WorldWideScience

Sample records for atom ssa dan

  1. PENENTUAN KANDUNGAN LOGAM Cd DAN Cu DALAM PRODUK IKAN KEMASAN KALENG SECARA SPEKTROFOTOMETRI SERAPAN ATOM (SSA

    Directory of Open Access Journals (Sweden)

    Hellna Tehubijuluw

    2013-05-01

    Full Text Available Determination of cadmium and copper concentration of canned fish have been done. Some canned fished were taken away from three mercks circulating in a market and marked as RS (the 1st sample, NF(2nd sample, and CP(3rd sample. The aim of this research is to determine of  cadmium (Cd and copper (Cu content of canned fish and to compare the content with the standard limit regulated by the Directorate General of Drug and Food Control No: 03725/B/SK/VII/89. Determination of metal concentration was conducted using  atomic absorption spectrophotometer (AAS. It was found that Cd concentrations of RS and  NF samples are 0.1969 mg/kg and0.0448 mg/kg, respecively while for  CP it was not detected. For Cu concentrations of  RS, NF, and CP are 3.3303 mg/kg, 4.6130 mg/kg, 3.3047 mg/kg  respectively. The results indicated that the samples of the canned fishes  have been contaminated with Cd and Cu metals although the levels of those metals are still lower than  the maximum limit regulated by the Directorate General of Drug and Food Control No: 03725/B/SK/VII/89 where the maximum limit for Cd and  Cu are 0,2 mg.kg and 5.0 mg/kg respectively.    

  2. PERANCANGAN DAN PEMBUATAB ALAT UKUR KADAR KROM DALAM AIR DENGAN MENGGUNAKAN PRINSIP SPEKTROSKOPI SERAPAN ATOM

    Directory of Open Access Journals (Sweden)

    Tin Yunis Mahfudloh, Mohammad Tirono

    2012-04-01

    Full Text Available Air adalah bahan yang berperan penting dalam berbagai aspek kehidupan manusia. Air steril dengan kandungan mineral yang cukup dan tidak terpolusi dapat berperan sebagai cairan yang menata keseimbangan tubuh. Apabila air yang dikosumsi manusia telah tercemar oleh sampah dan limbah industri yang mengandung zat-zat kimia/logam berat yang bersifat racun akan berbahaya Seperti kromium/krom dengan kode kimiawi Cr. Penelitian dilakukan untuk membuat alat ukur kadar krom dalam air dengan metode absorpsi dengan instrumen fotometri. Alat ukur kadar krom dalam air menggunakan prinsip spektroskopi serapan atom terdiri dari 2 sistem, yaitu sistem optik dan sistem elektronik. Sistem optik terdiri dari lampu halogen, filter cahaya dengan panjang gelombang 520.4, kuvet dan sensor photodioda. Sedangkan sistem elektronik terdiri dari ADC 0804, MCU AT89S51 dan LCD.  Prinsip keja alat ini adalah cahaya polikromatis yang dipancarkan oleh lampu halogen akan melewati filter sehingga cahaya polikromatis akan bersifat monokromatis. Cahaya akan melewati air dengan kadar krom 0% untuk mereset reagen dan pelarut kemudian dideteksi oleh sensor sehingga menghasilkan data I0. Setelah dideteksi air  akan bergeser ke atas dan sensor bergeser kebelakang untuk mendeteksi sampel yang mempunyai kadar krom tertentu dan menghasilkan data I1. Di dalam sampel ini terjadi penyerapan intensitas cahaya oleh atom krom. Kemudian data I0 dan I1 akan diolah oleh MCU AT89S51 dan ditampilkan pada LCD. Sampel yang digunakan adalah larutan H2O dengan K2Cr2O7 sebanyak 10 sampel dengan variasi kadar 0%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, dan 5%. Larutan krom diperoleh dengan cara mengencerkan 10gr K2Cr2O7 dalam 100ml H2O sehingga didapatkan K2Cr2O7 10% sebagai larutan stok, selanjutnya untuk mendapatkan K2Cr2O7 dengan kadar tertentu, maka diambil dari larutan stok kemudian diencerkan sampai volume 25 ml sesuai dengan rumus M1 V1 =M 2 V2 Hasil pegujian pada sistem elektronik menunjukkan

  3. SSA Disability Claim Data

    Data.gov (United States)

    Social Security Administration — The dataset includes fiscal year data for initial claims for SSA disability benefits that were referred to a state agency for a disability determination. Specific...

  4. Konsentrasi merkuri dan hubungannya dengan indeks kepadatan keong popaco (Telescopium telescopium) di Kao Teluk, Halmahera Utara

    OpenAIRE

    Ardan Samman; Djamar T.F. Lumban Batu; Isdradjad Setyobudiandi

    2014-01-01

    Penelitian ini bertujuan untuk mengetahui konsentrasi merkuri pada air laut, sedimen dan keong popaco (T. telescopium), serta hubungannya dengan indeks kepadatan. Sampling dilakukan pada tiga stasiun yaitu di muara Sungai Balaotin, Cibok dan Kobok. Analisis konsentrasi merkuri menggunakan Spektrofotometer Serapan Atom (SSA). Hasil penelitian menunjukkan konsentrasi merkuri pada air laut pada ketiga stasiun di Perairan Kao Teluk berkisar antara 0,000239-0,000560 ppm. Konsentrasi merkuri pada ...

  5. SSA State Agency Workload Data

    Data.gov (United States)

    Social Security Administration — The dataset is revised and expanded from 4 to 71 data fields. It includes monthly data from October 2000 onwards for SSA disability cases that were referred to the...

  6. Safety precautions in atomic pile control (1962); Securite dans le controle des piles atomiques (1962)

    Energy Technology Data Exchange (ETDEWEB)

    Furet, J. [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1962-07-01

    We have been led to study the problem of safety in atomic pile control as a result of our participation on the one hand in the planning of C.E.A. atomic piles, and on the other hand in the pile safety sub omission considering atomic pile safety of operational or planned C.E.A. piles. We have thus had to consider the wishes occurring in piles during their operation and also their behaviour in the dynamic state The present work deals mainly with the importance of intrinsic safety devices, with the influence of reactivity variations on the power fluctuations during accidental operation, and with the development of robust and reliable safety appliances. The starting p accident has been especially studied both for low-flux piles where a compromise is necessary between the response time of the safety appliances and the statistical fluctuations and for high lux piles where xenon poisoning has an effect on the lower limit of the velocity of reactivity liberation. The desirability has been stressed of automation as a safety factor in atomic pile control. The details required for an understanding of the diagrams of the apparatus are given. (author) [French] Nous avons aborde le probleme de la securite dans le controle des piles atomiques a la suite de notre participation d'une part aux avant rojets de piles atomiques du CE.A. et d'autre part a l'examen au sein de la sous ommission de surete des piles, de la securite des piles du CE.A. en fonctionnement ou en projet. Nous avons ete amenes a nous interesser alors aux risques encourus par les piles pendant leur fonctionnement et par la meme a leur comportement en regime dynamique. Ce travail traite principalement de l'importance des securites intrinseques, de l'influence des variations de reactivite sur les evolutions de puissance en regime d'accident et du developpement d'appareillages de securite robustes et de fonctionnement tres sur. L'accident de demarrage a ete particulierement

  7. Penggunaan Kitosan Magnetik Nanopartikel Untuk Menyerap Logam Kadmium (Cd) Dan TembagA (Cu) Dengan Menggunakan Spektrofotometer Serapan Atom(SSA)

    OpenAIRE

    Daulay, Ainun Mardhiyah

    2011-01-01

    Chitosan is one of the medium which is used as absorber of Cd metal and Cu metal. The making of magnetic chitosan nanoparticle to cause chitosan absorptive power to heavy metal liquid waste and cooler essence by expanding the substance the chitosan itself. The theory of reaction quick kinetic states that the more wider the substance of the essence so the reaction will be the more faster. The solution concentrate variation is needed to find that concentration of how much magnetic chitosan nano...

  8. Digitalisation in atomic pile control (1962); La digitalisation dans le controle des piles atomiques (1962)

    Energy Technology Data Exchange (ETDEWEB)

    Furet, J. [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1962-07-01

    A brief survey is first given of the general theorems of Boodle's algebra and of sequence systems using D.A. Huffmans theory. Some indications are then given concerning the setting-up and the operation of digital computers and also of the principal codes used in digital techniques. It is then shown how digitalisation in atomic pile control makes it possible to use new techniques having the following advantages in particular: greater working safety, a higher degree of centralisation, and suppression of the linear elements. A few examples are given of the application of these techniques to control, particularly with respect to the measurement of the neutronic power and of the period and also of course, to the treatment of the data and the sequence automatisms. The advantage of using digital techniques in the shutdown channels is also examined. Finally a review is given of the technology and the viability of the control devices used. (author) [French] On rappelle d'abord ici les theoremes generaux de l'algebre de Boole et des systemes a sequences en s'appuyant sur la theorie de D.A. Huffmann. On donne ensuite quelques indications sur l'agencement et le fonctionnement des calculateurs digitaux ainsi que les principaux codes utilises dans les techniques digitales. On montre alors comment la digitalisation dans le controle des piles atomiques permet d'utiliser de nouvelles techniques presentant principalement les avantages suivants: securite de fonctionnement plus grande, centralisation plus elevee et suppression des elements lineaires. Un certain nombre d'exemples sont donnes sur l'application de ces techniques au controle, particulierement en ce qui concerne la mesure de la puissance neutronique, de la periode et aussi bien entendu du traitement des informations et des automatismes a sequences. On analyse aussi l'avantage de l'utilisation des techniques digitales dans les chaines de securite. Enfin, un apercu est donne

  9. Dicty_cDB: SSA348 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SS (Link to library) SSA348 (Link to dictyBase) ssa348 - - Contig-U16217-1 SSA348E ...(Link to Original site) SSA348F 650 SSA348Z 416 SSA348P 1066 SSA348E 1046 Show SSA348 Library SS (Link to library) Clone ID SSA3...48 (Link to dictyBase) Atlas ID ssa348 NBRP ID - dictyBase ID - Link to Contig Contig-U1...6217-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SS/SSA3-B/SSA348Q....Seq.d/ Representative seq. ID SSA348E (Link to Original site) Representative DNA sequence >SSA348 (SSA348Q) /CSM/SS/SSA3-B/SSA3

  10. Penetapan Kadar Kalsium Dan Besi Pada Bubur Bayi Instan Yang Beredar Di Kota Medan Secara Spektrofotometri Serapan Atom

    OpenAIRE

    Marpaung, Elsa Elfrida

    2015-01-01

    Kalsium dan besi merupakan mineral yang diperlukan oleh bayi yang sedang bertumbuh dan jumlah yang diperlukan melebihi jumlah yang diperoleh dari ASI. Oleh karena itu, bayi harus mendapat makanan tambahan disamping ASI. Makanan pendamping ASI seperti bubur susu merupakan sumber yang baik bagi beberapa vitamin dan mineral seperti kalsium dan besi dalam kadar tertentu yang cukup untuk memenuhi kebutuhan bayi dalam hal pembentukan tulang dan gigi serta hemoglobin. Tujuan penelitian ini adalah un...

  11. Variational average atom in quantum plasmas; Atome moyen variationnel dans les plasmas quantiques (Variational Average-Atom in Quantum Plasmas, VAAQP)

    Energy Technology Data Exchange (ETDEWEB)

    Piron, R.

    2009-11-15

    Calculations of the radiative properties of dense plasmas are usually based on the concept of an atom in a plasma. Such a concept is often used in average-atom models which constitute a good starting point for more sophisticated statistical approaches. Average-atom models are also directly useful in the calculation of the equation of state and of some transport coefficients. Since Feynman, Metropolis and Teller application of the Thomas-Fermi model to dense plasmas, all attempts to construct a quantum extension of the model have led to some thermodynamic inconsistencies. This work concerns a variational average-atom model of dense plasmas. Contrary to other models, this one gives access to the thermodynamic equilibrium and respects the Virial theorem. In order to resolve the model's equations, a numerical code called VAAQP (Variational Average-Atom in Quantum Plasmas) was written. In particular, it allows us to calculate the equation of state. After a description of other models, we outline the variational model formalism in the framework of the Thomas-Fermi theory, of the non-relativistic quantum mechanics, and of the relativistic quantum mechanics. It is then shown that the variational model fulfills the Virial theorem and the thermodynamic inconsistencies of the other models are explained. The numerical methods which constitute the basis of the VAAQP code are described. Applications of the variational model to equation of state computations are presented and compared to results from other models, such as INFERNO. Comparisons to experiments on the Hugoniot shock adiabats are also shown. (author)

  12. Delivering SSA Capabilities to the Warfighter

    Science.gov (United States)

    van Weezendonk, J.; Sherk, J.; Ryan, T.; McGuire, R.

    The Space Superiority Systems Wing at the Space and Missile Center (SMC/SY) equips US forces with Offensive Counterspace (OCS), Defensive Counterspace (DCS), and Space Situation Awareness (SSA) systems that further enhance space superiority. The Technology Division (SYT) mission is to identify, develop, and transition cutting-edge technologies to the warfighter. SYT invests in the most relevant technologies for SSA, DCS and OCS that enhance SMC/SY's portfolio. This presentation will provide an overview of the SMC/SY SSA Technology being worked and highlights several key programs. The presentation will also highlight how the SMC/SY SSA efforts fit into to a Space Superiority Architecture. SYT executes its own Space Control Technology program line and leverages technologies from various DoD and national laboratories, Federally Funded Research and Development Companies, national agencies, industry and academia to accomplish their mission. The portions of the SY FY06 SSA portfolio that will be discussed are: Precision Metrics, Star Sensor Studies, Multi-mission Deployable Optical System, Intelligent Agent Data Fusion efforts, ESSA ACTD and the GReAT tech demo.

  13. The Josephson effect in atomic contacts; Effect Josephson dans les contacts atomiques

    Energy Technology Data Exchange (ETDEWEB)

    Chauvin, M

    2005-11-15

    The Josephson effect appears when a weak-link establishes phase coherence between two superconductors. A unifying theory of this effect emerged in the 90's within the framework of mesoscopic physics. Based on two cornerstone concepts, conduction channels and Andreev reflection, it predicts the current-phase relation for the most basic weak-link: a single conduction channel of arbitrary transmission. This thesis illustrates this mesoscopic point of view with experiments on superconducting atomic size contacts. In particular, we have focused on the supercurrent peak around zero voltage, put into evidence the ac Josephson currents in a contact under constant bias voltage (Shapiro resonances and photon assisted multiple Andreev reflections), and performed direct measurements of the current-phase relation. (author)

  14. Création d'atomes d'argon excités dans des états de Rydberg en vue de l'étude de l'autodétachement électronique d'ions moléculaires SF6 -6 dans un piège quadrupolaire radiofréquence

    OpenAIRE

    Brincourt, G.; Vedel, M.; Zerega, Y.; André, J; Vedel, F.

    1982-01-01

    Nous décrivons dans ce travail les conditions expérimentales d'obtention d'atomes d'argon excités dans des états de Rydberg par bombardement électronique. Nous précisons certaines de leurs propriétés qu'il est nécessaire de connaître dans la perspective de l'étude de l'auto-détachement électronique d'ions moléculaires SF6-dans un piège quadrupolaire radiofréquence. Ces ions sont créés par interaction, à énergie quasi-nulle, de molécules SF6 avec des atomes excités dans des états de Rydberg. D...

  15. Reuse of sewage sludge ashes (SSA) in cement mixtures: the effect of SSA on the workability of cement mortars.

    Science.gov (United States)

    Monzó, J; Payá, J; Borrachero, M V; Girbés, I

    2003-01-01

    The influence of sewage sludge ash (SSA) on workability of cement mortars has been studied. The irregular morphology of SSA particles produced a decrease of mortar workability. A nonlinear reduction of workability in mortars containing SSA was observed, but when SSA content in mortars was increased the workability reduction was less significant. A superplasticizer is used in order to compensate the decrease of workability produced by SSA. When SSA sized fractions were used, only significant differences in workability for mortars prepared with high water volumes or with the presence of superplasticizer were observed.

  16. Événement et trauma dans Doctor Atomic de John Adams

    Directory of Open Access Journals (Sweden)

    Mathieu Duplay

    2011-04-01

    Full Text Available This article is based on the hypothesis that, by investigating the question of trauma, psychoanalysis has made an innovative contribution to the debate surrounding the concept of event, not so much because of the points explicitly made by Freud and his successors as because the ambiguities, contradictions, and aporias which characterize their discourse reveal some of the previously unseen difficulties inherent in such a discussion. Thus, the writer argues that a theory and/or poetics of event, however alien to the Freudian tradition, would benefit greatly by paying close attention to the lessons it teaches in this respect. John Adams’s 2005 opera Doctor Atomic, written in collaboration with Peter Sellars, is a case in point, not only because it deals with one of the most violent traumas in 20th‑century history—namely the nuclear test conducted at Los Alamos prior to the bombing of Hiroshima and Nagasaki—but also because, in addition to offering a potent meditation on the unthinkable, it reveals that all events, be they historical or aesthetic, call for new and as yet unformulated modes of thought ; as psychoanalysis suggests (sometimes in spite of itself, this is a clear sign of their traumatic nature.Cet article s’appuie sur l’hypothèse que le travail mené par la psychanalyse sur la notion de trauma jette un éclairage novateur sur la question de l’événement, et cela moins en raison des thèses tour à tour avancées que parce que les ambiguïtés, les revirements et les apories qui caractérisent le discours de Freud et de ses successeurs révèlent quelques‑unes des difficultés jusque-là inaperçues que cette problématique soulève ; c’est pourquoi, suppose‑t‑on, toute pensée et toute esthétique de l’événement, si étrangères soient‑elles à la tradition freudienne, ne peuvent aujourd’hui que gagner à méditer les enseignements dont elle est porteuse sur ce point. L’exemple de Doctor Atomic (2005

  17. BMDS/SSA Integrated Sensing Demonstration (BISD)

    Science.gov (United States)

    Turner, T.; Springford, K.; Grimaldi, L.

    2011-09-01

    This demonstration is intended to provide a near-term prototype, leave-behind capability for integrating Ballistic Missile Defense System (BMDS) ground sensors for use in the Space Situational Awareness (SSA) mission. Closed-loop tasking and cueing capability will be implemented, and a demonstration of net-centric space data dissemination using the BMDS sensors will be undertaken using various SSA mission threads. The demonstration is designed to highlight the implications of modifying software and/or hardware at the BMDS command and control node so that cost, risk, and schedule for an operational implementation can be fully understood. Additionally, this demonstration is intended to assess the impacts to both mission areas as a multi-mission, non-traditional sensor capability is integrated into the SSA mission. A successful demonstration will have many leave-behind capabilities and first-of-its-kind achievements to include: a) an extensible SSA operational prototype configuration for BMDS X-Band radars such as AN/TPY-2 and Sea-Based X-Band (SBX) b) a prototype SSA tasking and cueing capability between the Joint Functional Component Command for Space (JFCC Space) Joint Space Operations Center (JSpOC) and the Command, Control, Battle Management, and Communications (C2BMC) Experimental Laboratory (X-Lab), extensible to the Combatant Commands (COCOMS), and out to BMDS sensors c) a capability for a twoway, net-centric, interface for JSpOC space operations, to include translation from net-centric communications to legacy systems and d) processing of BMDS X-Band Radar tracks in the Space Defense Operations Center (SPADOC).

  18. Konsentrasi merkuri dan hubungannya dengan indeks kepadatan keong popaco (Telescopium telescopium di Kao Teluk, Halmahera Utara

    Directory of Open Access Journals (Sweden)

    Ardan Samman

    2014-08-01

    Full Text Available Penelitian ini bertujuan untuk mengetahui konsentrasi merkuri pada air laut, sedimen dan keong popaco (T. telescopium, serta hubungannya dengan indeks kepadatan. Sampling dilakukan pada tiga stasiun yaitu di muara Sungai Balaotin, Cibok dan Kobok. Analisis konsentrasi merkuri menggunakan Spektrofotometer Serapan Atom (SSA. Hasil penelitian menunjukkan konsentrasi merkuri pada air laut pada ketiga stasiun di Perairan Kao Teluk berkisar antara 0,000239-0,000560 ppm. Konsentrasi merkuri pada sedimen berkisar antara 0,003-0,08 ppm. Konsentrasi merkuri pada keong berkisar antara 0,06-0,15 ppm. Berdasarkan Keputusan Menteri Lingkungan Hidup Nomor 51 Tahun 2004 tentang baku mutu air laut, dan US Environmental Protection Agency tentang baku mutu sedimen, serta World Health Organization/Food and Agriculture Organization (WHO/FAO tentang keamanan pangan maka kandungan merkuri pada air, sedimen dan keong popaco masih berada dibawah baku mutu yang ditetapkan. Hasil penelitian juga menunjukkan bahwa terdapat hubungan yang erat antara konsentrasi merkuri pada air dan sedimen dengan indek kepadatan keong popaco, dimana pada kepadatan tinggi maka kandungan merkuri cenderung rendah.

  19. The colour potentials of SSA-containing mortar

    DEFF Research Database (Denmark)

    Kappel, Annemette; Ottosen, Lisbeth M.; Kirkelund, Gunvor Marie

    2015-01-01

    This paper reports an experimental study of aesthetical qualities of mortar containing sewage sludgeash (SSA). SSA is the residue produced at water treatment plants where incineration of the sludge is applied in order to decrease volume and to prevent pathogens from spreading. Today SSA...

  20. The Aesthetical quality of SSA-containing mortar and concrete

    DEFF Research Database (Denmark)

    Kappel, Annemette; Kirkelund, Gunvor Marie; Ottosen, Lisbeth M.;

    2014-01-01

    SSA (sewage sludge ash) is resulting ash from the combustion of sewage sludge, and is a method employed at some water treatment plants in order to decrease volume and hygenize the sludge. Today, SSA is with a few exceptions landfilled. As cement production is responsible for app. 5 % of the total...... global CO2 emission, the advantage of replacing cement with a secondary resource as SSA is obvious. The focus of previous conducted research has mainly been on the chemical, mechanical properties and environmental consequences attached to the use of SSA in construction materials.(Cyr et al., 2007) Thus...... that gives a characteristic red colour. The process of grinding SSA has shown to improve the compressive strength of SSA- containing mortar (Donatello et al. 2010). Thus, in this study SSA was grinded in 6 different intervals ranging from 0 – 10 min, and then added to the mortar mix replacing 20% of cement...

  1. The colour potentials of SSA-containing mortar

    DEFF Research Database (Denmark)

    Kappel, Annemette; Ottosen, Lisbeth M.; Kirkelund, Gunvor Marie;

    2015-01-01

    This paper reports an experimental study of aesthetical qualities of mortar containing sewage sludgeash (SSA). SSA is the residue produced at water treatment plants where incineration of the sludge is applied in order to decrease volume and to prevent pathogens from spreading. Today SSA is with a......This paper reports an experimental study of aesthetical qualities of mortar containing sewage sludgeash (SSA). SSA is the residue produced at water treatment plants where incineration of the sludge is applied in order to decrease volume and to prevent pathogens from spreading. Today SSA...... the possibilities to accentuate the colours of the hardened mortar by using paper cuttings in the production of the samples. The result of the experiments showed that a colour scale can be developed from ground SSA, and that paper may have the potential of providing divers textural qualities when it is used...

  2. KANDUNGAN LOGAM BERAT PADA AIR DAN SEDIMEN DI PERAIRAN SOCAH DAN KWANYAR KABUPATEN BANGKALAN

    Directory of Open Access Journals (Sweden)

    Wahyu Andy Nugraha

    2009-10-01

    Full Text Available Logam berat sangat berbahaya bagi biota laut maupun trofik level diatasnya. Penelitian ini bertujuan untuk mengetahui kandungan logam berat di perairan Socah dan Kwanyar kabupaten Bangkalan. Penelitian ini dilaksanakan selama 3 bulan. Pengambilan sampel air menggunakan botol sampel, sedangkan pengambilan sampel sedimen menggunakan grab sampler. Sampel kemudian dianalisa dengan spektrofotometer serapan atom (SSA. Hasil menunjukkan bahwa kandungan logam berat Cd, Cu, Pb, dan Hg pada air di perairan Socah dan Kwanyar masih dibawah ambang batas baku mutu air laut, sedangkan kandungan logam berat di sedimen melebihi ambang batas baku mutu air laut untuk biota laut. Secara umum, kandungan logam berat di sedimen lebih tinggi dari pada kandungan logam berat di air. Kata Kunci : Logam berat, Pencemaran, Spektrophotometer  HEAVY METALS CONTENTS IN WATER AND SEDIMENT IN KWANYAR AND SOCAH WATER, BANGKALANHeavy metals are very dangerous for marine life as well as the trophic level above. This study aims to determine the content of heavy metals in the waters Socah and Kwanyar Bangkalan. This study was conducted over 3 months. Water sampled using a sample bottle, while sediment samples was taken using a grab sampler. The sample was then analyzed by atomic absorption spectrophotometer (AAS. Results showed that the content of heavy metals Cd, Cu, Pb and Hg in the water in the Socah and Kwanyar waters still below the seawater quality standard limits, whereas the heavy metal content in sediments exceeded the water quality standard for marine sea. In general, the content of heavy metals in sediment is higher than on the water.Keywords: Heavy metals, Pollution, AAS

  3. Atoms

    Institute of Scientific and Technical Information of China (English)

    刘洪毓

    2007-01-01

    Atoms(原子)are all around us.They are something like the bricks (砖块)of which everything is made. The size of an atom is very,very small.In just one grain of salt are held millions of atoms. Atoms are very important.The way one object acts depends on what

  4. Dosage de l'arsenic dans les charges de reformage catalytique par absorption atomique sans flamme Titration of Arsenic by Flameless Atomic Absorption in Catalytic Reforming Feedstocks

    Directory of Open Access Journals (Sweden)

    La Villa F.

    2006-11-01

    Full Text Available Nous décrivons une méthode de dosage de l'arsenic dans les charges de reformage catalytique par absorption atomique sans flamme. Après traitement de l'échantillon par une solution d'iode dans le toluène, l'arsenic est extrait par de l'acide nitrique dilué. L'addition de nitrate de magnésium a pour but de rendre l'arsenic extrait moins volatil. La méthode décrite permet d'atteindre une limite de détection de un microgramme par litre. Elle peut être appliquée à d'autres types de naphtas que les charges de reformage catalytique. This article describes a method for titrating arsenic in catalytic reforming feedstocks by flameless atomic absorption. After the sample has been treated by an iodine solution in toluene, the arsenic is extracted by diluted nitric acid. Magnesium nitrate is added sa as ta make the extracted arsenic less volatile. This method is capable of attaining a detection limit of one microgrom per liter. It con be applied to types of naphthos other than catalytic reforming feedstocks.

  5. Quelques problèmes à petit nombre d'atomes froids dans des guides d'onde.

    OpenAIRE

    2015-01-01

    This manuscript is motivated by the possibility of exploring many quantum regimes using cold atoms: interactions can be tuned very precisely by using Feshbach resonances and low-dimensional regimes can be approached with external potentials. Here, we study some properties of cold atoms trapped into uni- or bidimensional waveguides in the vicinity of a Feshbach resonance. The transition from a tridimensionnal to a low-dimensional system can then be studied by varying the intensity of the confi...

  6. Atomes une exploration visuelle de tous les éléments connus dans l'univers

    CERN Document Server

    Gray, Theodore

    2013-01-01

    Quelle est leur température critique ? Qu'est-ce que la masse atomique, la densité d'un matériau, l'ordre de remplissage des électrons ? Cet ouvrage invite avec pédagogie et humour à un passionnant voyage au pays des éléments, à partir de leur tableau périodique universel. Soutenue par une exploration visuelle qui montre l'élément à l'état pur mais aussi ses composés et ses applications les plus caractéristiques dans la vie quotidienne, cette approche pratique offre une combinaison parfaite de science chimique et de photographies, qui séduira les lecteurs les plus avertis comme tous les autres habitants sensibles de l'univers.

  7. Adding the "Local" Layer to the SSA Picture

    Science.gov (United States)

    Zaman, F.; Duckett, M.

    2012-09-01

    The heritage of Space Situational Awareness (SSA) has been limited to Earth based observation of space to support collision avoidance and space object identification. In part, this has led to reliance on multiple CONUS locations for optical and non-optical ground based observation. It has also led to the specialization of many fields and industries, which are highlighted at conferences like AMOS through discussion of state-of-the-art of observation capabilities. This paradigm alone no longer addresses the current needs for situational awareness of space assets in the changing space culture. Events in recent years have shown that space based sensing capabilities are increasingly critical as complements to ground based radar and optical systems. The SSA community would be better served by adopting the concept of "local" SSA and proliferating technologies to accomplish this. The traditional definition of SSA would expand to encompass an understanding of the immediate natural and manmade environment of the satellite. Multiple insights would be enabled, including baseline trending to support anomaly identification and resolution, catastrophic failure investigation, and anomaly and/or failure attribution. Additionally, protection measures could potentially be enabled to ensure space asset availability. Moving forward with a combination of traditional SSA and "local" SSA capabilities would allow a potential "global" SSA picture to be developed. This enhanced understanding would consist of ground observations in addition to the satellite's "first person" perspective. The potential for an exponentially increased comprehension of SSA is created by this powerful combination. The first step toward demonstrating this combination of SSA knowledge has been achieved with data from the SASSA Technology Demonstration.

  8. Dosage du mercure dans le gaz naturel par absorption atomique sans flammes Mercury Titration in Natural Gas by Flameless Atomic Absorption

    Directory of Open Access Journals (Sweden)

    La Villa F.

    2006-11-01

    Full Text Available Cet article présente la méthode mise au point par l'Institut Français du Pétrole pour déterminer par absorption atomique sans flamme, les traces de mercure métallique contenu dans un gaz naturel. La méthode d'analyse nécessite une extraction du mercure soit sous forme d'ion mercurique en faisant passer le gaz dans une solution oxydante, soit sous forme d'amalgame avec de l'or ou de l'argent. Le premier mode opératoire s'applique aux échantillons dont la concentration en mercure est supérieure à I ttg/Nm3, le second pour des concentrations inférieures à 5 pg/Nm3. Les seuils de détection sont respectivement 10 ng (en solution et 0,3 ng (en amalgame. La répétabilité pour 100 ng de mercure (en amalgame est de ± 7% pour une probabilité de.95 %. En conclusion, dans un échantillon de gaz naturel, compte tenu du volume des prélèvements effectués, il est possible de détecter des concentrations de l'ordre du nanogramme de mercure par mètre cube de gaz. This article describes the method developed by IFP using flameless atomic absorption to determine metallic mercury traces in a natural gas. The analyst method requires a mercury extraction either in the form of mercuric ions by making the gas pass through an oxidizing solution or in the form of an amalgam with gold or silver. The former operating method applies ta samples having a mercury concentration greater than I !ag/Nm3, and the latter for concentrations smaller than 5 (-Lg/Nm3. Detection thresholds are respectively 10 ng (in solution and 0.3 ng (in amalgam. The repeatability for 100 ng of mercury (in amalgam is ± 7 % with a probability of 95%. To conclude, in a sample of natural gas, considering the volume of the samples taken, it is possible ta detect concentrations in the vicinity of one nanogrom of mercury per cubic meter of gas.

  9. Enabling GEODSS for Space Situational Awareness (SSA)

    Science.gov (United States)

    Wootton, S.

    2016-09-01

    The Ground-Based Electro-Optical Deep Space Surveillance (GEODSS) System has been in operation since the mid-1980's. While GEODSS has been the Space Surveillance Network's (SSN's) workhorse in terms of deep space surveillance, it has not undergone a significant modernization since the 1990's. This means GEODSS continues to operate under a mostly obsolete, legacy data processing baseline. The System Program Office (SPO) responsible for GEODSS, SMC/SYGO, has a number of advanced Space Situational Awareness (SSA)-related efforts in progress, in the form of innovative optical capabilities, data processing algorithms, and hardware upgrades. Each of these efforts is in various stages of evaluation and acquisition. These advanced capabilities rely upon a modern computing environment in which to integrate, but GEODSS does not have one—yet. The SPO is also executing a Service Life Extension Program (SLEP) to modernize the various subsystems within GEODSS, along with a parallel effort to implement a complete, modern software re-architecture. The goal is to use a modern, service-based architecture to provide expedient integration as well as easier and more sustainable expansion. This presentation will describe these modernization efforts in more detail and discuss how adopting such modern paradigms and practices will help ensure the GEODSS system remains relevant and sustainable far beyond 2027.

  10. An Extragalactic Spectroscopic Survey of the SSA22 Field

    CERN Document Server

    Saez, C; Bauer, F E; Stern, D; Gonzales, A; Rreza, I; Alexander, D M; Matsuda, Y; Geach, J E; Harrison, F A; Havashino, T

    2015-01-01

    We present VLT VIMOS, Keck DEIMOS and Keck LRIS multi-object spectra of 367 sources in the field of the z ~ 3.09 protocluster SSA22. Sources are spectroscopically classified via template matching, allowing new identifications for 206 extragalactic sources, including 36 z > 2 Lyman-break galaxies (LBGs) and Lyman-a emitters (LAEs), 8 protocluster members, and 94 X-ray sources from the ~ 400 ks Chandra deep survey of SSA22. Additionally, in the area covered by our study, we have increased by ~ 4, 13, and 6 times the number of reliable redshifts of sources at 1.0 3.4, and with X-Ray emission, respectively. We compare our results with past spectroscopic surveys of SSA22 to investigate the completeness of the LBGs and the X-Ray properties of the new spectroscopically-classified sources in the SSA22 field.

  11. TiSSA eelkonverents doktorantidele Tallinnas / Koidu Saame

    Index Scriptorium Estoniae

    Saame, Koidu

    2010-01-01

    Tallinna Ülikoolis toimunud TiSSA doktorantide eelkonverentsist 22.-24. aug. 2010.a. Doktorantide ettekannetest. Esinesid: Hans-Uwe Otto, Andriy Yuryev, Tiina Naarits, Ivar Tröner, Koidu Saame, Maija Jäppinen, Janissa Miettinen

  12. Study of atomic jumps in quasi-crystals; Etude des sauts atomiques dans les quasi-cristaux

    Energy Technology Data Exchange (ETDEWEB)

    Lyonnard, S

    1997-05-07

    The terminology phason used in quasicrystals to refer to atomic jumps. The study of the hopping process is important for the understanding of many basic issues in quasi-crystallography: structure, stability, diffusion, phase transitions between quasicrystals and approximants, mechanical properties. Quasi-elastic neutron scattering allows to find the characteristics of each elementary jump: chemical species involves, relaxation times, activation energies, jump distances and orientations. We performed a series of experiments in the perfect icosahedral phases AlFeCu and AlMnPd, on both powders and single domain samples, using time-of-flight, backscattering and triple axis spectrometers. We evidenced the existence of very fast phason hopping, and studied about ten different atomic jumps. An unusual temperature dependence has been found systematically: each process is assisted by a thermally activated mechanism. The assistance process has to be determined case by case, but the more plausible explanation invokes assistance by phonons or phason clouds. Moreover, the dependence of the quasi elastic signal as a function of the momentum transfer shows that the jumps are local and do not give rise to any long-range diffusion. Phason hopping mainly corresponds to the atom moving forwards and backwards between two energetically equivalent sites. Finally, we have been able to show that the jumps occur along the various quasi-crystalline symmetry axes. (author) 91 refs.

  13. The Critical Role of Experimentation to Further SSA Understanding

    Science.gov (United States)

    Donnelly, P.; Ash, A.

    2016-09-01

    Dstl has developed an approach to explore the challenges of understanding the fundamental principles of SSA through the design and execution of a series of national and international SSA experiments conducted since 2008. These have involved a number of nations within different multi-lateral constructs (such as Combined Space Operations [CSPO] and NATO), and have also served as test case scenarios in support of international SSA research collaboration. It has been found that this experimentally-driven approach has been successful in linking government R&D activities to actual operations with UK MOD; enabling enhanced cooperation with academia through the provision of access to sensors and data; as well as an understanding of the operational imperatives and constraints, not usually available or apparent to these institutions. The experiences of the Dstl team over the past 8 years have yielded a number of lessons learnt that we believe the wider international community would benefit from in relation to effective SSA operations, including how to generate closer relationships between communities across government, industry, academia and operators. This paper describes the overall Dstl approach to a series of SSA experiments designed to inform the UK MOD on the challenges and potential technical solutions related to SSA mission areas. It includes details of the participants, design and execution; and illustrates some major findings of each event to date. Lessons learnt pertinent to the AMOS and wider SSA community are presented that will inform the audience on how this approach may be adopted to meet other SSA scenarios. Finally, it presents the UK roadmap for future experiments identified as possible activities under the CSPO initiative and the EU Space Surveillance and Tracking programme.

  14. ESA SSA Space Weather Services Supporting Space Surveillance and Tracking

    Science.gov (United States)

    Luntama, Juha-Pekka; Glover, Alexi; Hilgers, Alain; Fletcher, Emmet

    2012-07-01

    ESA Space Situational Awareness (SSA) Preparatory Programme was started in 2009. The objective of the programme is to support the European independent utilisation of and access to space research or services. This will be performed through providing timely and quality data, information, services and knowledge regarding the environment, the threats and the sustainable exploitation of the outer space surrounding the planet Earth. SSA serves the implementation of the strategic missions of the European Space Policy based on the peaceful uses of the outer space by all states, by supporting the autonomous capacity to securely and safely operate the critical European space infrastructures. The Space Weather (SWE) Segment of the SSA will provide user services related to the monitoring of the Sun, the solar wind, the radiation belts, the magnetosphere and the ionosphere. These services will include near real time information and forecasts about the characteristics of the space environment and predictions of space weather impacts on sensitive spaceborne and ground based infrastructure. The SSA SWE system will also include establishment of a permanent database for analysis, model development and scientific research. These services are will support a wide variety of user domains including spacecraft designers, spacecraft operators, human space flights, users and operators of transionospheric radio links, and space weather research community. The precursor SWE services to be established starting in 2010. This presentation provides an overview of the ESA SSA SWE services focused on supporting the Space Surveillance and Tracking users. This services include estimates of the atmospheric drag and archive and forecasts of the geomagnetic and solar indices. In addition, the SSA SWE system will provide nowcasts of the ionospheric group delay to support mitigation of the ionospheric impact on radar signals. The paper will discuss the user requirements for the services, the data

  15. DAN PIENAAR GUN PARK LAUNCHES MUSEUM INTO 21ST CENTURY

    Directory of Open Access Journals (Sweden)

    C. Monick

    2012-02-01

    Full Text Available On 14 February 1992 there occurred the official opening of the Dan Pienaar Gun Park at the South African National Museum of Military History. The Gun Park is a newly completed exhibition area created by roofing and repairing the central courtyard between the exhibition's main halls. Lt Gen G L Meiring, SSA, SO, officially opened the Dan Pienaar Gun Park. The statue of Maj Gen D H ('Dan' Pienaar was officially unveiled by his widow (now Mrs Norma Seuffert. Maj Gen Pienaar's children, Fay, Barry and Nelia, were also present, in addition to a very wide representation of the Pienaar family.

  16. Étude de la contribution de la diffusion simple et multiple à l'amplitude des atomes voisins du silicium dans SiO{2} : application à un granulat soumis à la réaction alcali-silice

    Science.gov (United States)

    Boinski, F.; Khouchaf, L.; Verstraete, J.; Tuilier, M. H.

    2004-11-01

    Les amplitudes des différentes distributions lointaines de la transformée de Fourier d'un spectre EXAFS contiennent des informations précieuses pour la caractérisation de l'ordre local autour d'un atome donné. Ces informations sont souvent nécessaires pour la proposition de modèles. Or souvent dans cette zone, les distances inter atomiques correspondent à des libres parcours moyens du photoélectron assez importants. La contribution due à la diffusion multiple perturbe le signal propre de la diffusion simple des atomes diffuseurs. Afin de mieux évaluer l'influence de la diffusion multiple dans nos échantillons constitués de granulats à base de SiO{2} attaqués par la réaction alcali-silice, nous avons calculé les différents parcours de diffusion simple et multiple dans ce composé. Les calculs montrent que lorsque la contribution de la diffusion multiple n'est pas atténuée, l'exploitation des voisins lointains est difficile voir impossible. La modélisation des spectres TF expérimentaux a pu être réalisée uniquement en négligeant la contribution de la diffusion multiple. Ce résultat va nous permettre l'exploitation des voisins lointains en particulier les atomes silicium dans le granulat brut et après dégradation en se basant sur le formalisme de la diffusion simple.

  17. BOREAS TGB-8 Photosynthetic Rate Data over the SSA-OBS and the SSA-OJP

    Science.gov (United States)

    Hall, Forrest G. (Editor); Conrad, Sara K. (Editor); Lerdau, Manuel

    2000-01-01

    The BOREAS TGB-8 team collected data to investigate the controls over NMHC fluxes from boreal forest tree species. This data set includes measurements of photosynthetic rates at mature jack pine and black spruce sites. The data were collected at the OJP and OBS tower flux locations in the BOREAS SSA. These areas contained mature stands of jack pine and black spruce and were the focal sites in the BOREAS program for studies of biosphere/atmosphere exchange from these two habitat types. The OBS site is situated in a black spruce/sphagnum bog with the largest trees 155 years old and 10-15 m tall. The OJP site is in a jack pine forest, 80 to 120 years old, which lies on a sandy bench of glacial outwash with the largest tree standing 15 m tall. Temporally, the data cover the period of 24-May-1994 to 19-Sep-1994. The data are stored in tabular ASCII files.

  18. Clinical and Pathological Roles of Ro/SSA Autoantibody System

    Directory of Open Access Journals (Sweden)

    Ryusuke Yoshimi

    2012-01-01

    Full Text Available Anti-Ro/SSA antibodies are among the most frequently detected autoantibodies against extractable nuclear antigens and have been associated with systemic lupus erythematosus (SLE and Sjögren's syndrome (SS. Although the presence of these autoantibodies is one of the criteria for the diagnosis and classification of SS, they are also sometimes seen in other systemic autoimmune diseases. In the last few decades, the knowledge of the prevalence of anti-Ro/SSA antibodies in various autoimmune diseases and symptoms has been expanded, and the clinical importance of these antibodies is increasing. Nonetheless, the pathological role of the antibodies is still poorly understood. In this paper, we summarize the milestones of the anti-Ro/SSA autoantibody system and provide new insights into the association between the autoantibodies and the pathogenesis of autoimmune diseases.

  19. Review of SSA results on deuteron at COMPASS

    CERN Document Server

    Richter, A

    2008-01-01

    The measuring of transverse single spin asymmetries (SSA) is part of the physics program at COMPASS, a fixed target experiment at CERN SPS. In 2002-04 the COMPASS experiment has collected data with a transversely polarised $^{6}$LiD target using a 160 GeV/c polarised $\\mu^{+}$ beam. By measuring transverse SSA one has access to the transversity distribution function $\\Delta_{T}q(x)$. This is one of the three quark distribution functions, which are needed to fully describe the spin structure of the nucleon at leading twist. At COMPASS three different quark polarimeters have been used to access transversity: the Collins effect, which produces an azimuthal asymmetry in the single hadron distribution, the azimuthal target spin asymmetries of charged hadron pairs and the transverse polarisation of $\\Lambda$ hyperons. In addition the SSA arising from the correlation between the transverse nucleon spin and the quark intrinsic transverse momentum (Sivers effect), was measured, together with six more transverse target...

  20. Preliminary approach of the MELiSSA loop energy balance

    Science.gov (United States)

    Poulet, Lucie; Lamaze, Brigitte; Lebrun, Jean

    Long duration missions, such as the establishment of permanent bases on the lunar surface or the travel to Mars, require a huge amount of life support consumables (e.g. food, water and oxygen). Current rockets are at the moment unable to launch such a mass from Earth. Consequently Regenerative Life Support Systems are necessary to sustain long-term manned space mission to increase recycling rates and so reduce the launched mass. Thus the European and Canadian research has been concentrating on the MELiSSA (Micro-Ecological Life Support System Alternative) project over the last 20 years. MELiSSA is an Environmental Controlled Life Support System (ECLSS), i.e. a closed regenerative loop inspired of a lake ecosystem. Using light as a source of energy, MELiSSA's goal is the recovery of food, water and oxygen from CO2 and organic wastes, using microorganisms and higher plants. The architecture of a ECLSS depends widely on the mission scenario. To compare several ECLSS architectures and in order to be able to evaluate them, ESA is developing a multi criteria evaluation tool: ALISSE (Advanced LIfe Support System Evaluator). One of these criteria is the energy needed to operate the ECLSS. Unlike other criteria like the physical mass, the energy criterion has not been investigated yet and needs hence a detailed analysis. It will consequently be the focus of this study. The main objective of the work presented here is to develop a dynamic tool able to estimate the energy balance for several configurations of the MELiSSA loop. The first step consists in establishing the energy balance using concrete figures from the MELiSSA Pilot Plant (MPP). This facility located at the Universitat Autonoma de Barcelona (UAB) is aimed at the ground demonstration of the MELiSSA loop. The MELiSSA loop is structured on several subsystems; each of them is characterized by supplies, exhausts and process reactions. For the purpose of this study (i.e. a generic tool) the solver EES (Engineering

  1. BOREAS TGB-8 Starch Concentration Data Over the SSA-OBS and the SSA-OJP

    Science.gov (United States)

    Lerdau, Manuel; Hall, Forrest G. (Editor); Conrad, Sara K. (Editor)

    2000-01-01

    The BOREAS TGB-8 team collected data to investigate the controls over NMHC fluxes from boreal forest tree species. This data set includes measurements of starch concentrations in foliar samples at mature jack pine and black spruce sites. The data were collected at the OJP and OBS tower flux locations in the BOREAS SSA. These areas contained mature stands of jack pine and black spruce and were the focal sites in the BOREAS program for studies of biosphere/atmosphere exchange from these two habitat types. The OBS site is situated in a black spruce/sphagnum bog with the largest trees 155 years old and 10-15 m tall. The OJP site is in a jack pine forest, 80 to 120 years old, which lies on a sandy bench of glacial outwash with the largest tree standing 15 m tall. Temporally, the data cover the period of 24-May-1994 to 19-Sep-1994. The data are stored in tabular ASCII files.

  2. [Anti-Ro/SSA antibodies in congenital heart block].

    Science.gov (United States)

    Barrios Prieto, Ernesto; Martínez Ceccopieri, David Alejandro; Panduro Barón, J Guadalupe; Fajardo Dueñas, Sergio

    2012-06-01

    Describe a case of a female patient having anti-Ro/SSA antibodies without any other risk factor or collagen disease. In her first pregnancy a congenital heart block and hydrops in the fetus were diagnosed, and these caused stillbirth. In a second pregnancy an in utero treatment resulted in the succesful delivery of a normal child.

  3. Multi-Scale SSA or Data-Adaptive Wavelets

    Science.gov (United States)

    Yiou, P.; Sornette, D.; Sornette, D.; Sornette, D.; Ghil, M.; Ghil, M.

    2001-05-01

    Using multi-scale ideas from wavelet analysis, the singular-spectrum analysis (SSA) is extended to the study of nonstationary time series, including the case where their variance diverges. The wavelet transform is similar to a local Fourier transform within a finite moving window whose width W, proportional to the major period of interest, is varied to explore a broad range of such periods. SSA, on the other hand, relies on the construction of the lag-correlation matrix C on M lagged copies of the time series over a fixed window width W proportional to M to detect the regular part of the variability in that window in terms of the minimal number of oscillatory components. The proposed multi-scale SSA is a local SSA analysis within a moving window of width Mwavelets; successive eigenvectors of C(M) correspond approximately to successive derivatives of the first mother wavelet in standard wavelet analysis. Multi-scale SSA thus solves objectively the delicate problem of optimizing the analyzing wavelet in the time-frequency domain, by a suitable localization of the signal's correlation matrix. We present several examples of application to synthetic signals with fractal or power-law behavior which mimic selected features of certain climatic or geophysical time series. The method is applied to the monthly values of the Southern Oscillation index (SOI) which captures major features of the El Niño/Southern Oscillation in the Tropical Pacific. Our methodology highlights an abrupt periodicity shift in the SOI near 1960. This abrupt shift between 5 and 3 years supports the Devil's staircase scenario for the El Niño/Southern Oscillation phenomenon.

  4. Spray Atomization Models in Engine Applications, from Correlations to Direct Numerical Simulations Modèles de spray dans les applications moteur, des corrélations aux simulations numériques directes

    Directory of Open Access Journals (Sweden)

    Dos Santos F.

    2011-09-01

    Full Text Available Sprays are among the very main factors of mixture formation and combustion quality in almost every (IC engine. They are of great importance in pollutant formation and energy efficiency although adequate modeling is still on development. For many applications, validation and calibration of models are still an open question. Therefore, we present an overview of existing models and propose some trends of improvement. Models are classified in zero dimensional and dimensional classes ranging from simple formulations aimed at close-to-real-time applications to complete detailed description of early atomization stages. Les sprays sont parmi les principaux facteurs de qualite, dans la formation du melange et la combustion, dans un grand nombre de moteurs (a combustion interne. Ils sont de toute premiere importance dans la formation de polluants et l’efficacite energetique, bien qu’une modelisation adequate soit encore en developpement. Pour un grand nombre d’applications, la validation et la calibration de ces modeles demeurent une question ouverte. Aussi, presentons-nous un apercu des modeles existants et proposons quelques voies d’amelioration. Les modeles sont classes en nondimensionnels et dimensionnels allant de formules simples dediees a des applications proches du temps reel a des descriptions detaillees des premiers stades de l’atomisation.

  5. Single methyl group determines prion propagation and protein degradation activities of yeast heat shock protein (Hsp)-70 chaperones Ssa1p and Ssa2p.

    Science.gov (United States)

    Sharma, Deepak; Masison, Daniel C

    2011-08-16

    Organisms encode multiple homologous heat shock protein (Hsp)-70s, which are essential protein chaperones that play the major role in cellular protein "quality control." Although Hsp70s are functionally redundant and highly homologous, many possess distinct functions. A regulatory motif underlying such distinctions, however, is unknown. The 98% identical cytoplasmic Hsp70s Ssa1p and Ssa2p function differently with regard to propagation of yeast [URE3] prions and in the vacuolar-mediated degradation of gluconeogenesis enzymes, such as FBPase. Here, we show that the Hsp70 nucleotide binding domain (NBD) regulates these functional specificities. We find little difference in ATPase, protein refolding, and amyloid inhibiting activities of purified Ssa1p and Ssa2p, but show that interchanging NBD residue alanine 83 (Ssa1p) and glycine 83 (Ssa2p) switched functions of Ssa1p and Ssa2p in [URE3] propagation and FBPase degradation. Disrupting the degradation pathway did not affect prion propagation, however, indicating these are two distinct processes where Ssa1/2p chaperones function differently. Our results suggest that the primary evolutionary pressure for Hsp70 functional distinctions is not to specify interactions of Hsp70 with substrate, but to specify the regulation of this activity. Our data suggest a rationale for maintaining multiple Hsp70s and suggest that subtle differences among Hsp70s evolved to provide functional specificity without affecting overall enzymatic activity.

  6. On the Complexity of Spill Everywhere under SSA Form

    CERN Document Server

    Bouchez, Florent; Rastello, Fabrice

    2007-01-01

    Compilation for embedded processors can be either aggressive (time consuming cross-compilation) or just in time (embedded and usually dynamic). The heuristics used in dynamic compilation are highly constrained by limited resources, time and memory in particular. Recent results on the SSA form open promising directions for the design of new register allocation heuristics for embedded systems and especially for embedded compilation. In particular, heuristics based on tree scan with two separated phases -- one for spilling, then one for coloring/coalescing -- seem good candidates for designing memory-friendly, fast, and competitive register allocators. Still, also because of the side effect on power consumption, the minimization of loads and stores overhead (spilling problem) is an important issue. This paper provides an exhaustive study of the complexity of the ``spill everywhere'' problem in the context of the SSA form. Unfortunately, conversely to our initial hopes, many of the questions we raised lead to NP-...

  7. Arctic Region Space Weather Customers and SSA Services

    DEFF Research Database (Denmark)

    Høeg, Per; Kauristi, Kirsti; Wintoft, Peter

    Arctic inhabitants, authorities, and companies rely strongly on precise localization information and communication covering vast areas with low infrastructure and population density. Thus modern technology is crucial for establishing knowledge that can lead to growth in the region. At the same time...... it is crucial for the development of the industrial sectors and transportation systems in the Arctic that the digital infrastructure for higher-level information are operating at the standards for modern industrial societies. This can only be done if the precision of the localization information...... and communication can be established without errors resulting from Space Weather effects. An ESA project have identified and clarified, how the products of the four ESA Space Weather Expert Service Centres (SWE) in the ESA Space Situational Awareness Programme (SSA), can contribute to the requirements of SSA...

  8. International and NASA SSA and Safety of Flight Issues

    Science.gov (United States)

    Johnson, Nicholas K,

    2010-01-01

    This presentation reviews the international and NASA interests in Space Situational Awareness (SSA) and space debris as it affects space flight safety. The international interesrt has increased since the collision of the Iridium and Cosmos satellites in 2009. The United Nations Committee on the Peaceful Uses of Outer Space (UN COPUOS) has commenced a multi-year effort to review the long-term sustainability of outer space activities.

  9. 30 kW SSA Test for the KOMAC MEBT

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Seong-Gu; Seol, Kyung-Tae; Kwon, Hyeok-Jung; Kim, Han-Sung; Song, Young-Gi; Cho, Yong-Sub [Korea Atomic Energy Research Institute, Gyeongju (Korea, Republic of)

    2015-10-15

    The 100 MeV proton accelerator is constructed in the KOMAC, KOMAC has been provided with the proton beam for the many industrial applications. In the 100 MeV proton linear accelerator (Linac) for KOMAC, the RF source will power two-accelerator cavities (an RFQ, a DTL1) operated at a frequency of 350 MHz. The low level RF (LLRF) system for 100 MeV proton linear accelerator provides field control including an RFQ and a DTL at 350 MHz. In our system, an accelerating electric field stability of ± 1% in amplitude and ± 1° in phase is required for the RF system. Now a total of 9 RF systems are being operated. To improve the beam quality, the additional RF system for MEBT (Medium Energy Beam Transport) is needed. An addition of a MEBT RF system will reduce loss of beam quantity caused by gab between 20 MeV DTL tank and 100 MeV DTL tank. To this end, we have developed MEBT RF system, and test 30 kW SSA which is key element of the RF system. The transmission lines from the RF control rack to the MEBT tank were installed. RF system for MEBT is being installed. LLRF analog and SSA have been tested.

  10. Investigation of Phase Congruency for SSA Data Reduction

    Science.gov (United States)

    Schultz, D.; Sydney, P.; Flewelling, B.

    2014-09-01

    The space situational awareness (SSA) data reduction pipeline is well established and formulated from our innate understanding of CCDs, optical distortion, and viewing conditions. Proper photometric calibration includes dark frame collection as well as the time-consuming task of on-sky flats which can vary with sky brightness and availability. Proper astrometric calibration includes synchronization of all timing sources, proper mount modeling, and jitter reduction. Once calibrated, further data analysis can include streak reduction, PSF fitting, and star separation with such goals as aperture photometry or dim object characterization. The ideal SSA feature detection algorithm would separate statistically-distinct spatial regions of an image into background, objects, and stars without need for darks/flats. Computer vision feature detection techniques may offer this one-stop-shop approach to data reduction and analysis using just the raw frames. One such technique uses phase congruency: a measure of the strength of how well the Fourier components of an image are in-phase which correlates with features such as edges. We examine a phase congruency approach based upon contrast invariant multi-scale image decomposition using simulated and nighttime Raven data.

  11. BOREAS TE-1 SSA-Fen Soil Profile Nutrient Data

    Science.gov (United States)

    Papagno, Andrea; Anderson, Darwin; Newcomer, Jeffrey A. (Editor); Hall, Forrest G. (Editor)

    2000-01-01

    The BOREAS TE-1 team collected various data to characterize the soil-plant systems in the BOREAS SSA. Particular emphasis was placed on nutrient biochemistry, the stores and transfers of organic carbon, and how the characteristics were related to measured methane fluxes. The overall traniect in the Prince Albert National Park (Saskatchewan, Canada) included the major plant communities and related soils that occurred in that section of the boreal forest. Soil physical, chemical, and biological measurements along the transect were used to characterize the static environment, which allowed them to be related to methane fluxes. Chamber techniques were used to provide a measure of methane production/uptake. Chamber measurements coupled with flask sampling were used to determine the seasonality of methane fluxes. This particular data set contains soil profile measurements of various nutrients at the SSA-Fen site. The data were collected from 23-May to 21-Oct- 1994. The data are stored in tabular ASCII files. The data files are available on a CD-ROM (see document number 20010000884), or from the Oak Ridge National Laboratory (ORNL) Distributed Active Archive Center (DAAC).

  12. PENGEMBANGAN INSTRUMEN ASESMEN DIRI DAN TEMAN SEJAWAT KOMPETENSI BIDANG STUDI PADA MAHASISWA

    Directory of Open Access Journals (Sweden)

    Enny Wijayanti

    2015-10-01

    Kata kunci: asesmen diri dan asesmen teman sejawat, kompetensi fisika   DEVELOPING SELF-ASSESSMENT AND PEER-ASSESSMENT FOR STUDENTS’ SUBJECT-MATTER COMPETENCY Abstract This study aimed to: (1 develop the construct of the Students’ Self-Assessment (SSA and Students’ Peer-Assessment (SPA as supplementary formative assessment on physics teaching and learning, (2 find out the chracteristic of the SSA and SPA, (3 find out the effectivenes and (4 find out the usefulness of the SSA and SPA. The development procedure consisted of two stages: development and validation, based of the spiral model from Cennamo and Kalk, with five phases, namely define, design, demonstrate, develop, and deliver. Content validity was determined by expert judgment through coefficient validity analysis from Aiken, focus group discussion, and Delphi technique. Construct validity was analyzed using software SmartPLS. The subjects of this study were sixth semester students majoring on Physics Education at Palangka Raya University. The result of the study can be concluded as follows: (1 the result of model fit, the GFI values 0.996 and the SRMR values of 0.062, may be taken to indicate good fit, (2 the characteristic of the SSA and SPA consisted of validity, reliability, difficulty index and discriminant index had been verified, (3 the effectiveness of group SSA and SPA is better than group of non SSA and SPA, besides students’ response declares SSA and SPA are reasonably effective, (4 SSA and SPA are very useful as feedback for the learning process, progress, and the learning outcome improvement. Keywords: Peer-and Self-assessment, Physics competency

  13. 20 CFR 411.330 - How will SSA evaluate an EN's performance?

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false How will SSA evaluate an EN's performance...-SUFFICIENCY PROGRAM Employment Networks § 411.330 How will SSA evaluate an EN's performance? (a) We will periodically review the results of the work of each EN to ensure effective quality assurance in the...

  14. Hearings by administrative law judges of certain Medicare claims--HCFA, SSA. General notice.

    Science.gov (United States)

    1988-06-01

    This notice is to advise the public that the Social Security Administration's Office of Hearings and Appeals (SSA, OHA) has recently been given temporary jurisdiction over Medicare Part B, Supplementary Medical Insurance, Administrative Law Judge (ALJ) hearings. Medicare Part A, Hospital Insurance, ALJ hearings and Medicare entitlement matters continue under SSA, OHA's jurisdiction.

  15. MELiSSA Food Characterization general approach and current status

    Science.gov (United States)

    Weihreter, Martin; Chaerle, Laury; Secco, Benjamin; Molders, Katrien; van der Straeten, Dominique; Duliere, Eric; Pieters, Serge; Maclean, Heather; Dochain, Denis; Quinet, Muriel; Lutts, Stanley; Graham, Thomas; Stasiak, Michael; Rondeau Vuk, Theresa; Zheng, Youbin; Dixon, Mike; Laniau, Martine; Larreture, Alain; Timsit, Michel; Aronne, Giovanna; Barbieri, Giancarlo; Buonomo, Roberta; Veronica; Paradiso, Roberta; de Pascale, Stafania; Galbiati, Massimo; Troia, A. R.; Nobili, Matteo; Bucchieri, Lorenzo; Page, Valérie; Feller, Urs; Lasseur, Christophe

    Higher plants play an important role in closed ecological life support systems as oxygen pro-ducers, carbon dioxide and water recyclers, and as a food source. For an integration of higher plant chambers into the MELiSSA (Micro Ecological Life Support System Alternative) loop, a detailed characterization and optimization of the full food production and preparation chain is needed. This implies the prediction and control of the nutritional quality of the final products consumed by the crew, the prediction of the wastes quality and quantity produced along the chain for further waste treatment (MELiSSA waste treatment) and the optimization of overall efficiencies. To reach this goal several issues have to be studied in an integrated manner: the physiological responses of crops to a range of environmental parameters, crop yield efficiencies and respective ratio and composition of edible and inedible biomass, the processability and storability of the produced food and last but not least composition of wastes in view of further degradation (fiber content). Within the Food Characterization (FC) project several compar-ative plant growth bench tests were carried out to obtain preliminary data regarding these aspects. Four pre-selected cultivars of each of the four energy-rich crops with worldwide usage -wheat, durum wheat, potato and soybean -were grown under well-characterized environmental conditions. The different cultivars of each species are screened for their performance in view of a closed loop application by parameter ranking. This comprises the characterization of edi-ble/inedible biomass ratio, nutritional quality, processability and overall performance under the specific conditions of hydroponic cultivation and artificial illumination. A second closely linked goal of the FC project is to develop a mechanistic physiological plant model, which will ease the integration of higher plants compartments in the MELiSSA concept by virtue of its predictive abilities

  16. Gap Filling of Precipitation Data by SSA - Singular Spectrum Analysis

    Science.gov (United States)

    Filho, A. S. F.; Lima, G. A. R.

    2016-10-01

    From the macroscopic standpoint, the precipitation time series is obtained from observation of natural systems rather than in the laboratory. These time series are often full of gaps (missing values) due to the conditions under which the measurements are made. Missing values give rise to various problems in spectral estimation, inhibit statistical analysis and in specifying boundary conditions for numerical models. Hence, gap filling is necessary in environmental science. The aim of this study is to highlight the application of the SSA forecasting algorithm to fill in missing values to real-life time series. It was applied to several monthly precipitation time series recorded over a large savannah area in Brazil. The results are promising and the accuracy and reliability depend on the pattern and relative length of the gaps with respect to the total length of the time series and presence of noise.

  17. Human Decision Processes: Implications for SSA Support Tools

    Science.gov (United States)

    Picciano, P.

    2013-09-01

    Despite significant advances in computing power and artificial intelligence (AI), few critical decisions are made without a human decision maker in the loop. Space Situational Awareness (SSA) missions are both critical and complex, typically adhering to the human-in-the-loop (HITL) model. The collection of human operators injects a needed diversity of expert knowledge, experience, and authority required to successfully fulfill SSA tasking. A wealth of literature on human decision making exists citing myriad empirical studies and offering a varied set of prescriptive and descriptive models of judgment and decision making (Hastie & Dawes, 2001; Baron, 2000). Many findings have been proven sufficiently robust to allow information architects or system/interface designers to take action to improve decision processes. For the purpose of discussion, these concepts are bifurcated in two groups: 1) vulnerabilities to mitigate, and 2) capabilities to augment. These vulnerabilities and capabilities refer specifically to the decision process and should not be confused with a shortcoming or skill of a specific human operator. Thus the framing of questions and orders, the automated tools with which to collaborate, priming and contextual data, and the delivery of information all play a critical role in human judgment and choice. Evaluating the merits of any decision can be elusive; in order to constrain this discussion, ‘rational choice' will tend toward the economic model characteristics such as maximizing utility and selection consistency (e.g., if A preferred to B, and B preferred to C, than A should be preferred to C). Simple decision models often encourage one to list the pros and cons of a decision, perhaps use a weighting schema, but one way or another weigh the future benefit (or harm) of making a selection. The result (sought by the rationalist models) should drive toward higher utility. Despite notable differences in researchers' theses (to be discussed in the full

  18. Processus de corrélations électroniques dans la photoionisation d'atomes et de molécules en couche profonde

    OpenAIRE

    Goldsztejn, Gildas

    2016-01-01

    Synchrotron radiation in the tender x-ray energy range (2-13 keV) allows deep core-shell excitation/ionization of atoms and molecules. The electronic states populated have ultrashort lifetimes, in the order of one femtosecond. The atoms will then relax through emission of a photon or an electron. In this thesis, we used electron spectroscopy as a tool to study the different processes implied by the interaction between the matter and highly energetic radiation. In the first part, the lifetime ...

  19. Lyman continuum leaking AGN in the SSA22 field

    CERN Document Server

    Micheva, Genoveva; Inoue, Akio K

    2016-01-01

    Subaru/SuprimeCam narrowband photometry of the SSA22 field reveals the presence of four Lyman continuum (LyC) candidates among a sample of 14 AGN. Two show offsets and likely have stellar LyC in nature or are foreground contaminants. The remaining two LyC candidates are Type I AGN. We argue that the average LyC escape fraction of high redshift quasars is not likely to be unity, as often assumed in the literature. From direct measurement we obtain the average LyC-to-UV flux density ratio and ionizing emissivity for a number of AGN classes and find it at least a factor of two lower than values obtained assuming f_esc = 1. Comparing to recent Ly{\\alpha} forest measurements, AGNs at redshift z\\sim3 make up at most \\sim20% and as little as 3% of the total ionizing budget. Our results suggest that AGNs are unlikely to dominate the ionization budget of the Universe at high redshifts.

  20. Lyman continuum leaking AGN in the SSA22 field

    Science.gov (United States)

    Micheva, Genoveva; Iwata, Ikuru; Inoue, Akio K.

    2017-02-01

    Subaru/SuprimeCam narrowband photometry of the SSA22 field reveals the presence of four Lyman continuum (LyC) candidates among a sample of 14 AGN. Two show offsets and likely have stellar LyC in nature or are foreground contaminants. The remaining two LyC candidates are Type I AGN. We argue that the average LyC escape fraction of high redshift low luminosity AGN is not likely to be unity, as often assumed in the literature. From direct measurement we obtain the average LyC-to-UV flux density ratio and ionizing emissivity for a number of AGN classes and find it at least a factor of two lower than values obtained assuming f_esc = 1. Comparing to recent Ly{\\alpha} forest measurements, AGNs at redshift z~3 make up at most ~12% and as little as ~5% of the total ionizing budget. Our results suggest that AGNs are unlikely to dominate the ionization budget of the Universe at high redshifts.

  1. Point defects and irradiation in oxides: simulations at the atomic scale; Defauts ponctuels et irradiation dans les oxydes: simulation a l'echelle atomique

    Energy Technology Data Exchange (ETDEWEB)

    Crocombette, J.P

    2005-12-15

    The studies done by Jean-Paul Crocombette between 1996 and 2005 in the Service de Recherches de Metallurgie Physique of the Direction de l'Energie Nucleaire in Saclay are presented in this Habilitation thesis. These works were part of the material science researches on the ageing, especially under irradiation, of oxides of interest for the nuclear industry. In this context simulation studies at the atomic scale were performed on two elementary components of ageing under irradiation : point defects and displacement cascades ; using two complementary simulation techniques : ab initio electronic structure calculations and empirical potential molecular dynamics. The first part deals with point defects : self defects (vacancies or interstitials) or hetero-atomic dopants. One first recalls the energetics of such defects in oxides, the specific features of defects calculations and the expected accuracy of these calculations. Then one presents the results obtained on uranium dioxide, oxygen in silver and amorphous silica. The second part tackles the modelling of disintegration recoil nuclei in various?displacement cascades created by crystalline matrices for actinide waste disposal. Cascade calculations give access to the amorphization mechanisms under irradiation of these materials. One thus predicts that the amorphization in zircon takes place directly in the tracks whereas in lanthanum zirconate, the amorphization proceeds through the accumulation of point defects. Finally the prospects of these studies are discussed. (author)

  2. Phase separation in Al-Zr-Sc alloys: from atomic jumps to ordered precipitates growth; Separation de phase dans les alliages Al-Zr-Sc: du saut des atomes a la croissance de precipites ordonnes

    Energy Technology Data Exchange (ETDEWEB)

    Clouet, E

    2004-07-01

    Zirconium and scandium addition to aluminium alloys leads to the formation of ordered precipitates. This study aims to a better understanding of precipitation kinetics thanks to an approach combining atomic and mesoscopic models. An experimental work has been undertaken too so as to characterize by transmission electron microscopy Al{sub 3}Zr kinetics of precipitation. We mainly focus on the nucleation stage and, in this purpose, an atomic model lying on a rigid lattice has been built for Al-Zr-Sc system allowing us to study precipitation with kinetic Monte Carlo simulations. While keeping the vacancy exchange mechanism for diffusion, we introduce multi-site interactions going thus beyond a simple pair interaction model, and test the influence of these interactions on kinetics of precipitation. The comparison between Monte Carlo simulations and classical nucleation theory shows that mesoscopic models can lead to a good description of the nucleation stage of Al{sub 3}Zr and Al{sub 3}Sc as long as the order tendency of the system has been taken into account to calculate input parameters of these models. For the ternary Al-Zr-Sc system, atomic simulations allow a better understanding of the precipitation kinetic path. It is then possible to extend the field of classical nucleation theory so as to model nucleation in a ternary alloy where the stoichiometry of the precipitates is unknown. (author)

  3. A cutoff phenomenon in accelerated stochastic simulations of chemical kinetics via flow averaging (FLAVOR-SSA)

    Science.gov (United States)

    Bayati, Basil; Owhadi, Houman; Koumoutsakos, Petros

    2010-12-01

    We present a simple algorithm for the simulation of stiff, discrete-space, continuous-time Markov processes. The algorithm is based on the concept of flow averaging for the integration of stiff ordinary and stochastic differential equations and ultimately leads to a straightforward variation of the the well-known stochastic simulation algorithm (SSA). The speedup that can be achieved by the present algorithm [flow averaging integrator SSA (FLAVOR-SSA)] over the classical SSA comes naturally at the expense of its accuracy. The error of the proposed method exhibits a cutoff phenomenon as a function of its speed-up, allowing for optimal tuning. Two numerical examples from chemical kinetics are provided to illustrate the efficiency of the method.

  4. VBA SSA Acc To Fed Rec Online (SAFRO) - Also known as Veterans Benefit Administration Query (VBAQ).

    Data.gov (United States)

    Social Security Administration — The purpose of this query is to provide SSA field office personnel with real-time access to military discharge data from the VA BIRLS database. This information is...

  5. 77 FR 74913 - Privacy Act of 1974, as Amended; Computer Matching Program (Social Security Administration (SSA...

    Science.gov (United States)

    2012-12-18

    ... From the Federal Register Online via the Government Publishing Office SOCIAL SECURITY ADMINISTRATION Privacy Act of 1974, as Amended; Computer Matching Program (Social Security Administration (SSA)/Office of Personnel Management (OPM))--Match Number 1307 AGENCY: Social Security Administration....

  6. GillespieSSA: Implementing the Gillespie Stochastic Simulation Algorithm in R

    Directory of Open Access Journals (Sweden)

    Mario Pineda-Krch

    2008-02-01

    Full Text Available The deterministic dynamics of populations in continuous time are traditionally described using coupled, first-order ordinary differential equations. While this approach is accurate for large systems, it is often inadequate for small systems where key species may be present in small numbers or where key reactions occur at a low rate. The Gillespie stochastic simulation algorithm (SSA is a procedure for generating time-evolution trajectories of finite populations in continuous time and has become the standard algorithm for these types of stochastic models. This article presents a simple-to-use and flexible framework for implementing the SSA using the high-level statistical computing language R and the package GillespieSSA. Using three ecological models as examples (logistic growth, Rosenzweig-MacArthur predator-prey model, and Kermack-McKendrick SIRS metapopulation model, this paper shows how a deterministic model can be formulated as a finite-population stochastic model within the framework of SSA theory and how it can be implemented in R. Simulations of the stochastic models are performed using four different SSA Monte Carlo methods: one exact method (Gillespie's direct method; and three approximate methods (explicit, binomial, and optimized tau-leap methods. Comparison of simulation results confirms that while the time-evolution trajectories obtained from the different SSA methods are indistinguishable, the approximate methods are up to four orders of magnitude faster than the exact methods.

  7. Ultracold lithium-6 atoms in the BEC-BCS crossover: experiments and the construction of a new apparatus; Atomes de lithium-6 ultra froids dans la transition BEC-BCS: experiences et construction d'un montage experimental

    Energy Technology Data Exchange (ETDEWEB)

    Teichmann, M

    2007-09-15

    We use a fermionic gas of Lithium-6 as a model system to study superfluidity. The limiting cases of superfluidity are Bose-Einstein condensation (BEC) and superconductivity, described by the theory by Bardeen, Cooper and Schrieffer (BCS). In Lithium-6 gases, we can explore the whole range between the two cases, known as the BEC-BCS crossover, using a Feshbach resonance. We study the change of the momentum distribution of the gas in this cross-over and compare to theoretical models. We also investigate the hydrodynamic expansion, characteristic for a superfluid gas. We observe a sudden change of the ellipticity of the gas close to the transition to the superfluid phase. Moreover, we localized heteronuclear Feshbach resonances between {sup 6}Li and {sup 7}Li. We are currently constructing a second generation of the experimental setup. An new laser system, based on high power laser diodes, was developed. Changes in the vacuum chamber, including a complete reconstruction of the Zeeman slower, have increased the atomic flux, allowing us to increase the repetition rate of our experiment. Modifications of the geometry of the magnetic traps lead to a higher number of trapped atoms. (author)

  8. Dose enhancement by synchrotron radiation and heavy atoms for the treatment of gliomas; Renforcement de la dose par rayonnement synchrotron et atomes lourds dans le cadre du traitement des gliomes

    Energy Technology Data Exchange (ETDEWEB)

    Bobyk, L.

    2010-11-15

    High grade gliomas are brain tumors of bad prognosis. The standard therapeutic treatment combines surgery, radiotherapy and sometimes use of temozolomide (chemotherapy agent). Healthy tissues radio-sensitivity is a major limitation for radiotherapy treatment. The stereotactic radiotherapy by synchrotron radiation is an innovative technique which combines a low energy radiation (lower 100 keV) with the presence of heavy atoms in the tumoral zone. Such an approach is used to increase the differential of dose deposited in the tumor compared to surrounding healthy tissues. In this study, several compounds containing heavy atoms such as chemotherapy agents: cisplatin/carbo-platin, a DNA base analog: 5-iodo-2'-deoxyuridine (IUdR) and gold nano-particles were considered. The dose enhancement factor induced by the presence of these compounds located for some of them in the extracellular medium or inside the cells for others, was determined using in vitro studies. Thereafter, in vivo studies on rats bearing gliomas, were performed to study the toxicity, the kinetic of distribution and the localization of these compounds together with their potential efficacy of treatment combining intracerebral injection with low energy radiation. (author)

  9. Mise en évidence d'un nouvel anion à huit atomes de bore dans Tl 4[B 8O 12(OH) 4]H 2O

    Science.gov (United States)

    Touboul, Marcel; Bois, Claudette; Amoussou, Denagnon

    1983-07-01

    The structure solution of an hydrated thallium diborate previously formulated Tl 2B 4O 7 · 2H 2O has led to the correct formula Tl 4[B 8O 12(OH) 4]H 2O. This compound is triclinic with a = 7.221(4)Å, b = 9.494(4)Å, c = 15.592(8)Å, α = 114°.86(4), β = 90°.25(7), γ = 99°.70(4), Z = 2, space group P overline1. Independent reflections numbering 1594 were used in the solution and refinement of the structure to R = 0.039 ( Rw = 0.042). The structure contains a new unit [B 8O 12(OH) 4] -, formed by four BO 4( T) tetrahedra and four BO 3(Δ) triangles. In the Christ and Clark classification for borates ( Phys. Chem. Mineral.2, 59 (1977)), the structural formula should be written [B 7O 10(OH) 3 · OBO(OH)] 4-. A fundamental building block with seven boron atoms is found for the first time; the correspondent fully hydrated polyanion is [B 7O 9(OH) 7] 4-; the shorthand notation is 7 : 3 Δ + 4 T. The units [B 7O 10(OH) 3 · OBO(OH)] 4- or 7 : (3 Δ + 4 T) + Δ are linked together to form an infinite chain. Tl + and H 2O are located between the chains.

  10. Pengaruh Medium Tercemar Logam Pb dan Cu terhadap Pertumbuhan Nannochloropsis Salina

    OpenAIRE

    Abd.Wahid Wahab; Yusafir Hala; Fibiyanthy

    2013-01-01

    Penelitian ini dilakukan dengan tujuan memanfaatkan fitoplankton Nannochloropsis salina sebagai biosorben untuk ion logam Pb dan Cu di perairan. Pada penelitian ini pemaparan ion logam Pb dan Cu dengan variasi konsentrasi masing-masing 10, 30, dan 50 ppm dilakukan di awal masa pertumbuhan fitoplankton N. salina dalam Medium Conwy pada salinitas 30 ???, aerasi dan pencahayaan kontinyu, serta suhu ruangan 20 ??C. Konsentrasi ion logam ditentukan dengan menggunakan spektrofotometer serapan atom ...

  11. Pengaruh Variasi Waktu Ultrasonikasi dan Waktu Tahan Hydrothermal terhadap Struktur dan Konduktivitas Listrik Material Graphene

    Directory of Open Access Journals (Sweden)

    Muhammad Junaidi

    2014-03-01

    Full Text Available Graphene merupakan satu lapis atom karbon yang mengalami hibridisasi sp2 membentuk struktur heksagonal 2D. Graphene memiliki potensi besar untuk aplikasi nanoelectronic materials. Penelitian ini bertujuan menganalisis waktu ultrasonikasi dan hidrothermal terbaik untuk mensintesis Graphene. Graphene disintesis dengan metode reduksi Grafit Oksida (GO. Grafit dioksidasi membentuk GO dengan modifikasi metode Hummer. GO diultrasonikasi dengan variasi waktu 60, 90 dan 120 menit. Kemudian proses reduksi GO dilakukan secara kimia dengan penambahan serbuk Zn dan teknik hidrothermal 200 oC dengan variasi waktu tahan 12, 18 dan 24 jam. Analisis morfologi dan struktur graphene dilakukan dengan pengujian SEM dan XRD. Pengujian Iodine Number untuk mengetahui kemampuan graphene menyerap Iodin. Pengujian FTIR untuk mengetahui gugus fungsi yang terbentuk  pada GO dan Graphene. Pengujian Four Point Probe Test (FPP untuk mengukur konduktivitas listrik Graphene. Hasil analsis menunjukkan bahwa graphene hasil ultrasonikasi 120 menit dan Holding 12 jam memiliki struktur Single Layer Graphene (SLG dengan konduktivitas listrik terbaik 0.0105 S/m

  12. Retrieval of snow Specific Surface Area (SSA) from MODIS data in mountainous regions

    Science.gov (United States)

    Mary, A.; Dumont, M.; Dedieu, J.-P.; Durand, Y.; Sirguey, P.; Milhem, H.; Mestre, O.; Negi, H. S.; Kokhanovsky, A. A.

    2012-05-01

    This study describes a method to retrieve snow specific surface area (SSA) from satellite radiance reasurements in mountainous terrain. It aims at comparing different retrieval methods and at addressing topographic corrections of reflectance, namely slope and aspect of terrain and multiple reflections on neighbouring slopes. We use an iterative algorithm to compute reflectance from radiance of the MODerate resolution Imaging Spectrometer (MODIS) with a comprehensive correction of local illumination with regards to topography. The retrieved SSA is compared to the results of the snowpack model Crocus, fed by driving data from the SAFRAN meteorological analysis, over a large domain in the French Alps. We compared SSA retrievals with and without topographic or anisotropy correction, and with a spherical or non-spherical snow reflectance model. The topographic correction enables SSA to be retrieved in better agreement with those from SAFRAN-Crocus. The root mean square deviation is 10.0 m2 kg-1 and the bias is -0.6 m2 kg-1, over 3829 pixels representing seven different dates and snow conditions. The standard deviation of MODIS retrieved data, larger than the one of SAFRAN-Crocus estimates, is responsible for half this RMSD. It is due to the topographic classes used by SAFRAN-Crocus. In addition, MODIS retrieved data show SSA gradients with elevation and solar exposition, physically consistent and in good agreement with SAFRAN-Crocus.

  13. Retrieval of snow Specific Surface Area (SSA from MODIS data in mountainous regions

    Directory of Open Access Journals (Sweden)

    A. Mary

    2012-05-01

    Full Text Available This study describes a method to retrieve snow specific surface area (SSA from satellite radiance reasurements in mountainous terrain. It aims at comparing different retrieval methods and at addressing topographic corrections of reflectance, namely slope and aspect of terrain and multiple reflections on neighbouring slopes. We use an iterative algorithm to compute reflectance from radiance of the MODerate resolution Imaging Spectrometer (MODIS with a comprehensive correction of local illumination with regards to topography. The retrieved SSA is compared to the results of the snowpack model Crocus, fed by driving data from the SAFRAN meteorological analysis, over a large domain in the French Alps. We compared SSA retrievals with and without topographic or anisotropy correction, and with a spherical or non-spherical snow reflectance model. The topographic correction enables SSA to be retrieved in better agreement with those from SAFRAN-Crocus. The root mean square deviation is 10.0 m2 kg−1 and the bias is −0.6 m2 kg−1, over 3829 pixels representing seven different dates and snow conditions. The standard deviation of MODIS retrieved data, larger than the one of SAFRAN-Crocus estimates, is responsible for half this RMSD. It is due to the topographic classes used by SAFRAN-Crocus. In addition, MODIS retrieved data show SSA gradients with elevation and solar exposition, physically consistent and in good agreement with SAFRAN-Crocus.

  14. Anti-Ro/SSA antibodies and cardiac arrhythmias in the adult: facts and hypotheses.

    Science.gov (United States)

    Lazzerini, P E; Capecchi, P L; Laghi-Pasini, F

    2010-09-01

    It is well established that the passive trans-placental passage of anti-Ro/SSA antibodies from mother to foetus is associated with the risk to develop an uncommon syndrome named neonatal lupus (NLE), where the congenital heart block represents the most severe clinical feature. Recent evidence demonstrated that also adult heart, classically considered invulnerable to the anti-Ro/SSA antibodies, may represent a target of the arrhythmogenicity of these autoantibodies. In particular, the prolongation of the QTc interval appears the most frequent abnormality observed in adults with circulating anti-Ro/SSA antibodies, with some data suggesting an association with an increased risk of ventricular arrhythmias, also life threatening. Moreover, even though the association between anti-Ro/SSA antibodies and conduction disturbances is undoubtedly less evident in adults than in infants, from the accurate dissection of the literature data the possibility arises that sometimes also the adult cardiac conduction tissue may be affected by such antibodies. The exact arrhythmogenic mechanisms involved in foetus/newborns and adults, respectively, have not been completely clarified as yet. However, increasing evidence suggests that anti-Ro/SSA antibodies may trigger rhythm disturbances through an inhibiting cross-reaction with several cardiac ionic channels, particularly the calcium channels (L-type and T-type), but also the potassium channel hERG, whose different expression and involvement in the cardiac electrophysiology during lifespan might account for the occurrence of age-related differences.

  15. Anti-Ro/SSA antibodies and cardiac rhythm disturbances: Present and future perspectives.

    Science.gov (United States)

    Santos-Pardo, Irene; Villuendas, Roger; Salvador-Corres, Iñaki; Martínez-Morillo, Melania; Olivé, Alejandro; Bayes-Genis, Antoni

    2015-04-01

    Several case reports, small case series, and original research papers have recently suggested that the action of certain auto-antibodies related to connective tissue diseases may be responsible for significant cardiac rhythm disturbances in adults. The relationship between anti-Ro/SSA antibodies and congenital complete atrioventricular block is well recognized in the fetal heart. Herein we review the emerging evidences of the link to increased levels of anti-Ro/SSA antibodies with rhythm disorders of unknown origin in the adult. Confirmation of this distinct etiology may eventually be the basis for new therapies.

  16. EKSTRAKSI DAN SINTESIS NANOSILIKA BERBASIS PASIR BANCAR DENGAN METODE BASAH

    Directory of Open Access Journals (Sweden)

    Munasir Munasir

    2016-11-01

    Full Text Available Pemurnian, ekstrak dan sintesis nanosilika dari bahan dasar pasir kuarsa yang diambil di daerah Bancar Tuban (utara Pulau Jawa-Indonesia telah dilakukan pada penelitian ini. Secara fisik pasir Bancar Tuban mempunyai bentuk butiran agak kasar dan berwarna kuning cerah. Pasir Bancar mempunyai unsur atom Si (69%Wt, dan unsur atom pengotor dominan adalah Ca (7,5%wt dan K (4,8%wt. Pola difraksinya menunjukan intesistas dominan terjadi pada sudut (2 theta ~26o, fase quartz (paling stabil di alam. Ukuran serbuk pasir yang telah dihaluskan sekitar 5-50 mikrometer. Sintesis nanosilika berbasis pasir alam digunakan metode basah, yang terdiri dari dua proses, yaitu: (1 serbuk pasir diproses dengan metode hidrotermal dengan menggunakan senyawa alkali (NaOH dengan molaritas 7M, hingga diperoleh larutan bening sodium silikat (Na2O.xSiO2, dan (2 larutan sodium silikat berperan sebagai prcursor diproses dengan metode co-presipitasi, larutan sodium silikat dititrasi dengan HCl 2 M hingga diperoleh bubur silicite Si(OH4. Produk akhir berupa serbuk silika dengan struktur amorf dan kristal (quartz; kemurnian (%Wt Si mencapai 95,7% dan analisis marfologi menunjukan bahwa partikel SiO2 cenderung membentuk aglomerasi dan ukuran partikel yang tidak beraglomerasi teramati berukuran sekitar ~58 nm.

  17. 76 FR 71417 - Privacy Act of 1974, as Amended; Computer Matching Program (SSA/Law Enforcement Agencies (LEA...

    Science.gov (United States)

    2011-11-17

    ...), the Master Beneficiary Record SSA/ORSIS (60-0090), the Master Representative Payee File System SSA... program that we are currently conducting with LEA. DATES: We will file a report of the subject matching... in a system of records are matched with other Federal, State, or local government records....

  18. 20 CFR 411.250 - How will SSA evaluate a PM?

    Science.gov (United States)

    2010-04-01

    ...) Business relations; and (5) Customer satisfaction. (b) Our Project Officer will perform the evaluation. The PM will have an opportunity to comment on the evaluation, and then the Contracting Officer will... Evaluation of Program Manager Performance § 411.250 How will SSA evaluate a PM? (a) We will...

  19. The Adsorption Capacity, Pore Structure, and Thermal Behavior of the Modified Clay Containing SSA

    Directory of Open Access Journals (Sweden)

    Haijun Lu

    2016-01-01

    Full Text Available Sewage sludge ash (SSA was created by burning municipal sludge. The potential of clay containing 1 or 3 or 5% SSA was assessed for use as a landfill liner-soil material. Batch adsorption, low temperature N2 adsorption, and TG-DTA tests were performed to evaluate the adsorption capacity, micropore structure, thermostability, and components of soils under Cr(VI and Pb(II chemical solutions. With the increasing amount of SSA in modified clay, the adsorption capacity of Cr(VI and Pb(II to the modified clay increases gradually. After absorption, the pore size of modified clay ranges from 2 nm to 8 nm. With the increasing amount of absorption, the pore volume decreases and the specific surface area increases. With the increasing of adsorption concentration of Cr(VI and Pb(II, the mass loss percentage of modified clay increases to 23.4% and 12.6%, respectively. The modified clay containing SSA may be used as a good barrier material to attenuate contamination of Cr(VI and Pb(II in landfills.

  20. [Neonatal lupus erythematosus: complete atrioventricular block and SSA/Ro antibodies].

    Science.gov (United States)

    Prados, R; Maroto, E; López Longo, J; Monteagudo, I; Carreño, L; García, E J

    1987-06-01

    A newborn boy with complete A-V block and positive anti-SSA/Ro antibodies is reported. Authors comment on pathological findings of neonatal lupus erythematosus. They also review prognosis and clinical course and point out management of these patients before and after birth.

  1. Fis is required for proper regulation of ssaG expression in Salmonella enterica serovar Typhimurium.

    Science.gov (United States)

    Lim, Sangyong; Kim, Byeongkwan; Choi, Hyun-Sook; Lee, Younghoon; Ryu, Sangryeol

    2006-07-01

    Salmonella pathogenicity island 2 (SPI2) encodes a type III secretion system (TTSS) necessary for bacterial survival and replication in intracellular environment of host cells. SPI2 genes are transcribed preferentially after Salmonella enters the host cells. Transcriptional regulation of ssaG encoding the component of SPI2-TTSS apparatus was studied in vivo and in vitro. Fis, one of the major components of bacterial nucleoid, activated the stationary phase-specific expression of ssaG when Salmonella was grown in LB media. Gel-shift and footprinting analysis showed Fis bound to four distinct sites of the ssaG promoter region with different affinities. All four Fis-binding sites were required for timely transcription activation of ssaG after Salmonella entered macrophage cells. Gentamicin protection experiments using bacteria grown to stationary phase prior to infection showed that the ability of the fis mutant strain to replicate within the RAW264.7 macrophage cells was lower than the wild type. These observations confirm that Fis plays an important role in regulations of SPI2 as well as SPI1 for an efficient regulation of the virulence genes.

  2. 77 FR 43639 - Privacy Act of 1974, as Amended; Computer Matching Program (Social Security Administration (SSA...

    Science.gov (United States)

    2012-07-25

    ... From the Federal Register Online via the Government Publishing Office SOCIAL SECURITY ADMINISTRATION Privacy Act of 1974, as Amended; Computer Matching Program (Social Security Administration (SSA.... ACTION: Notice of a renewal of an existing computer matching program that expired on May 10,...

  3. 77 FR 54943 - Privacy Act of 1974, as Amended; Computer Matching Program (Social Security Administration (SSA...

    Science.gov (United States)

    2012-09-06

    ... From the Federal Register Online via the Government Publishing Office SOCIAL SECURITY ADMINISTRATION Privacy Act of 1974, as Amended; Computer Matching Program (Social Security Administration (SSA.... ACTION: Notice of a renewal of an existing computer matching program that will expire on October 1,...

  4. The MELiSSA Pilot Plant Facility: Objectives and Integration Strategy

    Science.gov (United States)

    Gødia, F.; Pérez, J.; Albiol, J.; Lasseur, C.; Lamaze, B.; Ordónez, L.

    MELiSSA Micro-Ecological Life Support System Alternative is a closed artificial ecosystem intended as a tool for the development of a bio-regenerative life support system for long-term manned missions i e planetary base For its study and implementation the MELiSSA loop has been divided in five interconnected compartments organized in three different loops solid liquid and gas This compartments are microbial bioreactors and higher plant chambers The MELiSSA Pilot Plant facility an ESA External Laboratory located at Universitat Aut o noma of Barcelona has been conceived to achieve a preliminary terrestrial demonstration of the MELiSSA concept at pilot scale using animals as a model to substitute the crew The experience gained in the operation of such a facility will be highly relevant for planning future life support systems in Space In order to fulfill this challenging objective a number of steps have to be covered from the individual design of each compartment to the continuous operation of the complete loop with all compartments interconnected operating in sterile conditions in controlled conditions and in a biosafe manner A new site for the MELISSA Pilot Plant facility has been recently completed to host the final integration of the complete loop The contribution will cover the general design aspects of the loop including the current state of the different compartments and their interconnection with solid liquid and gas loops and the future plans of how these different elements will be integrated to achieve the final

  5. Establishment of Stable SSA/Ro52 Gene Silencing Cell Lines by Lentiviral Vectors%通过慢病毒载体构建SSA/Ro52稳定基因沉默细胞系

    Institute of Scientific and Technical Information of China (English)

    郭娟; 周炜

    2014-01-01

    Objective ToestablishthestableSSA/Ro52genesilencingcelllinesbylentiviralvestorsexpressing RNA interference molecule which should be powerful tools facilitating the study of SSA/Ro52 function. Methods Four specific sequences of SSA/Ro52 (clone 1 TGGCATGGTCTCCTTCTACAA;clone 2 CTGCCT-TCTTTATGGGACTTA;clone 9 TGAGAAGTTGGAAGTGGAAAT;clone 1 1 AGTTATCCTATGGTCCTGG-GT)and unrelated control sequence S were cloned into lentiviral vector pLKO-puro,which could express short hairpin RNA (shRNA)and inhibit expression of specific gene by RNA interference mechanism. Clone 1,2,9,11 which expressing SSA/Ro52 specific sequences and control clone S were packed with pGag-Pol and pVSV-G respectively,then 293 T cells were co-transfected. Culture medium containing virus particles were collected. The viral particles which expressing specific sequences SSA/Ro52 and unrelated control sequences were used to infected Hela cells,after antibiotic selection,stable cell lines were established. We used GAPDH as an internal control in real-time PCR for the detecting of SSA/Ro52 mRNA expression. Immunoblot was performed to detect SSA/Ro52 protein expression. The degree of gene expression inhibition was represented by the ratio of SSA/Ro52 expression level in Clone1,2,9,11 transfected cells and that in cloneS.Results LentiviruseffectivelyinfectedHelacells,thevectorDNAcontainingshRNAexpressing cassette were integrated into the cellullar gemone and stable cell lines were established. After antibiotics screening for 3 days,compared to transfected cells,the control clone S,the mRNA level of SSA/Ro52 of the transfected cells Clone 1,2,9,11 were 25. 5%,31. 2%,13. 0% and 77. 2%,respectively. While the protein level of SSA/Ro52 in the experimental group were 5%,50%,10%and 80%. After 4 weeks of culture,SSA/Ro52 protein expression did not change significantly. After stimulated by interferonα(IFN-α), the transfected cells with control clone expressed increased level of SSA/Ro52 protein;while the protein level

  6. Anti-TNFa treatment in patients with rheumatoid arthritis and anti-Ro/SSA antibodies

    Directory of Open Access Journals (Sweden)

    P. Airò

    2011-09-01

    Full Text Available Objective: To analyse clinical efficacy, onset of new autoantibodies or symptoms of autoimmune disease in patients affected by rheumatoid arthritis with anti-Ro/SSA treated with anti-TNFa agents. Methods: Six anti-Ro/SSA positive subjects with RA were studied every six months until 24th month of treatment in order to detect ANA titer (IFI, anti-dsDNA (Farr, anti-cardiolipin and anti-beta2glycoprotein I (ELISA, anti-ENA (CIE. The titre of anti-Ro/SSA were analysed by ELISA. Four patients were diagnosed as overlap RA/SS. Results: Six female patients (mean age 58ys, SD 9.8ys, with long-standing RA (mean 7ys, range 5-22 ys were treated with anti-TNFa agents for a mean of 31 months (SD: 20.4 m: 4 with Infliximab and 2 with Etanercept. All the patients showed a significant reduction of DAS until 24th month (p<0.006 with stability of sicca symptoms. The titer of ANA and anti-Ro/SSA was stable, while 4 subjects developed anti-dsDNA at low titer within 6-12 months. One patient withdrawn the treatment, because of lupus-like features; another one, with HCV hepatitis, interrupted Etanercept because of elevation of liver enzymes. No anticardiolipin or antibeta2GPI antibodies were detected. One subject with RA-SS also presented a primary biliary cirrhosis: clinical and histological features of cholangitis remained stable during Etanercept treatment. Conclusions: Anti-TNFa treatment showed good efficacy and safety in anti-Ro/SSA positive patients with RA. Anti-ds- DNA antibodies at low titer appeared in most patients while the onset of lupus-like disease could be considered a rare event also in RA patients with a rich autoimmune repertoire.

  7. Analisis Kebijakan dan Efektivitas Organisasi

    Directory of Open Access Journals (Sweden)

    Amir Syarifudin Kiwang

    2015-05-01

    Full Text Available Penerapan Peraturan Gubernur Nusa Tenggara Timur Nomor 8 Tahun 2011 tentang Organisasi dan Tata Kerja Unit Pelaksana Teknis Pendidikan dan Pelatihan Koperasi dan Usaha Mikro Kecil dan Menengah pada Dinas Koperasi dan Usaha Mikro Kecil dan Menengah Provinsi Nusa Tenggara Timur adalah dalam rangka untuk meningkatkan efektivitas kerja organisasi pada UPT Diklat Koperasi dan UMKM. Penelitian ini berusaha untuk melihat dampak kebijakan organisasi terhadap efektivitas organisasi dengan menggunakan enam elemen variabel dari kebijakan dan praktik manajemen. Keenam elemen tersebut adalah penetapan tujuan strategis, pencarian dan pemanfaatan sumber daya, lingkungan prestasi, proses komunikasi, kepemimpinan dan pengambilan keputusan, serta adaptasi dan inovasi organisasi. Penelitian kualitatif ini menggunakan pendekatan studi kasus. Teknik analisis data yang digunakan adalah analisis data model Miles dan Huberman, yang terdiri atas reduksi data, display/penyajian data, dan kesimpulan/verifikasi. Hasil penelitian menunjukkan bahwa efektivitas organisasi pada UPT Diklat koperasi dan UMKM belum berjalan secara baik, hal ini dapat dilihat dari beberapa hal antara lain, belum adanya tenaga spesialisasi pengelola diklat dan tenaga khusus (sarjana di bidang perkoperasian dan kondisi lingkungan kerja (lingkungan prestasi pada UPT Diklat koperasi dan UMKM yang belum efektif. Penempatan pegawai juga belum tepat, mutasi ke UPT Diklat Koperasi dan UMKM tidak memperhatikan latar belakang pendidikan dan spesialisasi/keahlian pegawai sehingga membutuhkan waktu dalam proses penyesuaian serta menurunkan jumlah pelaksanaan diklat dikarenakan keterbatasan alokasi dana.

  8. Keratoacanthoma Dan Perawatannya

    OpenAIRE

    Indah Heriyanti

    2008-01-01

    Keratoacanthoma adalah suatu tumor jinak yang berasal dari jaringan epitel dan biasanya di jumpai pada permukaan kulit yang umumnya terjadi pada bagian kulit yang sering terkena sinar matahari dimana tumor ini dapat sembuh dengan spontan. Lesi ini biasanya berawal sebagai makula yang kecil yang berwarna merah dan kemudian menjadi papula yang kokoh dan bersisik pada permukaanya. Papul ini dengan cepat membesar selama 2 sampai 8 minggu. Pada awalnya berbentuk bulat atau oval,kokoh menonjol ...

  9. Phenotypic and chemotypic studies using Arabidopsis and yeast reveal that GHB converts to SSA and induce toxicity.

    Science.gov (United States)

    Mekonnen, Dereje Worku; Ludewig, Frank

    2016-07-01

    γ-Hydroxybutyric acid (GHB) is a naturally occurring compound. It is detected in organisms such as yeasts, plants and mammals. GHB is produced from the reduction of succinic semialdehyde (SSA) by the activity of GHB dehydrogenase. Arabidopsis genome contains two GHB dehydrogenase encoding genes. The accumulation of GHB in ssadh mutants led to the speculation that GHB is the cause of aberrant phenotypes. Conversely, the accumulation of GHB in Arabidopsis plants subjected to abiotic stresses was described as a way of avoiding SSA induced damage. To resolve these contrasting views on GHB, we examined the effect of exogenous GHB and SSA on the growth of yeast and Arabidopsis plants. GHB concentrations up to 1.5 mM didn't affect shoots of Arabidopsis plants; however, root growth was inhibited. In contrast, 0.3 mM SSA has severely affected the growth of plants. Treatment of yeast wild-type strain with 10 mM SSA and 10 mM GHB didn't affect the growth. However, the growth of yeast uga2 mutant was greatly inhibited by the same concentration of SSA, but not GHB. Metabolic analysis and enzyme activity assay on native gel showed that Arabidopsis, but not yeast, possesses a GHB dehydrogenase activity that converts GHB back to SSA. The enzymatic assay has also indicated the existence of an additional GHB dehydrogenase encoding gene(s) in Arabidopsis genome. Taken together, we conclude that GHB is less toxic than SSA. Its accumulation in ssadh mutants and during abiotic stresses is a response to avoid the SSA induced damage.

  10. DEPRESI DAN GANGGUAN TIDUR

    Directory of Open Access Journals (Sweden)

    Wayan Eko Radityo

    2012-12-01

    Full Text Available Depresi merupakan gangguan mood berupa kesedihan yang intens, berlangsung dalamwaktu lama, dan mengganggu kehidupan normal yang insidennya semakin meningkatseiring dengan meningkatnya tekanan hidup. Tahun 2020, depresi diperkirakanmenempati urutan kedua penyakit di dunia. Gejala-gejala depresi terdiri dari gangguanemosi, gangguan kognitif, keluhan somatik, gangguan psikomotor, dan gangguanvegetatif. Salah satu gejala depresi yang muncul adalah gangguan tidur yang bisaberupa insomnia, bangun secara tiba-tiba, dan hipersomnia. Hal ini disebabkan olehgangguan neurotransmiter dan regulasi hormon. Selain sebagai gejala depresi, gangguantidur juga bisa merupakan penyebab depresi. Beberapa penelitian memberikanhubungan gangguan tidur dapat meningkatkan risiko depresi di kemudian hari.

  11. MELiSSA Pilot Plant: A facility for ground demonstration of a closed life support system

    Science.gov (United States)

    Godia, Francesc; Fossen, Arnaud; Peiro, Enrique; Gerbi, Olivier; Dussap, Gilles; Leys, Natalie; Arnau, Carolina; Milian, Ernest

    MELiSSA (Micro Ecological Life Support System Alternative) is an international collaborative effort focused on the development of a Life Support System for long-term Space missions. The goals of the MELiSSA loop are the recovery of food, water and oxygen from wastes, i.e. CO2 and organic wastes, using light as a source of energy. It is conceived as a series of compartments, each one performing a specific function within this cycle, inspired in the terrestrial ecological systems. Each one of the compartments is colonized with specific bacteria or higher plants depending on its dedicated function. Therefore, its design and operational conditions should guarantee that only a given specific biological activity takes place in each compartment. Moreover, this has to be done in a controlled manner, both at the subsystems level (i.e., compartments) and at the overall system level (i.e., complete loop). In order to achieve the complete operation of such a Closed Ecological System, in a first step each compartment has to be developed at individual level, and its operation demonstrated under its associated control law. In a second step, the complete loop needs to be integrated by the connection of the different compartments in the gas, loop and solid phases. An extensive demonstration of MELiSSA loop under terrestrial conditions is a mandatory step in the process of its adaptation to space. This is the main goal of the MPP. The demonstration scenario for the MPP is the respiration equivalent of a human being, and production of 20 percent of the diet of one person. To serve this goal, the different compartments of the MELiSSA loop have been designed and sized at the pilot scale level, and further characterized. Nowadays, the focus of the MELiSSA Pilot Plant is on the integration of its compartments. To this end, the integration challenge is concentrated in three compartments devoted to the following functions: nitrification (Compartment 3, an axenic co-culture of Nitrosomonas

  12. Remote Ultra-low Light Imaging (RULLI) For Space Situational Awareness (SSA): Modeling And Simulation Results For Passive And Active SSA

    Energy Technology Data Exchange (ETDEWEB)

    Thompson, David C [Los Alamos National Laboratory; Shirey, Robert L [Los Alamos National Laboratory; Roggemann, Michael C [MICH TECH UNIV; Gudimetla, Rao [AFRL

    2008-01-01

    Remote Ultra-Low Light Imaging detectors are photon limited detectors developed at Los Alamos National Laboratories. RULLI detectors provide a very high degree of temporal resolution for the arrival times of detected photoevents, but saturate at a photo-detection rate of about 10{sup 6} photo-events per second. Rather than recording a conventional image, such as output by a charged coupled device (CCD) camera, the RULLI detector outputs a data stream consisting of the two-dimensional location, and time of arrival of each detected photo-electron. Hence, there is no need to select a specific exposure time to accumulate photo-events prior to the data collection with a RULLI detector this quantity can be optimized in post processing. RULLI detectors have lower peak quantum efficiency (from as low as 5% to perhaps as much as 40% with modern photocathode technology) than back-illuminated CCD's (80% or higher). As a result of these factors, and the associated analyses of signal and noise, we have found that RULLI detectors can play two key new roles in SSA: passive imaging of exceedingly dim objects, and three-dimensional imaging of objects illuminated with an appropriate pulsed laser. In this paper we describe the RULLI detection model, compare it to a conventional CCD detection model, and present analytic and simulation results to show the limits of performance of RULLI detectors used for SSA applications at AMOS field site.

  13. A case study of high sea salt aerosol (SSA) concentrations as a hazard to aviation

    OpenAIRE

    2015-01-01

    Abstract: On the night of 2nd January 2014 an aircraft on approach to Cork airport was required to abort a landing attempt due to sea salt aerosol (SSA) accretion on the windscreen. The salt reduced forward facing visibility to dangerously low levels. This was the first time such an incident was recorded by Irelands Air Accident Investigation Unit. This paper describes the meteorological conditions at the time of the aborted landing approach. Sea salt aerosol formation mechanisms are ela...

  14. Sensor Simulator Supporting the Pilot Data Centres for the Space Situational Awareness (SSA) Preparatory Programme

    Science.gov (United States)

    Sanchez-Ortiz, Noelia; Dominguez-Gonzalez, Raul; Guijarro-Lopez, Nuria; Parrilla-Eudrino, Esther; Rivera-Campos, Andgela; Marina Perez, Eva; Pina Caballero, Fernando; Navarro, Vicente; Wright, Norrie

    2013-08-01

    This paper focuses on SSA's Sensor Simulator (SSIM), and how it is defined to support the testing and evaluation of Sensor Planning System and Data Processing Chain prior to the deployment of real sensors, in the frame of SSA programme. The Sensor Simulator for the Pilot Data Centres reproduces physical models for all system elements involved in the data generation process: observation constraints and strategies (tracking and survey), debris orbit propagation, Near Earth Objects (NEO) orbit propagation, generation of radar, ground based optical and space based optical measurements. A review of the capabilities, main models and associated algorithms is presented in this paper. Examples of the use of SSIM for the simulation of observations of both Space Surveillance and Tracking (SST) and NEO objects are provided, highlighting the differences between these two operational cases. SSIM is designed and implemented to make use of the ESA SIMULUS infrastructure and it will be deployed on top of the Common SSA Integration Framework. A brief description of the architecture of the system is provided.

  15. Pregnancy outcomes in patients with autoimmune diseases and anti-Ro/SSA antibodies.

    Science.gov (United States)

    Brucato, Antonio; Cimaz, Rolando; Caporali, Roberto; Ramoni, Véronique; Buyon, Jill

    2011-02-01

    Anti-Ro/SSA antibodies are associated with neonatal lupus (congenital heart block (CHB), neonatal transient skin rash, hematological and hepatic abnormalities), but do not negatively affects other gestational outcomes, and the general outcome of these pregnancies is now good, when followed by experienced multidisciplinary teams. The prevalence of CHB, defined as an atrioventricular block diagnosed in utero, at birth, or within the neonatal period (0-27 days after birth), in the offspring of an anti-Ro/SSA-positive women is 1-2%, of neonatal lupus rash around 10-20%, while laboratory abnormalities in asymptomatic babies can be detected in up to 27% of cases. The risk of recurrence of CHB is ten times higher. Most of the mothers are asymptomatic at delivery and are identified only by the birth of an affected child. Half of these asymptomatic women develop symptoms of a rheumatic disease, most commonly arthralgias and xerophtalmia, but few develop lupus nephritis. A standard therapy for CHB is still matter of investigation, although fluorinated corticosteroids have been reported to be effective for associated cardiomyopathy. Serial echocardiograms and obstetric sonograms, performed at least every 1-2 weeks starting from the 16th week of gestational age, are recommended in anti-Ro/SSA-positive pregnant women to detect early fetal abnormalities that might be a target of preventive therapy.

  16. Clinical characteristics of children with positive anti-SSA/SSB antibodies.

    Science.gov (United States)

    Chen, Pei-Hsuan; Yang, Yao-Hsu; Lin, Yu-Tsan; Lee, Jyh-Hong; Wang, Li-Chieh; Yu, Hsin-Hui; Chiang, Bor-Luen

    2014-08-01

    This study aimed to characterize the manifestations of clinical symptoms and signs, primary rheumatic diseases, and other autoantibodies in pediatric patients with positive anti-SSA and/or anti-SSB antibodies. Subjects under age 18 with positive anti-SSA and/or anti-SSB antibodies were screened and enrolled in a tertiary hospital in Taiwan. Data were collected via medical records,including age, gender, onset of the primary rheumatic disease, clinical symptoms and signs, and the medication used. Schirmer test for Sjögren's syndrome (SS) screening was performed in all enrolled patients. Among twenty enrolled subjects, seventeen of them had systemic lupus erythematosus; four of them were diagnosed as SS with positive Schirmer test. In addition to antinuclear antibodies and anti-DNA antibodies, other common autoantibodies were anti-RNP antibodies (50 %) and anti-Sm antibodies(30 %). The most common symptoms were arthritis (60 %)followed by malar rash (40 %). In conclusion, we observed that a low proportion of childhood SS (4/20) exists in our patients with positive SSA and/or anti-SSB antibodies. It is suggested that clinicians should focus more on the clinical symptoms in these patients, rather than undertaking invasive diagnostic interventions to rule out Sjögren's syndrome.

  17. Rapid assessment of populations trends of invasive species: Singular Spectrum Analysis (SSA

    Directory of Open Access Journals (Sweden)

    DANA, ED

    2010-01-01

    Full Text Available Singular Spectrum Analysis (SSA is a powerful analytical approach for biodi-versity management. Its main advan-tages are due to its intuitive processing and visualization, since mathematical workflow is conceptually similar to the widely accepted Principal Components Analysis. Detailed analyses of popula-tion trends with mathematical tools are often difficult to achieve for managers by a number of reasons (large numbers or areas monitored, large number of species, insufficient statistics skills, strong knowledge level in demographic analyses, etc.. SSA has been used since the 1970’s in signal processing to clarify signal vs. noisy information, but it has also been used in climate change analy-sis and other developmental areas. Be-sides, SSA is a rapid-learning method for technicians and managers with medium level of mathematical knowledge. Free software in Unix environment is avail-able. Unfortunately, no free and friendly software is available for Win-dows SO. Although R package may offer solutions for really advanced users, it does not fit real work situations for managers of biological invasions. Cater-pillar (Gistat Group, Ltd is by now, the best option found by the author in terms of price, facility for results inter-pretation and time consumed in learn-ing. The main disadvantage is the poor content of tutorial files

  18. Substructure within the SSA22 protocluster at $z\\approx3.09$

    CERN Document Server

    Topping, Michael W; Steidel, Charles C

    2016-01-01

    We present the results of a densely sampled spectroscopic survey of the SSA22 protocluster at $z\\approx 3.09$. Our sample with Keck/LRIS spectroscopy includes 106 Ly$\\alpha$ Emitters (LAEs) and 40 Lyman Break Galaxies (LBGs) at $z=3.05-3.12$. These galaxies are contained within the $9'\\times9'$ region in which the protocluster was discovered, which also hosts the maximum galaxy overdensity in the SSA22 region. The redshift histogram of our spectroscopic sample reveals two distinct peaks, at $z=3.069$ (blue, 43 galaxies) and $z=3.095$ (red, 103 galaxies). Furthermore, objects in the blue and red peaks are segregated on the sky, with galaxies in the blue peak concentrating towards the western half of the field. These results suggest that the blue and red redshift peaks represent two distinct structures in physical space. Although the double-peaked redshift histogram is traced in the same manner by LBGs and LAEs, and brighter and fainter galaxies, we find that nine out of 10 X-ray AGNs in SSA22, and all seven sp...

  19. Sewage sludge ash (SSA in high performance concrete: characterization and application

    Directory of Open Access Journals (Sweden)

    C. M. A. Fontes

    Full Text Available ABSTRACT Sewage sludge originated from the process of treatment of wastewater has become an environmental issue for three main reasons: contains pathogens, heavy metals and organic compounds that are harmful to the environmental and human health; high volumes are daily generated; and shortage of landfill sites for proper disposal. This research deals with the viability study of sewage sludge utilization, after calcination process, as mineral admixture in the production of concrete. High-performance concretes were produced with replacement content of 5% and 10% by weight of Portland cement with sewage sludge ash (SSA. The influence of this ash was analyzed through physical and mechanical tests. Analysis showed that the mixtures containing SSA have lower values of compressive strength than the reference. The results of absorptivity, porosity and accelerated penetration of chloride ions, presents that mixtures containing ash showed reductions compared to the reference. This indicates that SSA provided refinement of the pore structure, which was confirmed by mercury intrusion porosimetry test.

  20. Surviving space flight: case study on MELiSSA's CIII nitrifying compartment

    Science.gov (United States)

    Ilgrande, Chiara; Lasseur, Christophe; Mastroleo, Felice; Paille, Christel; Leys, Natalie; Morozova, Julia; Ilyin, Vyacheslav; Clauwaert, Peter; Christiaens, Marlies E. R.; Lindeboom, Ralph E. F.; Vlaeminck, Siegfried; Prat, Delphine; Arroyo, Jose M. C.; Conincx, Ilse; Van Hoey, Olivier; Roume, Hugo; Udert, Kai; Sas, Benedikt

    2016-07-01

    Space synthetic biology offers key opportunities for long-term space missions. Planets mining, terraformation, space medicine and Life Support technologies would all benefit from an integrative biological approach. However, space is a harsh environment for life: microgravity, temperature, UV and cosmic radiation can affect the health and functionality of microorganisms and plants, possibly preventing the optimal performance of the systems. The European Space Agency's Life Support System (MELiSSA) has been developed as a model for future long term Space missions and Space habitation. MELiSSA is a 5 compartment artificial ecosystem with microorganisms and higher, that aims at completely recycling gas, liquid and solid waste. In this study, the survival and functional activity after Lower Earth Orbit conditions of microbial nitrogen conversions, relevant for MELiSSA's CIII compartment, was tested. Synthetic communities containing Nitrosomonas europeae, Nitrosomonas ureae, Nitrobacter winogradskyi, Nitrospira moscoviensis and Cupriavidus pinatubonensis were exposed to the Lower Earth Orbit conditions of the International Space Station (ISS) for 7 days. Nitrosomonas europeae, Nitrobacter winogradskyi, Cupriavidus pinatubonensis, and three mixed communities (a urine nitrification sludge, a sludge containing aerobic ammonia oxidizing bacteria and anammox bacteria (OLAND), and an aquaculture sludge containing ammonia oxidizing archaea) were exposed to Lower Earth Orbit conditions for 44 days. Survival after both space flights was demonstrated because nitritation, nitratation, denitrification and anammox activity could be restored at a rate comparable to ground storage conditions. Our results validate the potential survival feasibility and suggest future space applications for N-related microorganisms.

  1. Resolving Changing Chemical and Physical Properties of SSA Particle Types during Laboratory Phytoplankton Blooms using Online Single Particle Analysis

    Science.gov (United States)

    Sultana, C. M.; Prather, K. A.; Richardson, R.; Wang, X.

    2015-12-01

    Changes in the chemical composition of sea spray aerosols (SSA) can modify their climate-relevant properties. Recent studies have shown a diverse set of distinct SSA particle types, however there are conflicting reports on how and whether biological activity controls the organic fraction and mixing state of SSA. This study leverages an aerosol time-of-flight mass spectrometer to give an accounting of the temporally resolved mixing state of primary SSA (0.4 - 3 µm vacuum aerodynamic diameter), encompassing 97% of particles detected over the course of laboratory phytoplankton blooms. The influence of biological activity on the climate relevant properties of defined particle types is also investigated. Spatial chemical particle heterogeneity and particularly the surface chemical composition of particles are described along with particle type specific water-particle interactions. These online measurements in tandem with chemical composition could give new insight on the link between seawater chemistry, marine aerosols, and climate properties.

  2. The Adsorption Capacity and Geotechnical Properties of Modified Clay Containing SSA Used as Landfill Liner-Soil Materials

    Directory of Open Access Journals (Sweden)

    Haijun Lu

    2015-01-01

    Full Text Available The potential of clay containing 0~5% sewage sludge ash (SSA is assessed for use as a landfill liner-soil material. Low temperature N2 adsorption, batch adsorption, permeability, and unconfined compressive strength tests are performed to evaluate pore structure, adsorption capacity, hydraulic conductivity, and unconfined compressive strength of the clays. The pore size distribution of the modified clay containing SSA is mainly composed of micropores (<2 nm and mesopores (2~7 nm. With the increasing of SSA from 0% to 5%, the adsorption capacity of Zn(II and Cu(II to the clay increases 37% and 273%, respectively. The hydraulic conductivity of modified clay is from 3.62 × 10−8 to 2.17 × 10−8 cm/s. At SSA = 3%, the unconfined compressive strength of the clay reaches the maximum value of 601.1 kPa. After the clay containing SSA is contaminated by acid and alkali chemical solutions, the amount of mesopores and hydraulic conductivity increase. The adsorption capacity and unconfined compressive strength of contaminated clay decrease about 2∼44% and 25.7∼38.2%, respectively. The modified clay containing SSA can meet the adsorption and geotechnical requirement of landfill liners.

  3. Fisiologi dan Gangguan Keseimbangan Natrium, Kalium dan Klorida serta Pemeriksaan Laboratorium

    Directory of Open Access Journals (Sweden)

    Rismawati Yaswir

    2012-09-01

    Full Text Available AbstrakElektrolit adalah senyawa di dalam larutan yang berdisosiasi menjadi partikel yang bermuatan (ion positifatau negatif. Sebagian besar proses metabolisme memerlukan dan dipengaruhi oleh elektrolit. Konsentrasielektrolit yang tidak normal dapat menyebabkan banyak gangguan. Pemeliharaan tekanan osmotik dan distribusibeberapa kompartemen cairan tubuh manusia adalah fungsi utama empat elektrolit mayor, yaitu natrium (Na+,kalium (K+, klorida (Cl-, dan bikarbonat (HCO3-. Pemeriksaan keempat elektrolit mayor tersebut dalam klinisdikenal sebagai ”profil elektrolit. Natrium adalah kation terbanyak dalam cairan ekstrasel, kalium kation terbanyakdalam cairan intrasel dan klorida merupakan anion terbanyak dalam cairan ekstrasel. Jumlah natrium, kalium danklorida dalam tubuh merupakan cermin keseimbangan antara yang masuk terutama dari saluran cerna dan yangkeluar terutama melalui ginjal. Gangguan keseimbangan natrium, kalium dan klorida berupa hipo- dan hiper-. Hipoterjadibila konsentrasi elektrolit tersebut dalam tubuh turun lebih dari beberapa miliekuivalen dibawah nilai normaldan hiper- bila konsentrasinya meningkat diatas normal.Pemeriksaan laboratorium untuk menentukan kadarnatrium, kalium dan klorida adalah dengan metode elektroda ion selektif, spektrofotometer emisi nyala,spektrofotometer atom serapan, spektrofotometri berdasarkan aktivasi enzim, pemeriksaan kadar klorida denganmetode titrasi merkurimeter, dan pemeriksaan kadar klorida dengan metode titrasi kolorimetrik-amperometrik.Kata kunci: elektrolit, keseimbangan, gangguan keseimbanganAbstractElectrolyte is compound in condensation which is disociation become particle which is charged (ionnegative or positive. Most metabolism processes need and influenced by electrolyte. Electrolyte concentrationwhich abnormal can cause many troubles. Conservancy of osmotic pressure and distribution some human beingbody fluid compartment are especial function four major electrolyte, that is natrium (Na

  4. Findings from the UK and Canadian Space Situational Awareness (SSA) Experimentation during the Relocation of SKYNET 5A Satellite

    Science.gov (United States)

    Ash, A.; Scott, L.; Feline, W.

    2016-09-01

    This paper describes the planning, execution, analysis and lessons identified from a collaborative Space Situational Awareness (SSA) experiment to observe the SKYNET 5A satellite during a series of orbital maneuvers that occurred in the summer of 2015. In March 2015 Airbus Defence and Space (Airbus DS) announced its intention to relocate the SKYNET 5A satellite from the Atlantic to the Asia Pacific region to increase its global coverage; this provided an opportunity to observe this high value asset to explore the challenges and technical solutions related to deep space SSA. Within the UK the Defence Science and Technology Laboratory (Dstl, part of the UK Ministry of Defence) were established as the lead agency to plan the observation campaign utilising operational and emerging experimental SSA capabilities. The campaign was then expanded to involve Canada, the United States and Australia under the auspices of the Combined Space Operations (CSpO) Memorandum of Understanding (MOU) to further explore the coordination of observations between operational systems and potential fusion of data collected using experimental SSA assets. The focus for this paper is the collaborative work between Dstl and Defence Research and Development Canada (DRDC) that featured a period of experimentation to explore methods that enable cross cueing between ground-based and space-based SSA sensors, namely the UK Starbrook facility (located on the island of Cyprus), and NEOSSat/ Sapphire space surveillance satellites located in low-Earth orbit. A number of conclusions and lessons are identified in this paper that seek to inform the wider SSA community on the challenges, potential solutions and benefits of operating a distributed SSA architecture such as the one utilized during this experiment.

  5. Utilisation and Further Development of Space Science Results in the ESA SSA Programme Space Weather Service Network

    Science.gov (United States)

    Glover, Alexi; Luntama, Juha-Pekka; Keil, Ralf

    2016-04-01

    ESA SSA Programme is approaching the end of its second period. Service development activities within the current period aim at advancing the SSA SWE Service Network from the initial utilisation of existing European assets toward development of these and new assets together with the associated coordination infrastructure necessary to provide consistently reliable services. The SSA SWE Service Network is based on a federated architecture where service provision is carried out by Expert Service Centres in the Programme Member States with overall coordination and helpdesk functions provided by a central node and coordination centre located at the Space Pole in Brussels, Belgium. The SSA SWE Service Network builds on the wealth of space weather expertise available within the Member States, and consequently, as the network continues to develop, emphasis will continue to be placed on building services based on demonstrated space science advances in key areas such as those highlighted by the COSPAR-ILWS Space Weather Roadmap, published in 2015. Activities supported by programmes including the ESA technology programmes, EC FP7 and H2020 have all demonstrated promising results, and the SSA SWE Network is actively investigating their potential application to SSA SWE Customer Requirements, and in many cases already adopting these as part of the suite of products provided via the Network to its registered users. This presentation will provide an overview of recent advances in the SSA SWE Service Network, emphasising the utilisation of scientific results within a pre-operational context. The presentation will show the layout of the federated Expert Service Centres, highlighting ongoing and upcoming service developments and provide a perspective on the service development plans for the next phase of the programme.

  6. Dan Performer Mei Lanfang

    DEFF Research Database (Denmark)

    Risum, Janne

    2010-01-01

    The convention of performing female characters (dan characters) in Beijing opera, as practised by its most prominent male performer of female characters Mei Lanfang, and its and his cultural context and aesthetic aim...

  7. Liever kraanwater dan bronwater

    NARCIS (Netherlands)

    Kole, A.P.W.

    2011-01-01

    Een test in het Restaurant van de Toekomst van de invloed van CO2-labels op het aankoopgedrag van consumenten, heeft nog geen duidelijk beeld opgeleverd. Wel pakten mensen vaker kraanwater dan bronwater.

  8. Makna Dan Ideologi Punk

    OpenAIRE

    Daniar Wikan Setyanto

    2015-01-01

    Punk Sebagai sebuah subkultur telah diadaptasi oleh para remaja Indonesia bukan hanya sebagai semangat bermusik, namun merambah sebagai ideologi dan gaya hidup. Punk merupakan warisan budaya dari barat yang awalnya bergerak pada bidang musik, namun lambat lain punk telah menjadi sebuah identitas global yang mewakili para remaja radikal yang memiliki visi anti kemapanan dan anti pemerintah. Selain ideologinya yang kontroversi, punk mempengaruhi dinamika fashion di dunia. Asesoris punk diadapta...

  9. Potential use of sewage sludge ash (SSA as a cement replacement in precast concrete blocks

    Directory of Open Access Journals (Sweden)

    Pérez-Carrión, M.

    2014-03-01

    Full Text Available The present study explored the technological feasibility of re-using sewage sludge ash (SSA as a Portland cement replacement in commercially manufactured pre cast concrete blocks. The blocks analysed were made to the guidelines laid down in Spain’s National Plan for Waste Water Treatment Plant Sludge, 2001–2006, and European Union specifications (CE marking for such products. Performance was compared in three families of blocks, with 0, 10 and 20% SSA. The findings proved that SSA is apt for pre cast concrete block manufacture and that, in addition to the economic and environmental benefits afforded, its use would improve certain of the properties of conventional block.El objetivo de esta investigación es estudiar el uso potencial de las cenizas de lodos de depuradora (CLD, como sustitución del cemento Portland en bloques de hormigón prefabricados, de forma que se pueda lograr una revalorización de este material de desecho mediante este procedimiento. La metodología utilizada en este trabajo se rige por las directrices del Plan Nacional Español de Lodos de Aguas Residuales de 2001–2006, y por las exigencias del Consejo Europeo (marcado CE, que es obligatorio para este tipo de productos. Se han utilizado dos niveles de sustitución de cemento (10% y 20%, y todos los resultados han sido referidos a las muestras control. Los resultados obtenidos muestran que es posible utilizar una sustitución parcial del cemento por CLD, en la fabricación de bloques de hormigón prefabricados, y por lo tanto, se pueden conseguir beneficios económicos y ambientales, así como la mejora de una serie de propiedades.

  10. Transverse Myelitis Associated with Anti-Ro (SSA) Autoantibodies: A Record of Two Cases.

    Science.gov (United States)

    Melikyan, G; Abdelrahman, M H; D'Suoza, A; Akhtar, N; Elzouki, A N; Hammoudeh, M

    2012-01-01

    Transverse myelitis (TM) is an inflammatory process involving a restricted area of the spinal cord. The usual dramatic presentation makes TM a medical emergency. Early detection and aggressive therapy are required in order to improve the prognosis. The association of this unique clinical phenotype and autoantibody provides circumstantial evidence that an autoimmune aetiology might be involved. We describe two cases of TM associated with anti-Ro (SSA) autoantibodies without connective tissue disease manifestations. The two patients were treated successfully with IV steroids and cyclophosphamide.

  11. MELiSSA third compartment: Nitrosomonas europaea and Nitrobacter winogradskyi axenic cultures in bioreactors

    Science.gov (United States)

    Cruvellier, Nelly; Lasseur, Christophe; Poughon, Laurent; Creuly, Catherine; Dussap, Gilles

    Nitrogen is a key element for the life and its balance on Earth is regulated by the nitrogen cycle. This loop includes several steps among which nitrification that permits the transformation of the ammonium into nitrate. The MELiSSA loop is an artificial ecosystem designed for life support systems (LSS). It is based on the carbon and nitrogen cycles and the recycling of the non-edible part of the higher plants and the waste produced by the crew. In this order, all the wastes are collected in the first compartment to degrade them into organic acids and CO2. These compounds are joining the second compartment which is a photoheterotrophic compartment where at the outlet an organic-free medium containing ammonium is produced. This solution will be the substrate of the third compartment where nitrification is done. This compartment has to oxidize the ammonium into nitrate, and this biological reaction needs two steps. In the MELiSSA loop, the nitrification is carried out by two bacteria: Nitrosomonas europaea ATCC® 19718™ which is oxidizing ammonia into nitrite and Nitrobacter winogradskyi ATCC® 25391™ which is producing nitrate from nitrite in the third compartment. These two bacteria are growing in axenic conditions on a fixed bed bioreactor filled with Biostyr® beads. The nitrogen compounds are controlled by Ionic Chromatography and colorimetric titration for each sample. The work presented here deals with the culture of both bacteria in pure cultures and mixed cultures in stirred and aerated bioreactors of different volumes. The first aim of our work is the characterization of the bacteria growth in bioreactors and in the nitrifying fixed-bed column. The experimental results confirm that the growth is slow; the maximal growth rate in suspended cultures is 0.054h-1 for Nitrosomonas europaea and 0.022h-1 for Nitrobacter winogradskyi. Mixed cultures are difficult to control and operate but one could be done for more than 500 hours. The characterization of the

  12. Pro-inflammatory role of Anti-Ro/SSA autoantibodies through the activation of Furin-TACE-amphiregulin axis.

    Science.gov (United States)

    Lisi, Sabrina; Sisto, Margherita; Lofrumento, Dario Domenico; Cucci, Liana; Frassanito, Maria Antonia; Mitolo, Vincenzo; D'Amore, Massimo

    2010-09-01

    Prolonged inflammation can be detrimental because it may cause host toxicity and tissue damage. Indeed, excessive production of inflammatory cytokines is often associated with many autoimmune diseases. In this study we demonstrate that the anti-Ro/SSA autoantibodies (Abs) stimulate the production of pro-inflammatory cytokines IL-6 and IL-8 by human healthy salivary gland epithelial cells (healthy SGEC). The secretion of these cytokines is due to amphiregulin (AREG) that is overexpressed in healthy SGEC treated with anti-Ro/SSA Abs and in Sjögren's syndrome. We have discovered that the up-regulation of AREG occurs through TNF-alpha produced following anti-Ro/SSA Abs treatment. The gene silencing technique was used to study the AREG-TNF-alpha-IL-6/IL-8 secretion pathway, demonstrating that: (i) TNF-alpha gene silencing provokes a significant decrease of proinflammatory cytokines production and AREG expression in anti-Ro/SSA Abs-treated healthy SGEC; (ii) AREG gene silencing has a potent inhibitory effect on TNF-alpha-induced IL-6 and IL-8 secretion in healthy SGEC treated with anti-Ro/SSA Abs. These findings indicate that TACE-mediated AREG shedding plays a critical role in TNF-alpha-induced IL-6 and IL-8 secretion by the human healthy salivary gland epithelial cells, suggesting that this may be one of the possible intracellular mechanisms involved in the salivary glands inflammatory response in Sjögren's syndrome.

  13. Effect of lime addition during sewage sludge treatment on characteristics of resulting SSA when it is used in cementitious materials.

    Science.gov (United States)

    Vouk, D; Nakic, D; Štirmer, N; Baricevic, A

    2017-02-01

    Final disposal of sewage sludge is important not only in terms of satisfying the regulations, but the aspect of choosing the optimal wastewater treatment technology, including the sludge treatment. In most EU countries, significant amounts of stabilized and dewatered sludge are incinerated, and sewage sludge ash (SSA) is generated as a by product. At the same time, lime is one of the commonly used additives in the sewage sludge treatment primarily to stabilize the sludge. In doing so, the question arose how desirable is such addition of lime if the sludge is subsequently incinerated, and the generated ash is further used in the production of cementitious materials. A series of mortars were prepared where 10-20% of the cement fraction was replaced by SSA. Since all three types of analyzed SSA (without lime, with lime added during sludge stabilization and with extra lime added during sludge incineration) yielded nearly same results, it can be concluded that if sludge incineration is accepted solution, lime addition during sludge treatment is unnecessary even from the standpoint of preserving the pozzolanic properties of the resulting SSA. Results of the research carried out on cement mortars point to the great possibilities of using SSA in concrete industry.

  14. Application of atomic absorption spectrophotometry to the rapid analysis of some elements in uranium; Application de la spectrophotometrie d'absorption atomique a l'analyse rapide de quelques elements dans l'uranium

    Energy Technology Data Exchange (ETDEWEB)

    Buffereau, M.; Robichet, J. [Commissariat a l' Energie Atomique, Bruyeres-le-Chatel (France). Centre d' Etudes

    1969-07-01

    After a brief review of the main conditions to analyse traces impurities in uranium, characteristics of the sample solution and analytical conditions in presence of uranium are studied. Some interferences are shown and comparative results are given. Limits of application of the method are discussed. (authors) [French] Apres avoir rapidement passe en revue les principales conditions d'application de la spectrophotometrie d'absorption atomique au dosage d'impurete dans l'uranium, on etudie les caracteristiques de la solution d'analyse et les conditions du dosage en presence d'uranium. On indique quelques interferences. Apres avoir mentionne quelques resultats comparatifs, on discute les limites d'application de la methode. (auteurs)

  15. SSA, PCA, TDPSC, ACFA: Useful combination of methods for analysis of short and nonstationary time series

    Energy Technology Data Exchange (ETDEWEB)

    Vitanov, Nikolay K. [Institute of Mechanics, Bulgarian Academy of Sciences, Akad. G. Bonchev Street, Bl. 4, 1113 Sofia (Bulgaria)], E-mail: vitanov@imech.imbm.bas.bg; Sakai, Kenshi [Department of Eco-Regional Science, Tokyo University of Agriculture and Technology, 3-5-8 Saiwai-cho, Fuchu-shi, Tokyo, 183-8509 (Japan); Dimitrova, Zlatinka I. [Institute of Solid State Physics, Bulgarian Academy of Sciences, Blvd. Tzarigradsko Chausee 72, 1784 Sofia (Bulgaria)

    2008-07-15

    Singular spectrum analysis (SSA), principal component analysis (PCA), and autocorrelation function analysis (ACFA) are useful tools for extracting information from time series. But the combination of these methods and the time delay phase space construction (TDPSC) is not much used. In this paper we present the opportunities of this bundle of four methods for analysis of short and nonstationary time series. The basis of our analysis are time series for the piglet prices and production in Japan before and after the Japan government intervention in the agriculture sector aiming at stabilization of the agriculture prices after the oil crisis in 1974. As a comparison we analyse long stationary chaotic time series from the classical Lorenz system. We show that SSA, PCA and TDPSC perfectly recognize the dimension of the Lorenz system only on the basis of time series for one of its three variables. The bundle of four methods leads us to enough information to make the conclusion that the intervention of the Japan government in agriculture sector was very successful and leaded (i) to stabilization of prices; (ii) to a coupling between the prices and production cycles and (iii) to decreasing the dimension of the phase space of price and production fluctuations around the year trend thus making their dynamics more forecastable.

  16. Solar Flare Prediction Science-to-Operations: the ESA/SSA SWE A-EFFort Service

    Science.gov (United States)

    Georgoulis, Manolis K.; Tziotziou, Konstantinos; Themelis, Konstantinos; Magiati, Margarita; Angelopoulou, Georgia

    2016-07-01

    We attempt a synoptical overview of the scientific origins of the Athens Effective Solar Flare Forecasting (A-EFFort) utility and the actions taken toward transitioning it into a pre-operational service of ESA's Space Situational Awareness (SSA) Programme. The preferred method for solar flare prediction, as well as key efforts to make it function in a fully automated environment by coupling calculations with near-realtime data-downloading protocols (from the Solar Dynamics Observatory [SDO] mission), pattern recognition (solar active-region identification) and optimization (magnetic connectivity by simulated annealing) will be highlighted. In addition, the entire validation process of the service will be described, with its results presented. We will conclude by stressing the need for across-the-board efforts and synergistic work in order to bring science of potentially limited/restricted interest into realizing a much broader impact and serving the best public interests. The above presentation was partially supported by the ESA/SSA SWE A-EFFort project, ESA Contract No. 4000111994/14/D/MRP. Special thanks go to the ESA Project Officers R. Keil, A. Glover, and J.-P. Luntama (ESOC), M. Bobra and C. Balmer of the SDO/HMI team at Stanford University, and M. Zoulias at the RCAAM of the Academy of Athens for valuable technical help.

  17. Isolated anti-Ro/SSA thrombocytopenia: a rare feature of neonatal lupus.

    Science.gov (United States)

    Ayadi, Imene Dahmane; Ben Hamida, Emira; Boukhris, Mohamed Riadh; Bezzine, Ahlem; Chaouachi, Sihem; Marrakchi, Zahra

    2015-01-01

    We report a rare case of isolated thrombocytopenia related to anti-Ro/SSA antibodies. The mother was followed for unlabeled familial thrombocytopenia. The mother had positive anti-Ro/SSA antibodies. She was asymptomatic without skin lesions or other criteria neither of systemic lupus erythematosus nor other connective tissue disease. Pregnancy was uneventful. The postnatal examination was normal. On the first day of life, blood cells count showed thrombocytopenia at 40 x 10(9)/L. Within the second day of life, platelet level dropped to 20 x 10(9)/L. The management of thrombocytopenia included platelet transfusion and human immunoglobulin infusion. On the fifth day of life, there has been a drop in platelet count to 10 x 10(9)/L requiring renewed platelet transfusion and human immunoglobulin infusion. On the 10(th) of life platelets rate was stable around 60 x 10(9)/L. The infant had no evidence of cardiac, dermatologic or hepatobilary involvement initially or throughout follow up.

  18. Batch Model for Batched Timestamps Data Analysis with Application to the SSA Disability Program

    Science.gov (United States)

    Yue, Qingqi; Yuan, Ao; Che, Xuan; Huynh, Minh; Zhou, Chunxiao

    2016-01-01

    The Office of Disability Adjudication and Review (ODAR) is responsible for holding hearings, issuing decisions, and reviewing appeals as part of the Social Security Administration’s disability determining process. In order to control and process cases, the ODAR has established a Case Processing and Management System (CPMS) to record management information since December 2003. The CPMS provides a detailed case status history for each case. Due to the large number of appeal requests and limited resources, the number of pending claims at ODAR was over one million cases by March 31, 2015. Our National Institutes of Health (NIH) team collaborated with SSA and developed a Case Status Change Model (CSCM) project to meet the ODAR’s urgent need of reducing backlogs and improve hearings and appeals process. One of the key issues in our CSCM project is to estimate the expected service time and its variation for each case status code. The challenge is that the systems recorded job departure times may not be the true job finished times. As the CPMS timestamps data of case status codes showed apparent batch patterns, we proposed a batch model and applied the constrained least squares method to estimate the mean service times and the variances. We also proposed a batch search algorithm to determine the optimal batch partition, as no batch partition was given in the real data. Simulation studies were conducted to evaluate the performance of the proposed methods. Finally, we applied the method to analyze a real CPMS data from ODAR/SSA.

  19. BOREAS TE-1 CO2 and CH4 Flux Data Over the SSA-OBS Site

    Science.gov (United States)

    Anderson, Darwin; Papagno, Andrea; Hall, Forrest G. (Editor); Newcomer, Jeffrey A. (Editor)

    2000-01-01

    The BOREAS TE-1 team collected various data to characterize the soil-plant systems in the BOREAS SSA. Particular emphasis was placed on nutrient biochemistry, the stores and transfers of organic carbon, and how the characteristics were related to measured methane fluxes. The overall transect in the Prince Albert National Park (Saskatchewan, Canada) included the major plant communities and related soils that occurred in that section of the boreal forest. Soil physical, chemical, and biological measurements along the transect were used to characterize the static environment, which allowed them to be related to methane fluxes. Chamber techniques were used to provide a measure of methane production/uptake. Chamber measurements coupled with flask sampling were used to determine the seasonality of methane fluxes. This particular data set contains carbon dioxide and methane flux values from the SSA-OBS site. The data were collected from 09-Jun to 04-Sep-1994. The data are stored in tabular ASCII files. The data files are available on a CD-ROM (see document number 20010000884), or from the Oak Ridge National Laboratory (ORNL) Distributed Active Archive Center (DAAC).

  20. BOREAS TE-1 CH4 Flux Data Over The SSA-OA

    Science.gov (United States)

    Anderson, Darwin; Papagno, Andrea; Hall, Forrest G. (Editor); Newcomer, Jeffrey A. (Editor)

    2000-01-01

    The BOREAS TE-1 team collected various data to characterize the soil-plant systems in the BOREAS SSA. Particular emphasis was placed on nutrient biochemistry, the stores and transfers of organic carbon, and how the characteristics were related to measured methane fluxes. The overall transect in the Prince Albert National Park (Saskatchewan, Canada) included the major plant communities and related soils that occurred in that section of the boreal forest. Soil physical, chemical, and biological measurements along the transect were used to characterize the static environment, which allowed them to be related to methane fluxes. Chamber techniques were used to provide a measure of methane production/uptake. Chamber measurements coupled with flask sampling were used to determine the seasonality of methane fluxes. This particular data set contains methane flux and soil profile methane concentration values from the SSA-OA site. The data were collected from 29-May to 17-Sep-1994. The data are stored in tabular ASCII files. The data files are available on a CD-ROM (see document number 20010000884), or from the Oak Ridge National Laboratory (ORNL) Distributed Active Archive Center (DAAC).

  1. Spatial correlation between submillimetre and Lyman-alpha galaxies in the SSA 22 protocluster.

    Science.gov (United States)

    Tamura, Yoichi; Kohno, Kotaro; Nakanishi, Kouichiro; Hatsukade, Bunyo; Iono, Daisuke; Wilson, Grant W; Yun, Min S; Takata, Tadafumi; Matsuda, Yuichi; Tosaki, Tomoka; Ezawa, Hajime; Perera, Thushara A; Scott, Kimberly S; Austermann, Jason E; Hughes, David H; Aretxaga, Itziar; Chung, Aeree; Oshima, Tai; Yamaguchi, Nobuyuki; Tanaka, Kunihiko; Kawabe, Ryohei

    2009-05-07

    Lyman-alpha emitters are thought to be young, low-mass galaxies with ages of approximately 10(8) yr (refs 1, 2). An overdensity of them in one region of the sky (the SSA 22 field) traces out a filamentary structure in the early Universe at a redshift of z approximately 3.1 (equivalent to 15 per cent of the age of the Universe) and is believed to mark a forming protocluster. Galaxies that are bright at (sub)millimetre wavelengths are undergoing violent episodes of star formation, and there is evidence that they are preferentially associated with high-redshift radio galaxies, so the question of whether they are also associated with the most significant large-scale structure growing at high redshift (as outlined by Lyman-alpha emitters) naturally arises. Here we report an imaging survey of 1,100-microm emission in the SSA 22 region. We find an enhancement of submillimetre galaxies near the core of the protocluster, and a large-scale correlation between the submillimetre galaxies and the low-mass Lyman-alpha emitters, suggesting synchronous formation of the two very different types of star-forming galaxy within the same structure at high redshift. These results are in general agreement with our understanding of the formation of cosmic structure.

  2. Advantageous use of SSA technique to observe effects of thickness, antioxidant and oxygen in gamma irradiated low density polyethylene

    Energy Technology Data Exchange (ETDEWEB)

    Perez, C.J., E-mail: cjperez@fi.mdp.edu.ar [Research Institute of Material Science and Technology (INTEMA), National Research Council (CONICET), Engineering Faculty, Mar del Plata University, Av. J.B. Justo 4302, 7600 Mar del Plata (Argentina); Failla, M.D. [Planta Piloto de Ingenieria Quimica-PLAPIQUI (UNS-CONICET), Camino ' La Carrindanga' Km 7, 8000 Bahia Blanca (Argentina); Carella, J.M. [Research Institute of Material Science and Technology (INTEMA), National Research Council (CONICET), Engineering Faculty, Mar del Plata University, Av. J.B. Justo 4302, 7600 Mar del Plata (Argentina)

    2012-06-20

    Highlights: Black-Right-Pointing-Pointer Information from successive self-nucleation and annealing technique is analyzed. Black-Right-Pointing-Pointer Oxygen and antioxidants reduce crosslinking efficiency by reaction with free radicals. Black-Right-Pointing-Pointer Recognizable differences are obtained in samples irradiated at different atmospheres. - Abstract: Information obtained from successive self-nucleation and annealing (SSA) technique is analyzed, paying special attention to the observable effects of samples thickness and antioxidant and oxygen concentrations. Molecular structure changes for low density polyethylene (LDPE) samples, irradiated under three different atmospheres for doses between 33 and 222 kGy were analyzed, with emphasis on the changes of longer polymethylene crystallizable lengths. Antioxidant and oxygen concentrations were varied for samples of different thickness to study the effects on degradation. The changes in the molecular structure were followed simultaneously by SSA and Infrared spectroscopy (FTIR) via carbonyl group concentration. Preliminary quantifications of the SSA technique sensitivity are also advanced.

  3. Ultrasound findings in fetal congenital heart block associated with maternal anti-Ro/SSA and Anti-La/SSB antibodies.

    Science.gov (United States)

    Lai, Jasmine; Clark, Toshi J; Tan, Justin H; Delaney, Shani; Jolley, Jennifer A

    2015-03-01

    We present the sonographic features of a second-trimester fetus diagnosed with a bradyarrhythmia at 19 weeks' gestation. The mother carried a diagnosis of Sjögren syndrome, including the presence of SSA and SSB antibodies. Ultrasound M-mode and fetal echocardiogram revealed the etiology of the bradycardia to be a complete fetal congenital heart block, likely due to transplacental passage of autoimmune anti-Ro/SSA and anti-La/SSB antibodies. Consequential to the congenital heart block, the fetus developed hydrops fetalis at 21 weeks' gestational age. We discuss the 2 major etiologies of congenital heart block and the implications in subsequent pregnancies.

  4. Effect of sewage sludge ash (SSA on the mechanical performance and corrosion levels of reinforced Portland cement mortars

    Directory of Open Access Journals (Sweden)

    Andión, L. G.ª

    2006-06-01

    Full Text Available The article describes a study conducted to determinecorrosion in reinforcement embedded in Portland cement(PC mortars with different percentages of sewage sludgeash (SSA admixtures. The polarization resistancetechnique was used to determine the steel corrosion rate(Icorr in the test specimens. The samples were subjectedto different environmental conditions and aggressiveagents: 100% relative humidity (RH, accelerated carbonationat 70% RH and seawater immersion. Portlandcement was partially substituted for SSA in the mixes atrates of 0, 10, 20, 30 and 60% (by mass to make thedifferent mortars. The results show that where cementwas replaced by SSA at rates of up to 10% by mass,mortar corrosion performance was comparable to thebehaviour observed in SSA-free mortars (control mortar:0% SSA. Data for higher rates are also shown. From themechanical standpoint, SSA exhibited moderate pozzolanicactivity and the best performance when SSA wasadded at a rate of 10% to mixes with a water/(binder:PC + SSA (w/b ratio of 0.5.Se ha estudiado el nivel de corrosion que presentan lasarmaduras embebidas en morteros fabricados con cementoPortland (CP con diferentes porcentajes de sustitucion deceniza de lodo de depuradora (CLD. Se ha utilizado la tecnicade la Resistencia a la Polarizacion para determinar lavelocidad de corrosion del acero embebido en las muestrasestudiadas. Las muestras se han sometido a diferentes condicionesambientales y agentes agresivos: 100% de humedadrelativa (HR, carbonatacion acelerada al 70% HR einmersion en agua de mar. Para la fabricacion de los distintosmorteros, el cemento Portland ha sido parcialmente sustituidopor CLD en los siguientes porcentajes en masa: 0,10, 20, 30 y 60%. Los resultados muestran que sustitucionesde cemento por CLD de hasta el 10% en masa no alteranel comportamiento frente a la corrosion de los morterosal compararlos con los morteros libres de CLD (morteroscontrol: 0% de sustitucion de cemento por CLD. Se

  5. Makna Dan Ideologi Punk

    Directory of Open Access Journals (Sweden)

    Daniar Wikan Setyanto

    2015-08-01

    Full Text Available Punk Sebagai sebuah subkultur telah diadaptasi oleh para remaja Indonesia bukan hanya sebagai semangat bermusik, namun merambah sebagai ideologi dan gaya hidup. Punk merupakan warisan budaya dari barat yang awalnya bergerak pada bidang musik, namun lambat lain punk telah menjadi sebuah identitas global yang mewakili para remaja radikal yang memiliki visi anti kemapanan dan anti pemerintah. Selain ideologinya yang kontroversi, punk mempengaruhi dinamika fashion di dunia. Asesoris punk diadaptasi oleh budaya bopuler sebagai pernak-pernik fashion. Kini punk, telah menjadi bagian dari dunia fashion di seluruh dunia. Apa sebenarnya yang melatar belakangi munculnya Punk? bagaimana Punk bisa berkembang di Indonesia? Kata Kunci: punk, fashion, budaya populer

  6. DanRIS

    DEFF Research Database (Denmark)

    Skou, Carl Verner

    2009-01-01

    Windows 2000/XP/Vista platform computerprogram til DanRIS indberetning baseret på indskrivning af klienter på CPR, klientsforløb, faseforløb, ASI EuropASI composite score beregninger. Udgave: 2.1.0.5 Udgivelsesdato: 01-01-2009......Windows 2000/XP/Vista platform computerprogram til DanRIS indberetning baseret på indskrivning af klienter på CPR, klientsforløb, faseforløb, ASI EuropASI composite score beregninger. Udgave: 2.1.0.5 Udgivelsesdato: 01-01-2009...

  7. Latest update on the SSA/Ro auto-antibodies system and arrhythmia%SSA/Ro抗原及其自身抗体与心律失常的研究进展

    Institute of Scientific and Technical Information of China (English)

    黄媛; 帅宗文

    2014-01-01

    The ribonucleoprotein SSA/Ro, which is the target antigen of anti-SSA/Ro antibodies, is composed of Ro proteins and hYRNAs. Ro proteins include Ro60 protein and Ro52 protein, among which, Ro60 protein consists of HEAT repeats domain and vWFA domain while Ro52 protein has the structural characteristics of TRIM family members. Both the Ro60 and Ro52 antigens are composed of a series of epitopes, which have their own specific autoantibodies, and the autoantibodies to the different epitopes may be related with miscellaneous clinical manifestations of the autoimmune diseases. Anti-SSA/Ro antibodies could be passed from mother to fetus through placenta, and then lead to inflammatory damages in fetal cardiomyocytes or interfered with the function of calcium ion channels, and eventually results in fetal or neonatal atrioventricular block. Moreover, the other arrhythmia has also been reported, such as QTc interval prolongation and sinus bradycardia. Recent studies demonstrated that also adult heart, classically considered invulnerable to anti-SSA/Ro antibodies, could be affected. Anti-SSA/Ro antibodies have inhibitory effect on KCNH2 potassium channel and disturbed myocardial repolarization, and then result in QTc interval prolongation. Besides, it was reported constantly that anti-SSA/Ro antibodies might correlate with atrioventricular block in adult. However, the exact arrhythmogenic mechanisms have not been completely clarified as yet. It was not clear that how antibodies to the epitopes on SSA/Ro distributed in arrhythmia. The study would have important theoretical and clinical significance which revealed the relationships between auto-antibodies to the epitopes on SSA/Ro and arrhythmia.%抗SSA/Ro抗体的靶抗原SSA/Ro核蛋白由Ro蛋白和hYRNA两部分组成,其中Ro蛋白包括Ro60和Ro52两种类型,Ro60蛋白是由Heat重复区域和vWFA区域两结构域组成, Ro52蛋白则具有三结构域蛋白家族成员的结构特征。Ro60抗原与Ro52抗原均

  8. The ESA SSA NEO Coordination Centre contribution to NEO hazard monitoring and observational campaigns

    Science.gov (United States)

    Micheli, Marco; Borgia, Barbara; Drolshagen, Gerhard; Koschny, Detlef; Perozzi, Ettore

    2015-08-01

    The NEO Coordination Centre (NEOCC) has recently been established in Frascati, near Rome, within the framework of the ESA Space Situational Awareness (SSA) Programme. Among its tasks is the coordination of observational activities related to the NEO hazard, and the distribution of relevant and up-to-date information on NEOs to both the scientific community and general users through its web portal (http://neo.ssa.esa.int).On the observational side, the NEOCC is linked to an increasingly large worldwide network of collaborating observatories, ranging from amateurs observers to large professional telescopes. The Centre organizes observation campaigns, alerting the network to suggest urgent or high-priority observations, and providing them with observational support.The NEOCC is also directly obtaining astrometric observations of high-priority targets, especially Virtual Impactors (VIs), on challenging objects as faint as magnitude 26.5, thanks to successful collaborations with ESO VLT in Chile and the INAF-sponsored LBT in Arizona. In addition, the Centre carries out regular monthly runs dedicated to NEO follow-up, recovery and survey activities with the 1-meter ESA OGS telescope in Tenerife.From a service perspective, the NEO System hosted at the NEOCC collects data and information on NEOs produced by various European services (e.g. NEODyS, EARN) and makes them available to a variety of users, with a particular focus on objects with possible collision solutions with the Earth. Among the tools provided through the web portal are the Risk List (a table of all known NEOs with impact solutions), a table of recent and upcoming close approaches, a database of physical properties of NEOs and the so-called Priority List, which allows observers to identify NEOs in most urgent need of observations, and prioritise their observational activities accordingly.The results of our recent observation campaigns and some major recent improvements to the NEO System will presented and

  9. The formation of the massive galaxies in the SSA22 z = 3.1 protocluster

    Energy Technology Data Exchange (ETDEWEB)

    Kubo, M.; Uchimoto, Y. K.; Yamada, T.; Ichikawa, T.; Akiyama, M. [Astronomical Institute, Tohoku University, 6-3 Aoba, Aramaki, Aoba-ku, Sendai, Miyagi, 980-8578 (Japan); Kajisawa, M. [Research Center for Space and Cosmic Evolution, Ehime University, Bunkyo-cho 2-5, Matsuyama 790-8577 (Japan); Matsuda, Y. [Chile Observatory, National Astronomical Observatory of Japan, Tokyo 181-8588 (Japan); Hayashino, T. [Research Center for Neutrino Science, Graduate School of Science, Tohoku University, Aramaki, Aoba-ku, Sendai, Miyagi, 980-8578 (Japan); Konishi, M. [Institute of Astronomy, University of Tokyo, 2-21-1 Osawa, Mitaka, Tokyo, 181-0015 (Japan); Nishimura, T.; Omata, K.; Suzuki, R.; Tanaka, I. [Subaru Telescope, National Astronomical Observatory of Japan, 650 North Aohoku Place, Hilo, HI 96720 (United States); Yoshikawa, T. [Koyama Astronomical Observatory, Kyoto Sangyo University, Motoyama, Kamigamo, Kita-ku, Kyoto 603-8555 (Japan); Alexander, D. M. [Department of Physics, Durham University, Durham DH1 3LE (United Kingdom); Fazio, G. G.; Huang, J.-S. [Center for Astrophysics, Cambridge, MA 02138 (United States); Lehmer, B. D. [The Johns Hopkins University, Homewood Campus, Baltimore, MD 21218 (United States)

    2013-12-01

    We study the properties of K-band-selected galaxies (K {sub AB} < 24) in the z = 3.09 SSA22 protocluster field. 430 galaxies at 2.6 < z {sub phot} < 3.6 are selected as potential protocluster members in a 112 arcmin{sup 2} area based on their photometric redshifts. We find that ≈20% of the massive galaxies with stellar masses >10{sup 11} M {sub ☉} at z {sub phot} ∼ 3.1 have colors consistent with those of quiescent galaxies with ages >0.5 Gyr. This fraction increases to ≈50% after correcting for unrelated foreground/background objects. We also find that 30% of the massive galaxies are heavily reddened, dusty, star-forming galaxies. Few such quiescent galaxies at similar redshifts are seen in typical survey fields. An excess surface density of 24 μm sources at z {sub phot} ∼ 3.1 is also observed, implying the presence of dusty star-formation activity in the protocluster. Cross-correlation with the X-ray data indicates that the fraction of K-band-selected protocluster galaxies hosting active galactic nuclei (AGNs) is also high compared with the field. The sky distribution of the quiescent galaxies, the 24 μm sources, and the X-ray AGNs show clustering around a density peak of z = 3.1 Lyα emitters. A significant fraction of the massive galaxies have already become quiescent, while dusty star-formation is still active in the SSA22 protocluster. These findings indicate that we are witnessing the formation epoch of massive early-type galaxies in the centers of the predecessors to present-day rich galaxy clusters.

  10. Akromegali Dan Gigantisme

    OpenAIRE

    Silvani, Melati; Pase, M. Aron; Syafril, Santi; Lindarto, Dharma; Solin, Steffie S

    2016-01-01

    Hormon pertumbuhan manusia (Growth Hormone/GH) merupakan peptida rantai tunggal yang terdiri dari 191 asam amino, yang diisolasi dari sel somatotrop pada kelenjar hipofisis anterior pada tahun 1956, dan pertama kali digunakan sebagai terapi untuk penatalaksanaan dwarfisme hipofisis pada tahun 1958. Dwarfisme hipofisis adalah bentuk klasik dari defisiensi hormon pertumbuhan pada anak-anak Melati Silvani

  11. Macapat dan Santiswara

    OpenAIRE

    Darusuprapta, Darusuprapta

    2013-01-01

    Dalam khazanah kebudayaan Indonesia, khusus Jawa, hidup berkembangan kesenian macapat yang disebut juga  macapatan, dan kesenian santiswara yang disebut pula santiswaran. Macapatan lebih mengutamakan pembacaan teks dengan dendangan tembang kemudian diikuti sarasehan atau diskusi yang membahas segala segi isi teks bacaannya, sedangkan santiswaran lebih mengutamakan alunan swara dengan dendangan tembang disertai iringan bunyi tabuh-tabuhan.

  12. Subclinical Sjögren's syndrome and anti-Ro/SSA-positive autoimmune fatigue syndrome in children.

    Science.gov (United States)

    Itoh, Y; Imai, T; Fujino, O; Igarashi, T; Fukunaga, Y

    2002-09-01

    Abstract Although Sjögren's syndrome (SS) is quite rare among children, subclinical conditions without any sicca symptoms have been reported. This condition is characterized by nonspecific rheumatic symptoms and histopathological findings in salivary glands which are equivalent to SS. Many children with subclinical SS are positive for anti-Ro/SSA. On the other hand, autoimmune fatigue syndrome (AIFS) is characterized by chronic nonspecific complaints and positive antinuclear antibodies, with or without fulfilling the criteria for chronic fatigue syndrome. Although a novel autoantibody against a 62 kD nuclear protein (anti-Sa) is detected in about 40% of AIFS patients, few marker antibodies for autoimmune diseases, such as anti-DNA, anti-Sm, anti-U1-ribonucleoprotein (RNP), or anticardiolipin, are found in AIFS patients. In this study, however, anti-Ro/SSA was detected in sera from 8 out of 122 AIFS patients. Seven of the 8 anti-Ro/SSA-positive patients were female. All 8 patients had fatigue and low-grade fever, but none complained of xerosis. Western immunoblot analysis revealed that 7 sera reacted with Ro52, and that none was positive for anti-La/SSB or anti-Sa. Two of the 8 patients had histories of recurrent parotitis. Lip biopsies showed mild chronic inflammation compatible with subclinical SS in these 2 patients, although the other 6 patients had no abnormal histopathology. Thus, at least some anti-Ro/SSA-positive patients could be diagnosed as having SS.

  13. Diketene-based neat four-component synthesis of the dihydropyrimidinones and dihydropyridine backbones using silica sulfuric acid (SSA)

    Institute of Scientific and Technical Information of China (English)

    Sadegh Rostamnia; Kamran Lamei

    2012-01-01

    Heterocyclic skeleton building blocks to afford dihydropyrimidinones and dihydropyridines based on neat adducts of diketene,alcohols and aldehydes via silica sulfuric acid (SSA) catalyzed ring opening of diketene in four-c6mponent Biginelli-type and Hantzsch-type reactions are presented.

  14. 78 FR 69926 - Privacy Act of 1974, as Amended; Computer Matching Program (SSA/Centers for Medicare & Medicaid...

    Science.gov (United States)

    2013-11-21

    ... ADMINISTRATION Privacy Act of 1974, as Amended; Computer Matching Program (SSA/ Centers for Medicare & Medicaid... accordance with the provisions of the Privacy Act, as amended, this notice announces a renewal of an existing... Act of 1988 (Pub. L 100-503), amended the Privacy Act (5 U.S.C. 552a) by describing the...

  15. 78 FR 69925 - Privacy Act of 1974, as Amended; Computer Matching Program (SSA/Bureau of the Fiscal Service...

    Science.gov (United States)

    2013-11-21

    ... ADMINISTRATION Privacy Act of 1974, as Amended; Computer Matching Program (SSA/ Bureau of the Fiscal Service..., 2013. SUMMARY: In accordance with the provisions of the Privacy Act, as amended, this notice announces... INFORMATION: A. General The Computer Matching and Privacy Protection Act of 1988 (Pub. L. 100-503),...

  16. 75 FR 18251 - Privacy Act of 1974, as Amended; Computer Matching Program (SSA/Internal Revenue Service (IRS...

    Science.gov (United States)

    2010-04-09

    ... the Privacy Act, as amended. ] Dated: March 31, 2010. Michael G. Gallagher, Deputy Commissioner for... File) system of records, SSA/ORSIS 60-0321, originally published at 69 FR 77816 (December 28, 2004), and as revised at 71 FR 42159 (July 25, 2006). IRS extracts return information with respect...

  17. 77 FR 32709 - Privacy Act of 1974, as Amended; Computer Matching Program (SSA/Department of Homeland Security...

    Science.gov (United States)

    2012-06-01

    ... us. DHS will disclose two separate data files through a computer matching operation for our use in... ADMINISTRATION Privacy Act of 1974, as Amended; Computer Matching Program (SSA/ Department of Homeland Security... an existing computer matching program that will expire on July 18, 2012. SUMMARY: In accordance...

  18. Comment s'inventer un père écrivain: Albert camus chez Maïssa Bey

    NARCIS (Netherlands)

    Rosello, M.

    2015-01-01

    This article focuses on the role played by Camus in Maïssa Bey’s work. Focusing on the ambivalent and paradoxical place he occupies in Au commencement était la mer and l’Ombre d’un homme qui marche au soleil, I analyse the construction of the father or rather Bey’s definition of fathers. The biologi

  19. 76 FR 77238 - Submission for OMB Review; Comment Request; The SSA-NIH Collaboration to Improve the Disability...

    Science.gov (United States)

    2011-12-12

    ... Disability Determination Process: Validation of IRT-CAT tools. Type of Information Collection Request: NEW... assist in the SSA disability determination process. The utilization of CAT technology could potentially... current employment status as ``permanently disabled''. Individuals will complete the CAT tools for...

  20. 76 FR 55690 - Submission for OMB Review; Comment Request; The SSA-NIH Collaboration To Improve the Disability...

    Science.gov (United States)

    2011-09-08

    ... Collection Request: NEW. Need and Use of Information Collection: The Epidemiology and Biostatistics section... being developed to assist in the SSA disability determination process. The utilization of CAT technology... report their current employment status as ``permanently disabled''. Individuals will complete the...

  1. Dislocation glide in Ni-Al solid solutions from the atomic scale up: a molecular dynamics study; Etude du glissement des dislocations dans la solution solide Ni-Al par simulation a l'echelle atomique

    Energy Technology Data Exchange (ETDEWEB)

    Rodary, E

    2003-01-01

    The glide of an edge dislocation in solid solutions is studied by molecular dynamics, at fixed temperature and imposed external stress. We have optimized an EAM potential for Ni(1 a 8% A1): it well reproduces the lattice expansion, local atomic order, stacking fault energy as a function of composition, as well as the elastic properties of the {gamma}' phase with L1{sub 2} structure. On increasing the stress, the dislocation is first immobile, then glides with a velocity proportional to the stress and the velocity saturates on reaching the transverse sound velocity. However, only beyond a static threshold stress, {sigma}{sub s}, does the dislocation glide a distance large enough to allow macroscopic shear; the linear part of the velocity-stress curve extrapolates to zero at a dynamical threshold stress, {sigma}{sub d}, The friction coefficient, and the threshold stresses ({sigma}{sub s} and {sigma}{sub d}), increase with the A1 concentration and decrease with temperature (300 and 500 K). Close to the critical shear stress, {sigma}{sub s}, the dislocation glide is analysed with a 'stop and go' model. The latter yields the flight velocity between obstacles, the mean obstacle density and the distribution of the waiting time on each obstacle as a function of stress, composition and temperature. The obstacle to the glide is proposed to be the strong repulsion between Al atoms brought into nearest neighbour position by the glide process, and not the dislocation-solute interaction. The microscopic parameters so defined are introduced into a micro-mechanical model, which well reproduces the known behaviour of nickel base solid solutions. (author)

  2. BAHAYA RADIASI DAN CARA PROTEKSINYA

    Directory of Open Access Journals (Sweden)

    Badunggawa P

    2014-09-01

    Full Text Available Radiasi yang kita terima setiap saat, termasuk radiasi untuk tujuan kedokteran, mempunyai dampak positif dan negatif terhadap keselamatan manusia dan lingkungan. Dampak positif dari radiasi terhadap keselamatan manusia diantaranya adalah digunakan sebagai pengobatan dan dampak negatifnya adalah tergantung dari besar dosis yang diterima diantaranya adalah mulai dari mual, muntah, pusing-pusing, rambut rontok, menyebabkan kanker, diturunkan secara genetik, dan yang lebih berbahaya lagi adalah menyebabkan kematian. Oleh karena itu kita harus berhati-hati terhadap bahaya yang ditimbulkannya, baik terhadap pekerja radiasi maupun masyarakat umum termasuk pasien. Perlindungan terhadap bahaya yang ditimbulkan radiasi ini dikenal dengan istilah proteksi radiasi. Sehingga dosis yang diterima pertahun oleh pekerja atau masyarakat umum tidak melebihi batas dosis yang ditetapkan oleh Bapeten. Berbagai upaya telah dilakukan untuk meminimalkan bahaya tersebut sehingga pekerja dan pasien merasa aman melakukan dan dikenai tindakan medik.[medicina 2009;40:47-51].  

  3. A study on atomic skips in AlFeCu perfect quasicrystals: application of the isotopic substitution method in neutron diffusion; Etude des sauts atomiques dans les quasicristaux parfaits AlFeCu: une application de la methode de substitution isotopique dans la diffusion des neutrons

    Energy Technology Data Exchange (ETDEWEB)

    Coddens, G. [Laboratoire Leon Brillouin (LLB) - Centre d`Etudes de Saclay, 91 - Gif-sur-Yvette (France); Soulie, E. [CEA Centre d`Etudes de Saclay, 91 - Gif-sur-Yvette (France). Dept. de Recherche sur l`Etat Condense, les Atomes et les Molecules

    1994-12-31

    In order to better understand the crystal structure and the atomic skip or phason in quasi-crystals, three samples of the AlFeCu ternary alloy have been experimentally studied: Al{sub 62}Cu{sub 25.5}Fe{sub 12.5} (perfect sample), Al{sub 63}Cu{sub 24.5}Fe{sub 12.5} (non-perfect sample), Al{sub 50}Cu{sub 25}Fe{sub 25} (beta phase). Quasielastic neutron scattering variations with temperature and Q were recorded and signals have been enhanced through the use of isotope labelled samples. 4 figs., 2 tabs., 19 refs.

  4. Nilai Dan Fungsi Ndungndungen Karo

    OpenAIRE

    Rosita Ginting

    2010-01-01

    Tesis ini berjudul “Nilai dan Fungsi Ndungndungen Karo”. Tesis ini menjabarkan tentang macam-macam Ndungndungen Karo, nilai-nilai yang terkandung dalam Ndungndungen Karo, fungsi Ndungndungen Karo, dan bagaimana penggunaan Ndungndungen Karo pada saat sekarang ini. Metode yang dipakai dalam penelitian ini adalah metode deskriptif kualitatif, dengan teknik rekaman dan interviu. Metode kepustakaan juga digunakan dalam penelitian ini karena data sekunder dari penelitian ini adalah data-data ya...

  5. Sifat Anatomi dan Fisis Kelapa Hibrida

    OpenAIRE

    Hutabarat, Marihot Hamonangan

    2010-01-01

    Penelitian ini bertujuan untuk mengevaluasi sifat anatomis dan fisis batang kelapa hibrida. Ciri anatomi diamati langsung pada sampel dan menggunakan mikroskop untuk pengamatan dimensi seratnya, dan pengujian sifat fisis menggunakan British Standard. Sifat anatomis dan fisis batang kelapa hibrida bervariasi menurut ketinggian dan kedalaman. Struktur anatomis batang kelapa hibrida didominasi oleh vascular bundle dan parenkim. Serat kayu dapat ditemukan didalam vascular bundle dengan rata-r...

  6. NYERI KEPALA DAN GANGGUAN TIDUR

    Directory of Open Access Journals (Sweden)

    Lina Kamelia

    2014-09-01

    Full Text Available Nyeri kepala dan tidur merupakan dua fenomena yang saling mempengaruhi dengan patomekanisme yang kompleks. Nyeri kepala primer, terutama migren, nyeri kepala klaster dan hypnic headache dapat timbul karena pengurangan waktu tidur, parasomnia, maupun gangguan pada regulasi arsitektur tidur terutama fase rapid eye movement. Sebaliknya, adanya nyeri kepala memicu timbulnya berbagai macam gangguan tidur. Studi pencitraan otak dan biokimia menunjukkan peranan penting melatonin dan nukleus suprachiasmatik   yang mengalami disfungsi pada penderita nyeri kepala yang berhubungan dengan gangguan tidur. [MEDICINA 2013;44:101-104].

  7. Perancangan dan Implementasi Modul Praktikum

    Directory of Open Access Journals (Sweden)

    Gita Indah Hapsari

    2015-05-01

    Full Text Available Kemajuan teknologi berbasis komputer berkembang dengan sangat pesat. Seiring dengan perkembangan jaman, kemajuan  tersebut memberikan pengaruh  terhadap  perubahan cara penyampaian pengajaran yang mengarah pada penggunaan jenis media penyampaian. Praktikum merupakan salah satu bentuk pengajaran yang memberikan pengalaman belajar secara nyata terhadap kondisi sebenarnya di lapangan mengenai penggunaan dan implementasi alat praktek yang berhubungan dengan berbagai materi yang dipelajari oleh mahasiswa dan memiliki tujuan untuk memberikan keterampilan dan pengenalan terhadap mahasiswa/peserta didik. Penelitian ini melakukan implementasi teknologi augmented reality terhadap salah satu modul praktikum yaitu pengenalan tata letak hardware dan Port I/O pada motherboard dan bertujuan sebagai alat bantu penyampaian pengajaran praktikum. Pengimplementasian teknologi augmented reality melibatkan aksi oleh user terhadap media penangkapan gambar motherboard menggunakan web camera dan tampilan pemetaan tata letak hardware dan port i/o pada motherboard. Penelitian telah diimplementasikan dan diujicoba terhadap 3 kelas dengan 97 responder. Adapun hasil dari penelitiannya adalah 83% responder menyukai aplikasi, 77% memahami materi, 84,5% menginginkan aplikasi ini menjadi alat bantu ajar, 65,98% meminta materi untuk dilengkapi dan diperbanyak, 77,3% dapat belajar mandiri menggunakan aplikasi ini, tanpa bantuan dari dosen ataupun asisten.

  8. ASIMETRI INFORMASI DAN UNDERPRICING

    Directory of Open Access Journals (Sweden)

    Tety Anggita Safitri

    2013-03-01

    Full Text Available Tujuan penelitian ini adalah untuk menguji pengaruh asimetri informasi terhadap underpricing. Penelitian ini menggunakan sampel 63 perusahaan yang melakukan penawaran umum perdana di Bursa Efek Indonesia dalam kurun waktu 2005-2010. Analisis data menggunakan regresi linier berganda, yaitu menguji proksi asimetri informasi yang terdiri atas ukuran perusahaan, umur perusahaan, proporsi saham yang ditawarkan kepada masyarakat, reputasi underwriter dan reputasi auditor terhadap underpricing. Hasil penelitian ini mengindikasikan bahwa reputasi underwriter dan reputasi auditor berpengaruh terhadap underpricing. Ukuran perusahaan, umur perusahaan dan proporsi saham yang ditawarkan tidak berpengaruh terhadap underpricing.The aim of this research is to examine the effect of assymetric information on underpricing. This research used a sample of 63 companies that make initial public offering on the Indonesia Stock Exchange in the period of 2005-2010. The data analysis is using multiple linear regression, which is testing the proxy of asymmetric information which consists of the firm size, the firm age, the proportion of shares offered to the public, underwriter reputation and auditor reputation on underpricing. This research indicates that underwriter reputation and auditor reputation have a significant effect on underpricing. The firm size, the firm age and the proportion of shares offered to the public have no significant effect on underpricing.

  9. The influence of quorum sensing in compartment II of the MELiSSA loop

    Science.gov (United States)

    Condori, Sandra; Mastroleo, Felice; Wattiez, Ruddy; Leys, Natalie

    MELiSSA (Micro-Ecological Life Support System Alternative) has been conceived as a 5 compartments microorganisms and higher plants recycling system for long haul space flights. Rhodospirillum rubrum S1H colonizes compartment II. Previous work reported that continuous culture of the bacterium in a photobioreactor could lead to thick biofilm formation, leading to bioreactor arrest. Our aim is to investigate the unknown quorum sensing (QS) system of R. rubrum S1H, specifically under MELiSSA relevant culture conditions meaning light anaerobic (LAN) and using acetate as carbon source. In that purpose an autoinducer synthase gene (Rru_A3396) knockout mutant was constructed by allelic exchange generating strain M68. In addition phenotypic comparison between wild type (WT) and M68 was performed. Results of thin layer chromatography assay where Agrobacterium tumefaciens NT1 have been used as reporter strain showed that WT produces acyl-homoserine lactones (AHLs) from C4 to C12 acyl carbon chain length; however, in M68 no AHLs were detected confirming that gene Rru_A3396 (named rruI) encodes an autoinducer synthase. Interestingly under a low shear or static environment M68 showed cell aggregation similar as reported in a closely related bacterium Rhodobacter sphaeroides (cerI mutant). In contrast to WT, M68 did not form biofilm and exhibited a decreased motility and pigment content. M68 vs wild type transcriptomics results showed that 326 genes were statistically significant differentially expressed. Downregulation of genes related to photosynthesis e.g., reaction center subunits, light harvesting complex and photosynthetic assembly proteins was observed. Similar results were obtained for preliminary proteomic analysis. Results obtained showed that in R. rubrum S1H the AHL-based QS system regulates almost 8% of the genome which is linked to biofilm formation among other biological processes described above. Since strain M68 could not be used in compartment II due to its less

  10. Observer Interface Analysis for Standardization to a Cloud Based Real-Time Space Situational Awareness (SSA)

    Science.gov (United States)

    Eilers, J.

    2013-09-01

    The interface analysis from an observer of space objects makes a standard necessary. This standardized dataset serves as input for a cloud based service, which aimed for a near real-time Space Situational Awareness (SSA) system. The system contains all advantages of a cloud based solution, like redundancy, scalability and an easy way to distribute information. For the standard based on the interface analysis of the observer, the information can be separated in three parts. One part is the information about the observer e.g. a ground station. The next part is the information about the sensors that are used by the observer. And the last part is the data from the detected object. Backbone of the SSA System is the cloud based service which includes the consistency check for the observed objects, a database for the objects, the algorithms and analysis as well as the visualization of the results. This paper also provides an approximation of the needed computational power, data storage and a financial approach to deliver this service to a broad community. In this context cloud means, neither the user nor the observer has to think about the infrastructure of the calculation environment. The decision if the IT-infrastructure will be built by a conglomerate of different nations or rented on the marked should be based on an efficiency analysis. Also combinations are possible like starting on a rented cloud and then go to a private cloud owned by the government. One of the advantages of a cloud solution is the scalability. There are about 3000 satellites in space, 900 of them are active, and in total there are about ~17.000 detected space objects orbiting earth. But for the computation it is not a N(active) to N problem it is more N(active) to N(apo peri) quantity of N(all). Instead of 15.3 million possible collisions to calculate a computation of only approx. 2.3 million possible collisions must be done. In general, this Space Situational Awareness System can be used as a

  11. Parameterization of single-scattering albedo (SSA) and absorption Ångström exponent (AAE) with EC / OC for aerosol emissions from biomass burning

    Science.gov (United States)

    Pokhrel, Rudra P.; Wagner, Nick L.; Langridge, Justin M.; Lack, Daniel A.; Jayarathne, Thilina; Stone, Elizabeth A.; Stockwell, Chelsea E.; Yokelson, Robert J.; Murphy, Shane M.

    2016-08-01

    Single-scattering albedo (SSA) and absorption Ångström exponent (AAE) are two critical parameters in determining the impact of absorbing aerosol on the Earth's radiative balance. Aerosol emitted by biomass burning represent a significant fraction of absorbing aerosol globally, but it remains difficult to accurately predict SSA and AAE for biomass burning aerosol. Black carbon (BC), brown carbon (BrC), and non-absorbing coatings all make substantial contributions to the absorption coefficient of biomass burning aerosol. SSA and AAE cannot be directly predicted based on fuel type because they depend strongly on burn conditions. It has been suggested that SSA can be effectively parameterized via the modified combustion efficiency (MCE) of a biomass burning event and that this would be useful because emission factors for CO and CO2, from which MCE can be calculated, are available for a large number of fuels. Here we demonstrate, with data from the FLAME-4 experiment, that for a wide variety of globally relevant biomass fuels, over a range of combustion conditions, parameterizations of SSA and AAE based on the elemental carbon (EC) to organic carbon (OC) mass ratio are quantitatively superior to parameterizations based on MCE. We show that the EC / OC ratio and the ratio of EC / (EC + OC) both have significantly better correlations with SSA than MCE. Furthermore, the relationship of EC / (EC + OC) with SSA is linear. These improved parameterizations are significant because, similar to MCE, emission factors for EC (or black carbon) and OC are available for a wide range of biomass fuels. Fitting SSA with MCE yields correlation coefficients (Pearson's r) of ˜ 0.65 at the visible wavelengths of 405, 532, and 660 nm while fitting SSA with EC / OC or EC / (EC + OC) yields a Pearson's r of 0.94-0.97 at these same wavelengths. The strong correlation coefficient at 405 nm (r = 0.97) suggests that parameterizations based on EC / OC or EC / (EC + OC) have good predictive

  12. DIVERSITAS DAN KERAPATAN MANGROVE, GASTROPODA DAN BIVALVIA DI ESTUARI PERANCAK, BALI

    OpenAIRE

    2011-01-01

    Penelitian ini bertujuan membandingkan diversitas dan kerapatan mangrove dengan kepadatan gastropoda dan bivalvia di mangrove alami dan rehabilitasi. Pengukuran ekosistem mangrove menggunakan transek kuadrat 10 m x 10 m. Kelimpahan dan kepadatan gastropoda dan bialvia menggunakan transek kuadrat berukuran 1 m x 1 m. Analisis nMDS, cluster untuk melihat hubungan karekteristik mangrove alami dan rehabilitasi dianalisis secara deskriptif dan analisis regresi untuk mendetermi...

  13. Atom chips

    CERN Document Server

    Reichel, Jakob

    2010-01-01

    This book provides a stimulating and multifaceted picture of a rapidly developing field. The first part reviews fundamentals of atom chip research in tutorial style, while subsequent parts focus on the topics of atom-surface interaction, coherence on atom chips, and possible future directions of atom chip research. The articles are written by leading researchers in the field in their characteristic and individual styles.

  14. Atomic energy

    CERN Multimedia

    1996-01-01

    Interviews following the 1991 co-operation Agreement between the Department of Atomic Energy (DAE) of the Government of India and the European Organization for Nuclear Research (CERN) concerning the participation in the Large Hadron Collider Project (LHC) . With Chidambaram, R, Chairman, Atomic Energy Commission and Secretary, Department of Atomic Energy, Department of Atomic Energy (DAE) of the Government of India and Professor Llewellyn-Smith, Christopher H, Director-General, CERN.

  15. IJTIHAD KONTEMPORER (Problem dan Solusinya

    Directory of Open Access Journals (Sweden)

    Mustaqim Mustaqim

    2011-04-01

    Full Text Available Ijtiha>d adalah merupakan bahasan yang tak henti-hentinya menjadi kajian ketat para ulama sejak dulu sampai kini, seperti imam al-Ghaza>li> membahas dalam bukunya al mustasfa, demikian juga imam assyaukani membahas dalam bukunya irsyadul puhul dan masih banyak lagi ulama yung membahas dalam masalah ijtiha>d ini, Begitu juga dari kalangan ulama kontemporer seperti, Shaykh Ah}mad Ibra>hi>m, Shaykh ‘Abd al-Wahha>b Khala>f, Dr. Yu>suf al-Qarad}awi>, Dr. T{a>ha> Jabi>r dan masih banyak lagi selain mereka. Bersama itu, pintu ijtiha>d tak pernah tertutup, karena kehidupan masih terus berlanjut, dan kejadian-kejadian masih terus berkembang, timbulnya krisis ekonomi dan sosial, rangkaian masalah dan berbagai macam solusinya, desakan kejadian yang tak pernah dipersiapkan oleh manusia yang menimbulkan aneka ragam kesulitan, dan terus mengakar sampai menyelami kehidupan tekhnologi, perdagangan, atau kehidupan individu dan umum. Berawal dari sini maka merupakan cambuk bagi seorang muslim dengan kebebasan berpikirnya untuk mengerahkan segala kemampuannya terhadap seluruh masalah, sebab islam adalah agama kehidupan yang mencakup segala aspek, Islam bukan hanya berurusan dengan masalah akhirat saja, tapi Islam lahir dalam bentuk yang luas, mampu mengobati penyakit sosial, ekonomi, internasional, dll, dan fiqih sendiri bukan hanya merupakan peraturan belaka, melainkan fiqih mencakup segala masalah tergantung kejadian dan kebutuhan, fiqih masih siap menerima perubahan selama masih tetap dalam rel qur’an dan sunnah, dari sinilah perlu adanya ijtiha>d, Ijtiha>d merupakan hal yang terbuka bagi seorang muslim agar merasakan kebebasan berfikir yang sempurna karena ijtiha>d adalah merupakan sebuah bukti akan luas dan mudahnya syariat islam.

  16. ALMA Deep Field in SSA22: Source Catalog and Number Counts

    CERN Document Server

    Umehata, Hideki; Kohno, Kotaro; Ivison, R J; Smail, Ian; Hatsukade, Bunyo; Nakanishi, Kouichiro; Kato, Yuta; Ikarashi, Soh; Matsuda, Yuichi; Fujimoto, Seiji; Iono, Daisuke; Lee, Minju; Steidel, Charles C; Saito, Tomoki; Alexander, D M; Yun, Min S; Kubo, Mariko

    2016-01-01

    We present results from a deep 2'x3' (comoving scale of 3.7 Mpc x 5.5 Mpc at z=3) survey at 1.1 mm taken with the Atacama Large Millimeter/submillimeter Array (ALMA) in the SSA22 field. We observe the core region of a z = 3.09 protocluster, achieving a typical rms sensitivity of 60 micro-Jy/beam at a spatial resolution of 0".7. We detect 18 robust ALMA sources at a signal-to-noise ratio (SNR) > 5. Comparison between the ALMA map and a 1.1 mm map taken with the AzTEC camera on the Atacama Submillimeter Telescope Experiment (ASTE) indicates that three submillimeter sources discovered by the AzTEC/ASTE survey are resolved into eight individual submillimeter galaxies (SMGs) by ALMA. At least ten of our 18 ALMA SMGs have spectroscopic redshifts of z = 3.09, placing them in the protocluster. This shows that a number of dusty starburst galaxies are forming simultaneously in the core of the protocluster. The nine brightest ALMA SMGs with SNR > 10 have a median intrinsic angular size of 0".32+0".13-0".06 (2.4+1.0-0.4 ...

  17. Thermal properties of poly(ethylene oxide)/lauric acid blends. A SSA-DSC study

    Energy Technology Data Exchange (ETDEWEB)

    Pielichowski, Krzysztof; Flejtuch, Kinga [Department of Chemistry and Technology of Polymers, Cracow University of Technology, ul. Warszawska 24, 31-155 Krakow (Poland)

    2006-03-15

    A series of poly(ethylene oxide) (PEO)/lauric acid blends with different compositions has been prepared and characterised by differential scanning calorimetry (DSC) in dynamic mode. It has been found that the enthalpy of melting and crystallisation reaches its highest value for PEO/lauric acid blend (1:1, w/w) which makes this system a promising candidate for thermal energy storage applications. Further studies by step-scan alternating (SSA)-DSC revealed that an increase of the temperature step causes that the average total heating rate is also increasing and the heat flow is characterised by higher values. Reversing component of the heat flow during melting reaches lowest values at highest step (step=1{sup o}) when the re-crystallisation of PEO is hindered. An increase of step generally leads to an increase of the number of non-equilibrium effects and facilitates the activation of kinetic non-reversing processes, hindering the overall crystallisation of PEO. For lauric acid, due to facile crystallisation and self-association, formation of ordered regular structures takes place faster and is influenced by non-reversing processes in higher proportion. (author)

  18. Searching for candidates of Lyman continuum sources - revisiting the SSA22 field

    CERN Document Server

    Micheva, Genoveva; Inoue, Akio K; Matsuda, Yuichi; Yamada, Toru; Hayashino, Tomoki

    2015-01-01

    We present the largest to date sample of hydrogen Lyman continuum (LyC) emitting galaxies at any redshift, with $18$ LyA Emitters (LAEs) and $7$ Lyman Break Galaxies (LBGs), obtained from the SSA22 field with Subaru/Suprime-Cam. The sample is based on the $136$ LBGs and $159$ LAEs observed in the field, all with spectroscopically confirmed redshifts, and they are selected as galaxies with counterpart in a narrow-band filter image which traces LyC at $z\\geq 3.06$. Many LyC candidates show a spatial offset between the rest-frame non-ionizing ultraviolet (UV) detection and the LyC-emitting substructure or between the LyA emission and LyC. Statistically it is highly unlikely that all candidates in our sample are contaminants, and there should be $\\sim9$ and $\\sim2$ viable LyC candidates among the LAEs and LBGs. There is some evidence for a positive LyC/LyA correlation, suggesting that both LyC and LyA escape via a similar mechanism. "Standard" SED models cannot explain the observed LyC LAEs colors, instead requir...

  19. BOREAS AFM-08 ECMWF Hourly Surface and Upper Air Data for the SSA and NSA

    Science.gov (United States)

    Viterbo, Pedro; Betts, Alan; Hall, Forrest G. (Editor); Newcomer, Jeffrey A.; Smith, David E. (Technical Monitor)

    2000-01-01

    The Boreal Ecosystem-Atmosphere Study (BOREAS) Airborne Fluxes and Meteorology (AFM)-8 team focused on modeling efforts to improve the understanding of the diurnal evolution of the convective boundary layer over the boreal forest. This data set contains hourly data from the European Center for for Medium-Range Weather Forecasts (ECMWF) operational model from below the surface to the top of the atmosphere, including the model fluxes at the surface. Spatially, the data cover a pair of the points that enclose the rawinsonde sites at Candle Lake, Saskatchewan, in the Southern Study Area (SSA) and Thompson, Manitoba, in the Northern Study Area (NSA). Temporally, the data include the two time periods of 13 May 1994 to 30 Sept 1994 and 01 Mar 1996 to 31 Mar 1997. The data are stored in tabular ASCII files. The number of records in the upper air data files may exceed 20,000, causing a problem for some software packages. The ECMWF hourly surface and upper air data are available from the Earth Observing System Data and Information System (EOSDIS) Oak Ridge National Laboratory (ORNL) Distributed Active Archive Center (DAAC). The data files are available on a CD-ROM (see document number 20010000884).

  20. BOREAS AFM-1 NOAA/ATDD Long-EZ Aircraft Flux data Over the SSA

    Science.gov (United States)

    Crawford, Timothy L.; Baldocchi, Dennis; Hall, Forrest G. (Editor); Knapp, David E. (Editor); Gunter, Laureen; Dumas, Ed; Smith, David E. (Technical Monitor)

    2000-01-01

    This data set contains measurements from the Airborne Flux and Meteorology (AFM)-1 National Oceanographic and Atmospheric Administration/Atmospheric Turbulence and Diffusion Division (NOAA/ATDD) Long-EZ Aircraft collected during the 1994 Intensive Field Campaigns (IFCs) at the southern study area (SSA). These measurements were made from various instruments mounted on the aircraft. The data that were collected include aircraft altitude, wind direction, wind speed, air temperature, potential temperature, water mixing ratio, U and V components of wind velocity, static pressure, surface radiative temperature, downwelling and upwelling total radiation, downwelling and upwelling longwave radiation, net radiation, downwelling and upwelling photosynthectically active radiation (PAR), greenness index, CO2 concentration, O3 concentration, and CH4 concentration. There are also various columns that indicate the standard deviation, skewness, kurtosis, and trend of some of these data. The data are stored in tabular ASCII files. The NOAA/ATDD Long-EZ aircraft flux data are available from the Earth Observing System Data and Information System (EOSDIS) Oak Ridge National Laboratory (ORNL) Distributed Active Archive Center (DAAC). The data files are available on a CD-ROM (see document number 20010000884).

  1. Are crude oil markets multifractal? Evidence from MF-DFA and MF-SSA perspectives

    Science.gov (United States)

    He, Ling-Yun; Chen, Shu-Peng

    2010-08-01

    In this article, we investigated the multifractality and its underlying formation mechanisms in international crude oil markets, namely, Brent and WTI, which are the most important oil pricing benchmarks globally. We attempt to find the answers to the following questions: (1) Are those different markets multifractal? (2) What are the dynamical causes for multifractality in those markets (if any)? To answer these questions, we applied both multifractal detrended fluctuation analysis (MF-DFA) and multifractal singular spectrum analysis (MF-SSA) based on the partition function, two widely used multifractality detecting methods. We found that both markets exhibit multifractal properties by means of these methods. Furthermore, in order to identify the underlying formation mechanisms of multifractal features, we destroyed the underlying nonlinear temporal correlation by shuffling the original time series; thus, we identified that the causes of the multifractality are influenced mainly by a nonlinear temporal correlation mechanism instead of a non-Gaussian distribution. At last, by tracking the evolution of left- and right-half multifractal spectra, we found that the dynamics of the large price fluctuations is significantly different from that of the small ones. Our main contribution is that we not only provided empirical evidence of the existence of multifractality in the markets, but also the sources of multifractality and plausible explanations to current literature; furthermore, we investigated the different dynamical price behaviors influenced by large and small price fluctuations.

  2. Simulation of the MELiSSA closed loop system as a tool to define its integration strategy

    Science.gov (United States)

    Poughon, L.; Farges, B.; Dussap, C. G.; Godia, F.; Lasseur, C.

    2009-12-01

    Inspired by a terrestrial ecosystem, Micro-Ecological Life Support System Alternative (MELiSSA) is a project focused on a closed-loop life support system intended for future long-term manned missions (Moon and Mars bases). Started by the ESA in 1989, this 5-compartment concept has evolved through a mechanistic engineering approach designed to acquire both theoretical and technical knowledge. In its current state of development, the project can now start to demonstrate the MELiSSA loop concept at pilot scale. Thus, an integration strategy for a MELiSSA Pilot Plant (MPP) has been defined, describing the different test phases and connections between compartments. The integration steps are due to be started in 2008 and completed with a complete operational loop in 2015. The ultimate objective is to achieve a closed liquid and gas loop fulfiling 100% of oxygen requirements and at least 20% of food requirements for one-man. Although the integration logic could start with the most advanced processes in terms of knowledge and hardware development, this logic needs to be expanded to encompass a high-level simulation policy. This simulation exercise will make it possible to run effective demonstrations of each independent process, followed by progressive coupling with other processes in operational conditions mirroring as far as possible the final configuration. The theoretical approach described in this paper is based on mass balance models of each MELiSSA compartment which are used to simulate each integration step and the complete MPP loop itself. These simulations will help identify criticalities in each integration step and check consistency between objectives, flows, recycling efficiencies and sizing of the pilot reactors. An MPP scenario compatible with current knowledge on the operation of the pilot reactors was investigated, and the theoretical performances of the system were compared against the objectives assigned to the MPP. This scenario makes it possible to

  3. Spontaneous rupture of atrioventricular valve tensor apparatus as late manifestation of anti-Ro/SSA antibody-mediated cardiac disease.

    Science.gov (United States)

    Cuneo, Bettina F; Fruitman, Deborah; Benson, D Woodrow; Ngan, Bo-Yee; Liske, Michael R; Wahren-Herlineus, Marie; Ho, S Yen; Jaeggi, Edgar

    2011-03-01

    Atrioventricular (AV) block and endocardial fibroelastosis associated with dilated cardiomyopathy are the most common clinical manifestations of anti-Ro/SSA-mediated fetal cardiac disease. Valvar dysfunction has not been a prominent feature of this disease; however, recent anecdotal cases have suggested an association between rupture of the AV valve tensor apparatus and maternal anti-Ro/SSA antibodies. In the present study, we have described the clinical and laboratory findings and reviewed the published data for infants of anti-Ro/SSA-positive pregnancies with AV valve insufficiency due to chordal rupture from the papillary muscles. The histopathologic features of the papillary muscle and ventricular free wall and septum biopsy specimens were examined and compared to the sections of AV leaflets from 6 autopsied fetuses with anti-Ro/SSA-mediated complete AV block without chordal disruption. Specific epitopes to the p200 region of Ro52, and Ro60 antibodies were evaluated in cases with chordal rupture. Severe AV valve insufficiency was detected prenatally (as early as 34 weeks of gestation) or postnatally (as late as 182 days) after areas of patchy echogenicity were noted in the papillary muscle at 19 to 22 weeks of gestation. Postnatally, urgent valve surgery was performed in 5 of 6 patients; 1 of 6 patients died preoperatively. All patients tested positive for Ro52. Valve leaflet tissue from the autopsy specimens was normal. The ventricular free wall and septum biopsy specimens from a patient with chordal rupture showed normal tissue; however, the papillary muscle biopsy specimens demonstrated severe atrophy with near total replacement of myocytes by fibrosis and dystrophic calcifications, and negative immunochemistry findings. In conclusion, these findings have defined an underappreciated complication of fetal antibody-mediated cardiac inflammation.

  4. Imaging of diffuse H I absorption structure in the SSA22 proto-cluster region at z = 3.1

    Science.gov (United States)

    Mawatari, Ken; Inoue, Akio K.; Yamada, Toru; Hayashino, Tomoki; Otsuka, Takuya; Matsuda, Yuichi; Umehata, Hideki; Ouchi, Masami; Mukae, Shiro

    2017-01-01

    Using galaxies as background light sources to map intervening Lyα absorption is a novel approach to study the interplay among galaxies, the circum-galactic medium (CGM), and the intergalactic medium (IGM). Introducing a new measure of z = 3.1 H I Lyα absorption relative to the cosmic mean, ΔNB497, estimated from photometric data of star-forming galaxies at 3.3 ⪉ z ⪉ 3.5, we have made two-dimensional ΔNB497 maps in the z = 3.1 SSA22 proto-cluster region and two control fields (SXDS and GOODS-N fields) with a spatial resolution of ˜5 comoving Mpc. The ΔNB497 measurements in the SSA22 field are systematically larger than those in the control fields, and this H I absorption enhancement extends more than 50 comoving Mpc. The field-averaged (i.e., ˜50 comoving Mpc scale) ΔNB497 and the overdensity of Lyα emitters (LAEs) seem to be correlated, while there is no clear dependency of the ΔNB497 on the local LAE overdensity in a few comoving Mpc scale. These results suggest that diffuse H I gas spreads out in/around the SSA22 proto-cluster. We have also found an enhancement of ΔNB497 at a projected distance <100 physical kpc from the nearest z = 3.1 galaxies at least in the SSA22 field, which is probably due to H I gas associated with the CGM of individual galaxies. The H I absorption enhancement in the CGM-scale tends to be weaker around galaxies with stronger Lyα emission, which suggests that the Lyα escape fraction from galaxies depends on hydrogen neutrality in the CGM.

  5. SARANA PENGUJIAAN MUTU MAKANAN PADA BEBERAPA PABRIK MAKANAN YANG MEMPRODUKSI PRODUK OLAHAN HASIL PETERNAKAN DAN PERIKANAN

    Directory of Open Access Journals (Sweden)

    Ani Isnawati

    2012-10-01

    oleh 7 pabrik (30,4 %, Gas Chromatografi dan Spektrofotometer Serapan Atom dimiliki hanya oleh 1 pabrik (4,3%. Untuk uji Mikrobiologi peralatan yang dipunyai pabrik adalah autoclave dan oven dipunyai 12 pabrik (52,2 % dan Laminar air flow hanya dimiliki oleh 2 pabrik  (8, 7 %.

  6. Atrioventricular Conduction Delay in Fetuses Exposed to Anti-SSA/Ro and Anti-SSB/La Antibodies: A Magnetocardiography Study

    Directory of Open Access Journals (Sweden)

    Annette Wacker-Gußmann

    2012-01-01

    Full Text Available Background. The presence of anti-SSA/Ro and anti-SSB/La antibodies during pregnancy is associated with fetal congenital heart block (CHB, which is primarily diagnosed through fetal echocardiography. Conclusive information about the complete electrophysiology of the fetal cardiac conducting system is still lacking. In addition to echocardiography, fetal magnetocardiography (fMCG can be used. fMCG is the magnetic analogue of the fetal electrocardiogram (ECG. Patients and Methods. Forty-eight pregnant women were enrolled in an observational study; 16 of them tested positive for anti-SSA/Ro and anti-SSB/La antibodies. In addition to routine fetal echocardiography, fMCG was used. Fetal cardiac time intervals (fCTIs were extracted from the magnetic recordings by predefined procedures. ECGs in the neonates of the study group were performed within the first month after delivery. Results. The PQ segment of the fCTI was significantly prolonged in the study group (P=0.007, representing a delay of the electrical impulse in the atrioventricular (AV node. Other fCTIs were within normal range. None of the anti-SSA/Ro and/or anti-SSB/La fetuses progressed to a more advanced heart block during pregnancy or after birth. Conclusion. The study identified a low-risk population within antibody positive mothers, where PQ segment prolongation is associated with a lack of progression of the disease.

  7. Atomic polarizabilities

    Energy Technology Data Exchange (ETDEWEB)

    Safronova, M. S. [Department of Physics and Astronomy, University of Delaware, Newark, DE 19716 (United States); Mitroy, J. [School of Engineering, Charles Darwin University, Darwin NT 0909 (Australia); Clark, Charles W. [Joint Quantum Institute, National Institute of Standards and Technology and the University of Maryland, Gaithersburg, Maryland 20899-8410 (United States); Kozlov, M. G. [Petersburg Nuclear Physics Institute, Gatchina 188300 (Russian Federation)

    2015-01-22

    The atomic dipole polarizability governs the first-order response of an atom to an applied electric field. Atomic polarization phenomena impinge upon a number of areas and processes in physics and have been the subject of considerable interest and heightened importance in recent years. In this paper, we will summarize some of the recent applications of atomic polarizability studies. A summary of results for polarizabilities of noble gases, monovalent, and divalent atoms is given. The development of the CI+all-order method that combines configuration interaction and linearized coupled-cluster approaches is discussed.

  8. Quantification of ion or atom transfer phenomena in materials implanted by nuclear methods; Quantification de phenomenes de transferts ioniques ou atomiques dans des materiaux implantes par la mise en oeuvre de methodes nucleaires

    Energy Technology Data Exchange (ETDEWEB)

    Oudadesse, Hassane [Clermont-Ferrand-2 Univ., 63 - Aubiere (France)

    1998-05-18

    Knowledge of transfer of the constituents of a system from regions of higher to lower concentration is of interest for implanted bio-materials. It allows determining the rate at which this material is integrated in a living material. To evaluate the ossification kinetics and to study the bio-functionality in corals of Ca and Sr, irradiations with a 10{sup 13} n.cm{sup -2}.s{sup -1} was performed, followed by the examination of changes in the localization of these elements. By using PIXE analysis method the distribution of Ca, P, Sr, Zn and Fe in the implant, bone and bone-implant interfaces were determined. Thus, it was shown that resorption of coral in sheep is achieved in 5 months after implantation and is identical to the cortical tissues 4 months after implantation in animals as for instance in hares. We have analyzed the tissues from around the prostheses extracted from patients. The samples were calcined and reduced to powder weighting some milligrams. We have adopted for this study the PIXE analysis method. The samples were irradiated by a proton beam of 3 MeV and about 400 {mu}m diameter. The results show the presence of the elements Ti, Fe, Cr, Ni or Zn according to the type of the implanted prosthesis. This dispersal of the metallic ions and atoms contaminate the tissues. The transfer factors translate the exchanges between bone and the implanted material. The solvatation phenomenon and the electric charge equilibrium explain the transfer order of cations Mg{sup 2+}, Ca{sup 2+} and Sr{sup 2+} and of the anion PO{sub 4}{sup 3-}. We have also determined these factors for the elements Ti, Cr and Ni. An original technique to study the bone bio-functionality was used. Use of phosphate derivatives labelled by {sup 99m}Tc allows obtaining information about the fixation of radioactive tracer. It was found that only after the eighth month at the implantation the neo-formed bone fixes the MDP (methyl diphosphate) labelled by {sup 99m}Tc in a similar way as in the

  9. Analisis dan Optimasi Desain Sistem Reaktor Gas Temperatur Tinggi RGTT200K dan RGTT200KT

    Directory of Open Access Journals (Sweden)

    Mohammad Dhandhang Purwadi

    2013-03-01

    dengan penyelesaian persamaan aljabar linier dari model RGTT200K dan RGTT200KT. Dari analisis dan optimasi ini dihasilkan desain konseptual sistem RGTT200K dan RGTT200KT dengan spesifikasi thermal-flow teras sama, dan peningkatan EUF dari 63% menjadi 80,14% (untuk RGTT200K dan dari 63,6% menjadi 78,02% (untuk RGTT200KT.

  10. Parameterization of single-scattering albedo (SSA) and absorption Ångström exponent (AAE) with EC / OC for aerosol emissions from biomass burning

    OpenAIRE

    Pokhrel, R. P.; N. L. Wagner; Langridge, J. M.; D. A. Lack; T. Jayarathne; E. A. Stone; C. E. Stockwell; Yokelson, R. J.; S. M. Murphy

    2016-01-01

    Single-scattering albedo (SSA) and absorption Ångström exponent (AAE) are two critical parameters in determining the impact of absorbing aerosol on the Earth's radiative balance. Aerosol emitted by biomass burning represent a significant fraction of absorbing aerosol globally, but it remains difficult to accurately predict SSA and AAE for biomass burning aerosol. Black carbon (BC), brown carbon (BrC), and non-absorbing coatings all make substantial contributions to the absor...

  11. Exfoliative Cheilitis dan Penatalaksanaannya

    Directory of Open Access Journals (Sweden)

    Dewi Agustina

    2012-12-01

    Full Text Available Latar Belakang: Exfoliative cheilitis adalah suatu keadaan inflamatori kronis superfisisal yang ditandai dengan adanya pengelupasan permukaankeratin bibir sedangkan area yang lain terjadi pembentukan lapisan keratin. Tujuan: untuk melaporkan suatu  kasus Exfoliative cheilitis yang diikuti +  selama 2 bulan beserta penatalaksanaanya. Laporan kasus: seorang wanita berusia 52 tahun mengeluh bibir bawahnya pecah-pecah, terasa kering dan panas berdasarkan pemeriksaan subyektif dan klinis, Exfoliative cheilitis ditetapkan sebagai diagnosis kerja. Penatalaksanaanya: Komunikasi-Informasi-Edukasi (KIE diberikan kepada pasien pada awal kunjungan disertai pemberian metil prednisolon, Vitamin B1,6,12 dan anjuran untuk menghentikan kebiasaan menjilat-jilat bibir bawah, menghindari stress dan meningkatkan asupan makanan yang mengandung vitamin A. Pada kunjungna berikutnya pemberian metil prednisolon dihentikan karena terdeteksi adanya peningkatan tekanan darah. Untuk selanjutnya kondisi bibir bawah dievaluasi +  selama 2 bulan. Kesimpulan: Progresitas Exfoliative cheilitis dapat dihentikan dengan bantuan KIE serta menghindari faktor pemicu stress, yang pada akhirnya akan dapat meminimalisir aktivitas factitious berupa menjilat-jilat bibir bawah.    Background: Exfoliative cheilitis is a chronic superficial inflammatory condition that is characterized by regular peeling of a superficial excessive layer of karatin, on the other hand, keratinization is developed in the other area. Aim: to report an Exfoliative cheilitis case monitored for two months and its management. Case Report: a 52 year female has been suffering from fissured lower lip with dry and burning sensations. According to subjective and clinical examinations, Exfoliative cheilitis was determined as the working diagnosis. Management: Communication-Information-Education (CIE were given to the patient at the first visit, besides metyl prednisolon and vitamin B1,6,12 administrations. Patient was

  12. ALMA Deep Field in SSA22: Source Catalog and Number Counts

    Science.gov (United States)

    Umehata, Hideki; Tamura, Yoichi; Kohno, Kotaro; Ivison, R. J.; Smail, Ian; Hatsukade, Bunyo; Nakanishi, Kouichiro; Kato, Yuta; Ikarashi, Soh; Matsuda, Yuichi; Fujimoto, Seiji; Iono, Daisuke; Lee, Minju; Steidel, Charles C.; Saito, Tomoki; Alexander, D. M.; Yun, Min S.; Kubo, Mariko

    2017-01-01

    We present results from a deep 2‧ × 3‧ (comoving scale of 3.7 Mpc × 5.5 Mpc at z = 3) survey at 1.1 mm, taken with the Atacama Large Millimeter/submillimeter Array (ALMA) in the SSA22 field. We observe the core region of a z = 3.09 protocluster, achieving a typical rms sensitivity of 60 μJy beam‑1 at a spatial resolution of 0.″7. We detect 18 robust ALMA sources at a signal-to-noise ratio (S/N) > 5. Comparison between the ALMA map and a 1.1 mm map, taken with the AzTEC camera on the Atacama Submillimeter Telescope Experiment (ASTE), indicates that three submillimeter sources discovered by the AzTEC/ASTE survey are resolved into eight individual submillimeter galaxies (SMGs) by ALMA. At least 10 of our 18 ALMA SMGs have spectroscopic redshifts of z ≃ 3.09, placing them in the protocluster. This shows that a number of dusty starburst galaxies are forming simultaneously in the core of the protocluster. The nine brightest ALMA SMGs with S/N > 10 have a median intrinsic angular size of 0\\buildrel{\\prime\\prime}\\over{.} {32}-0.06+0.13 ({2.4}-0.4+1.0 physical kpc at z = 3.09), which is consistent with previous size measurements of SMGs in other fields. As expected, the source counts show a possible excess compared to the counts in the general fields at S1.1mm ≥ 1.0 mJy, due to the protocluster. Our contiguous mm mapping highlights the importance of large-scale structures on the formation of dusty starburst galaxies.

  13. LINTASAN SEJARAH FILSAFAT PENDIDIKAN PERENIALISME DAN AKTUALISASINYA

    OpenAIRE

    2015-01-01

    Antara filsafat dan pendidikan terdapat kaitan yang erat. Filsafat memiliki aspek-aspek utama yang dapat dijadikan landasan bagi pendidikan. Aspek-aspek yang dimaksud adalah aspek-aspek metafisis, epistemologis, dan aksiologis. Aspek metafisis antara lain berkaitan dengan persoalan realitas yang tercermin pada bahan ajar, pengalaman dan keterampilan. Aspek epistemologis berkaitan dengan persoalan pengetahuan dan kebenaran, termasuk di dalamnya sumber belajar dan metode pembelajaran. Aspek aks...

  14. Singkatan Dan Akronim Dalam Chatting Di Internet

    OpenAIRE

    Hervina M. S.

    2010-01-01

    Penelitian ini menganalis pola singkatan dan akronim dalam chatting di internet. Tujuan penelitian ini adalah mendeskripsikan pola singkatan dan akronim dalam chatting di internet dan mendeskripsikan pola singkatan dan akronim yang paling dominan digunakan dalam chatting di internet. Teori yang digunakan adalah singkatan, akronim, bahasa dalam chatting, sosiolinguistik. Pengumpulan data digunakan dengan metode simak, yaitu penyimakan terhadap penggunaan bahasa (Sudaryanto,1993:133), dan tekni...

  15. RESISTENSI AGAMA DAN BUDAYA MASYARAKAT

    Directory of Open Access Journals (Sweden)

    David Samiyono

    2013-12-01

    Interaksi antar etnis, agama dan budaya bukanlah barang langka di Bali. Sejak semula hal tersebut sudah ada, ketika pulau ini menjadi locus perdagangan hasil bumi. Sebab sesungguhnya kebudayaan Bali menjujung tinggi nilai-nilai keseimbangan dan harmonisasi antar manusia dengan Tuhan (perhyangan, dengan sesama (pawongan dan dengan lingkungan (palemahan. Konsep ini disebut Tri hita karana. Bali kini berubah. Budayanya berorientasi pada jasa, yang berkait dengan industri pariwisata. Sikap orang Bali kini tidak lagi ramah dan harmoni. Akibat ledakan bom dalam bulan Oktober 2002 dan 2005, masyarakat lebih berhati-hati terhadap para pendatang. Ajeg Bali merupakan kearifan lokal –agama dan budaya– masyarakat Bali dalam rangka menanggulangi pengaruh luar yang mengakibatkan perubahan di berbagai bidang sehingga identitas kebalian mengalami degradasi. Ajeg Bali merupakan bentuk resistensi masyar­akat Bali dalam rangka membatasi pendatang dari luar Bali. Kajian ini berusaha untuk menjawab pertanyaan “apakah Ajeg Bali, sebuah kearifan lokal masyarakat Bali dapat membendung pengaruh budaya, agama dan ekonomi masyarakat Bali?”

  16. Kitab kuning dan perempuan, perempuan dan kitab kuning

    NARCIS (Netherlands)

    Bruinessen, M.M. van

    2007-01-01

    Kitab Kuning dan Emansipasi Perempuan: Konflik Budaya? Pengamatan-pengamatan Masdar mengenai kedudukan perempuan dalam diskursus (wacana, bahasan) dominan kitab kuning terasa tidak enak didengar tetapi memang sulit dibantah. Baik dalam penggunaan bahasa (yang sangat memihak kepada jenis mudzakkar) m

  17. Perancangan dan Analisis Redistribution Routing Protocol OSPF dan EIGRP

    Directory of Open Access Journals (Sweden)

    DWI ARYANTA

    2016-02-01

    Full Text Available Abstrak OSPF (Open Shortest Path First dan EIGRP (Enhanced Interior Gateway Routing Protocol adalah dua routing protokol yang banyak digunakan dalam jaringan komputer. Perbedaan karakteristik antar routing protokol menimbulkan masalah dalam pengiriman paket data. Teknik redistribution adalah solusi untuk melakukan komunikasi antar routing protokol. Dengan menggunakan software Cisco Packet Tracer 5.3 pada penelitian ini dibuat simulasi OSPF dan EIGRP yang dihubungkan oleh teknik redistribution, kemudian dibandingkan kualitasnya dengan single routing protokol EIGRP dan OSPF. Parameter pengujian dalam penelitian ini adalah nilai time delay dan trace route. Nilai trace route berdasarkan perhitungan langsung cost dan metric dibandingkan dengan hasil simulasi. Hasilnya dapat dilakukan proses redistribution OSPF dan EIGRP. Nilai delay redistribution lebih baik 1% dibanding OSPF dan 2-3% di bawah EIGRP tergantung kepadatan traffic. Dalam perhitungan trace route redistribution dilakukan 2 perhitungan, yaitu cost untuk area OSPF dan metric pada area EIGRP. Pengambilan jalur utama dan alternatif pengiriman paket berdasarkan nilai cost dan metric yang terkecil, hal ini terbukti berdasarkan perhitungan dan simulasi. Kata kunci: OSPF, EIGRP, Redistribution, Delay, Cost, Metric. Abstract OSPF (Open Shortest Path First and EIGRP (Enhanced Interior Gateway Routing Protocol are two routing protocols are widely used in computer networks. Differences between the characteristics of routing protocols pose a problem in the delivery of data packets. Redistribution technique is the solution for communication between routing protocols. By using the software Cisco Packet Tracer 5.3 in this study were made simulating OSPF and EIGRP redistribution linked by technique, then compared its quality with a single EIGRP and OSPF routing protocols. Testing parameters in this study is the value of the time delay and trace route. Value trace route based on direct calculation of cost

  18. Perawatan Pergeseran Mandibula dan Kliking Menggunakan Teknik Edgewise dan Trainer

    Directory of Open Access Journals (Sweden)

    Rully Utami

    2014-06-01

    Full Text Available Kasus ini terjadi pada perempuan usia 22 tahun yang bersedia dipublikasikan untuk kepentingan  ilmu pengetahuan. Keluhan utama mandibula dan dagunya bergeser ke kanan, gigitan terbuka posterior dan bunyi click di persendian temporomandibular. Diagnosis pasien adalah maloklusi Angle kelas III tipe dento skeletal, pergeseran garis tengah mandibula dan dagu ke kanan, gigitan terbuka posterior dan clicking pada sendi temporomandibular. Perawatan dilakukan dengan teknik Edgewise dan trainer. Leveling dan unraveling dilakukan menggunakan kawat stainless steel bulat diameter 0,014 mm dengan multiloop. Trainer digunakan untuk koreksi pergeseran mandibula. Perawatan dilakukan selama 11 bulan, dan menunjukkan hasil hubungan molar pertama kanan menjadi kelas I. Overjet meningkat dari 0,1 mm menjadi 2 mm, overbite meningkat dari 0,2 mm menjadi 2,57 mm, garis tengah mandibula yang semula bergeser ke kanan 4,38 mm menjadi 2,53 mm, gigitan terbuka posterior dan clicking telah terkoreksi. Compromised Treatment of Class III Malocclusion with Mandibular Shifting, Posterior Openbite and Clicking Using Edgewise Technique and Trainer In Adult. This case report described the treatment of an adult female 22 years old who complained that her mandibula and chin shift to the right, posterior openbite and clicking. The patient diagnosed class III molar relationship, skeletal class III malocclusion, mandibular midline and chin shift to the right, posterior openbite and clicking on temporomandibular joint. Treatment was conducted using combination between  Edgewise Technique and trainer.  Leveling and unraveling are achieved by round stainless steel archwire 0,014 mm with multiloop. Trainer used to corrected the mandibular shifting. Result after 1 years treatment showed that the right molar relationship became class I, overjet increased  from 0,1 mm to 2 mm, overbite increased  from 0,2 mm to 2,57 mm, mandibular midline shifting decresed from 4,38 mm to 2,53 mm

  19. KONSEP DAN PRAKTIK PENDIDIKAN MULTIKULTURAL DI AMERIKA SERIKAT DAN INDONESIA

    Directory of Open Access Journals (Sweden)

    Juju Masunah

    2011-11-01

    Full Text Available Abstract: Concepts and Practices of Multi Cultural Education in the United States and in Indonesia. The purpose of this article is to discuss multicultural education consepts and practices in the U.S.A and its application to Indonesia. Data is based on a case study research of two dance educators who implemented multicultural education concept in Columbus, Ohio in year 2007. The result of this research is that two dance educators teach students equally by developing a curriculum and pedagogy that face democracy for all students. This concept and practice is possible to be applied to dance education in Indonesia. Abstrak: Konsep dan Praktik Pendidikan Multikultural di Amerika Serikat dan Indonesia. Tujuan artikel ini adalah untuk mendiskusikan konsep dan praktik pendidikan multikultural di Amerika Serikat dan Indonesia. Data-data diperoleh dari hasil penelitian studi kasus dua orang pendidik tari di Columbus, Ohio yang menerapkan konsep pendidikan multikultural dalam pembelajaran tari pada tahun 2007. Peneli­tian ini menyimpulkan bahwa dua guru tari tersebut memberi perlakuan yang sama dan adil terhadap se­mua siswa dengan cara yang demokratis dengan memperhatikan keberagaman dan keperbedaan siswa. Cara-cara ini sangat memungkinkan untuk diaplikasikan dalam pendidikan tari di Indonesia.

  20. 抗-SSA/Ro抗体三种检测方法的比较%Detection of anti-SSA/Ro antibody by ELISA, double immunodiffusion,and immunoblotting: a comparative study

    Institute of Scientific and Technical Information of China (English)

    佟胜全; 史群; 温晓宏; 甘晓丹; 史艳萍; 赵岩; 曾小峰; 张奉春; 董怡

    2006-01-01

    目的 比较酶联免疫吸附实验(ELISA)、免疫双扩散(ID)和免疫印迹(IB)3种方法检测抗-SSA/Ro抗体,评价3种方法的符合度,同时提高IB检测相对分子质量52 000条带的认识.方法 采用ELISA法、IB法及ID法检测以下3组对象的抗-SSA/Ro抗体水平:正常献血员血清122份;实验室常规检测血清7736份;诊断明确结缔组织病血清166份.结果 (1)正常献血员122份血清ELISA、ID和IB检测抗-SSA/Ro抗体全部阴性;(2)实验室常规检测的7736份血清,IB检测相对分子质量52 000阳性1085例,其中抗核抗体和其他抗-ENA抗体均阴性的有92份,该组病人经过ID和ELISA两种方法检测全部阴性;(3)结缔组织病组166例,ELISA、ID和IB检测抗-SSA/Ro抗体的阳性率分别是76.5%(127/166),65.1%(108/166),49.4%(82/166);(4)结缔组织病166份血清中,ELISA和ID两种方法检测的符合率88.6%(147/166),两种方法的比较,χ2=17.1,P<0.001;ID和IB两种方法检测的符合率为75.9%(126/166),两种方法的比较,χ2=15.6,P<0.001;(5)ELISA和ID进行Spearman等级相关分析,相关系数为0.828,P<0.001.结论 (1)ELISA和ID特异性优于IB.(2)IB特异性较差,但如果同时ANA和或抗-ENA其他条带阳性,特异性会显著提高.(3)ELISA敏感性优于ID,ID敏感性优于IB.(4)ELISA和ID结果在数值上存在显著的正相关关系.

  1. Atomic physics

    CERN Document Server

    Born, Max

    1989-01-01

    The Nobel Laureate's brilliant exposition of the kinetic theory of gases, elementary particles, the nuclear atom, wave-corpuscles, atomic structure and spectral lines, electron spin and Pauli's principle, quantum statistics, molecular structure and nuclear physics. Over 40 appendices, a bibliography, numerous figures and graphs.

  2. Frequency chain to measure the 2S-8S/8D transitions in atomic hydrogen: measurement of the Rydberg constant in frequency unit; Chaine de frequence optique pour mesurer les transitions 2S-8S/8D dans l'atome d'hydrogene: mesure de la constante de Rydberg en unite de frequence

    Energy Technology Data Exchange (ETDEWEB)

    Nez, F

    1993-10-15

    The aim of this thesis is to make a pure measurement of the frequency of the 2S-8S/8D two-photon transition in atomic hydrogen. In that purpose we have built a frequency chain in which hydrogen frequencies are compared with the difference of two optical standards, the methane stabilized He-Ne laser (3.39 {mu}m) and the iodine stabilized He-Ne laser (633 nm). The radiation from a home made Ti-sapphire laser (TS2) at 778 nm is mixed, in a LiIO{sub 3} crystal, with the one of a auxiliary He-Ne laser at 3.39 {mu}m to produce a synthesized radiation at 633 nm. The frequency of the Ti-sapphire (TS1) laser used for the two photon excitation is 89 GHz away from the one of TS2. To compare these two lasers, we have used a Schottky diode. The two lasers and a microwave radiation at 89 GHz, produced by a Gunn diode, are focused on the Schottky diode. The Gunn diode is phase locked on an ultra-stable quartz oscillator. In this way, we have linked an optical frequency of atomic hydrogen to the cesium clock without interferometry. From our measurements, we have deduced a new value of the Rydberg constant: R{sub {infinity}} equals 109737.3156834 (24) cm{sup -1} with an uncertainty of 2.2 10{sup -11}. Our uncertainty is near the one of the Q.E.D calculations giving the theoretical values of the energy levels. This value, which is currently the most precise available, is in good agreement with the recent result obtained from the 1S-2S and 2S-4D transitions. (author)

  3. KAJIAN BIOAKTIF DAN ZAT GIZI PROPOLIS INDONESIA DAN BRASIL

    Directory of Open Access Journals (Sweden)

    Eliza Halim

    2012-11-01

    Full Text Available ABSTRACTIndonesia has a potency to produce its own propolis, however the propolis market in Indonesia is dominated by imported product, such as from Brazil. Currently, still there is no reasearch which evaluate bioactive compound and nutrient content of Indonesian Propolis (IP compare with Brazilian Propolis (BP. The objectivesof this study were to analyze bioactive compounds and nutrient contents of IP compared to BP. Bioactive compounds and nutrients content were analyzed by gas chromatography–mass spectrophotometry. The resultsshowed both IP and BP contain fenol, α-amyrin, cylolanost, and pyrimidines. Bioactive compounds which specifically found in IP were eudesmane compound, ethyl acridine, lupeol, friedooleanan; while β amyrin and cinnamic acid compound only found in BP. The nutrient contents of IP were higher than BP except for vitamin A. In conclusion, IP might have potential health benefit, similar to BP.Key words: propolis, bioactive, nutrientABSTRAKIndonesia mempunyai potensi untuk menghasilkan propolis tetapi pemasaran propolis di Indonesia didominasi oleh propolis impor seperti propolis yang berasal Brasil. Sampai saat ini belum ada penelitian yang mengungkapkandungan bioaktif dan zat gizi propolis Indonesia (PI dibandingkan dengan propolis Brasil (PB. Oleh karena itu tujuan penelitian ini adalah untuk melakukan kajian kandungan bioaktif dan zat gizi (vitamin dan mineral PI dibandingkan dengan PB. Komponen bioaktif dan kandungn gizi dianalisis dengan metode gas chromatography–mass spectrometry. Hasil analisis menyatakan bahwa baik PI maupun PB mengandung senyawa fenol, α-amyrin, cylolanost, dan pirimidin. Komponen bioaktif unik yang ditemukan di dalam PI adalah senyawaeudesmane, ethyl acridine, lupeol dan friedooleanan; sedangkan β-amyrin dan senyawa asam sinamat hanya ditemukan di dalam PB. Kandungan zat gizi PI lebih tinggi dari PB kecuali kandungan vitamin A. Hal ini menunjukkan bahwa PI kemungkinan mempunyai khasiat untuk

  4. Construcción de mutantes de Salmonella enterica por inactivación de los genes invG/invE y ssaJ/ssaK de las islas de patogenicidad 1 y 2

    Directory of Open Access Journals (Sweden)

    Judith Velasco

    2010-10-01

    To understand the genetic basis of Salmonella pathogenicity mechanisms, various methods have been described to manipulate and generate mutant genomic DNA with specific characteristics. In this study we report the construction of mutants from several serotypes of S. enterica, substitution and inactivation of genes invG/invE in SPI-1 gene and ssaJ/ssaK in SPI-2 by the technique of phage λ Red recombinase, as described by Datsenko and Wanner (2000. The gene deletion in SPI-1 and SPI-2 encodes proteins involved in the formation of type III secretion systems responsible for the invasion and intracellular survival of S. enterica in the host cells. The results of this work will allow in vivo studies to evaluate the possible attenuation of virulence of the mutant strains, as well as to provide new insights into the genetic mechanisms involved in the pathogenesis of diseases caused by these bacteria. Moreover, this technique is recommended to efficiently generate mutants of different serotypes of S. enterica in order to study the chromosomal genes and their products. Key words: red recombinasa, mutation, pathogenicity islands, Salmonella enterica.

  5. Production characteristics of lettuce Lactuca sativa L. in the frame of the first crop tests in the Higher Plant Chamber integrated into the MELiSSA Pilot Plant

    Science.gov (United States)

    Tikhomirova, Natalia; Lawson, Jamie; Stasiak, Michael; Dixon, Mike; Paille, Christel; Peiro, Enrique; Fossen, Arnaud; Godia, Francesc

    Micro-Ecological Life Support System Alternative (MELiSSA) is an artificial closed ecosystem that is considered a tool for the development of a bioregenerative life support system for manned space missions. One of the five compartments of MELiSSA loop -Higher Plant Chamber was recently integrated into the MELiSSA Pilot Plant facility at Universitat Aut`noma deo Barcelona. The main contributions expected by integration of this photosynthetic compartment are oxygen, water, vegetable food production and CO2 consumption. Production characteristics of Lactuca sativa L., as a MELiSSA candidate crop, were investigated in this work in the first crop experiments in the MELiSSA Pilot Plant facility. The plants were grown in batch culture and totaled 100 plants with a growing area 5 m long and 1 m wide in a sealed controlled environment. Several replicates of the experiments were carried out with varying duration. It was shown that after 46 days of lettuce cultivation dry edible biomass averaged 27, 2 g per plant. However accumulation of oxygen in the chamber, which required purging of the chamber, and decrease in the food value of the plants was observed. Reducing the duration of the tests allowed uninterrupted test without opening the system and also allowed estimation of the crop's carbon balance. Results of productivity, tissue composition, nutrient uptake and canopy photosynthesis of lettuce regardless of test duration are discussed in the paper.

  6. Integration of a Higher Plant Chamber into the European Space Agency's MELiSSA Pilot Plant: The Canadian Role in Advanced Life Support Test-Bed Development

    Science.gov (United States)

    Waters, Geoffrey; Lawson, Jamie; Gidzinski, Danuta; Stasiak, Michael; Dixon, Mike; Peiro, Enrique; Godia, Francesc; Paille, Christel; Fossen, Arnaud; Lamaze, Brigitte; Lasseur, Christophe

    The European Space Agency's Micro-Ecological Life Support System Alternative (MELiSSA) project has been conceived as a tool for developing the technology of future biological life support systems required for long-term human space exploration missions to the Moon or Mars. The main life support functions of MELiSSA are the recycling of waste (inedible plant biomass, human excrement), carbon dioxide and minerals and the production of food, fresh water and air revitalization. Based on the principle of an aquatic ecosystem, MELiSSA is comprised of four microbial compartments and a higher plant compartment integrated in a closed loop. Each compartment is studied, designed and demonstrated at laboratory scale before being scaled-up for subsequent integration into the MELISSA Pilot Plant (MPP) at the Universitat Aut`noma de Barcelona. Work related to higher plant cultivation systems, o which have been historically focussed at the University of Guelph's Controlled Environment Systems Research Facility (CESRF), has included design of the HPC for the MPP, the metabolic characterization of MELiSSA candidate crops and the validation of theoretical gas exchange and nutrient dynamic models, The presented paper will review some of the recent data and HPC design work of CESRF conducted as part of Canada's involvement in the MELiSSA program and its partnership in the development of the MPP terrestrial demonstration test-bed.

  7. EKSTRAKSI DAN SINTESIS NANOSILIKA BERBASIS PASIR BANCAR DENGAN METODE BASAH

    Directory of Open Access Journals (Sweden)

    Munasir .

    2013-11-01

    Full Text Available The Purification and synthesis nanosilika extracts from quartz sand base material taken Bancar Tuban area ( north of the Island of Java-Indonesia has been carried out in this study . Physically Tuban Bancar sand grains have a slightly rough shape and bright yellow. Sand Bancar has elements Si atoms (69 %Wt, and elements of the dominant impurity atoms is Ca (7.5 %Wt and K (4.8 %Wt. Diffraction pattern shows a dominant intesistas occurs at an angle (2Ɵ~26o the phase of quartz ( the most stable in nature. Size finely divided powder sand about 5-50 micrometers. Synthesis nanosilika based natural sand used wet method, which consists of two processes, namely: (1 sand powder processed by the hydrothermal method using alkaline compounds (NaOH with molarity 7M, to obtain a clear solution of sodium silicate (Na2O.xSiO2, and (2 a solution of sodium silicate acts as prcursor processed by co-precipitation method, sodium silicate solution was titrated with HCl 2 M (co-precipitation method to obtain a slurry silicite Si(OH4. The final product in the form of silica powder with amorphous and crystalline structures (quartz ; purity (%Wt Si reached 95.7 % and marfologi analysis showed that the SiO2 particles tend to form agglomeration and particle size of about ~ 58 nm Key words: nanosilica, bancar sands, amorphous, quartz   Abstrak Pemurnian, ekstrak dan sintesis nanosilika dari bahan dasar pasir kuarsa yang diambil di daerah Bancar Tuban (utara Pulau Jawa-Indonesia telah dilakukan pada penelitian ini. Secara fisik pasir  Bancar Tuban  mempunyai bentuk butiran agak kasar dan berwarna kuning cerah. Pasir Bancar mempunyai unsur atom Si (69%Wt, dan unsur atom pengotor dominan adalah Ca (7,5%wt dan K (4,8%wt. Pola difraksinya menunjukan intesistas dominan terjadi pada sudut (2 theta ~26o, fase quartz (paling stabil di alam. Ukuran serbuk pasir yang telah dihaluskan sekitar 5-50 mikrometer. Sintesis nanosilika berbasis pasir alam digunakan metode basah, yang

  8. PERBANDINGAN KARAKTERISTIK KIMIA KOPI LUWAK DAN KOPI BIASA DARI JENIS KOPI ARABIKA (Cafeea arabica. L) DAN ROBUSTA (Cafeea canephora. L)

    OpenAIRE

    Israyanti, -

    2012-01-01

    Penelitian ini bertujuan untuk mengetahui perbandingan jumlah kafein, karakteristik proksimat (protein dan lemak) dan rasa dan aroma antara kopi luwak dan kopi biasa dari jenis arabika (Cafeea arabica. L) dan robusta (Cafeea canephora. L). Perlakuan penelitian yakni A1 (luwak robusta), A2 (luwak arabika), B1 (robusta biasa) dan B2 (arabika biasa). Parameter penelitian yaitu pengujian organoleptik pada rasa (metode hedonik) dan aroma (metode ranking), analisa kafein dan uji proksimat berupa ...

  9. PERANAN KOMPETENSI INTI DALAM MERGER DAN AKUISISI

    Directory of Open Access Journals (Sweden)

    Dwi Sulistiani

    2013-11-01

    Full Text Available Dalam era globalisasi dan pedagangan  bebas dewasa ini strategi merger dan akuisisi  merupakan fenomena yang semakin marak dilakukan oleh para pelaku bisnis dan  semakin menarik untuk dicermati bersama. Untuk menjalankan perusahaan para manajemen perusahaan selalu dituntut menjaga pertumbuhan usahanya secara optimal. Penerapan strategi merger dan akuisisi merupakan jalan pintas untuk mewujudkan pertumbuhan usaha tanpa perusahaan perlu memulai dari awal suatu jenis usaha yang baru. Dalam suatu kondisi perusahaan yang kuat cenderung membeli perusahaan lain untuk meningkatkan daya saing dan penghematan biaya. Perusahaan yang terlibat dalam merger dan akuisisi akan dapat diperoleh pangsa pasar yang lebih besar dan efisiensi terhadap biaya. Perusahaan yang merasa tidak dapat bertahan hidup secara individual biasanya merelakan diri untuk menjadi target akuisisi. Merger dan akuisisi merupakan suatu realitas dan tantangan yang harus siap dihadapi oleh para pelaku usaha dalam era perdagangan bebas saat ini. Namun tingkat kesuksesan dalam melakukan kegiatan merger dan akuisisi juga sangat dipengaruhi oleh kondisi internal perusahaan meliputi sumber daya, kapabilitas dan kompetensi inti yang dimiliki oleh perusahaan. Tulisan ini akan mencoba memberikan pemahaman bahwa sumber daya, kapabilitas dan  kompetensi inti merupakan faktor penting dalam melakukan kegiatan penggabungan usaha yang pada akhirnya dapat menentukan tingkat keberhasilan proses merger dan akuisisi yang sedang dijalankan oleh perusahaan

  10. RANCANG BANGUN MODEL KOMPRESI DAN TARIK PERMODELAN SANDBOX DAN MANFAATNYA

    Directory of Open Access Journals (Sweden)

    Fahrudin Fahrudin

    2015-07-01

    Full Text Available Permodelan sandbox dibuat dengan system tektonik konvergen dan divergen dengan menggunakan pergerakan satu sumbu. Permodelan ini bertujuan untuk membuat alat mesin sandbox yang bisa digunakan untuk penelitian dan pengajaran. Mesin berhasil dibuat dan sudah diujicobakan. Ujicoba dengan menggunakan satu lapisan pasir yang diambil dari Formasi Ngrayong. Percobaan selanjutnya dengan beberapa lapisan. Percobaan dilakukan dengan pengamatan yang meliputi pengamatan permukaan dan penampang verikal. Pengamatan yang aspek morfologi, kelurusan struktur, dan perkembangan sesar yang terbentuk. Hasil percobaan menunjukkan bahwa pembentukan morfologi sangat berkaitan dengan pembentukan sesar. Struktur sesar dengan pola forward propagating thrust faults. Sesar tersebut disebabkan imbrikasi. Lipatan yang terbentuk akibat mekanisme propagasi sesar.[Design of Compression and Extensional of the Sandbox Model and Its Benefit] Divergent and convergent tectonic sytem can be studied from the sandbox modelling. This model has a axis of movement. Sandbox models itends to study the progress of structural geology such as fault and fold. We successfully made machine of sandbox. This machine has basal detachment from duraluminum. Material for model is taken by loose sand from Ngrayong Formation. This experiment focused to observation about morphology in surface and thrust or backthrust in subsurface. This experiment has compression system. Result of model was that morphological sequences associated with fault sequences. Fault is formed to have the pattern of forward propagating thrust faults. It’s caused by imbricate thrust system. Folding is formed by the mechanism of fault propagation folding. 

  11. Characterization of Brca2-deficient plants excludes the role of NHEJ and SSA in the meiotic chromosomal defect phenotype.

    Directory of Open Access Journals (Sweden)

    Marilyn Dumont

    Full Text Available In somatic cells, three major pathways are involved in the repair of DNA double-strand breaks (DBS: Non-Homologous End Joining (NHEJ, Single-Strand Annealing (SSA and Homologous Recombination (HR. In somatic and meiotic HR, DNA DSB are 5' to 3' resected, producing long 3' single-stranded DNA extensions. Brca2 is essential to load the Rad51 recombinase onto these 3' overhangs. The resulting nucleofilament can thus invade a homologous DNA sequence to copy and restore the original genetic information. In Arabidopsis, the inactivation of Brca2 specifically during meiosis by an RNAi approach results in aberrant chromosome aggregates, chromosomal fragmentation and missegregation leading to a sterility phenotype. We had previously suggested that such chromosomal behaviour could be due to NHEJ. In this study, we show that knock-out plants affected in both BRCA2 genes show the same meiotic phenotype as the RNAi-inactivated plants. Moreover, it is demonstrated that during meiosis, neither NHEJ nor SSA compensate for HR deficiency in BRCA2-inactivated plants. The role of the plant-specific DNA Ligase6 is also excluded. The possible mechanism(s involved in the formation of these aberrant chromosomal bridges in the absence of HR during meiosis are discussed.

  12. An enhanced merger fraction within the galaxy population of the SSA22 protocluster at z ~ 3.1

    CERN Document Server

    Hine, N K; Alexander, D M; Lehmer, B D; Chapman, S C; Matsuda, Y

    2015-01-01

    The over-dense environments of protoclusters of galaxies in the early Universe z>2 are expected to accelerate the evolution of galaxies, with an increased rate of stellar mass assembly and black hole accretion compared to co-eval galaxies in the average density `field'. These galaxies are destined to form the passive population of massive systems that dominate the cores of rich clusters today. While signatures of accelerated growth of galaxies in the SSA22 protocluster z=3.1 have been observed, the mechanism driving this remain unclear. In this work we show an enhanced rate of galaxy-galaxy mergers could be responsible. We morphologically classify Lyman-break Galaxies (LBGs) in the SSA22 protocluster and compare these to those of galaxies in a typical density field at z=3.1 as either active mergers or non-merging using Hubble Space Telescope F814W imaging, probing the rest frame ultraviolet stellar emission. We measure a merger fraction of 48+/-10% for LBGs in the protocluster compared to 30+/-6% for the fiel...

  13. MUWUJUDKAN BUDAYA POLITIK SANTUN, BERSIH DAN BERETIKA DALAM RANGKA MEMPERKOKOH KEHIDUPAN BERBANGSA DAN BERNEGARA

    Directory of Open Access Journals (Sweden)

    Wahyu Widodo

    2014-11-01

    Full Text Available Abstract Makalah ini membahas konsep budaya politik berpusat pada imajinasi (pikiran dan perasaan manusia yang merupakan dasar semua tindakan. Dalam rangka menuju arah pembangunan dan modernisasi suatu masyarakat akan menempuh jalan yang berbeda antara satu masyarakat dengan yang lain, dan itu terjadi karena peranan kebudayaan sebagai salah satu faktor. Budaya politik dapat membentuk aspirasi, harapan, preferensi, dan prioritas tertentu dalam menghadapi tantangan yang ditimbulkan oleh perubahan sosial politik. Pada gilirannya, disimpulkan bahwa peran budaya politik santun, bersih dan beretika dalam rangka memperkokoh kehidupan berbangsa dan bernegara menuju Indonesia baru adalah: pertama, etika politik dan pemerintahan mengandung misi kepada setiap pejabat dan elite politik untuk bersikap jujur, amanah, sportif, siap melayani, berjiwa besar, memiliki keteladanan, rendah hati, dan siap untuk mundur dari jabatan publik apabila terbukti melakukan kesalahan dan secara moral kebijakannya bertentangan dengan hukum dan rasa keadilan masyarakat. Kedua, perlu dilakukan upaya penanaman suatu kesadaran bahwa politik yang hendak kita perjuangkan bukan semata politik kekuasaan, melainkan suatu politik yang mengedepankan panggilan pengabdian demi kesejahteraan masyarakat luas, dialektika antara partai dan politikus serta masyarakat yang kritis. Ketiga, budaya politik santun, bersih dan beretika ini diperlukan karena dapat membuat para elite politik menjauhi sikap dan perbuatan yang dapat merugikan bangsa Indonesia. Akhirnya, disarankan agar dilaksanakan kembali pendidikan budi pekerti yang merupakan pondasi bagi pelaksanaan Civic Education agar tercipta generasi yang tidak hanya mau menjadi politisi, namun paham budaya dan etika politik.   Kata kunci: budaya politik, kehidupan berbangsa dan bernegara, menuju Indonesia baru

  14. KORELASI ANTARA ISLAM DAN EKONOMI

    Directory of Open Access Journals (Sweden)

    Akmal Zainal Abidin

    2015-03-01

    Full Text Available CORELATION BETWEEN ISLAM AND ECONOMY. This paper aims to identifies about the correlation between economic and Islam. Islam is the perfect religion that governs all things in life, including the economy. This is evident with the concept of  well-being which is described in the al-Quran and Sunnah. Basically the goal of every human life is to prosper, although humans make sense of  well- being with a different perspective. Most understand economics assume that welfare is the welfare of  earthly material. But to make sense of well-being with the term al-Falah, is meaning holistic wellbeing and balance between material and spiritual dimensions. al-Quran and Sunnah have taught that the human being will be achieved if  living in balance between material and spiritual. This is because human life does not just stop in the life of this world, but there is still a second life that will be faced by humanity in the hereafter, and well-being will be achieved with the truth is that people can balance the needs of the world and the hereafter, and that is what is taught in Islamic economics. Keywords: Islam, Economy, Prosperity. Tulisan ini bertujuan untuk menjelasakn tentang korelasi antara ekonomi  dan  Islam.  Islam  adalah  agama  yang  sempurna  yang mengatur segala hal dalam kehidupan ini, termasuk juga ekonomi. Hal ini terbukti dengan konsep kesejahteraan yang dipaparkan dalam al-Quran dan Sunnah. Pada dasarnya tujuan hidup setiap manusia adalah untuk mencapai kesejahteraan, meskipun manusia memaknai kesejahteraan dengan perspektif  yang berbeda-beda. Sebagian besar paham ekonomi menganggap bahwa kesejahteraan adalah kesejahteraan material duniawi. Namun Islam memaknai kesejahteraan dengan istilah  Falah  yang  berarti  kesejahteraan  holistik  dan  seimbang antara dimensi material dan spiritual. Al-Quran dan Sunnah telah mengajarkan bahwa kesejahteraan akan tercapai jika manusia menjalani hidup secara seimbang antara material dan

  15. RETRACTED: Blockade of TNF-α signaling suppresses the AREG-mediated IL-6 and IL-8 cytokines secretion induced by anti-Ro/SSA autoantibodies.

    Science.gov (United States)

    Sisto, Margherita; Lisi, Sabrina; Lofrumento, Dario Domenico; Cucci, Liana; Mitolo, Vincenzo; D'Amore, Massimo

    2010-09-20

    The aim of this study was to analyze the Furin-TNF-α-converting enzyme (TACE)-amphiregulin (AREG)-IL-6/IL-8 secretion pathway in non-neoplastic human salivary gland epithelial cells (SGECs) stimulated with anti-Ro/SSA autoantibodies (Abs). We examined whether anti-Ro/SSA Abs-mediated TACE activation is responsible for AREG activation. As recent studies have demonstrated that AREG could induce proinflammatory cytokines secretion in epithelial cells, we discuss how TACE-mediated AREG shedding, caused by anti-Ro/SSA Abs treatment, could have a critical role in TNF-α-induced IL-6 and IL-8 secretion by SGEC. Furthermore, the effects of TNF-α blockade on AREG expression and TNF-α-AREG-mediated IL-6 and IL-8 secretion were evaluated. We have discovered that the upregulation of AREG occurs through TNF-α produced after anti-Ro/SSA Abs uptake via Fcγ receptors. Biological drug adalimumab and the gene silencing technique were used to study the AREG-IL-6/IL-8 secretion pathway, demonstrating that (i) adalimumab-mediated TNF-α blocking and TNF-α gene silencing provoke a significant decrease of proinflammatory cytokines production and AREG expression in anti-Ro/SSA Abs-treated SGEC; (ii) AREG gene silencing has a potent inhibitory effect on TNF-α-induced IL-6 and IL-8 secretion in SGEC treated with anti-Ro/SSA Abs; (iii) an inspection of the kinetics of cytokine production after exogeni TNF-α and AREG addition, and the use of cycloheximide in the presence of exogenous TNF-α as stimulant, clarified that TNF-α induces IL-6 and IL-8 secretion through AREG.Laboratory Investigation advance online publication, 20 September 2010; doi:10.1038/labinvest.2010.168.

  16. Expression and secretion of Salmonella pathogenicity island-2 virulence genes in response to acidification exhibit differential requirements of a functional type III secretion apparatus and SsaL.

    Science.gov (United States)

    Coombes, Brian K; Brown, Nat F; Valdez, Yanet; Brumell, John H; Finlay, B Brett

    2004-11-26

    Salmonella pathogenicity island (SPI)-2 is pivotal to the intracellular survival of Salmonella and for virulence in mammals. SPI-2 encodes virulence factors (called effectors) that are translocated into the host cell, a type III secretion apparatus and a two-component regulatory system that regulates intracellular expression of SPI-2. Salmonella SPI-2 secretion activity appears to be induced in response to acidification of the vacuole in which it replicates. Here we show that the expression of the SPI-2 proteins, SseB and SseD (filament and pore forming components of the secretion apparatus, respectively) in response to acidification requires an intact secretion system and SsaL, a Salmonella homologue of SepL, a regulator required for type III-dependent secretion of translocators but not effectors in attaching and effacing gastrointestinal pathogens. We show that the expression of SPI-2-encoded effectors is acid-regulated but can be uncoupled from the expression of filament and translocon components, thus showing a differential requirement of SsaL for expression. The secretion and translocation of SPI-2-encoded effectors requires SsaL, but SsaL is dispensable for the secretion of SPI-2 effectors encoded in other pathogenicity loci, suggesting a secretion regulation function for SsaL. Further, we demonstrate that the differential expression of adjacent genes within the sseA operon (sseD and sseE) occurs at the transcriptional level. These data indicate that a Salmonella SPI-2 activation state is achieved by an acidregulated response that requires SsaL. These data also suggest the existence of a previously unrecognized regulatory element within SPI-2 for the "effector operon" region downstream of sseD that might demarcate the expression of translocators and effectors.

  17. KINERJA KEPALA SEKOLAH DALAM KEGIATAN BIMBINGAN DAN KONSELING

    Directory of Open Access Journals (Sweden)

    Abu Bakar M.Luddin

    2014-06-01

    Abstrak: Kinerja Kepala Sekolah dalam Kegiatan Bimbingan dan Konseling. Penelitian ini bertujuan mendeskripsikan kinerja kepala sekolah dalam pelaksanaan kegiatan bimbingan dan konseling. Penelitian dilaksanakan di SMU Negeri 2 Kota Binjai, dengan memergunakan rancangan deskriptif kualitatif. Subjek penelitian adalah kepala sekolah, koordinator bimbingan dan konseling, dan guru pembimbing. Data di­kumpulkan dengan observasi, wawancara mendalam, dan kajian dokumen, dan selanjutnya dianalisis sete­lah melalui proses triangulasi antarsubjek dan informasi. Temuan penelitian menunjukkan bahwa kinerja kepala sekolah terkait dengan pelaksanaan kegiatan bimbingan dan konseling masih belum sepenuhnya sebagaimana yang diharapkan. Kepala sekolah perlu meningkatkan kinerjanya dalam menjalankan fungsi koordinasi dan kepengawasan untuk mencapai kegiatan bimbingan dan konseling yang efektif.

  18. PEMBELAJARAN SENI TARI: AKTIF, INOVATIF DAN KREATIF

    OpenAIRE

    Gandes Nurseto

    2015-01-01

    Pendidikan seni tari perlu diberikan pada Sekolah Dasar karena keunikan, kebermaknaan terletak pada pemberian pengalaman estetik dalam bentuk berapresiasi dan menggunakan model pembelajaran yang PAIKEM Pembelajaran, Aktif, Inovatif, Kreatif, Efektif dan Menyenagkan dalam proses pembelajaran didalam kelas dari Standar Kompetensi dan Komptensi Dasar mengapresiasi karya seni tari tunggal nusantara yang bertujuan untuk mengenalkan karya seni tari daerah lain. Masalah dalam penelitian ini bagaiman...

  19. Kandidiasis di Mulut akibat Khemoterapi dan Penatalaksanaannya

    OpenAIRE

    2016-01-01

    Latar belakang: kandidiasis (kandidosis) adalah infeksi jamur yang disebabkan oleh spesies Candida biasanya Candida albicans. Faktor predisposisi yang memicu kandidiasis adalah terganggunya ekologi mulut karena antara lain pemakaian antibiotika, kortikosteroid, penyakit kronis dan keganasan, beberapa gangguan darah; terapi radiasi di leher dan kepala; khemoterapi; leukimia, obat sitotoksik, juga kebersihan mulut yang buruk. Tujuan: melaporkan kasus kandidiasis di mulut karena khemoterapi dan ...

  20. Ultraviolet radiation (UVR) induces cell-surface Ro/SSA antigen expression by human keratinocytes in vitro: a possible mechanism for the UVR induction of cutaneous lupus lesions

    Energy Technology Data Exchange (ETDEWEB)

    Jones, S.K. (Bristol Royal Infirmary (United Kingdom))

    1992-06-01

    Antinuclear antibodies are useful markers of connective tissue disease. In this study, UVB but not UVA induced the expression of Ro/SSA antigen on keratinocyte surfaces in vitro. This expression was also found with the extractable nuclear antigens RnP and Sm, but not with single or double-stranded DNA. The expression was prevented by blocking protein synthesis, suggesting that it was an active process. The results suggest that UVB exposure may result in the expression of Ro/SSA antigen on the surfaces of basal keratinocytes in vivo. This antigen could then bind circulating antibody leading to the cutaneous lesions in neonatal and subacute cutaneous lupus erythematosus. (Author).

  1. Atomic theories

    CERN Document Server

    Loring, FH

    2014-01-01

    Summarising the most novel facts and theories which were coming into prominence at the time, particularly those which had not yet been incorporated into standard textbooks, this important work was first published in 1921. The subjects treated cover a wide range of research that was being conducted into the atom, and include Quantum Theory, the Bohr Theory, the Sommerfield extension of Bohr's work, the Octet Theory and Isotopes, as well as Ionisation Potentials and Solar Phenomena. Because much of the material of Atomic Theories lies on the boundary between experimentally verified fact and spec

  2. PENGARUH PEMBERIAN HIJAUAN DAN KONSENTRAT MENGANDUNG UREA-KAPUR DAN UBI KAYU TERHADAP PENAMPILAN KAMBING PE

    Directory of Open Access Journals (Sweden)

    I G. Mahardika

    2015-06-01

    Full Text Available Penelitian telah dilakukan untuk mengetahui pengaruh pemberian hijauan dan konsentrat yang mengandung urea-kapur dan ubi kayu terhadap produktivitas kambing. Penelitian menggunakan Rancangan Acak Lengkap dengan 4 perlakuan dan 4 ulangan. Ke empat perlakuan yang dicobakan adalah Perlakuan A: ransum dengan 75% konsentrat (mengandung 4% urea, 2% kapur dan 50% ubikayu dan 25% hijauan (40% gamal dan 60% rumput raja, perlakuan B: rasnsum yang terdiri 60% konsentrat 40% hijauan, perlakuan C: ransum dengan 45% konsentrat dan 55% hijauan dan perlakuan D: ransum dengan 30% konsentrat dan 70% hijauan. Hasil penelitian mendapatkan bahwa produktivitas kambing yang mendapat ransum dengan level konsentrat 45% sampai 75% tidak berbeda sedangkan yang mendapat ransum dengan level konsentrat 30% lebih rendah. Ransum yang memebrikan nilai ekonomi tertinggi adalah ransum yang mengandung konsentrat antara 45% sampai 60%.

  3. STRUKTUR DAN PRODUKSI LEBAH Trigona spp. PADA SARANG BERBENTUK TABUNG DAN BOLA

    Directory of Open Access Journals (Sweden)

    Putu Ade Hinduari Putra

    2015-12-01

    Full Text Available Lebah tanpa sengat (Trigona spp. dapat menghasilkan madu yang bermanfaat bagi kesehatan. Penelitian bertujuan untuk mengetahui : (1 morfologi Trigona spp., (2 struktur internal sarang Trigona spp. pada sarang berbentuk tabung dan bola, (3 volume sarang serta perkiraan produksi madu, beebread dan selanakan Trigona spp. pada sarang berbentuk tabung dan bola. Penelitian dilaksanakan pada bulan November 2014. Sampel yang digunakan adalah koloni dan sarang Trigona spp. berbentuk tabung dan bola yang diambil di Desa Padang Tunggal,Kecamatan Selat, Kabupaten Karangasem, Bali. Hasil penelitian menunjukan bahwa nama spesies dari sampel koloni Trigona spp. pada sarang berbentuk tabung dan bola adalah Trigona laeviceps. Struktur internal sarang Trigona spp. pada sarang berbentuk tabung dan bola mempunyai pola susunan yaitu pot madu, pot beebread dan pot sel anakan. Volume sarang besar memberikan perkiraan total jumlah produksi madu, beebread dan selanakan lebih banyak dibandingkan volume sarang kecil.

  4. PERAN KEPALA SEKOLAH DAN PUSTAKAWAN DALAM PEMBERDAYAAN PERPUSTAKAAN SD MUHAMMADIYAH SAPEN DAN SD NEGERI GIWANGAN

    Directory of Open Access Journals (Sweden)

    Widya Setyaningrum Bagyoastuti

    2016-04-01

    Full Text Available Penelitian ini bertujuan untuk mendeskripsikan: (1 peran kepala sekolah dalam memberdayakan perpustakaan sekolah dasar, dan (2 peran pustakawan dalam memberdayakan perpustakaan sekolah dasar. Pendekatan kualitatif digunakan dalam penelitian ini dengan menjadikan perpustakaan SD Muhammadiyah Sapen dan SD Negeri Giwangan sebagai subjek penelitian. Data penelitian dikumpulkan melalui teknik observasi, wawancara, dan dokumentasi kemudian dianalisis dengan mengacu pada model interaktif menurut Miles dan Huberman. Hasil penelitian menunjukkan bahwa pemberdayaan perpustakaan sekolah dasar dimulai manakala terdapat dukungan kepala sekolah dan hadirnya pustakawan penuh waktu yang profesional. Kepala sekolah berperan sebagai (1 manajer sekolah, (2 pemimpin instruksional, dan (3 agen perubahan. Pustakawan berperan sebagai (1 manajer perpustakaan, (2 ahli informasi dan penggiat literasi informasi, (3 pelaku instruksional, dan (4 kolaborator. Pemberdayaan perpustakaan dapat dilakukan dengan (1 meningkatkan partisipasi warga sekolah dalam pengembangan koleksi pustaka, (2 meningkatkan kolaborasi antara pustakawan dengan guru dalam pembelajaran, dan (3 pengembangan literasi informasi yang terintegrasi ke dalam pembelajaran.

  5. IDENTIFIKASI DAN TEKNIK PENGENDALIAN HAMA DAN PENYAKIT BENIH PULAI (Alstonia scholaris

    Directory of Open Access Journals (Sweden)

    Evayusvita Rustam

    2016-09-01

    Full Text Available Tujuan dari penelitian ini adalah mengidentifikasi dan mengendalikan hama dan penyakit benih pulai yang terbawa dari lapangan. Identifikasi cendawan dilakukan dengan menginkubasi benih selama 7 hari, sedangkan untuk pengendalian terhadap hama dan penyakit benih diberi insektisida nabati dan kimia. Dari hasil identifikasi jenis cendawan pada benih pulai yaitu Aspergillus sp, Curvularia sp., Fusarium sp., Penicillium sp. dan Rhizopus sp. Persentase infeksi cendawan tertinggi pada benih pulai asal Nagrak (Aspergillus sp. sebesar 92%, Curvularia sp. 29% dan Fusarium sp. 21%, sedangkan persentase infeksi cendawan terendah pada benih pulai asal Jambi (Aspergillus sp. 2% dan Fusarium sp. 1%. Perlakuan terbaik yang dapat mengendalikan hama pada benih pulai adalah perlakuan yang diberi ekstrak daun suren dalam wadah plastik tertutup dan disimpan di ruang suhu kamar 270C selama 2 bulan. Pengendalian penyakit, terbaik pada benih adalah memberi bubuk kunyit ke dalam wadah plastik tertutup dan disimpan di lemari es 160C. Perlakuan tersebut menghasilkan daya kecambah masing-masing 70%.

  6. GRIYA DAN OMAH Penelusuran Makna dan Signifikasi di Arsitektur Jawa

    Directory of Open Access Journals (Sweden)

    Josef Prijotomo

    1999-01-01

    Full Text Available Terms and names in architecture may sometimes be powerful in exploring history of ideas. Philology and hermeneutics are discipline of knowledge that utilize this notion in a very throgh and critical way. Inspired by those discipline of knowledge, this musing on `Griya' and `Omah' tries to demonstrate that their meaning is not `house' as many still understand them. Rather, both terms understood by the Jawanese as `any building' constructed. Critical assessment upon old documents named `Kawruh Griya' not only supportive for this understanding among the Javanese, but also provide us with a hint on one of ideals of `what a home is' among the Jawanese. The Javanese once had a notion that to dwell in a house is like sheltering under a shady tree. Since `griya' and `omah' may open our musing up to regions and cultures outside Jawa, this paper will limit its musing within the Jawanese. Abstract in Bahasa Indonesia : Kata, sebutan dan istilah yang digunakan dalam arsitektur terkadang memiliki kemampuan untuk membantu dan menjadi bahan kajian sejarah bagi dunia arsitektur. Kajian filologi dan hermeneutika dengan baik telah memanfaatkan kemampuan tersebut. Tanpa harus memaksakan diri untuk mengikuti dengan ketat bidang pengetahuan tersebut, penelusuran atas arti `griya' dan `omah' ini mencoba untuk mengungkap sebagian kecil dari sejarah arsitektur Jawa. Melalui interpretasi-menerangkan (Poespoprodjo 1987: 194-195 atas arti kedua kata tersebut di dalam berbagai naskah Kawruh Griya, keduanya samasekali tidak memiliki arti: `rumah'. Dengan penelusuran ini ditemukan pula petunjuk yang mengarah pada salah satu gagasan orang Jawa tentang rumah yakni `bagaikan berteduh di bawah pohon'. Meskipun kedua kata tersebut dapat membawa penelusuran ini ke wilayah di luar arsitektur dan masyarakat Jawa, harus diakui bahwa penelusuran ini masih dibatasi pada telusuran internal bahasa Jawa, yakni hanya mengkaji kedua kata tersebut di dalam perjalanan kebahasaan bahasa Jawa

  7. PERANCANGAN DAN PENGEMBANGAN PROTOTYPE SISTEM PARKIR

    Directory of Open Access Journals (Sweden)

    Indah Ayu Septriyaningrum

    2016-10-01

    Abstrak  Sistem parkir manual pada pelayanan parkir mall memerlukan pengelolaan dan pengembangan sistem yang lebih rumit dan jauh dari kata efisien. Informasi yang didapatkan pengelola parkir terkait kondisi parkir di lapangan setiap harinya masih kurang. Tujuan dari penelitian ini adalah merancang dan mengembangkan prototype sistem parkir. Metode pengembangan dan perancangan sistem pada penelitian ini adalah metode Waterfall. Hasil yang didapatkan adalah sistem ini dapat mendeteksi keberadaan mobil pada slot parkir yang tersedia dengan bantuan Intel Galileo Board Gen 2 sebagai kontroler, sensor LDR (Light Dependent Resistor dan sensor ultrasonik (PING sebagai alat bantu pendeteksi keberadaan mobil. Sistem dapat menampilkan aktifitas parkir pada aplikasi web seperti kondisi lahan parkir kosong, lahan terisi, waktu masuk, waktu keluar, lama parkir dan kapasitas parkir yang tersedia serta grafik pemakaian lahan parkir. Dapat disimpulkan bahwa perancangan dan pengembangan sistem berhasil diimplementasikan. Kata Kunci : Sistem parkir, waterfall, Intel Galileo Board Gen 2,sensor LDR (Light Dependent Resistor, sensor ultrasonik

  8. Sistem Informasi Penjualan dan Pemesanan Layanan Berbasis Web dan SMS Gateway di Petshop "PetZone"

    Directory of Open Access Journals (Sweden)

    Siska Fadhilah Wati

    2013-09-01

    Full Text Available Dewasa ini teknologi informasi sangat membantu dalam dunia bisnis. Kemudahan yang ditawarkan akan menjaring lebih banyak konsumen. Namun, perusahan tingkat menengah seperti PetZone saat ini masih jarang yang menawarkan kemudahan berbelanja atau pemesanan layanan secara online. Oleh karena itu diperlukan sebuah sistem berbasis web di perusahaan PetZone yang dapat memudahkan pemilik dan karyawan dalam apenjualan, pelayanan, dan pemasaran, serta memudahkan pelanggan dalam jual-beli barang dan jasa. Atas dasar masalah tersebut dibangun Sistem Informasi Penjualan dan Pemesanan Layanan Berbasis Web dan SMS Gateway untuk menunjang proses bisnis yang ada. Sistem informasi dibangun menggunakan bahasa pemrograman PHP framework Codeigniter, javascript untuk tampilan yang dinamis, dan database MySQL. Proses pembuatan dan pengembangan Sistem Informasi Penjualan ini menggunakan metode air terjun. Metode air terjun meliputi kebutuhan pengguna, analisis, rancangan, implementasi dan pengujian. Pemodelan Sistem Informasi yang dibangun menggunakan metode berorientasi objek UML (Unified Modeling Language yang terdiri dari Use case  diagram, Class diagram dan Sequence diagram. Hasil pengujian Sistem Informasi Penjualan dan Pemesanan Layanan Berbasis Web dan SMS Gateway menunjukkan bahwa semua fitur yang terdapat baik dalam sistem informasi maupun SMS gateway dapat bekerja dengan baikdengan ratusan sample data, dan server SMS gateway dapat memproses lebih dari satu SMS secara bersamaan. Dalam perkembangan ke depannya nanti, Sistem Informasi Penjualan dan Pemesanan Layanan Berbasis Web dan SMS Gateway masih dapat dikembangkan lagi dengan menambah fitur-fitur pada SMS gateway sehingga lebih memudahkan konsumen.

  9. HUKUM DAN PERUBAHAN MASYARAKAT

    Directory of Open Access Journals (Sweden)

    Antoni Antoni

    2015-05-01

    Full Text Available Abstract: Where there is sugar there must be an ant, or likefish and water, as it were appropriate parable likens the Lawand Society, because where there is society there must be lawswill be needed. Law and society are two sides of which aredifficult to separate, because they will need each other andinfluence each other.ملخص:حیث یوجد السكر یجب أن یكون ھناك نملة، أو مثل السمك والماء، كما انھاكانت مناسبة المثل یشبھ القانون والمجتمع، وذلك لأن عندما یكون ھناك مجتمع یجبأن یكون ھناك وستكون ھناك حاجة القوانین .القانون والمجتمع وجھان لوالتي یصعبفصل، لأنھا سوف نحتاج إلى بعضنا البعض وتؤثر على بعضھا البعض.Kata Kunci: hukum dan perubahan masyarakat

  10. Transfection, overexpression and clinical application of human 60 kDa Ro/SSA autoantigens in HEp-2 cells

    Institute of Scientific and Technical Information of China (English)

    吕良敬; 陈顺乐; 顾越英; 沈南; 鲍春德; 王元; 薛峰; 叶萍; 俞翀曌

    2003-01-01

    Objective To develop an improved substrate for indirect immunofluorescence test (IIF) for detecting anti-Ro60/Sjogren's syndrome A (Ro/SSA) autoantibodies.Methods 60-kDa Ro/SSA autoantigens (Ro60) cDNAs were obtained from human placental cDNA library using polymerase chain reaction (PCR) and were cloned into the mammalian expression vector-pEGFP-C1. Then, the recombinant plasmids were transfected into HEp-2 cells. We confirmed the overexpression, localization and antigenicity of fusion proteins in transfected cells by means of immunoblotting, confocal fluorescence microscopy and IIF. HEp-2 and HEp-Ro60 were analyzed by IIF using a panel of 10 precipitin-positive anti-Ro human sera simultaneously.Results Stable expression of Ro60-green fluorescent protein (Ro60-GFP) fusion proteins were maintained ten more generations. Ro60-GFP kept the antigenicity of Ro while demonstrating its own characteristic immunofluorescent pattern in HEp-Ro60 cells. The transfectants dramatically increased the sensitivity of IIF testing (a mean increase of 6.7-fold in endpoint titer). Eight overten (8/10) positive anti-Ro sera showed characteristic immunofluorescent patterns for HEp-Ro60, including two sera that were anti-nuclear antibodies (ANA) negative for untransfected HEp-2. IIF-ANA in all healthy sera was negative for HEp-Ro60. Conclusions As a new substrate for IIF, the Ro60 transfectants can be used to detect anti-Ro antibodies. In addition, transfected HEp-2 cells keep the immunofluorescent properties of HEp-2 cells in IIF-ANA tests and can be employed as a substrate for routine IIF-ANA detection.

  11. Lõuka tuuliku restaureerimine / Dan Lukas

    Index Scriptorium Estoniae

    Lukas, Dan

    2005-01-01

    Hiiumaal Pühalepa vallas Vahtrepa külas Lõuka talu maadel asuva pukktuuliku ajaloost, restaureerimise käigust. Teostus: Dan Lukas. Muinsuskaitseline järelevalve: Tõnu Sepp, tema kommentaar. Ill.:pukktuuliku lõiked ja korruste plaanid, 7 värv. fotot

  12. Corner Office: Google's Dan Clancy

    Science.gov (United States)

    Albanese, Andrew Richard; Oder, Norman

    2009-01-01

    This article presents an interview with Dan Clancy, engineering director for Google Book Search. In this interview, Clancy talks about the pending Google Book Search settlement, involving millions of volumes digitized from libraries, which drew a lawsuit from the Association of American Publishers and the Authors Guild. He also discusses pricing,…

  13. 75 FR 30839 - Privacy Act of 1974; CMS Computer Match No. 2010-03, HHS Computer Match No. 1003, SSA Computer...

    Science.gov (United States)

    2010-06-02

    ... HUMAN SERVICES Centers for Medicare & Medicaid Services Privacy Act of 1974; CMS Computer Match No. 2010-03, HHS Computer Match No. 1003, SSA Computer Match No. 1048, IRS Project No. 241 AGENCY: Department... renewal of an existing computer matching program (CMP) that has an expiration date of June 30,...

  14. 78 FR 48170 - Privacy Act of 1974; CMS Computer Match No. 2013-12; HHS Computer Match No. 1307; SSA Computer...

    Science.gov (United States)

    2013-08-07

    ... Services Privacy Act of 1974; CMS Computer Match No. 2013-12; HHS Computer Match No. 1307; SSA Computer... Human Services (HHS). ACTION: Notice of Computer Matching Program (CMP). SUMMARY: In accordance with the....Wesolowski@cms.hhs.gov . SUPPLEMENTARY INFORMATION: The Computer Matching and Privacy Protection Act of...

  15. The SSB-positive/SSA-negative antibody profile is not associated with key phenotypic features of Sjögren's syndrome

    DEFF Research Database (Denmark)

    Baer, Alan N; McAdams DeMarco, Mara; Shiboski, Stephen C;

    2015-01-01

    OBJECTIVE: To determine whether the Sjögren's syndrome B (SSB)-positive/Sjögren's syndrome A (SSA)-negative antibody profile is associated with key phenotypic features of SS. METHODS: Among registrants in the Sjögren's International Collaborative Clinical Alliance (SICCA) with possible or establi...

  16. Ly alpha emissters at z=6.5 in the SSA22 field: An area more neutral or void at the end of the reionization epoch

    CERN Document Server

    Nakamura, E; Hayashino, T; Horie, M; Kousai, K; Fujii, T; Matsuda, Y

    2010-01-01

    We present results of a survey of Lyman $\\alpha$ emitters (LAEs) at $z=6.5$ which is thought to be the final epoch of the cosmic reionization. In a $\\approx530$ arcmin$^2$ deep image of the SSA22 field taken through a narrowband filter NB912 installed in the Subaru/Suprime-Cam, we have found only 14 LAE candidates with $L_{\\rm Ly\\alpha}\\ga3\\times10^{42}$ erg s$^{-1}$. Even applying the same colour selection criteria, the number density of the LAE candidates is a factor of 3 smaller than that found at the same redshift in the Subaru Deep field (SDF). Assuming the number density in the SDF is a cosmic average, the probability to have a number density equal to or smaller than that found in the SSA22 field is only 7% if we consider fluctuation by the large-scale structure (i.e. cosmic variance) and Poisson error. Therefore, the SSA22 field may be a rare void at $z=6.5$. On the other hand, we have found that the number density of $i'$-drop galaxies with $25.5SSA22 field agrees well with that...

  17. [Laboratory-based evaluation of "INOVA/QUANTA Lite" to determine antinuclear antibodies (ANA) and autoantibodies to double-stranded DNA, SS-A and SS-B].

    Science.gov (United States)

    Yamauchi, Megumi S; Shingaki, Naohiko; Yamane, Nobuhisa

    2012-05-01

    We evaluated QUANTA Lite reagent series (INOVA Diagnostics, CA, USA) to determine antinuclear antibodies (ANA) and autoantibodies to double-stranded (ds) DNA, SS-A and SS-B, in parallel with MESACUP (Medical & Biological Laboratories, Nagoya). Overall agreements between two reagents for qualitative interpretation ranged from 77.5% (ANA) to 99.0%(anti-SS-B antibodies). When we compared to the results by indirect fluorescent antibody (IFA) test on HEp-2 cells, QUANTA Lite ANA demonstrated better sensitivity and specificity; 92.2% versus 76.5% in sensitivity and 92.1% versus 86.8% in specificity. Also, determining anti-chromatin antibodies and IFA test onto Chrithidia luciliae demonstrated greater interpretive correlation to detect anti-ds DNA by QUANTA Lite than by MESACUP. All the discrepant sera to which QUANTA Lite SS-A gave positive interpretations were confirmed to contain the antibodies specific to SS-A 52kDa antigen, which is supplemented to QUANTA Lite capture-probes. With these results, we can conclude that QUANTA Lite has superiorities over MESACUP; (1) to detect a variety of autoantibodies consisting of ANA, (2) to have a better correlation with confirmatory tests to detect anti-ds DNA antibodies, (3)to detect additional autoantibodies specific to SS-A 52kDa antigen, and (4) to have an enough compatibility in determining anti-SS-B antibodies.

  18. The mapping of the human 52-kD Ro/SSA autoantigen gene to human chromosome II, and its polymorphisms

    Energy Technology Data Exchange (ETDEWEB)

    Frank, M.B.; Itoh, Kazuko (Oklahoma Medical Research Foundation, Oklahoma City (United States)); Fujisaku, Atsushi (Hokkaido Univ., Sapporo (Japan)); Pontarotti, P. (Centre de Recherches sur le Polymorphisme Genetique des Populations Humaines, Toulouse (France)); Mattei, M.G. (INSERM U 242, Marseille (France)); Neas, B.R. (Oklahoma Medical Research Foundation, Oklahoma City (United States) Univ. of Oklahoma, Oklahoma City (United States))

    1993-01-01

    Autoantibodies to the ribonucleoprotein Ro/SSA occur in nearly half of the patients with systemic lupus erythematosus and are associated with lymphopenia, photosensitive dermatitis, and pulmonary and renal disease, which suggests that they have an immunopathologic role. The majority of Ro/SSA precipitin-positive patients produce serum antibodies that bind to the 60-kD and 52-kD Ro/SSA proteins. The authors previously isolated and determined the nucleotide sequence of a cDNA clone that encodes the 52-kD form of the human Ro/SSA protein. In the present study, they have determined the chromosomal location of the gene by in situ hybridization to the end of the short arm of chromosome 11. Hybridization of portions of the cDNA probe to restriction enzyme-digested DNA indicated the gene is composed of at least three exons. The exon encoding the putative zinc fingers of this protein was found to be distinct from that which encodes the leucine zipper. An RFLP of this gene was identified and is associated with the presence of lupus, primarily in black Americans. 60 refs., 3 figs., 3 tabs.

  19. TiSSA pleenum "Sotsiaaltöö kriisi ajal" : mida on sotsiaaltööl pakkuda ja kes saab sellest kasu? / Regina Lind

    Index Scriptorium Estoniae

    Lind, Regina

    2010-01-01

    22.-27. aug. 2010 toimus Tallinna Ülikoolis TiSSA doktorantide eelkonverents ja pleenum. Pleenumil peetud sotsiaalteadlaste ettekannetest. Esinesid: Holger Ziegler, Karin Böllert, Catrin Heite, Hans van Ewijk, Walter Lorenz, Mikko Mäntysaari, Heinz Sünker, Synnöve Karvinen-Niinikoski, Olga Borodkina

  20. Gangguan Fungsi Penghidu dan Pemeriksaannya

    Directory of Open Access Journals (Sweden)

    Effy Huriyati

    2014-01-01

    Full Text Available AbstrakLatar belakang: Fungsi penghidu pada manusia memegang peranan penting. Gangguan penghidu dapat mempengaruhi keselamatan dan kualitas hidup seseorang. Tujuan: Untuk mengetahui jenis gangguan penghidu, penyebab gangguan penghidu, dan pemeriksaannya. Tinjauan Pustaka: Gangguan penghidu dapat berupa anosmia yaitu hilangnya kemampuan penghidu, atau hiposmia yaitu berkurangnya kemampuan penghidu. Gangguan penghidu disebabkan gangguan konduksi, gangguan sensoria dan gangguan neural. Penyakit tersering penyebab gangguan penghidu yaitu rinosinusitis kronis, rinitis alergi, infeksi saluran nafas atas dan trauma kepala. Ada beberapa modalitas pemeriksaan kemosensoris fungsi penghidu diantaranya Tes “Sniffin sticks”. Dengan tes „Sniffin sticks” dapat diketahui ambang penghidu, diskriminasi penghidu dan identifikasi penghidu seseorang. Kesimpulan: Gangguan penghidu memerlukan perhatian khusus. Diantara beberapa modalitas pemeriksaan kemosensoris penghidu, tes “Sniffin sticks” mempunyai beberapa kelebihan.Kata kunci: Gangguan penghidu, anosmia, hiposmia, tes “Sniffin sticks”.AbstractBackground: Olfactory function in humans plays an important role. Olfactory disorders can affect the safety and quality of life. Objective: To determine the type of olfactory disorder, the causes of olfactory disorders, and the examination. Literature Review: Olfactory disorder can be not smell anything or anosmia, and reduced of smell or hyposmia. Olfactory disorders caused by conduction disturbances, neural disturbances and sensoris disturbances. Disease that often causes disturbances of olfactory function is, chronic rhinosinusitis, allergic rhinitis, upper respiratory tract infections and head trauma. There are several modalities to examine chemosensoris smelling function, one of them is “Sniffin sticks” test. This test can examine threshold, discrimination, and identification of smelling. Conclusions: Impaired smelling require special attention

  1. PEMBINAAN DAN PENGEMBANGAN USAHA KECIL

    Directory of Open Access Journals (Sweden)

    Sentot Harman Glendoh

    2001-01-01

    Full Text Available Small business as an economic activity of society on a small scale, has a central role in the economy of Indonesia. Although the economic crisis has created a great disturbance in the live of large and middle-size business, apparently small business continues to function well in the lower levels of the economy. The main role of small business is: 1 use excess labor; 2 as a producer of goods and services at reachable prices for the lower economic levels of society; 3 as a potential producer of foreign exchange because of the success of this type of industry in producing non-oil commodities for export. Remembering that the role of small business is large and has great influence on the lower economic levels of society, it is quite necessary to pay attention to the development of this sector. Abstract in Bahasa Indonesia : Usaha kecil sebagai kegiatan ekonomi rakyat berskala kecil memiliki peran sentral dalam perekonomian Indonesia. Walaupun krisis ekonomi telah memporakporandakan kehidupan bidang usaha besar dan menengah, ternyata usaha kecil tetap tegar dan berjalan marak dikawasan kehidupan ekonomi tingkat bawah. Peran pokok usaha kecil ini adalah: (1 sebagai penyerap tenaga kerja, (2 sebagai penghasil barang dan jasa pada tingkat harga yang terjangkau bagi kebutuhan rakyat banyak yang berpenghasilan rendah, (3 sebagai penghasil devisa negara yang potensial kerena keberhasilannya dalam meproduksi komoditi ekspor non migas. Mengingat peran usaha kecil tersebut sangat besar andilnya bagi negara dan masyarakat kecil dilapisan bawah, maka pembinaan dan pengembangannya sangat perlu diperhatikan. Kata kunci: pembinaan, pengembangan, usaha kecil.

  2. Atomic physics

    Energy Technology Data Exchange (ETDEWEB)

    Livingston, A.E.; Kukla, K.; Cheng, S. [Univ. of Toledo, OH (United States)] [and others

    1995-08-01

    In a collaboration with the Atomic Physics group at Argonne and the University of Toledo, the Atomic Physics group at the University of Notre Dame is measuring the fine structure transition energies in highly-charged lithium-like and helium-like ions using beam-foil spectroscopy. Precise measurements of 2s-2p transition energies in simple (few-electron) atomic systems provide stringent tests of several classes of current atomic- structure calculations. Analyses of measurements in helium-like Ar{sup 16+} have been completed, and the results submitted for publication. A current goal is to measure the 1s2s{sup 3}S{sub 1} - 1s2p{sup 3}P{sub 0} transition wavelength in helium-like Ni{sup 26+}. Measurements of the 1s2s{sup 2}S{sub 1/2} - 1s2p{sup 2}P{sub 1/2,3/2} transition wavelengths in lithium-like Kr{sup 33+} is planned. Wavelength and lifetime measurements in copper-like U{sup 63+} are also expected to be initiated. The group is also participating in measurements of forbidden transitions in helium-like ions. A measurement of the lifetime of the 1s2s{sup 3}S{sub 1} state in Kr{sup 34+} was published recently. In a collaboration including P. Mokler of GSI, Darmstadt, measurements have been made of the spectral distribution of the 2E1 decay continuum in helium-like Kr{sup 34+}. Initial results have been reported and further measurements are planned.

  3. KINERJA DAN EFISIENSI BANK PEMERINTAH (BUMN DAN BUSN YANG GO PUBLIK DI INDONESIA

    Directory of Open Access Journals (Sweden)

    Sugeng Haryanto

    2012-06-01

    Full Text Available Penelitian ini menganalisis kinerja dan tingkat efisiensi bank-bank BUMN dan BUSN yang go Publik di Bursa Efek Indonesia.  Sample penelitian ini mengambil  tiga bank BUMN Bank BNI 46, Bank Mandiri dan Bank BRI  dan tiga bank BUSN (Bank BCA, Bank Niaga dan Bank Panin dengan periode analisis tahun 2005-2011. Varibael yang digunakan meliputi ROA, ROE, LAR. LDR, NPL dan BOPO. Tujuan dari penelitian ini adalah melihat dan menganalisis perbedaan kinerja antara Bank BUMN dan BUSN yang go public di Bursa Efek Indonesia tahun 2005-2011.  Pendekatan pengukuran kinerja yang digunakan adalah Return on Asset (ROA, Return on Equity (ROE dan Loan to Deposit Ratio (LDR, Loan to Asset Ratio (LAR,  dan efisiensi bank. Hasil dari penelitian menunjukkan bahwa 1 Bank-bank nasional, baik itu bank BUMN maupun BUSN menunjukkan kinerja yang semakin baik, 2 tidak terdapat perbedaan yang signifikan antara kinerja bank BUMN dan BUSN untuk variabel ROA, ROE, LAR, LDR, dan BOPO sedangkan variabel NPL yang merupakan indikator risiko kredit menunjukkan adanya perbedaan yang signifikan antara Bank BUMN dan BUSN

  4. INDUSTRIALISASI DAN TANTANGANNYA PADA SEKTOR PENDIDIKAN

    Directory of Open Access Journals (Sweden)

    Arif Unwanullah

    2015-10-01

    Full Text Available Abstrak: Industrialisasi dan Tantangannya pada Sektor Pendidikan. Sumbangan pendidikan dalam perubahan dan pembangunan masa lalu telah bergeser dengan kemajuan teknoekonomi dan komunikasi. Perubahan yang terjadi telah menggeser tatanan kehidupan dan pandangan masyarakat. Materialisme, kapitalisme, efisiensi, dan efektivitas telah menjadi tujuan dan semangat hidup. Pergeseran pandangan masyarakat telah mengubah pula pandangan keberhasilan dan mutu pendidikan, di mana pendidikan diukur dari keberhasilan dalam keterserapan lulusan dalam dunia kerja, oleh karenanya pendidikan dianalisis dari karakteristik sebagai investasi (capital-investment. Pergeseran makna dan tanggung jawab pendidikan mendorong dunia pendidikan melakukan pembaruan dengan alternatif: membangun pembaruan penalaran warganya menuju pemerdekaan dan pendewasaan, pendidikan dilaksanakan secara komprehensif dan bekerjasama dengan semua pihak secara kemitraan, dan membangun visi pendidikan secara komprehensif dan simultan dengan semua pihak. Kata kunci: perubahan sosial, materialistik, modernisasi dan kapitalis Abstract: Industrialization and its education Sector challenges. Contribution of education has shifted with the progress of technology, economy, and communication. The changes have shifted the society's views. Materialism, capitalism, efficiency, and effectiveness have become of interest and enthusiasm for life. The shift has changed society's view, i.e. the view of success and quality of education, in which education is measured from a rate of the absorption of graduates into labor market, therefore education is analyzed from the characteristics of an investment (capital-investment. A shift in meaning and responsibility of education encourages the education sector to create reformation through these following alternatives: creating new thoughts towards liberation and maturation, implementing education comprehensively and cooperating with all parties in partnership, and creating

  5. IMPLEMENTASI KEBIJAKAN PEMUNGUTAN PAJAK BUMI DAN BANGUNAN

    Directory of Open Access Journals (Sweden)

    Arifuddin - Sahabu

    2012-05-01

    Full Text Available ABSTRAKS   Penelitian ini menggunakan metode kualitatif dengan bentuk studi kasus. Pengumpulan data dilakukan dengan menggunakan teknik wawancara, dokumentasi, dan observasi. Analisis data mengunakan metode analisis Miles dan Huberman, dengan melalui tiga prosedur yaitu reduksi data, penyajian data dan menarik kesimpulan/verifikasi. Sedangkan keabsahan menggunakan teknik berdasarkan atas kriteria derajat kepercayaan, keteralihan, ketergantungan, dan kepastian suatu data. Tuntutan menghadapi  implementasi Otonomi Daerah mengandung arti pentingnya Pemerintah Daerah memperhatikan kemampuan “self suporting” dalam bidang keuangan. Sumber pendapatan daerah tidak hanya di peroleh dari Pendapatan Asli Daerah, tetapi juga berupa pemberian bagi hasil dari penerimaan Pemerintah Pusat. Diantara sumber penerimaan tersebut adalah Pajak Bumi dan Bangunan. Dalam Undang-undang Nomor 25 Tahun 1999 Tentang perimbangan keuangan antara Pemerintah Pusat  dan Daerah, diantaranya dijelaskan bahwa sumber penerimaan daerah dalam penyelenggaraan desentralisasi berasal dari dana perimbangan penerimaan Pajak Bumi dan Bangunan disamping pemberian Dana Alokasi Umum dan Alokasi Khusus. Langkah Implementasi dari pelaksanan pemungutan Pajak Bumi dan Bangunan tersebut dilakukan Departemen Keuangan melalui Kantor Pelayanan Pajak Bumi dan Bangunan, sedang Pemerintah daerah menerima pelimpahan penagihan pada Sektor Perkotaan dan Sektor Pedesaan. Meskipun telah ada pelimpahan kewenangan kepada daerah, akan tetapi pelimpahan kewenangan tersebut terbatas pada mekanisme penagihan saja, sedang implementor yang menyangkut masalah administrasi masih berada pada Kantor Pelayan Pajak Bumi dan Bangunan. Kondisi demikian ini ditambah dengan kurangnya koordinasi antara unit organisasi pelaksana menyebabkan setiap tahun terjadi tunggakan. Sebagai sandaran teoritik utama  untuk mendiskripsikan serta menganalisis hambatan-hambatan implementasi kebijakan publik (dalam hal ini pemungutan

  6. The Atomic orbitals of the topological atom

    OpenAIRE

    Ramos-Cordoba, Eloy; Salvador Sedano, Pedro

    2013-01-01

    The effective atomic orbitals have been realized in the framework of Bader's atoms in molecules theory for a general wavefunction. This formalism can be used to retrieve from any type of calculation a proper set of orthonormalized numerical atomic orbitals, with occupation numbers that sum up to the respective Quantum Theory of Atoms in Molecules (QTAIM) atomic populations. Experience shows that only a limited number of effective atomic orbitals exhibit significant occupation numbers. These c...

  7. VAKSIN DENGUE DAN PERKEMBANGANNYA SAAT INI DAN DI MASA MENDATANG

    Directory of Open Access Journals (Sweden)

    Triwibowo Ambar Garjito

    2012-09-01

    Full Text Available Dengue virus merupakan salah satu virus anggota dari famili Flaviviridae yang sejak tahun 1956 telah dikenal dapat menimbulkan demam dengue maupun demam berdarah dengue (DBD. Penyakit yang ditularkan oleh nyamuk Aedes aegypti ini diperkirakan telah menjangkiti pada selatar 50-100 juta manusia dengan 500.000 kasus di antaranya dalam manifestasi yang ganas yang dikenal sebagai dengue haemorrhagic fever dan dengue shock syndrome dan 25.000 di antaranya berakibat fatal (meninggal. Saat ini pengembangan vaksin merupakan salah satu solusi yang diharapkan dapat menekan penyebaran penyakit tersebut. E (envelope merupakan salah satu bagian dari protein struktural virus yang sangat penting dalam pengembangan vaksin, yaitu sebagai badan yang memproduksi antibodi netralisasi untuk protein. Non-struktural protein l juga telah diketahui sebagai salah satu komponen penting dalam pengembangan vaksin oleh karena kemampuannya untuk dapat diekspresi pada permukaan sel yang diinfeksi yang dapat menjadi target untuk immune cytolisis. Ada dua pendekatan yang digunakan dalam memproduksi suatu vaksin dengue, yaitu: a. Vaksin hidup yang telah dilemahkan (live attenuated vaccine: b. Vaksin hasil rekayasa (engineered vaccine. Penelitian terhadap vaksin DENV baik rekombinan maupun non-rekombinan yang didasarkan pada uji virus telah dilakukan secara terus-menerus baik pada monyet dan manusia. Sampai saat ini telah dikembangkan sejumlah kandidat vaksin DENV yang berdasar pada tetravalent virus dengue, yaitu a. vaksin konvensional, b. vaksin dengue rekombinan berdasar pada flavivirus, c. vaksin intertypic chimeric, d. vaksin chimerivac, e. vaksin dengue rekombinan menggunakan vector non-ftavivirus dan f. vector adenovirus. Namun demikian, sampai sekarang belum ada vaksin yang siap digunakan untuk menangkal infeksi ke empat serotype virus dengue, sehingga masih diharapkan untuk pengembangan virus lebih lanjut.   Kata kunci: Aedes aegypti, dengue virus, vaksin dengue.

  8. Muhammad sebagai pemimpin agama dan negara periode Makkah dan Madinah

    Directory of Open Access Journals (Sweden)

    Ummu Zakiyah Maulidah

    2014-07-01

    Full Text Available Muhammad was born in Mecca between AD 570 and 580 in the Banu Hashims,a reputable family of Quraysh. In Mecca, Muhammad is portrayed as a privatecitizen, as he had to limit himself and adapt his behavior to face the situationduring jahiliyyah era. While, in Medina he governed the community and guidedthem in religious life. His arrival in Medina has significant contribution towardhis role as political leader. His power in this city had protected himself and hisfollowers from violent opposition of the Quraysh. The doctrines he employedin politics were inseparable from the religious values rooted from the Quran.Through his innovation and skillful diplomacy, he had converted the peopleof Mecca and Medina into brighter Arab civilization. Such a positive changereflected his monumental accomplishment for the people.Muhammad lahir di kota Makkah antara tahun 570 sampai 580 Masehi dikeluarga Bani Hasyim, suku Quraisy terkemuka di Arab. Di kota Makkah,Muhammad dianggap sebagai masyarakat biasa, sebab ia harus membatasidirinya dan menyesuaikan prilakunya dalam menghadapi keadaan yangterjadi pada zaman jahiliyyah. Sedangkan di Madinah, ia dianggap sebagaipemimpin masyarakat dan menjadi pembimbing umat dalam hidup beragama.Kedatangannya di Madinah juga memberikan konstribusi besar pada perannyasebagai pemimpin politik. Kekuasaan di kota ini sangat membantu dirinya danpara pengikutnya dari kerasnya kelompok oposisi Quraisy. Doktin-doktrin yangdigunakan Muhammad dalam dunia politik juga tidak lepas dari nilai-nilaiagama yang bersumber dari al Quran. Dengan kreatifitas dan inovasinya dalammemimpin, Muhammad mampu mengarahkan masyarakat Makkah dan Madinah menuju kebangkitan peradaban bangsa Arab yang lebih cemerlang.Kondisi yang semakin membaik tersebut, tidak lain merupakan sebuah karyadan jasa monumental yang telah diukir oleh Muhammad untuk umatnya.

  9. Preparation and characterization of PVA/SSA membranes with Al{sub 2}O{sub 3} nanoparticles for fuel cell applications; Preparacao de caracterizacao de membranas de PVAL/SSA na presenca de nanoparticulas de Al{sub 2}O{sub 3} para aplicacao em celulas de combustivel

    Energy Technology Data Exchange (ETDEWEB)

    Oliveira, Paula N.; Pires, Alfredo T.N. [Grupo de Estudo em Materiais Polimericos - POLIMAT - UFSC, Florianopolis, SC (Brazil); Catarino, Margarida; Brandao, Lucia; Tanaka, Alfredo; Mendes, Adelio [Faculdade de Engenharia da Universidade do Porto, Porto (Portugal)

    2011-07-01

    In the present study, PVA/SSA membranes were prepared with and without the addition of Al{sub 2}O{sub 3} nanoparticles. Sulfosuccinic acid (SSA) was used as the crosslinking agent. Membranes were prepared with different amounts of SSA (26, 43 and 55 wt.%) and with 5 and 10 wt.% of nanoparticles. Crosslinking was performed at 90 degree C during 1.5 h. Membranes were analyzed by infrared spectroscopy, thermal analysis, water absorption, ion exchange capacity (IEC) and proton conductivity. The results showed that control of the crosslinking conditions, IEC value, water absorption and polymer structure are of significant importance to obtain a set of properties suitable for application in proton exchange membrane fuel cells. (author)

  10. Application of SSA analysis technique in biaxially oriented polypropylene specialty resin production%SSA 分析技术在双向拉伸聚丙烯专用料生产过程中的应用

    Institute of Scientific and Technical Information of China (English)

    刘兴旺; 朱宝兴; 赵爱利

    2012-01-01

    The isotacticity and its sequence distribution of several biaxially oriented polypropylene (BOPP) specialty resins were characterizated by successive self - nucleation annealing ( SSA ) method , and the relationship between crystallization and film forming performance was researched. On the basis of this,the cause for film breaking of BOPP resin manufactured in a 300 kt/a polypropylene unit of Lanzhou Petrochemical Company occurred during its extruding was analyzed, and the process parameters of the polymerization were optimized. The results showed that the film forming stability of BOPP resin was dependent on the isotacticity sequence distribution , that was the content of high isotacticity molecules needed to be decreased, and the content of low isotacticity molecules needed to be increased. The IPeakl/Peak2 ratio should be less than 1. With increasing the mass ratio of catalyst to external electron do-nor(T/D) ,the content of high isotacticity molecules decreased,the content of low and medium isotacticity molecules inceased,the lamellar became thinner, the isotacticity sequence distribution became broader , and the performance of film forming was improved.%采用连续自成核退火法(SSA)对几种不同双向拉伸聚丙烯(BOPP)树脂进行了等规度及等规序列分布表征,研究了其结晶行为与成膜稳定性之间的关系,据此分析了中国石油兰州石化公司30万t/a聚丙烯装置初期所产BOPP产品在使用过程中存在易破膜问题的原因,并进行了装置聚合工艺参数的优化.结果表明,BOPP树脂的成膜稳定性取决于其等规度分布情况,即高等规度组分含量应较低,低等规度组分含量应较高,峰高比值(Ipeak1/Ipeak2)以小于1为宜;随着催化剂与外给电子体质量比(T/D)的增大,BOPP树脂的高等规度组分含量逐渐降低,中、低等规度组分含量相对上升,晶片厚度变薄,分布加宽,成膜性能得以改善.

  11. Analisis Kesesuaian dan Daya Dukung untuk Wisata Pantai dan Snorkeling di Pulau Hoga, Kabupaten Wakatobi.

    OpenAIRE

    Ahmad, Bahar

    2014-01-01

    Kawasan wisata bahari agar dapat dimanfaatkan secara berkelanjutan maka pemanfaatan yang dilakukan harus berkesesuaian dengan kondisi dan daya dukung kawasan. Penelitian ini bertujuan untuk menganalisis kesesuaian dan daya dukung untuk wisata pantai dan snorkeling di Pulau Hoga Kabupaten Wakatobi. Data yang digunakan dalam penelitian ini menggunakan data primer dan sekunder. Pengumpulan data primer menggunakan metode survei lapangan, sedangkan data sekunder diperoleh dari Badan Pusat Statis...

  12. KONSEP WANUA DAN PALILI DI KONFEDERASI AJATAPPARENG: SEJARAH DAN BUDAYA POLITIK ORANG BUGIS DI SULAWESI SELATAN

    OpenAIRE

    Abd. Latif

    2014-01-01

    Kajian ini akan mendiskusikan tentang konsep wanua dan palili dalam struktur kerajaan-kerajaan yang tergabung dalam Konfederasi Ajatappareng di Sulawesi Selatan. Wanua dan palili adalah dua istilah yang digunakan oleh kerajaan pusat terhadap daerah bawahannya. Pertanyaannya, mengapa ada daerah bawahan yang disebut wanua dan yang lainnya disebut palili. Apakah kriteria yang mesti dipunyai satu daerah untuk disebut sebagai wanua dan apakah pula kriteria yang mesti dipunyai satu daerah untuk dis...

  13. PERJANJIAN SEWA GUNA USAHA ANTARA LESSEE DAN LESSOR

    Directory of Open Access Journals (Sweden)

    Aprilianti Aprilianti

    2014-03-01

    Full Text Available Perjanjian sewa guna usaha (leasing yang diadakan oleh Lessor dan Lesseen dilakukan secara tertulis dalam bentuk perjanjian standar. Isi perjanjian tersebut ditentukan oleh jenis dari leasing itu sendiri dan hubungan hukum (hak dan kewajiban timbal balik antara Lessor dan Lessee. Bagi Lessor, hak dan kewajibannya adalah memperoleh pembayaran sebagai imbalan jasa dan menyerahkan barang modal kepada Lessee. Sedangkan hak dan kewajiban Lessee adalah meperoleh kegunaan dari barang modal dan membayar sewa secara berkala. Tidak dipenuhinya hak dan kewajiban masing-masing pihak maka dapat disebut wanprestasi. Perjanjian akan berakhir jika hak dan kewajiban Lessor dan Lessee telah dilaksanakan sesuai dengan perjanjian. Kata Kunci: Leasing, Lessor, Lessee, hak dan kewajiban.

  14. KONTEKS DAN KONSTRUKSI SOSIAL MENGENAI KEMATIAN ELEKTIF ( EUTHANASIA ∗

    Directory of Open Access Journals (Sweden)

    Helly Prajitno Soetjipto

    2015-09-01

    konteks sosial dan konstruksi sosial kematian. Euthanasia didiskusikan di dalam suatu kerangka pikir yang mencoba memberi perhatian kepada hal-hal yang kontekstual dan interpretatif fenomena sosial suatu proses kematian dan kejadian kematian

  15. KEBEBASAN BERAGAMA DAN NORMA-NORMANYA

    Directory of Open Access Journals (Sweden)

    Abdillah Halim

    2013-04-01

      Abstrak Perdebatan tidak berkesudahan terus mewarnai perbincangan dan praktek kebebasan beragama, terutama mengenai kata “kebebasan” yang dilekatkan pada agama dan kepercayaan. Jika “kebebasan” dimaknai sebagai kemerdekaan, apa lantas berarti tidak adanya batasan terhadap kemerdekaan tersebut, dalam arti bahwa kebebasan tersebut bersifat mutlak. Atau barangkali “kebebasan” di sini dimaknai sebagai kebebasan relatif yang membuka kemungkinan perumusan definisi dan ruang lingkup yang jelas. Penulis berpandangan bahwa kebebasan beragama bukan kebebasan mutlak yang tidak menuntut pendefinisian, perumusan ruang-lingkup serta norma norma, dan pengaturan. Kebebasan mutlak pada taraf yang demikian bukan kebebasan yang bermakna sebenarnya, namun dapat berarti sebuah keadaan anarki dan anomi. Kebebasan beragama adalah kebebasan relatif yang menuntut adanya penjelasan tentang definisi, ruang lingkup, norma-norma, dan batasan-batasannya.

  16. Persebaran Layanan dan Infrastruktur Telekomunikasi Provinsi Papua

    Directory of Open Access Journals (Sweden)

    Prajna Deshanta Ibnugraha

    2014-05-01

    Full Text Available Layanan dan infrastruktur telekomunikasi merupakan bagian penting dari kehidupan modern karena hampir di segala bidang membutuhkan hal tersebut seperti pendidikan, pemerintahan, ekonomi dan sebagainya. Oleh karena pentingnya sektor telekomunikasi di Indonesia sebagai negara kepulauan maka perlu evaluasi tentang penyebaran layanan dan infrastrukturnya selain dilihat dari sisi fungsional dan perkembangan teknologinya. Provinsi Papua adalah provinsi terbesar di Indonesia namun justru memiliki layanan telekomunikasi yang paling sedikit dan terbatas. Demikian pula untuk penyebaran layanan ke kabupaten maupun ke distrik (kecamatan masih belum merata. Hal tersebut terbukti dari laporan hasil distribusi pita frekuensi yang hanya 1,5% untuk kawasan Maluku dan Papua serta kerapatan layanan tiap kabupaten yang ditunjukkan pada hasil penelitian ini.

  17. Imunopatogenesis Treponema pallidum dan Pemeriksaan Serologi

    OpenAIRE

    Efrida ,; Elvinawaty .

    2014-01-01

    AbstrakSifilis adalah penyakit menular seksual yang sangat infeksius, disebabkan oleh bakteri berbentuk spiral, Treponema pallidum subspesies pallidum. Penyebaran sifilis di dunia telah menjadi masalah kesehatan yang besar dengan jumlah kasus 12 juta pertahun. Infeksi sifilis dibagi menjadi sifilis stadium dini dan lanjut. Sifilis stadium dini terbagi menjadi sifilis primer, sekunder, dan laten dini. Sifilis stadium lanjut termasuk sifilis tersier (gumatous, sifilis kardiovaskular dan neurosi...

  18. Manifestasi Kehamilan Di Rongga Mulut Dan Perawatannya

    OpenAIRE

    Fatimah

    2008-01-01

    Kehamilan merupakan sebuah proses fisiologis yang melibatkan banyak sistem dalam tubuh dan mengakibatkan terjadinya perubahan pada sistem baik secara anatomis maupun fisiologis seperti pada sistem reproduksi, endokrin, sirkulasi pencernaan dan juga rongga mulut. Manifestasi kehamilan di rongga mulut merupakan suatu kondisi yang sering tetjadi, baik pada gigi maupun pada jaringan di sekitamya. Hal ini dapat terlihat dan tingginya tingkat karies, erosi enamel, terjadinya gingivitis kehamila...

  19. Atom Skimmers and Atom Lasers Utilizing Them

    Science.gov (United States)

    Hulet, Randall; Tollett, Jeff; Franke, Kurt; Moss, Steve; Sackett, Charles; Gerton, Jordan; Ghaffari, Bita; McAlexander, W.; Strecker, K.; Homan, D.

    2005-01-01

    Atom skimmers are devices that act as low-pass velocity filters for atoms in thermal atomic beams. An atom skimmer operating in conjunction with a suitable thermal atomic-beam source (e.g., an oven in which cesium is heated) can serve as a source of slow atoms for a magneto-optical trap or other apparatus in an atomic-physics experiment. Phenomena that are studied in such apparatuses include Bose-Einstein condensation of atomic gases, spectra of trapped atoms, and collisions of slowly moving atoms. An atom skimmer includes a curved, low-thermal-conduction tube that leads from the outlet of a thermal atomic-beam source to the inlet of a magneto-optical trap or other device in which the selected low-velocity atoms are to be used. Permanent rare-earth magnets are placed around the tube in a yoke of high-magnetic-permeability material to establish a quadrupole or octupole magnetic field leading from the source to the trap. The atoms are attracted to the locus of minimum magnetic-field intensity in the middle of the tube, and the gradient of the magnetic field provides centripetal force that guides the atoms around the curve along the axis of the tube. The threshold velocity for guiding is dictated by the gradient of the magnetic field and the radius of curvature of the tube. Atoms moving at lesser velocities are successfully guided; faster atoms strike the tube wall and are lost from the beam.

  20. Analisis Kinerja EIGRP dan OSPF pada Topologi Ring dan Mesh

    Directory of Open Access Journals (Sweden)

    DWI ARYANTA

    2016-02-01

    Full Text Available ABSTRAK EIGRP (Enhanced Interior Gateway Routing Protocol dan OSPF (Open Shortest Path Fisrt adalah routing protokol yang banyak digunakan pada suatu jaringan komputer. EIGRP hanya dapat digunakan pada perangkat Merk CISCO, sedangkan OSPF dapat digunakan pada semua merk jaringan. Pada penelitian ini dibandingkan delay dan rute dari kedua routing protokol yang diimplementasikan pada topologi Ring dan Mesh. Cisco Packet Tracer 5.3 digunakan untuk mensimulasikan kedua routing protokol ini. Skenario pertama adalah perancangan jaringan kemudian dilakukan pengujian waktu delay 100 kali dalam 5 kasus. Skenario kedua dilakukan pengujian trace route untuk mengetahui jalur yang dilewati paket data lalu memutus link utama. Pada skenario kedua juga dilakukan perbandingan nilai metric dan cost hasil simulasi dengan perhitungan rumus. Skenario ketiga dilakukan pengujian waktu konvergensi untuk setiap routing protokol pada setiap topologi. Hasilnya EIGRP lebih cepat 386 µs daripada OSPF untuk topologi Ring sedangkan OSPF lebih cepat 453 µs daripada EIGRP untuk topologi Mesh. Hasil trace route menunjukan rute yang dipilih oleh routing protokol yaitu nilai metric dan cost yang terkecil. Waktu konvergensi rata-rata topologi Ring pada EIGRP sebesar 12,75 detik dan 34,5 detik pada OSPF sedangkan topologi Mesh di EIGRP sebesar 13 detik dan 35,25 detik di OSPF. Kata Kunci : EIGRP, OSPF, Packet Tracer 5.3, Ring, Mesh, Konvergensi ABSTRACT EIGRP (Enhanced Interior Gateway Routing Protocol and OSPF (Open Shortest Path Fisrt is the routing protocol that is widely used in a computer network. EIGRP can only be used on devices Brand CISCO, while OSPF can be used on all brands of network. In this study comparison of both the delay and the routing protocol implemented on Ring and Mesh topology. Cisco Packet Tracer 5.3 is used to simulate both the routing protocol. The first scenario is the design of the network and then do the test of time delay 100 times in 5 cases. The

  1. KONTEKTUALISASI DAN (KEMUNGKINAN KONSEKUENSINYA BAGI PSIKOLOGI

    Directory of Open Access Journals (Sweden)

    Prof. Supratiknya

    2015-09-01

    jaran di perguruan tinggi seperti kita kenal sekarang (selanjutnya disebut psikologi, lahir di Jerman pada penghujung abad ke‐19. Selanjutnya psikologi berkembang pesat di Amerika Utara khususnya Amerika Serikat dan negara‐negara lain di Eropa yang lebih dulu mengalami industrialisasi khususnya di Eropa Barat. 1 Alhasil, paling tidak sampai dasawarsa 1980‐an perkembangan dan persebaran psikologi di tingkat global ditandai oleh ketimpangan di antara apa yang oleh Moghaddam (1987 disebut tiga dunia tempat psikologi dikembangkan dan dipraktekkan, disimak antara lain berdasarkan besarnya produksi pengetahuan psikologis yang disebarluaskan melalui penyelenggaraan pendidikan tinggi psikologi maupun lewat publikasi ilmiah berupa baik berkala maupun buku rujukan dan buku teks.

  2. KECEMASAN DAN STRATEGI COPING WARIA PELACUR

    Directory of Open Access Journals (Sweden)

    Haris Herdiansyah

    2007-05-01

    Full Text Available Dunia pelacuran adalah penuh dengan tekanan, ancaman dan hal negatif cacat yang menyebabkan ketertarikan kepada pelacur oleh karena itu mendorong pelacur untuk menciptakan strategi menghadapi cukup untuk menghadapi apa yang rasa mereka . Tujuan dari studi ini akan meliputi ke luar ketertarikan dan strategi pelacur yang menghadapi transgender di tiga lingkungan sosial berbeda termasuk dalam keluarga, masyarakat dan “ cebongan” ( tempat di mana pelacur bekerja. Ini adalah suatu riset kualitatif. Karena alat pengumpulan data adalah wawancara, dan pengamatan. Studi ini menggunakan purposive sampling. Ada 3 subjek dan 4 orang informan. Untuk menganalisis data menggunakan model interaktif dari Miles & Huberman yang terdiri dari 3 langkah, yaitu reduksi data, menampilkan data dan kesimpulan serta verifikasi. Hasil dari penelitian ini, banyak kecemasan yang dialami oleh waria pelacur yang datang dari lingkungan yang berbeda-beda. Dari keluarga misalnya, merupakan sumber kecemasan tertinggi, ketika keluarga waria mengetahui profesi mereka. Sumber lain berasal dari pengucilan oleh masyarakat dan mucikari, penangkapan oleh polisi dan preman, persaingan antar pelacur dan kekerasan dari pengguna mereka di “cebongan”

  3. KOMPLIKASI, PENCEGAHAN DAN PENANGANAN EKSTRAVASASI AGEN KEMOTERAPI

    Directory of Open Access Journals (Sweden)

    I G A Mirah K

    2012-12-01

    Full Text Available Ekstravasasi agen kemoterapi ke jaringan sekitarnya merupakan kecelakaan yangdapat menyebabkan kerusakan jaringan progresif ireversibel dalam hitungan jamsampai hari. Manifestasi klinis ekstravasasi berupa nyeri, edema, eritema, danindurasi yang kemudian berkembang menjadi ulkus dan eschar hitam dankerusakan jaringan yang mendasarinya. Pencegahan terjadinya ekstravasasi dapatdilakukan dengan menggunakan pembuluh darah yang paten dan dengan aliranyang cepat dan tetap memperhatikan keluhan yang disampaikan pasien. Setiaptenaga kesehatan yang akan menangani pasien kanker dengan kemoterapi, dituntutmemiliki pengetahuan mengenai ekstravasasi agen kemoterapi yang bergunadalam meningkatkan pelayanan pada pasien dan mengurangi morbiditas.

  4. Analisis Perbandingan Database Jurnal Elektronik Emerald, ProQuest ABI/INFORM dan SpringerLink Bidang Manajemen dan Ekonomi

    OpenAIRE

    Karyatin, Arianiansyah

    2016-01-01

    Penelitian ini dilakukan pada situs database jurnal elektronik Emerald, ProQuest ABI/INFORM dan SpringerLink. Tujuan penelitian ini adalah untuk mengetahui bagaimana konten (muatan) subjek kajian manajemen dan ekonomi pada database Emerald, ProQuest ABI/INFORM dan SpringerLink dan untuk mengetahui di dalam database manakah diantara database Emerald, ProQuest ABI/INFORM, dan Springerlink yang memuat bidang kajian manajemen dan ekonomi yang paling lengkap. Metode yang digunakan dalam pene...

  5. Atomic magnetometer

    Science.gov (United States)

    Schwindt, Peter [Albuquerque, NM; Johnson, Cort N [Albuquerque, NM

    2012-07-03

    An atomic magnetometer is disclosed which uses a pump light beam at a D1 or D2 transition of an alkali metal vapor to magnetically polarize the vapor in a heated cell, and a probe light beam at a different D2 or D1 transition to sense the magnetic field via a polarization rotation of the probe light beam. The pump and probe light beams are both directed along substantially the same optical path through an optical waveplate and through the heated cell to an optical filter which blocks the pump light beam while transmitting the probe light beam to one or more photodetectors which generate electrical signals to sense the magnetic field. The optical waveplate functions as a quarter waveplate to circularly polarize the pump light beam, and as a half waveplate to maintain the probe light beam linearly polarized.

  6. High Atom Number in Microsized Atom Traps

    Science.gov (United States)

    2015-12-14

    Final Performance Report on ONR Grant N00014-12-1-0608 High atom number in microsized atom traps for the period 15 May 2012 through 14 September...TYPE Final Technical Report 3. DATES COVERED (From - To) 05/15/2012-09/14/2012 4. TITLE AND SUBTITLE High atom number in microsized atom traps...forces for implementing a small-footprint, large-number atom -chip instrument. Bichromatic forces rely on absorption and stimulated emission to produce

  7. Effects of the Extraterrestrial Environment on Plants: Recommendations for Future Space Experiments for the MELiSSA Higher Plant Compartment

    Directory of Open Access Journals (Sweden)

    Silje A. Wolff

    2014-05-01

    Full Text Available Due to logistical challenges, long-term human space exploration missions require a life support system capable of regenerating all the essentials for survival. Higher plants can be utilized to provide a continuous supply of fresh food, atmosphere revitalization, and clean water for humans. Plants can adapt to extreme environments on Earth, and model plants have been shown to grow and develop through a full life cycle in microgravity. However, more knowledge about the long term effects of the extraterrestrial environment on plant growth and development is necessary. The European Space Agency (ESA has developed the Micro-Ecological Life Support System Alternative (MELiSSA program to develop a closed regenerative life support system, based on micro-organisms and higher plant processes, with continuous recycling of resources. In this context, a literature review to analyze the impact of the space environments on higher plants, with focus on gravity levels, magnetic fields and radiation, has been performed. This communication presents a roadmap giving directions for future scientific activities within space plant cultivation. The roadmap aims to identify the research activities required before higher plants can be included in regenerative life support systems in space.

  8. ALMA Deep Field in SSA22: A concentration of dusty starbursts in a z=3.09 protocluster core

    CERN Document Server

    Umehata, H; Kohno, K; Ivison, R J; Alexander, D M; Geach, J; Hatsukade, B; Hughes, D H; Ikarashi, S; Kato, Y; Izumi, T; Kawabe, R; Kubo, M; Lee, M; Lehmer, B; Makiya, R; Matsuda, Y; Nakanishi, K; Saito, T; Smail, I; Yamada, T; Yamaguchi, Y; Yun, M

    2015-01-01

    We report the results of $1^{\\prime}.5 \\times3^{\\prime}$ mapping at 1.1~mm with the Atacama Large Millimeter/submillimeter Array (ALMA) toward the central region of the $z=3.09$ SSA22 protocluster. By combining our source catalog with archival spectroscopic redshifts, we find that eight submillimeter galaxies (SMGs) with flux densities, $S_{\\rm 1.1~mm}=0.7-6.4$~mJy ($L_{\\rm IR}\\sim10^{12.1}-10^{13.1}L_\\odot$) are at $z=3.08-3.10$. Not only are these SMGs members of the protocluster but they in fact reside within the node at the junction of the 50 Mpc-scale filamentary three-dimensional structure traced by Lyman-$\\alpha$ emitters (LAEs) in this field. The eight SMGs account for a star formation rate density (SFRD) $\\sim$10 $M_\\odot$ yr$^{-1}$ Mpc$^{-3}$ in the node, which is two orders of magnitudes higher than the global SFRD at this redshift. We find that four of the eight SMGs host a X-ray luminous active galactic nuclei (AGN). Our results suggest that the vigorous star formation activity and the growth of ...

  9. Deep SAURON Spectral-Imaging of the diffuse Lyman-alpha halo LAB1 in SSA22

    CERN Document Server

    Bower, R; Bacon, R; Wilman, R J; Sullivan, M; Chapman, S C; Davies, R L; De Zeeuw, P T; Emsellem, E; Bower, Richard

    2004-01-01

    We have used the SAURON panoramic integral field spectrograph to study the structure of the Ly-alpha emission-line halo, LAB1, surrounding the sub-millimeter galaxy SMM J221726+0013. This emission-line halo was discovered during a narrow-band imaging survey of the z=3.1 large-scale structure in the SSA22 region. Our observations trace the emission halo out to almost 100 kpc from the sub-millimeter source and identify two distinct Ly-alpha `mini-haloes' around the nearby Lyman-break galaxies. The main emission region has a broad line profile, with variations in the line profile seeming chaotic and lacking evidence for a coherent velocity structure. The data also suggests that Ly-alpha emission is suppressed around the sub-mm source. Interpretation of the line structure needs care because Ly-alpha may be resonantly scattered, leading to complex radiative transfer effects, and we suggest that the suppression in this region arises because of such effects. We compare the structure of the central emission-line halo...

  10. KANDUNGAN ASAM AMINO, TAURIN, MINERAL MAKRO-MIKRO, DAN VITAMIN B12 UBUR-UBUR (Aurelia aurita SEGAR DAN KERING

    Directory of Open Access Journals (Sweden)

    - - Nurjanah

    2014-06-01

    Full Text Available Tujuan penelitian adalah menentukan komposisi gizi, asam amino, taurin, mineral makro dan mikro,dan vitamin B12 pada ubur-ubur (Aurelia aurita segar dan kering. Asam amino esensial pada ubur-uburyaitu arginina, leusina, valina, treonina, lisina, isoleusina, fenilalanina, metionina, dan histidina, sedangkanasam amino non esensial yaitu asam glutamat, glisina, asam aspartat, serina, alanina, dan tirosina. Asamamino esensial tertinggi segar dan kering adalah arginina sebesar 1,72% (bk dan 1,44% (bk dan terendahhistidina yaitu sebesar 0,19% (bk dan 0,13% (bk. Asam amino non esensial segar dan kering tertinggiadalah asam glutamat dan glisina yaitu sebesar 3,26% (bk dan 2,62% (bk dan terkecil tirosina sebesar0,38% (bk dan 0,41% (bk. Taurin segar sebesar 2,68% (bk dan kering sebesar 0,67% (bk. Mineral makrotertinggi segar dan kering adalah natrium yaitu 180.092,1 ppm (bk dan 111.209,4 ppm (bk, terkecil adalahkalsium yaitu 5.750,2 ppm (bk dan 11,1 ppm (bk. Mineral mikro tertinggi segar dan kering adalah iodium yaitu8.291,5 ppm (bk dan 1.800 ppm (bk dan yang terkecil adalah tembaga yaitu 1,1 ppm (bk dan 0,6 ppm (bk.Vitamin B12 segar adalah 396,6 μm/100 g (bk dan kering 63,5 μm/100 g (bk.Kata kunci: asam amino, mineral, taurin, ubur-ubur (Aurelia aurita, vitamin B12

  11. Function of SSA subfamily of Hsp70 within and across species varies widely in complementing Saccharomyces cerevisiae cell growth and prion propagation.

    Directory of Open Access Journals (Sweden)

    Deepak Sharma

    Full Text Available BACKGROUND: The cytosol of most eukaryotic cells contains multiple highly conserved Hsp70 orthologs that differ mainly by their spatio-temporal expression patterns. Hsp70s play essential roles in protein folding, transport or degradation, and are major players of cellular quality control processes. However, while several reports suggest that specialized functions of Hsp70 orthologs were selected through evolution, few studies addressed systematically this issue. METHODOLOGY/PRINCIPAL FINDINGS: We compared the ability of Ssa1p-Ssa4p from Saccharomyces cerevisiae and Ssa5p-Ssa8p from the evolutionary distant yeast Yarrowia lipolytica to perform Hsp70-dependent tasks when expressed as the sole Hsp70 for S. cerevisiae in vivo. We show that Hsp70 isoforms (i supported yeast viability yet with markedly different growth rates, (ii influenced the propagation and stability of the [PSI(+] and [URE3] prions, but iii did not significantly affect the proteasomal degradation rate of CFTR. Additionally, we show that individual Hsp70 orthologs did not induce the formation of different prion strains, but rather influenced the aggregation properties of Sup35 in vivo. Finally, we show that [URE3] curing by the overexpression of Ydj1p is Hsp70-isoform dependent. CONCLUSION/SIGNIFICANCE: Despite very high homology and overlapping functions, the different Hsp70 orthologs have evolved to possess distinct activities that are required to cope with different types of substrates or stress situations. Yeast prions provide a very sensitive model to uncover this functional specialization and to explore the intricate network of chaperone/co-chaperone/substrates interactions.

  12. ANALISIS TINGKAT KEPUASAN DAN HARAPAN PASEN TERHADAP PELAYANAN PUSKESMAS DAN RUMAH SAKIT DAERAH PROVINSI DIY

    Directory of Open Access Journals (Sweden)

    Sunarto Sunarto

    2010-10-01

    Full Text Available Kepuasan merupakan perasaan seseorang mengenai kesenangan atau kekecewaan sebagai hasil membandingkan antara kinerja dan harapan. Jumlah kunjungan Puskesmas tahun 2007 sebesar 3.094.027 pasien yang terdiri dari 3.076442 rawat jalan dan 17.585 rawat inap. Penelitian untuk mengentahui gambaran tingkat kepuasan dan untuk mengetahui perbedaan tingkat kepuasan dan harapan pasien yang mendapatkan pelayanan Puskemas dan rumah sakit menurut wilayah Kabupatet / Kota di Propinsi DIY Penelitian ini merupakan penelitian deskriptif analitik dengan menggunakan rancangan cros sectional. Instrumen penelitian yang digunakan adalah kuisioner dengan 35 item pernyataan yang diambil dari atribut-atribut SERVQUAL dalam 5 dimensi. Total sampel untuk lima Kabupaten Kota sebanyak 1000, masing-masing Kabupaten Kota 200. Penelitian ini dilakukan terhadap pasien yang menerima pelayanan kesehatan di Puskesmas dan Rumah Sakit Daerah di Kabupaten-Kota Daerah Istimewa Yogyakarta. Penilaian tingkat kepuasan pasien ketika mereka berobat ke Puskesmas dan Rumah Sakit di Propinsi DIY, dengan menggunakan skala O sampai 4. Hasilnya adalah dimensi tangibles, rata-rata kepuasan pasien (2,96 cukup dan harapan pasien (3,38 pada dimensi reliability, rata-rata kepuasan pasien (3,01 bagus dan harapan pasien (3,40. Pada dimensi responsiveness, rata-rata kepuasan pa-sien (3,07 bagus dan harapan pasien (3,42. Dimensi assurance, rata-rata kepuasan pasien (3, 1 0 bagus dan harapan pasien (3 ,42. pada dimensi emphaty, rata-rata kepuasan pasien (3,02 bagus dan harapan pasien (3,35. Hasil uji statistik didapatkan nilai p > 0.05, berarti pada alpha 5%, dapat disimpulkan bahwa tidak terdapat perbedaan tingkat kepuasan diantara kelima wilayah kabupaten/kota di DIY. Penilaian tingkat kepuasan pasien, ketika mereka berkunjung ke Puskesmas dan Rumah Sakit di DIY secara rata-rata bagus dan tidak ada perbedaan tingkat kepuasan menurut wilayah Kabupaten-Kota di Propinsi DIY. Kata Kunci : Kepuasan, harapan

  13. Vast voer in zoogperiode belangrijker dan gedacht

    NARCIS (Netherlands)

    Peet-Schwering, van der C.M.C.; Binnendijk, G.P.; Troquet, L.M.P.

    2012-01-01

    Biggen die voor spenen vast voer opnemen (eters) groeien na spenen circa 50 gram per dag sneller dan biggen die tijdens de zoogperiode geen vast voer opnemen (niet-eters). Daarnaast groeien zwaardere biggen bij spenen circa 50 gram per dag sneller dan lichtere biggen bij spenen. Dit blijkt uit onder

  14. Radiations cosmiques : danger dans l'Espace

    Science.gov (United States)

    Bonnet-Bidaud, J. M.; Dzitko, H.

    2000-06-01

    Au sol, l'atmosphere nous protege plus ou moins bien. Mais dans l'espace ou a bord des avions de ligne, l'homme est directement expose aux rayonnements cosmiques qui peuvent etre mortels. Un veritable frein a la presence humaine prolongee dans l'espace. Une menace que les agences spatiales prennent tres au serieux.

  15. Dhenggung Asmarandana dan Dhegung Banten: Sebuah Komparasi

    Directory of Open Access Journals (Sweden)

    Teguh -

    2013-11-01

    Full Text Available The Comparation of Dhenggung Asmarandana and Dhegung Banten. Penelitian ini membahas perbandinganantara gending Dhenggung Asmaradana gaya Surakarta dengan gending Dhegung Banten gaya Yogyakarta.Berdasarkan penelitian dapat disimpulkan bahwa kedua gending memiliki persamaan dan perbedaan. Persamaankeduanya terletak pada laras, pathet, bentuk gendhing, struktur gendhing, serta balungan gending. Sedangkanperbedaannya hanya pada nama dan garap tabuhan bonang.

  16. STRATEGI PERSONAL BRANDING FOTOGRAFER HOTEL DAN RESORT

    OpenAIRE

    GUSTAFIAN, THOMAS HENRY ADRIAN

    2014-01-01

    Identitas brand menjadi masalah penting dalam lingkungan bisnis yang semakin kompleks dan penuh dengan persaingan. Salah satu cara yang dapat dilakukan seorang entrepreneur untuk menunjukkan identitas brand adalah melalui personal branding. Strategi personal branding sangat dipengaruhi oleh konsep diri dan strategi komunikasi yang dimiliki oleh seorang entrepreneur. Tulisan ini menggambarkan bagaimana strategi personal branding mempengaruhi keberhasilan seorang entrepreneur

  17. Detection and significance of anti-SSA/Ro-52kD autoantibody using recombinant antigen%利用重组抗原检测抗SSA/Ro-52kD自身抗体及其临床意义

    Institute of Scientific and Technical Information of China (English)

    邓安梅; 仲人前; 陈孙孝; 施笑梅; 孔宪涛

    2000-01-01

    目的重组表达SSA/Ro-52kD融合蛋白,并用于检测自身抗体. 方法应用DNA重组技术构建SSA/Ro-52kD工程菌,并表达SSA/Ro-52kD融合蛋白.经谷胱甘肽巯基转移酶(GST)柱层析纯化后,作为抗原,分别用免疫印迹法(IBT)和酶联免疫吸附试验(ELISA)检测20份SS患者血清、60份SLE患者血清和30份正常人血清. 结果重组抗原检测抗SSA/Ro-52kD自身抗体敏感性较高,而且抗体滴度与病程相关. 结论利用重组抗原对自身抗体进行定性、定量分析有助于自身免疫病的诊断和监控.

  18. Study on the Effect of the Side Secondary Air Velocity on the Aerodynamic Field in a Tangentially Fired Furnace with HBC—SSA Burner

    Institute of Scientific and Technical Information of China (English)

    ZhuTong; SunShaozeng; 等

    1999-01-01

    The present paper has compared a group of furnace aerodynamic fields at different velocities of side secondary air(SSA) in a test model of 420t/h utility boiler,applying Horizontal Bias Conbustion Pulverized Coal Burner with Side Secondary AIr(HBC-SSA Burner).Experimental results show that,when the ram pressure ratio of side secondary air(SSA) to primary air(PA) ρ2sv232/ρ1v12)is between 1.0-2.4,the furnace aerodynamic field only varies slightly.The relative rotational diameters(φ/L)in the burner domain are moderate and the furnace is in good fullness.Whenρ2s v232/ρ1v12 is beyond4,φ/L is so large that the stream sweeps water-cooled wall and rotateds strongly in the furnace.Therefore,slagging and high temperature corrosion of tube metal will be formed on the water-cooled wall in actual operation.This investigation provides the basis for the application of this new type burner.In addition,numerical simulations are conducted,and some defects in the numerical simulation are also pointed out and analyzed in this paper.

  19. Penerapan Sistem Remunerasi dan Kinerja Pelayanan

    Directory of Open Access Journals (Sweden)

    Tri Wisesa Soetisna

    2015-08-01

    Full Text Available Remunerasi dapat memengaruhi motivasi pegawai sekaligus meningkatkan kinerjanya. Demikian halnya di rumah sakit sebagai institusi pelayanan kesehatan yang padat modal, sumber daya manusia serta padat ilmu dan teknologi. Penelitian ini bertujuan untuk menganalisis persepsi pegawai terhadap implementasi sistem remunerasi dan kinerja unit pelayanan bedah jantung dewasa (UPBJD di rumah sakit. Penelitian ini menggunakan pendekatan mixed methods (kuantitatif dan kualitatif. Desain penelitian kuantitatif adalah potong lintang menggunakan instrumen kuesioner self-assessment. Sedangkan desain penelitian kualitatif adalah deskriptif, dilakukan melalui focus group discussion dan telaah dokumen pada data berupa buku jadwal, buku registrasi, catatan keperawatan, dan rekam medis. Pengambilan data dilakukan pada tahun 2013 di salah satu rumah sakit di Jakarta. Responden/informan adalah staf medis fungsional, perawat, dan petugas administrasi berjumlah 29 orang. Data dianalisis secara univariat (metode kuantitatif, dan content analysis (metode kualitatif. Hasil penelitian menunjukkan bahwa sebagian besar staf medis fungsional dan perawat tidak puas (71,2% dengan beberapa hal dalam penerapan sistem remunerasi, seperti pada sistem penggajian dan penentuan grading. Terlihat kinerja unit pelayanan bedah jantung dewasa mengalami kenaikan setiap tahun sebelum dan setelah penerapan sistem remunerasi. Diharapkan agar rumah sakit ini dapat memperbaiki sistem remunerasi yang sesuai ketentuan kebijakan dan menyusun formulasi insentif dan bonus yang lebih sesuai dengan kondisi saat ini serta perlu dilakukan sosialisasi yang tepat dan evaluasi secara berkala. Implementation of Remuneration System and Service Performance Remuneration can influence worker`s motivation, and improve their performance. Likewise in hospital as capital-intensive, human resources-intensive as well as knowledge and technology-intensive health care institution. This study aimed to analyze employee

  20. Dynamique femtoseconde dans des atomes et molécules - précession de spin et dynamique de photoélectrons - transitoires cohérents - dynamique des états excités de l'acétylène

    OpenAIRE

    Zamith, Sébastien

    2001-01-01

    This thesis is about the study of dynamics of atoms and molecules on the femtosecond time scale by the pump-probe technique. In a first part the oscillation of a wave packet created by a superposition of fine structure states in atomic potassium has been observed. This oscillation is interpreted as the precession of the spin momentum around the total angular momentum. This is followed by a theoretical study showing that this oscillation can be used to produce spin polarised electrons. Another...

  1. The atomic orbitals of the topological atom.

    Science.gov (United States)

    Ramos-Cordoba, Eloy; Salvador, Pedro; Mayer, István

    2013-06-07

    The effective atomic orbitals have been realized in the framework of Bader's atoms in molecules theory for a general wavefunction. This formalism can be used to retrieve from any type of calculation a proper set of orthonormalized numerical atomic orbitals, with occupation numbers that sum up to the respective Quantum Theory of Atoms in Molecules (QTAIM) atomic populations. Experience shows that only a limited number of effective atomic orbitals exhibit significant occupation numbers. These correspond to atomic hybrids that closely resemble the core and valence shells of the atom. The occupation numbers of the remaining effective orbitals are almost negligible, except for atoms with hypervalent character. In addition, the molecular orbitals of a calculation can be exactly expressed as a linear combination of this orthonormalized set of numerical atomic orbitals, and the Mulliken population analysis carried out on this basis set exactly reproduces the original QTAIM atomic populations of the atoms. Approximate expansion of the molecular orbitals over a much reduced set of orthogonal atomic basis functions can also be accomplished to a very good accuracy with a singular value decomposition procedure.

  2. "Bohr's Atomic Model."

    Science.gov (United States)

    Willden, Jeff

    2001-01-01

    "Bohr's Atomic Model" is a small interactive multimedia program that introduces the viewer to a simplified model of the atom. This interactive simulation lets students build an atom using an atomic construction set. The underlying design methodology for "Bohr's Atomic Model" is model-centered instruction, which means the central model of the…

  3. Gene transcript analysis blood values correlate with {sup 68}Ga-DOTA-somatostatin analog (SSA) PET/CT imaging in neuroendocrine tumors and can define disease status

    Energy Technology Data Exchange (ETDEWEB)

    Bodei, L. [European Institute of Oncology, Division of Nuclear Medicine, Milan (Italy); Kidd, M.; Modlin, I.M.; Drozdov, I. [Wren Laboratories, Branford, CT (United States); Prasad, V. [Charite University Hospital, Department of Nuclear Medicine, Berlin (Germany); Severi, S.; Paganelli, G. [Istituto Scientifico Romagnolo per lo Studio e la Cura dei Tumori (IRST) IRCCS, Nuclear Medicine and Radiometabolic Units, Meldola (Italy); Ambrosini, V. [S. Orsola-Malpighi University Hospital, Nuclear Medicine, Bologna (Italy); Kwekkeboom, D.J.; Krenning, E.P. [Erasmus Medical Center Rotterdam, Nuclear Medicine Department, Rotterdam (Netherlands); Baum, R.P. [Zentralklinik Bad Berka, THERANOSTICS Center for Molecular Radiotherapy and Imaging, Bad Berka (Germany)

    2015-08-15

    Precise determination of neuroendocrine tumor (NET) disease status and response to therapy remains a rate-limiting concern for disease management. This reflects limitations in biomarker specificity and resolution capacity of imaging. In order to evaluate biomarker precision and identify if combinatorial blood molecular markers and imaging could provide added diagnostic value, we assessed the concordance between {sup 68}Ga-somatostatin analog (SSA) positron emission tomography (PET), circulating NET gene transcripts (NETest), chromogranin A (CgA), and Ki-67 in NETs. We utilized two independent patient groups with positive {sup 68}Ga-SSA PET: data set 1 ({sup 68}Ga-SSA PETs undertaken for peptide receptor radionuclide therapy (PRRT), as primary or salvage treatment, n = 27) and data set 2 ({sup 68}Ga-SSA PETs performed in patients referred for initial disease staging or restaging after various therapies, n = 22). We examined the maximum standardized uptake value (SUV{sub max}), circulating gene transcripts, CgA levels, and baseline Ki-67. Regression analyses, generalized linear modeling, and receiver-operating characteristic (ROC) analyses were undertaken to determine the strength of the relationships. SUV{sub max} measured in two centers were mathematically evaluated (regression modeling) and determined to be comparable. Of 49 patients, 47 (96 %) exhibited a positive NETest. Twenty-six (54 %) had elevated CgA (χ{sup 2} = 20.1, p < 2.5 x 10{sup -6}). The majority (78 %) had Ki-67 < 20 %. Gene transcript scores were predictive of imaging with >95 % concordance and significantly correlated with SUV{sub max} (R {sup 2} = 0.31, root-mean-square error = 9.4). The genes MORF4L2 and somatostatin receptors SSTR1, 3, and 5 exhibited the highest correlation with SUV{sub max}. Progressive disease was identified by elevated levels of a quotient of MORF4L2 expression and SUV{sub max} [ROC-derived AUC (R {sup 2} = 0.7, p < 0.05)]. No statistical relationship was identified

  4. TUGAS DAN WEWENANG PUSAT PELAPORAN DAN ANALISIS TRANSAKSI KEUANGAN (PPATK DALAM PEMBERANTASAN TINDAK PIDANA PENCUCIAN UANG

    Directory of Open Access Journals (Sweden)

    Johari Johari

    2014-03-01

    Full Text Available Tugas dan wewenang Pusat Pelaporan dan Analisis Transaksi Keuangan (PPATK terdapat di dalam Pasal 26 dan Pasal 27 Undang-Undang No. 25 Tahun 2003 tentang Tindak Pencucian Uang. Berdasarkan ketentuan tersebut, tugas dan wewenang PPATK tersebut bertujuan untuk mendeteksi terjadinya tindak pidana pencucian uang, dan membantu penegakan hukum yang berkaitan dengan pencucian uang, termasuk tindak pidana asal yang melahirkannya (predicate offences. Namun, Peranan PPATK akan berjalan secara efektif apabila aparat penegak hukum seperti Kepolisian, Kejaksaan, Pengadilan, Bea dan Cukai, para regulator seperti Bank Indonesia, Departemen Keuangan, Badan Pengawas Pasar Modal serta Penyedia Jasa Keuangan, industri perbankan, asuransi, perusahaan pembiayaan, dana pensiun, perusahaan efek, pengelola reksadana, media massa, masyarakat bekerjasama secara terorganisir dan terpadu dalam pemberantasan tindak pencucian uang di Indonesia. Dengan kewenangan yang dimilikinya, PPATK dapat mengejar hasil dari kejahatan, apabila hasil kejahatan tersebut dapat dikejar dan disita maka negara dengan sendirinya akan mengurangi tindak kejahatan itu sendiri. Kata kunci : Pencucian uang, tindak pidana pencucian uang (money laundering, kejahatan terorganisir, dan Pusat Pelaporan dan Analisis Transaksi Keuangan (PPATK.

  5. Kandidiasis di Mulut akibat Khemoterapi dan Penatalaksanaannya

    Directory of Open Access Journals (Sweden)

    Sri Budiarti Wonso Hardjono

    2016-10-01

    Full Text Available Latar belakang: kandidiasis (kandidosis adalah infeksi jamur yang disebabkan oleh spesies Candida biasanya Candida albicans. Faktor predisposisi yang memicu kandidiasis adalah terganggunya ekologi mulut karena antara lain pemakaian antibiotika, kortikosteroid, penyakit kronis dan keganasan, beberapa gangguan darah; terapi radiasi di leher dan kepala; khemoterapi; leukimia, obat sitotoksik, juga kebersihan mulut yang buruk. Tujuan: melaporkan kasus kandidiasis di mulut karena khemoterapi dan penatalaksanaannya. Kasus dan penatalaksanaannya: seorang anak laki-laki umur 3 tahun 11 bulan penderita Leukimia Limfoblastik Akut (LLA sedang dalam perawatan khemoterapi menderita kandidiasis di mulut sehingga mengalami disfoni dan disfagia. Makanan dimasukkan lewat hidung. Klinis pasien terlihat lemah infus lewat tangan. Dalam mulut terlihat patch putih tebal menutupi permukaan dorsal dan ventral lidah, palatum durum dan ventral lidah, palatum durum dan molle, mukosa pipi kanan kiri dan gingiva rahang atas dan bawah. Pasien disedasi untuk dilakukan pengerokan lapisan kandida di mulut; pemberian Nystatin solution dan ketokonazol dilanjutkan. Pengerokan psedomembran kandidiasis telah memberikan hasil yang memuaskan, satu minggu kemudian rongga mulut pasien sudah terlihat bersih, pasien sudah dapat makan minum melalui mulut, juga sudah dapat berbicara lagi/tidak serah. Kesimpulan: Pembersihan jamur dengan pengerokan telah dilakukan, kandidiasis pseudomembran dapat diangkat dan mulut pasien sudah bersih, pasien dapat makan dan berbicara lagi.   Background: Candidiasis (candidosis is an fungal infection caused by Candida species usually Candida albicans. Predisposing factors which trigger candidiasis are the ecological disruption caused by use of oral antibiotics, corticosteroids, malignancy and chronic disease; some blood disorders; head and neck radiation; chemotherapy; leukimia, cytotoxic drugs, as well as poor oral hygiene. Aim: To report a case of

  6. KONSTRUKSI DETERMINAN DALAM FRASA NOMINA BAHASA PRANCIS DAN BAHASA INDONESIA

    Directory of Open Access Journals (Sweden)

    Roswita Lumban Tobing

    2012-06-01

    Full Text Available Artikel ini bertujuan untuk memaparkan konstruksi determinan pada frasa nomina bahasa Perancis dan bahasa Indonesia. Analisis yang digunakan adalah analisis kontrastif. Hasil analisis menunjukkan bahwa nomina bahasa Perancis memiliki jenis kelamin (maskulin/feminin dan jumlah (tunggal/jamak. Gender dan jumlah dalam bahasa Prancis memiliki aturan konkordansi yang dapat memengaruhi bentuk dan makna nomina. Dalam bahasa Indonesia, meskipun nomina memiliki konsep gender tunggal dan jamak, jenis dan jumlah dalam bahasa Indonesia tidak muncul secara eksplisit. Bentuk ini hanya ditandai dengan karakteristik semantik tertentu yang dapat menunjukkan jenis kelamin, bentuk tunggal, dan bentuk jamak.

  7. ALMA DEEP FIELD IN SSA22: A CONCENTRATION OF DUSTY STARBURSTS IN A z = 3.09 PROTOCLUSTER CORE

    Energy Technology Data Exchange (ETDEWEB)

    Umehata, H.; Ivison, R. J. [European Southern Observatory, Karl-Schwarzschild-Str. 2, D-85748 Garching (Germany); Tamura, Y.; Kohno, K.; Izumi, T.; Makiya, R. [Institute of Astronomy, School of Science, The University of Tokyo, 2-21-1 Osawa, Mitaka, Tokyo 181-0015 (Japan); Alexander, D. M.; Smail, I. [Centre for Extragalactic Astronomy, Department of Physics, Durham University, South Road, Durham DH1 3LE (United Kingdom); Geach, J. E. [Centre for Astrophysics Research, Science and Technology Research Institute, University of Hertfordshire, Hatfield AL10 9AB (United Kingdom); Hatsukade, B.; Kato, Y.; Kawabe, R.; Lee, M.; Matsuda, Y.; Nakanishi, K.; Saito, T. [National Astronomical Observatory of Japan, 2-21-1 Osawa, Mitaka, Tokyo 181-8588 (Japan); Hughes, D. H. [Department of astronomy, University of Massachusetts, Amherst, MA 01003 (United States); Ikarashi, S. [Kapteyn Astronomical Institute, University of Groningen, P.O. Box 800, 9700AV Groningen (Netherlands); Kubo, M. [Institute for Cosmic Ray Research, University of Tokyo, 5-1-5 Kashiwa-no-Ha, Kashiwa City, Chiba 277-8582 (Japan); Lehmer, B., E-mail: humehata@eso.org [Department of Physics, University of Arkansas, 226 Physics Building, 835 West Dickson Street, Fayetteville, AR 72701 (United States); and others

    2015-12-10

    We report the results of 1.′5 × 3′ mapping at 1.1 mm with the Atacama Large Millimeter/submillimeter Array toward the central region of the z = 3.09 SSA22 protocluster. By combining our source catalog with archival spectroscopic redshifts, we find that eight submillimeter galaxies (SMGs) with flux densities, S{sub 1.1} {sub mm} = 0.7–6.4 mJy (L{sub IR} ∼ 10{sup 12.1}–10{sup 13.1} L{sub ⊙}) are at z = 3.08–3.10. Not only are these SMGs members of the protocluster, but they in fact reside within the node at the junction of the 50 Mpc scale filamentary three-dimensional structure traced by Lyα emitters in this field. The eight SMGs account for a star formation rate density (SFRD) ∼10 M{sub ⊙} yr{sup −1} Mpc{sup −3} in the node, which is two orders of magnitudes higher than the global SFRD at this redshift. We find that four of the eight SMGs host an X-ray-luminous active galactic nucleus. Our results suggest that the vigorous star formation activity and the growth of supermassive black holes (SMBHs) occurred simultaneously in the densest regions at z ∼ 3, which may correspond to the most active historical phase of the massive galaxy population found in the core of the clusters in the present universe. Two SMGs are associated with Lyα blobs, implying that the two populations coexist in high-density environments for a few cases.

  8. PERSEPSI NEGATIF PASIEN KANKER PAYUDARA DAN KOLOREKTAL TERHADAP KEMOTERAPI DAN RADIOTERAPI DI RUMAH SAKIT DI KOTA DENPASAR, BALI

    Directory of Open Access Journals (Sweden)

    Gede Wara Samsarga Samsarga

    2015-01-01

    Full Text Available Terapi adjuvan yang biasanya diberikan pada pasien kanker payudara dan kanker kolorektal adalah kemoterapi dan radioterapi. Terapi adjuvan biasanya diberikan setelah terapi primer untuk meningkatkan angka kesembuhan penyakit, mencegah rekurensi, dan membunuh sel-sel kanker yang tersisa ataupun yang telah bermetastasis (terutama mikrometastasis. Terapi adjuvan juga berfungsi sebagai terapi paliatif untuk meningkatkan harapan hidup pasien kanker. Dalam kenyataannya banyak pasien kanker, khususnya kanker payudara dan kolorektal yang menghindari tindakan kemoterapi dan radioterapi. Dari 38 orang pasien kanker payudara dan kolorektal, didapatkan bahwa 26,3% takut gagal, 39,5% takut efek samping, 7,9% biaya yang mahal, 10,5% karena berlangsung dalam jangka waktu yang lama, dan 15,8% tidak takut terhadap kemoterapi dan radioterapi. Hasil penelitian ini menunjukkan bahwa tingkat pemahaman pasien kanker payudara dan kanker kolorektal terhadap tindakan kemoterapi dan radioterapi masih cukup rendah dimana 68,4% sampel tidak tahu dan tidak mengerti tentang tindakan kemoterapi dan radioterapi. Pemahaman yang kurang tentang tindakan kemoterapi dan radioterapi ini nantinya dapat mengakibatkan timbulnya persepsi negatif terhadap tindakan kemoterapi dan radioterapi. Maka dari itu sangat diperlukan adanya suatu edukasi yang baik bagi setiap pasien tentang penyakit dan modalitas terapi yang akan diberikan. Dokter diharapkan mampu untuk mengubah persepsi negatif pasien terkait tindakan kemoterapi dan radioterapi.  

  9. APA DAN MANA DALAM KALIMAT DEKLARATIF

    Directory of Open Access Journals (Sweden)

    Sri Puji Astuti

    2016-06-01

    Full Text Available Kalimat merupakan salah satu sarana untuk menyampaikan maksud pembicara atau penulis kepada pendengar atau pembaca. Untuk menyampaikan informasi digunakan kalimat deklaratif. Dalam kalimat deklaratif sering ditemui kata apa dan mana serta bentuk turunannya. Bagaimana kehadiran apa dan mana serta bentuk turunannya dalam kalimat deklaratif dibahas dalam makalah ini. Teori yang digunakan untuk menganalisis adalah teori stuktural. Pengumpulan data dilakukan dengan cara menyimak pemakaian bahasa. Dalam analisis data digunakan metode distribusional yaitu metode analisis data yang berupa penghubungan aantarfenomena dalam bahasa tertentu itu sendiri  Adapun teknik yang d.igunakan dalam penelitian ini adalah teknik delisi, substitusi, dan teknik parafrasa. Dari hasil penelitian disimpilkan  bahwa apa dan mana serta bentuk tuturannya jika terdapat dalam kalimat deklaratif bukan merupakan interogativa. Kehadiran apa dan mana serta bentuk tuturannya dalam kalimat deklaratif ada yang bersifat wajib ada yang bersifat opsional. Apa dan mana serta bentuk turunannya  bersifat opsional jika dalam kalimat deklaratif apa dan mana serta bentuk tuturannya diikuti atau didahului oleh kata yang mempunyai makna yang sama

  10. M. Quraish Shihab dan Rasionalisasi Tafsir

    Directory of Open Access Journals (Sweden)

    Afrizal Nur

    2012-06-01

    Full Text Available Kesempurnaan Islam adalah karena bersumberkan kepada al-Qur’an dan Sunnah, kedua sumber ini melahirkan peraturan atau popular dengan istilah syari’at. Islam menuntut umat nya untuk mendalami dan menghayati ayat-ayat yang terkandung didalam kitab suci al-Qur’an karena mempunyai maksud tersendiri, maka oleh karena nya tafsir mengambil peranan yang strategis untuk memahami dan mengungkap rahasia keagungan khazanah pada setiap ayat al-Qur’an. Berdasar motifasi tinggi untuk memahami al-Qur’an, banyak ulama di Indonesia yang berkosentrasi untuk menjelaskan dan menafsirkan al-Qur’an, dalam sejrah aktifitas penafsiran al-Qur’an berawal dari Syeikh Abdurra’uf al-Singkli pada abad ke 17M sampai saat ini adalah era nya M.Quraish Shihab. Tokoh tafsir yang terakhir ini tidak pernah absent dan ketinggalan di kaji dan di analisa oleh para komunitas akademisi tafsir baik dalam bentuk kajian kritik ataupun mendukung pencapaian prestasi kitab tafsir yang diberi nama al-Mishbah ini. Kritikan yang selalu dapat perhatian utama akademisi tafsir meliputi pandangan-pandangan rasional Quraish Shihab yang sering kali menjadi tidak rasional disebabkan tidak mengikuti dan menyalahi pandangan jumhur ulama. Oleh sebab itu penulis tidak ingin ketinggalan menyumbangkan pemikiran dalam bentuk usaha intelektual alah kadarnya yang dimiliki untuk menempatkan tafsir al-Mishbah kemartabat yang tinggi di tangga samudera karya tafsir ulama tafsir Indonesia

  11. Perancangan dan Implementasi Presensi Digital Guru dan Karyawan SMA Negeri 9 Semarang

    Directory of Open Access Journals (Sweden)

    Th. Didot Septiawan

    2016-04-01

    Full Text Available Berdasarkan surat edaran dari Kepala Dinas Pendidikan Kota Semarang, terhitung mulai Januari 2015 tiap sekolah dihimbau untuk beralih dari sistem presensi manual menjadi digital. Hingga awal Maret ini, presensi guru dan karyawan di SMA Negeri 9 Semarang masih dilakukan secara manual. Maka diperlukan sebuah penelitian untuk merancang dan menerapkan sistem presensi digital bagi SMA Negeri 9 Semarang. Tahapan penelitian meliputi perencanaan, analisis, perancangan, implementasi, pengujian, dan pemeliharaan. Perangkat lunak dibangun dengan framework PHP Phalcon, basis data MySQL, dan aplikasi webserver Nginx pada sistem operasi Ubuntu 14.04. Mesin presensi dengan metode pengenalan wajah dipilih untuk mendapatkan data kehadiran yang bersifat autentik. Pengujian dilakukan dengan metode kotak hitam dan kotak putih. Semua kebutuhan fungsional telah diimplementasikan pada aplikasi web dan kebutuhan non-fungsional pun telah terpenuhi. Sistem presensi digital ini menjadi solusi bagi SMA Negeri 9 Semarang dalam usaha uji coba penggunaan presensi digital.

  12. TINJAUAN UMUM TENTANG HELPDESK DAN FRAMEWORK TERKAIT

    Directory of Open Access Journals (Sweden)

    Ali Tarmuji

    2013-04-01

    Full Text Available Penggunaan teknologi informasi dan komunikasi (TIK di suatu instansi sangat banyak dampaknya, baik positif maupun negatif. Seiring perkembangan teknologi semakin banyak pemanfaatan media TIK ini untuk membantu pelaksanaan suatu pekerjaan bahkan hampir seluruh bidang di suatu instansi. Dalam perjalanan penggunaan TIK sering muncul permasalahan-permasalahan yang jika tidak ditangani akan mengakibatkan adanya kemunduran kinerja dari bagian/seseorang yang menggunakan peralatan TIK untuk menunjang kerja mereka. Suatu instansi yang sudah sedemikian kompleksnya dalam penggunaan peralatan TIK di instansinya maka diperlukan suatu mekanisme dan unit khusus yang menangani penggunaan dan permasalahan dalam hal penggunaan TIK tersebut. Mekanisme dan unit khusus tersebut sering dinamakan tim helpdesk yang tujuan utamanya adalah menangani penyelesaian terhadap permasalahan yang muncul dari penggunaan suatu peralatan TIK tersebut sehingga mampu memperlancar kerja yang terkait. Suatu instansi dalam hal penerapan tim helpdesk memerlukan suatu perencanaan yang matang dan terorganisir. Langkah-langkah yang perlu dilakukan oleh instansi dalam implementasi tim helpdesknya antara lain, (1 membentuk tim khusus untuk menganalisis organisasinya terkait kebutuhan implementasi helpdesk tersebut, (2 membentuk organisasi helpdesk sesuai kebutuhan, (3 memilih workflow helpdesk yang disesuaikan dengan kondisi instansi, (4 memilih framework yang tepat untuk mendasari jalannya implementasi helpdesk di instansi terkait, dan (5 menuangkan aturan-aturan dasar (standard operation procedur-SOP untuk menguatkan kiprah tim helpdesk di instansi terkait.Terbentuknya tim helpdesk diharapkan dapat mengatasi permasalahan dan memberikan layanan terhadap seluruh permasalahan bidang TIK baik yang bersifat internal (pengembang aplikasi maupun seluruh permasalahan operasional aplikasi ataupun hal-hal yang berhubungan dengan sistem dan teknologi informasi dan komunikasi.

  13. HASIL ANALISIS VITAMIN A DAN β-KAROTEN BAHAN MAKANAN SUMBER VITAMIN A DAN KAROTEN DENGAN METODE HPLC

    Directory of Open Access Journals (Sweden)

    Yuniar Rosmalina

    2012-11-01

    Full Text Available Telah dilakukan analisis vitamin A DAN β-Karoten terhadap beberapa jenis pangan dengan menggunakan metode HPLC. Analisis dilakukan terhadap 9 jenis serealia dan umbi-umbian, 3 jenis kacang-kacangan, 40 jenis sayuran, 11 jenis daging dan hasilnya, 7 jenis telur dan hasilnya, 8 jenis ikan, 12 jenis buah-buahaan, dan 7 jenis kelompok lain-lain. Hasilnya menunjukkan sumber β-Karoten yang tinggi pada kelompok serealia dan umbi-umbian adalah umbi jalar, pada kelompok sayuran adalah daun katuk, daun pepaya, daun singkong, daun melinjo, daun talas dan daun sintrong, pada kelompok telur adalah telur bebek, pada kelompok buah-buahan adalah mangga golek dan mangga gedong. Sedangkan kelompok kacang-kacangan dan kelompok daging kandungan β-Karotennya rendah. Hati ayam, hati bebek, dan hati kambing merupakan sumber vitamin A yang tinggi, sedangkan pada kelompok ikan didapati ikan lele mempunyai kandungan vitamin A yang lebih tinggi dibandingkan jenis ikan lainnya.

  14. Sistem Komputerisasi Pengolahan Buku Induk Pegawai Pada UPT Dinas Pendidikan Pemuda Dan Olahraga Kecamatan Banjarmangu Berbasis PHP Dan MYSQL

    Directory of Open Access Journals (Sweden)

    Elisa Usada

    2011-11-01

    Full Text Available Permasalahan yang akan dibahas adalah bagaimana membuat sistem pengolahan buku induk pegawai di UPT Dinas Pendidikan Pemuda dan Olahraga Kecamatan Banjarmangu berbasis PHP dan MySQL. Sistem pengolahan buku induk pegawai  berbasis PHP dan MySQL ini dirancang komputerisasi menggunakan PHP dan database MySQL dengan tujuan agar pengolahan data pegawai di UPT Dinas Pendidikan Pemuda dan Olahraga Kecamatan Banjarmangu dapat terpusat. Metode penelitian yang digunakan adalah menggunakan metode waterfall. Sistem pengolahan buku induk pegawai ini menggunakan jaringan client server dan dapat diakses oleh administrator dan Kepala UPT dan Pegawai. Kelebihan dari sistem pengolahan ini adalah dilindungi password dan hak akses yang berbeda untuk setiap user sehingga keamanan data dapat terjamin, sedangkan kekurangannya adalah program yang dihasilkan belum maksimal karena mengkhususkan data pegawai pada buku induk saja. Saran dari sistem pengolahan ini yaitu pengembangan dari segi keamanan data, kelengkapan data, dan ketelitian sistem dalam input data untuk mengurangi kesalahan.

  15. Atomic phase diagram

    Institute of Scientific and Technical Information of China (English)

    LI Shichun

    2004-01-01

    Based on the Thomas-Fermi-Dirac-Cheng model, atomic phase diagram or electron density versus atomic radius diagram describing the interaction properties of atoms of different kinds in equilibrium state is developed. Atomic phase diagram is established based on the two-atoms model. Besides atomic radius, electron density and continuity condition for electron density on interfaces between atoms, the lever law of atomic phase diagram involving other physical parameters is taken into account, such as the binding energy, for the sake of simplicity.

  16. Prinsip Transparansi dalam Perjanjian TBT dan SPS

    Directory of Open Access Journals (Sweden)

    Dina Widyaputri Kariodimedjo

    2012-02-01

    Full Text Available Transparency principle in the TBT and SPS Agreement is implemented by notification. Its application is prepared by related agencies through the making of regulations, establishment of enquiry points, building capacity and infrastructure. It guarantees certainty, predictability and credibility of Indonesia in international trade, and its application should not undermine national trade policy. Prinsip transparansi dalam Perjanjian TBT dan SPS diterapkan melalui notifikasi. Penerapan prinsip ini dilakukan oleh instansi-instansi terkait melalui pembuatan peraturan, upaya terkait kelembagaan, SDM dan infrastruktur. Prinsip yang bertujuan menciptakan kepastian, konsistensi bagi perdagangan dan kredibilitas Indonesia dalam perdagangan internasional, harus dilakukan tanpa mengorbankan kepentingan untuk mengamankan kebijakan impor nasional.

  17. ANEMIA DAN ANEMIA GIZI BESI PADA KEHAMILAN: HUBUNGANNYA DENGAN ASUPAN PROTEIN DAN ZAT GIZI MIKRO

    OpenAIRE

    Nur Handayani Utami; Bunga CH. Rosha

    2015-01-01

    Anemia masih menjadi permasalahan kesehatan pada wanita hamil. Zat besi dianggap sebagai salah satu zat gizi mikro yang berperan terhadap terjadinya anemia. Kekurangan gizi besi dalam tingkat lanjut dapat menyebabkan anemia, yang disebut sebagai anemia gizi besi. Tujuan studi ini adalah untuk menganalisis perbedaan antara asupan protein dan gizi mikro serta menghitung odd ratio (OR) kejadian anemia dan anemia gizi besi akibat asupan protein dan gizi mikro pada wanita hamil di lokasi studi. An...

  18. Evaluasi Layanan Sirkulasi dan Layanan Pengguna Pada Kantor Perpustakaan, Kearsipan dan Dokumentasi Nias Utara

    OpenAIRE

    Zalukhu, Radius Seantero

    2016-01-01

    Tujuan penelitian ini adalah untuk mengetahui layanan perpustakaan pada kantor perpustakaan, kearsipan dan dokumentasi kabupaten Nias Utara. Penelitian yang dilakukan di Kantor Perpustakaan, Kearsipan dan Dokumenstasi Kabupaten Nias Utara, yang beralamat di Jl. Gunung Sitoli – Lehewa Km 42 Lotu, menitik beratkan pada layanan sirkulasi, layanan pengguna serta layanan koleksi. Metode Penelitian menggunakan metode deskriptif. Instrument yang digunakan dalam penelitian ini adalah kuesioner dan st...

  19. Pencahayaan Buatan pada Pendekatan Teknis dan Estetis untuk Bangunan dan Ruang Dalam

    OpenAIRE

    Budi Setiawan; Grace Hartanti

    2014-01-01

    Cahaya merupakan hal yang penting bagi manusia dan makhluk hidup lainnya. Tanpa cahaya atau penerangan tentu sulit untuk beraktivitas, terutama saat hari menjelang malam. Seiring berkembangnya peradaban dan teknologi, manusia menciptakan pencahayaan buatan. Awalnya, pencahayaan buatan sebagai pengganti sinar alami matahari, lalu cahaya buatan yang didapat dari api, kemudian penelitian dan pengembangan bola lampu oleh Alessandro Volta, Sir Humphry Davy, Warren De La Rue, hingga Tho...

  20. Penskalaan Butir Format Respons Pilihan dan Respons Bebas Berdasarkan Model Rasch dan Partial Credit

    Directory of Open Access Journals (Sweden)

    Eko Hariadi

    2007-06-01

    Full Text Available Penelitian melihat pengaruh jumlah parameter butir, kategori respons bebas (RB, pengaruh sampel terhadap akurasi estimasi parameter kemampuan untuk menghasilkan estimasi yang stabil dan pengaruh pembobotan butir RP dan butir RB terhadap kesalahan baku. Penelitian dalam dua tahap, simulasi menggunakan 30 kondisi dengan replikasi 50 dengan variabel panjang tes, jumlah kategori, dan jumlah parameter butir, dan analisis deskriptif, dilanjutkan penerapan penskalaan gabungan butir tipe respons pilihan (rp dan butir respons bebas (rb pada konstruksi tes elektronika yang terdiri 40 butir pilihan ganda dan 4 butir jawaban tersusun, 3 butir memiliki lima kategori jawaban dan 1 butir dengan 4 kategori jawaban, melibatkan 355 siswa. Hasil penelitian menunjukkan: ukuran sampel kurang berpengaruh pada root mean square error atau (RSME> dan korelasi antara 9 dengan 0, namun berpengaruh terhadap akurasi estimasi parameter butir pilihan ganda (/>/y,dan parameter butir respons tersusun (3^- Jumlah parameter butir berpengaruh terhadap parameter kemampuan, tetapi tidak berpengaruh terhadap akurasi dari b^, dan S„,. Estimasi dari parameter tingkat kesulitan butir jawaban tersusun tiga kategori lebih akurat daripada butir jawaban tersusun lima kategori. Estimasi tahan {robust untuk parameter kesulitan butir jawaban tersusun 5 kategori memerlukan sampel minimal 250 responden, sedangkan untuk butir respons tersusun 3 kategori memerlukan sampel minimal 100 responden. Estimasi parameter kemampuan dari skor total (0^^ tidak sama dengan rata-rata jumlah tbeta dari masing-masing subtes (0^ + 0CR. Theta dari tes yang dikalibrasi bersama-sama berbeda dengan theta dari total subtes yang dikalibrasi secara terpisah. Korelasi kemampuan yang mengunakan pembobotan dan kemampuan tanpa pembobotan mempunyai suatu rentang dari 0,988 sampai 0,948. Kata kunci: penyekaiaan, model rash dan partial credit.

  1. Status Oral Higiene Dan Periodontal Pada Pasien Diabetes Melitus Dan Non- Diabetes Di RSUD Dr. Pirngadi

    OpenAIRE

    Butar-Butar, Mardiah Rizqo

    2014-01-01

    Diabetes melitus adalah penyakit gangguan metabolisme ditandai dengan meningkatnya kadar gula darah yang terjadi karena kelainan sekresi insulin, kerja insulin, atau kedua-duanya. Diabetes melitus merupakan salah satu penyakit sistemik yang berperan sebagai faktor risiko penyakit periodontal. Penelitian ini bertujuan untuk mengetahui status oral higiene dan periodontal dan odd rasio periodontitis pada pasien Diabetes melitus dan non-Diabetes. Rancangan penelitian adalah case-control. Popul...

  2. DIAMETER SERAT DAN PANJANG SARKOMER DAGING SAPI BALI HASIL PENGGEMUKAN MENGGUNAKAN PAKAN DENGAN LEVEL KULIT BIJI KAKAO DAN OTOT BERBEDA

    OpenAIRE

    2015-01-01

    2015 NUR AMALIA (I111 11 271). Diameter Serat dan Panjang Sarkomer Daging Sapi Bali Hasil Penggemukan Menggunakan Pakan dengan Level Kulit Biji Kakao dan Otot Berbeda. Dibawah bimbingan Hikmah M. Ali sebagai pembimbing utama, dan Ratmawati Malaka sebagai pembimbing anggota. Penelitian ini bertujuan untuk mengetahui pengaruh jenis otot, level kulit biji kakao dalam pakan, dan interaksi keduanya terhadap panjang sarkomer dan diameter serat daging sapi Bali. Penelitian ini ...

  3. Perencanaan Pemerintah Kabupaten Kudus Dalam Mempersiapkan Pengalihan Pajak Bumi dan Bangunan Sektor Perdesaan dan Perkotaan Sebagai Pajak Daerah

    Directory of Open Access Journals (Sweden)

    Vitriana Masfita

    2013-08-01

    Full Text Available Penelitian ini dilatarbelakangi oleh terbitnya Undang-undang Nomor 28 Tahun 2009 tentang Pajak Daerah dan Retribusi Daerah, Pemerintah Pusat mengalihkan kewenangan pengelolaan Pajak Bumi dan Bangunan sektor Perdesaan dan Perkotaan kepada Pemerintah Daerah. Oleh karena itu, Pemerintah Daerah harus mempersiapkan segala keperluan agar proses pengalihan ini berjalan dengan lancar. Tujuan penelitian ini adalah untuk mendeskripsikan dan menganalisis (1 rencana pemerintah Kabupaten Kudus dalam persiapan pengambilalihan Pajak Bumi dan Bangunan Sektor Perkotaan dan Perdesaan, (2 faktor-faktor yang mempengaruhi persiapan Pemerintah Kabupaten Kudus dalam pengalihan Pajak Bumi dan Bangunan Sektor Perkotaan. Penelitian ini merupakan penelitian kualitatif deskriptif dengan menggunakan data-data kualitatif berupa kata-kata, tindakan dan dokumen. Teknik pengumpulan data yang digunakan adalah interview dengan Kepala DPPKD Kabupaten Kudus beserta Kepala Bidang, Kepala Seksi dan Staff, observasi partisipasi di DPPKD Kabupaten Kudus, dan studi dokumentasi dokumen kedinasan di DPPKD Kabupaten Kudus. Data diperoleh melalui Analisis data menggunakan model Miles dan Huberman. Hasil Penelitian: (1 Pemerintah Kabupaten kudus berencana untuk mempersiapkan Sarana dan Prasarana yang meliputi penyediaan ruang pelayanan, ruang server dan pengolahan data, pengadaan perlengkapan gedung kantor, pengadaan software dan hardware komputer, pengadaan barang cetakan; membentuk UPT Pelayananan Pajak Daerah; mempersiapkan personel dibidang IT, pelayanan pajak daerah, administrasi pajak daerah; membentuk Peraturan Daerah dan Peraturan Bupati terkait Pajak Bumi dan Bangunan; menyiapkan SOP; menjalin kerjasama dengan KPP Pratama dan Bank Jateng; membuka rekening PBB P2 di Bank Jateng.  (2 Faktor pendukung dari proses perencanaan Pemerintah Kabupaten Kudus adalah: tersedianya dana atau pembiayaan, partisipasi SKPD terkait, serta partisipasi dari Kantor Pelayanan Pajak Pratama dan Bank

  4. Cold Matter Assembled Atom-by-Atom

    CERN Document Server

    Endres, Manuel; Keesling, Alexander; Levine, Harry; Anschuetz, Eric R; Krajenbrink, Alexandre; Senko, Crystal; Vuletic, Vladan; Greiner, Markus; Lukin, Mikhail D

    2016-01-01

    The realization of large-scale fully controllable quantum systems is an exciting frontier in modern physical science. We use atom-by-atom assembly to implement a novel platform for the deterministic preparation of regular arrays of individually controlled cold atoms. In our approach, a measurement and feedback procedure eliminates the entropy associated with probabilistic trap occupation and results in defect-free arrays of over 50 atoms in less than 400 ms. The technique is based on fast, real-time control of 100 optical tweezers, which we use to arrange atoms in desired geometric patterns and to maintain these configurations by replacing lost atoms with surplus atoms from a reservoir. This bottom-up approach enables controlled engineering of scalable many-body systems for quantum information processing, quantum simulations, and precision measurements.

  5. PENGKAJIAN PROGRAM KURSUS DAN PELATIHAN TERKAIT DENGAN JENIS KETERAMPILAN, SERTIFIKASI DAN PENEMPATAN LULUSAN

    Directory of Open Access Journals (Sweden)

    Melati Indri Hapsari

    2016-02-01

    Full Text Available Penelitian ini bertujuan mengidentifikasi jenis-jenis keterampilan yang dibutuhkan di dunia usaha dan industri terutama pasar ASEAN yang telah tersedia lembaga sertifikasinya, mengetahui pelaksanaan sertifikasi kompetensinya, dan proses penempatan tenaga kerja yang akan bekerja di luar negeri. Lokasi penelitian dilakukan di BNSP, BKSP, Dinas Tenaga Kerja dan Transmigrasi, serta BP3TKI. Subyek dipilih sesuai kompetensinya. Penelitian deskriptif kualitatif ini menggunakan teknik pengumpulan data dengan wawancara, dokumentasi dan studi pustaka. Keabsahan data menggunakan kriteria kredibilitas, dependabilitas, konfirmabilitas, dan transferabilitas. Simpulan penelitian ini adalah bahwa jenis-jenis keterampilan yang dibutuhkan di dunia usaha dan industri terutama pasar ASEAN antara lain pariwisata, operator produksi, kayu lapis, konstruksi. Yang telah siap MRA-nya adalah bidang pariwisata dengan dikeluarkannya ACCSTP dan CATC. Pelaksanaan sertifikasi kompetensi di Indonesia adalah Lembaga Sertifikasi Profesi yang telah mendapat lisensi dari Badan Nasional Sertifikasi Profesi. Proses penempatan tenaga kerja yang akan bekerja di luar negeri hanya dapat dilakukan oleh pemerintah dan pelaksana penempatan TKI swasta. Prosedur penempatan dimulai dari pra penempatan, penempatan dan pasca penempatan.

  6. Sintesa dan Karakteristik Sifat Mekanik Karet Nanokomposit

    Directory of Open Access Journals (Sweden)

    Pocut Nurul Alam

    2007-06-01

    Full Text Available Peningkatan sifat mekanik karet alam dengan penambahan tanah liat nanokomposit pada kosentrasi berbeda yaitu 1, 3 dan 5 % berat sudah berhasil diteliti. Pada percobaan ini pengujian dilakukan dengan X-Ray Difraction (X-RD untuk analisa morphologi dan Instron untuk analisa uji tarik. Penambahan tanah liat nanokomposit kedalam matrik polimer adalah untuk meningkatkan sifat mekanik dari material asli dan juga untuk menghasilkan suatu produk polimer yang lebih murah. Hasil yang diperoleh adalah terjadinya peningkatan yang drastis terhadap basal spacing dari matrik polimer dan menunjukkan intercalasi diantara polimer dengan pengisinya. Uji tarik juga menununjukkan peningkatan yang sangat signifikan yaitu 14.983 MPa pada karet alam menjadi 40.178 MPa pada karet alam-tanah liat nanokomposit 5% berat. Kata kunci: karet alam, sifat mekanik, tanah liat nanokomposit

  7. BY PRODUCT TERNAK. Teknologi dan Aplikasinya

    OpenAIRE

    Said, Muhammad Irfan

    2014-01-01

    DAFTAR PUSTAKA Adventini, N., Muhayatun, D. D. Lestiani dan W.Y.N. Syahfitri. 2012. Analisis Mikronutrien dalam Daging, Limpa, dan Hati Sapi. Jurnal Medika. 38 (8), 580???586. Angelidaki, I., and B. K. Ahring. 2000. Methods for increasing the biogas potential from the recalcitrant organic matter contained in manure. Water Science Technology. 41 (3), 189-194. Anonim. 1974. Gelita-Instant-Gelatins Type 800 A Type 800 B. Gelatine-Information-Service. Deutsche Gelatine-Febrike...

  8. La guitare dans les musiques traditionnelles

    OpenAIRE

    Rougier, Thierry

    2002-01-01

    International audience; Ce que l'organologie classique désigne sous le nom de "guitare" connaît en fait une très grande variété (de forme, d'accord, de mode de jeu) dans les musiques traditionnelles. L'ethnomusicologie rend compte de la continuité entre les cordophones de type guitare, les autres cordophones et les instruments à percussion, sur de nombreux terrains (dans la musique flamenca, brésilienne...)

  9. Al-Farabi dan Filsafat Kenabian

    Directory of Open Access Journals (Sweden)

    Qosim Nursheha Dzulhadi

    2014-03-01

    Full Text Available Artikel ini mengulas pemikiran al-Farabi tentang konsep kenabian dalam Islam. Masalah berawal dari adanya pemikiran yang menolak konsep kenabian pada umumnya dan kenabian Nabi Muhammad SAW khususnya. Sebagaimana yang dilontarkan oleh Muhammad Ahmad ibn al-Ruwandi. Ia mengatakan bahwa nabi sebenarnya tidak diperlukan manusia karena Tuhan telah mengaruniakan akal kepada manusia tanpa terkecuali. Dengan akal ini, manusia dapat mengetahui Tuhan beserta segala nikmat Nya dan dapat pula mengetahui perbuatan baik dan buruk, menerima suruhan dan larangan-Nya. Dengan demikian, nabi dengan segala fungsinya tidak diperlukan lagi. Bahkan, kitab suci pun tidak berguna untuk dibaca. Lebih berguna membaca buku filsafat Epicurus, Plato, Aristoteles, dan buku astronomi, logika, serta obat-obatan. Hal ini tentunya bertolak belakang dengan yang diajarkan dalam Islam. Beriman kepada nabi nabi merupakan hal inti dalam ajaran agama ini. Atas dasar itu al-Farabi bereaksi keras. Baginya, pandangan Ibn al-Ruwandi di atas tidak dapat dibenarkan, khususnya dari sisi akidah Islam. Sebagai al-Mu‘allim al-Tsani (Guru Kedua, karena prestasinya dalam menjelaskan dan mengulas-ulang filsafat Aristoteles, al-Farabi mengkritik secara sistematik pandangan menyimpang al-Ruwandi di atas.

  10. Pembuatan dan Karakteristik Komposit Polimer Berpenguat Bagasse

    Directory of Open Access Journals (Sweden)

    Eqitha Dea Clareyna

    2013-09-01

    Full Text Available Bagasse memiliki kandungan serat yang cukup besar dan berpotensi digunakan sebagai bahan penguat dalam pembuatan komposit karena sifatnya yang kuat dan ringan. Dalam penelitian tugas akhir ini telah dibuat bahan komposit berpenguat bagasse dengan empat macam ukuran penguat yaitu serat chopped serta partikel berukuran 100 mesh, 140 mesh, dan 200 mesh. Pembuatan komposit menggunakan metode hand lay-up dan fraksi volume penguat divariasi dari 2,5% hingga 15%. Hasil karakterisasi yang telah dilakukan, menunjukkan bahwa kekuatan tarik dan densitas terbaik dimiliki oleh sampel komposit dengan penguat berukuran 200 mesh sebanyak 7,5% volume. Kekuatan tarik sampel tersebut adalah  28,83  MPa dan densitasnya adalah 1,15 gr/cm3. Adapun kekuatan impak terbesar dimiliki oleh sampel komposit dengan 2,5% volume sebesar 0,00271 J/mm2. Dengan demikian sampel komposit yang telah dibuat dapat digunakan sebagai alternatif bahan baku industri menggantikan tiang penyangga (scantlings pada struktur kayu (timber structure sesuai standar AS 1720.1.

  11. Kontestasi Kekuasaan dan Keteladanan Semu di Indonesia

    Directory of Open Access Journals (Sweden)

    Michael HB Raditya

    2016-04-01

    Full Text Available Kepemimpinan di Indonesia merupakan persoalan yang menarik untuk ditelaah. Jika bertolak dari tataran diakronis, secara kronologis Indonesia telah mengalami pelbagai macam fase kepemimpinan dan rezim. Ihwal ini dapat menjadi stimulan positif jika masyarakat dapat mengartikulasikan pengalaman bernegaranya dengan tepat. Kontestasi kekuasaan pun tidak dapat terhindarkan, terlebih setiap pemimpin melakukan persaingan dalam memperebutkan kekuasaan. Kontestasi ini tidak hanya merujuk pada tingkat lokal, namun hingga tingkat nasional. Berbagai aspek pun turut menjadi faktor utama dari kontestasi tersebut, seperti tipe kepemimpinan aristokrasi dan demokrasi, hingga perbedaan gender pemimpinnya. Ihwal tersebut turut mengejewantah kan bahwa keteladanan yang didasarkan atas beberapa kontekstual, bersifat pseudo, atau semu. Dalam mengupas ihwal tersebut, telaah yang digunakan merujuk pada pemahaman Barkerakan agen, dan Gramsci akan hegemoni. Tidak hanya itu, Kouzes dan Posner digunakan untuk menilik parameter keteladanan. Asumsi penulis, keteladanan merupakan unsur yang tercipta untuk menghegomoni agen di dalamnya. Bertolak dari mempertanyakan keteladanan, maka pembahasan akan lebih mempertimbangkan aspek agen, hegemoni dan kuasa. Penulis menyadari bahwa tidak mungkin meneliti semua pola kepemimpinan yang ada di Indonesia, maka rujukan contoh kepemimpinan didasarkan pada beberapa contoh di era kolonial, orde lama, orde baru,dan pemerintahan kini. Penelitian ini mencoba untuk mengupas persoalan keteladanan dalam kepemimpinan yang kerap diunggulkan kepemimpinan yang ada di Indonesia.

  12. Dimensi Agama dan Reaksi Dunia Melayu Terhadap Penetrasi Barat di Abad XVIII dan XIX Khasnya di Riau, Melaka, Palembang, dan Aceh

    OpenAIRE

    Alfian, Ibrahim

    2013-01-01

    Tulisan ini mengangkat "kisah" dua kitab Dala'il al-Khairat dan Nasihat al-Muslimin yakni dua aspek ajaran Islam shalwat kepada Nabi Besar Muhammad saw. dan panggilan jihad sabilillah di dunia Melayu abad 18 dan 19 yang dapat memberikan kita beberapa hal penting.

  13. RUMAH TRADISIONAL OSING KONSEP RUANG DAN BENTUK

    Directory of Open Access Journals (Sweden)

    Iwan Suprijanto

    2002-01-01

    , Banyuwangi-Jawa Timur, yang secara historis-genealogis-sosiologis masih memperlihatkan tata kehidupan tradisional dan memiliki rumah Osing relatif banyak. Tujuan penelitian adalah memperoleh konsep ruang dan bentuk pada rumah tradisional Osing di Desa Kemiren dan faktor-faktor yang melatarbelakanginya. Hasil penelitian adalah : 1. Konsep Ruang Rumah Osing Pola ruang menganut susunan ruang Bale, Jrumah dan Pawon secara berurut dari depan ke belakang. Organisasi ruang menganut prinsip closed ended plan. Konsep ruang memperlihatkan adanya dualitas dan centralitas. 2. Konsep Bentuk Rumah Osing Bentuk atap merupakan indikator utama bentuk rumah Osing, yang dapat dibedakan menjadi Tikel Balung, Baresan dan Cerocogan. Karakteristik bentuk rumah Osing terletak pada penggunaan 1, 2 atau 3 bentuk dasar tersebut secara sekaligus dalam susunan berurut dari depan ke belakang sesuai dengan susunan ruangnya. 3. Faktor-faktor yang melatarbelakangi Konsep masing-masing ruang dipengaruhi oleh fungsi dan aktivitas, makna kegiatan yang dilakukan serta siapa yang boleh menghuni/melakukan kegiatan. Organisasi ruang merupakan manifestasi sifat tertutup, berhati-hati dan curiga masyarakatnya. Bentuk rumah Osing berkaitan erat dengan struktur sosial masyarakat yang cenderung egaliter. Nama bagian-bagian rumah dan susunannya merupakan pengungkapan pesan, makna dan kehendak sebagai ekspresi rasa dan karsa pemiliknya. Makna tersebut tidak terkandung dalam bentuk itu sendiri, melainkan dalam diri manusia yang menginginkan bentuk tersebut mencerminkan sifat laten dan asosiasional, sekaligus menggambarkan apresiasi cipta dan karya. Kata kunci: dualitas dan centralitas; Tikel Balung, Baresan dan Cerocogan.

  14. Atom Lithography with a Chromium Atomic Beam

    Institute of Scientific and Technical Information of China (English)

    ZHANG Wen-Tao; LI Tong-Bao

    2006-01-01

    @@ Direct write atom lithography is a new technique in which resonant light is used to pattern an atomic beam and the nanostructures are formed when the atoms deposit on the substrate. We design an experiment setup to fabricate chromium nanolines by depositing an atomic beam of 52 Cr through an off-resonant laser standing wave with the wavelength of 425.55 nm onto a silicon substrate. The resulting nanolines exhibit a period of 215 ± 3 nm with height of 1 nm.

  15. KEEFEKTIFAN MODEL PEMBELAJARAN ISK DAN DI DITINJAU DARI MOTIVASI, SIKAP, DAN KEMAMPUAN KOMUNIKASI MATEMATIS

    Directory of Open Access Journals (Sweden)

    Djuwita Amin Mahmud

    2014-11-01

    Full Text Available Penelitian ini bertujuan untuk mendeskripsikan keefektifan dan perbedaan keefektifan model pembelajaran interaktif setting kooperatif dengan direct instruction ditinjau dari motivasi belajar, sikap, dan kemampuan komunikasi matematis. Populasi penelitian ini adalah siswa kelas X SMA Negeri 3 Ternate yang terdiri dari 5 kelas. Dari populasi yang ada diambil secara acak dua kelas yaitu kelas X-1 dan X-3 sebagai sampel penelitian. Kelas X-1 diberi treatment dengan model pembelajaran interaktif setting kooperatif, sedangkan kelas X-3 dengan model direct instruction. Data penelitian dianalisis dengan statistik uji one sampel t-test, uji MANOVA dengan T2 Hotelling’s pada taraf signifikan 0,05 dan uji univariat untuk menentukan model mana yang lebih efektif. Hasil penelitian menunjukkan bahwa: (1 pembelajaran matematika dengan model pembelajaran interaktif setting kooperatif efektif ditinjau dari motivasi belajar, sikap, dan komunikasi matematis sedangkan pada model pembelajaran direct instruction efektif ditinjau dari motivasi belajar dan sikap belajar siswa tetapi tidak efektif ditinjau dari komunikasi matematis; (2 terdapat perbedaan keefektifan antara model pembelajaran interaktif setting kooperatif dengan direct instruction. Model pembelajaran interaktif setting kooperatif lebih efektif daripada model direct instruction ditinjau dari motivasi belajar, sikap, dan kemampuan komunikasi matematis siswa kelas X SMA Negeri 3 Ternate. Kata Kunci: Model pembelajaran interaktif setting kooperatif, direct instruction, motivasi belajar, sikap, dan kemampuan komunikasi matematis.

  16. Profil Bibir dan Posisi Insisivus Perawatan Kasus Borderline Klas I dengan Pencabutan dan Tanpa Pencabutan

    Directory of Open Access Journals (Sweden)

    Yenni Hanimastuti

    2013-12-01

    Full Text Available Penentuan rencana perawatan ortodontik dengan pencabutan atau tanpa pencabutan masih menjadi perdebatan, terutama pada kasus borderline.Perawatan ortodontik dengan atau tanpa pencabutan dapat mempengaruhi profil wajah.Perubahan pada penampilan wajah terjadi akibat adanya perubahan posisi gigi anterior yang dapat mempengaruhi perubahan profil jaringan lunak wajah terutama pada daerah bibir. Penelitian ini bertujuan mengetahui perbandingan perubahan profil bibir dan posisi gigi insisivus pada kasus borderline klas I antara perawatan dengan pencabutan 4 premolar kedua dan tanpa pencabutan. Penelitian dilakukan pada 28 sefalogram lateral kasus borderline klas I  yang dirawat dengan teknik straight wire, terdiri dari 2 kelompok (13 kasus dengan pencabutan dan 15 kasus tanpa pencabutan. Masing-masing sefalogram dilakukan pengukuran profil bibir,yaitu jarak bibir atas dan bawah terhadapVertical Reference Plane (VRP dan sudut interlabial; serta posisi gigi insisivus, yaitu jarak gigi insisivus atas dan bawah terhadap Vertical Reference Plane (VRP, sebelum dan sesudah perawatan. Hasil penelitian menunjukkan pada tahap awal perawatan kedua kelompok memiliki karakteristik profil bibir dan posisi gigi insisivus yang sama (p>0,05. Terdapat perbedaan bermakna (p0,05. There are significant differences (p<0.05 on lips position, interlabial angle, and incisors position changes between the extraction and non- extractiion cases after orthodontic treatment. From this study, it can be concluded that lips profile and incisors position in class I borderline cases treated with the extraction of second bicuspid are more retruded than that of non-extraction cases

  17. MUTU ORGANOLEPTIK DAN KIMIAWI TERASI UDANG REBON DENGAN KADAR GARAM BERBEDA DAN LAMA FERMENTASI

    Directory of Open Access Journals (Sweden)

    apri dwi anggo

    2014-07-01

    Full Text Available Terasi merupakan produk fermentasi udang dengan penambahan garam. Fermentasi dengan garam menyebabkan perombakan protein menjadi asam amino misalnya asam glutamat sebagai penghasil cita rasa khas terasi. Kadar garam dan lama fermentasi merupakan faktor penting pada proses pembuatan terasi. Penelitian ini bertujuan untuk menganalisis pengaruh perbedaan konsentrasi garam dan lama fermentasi terhadap kualitas terasi rebon terutama kandungan asam glutamat. Bahan baku yang digunakan pada penelitian ini adalah rebon (Acetes sp. kering tawar dengan panjang ±2 cm per ekor. Perlakuan garam dengan konsentrasi 2%, 8,5%, 15% dan lama fermentasi (8 hari dan 32 hari. Metode penelitian menggunakan metode experimental field dengan Rancangan Acak Kelompok (RAK pola split plot in time 3 kali ulangan. Parameter yang diuji meliputi organoleptik, pH, kadar protein, asam glutamat, kadar air dan profil asam amino. Parameter kadar protein, asam glutamat dan profil asam amino pada fermentasi hari ke 32 yang diamati hanya perlakuan konsentrasi kadar garam terbaik pada hari ke 8. Nilai organoleptik terasi berkisar antara 7,65-8,32 artinya produk tersebut dapat diterima konsumen. Nilai pH Nilai pH terasi rebon berkisar antara 7,09 sampai 7,89. Konsentrasi garam 2% pada terasi rebon menghasilkan kadar protein dan asam glutamat tertinggi yaitu 47,14%+0,20 (dry base. Asam amino yang dominan pada terasi rebon adalah asam glutamat dan asam aspartat. Lama fermentasi menyebabkan penurunan asam glutamat terasi rebon.Kata kunci: asam glutamat, fermentasi, garam, rebon

  18. Gereja dan Paradigma Pembaharuan Ditinjau dari Perspektif Teologi Agama dan Masyarakat

    Directory of Open Access Journals (Sweden)

    Yunny Jones Akal

    2005-04-01

    Full Text Available Gereja atau umat Allah diharapkan selalu berada dalam perubahan positif, agar tegar dan siap terusmelaksanakan tanggung jawab vertical dan horizontal. Prinsip yang perlu adalahgereja memberi kontribusi bagi masyarakat. Peluang-peluang seperti halnyamengembangkan pelayanan berdasarkan panggilan Allah, bermotif kasih, danberorientasikan perbuatan baik menjadi kekuatan lahirnya pengakuan“Allahmu adalah Allahku, Kristusmu adalah Kristusku”

  19. Perancangan dan Implementasi Algoritma DES untuk Mikroprosesor Enkripsi dan Dekripsi pada FPGA

    Directory of Open Access Journals (Sweden)

    Imaduddin Amrullah Muslim

    2015-04-01

    Full Text Available Seiring dengan semakin luasnya penerapan teknologi komputasi di sekitar kita, menjadikan informasi menjadi sangat mudah dan cepat untuk disebarkan. Kita dapat mengakses informasi dan data-data yang kita butuhkan dengan mudah. Namun permasalahan yang kita hadapi saat ini kerhasiaan informasi menjadi sangat riskan. Oleh karena itu Sistem keamanan merupakan hal penting yang perlu diperhatikan dalam mengembangkan suatu sistem komputer hal ini lah yang menjadikan enkripsi dan dekripsi data menjadi hal yang penting. Modul rancangan IP Core ini dirancang menggunakan aplikasi Xilinx ISE Design Suite 12.4. Kemudian rancangan IP Core ini diimplementasikan pada papan Xilinx FPGA Spartan-3E XC3S500E-4FG320C dari keluarga Xilinx FPGA Spartan-3E dengan 500K sistem gerbang. Verifikasi fungsional dari IP Core yang dirancang menggunakan testbench dan simulasi diagram pewaktuan menggunakan aplikasi Xilinx ISE Simulator. Tugas akhir ini ditujukan untuk mengembangkan IP Core yang mampu menjalankan fungsi enkripsi DES (Data Encryption Standard dan ditulis menggunakan bahasa Verilog. Implementasi algoritma enkripsi dan dekripsi algoritma DES telah berhasil dilakukan. Hasil analisis menunjukkan sistem telah dapat melakukan enkripsi dan dekripsi data sesuai dengan spesifikasi algoritma DES. Sebaiknya penelitian ini dikembangkan kembali dengan menguji sistem untuk melakukan transmisi data berupa file ataupun teks. Selain itu juga perlu meningkatkan unjuk kerja sistem dengan optimasi sumber daya dan kecepatan waktu proses pada perancangan rekonstruksi kode verilog.

  20. PROFIL ASAM LEMAK DAN KESTABILAN PRODUK FORMULASI MINYAK IKAN DAN HABBATUSSAUDA

    Directory of Open Access Journals (Sweden)

    Sugeng Heri Suseno

    2014-06-01

    Full Text Available Minyak ikan dan minyak habbatussauda saat ini banyak digunakan untuk meningkatkan kecerdasandan mencegah berbagai penyakit. Tujuan penelitian ini adalah menentukan karakteristik dan kestabilanproduk kombinasi minyak ikan dan habbatussauda. Formulasi kombinasi minyak ikan dan habbatussaudayaitu sebesar 1:1, 3:1, 5:1, dan 7:1. Analisis profi l asam lemak menunjukkan bahwa minyak ikan didominasioleh EPA dan DHA, sedangkan komponen utama minyak habbatussauda adalah asam oleat dan asamlinoleat. Minyak habbatussauda memiliki aktivitas antioksidan sebesar 551,17 mM AEAC, sedangkanminyak ikan sebesar 61,15 mM AEAC. Formulasi terbaik berdasarkan uji FFA, bilangan peroksida, dananisidin adalah formulasi 1:1 dengan nilai masing-masing 1,68%, 26,67 meq/kg dan 13,65 meq/kg. Hasilterbaik berdasarkan uji kestabilan adalah produk kombinasi 3:1 dengan nilai FFA terendah hingga harike-9 sebesar 5,94%, sedangkan untuk uji organoleptik adalah formulasi 7:1, paling disukai panelis karenamemiliki warna yang paling cerah.Kata kunci: anisidin, kestabilan, organoleptik, peroksida

  1. Pengaruh Rasio Biji terhadap Pelarut dan Waktu Ekstraksi terhadap Yield dan Kualitas Minyak Biji Alpukat

    Directory of Open Access Journals (Sweden)

    Novia Mehra Erfiza

    2016-06-01

    Full Text Available Penelitian ini bertujuan untuk mengetahui pengaruh rasio biji alpukat terhadap pelarut dan waktu ekstraksi pada proses ekstraksi minyak biji alpukat menggunakan pelarut n-heksan. Penelitian menggunakan rancangan acak kelompok dengan pola faktorial terdiri atas 2 faktor yang masing-masing terdiri dari 3 taraf dengan 3 kali ulangan. Faktor pertama adalah rasio biji alpukat terhadap pelarut yaitu 1:5, 1:10 dan 1:15 (g/mL, sedangkan faktor kedua adalah waktu ekstraksi yaitu 120, 150, dan 180 menit. Hasil sidik ragam menunjukkan bahwa perlakuan rasio bahan terhadap pelarut tidak berpengaruh nyata (P>0,05 terhadap yield dan bilangan asam. Sementara itu, perlakuan waktu ekstraksi berpengaruh nyata (P≤0,05 terhadap yield minyak biji alpukat, dan berpengaruh tidak nyata (P>0,05 terhadap bilangan asam. Yield tertinggi (2,23% diperoleh dari sampel minyak pada perlakuan rasio bubuk biji alpukat terhadap pelarut 1:5 dan waktu ekstraksi 120 menit dengan aktivitas antioksidan 62,87%, serta nilai viskositas dan densitas masing-masing yaitu 13,5 cP dan 0,96 g/mL. Asam lemak oleat merupakan komponen terbesar dalam minyak biji alpukat.

  2. PENGARUH WORKSHOP DAN SERTIFIKASI AKUNTANSI TERHADAP PEMAHAMAN DASAR AKUNTANSI DAN PRAKTEK ( STUDI KASUS DI AMIK BSI SUKABUMI

    Directory of Open Access Journals (Sweden)

    Yuri Rahayu

    2016-03-01

      Abstrak - Mata kuliah dasar akuntansi dan praktek merupakan mata kuliah unggulan bagi jurusan Komputer Akuntansi dan harus menjadi pondasi yang kuat untuk bisa mengerti dan memahaminya dengan baik dan benar. Tapi pada kenyataannya hanya 30  % saja dari jumlah mahasiswa yang bisa memahami dan mengerti akan mata kuliah tersebut. Untuk bisa mengatasi masalah tersebut di perlukan metode pembelajaran yang lebih mendalam terhadap suatu topik tertentu dengan melakukan  pertukaran informasi dan interaksi antar peserta dengan pembahasan yang bersifat tutorial dan cenderung teknis atau yang di sebut dengan istilah Workshop dan untuk mengetahui sampai sejauh mana pemahaman terhadap  hasil workshop tersebut  perlu di laksanakan Sertifikasi. Penelitian ini untuk mengetahui sampai sejauh mana pengaruhnya Workshop dan Sertifikasi terhadap pemahaman dasar akuntansi. Metode penelitian yang digunakan adalah metode penelitian kuantitatif dan untuk menguji hipotesis dipilih teknik pengumpulan data dengan cara survey dengan  teknik analisisnya menggunakan metode Metode Deskriptif analisis yaitu suatu metode penelitian yang mengambil sample dari suatu populasi dan menggunakan kuesioner sebagai alat pengumpul datanya. Populasi dalam penelitian ini adalah jumlah peserta workshop dan sertifikasi akuntansi  jurusan  Komputer Akuntansi   AMIK BSI  yang berjumlah 242 orang. Pemilihan dan penetapan jumlah sample berdasarkan teknik Sampling purposive sebanyak 48 orang (studi kasus peserta di AMIK BSI Sukabumi. Kesimpulan dari penelitian ini adalah  pelaksanaan workshop dan sertifikasi akuntansi berpengaruh signifikan terhadap pemahaman dasar akuntansi dan praktek. Hal ini menunjukkan pengaruh yang positif dan mempunyai arti bahwa apabila mahasiswa sering mengikuti workshop dan sertifikasi akuntansi maka akan diikuti kenaikan  yang sangat kuat terhadap pemahaman dasar akuntansi dan praktek.   Kata kunci : pemahamana akuntansi, sertifikasi, workshop

  3. PERKEMBANGAN DAN EKSISTENSI MUSIK TARLING CIREBON

    Directory of Open Access Journals (Sweden)

    Salim -

    2015-08-01

    Full Text Available Kemajuan teknologi berpengaruh terhadap perkembangan Tarling namun demikian Tarling masih tetap menunjukan eksistensinya. Nampaknya ada hal yang menarik bagi peneliti untuk selanjutnya mengadakan penelitian tentang perkembangan dan eksistensi Tarling. Sehubungan dengan permasalahan tersebut maka masalah penelitiannya adalah bagaimana perkembangan Tarling, dan Bagaimana eksistensi Tarling. Penelitian Tesis ini menggunakan metoda penelitian kualitatif. Peneliti berusaha mendeskripsikan perkembangan dan eksistensi Tarling. Untuk memahami  perkembangan, dan eksistensi maka penelitian ini  menggunakan teori perkembangan dan eksistensi. Teknik pengumpulan data dilakukan dengan cara observasi, wawancara, dan dokumentasi. Pemeriksaan keabsahan data dilakukan dengan  menggunakan metode tringulasi. Analisis data dilakukan dengan tahapan: Reduksi data, penyajian data dan penarikan kesimpulan. Hasil penelitian menunjukan bahwa berdasarkan perkembangannya Tarling mengalami beberapa periodisasi perubahan yaitu periode musik, periode  lagu dan lawak kemudian periode teater. Berkenaan dengan eksistensinya musik Tarlingpun mengalami perubahan bentuk yaitu Tarling kreasi dan Tarling dangdut. Eksistensi musik Tarling terbentuk melalui proses akulturasi. Saran dari hasil penelitian menyatakan bahwa, perubahan yang terjadi dalam  Tarling dimaksudkan sebagai upaya agar Tarling tetap menarik kemudian eksis. Maka bagi Para tokoh masyarakat, seniman Tarling, pemerintah dan masyarakat Cirebon harus bersinergi melakukan berbagai langkah agar Tarling tetap menujukan eksistensinya The progress of technology influence the development Tarling, however Tarling still shows its existence. It seems that there is something interesting for researchers to conduct further research on the development and existence Tarling. In connection with these problems, the research problem is how the development Tarling and How existence Tarling. This thesis research uses qualitative

  4. PERAN TEKNOLOGI KOMUNIKASI DALAM INTERAKSI AYAH DAN ANAK STUDI KASUS: INTERAKSI AYAH DAN ANAK MELALUI SMARTPHONE

    Directory of Open Access Journals (Sweden)

    Detania Savitri

    2016-02-01

    Fungsi ayah dalam keluarga adalah sebagai pencari nafkah untuk memenuhi kebutuhan keluarga, sementara ibu berfungsi dalam mendidik anak. Ayah yang bekerja penuh waktu akan berkurang interaksinya dengan anak. Disisi lain, teknologi komunikasi diciptakan untuk mempermudah interaksi antar individu. Penelitian ini ingin mengetahui apakah smartphone dapat meningkatkan intensitas kedekatan interaksi antara ayah dan anak. Selain itu, penelitian ini juga ingin mengetahui apakah ayah dapat memberikan sosialisasi kepada anak melalui smartphone dan mengontrol keseharian anak. Artikel ini menggunakan perspektif fungsionalis. Pendekatan kualitatif digunakan oleh penulis dengan mewawancarai tiga ayah dan tiga anak berusia 20 tahun ke atas yang sama-sama menggunakan smartphone di kota Depok. Temuan yang diperoleh penulis yaitu smartphone dapat merubah interaksi ayah dengan anak, dan ayah dapat memberikan kontrol sosial kepada anak dalam interaksi melalui smartphone. Dalam interaksi ayah dan anak, smartphone juga dapat digunakan ayah untuk mensosialisasikan nilai-nilai kepada anak.

  5. HASIL ANALISIS VITAMIN A DAN β-KAROTEN BAHAN MAKANAN SUMBER VITAMIN A DAN KAROTEN DENGAN METODE HPLC

    OpenAIRE

    Yuniar Rosmalina; Dewi Permaesih

    2012-01-01

    Telah dilakukan analisis vitamin A DAN β-Karoten terhadap beberapa jenis pangan dengan menggunakan metode HPLC. Analisis dilakukan terhadap 9 jenis serealia dan umbi-umbian, 3 jenis kacang-kacangan, 40 jenis sayuran, 11 jenis daging dan hasilnya, 7 jenis telur dan hasilnya, 8 jenis ikan, 12 jenis buah-buahaan, dan 7 jenis kelompok lain-lain. Hasilnya menunjukkan sumber β-Karoten yang tinggi pada kelompok serealia dan umbi-umbian adalah umbi jalar, pada kelompok sayuran adalah daun katuk, daun...

  6. Advances in atomic spectroscopy

    CERN Document Server

    Sneddon, J

    2000-01-01

    This fifth volume of the successful series Advances in Atomic Spectroscopy continues to discuss and investigate the area of atomic spectroscopy.It begins with a description of the use of various atomic spectroscopic methods and applications of speciation studies in atomic spectroscopy. The emphasis is on combining atomic spectroscopy with gas and liquid chromatography. In chapter two the authors describe new developments in tunable lasers and the impact they will have on atomic spectroscopy. The traditional methods of detection, such as photography and the photomultiplier, and how they are being replaced by new detectors is discussed in chapter three. The very active area of glow discharge atomic spectrometry is presented in chapter four where, after a brief introduction and historical review, the use of glow discharge lamps for atomic spectroscopy and mass spectrometry are discussed. Included in this discussion is geometry and radiofrequency power. The future of this source in atomic spectroscopy is also dis...

  7. Atomic and molecular manipulation

    CERN Document Server

    Mayne, Andrew J

    2011-01-01

    Work with individual atoms and molecules aims to demonstrate that miniaturized electronic, optical, magnetic, and mechanical devices can operate ultimately even at the level of a single atom or molecule. As such, atomic and molecular manipulation has played an emblematic role in the development of the field of nanoscience. New methods based on the use of the scanning tunnelling microscope (STM) have been developed to characterize and manipulate all the degrees of freedom of individual atoms and molecules with an unprecedented precision. In the meantime, new concepts have emerged to design molecules and substrates having specific optical, mechanical and electronic functions, thus opening the way to the fabrication of real nano-machines. Manipulation of individual atoms and molecules has also opened up completely new areas of research and knowledge, raising fundamental questions of "Optics at the atomic scale", "Mechanics at the atomic scale", Electronics at the atomic scale", "Quantum physics at the atomic sca...

  8. KEPEMIMPINAN, SISTEM DAN STRUKTUR ORGANISASI, LINGKUNGAN FISIK, DAN KEEFEKTIFAN ORGANISASI SEKOLAH

    Directory of Open Access Journals (Sweden)

    Connie Chairunnisa

    2013-05-01

    Full Text Available Abstract: The Effects of Leadership, System and Structure, and Physical Environment on the Ef­fectiveness of School Organization. The study aims at obtaining information of the effects of leadership, system and structure, and physical environment on the effectiveness of organization. This causal study was conducted in one hundred schools in Jakarta. Survey method with causal approach and  path analysis was employed. The population consisted of288 teachers in junior high schools in DKI Province of Jakarta. The sample of 100 teachers was selected by applying simple random sampling technique. The results show di­rect effects of (1 system and structure on physical environment,  (2  leadership  on the effectiveness, (3 system and structure on physical environment as well as the effectiveness of organization, (4 physical en­vironment on the effectiveness of organization. In addition, system and structure show indirect effect on the effectiveness of organization through the physical environment. The research concludes that any change or variation in organizational effectiveness can be influenced by leadership, system and structure, and physical environment. Abstrak: Kepemimpinan, Sistem dan Struktur Organisasi, Lingkungan Fisik, dan Keefektifan Orga­nisasi. Penelitian ini bertujuan untuk mendeskripsikan pengaruh kepemimpinan, sistem dan struktur organi­sasi, dan lingkungan fisik terhadap keefektifan organisasi. Penelitian diselenggarakan di seratus sekolah di Jakarta, dengan menggunakan metode survei melalui pendekatan kausal dan analisis jalur. Sampel sebanyak 100 guru SMP Negeri Provinsi DKI Jakarta diambil dengan teknik penyampelan acak sederhana. Hasil penelitian menunjukkan bahwa terdapat pengaruh langsung dari (1 sistem dan struktur organisasi terhadap lingkungan fisik; (2 kepemimpinan kepala sekolah terhadap keefektifan organisasi; (3 sistem dan struktur terhadap lingkungan fisik juga terhadap keefektifan organisasi; (4 lingkungan fisik

  9. Intrication de deux atomes en utilisant le blocage de Rydberg

    Science.gov (United States)

    Gaëtan, A.

    2010-12-01

    Considérons un système quantique constitué de deux sous-systèmes : on dit qu'il est dans un état intriqué s'il existe des corrélations quantiques entre les états de ces derniers. La compréhension et la mise en œuvre d'états intriqués ont de nombreuses applications (métrologie quantique, étude des systèmes fortement corrélés, traitement quantique de l'information, etc.) et constituent le contexte général de ce travail de thèse. Plus en détail, nous démontrons la réalisation d'un état intriqué de deux atomes neutres piégés indépendamment. Pour cela, nous exploitons le phénomène de blocage de Rydberg : lorsqu'on essaie d'exciter simultanément deux atomes séparés de quelques micromètres vers un état de Rydberg donné, la forte interaction entre atomes de Rydberg peut empêcher cette excitation simultanée. Dans ce cas, seul un des deux atomes est excité et l'on génère ainsi des corrélations quantiques entre les états des deux atomes, c'est-à-dire de l'intrication. Dans notre expérience, deux atomes de 87Rb dans l'état fondamental 5S1/2 sont piégés chacun dans une pince optique microscopique, à une distance relative de 4 micromètres. En réalisant des transitions entre l'état 5S1/2 et l'état de Rydberg 58D3/2 par des transitions à deux photons, nous obtenons un état intriqué des deux atomes dans les sous-niveaux |5S1/2, f = 1, mf = 1> et |5S1/2, f = 2, mf = 2>. Afin de quantifier l'intrication, nous mesurons la fidélité par rapport à l'état-cible en réalisant des transitions Raman entre ces deux sous-niveaux. La fidélité des paires d'atomes présentes à la fin de l'expérience est supérieure à la valeur seuil de 0,5, ce qui prouve la création d'un état intriqué.

  10. PENINGKATAN MINAT DAN KEPUTUSAN BERPARTISIPASI AKSEPTOR KB

    Directory of Open Access Journals (Sweden)

    Ken Sudarti

    2011-09-01

    Full Text Available Tujuan dari studi ini adalah untuk menemukan dampak dari kualitas layanan dan konseling yang disediakan oleh PLKB dan persepsi pengguna kontrasepsi pada budaya lingkungan yang berkontribusi terhadap ketertarikan dan keputusan para pengguna alat kotrasepsi. Populasi penelitian ini adalah 98 wanita yang melakukan program keluarga berencana dalam jangka waktu lama dengan menggunakan sample convenience. Penelitian ini menunjukkan mayoritas pengguna kontrasepsi adalah usia rawan untuk melahirkan, memiliki lebih dari dua anak, dan relatif memiliki latar belakang pendidikan rendah. Kualitas layanan program konseling dan budaya lingkungan dalam program keluarga berencana mempunyai dampak positif terhadap ketertarikan dan keputusan untuk berpartisipasi terhadap program keluarga berencana. Kualitas layanan ditemukan sebagai kontribusi terbesar terhadap peningkatan ketertarikan dan partisipasi dalam program keluarga berencana.The aim of this study was to find out the effect of the service quality and counceling provided by the family planning field workers (PLKB and the perception of the contraception users on the environmental culture that contribute to the interest and decision of the contraception users.The population of this study was the contraception users in Demak District. The traditional statistical model of yamae was applied to recruit the 98 women who were long-term users of birth control within the government-sponsored family planning program using the convenience sampling method.The study showed that the majority of the contraception users were in the age at risk of giving birth , with more than two children and relatively had low education background. The service quality, councelling program and environmental culture had a possitive effect on the interest and the decision of participating in the family planning program . Service quality was found to give the biggest contribution for the improved interest and partisipation in the family

  11. An extremely dense group of massive galaxies at the centre of the protocluster at z = 3.09 in the SSA22 field

    CERN Document Server

    Kubo, M; Ichikawa, T; Kajisawa, M; Matsuda, Y; Tanaka, I; Umehata, H

    2015-01-01

    We report the discovery of an extremely dense group of massive galaxies at the centre of the protocluster at $z=3.09$ in the SSA22 field from near-infrared spectroscopy conducted with the Multi-Object InfraRed Camera and Spectrograph (MOIRCS) equipped on the Subaru Telecope. The newly discovered group comprises seven galaxies confirmed at $z_{\\rm spec}\\approx3.09$ within 180 kpc including five massive objects with the stellar masses larger than $10^{10.5}~M_{\\odot}$ and is associated with a bright sub-mm source SSA22-AzTEC14. The dynamical mass of the group estimated from the line-of-sight velocity dispersion of the members is $M_{\\rm dyn}\\sim1.6\\pm0.3\\times10^{13}~M_{\\odot}$. Such a dense group is expected to be very rare at high redshift as we found only a few comparable systems in large-volume cosmological simulations. Such rare groups in the simulations are hosted in collapsed halos with $M_{\\rm vir}=10^{13.4}-10^{14.0}~M_{\\odot}$ and evolve into the brightest cluster galaxies (BCGs) of the most massive c...

  12. The virtual observatory service TheoSSA: Establishing a database of synthetic stellar flux standards. II. NLTE spectral analysis of the OB-type subdwarf Feige 110

    CERN Document Server

    Rauch, T; Kampka, D; Werner, K; Kruk, J W; Moehler, S

    2014-01-01

    In the framework of the Virtual Observatory (VO), the German Astrophysical Virtual Observatory (GAVO) developed the registered service TheoSSA (Theoretical Stellar Spectra Access). It provides easy access to stellar spectral energy distributions (SEDs) and is intended to ingest SEDs calculated by any model-atmosphere code, generally for all effective temperature, surface gravities, and elemental compositions. We will establish a database of SEDs of flux standards that are easily accessible via TheoSSA's web interface. The OB-type subdwarf Feige 110 is a standard star for flux calibration. State-of-the-art non-local thermodynamic equilibrium (NLTE) stellar-atmosphere models that consider opacities of species up to trans-iron elements will be used to provide a reliable synthetic spectrum to compare with observations. In case of Feige 110, we demonstrate that the model reproduces not only its overall continuum shape from the far-ultraviolet (FUV) to the optical wavelength range but also the numerous metal lines ...

  13. Perawatan Kandidiasis Pseuodomembran Akut dan Mukositis Oral pada Penderita Kanker Nasofaring yang Menerima Khemoterapi dan Radioterapi

    Directory of Open Access Journals (Sweden)

    S. Supriatno

    2016-10-01

    Full Text Available Latar belakang: Terapi radiasi merupakan metode primer perawatan pasien kanker leher dan kepala. Perubahan funsional dan kerusakan jaringan oral menyebabkan timbulnya mukositia oral yang diikuti dengan kandidiasis oral. Tujuan: Melaporkan efek samping perawatan khemoterapi dan radioterapi pada pasien kanker nasofaring yang terjadi di rongga mulut berupa kandidiasis pseudomembran akut dan mukositis oral serta penatalaksanaannya. Kasus: Seorang laki-laki, 69 tahun, datang ke Bagian Gigi dan Mulut RSUP Dr. Sardjito, atas rujukan dari instalasi Penyakit Dalam., RSUP Dr. Sardjito, dengan keluhan sakit untuk menelan makanan dan mulutnya banyak bercak-bercak putih. Keluhan dirasakan satu minggu setelah dilakukan khemoterapi ke-3 dan radioterapi ke-9. Pasien didiagnosa kanker nasofaring (NPC dengan klasifikasi T2N3M0. Pemeriksaan klinik menunjukkan adanya lapisan putih pada mukosa lidah, pipi, palatum, dan mukosa bibir. Seluruh mukosa mulut berwarna merah tua dan terdapat anguler cheilitis di kedua sudut bibir. Pasien diklasifikasikan menderita mukositis oral derajat 1. Penatalaksanaan: Menghilangkan jaringan nekrotik dan debris dengan berkumur larutan perhidrol 3% dan pemberian medikasi termasuk tablet nistatin 500.000 IU, betadin kumur, dan larutan perhidrol 3% selama 1 minggu. Saat reevaluasi, pasien sudah dapat menelan dan makan yang sedikit keras tanpa ada rasa sakit lagi. Pemeriksaan klinis didapatkan bercak putih di lidah, palatum, pipi dan bibir sudah tidak ada. Warna mukosa oral telah normal, OHI dan kondisi umum baik dalam 1 minggu pasca perawatan. Kesimpulan: Perawatan kandidiasis dan mukositis oral akibat kemoradioterapi pada pasien kanker nasofaring telah berhasil dan kondisi oral membaik. Pasien dapat mengunyah dan menelan makanan tanpa ada rasa sakit, dan hasil pengobatan yang diberikan pada pasien sesuai dengan harapan operator.   Background: Radiation therapy remains the primary method of treatment for patients with head and neck

  14. Cross section measurements of the processes occurring in the fragmentation of H{sub n}{sup +} (3 {<=} n {<=} 35) hydrogen clusters induced by high speed (60 keV/u) collisions on helium atoms; Mesure des sections efficaces des differents processus intervenant dans la fragmentation d`agregats d`hydrogene H{sub n}{sup +} (3 {<=} n {<=} 35) induite par collision a haute vitesse (60 keV/u) sur un atome d`helium

    Energy Technology Data Exchange (ETDEWEB)

    Louc, Sandrine [Inst. de Physique Nucleaire, Lyon-1 Univ., 69 - Villeurbanne (France)

    1997-09-15

    Different processes involved in the fragmentation of ionised hydrogen clusters H{sub 3} + (H{sub 2}){sub (n-3)/2} (n = 5-35) have been studied in the same experiment: the fragmentation of the cluster is induced by the collision with an helium atom at high velocity ({approx_equal} c/100). The collision is realised in reversed kinematic - clusters are accelerated - which allows the detection of neutral and charged fragments. The different channels of fragmentation are identified by using coincidence techniques. For all the cluster sizes studied the capture cross sections of one electron of the target by the cluster is equal to the capture cross section of the H{sub 3}{sup +} ion. In the same way, the dissociation cross section of the H{sub 3}{sup +} core of the cluster does not depend on cluster size. These fragmentation processes are due to the interaction of H{sub 3}{sup +} core of the cluster and the helium atom without ionization of another component of the cluster. On the contrary, the cross sections of loss of one, two and three molecules by the cluster and the dissociation cross section of the cluster in all its molecular components depends strongly on the cluster size. This dependence is different from the one measured for the metastable decay of the cluster. Thus, the process of loss of molecules induced by a collision should correspond to a different dissociation mechanism. In regard of the singularities observed for the size dependence, the H{sub 9}{sup +}, H{sub 15}{sup +}, H{sub 19}{sup +} and H{sub 29}{sup +} clusters could be the `core` of the biggest clusters. These observation are in agreement with the size effects of smaller magnitude observed for the dissociation cross section (all the processes). The values of the cross section for the process of at least one ionization of the cluster indicate that about 80% of the fragmentation events result from this process. (author) 114 refs., 74 figs., 9 tabs.

  15. PEMBELAJARAN KETERAMPILAN BERBICARA MODEL KOOPERATIF TEKNIK MENCARI PASANGAN DAN TEKNIK KANCING GEMERINCING PADA SISWA INTROVER DAN EKSTROVER DI SMP

    Directory of Open Access Journals (Sweden)

    Sri Sunarsih

    2012-06-01

    Full Text Available Unit Penelitian dan Pengabdian pada Masyarakat merupakan salah satu unit di Universitas Respati Yogyakarta yang bertugas untuk mengelola kegiatan penelitian dan pengabdian kepada masyarakat yang dilakukan oleh dosen. Dalam proses pengolahan data kegiatan kegiatan penelitian dan pengabdian kepada masyarakat masih mengalami beberapa permasalahan yaitu belum adanya basis data yang digunakan untuk pengumpulan data rekam jejak kegiatan penelitian dan pengabdian kepada masyarakat oleh dosen dan sistem pengarsipan dokumen masih berbentuk kertas yang berdampak pada kerusakan dokumen, hilangnya dokumen, efisiensi ruang dan pencarian data. Penelitian yang dilakukan bertujuan menghasilkan luaran sistem informasi yang dapat melakukan proses pengolahan data penelitian dan kegiatan pengabdian kepada masyarakat yang dikelola oleh Unit Penelitian dan Pengabdian pada Masyarakat di Universitas Respati Yogyakarta. Pengolahan data mengacu pada komponen beban kerja dosen dibidang penelitian dan pengabdian kepada masyarakat. Metode pengembangan dilakukan dengan tahapan analisa sistem, perancangan sistem, coding dan implementasi sistem. Hasil pengembangan sistem informasi penelitian dan pengabdian masyarakat yaitu sebuah sistem yang dapat membantu Unit Penelitian dan Pengabdian pada Masyarakat dalam proses pengolahan data rekam jejak kegiatan penelitian dan kegiatan pengabdian kepada masyarakat yang dilakukan dosen.

  16. PENGARUH METODE PENGERINGAN DAN KONSENTRASI BUMBU SERTA LAMA PERENDAMAN DALAM LARUTAN BUMBU TERHADAP KUALITAS FISIK DAN SENSORI DENDENG BABI

    Directory of Open Access Journals (Sweden)

    Marcus Veerman

    2013-06-01

    Full Text Available Penelitian ini bertujuan untuk mengetahui pengaruh metode pengeringan dan konsentrasi bumbu serta lama perendaman terhadap pH dan sensori dendeng daging babi. Irisan daging direndam dalam larutan bumbu dengan konsentrasi 40, 20, 13,3, dan 10%. Lamanya perendaman adalah 1, 3, 5, dan 7 jam, kemudian dilakukan pengeringan dengan sinar matahari dan oven. Parameter yang diamati meliputi pH dan parameter sensori. Data pH dianalisis dengan analisis variansi Rancangan Acak Lengkap pola faktorial 2×4×4 dengan tiga kali ulangan, dan dilanjutkan dengan uji jarak berganda Duncan. Data uji sensori dianalisis dengan analisis non parametrik  menggunakan uji Hedonik menurut Kruskal-Wallis, dilanjutkan  analisis deskriptif kuantitatif (jaring labalaba pada program MS Excel. Metode pengeringan dan konsentrasi bumbu serta lama perendaman, dan interaksi ketiga perlakuan berpengaruh sangat nyata (P<0,01 terhadap pH dendeng daging babi. Berdasarkan diagram jaring laba-laba, uji sensori meliputi parameter warna menunjukkan coklat sampai coklat keemasan, rasa menunjukkan agar suka sampai sangat suka dan daya terima menunjukkan agak suka sampai sangat suka. Metode pengeringan matahari menghasilkan tekstur kasar sampai agak kasar dan keempukan menunjukkan keras sampai agak keras. Metode pengeringan oven menunjukkan parameter warna agak coklat sampai coklat keemasan dan rasa agak suka sampai sangat suka, sedangkan daya terima tidak suka sampai agak suka, tekstur kasar sampai agak kasar dan keempukan keras sampai agak keras. (Kata kunci: Dendeng babi, Kualitas pH, Uji sensori, Metode pengeringan, Konsentrasi bumbu

  17. UJI AKTIVITAS ANTIBAKTERI EKSTRAK RUMPUT LAUT Kappaphycus alvarezii DAN Eucheuma denticullatum TERHADAP BAKTERI Aeromonas hydrophila DAN Vibrio harveyii

    Directory of Open Access Journals (Sweden)

    Dwi Budi Wiyanto

    2010-04-01

    Full Text Available Penelitian tentang Uji Aktivitas Antibakteri Ekstrak Rumput Laut Kappaphycus alvarezii dan Eucheuma denticullatum Terhadap Bakteri Aeromonas hydrophila dan Vibrio harveyii dilakukan, mengingat banyak dijumpai  penyakit pada usaha budidaya ikan dan udang, terutama bakteri Aeromonas hydrophila dan Vibrio harveyii. Penelitian ini bertujuan untuk mengetahui efektifitas senyawa bioaktif rumput laut K. alvarezii dan E. denticullatum yang diekstrak menggunakan pelarut metanol dan etanol sebagai antibakteri terhadap A. hydrophila dan V. harveyii.  Penelitian dilakukan sebanyak dua tahap, yaitu: (1 Uji aktivitas antibakteri ekstrak rumput laut; dan (2 Analisa senyawa bioaktif yang terdapat pada ekstrak rumput laut, dimana masing-masing tahapan dianalisis menggunakan rancangan acak lengkap faktorial. Hasil penelitian menunjukkan, dua jenis ekstrak rumput laut dengan pelarut metanol dan etanol, mempunyai daya antibakteri terhadap A. hydrophila dan V. harveyii. Ekstrak E. denticullatum dengan pelarut metanol memiliki daya hambat lebih luas dibanding ekstrak K. alvarezii dengan pelarut metanol terhadap A. hydrophila (19.43±0,55 mm. Ekstrak E. denticullatum dengan pelarut metanol memiliki daya hambat lebih luas dibanding ekastrak K. alvarezii dengan pelarut metanol terhadap V. harveyii (19.85±0,23 mm. Asam heksadekanoat merupakan senyawa paling dominan dijumpai pada ekstrak rumput laut K. alvarezii, dan E. denticullatum yang diekstrak menggunakan pelarut metanol. Kata Kunci : Aktivitas Antibakteri, Rumput laut K. alvarezii dan E. denticullatum,  Bakteri A.  hydrophila dan V. harveyii. 

  18. STUDI TEORITIS ISO 9000 DAN TQM: SUBSTITUSI ATAU KOMPLEMETER?

    Directory of Open Access Journals (Sweden)

    Harianto Respati

    2007-09-01

    Full Text Available Banyak pertentangan pendapat tentang dampak ISO 9000 dan TQM dalam kaitannya dengan tujuannya yakni kepuasan pelanggan. Selain itu peran ISO 9000 dan TQM dipandang masih membingungkan. Penjelasan pada jurnal ini, diuraikan secara konseptual baik dari pernyataan para pakar maupun hasil-hasil penelitian terdahulu tentang peran ISO 9000 dan TQM. Hasil menujukkan bahwa secara umum ISO 9000 dan TQM mempunyai tujuan yang sama yakni kepuasan pelanggan. Peran implementasi sertifikasi ISO 9000 dan praktek TQM adalah komplementer artinya ISO 9000 dan TQM merupakan sistem yang terpadu serta bekerja sama untuk mencapai sasaran yakni kepuasan pelanggan. Kajian teoritis tentang peran ISO 9000 dan TQM bertujuan untuk mempertegas keberadaan ISO 9000 dan TQM untuk kepentingan para peneliti, akademik maupun para praktisi

  19. Dans le tourbillon des particules

    CERN Document Server

    Zito, Marco

    2015-01-01

    Accélérateurs géants, détecteurs complexes, particules énigmatiques... La physique subatomique peut sembler bien intimidante pour le novice. Et pourtant, qui n a jamais entendu parler du boson de Higgs et du CERN, le laboratoire européen où il a été découvert en 2012 ? Nul besoin d être un spécialiste pour comprendre de quoi il s agit. Aujourd hui, une théorie extraordinairement élégante, le Modèle Standard, décrit tous les résultats des expériences dans le domaine. Trente-sept particules élémentaires et quatre forces fondamentales : c est tout ce dont nous avons besoin pour expliquer la matière et l Univers ! Ce livre, destiné à un large public, raconte sans équations le long parcours qui a abouti au Modèle Standard. Ce parcours, parfois sinueux, a été entamé lorsque les Grecs anciens, et peut-être d autres avant eux, ont imaginé que la matière est composée de petites « billes ». Il faudra attendre plusieurs siècles pour qu on réalise que la matière, à l échelle micros...

  20. KORELASI ANTARA BIMBINGAN KONSELING ISLAM DAN DAKWAH

    Directory of Open Access Journals (Sweden)

    Marzuki Agung Prasetya

    2015-11-01

    Full Text Available Dakwah merupakan kegiatan untuk menyeru, memanggil dan mengajak orang lain menuju jalan yang diridhai Allah. Bimbingan dan Konseling Islam merupakan cabang dalam rumpun ilmu-ilmu sosial yang mulai dikembangkan sebagai disiplin ilmu yang mandiri. Keberadaan aktifitas bimbingan dan konseling Islam tersebut didasarkan pada kenyataan bahwa dalam menghadapi dan menyelesaikan masalah, ada individu yang mampu menyelesaikan sendiri, namun ada juga yang membutuhkan bantuan pihak lain. Dalam prakteknya bimbingan konseling akan mengacu pada beberapa pendekatan, diantaranya: pendekatan behavioristik, psikodinamika, eklektik, psikoanalisa dan eksistensial humanistik. Pendekatan tersebut dipilih berdasarkan kondisi klien, masalah yang dihadapi, kemampuan konselor selaku pihak yang memberikan bimbingan maupun kondisi dan situasi pada saat bimbingan konseling berlangsung. Menurut Hamdan Bakran ad-Dzaky, bimbingan konseling Islam merupakan suatu aktifitas memberikan bimbingan, pelajaran,dan pedoman kepada individu yang meminta bimbingan (klien dalam hal bagaimana seharusnya dirinya dapat mengembangkan akal dan pikirannya, jiwanya, keimanannya dan keyakinannya, serta dapat menanggulangi problematika hidup dengan baik dan benar sacara mandiri, yang berparadigma kepada Al-Quran dan as-Sunnah Rasulullah saw. Proses pelaksanaan bimbingan konseling Islam mengacu pada prinsip- prinsip etika berdakwah dalam Islam, yakni bi al-hikmah, al-mauidhah hasanah, dan al-mujadalah bi al-lati hiya ahsan. Tulisan ini melihat relasi antara bimbingan konseling Islam dan dakwah, sehingga dapat diketahui bagaimana hubungan yang terjalin antara keduanya. Kata Kunci: Dakwah, Bimbingan, Konseling Islam. THE CORRELATION BETWEEN ISLAMIC COUNSELING GUIDANCE AND DAWA. Dawa is an activity to call and invite others towards the path of Allah. Islamic Guidance and Counselling is a branch of social sciences which began to be developed as an independent discipline. The existence of the Islamic

  1. KANDUNGAN LEMAK KASAR, SERAT KASAR DAN BETN PAKAN BERBAHAN JERAMI PADI, DAUN GAMAL DAN UREA MINERAL MOLASES LIQUID DENGAN PERLAKUAN BERBEDA

    OpenAIRE

    GAZALI, MUH.

    2014-01-01

    2014 Muh. Gazali (I 211 08 262). Kandungan Lemak Kasar, Serat Kasar dan BETN Pakan Berbahan Jerami padi, Daun gamal dan Urea Mineral Molases Liquid dengan Perlakuan Berbeda. Dibawah bimbingan Sjamsuddin Rasjidsebagai Pembimbing Utama dan Rohmiatul Islamiyatisebagai Pembimbing Anggota Penelitian ini bertujuan untuk mengetahui seberapa besar kandungan lemak kasar, serat kasar dan betn pakan berbahan jerami padi, daun gamal dan urea ...

  2. Frequency shift due to blackbody radiation in a cesium atomic fountain and improvement of the clock performances; Deplacement de frequence du au rayonnement du corps noir dans une fontaine atomique a cesium et amelioration des performances de l'horloge

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, S

    2004-07-01

    FO1 was the first caesium fountain primary frequency standard in the world. The most recent evaluation in 2002 before improvement reached an accuracy of 1*10{sup -15} when operated with optical molasses. Working as an extremely precise and stable instrument, FO1 has contributed to fundamental physics and technical measurements: - Frequency comparison between Cs and Rb fountains over an interval of 5 years sets an upper limit for a possible variation of the fine structure constant as |alpha/alpha| < 2*10{sup -15}/y. The resolution is about 5 times better than the previous test in our laboratory. The projected accuracy of the space clock PHARAO is 1*10{sup -16}. We confirmed its Ramsey cavity performance by testing the phase difference between the two interaction zones in FO1. The measured temperature T dependent frequency shift of the Cs clock induced by the blackbody radiation field is given as nu(T)=154(6)*10{sup -6}*(T/300){sup 4}[1+{epsilon}(T/300){sup 2}] Hz with the theoretical value {epsilon} = 0,014. The obtained accuracy represents a 3 times improvement over the previous measurement by the PTB group. Some improvements have been carried out on FO1. The new FO1 version works directly with optical molasses loaded by a laser slowed atomic beam. The application of the adiabatic passage method to perform the state selection allows us to determine the atom number dependent frequency shifts due to the cold collision and cavity pulling effects at a level of of 10{sup -16}. Recently, the obtained frequency stability is 2,8*10{sup -14}*{tau}{sup -1/2} for about 4*10{sup 6} detected atoms. The accuracy is currently under evaluation, the expected value is a few times 10{sup -16}. (author)

  3. PENGARUH PENGELUARAN PEMERINTAH TERHADAP PDRB DAN PAD

    Directory of Open Access Journals (Sweden)

    Harry A. P. Sitaniapessy

    2013-04-01

    Full Text Available Abstrak: Pengaruh Pengeluaran Pemerintah Terhadap PDRB dan PAD. Penelitian ini bertujuan untuk menentukan  pengaruh pengeluaran pemerintah terhadap Produk Domestik Regional Bruto dan Pendapatan Asli Daerah Kabupaten Maluku Tengah periode 2005-2011. Penelitian ini lebih difokuskan pada tiga sektor utama yaitu sektor pengeluaran pemerintah yaitu sektor pertanian, perikanan serta perindustrian dan perdagangan karena ketiga sektor tersebut memiliki pengeluaran yang lebih besar dibanding sektor – sektor lain. Untuk menganalisis data, penelitian ini menggunakan analisis regresi sederhana dan regresi berganda. Pengujian dilakukan dengan menggunakan regresi berganda dan regresi sederhana untuk empat hipotesis yang diujikan. Hasil penelitian menunjukkan bahwa keempat hipotesis yang diajukan dalam penelitian ini terdukung.   Kata Kunci:    Pengeluaran Pemerintah, Produk Domestik Regional Bruto, Pendapatan Asli Daerah.   Abstract: Government Expenditure Influence on Gross Regional Domestic Product and Regional Income. This study aims to determine the impact of government expenditure towards GRDP and PAD of Kabupaten Maluku Tengah in period 2003-2011. This study are focused to three majors of government expenditure ;  agriculture,  fishery, industry and commerce, because they have larger expenditure than the others. The analysis of the data were conducted using simple regression analysis and multiple regression. Testing was done using multiple regression and simple regression for the four hypotheses tested. The result shows that the four hypotheses proposed in this study is supported.   Keywords:    government expenditure, gross regional domestic product, regional income

  4. LEMAK TUBUH DAN KESEGARAN JASMANI PEKERJA INDONESIA

    Directory of Open Access Journals (Sweden)

    Y. Krisdinamurtirin

    2012-11-01

    Full Text Available Penelitian mengenai Lemak Tubuh dan Kesegaran Jasmani telah dilakukan terhadap 62 orang karyawan gemuk, 73 orang karyawan sedang dan 86 orang karyawan kurus. Mereka terdiri atas kelompok Gemuk Aktif (GPA: 33 orang; Gemuk Sendentary (GPSD: 29 orang; Sedang Aktif (SPA: 33 orang; Sedang Sendentary (SPSD: 40 orang; Kurus Aktif (KPA: 35 orang; Kurus Sendentary (KPSD: 51 orang. Umur mereka adalah antara 20 tahun dan 40 tahun. Uji Kesegaran jasmani menggunakan cara Harvard Step Test (HST menunjukkan bahwa skor list kelompok Gemuk cenderung kurang bila dibandingkan dengan kelompok Sedang maupun Kurus. Uji kemaknaan perbedaan secara statistik menggunakan Student test, ternyata perbedaan terdapat pada tingkat Kegemukan, sedangkan pada tingkat jenis kegiatan (aktif/sendentary tidak menunjukkan perbedaan skor. Demikian pula clengan menggunakan Analisis Variance, menunjukkan bahwu ada kailan antaru Kegemuknn dengan skor HST (P:0,002, sedangkan antara jenis kegiatan dengan skor HST tidak ada kaitan (P:0,9049. Garis regresi memberikan gambaran bahwa makin tinggi presentase lemak tubuh, tingkat kesegaran jasmani yang dinyatakan dalam skor HST makin menurun. Garis regresi antara% 88/TB dengan kesegaran jasmani, memberikan gambaran pula ada kecenderungan bahwa pada % 88/TB 100%, kesegaran jasmani menurun. Sedangkan regresi antara kesegaran jasmani dengan tinggi duduk tidak menunjukkan kaitan yang jelas. Tetapi antara urnur dan kesegaran jasmani, menunjukkan ada kecenderungan makin tinggi urnur, kesegaran jasmani menurun. Kesimpulan dari penelitlan inl ialah bahwa ada kaitan antara kesegaran jasmani yang dinyatakan dalam skor Uji HST dengan (a kegemukan dan (b umur.

  5. Dialektika Rasio dan Moral: Refleksi Kritis Terhadap Perkembangan Ilmu Pengetahuan

    Directory of Open Access Journals (Sweden)

    Irwandra Irwandra

    2010-11-01

    Full Text Available Rasio, sebagai sebuah kekuatan dan alat bagi perkembangan ilmu pengetahuan telah menghadirkan wajah-wajah yang “menawan” bagi kehidupan saat ini. Namun dibalik itu, tersimpan luka yang semakin kronis yang dapat menular dan menggerogoti sendi-sendi kemanusiaan dan keber-ada-an kita sebagai makhluk yang unik dan memiliki keunggulan dari makhluk lainnya. Moral-spiritual, itulah yang menjadi pertaruhan kita saat ini di tengah menguatnya bangunan ilmu yang dipandu oleh nahkoda rasionalitas.

  6. MODEL TES DAN ANALISIS PRESTASI BELAJAR MATEMATIK SISWA SEKOLAH DASAR

    OpenAIRE

    Zamsir Zamsir

    2013-01-01

    Penelitian ini bertujuan untuk menemukan model tes dan analisis prestasi belajar siswa yang dapat dipakai untuk melakukan identifikasi level kemampuan dan menyusun profil pencapaian kompetensi siswa, khususnya di sekolah dasar. Penelitian ini merupakan penelitian pengembangan model yang dikembangkan menyangkut dua hal, yaitu: (1) prosedur dan langkah-langkah penyusunan tes serta teknik identifikasi level kemampuan siswa, dan (2) pelaporan hasil tes. Identifikasi dilakukan dengan cara menempat...

  7. PENGETAHUAN TENTANG STRATEGI PEMBELAJARAN, SIKAP, DAN MOTIVASI GURU

    Directory of Open Access Journals (Sweden)

    Dadan Suryana

    2014-06-01

    Abstrak: Pengetahuan tentang Strategi Pembelajaran, Sikap dan Motivasi Guru. Penelitian ini ber­tujuan untuk mendeskripsikan pengaruh pengetahuan tentang strategi pembelajaran, sikap dan motivasi guru terhadap hasil belajar anak melalui metode survai. Sampel penelitian adalah 25 orang guru Taman Kanak-kanak di Kecamatan Koto Tangah, Kota Padang. Data dikumpulkan dengan cara wawancara dan penyebaran angket serta dukungan dokumentasi. Hasil penelitian menunjukkan bahwa pengetahuan tentang strategi pembelajaran, sikap dan motivasi guru berpengaruh langsung terhadap hasil belajar anak.

  8. Analisis Kelelahan dan Hubungannya dengan Umur Material Pada Camshaft

    OpenAIRE

    Kurnia Brahmana

    2006-01-01

    Tekanan yang berubah-ubah secara berulang-ulang selama selang waktu tertentu pada bahan akan mengakibatkan kegagalan akibat kelelahan, selanjutnya penyebaran keretakan dan keretakan yang semakin melebar dan sehingga mengakibatkan patah. Umur lelah dari suatu bahan dipengaruhi oleh tingkat amplitudo dari beban yang diberikan kepada bahan tersebut, dan pada umumnya kelelahan pada benjolan camshaft terjadi mulai pada 50 juta getaran. Analisis kelelahan akibat stress, strain, dan gaya memberikan ...

  9. Presenting the Bohr Atom.

    Science.gov (United States)

    Haendler, Blanca L.

    1982-01-01

    Discusses the importance of teaching the Bohr atom at both freshman and advanced levels. Focuses on the development of Bohr's ideas, derivation of the energies of the stationary states, and the Bohr atom in the chemistry curriculum. (SK)

  10. PERGESERAN KARIR TRADISIONAL MENJADI KARIR PROTEAN: DAMPAK DAN IMPLIKASINYA PADA INDIVIDU DAN PERUSAHAAN

    Directory of Open Access Journals (Sweden)

    Christofera Marliana Junaedi

    2003-01-01

    Full Text Available It was started by The Great Depression in America that so many changes happened on the organization internally and externally, and the change of career development from career job to protean career as well. Some researchers prove it and state that the job esspecially for career nowadays is different from it was few decades ago. The effect of this changes occur on the system and value that employees have and career development management conducted by the company. This article will discuss the change factor of company internally and externally, its effects,the subtitution of the new paradigm from the old one, and also its implications on the individu and the company. Abstract in Bahasa Indonesia : Berawal dari terjadinya depresi yang besar (The Great Depression di Amerika yang menyebabkan perubahan organisasi secara internal dan eksternal, perubahan pengembangan karir pun bergeser dari karir tradisional menjadi karir protean. Banyak peneliti yang membuktikannya dan menyatakan bahwa karir saat ini berbeda dengan beberapa decade sebelumnya. Dampak dari perubahan ini tentu saja menimbulkan sistem dan nilai yang dimiliki karyawan dan juga manajemen pengembangan karir perusahaan. Artikel ini akan membahas tentang perubahan factor internal dan eksternal organisasi, dampaknya pada perubahan paradigma dari paradigma lama menjadi baru, dan juga implikasinya pada individu dan perusahaan. Kata kunci: karir tradisional, karir protean, paradigma lama, paradigma baru, manajemen karir.

  11. PROFIL PEMIJAHAN DAN PERKEMBANGAN MORFOLOGI LARVA DAN YUWANA IKAN CLOWN HITAM (Amphiprion percula

    Directory of Open Access Journals (Sweden)

    Daniar Kusumawati

    2016-11-01

    Full Text Available Amphiprion percula (ikan clown hitam atau clown Biak merupakan salah satu spesies ikan hias laut yang umumnya ditangkap untuk tujuan komersial. Di samping itu, indikasi menurunnya jumlah ikan clown hitam disebabkan oleh kematian secara alami di alam sebesar 75% akibat tingkat agresivitas ikan clown hitam dalam mempertahankan wilayahnya. Tujuan penelitian ini adalah untuk mengetahui profil pemijahan dan perkembangan morfologi larva dan yuwana ikan clown hitam. 10 pasang koleksi induk diperoleh dari Biak. Pengamatan dilakukan selama 1 tahun yang meliputi pengamatan reproduksi biologis dan aspek morfologi dan perkembangan larva dan yuwana ikan clown hitam. Berdasarkan pengamatan diketahui bahwa 70% dari populasi induk ikan clown hitam telah berhasil bertelur dengan periode pemijahan 9-30 hari. Jumlah produksi telur yang diperoleh 25 hingga 2.244 butir. Jumlah telur dengan bobot induk betina berkorelasi positif. Masa inkubasi telur terjadi selama 6 hingga 7 hari. Sesaat setelah menetas, larva (D0 dapat mengkonsumsi rotifer. Artemia dan pakan pelet yang diberikan mulai dari D6 dan D17. Periode perkembangan larva sangat singkat yaitu 17 hari. Selama pengamatan ikan clown hitam menunjukkan pertumbuhan yang relatif lambat

  12. Pengaruh Variasi Kadar Zn Dan Temperatur Hydrotermal Terhadap Struktur Dan Nilai Konduktivitas Elektrik Material Graphene

    Directory of Open Access Journals (Sweden)

    Lita Nur Azizah

    2014-09-01

    Full Text Available Graphene adalah bentuk 2D dari karbon dengan sifat-sifat unggul yang menarik untuk dikembangkan. Permasalahan yang kemudian muncul adalah proses sintesis massal yang masih menjadi kendala. Penelitian ini bertujuan untuk mensintesis material graphene secara kimiawi dengan menggunakan reduktor zinc dan metode hydrothermal dan menganalisa pengaruh varaiasi penambahan massa sebesar 0,8 gram, 1,6 gram, dan 2,4 gram zinc serta variasi temperatur hydrthermal 160ᵒC, 180ᵒC, 200ᵒC. Proses karakterisasi material graphene dilakukan dengan pengujian Scanning Electron Microscope (SEM, X-Ray Diffraction (XRD, Fourier Transform Infrared spectroscopy, Uji Iodine number, dan Four Point Probe digunakan untuk mengetahui nilai konduktivitas elektrik material. Morfologi dari graphene yang dihasilkan berbentuk lembaran-lembaran transparan dan disertai dengan kerutan pada permukaannya. Nilai konduktivitas elektrik terbesar dihasilkan dari variasi panambahan serbuk zinc sebesar 0,8 gram dan temperatur hydrothermal sebesar 200ᵒC dengan nilai sebesar 0,10281 S/cm dan bilangan iodine 11384,64.

  13. EFEKTIVITAS MODEL BLENDED LEARNING TERHADAP MOTIVASI DAN TINGKAT PEMAHAMAN MAHASISWA MATA KULIAH ALGORITMA DAN PEMROGRAMAN

    Directory of Open Access Journals (Sweden)

    Sarah Bibi

    2015-02-01

    Full Text Available Penelitian ini bertujuan untuk (1 mengetahui perbedaan motivasi dan tingkat pemahaman mahasiswa antara pembelajaran model blended learning dengan pembelajaran konvensional, dan (2 mengetahui peningkatan motivasi dan tingkat pemahaman mahasiswa akibat penerapan pembelajaran model blended learning. Jenis penelitian ini adalah quasi experimental. Populasi penelitian adalah mahasiswa semester 2 tahun ajaran 2013/2014 Program Studi Pendidikan Teknologi Informasi dan Komputer STKIP PGRI Pontianak yang berjumlah sebanyak 270 mahasiswa. Penentuan sampel menggunakan teknik purposive sampling berjumlah 156 mahasiswa. Pengumpulan data menggunakan tes soal berbentuk pilihan ganda dan angket, teknik analisis data yang digunakan adalah statistik parametrik uji-t dengan taraf signifikansi 0,05. Hasil penelitian ini menunjukkan bahwa (1 terdapat perbedaan motivasi belajar mahasiswa antara pembelajaran model blended learning dengan pembelajaran konvensional sebesar 5,782 dan terdapat perbedaan tingkat pemahaman sebesar 9,935 serta (2 ada peningkatan motivasi belajar mahasiswa akibat penerapan pembelajaran model blended learning rata-rata peningkatan 11,705 dan ada peningkatan pemahaman mahasiswa rata-rata peningkatan 30,288.

  14. Atomic Storage States

    Institute of Scientific and Technical Information of China (English)

    汪凯戈; 朱诗尧

    2002-01-01

    We present a complete description of atomic storage states which may appear in the electromagnetically induced transparency (EIT). The result shows that the spatial coherence has been included in the atomic collective operators and the atomic storage states. In some limits, a set of multimode atomic storage states has been established in correspondence with the multimode Fock states of the electromagnetic field. This gives a better understanding of the fact that, in BIT, the optical coherent information can be preserved and recovered.

  15. Atoms Talking to SQUIDs

    CERN Document Server

    Hoffman, J E; Kim, Z; Wood, A K; Anderson, J R; Dragt, A J; Hafezi, M; Lobb, C J; Orozco, L A; Rolston, S L; Taylor, J M; Vlahacos, C P; Wellstood, F C

    2011-01-01

    We present a scheme to couple trapped $^{87}$Rb atoms to a superconducting flux qubit through a magnetic dipole transition. We plan to trap atoms on the evanescent wave outside an ultrathin fiber to bring the atoms to less than 10 $\\mu$m above the surface of the superconductor. This hybrid setup lends itself to probing sources of decoherence in superconducting qubits. Our current plan has the intermediate goal of coupling the atoms to a superconducting LC resonator.

  16. Single Atom Plasmonic Switch

    OpenAIRE

    Emboras, Alexandros; Niegemann, Jens; Ma, Ping; Haffner, Christian; Luisier, Mathieu; Hafner, Christian; Schimmel, Thomas; Leuthold, Juerg

    2015-01-01

    The atom sets an ultimate scaling limit to Moores law in the electronics industry. And while electronics research already explores atomic scales devices, photonics research still deals with devices at the micrometer scale. Here we demonstrate that photonic scaling-similar to electronics-is only limited by the atom. More precisely, we introduce an electrically controlled single atom plasmonic switch. The switch allows for fast and reproducible switching by means of the relocation of an individ...

  17. Atomic Scale Plasmonic Switch

    OpenAIRE

    Emboras, A.; Niegemann, J.; Ma, P.; Haffner, C; Pedersen, A.; Luisier, M.; Hafner, C.; Schimmel, T.; Leuthold, J.

    2016-01-01

    The atom sets an ultimate scaling limit to Moore’s law in the electronics industry. While electronics research already explores atomic scales devices, photonics research still deals with devices at the micrometer scale. Here we demonstrate that photonic scaling, similar to electronics, is only limited by the atom. More precisely, we introduce an electrically controlled plasmonic switch operating at the atomic scale. The switch allows for fast and reproducible switching by means of the relocat...

  18. Kapasitas Jerap Niosom Terhadap Ketoprofen dan Perdiksi Penggunaan Transdermal

    OpenAIRE

    Rahman, Latifah; Ismail, Isriani; Wahyudin, Elly

    2013-01-01

    Niosom adalah system vesikel yang dapat digunakan sebagai pembawa obat lipofilik, hidrofilik dan ampifilik. Ketoprofen adalah salah satu golongan AINS yang sangat sukar larut dalam air dan dapat menyebabkan iritasi lambung pada penggunaan oral. System penghantaran obat secara transdermal sangat penting dikembangkan untuk ketoprofen. Penelitian ini bertujuan untuk memformulasi niosom yang dapat menjerap ketoprofen secara optimal dan dapat menghantarkan ketoprofen melalui rute pemberian transde...

  19. Demam Rematik Dan Penyakit Jantung Rematik Permasalahan Indonesia

    OpenAIRE

    Siregar, Abdullah Afif

    2008-01-01

    Demam rematik dan penyakit jantung rematik telah lama dikenal. Demam rematik (DR) dan atau Penyakit jantung rematik (PJR) eksaserbasi akut adalah suatu sindroma klinik penyakit akibat infeksi kuman Streptokokus ? hemolitik grup A pada tenggorokan yang terjadi secara akut ataupun berulang dengan satu atau lebih gejala mayor yaitu poliartritis migrans akut, karditis, korea, nodul subkutan dan eritema marginatum. 08E00203

  20. PENGARUH RISIKO DAN HARGA TERHADAP KEPUTUSAN PEMBELIAN MELALUI KEPERCAYAAN KONSUMEN

    OpenAIRE

    Murwatiningsih -; Erin Puri Apriliani

    2013-01-01

    Penelitian ini bertujuan untuk mengetahui pengaruh langsung dan tidak langsung risiko dan harga terhadap keputusan pembelian online melalui kepercayaan, serta pengaruh kepercayaan terhadap keputusan pembelian online. Populasi dalam penelitian ini berjumlah 291 konsumen. Teknik pengambilan sampel yang digunakan adalah random sampling Jumlah sampel sebanyak 74 responden diperoleh menggunakan rumus Slovin. Metode pengumpulan data yaitu kuesioner dan dokumentasi. Metode analisis data yang digunak...

  1. PENGARUH KOMITMEN ORGANISASI DAN GAYA KEPEMIMPINAN TERHADAP INDEPENDENSI AUDITOR INTERNAL

    OpenAIRE

    INAYAH, FARAH NURUL

    2015-01-01

    2015 Penelitian ini bertujuan untuk mengetahui pengaruh komitmen organisasi, terhadap independensi internal auditor dan gaya kepemimpinan terhadap independensi auditor internal, serta pengaruh komitmen organisasi dan gaya kepemimpinan berpengaruh secara simultan terhadap independensi internal auditor. Metode penelitian yang digunakan adalah metode analisis regresi linear berganda dan untuk analisis data menggunakan analisis statistik. Data ini diperoleh dari hasil kuisi...

  2. ANALISIS KANDUNGAN UNSUR ESENSIAL DAN TOKSIK DALAM TEH DAN AIR SEDUHANNYA DENGAN AKTIVASI NEUTRON

    Directory of Open Access Journals (Sweden)

    Th. Rina Mulyaningsih

    2015-04-01

    Full Text Available Kadar unsur logam K, Ca, Mn, Mg, Fe, Na, Zn, Rb, Br, Cr, Cs, La,Sc dan Co dalam 14 sampel teh hijau, teh hitam, teh hitam dengan aroma melati, aroma vanila, bunga rosella dan air seduhan teh telah ditentukan dengan analisis aktivasi neutron. Sampel teh dipilih dari produksi dalam negeri dan diperoleh dari Pasar Swalayan di daerah Serpong. Iradiasi neutron sampel dilakukan di Fasilitas Iradiasi reaktor RSG-GAS pada fluks neutron thermal sekitar sekitar 1013 ncm-2s-1. Prosedur kerja menggunakan SOP yang dikeluarkan oleh FNCA. Sebagai kontrol mutu digunakan SRM-NIST 1573a Tomato leaves dan NIST 1547 Peach leaves. Hasil analisis menunjukkan bahwa konsentrasi semua unsur bervariasi tergantung jenis teh. Konsentrasi Ca, K, Mg dan Mn dalam teh cukup tinggi > 100 mg/kg . Konsentrasi Ca dan K memiliki rentang nilai antara 1135,36-9123,21 dan 1064,41-2473,12 mg/kg serta Mg 2725,6-5528,5; dan Mn 95,38-815,48 mg/kg. Unsur mikroesensial Na, Fe, Co, La, Cr, Br, Sc, Cs, Rb dan Zn memiliki konsentrasi 100 mg/kg. Concentration of Ca and K have values in a range of 1135.36-9123.21 and 1064.41-2473.12 mg/kg as well as Mg of 2725.6-5528.5; and Mn of 95.38-815.48 mg/kg.Concentration of Na, Fe, Co, La, Cr, Br, Sc, Cs, Rb and Zn <100 mg/kg. Most elements in these tea were released into the infusions at defferent percentages in a range of 27.89-68.94% depending on the sort of the tea. There were not detected toxical elements Hg, Cd and As except Cr with low concentration. Therefore tea drink sare adequately good enough as essential elements source and content no toxic elements. Keywords: elemental analysis, essential, toxic, tea, neutron activation.

  3. Innovation and optimization of a method of pump-probe polarimetry with pulsed laser beams in view of a precise measurement of parity violation in atomic cesium; Innovation et optimisation d'une methode de polarimetrie pompe-sonde avec des faisceaux laser impulsionnels en vue d'une mesure precise de violation de la parite dans l'atome de cesium

    Energy Technology Data Exchange (ETDEWEB)

    Chauvat, D

    1997-10-15

    While Parity Violation (PV) experiments on highly forbidden transitions have been using detection of fluorescence signals; our experiment uses a pump-probe scheme to detect the PV signal directly on a transmitted probe beam. A pulsed laser beam of linear polarisation {epsilon}{sub 1} excites the atoms on the 6S-7S cesium transition in a colinear electric field E || k(ex). The probe beam (k(pr) || k(ex)) of linear polarisation {epsilon}{sub 2} tuned to the transition 7S-6P(3/2) is amplified. The small asymmetry ({approx} 10{sup -6}) in the gain that depends on the handedness of the tri-hedron (E, {epsilon}{sub 1}, {epsilon}{sub 2}) is the manifestation of the PV effect. This is measured as an E-odd apparent rotation of the plane of polarization of the probe beam; using balanced mode polarimetry. New criteria of selection have been devised, that allow us to distinguish the true PV-signal against fake rotations due to electromagnetic interferences, geometrical effects, polarization imperfections, or stray transverse electric and magnetic fields. These selection criteria exploit the symmetry of the PV-rotation - linear dichroism - and the revolution symmetry of the experiment. Using these criteria it is not only possible to reject fake signals, but also to elucidate the underlying physical mechanisms and to measure the relevant defects of the apparatus. The present signal-to-noise ratio allows embarking in PV measurements to reach the 10% statistical accuracy. A 1% measurement still requires improvements. Two methods have been demonstrated. The first one exploits the amplification of the asymmetry at high gain - one major advantage provided by our detection method based on stimulated emission. The second method uses both a much higher incident intensity and a special dichroic component which magnifies tiny polarization rotations. (author)

  4. Atomic Spectra Database (ASD)

    Science.gov (United States)

    SRD 78 NIST Atomic Spectra Database (ASD) (Web, free access)   This database provides access and search capability for NIST critically evaluated data on atomic energy levels, wavelengths, and transition probabilities that are reasonably up-to-date. The NIST Atomic Spectroscopy Data Center has carried out these critical compilations.

  5. Sens et reconnaissance dans le travail

    OpenAIRE

    Loriol, Marc

    2011-01-01

    Traduction d'un texte de Marc Loriol, 2011, publié (en grec) dans le Traité de sociologie du travail, Sous la direction de Christina Karakioulafis, Athènes, AIONIKOS, 2011; La plupart des sociologues ayant interrogé des salariés dans différents secteurs économiques, ont été confrontés à une plainte récurrente : le manque de reconnaissance. Ce désir de reconnaissance peut être vu comme le corollaire, dans de nombreuses activités, d'un sentiment de perte de sens du travail. Si l'on ressent le b...

  6. KARAKTERISTIK BATUBARA DAN PENGARUHNYA TERHADAP PROSES PENCAIRAN

    Directory of Open Access Journals (Sweden)

    Harli Talla

    2014-12-01

    Full Text Available Tujuan penelitian ini adalah mempelajari pengaruh karakteristik batubara terhadap proses pencairan dengan menggunakan metoda hidrogenasi katalitik. Sampel batubara yang digunakan adalah batubara Sorong dengan peringkat lignit dan batubara Mulia dengan peringkat sub bituminus. Proses pencairan dilakukan dalam sebuah otoklaf yang berkapasitas 5 liter dengan menggunakan pelarut antrasen dan katalis bijih besi. Kisaran suhu pencairan adalah 375ºC, 400ºC, 425ºC, dan 450ºC, sementara tekanan awal hidrogen ditetapkan 100 bar. Hasil yang diperoleh menunjukan bahwa karakteristik batubara memiliki pengaruh yang signifikan terhadap pencairan. Konversi tertinggi batubara Sorong adalah 89,94% pada suhu 400ºC, sementara untuk batubara Mulia sebesar 87,28% pada suhu 450ºC

  7. PERANAN PENGAPURAN DAN FAKTOR FISIKA KIMIA AIR TERHADAP PERTUMBUHAN DAN SINTASAN LOBSTER AIR TAWAR (Cherax sp.

    Directory of Open Access Journals (Sweden)

    Titin Kurniasih

    2008-12-01

    Full Text Available Pertumbuhan lobster air tawar (Cherax sp. hanya akan terjadi apabila didahului oleh proses pergantian kulit. Semakin sering pergantian kulit terjadi, maka pertumbuhannya makin pesat. Frekuensi ganti kulit dipengaruhi umur, kecukupan makanan dan kalsium media, serta kualitas air yang sesuai. Kadar kalsium perairan dapat ditingkatkan melalui pengapuran. Kualitas air yang berpengaruh terhadap pertumbuhan dan sintasan Cherax sp. antara lain: alkalinitas, pH, oksigen terlarut, suhu, amoniak, dan nitrit.

  8. Les AOC dans la mondialisation

    Directory of Open Access Journals (Sweden)

    Jean-Claude Hinnewinkel

    2004-12-01

    Full Text Available Fruit du conflit plusieurs fois séculaire entre les producteurs et le négoce, le terroir vitivinicole est né de phénomènes de « distinction » qui en Bordelais donnent les « crus ». Ces terroirs de production identifiés, il fallut les faire durer, face à conjoncture, face au négoce. Les réussites les plus nettes sont le résultat d’un projet collectif dont l’AOC à la française est l’une des plus spectaculaires. Renforcer le terroir, compris comme un espace de production géré par les producteurs, devient alors une des conditions essentielles de la durabilité du système. L’avenir des AOC réside sans doute dans une meilleure gestion du conflit négoce/production par l’interprofession mais aussi (surtout ! dans un renforcement de la gestion de la production au sein de l’aire de production qu’est le terroir. L’avenir du terroir relève de la gouvernance de cette aire de production avec trois partenaires : la puissance publique (INAO, l’interprofession et le syndicat des producteurs. Se pose dès lors la question du partage des compétences et la durabilité des AOC paraît liée en grande partie à une définition claire du rôle et donc du statut des syndicats de producteurs, à une véritable gouvernance locale, seule capable de donner du sens à l’ancrage géographique des vins dits de « terroir ». Mais alors ne faut-il pas impliquer un troisième partenaire, la société locale toute entière à travers ses représentations démocratique et associative ?Resulting from century-long conflicts between producers and merchants, vineyards have developped out of "distinction" phenomenons which in the Bordeaux region gave birth to "crus" (vintages. Such identified terroirs had to be defended: the French collective AOC (Denomination of Origin project is one of the most spectacular success. The terroir, as production territory organized by producers, is one of the essential conditions for sustainability

  9. Espaces de femmes dans les territoires urbains

    OpenAIRE

    Rouag Djenidi, Abla

    2012-01-01

    En Algérie, les espaces féminins étaient essentiellement les espaces domestiques de la maison traditionnelle où la femme régnait sur les activités et le groupe domestique. Les espaces publics urbains étaient des espaces masculins Nous assistons actuellement à une évolution dans la condition de la femme mais également dans sa relation à l’espace urbain qui est de plus en plus investi par la population féminine. L’espace domestique s’ouvre de plus en plus à l’homme, en restant toutefois le terr...

  10. KERAGAAN USAHATANI DAN PEMASARAN BUAH NAGA ORGANIK

    Directory of Open Access Journals (Sweden)

    Kustiawati Ningsih

    2015-11-01

    Full Text Available Salah satu faktor penting dalam agribisnis hortikultura adalah kelembagaan pemasaran dan salah satu komoditi yang menjanjikan adalah buah naga organik. Penelitian ini bertujuan mengetahui penerimaan petani dan marjin pemasaran buah naga organik di Kabupaten Pamekasan. Hasil analisis usahatani menunjukkan adanya keuntungan dalam usahatani buah naga organik, hal ini ditunjukkan oleh nilai R/C=2,34. Bila dibandingkan dengan nilai R/C rasio usahatai tembakau Madura yaitu sebesar 1,38 maka dapat disimpulkan bahwa usahatani buah naga organik lebih efisien sehingga dapat dikatakan usahatani buah naga organik dapat dijadikan sebagai alternatif usahatani tembakau Madura. Kisaran (Acquirement marjin pemasaran antara lembaga-lembaga pemasaran cenderung bervariasi dan timpang. Besarnya marjin pemasaran pada tengkulak dan pedagang pengumpul masing-masing Rp 5.000/kg dan Rp 4.000/kg. Besarnya bagian petani (farmer share buah naga organik pada tengkulak dan pedagang pengumpul masing-masing 10%dan 10,67%. Secara ekonomi, buah naga organik masih menguntungkan. Keuntungan ini masih dapat ditingkatkan dengan memperbaiki sistem produksi, sehingga produktivitas dapat ditingkatkan. Diperkirakan dengan proses produksi ini dapat memperbaiki kualitas dan kuantitas, terutama pada tingkat lebih tinggi lagi, sehingga memiliki peluang mengakses pasar lebih luas, khususnya pasar luar negeri (ekspor. Abstract One important factor in the agribusiness of horticulture is institutional marketing and one of the commodities that prospecive is organic dragon fruit. This study aims to determine the revenue of farmers and marketing margin of organic dragon fruit in Pamekasan. Results of the analysis showed profit in organic dragon fruit farming, this is indicated by the value of R / C = 2,34. When compared with the value of R / C ratio of Madura tobacco farming in the amount of 1.38 it can be concluded that organic dragon fruit farming more efficient so that it can be said dragon

  11. PROSTITUSI KELING (Konstruksi Sosial Masyarakat dan Stigmatisasi

    Directory of Open Access Journals (Sweden)

    Septi Purfitasari

    2014-08-01

    Full Text Available Keling memiliki prostitusi baik di perantauan maupun lokal. Praktik prostitusi lokalmenunjukkan prostitusi terkait dengan sejarah dan budaya komunitas tersebut.Hal ini juga memunculkan stigmatisasi terhadap perempuan Keling. Penelitian inimengkaji konstruksi sosial masyarakat Keling terhadap prostitusi dan stigmatisasiterhadap perempuan Keling.Penelitian menggunakan pendekatan kualitatif. Teknikpengumpulan data melalui wawancara mendalam, observasi, dan dokumentasi.Analisis data meliputi analisis tematis, analisis tekstual, dan analisis interpretatif.Hasil penelitian menunjukkan konstruksi sosial prostitusi sebagai kesalahan perempuanyang terlalu tergiur materi dan mencoreng nama baik kyai, sebagai pekerjaanberpenghasilan tinggi, sebagai perusak kualitas generasi muda, sebagai penyebabpenyebaran HIV/AIDS, dan sebagai hiburan yang bergengsi. (2 Stigmatisasi terhadapperempuan Keling, yaitu bukan perempuan baik-baik, cantik-cantik tetapi banyakyang PSK. Tokoh masyarakat tidak sepenuhnya mengakui stigmatisasi. Pelakumengakui stigmatisasi, ada yang menyembunyikan, ada yang merasa bangga.Saranyang direkomendasikan adalah lembaga pendidikan perlu mempertimbangkan latarbelakang sosial budaya siswa sehingga proses transfer of values dalam pendidikanIPS lebih tepat dan dapat menghasilkan output yang baik. Tokoh kesehatan agarmelakukan pendampingan dan sosialisasi terhadap remaja mengenai prostitusi danresiko penularan penyakit. Tokoh agama agar memfasilitasi kegiatan keagamaanbagi generasi muda, tokoh masyarakat agar menertibkan prostitusi berkedok karaoke Implementation of Curriculum 2013 brought a change in the learning process. Regulation ofthe Minister of Education and Culture Number 65/2013 about Standard Process Primaryand Secondary Education hinted on the need for the learning process guided by the rules ofscientific approach. Scientific approach is applied to all subjects for all levels. The applicationof scientific approach certainly can cause

  12. Le corps dans l'Antiquité

    Directory of Open Access Journals (Sweden)

    Sophie Lalanne

    2008-06-01

    Full Text Available Ouvrages générauxLaqueur Thomas, La fabrique du sexe. Essai sur le corps et le genre en Occident, trad. fr., Paris, Gallimard, 1992.Feher Michel, Naddaff Ramona, Tazi Nadia, Fragments for a History of the Human Body, 3 volumes, New York, Zone Books, 1989.Le Corps dans l’AntiquitéBodiou Lydie, Frère Dominique, Mehl Véronique dir., L’expression des corps. Gestes, attitudes, regards dans l’iconographie antique, Rennes, Presses Universitaires de Rennes, 2006.Bonnard Jean-Baptiste, Le complexe de ...

  13. Constraints on deformation of Hekla volcano, Iceland, 2011-2014, from time-series interferometric analysis of COSMO-SkyMed SAR data and Singular Spectrum Analysis (SSA)

    Science.gov (United States)

    Dumont, Stéphanie; Sigmundsson, Freysteinn; Parks, Michelle; Ófeigsson, Benedikt; Bagnardi, Marco; Hooper, Andy; Einarsson, Páll; Wittmann, Werner

    2015-04-01

    Hekla volcano is one of the most active volcanoes in Iceland with 18 summit eruptions during the last 1100 years. Since 1970, the volcano has erupted approximatively every 10 years: in 1980-1981, 1991 and 2000. A special feature of Hekla volcano is its aseismic behavior except within 2 hours before these eruptions. However, in 2013 and 2014, some seismic swarms were detected within a 5km radius centered on the volcano, which is unusual for any time period between eruptions. No change in the ground deformation (continuous borehole strainmeter and ground-based GPS), was observed during these events. This year, will be the fifteenth year without an eruption at Hekla, the extended period (since the last eruption) raises the following question: Has the magma plumbing system or the rate of melt supply changed since the last eruption? What is the state of the volcano? What does it imply for its eruptive cycle? To address these questions, we study ground deformation around Hekla volcano using time-series analysis. We analyzed COSMO-SkyMed SAR data acquired between 2011 and 2014 using the Persistent Scatterer Interferometric Synthetic Aperture Radar (PS-InSAR) approach for both ascending and descending configurations. As highlighted by previous studies of ground deformation around Hekla, the small deformation rate distributed over a large area increases the importance of the noise reduction process. Once the signal to noise ratio is improved, both time-series display a dominant subsidence signal. The subsiding areas correlate with lava flows extruded during the 2000 eruption. A small inflation signal is more difficult to substantiate from the SAR data alone. For this reason further investigation of source characteristics using a Singular Spectrum Analysis (SSA) is required. SSA is an empirical based decomposition of the signal. This decomposition is applied on a trajectory matrix, called a Hankel matrix (similar to a cross-lag correlation matrix). This method enables the

  14. Karakterisasi Simplisia Daun Dan Biji Kelor (Moringa Oleifera Lam.) Serta Analisis Magnesium Dan Besi Secara Spektrofotometri Serapan Atom

    OpenAIRE

    2016-01-01

    Moringa leaves was used as vegetable by most of the villagers and also used as a medicinal plant efficacious. Nowaday people are starting to utilize parts of the moringa plant in the form of fresh are then processed into simplicia of moringa leaves, tea of moringa and simplicia of moringa seeds. Monograph of characterization simplicia of moringa leaves and seeds have not been listed in the Indonesian Herbal Pharmacapoeia. Minerals are nutrients needed to maintain health. This study aims to in...

  15. Analisis Kandungan Kalsium, Kalium, dan Magnesium pada Daun Kelor (Moringa oleifera Lam.) Segar dan Direbus Secara Spektrofotometri Serapan Atom

    OpenAIRE

    Wahyuni, Sri

    2015-01-01

    Moringa oleifera Lam that we know as Moringa is the best-known species of the thirteen species of the genus Moringacae. Minerals contained in Moringa are calcium, copper, iron, manganese, magnesium, phosphorus, potassium, sodium, sulphur, and zinc. Moringa leaves as a source of vitamins and minerals can be consumed in a way cooked, or eaten raw or dried into powder. One of the cooking method is boiling in the water. Vitamins and minerals are easily soluble in water is a nutrient that is quick...

  16. Analisis Kandungan Mangan dan Zink Pada Daun Kelor (Moringa oleifera Lam.) Kering dan Rebus Secara Spektrofotometri Serapan Atom

    OpenAIRE

    Faza, Afina

    2017-01-01

    Moringa (Moringa oleifera Lam.) is included in the family Moringaceae, the utilizaation of moringa plant in indonesia society has been a long a time, but moringa’s leaves is the most common used to be dietary fiber. Moringa contains excess nutrients for body needed, one of them is mineral such as calcium, cromium, cupri, flour, iron, manganese, magnesium, molybdenum, phosphor, potasium, sodium, selenium, sulphur, and zinc. The aim of this study is to determine the differentiation content of m...

  17. Single Atom Plasmonic Switch

    CERN Document Server

    Emboras, Alexandros; Ma, Ping; Haffner, Christian; Luisier, Mathieu; Hafner, Christian; Schimmel, Thomas; Leuthold, Juerg

    2015-01-01

    The atom sets an ultimate scaling limit to Moores law in the electronics industry. And while electronics research already explores atomic scales devices, photonics research still deals with devices at the micrometer scale. Here we demonstrate that photonic scaling-similar to electronics-is only limited by the atom. More precisely, we introduce an electrically controlled single atom plasmonic switch. The switch allows for fast and reproducible switching by means of the relocation of an individual or at most - a few atoms in a plasmonic cavity. Depending on the location of the atom either of two distinct plasmonic cavity resonance states are supported. Experimental results show reversible digital optical switching with an extinction ration of 10 dB and operation at room temperature with femtojoule (fJ) power consumption for a single switch operation. This demonstration of a CMOS compatible, integrated quantum device allowing to control photons at the single-atom level opens intriguing perspectives for a fully i...

  18. Aspek Legal dan Komitmen Etikal dalam Mu’amalah Maliyah

    Directory of Open Access Journals (Sweden)

    Lalu Fahmi Zainul Arifin

    2015-11-01

    Full Text Available Legalitas dalam mu’amalah maliyah bukanlah sekedar formalitas yang apriori ataupun pesimistik terhadap relativisme moral, karena aspek etikal yang diartikulasikan dalam berbagai prinsip mu’amalah adalah salah satu konsideran yang mendasar dan pokok dalam proses memahami dan inheren dengan “halal haram”, sehingga terkadang sukar untuk menarik garis tegas antara normativitas dan positivitas. Artikel ini menjelaskan bagaimana prinsip-prinsip moral keislaman sebagai aspek pokok dan karakteristik mendasr mu’amalah maliyah, sehingga komitmen moral di dalam mu’amalah maliyah dapat diukur melalui sistem pengawasan internal, yaitu tanggungjawab personal hamba kepada Tuhan dan pengawasan eksternal melalui otoritas pemerintah atau lembaga berwenang.

  19. BERMAIN DAN KOMPETENSI SOSIAL ANAK: STUDI META ANALISIS

    Directory of Open Access Journals (Sweden)

    Iswinarti Iswinarti

    2016-10-01

    Full Text Available Studi ini bertujuan untuk menguji hubungan antara bermain dan kompetensi sosial anak dengan menggunakan metaanalisis terhadap 20 penelitian yang berasal dari 17 artikel. Artikel terdiri dari 10 studi eksperimen dan 7 studi survei. Hipotesis yang diajukan dalam penelitian ini adalah ada hubungan positif antara bermain dan kompetensi sosial anak. Ringkasan hasil analisis tidak mendukung diterimanya hipotesis karena hasil penelitian menunjukkan bahwa hubungan antara bermain dan kompetensi sosial anak tidak selalu positif. Penjelasan tentang mengapa hubungan antara bermain dan kompetensi sosial anak tidak selalu positif didiskusikan dalam pembahasan.

  20. PENGEMBANGAN MODEL TRACKING DAN TRACING DALAM DISTRIBUSI KOMODITI PERTANIAN

    Directory of Open Access Journals (Sweden)

    Yandra Rahadian Perdana

    2011-06-01

    Full Text Available Kegagalan distribusi komoditi pertanian dapat berdampak pada penurunan dan kehilangan nilai baik secara kualitas dan kuantitas karena suatu perubahan dimensi waktu-jarak atau suhu serta sarana pengangkutan dalam setiap mata rantai aktivitas distribusi. Model tracking dan tracing system dapat menjadi strategi untuk menjamin keberhasilan distribusi komoditi pertanian secara tepat baik kuantitas maupun kualitas. Model tracking dan tracing komoditi pertanian adalah sebuah sistem proaktif yang real time yang dilengkapi dengan komponen pendukung proses distribusi dengan data yang akurat, terpercaya, berguna, dan cepat dengan memberikan informasi posisi barang atau sarana moda transportasinya.

  1. EFEKTIVITAS DAN EFEK TOKSIK EKSTRAK STEROID TERIPANG DAN 17α METILTESTOSTERON PADA MANIPULASI KELAMIN UDANG GALAH

    Directory of Open Access Journals (Sweden)

    Apri Arisandi

    2012-10-01

    Full Text Available Testosteron selain dapat dimanfaatkan sebagai obat, juga dimanfaatkan untuk sex reversal pada udang galah (Macrobrachium rosenbergii de Man.  Hormon yang umum dipakai untuk sex reversal jantan adalah 17α metiltestosteron, merupakan hormon sintetis.  Bioassay pada ayam, diketahui bahwa hormon sintetis memberikan efek samping toksik pada hati, limpa dan bursa fabricius.  Agar tidak memberikan efek toksik, salah satu cara dengan menggunakan sumber hormon testosteron alami dari teripang.  Pemberian hormon menggunakan metode dipping, lima perlakuan dan tiga ulangan.  Dosis ekstrak steroid teripang 1, 2 dan 3mg/l, serta 17α metiltestosteron 2mg/l dapat menghasilkan populasi jantan lebih tinggi dari kontrol negatif (tanpa hormon, yaitu 44,15%, 49,65%, 49,72% dan 50,45%.   Kata kunci: ekstrak steroid teripang, 17α metiltestosteron, udang galah

  2. ANALISA PENGARUH PERIODIK CHARGING DAN DISCHARGING PADA WAKTU CHARGING DAN DISCHARGING DARI METAL HYDRIDE REACTOR (MHR

    Directory of Open Access Journals (Sweden)

    Taurista Perdana Syawitri

    2015-01-01

    Full Text Available Perpindahan panas merupakan faktor penting yang mempengaruhi kinerja tangki penyimpanan hydrogen dalam bentuk metal hydride. Penelitian sebelumnya menyimpulkan bahwa penambahan sejumlah kecil metal foam pada interior metal hydride reactor (MHR merupakan cara yang efektif untuk meningkatkan perpindahan panas pada reaktor, sehingga mengurangi waktu charging. Namun, proses charging dan discharging MHR dilakukan secara terpisah dalam studi ini. Oleh karena itu, penelitian ini menyimulasikan model 2-D axisymmetric menggunakan software COMSOL untuk menginvestigasi pengaruh dari periodik charging dan discharging dari MHR yang mengandung metal foam dengan fraksi volume tertentu. Hasil simulasi menunjukkan bahwa model saat ini mempunyai hasil yang sesuai dengan hasil yang ditunjukkan di dalam literatur. Selain itu, ditemukan bahwa terdapat nilai optimum dari fraksi volume metal foam di setiap proses charging dan proses discharging yang memberikan waktu charging dan discharging lebih pendek.

  3. PENYAKIT MENULAR SEKSUAL AKIBAT JAMUR, PROTOZOA, DAN PARASIT

    Directory of Open Access Journals (Sweden)

    Max Joseph Herman

    2012-09-01

    Full Text Available Berbagai penyakit akibat hubungan seksual (PHS selain yang disebabkan oleh bakteri, klamidia, virus, dan mikroplasma, juga mungkin disebabkan oleh jamur, protozoa dan parasit, antara lain kandidiasis, trikomoniasis, giardiasis, amebiasis, kudis, dan kutu pubis. Diagnosis PHS yang tepat dan pasti sangat penting karena mcmiliki konotasi sosial dan biasanya diperoleh melalui pemeriksaan mikroskopik, pembenihan bakteriologis atau virologis. Sedangkan penatalaksanaan PHS bergantung pada infeksi masing-masing individu, tetapi secara umum apabila PHS sendiri tidak/kurang serius seperti trikomoniasis atau ektoparasit maka tidak perlu pengamatan pasangan seksual meskipun harus diobati juga karena hampir pasti ia juga terinfeksi. Sebagian besar PHS lain demikian berat (dalam kasus gonore resistensi terhadap antibiotika merupakan masalah sehingga semua kontak seksual harus ditelusuri dan diobati, khususnya pada gonore, sifilis dan AIDS.

  4. CARA MENGHILANGKAN RASA DAN BAU PADA PENGOLAHAN AIR MINUM

    Directory of Open Access Journals (Sweden)

    Sri Soewasti Soesanto

    2012-12-01

    Full Text Available Salah satu syarat kualitas air minum adalah tidak berwarna, tidak ada rasa, dan tidak berbau. Kebanyakan konsumen air minum menilai baik tidaknya kualitas air minum hanya secara visual, keruh atau jernih, berwarna atau tidak dan dengan indera pengecap apakah ada rasa atau tidak serta dengan indera pencium; berbau atau tidak. Tulisan ini hanya akan membahas dua aspek yaitu rasa dan bau yang sering dikeluhkan oleh konsumen.Sumber kontaminasi yang menimbulkan rasa dan bau dalam air dapat bersifat alami maupun anthropogenik.Untuk menghilangkan rasa dan bau karena sebab alami ada beberapa pilihan cara pengolahan yaitu sedimentasi konvensional secara gaya berat (Conventional Gravity Sedimentatin = CGS dan pengembangan udara terlarut (Dissolved Air Flotation = DAF, ozonisasi dan filtrasi dengan karbon aktif granular (Granular Activated Carbon = GAC. 

  5. Pengemabnagn dan Validasi Skala Pengukuran Kualitas Layanan Tridarma Perguruan Tinggi

    Directory of Open Access Journals (Sweden)

    Hisyam Ihsan

    2010-06-01

    Full Text Available Paper ini mengemukakan hasil penelitian yang mengembangkan dan memvalidasi skala pengukuran kualitas layanan pendidikan tinggi, yang merupakan penjabaran dari tridarma perguruan tinggi. Berdasarkan adaptasi model Service Quality 5-dimensi sebagaimana dalam Parasuraman, Zeithaml dan Barry (1993, instrumen 16-butir kualitas layanan pengajaran (teacbqnal, 14-butir kualitas layanan penelitian (resqual, dan 11-butir kualitas layanan pengabdian masyarakat (p/tbqual dibuat untuk menilai kualitas layanan pendidikan. Masing-masing istrumen menggambarkan sikap dan perilaku mahasiswa mengenai kinerja layanan perguruan tinggi. Instrumen tersebut menilai kualitas secara fungsional (process maupun teknikal (output-outcome. Tiga ratus sebelas mahasiswa program sarjana tahun terakhir sebagai responden intsrumen. Unidimensional, reliabilitas, validitas isi, validitas terkait-kriterion, validitas konvergen, validitas diskriminan, dan validitas nomologikal diperiksa dengan menggunakan Structural Equation Modeling. Instrumen KLTPT telah dikembangkan dan berpotensi aplikasi untuk ekplorasi bagi para praktisi dan peneliti. Kata kunci: pengukuran kualitas layanan tridharma perguruan tinggi

  6. MENDORONG PASAR MODAL EFISIEN DAN BERDAYA SAING GLOBAL

    Directory of Open Access Journals (Sweden)

    Satia Nur Maharani

    2006-01-01

    Full Text Available Globalisasi semakin memperpendek jarak dan waktu. Kemampuannya mampu  merubah wajah planet bumi menjadi” just a small village “ melalui peningkatan ilmu pengetahuan dan teknologi. Perubahan tersebut bertransformasi pula pada  sistem ekonomi. Modal berdiri sendiri tanpa identitas dan siapa saja berhak untuk berinvestasi tanpa batas melalui sebuah mekanisme antar negara dan benua. Salah satu lintasan modal untuk meraih keuntungan adalah melalui mekanisme pasar modal. Pasar modal manakah yang diminati oleh arus modal masuk adalah pasar modal yang mampu memberikan jamuan terbaik berupa keuntungan yang tinggi dengan resiko yang optimal. Maka untuk mencapai pelayan yang maksimal bagi masyarakat pemodal , pasar modal harus efisien dan berdaya saing global. Maka keterbukaan informasi, peningkatan teknologi, efisiensi biaya penegakan hukum, partisipasi masyarakat dan pemerintah, inovasi produk mutlak untuk dievaluasi dan ditingkatkan

  7. Semiotika Kemasan Produk Susu Rasa Coklat Dan Stroberi pada Merek Indomilk Kids Dan Boneeto

    OpenAIRE

    Mukaromah Mukaromah

    2016-01-01

    Abstrak Kemasan adalah salah satu penentu keberhasilan dalam penjualan produk terkait dengan informasi pesan yang ingin disampaikan,untuk itu visualisasi dibuat semenarik mungkin agar dapat menyasar segmen yang ingin diraih. Demikian halnya dengan susu kemasan kotak untuk anak-anak yang terpapar di meja elalase di pusat- pusat perbelanjaan. Dalam penelitian ini penulis melihat bagaimana susu kemasan kotak merek Indomilk Kids dan Boneeto rasa coklat dan rasa stroberi yang dikonstruksikan sed...

  8. Influence of processing on the ethylene-vinyl alcohol (EVOH properties: Application of the successive self-nucleation and annealing (SSA technique

    Directory of Open Access Journals (Sweden)

    2010-03-01

    Full Text Available Films of EVOH copolymers, processed three times by twin-screw extrusion were prepared using a cast-film line. The variation on the melt flow rate (MFR and rheological behaviour of the films were determined, as well as the thermal properties assessed by differential scanning calorimetry (DSC and dynamic-mechanical thermal analysis (DMTA. As the results showed that the reprocessing induced an increase in the viscosity and orientation of the films, it was suggested that structural modifications from chain-extension or cross-linking reactions promoted by hydroxyl and residual acetoxyl groups, could be occurring. The successive self-nucleation and annealing (SSA technique was applied, evidencing the structural modifications on the EVOH copolymer.

  9. Highlights from 4STAR Sky-Scanning Retrievals of Aerosol Intensive Optical Properties from Multiple Field Campaigns with Detailed Comparisons of SSA Reported During SEAC4RS

    Science.gov (United States)

    Dunagan, Stephen E.

    2016-01-01

    The 4STAR (Spectrometer for Sky-Scanning, Sun-Tracking Atmospheric Research) instrument combines airborne sun tracking capabilities of the Ames Airborne Tracking Sun Photometer (AATS-14) with AERONET (Aerosol Robotic Network)-like sky-scanning capability and adds state-of-the-art fiber-coupled grating spectrometry to yield hyperspectral measurements of direct solar irradiance and angularly resolved sky radiance. The combination of sun-tracking and sky-scanning capability enables retrievals of wavelength-dependent aerosol optical depth (AOD), mode-resolved aerosol size distribution (SD), asphericity, and complex refractive index, and thus also the scattering phase function, asymmetry parameter, single-scattering albedo (SSA), and absorption aerosol optical thickness (AAOT). From 2012 to 2014 4STAR participated in four major field campaigns: the U.S. Dept. of Energy's TCAP (Two-Column Aerosol Project) I & II campaigns, and NASA's SEAC4RS (Studies of Emissions, Atmospheric Composition, Clouds and Climate Coupling by Regional Surveys) and ARISE (Arctic Radiation - IceBridge Sea & Ice Experiment) campaigns. Establishing a strong performance record, 4STAR operated successfully on all flights conducted during each of these campaigns. Sky radiance spectra from scans in either constant azimuth (principal plane) or constant zenith angle (almucantar) were interspersed with direct beam measurements during level legs. During SEAC4RS and ARISE, 4STAR airborne measurements were augmented with flight-level albedo from the collocated Shortwave Spectral Flux Radiometer (SSFR) providing improved specification of below-aircraft radiative conditions for the retrieval. Calibrated radiances and retrieved products will be presented with particular emphasis on detailed comparisons of ambient SSA retrievals and measurements during SEAC4RS from 4STAR, AERONET, HSRL2 (High Spectral Resolution Lidar), and from in situ measurements.

  10. 4STAR Sky-Scanning Retrievals of Aerosol Intensive Optical Properties from Multiple Field Campaigns with Detailed Comparisons of SSA Reported During SEAC4RS

    Science.gov (United States)

    Flynn, Connor; Dahlgren, R. P.; Dunagan, S.; Johnson, R.; Kacenelenbogen, M.; LeBlanc, S.; Livingston, J.; Redemann, J.; Schmid, B.; Segal Rozenhaimer, M.; Shinozuka, Y.; Zhang, Q.; Schmidt, S.; Holben, B.; Sinyuk, A.; Hair, J.; Anderson, B.; Ziemba, L.

    2015-01-01

    The 4STAR (Spectrometer for Sky-Scanning, Sun-Tracking Atmospheric Research) instrument combines airborne sun tracking capabilities of the Ames Airborne Tracking Sun Photometer (AATS-14) with AERONET-like sky-scanning capability and adds state-of-the-art fiber-coupled grating spectrometry to yield hyper spectral measurements of direct solar irradiance and angularly resolved sky radiance. The combination of sun-tracking and sky-scanning capability enables retrievals of wavelength-dependent aerosol optical depth (AOD), mode-resolved aerosol size distribution (SD), asphericity, and complex refractive index, and thus also the scattering phase function, asymmetry parameter, single-scattering albedo (SSA), and absorption aerosol optical thickness (AAOT).From 2012 to 2014 4STAR participated in four major field campaigns: the U.S. Dept. of Energy TCAP I II campaigns, and NASAs SEAC4RS and ARISE campaigns. Establishing a strong performance record, 4STAR operated successfully on all flights conducted during each of these campaigns. Sky radiance spectra from scans in either constant azimuth (principal plane) or constant zenith angle (almucantar) were interspersed with direct beam measurements during level legs. During SEAC4RS and ARISE, 4STAR airborne measurements were augmented with flight-level albedo from the collocated Shortwave Spectral Flux Radiometer (SSFR) providing improved specification of below-aircraft radiative conditions for the retrieval. Calibrated radiances and retrieved products will be presented with particular emphasis on detailed comparisons of ambient SSA retrievals and measurements during SEAC4RS from 4STAR, AERONET, HSRL2, and from in situ measurements.

  11. Perbedaan konsumsi buah dan sayur pada anak sekolah dasar yang obes dan tidak obes di Kota Yogyakarta dan Kabupaten Bantul

    Directory of Open Access Journals (Sweden)

    Irma Nuraeni

    2016-03-01

    gender and energy intake, showed that obese  children who rarely consuming fruits (<7 times/week (OR=2,24, 95%CI: 1.53-3.28, rarely consuming vegetables (<7 times/week (OR=2,52, 95%CI: 1,70-3,73, and consuming fruits and vegetables less than 5 servings/day (equivalent to 400 g/day (OR= 4,59, 95%CI:2,11-10,00 were greater risk for being obesity.Conclusion:Obese children had rarely and less consume of fruits and vegetables than that did in non-obese children at Yogyakarta Municipality and District of Bantul. The children rarely and less consuming fruits and vegetables increased the risk of obesity.KEYWORDS: children obesity, vegetable, fruitABSTRAKLatar Belakang: Indonesia saat ini mengalami masalah gizi ganda, yaitu masalah gizi kurang dan gizi lebih. Kelebihan  gizi atau obesitas pada anak dan remaja apabila tidak diatasi maka berdampak menjadi obesitas pada masa dewasa yang berpotensi mengalami penyakit tidak menular, seperti jantung, hipertensi dan diabetes mellitus. Prevalensi obesitas pada anak di Provinsi Daerah Istimewa Yogyakarta mengalami peningkatan dari tahun ke tahun (1; 2. Obesitas disebabkan ketidakseimbangan antara masukan dengan keluaran energi. Anak cenderung mengkonsumsi padat energi yang berasa manis dan berlemak tinggi serta makanan kurang serat dari buah dan sayur. Beberapa penelitian menunjukkan peningkatan risiko obesitas pada orang yang kurang konsumsi buah dan sayur.Tujuan: Untuk mengetahui perbedaan frekuensi dan jumlah konsumsi buah dan sayur pada anak SD obes dan tidak obes di Kota Yogyakarta dan Kabupaten Bantul serta peran konsumsi buah dan sayur terhadap kejadian obesitas. Metode: Rancangan penelitian ini adalah case-control, 244 kasus (anak obes dan 244 kontrol (anak tidak obes. Subjek penelitian adalah anak usia 6-12 tahun yang duduk di kelas 1 hingga kelas 5 sekolah dasar di Kota Yogyakarta dan di Kabupaten Bantul. Data identitas diperoleh dari kuesioner terstruktur, sedangkan data frekuensi dan jumlah konsumsi buah dan sayur diperoleh

  12. Long range intermolecular forces in triatomic systems: connecting the atom-diatom and atom-atom-atom representations

    OpenAIRE

    2005-01-01

    The long-range forces that act between three atoms are analysed in both atom-diatom and atom-atom-atom representations. Expressions for atom-diatom dispersion coefficients are obtained in terms of 3-body nonadditive coefficients. The anisotropy of atom-diatom C_6 dispersion coefficients arises primarily from nonadditive triple-dipole and quadruple-dipole forces, while pairwise-additive forces and nonadditive triple-dipole and dipole-dipole-quadrupole forces contribute significantly to atom-di...

  13. Pengaruh Massa Zn Dan Temperatur Hydrotermal Terhadap Struktur Dan Sifat Elektrik Material Graphene

    Directory of Open Access Journals (Sweden)

    Muhammad Rizki Ilhami

    2014-09-01

    Full Text Available Kemajuan teknologi yang sangat berkembang pada saat ini membutuhkan material yang tidak hanya kecil ataupun ringan, tetapi juga memiliki sifat thermal, elektrik, dan mekanik yang baik. Graphene adalah material yang dapat menjawab kebutuhan hal tersebut. Permasalahan yang kemudian muncul adalah proses sintesis massal yang masih menjadi kendala. Penelitian ini bertujuan untuk mensintesis material graphene dengan metode hydrothermal dan menggunakan serbuk Zn sebagai reduktor. Penelitian ini menganalisa pengaruh varaiasi penambahan massa sebesar 0,8 gram, 1,6 gram, dan 2,4 gram zinc serta variasi temperatur hydrthermal 160ᵒC, 180ᵒC, 200ᵒC. Proses karakterisasi material graphene dilakukan dengan pengujian Scanning Electron Microscope (SEM, X-Ray Diffraction (XRD, Fourier Transform Infraredspectroscopy, Thermo Gravimetric Analysis/Differential Scanning Calorimetry (TGA/DSC, dan Four Point Probe digunakan untuk mengetahui nilai konduktivitas elektrik material. Morfologi dari graphene yang dihasilkan berbentuk lembaran-lembaran transparan dan tipis yang saling menumpuk.Semakin banyak serbuk Zn yang diberikan menjadikan permukaan graphene semakin tipis. Nilai konduktivitas elektrik terbesar dihasilkan dari variasi panambahan serbuk zinc sebesar 2,4 gram dan temperatur hydrothermal sebesar 180ᵒC dengan nilai sebesar 0,012526 S/cm.

  14. ASUPAN ZAT GIZI DAN STATUS GIZI PADA REMAJA PUTRI YANG SUDAH DAN BELUM MENSTRUASI

    Directory of Open Access Journals (Sweden)

    Dyan Fajar Christianti

    2013-11-01

    Full Text Available ABSTRACTThe objective of this study was to analyze nutrient intake and nutritional status of menstruating and non-menstruating girls. This survey was conducted from April to September 2012 in elementary schools and junior high schools in Bogor. Total subjects consisted of 35 menstruating and 35 non-menstruating girls who were chosen through screening. The results showed that the percentage of menstruating girls in urban (28.0% were more than in rural (25.1%. About 57.1% of subjects had menarche at 10 years old. The average of nutrient intake on menstruating and non-menstruating girls were under DRI (Keywords: BMI/age, girls, menstruation, nutrient intake, percent body fatABSTRAKTujuan penelitian ini adalah untuk menganalisis asupan zat gizi dan status gizi pada remaja putri yang sudah dan belum menstruasi. Survei ini dilaksanakan pada April—September 2012 di Sekolah Dasar (SD dan Sekolah Menengah Pertama (SMP di Bogor. Jumlah subjek terdiri dari 35 orang yang sudah menstruasi dan 35 orang yang belum menstruasi dan dipilih melalui screening. Hasil penelitian menunjukkan bahwa persentase terjadinya menstruasi pada siswi di sekolah kota lebih besar (28.0% dibandingkan dengan di kabupaten (25.1%. Sebanyak 57.1% subjek mengalami menarche pada usia 10 tahun. Rata-rata asupan zat gizi subjek yang sudah dan belum menstruasi masih berada di bawah AKG (Kata kunci: asupan zat gizi, IMT/U, menstruasi, persen lemak tubuh, remaja putri*

  15. Pemahaman dan Keterampilan Siswa dalam Pengelolaan Sampah Rumah Tangga dan Penerapan E-Media

    Directory of Open Access Journals (Sweden)

    Mimien Henie Irawati Al Muhdhar

    2013-01-01

    Full Text Available Abstract: Students' Understanding and Skills in Managing Household Waste and the Implementation of E-Media. This classroom action research aims at examining how the implementation of e-media can improve the understanding and the skills of students of various levels of education in Malang in managing household waste. Through the stages of planning, implementing, observing, and reflecting, the study reveals that the implementation of e-media can improve the  understanding and skills of students of elementary schools, junior high schools, and senior high schools.   Abstrak: Pemahaman dan Keterampilan Siswa dalam Pengelolaan Sampah Rumah Tangga dan Penerapan E-Media. Penelitian ini telah dilakukan pada tahun 2010 di kota Malang. Tujuan penelitian tindakan ini adalah untuk mengetahui meningkatkan pemahaman dan keterampilan siswa dalam pengelo­laan sampah rumah tangga. Tahap-tahap penelitian meliputi perencanaan, pelaksanaan tindakan, observasi, dan refleksi. Hasil penelitian menunjukkan bahwa penerapan E-Media VCD 6M telah meningkatkan pemahaman dan keterampilan dalam pengelolaan sampah rumah tangga oleh siswa SD/MI, SMP/MTs, dan SMA/MA di kota Malang.

  16. DETEKSI Fasciola hepatica DAN Fasciola gigantica PADA KERBAU PERAH ( DETEKSI Fasciola hepatica DAN Fasciola gigantica PADA KERBAU PERAH ( DETEKSI Fasciola hepatica DAN Fasciola gigantica PADA KERBAU PERAH (

    OpenAIRE

    -, YAUMIL NI???MAH YAUMIL NI???MAH YAUMIL NI???MAH

    2016-01-01

    2015 ABSTRAK YAUMIL NI???MAH O11111101.Deteksi Fasciola hepatica dan Fasciola gigantica pada Kerbau Perah Fasciola hepatica dan Fasciola gigantica merupakan cacing kelas trematoda.Telur cacing ini berbentuk oval dan dilengkapi dengan operculum yang berfungsi sebagai jalan keluar larva mirasidium pada saat telur menetas.Ukuran telur Fasciola gigantica lebih besar dibandingkan ukuran telur Fasciola hepatica.Penelitian ini bertujuan untuk mendeteksi telur cacing Fasciola...

  17. Des Taiwanais dans Ie sud du Fujian

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    Se trouvant dans le sud-est de la Chine au bord dela mer, la province du Fujian s’appelle aussi toutsimplement "Min". Les anc(?)tres d’une grande partie de lapopulation de Taiwan sont venus du Fujian (Min). Les deux

  18. Fungsi Metabolisme Dan Sintesis Pada Jaringan Kambium

    OpenAIRE

    Utomo, Budi

    2008-01-01

    Hutan merupakan areal penghasil energi yang paling produktif di dunia. Hutan mampu menghasilkan dan mengumpulkan energi setiap tahunnya (Lehninger, 1965; Whittaker, 1975). Proses pembentukan energi diawali dengan pengubahan energi dari cahaya matahari menjadi energi kimia dalam bentuk ikatan kimia yang stabil melalui proses fotosintesis. Banyak orang menganggap agregat berguna tersebut sebagai ikatan kimia kayu yang stabil. 132305100(3)

  19. TRADISIONALITAS DAN MODERNITAS TIPOLOGI ARSITEKTUR MASJID

    Directory of Open Access Journals (Sweden)

    M. Syaom Barliana Iskandar

    2004-01-01

    Full Text Available This research want to present what the religious doctrine of the mosque community included the way and mind orientation could be supposed influence in the architecture typhology of mosque. Qualitative descriptive research method is used based on syncronic and diacronic approach with three steps: generic typhology, genetic morphology, and holistic comparison. The result of research shown that Nahdlatul Ulama mosques typhology is reflecting the traditionality of architecture, and vise verse Muhammadiyah mosques typhology is reflecting the modernity of architecture. Finally the study concludes that the specific differences of the mosque architecture typhology due to the religious doctrine differences. Abstract in Bahasa Indonesia : Penelitian ini bermaksud mendeskripsikan apakah faham keagamaan masyarakat pendukung masjid yang didalamnya menyangkut pula cara dan orientasi berfikir, turut mempengaruhi bentukan tipologi arsitektur masjid. Metode penelitian deskriptif kualitatif digunakan dengan pendekatan penelitian sinkronik-diakronik; dalam tiga langkah generik tipologi, generik morfologi, dan holistik komparasi. Hasil penelitian pada kasus masjid yang diteliti dan tidak dapat digeneralisasi pada kasus lain, menunjukkan bahwa tipologi masjid Nahdlatul Ulama mencerminkan tradisionalitas arsitektur masjid, dan sebaliknya tipologi masjid Muhammadiyah menampilkan modernitas arsitektur masjid. Artinya terdapat perbedaan yang khas dari tipologi arsitektur masjid, yang disebabkan oleh perbedaan dalam doktrin keagamaan. Kata kunci: faham/doktrin keagamaan, tradisionalitas, modernitas tipologi arsitektur masjid.

  20. Diagnosis dan Penatalaksanaan Abses Retrofaring pada Anak

    Directory of Open Access Journals (Sweden)

    Novialdi .

    2012-11-01

    Full Text Available Abstrak Pendahuluan: Abses retrofaring adalah terkumpulnya nanah di ruang retrofaring yang merupakan salah satu daerah potensial di leher dalam. Abses retrofaring merupakan kasus yang jarang tetapi dapat menyebabkan kematian terutama pada umur di bawah 5 tahun. Sejak ditemukannya antibiotika, angka kesakitan dan kematian akibat abses menurun drastis. Metode: Dilaporkan satu kasus abses retrofaring dengan riwayat ketulangan pada anak gizi kurang umur 9 tahun. Diagnosis ditegakkan berdasarkan anamnesis, pemeriksaan fisik dan pemeriksaan radiologi. Pada pemeriksaan foto polos jaringan lunak leher, terlihat gambaran pelebaran ruang retrofaring dan air fluid level. Diskusi: Penatalaksanaan meliputi pemberian antibiotika, drainase dan eksplorasi abses serta perbaikan keadaan umum. Kata kunci: abses retrofaring, benda asing, drainase Abstract Introduction: Retropharyngeal abscess is defined as accumulation pus in retropharyngeal space which is a potential area in deep neck space. Retropharyngeal abscess is a rare case but it can cause death especially in children under five years old. Since antibiotics were found, morbidity and mortality of this case was drastically decreased. Methods: A retropharyngeal abscess of child 9 years old with history of swallowed foreign body (fishbone and lack of nutrition has been reported. Diagnosis was based on anamnesis, physical examination and radiographic finding. In soft tissue cervical radiograph we found, widening of retropharyngeal space with air fluid level. Discussion: Management for abscess is intravenous antibiotics, drainage and exploration abscess and improve general condition has been performed Keywords:Retropharyngeal abscess, foreign body, drainage

  1. DAMPAK DAN PENGENDALIAN HUJAN ASAM DI INDONESIA

    OpenAIRE

    Erni M Yatim

    2007-01-01

    Hujan asam ialah turunnya asam dalam bentuk hujan. Hal ini terjadi apabila asam di udara larut dalam butirbutir air di awan. Jika hujan turun dari awan itu, air hujan bersifat asam. Asam itu terhujankan atau rainout. Hujan asam dapat pula terjadi karena hujan turun melalui udara yang mengandung asam sehingga asam itu terlarut kedalam air hujan dan turun kebumi.

  2. Twee weten meer dan een : Eindrapportage

    NARCIS (Netherlands)

    Schober, B.M.; Wertheim-Heck, S.C.O.; Oosterkamp, E.B.; Velzen, van V.N.H.; Gerretsen, J.J.A.

    2005-01-01

    Het AKK project Twee Weten Meer Dan Een wil de belangrijkste kennisthema’s en bijbehorende doelgroepen in biologische afzetketens identificeren en nagaan welke kennisverspreidingsactiviteiten, zowel binnen de projecten als binnen de biologische keten het meeste effect hebben. Behoefte en interesse v

  3. VAKSINASI IKAN TILAPIA (Oreochromis niloticus MENGGUNAKAN VAKSIN MONOVALEN DAN BIVALEN UNTUK PENCEGAHAN PENYAKIT MOTILE AEROMONAS SEPTICEMIA DAN STREPTOCOCCOSIS

    Directory of Open Access Journals (Sweden)

    Desy Sugiani

    2013-08-01

    Full Text Available Peningkatan respon antibodi pascavaksinasi dengan antigen tunggal dan campuran dari bakterin Aeromonas hydrophila and Streptococcus agalactiae diharapkan dapat meningkatkan daya tahan ikan tilapia (Oreochromis niloticus terhadap penyakit Motile Aeromonas Septicemia/MAS dan Streptococcosis. Sediaan vaksin disiapkan dengan metode pembuatan dan formula yang berbeda, proses inaktifasi dilakukan dengan menambahkan 3% Neutral Buffer Formalin (NBF 10% pada biakan bakteri dalam media tumbuh BHI dan TSB. Vaksinasi diberikan melalui injeksi intraperitoneal dengan sediaan vaksin monovalen A. hydrophila, monovalen S. agalactiae, dan bivalen A. hydrophila + S. agalactiae (Sel utuh, produk ektraselular/ECP, crude supernatan, campuran sel utuh + ECP, dan broth. Uji tantang dilakukan menggunakan dosis LD50 infeksi tunggal maupun ko-infeksi dari bakteri A. hydrophila dan S. agalactiae. Efektivitas dan keampuhan vaksin tersebut dihitung berdasarkan nilai RPS (Relative Percent Survival dan hasil respon hematologi. Titer antibodi dapat terdeteksi setelah satu minggu pemeliharaan pasca vaksinasi. Nilai titer antar perlakuan vaksin bivalen berbeda nyata (P<0.05 dengan vaksin monovalen dan kontrol. Nilai RPS vaksin bivalen (campuran sel utuh + ECP mencapai 100 untuk uji tantang dengan A. hydrophila dan 56,7 pada uji tantang ko-infeksi. Vaksin monovalen A. hydrophila maupun S. agalactiae hanya mampu memproteksi terhadap bakteri homolog, tidak terjadi proteksi silang di antara keduanya.

  4. PROFIL PROTEIN SUSU DAN PRODUK OLAHANNYA

    Directory of Open Access Journals (Sweden)

    R. Susanti

    2017-03-01

    Full Text Available Penelitian ini bertujuan untuk menganalisis kadar protein dan profil protein pada beberapa susu (susu kedelai, susu kambing dan olahannya (yogurt, tofu. Kadar protein diukur dengan metode Lowry, sedangkan profil protein dianalisis menggunakan SDS PAGE. Data yang diperoleh dianalisis secara deskriptif. Kadar protein tertinggi pada sampel yang dianalisis terdapat pada produk yogurt A (579,5 mg/ml, disusul susu kedelai (289,99 mg/ml dan susu kambing (133,1 mg/ml. Analisis profil protein terlihat pita protein dengan mobilitas terendah sampai tertinggi terletak pada berat molekul 14-150 KDa. Pita protein khas yang hanya dimiliki susu kambing adalah pita 150kDa. Sementara pita protein khas yang hanya dimiliki susu kedelai adalah pita 44 kDa dan 55kDa. Pita protein yang khas hanya dimiliki yogurt A (dengan bakteri Lactobacillus bulgaricus dan Streptococcus thermophillus adalah pita 65Da. Semua jenis susu dan olahannya memiliki pita 70kDa, kecuali susu kedelai. Profil protein susu kedelai dan tofu menunjukkan profil protein yang sangat berbeda, namun keduanya memiliki pita 18kDa.This study aimed to observe protein level and profiles on some milks (soy milk, goat's milk and dairy (yogurt, tofu product. Protein content was observed by Lowry method, whereas the protein profiles were analyzed by polyacrylamide gel electrophoresis. Data were analyzed descriptively. The highest protein content of the observed sample was in yogurt A products (579,5 mg/ml, followed by soy milk (289,99 mg/ml and goat's milk (133,1 mg/ml. Analysis of protein profiles showed protein bands with lowest to highest mobility lies in the molecular weight of 14-150 KDa. Typical protein band of goat's milk was a 150kDa band. While the typical protein bands of soy milk were 44 kDa and 55kDa band. The typical protein band of yogurt A (with Lactobacillus bulgaricus and Streptococcus thermophillus bacterium was 65Da. All types of milks and dairy had 70kDa band, except for soy milk. Protein

  5. LANDASAN PSIKOLOGI DAN AKTUALISASINYA DALAM PENDIDIKAN ISLAM

    Directory of Open Access Journals (Sweden)

    Nur Ulwiyah

    2015-04-01

    Full Text Available Pendidikan Islam memiliki peran strategis bagi pembentukan karakter peserta didik yang sangat dibutuhkannya dalam menjalani kehidupan sehari-hari, dimana dalam proses keberlangsungannya, pendidikan Islam berpijak pada nilai-nilai al-Qur’an dan Hadis. Dengan ini, pendidikan Islam merupakan pondasi penguat terhadap akhlak dan perilaku peserta didik. Namun demikian, pendidikan Islam masih perlu pula kontribusi disiplin ilmu lain sebagai faktor pendukung guna melangsungkan pendidikan secara konkret dan membumi. Salah satu disiplin ilmu itu adalah psikologi. Psikologi adalah disiplin ilmu yang mengkaji sekaligus melihat peserta didik dari sudut pandang psikis (jiwa, dimana aspek psikis harus menjadi pertimbangan para pendidik dalam proses pencapaian tujuan pendidikan. Di antara psikologi yang bisa dijadikan sebagai landasan pendidikan yaitu psikologi perkembangan, psikologi belajar, dan psikologi sosial. Pendidikan harus melihat kondisi psikologi individu dalam hal ini adalah peserta didik, utamanya dalam menyusun dan melaksanakan kurikulum sehingga tujuan pendidikan dapat tercapai secara optimal. Adapun dalam pendidikan Islam psikologi yang dijadikan sebagai acuan adalah psikologi yang berwawasan pada al-Qur’an dan Hadis. Dimana akhirnya menghasilkan output yang berorientasi ketuhanan, insan kamil bahagia di dunia dan akhirat.Islamic education a strategic role for the formation of the very character of learners needs through daily life, where in the process of its continuity, Islamic education based on the values of the Qur'an and al-Hadith. With this, Islamic education is the Foundation of the amplifier against akhlaq and behaviours learners. However, Islamic education still needs also contribute to other disciplines as the factor endowments in order to carry out the education concretely and grounded. One of the disciplines it is psychology. Psychology is a scientific discipline that examines while seeing learners from the perspective of a

  6. Musik Internal dan Eksternal dalam Kesenian Randai

    Directory of Open Access Journals (Sweden)

    Sri Rustiyanti

    2015-03-01

    Full Text Available Kehidupan musik pada masyarakat Minangkabau tidak terlepas adanya peranan serta fungsi yang melekat pada kesenian Randai. Melalui pendekatan etnomusikologi, tulisan ini menelaah peranan musik internal dan eksternal dalam kesenian Randai. Kesenian ini menggunakan medium seni ganda atau kolektif karena didukung oleh beberapa cabang seni antara lain tari, musik, teater, sastra, dan rupa. Hasil penelitian menunjukkan bahwa musik iringan dalam Randai terbagi menjadi dua, yaitu musik internal dan musik eksternal. Musik internal adalah musik atau bunyi-bunyian yang berasal dari anggota tubuh manusia (penari, misalnya tepukan tangan, petik jari, tepuk dada, siulan, hentakan kaki ke tanah dan sebagainya, sedangkan musik eksternal adalah bunyi-bunyian atau suara yang berasal dari alat musik atau instrumen seperti talempong, gandang, saluang, dan rabab.   The Role of Internal and External Music in the Arts of Randai. The musical life in Minangkabau society is inseparable from its roles and functions which attach to the arts of Randai. Through the ethnomusicology approach, this paper examines the role of internal and external music in the art of Randai. Considering its sustainability and amendment, the musicality is the identity of Minangkabau society so that the sustainability of the music can be run in accordance with the dynamics of society today. Among the types of arts in Minangkabau, Randai is an art form that uses multiple or collective art medium for it is supported by several branches of the arts, including dance, music, theater arts, literary arts, and fine arts. The results of this study is more focused on the art of music. Musical accompaniment in Randai is divided into two, namely internal and external music. The internal music is the music or the sounds that come from the human body (a dancer, for example, clapping, finger picking, patting the chest, whistling, stomping on the ground, and so on, while the external music is the sounds

  7. Diagnosis dan Penatalaksanaan Tumor Ganas Laring

    Directory of Open Access Journals (Sweden)

    Dolly Irfandy

    2015-05-01

    Full Text Available Abstrak Laring berperan dalam koordinasi fungsi saluran aerodigestif atas seperti bernafas, berbicara dan menelan.Laring terbagi tiga yaitu supraglotis, glotis dan subglotis. Laring merupakan daerah tersering kedua untuk kasuskarsinoma sel skuamosa kepala-leher, biasanya berhubungan dengan tembakau dan alkohol. Lebih dari 95% kasustumor ganas laring adalah karsinoma sel skuamosa. Pasien tumor ganas laring datang dengan berbagai keluhanseperti disfonia, obstruksi jalan napas, disfagia, odinofagi dan hemoptisis. Diagnosis tumor ganas laring ditegakkanberdasarkan anamnesis, pemeriksaan klinis menggunakan endoskopi kaku, serat optik dan biopsi. Penatalaksanaantumor ganas laring tergantung stadium dengan modalitas berupa operasi, kemoterapi, radiasi atau terapi kombinasi.Dilaporkan kasus laki-laki 53 tahun dengan karsinoma glotis stadium III (T3N0M0 squamous cell ca keratinized welldifferentiated. Penatalaksanaan pada pasien ini dengan melakukan laringektomi total.Kata kunci: Tumor ganas laring, karsinoma, laringektomi, tembakau Abstract Larynx plays a certain role in coordinating functions of the upper aerodigestive tract, such as respiration,speech, and swallowing. The larynx is divided into three region; supraglottic, glottic, and subglottic. Larynx is thesecond most common site for squamous cell carcinoma in the head and neck and usually related to tobacco andalcohol exposure. Primary malignant tumors of the larynx are squamous cell carcinomas can found more than 95% ofcases. Patients with laryngeal tumors usually present with complaints of hoarseness, respiratory obstruction,dysphagia, odynophagia and hemoptysis. Diagnosis of laryngeal cancer is made by medical history, clinicalexamination using a rigid or fiberoptic endoscope and biopsy. Management of laryngeal tumour depends on stadiumwith various modality included surgery, chemotheraphy, radiotheraphy or combined therapy. Reported case of 53years old male with Glottic carcinoma of the larynx

  8. PENGARUH KETEBALAN IRISAN DAN LAMA PEREBUSAN (BLANCHING TERHADAP GAMBARAN MAKROSKOPIS DAN KADAR MINYAK ATSIRI SIMPLISIA DRINGO (Acorus calamus L.

    Directory of Open Access Journals (Sweden)

    Heru Sudrajad

    2012-10-01

    Full Text Available Beberapa simplisia perlu mengalami proses seperti perajangan dan blanching. Perajangan dilakukan untuk mempermudah proses pengeringan, pengepakan dan penggilingan. Semakin tipis bahan yang dikeringkan, semakin cepat penguapan air yang dikandung, sehingga mempercepat waktu pengeringan. Namun irisan yang terlalu tipis menyebabkan zat yang mudah menguap seperti minyak atsiri akan berkurang kadarnya, sehingga mempengaruhi komposisi, bau dan rasa terutama pada simplisia seperti temu lawak, temu giring, jahe, kencur dan bahan sejenis lainnya. Perebusan (blanching adalah suatu proses pemanasan yang diberikan kepada bahan mentah selama beberapa menit  pada  suhu  air  mendidih yang bertujuan untuk memperbaiki kualitas produk yang diolah. Rimpang tanaman ini secara empiris digunakan sebagai insektisida, demam nifas, karminatif. disentri dan limpa bengkak. Penelitian ini bertujuan untuk melihat pengaruh ketebalan irisan dan lama perebusan (blanching terhadap gambaran makroskopis dan kadar minyak atsiri simplisia dringo (Acorus calamus L. Sebagai model digunakan Acorus calamus L. Penelitian disusun dalam rancangan acak lengkap menggunakan 2 faktor perlakuan, yaitu faktor pertama ketebalan irisan (K. yaitu K1 =2 mm, K2 =4 mm. K3 = 6 mm dan lama blanching (B yaitu BO = tanpa blanching, B 1 = 5 menit dan B2 = 10 menit. Pengamatan dilakukan terhadap kualitas (warna, bentuk permukaan dan tekstur simplisia dan kadar minyak atsiri rimpang dringo. Simplisia dengan ketebalan irisan 2 mm tanpa perlakuan blanching menghasilkan minyak atsiri lebih tinggi (4,5% dengan kualitas simplisia yang lebih baik (warna putih kekuningan, permukaan rata dan tekstur liat, mudah dipatahkan sedangkan yang hasil terendah diperoleh pada perlakuan ketebalan irisan 2 mm dengan perlakuan lama blanching 10 menit yaitu  warna simplisia coklat, keadaan fisik irisan bergelombang, permukaan keras, sukar dipatahkan dengan kadar minyak atsiri (2%. Hasil percobaan menunjukkan bahwa tebal

  9. Atomic homodyne detection of weak atomic transitions.

    Science.gov (United States)

    Gunawardena, Mevan; Elliott, D S

    2007-01-26

    We have developed a two-color, two-pathway coherent control technique to detect and measure weak optical transitions in atoms by coherently beating the transition amplitude for the weak transition with that of a much stronger transition. We demonstrate the technique in atomic cesium, exciting the 6s(2)S(1/2) --> 8s(2)S(1/2) transition via a strong two-photon transition and a weak controllable Stark-induced transition. We discuss the enhancement in the signal-to-noise ratio for this measurement technique over that of direct detection of the weak transition rate, and project future refinements that may further improve its sensitivity and application to the measurement of other weak atomic interactions.

  10. The Software Atom

    CERN Document Server

    Javanainen, Juha

    2016-01-01

    By putting together an abstract view on quantum mechanics and a quantum-optics picture of the interactions of an atom with light, we develop a corresponding set of C++ classes that set up the numerical analysis of an atom with an arbitrary set of angular-momentum degenerate energy levels, arbitrary light fields, and an applied magnetic field. As an example, we develop and implement perturbation theory to compute the polarizability of an atom in an experimentally relevant situation.

  11. The Software Atom

    Science.gov (United States)

    Javanainen, Juha

    2017-03-01

    By putting together an abstract view on quantum mechanics and a quantum-optics picture of the interactions of an atom with light, we develop a corresponding set of C++ classes that set up the numerical analysis of an atom with an arbitrary set of angular-momentum degenerate energy levels, arbitrary light fields, and an applied magnetic field. As an example, we develop and implement perturbation theory to compute the polarizability of an atom in an experimentally relevant situation.

  12. Advances in atomic spectroscopy

    CERN Document Server

    Sneddon, J

    1997-01-01

    This series describes selected advances in the area of atomic spectroscopy. It is primarily intended for the reader who has a background in atmoic spectroscopy; suitable to the novice and expert. Although a widely used and accepted method for metal and non-metal analysis in a variety of complex samples, Advances in Atomic Spectroscopy covers a wide range of materials. Each Chapter will completely cover an area of atomic spectroscopy where rapid development has occurred.

  13. Advances in atomic spectroscopy

    CERN Document Server

    Sneddon, J

    1995-01-01

    This series describes selected advances in the area of atomic spectroscopy. It is promarily intended for the reader who has a background in atmoic spectroscopy; suitable to the novice and expert. Although a widely used and accepted method for metal and non-metal analysis in a variety of complex samples, Advances in Atomic Spectroscopy covers a wide range of materials. Each Chapter will completely cover an area of atomic spectroscopy where rapid development has occurred.

  14. Atomicity in Electronic Commerce,

    Science.gov (United States)

    1996-01-01

    tremendous demand for the ability to electronically buy and sell goods over networks. Electronic commerce has inspired a large variety of work... commerce . It then briefly surveys some major types of electronic commerce pointing out flaws in atomicity. We pay special attention to the atomicity...problems of proposals for digital cash. The paper presents two examples of highly atomic electronic commerce systems: NetBill and Cryptographic Postage Indicia.

  15. MEKANISME PENGAWASAN YANG SINERGIS IMPLEMENTASI STANDAR PELAYANAN MINIMAL PENDIDIKAN DASAR DAN MENENGAH

    Directory of Open Access Journals (Sweden)

    Moerdiyanto *

    2005-01-01

    ment index, Indonesia hanya berada di peringkat 111 dari 177 negara di dunia yang disurvei. Salah satu upaya pemerintah untuk meningkatkan mutu layanan pendidikan dituangkan dalam Keputusan Mendiknas nomor 0971U/2002, tentang pengawasan penyelenggaraan pendidikan, termasuk pemenuhan standar pelayanan minimal (SPM. Pada tataran praktis justru yang harus menjadi perhatian adalah bagaimana mekanisme dan prosedur monitoring dan kontrol dilakukan, agar pelaksanaan SPM di setiap lembaga pendidikan berjalan sebagaimana mestinya. Model monitoring dan pengawasan yang intensif adalah bentuk kolaborasi yang sinergis dan produktif antara inspektorat jenderal, Bawasda Provinsi, Bawasda KabupatenlKota dan Pengawas Sekolah, dan masyarakat. Oi dalam pelaksanaan pengawasan perlu dilakukan koordinasi dan sinkronisasi melalui pembagian kekuasaan dan kewenangan pengawasan yang diatur dalam Buku Pedoman Pengawasan Standar Pelayanan Minimal. Pelaksanaan pemeriksaan kolaboratif hendaknya dilandasi oleh prinsip-prinsip sebagai berikut: (1 prinsip manajemen yaitu fungsi kontrol, (2 prinsip pengendalian yaitu memberikan bimbingan, (3 prinsip integritas yang dilandasi integritas pribadi dan profesional, (4 prinsip pemberdayaan atas kemampuan dan kinerja kelembagaan, dan (5 prinsip efektivitas dan efisiensi agar pengawasan hemat biaya, tenaga, dan waktu. Selain itu, pengawasan harus ditempuh secara prosedural, yaitu: (1 dilaksanakan secara berkala dan terpadu, (2 melakukan penilaian atas manfaat dan keberhasilan pelaksanaan program kegiatan, (3 memberikan informasi adanya kotupsi, kolusi dan nepotisme, dan penyampaian saran perbaikan, (4 dilakukan oleh pengawas yang memadai, dan (5 adanya semangat saling memberi dan menerima secara profesional, obyektif dan akuntabel yang bernuansa pemberdayaan.

  16. KANDUNGAN GIZI, RENDEMEN TEPUNG, DAN KADAR FENOL TOTAL ALPUKAT (Persea americana, Mill VARIETAS I JO PANJANG DAN I JO BUNDAR

    Directory of Open Access Journals (Sweden)

    Wuri Marsigit

    2016-04-01

    Full Text Available The aims of the study were to determine pulp proportion, dried pulp rendement, nutrient dan  total phenolic content avocado variety of Ijo Panjang dan Ijo Bundar. Variety of Ijo Panjang and Ijo Bundar were selected because both of varieties were categorized as excelent varities and recomendedto develop in Indonesia. Water, carbohydrate, protein, fat dan ash content were determined by using proxymate analysis (AOAC, vitamin A dan E using spectrophotometry method, vitamin C using titration method, dan minerals using AAS method. Total phenolic content were determined by using Follin-Cialcetau method. The result of the studies found that pulp portion Ijo Bundar Variety higher than Ijo Panjang. Water content dan zinc of Ijo Panjang variety higher than Ijo Bundar. Dried pulp rendement of Ijo Bundar higher than Ijo Panjang. Protein, fat,  ash, minerals (Fe, Na, K dan P avocado variety of Ijo Bundar higher than Ijo Panjang. Magnesium dan mangan content of both varieties have not significant different. Total phenolic content of pulp dan dried pulp were higher in Ijo Bundar than Ijo Bundar. Keywords: Pulp proportion, dried pulp rendement, nutrients dan total phenolics content   ABSTRAK Penelitian ini bertujuan untuk mengetahui proporsi daging buah, rendemen tepung, kandungan gizi dan fenol total alpukat varietas Ijo Panjang dan Ijo Bundar. Pemilihan kedua varietas tersebut karena merupakan varietas unggul dan direkomendasikan untuk dikembangkan di Indonesia. Kandungan, air, karbohidat, protein, lemak dan abu dilakukan dengan analisis proksimat (AOAC, kandungan vitamin A dan E dengan metode spektrofotometri dan vitamin C dengan metode titrasi, analisis mineral dengan metode AAS. Total fenol dianalisis dengan metode Folin-Ciocalteu. Hasil penelitian menunjukan bahwa proporsi daging buah, kadar air, seng varietas Ijo Panjang lebih tinggi dibandingkan Ijo Bundar. Rendemen tepung alpukat lebih tinggi pada varietas Ijo Bundar. Kandungan protein, lemak, abu

  17. Dephasing in an atom

    OpenAIRE

    2011-01-01

    When an atom in vacuum is near a surface of a dielectric the energy of a fluctuating electromagnetic field depends on a distance between them resulting, as known, in the force called van der Waals one. Besides this fluctuation phenomenon there is one associated with formation of a mean electric field which is equivalent to an order parameter. In this case atomic electrons are localized within atomic distances close to the atom and the total ground state energy is larger, compared to the bare ...

  18. KELUHAN DAN KEPATUHAN PENDERITA MALARIA TERHADAP PENGOBATAN MALARIA ARTESUNAT-AMODIAKUIN DI KALIMANTAN DAN SULAWESI

    Directory of Open Access Journals (Sweden)

    Mariana Raini

    2012-07-01

    . Sejak tahun 2004, Program Pemberantasan Malaria menggunakan Artemisinin-based Combination Therapy (ACT yaitu kombinasi Artesunat dan Amodiakuin (AS+AQ untuk pengobatan malaria falciparum dan vivax tanpa komplikasi sebagai pengganti obat malaria klorokuin yang telah resisten. Sejak itu implementasi AS+AQ belum pernah dievaluasi. Telah dilaporkan bahwa cakupan AS+AQ adalah 33,7% kemungkinan karena ketidakpatuhan pasien  akibat keluhan yang ditimbulkan dan formula obat yang tidak tunggal (fixed dose. Penelitian ini bertujuan untuk menilai dan mengevaluasi keluhan dan kepatuhan subyek yang mendapatkan pengobatan AS+AQ pada penderita malaria falciparum, vivax dan campuran falciparum-vivax di puskesmas sentinel di Kalimantan dan Sulawesi. Desain penelitian adalah potong lintang  melibatkan 99 subyek malaria dewasa (usia ≥15 tahun yang diobati dengan AS+AQ (Artesunat-Amodiakuin selama 3 hari sesuai dengan pedoman. Upaya tindak lanjut (follow up kepada subyek dilakukan pada hari ke 3 (H3, hari ke 7 (H7 dan hari ke 28 (H28 setelah minum AS+AQ. Di samping itu, dilakukan wawancara mendalam (kualitatif pada sejumlah subyek dan tenaga kesehatan untuk menilai Pengetahuan Sikap dan Perilaku (PSP terhadap kepatuhan pengobatan AS+AQ.Hasil penelitian : Sebagian besar subyek (92,9 % menyelesaikan terapi dan 7,1% drop out dari penelitian;  dua subyek diantaranya mengalami Serious Adverse Events (SAE, empat subyek mengalami keluhan yang tidak dapat ditolerir dan dua subyek tidak datang pada kunjungan ulang yang telah ditetapkan jadwalnya. Meskipun 84,1% mengalami keluhan setelah minum AS+AQ, namun keluhan bersifat ringan-sedang, masih dapat ditolerir dan jauh berkurang setelah 1 minggu pengobatan. Kesimpulan : pengobatan AS+AQ selama 3 hari relatif masih dapat ditoleransi dan kepatuhan subyek minum obat  masih cukup baik.

  19. KEMAJUAN TEKNOLOGI DAN POLA HIDUP MANUSIA DALAM PERSPEKTIF SOSIAL BUDAYA

    Directory of Open Access Journals (Sweden)

    Muhamad Ngafifi

    2014-06-01

    Full Text Available Makalah ini bertujuan untuk: (1 mengetahui proses perkembangan kemajuan teknologi, (2 mengetahui perubahan pola hidup manusia akibat kemajuan teknologi, (3 mengetahui pengaruh kemajuan teknologi di bidang sosial budaya, dan (4 mendapatkan solusi dalam mengatasi dampak negatif dari kemajuan teknologi. Makalah ini merupakan hasil studi pustaka yang bersumber pada buku, artikel, jurnal, dan dilengkapi dengan hasil survei tentang penggunaan teknologi modern yang digunakan sebagai teknik pengumpulan datanya. Data yang diperoleh dianalisis deskriptif secara kritis oleh penulis dengan menggunakan pendekatan teori perubahan sosial budaya. Hasil pembahasan dalam makalah ini menunjukkan sebagai berikut: (1 kemajuan teknologi terus berkembang sangat pesat dan melahirkan masyarakat digital; (2 terjadi perubahan pola hidup manusia akibat kemajuan teknologi sehingga menjadi lebih pragmatis, hedonis, sekuler, dan melahirkan generasi instan namun juga mengedepankan efektifitas dan efisiensi dalam tingkah laku dan tindakannya; (3 kemajuan teknologi berwajah ganda karena menimbulkan pengaruh positif dan negatif bagi kehidupan manusia; (4 upaya untuk menekan dan mengatasi dampak negatif dari kemajuan teknologi dapat dilakukan dengan mensinergiskan peran keluarga, pendidikan, masyarakat, dan negara.Kata kunci: teknologi, pola hidup, dan perubahan sosial budaya

  20. Efek Pengunyahan Permen Karet Gula dan Xylitol terhadap Status Saliva

    Directory of Open Access Journals (Sweden)

    Lisna Kurnia Rezky

    2016-11-01

    Full Text Available Latar belakang. Rongga mulut sebagai pintu masuk makanan ke dalam tubuh selalu dibasahi oleh saliva setiap harinya. Saat ini banyak produk permen karet yang beredar di masyarakat yang mengandung gula dan xylitol. Banyak orang yang gemar mengunyah permen karet dengan kurang memperhatikan komposisinya baik yang mengandung gula ataupun xylitol sehingga kurang mengetahui efek masing-masing jenis permen karet tersebut terhadap kesehatan rongga mulut. Tujuan. Penelitian ini bertujuan untuk mengetahui efek pengunyahan permen karet gula dengan permen karet xylitol terhadap status saliva yang terdiri dari volume, pH, dan viskositas saliva. Metode penelitian. Subjek penelitian berjumlah 30 orang dibagi menjadi 3 kelompok masing-masing 10 orang, terdiri dari kelompok mengunyah permen karet gula, xylitol, dan kontrol dengan mengunyah apel. Pengambilan saliva dilakukan pagi hari dan siang hari. Subjek mengunyah 2 butir permen karet dan tidak diperbolehkan untuk makan dan minum 1 jam sebelum mengunyah. Subjek diinstruksikan meludah ke dalam pot saliva selama 10 menit dalam interval setiap 1 menit. Pengukuran volume saliva menggunakan pipet volume, pH saliva dengan menggunakan pH meter, dan viskositas saliva dengan menggunakan viskometer Ostwald hari ke-1 dan ke-4. Analisis data dengan uji statistik Mann-Whitney. Hasil. penelitian menunjukkan adanya peningkatan bermakna volume dan viskositas saliva pada pengunyahan permen karet xylitol dan gula. Derajat keasaman (pH saliva menurun setelah mengunyah permen karet gula sedangkan pada perm en karet xylitol relatif stabil. Disimpulkan bahwa permen karet xylitollebih baik untuk kestabilan status saliva dibandingkan permen karet gula.

  1. RISIKO RELATIF KAMBUH KEMBALI (RELAPTATION DAN KEMATIAN PENDERITA XEROFTALMIA

    Directory of Open Access Journals (Sweden)

    Sukati Sukati

    2012-11-01

    Full Text Available Telah dilakukan analisis data hasil penelitlan "Rintisan Penanggulangan Kekurangan Vitamin A dan Xeroftalmia dengan Mono Sodium Glutamat (MSG yang difortifikasi Vitamin A (MSG-A" di Kecamatan Cijeruk dan Caringin, Kabupaten Bogor. Dari 8000 anak balita yang diperiksa, sebanyak 5758 anak dapat dianalisis pada evaluasi pertama dan 5612 anak dapat dianalisis pada evaluasi kedua, yang terbagi menjadi kelompok perlakuan dan pembanding. Anak Balita penderita xeroftalmia pada kelompok perlakuan selain mendapatkan vitamin A dari kapsul vitamin A dosis tinggi juga mendapatkan tambahan dari MSG-A. Sedangkan pada kelompok pembanding anak balita xeroftalmia hanya mendapatkan vitamin A dari kapsul vitamin A dosis tinggi. Hasil analisis menunjukkan bahwa risiko relatif (RR kambuh kembali anak penderlta xeroftalmia, secara keseluruhan (perlakuan dan pembanding pada evaluasi I dan II, berturut-turut sebesar 20,2 kali dan 18,2 kali dibandingkan dengan anak bukan xeroftalmia (normal. Bila dipisahkan antara kelompok perlakuan dan pembanding maka RR kambuh kembali anak penderita xeroftalmia kelompok perlakuan pada evaluasi I sebesar 28,6 kali dibandingkan dengan anak normal, dan pada evaluasi II, tidak ada anak penderita xeroftalmia yang kambuh kembali. Sedangkan di kelompok pembanding, RR kambuh kembali pada evaluasi I dan II adalah 20 kali dan 17,5 kali. Risiko relatif kematian anak penderita xeroftalmia secara keseluruhan (perlakuan dan pembanding sebesar 2,9 kali dibanding dengan anak normal. Bila dirinci menurut kelompok perlakuan dan pembanding, maka RR kematian anak penderita xeroftalmia di daerah perlakuan sebesar 3 kali dibandingkan dengan RR kematian anak normal. Sedangkan di daerah pembanding, RR kematian sebesar 5 kali dibanding dengan anak normal.

  2. ANALISA DAN EVALUASI SISA MATERIAL KONSTRUKSI SUMBER PENYEBAB KUANTITAS DAN BIAYA

    Directory of Open Access Journals (Sweden)

    Suryanto Intan

    2005-01-01

    Full Text Available Waste material is a crucial problem in building construction. By minimizing waste materials, contractors can increase their profit and minimize the environmental impacts. This research is conducted to obtain the quantities of construction waste material, influencing factors, classify waste materials into direct waste and indirect waste, and propose a cost model of construction waste materials on shop-houses projects. Data are collected by questionnaire survey and construction site observation. The research findings indicate that quantities of bricks and sand waste are the biggest. Cost model findings indicate that minimum value of waste material (good waste management practice are 3,33%, and maximum value (poor waste management practice are 4,67% of construction budget for a shop-house building, so “potential waste saving cost” is equal to 1.34%. Abstract in Bahasa Indonesia : Sisa material merupakan salah satu masalah yang serius pada konstruksi bangunan. Usaha minimalisasi sisa material konstruksi akan membantu kontraktor untuk meningkatkan keuntungan dan mengurangi dampak lingkungan. Tujuan penelitian ini adalah untuk mengetahui kuantitas sisa material dan faktor-faktor penyebab, mengkategorikan sisa material berdasarkan direct waste dan indirect waste, dan mengusulkan suatu model biaya sisa material pada proyek ruko. Data penelitian diperoleh melalui survey penyebaran kuesioner pada para pelaku konstruksi, dan pengamatan di lapangan pada komplek proyek ruko di Surabaya. Hasil penelitian menunjukkan bahwa: (1 volume sisa material batu bata dan pasir adalah yang terbesar, (2 model biaya menunjukkan nilai minimum biaya sisa material (good waste management practice sebesar 3,33%, dan nilai maksimum biaya sisa material (poor waste management practice sebesar 4,67% dari total anggaran biaya satu ruko, sehingga Potential waste saving cost menjadi 1,34%.

  3. Pengaruh Faktor Internal dan Eksternal Perusahaan Terhadap Audit Delay dan Timeliness

    Directory of Open Access Journals (Sweden)

    Sistya Rachmawati

    2008-01-01

    Full Text Available The objective of this research is to investigate the influence of the firm size, the profitability, the solvability, the public accountant size and the existence of internal auditor division toward the Audit Delay and Timeliness on manufacture companies that listed in Jakarta Stock Exchange.The Research sample was taken from Fifty-nine listed companies in Jakarta Stock Exchange. These samples were selected by using Purposive sampling method. Analysis hypothesis is using Multiple Regression, before hypothesis test, normality data test using P-Plot test.The result of Multiple Regression model shows that Audit Delay influenced by firm size and public accountant size, and Timeliness influenced by firm size and solvability. This result is recommended for auditor to increase effectiveness and efficiency of his audit performance and for all existing studies to contribute towards the current literature on Auditing. Abstract in Bahasa Indonesia: Penelitian ini bertujuan untuk mengukur pengaruh faktor internal yaitu: profitabilitas, solva¬bili¬tas, internal auditor dan size perusahaan dan faktor eksternal, yaitu ukuran KAP terhadap audit delay dan Timeliness pada perusahaan manufaktur yang terdaftar pada Jakarta Stock Exchange. Pemilihan sampel menggunakan metode Purposive Sampling. Dari hasil pengolahan Regresi Berganda pada Audit Delay diketahui bahwa koefisien determi¬nasi Adjusted R2 = 0,123. Artinya seluruh variabel independen (Profitabilitas, Solvabilitas, Internal Auditor, Size Perusahaan, dan KAP hanya mampu menjelaskan variasi dari variabel depen¬den (Audit Delay adalah sebesar 12,3%. Sedang¬kan pada Timeliness, seluruh variabel independen (Profitabilitas, Solvabilitas, Internal Auditor, Size Perusahaan, dan KAP dapat men¬jelaskan variasi pada variabel dependennya (Timeliness adalah sebesar 7,9%. Hasil dari penelitian ini dapat membantu profesi akuntan publik dalam upaya meningkatkan efisiensi dan efektivitas proses audit dengan

  4. Evanescent Wave Atomic Mirror

    Science.gov (United States)

    Ghezali, S.; Taleb, A.

    2008-09-01

    A research project at the "Laboratoire d'électronique quantique" consists in a theoretical study of the reflection and diffraction phenomena via an atomic mirror. This poster presents the principle of an atomic mirror. Many groups in the world have constructed this type of atom optics experiments such as in Paris-Orsay-Villetaneuse (France), Stanford-Gaithersburg (USA), Munich-Heidelberg (Germany), etc. A laser beam goes into a prism with an incidence bigger than the critical incidence. It undergoes a total reflection on the plane face of the prism and then exits. The transmitted resulting wave out of the prism is evanescent and repulsive as the frequency detuning of the laser beam compared to the atomic transition δ = ωL-ω0 is positive. The cold atomic sample interacts with this evanescent wave and undergoes one or more elastic bounces by passing into backward points in its trajectory because the atoms' kinetic energy (of the order of the μeV) is less than the maximum of the dipolar potential barrier ℏΩ2/Δ where Ω is the Rabi frequency [1]. In fact, the atoms are cooled and captured in a magneto-optical trap placed at a distance of the order of the cm above the prism surface. The dipolar potential with which interact the slow atoms is obtained for a two level atom in a case of a dipolar electric transition (D2 Rubidium transition at a wavelength of 780nm delivered by a Titane-Saphir laser between a fundamental state Jf = l/2 and an excited state Je = 3/2). This potential is corrected by an attractive Van der Waals term which varies as 1/z3 in the Lennard-Jones approximation (typical atomic distance of the order of λ0/2π where λ0 is the laser wavelength) and in 1/z4 if the distance between the atom and its image in the dielectric is big in front of λ0/2π. This last case is obtained in a quantum electrodynamic calculation by taking into account an orthornormal base [2]. We'll examine the role of spontaneous emission for which the rate is inversely

  5. KARAKTERISASI FILM KOMPOSIT ALGINAT DAN KITOSAN

    Directory of Open Access Journals (Sweden)

    Nur Rokhati

    2012-11-01

    Full Text Available CHARACTERIZATION OF ALGINATE AND CHITOSAN COMPOSITE FILM. Due to the specific characteristics of (thin films, the use of polymer films in various aplications has singnificantly increased. Alginate and chitosan are natural polymers, which have potential as a raw material for the manufacture of composite films. This paper presents the preparation and characterization of alginate, chitosan and chitosan-alginate composite films. The film characterization included permeability test, degree of swelling, mechanical property, morphology (by SEM, and surface chemistry (by FTIR. The results showed that alginate films have a higher permeability ​​and degree of swelling (DS than chitosan films. Both permeability and DS decreased with increasing concentration for both alginate and chitosan films. DS experiments showed that the films have the highest DS in water followed by ethanol 95% and ethanol >99.9%, respectively. The mechanical strength of chitosan films was larger than alginate films. Alginate-chitosan composite films prepared by layer by layer method showed better characteristics than the composite films prepared by blending of alginate and chitosan solutions. Meningkatnya aplikasi film polimer di berbagai industri tidak terlepas dari keunggulan yang dimiliki. Alginat dan kitosan merupakan polimer alam yang mempunyai potensi sebagai bahan dasar pembuatan film komposit. Pada penelitian ini dilakukan pembuatan dan karakterisasi film komposit berbasis alginat dan kitosan. Karakterisasi film yang dilakukan meliputi uji: permeabilitas, derajat swelling, mekanik, morfologi (dengan SEM, dan struktur kimia permukaan (dengan FTIR. Hasil penelitian menunjukkan bahwa film alginat mempunyai nilai permeabilitas maupun derajat swelling yang lebih tinggi dibanding dengan film kitosan. Baik pada kitosan maupun alginat memberikan fenomena bahwa semakin besar konsentrasi larutan maka semakin kecil nilai permeabilitas maupun derajat swelling, dengan derajat

  6. Asupan Gizi dan Mengantuk pada Mahasiswa

    Directory of Open Access Journals (Sweden)

    Sada Rasmada

    2012-10-01

    Full Text Available Asupan nutrisi dan energi, status nutrisi, serta aktivitas harian berpengaruh pada kejadian mengantuk yang berpengaruh negatif pada konsentrasi dan produktivitas belajar pada mahasiswa. Kejadian mengantuk berhubungan dengan penurunan kemampuan kognitif yang disebabkan oleh defisiensi zat besi. Seseorang yang mengantuk akan mengalami penurunan aktivitas fisik yang menyebabkan kelebihan berat badan sehingga berisiko lebih tinggi untuk terkena penyakit degeneratif seperti penyakit kardiovaskular dan diabetes melitus. Penelitian ini bertujuan untuk menganalisis faktor dominan yang berpengaruh pada kejadian mengantuk di kalangan mahasiswa. Penelitian dengan desain studi cross sectional ini dilakukan terhadap sampel 139 mahasiswa Fakultas Kesehatan Masyarakat Universitas Indonesia. Proporsi mahasiswa yang hampir mengantuk sekitar 28,80%. Terdapat hubungan yang signifikan antara durasi tidur dan masalah kantuk (nilai p = 0,048. Mahasiswa dengan durasi tidur < 8 jam per hari mengalami kejadian mengantuk 0,50 kali lebih besar daripada mahasiswa dengan durasi tidur ³ 8 jam per hari. Faktor dominan yang berhubungan dengan kejadian mengantuk adalah durasi tidur setelah dikontrol dengan asupan protein dan lemak, aktivitas fisik, dan paparan media. Mahasiswa yang sering mengantuk memperlihatkan asupan zat besi rendah sehingga disarankan untuk meningkatkan asupan zat besi yang berasal dari sumber makanan yang mengandung heme. Kata kunci: Asupan nutrisi, aktivitas fisik, konsentrasi, masalah kantuk Abstract Nutrient and energy intake, nutrition status, and daily activity could give impact for sleepiness problem. Sleepiness related to the decreasing of cognitive ability that caused by iron deficiency. A person who feels sleepy will have a lack of physical activities that lead to overweight and therefore has a higher risk to suffer degenerative diseases such as cardiovascular and diabetes mellitus. This study aimed to analyze dominant factor that can give

  7. Greek Atomic Theory.

    Science.gov (United States)

    Roller, Duane H. D.

    1981-01-01

    Focusing on history of physics, which began about 600 B.C. with the Ionian Greeks and reaching full development within three centuries, suggests that the creation of the concept of the atom is understandable within the context of Greek physical theory; so is the rejection of the atomic theory by the Greek physicists. (Author/SK)

  8. Atoms, Molecules, and Compounds

    CERN Document Server

    Manning, Phillip

    2007-01-01

    Explores the atoms that govern chemical processes. This book shows how the interactions between simple substances such as salt and water are crucial to life on Earth and how those interactions are predestined by the atoms that make up the molecules.

  9. Atomic Scale Plasmonic Switch.

    Science.gov (United States)

    Emboras, Alexandros; Niegemann, Jens; Ma, Ping; Haffner, Christian; Pedersen, Andreas; Luisier, Mathieu; Hafner, Christian; Schimmel, Thomas; Leuthold, Juerg

    2016-01-13

    The atom sets an ultimate scaling limit to Moore's law in the electronics industry. While electronics research already explores atomic scales devices, photonics research still deals with devices at the micrometer scale. Here we demonstrate that photonic scaling, similar to electronics, is only limited by the atom. More precisely, we introduce an electrically controlled plasmonic switch operating at the atomic scale. The switch allows for fast and reproducible switching by means of the relocation of an individual or, at most, a few atoms in a plasmonic cavity. Depending on the location of the atom either of two distinct plasmonic cavity resonance states are supported. Experimental results show reversible digital optical switching with an extinction ratio of 9.2 dB and operation at room temperature up to MHz with femtojoule (fJ) power consumption for a single switch operation. This demonstration of an integrated quantum device allowing to control photons at the atomic level opens intriguing perspectives for a fully integrated and highly scalable chip platform, a platform where optics, electronics, and memory may be controlled at the single-atom level.

  10. When Atoms Want

    Science.gov (United States)

    Talanquer, Vicente

    2013-01-01

    Chemistry students and teachers often explain the chemical reactivity of atoms, molecules, and chemical substances in terms of purposes or needs (e.g., atoms want or need to gain, lose, or share electrons in order to become more stable). These teleological explanations seem to have pedagogical value as they help students understand and use…

  11. DAN IDENTIFIKASI PATOGEN POTENSIAL YANG MENGINFEKSI IKAN RAINBOW (Melanotaenia sp.

    Directory of Open Access Journals (Sweden)

    Lili Sholichah

    2014-03-01

    Full Text Available Pemeliharaan ikan rainbow (Melanotaenia sp. di Balai Penelitian dan Pengembangan Budidaya Ikan Hias selalu terjadi kematian secara bertahap mulai calon induk hingga proses pemijahan. Hal ini terjadi berulang kali sehingga ketersediaan induk Melanotaenia sp. sangat terancam. Ikan ini berasal dari Papua yang diperoleh mengandalkan penangkapan di alam. Tujuan dari penelitian ini adalah untuk menginventarisir dan mengidentifikasi berbagai patogen (parasit, jamur, bakteri potensial yang menginfeksi ikan rainbow yang dipelihara di dalam akuarium berukuran 50 cm x 50 cm x 50 cm dengan sistem aliran air stagnan. Tiga jenis rainbow yang dipelihara yaitu: rainbow Sungai Salawati, asal Sungai Sawiat, dan asal Danau Kurumoi. Setiap ikan masing-masing berjumlah 100 ekor dipelihara di akuarium dengan penambahan batu karang dan tanpa penambahan karang (kontrol ke dalam akuarium. Ikan diberi pakan sekenyangnya berupa jentik nyamuk dan cacing rambut beku setiap pagi dan sore hari. Sampling dilakukan secara random sebulan sekali dan secara unrandom setiap ada kejadian ikan sakit. Gejala klinis ikan yang sakit sebagai berikut: ikan berenang di permukaan dan menggosok-gosokkan badan di dinding akuarium, nafsu makan berkurang, gerakan berputar-putar, warna memudar menjadi putih, penekanan warna hitam pada sirip punggung dan perut meningkat, pendarahan pada perut, lendir berlebihan dan sangat berbau, serta sisik berdiri/terbuka. Diagnosa dan deteksi penyakit awal berupa pengamatan parasit baik ektoparasit maupun endoparasit, pengamatan dan isolasi jamur pada media selektif jamur, dan isolasi bakteri dilakukan untuk mengetahui jenis-jenis patogen yang menginfeksi ketiga jenis ikan rainbow. Selanjutnya dilakukan uji histologi dan analisa DNA beberapa patogen. Hasil pengamatan diperoleh patogen berupa parasit (Ichthyophthirius sp., Dactylogyrus sp., Gyrodactylus sp., dan Trichodina sp. dan bakteri (Aeromonas hydrophila, Acinetobacter sp

  12. STATUS PEMANFAATAN DAN PENGELOLAAN SUMBERDAYA IKAN TUNA NERITIK DI SAMUDERA HINDIA WPP 572 DAN 573

    Directory of Open Access Journals (Sweden)

    Agustinus Anung Widodo

    2014-05-01

    Full Text Available Dalam rangka mendeskripsikan status pemanfaatan dan pengelolaan sumberdaya tuna neritik di perairan Samudera Hindia (WPP 572 dan 573 telah dilakukan analisis terhadap informasi tentang jenis dan produksi tuna neritik yang disajikan dalam Statistik Perikanan Tangkap di Laut Menurut WPP tahun 2005-2012 (DJPT, 2013 serta data hasil penelitian berbasis di PPS Cilacap dan PPN Sibolga tahun 2011. Rekomendasi ‘working party’ tentang tuna neritik dari IOTC dikaji sebagai langkah pengelolaan perikanan tuna neritik di Indonesia. Hasil analisis dan kajian menunjukkan bahwa sumberdaya ikan tuna neritik yang tertangkap nelayan Indonesia di perairan WPP 572 dan 573 meliputi tongkol lisong (Auxis rochei, tongkol krai (Auxis thazard, tongkol komo atau kawakawa (Euthynnus affinis dan tongkol abu-abu (Thunnus tonggol. Tuna neritik tertangkap sebagai by-product dari pukat cincin, jaring insang hanyut, pancing tonda, pancing ulur dan bagan. Tahun 2011 produksi neritik tuna di Samudera Hindia khususnya WPP 572 dan 573 mencapai 121.818 ton atau 29,4% dari total produksi tuna neritik nasional. Tuna neritik jenis tongkol lisong dan krai yang tertangkap jaring insang hanyut yang berbasis di Cilacap > 70% merupakan ikan yang telah dewasa. Adapun tongkol komo yang tertangkap pukat cincin yang berbasis di Sibolga sekitar 55,5% merupakan ikan dewasa. Belum ada langkah-langkah pengelolaan secara spesifik terhadap sumberdaya tuna neritik di Indonesia. Merujuk hasil Working Party on Neritic Tuna pertama dan kedua tahun 2011 dan 2012, Indian Ocean Tuna Commission (IOTC merekomendasikan adanya kerjasama antar negara anggota IOTC yang saling berdekatan didalam melakukan pengelolaan sumberdaya neritik tuna. Langkah pertama adalah dilakukan perelitian mengenai populasi melalui studi mtDNA untuk memastikan status stok dan populasinya.   The species of neritic tuna caught by fishers in the Indian Ocean particularly FMAs 572 and 573 consisted of frigate tuna (Auxis thazard

  13. Perbandingan Inklinasi dan Ukuran Rahang antara Orang Jawa Buta dan Normal

    Directory of Open Access Journals (Sweden)

    C. Christnawati

    2016-10-01

    Full Text Available Latar Belakang. Penglihatan merupakan salah satu faktor yang diperlukan untuk mengontrol postur kepala. Postur kepala berhubungan dengan kompleks kraniofasial. Maksila dan mandibula merupakan bagian dari kompleks kraniofasial. Pada orang buta terjadi penyimpangan pertumbuhan dan perkembangan daerah orbita karena tidak adanya rangsang. Tujuan Penelitian adalah untuk mempelajari perbandingan inklinasi dan ukuran rahang berdasarkan jenis kelamin antara orang Jawa buta dan normal. Metode Penelitian. Penelitian ini dilakukan terhadap 53 subjek, terdiri dari 25 orang buta ( 12 orang laki-laki dan 13 orang perempuan dan 28 orang normal (14 orang laki-laki dan 14 orang perempuan. Setiap subjek penelitian dilakukan pengambilan sefalogram lateral pada posisi alamiah kepala, kemudian dilakukan penapakan pada kertas kalkir di atas iluminator. Pengukuran sembilan parameter inklinasi dan ukuran maksila dan mandibula dilakukan pada hasil penapakan. Data dianalisis dengan uji Anava dua jalur. Hasil penelitian menunjukkan bahwa terdapat perbedaan yang tidak bermakna (p<0,05. Panjang mandibula dan panjang basis mandibula laki-laki normal lebih besar daripada perempuan normal dan kelompok buta, serta perempuan normal lebih besar daripada perempuan buta (p<0,05. Kesimpulan Ukuran maksila laki-laki buta lebih besar daripada perempuan normal. Panjang mandibula dan panjang basis mandibula laki-laki normal lebih besar daripada perempuan normal lebih besar daripada perempuan normal, laki-laki buta, dan perempuan buta, serta perempuan normal lebih besar daripada perempuan buta.   Background Vision is one of the factors involved in the control of head posture. The posture of the head is related to craniofacial complex. Maxilla and mandible are part of craniofacial complex. In the blind there are deviations of growth and development of the orbital region in the absence of stimuli. The purpose of this study was to compare the inclinations and sizes of maxilla and mandible

  14. Regret Aversion Bias dan Risk Tolerance Investor Muda Jakarta dan Surabaya

    Directory of Open Access Journals (Sweden)

    Yohnson Yohnson

    2008-01-01

    Full Text Available Investment decision behavior is an interesting topic in finance research. Bailey and Kinerson’s (2005 research found that individual risk tolerance and experienced regret significantly influenced investment decisions. Anticipation of potential future regret did not predict subsequent investment decision behavior. Specifically, this research also wants to know the effects of a person’s experienced regret and anticipated regret or the effects of individual risk tolerance on investment decision behavior in Jakarta and Surabaya. Respondent of this research is 323 students from UK Petra who represent young investors from Surabaya and students from UPH who represent young investors from Jakarta. The method of research is experimental study and the design of research is 2x2x2 (between subject with experienced regret (time deposit and stock as first variable, anticipated regret (time deposit and stock as second variable and risk tolerance (high and low as third variable This study finds that an individual risk tolerance significantly influences decisions. Regret aversion bias does not influence young investors in Indonesia. (We assume that it is because the character of Indonesian investors is different from foreign investors. The couse of this is supposedly the unique characteristics of Indonesian investors and the different view points between Indonesian investors and investors from other countries. Abstract in Bahasa Indonesia: Perilaku keputusan investasi sangat menarik untuk diteliti. Dalam penelitian Bailey dan Kinerson (2005 ditemukan risk tolerance dan experienced regret mempengaruhi keputusan investasi. Anticipated regret tidak dapat dipakai sebagai predictor perilaku keputusan investasi. Penelitian ini juga ingin mengetahui experienced regret, anticipated regret atau risk tolerance yang lebih mempengaruhi perilaku keputusan investasi di Jakarta dan Surabaya. Responden yang diteliti sebesar 323 mahasiswa berasal dari UK Petra yang mewakili

  15. Maximally Atomic Languages

    Directory of Open Access Journals (Sweden)

    Janusz Brzozowski

    2014-05-01

    Full Text Available The atoms of a regular language are non-empty intersections of complemented and uncomplemented quotients of the language. Tight upper bounds on the number of atoms of a language and on the quotient complexities of atoms are known. We introduce a new class of regular languages, called the maximally atomic languages, consisting of all languages meeting these bounds. We prove the following result: If L is a regular language of quotient complexity n and G is the subgroup of permutations in the transition semigroup T of the minimal DFA of L, then L is maximally atomic if and only if G is transitive on k-subsets of 1,...,n for 0 <= k <= n and T contains a transformation of rank n-1.

  16. Coaxial airblast atomizers

    Science.gov (United States)

    Hardalupas, Y.; Whitelaw, J. H.

    1993-01-01

    An experimental investigation was performed to quantify the characteristics of the sprays of coaxial injectors with particular emphasis on those aspects relevant to the performance of rocket engines. Measurements for coaxial air blast atomizers were obtained using air to represent the gaseous stream and water to represent the liquid stream. A wide range of flow conditions were examined for sprays with and without swirl for gaseous streams. The parameters varied include Weber number, gas flow rate, liquid flow rate, swirl, and nozzle geometry. Measurements were made with a phase Doppler velocimeter. Major conclusions of the study focused upon droplet size as a function of Weber number, effect of gas flow rate on atomization and spray spread, effect of nozzle geometry on atomization and spread, effect of swirl on atomization, spread, jet recirculation and breakup, and secondary atomization.

  17. Atomic diffusion in stars

    CERN Document Server

    Michaud, Georges; Richer, Jacques

    2015-01-01

    This book gives an overview of atomic diffusion, a fundamental physical process, as applied to all types of stars, from the main sequence to neutron stars. The superficial abundances of stars as well as their evolution can be significantly affected. The authors show where atomic diffusion plays an essential role and how it can be implemented in modelling.  In Part I, the authors describe the tools that are required to include atomic diffusion in models of stellar interiors and atmospheres. An important role is played by the gradient of partial radiative pressure, or radiative acceleration, which is usually neglected in stellar evolution. In Part II, the authors systematically review the contribution of atomic diffusion to each evolutionary step. The dominant effects of atomic diffusion are accompanied by more subtle effects on a large number of structural properties throughout evolution. One of the goals of this book is to provide the means for the astrophysicist or graduate student to evaluate the importanc...

  18. METODE ANUITAS DAN PROPORSIONAL MURABAHAH SEBAGAI BENTUK TRANSPARANSI DAN PUBLIKASI LAPORAN BANK

    Directory of Open Access Journals (Sweden)

    Mr Faisal

    2015-02-01

    Full Text Available Proportional and annuity methods are based on PBI 14/14/PBI/2012 on Transparency and Publication Reports of Islamic Banking and SEBI No. 15/26/DPbs/2013 on Implementation of Accounting Guidelines of Islamic Banking in Indonesia. These methods are forms of commitment to bring transparency in the Islamic banks and recognition on financial statement of profit on murabaha. The Annuity method is referred to PSAK 50, PSAK 55 and PSAK 60 because the substance is classified as a form of financing. Proportional method is referred to PSAK 102 because the substance is classified as trading activities. Metode anuitas dan proporsional didasarkan pada PBI No. 14/14/PBI/2012 tentang Transparansi dan Publikasi Laporan Bank Syariah dan SEBI No. 15/26/DPbs/2013 tentang Pelaksanaan Pedoman Akuntansi Perbankan Syariah Indonesia. Metode tersebut merupakan bentuk komitmen bank syariah dalam mewujudkan transparansi dan laporan keuangan pada pengakuan keuntungan murabahah. Metode anuitas mengacu pada PSAK 50, PSAK 55, dan PSAK 60 karena secara substansi dikategorikan sebagai bentuk pembiayaan. Metode proporsional mengacu pada PSAK 102 karena secara substansi dikategorikan sebagai bentuk kegiatan jual beli.

  19. IMPLEMENTASI E-POSYANDU UNTUK MONITORING PERKEMBANGAN KESEHATAN DAN GIZI IBU DAN ANAK

    Directory of Open Access Journals (Sweden)

    - Sumardi

    2012-11-01

    Full Text Available Salah satu kegiatan Posyandu adalah untuk memonitoring gizi anak pada daerah sekitarnya. Memonitoring dilakukan oleh Kader Posyandu dengan mencatat dan melaporkan sesuai dengan format yang diberikan oleh puskesmas. Informasi yang dihasilkan berupa status gizi anak, daftar anak pengikut penimbangan, daftar anak yang melakukan imunisasi, dan data kematian anak. Selama ini penyampaian informasi belum menghasilkan lengkap, akurat, jelas, dan tepat waktu. Hal ini tentunya menjadi masalah dalam memonitoring gizi anak pada suatu Posyandu. Sistem dikembangkan dengan bahasa pemrograman PHP dan database dengan PHPMyAdmin. Desain sistem meliputi form login admin, form pengolahan daftar anak, form pengolahan layanan anak, form pengolahan catatan imunisasi, form data kematian, form daftar imunisasi. Untuk menghasilkan laporan pengolahan data dibuat dalam bentuk pdf agar tidak terjadi manipulasi informasi. Sistem ini diharapkan mampu mengatasi permasalahan yang berhubungan dengan kualitas informasi, berupa : ketersedian informasi saat dibutuhkan secara cepat, sudah dalam bentuk komputerisasi, tidak ada keterlambatan pelaporan hasil pengolahan data, dan hasil pengolahan data sesuai dengan keadaan yang ada. Pada tahap akhir pembuatan produk akan dilakukan evaluasi untuk memaksimalkan fungsinya. Kata kunci: E-Posyandu, monitoring, gizi anak, web report, Puskesmas

  20. Artikula Takrif dan Taktakrif dalam Bahasa Inggris (Kajian Sintaksis dan Semantik

    Directory of Open Access Journals (Sweden)

    Iis Kurnia Nurhayati

    2013-05-01

    Full Text Available The research is to discuss definiteness in English. The method used is analytical descriptive. For the analysis, substitution technique as one of the distributional methods is used. The data sources are non-fiction papers in English magazines and newspapers. The results show that the noun phrase having an article and followed by a post-modification can be formed in various constructions based on the type of nouns as the head of NP and the type of post-modifications that complete the phrase. In addition, some factors determining the choice of the articles in NP are based on the type and the number of the noun, and the knowledge of speakers and hearers about the noun.   Penelitian ini untuk membahas ketakrifan dalam bahasa Inggris. Metode yang digunakan adalah deskriptif analitis. Untuk menganalisis, teknik substitusi sebagai salah satu metode distribusional digunakan. Sumber data adalah tulisan nonfiksi yang terdapat dalam majalah dan surat kabar berbahasa Inggris. Hasilnya menunjukkan bahwa frase nomina yang memiliki artikula dan diikuti oleh post modification dapat dibentuk dalam konstruksi yang berbeda tergantung pada jenis nomina yang menjadi frasa benda ini dan jenis postmodifikator yang melengkapi frasa itu. Di samping itu, beberapa faktor yang menentukan pilihan artikula dalam frase nomina didasarkan pada jenis dan jumlah nomina, serta pengetahuan penutur dan mitra tuturnya tentang nomina itu.

  1. INFEKSI VIRUS HEPATITIS B DAN HEPATITIS C PADA PENDERITA HEPATITIS KRONIS DAN HEMODIALISIS DI JAKARTA

    Directory of Open Access Journals (Sweden)

    Djoko Yuwono

    2012-10-01

    Full Text Available Virus Hepatitis C dan Hepatitis B merupakan penyebab hepatitis kronik aktif yang dapat berkembang menjadi hepatoselular karsinoma. Untuk mengetahui peranan kedua jenis virus tersebut sebagai penyebab hepatoselular karsinoma, telah dilakukan pemeriksaan HbsAg, anti-VHC dan RNA-VHC pada 17 penderita hepatitis kronis. 19 Pasien hemodialisis dan 198 donor darah PMI. Pemeriksaan HbsAg dilakukan dengan RPHA Cell: pemeriksaan anti-VHC dengan dipstik anti-VHC kit diagnotik produksi NTB Mataram, Lombok. Deteksi RNA-VHC dilakukan dengan teknik RT-PCR, menggunakan primer spesifik untuk daerah 5'NCR. Hasil pemeriksaan menunjukkan bahwa pada penderita hepatitis kronis ditemukan 5 orang (23,5% positif HbsAg dan 1 orang (5,8% anti-VHC. Pada penderita hemodialisis ditemukan 14 orang (73,6% positif anti-VHC, persentase anti-VHC meningkat sesuai dengan meningkatnya frekuensi hemodialisis. Pada donor darah PMI ditemukan 5 orang (2,2% positif HbsAg dan tidak satupun ditemukan anti-VHC positif.

  2. STRUKTUR META TEORI AKUNTANSI KEUANGAN (Sebuah Telaah dan Perbandingan antara FASB dan IASC

    Directory of Open Access Journals (Sweden)

    I Made Narsa

    2007-01-01

    Full Text Available The objectives of this paper is to analyses the structure of meta-theoretical of financial accounting that was used by FASB and IASC to develop the conceptual framework for financial accounting reporting. The discussion of conceptual framework conducted by comparison of the basic different between the FASB and IASC framework, then analyses the constraints to implement IFRS and identify the way out of the constraints faced by the body. Abstract in Bahasa Indonesia : Penelitian ini bertujuan untuk membahas struktur meta teori yang dipergunakan oleh FASB dan IASC dalam mengembangkan rerangka konseptual, menelaah perbedaan-perbedaan mendasar, menganalisis hambatan-hambatan yang dialami serta mengidentifikasi upaya-upaya yang harus dilakukan agar IFRS diterapkan oleh negara-negara anggota. Penelitian ini dilakukan dengan cara membandingkan rerangka dasar yang diatur dalam FASB dan IASC dan kemudian menganalisa hambatan yang timbul dengan adanya penerapan IFRS dan mengidentifikasi bagaimana hambatan tersebut dapat diselesaikan. Kata kunci: globalisasi, harmonisasi, meta teori, FASB dan IASC, kerangka dasar, akuntansi keuangan

  3. Svetislav Basara, Perdu dans un supermarché

    Directory of Open Access Journals (Sweden)

    Katia Vandenborre

    2008-10-01

    Full Text Available Tomber amoureux dans le jazz de la nature quand on est pris d’élancements dans le bras. Souffrir d’un incurable serpent dans le sein après que sa mère ait été enlevée par des esclavagistes. Se dégonfler à la brûlure de cigarette lors d’une boum fatale. Discuter avec Dieu par téléphone dans un supermarché. Telles sont les aventures plus loufoques les unes que les autres dont Svetislav Basara nous tisse le décousu dans Perdu dans un supermarché. Ce recueil réunit une vingtaine de nouvelles liée...

  4. PENGARUH PEMBERIAN PUPUK HIJAU CAIR KIHUJAN (Samanea saman) DAN AZOLLA (Azolla pinnata) TERHADAP KANDUNGAN SELULOSA DAN HEMISELULOSA RUMPUT GAJAH (Pennisetum purpureum)

    OpenAIRE

    KARIMUDDIN, KHAERUN NUR

    2016-01-01

    2016 KHAERUN NUR KARIMUDDIN (I11111018). Pengaruh Pemberian Pupuk Hijau Cair Ki hujan (Samanea saman) dan Azolla (Azolla pinnata) Terhadap Kandungan Selulosa dan Hemiselulosa Rumput Gajah (Pennisetum purpureum). Dibawah bimbingan SYAMSUDDIN NOMPO sebagai pembimbing utama dan MARHAMAH NADIR sebagai pembimbing anggota. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian pupuk hijau cair dari tanaman Ki hujan (Samanea saman), dan Azolla (Azolla pinnata) terhadap ...

  5. PENGARUH PROFESIONALISME , KOMITMEN ORGANISASI DAN KEPUASAN KERJA TERHADAP KINERJA INTERNAL AUDITOR (Studi Empiris pada Inspektorat Daerah Kabupaten Pinrang dan Kota Parepare)

    OpenAIRE

    ACHMAD A.M., FADLY

    2016-01-01

    2016 Penelitian ini bertujuan untuk menguji : (1) pengaruh profesionalisme dan kepuasan kerja terhadap kinerja internal auditor, (2) pengaruh komitmen organisasi dan kepuasan kerja terhadap kinerja internal auditor. Pengumpulan data dengan menggunakan kuesioner yang diberikan kepada 60 (enam puluh) orang internal auditor (inspektorat Kabupaten Pinrang dan Kota Parepare) dan dikembalikan sebanyak 45 (empat puluh lima) kuesioner. Hasil penelitian ini menunjukkan sebesar 66,...

  6. RADIKALISME ISLAM DAN UPAYA DERADIKALISASI PAHAM RADIKAL

    Directory of Open Access Journals (Sweden)

    Abu Rokhmad

    2012-05-01

    Lembaga-lembaga pendidikan diduga tidak kebal terhadap pengaruh ideologi radikal. Penelitian ini menyimpulkan bahwa: (1 Beberapa guru mengakui ada­nya konsep Islam radikal yang mungkin menyebar di kalangan siswa karena kurangnya pengetahuan keagamaan; (2 Unit-unit kajian Islam di sekolah-sekolah berkembang baik namun tidak ada jaminan adanya kekebalan dari radikalisme karena proses belajarnya diserahkan kepada pihak ketiga; (3 Di dalam buku rujukan dan kertas kerja terdapat beberapa pernyataan yang dapat mendorong siswa untuk membenci agama atau bangsa lain. Dapat disimpulkan  bahwa ada beberapa strategi deradikalisasi yang dapat diimplementasikan  yaitu deradikalisasi preventif, deradikalisasi preservatif terhadap Islam mo­derat, dan deradikalisasi kuratif.

  7. Les convertisseurs statiques dans leur environnement

    OpenAIRE

    Ginot, Nicolas

    2013-01-01

    Les travaux présentés dans ce mémoire en vue d’obtenir le diplôme d’Habilitation à Diriger des Recherches se décomposent en trois principales parties. Ce document témoigne de l’évolution de mes activités de recherches effectuées dans un cadre industriel puis universitaire. L’électronique de puissance, et plus généralement la conversion statique de l’énergie électrique, est le pivot de ces travaux qui mettent en avant des domaines connexes comme l’émulation Hardware In the Loop, la modélisatio...

  8. REFORMASI EKONOMI, KONSENSUS WASHINGTON, DAN RINTANGAN POLITIK

    Directory of Open Access Journals (Sweden)

    Ahmad Erani Yustika

    2004-01-01

    Full Text Available In the practice of policy reform, the new thinking in development theorizing found its expression in the formulation of the so-called Washington Consensus. Triggered by widespread government failures, the Washington Consensus is based on stabilization-cum-adjustment policies recommended by the Bretton Woods organizations and US economic officials. It emphasizes the need for prudent macroeconomic and financial policies, unified and competitive exchange rates, trade and financial liberalization, privatization, and deregulation. However, because of neglecting political domain, the running of economic reform resulted a deeper economic crisis. Beside, in the implementation phase, economic reform process often meet political barriers. At least three political barriers often fail economic reform program. First, collective action problems arise to the extent that economic reforms have the properties of a public good, either for the society as a whole or for a large number of potential beneficiaries. Second, In a distributive model, policy reform is supported by winners and opposed by losers, and the outcome is given by the balance of political power between the respective action. Third, one classic problem with many reforms is that the costs of reform tend to be concentrated, while benefits are diffuse, producing perverse organizational incentives (Haggard dan Kaufman, 1995:156-157. Argentina and Mexico cases show that economic reform can failure due to polical barriers. Abstract in Bahasa Indonesia : Dalam pelaksanaan kebijakan reformasi, teori pembangunan mutakhir telah menemukan konsep baru yang diformulasikan dalam istilah yang biasa disebut dengan Konsensus Washington. Dipicu oleh kegagalan pemerintah yang semakin meluas dalam mengelola kegiatan ekonomi, konsep Konsensus Washington berpijak pada upaya stabilisasi melalui kebijakan penyesuaian struktural, yang direkomendasikan oleh organisasi Bretton Woods dan Badan Ekonomi Amerika Serikat

  9. LIMBAH CAIR INDUSTRI KECIL DAN PENCEMARAN

    Directory of Open Access Journals (Sweden)

    Kumoro Palupi

    2012-10-01

    Full Text Available Beberapa jenis industri kecil yang banyak tersebar, antara lain adalah pabrik tempe, tabu, kecap, dan sirup. Kualitas limbah yang dihasilkan industri-industri tersebut sangat jauh dari memenuhi syarat. Selain itu, limbah cair tersebut dibuang langsung ke saluran terbuka/tertutup yang bermuara di badan-badan air terdekat.Untuk mengurangi besamya beban pencemaran, sejak tahun 1989 pemerintah DKI Jakarta mengadakan Program Kali Bersih  (Prokasih. Sasaran progam adalah penurunan beban pencemaran dari sumbemya secara bertahap sehingga kualitas air sungai akan menjadi lebih baik. Sumber pencemaran yang menjadi sasaran dalam Prokasih adalah industri-industri skala besar dan menengah, sedangkan industri-industri kecil belum termasuk sasaran Prokasih untuk sementara waktu ini. 

  10. Lipa Sabbe??? Sengkang: Identitas dan Tantangan Teknologi Sarung Sutera Bugis

    OpenAIRE

    Tahara, Tasrifin

    2013-01-01

    Makalah ini menguraikan teknologi sarung sutera Bugis yang sudah terkenal sejak lama bagi masyarakat Bugis sejak tahun 1785 dan menjadi identitas budaya lokal yang terkenal hingga ke manca negara. Namun pada perkembangannya industri sarung sutera Bugis mendapat tantangan dalam proses produksi dan teknologi industri yang lebih maju dengan padat modal. Kondisi inilah menjadi dilematis bagi industri sarung sutera bugis lokal sebagai upaya ???melestarikan budaya??? dan melawan kekuatan global (in...

  11. La construction relative dans Chrétien de Troyes

    NARCIS (Netherlands)

    Fabriek, Pieter

    1924-01-01

    1. On peut reléguer à la syntaxe figée la construction relative avec la pronom neutre que dans feire que sages, que je sache, (au) plus tost qu'il pot, je n'ai que feire; avec le pronom adjectif qui dans il n'i a celui (nul, un seul) qui, com cil qui; en outre qui vive dans riens (om) qui vive (Char

  12. Pengukuran Kekuatan dan Sudut Elevasi Pancaran Antena Omnidirectional

    OpenAIRE

    Sunarno, Sunarno

    2012-01-01

    Penelitian ini dimaksud untuk mendapatkan metode pengukuran yang praktis dan presisi untuk menentukan kekuatan pancar antena (gain) dan juga pola pancaran berbagai jenis antena yang biasa dipakai para praktisi di bidang telemetri dan telekontroling. Pada metode ini digunakan pipa vertikal yang berfungsi sebagai rel untuk mengatur ketinggian sensor pengukur gelombang elektromagnetik yang disebut Field Strength Meter (FSM). Pada penelitian ini digunakan 5 (lima) unit antena dari berbagai model,...

  13. UJI TOLERANSI TANAMAN TEMBAKAU (Nicotiana tabacum L. TERHADAP CEKAMAN KADMIUM (Cd, TIMBAL (Pb, DAN TEMBAGA (Cu PADA KULTUR CAIR

    Directory of Open Access Journals (Sweden)

    S Rosidah

    2014-11-01

    Full Text Available Penelitian ini menyelidiki respon fisiologis, anatomis, dan morfologis tanaman tembakau (Nicotiana tabacum L. terhadap cekaman logam berat Cu, Cd, dan Pb. Sampel yang digunakan adalah tembakau umur 3-4 minggu yang dikecambahkan secara in vitro dan kemudian dipapar logam berat selama 14 hari. Desain penelitian yang digunakan yaitu rancangan acak lengkap dengan satu faktor, yaitu konsentrasi logam Cu (0 µM, 50 µM, 100 µM, 150 µM & 200 µM, Cd (0 µM, 50 µM, 100 µM, 200 µM & 300 µM, dan Pb (0 µM, 5 µM, 20 µM, 50 µM & 100 µM. Parameter yang digunakan: pertambahan panjang akar, pertambahan jumlah akar, akumulasi logam dalam akar, lokalisasi penimbunan dalam akar, dan warna daun. Bertambahnya konsentrasi logam menghambat pertumbuhan akar dan menyebabkan deposit logam pada jaringan akar dan gejala klorosis. Hasil uji Atomic Absorbtion Spectrophotometry (AAS menunjukkan semakin besar konsentrasi semakin banyak akumulasi logam pada jaringan akar. Akan tetapi, akumulasi Cd pada konsentrasi 200 µM lebih besar dibanding pada konsentrasi 300 µM. Analisis kualitatif membuktikan bahwa cekaman Cu tidak berpengaruh signifikan terhadap warna daun, sedangkan pada cekaman Cd (100, 150 dan 200 µM dan Pb (150 µM daun mengalami klorosis. Pada konsentrasi logam yang rendah seperti 50 µM Cu, 50 µM Cd, dan 5 µM Pb tidak berbeda nyata dengan kontrol. Dengan demikian disimpulkan bahwa tembakau mampu mentoleransi cekaman logam pada konsentrasi yang rendah.  This research investigated the physiological, anatomical, and morphological responses of tobacco (Nicotiana tabacum L. on stresses of heavy metals Cu, Cd, and Pb. The samples were 3- to 4-week tobacco plants germinated in vitro and then were exposed to heavy metals for 14 days. This study used a completed random design with single factor, i.e. the concentrations of Cu (0 µM, 50 µM, 100 µM, 150 µM & 200 µM, Cd (0 µM, 50 µM, 100 µM, 200 µM & 300 µM, and Pb (0 µM, 5 µM, 20 µM, 50 µM & 100

  14. Imunopatogenesis Treponema pallidum dan Pemeriksaan Serologi

    Directory of Open Access Journals (Sweden)

    Efrida .

    2014-09-01

    Full Text Available AbstrakSifilis adalah penyakit menular seksual yang sangat infeksius, disebabkan oleh bakteri berbentuk spiral, Treponema pallidum subspesies pallidum. Penyebaran sifilis di dunia telah menjadi masalah kesehatan yang besar dengan jumlah kasus 12 juta pertahun. Infeksi sifilis dibagi menjadi sifilis stadium dini dan lanjut. Sifilis stadium dini terbagi menjadi sifilis primer, sekunder, dan laten dini. Sifilis stadium lanjut termasuk sifilis tersier (gumatous, sifilis kardiovaskular dan neurosifilis serta sifilis laten lanjut. Sifilis primer didiagnosis berdasarkan gejala klinis ditemukannya satu atau lebih chancre (ulser. Sifilis sekunder ditandai dengan ditemukannya lesi mukokutaneus yang terlokalisir atau difus dengan limfadenopati. Sifilis laten tanpa gejala klinis sifilis dengan pemeriksaan nontreponemal dan treponemal reaktif, riwayat terapi sifilis dengan titer uji nontreponemal yang meningkat dibandingkan dengan hasil titer nontreponemal sebelumnya. Sifilis tersier ditemukan guma dengan pemeriksaan treponemal reaktif, sekitar 30% dengan uji nontreponemal yang tidak reaktifKata kunci: sifilis, Treponema pallidum, serologiAbstractSyphilis is a sexually transmitted disease that is highly infectious, caused by a spiral -shaped bacterium, Treponema pallidum subspecies pallidum. The spread of syphilis in the world has become a major health problem and the common, the number of 12 million cases per year. Infectious syphilis is divided into early and late-stage syphilis. Early-stage syphilis is divided into primary, secondary, and early latent. Advanced stage of syphilis include tertiary syphilis (gumatous, cardiovascular syphilis, and neurosyphilis and late latent syphilis. Primary syphilis is diagnosed by clinical symptoms of the discovery of one or more chancre (ulcer. Secondary syphilis is characterized by the finding of localized mucocutaneous lesions or with diffuse lymphadenopathy. Latent syphilis without clinical symptoms of syphilis with

  15. POLA KEGIATAN DAN PENGGUNAAN ENERGI REMAJA PUTRI

    Directory of Open Access Journals (Sweden)

    Y. Krisdinamurtirin

    2012-11-01

    Full Text Available Penelitian mengenai pola kegiatan dan penggunaan energi remaja putri telah dilakukan pada tahun 1991/1992, dengan anggaran rutin. Sebagai subjek adalah siswi SLTA. Remaja putri daerah perkotaan 49 orang SLTA di Kodya Bogor, dan remaja putri daerah pedesaan 45 orang siswi SLTA Kabupaten Bogor. Tujuan penelitian ialah mendapatkan nilai penggunaan energi sehubungan dengan kegiatan yang dilakukan golongan remaja putri, baik dari daerah perkotaan maupun dari daerah pedesaan. Jumlah subjek perkotaan untuk analisis data 33 orang, untuk subjek pedesaan 37 orang. Hasil analisis data menunjukkan bahwa: rata-rata umur, berat badan, tinggi badan, Body Mass Index (BMI, keadaan gizi (% BB/TB, % lemak tubuh/BB, kedua kelompok perbedaannya tidak bermakna (P>0.05. Rata-rata Hb subjek perkotaan 12.5g%, subjek pedesaan 11.0g% (perbedaan bermakna, p<0.01. Rata-rata BMR subjek perkotaan 1104 Kkal/hari, atau 24.39 Kkal/kg BB/hari atau 0.017 Kkal/kg BB/mmenit atau 58.05 Kkal/BMI/24 jam. BMR subjek pedesaan 1238 Kkal/hari atau 27.3 Kkal/kg BB/hari, atau 0.019 Kkal/kg BB/hari, atau 65.73 Kkal/BMI/24 jam. Pola kegiatan kedua kelompok terdapat perbedaan terutama pada kegiatan occupational household task dan naik mobil, lebih banyak dilakukan oleh subjek pedesaan. Besarnya penggunaan energi untuk berbagai kegiatan sehari-hari, kelompok pedesaan lebih besar (39.7 Kkal/kg BB/hari daripada penggunaan energi kelompok perkotaan (35.5 Kkal/kg BB/hari. Maka taksiran nilai kecukupan energi bagi remaja putri adalah 40 Kkal/kg BB/hari, sepadan dengan nilai anjuran kecukupan Widya Karya Nasional Pangan dan Gizi tahun 1988.

  16. Epistemologi Sufi dan Tanggung Jawab Ilmiah

    Directory of Open Access Journals (Sweden)

    Syaifan Nur

    2012-06-01

    Full Text Available Abstract : A Characteristic of sufi knowledge or epistemology based on intuition and reality of the spiritual world that only could be experienced by sufis. This  distinctive mode of epistemology invited numerous questions, especially for those who were influenced by  empirical - positivistic points of view. How it could be and how is it scientifically responsible. For them, this mode of knowledge is assumed as “unreal”, and is impossible to being scientific, let alone objectively recognized for its reliability. This article attempts to respond to that challenge or perhaps “accusation”, while stressing the point on two aspects: fi rst, exposition of characteristics of sufi  epistemology that seem so different from Western mode of epistemology (rationalism or empiricism, and second, trying to rationalize the reality of sufi  spiritual experiences as being scientifically responsible.Keywords : Divine knowledge, Unveiling, Dhawq, Imaginal world Abstrak :  Karakteristik pengetahuan atau epistemologi sufi didasarkan pada penggunaan intuisi dan realitas dunia spiritual yang hanya bisa dialami oleh kaum sufi. Kekhasan model epistemologi ini membuat banyak orang, terutama mereka yang terpengaruh oleh pandangan positivisme - empirik, bertanya-tanya tentang bagaimana mungkin hal itu bisa terjadi, dan bagaimana pula mempertanggungjawabkannya secara ilmiah. Bagi mereka yang berpandangan positivistik, model pengetahuan khas kaum sufi dianggap “tidak nyata”, dan karenanya tidak mungkin bisa diilmiahkan, apalagi diakui kebenarannya secara objektif. Tulisan ini menjawab tantangan atau mungkin “tuduhan” itu, dengan memberikan penekanan yang kuat terhadap dua hal, yaitu pertama, menjelaskan karakteristik epistemologi sufi yang tampak berbeda dengan model epistemologi Barat (rasionalisme maupun empirisme, dan kedua, usaha merasionalkan realitas pengalaman spiritual kaum sufi sebagai tuntutan tanggung jawab ilmiah.Kata kunci : Ilmu

  17. TRADISI DAN INOVASI MATERIAL FASADE BANGUNAN TINGGI

    Directory of Open Access Journals (Sweden)

    Jimmy Priatman

    1999-01-01

    Full Text Available Designers of tall building realize that the product of their creativity will impact the built environment for hundred of years. Differ from the past (great pyramids Giza Egypt, the Parthenon Athens- Greece, Cliff Palace Mesa Verde- Colorado, current tall buildings are designed with systems and materials to be properly maintained to enhance the life expectancy of the building. These timeless structures demand a higher level of performance and integration among its major components such as structure, mechanical-electrical, interior and envelope system, which can be extensively monitored and modified. The building facade as "the epidermis" plays a significant role in the protective outer layer. The research was initiated in response to fulfill this criteria had lead to creative innovations in building envelope materials as a future prospective material. Abstract in Bahasa Indonesia : Para perancang bangunan tinggi menyadari bahwa hasil karya kreativitas perancangannya akan mempengaruhi tatanan lingkungan hidup manusia untuk jangka waktu lama. Berbeda dengan bangunan tinggi masa lalu (piramida agung Giza di Mesir, kuil Parthenon di Yunani, Cliff Palace Mesa Verde di Colorado, bangunan tinggi dewasa ini dirancang dengan perangkat sistim dan material yang mudah dirawat untuk meningkatkan umur bangunan. Gedung gedung tinggi ini menuntut suatu kinerja dan integrasi prima diantara komponen komponen utama yang terkait melalui sistim struktur, mekanikal, interior dan sistim selubung bangunan, yang dapat di monitor dan dimodifikasi secara ekstentif. Fasade bangunan sebagai "epidermis" memainkan peran penting melalui fungsi pelapis luar yang protektif. Serangkaian riset yang telah dilakukan sebagai tindakan responsif untuk menjawab kriteria ini telah menuntun kepada inovasi inovasi kreatif di bidang material selubung bangunan sebagai material masa depan yang dapat diandalkan. Kata kunci: selubung bangunan, fasade bangunan.

  18. Kromium, Timbal, dan Merkuri dalam Air Sumur Masyarakat di Sekitar Tempat Pembuangan Akhir Sampah

    Directory of Open Access Journals (Sweden)

    Taufik Ashar

    2013-04-01

    Full Text Available Tempat pembuangan akhir (TPA sampah domestik dengan sistem penampungan terbuka sangat berisiko mencemari air tanah milik warga yang bermukim di sekitarnya melalui proses perlindian. Untuk mengetahui kandungan logam berat dalam air tanah di sekitar TPA, sebanyak 68 sampel air sumur gali (45 sumur Dusun I dan 23 sumur Dusun IV dari Desa Namobintang Kecamatan Pancurbatu Kabupaten Deli Serdang, Sumatera Utara, telah dianalisis dengan inductively couple plasma atomic emission spectroscopy. Hubungan jarak sumur dengan konsentrasi kromium, merkuri, dan timbal diuji dengan Mann-Whitney, Spearman’s Correlation dan analisis regresi linier sederhana. Hasil penelitian menunjukkan konsentrasi kromium, timbal, dan merkuri (rerata ± deviasi standar, mg/L masing-masing 0,036 ± 0,0096; 0,0003 ± 0,00018; dan 0,005 ± 0,0041 (Dusun I; 0,0370 ± 0,0115; 0,00026 ± 0,00013; dan 0,0070 ± 0,0069 (Dusun IV. Dari 68 sumur yang dianalisis, hanya ada 8 sumur yang konsentrasi timbalnya melebihi batas menurut Peraturan Kementerian Kesehatan Republik Indonesia Nomor 492/Per/IV/2010. Sementara itu, tidak ada korelasi jarak sumur gali ke TPA dengan konsentrasi kromium, merkuri, dan timbal dalam air sumur gali tersebut. Disimpulkan bahwa perlindian sampah di Namobintang tidak mencemari air sumur-sumur gali yang berjarak 84 meter atau lebih dari TPA. Dumping site of domestic wastes has potential risk to contaminate groundwater of the surrounding population through leaching process. To determine heavy metals (chromium, lead, and mercury in groundwater at surrounding dumping site, a total of 68 dig well water samples (45 from Hamlet I and 23 from Hamlet IV of Namobintang Village, Pancurbatu Sub-District of Deli Serdang Regency, North Sumatra, were analyzed using Inductively Couple Plasma Atomic Emission Spectroscopy. The relationship between the dig well distance and chromium, mercury, and lead content was tested by Mann-Whitney, Spearman’s Correlation and Simple Linier

  19. Akumulasi dan Distribusi Logam Berat pada Vegetasi Mangrove di Pesisir Sulawesi Selatan

    Directory of Open Access Journals (Sweden)

    Heru Setiawan

    2015-04-01

    Full Text Available Tumbuhan mangrove mempunyai fungsi ekologis yaitu dapat menyerap, mengangkut dan menimbun materi yang bersifat toksik yang berasal dari sekitar lingkungan tempat tumbuhnya, salah satunya adalah logam berat. Penelitian ini bertujuan untuk mengetahui akumulasi dan distribusi logam berat jenis Timbal (Pb, Tembaga (Cu dan Kadmium (Cd pada vegetasi mangrove di perairan pesisir Sulawesi Selatan. Sampel vegetasi mangrove diambil dari empat lokasi, yaitu sekitar Pantai Tanjung Bunga Makassar, Muara Sungai Tallo Makassar, Teluk Pare-Pare dan Teluk Bone. Distribusi logam berat pada vegetasi mangrove dibagi dalam lima jaringan yaitu, akar napas, akar kawat, daun muda, daun tua dan ranting. Kandungan logam berat dalam sampel diukur dengan menggunakan alat Atomic Absorption Spectrophotometric(AAS. Hasil penelitian menunjukkan, akumulasi Pb terbesar berasal dari sampel vegetasi mangrove di Muara Sungai Tallo yaitu 36,1 ppm, akumulasi Cu terbesar dari Pantai Tanjung Bunga Makassar 42,8 ppm, dan akumulasi Cd terbesar dari Muara Sungai Tallo yaitu 29,3 ppm. Distribusi logam berat pada jaringan vegetasi mangrove yang paling tinggi, untuk Pb terdapat pada akar kawat yaitu 9,5 ppm, akumulasi logam berat Cd tertinggi terdapat pada jaringan daun muda yaitu 3,1 ppm, sedangkan akumulasi logam berat Cu yang tertinggi terdapat pada jaringan akar kawat yaitu 10,1 ppm. Secara umum, jenis Api-api (Avicennia marina merupakan jenis mangrove yang paling besar menyerap logam berat dengan kandungan Pb sebesar 24,2 ppm, Cd sebesar 30, 9 ppm dan Cu sebesar 71,2 ppm. Katakunci: logam berat, mangrove, perairan pesisir, Sulawesi Selatan   Accumulation and Distribution of Heavy Metals in Mangrove Vegetation of the Coastal of South Sulawesi Abstract Mangroves have ecological functions to absorb, transport and stockpile toxic materials, e.g., heavy metal from surrounding environment. This research aimed to know the accumulation and distribution of heavy metals, i.e. Lead (Pb, Cuprum

  20. 78 FR 58571 - Maine Yankee Atomic Power Company, Connecticut Yankee Atomic Power Company, and The Yankee Atomic...

    Science.gov (United States)

    2013-09-24

    ... Atomic Power Company, Connecticut Yankee Atomic Power Company, and The Yankee Atomic Electric Company... Power Company (Maine Yankee), Connecticut Yankee Atomic Power Company (Connecticut Yankee), and the Yankee Atomic Electric Company (Yankee Atomic) (together, ``licensees'' or ``the Yankee Companies'')...

  1. Misi Kristen di Indonesia: Bahaya dan Pengaruhnya Terhadap Umat Islam

    Directory of Open Access Journals (Sweden)

    Tarpin Tarpin

    2011-06-01

    Full Text Available Misi merupakan bagian yang integral dengan agama Kristen. Terlebih sejak masuknya Paulus,yang kemudian mengklaim bahwa agama ini telah mengamanatkan pemeluknya untuk bertebaran ke seluruh penjuru dunia guna mengabarkan Injil kepada bangsa-bangsa yang belum mengimani Yesus sebagai Tuhan penyelamat manusia. Dalam konteks keindonesiaan, kegiatan misi berkait erat dengan kolonialisme, dan orientalisme, serta kristenisasi. Dalam era pasca reformasi, kegiatan misi tidak hanya sebatas kristenisasi umat Islam. Dengan berbagai metode dan sarana yang disusun sistematis dan terorganisir, kegiatan ini bertendensi untuk menjauhkan umat Islam dari ajaran agamanya, serta memecah belah kesatuan dan persatuan umat.

  2. PENGARUH RELIGIUSITAS DAN ETIKA KERJA ISLAMI TERHADAP MOTIVASI KERJA

    Directory of Open Access Journals (Sweden)

    Fauzan Fauzan

    2015-08-01

    Full Text Available Penelitian ini bertujuan untuk mengetahui apakah ada pengaruh antara religiustas dan etika kerja islami terhadap motivasi kerja. Dugaan awal, religiustas dan etika kerja islami berpengaruh terhadap motivasi kerja. Subjek penelitian ini adalah para guru di SMP yang dikelola oleh LP Ma’arif Kota Malang. Penelitian ini menggunakan kuesioner adaptasi dan modifikasi skala Islamic Work Ethics yang dkembangkan oleh Abbas Ali ( 1987 dan skala religiusitas yang dikembangkan oleh Glock dan Stark (1996. Hasil dari penelitian mengindikasikan bahwa, (1 Religiusitas atau rasa keberagamaan, cukup mewarnai Motivasi Kerja seorang guru dalam melaksanakan aktivitasnya. Karena diakui atau tidak para guru mayoritas adalah pemeluk agama Islam. Sehingga muatan-muatan ajaran Islam cukup mewarnai aktifitas mengajarnya. Religiusitas memberikan suatu dorongan kepada seseorang (guru untuk bekerja lebih baik, meningkatkan kualitas kerjanya, serta bertanggung jawab terhadap pekerjaannya. Religiusitas sangat panting dalam menciptakan etika kerja yang baik yang bertanggung jawab secara horizontal kepada sesama manusia dan secara vertikal kepada Tuhan Yang Maha Esa. Dengan demikian kita memiliki sumber daya manusia yang jujur dan berdedikasi baik. (2 Etika Kerja Islami belum mampu memotivasi kerja guru. Artinya, selama ini etika masih dipahami secara normative saja, tapi belum menjadi suatu praktek dalam berkehidupan serta belum terinternalisasi dalam setiap aktivas. (3 secara bersama-sama Religiusitas dan Etika Kerja Islami berpengaruh secara positif dan signifikan terhadap Motivasi Kerja guru SMP Islam LP Ma’arif Kota Malang

  3. Pengunyahan Permen Karet Gula dan Xylitol Menurunkan Pembentukan Plak Gigi

    Directory of Open Access Journals (Sweden)

    Indah Fatikarini

    2016-11-01

    Full Text Available Latar belakang. Plak gigi adalah deposit lunak yang terdiri dari kumpulan berbagai macam mikroorganisme pada permukaan gigi yang berada dalam suatu polimer matriks bakteri. Pengunyahan perm en karet dapat membersihkan gigi dari debris dan plak gigi, mencegah terjadinya penyakit gingivitis dan periodontal, meningkatkan pH plak gigi, dan merangsang pengeluaran saliva. Tujuan. Penelitian ini bertujuan untuk mengetahui efek pengunyahan permen karet gula dan xylitol terhadap pembentukan plak gigi. Metode penelitian. Subjek penelitian yang digunakan adalah mahasiswa universitas Muhammadiyah Yogyakarta dengan rentang usia 18-24 tahun sebanyak 30 subjek. Kelompok subyek dibagi menjadi tiga yaitu mengunyah permen karet gula, permen karet xylitol, dan kontrol (masing-masing kelompok sebanyak 10 subjek. Data yang diambil adalah indeks plak gigi (Podshadley dan Haley Indeks kemudian dianalisis dengan statistik Kruskal-Wallis dan Mann-Whitney. Hasil penelitian menunjukkan perbedaan bermakna pembentukan plak gigi antara mengunyah permen karet xylitol, gula, dan kontrol salama tujuh hari. Disimpulkan. bahwa pengunyahan permen karet gula dan xylitol dapat menurunkan indeks plak gigi.

  4. Pandangan Kristen Tentang Dosa: Asal Muasal dan Cara Menebusnya

    Directory of Open Access Journals (Sweden)

    Tarpin Tarpin

    2010-11-01

    Full Text Available Agama Kristen memiliki konsep tersendiri tentang dosa. Dosa yang secara umum adalah tindakan manusia melanggar perintah dan norma serta aturan Tuhan, secara dogmatis, merupakan kesalahan krusial, dimana manusia dianggap melanggar rencana-rencana Tuhan. Keserakahan Adam dan Hawa melanggar perintah Tuhan dengan memakan buah pohon pengetahuan, telah menyebabkan putusnya Rahmat Tuhan kepada manusia. Adam dan Hawa telah menjerumuskan dirinya dan anak cucunya dalam dosa warisan. Kehadiran Yesus Kristus, sebagai oknum Tuhan, yang menebus dosa manusia dengan kematiannya di tiang salib, adalah bentuk Kasih Tuhan kepada hambahamba- Nya yang berdosa.

  5. POLITIK DAN “TEATER RITUAL” DI BALI

    Directory of Open Access Journals (Sweden)

    I Ngurah Suryawan

    2012-12-01

    Hubungan antara ritual dengan lingkungan sosial politik harus menjadi bahan renungan yang dalam. Ritual yang dilaku­kan untuk tujuan keselamatan, harmoni, dan ke­seimbang­an alam bahkan menimbulkan kondisi ambigue dan ironis. Ritual berjalan secara mengesankan namun bencana sosial maupun bencana alam terus menerus terjadi. Di Bali, ritual agama yang sebelumnya diwarnai mantra-mantra kini diisi oleh Pecalang (pengawal tradisi Bali dan metal detector (pada saat Pamarisudha Kariphaya Bom Bali 2002 dan 2005. Kini orang Bali cenderung melaksanakan ritual secara spektakuler. Akan tetapi Bali seringkali didera ben­cana, baik bencana yang berasal dari dalam maupun luar.

  6. PEMBELAJARAN SISTEM HIDROLIK DAN PNEUMATIK DENGAN MENGGUNAKAN AUTOMATION STUDIO

    Directory of Open Access Journals (Sweden)

    Adi Dewanto

    2015-02-01

    Full Text Available ABSTRAK Beberapa mahasiswa mengalami kesulitan dalam menguasai sistem hidrolik dan pneumatik dikarenakan kesulitan dalam membayangkan atau mengimajinasikan gerakan-gerakan komponen sistem hidrolik dan pneumatik. Hal ini mengakibatkan hambatan pada penguasaan desain dan aplikasi sistem hidrolik dan pneumatik. Untuk mengatasi hal tersebut dosen pengajar mata kuliah Mekatronika menggunakan aplikasi Automation Studio. Software ini membantu dalam desain berbagai automasi, seperti kombinasi sistem hidrolik, sistem pneumatik, sistem elektrik dan PLC. Ceramah dosen dan simulasi desain yang dilakukan mahasiswa menggunakan bantuan Automation studio. Secara umum, mahasiswa sangat terbantu dengan software tersebut. Di sisi lain, ditemukan permasalahan dalam pengaplikasian program Automation Studio di kelas, misalnya terbatasnya menu program dan permasalahan seputar terbatasnya jumlah komputer. Implikasi dari pengalaman penulis dalam menggunakan Automation Studio adalah terbukanya peluang bagi para programer komputer untuk menciptakan program/software pembelajaran yang relevan dengan kompetensi tertentu, terjangkau, dan mudah digunakan. Selain itu disarankan juga agar dosen dan mahasiswa melakukan persiapan atau pengkondisian sebelum perkuliahan berjalan berkaitan dengan penyiapan software yang akan digunakan selama kuliah berlangsung.   Kata Kunci: automation studio program, learning process, Pneumatic and hydraulic learning

  7. Perlindungan Hak Cipta, Hak Terkait, dan Desain Industri

    Directory of Open Access Journals (Sweden)

    Dina Widyaputri Kariodimedjo

    2012-02-01

    Full Text Available This writing is intended to disseminate the concept of copyright, related right, and industrial design to researchers and professors at universities. It also discusses the recent development on the protection of those rights according to international convention and Indonesian law, as well as explains the procedures to admit the rights.  Tulisan ini merupakan bahan dalam rangka sosialisasi hak cipta, hak terkait, dan desain industri kepada peneliti dan dosen di perguruan tinggi. Tulisan ini membahas perkembangan seputar perlindungan hak-hak tersebut berdasarkan konvensi internasional dan hukum Indonesia, serta menjelaskan prosedur dan persyaratan permohonan pendaftaran hak.

  8. PREPARASI DAN KARAKTERISASI SIFAT OPTIK KACA POSFAT

    Directory of Open Access Journals (Sweden)

    - Sulhadi

    2012-05-01

    Full Text Available Gelas fosfat telah sukses dibuat dengan komposisi P2O5-MgO dan P2O5-CaO menggunakan teknik quenching leleh. Bahangelas dibuat dengan memanasinya pada suhu 850oC selama 30 menit. Sampel gelas dipersiapkan dengan komposisi fosfat 70-85%, dengan interval 5%. Gelas fosfat yang diproduksi dengan komposisi 80% memiliki sifat transparan yang baik dan tidak pecahketika dicetak. hasil analisis optik menunjukkan bahwa gelas fosfat dengan pemodifikasi MgO memiliki sifat optik yang baik. lebihtransparan daripada CaO. Phosphate glass has been successfully made with compotition P O -MgO dan P O -CaO by melt quenching technique. The 2 5 2 5 process of making glass forming material by heating at a temperature 850oC and maintained for 30 minutes. Glass samlpe preparedwith the compotition of phosphate 85%, 80%, 75%, 70%. Phosphate glass produced with 80% compotitions which have goodtransparency properties and do not break when molded. The result of optical analysis shows phosphate glass with modifier MgOhas good optical properties than CaO. Taken as a macroscopic phosphate glass with MgO modifier is more transparent than withCaO, so that both glass allows for futher applicationsKeywords: phosphate glass; optical properties; preparation,quenching

  9. ARSITEKTUR "GUNA DAN CITRA" SANG ROMO MANGUN

    Directory of Open Access Journals (Sweden)

    IN MEMORIAM : YUSUF BILYARTA MANGUNWIJAYA

    1999-01-01

    Full Text Available Yusuf Bilyarta Mangunwijaya is not only recognized as a pastor but also as a cultural observer, writer and architect. The architectural works he produced even touch the marginal people. The work does not only result in the physical building but also the total work of human development, "use" and "image". World Architecture never escapes from Vitruvius trilogy saying : Firmitas, Utilitas and Venustas. In his amazing writing, Mangunwijaya offered a distillation of trilogy (three categories into two categories, 'use' and 'image'. This writing is going to impart how the distillation of three categories becomes a 'two-categories. Abstract in Bahasa Indonesia : Yusuf Bilyarta Mangunwijaya tidak saja dikenal sebagai seorang Pastor, tetapi dia juga seorang budayawan, sastrawan, bahkan arsitek. Karya arsitekturnya menyentuh bahkan sampai ke mereka-mereka yang dipinggirkan (kaum marjinal. Karya arsitekturnya tidak saja sebuah sosok bangunan, tetapi sekaligus karya total dengan pembangunan manusianya, "Guna" dan "Citra". Arsitektur dunia tidak dapat melepaskan diri dari Trilogi Vitruvius: Firmitas, utilitas dan venustas. Dalam karya tulisnya yang luarbiasa, Romo Mangunwijaya menyingkatnya hanya dwilogi saja, Guna dan Citra. Tulisan ini akan membahas bagaimana perasan trilogi itu menjadi dwilogi saja. Kata kunci: Mangunwijaya, Vitruvius, guna, citra.

  10. Mixoma Odontogenik: Tinjauan Klinis dan Penatalaksanaanya

    Directory of Open Access Journals (Sweden)

    Y. Mulyaka

    2010-06-01

    Full Text Available Pendahuluan Mixoma pada mulut adalah lesi yang jarang, tumbuh lambat, suatu masa submukosa yang asimtomatik, lebih sering terjadi pada mandibula. Mixoma bisa mengenai laki-Iaki maupun wanita pada semua umur.Tujuan perawatan mixoma pada mulut, seperti mixoma pada jaringan tubuh lain adalah eksisi bedah. Semua mixoma adalah jinak dan hanya memerlukan terapi konservatif. Gambaran klinis mixoma pada mulut tidak berkapsul dan menunjukan infiltrasi ke jaringan sekitarnya. Secara histology mixoma berisi material gelatin. Seeara radiologi berupa lesi lusen, seringnya multilokuler atau seperti gambaran sarang Mixoma lebah, dengan batas tidak jelas. Rekurensi kadang kala terjadi. Laporan kasus seorang lelaki 24 tahun datang ke Klinik Bedah Mulut & Maksilofasial, RS Dr. Sardjito, Yogyakarta. Dia mengeluh adanya benjolan pada pipi kanan sekitar 3 tahun yang lalu, tidak sakit. Pemeriksaan klinik menunjukan suatu pembengkakan, 9 x 9 x 7 em, konsistensi kenyal, warna sama dengan jaringan sekitarnya. Prognosa dubia ad bonam. Hasil Pasien menjalani operasi hemimandibulektomi dan pemasangan pelat rekonstruksi mandibula di bawah anastesi umum. Hasil patologi anatomi pasea operasi menunjukan mixoma odontogenik.

  11. Pengaruh Pembelajaran Search, Solve, Create dan Share dengan Strategi Metakognitif terhadap Kemampuan Menyelesaikan Masalah dan Berpikir Kritis Fisika

    Directory of Open Access Journals (Sweden)

    Nia Suciati

    2014-06-01

    Full Text Available Penelitian ini bertujuan menguji perbedaan kemampuan siswa menyelesaikan masalah dan berpikir kritis fisika serta efektifitas model pembelajaran SSCS dengan strategi metakognitif untuk meningkatkan kemampuan siswa dalam menyelesaikan masalah dan berpikir kritis fisika dibandingkan dengan model pembelajaran SSCS dan pembelajaran konvensional. Rancangan penelitian yang diguna-kan adalah Postest Only Control Group Design dengan pemilihan sampel acak. Data dikumpulkan melalui tes kemampuan menyelesaikan masalah, tes kemampuan berpikir kritis, dan observasi pembela-jaran. Hasil penelitian menunjukkan bahwa terdapat perbedaan kemampuan siswa menyelesaikan masalah dan berpikir kritis fisika serta model pembelajaran SSCS dengan strategi metakognitif lebih efektif untuk meningkatkan kemampuan siswa dalam menyelesaikan masalah berpikir kritis fisika di-bandingkan dengan model pembelajaran SSCS dan pembelajaran konvensional.Kata kunci: pembelajaran SSCS, strategi metakognitif, menyelesaikan masalah, berpikir kritis

  12. Linear atomic quantum coupler

    CERN Document Server

    El-Orany, Faisal A A

    2009-01-01

    In this paper, we develop the notion of the linear atomic quantum coupler. This device consists of two modes propagating into two waveguides, each of them includes a localized and/or a trapped atom. These waveguides are placed close enough to allow exchanging energy between them via evanescent waves. Each mode interacts with the atom in the same waveguide in the standard way, i.e. as the Jaynes-Cummings model (JCM), and with the atom-mode in the second waveguide via evanescent wave. We present the Hamiltonian for the system and deduce the exact form for the wavefunction. We investigate the atomic inversions and the second-order correlation function. In contrast to the conventional linear coupler, the atomic quantum coupler is able to generate nonclassical effects. The atomic inversions can exhibit long revival-collapse phenomenon as well as subsidiary revivals based on the competition among the switching mechanisms in the system. Finally, under certain conditions, the system can yield the results of the two-m...

  13. POTENSI GEN dtx DAN dtxR SEBAGAI MARKER UNTUK DETEKSI DAN PEMERIKSAAN TOKSIGENISITAS Corynebacterium diphtheriae

    Directory of Open Access Journals (Sweden)

    Sunarno Sunarno

    2013-05-01

    Full Text Available Abstract.   Corynebacterium diphtheriae is the causative agent of diphtheria. The main virulence determinant of the bacteria is diphtheria toxin, the cause of the systemic complication seen with diphtheria. Production of diphtheria toxin by toxigenic strain encoded by dtx/tox gene and repressed by dtxR gene. Gold standard for bacterial toxigenicity test carried out by conventional methods (Elek test, Guinea pig and vero cell cytotoxicity. However, Elek test have variety result, time consume and problem of the reagent availability. On the other hand, the animal (Guinea pig testing was opposed by many animal lovers and the vero cell cytotoxicity test require high cost. The study purposed to evaluate the using of dtx and dtxR genes as a detection marker of C.diphtheriae and bacterial toxigenicity test simultaneusly by Multiplex PCR. The study examined 44 bacterial and fungal isolates, included 22 C.diphtheriae (4 reference strains and 18 clinical isolates, 5 other specieses of Corynebacterium  (reference strains and 17 non-Corynebacterium (10 reference strains and 7 stock cultures . All of sample were examined by Multiplex PCR for 2 primer pairs targeted dtx and dtxR genes. The study showed that the Multiplex PCR for dtx and dtxR as target genes able to detect all of sample correctly thus concluded that dtx and dtxR genes could be used as a marker for alternative detection and toxigenicity test of C.diphtheriae by Multiplex PCR rapidly and accuratelly. Key words: Corynebacterium diphtheriae, dtx, dan dtxR Abstrak. Corynebacterium diphtheriae merupakan agen penyebab penyakit difteri.. Faktor virulensi utama  C. diphtheriae adalah toksigenisitas (kemampuan memproduksi toksin bakteri toxin. Produksi toksin diatur seperangkat gen yang disebut gen tox/dtx dan diregulasi oleh gen dtxR. Gold standard untuk pemeriksaan toksigenisitas C.diphtheriae adalah dengan metode konvensional (Elek test, Guinea pig dan vero cell cytotoxigenicity,namun  Elek test

  14. Pengembangan Media Poster dan Strategi Edukasi Gizi untuk Pengguna Posyandu dan Calon Pengantin

    Directory of Open Access Journals (Sweden)

    Hermina Hermina

    2015-11-01

    Full Text Available AbstractThe results of study Nutrition Awareness Family (Kadarzi in six provinces showed that nutrition knowledge and behavior of adults group is still low. The study of Kadarzi focused on the development of nutrition education strategies which was adjusted to the problems found in the community. The goal is to develop a media strategy posters and nutrition education for mothers of posyandu users and the future brides in an effort to achieve Kadarzi. The type of study was operational research. The study design wascross-sectional, with qualitative and quantitative methods. The study was conducted in three provinces: West Java, West Sumatra and East Kalimantan. The Samples taken for messenger is posyandu cadres andmarriage-guidance counsellors. The Samples taken for nutritional education is the mothers of posyandu users and the bride. Educational messages developed were advice to eat vegetables and fruits, weighingfor children under five, pregnant women anemia, exclusive breastfeeding and malnutrition. The results from the test of implementation nutrition education using posters media Kadarzi showing >70 % of targeted education increased their nutrition knowledge better than before, and generally the posyandu cadres were able to convey the message properly as well as the marriage-guidance counsellors in the Office of Religious Affairs. This study concluded that nutrition education posters which were made fairly simple, easy to understand, universal and also effective were able to improve the nutritional knowledge of mothers of posyandu users and future brides.Keywords : Nutrition Education, poster, aware family nutrition, posyandu users, future brides.AbstrakHasil Studi Keluarga Sadar Gizi (Kadarzi di enam provinsi menunjukkan bahwa pengetahuan dan perilaku gizi kelompok usia dewasa masih rendah. Penelitian ini memfokuskan pada pengembangan strategi edukasi gizi yang disesuaikan dengan permasalahan yang ditemukan di masyarakat. Tujuannya

  15. Perbandingan Kadar IL-5 dan Jumlah Eosinofil Antara Anak dan Orang Dewasa yang Terinfeksi Ascaris Lumbricoides

    Directory of Open Access Journals (Sweden)

    Darmadi ,

    2015-09-01

    Full Text Available Abstrak Ascaris lumbricoides pada umumnya menginfeksi anak, tetapi juga dapat terjadi pada orang dewasa. Respon imun hospes terhadap infeksi cacing dimulai dengan teraktifasinya Th2 dengan peningkatan yang signifikan dari IL-4, IL-5, IL-9, IL-10 dan IL-13. IL-5 yang terbentuk merangsang perkembangan dan aktivasi eosinofil. Tujuan penelitian ini adalah mengetahui perbandingan kadar IL-5 dan jumlah eosinofil antara anak dan orang dewasa yang terinfeksi oleh Ascaris lumbricoides. Telah dilakukan penelitian secara cross sectional terhadap 16 orang anak dan 16 orang dewasa yang terinfeksi Ascaris lumbricoides. Spesimen darah dan serum anak dan orang dewasa diperiksa IL-5 metode ELISA dan jumlah eosinofil metode mikroskopis. Data dianalisis dengan uji t independent dengan hasil statistik bermakna bila p<0,05. Didapatkan rerata kadar IL-5 anak 5,90±3,61 pg/ml dan 4,10±1,98 pg/ml rerata kadar IL-5 pada orang dewasa dengan nilai p=0,092 (p>0,05, sedangkan rerata jumlah eosinofil anak 14,56±7,77% dan 8,81±4,65% rerata jumlah eosinofil orang dewasa dengan nilai p=0,018 (p<0,05. Kadar IL-5 tidak berbeda signifikan antara anak dan orang dewasa, sebaliknya jumlah eosinofil terdapat perbedaan yang signifikan antara anak dan orang dewasa. Kesimpulan hasil penelitian ini ialah jumlah eosinofil anak lebih tinggi dari pada jumlah eosinofil orang dewasa yang terinfeksi Ascaris lumbricoides. Kata kunci: IL-5, jumlah eosinofil, anak, orang dewasa, infeksi Ascaris lumbricoides Abstract The infection of Ascaris lumbricides common infect children, but it also can be occurred to adult. The immune’s host respond to the worm infection begin from the activation of Th2 by the significant increasing from IL-4, IL-5, IL-9 and IL-13. IL-5 which formed stimulate the development and eosinofil’s activation. The objective of this study was to know the comparison IL-5 degree with the total of eosinofil between the child and adult who is infected by Ascaris lumbricides. The

  16. PENGARUH PERENDAMAN DAN PEREBUSAN TERHADAP KANDUNGAN PROTEIN, GULA, TOTAL FENOLIK DAN AKTIVITAS ANTIOKSIDAN KERANDANG (Canavalia virosa

    Directory of Open Access Journals (Sweden)

    Titiek Farianti Djaafar

    2013-03-01

    Full Text Available The Effect of Soaking and Boiling on Protein, Oligosaccharides, Total Phenolic Content and Antioxidant Activity ofKerandang (Canavalia virosa Titiek Farianti Djaafar, Umar Santosa, Muhammad Nur Cahyanto, Endang Sutriswati Rahayu ABSTRAK Kerandang (Canavalia virosa tergolong tanaman legum dan menghasilkan biji, tumbuh menjalar di lahan pasir pantaiDaerah Istimewa Yogyakarta, khususnya di Kabupaten Bantul dan Kulon Progo dengan luas lahan sekitar 3.500 ha.Tanaman kerandang merupakan sumber protein nabati, mengandung senyawa fenolik dan memiliki aktivitas antioksidan.Penelitian tentang aktivitas antioksidan biji kerandang belum dilakukan. Penelitian ini bertujuan untuk mengetahuipengaruh perendaman dan perebusan terhadap perubahan kandungan protein, gula, total fenolik dan aktivitas antioksidanbiji kerandang. Perendaman dilakukan pada 0, 12, dan 24 jam dengan rasio biji kerandang dan air sebesar 1:6 (b/v.Perlakuan perendaman ini dikombinasikan dengan perebusan biji pada suhu didih air (80 – 90 ºC selama 0, 10, dan20 menit. Perbandingan biji kerandang dan air untuk perebusan adalah 1:5 (b/v. Pengujian yang dilakukan meliputikadar protein, jenis gula, total fenolik dan aktivitas antioksidan. Penelitian dilakukan menggunakan Rancangan AcakLengkap dengan ulangan dua kali. Hasil penelitian menunjukkan bahwa kadar protein biji kerandang menurun denganperlakuan perendaman dan perebusan. Biji kerandang mengandung oligosakarida tahan cerna (raÞ nosa yang cukuptinggi. Kandungan total fenolik biji kerandang segar sebesar 7,42 g GAE/100 g biji kerandang. Perlakuan perendamandan perebusan menyebabkan kandungan total fenolik menurun sampai dengan 74,93 %. Aktivitas antioksidan bijikerandang dinyatakan sebagai Radical Scavenging Activity sebesar 10,22 %. Pada perendaman selama 12 dan 24 jamterjadi penurunan aktivitas antioksidan.Kata kunci: kerandang, total fenol, aktivitas antioksidan ABSTRACT Kerandang (Canavalia virosa is legume crops and producing seeds

  17. KUALITAS DIET DAN HUBUNGANNYA DENGAN PENGETAHUAN GIZI, STATUS SOSIAL EKONOMI, DAN STATUS GIZI

    Directory of Open Access Journals (Sweden)

    Nurul Muslihah

    2013-11-01

    Full Text Available ABSTRACTThe objective of study was to assess the diet quality and its relation to nutrition knowledge, body mass index (BMI, and socio economic status (SES among adults person. The cross sectional study was conducted with 100 adults aged ≥25 years old from Kedung Kandang sub district, Malang. Dietary quality was assessed using two non-consecutive 24-h dietary recalls and semi quantitative FFQ. Nutrition knowledge questionnaire was modified from Parmenter and Wardle. The most subjects were middle SES and the BMI were normal and overweight. The average of diet quality score was 7.14±1.96 with dietary diversity score 1.93±0.43; micronutrient adequacy score 2.3±1.4; prevention NCD score 2.87±0.92. Nutrition knowledge score was 43.3±24.6 with dietary recommendation 9.3±3.6; sources of nutrients 14±11.5; choosing foods 6.3±4.9; diet-disease relationships 13.7±8.6. Nutrition knowledge score was no correlation with BMI, dietary diversity, prevention NCD score, but positively associated with SES, quality diet, micronutrient adequacy score. SES was no associated with BMI and quality diet index. Dietary diversity score was associated with BMI. Diet quality score was associated with nutrition knowledge but no correlation with BMI and SES. The conclusion is diet quality and nutrition knowledge was still poor and not correlated with BMI and SES, but only nutrition knowledge score.Keywords: diet quality, nutrition knowledge, socio economic statusABSTRAKTujuan penelitian mengkaji kualitas diet dan hubungannya dengan pengetahuan gizi, indek massa tubuh (IMT, dan status sosial ekonomi (SSE pada orang dewasa. Rancangan penelitian menggunakan cross sectional study pada 100 orang dewasa usia ≥25 tahun dari Kecamatan Kedung Kandang, Malang. Kualitas makanan diukur dengan 24-hour recall selama dua hari yang tidak berurutan dan semi quantitative FFQ, kuesioner pengetahuan gizi terstruktur dimodifikasi dari Parmenter dan Wardle. Umumnya subjek dengan SSE

  18. Atomic Structure Theory Lectures on Atomic Physics

    CERN Document Server

    Johnson, Walter R

    2007-01-01

    Atomic Structure Theory is a textbook for students with a background in quantum mechanics. The text is designed to give hands-on experience with atomic structure calculations. Material covered includes angular momentum methods, the central field Schrödinger and Dirac equations, Hartree-Fock and Dirac-Hartree-Fock equations, multiplet structure, hyperfine structure, the isotope shift, dipole and multipole transitions, basic many-body perturbation theory, configuration interaction, and correlation corrections to matrix elements. Numerical methods for solving the Schrödinger and Dirac eigenvalue problems and the (Dirac)-Hartree-Fock equations are given as well. B-spline basis sets are used to carry out sums arising in higher-order many-body calculations. Illustrative problems are provided, together with solutions. FORTRAN programs implementing the numerical methods in the text are included.

  19. KARAKTERISASI DAN AKTIVITAS KATALITIK BERBAGAI VARIASI KOMPOSISI KATALIS Ni DAN ZnBr2 DALAM Γ-Al2O3 UNTUK ISOMERISASI DAN HIDROGENASI (R-(+-SITRONELAL

    Directory of Open Access Journals (Sweden)

    ED Iftitah

    2014-06-01

    Full Text Available Pengaruh sifat dan karakter berbagai variasi komposisi katalis Ni dan ZnBr2 yang terimpregnasi dalam γ-Al2O3 terhadap aktivitas dan selektivitasnya untuk reaksi isomerisasi dan hidrogenasi (R-(+-Sitronelal telah dilakukan. Dalam penelitian ini, terdapat tiga jenis variasi komposisi Ni dan ZnBr2 dalam γ-Al2O3, yaitu: A1=Ni/ZnBr2/γ-Al2O3 (3:2, A2=Ni/ZnBr2/γ-Al2O3 (1:1 dan A3=Ni/ZnBr2/γ-Al2O3 (2:3. Katalis dikarakterisasi menggunakan X-ray diffraction (XRD, Brunauer-Emmett-Teller (BET surface area, dan SEM-EELS. Luas area permukaan spesifik dan porositasnya ditentukan berdasarkan adsorption-desorption gas nitrogen pada 77 K. Distribusi dan volume pori ditentukan dengan desorption isotherm pada P/Po ≥ 0,3. Hasil yang didapat menunjukkan bahwa terdapat hubungan antara karakter dan sifat katalis dengan aktivitas katalitiknya terhadap produk isomerisasi dan hidrogenasi (R-(+-Sitronelal. Uji aktivitas dilakukan dalam sebuah reaktor mini dengan 0,5 g katalis dan 3 mL (R-(+-Sitronelal menggunakan atmosfir gas N2 dan/atau H2 dalam waktu 5 dan 24 jam masing-masing pada suhu 90 dan 120 °C. Komposisi katalis, pemilihan jenis atmosfir gas dan suhu sangat berpengaruh terhadap aktivitas dan selektivitas pembentukan produk isomerisasi dan hidrogenasi. Konversi (R-(+-Sitronelal tertinggi ditunjukkan oleh katalis A3=Ni/ZnBr2/γ-Al2O3 (2:3 dengan kondisi reaksi selama 5 jam (4 jam N2 + 1 jam H2 pada suhu 90 °C dan 24 jam (4 jam N2 + 20 jam H2 pada suhu 120 °C. The influence of catalyst properties and characteristics of Ni and ZnBr2 catalysts impregnated in γ-Al2O3 on the activity and selectivity of (R-(+-Citronellal isomerisation and hydrogenation has been done. In this study, there were three sets of Ni and ZnBr2 in γ-Al2O3 with various composition, they were A1=Ni/ZnBr2/γ-Al2O3 (3:2, A2=Ni/ZnBr2/γ-Al2O3 (1:1, A3=Ni/ZnBr2/γ-Al2O3 (2:3. The catalysts were characterized using X-ray diffraction (XRD, Brunauer-Emmett-Teller (BET surface area and SEM

  20. Atomic and molecular supernovae

    Energy Technology Data Exchange (ETDEWEB)

    Liu, W.

    1997-12-01

    Atomic and molecular physics of supernovae is discussed with an emphasis on the importance of detailed treatments of the critical atomic and molecular processes with the best available atomic and molecular data. The observations of molecules in SN 1987A are interpreted through a combination of spectral and chemical modelings, leading to strong constraints on the mixing and nucleosynthesis of the supernova. The non-equilibrium chemistry is used to argue that carbon dust can form in the oxygen-rich clumps where the efficient molecular cooling makes the nucleation of dust grains possible. For Type Ia supernovae, the analyses of their nebular spectra lead to strong constraints on the supernova explosion models.

  1. Atomic entanglement and decoherence

    Science.gov (United States)

    Genes, Claudiu

    The generation of entanglement in atomic systems plays a central topic in the fields of quantum information storage and processing. Moreover, a special category of entangled states of multi-atom ensembles, spin squeezed states, have been proven to lead to considerable improvement in the sensitivity of precision measurements compared to systems involving uncorrelated atoms. A treatment of entanglement in open systems is, however, incomplete without a precise description of the process of decoherence which necessarily accompanies it. The theory of entanglement and decoherence are the two main topics of this thesis. Methods are described for the generation of strong correlations in large atomic ensembles using either cavity quantum electrodynamics or measurement outcome conditioned quantum dynamics. Moreover, the description of loss of entanglement resulting from the coupling to a noise reservoir (electromagnetic vacuum) is explored. A spin squeezing parameter is used throughout this thesis as both a measure of entanglement strength and as an indication of the sensitivity improvement above the so-called standard quantum limit (sensitivity obtained with uncorrelated particles) in metrology. The first scheme considered consists of a single mode cavity field interacting with a collection of atoms for which spin squeezing is produced in both resonant and off-resonant regimes. In the resonant case, transfer of squeezing from a field state to the atoms is analyzed, while in the off-resonant regime squeezing is produced via an effective nonlinear interaction (one-axis twisting Hamiltonian). A second, more experimentally realistic case, is one involving the interaction of free space atoms with laser pulses; a projective measurement of a source field originating from atomic fluctuations provides a means of preparing atomic collective states such as spin squeezed and Schrodinger cat states. A new "unravelling" is proposed, that employs the detection of photon number in a single

  2. Atom probe tomography today

    Directory of Open Access Journals (Sweden)

    Alfred Cerezo

    2007-12-01

    Full Text Available This review aims to describe and illustrate the advances in the application of atom probe tomography that have been made possible by recent developments, particularly in specimen preparation techniques (using dual-beam focused-ion beam instruments but also of the more routine use of laser pulsing. The combination of these two developments now permits atomic-scale investigation of site-specific regions within engineering alloys (e.g. at grain boundaries and in the vicinity of cracks and also the atomic-level characterization of interfaces in multilayers, oxide films, and semiconductor materials and devices.

  3. Physics of the atom

    CERN Document Server

    Wehr, Russell M; Adair, Thomas W

    1984-01-01

    The fourth edition of Physics of the Atom is designed to meet the modern need for a better understanding of the atomic age. It is an introduction suitable for students with a background in university physics and mathematical competence at the level of calculus. This book is designed to be an extension of the introductory university physics course into the realm of atomic physics. It should give students a proficiency in this field comparable to their proficiency in mechanics, heat, sound, light, and electricity.

  4. Atom trap trace analysis

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Z.-T.; Bailey, K.; Chen, C.-Y.; Du, X.; Li, Y.-M.; O' Connor, T. P.; Young, L.

    2000-05-25

    A new method of ultrasensitive trace-isotope analysis has been developed based upon the technique of laser manipulation of neutral atoms. It has been used to count individual {sup 85}Kr and {sup 81}Kr atoms present in a natural krypton sample with isotopic abundances in the range of 10{sup {minus}11} and 10{sup {minus}13}, respectively. The atom counts are free of contamination from other isotopes, elements,or molecules. The method is applicable to other trace-isotopes that can be efficiently captured with a magneto-optical trap, and has a broad range of potential applications.

  5. Single-atom nanoelectronics

    CERN Document Server

    Prati, Enrico

    2013-01-01

    Single-Atom Nanoelectronics covers the fabrication of single-atom devices and related technology, as well as the relevant electronic equipment and the intriguing new phenomena related to single-atom and single-electron effects in quantum devices. It also covers the alternative approaches related to both silicon- and carbon-based technologies, also from the point of view of large-scale industrial production. The publication provides a comprehensive picture of the state of the art at the cutting edge and constitutes a milestone in the emerging field of beyond-CMOS technology. Although there are

  6. EINSTEIN, SCHROEDINGER, AND ATOM

    Directory of Open Access Journals (Sweden)

    Trunev A. P.

    2014-03-01

    Full Text Available In this paper, we consider gravitation theory in multidimensional space. The model of the metric satisfying the basic requirements of quantum theory is proposed. It is shown that gravitational waves are described by the Liouville equation and the Schrodinger equation as well. The solutions of the Einstein equations describing the stationary states of arbitrary quantum and classical systems with central symmetry have been obtained. Einstein’s atom model has been developed, and proved that atoms and atomic nuclei can be represented as standing gravitational waves

  7. Rydberg atoms in astrophysics

    CERN Document Server

    Gnedin, Yu N; Ignjatovic, Lj M; Sakan, N M; Sreckovic, V A; Zakharov, M Yu; Bezuglov, N N; Klycharev, A N; 10.1016/j.newar.2009.07.003

    2012-01-01

    Elementary processes in astrophysical phenomena traditionally attract researchers attention. At first this can be attributed to a group of hemi-ionization processes in Rydberg atom collisions with ground state parent atoms. This processes might be studied as a prototype of the elementary process of the radiation energy transformation into electrical one. The studies of nonlinear mechanics have shown that so called regime of dynamic chaos should be considered as typical, rather than exceptional situation in Rydberg atoms collision. From comparison of theory with experimental results it follows that a such kind of stochastic dynamic processes, occurred during the single collision, may be observed.

  8. Inside the Hydrogen Atom

    CERN Document Server

    Nowakowski, M; Fierro, D Bedoya; Manjarres, A D Bermudez

    2016-01-01

    We apply the non-linear Euler-Heisenberg theory to calculate the electric field inside the hydrogen atom. We will demonstrate that the electric field calculated in the Euler-Heisenberg theory can be much smaller than the corresponding field emerging from the Maxwellian theory. In the hydrogen atom this happens only at very small distances. This effect reduces the large electric field inside the hydrogen atom calculated from the electromagnetic form-factors via the Maxwell equations. The energy content of the field is below the pair production threshold.

  9. Pengaruh VCO terhadap hitung jenis leukosit, kadar glukosa dan kreatinin darah Mus musculus Balb/c hiperglikemi dan tersensitisasi ovalbumin

    Directory of Open Access Journals (Sweden)

    NOOR SOESANTI HANDAJANI

    2009-05-01

    Full Text Available Handajani NS, Dharmawan R. 2009. Pengaruh VCO terhadap hitung jenis leukosit, kadar glukosa dan kreatinin darah Mus musculus Balb/c hiperglikemi dan tersensitisasi ovalbumin. Bioteknologi 6: 1-10. Obat-obatan kimia dan insulin dapat menurunkan kadar glukosa darah pada pasien dengan efek samping hiperglikemi makro vaskular. Diabetes dan insiden alergi dipengaruhi kualitas dan kuantitas leukosit. Asam laurat dalam VCO dilaporkan menurunkan tingkat glukosa darah pada kejadian diabetes dan beberapa insiden alergi. Tujuan penelitian ini adalah mengetahui pengaruh VCO pada tingkat glukosa darah, diferensial leukosit dan kadar kreatinin pada mencit hiperglikemi dan normoglicemic tersensitisasi ovalbumin. Empat puluh lima (45 mencit Mus musculus Balb/c jantan dengan berat rata-rata 35 g dibagi menjadi 9 kelompok dengan 5 ulangan, yaitu 4 kelompok non aloksan dan 5 kelompok hiperglikemi yang diinduksi aloksan, Pada hari ke-22 sampai ke-36, mereka disensitisasi dengan ovalbumin sebagai penyebab alergi. Sampel darah diperoleh dari vena orbital menggunakan heparin sebagai anti koagulan, kadar glukosa darah diukur dengan metode GOD sebanyak 6 kali, pada hari ke-1, 4, 18, 22, 32 dan 37, kemudian diuji dengan ANAVA yang diikuti oleh DMRT 0,05 untk mengetahui tingkat perbedaan antar perlakuan. Pada hari ke-37, diferensial leukosit dan tingkat kreatinin darah ditentukan, lalu dibandingkan dengan nilai normal. Hasil penelitian menunjukkan bahwa dalam hitungan diferensial leukosit mencit hiperglikemi, persentase neutrofil jauh lebih rendah daripada nilai normal (3.22%, dan persentase limfosit jauh lebih tinggi daripada nilai normal (94.54%. Konsumsi 0.003 mL/35 g VCO lebih dari 18 hari menurunkan kadar glukosa darah pada mencit hiperglikemi, menurunkan persentase basophile pada mencit tersensitisasi ovalbumin, normalisasi persentase neutrophile tidak meningkatkan tingkat kreatinin darah.

  10. POTENSI DARI KAPANG Aspergilus niger, Rhizophus oryzae DAN Neurospora sitophila SEBAGAI PENGHASIL EZIM FITASE DAN AMILASE PADA SUBSTRATE AMPAS TAHU

    Directory of Open Access Journals (Sweden)

    Atit - Kanti

    2017-02-01

    Full Text Available Penambahan enzim hidrolisis untuk pakan ternak dapat meningkatkan nilai nutrisi pakan. Penelitian bertujuan untuk mendapatkan kondisi optimal untuk produksi enzim amilase dan fitase pada media ampas tahu menggunakan Aspergilus niger, Rhizophus oryzae dan Neurospora sitophila. Uji kemampuan produksi enzim fitase dan amilase oleh Aspergilus niger, Rhizophus oryzae dan Neurospora sitophila dilakukan menggunakan media ampas tahu yang disterilisasi. Pemilihan ketiga isolat ini diawali dengan uji produksi enzim amilase pada kultur cair yang mengandung 2 % pati, dan uji fitase dilakukan pada media yang mengandung 0.5 % sodium fitat. Hasil uji pada medium cair selanjutnya digunakan untuk uji produksi enzim fitase dan fitase pada sistem fermentasi padat (SSF menggunakan ampas tahu sebagai media fermentasi. Untuk mendapatkan produksi enzim yang tinggi dilakukan melalui optimasi waktu inkubasi, suhu inkubasi dan pH media. Fitase dan amilase dapat diproduksi dengan media ampas tahu oleh R. oryzae, A. niger dan N. sitophila. Kondisi optimum untuk produksi fitase, yaitu waktu inkubasi pada hari keempat untuk ketiga kapang, suhu 25 °C untuk R. oryzae dan A. niger, suhu 30°C untuk N. sitophila, pH 8 untuk R. oryzae, pH 6 untuk Aspergillus niger dan N. Sitophila. Neurospora sitophila menghasilkan amilase optimum pada suhu 35°C, sedangkan Aspergillus niger dan Rhizopus oryzae optimum pada suhu 30°C. Penurunan aktivitas produksi amilase menurun oleh R. oryzae pada suhu 40°C. Amilase diproduksi optimal pada pH 6-7. Pakan ternak yang mengandung asam fitat mampu dihidrolisis oleh fitase pada kondisi optimum. Ketiga kapang juga menghasilkan enzim amilase pada media ampas tahu mengindikasikan bahwa ampas tahu merupakan susbtrat yang baik untuk produksi enzim hidrolisis yang berguna untuk meningkatkan nilai nutrisi pakan ternak. (Kata kunci: Amilase, Aspergilus niger, Neurospora sitophila, phytase, Rhizophus oryzae

  11. IDENTIFIKASI GLIKOKONJUGAT PENGHANTAR BAU DAN DISTRIBUSINYA PADA EPITELIUM OLFAKTORIUS HIDUNG KALONG KAPAUK (Pteropus vampyrus) DAN LASIWEN DEIGNAN (Myotis horsfieldii)

    OpenAIRE

    Nicolory Paula, Yosephine; Budipitojo, Teguh

    2012-01-01

    Penelitian ini bertujuan untuk mengidentifikasi jenis-jenis residu gula dalam glikokonjugat menggunakan 4 jenis lektin yaitu wheat germ agglutinin (WGA), soybean agglutinin (SBA), concanavalin A (Con A), Rhicinus communis Agglutinin (RCA) dan distribusinya pada epitelium olfaktorius tunika mukosa hidung kelelawar pemakan buah (Pteropus vampyrus) dan kelelawar pemakan serangga (Myotis horsfieldii). Sebanyak 3 ekor Kalong betina dewasa dan 2 ekor Lawabetina dewasa digunakan dalam penelitian. Pr...

  12. Sintesis Senyawa Turunan Sekunder dan Tersier p-Kumaramida dan Uji Aktivitasnya Sebagai Anti Tumor Sel Leukimia P388

    OpenAIRE

    2014-01-01

    Senyawa-senyawa turunan p-kumaramida berpotensi sebagai anti tumor. Penelitian tentang metode sintesis senyawa turunan p-kumaramida, yakni N-propil-p-kumaramida, N,N-dietil-p-kumaramida, dan piperidinil-p-kumaramida serta uji aktivitasnya terhadap sel tumor leukimia P388 telah dilakukan. Senyawa turunan p-kumaramida disintesis dari asam p-kumarat dan amina yang sesuai sebagai reaktan dengan menggunakan katalis asam borat pada kondisi refluks di dalam pelarut DMF dan atmosfir nitrogen selam...

  13. PENGARUH LINGKUNGAN SUHU TINGGI DAN SUHU RENDAH TERHADAP KONSUMSI ZAT GIZI DAN STATUS GIZI ORANG DEWASA

    Directory of Open Access Journals (Sweden)

    Fithia Dyah Puspitasari

    2016-09-01

    Full Text Available ABSTRACTThe imbalance nutrition intake for a long term period can cause changes in weight, body composition andmay alter health problem. The environment temperature can affect the 24 Hours Energy Expenditure (24-hEE magnitude. This research was aimed to investigate the differences of adult's nutrient intake pattern inhigh-temperature and low-temperature area. Research was held in high-temperature area (Jakarta and lowtemperaturearea (Tawangmangu. Frequency distribution analysis was done to obtain the respondentcharacteristics, while bivariat test was done to determine the difference of energy consumption rate andnutritions. The results showed that the subjects in high-temperature area consumed higher total protein,total vitamin B2 and total calcium than the subjects in low-temperature area. Subject in low-temperaturearea consumed more partial calcium compare to subjects in high-temperature area. There was a signifiCantdifference in average of total vitamin A intake between less and overweight group (p=0,049; normal andoverweight group (p=0,007 and between overweight and obese group (p=0,004.Keywords: Nutrient intake, nutrition status, environment temperature ABSTRAKKetidakseimbangan asupan zat gizi pada jangka waktu yang lama mengakibatkan perubahan berat badan,komposisi tubuh dan memungkinan timbulnya gangguan kesehatan. Suhu lingkungan mempengaruhibesaran 24 Hours Energy Expenditure (24-h EE. Penelitian ini bertujuan untuk mengetahui perbedaan polakonsumsi zat gizi orang dewasa di lingkungan bersuhu tinggi dan lingkungan bersuhu rendah. Penelitiandilakukan di area bersuhu tinggi (Jakarta dan area bersuhu rendah (Tawangmangu. Analisis distribusifrekuensi dilakukan untuk mengetahui karakteristik responden sedangkan uji bivariat dilakukan untukmengetahui beda jumlah konsumsi energi dan zat gizi. Hasil penelitian menunjukkan bahwa subyek padaarea suhu tinggi mengonsumsi protein total, vitamin B2 total dan kalsium total lebih banyak

  14. PEMETAAN PASANG SURUT DAN ARUS LAUT PULAU BATAM DAN PENGARUHNYA TERHADAP JALUR TRANSPORTASI ANTARPULAU

    Directory of Open Access Journals (Sweden)

    Sudra Irawan

    2016-03-01

    Full Text Available TIDAL AND CURRENT MAPPING OF BATAM ISLAND AND THEIR EFFECT ON THE INTER-ISLAND TRANSPORTATIONThe strategic geographical position of Batam Island makes sea transportation become a basic means connecting the islands of the Riau Islands, Riau, Kalimantan, even with neighboring Singapore and Malaysia. The development of coastal areas and the determination of the transportation ways needs tidal and ocean currents data. This study measures and analyzes the tidal type usingmeasuring signs and current patterns using Lagrangian method, then presented in the web form. Five research sites were selected by purposive sampling method with a measurement time of 24 hours in one hour intervals. The results showed that the type of tidal in Batam Island in general is semidiurnal tide. Tidal period an average of 12 hours and 24 minutes. Wave height of about 0.2 to 2.77 meters from the south to the northwest. Batam Island ocean current patterns ranging from 0.02 m/s to 0.1 m/s from north towards the northeast. Tidal and current survey is one of the conditions in developing inter-island transportation. The tidal and current is useful in design port building, determining the route of transport, port basin design and planning of the breakwater.Keywords: current patterns, lagrangian, signs measure, tidal, transport route.ABSTRAKPosisi geografis Pulau Batam yang strategis membuat jalur transportasi laut merupakan sarana dasar menghubungkan antarpulau di Kepulauan Riau, Riau, Kalimantan, bahkan dengan negara tetangga Singapura dan Malaysia. Pengembangan wilayah pesisir dan penentuan jalur transportasi membutuhkan data pasang surut dan arus laut. Penelitian ini mengukur dan menganalisis tipe pasang surut dengan rambu ukur dan pola arus dengan metode metode Lagrangian, kemudian disajikan dalam bentuk web. Dipilih lima lokasi penelitian berdasarkan metode Purposive Sampling dengan waktu pengukuran 24 jam dalam interval satu jam. Hasil penelitian menunjukkan bahwa tipe pasang

  15. Peranan Faktor Imun dan Profil Protein dalam Penelitian dan Pengembangan Vaksin Malaria Iradiasi

    Directory of Open Access Journals (Sweden)

    Mukh Syaifudin

    2014-03-01

    Full Text Available Pengembangan vaksin terhadap malaria yang merupakan penyakit yang mematikan tetap menjadi satu prioritas kesehatan masyarakat global, termasuk pemanfaatan parasit iradiasi sebagai bahan vaksin. Imunisasi dengan sporozoit iradiasi mampu memberikan imunitas protektif pada hewan coba dan sukarelawan. Mekanisme sistem kekebalan tubuh ini banyak dipelajari karena merupakan faktor penting dalam pengembangan vaksin, demikian halnya profil dan/atau ekspresi protein pasca iradiasi yang terkait erat dengan keamanan dan aspek lain dari bahan vaksin. Meskipun telah melalui penelitian yang ekstensif, vaksin yang aman dan protektif belum dapat diperoleh karena masih diperlukan pengetahuan yang lebih mendalam mengenai mekanisme imunitas dan protein dalam litbang malaria. Hasil penelitian menunjukkan bahwa sel limfosit T berperan penting dalam pengaturan respon imun dan pembentukan memori imunologik yang mengontrol dan mengeliminasi infeksi. Sitokin proinflamasi seperti interleukin-12 (IL-12, interferon-gamma (IFN-γ, dan tumor necrosis factor alpha (TNF-α juga merupakan mediator esensial dari imunitas protektif pada malaria eritrositik. Berbagai pendekatan lain terkait respon imun seperti genetika molekuler saat ini sedang dilakukan. Studi juga menunjukkan bahwa profil protein bergantung pada beberapa faktor yang akan dibahas lebih lanjut dalam makalah. The development of vaccine against malaria as the deadly disease remains the global public health priority; and it includes the use of irradiated parasites as vaccine materials. Immunization with irradiated sporozoites could provide protective immunity in animals and volunteers. The mechanism of this body immunity system has been studied widely due to its important role in the development of vaccines and profiles and/or protein expression post-irradiation which are closely related to safety and other aspects of vaccine materials. Even though extensive research has been done, a safe and protective vaccine

  16. TANTANGAN DAKWAH DI ERA TEKNOLOGI DAN INFORMASI: Formulasi Karakteristik, Popularitas, dan Materi di Jalan Dakwah

    Directory of Open Access Journals (Sweden)

    nur Ahmad

    2015-11-01

    Full Text Available Teknologi di era globalisasi telah mengalami kemajuan yang begitu pesat. Berbagai macam media komunikasi bersaing dalam memberikan informasi tanpa batas. Fasilitas internet merupakan yang terlengkap dan efisien, dimana segala bentuk dan macam informasi dapat diakses dengan mudah dan murah termasuk dalam hal ini adalah dakwah di era teknologi didukung dengan semakin menjamurnya warung internet yang memasang tarif murah, kemana dan dengan siapapun. Sekarang kita bisa melakukan dakwah dengan mengunakan fasilitas digital, diantaranya bisa melalui radio, televisi, telepon seluler, media internet, facebook, atau twiter. Berdakwah melalui media internet merupakan salah satu media komunikasi yang fenomenal dan canggih yang lahir di era 60-an. Namun, kemajuan teknologi dan informasi, khususnya media televisi, memungkinkan seorang dai untuk berimprovisasi dengan selingan humor dan hal-hal lain, agar materi ceramahnya tetap menarik untuk disimak. Dampaknya, orientasi dakwah yang diperankan para dai, juga semakin berkembang, bahkan cenderung menjadi bias. Pola berdakwah melalui media sebagai wujud kemajuan teknologi menjadi tantangan bagi diri sendiri bagi seseorang dai. Pengaruh media memungkinkan seorang dai memperoleh popularitas di mata pemirsanya seperti layaknya seorang selebriti (publik figur dan tidak menutup kemungkinan pula setiap kegiatan dakwahnya sering dinilai dengan materi. Kata Kunci: Karakteristik, Popularitas, Materi, Tantangan Dakwah. THE CHALLENGES OF DAWA IN THE ERA OF TECHNOLOGY AND INFORMATION: THE FORMULATION CHARACTERISTICS, POPULARITY, AND MATERIAL IN THE PATH OF DAWA. Technology in the era of globalization has experienced a rapid progress. A wide range of communication media compete in providing information without limits. The internet is the most comprehensive and efficient, where all shapes and kinds of information can be accessed easily and inexpensively included in this is the dawa in the era of technology supported by the

  17. Kriptokokal meningitis: Aspek klinis dan diagnosis laboratorium

    Directory of Open Access Journals (Sweden)

    Efrida .

    2012-07-01

    Full Text Available Abstrak Kriptokokosis merupakan infeksi yang disebabkan oleh jamur Cryptococcus neoformans, infeksi ini secara luas ditemukan di dunia dan umumya dialami oleh penderita dengan sistem imun yang rendah. Munculan klinis terutama adalah meningitis dan meningoensefalitis yang dikenal dengan kriptokokal meningitis. Sejalan dengan infeksi HIV yang menjadi pandemi, kriptokokosis sebagai infeksi oportunistik juga semakin berkembang di dunia. Kriptokokal meningitis merupakan infeksi oportunistik kedua paling umum yang terkait dengan AIDS di Afrika dan Asia Selatan dengan kejadian kriptokokosis 15%-30% ditemukan pada pasien dengan AIDS. Tanpa pengobatan dengan antifungal yang spesifik, mortalitas dilaporkan 100% dalam dua minggu setelah munculan klinis kriptokokosis dengan meningoensefalitis pada populasi terinfeksi HIV. Di Indonesia, sebelum pandemi AIDS kasus kriptokokosis jarang dilaporkan. Sejak tahun 2004, seiring dengan pertambahan pasien terinfeksi HIV, Departemen Parasitologi FKUI mencatat peningkatan insidensi kriptokokal meningitis pada penderita AIDS yaitu sebesar 21,9%. Faktor yang terkait dengan virulensi Cryptococcus neoformans adalah adanya kapsul polisakarida, produksi melanin dan sifat thermotolerance. Imunitas yang dimediasi oleh sel memiliki peranan penting dalam pertahanan pejamu terhadap Cryptococcus. Pemeriksaan laboratorium penunjang untuk diagnosis adalah pemeriksaan mikroskopis langsung menggunakan tinta India, deteksi antigen, metode enzyme immunoassay, kultur, dan metode molekular. Kata kunci: kriptokokal meningitis, Cryptococcus neoformans,infeksi oportunistik Abstract Cryptococcosis is an infection caused by Cryptococcus neoformans, that is widely found worldwide and generally experienced by patients with immunodeficiency. Meningitis and meningoencephalitis is the major clinical symptoms in cryptococcal meningitis. Coincide with the pandemic of HIV infection, cryptococcosis as an opportunistic infection is also growing in the

  18. REENGINEERING PROSES BISNIS : TINJAUAN KONSEPTUAL DAN METODOLOGI

    Directory of Open Access Journals (Sweden)

    Lena Ellitan

    1999-01-01

    Full Text Available Business process reengineering is fundamental rethinking and radical redesign of an organization's business processes that leads the organization to achieve dramatic improvement in business performance. Many firms have successfully embraced this new innovation paradigm to achieve orders of magnitude improvements in cost, eficiency, quality and value. Even more firms are seeking opportunities to apply reengineering and methodologies to assist them in doing so. The recognition of reengineering as a new management paradigm emerged in the 1990's, though it may be argued that the principle of reengineering has been applied well before then. The early 1990's saw world wide interest in reengineering. Consequently, many organizations have reported their first-cycle experiences in reengineering. Reengineering practices in the period of the 1990's was largerly characterized by application to operational processes and emphasis on operational measure of time, cost, and quality. Quite recently, a more strategic flavor of reengineering has been advocated. One of the hopes of new thinking is that by trancending microscopic concern of operational strategy, it would help the organization derive significantly greater value out of the reengineering effort. This paper presents: 1. The concept of reengineering 2. Various problems in business process reengineering. 3. The rigorous methodology for organizing reengineering activities. Abstract in Bahasa Indonesia : Reengineering proses bisnis adalah pemikiran ulang fundamental dan disain ulang radikal suatu proses bisnis organisasi yang akan mengarahkan organisasi untuk mencapai peningkatan kinerja bisnis secara dramatis. Beberapa perusahaan telah menerapkan paradigma inovasi baru ini untuk mencapai berbagai perbaikan dalam biaya, kualitas, dan efisiensi. Bahkan makin banyak perusahaan yang mencari peluang untuk menerapkan proyek reengineering dan metodologi-metodologi yang membantu mereka dalam mencapai usaha

  19. Pengaruh Ketebalan Media Geotextile dan Arah Aliran Slow Sand Filter Rangkaian Seri untuk Menyisihkan P Total dan N Total

    Directory of Open Access Journals (Sweden)

    Ayuningtyas Ayuningtyas Ayuningtyas

    2014-03-01

    Full Text Available Pada penelitian ini dilakukan pengujian terhadap parameter-parameter yang berkaitan dengan standar kualitas air minum berdasarkan Peraturan Menteri Kesehatan Republik Indonesia No.492/MENKES/PER/IV/2010 pada air baku Kali Surabaya yang terlebih dahulu diolah pada unit pretreatment di IPAM Ngagel 1 Surabaya dan air yang akan diolah berasal dari outlet prasedimentasi. Air outlet prasedimentasi diolah terlebih dahulu menggunakan 4 unit roughing filter yang disusun secara seri kemudian diolah lebih lanjut ke unit slow sand filter dengan rangkaian seri. Digunakan dua variabel yaitu variasi arah aliran dan variasi ketebalan media geotextile. Media geotextile yang digunakan berjenis geotextile non woven. Ketebalan media geotextile yang digunakan sebesar 4 cm dan 6 cm sedangkan variasi arah aliran yang digunakan yaitu downflow-upflow dan downflow-downflow. Digunakan unit pengolahan slow sand filter dengan rangkaian seri sebanyak 2 reaktor. Pada penelitian ini akan dilakukan penambahan media geotextile di unit slow sand filter dan nantinya diharapkan supaya kandungan N total dan P total dapat diturunkan. Flow rate yang digunakan pada unit slow sand filter sebesara 0,3 m3/m2 jam. Tujuan dari penelitian ini yaitu untuk mengetahui ketebalan media geotextile dan arah aliran yang optimum pada unit slow sand filter dan menganalisis pengaruh penambahan media geotextile terhadap kualitas air hasil olahan unit slow sand filter untuk menyisihkan N total dan P total.

  20. Pemetaan Sebaran Dan Karakter Populasi Tanaman Buah Di Sepanjang Koridor Jalur Wisatadesa Kemiren, Tamansuruh, Dan Kampunganyar, Kabupaten Banyuwangi

    Directory of Open Access Journals (Sweden)

    Zakiyah Zakiyah

    2013-09-01

    Full Text Available Penelitian ini bertujuan untuk mengetahui peta persebaran tanaman buah, karakter populasi tanaman buah, serta persepsi masyarakat pemilik tanaman buah di sepanjang jalur wisata Desa Kemiren, Tamansuruh, dan Kampunganyar, Kabupaten Banyuwangi. Metode yang dilakukan meliputi survei pemetaan tanaman buah (mangga, rambutan, manggis, durian, jambu air dan jambu biji dengan merekam titik koordinat dari GPS untuk setiap tanaman buah. Penentuan karakter populasi tanaman buah dilakukan dengan mengamati morfologi tanaman terkait vitalitas dan periodisitas. Persepsi masyarakat dilakukan dengan wawancara dan kuisioner. Analisis data dilakukan dengan mengolah data koordinat dan data pengamatan karakter populasi tanaman buah ke dalam peta dasar melalui aplikasi GIS. Pemetaan persepsi masyarakat diperoleh dengan wawancara dan kuisioner yang dihitung dengan skala Likert kemudian dipetakan sebaran spasialnya dengan aplikasi GIS. Hasil penelitian menunjukkan bahwa persebaran tanaman buah yang ada di pekarangan rumah banyak tersebar di sepanjang jalur desa wisata dengan perbandingan jumlah buah yang ditemukan di Desa Kemiren 76 pohon, Tamansuruh 53 pohon, dan Kampunganyar 40 pohon. Kondisi tanaman buah dalam keadaan tumbuh dengan baik, bertunas, berbunga dan berbuah, hal ini dikarenakan pada saat penelitian waktunya tanaman buah memasuki masa berbuah dan masa panen. Antusiasme masyarakat tinggi untuk menjadikan tanaman buah yang ada di sepanjang jalur desa wisata sebagai daya tarik wisatawan. Kata Kunci: jalur wisata, karakter populasi, pemetaan, persepsi, tanaman buah

  1. Atom chip gravimeter

    Science.gov (United States)

    Schubert, Christian; Abend, Sven; Gebbe, Martina; Gersemann, Matthias; Ahlers, Holger; Müntinga, Hauke; Matthias, Jonas; Sahelgozin, Maral; Herr, Waldemar; Lämmerzahl, Claus; Ertmer, Wolfgang; Rasel, Ernst

    2016-04-01

    Atom interferometry has developed into a tool for measuring rotations [1], accelerations [2], and testing fundamental physics [3]. Gravimeters based on laser cooled atoms demonstrated residual uncertainties of few microgal [2,4] and were simplified for field applications [5]. Atomic gravimeters rely on the interference of matter waves which are coherently manipulated by laser light fields. The latter can be interpreted as rulers to which the position of the atoms is compared. At three points in time separated by a free evolution, the light fields are pulsed onto the atoms. First, a coherent superposition of two momentum states is produced, then the momentum is inverted, and finally the two trajectories are recombined. Depending on the acceleration the atoms experienced, the number of atoms detected in the output ports will change. Consequently, the acceleration can be determined from the output signal. The laser cooled atoms with microkelvin temperatures used in state-of-the-art gravimeters impose limits on the accuracy [4]. Therefore, ultra-cold atoms generated by Bose-Einstein condensation and delta-kick collimation [6,7] are expected to be the key for further improvements. These sources suffered from a low flux implying an incompatible noise floor, but a competitive performance was demonstrated recently with atom chips [8]. In the compact and robust setup constructed for operation in the drop tower [6] we demonstrated all steps necessary for an atom chip gravimeter with Bose-Einstein condensates in a ground based operation. We will discuss the principle of operation, the current performance, and the perspectives to supersede the state of the art. The authors thank the QUANTUS cooperation for contributions to the drop tower project in the earlier stages. This work is supported by the German Space Agency (DLR) with funds provided by the Federal Ministry for Economic Affairs and Energy (BMWi) due to an enactment of the German Bundestag under grant numbers DLR 50WM

  2. Advances in atomic spectroscopy

    CERN Document Server

    Sneddon, J

    1998-01-01

    This volume continues the series'' cutting-edge reviews on developments in this field. Since its invention in the 1920s, electrostatic precipitation has been extensively used in industrial hygiene to remove dust and particulate matter from gases before entering the atmosphere. This combination of electrostatic precipitation is reported upon in the first chapter. Following this, chapter two reviews recent advances in the area of chemical modification in electrothermal atomization. Chapter three consists of a review which deal with advances and uses of electrothermal atomization atomic absorption spectrometry. Flow injection atomic spectroscopy has developed rapidly in recent years and after a general introduction, various aspects of this technique are looked at in chapter four. Finally, in chapter five the use of various spectrometric techniques for the determination of mercury are described.

  3. Atomic & Molecular Interactions

    Energy Technology Data Exchange (ETDEWEB)

    None

    2002-07-12

    The Gordon Research Conference (GRC) on Atomic & Molecular Interactions was held at Roger Williams University, Bristol, RI. Emphasis was placed on current unpublished research and discussion of the future target areas in this field.

  4. Topics in atomic physics

    CERN Document Server

    Burkhardt, Charles E

    2006-01-01

    The study of atomic physics propelled us into the quantum age in the early twentieth century and carried us into the twenty-first century with a wealth of new and, in some cases, unexplained phenomena. Topics in Atomic Physics provides a foundation for students to begin research in modern atomic physics. It can also serve as a reference because it contains material that is not easily located in other sources. A distinguishing feature is the thorough exposition of the quantum mechanical hydrogen atom using both the traditional formulation and an alternative treatment not usually found in textbooks. The alternative treatment exploits the preeminent nature of the pure Coulomb potential and places the Lenz vector operator on an equal footing with other operators corresponding to classically conserved quantities. A number of difficult to find proofs and derivations are included as is development of operator formalism that permits facile solution of the Stark effect in hydrogen. Discussion of the classical hydrogen...

  5. Atomical Grothendieck categories

    Directory of Open Access Journals (Sweden)

    C. Năstăsescu

    2003-01-01

    Full Text Available Motivated by the study of Gabriel dimension of a Grothendieck category, we introduce the concept of atomical Grothendieck category, which has only two localizing subcategories, and we give a classification of this type of Grothendieck categories.

  6. Atomic Interferometry Project

    Data.gov (United States)

    National Aeronautics and Space Administration — Vertical cavity surface emitting lasers (VCSELs) is a new technology which can be used for developing high performance laser components for atom-based sensors...

  7. Optical atomic magnetometer

    Science.gov (United States)

    Budker, Dmitry; Higbie, James; Corsini, Eric P

    2013-11-19

    An optical atomic magnetometers is provided operating on the principles of nonlinear magneto-optical rotation. An atomic vapor is optically pumped using linearly polarized modulated light. The vapor is then probed using a non-modulated linearly polarized light beam. The resulting modulation in polarization angle of the probe light is detected and used in a feedback loop to induce self-oscillation at the resonant frequency.

  8. Cavity enhanced atomic magnetometry

    OpenAIRE

    Herbert Crepaz; Li Yuan Ley; Rainer Dumke

    2015-01-01

    Atom sensing based on Faraday rotation is an indispensable method for precision measurements, universally suitable for both hot and cold atomic systems. Here we demonstrate an all-optical magnetometer where the optical cell for Faraday rotation spectroscopy is augmented with a low finesse cavity. Unlike in previous experiments, where specifically designed multipass cells had been employed, our scheme allows to use conventional, spherical vapour cells. Spherical shaped cells have the advantage...

  9. Hirshfeld atom refinement.

    Science.gov (United States)

    Capelli, Silvia C; Bürgi, Hans-Beat; Dittrich, Birger; Grabowsky, Simon; Jayatilaka, Dylan

    2014-09-01

    Hirshfeld atom refinement (HAR) is a method which determines structural parameters from single-crystal X-ray diffraction data by using an aspherical atom partitioning of tailor-made ab initio quantum mechanical molecular electron densities without any further approximation. Here the original HAR method is extended by implementing an iterative procedure of successive cycles of electron density calculations, Hirshfeld atom scattering factor calculations and structural least-squares refinements, repeated until convergence. The importance of this iterative procedure is illustrated via the example of crystalline ammonia. The new HAR method is then applied to X-ray diffraction data of the dipeptide Gly-l-Ala measured at 12, 50, 100, 150, 220 and 295 K, using Hartree-Fock and BLYP density functional theory electron densities and three different basis sets. All positions and anisotropic displacement parameters (ADPs) are freely refined without constraints or restraints - even those for hydrogen atoms. The results are systematically compared with those from neutron diffraction experiments at the temperatures 12, 50, 150 and 295 K. Although non-hydrogen-atom ADPs differ by up to three combined standard uncertainties (csu's), all other structural parameters agree within less than 2 csu's. Using our best calculations (BLYP/cc-pVTZ, recommended for organic molecules), the accuracy of determining bond lengths involving hydrogen atoms from HAR is better than 0.009 Å for temperatures of 150 K or below; for hydrogen-atom ADPs it is better than 0.006 Å(2) as judged from the mean absolute X-ray minus neutron differences. These results are among the best ever obtained. Remarkably, the precision of determining bond lengths and ADPs for the hydrogen atoms from the HAR procedure is comparable with that from the neutron measurements - an outcome which is obtained with a routinely achievable resolution of the X-ray data of 0.65 Å.

  10. Atoms, molecules & elements

    CERN Document Server

    Graybill, George

    2007-01-01

    Young scientists will be thrilled to explore the invisible world of atoms, molecules and elements. Our resource provides ready-to-use information and activities for remedial students using simplified language and vocabulary. Students will label each part of the atom, learn what compounds are, and explore the patterns in the periodic table of elements to find calcium (Ca), chlorine (Cl), and helium (He) through hands-on activities.

  11. ADAPTASI DAN RESPON PONDOK TREMAS TERHADAP ARUS GLOBALISASI

    Directory of Open Access Journals (Sweden)

    Mukodi Mukodi

    2016-10-01

    Full Text Available Penelitian ini bertujuan untuk: (1 mengkaji dan menganalisis adaptasi yang dilakukan Pesantren Tremas terhadap tuntutan perubahan kehidupan, mulai dari pergeseran nilai-nilai, politik, ekonomi, bahkan sosial budaya di era globalisasi, dan (2 mengkaji dan menganalisis respon yang dibangun di Pondok Tremas, sehingga ia tetap bertahan di tengah himpitan arus perubahan sosial era globalisasi. Jenis penelitian ini adalah kualitatif, dengan menggunakan pendekatan fenomenologi. Model penelitian ini menggunakan interaksi simbolik. Interaksi simbolis mengejar makna dibalik yang sensual, mencari phenomena yang lebih esensial daripada sekadar gejala. Fokus penelitian ini adalah Pondok Pesantren Tremas, di Kecamatan Arjosari Kabupaten Pacitan. Key informan sekaligus kiai yang diamati di Pesantren Tremas adalah KH. Fuad Habib, dan KH. Luqman Harist Dimyathi. Metode pengumpulan meliputi tiga tahap, yakni: (i tahap pra lapangan; (ii tahap di lapangan; dan (iii tahap analisis data. Analisis data melalui intensionalitas; intersubjectivity; refleksi atau intuisi; dan transendental logic. Penelitian di rancang selama satu tahun mulai dari pembuatan proposal, pelaksanaan sampai laporan penelitian. Hasil penelitian ini menemukan dua hal dasar. Pertama, bahwa adaptasi Pondok Tremas dalam mewarnai modernisasi dilakukan dengan dibukanya pendidikan formal mulai dari Taman Kanak-Kanak, MTs, MA Salafiyah hingga community college, dan Ma’had Aly. Eksistensi pendidikan formal di lingkungan Pondok Tremas yang dimulai pada tahun 1952 seolah mempertegas keberpihakan para kiai terhadap modernisasi, sekaligus tanggap atas kebutuhan masyarakat sekitar atas pendidikan formal. Kedua, respon Pondok Tremas dalam menghadapi era globalisasi dilakukan dengan pembagian peran dan tanggung jawab, yakni KH. Fuad Habib Dimyathi menjadi penjaga kedalaman Pondok Tremas, khususnya urusan domestik, terkait masalah pendidikan dan pengajaran, sedangkan KH. Lukman Hakim bertanggung jawab sebagai

  12. PROFIL WAJIB BELAJAR 9 TAHUN DAN ALTERNATIF PENUNTASANNYA

    Directory of Open Access Journals (Sweden)

    Nurul Ulfatin

    2016-02-01

    Full Text Available The Profile of 9-year Compulsory Education and an Alternative to Its Completion. The focus of this study is on describing the 9-years compulsory education profiles at Kediri district and por­traying the problems in implementing the program. The data were collected through analyzing the relevant documents, observing, interviewing, and carrying out focused-group discussions involving go respondents. The results of descriptive, qualitative analyses reveal that the profiles of  Kediri’s 9 year compulsory education reflect the population, development, distribution, quality and efficiency of each district. This suggests the need for an education model as the alternative to deal with the existing problems.   Profil Wajib Belajar 9 Tahun dan Alternatif Penuntasannya. Tujuan penelitian ini untuk mengetahui (1 profil wajib belajar 9 tahun di kabupaten kediri, (2 profil wajib belajar di kecamatan yang memiliki APK terendah dan tertinggi, (3 peta masalah wajib belajar, (4 potensi sumber daya pe­nunjang penuntasan wajib belajar, (5 kebutuhan dan alternatif untuk mengatasi masalah yang timbul dalam pelaksanaan wajib belajar 9 tahun. Data dikumpulkan dengan analisis dokumen, pengamatan, wawancara, dan FGD dari 90 orang informan, dan dianalisis dengan teknik deskriptif dan kualitatif. Hasil penelitian adalah: (1 profil wajib belajar 9 tahun dapat terlihat dari sisi kependudukan, pembangunan pendidikan, data pokok, pemerataan, mutu, efisiensi, dan sebaran APK tiap kecamatan; (2 profil keti­daktuntasan wajib belajar terlihat dari rendahnya APK, jumlah sekolah, siswa, lulusan dan drop out; (3 peta masalah ketidaktuntasan bersumber dari rendahnya ekonomi orang tua, geografis-demografis, dan sosial-budaya orang tua, (4 potensi sumber daya yang perlu diperhatikan dalam penuntasan wajib belajar adalah sumber daya alam dan sosial; (5 kebutuhan yang harus dipenuhi dalam penuntasan wajib bela­jar 9 tahun adalah alternatif model pendidikan yang dikembangkan

  13. PENINGKATAN KUALITAS DAN PROSES PEMBUATAN BIODIESEL DARI BLENDING MINYAK KELAPA SAWIT (PALM OIL DAN MINYAK KELAPA (COCONUT OIL DAN BANTUAN GELOMBANG ULTRASONIK

    Directory of Open Access Journals (Sweden)

    Hantoro Satriadi

    2015-01-01

    Full Text Available Keterbatasan solar sebagai sumber energi bahan bakunya tidak dapat diperbaharui menuntut adanya bahan baku alternatif yang dapat diperbaharui dan ramah lingkungan untuk pembuatan biodiesel. Reaksi utama produksi biodiesel adalah esterifikasi dan transestirifikasi yang berlangsung lambat dan membutuhkan banyak katalis dan alkohol. Reaksi yang terjadi belum sempurna dan belum memenuhi standar SNI dan ASTM. Untuk memperbaiki mutu biodiesel serta menghasilkan yield maksimal, maka dilakukan blending bahan baku antara minyak kelapa sawit dan minyak kelapa dan dengan bantuan gelombang ultrasonic. Penelitian ini bertujuan untuk mempelajari pengaruh variabel perbandingan volume minyak kelapa sawit dan minyak kelapa, perbandingan volume methanolminyak, dan persentase berat katalis terhadap minyak terhadap hasil atau yield biodiesel. Alat utama yang digunakan adalah reaktor yang dilengkapi pembangkit gelombang ultrasonic dengan temperature 60 oC, tekanan 1 atm, volume 3 liter, dan frekuensi 28 kHz. Variabel proses pada penelitian ini adalah perbandingan volume minyak sawit dan kelapa 2:1, 3:1, dan 4:1, pebandingan volume metanol-minyak 0,2:1, 0,25:1, dan 0,3:1, dan persentase berat katalis KOH terhadap minyak 0,3%, 0,5%, dan 0,7%. Hasil penelitian didapat konversi tertinggi dicapai pada variabel perbandingan volume minyak sawit dan kelapa 3:1, perbandingan volume metanol/minyak 0,25:1, dan persentase berat katalis terhadap minyak dengan yield 97,26%.[A Improvement of Quality and Process for Biodiesel Production from Palm Oil and Coconut Oil Blends with Ultrasound Assisted] Limitations of solar energy as a source of raw material cannot be renewed demands for alternative raw materials that are renewable and environmentally friendly for the manufacture of biodiesel. The main production of biodiesel reaction is esterification and transestirifikasi which runs slow and requires a lot of alcohol and a catalyst. Reactions that happen yet perfect, and has not met

  14. Discovery of a Damped Lya Absorber at z = 3.3 along a galaxy sight-line in the SSA22 field

    CERN Document Server

    Mawatari, K; Kousai, K; Hayashino, T; Cooke, R; Prochaska, J X; Yamada, T; Matsuda, Y

    2015-01-01

    Using galaxies as background light sources to map the Lya absorption lines is a novel approach to study Damped Lya Absorbers (DLAs). We report the discovery of an intervening z = 3.335 +- 0.007 DLA along a galaxy sight-line identified among 80 Lyman Break Galaxy (LBG) spectra obtained with our VLT/VIMOS survey in the SSA22 field. The measured DLA neutral hydrogen (HI) column density is log (NHI/cm^{-2}) = 21.68 +- 0.17. The DLA covering fraction over the extended background LBG is > 70 % (2 sigma), yielding a conservative constraint on the DLA area as > 1 kpc^2. Our search for a counterpart galaxy hosting this DLA concludes that there is no counterpart galaxy with star formation rate (SFR) larger than a few Msun yr^{-1}, ruling out an unobscured violent star formation in the DLA gas cloud. We also rule out the possibility that the host galaxy of the DLA is a passive galaxy with Mstar > 5 x 10^{10} Msun or a heavily dust-obscured galaxy with E(B-V) > 2. The DLA may coincide in a large-scale overdensity of the ...

  15. Effect of the Prevalence of HIV/AIDS and the Life Expectancy Rate on Economic Growth in SSA Countries: Difference GMM Approach.

    Science.gov (United States)

    Waziri, Salisu Ibrahim; Mohamed Nor, Norashidah; Raja Abdullah, Nik Mustapha; Adamu, Peter

    2015-09-01

    The productivity of countries around the globe is adversely affected by the health-related problems of their labour force. This study examined the effect of the prevalence of human immunodeficiency virus/acquired immune deficiency syndrome (HIV/AIDS) and life expectancy on the economic growth of 33 Sub-Saharan African (SSA) countries over a period of 11 years (2002-2012). The study employed a dynamic panel approach as opposed to the static traditional approach utilised in the literature. The dynamic approach became eminent because of the fact that HIV/AIDS is a dynamic variable as its prevalence today depends on the previous years. The result revealed that HIV/AIDS is negatively correlated with economic growth in the region, with a coefficient of 0.014, and significant at the 1% level. That is, a 10% increase in HIV/AIDS prevalence leads to a 0.14% decrease in the GDP of the region. Tackling HIV/AIDS is therefore imperative to the developing Sub-Saharan African region and all hands must be on deck to end the menace globally.

  16. Anomalies de Résistivité dans Certains Métaux Magnétiques

    Science.gov (United States)

    de Gennes, P. G.; Friedel, J.

    La résistivité anormale de certaines terres rares et des alliages tels que AuMn, Au3Mn, est interpretée en admettant qu'il existe un couplage d'échange entre électrons de conduction et porteurs de magnétisme. La valeur absolue de la section efficace correspondante est traitée comme une quantité phénomènologique. Aux températures élevées, les spins atomiques sont orientés au hasard, et les électrons de conduction ont un libre parcours moyen fini. Aux basses températures, les moments atomiques sont tous alignés et ne diffusent plus les électrons. Les effets d'ordre à courte distance sont analysés dans les limites de l'approximation de BORN. Its sont petits dans la plupart des cas physiques. The anomalous resistivity of some rare earth metals, and of alloys like AuMn, Au3Mn, is studied by assuming a coupling between conduction electrons and atomic spins. The magnitude of the corresponding cross section is treated as a phenomenological quantity. At high temperatures, the atomic spins are at random, and the conduction electrons have a finite mean free path. At low temperatures, the atomic spins are all alined and no scattering can occur. Short-range order effects in the spin lattice are analysed in the Born approximation, and shown to be small in most physical situations.

  17. The high incidence of anti-Ro/SSA and anti-p200 antibodies in female patients with connective tissue diseases confirms the importance of screening for congenital heart block-associated autoantibodies during pregnancy.

    Science.gov (United States)

    Cozzani, E; Agnoletti, Arianna Fay; Pappalardo, F; Schiavetti, I; Torino, A; Parodi, A

    2016-03-01

    It is known that anti-Ro/SSA positivity leads to higher risk of miscarriage and fetal cardiac malformations. Particularly, anti-p200 antibodies against a finer specificity of the Ro/SSA antigen, have been associated with congenital heart block. The aim of the study was to assess the frequency of anti-p200 among female patients with different connective tissue diseases and, among these, the relevance of anti-p200 values in patients with cutaneous diseases compared to systemic diseases. Anti-p200 were investigated in 110 anti-Ro/SSA positive female sera, sent to our laboratory between 2008 and 2014 with suspect of connective disease, by using ELISA testing. Positivity was found in 40.9 % samples, 34 of them showed a strong positivity (values ≥ 1.0, cut off = 0.7). Patients with systemic diseases were anti-p200 positive in the 45.9 % of cases while patients with cutaneous diseases were positive in the 24.0 % of cases. Positivity for anti-p200 antibodies was revealed in 24.0 % of patients with discoid lupus erythematosus; 100 % of patients with dermatomyositis; 40.0 % of patients with mixed connective tissue disease; 25.0 % of patients with rheumatoid arthritis; 100 % of patients with Sjögren's syndrome; 33.3 % of patients with subacute cutaneous lupus erythematosus; 42.9 % of patients with systemic lupus erythematosus; 80.0 % of patients with systemic sclerosis. No significant difference in anti-p200 prevalence was found between systemic and cutaneous involvement, nevertheless, considering only positive sera, the antibody titer was higher in systemic diseases rather than in cutaneous diseases (2.6 ± 1.7 and 1.7 ± 1.9; p = 0.041). The authors think screenings for anti-Ro/SSA and anti-p200 antibodies should be included in the laboratory checklist for pregnancy.

  18. VCS-SSA Mainz Experiment. Measurement of the beam spin asymmetry in (e polarized p {yields} ep{gamma}) and (e polarized p {yields} ep{pi}{sup 0}). Final analysis - MEMO I

    Energy Technology Data Exchange (ETDEWEB)

    Fonvieille, H.; Bensafa, I. [LPC-Clermont-Fd, Universite Blaise Pascal, F-63170 Aubiere Cedex (France)

    2006-02-15

    This note gives details on the final analysis of the VCS-SSA experiment in terms of Beam Spin Asymmetry. It summarizes the changes between the first and second pass analysis. Then the measured asymmetry is presented for both channels e polarized p {yields} ep{gamma} and e polarized p {yields} ep{pi}{sup 0} including systematic studies. The final experimental result is briefly compared to some model predictions. (authors)

  19. KETIDAKSEIMBANGAN HAK DAN KEWAJIBAN ANTARA INVESTOR ASING DENGAN PEKERJA INDONESIA DALAM PENGATURAN PENANAMAN MODAL DAN KETENAGAKERJAAN

    Directory of Open Access Journals (Sweden)

    Mrs. Sulistyowati

    2015-10-01

    Full Text Available This research purports to identify and find the form of imparity on the rights and obligations of the foreign investors and Indonesian workers in Indonesian regulations of investment law. The imparity is shown in: (idiscrepancies in minimum wage among employee working in foreign investment and domestic investment;(ii rights and obligations; as well as (iii legal culture which perceives Indonesian employee as one ofthe production factors. Such imparity, however, are not without purpose. It is aimed to complete verticalharmonization to avoid overlapping regulations. Nonetheless, the author finds this imparity still bringmore favour to the foreign investors. Penelitian ini ditujukan untuk mengidentifikasi dan menemukan bentuk-bentuk ketidakseimbangan hak dan kewajiban antara penanam modal asing dan pekerja Indonesia dalam peraturan perundang-undanganmengenai penanaman modal. Ketidakseimbangan tampak pada: (i upah minimum yang sama terhadappekerja Indonesia baik yang bekerja di PMA maupun PMDN; (ii hak dan kewajiban; serta (iii budayahukum yang menganggap pekerja Indonesia sebagai salah satu faktor produksi yang sama halnya denganfaktor produksi lainnya. Ketidakseimbangan ini bukanlah tanpa tujuan. Ketidakseimbangan yang adaditujukan untuk menciptakan harmonisasi vertikal dalam rangka menghindari kebijakan yang tumpangtindih. Hanya saja, penulis berpendapat bahwa ketidakseimbangan ini masih lebih menguntungkanpenanam modal asing.

  20. REFORMASI PENYUSUNAN ANGGARAN DAN KUALITAS ANGGARAN PENDAPATAN DAN BELANJA DAERAH (APBD

    Directory of Open Access Journals (Sweden)

    Jurica Lucyanda

    2012-03-01

    Full Text Available Penelitian ini bertujuan untuk membuktikan secara empiris pengaruh akuntabilitas publik, partisipasi masyarakat, transparansi publik dan APBD pendekatan kinerja terhadap kualitas APBD di Kabupaten Semarang. Sampel penelitian terdiri dari Lembaga Swadaya Masyarakat (LSM, tokoh masyarakat, organisasi masyarakat, akademisi, mahasiswa dan media masa yang berada di wilayah Kabupaten Semarang Jawa Tengah. Metode pengumpuan data dilakukan dengan menggunakan kuesioner yang disebarkan pada 60 responden. Analisis data dilakukan dengan menggunakan analisis regresi. Hasil penelitian menunjukkan bahwa variabel akuntabilitas publik, partisipasi masyarakat, transparansi publik dan APBD pendekatan kinerja memiliki pengaruh yang positif dan signifikan terhadap kualitas APBD. AbstractThis study purposed to get empirically the effects of public accountability, public participation, public transparency and performance approach APBD on the quality of APBD in Semarang Regency.The sample of this research consist in Non Government Organization, public figure, public organization, an academic, colleges and mass media in Semarang, Central of Java. Colecting data by  questioner and was distribute, the questioner got back with 60 respondences. Data analyzed by regression test. Regression analysis was also seen from coefficient and t values those were negative or positive. It was because hypothesis proposed in this study were positively or negatively correlated.The result of study showed that there are effects of public accountability, public participation, public transparency and performance approach APBD to quality of APBD.Keywords: APBD;  performance approach; quality of APBD