length Drosophila cryptochrome

    Energy Technology Data Exchange (ETDEWEB)

    Zoltowski, Brian D.; Vaidya, Anand T.; Top, Deniz; Widom, Joanne; Young, Michael W.; Crane, Brian R. (Cornell); (Rockefeller)

    2011-12-15

    The cryptochrome/photolyase (CRY/PL) family of photoreceptors mediates adaptive responses to ultraviolet and blue light exposure in all kingdoms of life. Whereas PLs function predominantly in DNA repair of cyclobutane pyrimidine dimers (CPDs) and 6-4 photolesions caused by ultraviolet radiation, CRYs transduce signals important for growth, development, magnetosensitivity and circadian clocks. Despite these diverse functions, PLs/CRYs preserve a common structural fold, a dependence on flavin adenine dinucleotide (FAD) and an internal photoactivation mechanism. However, members of the CRY/PL family differ in the substrates recognized (protein or DNA), photochemical reactions catalysed and involvement of an antenna cofactor. It is largely unknown how the animal CRYs that regulate circadian rhythms act on their substrates. CRYs contain a variable carboxy-terminal tail that appends the conserved PL homology domain (PHD) and is important for function. Here, we report a 2.3-{angstrom} resolution crystal structure of Drosophila CRY with an intact C terminus. The C-terminal helix docks in the analogous groove that binds DNA substrates in PLs. Conserved Trp536 juts into the CRY catalytic centre to mimic PL recognition of DNA photolesions. The FAD anionic semiquinone found in the crystals assumes a conformation to facilitate restructuring of the tail helix. These results help reconcile the diverse functions of the CRY/PL family by demonstrating how conserved protein architecture and photochemistry can be elaborated into a range of light-driven functions.

  16. How Food Controls Aggression in Drosophila

    Science.gov (United States)

    Lim, Rod S.; Eyjólfsdóttir, Eyrún; Shin, Euncheol; Perona, Pietro; Anderson, David J.

    2014-01-01

    How animals use sensory information to weigh the risks vs. benefits of behavioral decisions remains poorly understood. Inter-male aggression is triggered when animals perceive both the presence of an appetitive resource, such as food or females, and of competing conspecific males. How such signals are detected and integrated to control the decision to fight is not clear. For instance, it is unclear whether food increases aggression directly, or as a secondary consequence of increased social interactions caused by attraction to food. Here we use the vinegar fly, Drosophila melanogaster, to investigate the manner by which food influences aggression. We show that food promotes aggression in flies, and that it does so independently of any effect on frequency of contact between males, increase in locomotor activity or general enhancement of social interactions. Importantly, the level of aggression depends on the absolute amount of food, rather than on its surface area or concentration. When food resources exceed a certain level, aggression is diminished, suggestive of reduced competition. Finally, we show that detection of sugar via Gr5a+ gustatory receptor neurons (GRNs) is necessary for food-promoted aggression. These data demonstrate that food exerts a specific effect to promote aggression in male flies, and that this effect is mediated, at least in part, by sweet-sensing GRNs. PMID:25162609

  17. Ferritin Assembly in Enterocytes of Drosophila melanogaster

    Directory of Open Access Journals (Sweden)

    Abraham Rosas-Arellano

    2016-02-01

    Full Text Available Ferritins are protein nanocages that accumulate inside their cavity thousands of oxidized iron atoms bound to oxygen and phosphates. Both characteristic types of eukaryotic ferritin subunits are present in secreted ferritins from insects, but here dimers between Ferritin 1 Heavy Chain Homolog (Fer1HCH and Ferritin 2 Light Chain Homolog (Fer2LCH are further stabilized by disulfide-bridge in the 24-subunit complex. We addressed ferritin assembly and iron loading in vivo using novel transgenic strains of Drosophila melanogaster. We concentrated on the intestine, where the ferritin induction process can be controlled experimentally by dietary iron manipulation. We showed that the expression pattern of Fer2LCH-Gal4 lines recapitulated iron-dependent endogenous expression of the ferritin subunits and used these lines to drive expression from UAS-mCherry-Fer2LCH transgenes. We found that the Gal4-mediated induction of mCherry-Fer2LCH subunits was too slow to effectively introduce them into newly formed ferritin complexes. Endogenous Fer2LCH and Fer1HCH assembled and stored excess dietary iron, instead. In contrast, when flies were genetically manipulated to co-express Fer2LCH and mCherry-Fer2LCH simultaneously, both subunits were incorporated with Fer1HCH in iron-loaded ferritin complexes. Our study provides fresh evidence that, in insects, ferritin assembly and iron loading in vivo are tightly regulated.

  18. A Model of Drosophila Larva Chemotaxis.

    Directory of Open Access Journals (Sweden)

    Alex Davies

    2015-11-01

    Full Text Available Detailed observations of larval Drosophila chemotaxis have characterised the relationship between the odour gradient and the runs, head casts and turns made by the animal. We use a computational model to test whether hypothesised sensorimotor control mechanisms are sufficient to account for larval behaviour. The model combines three mechanisms based on simple transformations of the recent history of odour intensity at the head location. The first is an increased probability of terminating runs in response to gradually decreasing concentration, the second an increased probability of terminating head casts in response to rapidly increasing concentration, and the third a biasing of run directions up concentration gradients through modulation of small head casts. We show that this model can be tuned to produce behavioural statistics comparable to those reported for the larva, and that this tuning results in similar chemotaxis performance to the larva. We demonstrate that each mechanism can enable odour approach but the combination of mechanisms is most effective, and investigate how these low-level control mechanisms relate to behavioural measures such as the preference indices used to investigate larval learning behaviour in group assays.

  19. Flavonoids and oxidative stress in Drosophila melanogaster.

    Science.gov (United States)

    Sotibrán, América Nitxin Castañeda; Ordaz-Téllez, María Guadalupe; Rodríguez-Arnaiz, Rosario

    2011-11-27

    Flavonoids are a family of antioxidants that are widely represented in fruits, vegetables, dry legumes, and chocolate, as well as in popular beverages, such as red wine, coffee, and tea. The flavonoids chlorogenic acid, kaempferol, quercetin and quercetin 3β-d-glycoside were investigated for genotoxicity using the wing somatic mutation and recombination test (SMART). This test makes use of two recessive wing cell markers: multiple wing hairs (mwh) and flare (flr(3)), which are mutations located on the left arm of chromosome 3 of Drosophila melanogaster and are indicative of both mitotic recombination and various types of mutational events. In order to test the antioxidant capacities of the flavonoids, experiments were conducted with various combinations of oxidants and polyphenols. Oxidative stress was induced using hydrogen peroxide, the Fenton reaction and paraquat. Third-instar transheterozygous larvae were chronically treated for all experiments. The data obtained in this study showed that, at the concentrations tested, the flavonoids did not induce somatic mutations or recombination in D. melanogaster with the exception of quercetin, which proved to be genotoxic at only one concentration. The oxidants hydrogen peroxide and the Fenton reaction did not induce mutations in the wing somatic assay of D. melanogaster, while paraquat and combinations of flavonoids produced significant numbers of small single spots. Quercetin 3β-d-glycoside mixed with paraquat was shown to be desmutagenic. Combinations of the oxidants with the other flavonoids did not show any antioxidant activity. Copyright © 2011 Elsevier B.V. All rights reserved.

  20. Place learning overrides innate behaviors in Drosophila.

    Science.gov (United States)

    Baggett, Vincent; Mishra, Aditi; Kehrer, Abigail L; Robinson, Abbey O; Shaw, Paul; Zars, Troy

    2018-03-01

    Animals in a natural environment confront many sensory cues. Some of these cues bias behavioral decisions independent of experience, and action selection can reveal a stimulus-response (S-R) connection. However, in a changing environment it would be a benefit for an animal to update behavioral action selection based on experience, and learning might modify even strong S-R relationships. How animals use learning to modify S-R relationships is a largely open question. Three sensory stimuli, air, light, and gravity sources were presented to individual Drosophila melanogaster in both naïve and place conditioning situations. Flies were tested for a potential modification of the S-R relationships of anemotaxis, phototaxis, and negative gravitaxis by a contingency that associated place with high temperature. With two stimuli, significant S-R relationships were abandoned when the cue was in conflict with the place learning contingency. The role of the dunce ( dnc ) cAMP-phosphodiesterase and the rutabaga ( rut ) adenylyl cyclase were examined in all conditions. Both dnc 1 and rut 2080 mutant flies failed to display significant S-R relationships with two attractive cues, and have characteristically lower conditioning scores under most conditions. Thus, learning can have profound effects on separate native S-R relationships in multiple contexts, and mutation of the dnc and rut genes reveal complex effects on behavior. © 2018 Baggett et al.; Published by Cold Spring Harbor Laboratory Press.

  1. Meiotic transmission of Drosophila pseudoobscura chromosomal arrangements.

    Directory of Open Access Journals (Sweden)

    Richard P Meisel

    Full Text Available Drosophila pseudoobscura harbors a rich gene arrangement polymorphism on the third chromosome generated by a series of overlapping paracentric inversions. The arrangements suppress recombination in heterokaryotypic individuals, which allows for the selective maintenance of coadapted gene complexes. Previous mapping experiments used to determine the degree to which recombination is suppressed in gene arrangement heterozygotes produced non-recombinant progeny in non-Mendelian ratios. The deviations from Mendelian expectations could be the result of viability differences between wild and mutant chromosomes, meiotic drive because of achiasmate pairing of homologues in heterokaryotypic females during meiosis, or a combination of both mechanisms. The possibility that the frequencies of the chromosomal arrangements in natural populations are affected by mechanisms other than adaptive selection led us to consider these hypotheses. We performed reciprocal crosses involving both heterozygous males and females to determine if the frequency of the non-recombinant progeny deviates significantly from Mendelian expectations and if the frequencies deviate between reciprocal crosses. We failed to observe non-Mendelian ratios in multiple crosses, and the frequency of the non-recombinant classes differed in only one of five pairs of reciprocal crosses despite sufficient power to detect these differences in all crosses. Our results indicate that deviations from Mendelian expectations in recombination experiments involving the D. pseudoobscura inversion system are most likely due to fitness differences of gene arrangement karyotypes in different environments.

  2. Tools for neuroanatomy and neurogenetics in Drosophila

    Energy Technology Data Exchange (ETDEWEB)

    Pfeiffer, Barret D.; Jenett, Arnim; Hammonds, Ann S.; Ngo, Teri-T B.; Misra, Sima; Murphy, Christine; Scully, Audra; Carlson, Joseph W.; Wan, Kenneth H.; Laverty, Todd R.; Mungall, Chris; Svirskas, Rob; Kadonaga, James T.; Doe, Chris Q.; Eisen, Michael B.; Celniker, Susan E.; Rubin, Gerald M.

    2008-08-11

    We demonstrate the feasibility of generating thousands of transgenic Drosophila melanogaster lines in which the expression of an exogenous gene is reproducibly directed to distinct small subsets of cells in the adult brain. We expect the expression patterns produced by the collection of 5,000 lines that we are currently generating to encompass all neurons in the brain in a variety of intersecting patterns. Overlapping 3-kb DNA fragments from the flanking noncoding and intronic regions of genes thought to have patterned expression in the adult brain were inserted into a defined genomic location by site-specific recombination. These fragments were then assayed for their ability to function as transcriptional enhancers in conjunction with a synthetic core promoter designed to work with a wide variety of enhancer types. An analysis of 44 fragments from four genes found that >80% drive expression patterns in the brain; the observed patterns were, on average, comprised of <100 cells. Our results suggest that the D. melanogaster genome contains >50,000 enhancers and that multiple enhancers drive distinct subsets of expression of a gene in each tissue and developmental stage. We expect that these lines will be valuable tools for neuroanatomy as well as for the elucidation of neuronal circuits and information flow in the fly brain.

  3. In-vivo Centrifugation of Drosophila Embryos

    Science.gov (United States)

    Tran, Susan L.; Welte, Michael A.

    2010-01-01

    A major strategy for purifying and isolating different types of intracellular organelles is to separate them from each other based on differences in buoyant density. However, when cells are disrupted prior to centrifugation, proteins and organelles in this non-native environment often inappropriately stick to each other. Here we describe a method to separate organelles by density in intact, living Drosophila embryos. Early embryos before cellularization are harvested from population cages, and their outer egg shells are removed by treatment with 50% bleach. Embryos are then transferred to a small agar plate and inserted, posterior end first, into small vertical holes in the agar. The plates containing embedded embryos are centrifuged for 30 min at 3000g. The agar supports the embryos and keeps them in a defined orientation. Afterwards, the embryos are dug out of the agar with a blunt needle. Centrifugation separates major organelles into distinct layers, a stratification easily visible by bright-field microscopy. A number of fluorescent markers are available to confirm successful stratification in living embryos. Proteins associated with certain organelles will be enriched in a particular layer, demonstrating colocalization. Individual layers can be recovered for biochemical analysis or transplantation into donor eggs. This technique is applicable for organelle separation in other large cells, including the eggs and oocytes of diverse species. PMID:20613707

  4. Insulin signaling mediates sexual attractiveness in Drosophila.

    Directory of Open Access Journals (Sweden)

    Tsung-Han Kuo

    Full Text Available Sexually attractive characteristics are often thought to reflect an individual's condition or reproductive potential, but the underlying molecular mechanisms through which they do so are generally unknown. Insulin/insulin-like growth factor signaling (IIS is known to modulate aging, reproduction, and stress resistance in several species and to contribute to variability of these traits in natural populations. Here we show that IIS determines sexual attractiveness in Drosophila through transcriptional regulation of genes involved in the production of cuticular hydrocarbons (CHC, many of which function as pheromones. Using traditional gas chromatography/mass spectrometry (GC/MS together with newly introduced laser desorption/ionization orthogonal time-of-flight mass spectrometry (LDI-MS we establish that CHC profiles are significantly affected by genetic manipulations that target IIS. Manipulations that reduce IIS also reduce attractiveness, while females with increased IIS are significantly more attractive than wild-type animals. IIS effects on attractiveness are mediated by changes in CHC profiles. Insulin signaling influences CHC through pathways that are likely independent of dFOXO and that may involve the nutrient-sensing Target of Rapamycin (TOR pathway. These results suggest that the activity of conserved molecular regulators of longevity and reproductive output may manifest in different species as external characteristics that are perceived as honest indicators of fitness potential.

  5. Effects of Spaceflight on Drosophila Neural Development

    Science.gov (United States)

    Keshishian, Haig S.

    1997-01-01

    The major goal from the animal side, however, has been achieved, namely to develop Drosophila lines where we can assay individual neuromuscular endings directly without dissection. This was achieved by means of using the GAL4-UAS system, where we have succeeded in establishing stocks of flies where the key neuromuscular connections can be assayed directly in undissected larvae by means of the expression of endogenously fluorescent reporters in the specific motor endings. The green fluorescent protein (GFP) as a reporter allows scoring of neural anatomy en-masse in whole mount using fluorescent microscopy without the need for either dissection or specific labeling. Two stocks have been developed. The first, which we developed first, uses the S65T mutant form, which has a dramatically brighter expression than the native protein. This animal will use GAL4 drivers with expression under the control of the elav gene, and which will ensure expression in all neurons of the embryo and larva. The second transgenic animal we have developed is of a novel kind, and makes use of dicistronic design, so that two copies of the protein will be expressed per insert. We have also developed a tricistronic form, but this has not yet been transformed into flies, and we do not imagine that this third line will be ready in time for the flight.

  6. Quantifying Abdominal Pigmentation in Drosophila melanogaster.

    Science.gov (United States)

    Saleh Ziabari, Omid; Shingleton, Alexander W

    2017-06-01

    Pigmentation is a morphologically simple but highly variable trait that often has adaptive significance. It has served extensively as a model for understanding the development and evolution of morphological phenotypes. Abdominal pigmentation in Drosophila melanogaster has been particularly useful, allowing researchers to identify the loci that underlie inter- and intraspecific variations in morphology. Hitherto, however, D. melanogaster abdominal pigmentation has been largely assayed qualitatively, through scoring, rather than quantitatively, which limits the forms of statistical analysis that can be applied to pigmentation data. This work describes a new methodology that allows for the quantification of various aspects of the abdominal pigmentation pattern of adult D. melanogaster. The protocol includes specimen mounting, image capture, data extraction, and analysis. All the software used for image capture and analysis feature macros written for open-source image analysis. The advantage of this approach is the ability to precisely measure pigmentation traits using a methodology that is highly reproducible across different imaging systems. While the technique has been used to measure variation in the tergal pigmentation patterns of adult D. melanogaster, the methodology is flexible and broadly applicable to pigmentation patterns in myriad different organisms.

  7. Drosophila as a genetically tractable model for social insect behaviour

    Directory of Open Access Journals (Sweden)

    Alison L Camiletti

    2016-04-01

    Full Text Available The relatively simple communication, breeding and egg-making systems that govern reproduction in female Drosophila retain homology to eusocial species in which these same systems are modified to the social condition. Despite having no parental care, division of labour or subfertile caste, Drosophila may nonetheless offer a living test of certain sociobiological hypotheses framed around gene function. In this review, we make this case, and do so around the recent discovery that the non-social fly, Drosophila melanogaster, can respond to the ovary-suppressing queen pheromone of the honey bee Apis meliffera. Here, we first explain the sociobiological imperative to reconcile kin theory with molecular biology, and qualify a potential role for Drosophila. Then, we offer three applications for the fly-pheromone assay. First, the availability and accessibility of massive mutant libraries makes immediately feasible any number of open or targeted gene screens against the ovary-inhibiting response. The sheer tractability of Drosophila may therefore help to accelerate the search for genes in pheromone-responsive pathways that regulate female reproduction, including potentially any that are preserved with modification to regulate worker sterility in response to queen pheromones in eusocial taxa. Secondly, Drosophila’s powerful Gal4/UAS expression system can complement the pheromone assay by driving target gene expression into living tissue, which could be well applied to the functional testing of genes presumed to drive ovary activation or de-activation in the honey bee or other eusocial taxa. Finally, coupling Gal4 with UAS-RNAi lines can facilitate loss-of-function experiments against perception and response to the ovary inhibiting pheromone, and do so for large numbers of candidates in systematic fashion. Drosophila's utility as an adjunct to the field of insect sociobiology is not ideal, but retains surprising potential.

  8. Regulation of online pharmacy: an Australian perspective.

    Science.gov (United States)

    Bernath, Paul

    2003-02-01

    This article argues that existing Australian regulations do not adequately cover online pharmacies or Internet advertising of medicines and that existing penalties and sanctions are often ineffective, potentially placing public health and safety at risk. Suggestions are made for future regulatory approaches. It is concluded that as well as an effective program of public education, cautious domestic legislative reform is necessary to ensure specific regulation of Australian online pharmacy practice and Internet advertising of medicines. In addition, the global nature of the Internet demands international co-operation and increased regulator and consumer vigilance.

  9. Australian internet histories: Past, present and future

    DEFF Research Database (Denmark)

    Brügger, Niels

    2012-01-01

    be worth considering in the future: constituting the field based on shared theoretical and methodological reflections; using archived web material to a larger extent; participating in the shaping of a digital research infrastructure for internet studies; and increasing international research relations.......This Afterword compares the articles in this issue of Media International Australia to the ‘first wave’ of Australian internet historiography, a field of study established by Australian internet scholars around 2000. After identifying what is new in the present issue, I outline four paths that may...

  10. Australian uranium wants to stay at home

    International Nuclear Information System (INIS)

    Slovak, K.

    2005-01-01

    In this issue a battle of purchase of Australian WMC Company - minor of nickel, copper and uranium. Domestic company BHB Hilton will probably win this battle. This company offers 7.3 billion USD for WMC. Australian company offers approximately in 800 million USD more than Swiss competitor Xstrata. WMC controls more than one third of worldwide known uranium deposits in its mine Olympic Dam. WMC is the fifth largest producer of nickel in the world. United company should be the second in the world in copper mining after Chile Codelco and the third in aluminium mining after Russian company Norilsk Nickel and Canadian Inco

  11. Learning Design and Inquiry in Australian History Classrooms

    Science.gov (United States)

    Carroll, Kay

    2012-01-01

    Global and digital connectivity transform Australian classrooms by creating rich environments for inquiry learning. Developing inquiry learning in this Information Communication Technology (ICT) context is an Australian educational goal. Recently the Australian Curriculum reform and the Digital Education Revolution has become a catalyst for…

  12. Drama in the Australian National Curriculum: Decisions, Tensions and Uncertainties

    Science.gov (United States)

    Stinson, Madonna; Saunders, John Nicholas

    2016-01-01

    In September 2015, the Australian Federal Government endorsed the final version of the Australian Curriculum arts framework a document resulting from nearly seven years of consultation and development. "The Australian Curriculum: The Arts Version 8.0" comprises five subjects: dance, drama, media arts, music and visual arts. This article…

  13. Building Innovation: Learning with Technologies. Australian Education Review Number 56

    Science.gov (United States)

    Moyle, Kathryn

    2010-01-01

    Australian Education Review (AER) 56 explores national and international policy priorities for building students' innovation capabilities through information and communication technologies (ICT) in Australian schools. Section 1 sets out the Australian policy context for digital education and highlights some of the emerging challenges. It provides…

  14. Intraspecific hybridization, developmental stability and fitness in Drosophila mercatorum

    DEFF Research Database (Denmark)

    Andersen, DH; Pertoldi, C; Scali, V

    2002-01-01

    (hybrid vigour) may be a result of hybridization, probably due to increased heterozygosity. Developmental stability is assumed to be correlated with fitness and is commonly measured as fluctuating asymmetry or phenotypic variance. Drosophila mercatorum is capable of reproducing sexually, but also....... Intraspecific hybridization between a parthenogenetic and a sexually reproducing strain of Drosophila mercatorum resulted in significant changes in fecundity as well as fluctuating asymmetry and phenotypic variance for the number of sternopleural bristles and in the length of two wing traits over three...

  15. Getting started : an overview on raising and handling Drosophila.

    Science.gov (United States)

    Stocker, Hugo; Gallant, Peter

    2008-01-01

    Drosophila melanogaster has long been a prime model organism for developmental biologists. During their work, they have established a large collection of techniques and reagents. This in turn has made fruit flies an attractive system for many other biomedical researchers who have otherwise no background in fly biology. This review intends to help Drosophila neophytes in setting up a fly lab. It briefly introduces the biological properties of fruit flies, describes the minimal equipment required for working with flies, and offers some basic advice for maintaining fly lines and setting up and analyzing experiments.

  16. Using the Drosophila Nephrocyte to Model Podocyte Function and Disease

    Directory of Open Access Journals (Sweden)

    Martin Helmstädter

    2017-12-01

    Full Text Available Glomerular disorders are a major cause of end-stage renal disease and effective therapies are often lacking. Nephrocytes are considered to be part of the Drosophila excretory system and form slit diaphragms across cellular membrane invaginations. Nehphrocytes have been shown to share functional, morphological, and molecular features with podocytes, which form the glomerular filter in vertebrates. Here, we report the progress and the evolving tool-set of this model system. Combining a functional, accessible slit diaphragm with the power of the genetic tool-kit in Drosophila, the nephrocyte has the potential to greatly advance our understanding of the glomerular filtration barrier in health and disease.

  17. Mutagenic effects of irradiated glucose in Drosophila melanogaster

    International Nuclear Information System (INIS)

    Varma, M.B.; Rao, K.P.; Nandan, S.D.; Rao, M.S.

    1982-01-01

    The mutagenic effects of irradiated glucose were studied using the sex-linked recessive lethal test in Drosophila melanogaster. Oregon K males of D. melanogaster reared on a medium containing 20 or 40% glucose irradiated with a dose of 0.02, 0.10, 0.20, 2 or 5 Mrad #betta#-rays were scored for the induction of sex-linked recessive lethals. The results showed no significant increase in the frequency of X-lethals in Drosophila at any of the dose levels. (author)

  18. Polytene chromosome map and inversion polymorphism in Drosophila mediopunctata

    Directory of Open Access Journals (Sweden)

    Galina Ananina

    2002-07-01

    Full Text Available Drosophila mediopunctata belongs to the tripunctata group, and is one of the commonest Drosophila species collected in some places in Brazil, especially in the winter. A standard map of the polytene chromosomes is presented. The breakpoints of the naturally occurring chromosomal rearrangements are marked on the map. The distribution of breaking points through the chromosomes of D. mediopunctata is apparently non-random. Chromosomes X, II and IV show inversion polymorphisms. Chromosome II is the most polymorphic, with 17 inversions, 8 inversions in the distal region and 9 in the proximal region. Chromosome X has four different gene arrangements, while chromosome IV has only two.

  19. Genetic analysis of a Drosophila microtubule-associated protein

    OpenAIRE

    1992-01-01

    The 205-kD microtubule-associated protein (205K MAP) is one of the principal MAPs in Drosophila. 205K MAP is similar to the HeLa 210K/MAP4 family of MAPs since it shares the following biochemical properties: it is present in several isoforms, has a molecular mass of approximately 200 kD, and is thermostable. Furthermore, immuno-crossreactivity has been observed between mouse MAP4, HeLa 210K, and Drosophila 205K MAP. Currently, there is little information concerning the biological function of ...

  20. Egg size, embryonic development time and ovoviviparity in Drosophila species.

    Science.gov (United States)

    Markow, T A; Beall, S; Matzkin, L M

    2009-02-01

    Lengths, widths and volumes of eggs from 11 species of Drosophila whose genomes have been fully sequenced exhibit significant variation that is not explained by their phylogenetic relationships. Furthermore, egg size differences are unrelated to embryonic development time in these species. In addition, two of the species, Drosophila sechellia and, to a lesser degree, D. yakuba, both ecological specialists, exhibit ovoviviparity, suggesting that female control over oviposition in these species differs from what is observed in D. melanogaster. The interspecific differences in these reproductive characters, coupled with the availability of whole genome sequences for each, provide an unprecedented opportunity to examine their evolution.

  1. Western Australian food security project

    Directory of Open Access Journals (Sweden)

    Maycock Bruce

    2007-08-01

    Full Text Available Abstract Background The aim of the Western Australian (WA Food Security Project was to conduct a preliminary investigation into issues relating to food security in one region within the Perth metropolitan area in Western Australia. The first phase of the project involved a food audit in one lower income area that was typical of the region, to identify the range, variety and availability of foods in the region. Methods A comprehensive food audit survey was provided to all food outlet owners/operators in one lower socio-economic region within the City of Mandurah (n = 132 outlets. The purpose of the survey was to investigate the range, variety and availability of foods in the Mandurah region as well as examining specific in-store characteristics such as the types of clientele and in-store promotions offered. Surveys were competed for 99 outlets (response rate = 75%. Results The range of foods available were predominantly pre-prepared with more than half of the outlets pre-preparing the majority of their food. Sandwiches and rolls were the most popular items sold in the outlets surveyed (n = 51 outlets followed by pastries such as pies, sausage rolls and pasties (n = 33 outlets. Outlets considered their healthiest food options were sandwiches or rolls (n = 51 outlets, salads (n- = 50 outlets, fruit and vegetables (n = 40 outlets, seafood (n = 27 outlets, meats such as chicken (n = 26 outlets and hot foods such as curries, soups or quiches (n = 23 outlets. The majority of outlets surveyed considered pre-prepared food including sandwiches, rolls and salads, as healthy food options regardless of the content of the filling or dressings used. Few outlets (n = 28% offered a choice of bread type other than white or wholemeal. High fat pastries and dressings were popular client choices (n = 77% as were carbonated drinks (n = 88% and flavoured milks (n = 46%. Conclusion These findings clearly indicate the need for further investigation of the impact of

  2. The molecular genetics of clinal variation: a case study of ebony and thoracic trident pigmentation in Drosophila melanogaster from eastern Australia.

    Science.gov (United States)

    Telonis-Scott, Marina; Hoffmann, Ary A; Sgrò, Carla M

    2011-05-01

    Widespread pigmentation diversity coupled with a well-defined genetic system of melanin synthesis and patterning in Drosophila provides an excellent opportunity to study phenotypes undergoing evolutionary change. Pigmentation variation is highly correlated with different ecological variables and is thought to reflect adaptations to different environments. Several studies have linked candidate genes from Drosophila melanogaster to intra-population variation and interspecific morphological divergence, but less clearly to variation among populations forming pigmentation clines. We characterized a new thoracic trident pigmentation cline in D. melanogaster populations from eastern Australia, and applied a candidate gene approach to explain the majority of the geographically structured phenotypic variation. More melanized populations from higher latitudes tended to express less ebony than their tropical counterparts, and an independent artificial selection experiment confirmed this association. By partitioning temperature dependent effects, we showed that the genetic differences underlying clinal patterns for trident variation at 25 °C do not explain the patterns observed at 16 °C. Changes in thoracic trident pigmentation could be a common evolutionary response to climatically mediated environmental pressures. On the Australian east coast most of the changes appear to be associated with regulatory divergence of the ebony gene but this depends on temperature. © 2011 Blackwell Publishing Ltd.

  3. A Community Standard: Equivalency of Healthcare in Australian Immigration Detention.

    Science.gov (United States)

    Essex, Ryan

    2017-08-01

    The Australian government has long maintained that the standard of healthcare provided in its immigration detention centres is broadly comparable with health services available within the Australian community. Drawing on the literature from prison healthcare, this article examines (1) whether the principle of equivalency is being applied in Australian immigration detention and (2) whether this standard of care is achievable given Australia's current policies. This article argues that the principle of equivalency is not being applied and that this standard of health and healthcare will remain unachievable in Australian immigration detention without significant reform. Alternate approaches to addressing the well documented issues related to health and healthcare in Australian immigration detention are discussed.

  4. Indigenous Australian art in intercultural contact zones

    Directory of Open Access Journals (Sweden)

    Eleonore Wildburger

    2009-06-01

    Full Text Available This article comments on Indigenous Australian art from an intercultural perspective. The painting Bush Tomato Dreaming (1998, by the Anmatyerre artist Lucy Ngwarai Kunoth serves as model case for my argument that art expresses existential social knowledge. In consequence, I will argue that social theory and art theory together provide tools for intercultural understanding and competence.

  5. Demands of Training: Australian Tourism and Hospitality.

    Science.gov (United States)

    Freeland, Brett

    Qualitative research was conducted as part of a four-industry project studying operation of training markets, one of which was Australian tourism and hospitality (T&H). Semi-structured interviews were conducted with 23 individuals representing stakeholder groups. Interviews were conducted across Queensland, Victoria, and South Australia and…

  6. Wilderness quality mapping - the Australian experiences

    Science.gov (United States)

    Nick Sawyer

    2015-01-01

    By 1995 wilderness quality maps developed under the Australian Government's National Wilderness Inventory (NWI) program had been published for most of Australia, but few traces of the NWI now remain and the word "wilderness" has become almost unmentionable in government and professional land management circles. Yet its popular appeal is demonstrated by...

  7. Homelessness: An Annotated Bibliography of Australian Research.

    Science.gov (United States)

    Loft, Jenny, Comp.; Davis, Mari, Comp.

    This bibliography, compiled for the International Year of Shelter for the Homeless, lists Australian works published since 1974 about homelessness. It includes definitions of homelessness from the literature and an introductory article looking at different perspectives on homelessness. The entries, mainly taken from FAMILY database, are each…

  8. Professional Standards for Australian Special Education Teachers

    Science.gov (United States)

    Dempsey, Ian; Dally, Kerry

    2014-01-01

    Although professional standards for Australian teachers were developed several years ago, this country is yet to develop such standards for special education teachers. The lack of standards for the special education profession is associated with the absence of a consistent process of accreditation in Australia and a lack of clarity in the pathways…

  9. Learning Choices, Older Australians and Active Ageing

    Science.gov (United States)

    Boulton-Lewis, Gillian M.; Buys, Laurie

    2015-01-01

    This paper reports on the findings of qualitative, semistructured interviews conducted with 40 older Australian participants who either did or did not engage in organized learning. Phenomenology was used to guide the interviews and analysis to explore the lived learning experiences and perspectives of these older people. Their experiences of…

  10. The Banality of Exclusion in Australian Universities

    Science.gov (United States)

    White, Julie

    2017-01-01

    The systematic exclusion of asylum seekers from Australian higher education reveals much about present day Australia. This essay begins with a brief context and outline of the international refugee crisis and Australia's reaction. Next, consideration is given to how this nation has identified itself historically and how it has behaved in recent…

  11. Does Academic Work Make Australian Academics Happy?

    Science.gov (United States)

    Duncan, Roderick; Tilbrook, Kerry; Krivokapic-Skoko, Branka

    2015-01-01

    Happiness research is a rapidly-growing area in social psychology and has emphasised the link between happiness and workplace productivity and creativity for knowledge workers. Recent articles in this journal have raised concerns about the level of happiness and engagement of Australian academics with their work, however there is little research…

  12. Australian Geography and the Corporate Management Paradigm.

    Science.gov (United States)

    Powell, J. M.

    1990-01-01

    Criticizes the intrusion into Australian higher education of the corporate management model. Considers the implications of this mechanization for geography instruction. Notes centralizing tendencies and merger policies with the corresponding market imperatives of efficiency and accountability. Argues that this produces employable manpower but does…

  13. Australian Education Journals: Quantitative and Qualitative Indicators

    Science.gov (United States)

    Haddow, Gaby; Genoni, Paul

    2009-01-01

    This paper reports on a study that applied citation-based measurements to Australian education journals. Citations data were drawn from two sources, Web of Science and Scopus, and these data were used to calculate each journal's impact factor, "h"-index, and diffusion factor. The rankings resulting from these analyses were compared with…

  14. Marketing in the Australian Higher Education Sector

    Science.gov (United States)

    Favaloro, Chrissa

    2015-01-01

    This article examines domestic marketing in the Australian higher education sector, specifically, the marketing investment patterns of universities and their levels of student growth as a return on marketing investment. Marketing expenditure by universities has risen 23 per cent in the five years to 2013, with several institutions allocating in…

  15. Commercial Activities and Copyright in Australian Universities

    Science.gov (United States)

    Shelly, Marita

    2008-01-01

    With government funding for most Australian universities below 60% and falling a major strategic emphasis for universities has been on securing other sources of operating revenue, including commercial opportunities and partnerships. The implication of increasing commercial activities such as non-award and tailored professional programmes, contract…

  16. Caught between Empires: Ambivalence in Australian Films ...

    African Journals Online (AJOL)

    Caught between Empires: Ambivalence in Australian Films. Greg McCarthy. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's Partners · Terms and Conditions of Use · Contact AJOL · News. OTHER RESOURCES... for Researchers · for ...

  17. Conversion Disorder in Australian Pediatric Practice

    Science.gov (United States)

    Kozlowska, Kasia; Nunn, Kenneth P.; Rose, Donna; Morris, Anne; Ouvrier, Robert A.; Varghese, John

    2007-01-01

    Objectives: To describe the incidence and clinical features of children presenting to Australian child health specialists with conversion disorder. Method: Active, national surveillance of conversion disorder in children younger than 16 years of age during 2002 and 2003. Results: A total of 194 children were reported on. The average age was 11.8…

  18. Financial Management and Young Australian Workers

    Science.gov (United States)

    Dowling, Nicki; Hoiles, Lauren; Corney, Tim; Clark, David

    2008-01-01

    In two studies of young Australian workers, participants generally displayed positive attitudes towards financial management practices; however, a substantial proportion failed to display positive financial management practices, experienced financial problems and dissatisfaction, and reported low rates of seeking financial assistance, particularly…

  19. Australian orchids and the doctors they commemorate.

    Science.gov (United States)

    Pearn, John H

    2013-01-21

    Botanical taxonomy is a repository of medical biographical information. Such botanical memorials include the names of some indigenous orchids of Australia. By searching reference texts and journals relating to Australian botany and Australian orchidology, as well as Australian and international medical and botanical biographical texts, I identified 30 orchids indigenous to Australia whose names commemorate doctors and other medical professionals. Of these, 24 have names that commemorate a total of 16 doctors who worked in Australia. The doctors and orchids I identified include: doctor-soldiers Richard Sanders Rogers (1862-1942), after whom the Rogers' Greenhood (Pterostylis rogersii) is named, and Robert Brown (1773-1858), after whom the Purple Enamel Orchid (Elythranthera brunonis) is named; navy surgeon Archibald Menzies (1754-1842), after whom the Hare Orchid (Leptoceras menziesii) is named; radiologist Hugo Flecker (1884-1957) after whom the Slender Sphinx Orchid (Cestichis fleckeri) is named; and general medical practitioner Hereward Leighton Kesteven (1881-1964), after whom the Kesteven's Orchid (Dendrobium kestevenii) is named. Biographic references in scientific names of plants comprise a select but important library of Australian medical history. Such botanical taxonomy commemorates, in an enduring manner, clinicians who have contributed to biology outside clinical practice.

  20. Japanese wives in Japanese-Australian intermarriages

    Directory of Open Access Journals (Sweden)

    Jared Denman

    2009-12-01

    Full Text Available The diasporic experiences of Japanese partners married to Australians and living in Australia are largely unexamined. This article is based on a study, conducted for an honours thesis, which invited four Japanese wives living in South East Queensland to describe, together with their Australian husbands, their family’s interactions with Japan, its language and culture, and the local Japanese community. It was recognised that the extensive social networks these wives had established and maintained with local Japanese women from other Japanese-Australian intermarriage families were an important part of their migrant experience. This article will firstly review the literature on contemporary Japanese- Australian intermarriage in Australia and Japanese lifestyle migration to Australia. It will then describe and examine the involvement and motivations of the four wives in their social networks. Entry into motherhood was found to be the impetus for developing and participating in informal, autonomous networks. Additionally, regular visits to Japan were focused on engagement with existing family and friendship networks. The contemporary experience of intermarriage for these women is decidedly transnational and fundamentally different from that of the war brides, or sensō hanayome.

  1. Brain drain threat to Australian science

    Science.gov (United States)

    Banks, Michael

    2011-11-01

    Around half of all academics in Australia intend to retire, move to an overseas university or leave Australian higher education within the next 10 years, according to a survey of more than 5500 researchers based at 20 universities in the country.

  2. Publications of Australian LIS Academics in Databases

    Science.gov (United States)

    Wilson, Concepcion S.; Boell, Sebastian K.; Kennan, Mary Anne; Willard, Patricia

    2011-01-01

    This paper examines aspects of journal articles published from 1967 to 2008, located in eight databases, and authored or co-authored by academics serving for at least two years in Australian LIS programs from 1959 to 2008. These aspects are: inclusion of publications in databases, publications in journals, authorship characteristics of…

  3. Australian Allograpta Osten Sacken (Diptera, Syrphidae

    Directory of Open Access Journals (Sweden)

    Ximo Mengual

    2015-07-01

    Full Text Available Allograpta terraenovae sp. n. and Allograpta notiale sp. n. are described from Australia. Notes on the Australian species of Allograpta and an identification key to them are also given. The lectotype of Allograpta javana Wiedemann is designated, and the species Syrphus pallidus Bigot is synonymized under Allograpta australensis (Schiner.

  4. The Australians--A "Fair Go" People.

    Science.gov (United States)

    Hurst, Herschel

    1984-01-01

    Australians are known for their egalitarian spirit, manifested by a dislike of social pretension and affectation. A brief history of the country from the time of its establishment in 1788 as a dumping ground for Britain's unwanted criminals to the present is presented. (RM)

  5. Contributions to Indo-Australian Herpetology

    NARCIS (Netherlands)

    Brongersma, L.D.

    1934-01-01

    A complete account of all the reptiles then known to occur in the Indo-Australian Archipelago was published by De Rooij in 1915 and 1917. Since this time several new species have been described, while others have been suppressed or revived. Also the problem of geographical variation begins to

  6. Sustainability in the Australian Curriculum: Geography

    Science.gov (United States)

    Maude, Alaric

    2014-01-01

    "Sustainability" is one of the seven major concepts in the geography curriculum. It is also one of the three cross-curriculum priorities in the Australian curriculum, together with Asia and Australia's engagement with Asia, and Aboriginal and Torres Strait Islander histories and cultures. This paper describes how the concept is explained…

  7. Early Childhood Intervention: An Australian Perspective

    Science.gov (United States)

    Sukkar, Hanan

    2013-01-01

    This article uses the developmental systems approach, an approach developed by M. Guralnick (2001), with an aim to assess and evaluate early childhood intervention (ECI) practices in Australia. The author explores the Australian national context of ECI and its complexities and conclude with recommendations to address (a) the possibility of a…

  8. Australian clinical dosimetry service at ARPANSA

    International Nuclear Information System (INIS)

    McDonald, Abel; Williams, Ivan

    2010-01-01

    Full text: Earlier this year, the Australian Health Ministers' Advisory Council accepted the Federal Government's offer to fund the establishment and operation for 3 years of an Australian Clinical Dosimetry Service (ACDS). The service will be located within the Australian Radiation Protection and Nuclear Safety Agency in Yallambie, Victoria and will commence operation at the beginning of 20II. The purpose of the ACDS is to make available independent checks and auditing services to all Australian radiotherapy services. These services will range form postal audits to site visits, and include treatment dose assessments using phantoms (Level III audits). There will be a Clinical Advisory Group to oversee the development of the service, so the ACPSEM and other professional groups will playa key role in developing the ACDS. In consultation with radiotherapy facilities, the ACDS will establish an Audit Panel which will be made up of local staff to assist with on site work and minimise travel costs. The results of all measurements made by the ACDS will be confi dential: only de-identified data would be publicly reported. The service will be free to participating facilities in the first 3 years. An independent review will be conducted in the third year to determine the ongoing arrangements for the service.

  9. Pteropoda (Gastropoda, Euthecosomata) from the Australian Cainozoic

    NARCIS (Netherlands)

    Janssen, A.W.

    1989-01-01

    All Tertiary euthecosomatous gastropods from the Australian continent known to the author are described. The species introduced by Ralph Tate (1887) are revised. Altogether 18 species are discussed. A new genus, Spoelia, and five new species, viz. Limacina curryi, L. lunata, L. tatei, Spoelia

  10. Industrial Relations in Australian Tertiary Education.

    Science.gov (United States)

    Hancock, Keith

    1989-01-01

    A government official in industrial relations and former university administrator chronicles the emergence of unions in Australian universities and discusses the current state of academic trade unionism, focusing on the restructuring of the compensation system and the problems resulting from the process. (MSE)

  11. Religious Identity and Plurality amongst Australian Catholics ...

    African Journals Online (AJOL)

    In recent years, the Catholic Education Offices in the State of Victoria, Australia, have collaborated on a large research project with the Catholic University in Leuven that focuses on Catholic Identity. This is an interesting situation when there are, indeed, multiple Catholic identities evident in Australian society. This article ...

  12. Ethnicity and Gender in Australian Education.

    Science.gov (United States)

    Harvey, Jim

    The Australian education system is denying equity and social justice to ethnic minorities and women. This paper examines the development of Australia's educational policy for those two groups. It argues that the educational disadvantages they have experienced have been enhanced by the marginalization of the issues. Policies such as multicultural…

  13. Modeling peripheral olfactory coding in Drosophila larvae.

    Directory of Open Access Journals (Sweden)

    Derek J Hoare

    Full Text Available The Drosophila larva possesses just 21 unique and identifiable pairs of olfactory sensory neurons (OSNs, enabling investigation of the contribution of individual OSN classes to the peripheral olfactory code. We combined electrophysiological and computational modeling to explore the nature of the peripheral olfactory code in situ. We recorded firing responses of 19/21 OSNs to a panel of 19 odors. This was achieved by creating larvae expressing just one functioning class of odorant receptor, and hence OSN. Odor response profiles of each OSN class were highly specific and unique. However many OSN-odor pairs yielded variable responses, some of which were statistically indistinguishable from background activity. We used these electrophysiological data, incorporating both responses and spontaneous firing activity, to develop a bayesian decoding model of olfactory processing. The model was able to accurately predict odor identity from raw OSN responses; prediction accuracy ranged from 12%-77% (mean for all odors 45.2% but was always significantly above chance (5.6%. However, there was no correlation between prediction accuracy for a given odor and the strength of responses of wild-type larvae to the same odor in a behavioral assay. We also used the model to predict the ability of the code to discriminate between pairs of odors. Some of these predictions were supported in a behavioral discrimination (masking assay but others were not. We conclude that our model of the peripheral code represents basic features of odor detection and discrimination, yielding insights into the information available to higher processing structures in the brain.

  14. moleculares de insectos (Drosophila y de primates

    Directory of Open Access Journals (Sweden)

    Enio Hernández Aguirre

    2006-01-01

    Full Text Available La mayoría de las especies poseen un macho heterogamético XY y una hembra homogamética XX. En el macho XY sólo se conservan unas regiones donde se intercambian información entre el X y el Y (Xpter y Ypter durante la meiosis, que se le llama región seudoautosómica (RSA. Se ha planteado la hipótesis que el cromosoma Y se deriva del cromosoma X, y que antiguamente eran homólogos en toda su extensión. Un posible mecanismo biológico implicado en este proceso evolutivo son fragmentos de ADN que pueden moverse a través del genoma. En general se llaman elementos genéticos móviles. Con base en los elementos génicos móviles y en los genes de la cutícula larval (Lcp se han realizado estudios en los cromosomas sexuales de Drosophila melanogaster, D. Permisilis, D. Seudooscura y D. Miranda. Los análisis moleculares realizados en D. Miranda son una clara evidencia científica de cómo un evento de translocacion cromosómica asociados a procesos biológicos naturales y normales del ADN, como lo es la transposición, pudieron generar un cromosoma “Y” a través de la evolución, que en su forma prístina fue homólogo del cromosoma X.

  15. The Asian currency crisis and the Australian health industry.

    Science.gov (United States)

    Barraclough, S

    1998-01-01

    This article identifies linkages between the Australian health industry and the global economy. It discusses some of the consequences of the Asian currency crisis of 1997-98 for the Australian economy and health industry, with special emphasis upon exports. Devaluation of the Australian dollar will increase the cost of most pharmaceutical and medical imports, but may offer competitive advantages to some Australian exporters. The nascent engagement with Asia of many health industry enterprises is likely to be stifled. It is therefore important for Australian governments, as well as the Australian health industry, to provide intelligence and encouragement to those enterprises that wish to continue their engagement with Asia or resume it when economic equilibrium returns. Markets throughout the world must also be further developed. The crisis may therefore provide the stimulus for re-thinking and re-stating Australian health export policy.

  16. The mode of evolution of aggregation pheromones in Drosophila species

    NARCIS (Netherlands)

    Symonds, MRE; Wertheim, B

    Aggregation pheromones are used by fruit flies of the genus Drosophila to assemble on breeding substrates, where they feed, mate and oviposit communally. These pheromones consist of species-specific blends of chemicals. Here, using a phylogenetic framework, we examine how differences among species

  17. Comprehensive functional analysis of Rab GTPases in Drosophila nephrocytes.

    Science.gov (United States)

    Fu, Yulong; Zhu, Jun-Yi; Zhang, Fujian; Richman, Adam; Zhao, Zhanzheng; Han, Zhe

    2017-06-01

    The Drosophila nephrocyte is a critical component of the fly renal system and bears structural and functional homology to podocytes and proximal tubule cells of the mammalian kidney. Investigations of nephrocyte cell biological processes are fundamental to understanding the insect renal system. Nephrocytes are highly active in endocytosis and vesicle trafficking. Rab GTPases regulate endocytosis and trafficking but specific functions of nephrocyte Rabs remain undefined. We analyzed Rab GTPase expression and function in Drosophila nephrocytes and found that 11 out of 27 Drosophila Rabs were required for normal activity. Rabs 1, 5, 7, 11 and 35 were most important. Gene silencing of the nephrocyte-specific Rab5 eliminated all intracellular vesicles and the specialized plasma membrane structures essential for nephrocyte function. Rab7 silencing dramatically increased clear vacuoles and reduced lysosomes. Rab11 silencing increased lysosomes and reduced clear vacuoles. Our results suggest that Rab5 mediates endocytosis that is essential for the maintenance of functionally critical nephrocyte plasma membrane structures and that Rabs 7 and 11 mediate alternative downstream vesicle trafficking pathways leading to protein degradation and membrane recycling, respectively. Elucidating molecular pathways underlying nephrocyte function has the potential to yield important insights into human kidney cell physiology and mechanisms of cell injury that lead to disease. The Drosophila nephrocyte is emerging as a useful in vivo model system for molecular target identification and initial testing of therapeutic approaches in humans.

  18. Resources for Functional Genomics Studies in Drosophila melanogaster

    Science.gov (United States)

    Mohr, Stephanie E.; Hu, Yanhui; Kim, Kevin; Housden, Benjamin E.; Perrimon, Norbert

    2014-01-01

    Drosophila melanogaster has become a system of choice for functional genomic studies. Many resources, including online databases and software tools, are now available to support design or identification of relevant fly stocks and reagents or analysis and mining of existing functional genomic, transcriptomic, proteomic, etc. datasets. These include large community collections of fly stocks and plasmid clones, “meta” information sites like FlyBase and FlyMine, and an increasing number of more specialized reagents, databases, and online tools. Here, we introduce key resources useful to plan large-scale functional genomics studies in Drosophila and to analyze, integrate, and mine the results of those studies in ways that facilitate identification of highest-confidence results and generation of new hypotheses. We also discuss ways in which existing resources can be used and might be improved and suggest a few areas of future development that would further support large- and small-scale studies in Drosophila and facilitate use of Drosophila information by the research community more generally. PMID:24653003

  19. Multidimensional analysis of Drosophila wing variation in Evolution ...

    Indian Academy of Sciences (India)

    In this study, using Drosophila melanogaster isofemale lines derived from wild flies collected on both slopes of the canyon, we investigated the effect of developmental temperature upon the different components of phenotypic variation of a complex trait: the wing. Combining geometric and traditional morphometrics, we find ...

  20. A map of taste neuron projections in the Drosophila CNS

    Indian Academy of Sciences (India)

    We provide a map of the projections of taste neurons in the CNS of Drosophila. Using a collection of 67 GAL4 drivers representing the entire repertoire of Gr taste receptors, we systematically map the projections of neurons expressing these drivers in the thoracico-abdominal ganglion and the suboesophageal ganglion ...

  1. Investigating Biological Controls to Suppress Spotted Wing Drosophila Populations

    Science.gov (United States)

    The spotted wing drosophila has become a major cherry pest in California. To develop sustainable management options for this highly mobile pest, we worked with cooperators at Oregon State University and the USDA to discover and import natural enemies of the fly from its native range in South Korea ...

  2. Dynamical Analysis of bantam-Regulated Drosophila Circadian Rhythm Model

    Science.gov (United States)

    Li, Ying; Liu, Zengrong

    MicroRNAs (miRNAs) interact with 3‧untranslated region (UTR) elements of target genes to regulate mRNA stability or translation, and play a crucial role in regulating many different biological processes. bantam, a conserved miRNA, is involved in several functions, such as regulating Drosophila growth and circadian rhythm. Recently, it has been discovered that bantam plays a crucial role in the core circadian pacemaker. In this paper, based on experimental observations, a detailed dynamical model of bantam-regulated circadian clock system is developed to show the post-transcriptional behaviors in the modulation of Drosophila circadian rhythm, in which the regulation of bantam is incorporated into a classical model. The dynamical behaviors of the model are consistent with the experimental observations, which shows that bantam is an important regulator of Drosophila circadian rhythm. The sensitivity analysis of parameters demonstrates that with the regulation of bantam the system is more sensitive to perturbations, indicating that bantam regulation makes it easier for the organism to modulate its period against the environmental perturbations. The effectiveness in rescuing locomotor activity rhythms of mutated flies shows that bantam is necessary for strong and sustained rhythms. In addition, the biological mechanisms of bantam regulation are analyzed, which may help us more clearly understand Drosophila circadian rhythm regulated by other miRNAs.

  3. Species and genetic diversity in the genus Drosophila inhabiting the ...

    Indian Academy of Sciences (India)

    Genus Drosophila belongs to the family Drosophilidae (class Insecta, order Diptera), characterized by rich species diversity at global level and also in India, which is a megadiverse country. At global level, more than 1500 species have been described and several thousands estimated. Hawaiian Islands are particularly rich ...

  4. Is premating isolation in Drosophila overestimated due to ...

    Indian Academy of Sciences (India)

    ... give rise to statistically significant results in multiple-choice mating tests, leading to positive isolation values and the artifactual inference of sexual isolation between populations. This fact agrees with a nonrandom excess of significant positive tests found in a review of the literature of Drosophila intraspecific mating choice.

  5. Evolution of genes and genomes on the Drosophila phylogeny

    DEFF Research Database (Denmark)

    Clark, Andrew G; Eisen, Michael B; Smith, Douglas R

    2007-01-01

    Comparative analysis of multiple genomes in a phylogenetic framework dramatically improves the precision and sensitivity of evolutionary inference, producing more robust results than single-genome analyses can provide. The genomes of 12 Drosophila species, ten of which are presented here for the ...

  6. Fluctuation-Driven Neural Dynamics Reproduce Drosophila Locomotor Patterns.

    Directory of Open Access Journals (Sweden)

    Andrea Maesani

    2015-11-01

    Full Text Available The neural mechanisms determining the timing of even simple actions, such as when to walk or rest, are largely mysterious. One intriguing, but untested, hypothesis posits a role for ongoing activity fluctuations in neurons of central action selection circuits that drive animal behavior from moment to moment. To examine how fluctuating activity can contribute to action timing, we paired high-resolution measurements of freely walking Drosophila melanogaster with data-driven neural network modeling and dynamical systems analysis. We generated fluctuation-driven network models whose outputs-locomotor bouts-matched those measured from sensory-deprived Drosophila. From these models, we identified those that could also reproduce a second, unrelated dataset: the complex time-course of odor-evoked walking for genetically diverse Drosophila strains. Dynamical models that best reproduced both Drosophila basal and odor-evoked locomotor patterns exhibited specific characteristics. First, ongoing fluctuations were required. In a stochastic resonance-like manner, these fluctuations allowed neural activity to escape stable equilibria and to exceed a threshold for locomotion. Second, odor-induced shifts of equilibria in these models caused a depression in locomotor frequency following olfactory stimulation. Our models predict that activity fluctuations in action selection circuits cause behavioral output to more closely match sensory drive and may therefore enhance navigation in complex sensory environments. Together these data reveal how simple neural dynamics, when coupled with activity fluctuations, can give rise to complex patterns of animal behavior.

  7. Coexistence of three different Drosophila species by rescheduling ...

    Indian Academy of Sciences (India)

    We present evidence for coexistence of three different Drosophila species by rescheduling their life history traits in a natural population using the same resource, at the ... Genetics Laboratory, Department of Zoology, Banaras Hindu University, Varanasi 221 005, India; Department of Zoology, Institute of Basic Sciences, ...

  8. Drosophila phosphopantothenoylcysteine synthetase is required for tissue morphogenesis during oogenesis

    NARCIS (Netherlands)

    Bosveld, Floris; Rana, Anil; Lemstra - Wierenga, Willemina; Kampinga, Harm; Sibon, Ody

    2008-01-01

    Background: Coenzyme A (CoA) is an essential metabolite, synthesized from vitamin B5 by the subsequent action of five enzymes: PANK, PPCS, PPCDC, PPAT and DPCK. Mutations in Drosophila dPPCS disrupt female fecundity and in this study we analyzed the female sterile phenotype of dPPCS mutants in

  9. Odour avoidance learning in the larva of Drosophila melanogaster

    Indian Academy of Sciences (India)

    2008-12-11

    Dec 11, 2008 ... Drosophila larvae can be trained to avoid odours associated with electric shock. We describe here, an improved method of aversive conditioning and a procedure for decomposing learning retention curve that enables us to do a quantitative analysis of memory phases, short term (STM), middle term (MTM) ...

  10. Muscarinic ACh Receptors Contribute to Aversive Olfactory Learning in Drosophila.

    Science.gov (United States)

    Silva, Bryon; Molina-Fernández, Claudia; Ugalde, María Beatriz; Tognarelli, Eduardo I; Angel, Cristian; Campusano, Jorge M

    2015-01-01

    The most studied form of associative learning in Drosophila consists in pairing an odorant, the conditioned stimulus (CS), with an unconditioned stimulus (US). The timely arrival of the CS and US information to a specific Drosophila brain association region, the mushroom bodies (MB), can induce new olfactory memories. Thus, the MB is considered a coincidence detector. It has been shown that olfactory information is conveyed to the MB through cholinergic inputs that activate acetylcholine (ACh) receptors, while the US is encoded by biogenic amine (BA) systems. In recent years, we have advanced our understanding on the specific neural BA pathways and receptors involved in olfactory learning and memory. However, little information exists on the contribution of cholinergic receptors to this process. Here we evaluate for the first time the proposition that, as in mammals, muscarinic ACh receptors (mAChRs) contribute to memory formation in Drosophila. Our results show that pharmacological and genetic blockade of mAChRs in MB disrupts olfactory aversive memory in larvae. This effect is not explained by an alteration in the ability of animals to respond to odorants or to execute motor programs. These results show that mAChRs in MB contribute to generating olfactory memories in Drosophila.

  11. Limitations of the RAPD technique in phylogeny reconstruction in Drosophila

    NARCIS (Netherlands)

    van de Zande, Louis; Bijlsma, R.

    In this study the limitations of the RAPD technique for phylogenetic analysis of very closely related and less related species of Drosophila are examined. In addition, assumptions of positional homology of amplified fragments in different species are examined by cross-hybridization of RAPD

  12. Active sampling and decision making in Drosophila chemotaxis

    NARCIS (Netherlands)

    Gomez-Marin, Alex; Stephens, Greg J; Louis, Matthieu

    2011-01-01

    The ability to respond to chemical stimuli is fundamental to the survival of motile organisms, but the strategies underlying odour tracking remain poorly understood. Here we show that chemotaxis in Drosophila melanogaster larvae is an active sampling process analogous to sniffing in vertebrates.

  13. Gene structure of Drosophila diaphorase-1: diversity of transcripts in ...

    Indian Academy of Sciences (India)

    Moreover, we obtained only the third transcript (CG4199-RC) in the sample of testis from adult flies and the fourth transcript (CG4199-RD) in an embryo sample. None of the other five transcripts were found in the samples of different organs and in the samples obtained at different stages of Drosophila development.

  14. The Drosophila bipectinata species complex: degree of sterility and ...

    Indian Academy of Sciences (India)

    Genetica 140, 75–81. Banerjee P. and Singh B. N. 2015 Interspecific hybridization does not affect the level of fluctuating asymmetry (FA) in the. Drosophila bipectinata species complex. Genetica 143, 459–471. Barbash B. A., Awadalla P. and Parone A. M. 2004 Functional divergence caused by ancient positive selection of ...

  15. Odour avoidance learning in the larva of Drosophila melanogaster

    Indian Academy of Sciences (India)

    Prakash

    with electric shock in normal and mutant larvae and Tully et al. reported the passage of olfactory ... Drosophila larvae can be trained to avoid odours associated with electric shock. We describe here, an improved method of ..... Pairing odour with shock drives the larvae to the opposite zone. Preference learning index PLI.

  16. Gene structure of Drosophila diaphorase-1: diversity of transcripts in ...

    Indian Academy of Sciences (India)

    Drosophila culture. Adult D. melanogaster were maintained on a standard corn- meal/agar medium at 25. ◦. C. Embryos (2 h), larvae (third in- star), pupae (light and dark) were selected from mass cul- tures. The different organs (ovaries, testes and heads) were collected from adult flies. RT-PCR. The cDNA samples from ...

  17. Drosophila simulans Lethal hybrid rescue mutation (Lhr) rescues ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 86; Issue 3. Drosophila simulans Lethal hybrid rescue mutation (Lhr) rescues inviable hybrids by restoring X chromosomal dosage compensation and causes fluctuating asymmetry of development. R. N. Chatterjee P. Chatterjee A. Pal M. Pal-Bhadra. Research Article Volume 86 ...

  18. Immunohistological techniques for studying the Drosophila male germline stem cell.

    Science.gov (United States)

    Singh, Shree Ram; Hou, Steven X

    2008-01-01

    Stem cells are undifferentiated cells that have a remarkable ability to self-renew and produce differentiated cells that support normal development and tissue homeostasis. This unique capacity makes stem cells a powerful tool for future regenerative medicine and gene therapy. Accumulative evidence suggests that stem cell self-renewal or differentiation is controlled by both intrinsic and extrinsic factors, and that deregulation of stem cell behavior results in cancer formation, tissue degeneration, and premature aging. The Drosophila testis provides an excellent in vivo model for studying and understanding the fundamental cellular and molecular mechanisms controlling stem cell behavior and the relationship between niches and stem cells. At the tip of the Drosophila testes, germline stem cells (GSCs) and somatic stem cells (SSCs) contact each other and share common niches (known as a hub) to maintain spermatogenesis. Signaling pathways, such as the Janus kinase (JAK)/signal transducer and activator of transcription (STAT), bone morphogenetic protein (BMP), ras-associated protein-guanine nucleotide exchange factor for small GTPase (Rap-GEF), and epidermal growth factor receptor (EGFR)/mitogen-activated protein kinase (MAPK), are known to regulate self-renewal or differentiation of Drosophila male germline stem cells. We describe the detailed in vivo immunohistological protocols that mark GSCs, SSCs, and their progeny in Drosophila testes.

  19. Drosophila simulans Lethal hybrid rescue mutation (Lhr) rescues ...

    Indian Academy of Sciences (India)

    yellow (y), and (c) wild type strain of D. simulans (Califor- nia 0251.163 strain) were used for present investigation. Flies were raised on standard Drosophila food medium containing corn-meal – molasses – yeast – agar-agar. Propi- onic acid was added as a mold inhibitor. Adults and all de- velopmental stages were reared ...

  20. Coexistence of three different Drosophila species by rescheduling ...

    Indian Academy of Sciences (India)

    Unknown

    We present evidence for coexistence of three different Drosophila species by rescheduling their life history traits in a natural population using the same resource, at the same time and same place. D. ananassae has faster larval develop- ment time (DT) and faster DT(egg-fly) than other two species thus utilizing the ...

  1. Monitoring Drosophila suzukii Matsumura in Oregon, USA sweet cherry orchards.

    Science.gov (United States)

    Drosophila suzukii rapidly became a significant cherry pest in the western United States after it was observed damaging cherries in 2009 in California. It has caused significant damage to ripening cherries in all major USA cherry production districts leading to increased management costs and reduced...

  2. Ultradian rhythm unmasked in the Pdf clock mutant of Drosophila

    Indian Academy of Sciences (India)

    2014-07-20

    Jul 20, 2014 ... A diverse range of organisms shows physiological and behavioural rhythms with various periods. Extensive studies have been performed to elucidate the molecular mechanisms of circadian rhythms with an approximately 24 h period in both Drosophila and mammals, while less attention has been paid to ...

  3. Thermal phenotypic plasticity of body size in Drosophila ...

    Indian Academy of Sciences (India)

    Thermal phenotypic plasticity of body size in Drosophila melanogaster: sexual dimorphism and genetic correlations. Jean R. David Amir Yassin ... Thirty isofemale lines collected in three different years from the same wild French population were grown at seven different temperatures (12–31°C). Two linear measures, wing ...

  4. Ultradian rhythm unmasked in the Pdf clock mutant of Drosophila

    Indian Academy of Sciences (India)

    A diverse range of organisms shows physiological and behavioural rhythms with various periods. Extensive studies have been performed to elucidate the molecular mechanisms of circadian rhythms with an approximately 24 h period in both Drosophila and mammals, while less attention has been paid to ultradian rhythms ...

  5. is pupation height affected by circadian organization in Drosophila ...

    Indian Academy of Sciences (India)

    Unknown

    and reproduction related events that constitute the life- history of an .... of light are not perceived by the Drosophila circadian system. (Chandrashekaran et al. 1973) ..... J. Insect. Physiol. 13, 1547–1568. Rizki M. T. M. and Davis C. G. Jr. 1953 Light as an ecological determinant of interspecific competition between D. willistoni.

  6. DIRECT SELECTION ON LIFE-SPAN IN DROSOPHILA-MELANOGASTER

    NARCIS (Netherlands)

    ZWAAN, B; BIJLSMA, R; HOEKSTRA, RE

    An important issue in the study of the evolution of aging in Drosophila melanogaster is whether decreased early fecundity is inextricably coupled with increased life span in selection experiments on age at reproduction. Here, this problem has been tackled using an experimental design in which

  7. Genotype–environment interaction for total fitness in Drosophila

    Indian Academy of Sciences (India)

    2008-12-23

    Dec 23, 2008 ... A fundamental assumption of models for the maintenance of genetic variation by environmental heterogeneity is that selection favours different genotypes in different environments. Here, I use a method for measuring total fitness of chromosomal heterozygotes in Drosophila melanogaster to assess ...

  8. Metabolic Activity of Radish Sprouts Derived Isothiocyanates in Drosophila melanogaster

    Science.gov (United States)

    Baenas, Nieves; Piegholdt, Stefanie; Schloesser, Anke; Moreno, Diego A.; García-Viguera, Cristina; Rimbach, Gerald; Wagner, Anika E.

    2016-01-01

    We used Drosophila melanogaster as a model system to study the absorption, metabolism and potential health benefits of plant bioactives derived from radish sprouts (Raphanus sativus cv. Rambo), a Brassicaceae species rich in glucosinolates and other phytochemicals. Flies were subjected to a diet supplemented with lyophilized radish sprouts (10.6 g/L) for 10 days, containing high amounts of glucoraphenin and glucoraphasatin, which can be hydrolyzed by myrosinase to the isothiocyanates sulforaphene and raphasatin, respectively. We demonstrate that Drosophila melanogaster takes up and metabolizes isothiocyanates from radish sprouts through the detection of the metabolite sulforaphane-cysteine in fly homogenates. Moreover, we report a decrease in the glucose content of flies, an upregulation of spargel expression, the Drosophila homolog of the mammalian PPARγ-coactivator 1 α, as well as the inhibition of α-amylase and α-glucosidase in vitro. Overall, we show that the consumption of radish sprouts affects energy metabolism in Drosophila melanogaster which is reflected by lower glucose levels and an increased expression of spargel, a central player in mitochondrial biogenesis. These processes are often affected in chronic diseases associated with aging, including type II diabetes mellitus. PMID:26901196

  9. Genetic Analysis of Micro-environmental Plasticity in Drosophila melanogaster

    DEFF Research Database (Denmark)

    Morgante, Fabio; Sorensen, Daniel A; Sørensen, Peter

    be genetically variable. This study utilized the Drosophila Genetic Reference Panel (DGRP) to accurately estimate the genetic variance of micro-environmental plasticity for chill coma recovery time and startle response. Estimates of broad sense heritabilities for both traits are substantial (from 0.51 to 0...

  10. Modern aspects of Drosophila melanogaster radiobiology. Apoptosis and aging

    International Nuclear Information System (INIS)

    Zajnulin, V.G.; Moskalev, A.A.; Shaposhnikov, M.V.; Taskaev, A.I.

    1999-01-01

    An attempt is made to explain the radioinduced change in life span of multicell organisms by deregulation of apoptosis processes. Radiation capacity to induce the apoptosis is shown in Drosophila as well. Assumption is made that radiation changes the rate of natural organism aging deregulating the control of apoptosis mechanisms [ru

  11. Nearly Neutral Evolution Across the Drosophila melanogaster Genome

    DEFF Research Database (Denmark)

    Esteve, David Castellano; James, Jennifer; Eyre-Walker, Adam

    2017-01-01

    Under the nearly neutral theory of molecular evolution the proportion of effectively neutral mutations is expected to depend upon the effective population size (Ne). Here we investigate whether this is the case across the genome of Drosophila melanogaster using polymorphism data from 128 North...

  12. P element excision in drosophila melanogaster and related drosophilids

    Science.gov (United States)

    The frequency of P element excision and the structure of the resulting excision products were determined in three drosophilid species, Drosophila melanogaster, D. virilis, and Chymomyza procnemis. A transient P element mobility assay was conducted in the cells of developing insect embryos, but unlik...

  13. mutations of Drosophila melanogaster cause nonrandom cell death ...

    Indian Academy of Sciences (India)

    In Drosophila melanogaster, the intersex (ix) is a terminally positioned gene in somatic sex determination hierarchy and function with the female specific product of double sex (DSXF) to implement female sexual differentiation. The null phenotype of ix is to transform diplo-X individuals into intersexes while leaving haplo-X ...

  14. Handling Alters Aggression and "Loser" Effect Formation in "Drosophila Melanogaster"

    Science.gov (United States)

    Trannoy, Severine; Chowdhury, Budhaditya; Kravitz, Edward A.

    2015-01-01

    In "Drosophila," prior fighting experience influences the outcome of later contests: losing a fight increases the probability of losing second contests, thereby revealing "loser" effects that involve learning and memory. In these experiments, to generate and quantify the behavioral changes observed as consequences of losing…

  15. The metabolic profile of long-lived Drosophila melanogaster

    DEFF Research Database (Denmark)

    Sarup, Pernille Merete; Pedersen, Simon Metz Mariendal; Nielsen, Niels Chr

    2012-01-01

    We investigated the age-related changes in the metabolic profile of male Drosophila melanogaster and compared the metabolic profile of flies selected for increased longevity to that of control flies of equal age. We found clear differences in metabolite composition between selection regimes...

  16. Inbreeding affects locomotor activity in Drosophila melanogaster at different ages

    DEFF Research Database (Denmark)

    Manenti, Tommaso; Pertoldi, Cino; Nasiri Moghadam, Neda

    2015-01-01

    The ability to move is essential for many behavioural traits closely related to fitness. Here we studied the effect of inbreeding on locomotor activity (LA) of Drosophila melanogaster at different ages under both dark and light regimes. We expected to find a decreased LA in inbred lines compared...

  17. Characterization of reproductive dormancy in male Drosophila melanogaster

    Czech Academy of Sciences Publication Activity Database

    Kubrak, O. I.; Kučerová, Lucie; Theopold, U.; Nylin, S.; Nässel, D. R.

    2016-01-01

    Roč. 7, NOV 24 (2016), č. článku 572. ISSN 1664-042X Institutional support: RVO:60077344 Keywords : Drosophila melanogaster * diapause * reproduction Subject RIV: ED - Physiology Impact factor: 4.134, year: 2016 http://journal.frontiersin.org/article/10.3389/fphys.2016.00572/full

  18. Late replication domains are evolutionary conserved in the Drosophila genome.

    Science.gov (United States)

    Andreyenkova, Natalya G; Kolesnikova, Tatyana D; Makunin, Igor V; Pokholkova, Galina V; Boldyreva, Lidiya V; Zykova, Tatyana Yu; Zhimulev, Igor F; Belyaeva, Elena S

    2013-01-01

    Drosophila chromosomes are organized into distinct domains differing in their predominant chromatin composition, replication timing and evolutionary conservation. We show on a genome-wide level that genes whose order has remained unaltered across 9 Drosophila species display late replication timing and frequently map to the regions of repressive chromatin. This observation is consistent with the existence of extensive domains of repressive chromatin that replicate extremely late and have conserved gene order in the Drosophila genome. We suggest that such repressive chromatin domains correspond to a handful of regions that complete replication at the very end of S phase. We further demonstrate that the order of genes in these regions is rarely altered in evolution. Substantial proportion of such regions significantly coincide with large synteny blocks. This indicates that there are evolutionary mechanisms maintaining the integrity of these late-replicating chromatin domains. The synteny blocks corresponding to the extremely late-replicating regions in the D. melanogaster genome consistently display two-fold lower gene density across different Drosophila species.

  19. Dosage compensation and demasculinization of X chromosomes in Drosophila.

    Science.gov (United States)

    Bachtrog, Doris; Toda, Nicholas R T; Lockton, Steven

    2010-08-24

    The X chromosome of Drosophila shows a deficiency of genes with male-biased expression, whereas mammalian X chromosomes are enriched for spermatogenesis genes expressed premeiosis and multicopy testis genes. Meiotic X-inactivation and sexual antagonism can only partly account for these patterns. Here, we show that dosage compensation (DC) in Drosophila may contribute substantially to the depletion of male genes on the X. To equalize expression between X-linked and autosomal genes in the two sexes, male Drosophila hypertranscribe their single X, whereas female mammals silence one of their two X chromosomes. We combine fine-scale mapping data of dosage compensated regions with genome-wide expression profiles and show that most male-biased genes on the D. melanogaster X are located outside dosage compensated regions. Additionally, X-linked genes that have newly acquired male-biased expression in D. melanogaster are less likely to be dosage compensated, and parental X-linked genes that gave rise to an autosomal male-biased retrocopy are more likely located within compensated regions. This suggests that DC contributes to the observed demasculinization of X chromosomes in Drosophila, both by limiting the emergence of male-biased expression patterns of existing X genes, and by contributing to gene trafficking of male genes off the X. Copyright 2010 Elsevier Ltd. All rights reserved.

  20. Gene structure of Drosophila diaphorase-1: diversity of transcripts in ...

    Indian Academy of Sciences (India)

    [Ivanova P. M., Dunkov B. H. and Ralchev K. H. 2008 Gene structure of Drosophila diaphorase-1: diversity of transcripts in adult males and females, in different ... ditions, close to 60 kD, indicating a monomeric structure. (Ralchev et al. .... Diversity in the exon–intron organization of diaphorase-1 gene. The six transcripts with ...

  1. Species and genetic diversity in the genus Drosophila inhabiting the ...

    Indian Academy of Sciences (India)

    These species are D. ananassae, D. melanogaster,. D. bipectinata, D. nasuta and a few others. The work done was with particular reference to inversion and allozyme poly- morphisms and .... species diversity, the scenario of Drosophila research is not ..... vary in their susceptibility to starvation owing to the differ- ence in ...

  2. Status of research on Drosophila ananassae at global level

    Indian Academy of Sciences (India)

    Extensive research work on D. ananassae has been done by numerous researchers per- taining to ... Also, the polytene chromosomes of. Keywords. genetic peculiarities; status of research; global level; Drosophila ananassae. Journal of Genetics, Vol. 94, No. ..... starvation because of difference in their propensity to store.

  3. Ultradian rhythm unmasked in the Pdf clock mutant of Drosophila

    Indian Academy of Sciences (India)

    ... kept under constant dark conditions. In particular, the Pigment-dispersing factor mutant (Pdf01) demonstrated a precise and robust ultradian rhythmicity, which was not temperature compensated. Our results suggest that Drosophila has an endogenous ultradian oscillator that is masked by circadian rhythmic behaviours.

  4. The route of infection determines Wolbachia antibacterial protection in Drosophila

    Science.gov (United States)

    Gupta, Vanika; Vasanthakrishnan, Radhakrishnan B.; Siva-Jothy, Jonathon; Monteith, Katy M.; Brown, Sam P.

    2017-01-01

    Bacterial symbionts are widespread among metazoans and provide a range of beneficial functions. Wolbachia-mediated protection against viral infection has been extensively demonstrated in Drosophila. In mosquitoes that are artificially transinfected with Drosophila melanogaster Wolbachia (wMel), protection from both viral and bacterial infections has been demonstrated. However, no evidence for Wolbachia-mediated antibacterial protection has been demonstrated in Drosophila to date. Here, we show that the route of infection is key for Wolbachia-mediated antibacterial protection. Drosophila melanogaster carrying Wolbachia showed reduced mortality during enteric—but not systemic—infection with the opportunist pathogen Pseudomonas aeruginosa. Wolbachia-mediated protection was more pronounced in male flies and is associated with increased early expression of the antimicrobial peptide Attacin A, and also increased expression of a reactive oxygen species detoxification gene (Gst D8). These results highlight that the route of infection is important for symbiont-mediated protection from infection, that Wolbachia can protect hosts by eliciting a combination of resistance and disease tolerance mechanisms, and that these effects are sexually dimorphic. We discuss the importance of using ecologically relevant routes of infection to gain a better understanding of symbiont-mediated protection. PMID:28592678

  5. Thermal phenotypic plasticity of body size in Drosophila ...

    Indian Academy of Sciences (India)

    ... body size in Drosophila melanogaster: sexual dimorphism and genetic correlations. Jean R. David, Amir Yassin, Jean-Claude Moreteau, Helene Legout and Brigitte Moreteau. J. Genet. 90, 295–302. Table 1. Correlations between wing and thorax length at the within (n = 420) and between line level (n = 30). Temperature.

  6. Tandem Duplications and the Limits of Natural Selection in Drosophila yakuba and Drosophila simulans.

    Directory of Open Access Journals (Sweden)

    Rebekah L Rogers

    Full Text Available Tandem duplications are an essential source of genetic novelty, and their variation in natural populations is expected to influence adaptive walks. Here, we describe evolutionary impacts of recently-derived, segregating tandem duplications in Drosophila yakuba and Drosophila simulans. We observe an excess of duplicated genes involved in defense against pathogens, insecticide resistance, chorion development, cuticular peptides, and lipases or endopeptidases associated with the accessory glands across both species. The observed agreement is greater than expectations on chance alone, suggesting large amounts of convergence across functional categories. We document evidence of widespread selection on the D. simulans X, suggesting adaptation through duplication is common on the X. Despite the evidence for positive selection, duplicates display an excess of low frequency variants consistent with largely detrimental impacts, limiting the variation that can effectively facilitate adaptation. Standing variation for tandem duplications spans less than 25% of the genome in D. yakuba and D. simulans, indicating that evolution will be strictly limited by mutation, even in organisms with large population sizes. Effective whole gene duplication rates are low at 1.17 × 10-9 per gene per generation in D. yakuba and 6.03 × 10-10 per gene per generation in D. simulans, suggesting long wait times for new mutations on the order of thousands of years for the establishment of sweeps. Hence, in cases where adaptation depends on individual tandem duplications, evolution will be severely limited by mutation. We observe low levels of parallel recruitment of the same duplicated gene in different species, suggesting that the span of standing variation will define evolutionary outcomes in spite of convergence across gene ontologies consistent with rapidly evolving phenotypes.

  7. Erythritol and Lufenuron detrimentally alter age structure of Wild Spotted Wing Drosophila (SWD) Drosophila suzukii (Diptera: Drosophilidae) populations in blueberry and blackberry

    Science.gov (United States)

    We report on the efficacy of 0.5 M (61,000 ppm) Erythritol (E) in Truvia Baking Blend®, 10 ppm Lufenuron (L), and their combination (LE) to reduce egg and larval densities of wild populations of spotted wing Drosophila, Drosophila suzukii (Matsumura) (SWD) infesting fields of rabbiteye blueberries (...

  8. Image tracking study on courtship behavior of Drosophila.

    Directory of Open Access Journals (Sweden)

    Hung-Yin Tsai

    Full Text Available BACKGROUND: In recent years, there have been extensive studies aimed at decoding the DNA. Identifying the genetic cause of specific changes in a simple organism like Drosophila may help scientists recognize how multiple gene interactions may make some people more susceptible to heart disease or cancer. Investigators have devised experiments to observe changes in the gene networks in mutant Drosophila that responds differently to light, or have lower or higher locomotor activity. However, these studies focused on the behavior of the individual fly or on pair-wise interactions in the study of aggression or courtship. The behavior of these activities has been captured on film and inspected by a well-trained researcher after repeatedly watching the recorded film. Some studies also focused on ways to reduce the inspection time and increase the accuracy of the behavior experiment. METHODOLOGY: In this study, the behavior of drosophila during courtship was analyzed automatically by machine vision. We investigated the position and behavior discrimination during courtship using the captured images. Identification of the characteristics of drosophila, including sex, size, heading direction, and wing angles, can be computed using image analysis techniques that employ the Gaussian mixture model. The behavior of multiple drosophilae can also be analyzed simultaneously using the motion-prediction model and the variation constraint of heading direction. CONCLUSIONS: The overlapped fruit flies can be identified based on the relationship between body centers. Moreover, the behaviors and profiles can be correctly recognized by image processing based on the constraints of the wing angle and the size of the body. Therefore, the behavior of the male fruit flies can be discriminated when two or three fruit flies form a close cluster. In this study, the courtship behavior, including wing songs and attempts, can currently be distinguished with accuracies of 95.8% and

  9. Positive and purifying selection on the Drosophila Y chromosome.

    Science.gov (United States)

    Singh, Nadia D; Koerich, Leonardo B; Carvalho, Antonio Bernardo; Clark, Andrew G

    2014-10-01

    Y chromosomes, with their reduced effective population size, lack of recombination, and male-limited transmission, present a unique collection of constraints for the operation of natural selection. Male-limited transmission may greatly increase the efficacy of selection for male-beneficial mutations, but the reduced effective size also inflates the role of random genetic drift. Together, these defining features of the Y chromosome are expected to influence rates and patterns of molecular evolution on the Y as compared with X-linked or autosomal loci. Here, we use sequence data from 11 genes in 9 Drosophila species to gain insight into the efficacy of natural selection on the Drosophila Y relative to the rest of the genome. Drosophila is an ideal system for assessing the consequences of Y-linkage for molecular evolution in part because the gene content of Drosophila Y chromosomes is highly dynamic, with orthologous genes being Y-linked in some species whereas autosomal in others. Our results confirm the expectation that the efficacy of natural selection at weakly selected sites is reduced on the Y chromosome. In contrast, purifying selection on the Y chromosome for strongly deleterious mutations does not appear to be compromised. Finally, we find evidence of recurrent positive selection for 4 of the 11 genes studied here. Our results thus highlight the variable nature of the mode and impact of natural selection on the Drosophila Y chromosome. © The Author 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  10. Cellular and developmental adaptations to hypoxia: a Drosophila perspective.

    Science.gov (United States)

    Romero, Nuria Magdalena; Dekanty, Andrés; Wappner, Pablo

    2007-01-01

    The fruit fly Drosophila melanogaster, a widely utilized genetic model, is highly resistant to oxygen starvation and is beginning to be used for studying physiological, developmental, and cellular adaptations to hypoxia. The Drosophila respiratory (tracheal) system has features in common with the mammalian circulatory system so that an angiogenesis-like response occurs upon exposure of Drosophila larvae to hypoxia. A hypoxia-responsive system homologous to mammalian hypoxia-inducible factor (HIF) has been described in the fruit fly, where Fatiga is a Drosophila oxygen-dependent HIF prolyl hydroxylase, and the basic helix-loop-helix Per/ARNT/Sim (bHLH-PAS) proteins Sima and Tango are, respectively, the Drosophila homologues of mammalian HIF-alpha (alpha) and HIF-beta (beta). Tango is constitutively expressed regardless of oxygen tension and, like in mammalian cells, Sima is controlled at the level of protein degradation and subcellular localization. Sima is critically required for development in hypoxia, but, unlike mammalian model systems, it is dispensable for development in normoxia. In contrast, fatiga mutant alleles are all lethal; however, strikingly, viability to adulthood is restored in fatiga sima double mutants, although these double mutants are not entirely normal, suggesting that Fatiga has Sima-independent functions in fly development. Studies in cell culture and in vivo have revealed that Sima is activated by the insulin receptor (InR) and target-of-rapamycin (TOR) pathways. Paradoxically, Sima is a negative regulator of growth. This suggests that Sima is engaged in a negative feedback loop that limits growth upon stimulation of InR/TOR pathways.

  11. Crowd control: sex ratio affects sexually selected cuticular hydrocarbons in male Drosophila serrata.

    Science.gov (United States)

    Gershman, S N; Rundle, H D

    2017-03-01

    Although it is advantageous for males to express costly sexually selected signals when females are present, they may also benefit from suppressing these signals to avoid costly interactions with rival males. Cuticular chemical profiles frequently function as insect sexual signals; however, few studies have asked whether males alter these signals in response to their social environment. In Drosophila serrata, an Australian fly, there is sexual selection for a multivariate combination of male cuticular hydrocarbons (CHCs). Here, we show that the ratio of females to males that an adult male experiences has a strong effect on his CHC expression, with female-biased adult sex ratios eliciting greater expression of CHC profiles associated with higher male mating success. Classical models predict that male reproductive investment should be highest when there is a small but nonzero number of rivals, but we found that males expressed the most attractive combination of CHCs when there were no rivals. We found that male CHCs were highly sensitive to adult sex ratio, with males expressing higher values of CHC profiles associated with greater mating success as the ratio of females to males increased. Moreover, sex ratio has a stronger effect on male CHC expression than adult density. Finally, we explore whether sex ratio affects the variance among a group of males in their CHC expression, as might be expected if individuals respond differently to a given social environment, but find little effect. Our results reveal that subtle differences in social environment can induce plasticity in male chemical signal expression. © 2016 European Society For Evolutionary Biology. Journal of Evolutionary Biology © 2016 European Society For Evolutionary Biology.

  12. Effect of sterol metabolism in the yeast-Drosophila system on the frequency of radiation-induced aneuploidy in the Drosophila melanogaster oocytes

    International Nuclear Information System (INIS)

    Savitskii, V.V.; Luchnikova, E.M.; Inge-Vechtomov, S.G.

    1986-01-01

    The effect of sterol metabolism on induced mutagenesis of Drosophila melanogaster was studied in the ecogenetic system of yeast-Drosophila. Sterol deficiency was created in Drosophila by using the biomass of live cells of Saccharomyces cerevisiae strain 9-2-P712 till mutation in locus nys/sup r1/ blocking the synthesis of ergosterol as the food. It was found that rearing of Drosophila females on the mutant yeast increases the frequency of loss and nondisjunction of X chromosomes induced in mature oocytes by X rays (1000 R). Addition of 0.1% of cholesterol solution in 10% ethanol to the yeast biomass restores the resistance of oocyte to X irradiation to the control level. The possible hormonal effect on membrane leading to increased radiation-induced aneuploidy in Drosophila and the role of sterol metabolism in determining the resistance to various damaging factors are discussed

  13. Asymmetrical reinforcement and Wolbachia infection in Drosophila.

    Directory of Open Access Journals (Sweden)

    John Jaenike

    2006-10-01

    Full Text Available Reinforcement refers to the evolution of increased mating discrimination against heterospecific individuals in zones of geographic overlap and can be considered a final stage in the speciation process. One the factors that may affect reinforcement is the degree to which hybrid matings result in the permanent loss of genes from a species' gene pool. Matings between females of Drosophila subquinaria and males of D. recens result in high levels of offspring mortality, due to interspecific cytoplasmic incompatibility caused by Wolbachia infection of D. recens. Such hybrid inviability is not manifested in matings between D. recens females and D. subquinaria males. Here we ask whether the asymmetrical hybrid inviability is associated with a corresponding asymmetry in the level of reinforcement. The geographic ranges of D. recens and D. subquinaria were found to overlap across a broad belt of boreal forest in central Canada. Females of D. subquinaria from the zone of sympatry exhibit much stronger levels of discrimination against males of D. recens than do females from allopatric populations. In contrast, such reproductive character displacement is not evident in D. recens, consistent with the expected effects of unidirectional cytoplasmic incompatibility. Furthermore, there is substantial behavioral isolation within D. subquinaria, because females from populations sympatric with D. recens discriminate against allopatric conspecific males, whereas females from populations allopatric with D. recens show no discrimination against any conspecific males. Patterns of general genetic differentiation among populations are not consistent with patterns of behavioral discrimination, which suggests that the behavioral isolation within D. subquinaria results from selection against mating with Wolbachia-infected D. recens. Interspecific cytoplasmic incompatibility may contribute not only to post-mating isolation, an effect already widely recognized, but also to

  14. System identification of Drosophila olfactory sensory neurons.

    Science.gov (United States)

    Kim, Anmo J; Lazar, Aurel A; Slutskiy, Yevgeniy B

    2011-02-01

    The lack of a deeper understanding of how olfactory sensory neurons (OSNs) encode odors has hindered the progress in understanding the olfactory signal processing in higher brain centers. Here we employ methods of system identification to investigate the encoding of time-varying odor stimuli and their representation for further processing in the spike domain by Drosophila OSNs. In order to apply system identification techniques, we built a novel low-turbulence odor delivery system that allowed us to deliver airborne stimuli in a precise and reproducible fashion. The system provides a 1% tolerance in stimulus reproducibility and an exact control of odor concentration and concentration gradient on a millisecond time scale. Using this novel setup, we recorded and analyzed the in-vivo response of OSNs to a wide range of time-varying odor waveforms. We report for the first time that across trials the response of OR59b OSNs is very precise and reproducible. Further, we empirically show that the response of an OSN depends not only on the concentration, but also on the rate of change of the odor concentration. Moreover, we demonstrate that a two-dimensional (2D) Encoding Manifold in a concentration-concentration gradient space provides a quantitative description of the neuron's response. We then use the white noise system identification methodology to construct one-dimensional (1D) and two-dimensional (2D) Linear-Nonlinear-Poisson (LNP) cascade models of the sensory neuron for a fixed mean odor concentration and fixed contrast. We show that in terms of predicting the intensity rate of the spike train, the 2D LNP model performs on par with the 1D LNP model, with a root mean-square error (RMSE) increase of about 5 to 10%. Surprisingly, we find that for a fixed contrast of the white noise odor waveforms, the nonlinear block of each of the two models changes with the mean input concentration. The shape of the nonlinearities of both the 1D and the 2D LNP model appears to be

  15. Accelerators for the Australian environment and heritage

    International Nuclear Information System (INIS)

    Tuniz, C.

    1999-01-01

    Australian researchers have access to a variety of natural systems where records of the Earth's past environment have been stored. These archives include sediment cores, Antarctic ice, Tasmanian pine trees, rock surfaces, corals, etc. Each of these media contain information on past environmental conditions but the records must be carefully deciphered and compared with one-another. The AMS analysis of long-lived cosmogenic radionuclides is essential for providing absolute time scales for these natural archives. Other analytical methods based on high-energy ion interactions are well suited to characterise environmental and archaeological samples with high sensitivity. The use of ANSTO's accelerators in research programs related to the environment in the Australian region is reviewed

  16. Decolonising Australian Psychology: Discourses, Strategies, and Practice

    Directory of Open Access Journals (Sweden)

    Pat Dudgeon

    2015-08-01

    Full Text Available Colonisation in Australia has had a devastating and lasting impact on the wellbeing of Aboriginal and Torres Strait Islander peoples in Australia (herein referred to as Indigenous Australians. This paper discusses the role of psychology in Australia and the negative impact that certain disciplinary theories and practices have had on Indigenous Australians. The impact has been further exacerbated by the failure of mainstream policy makers and mental health practitioners to recognise the key, distinctive cultural and social determinants that contribute to Aboriginal health and wellbeing. There is a growing response by Aboriginal psychologists, critical social theorists, and their allies to decolonise psychological theory and practice to redress this situation. This paper outlines key decolonising strategies that have been effective in interrupting those aspects of psychology that are inimical to Aboriginal wellbeing.

  17. A genomic investigation of ecological differentiation between free-living and Drosophila-associated bacteria.

    Science.gov (United States)

    Winans, Nathan J; Walter, Alec; Chouaia, Bessem; Chaston, John M; Douglas, Angela E; Newell, Peter D

    2017-09-01

    Various bacterial taxa have been identified both in association with animals and in the external environment, but the extent to which related bacteria from the two habitat types are ecologically and evolutionarily distinct is largely unknown. This study investigated the scale and pattern of genetic differentiation between bacteria of the family Acetobacteraceae isolated from the guts of Drosophila fruit flies, plant material and industrial fermentations. Genome-scale analysis of the phylogenetic relationships and predicted functions was conducted on 44 Acetobacteraceae isolates, including newly sequenced genomes from 18 isolates from wild and laboratory Drosophila. Isolates from the external environment and Drosophila could not be assigned to distinct phylogenetic groups, nor are their genomes enriched for any different sets of genes or category of predicted gene functions. In contrast, analysis of bacteria from laboratory Drosophila showed they were genetically distinct in their universal capacity to degrade uric acid (a major nitrogenous waste product of Drosophila) and absence of flagellar motility, while these traits vary among wild Drosophila isolates. Analysis of the competitive fitness of Acetobacter discordant for these traits revealed a significant fitness deficit for bacteria that cannot degrade uric acid in culture with Drosophila. We propose that, for wild populations, frequent cycling of Acetobacter between Drosophila and the external environment prevents genetic differentiation by maintaining selection for traits adaptive in both the gut and external habitats. However, laboratory isolates bear the signs of adaptation to persistent association with the Drosophila host under tightly defined environmental conditions. © 2017 John Wiley & Sons Ltd.

  18. Environmental and facility conditions promote singular gravity responses of transcriptome during Drosophila metamorphosis

    Data.gov (United States)

    National Aeronautics and Space Administration — Genome-wide transcriptional profiling showed that reducing gravity levels in the International Space Station (ISS) causes important alterations in Drosophila gene...

  19. Exploring the professional values of Australian physiotherapists.

    Science.gov (United States)

    Aguilar, Alejandra; Stupans, Ieva; Scutter, Sheila; King, Sharron

    2013-03-01

    A profession's values guide daily practice and professional behaviours. They clarify what professionalism means to a profession, by providing insight into the values that members of the profession aim to uphold and profess. There has been limited research into the values of the Australian physiotherapy profession, and as such, the values that guide practice and constitute professionalism are not explicit. This study aimed to make a preliminary identification of the values of the profession, by exploring the shared professional values of 14 Australian physiotherapists. This study was guided by a qualitative approach and constructivist paradigm. Purposive sampling was employed to identify physiotherapists who could contribute rich information to the study. Semi-structured interviews were conducted and analysed using an inductive data analysis method. The emerging professional values formed three main themes. The first theme, 'the patient and the patient-therapist partnership', incorporated values such as having patient trust and working collaboratively with patients. The theme labelled 'physiotherapy knowledge, skills and practice' included the values of having an evidence base and respecting professional boundaries. The last theme, 'altruistic values', was inclusive of values such as honesty, empathy and caring. The values that emerged went beyond philanthropic values, to values that guided every day practice, professional relationships and the responsibilities of being a professional. The results contribute to research orientated towards identifying the values of the profession and in doing so, clarifying what professionalism means to the Australian physiotherapy profession. Differences between the values identified by the American Physical Therapy Association and the study reported in this paper highlight the importance of identifying the values of the profession within the Australian context. In terms of practice implications, physiotherapists may be prompted to

  20. Dendroclimatological potential of the Australian red cedar

    OpenAIRE

    Heinrich, Ingo; Banks, J. C. G.

    2005-01-01

    We examined Toona ciliata M.Roemer (Australian red cedar) for its potential to deliver annually resolved tree-ring proxy data. Such proxies are valuable and sought-after sources for reconstructing climate beyond instrumental records, especially in Australia. T. ciliata was chosen because it is one of the few deciduous tree species in Australia experiencing a seasonally dormant period of the cambium. This was confirmed by a preliminary tree-ring analysis which revealed distinct growth rings. B...

  1. Farming fit? Dispelling the Australian agrarian myth

    Directory of Open Access Journals (Sweden)

    McCoombe Scott

    2011-03-01

    Full Text Available Abstract Background Rural Australians face a higher mental health and lifestyle disease burden (obesity, diabetes and cardiovascular disease than their urban counterparts. Our ongoing research reveals that the Australian farming community has even poorer physical and mental health outcomes than rural averages. In particular, farm men and women have high rates of overweightness, obesity, abdominal adiposity, high blood pressure and psychological distress when compared against Australian averages. Within our farming cohort we observed a significant association between psychological distress and obesity, abdominal adiposity and body fat percentage in the farming population. Presentation of hypothesis This paper presents a hypothesis based on preliminary data obtained from an ongoing study that could potentially explain the complex correlation between obesity, psychological distress and physical activity among a farming population. We posit that spasmodic physical activity, changing farm practices and climate variability induce prolonged stress in farmers. This increases systemic cortisol that, in turn, promotes abdominal adiposity and weight gain. Testing the hypothesis The hypothesis will be tested by anthropometric, biochemical and psychological analysis matched against systemic cortisol levels and the physical activity of the subjects. Implications of the hypothesis tested Previous studies indicate that farming populations have elevated rates of psychological distress and high rates of suicide. Australian farmers have recently experienced challenging climatic conditions including prolonged drought, floods and cyclones. Through our interactions and through the media it is not uncommon for farmers to describe the effect of this long-term stress with feelings of 'defeat'. By gaining a greater understanding of the role cortisol and physical activity have on mental and physical health we may positively impact the current rates of psychological

  2. Do Momentum Strategies Work?: - Australian Evidence

    OpenAIRE

    Michael E. Drew; Madhu Veeraraghavan; Min Ye

    2004-01-01

    This paper investigates the profitability of momentum investment strategy and the predictive power of trading volume for equities listed in the Australian Stock Exchange. Recent research finds that momentum and trading volume appear to predict subsequent returns in U.S. market and past volume helps to reconcile intermediate-horizon “under reaction” and long-horizon “overreaction” effects. However, bulk of the evidence on this important relationship between past returns and future returns is l...

  3. Occupational heat stress in Australian workplaces

    OpenAIRE

    Jay, Ollie; Brotherhood, John R.

    2016-01-01

    ABSTRACT The aim of this review was to summarize the current state of knowledge on heat stress risk within typical Australian occupational settings. We assessed identified occupations (mining, agriculture, construction, emergency services) for heat production and heat loss potential, and resultant levels of physiological heat strain. A total of 29 reports were identified that assessed in-situ work settings in Northern Territory, South Australia, Western Australia, Queensland, New South Wales ...

  4. Benchmarking management practices in Australian public healthcare.

    Science.gov (United States)

    Agarwal, Renu; Green, Roy; Agarwal, Neeru; Randhawa, Krithika

    2016-01-01

    The purpose of this paper is to investigate the quality of management practices of public hospitals in the Australian healthcare system, specifically those in the state-managed health systems of Queensland and New South Wales (NSW). Further, the authors assess the management practices of Queensland and NSW public hospitals jointly and globally benchmark against those in the health systems of seven other countries, namely, USA, UK, Sweden, France, Germany, Italy and Canada. In this study, the authors adapt the unique and globally deployed Bloom et al. (2009) survey instrument that uses a "double blind, double scored" methodology and an interview-based scoring grid to measure and internationally benchmark the management practices in Queensland and NSW public hospitals based on 21 management dimensions across four broad areas of management - operations, performance monitoring, targets and people management. The findings reveal the areas of strength and potential areas of improvement in the Queensland and NSW Health hospital management practices when compared with public hospitals in seven countries, namely, USA, UK, Sweden, France, Germany, Italy and Canada. Together, Queensland and NSW Health hospitals perform best in operations management followed by performance monitoring. While target management presents scope for improvement, people management is the sphere where these Australian hospitals lag the most. This paper is of interest to both hospital administrators and health care policy-makers aiming to lift management quality at the hospital level as well as at the institutional level, as a vehicle to consistently deliver sustainable high-quality health services. This study provides the first internationally comparable robust measure of management capability in Australian public hospitals, where hospitals are run independently by the state-run healthcare systems. Additionally, this research study contributes to the empirical evidence base on the quality of

  5. Use of Opioid Analgesics in Older Australians.

    Science.gov (United States)

    Veal, Felicity C; Bereznicki, Luke R E; Thompson, Angus J; Peterson, Gregory M

    2015-08-01

    To identify potential medication management issues associated with opioid use in older Australians. Retrospective cross-sectional review of the utilization of analgesics in 19,581 people who underwent a medication review in Australia between 2010 and 2012. Australian residents living in the community deemed at risk for adverse medication outcomes or any resident living fulltime in an aged care facility. Patient characteristics in those taking regularly dosed opioids and not and those taking opioid doses >120 mg and ≤120 mg MEQ/day were compared. Multivariable binary logistic regression was used to analyze the association between regular opioid and high dose opioid usage and key variables. Additionally, medication management issues associated with opioids were identified. Opioids were taken by 31.8% of patients, with 22.1% taking them regularly. Several major medication management issues were identified. There was suboptimal use of multimodal analgesia, particularly a low use of non-opioid analgesics, in patients taking regular opioids. There was extensive use (45%) of concurrent anxiolytics/hypnotics among those taking regular opioid analgesics. Laxative use in those prescribed opioids regularly was low (60%). Additionally, almost 12% of patients were taking doses of opioid that exceeded Australian recommendations. A significant evidence to practice gap exists regarding the use of opioids amongst older Australians. These findings highlight the need for a quick reference guide to support prescribers in making appropriate decisions regarding pain management in older patients with persistent pain. This should also be combined with patient and caregiver education about the importance of regular acetaminophen to manage persistent pain. Wiley Periodicals, Inc.

  6. The Australian synchrotron - a progress report

    International Nuclear Information System (INIS)

    Boldeman, J.; Jackson, A.; Seaborne, G.; Hobbs, R.; Garrett, R.

    2003-01-01

    This paper summarises progress with the development of the Australian Synchrotron. The facility is based on the Boomerang Storage Ring which has a DBA structure with 14 superperiods. The design objective was to achieve a low emittance in a relatively compact circumference that had an excellent dynamic aperture and was obust with respect to potential construction aberrations. The potential suite of beamline and instrument stations is discussed and some examples are given

  7. Military Retirement Reform: An Australian Perspective

    Science.gov (United States)

    2014-03-01

    by Disney and Johnson (2001) and the World Bank (Pordes, 1994). There have also been various papers and reviews about Australian and U.S. military...longer able to earn income to support themselves. As identified by the World Bank (Pordes, 1994) changes in social trends imply that extended...industrialized world , government policy on retirement has slowly become a major part of a country’s social construct (be it in the form of publicly funded

  8. Palliative care in Australian medical student education.

    Science.gov (United States)

    Cheng, Daryl R; Teh, Andrew

    2014-01-01

    Greater emphasis needs to be placed on medical student palliative care education within the Australian arena. The development of a comprehensive, relevant and practical educational curriculum in this area during medical school is imperative in order to adequately equip the future junior medical workforce. Further development of a national palliative care curriculum as well as research comparing various teaching methods and curricula should be the priorities in the near future.

  9. Nature Study, Aborigines and the Australian Kindergarten: Lessons from Martha Simpson's "Australian Programme Based on the Life and Customs of the Australian Black"

    Science.gov (United States)

    Jones, Jennifer

    2014-01-01

    This article examines an experimental kindergarten programme "Work in the Kindergarten: An Australian Programme based on the Life and Customs of the Australian Black" developed by Martha Simpson in early twentieth-century Australia. Here Simpson adapted international Revisionist Froebelian approaches to cultural epoch theory and nature…

  10. Landscape Salinisation and Management: An Australian Perspective

    Directory of Open Access Journals (Sweden)

    D. Hoey

    2002-06-01

    Full Text Available Australian landscapes are facing an increasing salinisation threat. It is estimated that 2.5 million hectares are affected by land salinisation, and this area is expected to triple by 2050. Federal and State governments have jointly developed a policy framework to address this issue, with each state refining their own salinity management strategies within this framework. Scientific assessment and modelling underpin these salinity management strategies, though socio-economic considerations are also important. Landscape salinity assessment techniques used in the Australian context are outlined, and examples of salinity hazard and recharge mapping at the landscape scale described. Current developments in both recharge assessment, and groundwater flow modelling in Australia are described, and the use of these models in underpinning state salinity strategic planning discussed. The salinity management ‘toolkit’ is discussed. The progression from initially applying engineering solutions to deal with the symptoms of salinisation; to dealing with the causes of salinisation; to developing an integrated catchment management approach; to including a stronger emphasis on market-based economic measures; and the importance of over-arching Catchment Blueprints, is described in detail.The application of knowledge and experience gained through the management of Australian land salinisation to other countries is discussed in the context of the salinity problem in the Sultanate of Oman.

  11. Exposure to radon in Australian tourist caves

    Energy Technology Data Exchange (ETDEWEB)

    Solomon, S.B.; Langroo, R. [Australian Radiation Lab., Melbourne, VIC (Australia); Lyons, R.G. [Auckland Univ. (New Zealand). Dept. of Physics

    1994-12-31

    In 1991 the International Commission on Radiological Protection(ICRP) produced guidelines and recommendations dealing with workplace exposure to elevated background radiation, in particular, the risk associated with the inhalation of radon and radon progeny. An intervention level of 1000 Bq m{sup -3} has been proposed. Australia has over 40 tourist caves, under the management of the various State Departments or private groups. The limited data available on radon levels in Australian caves would suggest that some of these caves may be in excess of the proposed intervention level, thus presenting a potential health risk for the cave guides. This paper summarises the current information on radon in Australian caves and describes the proposed methodologies to be used for a Worksafe Australia-funded survey of radon levels in Tourist caves within Australia. This survey is to be carried out jointly by researchers at the Australian Radiation Laboratory, University of Auckland and the University of Sydney, during 1994 and 1995. 7 refs., 3 tabs.

  12. Exposure to radon in Australian tourist caves

    International Nuclear Information System (INIS)

    Solomon, S.B.; Langroo, R.; Lyons, R.G.

    1994-01-01

    In 1991 the International Commission on Radiological Protection(ICRP) produced guidelines and recommendations dealing with workplace exposure to elevated background radiation, in particular, the risk associated with the inhalation of radon and radon progeny. An intervention level of 1000 Bq m -3 has been proposed. Australia has over 40 tourist caves, under the management of the various State Departments or private groups. The limited data available on radon levels in Australian caves would suggest that some of these caves may be in excess of the proposed intervention level, thus presenting a potential health risk for the cave guides. This paper summarises the current information on radon in Australian caves and describes the proposed methodologies to be used for a Worksafe Australia-funded survey of radon levels in Tourist caves within Australia. This survey is to be carried out jointly by researchers at the Australian Radiation Laboratory, University of Auckland and the University of Sydney, during 1994 and 1995. 7 refs., 3 tabs

  13. Earthrods: The need for an Australian standard

    Energy Technology Data Exchange (ETDEWEB)

    Lyle, W. [Transnorth Pty Ltd., Morphett Vale, SA (Australia)

    1995-12-31

    Earth-rods are an integral and important part of most electrical distribution systems but there is no Australian Standard covering their design and detail. This leads to a wide and diverse range of earth-rod types in use as many authorities prepare their own criteria which may differ from others and yet the basic performance of the earth-rods is expected to be the same. This paper presents a case for the preparation of an Australian Standard so that users can select standard earth-rods and manufacturers can optimize production costs. It identifies the many and various types, forms and materials used in Australia for earth-rods by power authorities, communications, consumers and other major users of earthing systems. Add-on points, couplings, driving heads and installation methods are also discussed. The paper concludes with a request that the Electricity Supply Association of Australia (ESAA) and/or Standards Australia become involved in establishing an Australian Standard for earth-rods covering such aspects as materials, dimensions, cladding thickness, coupling characteristics, mechanical and electrical properties and tests, and any other variables which control the effectiveness of the earth-rods. (author). 6 figs.

  14. The Australian Centre for Minesite Rehabilitation Research

    International Nuclear Information System (INIS)

    Bell, L.C.

    1994-01-01

    The Australian Centre for Minesite Rehabilitation Research (ACMRR) is a joint venture between the Australian mining industry through the Australian Mineral Industries Research Association Ltd. (AMIRA) and three of the organizations working most actively in this area in Australia: CSIRO Minesite Rehabilitation Research Program; University of Queensland Centre for Mined Land Rehabilitation; and Curtin University Mulga Research Centre. The ACMRR was established in July 1993 to provide a national framework to conduct Strategic Research into minesite rehabilitation. It is an industry led and funded initiative. The Goals of the Centre include: to conduct strategic research into minesite rehabilitation to provide sustainable environmental solutions which are acceptable to industry, government and the community; to be recognized as a center of excellence undertaking commissioned research on minesite rehabilitation in an independent and thorough manner; to provide scientific and technological foundations to facilitate industry and government in setting acceptable standards; to act as networking and communications focus; and to enhance education and training in minesite rehabilitation. Strategic Research Programs in: Water Systems--downstream surface and groundwater quality; Land--the long-term behavior and stability of constructed landforms; Ecosystems--the long-term sustainability of constructed landforms; Waste--the long-term treatment and disposal of waste products; will allow the ACMRR to achieve these goals through specific research projects in these areas, developed with industry sponsors. This paper will discuss their progress to date, research projects underway, and plans for the future

  15. Spatially varying selection shapes life history clines among populations of Drosophila melanogaster from sub-Saharan Africa.

    Science.gov (United States)

    Fabian, D K; Lack, J B; Mathur, V; Schlötterer, C; Schmidt, P S; Pool, J E; Flatt, T

    2015-04-01

    Clines in life history traits, presumably driven by spatially varying selection, are widespread. Major latitudinal clines have been observed, for example, in Drosophila melanogaster, an ancestrally tropical insect from Africa that has colonized temperate habitats on multiple continents. Yet, how geographic factors other than latitude, such as altitude or longitude, affect life history in this species remains poorly understood. Moreover, most previous work has been performed on derived European, American and Australian populations, but whether life history also varies predictably with geography in the ancestral Afro-tropical range has not been investigated systematically. Here, we have examined life history variation among populations of D. melanogaster from sub-Saharan Africa. Viability and reproductive diapause did not vary with geography, but body size increased with altitude, latitude and longitude. Early fecundity covaried positively with altitude and latitude, whereas lifespan showed the opposite trend. Examination of genetic variance-covariance matrices revealed geographic differentiation also in trade-off structure, and QST -FST analysis showed that life history differentiation among populations is likely shaped by selection. Together, our results suggest that geographic and/or climatic factors drive adaptive phenotypic differentiation among ancestral African populations and confirm the widely held notion that latitude and altitude represent parallel gradients. © 2015 European Society For Evolutionary Biology. Journal of Evolutionary Biology © 2015 European Society For Evolutionary Biology.

  16. The Portrayal of Indigenous Health in Selected Australian Media

    Directory of Open Access Journals (Sweden)

    Melissa J. Stoneham

    2014-04-01

    Full Text Available It is acknowledged that health outcomes for Australian Indigenous peoples are lower than those of non-Indigenous Australians. Research suggests negative media in relation to Indigenous Australians perpetuates racist stereotypes among the wider population and impacts on the health of Indigenous Australians. This study examined the media portrayal of Indigenous Australian public health issues in selected media over a twelve month period and found that, overwhelmingly, the articles were negative in their portrayal of Indigenous health. A total of 74 percent of the coverage of Australian Indigenous related articles were negative, 15 percent were positive, and 11 percent were neutral. The most common negative subject descriptors related to alcohol, child abuse, petrol sniffing, violence, suicide, deaths in custody, and crime.

  17. Descripción de tres especies nuevas del género Drosophila (Diptera, Drosophilidae en el Ecuador

    Directory of Open Access Journals (Sweden)

    María Luna Figuero

    2013-09-01

    Full Text Available Se encontraron tres especies nuevas de Drosophila entre los individuos colectados en diferentes localidades del Ecuador. Una de las especies nuevas pertenecen al grupo Drosophila willistoni y otra al grupo Drosophila asiri, la tercera especie se encuentra sin agrupar. En todos los muestreos realizados se usaron trampas fabricadas con botellas de plástico agujereadas con cebo de banano y levadura. Las tres especies son: D. (Sophophora neocapnoptera sp. nov., esta especie es similar a D. capnoptera Patterson & Mainland, 1944, sin embargo presentan algunas diferencias en el ala que permiten distinguirlas. Drosophila (Drosophila neoasiri sp. nov., una especie similar a D. asiri Vela & Rafael, 2005, la diferencia más relevante entre las dos especies se observa a nivel del edeago y Drosophila (Drosophila papallacta sp. nov. que por el momento no se encuentra relacionada a ningún grupo de especies del género Drosophila.

  18. CAUSALITY OF WEATHER CONDITIONS IN AUSTRALIAN STOCK EQUITY RETURNS

    OpenAIRE

    Svetlana Vlady; Ekrem Tufan; Bahattin Hamarat

    2011-01-01

    This study investigates causality of weather and its impact on the The S&P/ASX All Australian 200 Index has been selected as a proxy for the Australian capital market. The index consists exclusively of Australian domiciled companies. Following previous research in behaviour finance in the area of environmental psychology, the data set covers temperature, quality temperature, wet bulb temperature, quality wet bulb temperature, humidity, pressure and vapour pressure variables. The data set is a...

  19. Offshore Processes: International Perspectives on Australian Film and Television

    OpenAIRE

    Haag, Oliver

    2012-01-01

    Australian cinema has never been solely national, neither in the contexts of its production nor in its themes and influences. It reflects the cultural and historical diversity of a continent that has been shaped by the sovereign presence of Indigenous people and more than two centuries of migration. Australian film and television is diverse and inherently international. The symposium “Offshore Processes: International Perspectives on Australian Film and Television” explored the transnational ...

  20. How Australian and Indonesian Universities Treat Plagiarism: a Comparative Study

    OpenAIRE

    Cahyono, Bambang Yudi

    2005-01-01

    This article is a part of a larger study comparing various aspects of policies on plagiarism in two university contexts. It compares policies on plagiarism in universities in Australia and Indonesia. The results of this comparative study showed that Australian and Indonesian universities treat plagiarism differently. Australian universities treat plagiarism explicitly in their university policies. In Australian universities, plagiarism is defined clearly and forms of plagiarism are explained ...

  1. Effects of Exchange Rates on World Prices of Australian Wool

    OpenAIRE

    Islam, Nazrul; Tcha, MoonJoong; Stanton, John

    2006-01-01

    Australian wool producers are being told that exchange rate have driven systematic fluctuation in the price of their wool at auction. This paper presents some key findings of a major collaborative study on the effect of exchange rates on Australian wool prices with the Economic Research Centre at the University of Western Australia. The effect of the exporter and importer’s market powers on the extent of price changes due to exchange rates, was analysed using Australian Bureau of Statistics w...

  2. The decline in Australian young male suicide.

    Science.gov (United States)

    Morrell, Stephen; Page, Andrew N; Taylor, Richard J

    2007-02-01

    Since the late 1990s there has been a sharp downward trend in Australian young male suicide. It is possible that a major government youth suicide prevention initiative, the National Youth Suicide Prevention Strategy (NYSPS), implemented during 1995-1999 may have influenced the decline. In this article, we examine time trends in age- and means-specific male and female Australian suicide rates in relation to unemployment rates and the NYSPS. Based on Australian suicide data over the period 1966-2003, we assess secular changes in the 20-24 year male suicide to total (crude) male suicide rate ratio in relation to the NYSPS, using interrupted time series analysis (ARIMA), since this was previously found to be significantly associated with the 20-24 year male unemployment to total employment ratio. Results show that a dramatic reduction in Australian young male (aged 20-34 years) suicide has occurred since 1997-1998, declining from approximately 40 per 100,000 in 1997-1998 to approximately 20 per 100,000 in 2003. Most of the decline is due to a decrease in suicide by hanging and to a lesser extent from motor vehicle carbon monoxide and other gases. Further, the previously established strong secular association (lasting over 3 decades from 1966) between the rate ratio of 20-24 year male suicide to total (crude) male suicide, and the rate ratio of 20-24 year male unemployment to total unemployment, appears to have been disrupted. ARIMA modelling of the suicide ratio against the initiative indicates a highly significant statistical association between the NYSPS and the suicide ratio reduction but not between the NYSPS and the unemployment indicator trend, suggesting a break in the link between young male suicide and unemployment. The recent sudden turnaround in Australian young male suicide trends and its extent appears to preclude explanations centring on slow-moving social indices traditionally associated with suicide, or on possible cohort effects. This sudden decrease

  3. Sporting Chance: Indigenous Participation in Australian Sport History

    Directory of Open Access Journals (Sweden)

    Sean Gorman

    2010-08-01

    Full Text Available For many non-Indigenous Australians the only time they have any engagement with Indigenous peoples, history or issues is through watching sport on television or being at a football match at the MCG. This general myopia and indifference by settler Australians with Indigenous Australians manifests itself in many ways but perhaps most obscenely in the simple fact that Indigenous Australians die nearly 20 years younger than the rest of Australias citizens. Many non-Indigenous Australians do not know this. Sport in many ways has offered Indigenous Australians a platform from which to begin the slow, hard process for social justice and equity to be actualised. This paper will discuss the participation of Indigenous Australians in sport and show how sport has enabled Indigenous Australians to create a space so that they can speak out against the injustices they have experienced and to further improve on relations going into the future. The central contention is that through sport all Australians can begin a process of engaging with Indigenous history as a means to improve race relations between the two groups.

  4. Sleep, aging, and lifespan in Drosophila

    Directory of Open Access Journals (Sweden)

    Tononi Giulio

    2010-04-01

    Full Text Available Abstract Background Epidemiological studies in humans suggest that a decrease in daily sleep duration is associated with reduced lifespan, but this issue remains controversial. Other studies in humans also show that both sleep quantity and sleep quality decrease with age. Drosophila melanogaster is a useful model to study aging and sleep, and inheriting mutations affecting the potassium current Shaker results in flies that sleep less and have a shorter lifespan. However, whether the link between short sleep and reduced longevity exists also in wild-type flies is unknown. Similarly, it is unknown whether such a link depends on sleep amount per se, rather than on other factors such as waking activity. Also, sleep quality has been shown to decrease in old flies, but it remains unclear whether aging-related sleep fragmentation is a generalized phenomenon. Results We compared 3 short sleeping mutant lines (Hk1, HkY and Hk2 carrying a mutation in Hyperkinetic, which codes for the beta subunit of the Shaker channel, to wild-type siblings throughout their entire lifespan (all flies kept at 20°C. Hk1 and HkY mutants were short sleeping relative to wild-type controls from day 3 after eclosure, and Hk2 flies became short sleepers about two weeks later. All 3 Hk mutant lines had reduced lifespan relative to wild-type flies. Total sleep time showed a trend to increase in all lines with age, but the effect was most pronounced in Hk1 and HkY flies. In both mutant and wild-type lines sleep quality did not decay with age, but the strong preference for sleep at night declined starting in "middle age". Using Cox regression analysis we found that in Hk1 and HkY mutants and their control lines there was a negative relationship between total sleep amount during the first 2 and 4 weeks of age and hazard (individual risk of death, while no association was found in Hk2 flies and their wild-type controls. Hk1 and HkY mutants and their control lines also showed an

  5. Extracellular matrix and its receptors in Drosophila neural development

    Science.gov (United States)

    Broadie, Kendal; Baumgartner, Stefan; Prokop, Andreas

    2011-01-01

    Extracellular matrix (ECM) and matrix receptors are intimately involved in most biological processes. The ECM plays fundamental developmental and physiological roles in health and disease, including processes underlying the development, maintenance and regeneration of the nervous system. To understand the principles of ECM-mediated functions in the nervous system, genetic model organisms like Drosophila provide simple, malleable and powerful experimental platforms. This article provides an overview of ECM proteins and receptors in Drosophila. It then focuses on their roles during three progressive phases of neural development: 1) neural progenitor proliferation, 2) axonal growth and pathfinding and 3) synapse formation and function. Each section highlights known ECM and ECM-receptor components and recent studies done in mutant conditions to reveal their in vivo functions, all illustrating the enormous opportunities provided when merging work on the nervous system with systematic research into ECM-related gene functions. PMID:21688401

  6. A pulsed magnetic stress applied to Drosophila melanogaster flies

    International Nuclear Information System (INIS)

    Delle Side, D; Giuffreda, E; Nassisi, V; Velardi, L; Bozzetti, M P; Friscini, A; Specchia, V

    2014-01-01

    We report the development of a system to feed pulsed magnetic stress to biological samples. The device is based on a RLC circuit that transforms the energy stored in a high voltage capacitor into a magnetic field inside a coil. The field has been characterized and we found that charging the capacitor with 24 kV results in a peak field of 0.4 T. In order to test its effect, we applied such a stress to the Drosophila melanogaster model and we examined its bio-effects. We analysed, in the germ cells, the effects on the control of specific DNA repetitive sequences that are activated after different environmental stresses. The deregulation of these sequences causes genomic instability and chromosomes breaks leading to sterility. The magnetic field treatment did not produce effects on repetitive sequences in the germ cells of Drosophila. Hence, this field doesn't produce deleterious effects linked to repetitive sequences derepression.

  7. Dissecting neural pathways for forgetting in Drosophila olfactory aversive memory.

    Science.gov (United States)

    Shuai, Yichun; Hirokawa, Areekul; Ai, Yulian; Zhang, Min; Li, Wanhe; Zhong, Yi

    2015-12-01

    Recent studies have identified molecular pathways driving forgetting and supported the notion that forgetting is a biologically active process. The circuit mechanisms of forgetting, however, remain largely unknown. Here we report two sets of Drosophila neurons that account for the rapid forgetting of early olfactory aversive memory. We show that inactivating these neurons inhibits memory decay without altering learning, whereas activating them promotes forgetting. These neurons, including a cluster of dopaminergic neurons (PAM-β'1) and a pair of glutamatergic neurons (MBON-γ4>γ1γ2), terminate in distinct subdomains in the mushroom body and represent parallel neural pathways for regulating forgetting. Interestingly, although activity of these neurons is required for memory decay over time, they are not required for acute forgetting during reversal learning. Our results thus not only establish the presence of multiple neural pathways for forgetting in Drosophila but also suggest the existence of diverse circuit mechanisms of forgetting in different contexts.

  8. Drosophila DNA-Binding Proteins in Polycomb Repression

    Directory of Open Access Journals (Sweden)

    Maksim Erokhin

    2018-01-01

    Full Text Available The formation of individual gene expression patterns in different cell types is required during differentiation and development of multicellular organisms. Polycomb group (PcG proteins are key epigenetic regulators responsible for gene repression, and dysregulation of their activities leads to developmental abnormalities and diseases. PcG proteins were first identified in Drosophila, which still remains the most convenient system for studying PcG-dependent repression. In the Drosophila genome, these proteins bind to DNA regions called Polycomb response elements (PREs. A major role in the recruitment of PcG proteins to PREs is played by DNA-binding factors, several of which have been characterized in detail. However, current knowledge is insufficient for comprehensively describing the mechanism of this process. In this review, we summarize and discuss the available data on the role of DNA-binding proteins in PcG recruitment to chromatin.

  9. Measurement of larval activity in the Drosophila activity monitor.

    Science.gov (United States)

    McParland, Aidan L; Follansbee, Taylor L; Ganter, Geoffrey K

    2015-04-30

    Drosophila larvae are used in many behavioral studies, yet a simple device for measuring basic parameters of larval activity has not been available. This protocol repurposes an instrument often used to measure adult activity, the TriKinetics Drosophila activity monitor (MB5 Multi-Beam Activity Monitor) to study larval activity. The instrument can monitor the movements of animals in 16 individual 8 cm glass assay tubes, using 17 infrared detection beams per tube. Logging software automatically saves data to a computer, recording parameters such as number of moves, times sensors were triggered, and animals' positions within the tubes. The data can then be analyzed to represent overall locomotion and/or position preference as well as other measurements. All data are easily accessible and compatible with basic graphing and data manipulation software. This protocol will discuss how to use the apparatus, how to operate the software and how to run a larval activity assay from start to finish.

  10. Sensory integration and neuromodulatory feedback facilitate Drosophila mechanonociceptive behavior.

    Science.gov (United States)

    Hu, Chun; Petersen, Meike; Hoyer, Nina; Spitzweck, Bettina; Tenedini, Federico; Wang, Denan; Gruschka, Alisa; Burchardt, Lara S; Szpotowicz, Emanuela; Schweizer, Michaela; Guntur, Ananya R; Yang, Chung-Hui; Soba, Peter

    2017-08-01

    Nociception is an evolutionarily conserved mechanism to encode and process harmful environmental stimuli. Like most animals, Drosophila melanogaster larvae respond to a variety of nociceptive stimuli, including noxious touch and temperature, with stereotyped escape responses through activation of multimodal nociceptors. How behavioral responses to these different modalities are processed and integrated by the downstream network remains poorly understood. By combining trans-synaptic labeling, ultrastructural analysis, calcium imaging, optogenetics and behavioral analyses, we uncovered a circuit specific for mechanonociception but not thermonociception. Notably, integration of mechanosensory input from innocuous and nociceptive sensory neurons is required for robust mechanonociceptive responses. We further show that neurons integrating mechanosensory input facilitate primary nociceptive output by releasing short neuropeptide F, the Drosophila neuropeptide Y homolog. Our findings unveil how integration of somatosensory input and neuropeptide-mediated modulation can produce robust modality-specific escape behavior.

  11. Learning the specific quality of taste reinforcement in larval Drosophila.

    Science.gov (United States)

    Schleyer, Michael; Miura, Daisuke; Tanimura, Teiichi; Gerber, Bertram

    2015-01-27

    The only property of reinforcement insects are commonly thought to learn about is its value. We show that larval Drosophila not only remember the value of reinforcement (How much?), but also its quality (What?). This is demonstrated both within the appetitive domain by using sugar vs amino acid as different reward qualities, and within the aversive domain by using bitter vs high-concentration salt as different qualities of punishment. From the available literature, such nuanced memories for the quality of reinforcement are unexpected and pose a challenge to present models of how insect memory is organized. Given that animals as simple as larval Drosophila, endowed with but 10,000 neurons, operate with both reinforcement value and quality, we suggest that both are fundamental aspects of mnemonic processing-in any brain.

  12. Mitochondrial apoptotic pathways induced by Drosophila programmed cell death regulators

    International Nuclear Information System (INIS)

    Claveria, Cristina; Torres, Miguel

    2003-01-01

    Multicellular organisms eliminate unwanted or damaged cells by cell death, a process essential to the maintenance of tissue homeostasis. Cell death is a tightly regulated event, whose alteration by excess or defect is involved in the pathogenesis of many diseases such as cancer, autoimmune syndromes, and neurodegenerative processes. Studies in model organisms, especially in the nematode Caenorhabditis elegans, have been crucial in identifying the key molecules implicated in the regulation and execution of programmed cell death. In contrast, the study of cell death in Drosophila melanogaster, often an excellent model organism, has identified regulators and mechanisms not obviously conserved in other metazoans. Recent molecular and cellular analyses suggest, however, that the mechanisms of action of the main programmed cell death regulators in Drosophila include a canonical mitochondrial pathway

  13. Context generalization in Drosophila visual learning requires the mushroom bodies

    Science.gov (United States)

    Liu, Li; Wolf, Reinhard; Ernst, Roman; Heisenberg, Martin

    1999-08-01

    The world is permanently changing. Laboratory experiments on learning and memory normally minimize this feature of reality, keeping all conditions except the conditioned and unconditioned stimuli as constant as possible. In the real world, however, animals need to extract from the universe of sensory signals the actual predictors of salient events by separating them from non-predictive stimuli (context). In principle, this can be achieved ifonly those sensory inputs that resemble the reinforcer in theirtemporal structure are taken as predictors. Here we study visual learning in the fly Drosophila melanogaster, using a flight simulator,, and show that memory retrieval is, indeed, partially context-independent. Moreover, we show that the mushroom bodies, which are required for olfactory but not visual or tactile learning, effectively support context generalization. In visual learning in Drosophila, it appears that a facilitating effect of context cues for memory retrieval is the default state, whereas making recall context-independent requires additional processing.

  14. Automated protein-DNA interaction screening of Drosophila regulatory elements.

    Science.gov (United States)

    Hens, Korneel; Feuz, Jean-Daniel; Isakova, Alina; Iagovitina, Antonina; Massouras, Andreas; Bryois, Julien; Callaerts, Patrick; Celniker, Susan E; Deplancke, Bart

    2011-10-30

    Drosophila melanogaster has one of the best characterized metazoan genomes in terms of functionally annotated regulatory elements. To explore how these elements contribute to gene regulation, we need convenient tools to identify the proteins that bind to them. Here we describe the development and validation of a high-throughput yeast one-hybrid platform, which enables screening of DNA elements versus an array of full-length, sequence-verified clones containing over 85% of predicted Drosophila transcription factors. Using six well-characterized regulatory elements, we identified 33 transcription factor-DNA interactions of which 27 were previously unidentified. To simultaneously validate these interactions and locate the binding sites of involved transcription factors, we implemented a powerful microfluidics-based approach that enabled us to retrieve DNA-occupancy data for each transcription factor throughout the respective target DNA elements. Finally, we biologically validated several interactions and identified two new regulators of sine oculis gene expression and hence eye development.

  15. Analysis of Glial Cell Development and Function in Drosophila

    Science.gov (United States)

    Stork, Tobias; Bernardos, Rebecca; Freeman, Marc R.

    2016-01-01

    Glial cells are the most abundant cell type in our brains, yet we understand very little about their development and function. An accumulating body of work over the last decade has revealed that glia are critical regulators of nervous system development, function, and health. Based on morphological and molecular criteria, glia in Drosophila melanogaster are very similar to their mammalian counterparts, suggesting that a detailed investigation of fly glia has the potential to add greatly to our understanding of fundamental aspects of glial cell biology. In this article, we provide an overview of the subtypes of glial cells found in Drosophila and discuss our current understanding of their functions, the development of a subset of well-defined glial lineages, and the molecular-genetic tools available for manipulating glial subtypes in vivo. PMID:22194269

  16. Drosophila Cancer Models Identify Functional Differences between Ret Fusions

    Directory of Open Access Journals (Sweden)

    Sarah Levinson

    2016-09-01

    Full Text Available We generated and compared Drosophila models of RET fusions CCDC6-RET and NCOA4-RET. Both RET fusions directed cells to migrate, delaminate, and undergo EMT, and both resulted in lethality when broadly expressed. In all phenotypes examined, NCOA4-RET was more severe than CCDC6-RET, mirroring their effects on patients. A functional screen against the Drosophila kinome and a library of cancer drugs found that CCDC6-RET and NCOA4-RET acted through different signaling networks and displayed distinct drug sensitivities. Combining data from the kinome and drug screens identified the WEE1 inhibitor AZD1775 plus the multi-kinase inhibitor sorafenib as a synergistic drug combination that is specific for NCOA4-RET. Our work emphasizes the importance of identifying and tailoring a patient’s treatment to their specific RET fusion isoform and identifies a multi-targeted therapy that may prove effective against tumors containing the NCOA4-RET fusion.

  17. Unraveling the Neurobiology of Sleep and Sleep Disorders Using Drosophila.

    Science.gov (United States)

    Chakravarti, L; Moscato, E H; Kayser, M S

    2017-01-01

    Sleep disorders in humans are increasingly appreciated to be not only widespread but also detrimental to multiple facets of physical and mental health. Recent work has begun to shed light on the mechanistic basis of sleep disorders like insomnia, restless legs syndrome, narcolepsy, and a host of others, but a more detailed genetic and molecular understanding of how sleep goes awry is lacking. Over the past 15 years, studies in Drosophila have yielded new insights into basic questions regarding sleep function and regulation. More recently, powerful genetic approaches in the fly have been applied toward studying primary human sleep disorders and other disease states associated with dysregulated sleep. In this review, we discuss the contribution of Drosophila to the landscape of sleep biology, examining not only fundamental advances in sleep neurobiology but also how flies have begun to inform pathological sleep states in humans. © 2017 Elsevier Inc. All rights reserved.

  18. Resolving the prevalence of somatic transposition inDrosophila.

    Science.gov (United States)

    Treiber, Christoph D; Waddell, Scott

    2017-07-25

    Somatic transposition in mammals and insects could increase cellular diversity and neural mobilization has been implicated in age-dependent decline. To understand the impact of transposition in somatic cells it is essential to reliably measure the frequency and map locations of new insertions. Here we identified thousands of putative somatic transposon insertions in neurons from individual Drosophila melanogaster using whole-genome sequencing. However, the number of de novo insertions did not correlate with transposon expression or fly age. Analysing our data with exons as 'immobile genetic elements' revealed a similar frequency of unexpected exon translocations. A new sequencing strategy that recovers transposon: chromosome junction information revealed most putative de novo transposon and exon insertions likely result from unavoidable chimeric artefacts. Reanalysis of other published data suggests similar artefacts are often mistaken for genuine somatic transposition. We conclude that somatic transposition is less prevalent in Drosophila than previously envisaged.

  19. A Drosophila model of high sugar diet-induced cardiomyopathy.

    Directory of Open Access Journals (Sweden)

    Jianbo Na

    Full Text Available Diets high in carbohydrates have long been linked to progressive heart dysfunction, yet the mechanisms by which chronic high sugar leads to heart failure remain poorly understood. Here we combine diet, genetics, and physiology to establish an adult Drosophila melanogaster model of chronic high sugar-induced heart disease. We demonstrate deterioration of heart function accompanied by fibrosis-like collagen accumulation, insulin signaling defects, and fat accumulation. The result was a shorter life span that was more severe in the presence of reduced insulin and P38 signaling. We provide evidence of a role for hexosamine flux, a metabolic pathway accessed by glucose. Increased hexosamine flux led to heart function defects and structural damage; conversely, cardiac-specific reduction of pathway activity prevented sugar-induced heart dysfunction. Our data establish Drosophila as a useful system for exploring specific aspects of diet-induced heart dysfunction and emphasize enzymes within the hexosamine biosynthetic pathway as candidate therapeutic targets.

  20. Sensory Conflict Disrupts Activity of the Drosophila Circadian Network

    Directory of Open Access Journals (Sweden)

    Ross E.F. Harper

    2016-11-01

    Full Text Available Periodic changes in light and temperature synchronize the Drosophila circadian clock, but the question of how the fly brain integrates these two input pathways to set circadian time remains unanswered. We explore multisensory cue combination by testing the resilience of the circadian network to conflicting environmental inputs. We show that misaligned light and temperature cycles can lead to dramatic changes in the daily locomotor activities of wild-type flies during and after exposure to sensory conflict. This altered behavior is associated with a drastic reduction in the amplitude of PERIOD (PER oscillations in brain clock neurons and desynchronization between light- and temperature-sensitive neuronal subgroups. The behavioral disruption depends heavily on the phase relationship between light and temperature signals. Our results represent a systematic quantification of multisensory integration in the Drosophila circadian system and lend further support to the view of the clock as a network of coupled oscillatory subunits.

  1. Drosophila melanogaster as a Model Organism of Brain Diseases

    Directory of Open Access Journals (Sweden)

    Werner Paulus

    2009-02-01

    Full Text Available Drosophila melanogaster has been utilized to model human brain diseases. In most of these invertebrate transgenic models, some aspects of human disease are reproduced. Although investigation of rodent models has been of significant impact, invertebrate models offer a wide variety of experimental tools that can potentially address some of the outstanding questions underlying neurological disease. This review considers what has been gleaned from invertebrate models of neurodegenerative diseases, including Alzheimer’s disease, Parkinson’s disease, metabolic diseases such as Leigh disease, Niemann-Pick disease and ceroid lipofuscinoses, tumor syndromes such as neurofibromatosis and tuberous sclerosis, epilepsy as well as CNS injury. It is to be expected that genetic tools in Drosophila will reveal new pathways and interactions, which hopefully will result in molecular based therapy approaches.

  2. New research resources at the Bloomington Drosophila Stock Center.

    Science.gov (United States)

    Cook, Kevin R; Parks, Annette L; Jacobus, Luke M; Kaufman, Thomas C; Matthews, Kathleen A

    2010-01-01

    The Bloomington Drosophila Stock Center (BDSC) is a primary source of Drosophila stocks for researchers all over the world. It houses over 27,000 unique fly lines and distributed over 160,000 samples of these stocks this past year. This report provides a brief overview of significant recent events at the BDSC with a focus on new stock sets acquired in the past year, including stocks for phiC31 transformation, RNAi knockdown of gene expression, and SNP and quantitative trait loci discovery. We also describe additions to sets of insertions and molecularly defined chromosomal deficiencies, the creation of a new Deficiency Kit, and planned additions of X chromosome duplication sets.

  3. A horseshoe crab receptor structurally related to Drosophila Toll.

    Science.gov (United States)

    Inamori, K; Koori, K; Mishima, C; Muta, T; Kawabata, S

    2000-01-01

    Innate immunity against microbial pathogens relies on the pattern recognition of cell wall components on invading microbes. Recent evidence has shown that a mammalian Toll-like receptor (TLR) is activated by bacterial lipopolysaccharides (LPS). The innate immunity in invertebrates is also triggered by LPS, as seen in the hemolymph coagulation in horseshoe crab. We report the cloning of a TLR from the Japanese horseshoe crab Tachypleus tridentatus. A cDNA coding for Tachypleus Toll was isolated from a hemocyte cDNA library and the open reading frame codes for a proprotein including a signal sequence. Like Drosophila Toll, Tachypleus Toll is a type I transmembrane protein with an extracellular domain consisting of two leucine-rich repeats flanked by two cystein-rich clusters and a cytoplasmic domain exhibiting striking similarity with the cytoplasmic domain of interleukin-1 receptor. Tachypleus Toll is most similar to Drosophila Toll in the domain architecture and the overall length.

  4. A pulsed magnetic stress applied to Drosophila melanogaster flies

    Science.gov (United States)

    Delle Side, D.; Bozzetti, M. P.; Friscini, A.; Giuffreda, E.; Nassisi, V.; Specchia, V.; Velardi, L.

    2014-04-01

    We report the development of a system to feed pulsed magnetic stress to biological samples. The device is based on a RLC circuit that transforms the energy stored in a high voltage capacitor into a magnetic field inside a coil. The field has been characterized and we found that charging the capacitor with 24 kV results in a peak field of 0.4 T. In order to test its effect, we applied such a stress to the Drosophila melanogaster model and we examined its bio-effects. We analysed, in the germ cells, the effects on the control of specific DNA repetitive sequences that are activated after different environmental stresses. The deregulation of these sequences causes genomic instability and chromosomes breaks leading to sterility. The magnetic field treatment did not produce effects on repetitive sequences in the germ cells of Drosophila. Hence, this field doesn't produce deleterious effects linked to repetitive sequences derepression.

  5. GABAA receptor-expressing neurons promote consumption in Drosophila melanogaster.

    Science.gov (United States)

    Cheung, Samantha K; Scott, Kristin

    2017-01-01

    Feeding decisions are highly plastic and bidirectionally regulated by neurons that either promote or inhibit feeding. In Drosophila melanogaster, recent studies have identified four GABAergic interneurons that act as critical brakes to prevent incessant feeding. These GABAergic neurons may inhibit target neurons that drive consumption. Here, we tested this hypothesis by examining GABA receptors and neurons that promote consumption. We find that Resistance to dieldrin (RDL), a GABAA type receptor, is required for proper control of ingestion. Knockdown of Rdl in a subset of neurons causes overconsumption of tastants. Acute activation of these neurons is sufficient to drive consumption of appetitive substances and non-appetitive substances and acute silencing of these neurons decreases consumption. Taken together, these studies identify GABAA receptor-expressing neurons that promote Drosophila ingestive behavior and provide insight into feeding regulation.

  6. Generating patterns from fields of cells. Examples from Drosophila segmentation.

    Science.gov (United States)

    Sanson, B

    2001-12-01

    In Drosophila, a cascade of maternal, gap, pair-rule and segment polarity genes subdivides the antero/posterior axis of the embryo into repeating segmental stripes. This review summarizes what happens next, i.e. how an intrasegmental pattern is generated and controls the differentiation of specific cell types in the epidermis. Within each segment, cells secreting the signalling molecules Wingless (the homologue of vertebrate Wnt-1) and Hedgehog are found in narrow stripes on both sides of the parasegmental boundary. The Wingless and Hedgehog organizing activities help to establish two more stripes per segment that localize ligands for the Epidermal Growth Factor and the Notch signalling pathways, respectively. These four signals then act at short range and in concert to control epidermal differentiation at the single cell level across the segment. This example from Drosophila provides a paradigm for how organizers generate precise patterns, and ultimately different cell types, in a naïve field of cells.

  7. Conserved family of glycerol kinase loci in Drosophila melanogaster

    Science.gov (United States)

    Martinez Agosto, Julian A.; McCabe, Edward R.B.

    2009-01-01

    Glycerol kinase (GK) is an enzyme that catalyzes the formation of glycerol 3-phosphate from ATP and glycerol, the rate-limiting step in glycerol utilization. We analyzed the genome of the model organism Drosophila melanogaster and identified five GK orthologs, including two loci with sequence homology to the mammalian Xp21 GK protein. Using a combination of sequence analysis and evolutionary comparisons of orthologs between species, we characterized functional domains in the protein required for GK activity. Our findings include additional conserved domains that suggest novel nuclear and mitochondrial functions for glycerol kinase in apoptosis and transcriptional regulation. Investigation of GK function in Drosophila will inform us about the role of this enzyme in development and will provide us with a tool to examine genetic modifiers of human metabolic disorders. PMID:16545593

  8. Fluorescent visualization of macromolecules in Drosophila whole mounts.

    Science.gov (United States)

    Ramos, Ricardo Guelerman Pinheiro; Machado, Luciana Claudia Herculano; Moda, Livia Maria Rosatto

    2010-01-01

    The ability to determine the expression dynamics of individual genes "in situ" by visualizing the precise spatial and temporal distribution of their products in whole mounts by histochemical and immunocytochemical reactions has revolutionized our understanding of cellular processes. Drosophila developmental genetics was one of the fields that benefited most from these technologies, and a variety of fluorescent methods were specifically designed for investigating the localization of developmentally important proteins and cell markers during embryonic and post embryonic stages of this model organism. In this chapter we present detailed protocols for fluorescence immunocytochemistry of whole mount embryos, imaginal discs, pupal retinas, and salivary glands of Drosophila melanogaster, as well as methods for fluorescent visualization of specific subcellular structures in these tissues.

  9. Feature Integration Drives Probabilistic Behavior in the Drosophila Escape Response.

    Science.gov (United States)

    von Reyn, Catherine R; Nern, Aljoscha; Williamson, W Ryan; Breads, Patrick; Wu, Ming; Namiki, Shigehiro; Card, Gwyneth M

    2017-06-21

    Animals rely on dedicated sensory circuits to extract and encode environmental features. How individual neurons integrate and translate these features into behavioral responses remains a major question. Here, we identify a visual projection neuron type that conveys predator approach information to the Drosophila giant fiber (GF) escape circuit. Genetic removal of this input during looming stimuli reveals that it encodes angular expansion velocity, whereas other input cell type(s) encode angular size. Motor program selection and timing emerge from linear integration of these two features within the GF. Linear integration improves size detection invariance over prior models and appropriately biases motor selection to rapid, GF-mediated escapes during fast looms. Our findings suggest feature integration, and motor control may occur as simultaneous operations within the same neuron and establish the Drosophila escape circuit as a model system in which these computations may be further dissected at the circuit level. VIDEO ABSTRACT. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Maternal control of the Drosophila dorsal–ventral body axis

    Science.gov (United States)

    Stein, David S.; Stevens, Leslie M.

    2016-01-01

    The pathway that generates the dorsal–ventral (DV) axis of the Drosophila embryo has been the subject of intense investigation over the previous three decades. The initial asymmetric signal originates during oogenesis by the movement of the oocyte nucleus to an anterior corner of the oocyte, which establishes DV polarity within the follicle through signaling between Gurken, the Drosophila Transforming Growth Factor (TGF)-α homologue secreted from the oocyte, and the Drosophila Epidermal Growth Factor Receptor (EGFR) that is expressed by the follicular epithelium cells that envelop the oocyte. Follicle cells that are not exposed to Gurken follow a ventral fate and express Pipe, a sulfotransferase that enzymatically modifies components of the inner vitelline membrane layer of the eggshell, thereby transferring DV spatial information from the follicle to the egg. These ventrally sulfated eggshell proteins comprise a localized cue that directs the ventrally restricted formation of the active Spätzle ligand within the perivitelline space between the eggshell and the embryonic membrane. Spätzle activates Toll, a transmembrane receptor in the embryonic membrane. Transmission of the Toll signal into the embryo leads to the formation of a ventral-to-dorsal gradient of the transcription factor Dorsal within the nuclei of the syncytial blastoderm stage embryo. Dorsal controls the spatially specific expression of a large constellation of zygotic target genes, the Dorsal gene regulatory network, along the embryonic DV circumference. This article reviews classic studies and integrates them with the details of more recent work that has advanced our understanding of the complex pathway that establishes Drosophila embryo DV polarity. PMID:25124754

  11. Fungal diversity associated with Hawaiian Drosophila host plants.

    Directory of Open Access Journals (Sweden)

    Brian S Ort

    Full Text Available Hawaiian Drosophila depend primarily, sometimes exclusively, on specific host plants for oviposition and larval development, and most specialize further on a particular decomposing part of that plant. Differences in fungal community between host plants and substrate types may establish the basis for host specificity in Hawaiian Drosophila. Fungi mediate decomposition, releasing plant micronutrients and volatiles that can indicate high quality substrates and serve as cues to stimulate oviposition. This study addresses major gaps in our knowledge by providing the first culture-free, DNA-based survey of fungal diversity associated with four ecologically important tree genera in the Hawaiian Islands. Three genera, Cheirodendron, Clermontia, and Pisonia, are important host plants for Drosophila. The fourth, Acacia, is not an important drosophilid host but is a dominant forest tree. We sampled fresh and rotting leaves from all four taxa, plus rotting stems from Clermontia and Pisonia. Based on sequences from the D1/D2 domain of the 26S rDNA gene, we identified by BLAST search representatives from 113 genera in 13 fungal classes. A total of 160 operational taxonomic units, defined on the basis of ≥97% genetic similarity, were identified in these samples, but sampling curves show this is an underestimate of the total fungal diversity present on these substrates. Shannon diversity indices ranged from 2.0 to 3.5 among the Hawaiian samples, a slight reduction compared to continental surveys. We detected very little sharing of fungal taxa among the substrates, and tests of community composition confirmed that the structure of the fungal community differed significantly among the substrates and host plants. Based on these results, we hypothesize that fungal community structure plays a central role in the establishment of host preference in the Hawaiian Drosophila radiation.

  12. A Modified Cooling Method and Its Application in "Drosophila" Experiments

    Science.gov (United States)

    Qu, Wen-hui; Zhu, Tong-bo; Yang, Da-Xiang

    2015-01-01

    Chilling is a cost-effective and safe method of immobilising flies in "Drosophila" experiments. However, should condensation form on the plate, it would be fatal to the flies. Here we describe a modified cooling method using reusable commercial ice pack(s) (ca. 400 ml, 2-3 cm tall) rather than crushed ice. The ice pack is covered with a…

  13. EFFECT OF SOME BEVERAGES ON THE DROSOPHILA MELANOGASTER SURVIVAL PERCENTAGE

    OpenAIRE

    SARIKAYA, Rabia; KARABAY, Kübra; ERKOÇ, Figen

    2018-01-01

     Energy drinksare a group of products that are advertised as being able to provide alertnessand energy, and conteract sleepiness. In this study, different types of energydrinks and some beverages have been evaluated for toxic effectsin Drosophilamelanogaster individual. During the experiments, 1.5 g medium waswettedwith5mLbeverages and100 third-instar larvae were chronically fed with theDrosophila instant medium. Feeding ended with pupation of the surviving larvae.The experiments wer...

  14. Genome-Wide Approaches to Drosophila Heart Development

    Directory of Open Access Journals (Sweden)

    Manfred Frasch

    2016-05-01

    Full Text Available The development of the dorsal vessel in Drosophila is one of the first systems in which key mechanisms regulating cardiogenesis have been defined in great detail at the genetic and molecular level. Due to evolutionary conservation, these findings have also provided major inputs into studies of cardiogenesis in vertebrates. Many of the major components that control Drosophila cardiogenesis were discovered based on candidate gene approaches and their functions were defined by employing the outstanding genetic tools and molecular techniques available in this system. More recently, approaches have been taken that aim to interrogate the entire genome in order to identify novel components and describe genomic features that are pertinent to the regulation of heart development. Apart from classical forward genetic screens, the availability of the thoroughly annotated Drosophila genome sequence made new genome-wide approaches possible, which include the generation of massive numbers of RNA interference (RNAi reagents that were used in forward genetic screens, as well as studies of the transcriptomes and proteomes of the developing heart under normal and experimentally manipulated conditions. Moreover, genome-wide chromatin immunoprecipitation experiments have been performed with the aim to define the full set of genomic binding sites of the major cardiogenic transcription factors, their relevant target genes, and a more complete picture of the regulatory network that drives cardiogenesis. This review will give an overview on these genome-wide approaches to Drosophila heart development and on computational analyses of the obtained information that ultimately aim to provide a description of this process at the systems level.

  15. Architecture of the primary taste center of Drosophila melanogaster larvae

    OpenAIRE

    Colomb, Julien; Grillenzoni, Nicola; Ramaekers, Ariane; Stocker, Reinhard F.

    2007-01-01

    A simple nervous system combined with stereotypic behavioral responses to tastants, together with powerful genetic and molecular tools, have turned Drosophila larvae into a very promising model for studying gustatory coding. Using the Gal4/UAS system and confocal microscopy for visualizing gustatory afferents, we provide a description of the primary taste center in the larval central nervous system. Essentially, gustatory receptor neurons target different areas of the subesophageal ganglion (...

  16. Geographic polymorphism of P element in populations of Drosophila sturtevanti

    Directory of Open Access Journals (Sweden)

    Luciane M. de Almeida

    2003-01-01

    Full Text Available The aim of this report was to detect full-sized P element sequences in eight strains of Drosophila sturtevanti populations from distant geographic regions and to assess the structural geographic variation among P element sequences. PCR analysis confirmed the presence of a putative complete P element in all strains. Southern blot analysis indicated bands shared by all strains, and bands restricted to geographically related strains. Parsimony analysis corroborated the hybridization pattern that reflected the geographic relationships.

  17. Drosophila lowfat, a novel modulator of Fat signaling

    OpenAIRE

    Mao, Yaopan; Kucuk, Binnaz; Irvine, Kenneth D.

    2009-01-01

    The Fat-Hippo-Warts signaling network regulates both transcription and planar cell polarity. Despite its crucial importance to the normal control of growth and planar polarity, we have only a limited understanding of the mechanisms that regulate Fat. We report here the identification of a conserved cytoplasmic protein, Lowfat (Lft), as a modulator of Fat signaling. Drosophila Lft, and its human homologs LIX1 and LIX1-like, bind to the cytoplasmic domains of the Fat lig...

  18. A role for adenosine deaminase in Drosophila larval development

    Czech Academy of Sciences Publication Activity Database

    Doležal, T.; Doleželová, Eva; Žurovec, Michal; Bryant, P. J.

    2005-01-01

    Roč. 3, č. 7 (2005), s. 1213-1224 ISSN 1544-9173 R&D Projects: GA ČR(CZ) GA204/04/1205; GA AV ČR(CZ) IAA5007107 Grant - others:United States National Science Foundation(US) 440860-21565 Institutional research plan: CEZ:AV0Z50070508 Keywords : Drosophila Subject RIV: ED - Physiology Impact factor: 14.672, year: 2005

  19. Contribution of photoreceptor subtypes to spectral wavelength preference in Drosophila

    OpenAIRE

    Yamaguchi, Satoko; Desplan, Claude; Heisenberg, Martin

    2010-01-01

    The visual systems of most species contain photoreceptors with distinct spectral sensitivities that allow animals to distinguish lights by their spectral composition. In Drosophila, photoreceptors R1–R6 have the same spectral sensitivity throughout the eye and are responsible for motion detection. In contrast, photoreceptors R7 and R8 exhibit heterogeneity and are important for color vision. We investigated how photoreceptor types contribute to the attractiveness of light by blocking the func...

  20. CULTURE OF EMBRYONIC CELLS OF DROSOPHILA MELANOGASTER IN VITRO.

    Science.gov (United States)

    HORIKAWA, M; FOX, A S

    1964-09-25

    Embryonic cells isolated from eggs ofDrosophila melanogasterhave been cultured continuously in a new medium. Generation time for cell division is 30 hours. Chromosome number remains constant for at least 10 days. Cells from embryos of the mutant maroon-like grow at the same rate as those from wild-type embryos, but cells from rosy-2 grow slower and at a lower optimum temperature.

  1. Hox gene regulation in the central nervous system of Drosophila

    Directory of Open Access Journals (Sweden)

    Maheshwar eGummalla

    2014-04-01

    Full Text Available Hox genes specify the structures that form along the anteroposterior (AP axis of bilateria. Within the genome, they often form clusters where, remarkably enough, their position within the clusters reflects the relative positions of the structures they specify along the AP axis. This correspondence between genomic organization and gene expression pattern has been conserved through evolution and provides a unique opportunity to study how chromosomal context affects gene regulation. In Drosophila, a general rule, often called posterior dominance, states that Hox genes specifying more posterior structures repress the expression of more anterior Hox genes. This rule explains the apparent spatial complementarity of Hox gene expression patterns in Drosophila. Here we review a noticeable exception to this rule where the more-posteriorly expressed Abd-B hox gene fails to repress the more-anterior abd-A gene in cells of the central nervous system (CNS. While Abd-B is required to repress ectopic expression of abd-A in the posterior epidermis, abd-A repression in the posterior CNS is accomplished by a different mechanism that involves a large 92kb long non-coding RNA (lncRNA encoded by the intergenic region separating abd-A and Abd-B (the iab8ncRNA. Dissection of this lncRNA revealed that abd-A is repressed by the lncRNA using two redundant mechanisms. The 1st mechanism is mediated by a microRNA (mir-iab-8 encoded by intronic sequence within the large iab8-ncRNA. Meanwhile, the second mechanism seems to involve transcriptional interference by the long iab-8 ncRNA on the abd-A promoter. Recent work demonstrating CNS-specific regulation of genes by ncRNAs in Drosophila, seem to highlight a potential role for the iab-8-ncRNA in the evolution of the Drosophila hox complexes

  2. Genetic Analysis of Micro-environmental Plasticity in Drosophila melanogaster

    OpenAIRE

    Morgante, Fabio; Sorensen, Daniel A; Sørensen, Peter; Maltecca, Christian; Mackay, Trudy F C

    2014-01-01

    Quantitative genetic models recognize the potential for genotype by environment interaction, whereby different genotypes have different plastic responses to changes in macro-environmental conditions. Recently, it has been recognized that micro-environmental plasticity (‘residual’ variance) may also be genetically variable. This study utilized the Drosophila Genetic Reference Panel (DGRP) to accurately estimate the genetic variance of micro-environmental plasticity for chill coma recovery time...

  3. Intraspecific hybridization, developmental stability and fitness in Drosophila mercatorum

    DEFF Research Database (Denmark)

    Andersen, DH; Pertoldi, C; Scali, V

    2002-01-01

    One of the possible effects of intraspecific hybridization is outbreeding depression, due to a breakdown of coadapted gene complexes, which can lead to reduced fitness and decreased developmental stability in hybrids. Alternatively, increased fitness and increased developmental stability in hybrids...... (hybrid vigour) may be a result of hybridization, probably due to increased heterozygosity. Developmental stability is assumed to be correlated with fitness and is commonly measured as fluctuating asymmetry or phenotypic variance. Drosophila mercatorum is capable of reproducing sexually, but also...

  4. Functional Analysis of Human NF1 in Drosophila

    Science.gov (United States)

    2007-01-01

    Stratagene Chameleon kit with a pBSK-specific phosphorylated selection primer (50 pCCGCCACCGCGATGTAGCTCCAATTCGC 30) and mutation -specific mutagenesis...identified by examining the phenotypes of mutated human gene expressed in Drosophila NF1 null mutants. We also propose that Gsα/NF1-activated AC...With this paradigm established, we further tested the effects of different hNF1 deletion mutations our lab created have on the stimulation event. We

  5. The Immune Phenotype of Three Drosophila Leukemia Models

    Directory of Open Access Journals (Sweden)

    Badrul Arefin

    2017-07-01

    Full Text Available Many leukemia patients suffer from dysregulation of their immune system, making them more susceptible to infections and leading to general weakening (cachexia. Both adaptive and innate immunity are affected. The fruit fly Drosophila melanogaster has an innate immune system, including cells of the myeloid lineage (hemocytes. To study Drosophila immunity and physiology during leukemia, we established three models by driving expression of a dominant-active version of the Ras oncogene (RasV12 alone or combined with knockdowns of tumor suppressors in Drosophila hemocytes. Our results show that phagocytosis, hemocyte migration to wound sites, wound sealing, and survival upon bacterial infection of leukemic lines are similar to wild type. We find that in all leukemic models the two major immune pathways (Toll and Imd are dysregulated. Toll–dependent signaling is activated to comparable extents as after wounding wild-type larvae, leading to a proinflammatory status. In contrast, Imd signaling is suppressed. Finally, we notice that adult tissue formation is blocked and degradation of cell masses during metamorphosis of leukemic lines, which is akin to the state of cancer-dependent cachexia. To further analyze the immune competence of leukemic lines, we used a natural infection model that involves insect-pathogenic nematodes. We identified two leukemic lines that were sensitive to nematode infections. Further characterization demonstrates that despite the absence of behavioral abnormalities at the larval stage, leukemic larvae show reduced locomotion in the presence of nematodes. Taken together, this work establishes new Drosophila models to study the physiological, immunological, and behavioral consequences of various forms of leukemia.

  6. A high-quality catalog of the Drosophila melanogaster proteome

    DEFF Research Database (Denmark)

    Brunner, Erich; Ahrens, Christian H.; Mohanty, Sonaly

    2007-01-01

    % of the predicted Drosophila melanogaster proteome by detecting 9,124 proteins from 498,000 redundant and 72,281 distinct peptide identifications. This unprecedented high proteome coverage for a complex eukaryote was achieved by combining sample diversity, multidimensional biochemical fractionation and analysis...... matching approximately 50% of D. melanogaster gene models. This library of proteotypic peptides should enable fast, targeted and quantitative proteomic studies to elucidate the systems biology of this model organism....

  7. Male killing Spiroplasma protects Drosophila melanogaster against two parasitoid wasps

    Science.gov (United States)

    Xie, J; Butler, S; Sanchez, G; Mateos, M

    2014-01-01

    Maternally transmitted associations between endosymbiotic bacteria and insects are diverse and widespread in nature. Owing to imperfect vertical transmission, many heritable microbes have evolved compensational mechanisms to enhance their persistence in host lineages, such as manipulating host reproduction and conferring fitness benefits to host. Symbiont-mediated defense against natural enemies of hosts is increasingly recognized as an important mechanism by which endosymbionts enhance host fitness. Members of the genus Spiroplasma associated with distantly related Drosophila hosts are known to engage in either reproductive parasitism (i.e., male killing) or defense against natural enemies (the parasitic wasp Leptopilina heterotoma and a nematode). A male-killing strain of Spiroplasma (strain Melanogaster Sex Ratio Organism (MSRO)) co-occurs with Wolbachia (strain wMel) in certain wild populations of the model organism Drosophila melanogaster. We examined the effects of Spiroplasma MSRO and Wolbachia wMel on Drosophila survival against parasitism by two common wasps, Leptopilina heterotoma and Leptopilina boulardi, that differ in their host ranges and host evasion strategies. The results indicate that Spiroplasma MSRO prevents successful development of both wasps, and confers a small, albeit significant, increase in larva-to-adult survival of flies subjected to wasp attacks. We modeled the conditions under which defense can contribute to Spiroplasma persistence. Wolbachia also confers a weak, but significant, survival advantage to flies attacked by L. heterotoma. The host protective effects exhibited by Spiroplasma and Wolbachia are additive and may provide the conditions for such cotransmitted symbionts to become mutualists. Occurrence of Spiroplasma-mediated protection against distinct parasitoids in divergent Drosophila hosts suggests a general protection mechanism. PMID:24281548

  8. Splinkerette PCR for mapping transposable elements in Drosophila.

    OpenAIRE

    Christopher J Potter; Liqun Luo

    2010-01-01

    Transposable elements (such as the P-element and piggyBac) have been used to introduce thousands of transgenic constructs into the Drosophila genome. These transgenic constructs serve many roles, from assaying gene/cell function, to controlling chromosome arm rearrangement. Knowing the precise genomic insertion site for the transposable element is often desired. This enables identification of genomic enhancer regions trapped by an enhancer trap, identification of the gene mutated by a transpo...

  9. Cadmium resistance in Drosophila: a small cadmium binding substance

    International Nuclear Information System (INIS)

    Jacobson, K.B.; Williams, M.W.; Richter, L.J.; Holt, S.E.; Hook, G.J.; Knoop, S.M.; Sloop, F.V.; Faust, J.B.

    1985-01-01

    A small cadmium-binding substance (CdBS) has been observed in adult Drosophila melanogaster that were raised for their entire growth cycle on a diet that contained 0.15 mM CdCl 2 . Induction of CdBS was observed in strains that differed widely in their sensitivity of CdCl 2 . This report describes the induction of CdBS and some of its characteristics. 17 refs., 4 figs., 1 tab

  10. Caffeine promotes wakefulness via dopamine signaling in Drosophila

    OpenAIRE

    Aleksandra H. Nall; Iryna Shakhmantsir; Karol Cichewicz; Serge Birman; Jay Hirsh; Amita Sehgal

    2016-01-01

    Caffeine is the most widely-consumed psychoactive drug in the world, but our understanding of how caffeine affects our brains is relatively incomplete. Most studies focus on effects of caffeine on adenosine receptors, but there is evidence for other, more complex mechanisms. In the fruit fly Drosophila melanogaster, which shows a robust diurnal pattern of sleep/wake activity, caffeine reduces nighttime sleep behavior independently of the one known adenosine receptor. Here, we show that dopami...

  11. Dopamine modulates metabolic rate and temperature sensitivity in Drosophila melanogaster.

    Directory of Open Access Journals (Sweden)

    Taro Ueno

    Full Text Available Homeothermal animals, such as mammals, maintain their body temperature by heat generation and heat dissipation, while poikilothermal animals, such as insects, accomplish it by relocating to an environment of their favored temperature. Catecholamines are known to regulate thermogenesis and metabolic rate in mammals, but their roles in other animals are poorly understood. The fruit fly, Drosophila melanogaster, has been used as a model system for the genetic studies of temperature preference behavior. Here, we demonstrate that metabolic rate and temperature sensitivity of some temperature sensitive behaviors are regulated by dopamine in Drosophila. Temperature-sensitive molecules like dTrpA1 and shi(ts induce temperature-dependent behavioral changes, and the temperature at which the changes are induced were lowered in the dopamine transporter-defective mutant, fumin. The mutant also displays a preference for lower temperatures. This thermophobic phenotype was rescued by the genetic recovery of the dopamine transporter in dopamine neurons. Flies fed with a dopamine biosynthesis inhibitor (3-iodo-L-tyrosine, which diminishes dopamine signaling, exhibited preference for a higher temperature. Furthermore, we found that the metabolic rate is up-regulated in the fumin mutant. Taken together, dopamine has functions in the temperature sensitivity of behavioral changes and metabolic rate regulation in Drosophila, as well as its previously reported functions in arousal/sleep regulation.

  12. Human Intellectual Disability Genes Form Conserved Functional Modules in Drosophila

    Science.gov (United States)

    Oortveld, Merel A. W.; Keerthikumar, Shivakumar; Oti, Martin; Nijhof, Bonnie; Fernandes, Ana Clara; Kochinke, Korinna; Castells-Nobau, Anna; van Engelen, Eva; Ellenkamp, Thijs; Eshuis, Lilian; Galy, Anne; van Bokhoven, Hans; Habermann, Bianca; Brunner, Han G.; Zweier, Christiane; Verstreken, Patrik; Huynen, Martijn A.; Schenck, Annette

    2013-01-01

    Intellectual Disability (ID) disorders, defined by an IQ below 70, are genetically and phenotypically highly heterogeneous. Identification of common molecular pathways underlying these disorders is crucial for understanding the molecular basis of cognition and for the development of therapeutic intervention strategies. To systematically establish their functional connectivity, we used transgenic RNAi to target 270 ID gene orthologs in the Drosophila eye. Assessment of neuronal function in behavioral and electrophysiological assays and multiparametric morphological analysis identified phenotypes associated with knockdown of 180 ID gene orthologs. Most of these genotype-phenotype associations were novel. For example, we uncovered 16 genes that are required for basal neurotransmission and have not previously been implicated in this process in any system or organism. ID gene orthologs with morphological eye phenotypes, in contrast to genes without phenotypes, are relatively highly expressed in the human nervous system and are enriched for neuronal functions, suggesting that eye phenotyping can distinguish different classes of ID genes. Indeed, grouping genes by Drosophila phenotype uncovered 26 connected functional modules. Novel links between ID genes successfully predicted that MYCN, PIGV and UPF3B regulate synapse development. Drosophila phenotype groups show, in addition to ID, significant phenotypic similarity also in humans, indicating that functional modules are conserved. The combined data indicate that ID disorders, despite their extreme genetic diversity, are caused by disruption of a limited number of highly connected functional modules. PMID:24204314

  13. A computational model of conditioning inspired by Drosophila olfactory system.

    Science.gov (United States)

    Faghihi, Faramarz; Moustafa, Ahmed A; Heinrich, Ralf; Wörgötter, Florentin

    2017-03-01

    Recent studies have demonstrated that Drosophila melanogaster (briefly Drosophila) can successfully perform higher cognitive processes including second order olfactory conditioning. Understanding the neural mechanism of this behavior can help neuroscientists to unravel the principles of information processing in complex neural systems (e.g. the human brain) and to create efficient and robust robotic systems. In this work, we have developed a biologically-inspired spiking neural network which is able to execute both first and second order conditioning. Experimental studies demonstrated that volume signaling (e.g. by the gaseous transmitter nitric oxide) contributes to memory formation in vertebrates and invertebrates including insects. Based on the existing knowledge of odor encoding in Drosophila, the role of retrograde signaling in memory function, and the integration of synaptic and non-synaptic neural signaling, a neural system is implemented as Simulated fly. Simulated fly navigates in a two-dimensional environment in which it receives odors and electric shocks as sensory stimuli. The model suggests some experimental research on retrograde signaling to investigate neural mechanisms of conditioning in insects and other animals. Moreover, it illustrates a simple strategy to implement higher cognitive capabilities in machines including robots. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Drosophila cuticular hydrocarbons revisited: mating status alters cuticular profiles.

    Directory of Open Access Journals (Sweden)

    Claude Everaerts

    2010-03-01

    Full Text Available Most living organisms use pheromones for inter-individual communication. In Drosophila melanogaster flies, several pheromones perceived either by contact/at a short distance (cuticular hydrocarbons, CHs, or at a longer distance (cis-vaccenyl acetate, cVA, affect courtship and mating behaviours. However, it has not previously been possible to precisely identify all potential pheromonal compounds and simultaneously monitor their variation on a time scale. To overcome this limitation, we combined Solid Phase Micro-Extraction with gas-chromatography coupled with mass-spectrometry. This allowed us (i to identify 59 cuticular compounds, including 17 new CHs; (ii to precisely quantify the amount of each compound that could be detected by another fly, and (iii to measure the variation of these substances as a function of aging and mating. Sex-specific variation appeared with age, while mating affected cuticular compounds in both sexes with three possible patterns: variation was (i reciprocal in the two sexes, suggesting a passive mechanical transfer during mating, (ii parallel in both sexes, such as for cVA which strikingly appeared during mating, or (iii unilateral, presumably as a result of sexual interaction. We provide a complete reassessment of all Drosophila CHs and suggest that the chemical conversation between male and female flies is far more complex than is generally accepted. We conclude that focusing on individual compounds will not provide a satisfactory understanding of the evolution and function of chemical communication in Drosophila.

  15. Ack kinase regulates CTP synthase filaments during Drosophila oogenesis.

    Science.gov (United States)

    Strochlic, Todd I; Stavrides, Kevin P; Thomas, Sam V; Nicolas, Emmanuelle; O'Reilly, Alana M; Peterson, Jeffrey R

    2014-11-01

    The enzyme CTP synthase (CTPS) dynamically assembles into macromolecular filaments in bacteria, yeast, Drosophila, and mammalian cells, but the role of this morphological reorganization in regulating CTPS activity is controversial. During Drosophila oogenesis, CTPS filaments are transiently apparent in ovarian germline cells during a period of intense genomic endoreplication and stockpiling of ribosomal RNA. Here, we demonstrate that CTPS filaments are catalytically active and that their assembly is regulated by the non-receptor tyrosine kinase DAck, the Drosophila homologue of mammalian Ack1 (activated cdc42-associated kinase 1), which we find also localizes to CTPS filaments. Egg chambers from flies deficient in DAck or lacking DAck catalytic activity exhibit disrupted CTPS filament architecture and morphological defects that correlate with reduced fertility. Furthermore, ovaries from these flies exhibit reduced levels of total RNA, suggesting that DAck may regulate CTP synthase activity. These findings highlight an unexpected function for DAck and provide insight into a novel pathway for the developmental control of an essential metabolic pathway governing nucleotide biosynthesis. © 2014 The Authors.

  16. The impact of host diet on Wolbachia titer in Drosophila.

    Directory of Open Access Journals (Sweden)

    Laura R Serbus

    2015-03-01

    Full Text Available While a number of studies have identified host factors that influence endosymbiont titer, little is known concerning environmental influences on titer. Here we examined nutrient impact on maternally transmitted Wolbachia endosymbionts in Drosophila. We demonstrate that Drosophila reared on sucrose- and yeast-enriched diets exhibit increased and reduced Wolbachia titers in oogenesis, respectively. The yeast-induced Wolbachia depletion is mediated in large part by the somatic TOR and insulin signaling pathways. Disrupting TORC1 with the small molecule rapamycin dramatically increases oocyte Wolbachia titer, whereas hyper-activating somatic TORC1 suppresses oocyte titer. Furthermore, genetic ablation of insulin-producing cells located in the Drosophila brain abolished the yeast impact on oocyte titer. Exposure to yeast-enriched diets altered Wolbachia nucleoid morphology in oogenesis. Furthermore, dietary yeast increased somatic Wolbachia titer overall, though not in the central nervous system. These findings highlight the interactions between Wolbachia and germline cells as strongly nutrient-sensitive, and implicate conserved host signaling pathways by which nutrients influence Wolbachia titer.

  17. Preference for and learning of amino acids in larval Drosophila

    Directory of Open Access Journals (Sweden)

    Nana Kudow

    2017-03-01

    Full Text Available Relative to other nutrients, less is known about how animals sense amino acids and how behaviour is organized accordingly. This is a significant gap in our knowledge because amino acids are required for protein synthesis − and hence for life as we know it. Choosing Drosophila larvae as a case study, we provide the first systematic analysis of both the preference behaviour for, and the learning of, all 20 canonical amino acids in Drosophila. We report that preference for individual amino acids differs according to the kind of amino acid, both in first-instar and in third-instar larvae. Our data suggest that this preference profile changes across larval instars, and that starvation during the third instar also alters this profile. Only aspartic acid turns out to be robustly attractive across all our experiments. The essentiality of amino acids does not appear to be a determinant of preference. Interestingly, although amino acids thus differ in their innate attractiveness, we find that all amino acids are equally rewarding. Similar discrepancies between innate attractiveness and reinforcing effect have previously been reported for other tastants, including sugars, bitter substances and salt. The present analyses will facilitate the ongoing search for the receptors, sensory neurons, and internal, homeostatic amino acid sensors in Drosophila.

  18. Specialized Cortex Glial Cells Accumulate Lipid Droplets in Drosophila melanogaster

    Science.gov (United States)

    Kis, Viktor; Barti, Benjámin; Lippai, Mónika; Sass, Miklós

    2015-01-01

    Lipid droplets (LDs) are common organelles of the majority of eukaryotic cell types. Their biological significance has been extensively studied in mammalian liver cells and white adipose tissue. Although the central nervous system contains the highest relative amount and the largest number of different lipid species, neither the spatial nor the temporal distribution of LDs has been described. In this study, we used the brain of the fruitfly, Drosophila melanogaster, to investigate the neuroanatomy of LDs. We demonstrated that LDs are exclusively localised in glial cells but not in neurons in the larval nervous system. We showed that the brain’s LD pool, rather than being constant, changes dynamically during development and reaches its highest value at the beginning of metamorphosis. LDs are particularly enriched in cortex glial cells located close to the brain surface. These specialized superficial cortex glial cells contain the highest amount of LDs among glial cell types and encapsulate neuroblasts and their daughter cells. Superficial cortex glial cells, combined with subperineurial glial cells, express the Drosophila fatty acid binding protein (Dfabp), as we have demonstrated through light- and electron microscopic immunocytochemistry. To the best of our best knowledge this is the first study that describes LD neuroanatomy in the Drosophila larval brain. PMID:26148013

  19. Specialized Cortex Glial Cells Accumulate Lipid Droplets in Drosophila melanogaster.

    Science.gov (United States)

    Kis, Viktor; Barti, Benjámin; Lippai, Mónika; Sass, Miklós

    2015-01-01

    Lipid droplets (LDs) are common organelles of the majority of eukaryotic cell types. Their biological significance has been extensively studied in mammalian liver cells and white adipose tissue. Although the central nervous system contains the highest relative amount and the largest number of different lipid species, neither the spatial nor the temporal distribution of LDs has been described. In this study, we used the brain of the fruitfly, Drosophila melanogaster, to investigate the neuroanatomy of LDs. We demonstrated that LDs are exclusively localised in glial cells but not in neurons in the larval nervous system. We showed that the brain's LD pool, rather than being constant, changes dynamically during development and reaches its highest value at the beginning of metamorphosis. LDs are particularly enriched in cortex glial cells located close to the brain surface. These specialized superficial cortex glial cells contain the highest amount of LDs among glial cell types and encapsulate neuroblasts and their daughter cells. Superficial cortex glial cells, combined with subperineurial glial cells, express the Drosophila fatty acid binding protein (Dfabp), as we have demonstrated through light- and electron microscopic immunocytochemistry. To the best of our best knowledge this is the first study that describes LD neuroanatomy in the Drosophila larval brain.

  20. The Persistence of Facultative Parthenogenesis in Drosophila albomicans

    Science.gov (United States)

    Chang, Ching-Ho; Fang, Shu; Chang, Hwei-yu

    2014-01-01

    Parthenogenesis has evolved independently in more than 10 Drosophila species. Most cases are tychoparthenogenesis, which is occasional or accidental parthenogenesis in normally bisexual species with a low hatching rate of eggs produced by virgin females; this form is presumed to be an early stage of parthenogenesis. To address how parthenogenesis and sexual reproduction coexist in Drosophila populations, we investigated several reproductive traits, including the fertility, parthenogenetic capability, diploidization mechanisms, and mating propensity of parthenogenetic D. albomicans. The fertility of mated parthenogenetic females was significantly higher than that of virgin females. The mated females could still produce parthenogenetic offspring but predominantly produced offspring by sexual reproduction. Both mated parthenogenetic females and their parthenogenetic-sexual descendants were capable of parthenogenesis. The alleles responsible for parthenogenesis can be propagated through both parthenogenesis and sexual reproduction. As diploidy is restored predominantly by gamete duplication, heterozygosity would be very low in parthenogenetic individuals. Hence, genetic variation in parthenogenetic genomes would result from sexual reproduction. The mating propensity of females after more than 20 years of isolation from males was decreased. If mutations reducing mating propensities could occur under male-limited conditions in natural populations, decreased mating propensity might accelerate tychoparthenogenesis through a positive feedback mechanism. This process provides an opportunity for the evolution of obligate parthenogenesis. Therefore, the persistence of facultative parthenogenesis may be an adaptive reproductive strategy in Drosophila when a few founders colonize a new niche or when small populations are distributed at the edge of a species' range, consistent with models of geographical parthenogenesis. PMID:25415200