WorldWideScience

Sample records for atf torsatron

  1. Runaway studies in the ATF [Advanced Toroidal Facility] torsatron

    International Nuclear Information System (INIS)

    Pulsed torsatrons and heliotrons are susceptible to runaway electron formation and confinement resulting from the inherent good containment in the vacuum fields and the high loop voltages during the initiation and termination of the helical and vertical fields (''field ramping''). Because runaway electrons can cause an unacceptable level of hard X rays near the machine, a runaway suppression system was designed and included in the initial operation of the Advanced Toroidal Facility (ATF). The main component of the system is a rotating paddle that is normally left in the vacuum chamber during the field ramps. This device proved to be very effective in reducing the runaway population. Measurements of hard X rays from ATF have shown that the runaways are produced primarily during the field ramping but that usually a small steady-state runaway component is also present during the ''flat-top'' portion of the fields. The paddle is the main source of the hard X rays (thick-target bremsstrahlung), although other objects in the vacuum chamber also serve as targets for the runaways at various times. The maximum X-ray energy found by pulse height analysis is /approximately/12--15 MeV; the mean energy appears to be a few mega-electron-volts. A noticeable forward peaking of the bremsstrahlung from the paddle is evident. The limiters do not appear to be major sources of bremsstrahlung. 17 refs., 14 figs

  2. Effects of magnetic field perturbations in the ATF torsatron

    International Nuclear Information System (INIS)

    The effects of errors in the magnetic fields of tokamaks on the plasma are quite different from those in stellarators. In tokamaks, field errors can cause disruptive locked modes through the non-linear evolution of tearing modes acting on initially small error-induced islands. Scaling predictions for these effects indicate that the critical relative field error which can be tolerated becomes smaller as the tokamak size becomes larger. In stellarators, the effect is more benign, as field errors appear only to cause increased plasma transport in the vicinity of islands. Great care has been taken to minimize magnetic field errors in the most recent generation of stellarator-type magnetic plasma traps. In the past six years, several new and sensitive techniques have been developed to detect and map field errors. These methods all rely on the detection of electrons injected along magnetic field lines. During the commissioning of ATF, flux surfaces were mapped using the fluorescent screen technique. Field errors were discovered and traced to uncompensated dipoles in the helical current feeds. Prior to elimination of these errors, plasma discharges indicated centrally peaked plasma profiles. After correction of the uncompensated dipoles, flux surfaces were mapped a second time, and the island widths were found to be greatly reduced. Field errors were then deliberately introduced using a set of perturbation coils that had been added to ATF, and electron-beam mapping of the flux surfaces showed that islands several centimeters in width could easily be created by these coils. After elimination of the error fields, the measured plasma temperature and density profiles were much broader. The field-perturbation coils were then used to produce magnetic field asymmetries, and the measured plasma profiles were again shown to narrow as a result of islands

  3. Experimental studies of radio frequency waves and confinement in the Auburn Torsatron

    International Nuclear Information System (INIS)

    The Auburn University Torsatron Group has been very active during the past year. The design of the new Compact Auburn Torsatron (CAT) was completed and construction is underway. Plasma experiments on the existing Auburn Torsatron in the areas of ICH and plasma microwave emission have also been carried out. Personnel from the Auburn Torsatron Group have also been involved in collaborative research with other research institutions, particularly the ATF Group at ORNL. Another significant development has been the Auburn Torsatron laboratory renovation project. Auburn University committed $75,000 to a laboratory upgrade in the Nuclear Science Center, the building which houses the Torsatron laboratory. The main result of this renovation is a doubling of the floor space in the Auburn Torsatron laboratory. This renovation work started on August 1, 1989 and is scheduled for completion on October 30, 1989

  4. Compact Torsatron configurations

    International Nuclear Information System (INIS)

    Low-aspect-ratio stellarator configurations can be realized by using torsatron winding. Plasmas with aspect ratios in the range of 3.5 to 5 can be confined by these Compact Torsatron configurations. Stable operation at high Β should be possible in these devices, if a vertical field coil system is adequately designed to avoid breaking of the magnetic surfaces at finite Β. 17 refs., 21 figs., 1 tab

  5. MHD stability of torsatrons using the average method

    International Nuclear Information System (INIS)

    The stability of torsatrons is studied using the average method, or stellarator expansion. Attention is focused upon the Advanced Toroidal Fusion Device (ATF), an l = 2, 12 field period, moderate aspect ratio configuration which, through a combination of shear and toroidally induced magnetic well, is stable to ideal modes. Using the vertical field (VF) coil system of ATF it is possible to enhance this stability by shaping the plasma to control the rotational transform. The VF coils are also useful tools for exploring the stability boundaries of ATF. By shifting the plasma inward along the major radius, the magnetic well can be removed, leading to three types of long wavelength instabilities: (1) A free boundary ''edge mode'' occurs when the rotational transform at the plasma edge is just less than unity. This mode is stabilized by the placement of a conducting wall at 1.5 times the plasma radius. (2) A free boundary global kink mode is observed at high β. When either β is lowered or a conducting wall is placed at the plasma boundary, the global mode is suppressed, and (3) an interchange mode is observed instead. For this interchange mode, calculations of the second, third, etc., most unstable modes are used to understand the nature of the degeneracy breaking induced by toroidal effects. Thus, the ATF configuration is well chosen for the study of torsatron stability limits

  6. Divertor for a torsatron

    International Nuclear Information System (INIS)

    The divertor for a torsatron comprising a toroidal vacuum chamber embracing the toroidal chamber of torsatron trap and communicating with it through the gaps between helical conductors of the system for creation of the trap magnetic field is described. The divertor comprises also a collector realized in a form of plates crossing magnetic field force lines. With the purpose of decreasing the plasma contamination level the collector plates realized curvilinear and embrace conductors at full their length and have the curvature less than that of the magnetic field force lines in the plate mounting point. The invention permits to decrease the plasma contamination by decreasing the particles flux formed as a result of collector plates errosion and accordingly increase plasma temperature in the trap

  7. Compact torsatron reactors

    International Nuclear Information System (INIS)

    Low-aspect-ratio torsatron configurations could lead to compact stellarator reactors with R0 = 8--11m, roughly one-half to one-third the size of more conventional stellarator reactor designs. Minimum-size torsatron reactors are found using various assumptions. Their size is relatively insensitive to the choice of the conductor parameters and depends mostly on geometrical constraints. The smallest size is obtained by eliminating the tritium breeding blanket under the helical winding on the inboard side and by reducing the radial depth of the superconducting coil. Engineering design issues and reactor performance are examined for three examples to illustrate the feasibility of this approach for compact reactors and for a medium-size (R0 ≅ 4 m,/bar a/ /approx lt/ 1 m) copper-coil ignition experiment. 26 refs., 11 figs., 7 tabs

  8. Computer simulation of magnetic field circuits in ATF

    International Nuclear Information System (INIS)

    The proposed design of the Advanced Toroidal Facility (ATF) contains several closely coupled magnetic field circuits that are being modeled using the SUPER*SCEPTRE computer program in order to predict their transient behavior. The results of this transient analysis study will be used to determine component values and/or special precautions that may be required for power supply and other circuit element protection due to the mutual coupling between circuits. ATF is a continuous-coil torsatron device using resistive coils in a pulsed mode of operation in which a current fluctuation in one coil induces voltages in the other circuit element protection due to the mutual coupling between circuits. ATF is a continuous-coil torsatron device using resistive coils in a pulsed mode of operation in which a current fluctuation in one coil induces voltages in the other circuit that may not be desirable. The model contains the solid-state power supplies' equivalent circuits, the resistance and self-inductance of each magnetic field coil, and the mutual inductances of every coil combination. The SUPER*SCEPTRE program allows for the direct input of all electrical components as well as the mutual inductances. The power supply voltages are entered as preprogrammed wave shapes designed to achieve the desired magnetic field strengths. The outputs of this program are tables and plots of voltages and currents associated with each circuit component

  9. ATF [Advanced Toroidal Facility]-2 studies

    International Nuclear Information System (INIS)

    Design studies for a low-aspect-ratio, large next-generation stellarator, ATF-II, with high-current-density, high-field, stable NbTi/Cu helical windings are described. The design parameters are an average plasma radius of 0.52 m, a major radius of 2 m, and a field on axis of 4-5 T, with 10 to 15 MW of heating power. Such a device would be comparable in scope to other next-generation stellarators but would have roughly the same aspect ratio as the tokamaks without, however, the need for current drive to sustain steady-state operation. A number of low-aspect-ratio physics issues need to be addressed in the design of ATF-II, primarily compromises between high-beta capability and good confinement properties. A six-field-period Compact Torsatron is chosen as a reference design for ATF-II, and its main features and performance predictions are discussed. An integrated (beta capability and confinement) optimization approach and optimization of superconducting windings are also discussed. 36 refs., 13 figs., 2 tabs

  10. Torsatron equilibrium and stability studies

    International Nuclear Information System (INIS)

    Equilibrium and stability results are presented for the Advanced Toroidal Facility (ATF) device. The results of three-dimensional equilibrium calculations and free boundary average method calculations are shown to be in good agreement with previous fixed boundary average method results. These favorable comparisons serve as a valuable validation of the simple and computationally efficient fixed boundary average method. Stability calculations for the free boundary average method equilibria are also in good agreement with fixed boundary calculations, showing instability only when the plasma is shifted inward with an applied vertical field

  11. Wisconsin Torsatron/Stellarator Program, FY 1987

    International Nuclear Information System (INIS)

    The research of the Torsatron/Stellarator Laboratory during the present contract period has concentrated on several main areas. The confinement in IMS is being investigated under the conditions of an applied vertical magnetic field and with the insertion of a localized limiter. Excellent agreement between a simplified stochastic heating theory and the measured electron cyclotron breakdown and heating phases of the Proto-Cleo torsatron have been achieved. Measurements of the secondary currents and the ability to drive currents using Alfven waves are continuing on the Proto-Cleo stellarator. Theoretical efforts have concentrated on modelling the experimental devices, including 1-D transport modelling, particle-in-cell simulation and divertor field line following codes

  12. Wisconsin torsatron/stellarator program, FY 1989

    International Nuclear Information System (INIS)

    This proposal documents recent activities within the University of Wisconsin-Madison Torsatron/Stellarator Laboratory and presents plans for future research activities for a three year period. Research efforts have focused on fundamental stellarator physics issues through experimental investigations on the Interchangeable Module Stellarator (IMS) and the Proto-Cleo Stellarator. Theoretical activities and studies of new configurations are being undertaken to support and broaden the experimental program. Experimental research at the Torsatron Stellarator Laboratory has been primarily concerned with effects induced through electron-cyclotron resonant frequency plasma production and heating in the IMS device. Plasma electric fields have been shown to play a major role in particle transport and confinement in IMS. ECRF heating at 6 kG has produced electron tail populations in agreement with Monte-Carlo models. Electric and magnetic fields have been shown to alter the particle flows to the IMS modular divertors. 48 refs

  13. Design of the Compact Auburn Torsatron

    International Nuclear Information System (INIS)

    This paper describes the design and optimization procedure for the Compact Auburn Torsatron. Included in this is a description of the Cary-Hanson Optimization technique. In this paper the properties of the magnetic fields are presented and a description of the machine and the construction procedure. The experimental setup for the surface mapping is described and conclusions are presented. 10 refs., 9 figs., 1 tab

  14. Perspectives on low-aspect-ratio torsatron/heliotron

    International Nuclear Information System (INIS)

    The advantages of the low-aspect-ratio torsatron/heliotron configuration is discussed from the point of view of plasma confinement. Recent numerical results on the configuration study and the experimental data base are reviewed. (author)

  15. ATF2 Proposal

    Energy Technology Data Exchange (ETDEWEB)

    Grishanov, Boris Ivanovich; Logachev, Pavel; Podgorny, Fedor; Telnov, Valery; /Novosibirsk, IYF; Angal-Kalinin, Deepa; Appleby, Robert; Jones, James; Kalinin, Alexander; /Daresbury; Napoly, Olivier; Payet, Jacques; /DAPNIA, Saclay; Braun, Hans-Heinrich; Schulte, Daniel; Zimmermann, Frank; /CERN; Barlow, Roger; Bailey, Ian; Jenner, Leo; Jones, Roger; Kourevlev, German; /Daresbury; Walker, Nick; /DESY; Takahasi, Tohru; /Hiroshima U.; Gao, Jie; /Beijing, Inst. High Energy Phys. /Oxford U. /KEK, Tsukuba /Kyoto U., Inst. Chem. Res.

    2005-08-23

    This document is the first of two volumes describing the ATF2 project. The present volume discusses the technical justification for ATF2 and presents a design description. Since the International Committee for Future Accelerator (ICFA) decision on the choice of technology, a world-wide collaboration on the design of the International Linear Collider (ILC) has rapidly progressed [1]. The formation of the Global Design Effort (GDE) will accelerate the work towards a final design. An important technical challenge is obviously the high gradient acceleration but what is similarly challenging is the collision of extremely small beams of a few nanometer size. The latter challenge has three distinct issues: creating small emittance beams, preserving the emittance during acceleration and transport, and focusing the beams to nanometers. Most studies have been done using computer simulations but many issues still remain that require experimental verification. Accelerator Test Facility (ATF) at KEK was built to create small emittance beams, and succeeded in obtaining an emittance that almost satisfies the ILC requirements [2]. In this proposal we present a project, ATF2, which addresses the focusing of the beam into a nanometer spot. The ATF2 project will extend the extraction beamline of the ATF with an ILC-type final focus system to create a tightly focused, stable beam by making use of the small emittance of the ATF. The layout is shown in Figure 1.1. In the longer term, the ATF2 project would also provide invaluable input for the CLIC design of a future multi-TeV collider.

  16. ATF2 Proposal

    International Nuclear Information System (INIS)

    This document is the first of two volumes describing the ATF2 project. The present volume discusses the technical justification for ATF2 and presents a design description. Since the International Committee for Future Accelerator (ICFA) decision on the choice of technology, a world-wide collaboration on the design of the International Linear Collider (ILC) has rapidly progressed [1]. The formation of the Global Design Effort (GDE) will accelerate the work towards a final design. An important technical challenge is obviously the high gradient acceleration but what is similarly challenging is the collision of extremely small beams of a few nanometer size. The latter challenge has three distinct issues: creating small emittance beams, preserving the emittance during acceleration and transport, and focusing the beams to nanometers. Most studies have been done using computer simulations but many issues still remain that require experimental verification. Accelerator Test Facility (ATF) at KEK was built to create small emittance beams, and succeeded in obtaining an emittance that almost satisfies the ILC requirements [2]. In this proposal we present a project, ATF2, which addresses the focusing of the beam into a nanometer spot. The ATF2 project will extend the extraction beamline of the ATF with an ILC-type final focus system to create a tightly focused, stable beam by making use of the small emittance of the ATF. The layout is shown in Figure 1.1. In the longer term, the ATF2 project would also provide invaluable input for the CLIC design of a future multi-TeV collider

  17. [Wisconsin Torsatron/Stellarator Program: FY 1988

    International Nuclear Information System (INIS)

    The Torsatron/Stellarator Laboratory Program during the present period has concentrated on experimental investigations into ECR-produced plasmas in the IMS device. Significant progress has been made in understanding the role of convection in maintaining the hollow plasma density profiles under a wide range of operating conditions. Divertor studies have continued to show good agreement with predictions derived from simple field-line models and the ability to effect particle flows through biasing of divertor plates. Preliminary fluctuation studies showed a dependence of the amplitudes of the fluctuations and profile shapes as a function of the magnetic topology of the device. Theoretical support of the experimental program has provided models to help interpret the experimental results. New initiatives have begun in reduced-Q operation of the Proto-Cleo Stellarator, and in ion-Bernstein wave heating in IMS

  18. Recent progress on ATF

    International Nuclear Information System (INIS)

    The ATF experiment will test improvements to high-beta, steady-state toroidal confinement using external helical fields. The device design has been optimized to (1) provide direct access to the high-beta second-stability regime, (2) have sufficient flexibility to study a large range of toroidal configurations both with and without plasma current, (3) test the reduction of low-collisionality transport by EXB drifts induced by the self-consistent radial electric field, and (4) permit steady-state, high-beta operation without disruptions. Continued physics studied at ORNL and recent results from foreign stellarator experiments have increased confidence in ATF performance

  19. Electron temperature measurements on ATF using electron cyclotron emission

    International Nuclear Information System (INIS)

    Second and third harmonic electron cyclotron emission measurements have been carried out on the Advanced Toroidal Facility (ATF) at Oak Ridge National Laboratory. ATF is a 1=2, m=12 torsatron with a major radius of 2.1m and an average plasma radius of 0.3m. At the standard magnetic field values of 1T and 2T, we have used heterodyne receivers with fixed frequency Gunn local oscillators. The optically thick second harmonic emission has been used to monitor the electron temperature profile as a function of time. The optically thin third harmonic emission has been used to measure the central electron temperature during ECH and Neutral Beam Injection. Results from both harmonics agree well with the Thomson scattering data. Calculations of the width of the resonance zones indicate values from 1 cm at the edge to 5 cm centrally. An in-situ absolute calibration of the system using a liquid nitrogen source has been performed. The beam pattern of the system has also been measured in-situ and agrees well with theoretical calculations. A beam viewing dump has been installed to reduce the wall reflection problem for the optically thin emission. (author)

  20. ATF2 Proposal Vol.2

    OpenAIRE

    ATF2 Group

    2006-01-01

    The two major goals for this facility, called ATF2, are : (A) Achievement of a 37 nm beam size, and (B) control of beam position down to 2 nm level. The scientific justification for the ATF2 project and its technical design have been described in Volume 1 of the ATF2 Proposal. We present here Volume 2 of the ATF2 Proposal, in which we present specifics of the construction plans and the group organization to execute the research programs at ATF2.

  1. Control system of ATF

    International Nuclear Information System (INIS)

    A computer control system of Accelerator Test Facility(ATF) is described in detail. The ATF presently consists of 60MeV electron injector linac and two klystron Lest stands, and is controlled by a workstation computer with CAMAC interfaces. For its nature of R and D accelerator aimed to realize TeV region linear collider, the control system also should have a flexibility in both hardware and software. Programmable sequence controllers are introduced in the electron gun system and klystron modulator systems and their performances are tested. The control software which is coded using FORTRAN consists in many independent programs. Each program can access to full functions of a specified device or can control the function which is common to many devices

  2. ATF2 Proposal Volume 2

    Energy Technology Data Exchange (ETDEWEB)

    Grishanov, B.I.; Logachev, P.; Podgorny, F.; Telnov, V.; /Novosibirsk, IYF; Angal-Kalinin, D.; Jones, J.; Kalinin, A.; /Daresbury; Napoly, O.; Payet, J.; /DAPNIA, Saclay; Braun, H.H.; Schulte, D.; Zimmermann, F.; /CERN; Appleby, R.; Barlow, R.; Bailey, I.; Jenner, L.; Jones, R.; Kourevlev, G.; /Cockcroft Inst.; Elsen, E.; Vogel, V.; Walker, N.; /DESY

    2006-02-27

    For achieving the high luminosity required at the International Linear Collider (ILC), it is critical to focus the beams to nanometer size with the ILC Beam Delivery System (BDS), and to maintain the beam collision with a nanometer-scale stability. To establish the technologies associated with this ultra-high precision beam handling, it has been proposed to implement an ILC-like final focus optics in an extension of the existing extraction beamline of ATF at KEK. The ATF is considered to be the best platform for this exercise, since it provides an adequate ultra-low emittance electron beam in a manner dedicated to the development of ILC. The two major goals for this facility, called ATF2, are: (A) Achievement of a 37 nm beam size, and (B) control of beam position down to 2 nm level. The scientific justification for the ATF2 project and its technical design have been described in Volume 1 of the ATF2 Proposal [1]. We present here Volume 2 of the ATF2 Proposal, in which we present specifics of the construction plans and the group organization to execute the research programs at ATF2. The sections in this report have been authored by relevant ATF2 subgroups within the International ATF Collaboration. The time line of the project is described in Section 2. Section 3 discuss the structure of the international collaboration. Sections 4 and 5 discuss budget considerations, which are presented as well as the design and construction tasks to be shared by the international collaboration at ATF2. Concluding remarks have been contributed by Dr. Ewan Paterson, Chair of the International Collaboration Board of the ATF collaboration.

  3. Status of ATF, 2004

    International Nuclear Information System (INIS)

    Accelerator Test Facility (ATF) has already achieved the vertical emittance of GLC specification. In order to make the multi-bunch emittance achievement, high quality multi-bunch beam from photo-cathode rf gun was employed. The maximum allowable current was raised to 3 times more. From the study, it was found that the vacuum level of damping ring is related to the achieved vertical emittance. The ring scrubbing with high current accumulation made tail bunch emittance growth lower. We describe the status of multi-bunch emittance study together with the development status of the various emittance monitors and beam position monitors. (author)

  4. TOREX-4: a torsatron proof of principle experiment

    International Nuclear Information System (INIS)

    TOREX-4 is a torsatron Proof of Principle experiment designed to simultaneously achieve ntau approx. = to 5 x 1013, n approx. = to 5 x 1014/cm3, and T greater than or equal to 1 keV. TOREX-4 is capable of operating without externally driven currents; sufficient neutral beam power to reach betas of 2 to 5% is provided. The unique 4(+2) constant pitch angle winding configuration allows the reliable design of large systems with far greater experimental flexibility than can be achieved in conventional stellarators of comparable size. This will allow investigation of the basic physics questions of the torsatron configuration over a wide range of plasma properties and field configurations without sacrifice of the Proof of Principle goals

  5. Initial high-power testing of the ATF [Advanced Toroidal Facility] ECH [electron cyclotron heating] system

    International Nuclear Information System (INIS)

    The Advanced Toroidal Facility (ATF) is a moderate aspect ratio torsatron that will utilize 53.2 GHz 200 kW Electron Cyclotron Heating (ECH) to produce nearly current-free target plasmas suitable for subsequent heating by strong neutral beam injection. The initial configuration of the ECH system from the gyrotron to ATF consists of an optical arc detector, three bellows, a waveguide mode analyzer, two TiO2 mode absorbers, two 900 miter bends, two waveguide pumpouts, an insulating break, a gate valve, and miscellaneous straight waveguide sections feeding a launcher radiating in the TE02 mode. Later, a focusing Vlasov launcher will be added to beam the ECH power to the saddle point in ATF magnetic geometry for optimum power deposition. The ECH system has several unique features; namely, the entire ECH system is evacuated, the ECH system is broadband, forward power is monitored by a newly developed waveguide mode analyzer, phase correcting miter bends will be employed, and the ECH system will be capable of operating short pulse to cw. Initial high-power tests show that the overall system efficiency is 87%. The waveguide mode analyzer shows that the gyrotron mode output consists of 13% TE01, 82.6% TE02, 2.5% TE03, and 1.9% TE04. 4 refs

  6. ATF neutral beam injection system

    International Nuclear Information System (INIS)

    The Advanced Toroidal Facility is a stellarator torsatron being built at Oak Ridge National Laboratory to investigate improved plasma confinement schemes. Plasmas heating will be carried out predominantly by means of neutral beam injection. This paper describes the basic parameters of the injection system. Numerical calculations were done to optimize the aiming of the injectors. The results of these calculations and their implications on the neutral power to the machine are elaborated. The effects of improving the beam optics and altering the focal length on the power transmitted to the plasma are discussed

  7. ATF beam image monitor software

    International Nuclear Information System (INIS)

    We report about software for the beam image analysis at ATF. We developed image analysis software with a Linux computer. It acquire image data from a video and an IEEE1394 digital camera of the analog. (author)

  8. ATF2 Proposal v. 2

    CERN Document Server

    Grishanov, B I; Alabau-Pons, M; Angal-Kalinin, Deepa; Appleby, R; Araki, S; Bailey, I; Bambade, P; Bane, Karl Leopold Freitag; Barlow, R; Blair, G A; Bolzon, B; Boorman, G; Bosco, A; Brachmann, A; Braun, Hans Heinrich; Burrows, P N; Carter, J; Choi, J; Christian, Glenn B; Clarke, C; Dabiri-Khah, A; Dadoun, O; Danagulyan, S; Delerue, N; Dixit, S; Driouichi, C; Elsen E; Gao, J; Geffroy, N; Gronberg, J; Hartin, Anthony F; Hayano, H; Higashi, Y; Himel, T; Honda, Y; Howell, D; Huang, J Y; Iwashita, Y; Jenner, L; Jones, J; Jones, R; Jérémie, A; Kalinin, A; Kanazawa, K; Kang, H S; Karyotakis, Yu; Kim, E S; Kim, S; Komamiya, S; Kourevlev, German Yu; Kubo, K; Kumada, M; Kume, T; Kuriki, M; Kuroda, S; Liu, W; Logatchev, P V; Lyapin, A; Malton, S; Markiewicz, T W; Masuzawa, M; Mihara, T; Miller, D J; Molloy, S; Mtingwa, S; Naito, T; Nan-Phinney, Y; Napoly, O; Nelson, J; Okugi, T; Payet, J; Pei, G X; Pivi, M T F; Podgorny, F; Price, M; Raubenheimer, T O; Reichold, A; Ross, M; Sanuki, T; Schulte, Daniel; Seryi, R A; Solyak, N; Soo Ko In; Spencer, C M; Suehara, T; Sugahara, R; Takahashi, T; Takashi-Boogert, S; Tauchi, T; Telnov, Valery I; Tenenbaum, P G; Terunuma, N; Toge, N; Torrence, E; Urakawa, J; Urner, D; Vogel, V; Walker, N; Wang, J Q; Wendt, M; White, G; Wing, M; Wolski, A; Woodley, M; Yamaoka, H; Yokoya, K; Zimmermann, Frank

    2006-01-01

    For achieving the high luminosity required at the International Linear Collider (ILC), it is critical to focus the beams to nanometer size with the ILC Beam Delivery System (BDS), and to maintain the beam collision with a nanometer-scale stability. To establish the technologies associated with this ultra-high precision beam handling, it has been proposed to implement an ILC-like final focus optics in an extension of the existing extraction beamline of ATF at KEK. The ATF is considered to be the best platform for this exercise, since it provides an adequate ultra-low emittance electron beam in a manner dedicated to the development of ILC. The two major goals for this facility, called ATF2, are : (A) Achievement of a 37 nm beam size, and (B) control of beam position down to 2 nm level. The scientific justification for the ATF2 project and its technical design have been described in Volume 1 of the ATF2 Proposal [1]. We present here Volume 2 of the ATF2 Proposal, in which we present specifics of the construction...

  9. Observation of parallel viscosity in the CHS Heliotron/Torsatron

    International Nuclear Information System (INIS)

    Damping of the toroidal velocity owing to parallel viscosity is observed in the plasma with a tangential neutral beam injection in the CHS Heliotron/Torsatron device. Toroidal velocity profile is dominated by the perpendicular viscosity when magnetic field modulation is weak near axis. However, the parallel viscosity is found to be dominant when the modulation is strong enough and to increase in proportion to the square of the modulation of magnetic field. The absolute values of the viscosity agree with the neoclassical prediction within a factor of three. (author)

  10. Alpha-particle losses in compact torsatron reactors

    International Nuclear Information System (INIS)

    Loss of alpha particles in compact torsatron reactors is studied. For 6, 9, and 12 field period reactors, the direct loss is a relatively weak function of radius and energy and varies from ≅33% for M = 6 to ≅18% for M = 12. Loss of alpha particles through scattering into the loss region is calculated using the Fokker-Plank equation for fast ions and found to contribute an additional alpha-particle energy loss of ≅15%. The consequences of these relatively large losses for torsatron reactor design are discussed. The relationship between the direct particle losses and the magnetic field structure is also studied. Orbit losses from a variety of stellarator configurations are calculated and a figure-of-merit that characterizes the orbit confinement of a magnetic configuration is deduced from these calculations. This figure-of-merit is used to show how the direct losses might be reduced at low aspect-ratio. Effects of finite beta on the direct particle losses are also addressed, and are shown to significantly increase the direct losses in some configurations. 15 refs., 8 figs

  11. Microprocessor based hardware-software complex for investigating the magnetic surfaces of torsatron URAGAN-2M

    International Nuclear Information System (INIS)

    This paper describes the microprocessor hardware and software complex designed to control the fluorescent rod scanning in the poloidal cross section of vacuum toroidal chamber in order to study the structure of magnetic surfaces in the torsatron 'URAGAN-2M'.

  12. BNL ATF II beamlines design

    International Nuclear Information System (INIS)

    The Brookhaven National Laboratory. Accelerator Test Facility (BNL ATF) is currently undergoing a major upgrade (ATF-II). Together with a new location and much improved facilities, the ATF will see an upgrade in its major capabilities: electron beam energy and quality and CO2 laser power. The electron beam energy will be increased in stages, first to 100-150 MeV followed by a further increase to 500 MeV. Combined with the planned increase in CO2 laser power (from 1-100 TW), the ATF-II will be a powerful tool for Advanced Accelerator research. A high-brightness electron beam, produced by a photocathode gun, will be accelerated and optionally delivered to multiple beamlines. Besides the energy range (up to a possible 500 MeV in the final stage) the electron beam can be tailored to each experiment with options such as: small transverse beam size (<10 um), short bunch length (<100 fsec) and, combined short and small bunch options. This report gives a detailed overview of the ATFII capabilities and beamlines configuration.

  13. BNL ATF II beamlines design

    Energy Technology Data Exchange (ETDEWEB)

    Fedurin, M. [Brookhaven National Lab. (BNL), Upton, NY (United States); Jing, Y. [Brookhaven National Lab. (BNL), Upton, NY (United States); Stratakis, D. [Brookhaven National Lab. (BNL), Upton, NY (United States); Swinson, C. [Brookhaven National Lab. (BNL), Upton, NY (United States)

    2015-05-03

    The Brookhaven National Laboratory. Accelerator Test Facility (BNL ATF) is currently undergoing a major upgrade (ATF-II). Together with a new location and much improved facilities, the ATF will see an upgrade in its major capabilities: electron beam energy and quality and CO2 laser power. The electron beam energy will be increased in stages, first to 100-150 MeV followed by a further increase to 500 MeV. Combined with the planned increase in CO2 laser power (from 1-100 TW), the ATF-II will be a powerful tool for Advanced Accelerator research. A high-brightness electron beam, produced by a photocathode gun, will be accelerated and optionally delivered to multiple beamlines. Besides the energy range (up to a possible 500 MeV in the final stage) the electron beam can be tailored to each experiment with options such as: small transverse beam size (<10 um), short bunch length (<100 fsec) and, combined short and small bunch options. This report gives a detailed overview of the ATFII capabilities and beamlines configuration.

  14. Structural design and analysis for the ISX-C/ATF tokamak of the vacuum vessel, coil joints, and supports

    International Nuclear Information System (INIS)

    The ISX-C/ATF is being designed as a test bed for advanced toroidal concepts. Because of numerous design concepts being evaluated, a flexible, easily changeable structural-design math-model was needed to afford quick evalution of the structural feasibility of the many proposed concepts. To satisfy this need, the NASTRAN Automated Multi-Stage Substructures technique was used to build a quick-changeable math model. This technique was especially needed because all the coils, first wall and diagnostic devices are to be supported by the vacuum vessel, requiring the entire structure to be analyzed as a system. Without the use of the substructuring technique, the required man hours and computer core would have made timely design analysis impossible. To illustrate the technique, the detailed design analysis of the concept Torsatron (with helical coils and T.F. coils) is presented

  15. Wall conditioning VHF discharges at Uragan-2M torsatron

    International Nuclear Information System (INIS)

    Full text of publication follows. The studies of the RF discharges for wall conditioning have been performed at Uragan-2M torsatron (stellarator). The purpose of the RF discharge wall conditioning is the removal of species adsorbed by the wall, so that they may be pumped out of the vacuum chamber. This can be done by ion or atom impact owing to the momentum transfer or chemical interaction. In the magnetically confined plasma, the outflow of ions is not intensive and their flux to the wall of the vacuum vessel is not uniformly distributed. In such conditions, the wall conditioning with chemically active neutral atoms and molecules is advantageous. Such neutrals are produced intensively in partially ionized plasma when the degree of ionization is low. A scenario for wall conditioning is studied for the discharges in hydrogen. In this scenario the cleaning agents are hydrogen atoms resulting from the dissociation of the hydrogen molecules. If the electron temperature in the discharge is less than the ionization threshold, i.e. 4-10 eV, the dissociation rate is higher than the ionization one, and one electron produces a number of neutral atoms during its lifetime. Continuous VHF discharges in Uragan-2M torsatron are sustained by 2.5 kW oscillator with frequency 150 MHz. For wall conditioning a special small size antenna is designed. It could be fed by both generators. The discharge parameters are measured in wide range of confining magnetic field and pressures. The dependence on launched power is also investigated. Evolution of the impurities in the discharge signified by the optical measurements, the residual gas composition and partial pressures measured with the mass-spectrometer indicate the wall conditioning. Their development is analyzed during days of operation. The studies made indicate that the VHF type discharge could be used at high magnetic fields. This feature is useful for steady-state superconducting machines. (authors)

  16. Fluctuations and confinement in ATF

    International Nuclear Information System (INIS)

    In the period immediately prior to the suspension of ATF operation in November, 1991, a great deal of emphasis was palced on investigations of the fundamental mechanisms controlling confinement in this device. At that time, measurements of the density fluctuations throughout the plasma volume indicated the existence of theoretically predicted dissipative trapped electron and resistive interchange instabilities. These identifications were supported by results of dynamic configuration scans of the magnetic fields during which the extent of the magnetic well, shear, and fraction of confined trapped particles were changed continuously. Interpretation of the data from these experiments has been an ongoing exercise. Most recently, analysis of discharges employing strong gas puffing to change density gradients and fluctuation levels have strengthened the view that dissipative trapped electron modes may be present but do not play a significant direct role in energy transport. The present paper summarizes the current understanding concerning the identification of instabilities and their relationship to confinement in ATF

  17. High-mode-number ballooning modes in a heliotron/torsatron system: 1, Local magnetic shear

    International Nuclear Information System (INIS)

    The characteristics of the local magnetic shear, a quantity associated with high-mode-number ballooning mode stability, are considered in heliotron/torsatron devices that have a large Shafranov shift. The local magnetic shear is shown to vanish even in the stellarator-like region in which the global magnetic shear is positive. The reason for this is that the degree of the local compression of the poloidal magnetic field on the outer side of the torus, which maintains the toroidal force balance, is reduced in the stellarator-like region of global magnetic shear because the global rotational transform in heliotron/torsatron systems is a radially increasing function. This vanishing of the local magnetic shear is a universal property in heliotron/torsatron systems with a large Shafranov shift since it results from toroidal force balance in the stellarator-like global shear regime that is inherent to such systems

  18. Studies on magnetic surface structures and basic magnetic field properties in 'Ultimate' configurations of the L=1, m=13 torsatron and the 'Vint-20' torsatron

    International Nuclear Information System (INIS)

    The paper is concerned with numerical investigations of various magnetic configurations of a single-pole toroidal L=1, m=13 'ultimate' torsatron having a low aspect ratio Ah=4.345 and the modulation factors (-0.23) ≤ α ≤ 0.71 (K=1, β=0) of the helix law -mφ=Θ-αK SinΘ-βK sin2Θ. The extremums of the basic properties of closed magnetic surfaces as functions of the coefficient α in the neighborhood of α ∼ 0.4, as well as the structures of the edge magnetic field (substructures of virtual current) and the separatrix have been first determined for the L=1, m=13 'ultimate' torsatron and the 'Vint-20' torsatron. Unusual positions of the separatrix X-points in the cross sections for 1/4- and 3/4-magnetic field periods have been identified. The formula that takes into account the modulation factor α of the helix law was first derived to determine the average vertical magnetic field on the geometrical axis of the torus.

  19. On vacuum field properties of the URAGAN-2M Torsatron standard configuration

    International Nuclear Information System (INIS)

    Vacuum field properties of the URAGAN-2M Torsatron are investigated. In the 'Standard Case', within a certain range of field parameters, the size of the observed magnetic islands at τ = 2/3 can be reduced considerably. Some characteristic quantities for stellarator vacuum fields are reported. (orig.)

  20. Analytical estimation of ATF beam halo distribution

    CERN Document Server

    Wang, Dou; Yokoya, Kaoru; Gao, Jie

    2013-01-01

    In order to study the background status in the ATF2 beam line and the interaction point (IP), this paper developed an analytical method to give the estimation of ATF beam halo distribution based on K. Hirata and K. Yokoya's theory. The equilibrium particle distribution of beam tail in ATF damping ring, when each electron is being affected by, in addition to the synchrotron radiation damping effects, several stochastic processes, such as beam-gas scattring, beam-gas bremsstrahlung and intra-beam scattering, was presented. This method is common and can be applied on other electron rings.

  1. Chondrocytic Atf4 regulates osteoblast differentiation and function via Ihh

    OpenAIRE

    Wang, Weiguang; Lian, Na; Ma., Yun; LI, LINGZHEN; Gallant, Richard C.; Elefteriou, Florent; Yang, Xiangli

    2012-01-01

    Atf4 is a leucine zipper-containing transcription factor that activates osteocalcin (Ocn) in osteoblasts and indian hedgehog (Ihh) in chondrocytes. The relative contribution of Atf4 in chondrocytes and osteoblasts to the regulation of skeletal development and bone formation is poorly understood. Investigations of the Atf4–/–;Col2a1-Atf4 mouse model, in which Atf4 is selectively overexpressed in chondrocytes in an Atf4-null background, demonstrate that chondrocyte-derived Atf4 regulates osteog...

  2. ATF [Advanced Toroidal Facility] data management

    International Nuclear Information System (INIS)

    Data management for the Advanced Toroidal Facility (ATF), a stellarator located at Oak Ridge National Laboratory (ORNL), is provided by DMG, a locally developed, VAX-based software system. DMG is a data storage and retrieval software system that provides the user interface to ATF raw and analyzed data. Data are described in terms of data models and data types and are organized as signals into files, which are internally documented. The system was designed with user accessibility, software maintainability, and extensibility as primary goals. Extensibility features include compatibility with ATF as it moves from pulsed to steady-state operation and capability for use of the DMG system with experiments other than ATF. DMG is implemented as a run-time library of routines available as a shareable image. General-purpose and specialized data acquisition and analysis applications have been developed using the DMG system. This paper describes the DMG system and the interfaces to it. 4 refs., 2 figs

  3. The Straightness Monitor System at ATF2

    Energy Technology Data Exchange (ETDEWEB)

    Hildreth, Michael; /Notre Dame U.; Aryshev, Alexander; /Royal Holloway, U. of London; Boogert, Stewart; /Oxford U., JAI; Honda, Yosuke; /KEK, Tsukuba; Tauchi, Toshiaki; /KEK, Tsukuba; Terunuma, Nobuhiro; /KEK, Tsukuba; White, Glen; /SLAC

    2012-07-06

    The demonstration of absolute stability of the position of the focused beam is the primary goal of the ATF2 commissioning effort. We have installed a laser interferometer system that will eventually correct the measurement of high-precision Beam Position Monitors used in the ATF2Final Focus Steering Feedback for mechanical motion or vibrations. Here, we describe the installed system and present preliminary data on the short- and long-term mechanical stability of the BPM system.

  4. Investigation of a washer-stack plasma gun on the Auburn torsatron

    International Nuclear Information System (INIS)

    A pulsed device for producing a highly-ionized plasma in the Auburn Torsatron is described and construction details given. A plasma is formed by discharging a 14 uF capacitor charged to 6 to 12 kV through a titanium washer impregnated with hydrogen. The ions and electrons are injected transversely into the Torsatron confinement field and the plasma is studied with an x-band microwave interferometer and H-alpha spectral-line detectors. The results of initial measurements to determine the optimal performance parameters for the gun, such as discharge voltage and position, are presented. Also, peak electron density and decay time of the guns plasma are given for different machine and souce conditions

  5. Effect of a noncircular shape of the torus on the magnetic surfaces of l=1 torsatron

    International Nuclear Information System (INIS)

    The paper presents the numerical calculation results on the magnetic field produced by one helical winding laying on the surface of a noncircular torus. The influence of the chosen poloidal cross-section shape of the torus on the parameters of the closed magnetic surface configuration has been investigated. The calculation results show that the change of a torus with circular cross-section by a torus with noncircular cross-section in the l=1 torsatron under consideration decreases the value of the mirror ratio on the magnetic surfaces by a factor of ∼8. And other parameters of magnetic surfaces were changed no more than by a factor of 1.5 to 2. A feasibility of the simplest torsatron with central stochastic magnetic field line region is discussed

  6. ATF3 inhibits PPARγ-stimulated transactivation in adipocyte cells

    Energy Technology Data Exchange (ETDEWEB)

    Jang, Min-Kyung; Jung, Myeong Ho, E-mail: jung0603@pusan.ac.kr

    2015-01-02

    Highlights: • ATF3 inhibits PPARγ-stimulated transcriptional activation. • ATF3 interacts with PPARγ. • ATF3 suppresses p300-mediated transcriptional coactivation. • ATF3 decreases the binding of PPARγ and recruitment of p300 to PPRE. - Abstract: Previously, we reported that activating transcription factor 3 (ATF3) downregulates peroxisome proliferator activated receptor (PPARγ) gene expression and inhibits adipocyte differentiation in 3T3-L1 cells. Here, we investigated another role of ATF3 on the regulation of PPARγ activity. ATF3 inhibited PPARγ-stimulated transactivation of PPARγ responsive element (PPRE)-containing reporter or GAL4/PPARγ chimeric reporter. Thus, ATF3 effectively repressed rosiglitazone-stimulated expression of adipocyte fatty acid binding protein (aP2), PPARγ target gene, in 3T3-L1 cells. Coimmunoprecipitation and GST pulldown assay demonstrated that ATF3 interacted with PPARγ. Accordingly, ATF3 prevented PPARγ from binding to PPRE on the aP2 promoter. Furthermore, ATF3 suppressed p300-mediated transcriptional coactivation of PPRE-containing reporter. Chromatin immunoprecipitation assay showed that overexpression of ATF3 blocked both binding of PPARγ and recruitment of p300 to PPRE on aP2 promoter induced by rosiglitazone treatment in 3T3-L1 cells. Taken together, these results suggest that ATF3 interacts with PPARγ and represses PPARγ-mediated transactivation through suppression of p300-stimulated coactivation in 3T3-L1 cells, which may play a role in inhibition of adipocyte differentiation.

  7. R and D status of the ATF damping ring

    International Nuclear Information System (INIS)

    The KEK accelerator test facility (ATF) is under construction. This paper gives the status of the design studies, the various R and D works and the construction for the damping ring of the ATF. (author)

  8. ATF3 represses PPARγ expression and inhibits adipocyte differentiation

    Energy Technology Data Exchange (ETDEWEB)

    Jang, Min-Kyung; Jung, Myeong Ho, E-mail: jung0603@pusan.ac.kr

    2014-11-07

    Highlights: • ATF3 decrease the expression of PPARγ and its target gene in 3T3-L1 adipocytes. • ATF3 represses the promoter activity of PPARγ2 gene. • ATF/CRE (−1537/−1530) is critical for ATF3-mediated downregulation of PPARγ. • ATF3 binds to the promoter region containing the ATF/CRE. • ER stress inhibits adipocyte differentiation through downregulation of PPARγ by ATF3. - Abstract: Activating transcription factor 3 (ATF3) is a stress-adaptive transcription factor that mediates cellular stress response signaling. We previously reported that ATF3 represses CCAAT/enhancer binding protein α (C/EBPα) expression and inhibits 3T3-L1 adipocyte differentiation. In this study, we explored potential role of ATF3 in negatively regulating peroxisome proliferator activated receptor-γ (PPARγ). ATF3 decreased the expression of PPARγ and its target gene in 3T3-L1 adipocytes. ATF3 also repressed the activity of −2.6 Kb promoter of mouse PPARγ2. Overexpression of PPARγ significantly prevented the ATF3-mediated inhibition of 3T3-L1 differentiation. Transfection studies with 5′ deleted-reporters showed that ATF3 repressed the activity of −2037 bp promoter, whereas it did not affect the activity of −1458 bp promoter, suggesting that ATF3 responsive element is located between the −2037 and −1458. An electrophoretic mobility shift assay and chromatin immunoprecipitation assay demonstrated that ATF3 binds to ATF/CRE site (5′-TGACGTTT-3′) between −1537 and −1530. Mutation of the ATF/CRE site abrogated ATF3-mediated transrepression of the PPARγ2 promoter. Treatment with thapsigargin, endoplasmic reticulum (ER) stress inducer, increased ATF3 expression, whereas it decreased PPARγ expression. ATF3 knockdown significantly blocked the thapsigargin-mediated downregulation of PPARγ expression. Furthermore, overexpression of PPARγ prevented inhibition of 3T3-L1 differentiation by thapsigargin. Collectively, these results suggest that ATF3-mediated

  9. Absence of second stability in ATF

    Energy Technology Data Exchange (ETDEWEB)

    Dominguez, N.; Lynch, V.E.

    1995-07-01

    Ideal Mercier and ballooning modes for three-dimensional (3-D) equilibria of the Advanced Toroidal Facility (ATF) are studied in detail. These modes are found to introduce instability limits at modest beta values for pressure profiles for which previous results, based on a two-dimensional (2-D) equilibrium approximation, predicted the existence of a second stability region. This absence of second stability is in agreement with an analysis by Cooper et al. who used a simplified model for the ATF plasma boundary. The increased instability is found to result from the 3-D feature of the Pfirsch-Schlueter current. Furthermore, a strong quadrupole field is found to decrease the beta limit of these modes, contrary to the results obtained using the 2-D equilibria. Although direct comparison with measured beta values is not possible owing to the absence of profile data for ATF plasmas, pressure profiles used previously to model ATF data as well as in the 2-D analysis are used to obtain the results. The details of the pressure profiles and the plasma configurations strongly influence the stability limits on average beta which remains below 3%.

  10. Analysis list: ATF7IP [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available ATF7IP Epidermis + hg19 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/target/ATF7IP....1.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/target/ATF7IP.5.tsv http://dbarchive.biosciencedbc....jp/kyushu-u/hg19/target/ATF7IP.10.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/ATF7IP.Epidermis.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/Epidermis.gml ...

  11. A Superconducting Magnet Upgrade of the ATF2 Final Focus

    International Nuclear Information System (INIS)

    The ATF2 facility at KEK is a proving ground for linear collider technology with a well instrumented extracted beam line and Final Focus (FF). The primary ATF2 goal is to demonstrate the extreme beam demagnification and spot stability needed for a linear collider FF. But the ATF2 FF uses water cooled magnets and the ILC baseline has a superconducting (SC) FF. We plan to upgrade ATF2 and replace some of the warm FF magnets with SC FF magnets. The ATF2 SC magnets, like the ILC FF, will made via direct wind construction. ATF2 coil winding is in progress at BNL and warm magnetic measurements indicate we have achieved good field quality. Studies indicate that having ATF2 FF magnets with larger aperture and better field quality should allow reducing the ATF2 FF beta function for study of focusing regimes relevant to CLIC. The ATF2 magnet cryostat will have laser view ports for directly monitoring cold mass movement. We plan to make stability measurements at BNL and KEK to relate ATF2 FF magnet performance to that of a full length ILC QD0 R and D FF prototype under construction at BNL.

  12. Torsatron/stellarator research at the University of Wisconsin-Madison, 1983

    International Nuclear Information System (INIS)

    This report details experimental activities of the University of Wisconsin-Madison Torsatron/Stellarator Laboratory during the period 1978 through 1983. Experiments on the Proto-Cleo Stellarator have demonstrated the effectiveness of ion-cyclotron resonance heating with ion temperatures increased to 150 eV. Tangential injection of gun-produced plasmas showed a reduction in convective cell structures with an increase in confinement time of a factor of two. Pfirsch-Schluter currents were measured to be in excellent agreement with neoclassical predictions. Studies on the Proto-Cleo Torsatron identified the presence of drift waves and rippling modes and identified a runaway instability under certain operating conditions. Heat pulse propagation measurement were used to obtain transport coefficients. Electron-cyclotron resonance heating was observed with good agreement to a stochastic heating model related to local field gradients. During this period, the Interchangeable Module Stellarator (IMS) was designed and fabricated. IMS is the first modular stellarator to be built based upon the modular coil concept of Rehker and Wobig. Details of the design and construction are presented. Initial operation of IMS demonstrated well formed vacuum magnetic surfaces with no evidence of significant isolation. Experience gained in the design of IMS was utilized in a modular stellarator reactor study. UWTOR-M, to demonstrate the feasibility of stellarator reactors based upon this concept

  13. Ripple transport in helical-axis advanced stellarators - a comparison with classical stellarator/torsatrons

    International Nuclear Information System (INIS)

    Calculations of the neoclassical transport rates due to particles trapped in the helical ripples of a stellarator's magnetic field are carried out, based on solutions of the bounce-averaged kinetic equation. These calculations employ a model for the magnetic field strength, B, which is an accurate approximation to the actual B for a wide variety of stellarator-type devices, among which are Helical-Axis Advanced Stellarators (Helias) as well as conventional stellarators and torsatrons. Comparisons are carried out in which it is shown that the Helias concept leads to significant reductions in neoclassical transport rates throughout the entire long-mean-free-path regime, with the reduction being particularly dramatic in the ν-1 regime. These findings are confirmed by numerical simulations. Further, it is shown that the behavior of deeply trapped particles in Helias can be fundamentally different from that in classical stellarator/torsatrons; as a consequence, the beneficial effects of a radial electric field on the transport make themselves felt at lower collision frequency than is usual. (orig.)

  14. Analysis list: ATF4 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available ATF4 Blood,Others + hg19 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/target/ATF...4.1.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/target/ATF4.5.tsv http://dbarchive.biosciencedbc.jp/...kyushu-u/hg19/target/ATF4.10.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/ATF4.Blood.tsv,http://dbarchive.bioscience...dbc.jp/kyushu-u/hg19/colo/ATF4.Others.tsv http://dbarchive.bioscience...dbc.jp/kyushu-u/hg19/colo/Blood.gml,http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/Others.gml ...

  15. 35 years since the start up and the first plasma of the stellarator-torsatron Saturn. Main results for one decade of operation

    International Nuclear Information System (INIS)

    In the long history of development of the stellarator conception, there were the steps which strongly influenced the further movement. This happened when instead of the figure-of-eight was suggested the system with helical currents flowing in opposite directions in every neighbor helical coil with total number of coils 4 (l=2) or 6 (l=3). The next important step - transmission from bi-directional to the uni-directional system of helical currents, i.e., transmission from a stellarator conception to a torsatron conception (in Japan this conception is named heliotron). The principal difference and at the same time the significant benefits of torsatron configuration in comparison with the classical stellarator configuration is the possibility to have a natural (intrinsic) divertor. Thus, the torsatron/heliotron conception, with magnetic configuration produced without toroidal coils can be the base for the development of a fusion reactor. Let us note the most important milestones in the origin and evolution of the torsatron idea, following [1]. 1) In 1961 V.F.Aleksin (KIPT) has showed that in a system composed of a direct solenoid and several helical conductors with a unidirectional current, magnetic surfaces (MS) can exist. 2) Later C.Gourdon and collaborators suggested independently a toroidal trap with unidirectional helical current called as a torsatron (e.g., [2]). Soon after C.Gourdon, P.Hubert, D.Marty suggested the shape of coils which allows to have closed magnetic surfaces with only helical winding (so called ultimate torsatron [3]; C.Gourdon and others disclosed that the torsatron configuration can have an intrinsic spatial divertor [4], and considered the scheme of torsatron-reactor [4]. 3) Due to efforts of Japanese scientists (K.Uo et al.) an earlier heliotron conception has come to this direction too (named Helical heliotron) [5,6]. 4) A great contribution into improving the torsatron design was made by researchers of different countries. Because of

  16. ICRF plasma production and heating in the URAGAN-3M torsatron

    International Nuclear Information System (INIS)

    The results of experimental and theoretical studies of Alfven wave production and heating of plasma in the frequency range below the ion cyclotron frequency (ω0 ci) are presented. Several types of antenna have been studied for plasma RF production and heating in the URAGAN-3M torsatron (R = 100 cm, apl ≤ 12.5 cm, B ≤ 1.3 T): A frame type antenna (FTA) conventionally used for plasma RF production and heating with the best operational properties at low and moderate plasma densities (n-bare ≤ 5 x 1012 cm-3); compact three-half-turn antenna (THTA) proposed for plasma heating and density ramp up (up to 3 x 1013 cm-3) after the low density target plasma (n-bare ≥ 4 x 1011 cm-3) had been produced by FTA; recently proposed antenna of combined type (''crankshaft''), which has the best properties of both above mentioned antennae in the whole range of densities. The excitation of the electromagnetic fields in URAGAN-3M plasmas by FTA, THTA and crankshaft antenna has been studied numerically using 1-D wave code. To study the dynamics of RF plasma production in the URAGAN-3M torsatron the 0-dimensional code have been used. The results of calculations showed better performance of crankshaft antenna compared with FTA and THTA in the whole range of plasma densities. When using the THTA at the scenario with FTA as a target plasma source, the experiments performed showed the possibility of dense plasma production (n-bare > 2 x 1013 cm-3) and heating, which had not been obtained earlier in the URAGAN-3M torsatron. The shifted towards the plasma core power deposition profile of THTA resulted in modification of plasma density profile and improvement in plasma confinement. The preliminary experiments with crankshaft antenna on plasma production showed that this antenna can produce the dense (up to 1013 cm-3) plasma in the URAGAN-3M without any additional source of target plasma and it can be used for subsequent Alfven heating. (author)

  17. Studies of emittance growth in the ATF

    International Nuclear Information System (INIS)

    Several different mechanisms of emittance growth in the Accelerator Test Facility (ATF) at KEK are investigated: the author calculates rise times of the fast beam-ion instability for the damping ring (DR), and discusses the emittance growth caused by coherent synchrotron radiation in the beam-transport line (BT), the effect of quadrupole wake fields in the injector linac, and, finally, a single-bunch head-tail ion effect that can occur in both the DR and the BT. A first attempt to measure the quadrupole wake on the real machine is also reported

  18. Wire alignment system for ATF LINAC

    International Nuclear Information System (INIS)

    A wire based alignment system is adopted to make less than 40μm precision alignment for injector linac of Accelerator Test Facility (ATF). The system consists of two stretched SUS wires, pickup coils and active mover stages. The position of pickup coils in a mount which will be installed into LINAC stages is set to the calculated wire position prior to installation. All of LINAC stages are then moved to keep the calculated position by the active mover. The test results of wire position detection in a long term are described. (author)

  19. Permutation entropy analysis of density fluctuations in the torsatron TJ-K

    International Nuclear Information System (INIS)

    In order to explore the nature of density fluctuations in the edge of magnetically confined fusion plasmas, the technique of permutation entropy and statistical complexity is used. The location of fluctuations on the entropy versus complexity plane classifies the dynamical behaviour of the system. The behaviour can be differentiated between stochastic and chaotic. The latter is supposed to be connected to a specific temporal form of intermittent density events, i.e. blobs, in the scrape-off layer (SOL). In this contribution, density fluctuations measured with a Langmuir probe in the torsatron TJ-K are analyzed with respect to the dynamical nature. Radial scans are performed across the separatrix to distinguish the dynamics in the inner edge and the SOL. Comparisons with well known test systems indeed point to a qualitative change in the dynamics across the separatrix. In the region of maximum density gradient, the fluctuations are characterized by minimum entropy. The results will be discussed on separated scales.

  20. Determination of the electronic temperature in the torsatron TJ-I Upgrade by the two filters

    Energy Technology Data Exchange (ETDEWEB)

    Medina, F.; Ochando, M.

    1994-07-01

    A Te monitor for the TJ-IU torsatron, based on the two-filters method, has been designed. It will consist of two surface-barrier silicon detectors looking at the same plasma region through berylium filters of different thickness. Plasma electron temperature is deduced from the ratio of the soft-x-ray fluxes transmitted through the two filters. The flexibility in magnetic configuration of TJ-IU plasmas has been taken into account in the mechanical design of this diagnostic. It will be attached to an upper 1 port of the vacuum vessel and the whole system will be movable both, to change the spatial resolution when needed and to enable the scan of the full plasma cross-section to obtain the radial profile of electron temperature in a shot-to-shot basis. (Author) 7 refs.

  1. Determination of the electronic temperature in the torsatron TJ-I Upgrade by the two filters

    International Nuclear Information System (INIS)

    A Te monitor for the TJ-IU torsatron, based on the two-filters method, has been designed. It will consist of two surface-barrier silicon detectors looking at the same plasma region through berilium filters of different thickness. Plasma electron temperature is deduced from the ratio of the soft-x-ray fluxes transmitted through the two filters. The flexibility in magnetic configuration of TJ-IU plasmas has been taken into account in the mechanical design of this diagnostic. It will be attached to an upper port of the vacuum vessel and the whole system will be movable both, to change the spatial resolution when needed and to enable the scan of the full plasma cross-section to obtain the radial profile of electron temperature in a shot-to-shot basis. (Author)

  2. Experimental studies of radio frequency waves and confinement in the Auburn Torsatron. Progress report

    International Nuclear Information System (INIS)

    The first year of operation of the Auburn Torsatron has resulted in the majority of the basic operating systems becoming operational or nearly operational. The diagnostic systems now include two microwave interferometers, a monochrometer, several probes and photodiodes. The plasma is produced by any of three sources: electron cyclotron heating with a cw power of 1 kW, low frequency rf heating with power soon to come up to 10 kW cw, and a pulsed washer-stack gun. The magnetic field studies have mapped the field surfaces and several corrections have been made to center the plasma. The ion-cyclotron source and antenna are nearly ready for experiments to begin

  3. The University of Wisconsin-Madison Torsatron/Stellarator Laboratory program, FY 1991--1993

    International Nuclear Information System (INIS)

    This document summarizes results obtained during the first eight months of the current three year grant for research at the University of Wisconsin-Madison Torsatron/Stellarator Laboratory (TSL) and presents plans for future activity during fiscal years 1992 and 1993. Research efforts have focused on fundamental physics issues associated with toroidal confinement, predominantly through experimental investigations on the Interchangeable Module Stellarator (IMS). The program direction has been guided into studies of fluctuations, potentials and electric fields, plasma currents and flows, and effects of magnetic islands by a desire for increased relevance and impact on the general toroidal confinement program. Theoretical and computational activities are also being undertaken to support the experimental research and to identify interesting new toroidal confinement concepts which could contribute to the understanding of tokamak transport

  4. Proto-CIRCUS tilted-coil tokamak–torsatron hybrid: Design and construction

    Energy Technology Data Exchange (ETDEWEB)

    Clark, A.W.; Doumet, M.; Hammond, K.C. [Department of Applied Physics and Applied Mathematics, Columbia University, New York, NY 10027 (United States); Kornbluth, Y. [Yeshiva University, New York, NY 10033 (United States); Spong, D.A. [Oak Ridge National Laboratory, Oak Ridge, TN 37830 (United States); Sweeney, R. [Department of Applied Physics and Applied Mathematics, Columbia University, New York, NY 10027 (United States); Volpe, F.A., E-mail: fvolpe@columbia.edu [Department of Applied Physics and Applied Mathematics, Columbia University, New York, NY 10027 (United States)

    2014-11-15

    Highlights: • A tokamak-like device with tilted toroidal field (TF) coils needs less plasma current than a conventional tokamak. • Rotational transform is partly generated by external coils. Device can be considered a tokamak–torsatron hybrid. • We designed and constructed the first device of this type. • Tilted TF coils are interlinked to each other, which helps to reduce aspect ratio of plasma. • This is a six-coil generalization of CNT stellarator, also at Columbia University, which features two interlinked coils. - Abstract: We present the field-line modeling, design, and construction of a prototype circular-coil tokamak–torsatron hybrid called Proto-CIRCUS. The device has a major radius R = 16 cm and minor radius a < 5 cm. The six “toroidal field” coils are planar as in a tokamak, but they are tilted. This, combined with induced or driven plasma current, is expected to generate rotational transform, as seen in field-line tracing and equilibrium calculations. The device is expected to operate at lower plasma current than a tokamak of comparable size and magnetic field, which might have interesting implications for disruptions and steady-state operation. Additionally, the toroidal magnetic ripple is less pronounced than in an equivalent tokamak in which the coils are not tilted. The tilted coils are interlocked, resulting in a relatively low aspect ratio, and can be moved, both radially and in tilt angle, between discharges. This capability will be exploited for detailed comparisons between calculations and field-line mapping measurements. Such comparisons will reveal whether this relatively simple concept can generate the expected rotational transform.

  5. ATF2 High Availability Power Supplies

    Energy Technology Data Exchange (ETDEWEB)

    Bellomo, A; Lira, C.de; Lam, B.; MacNair, D.; White, G.; /SLAC

    2008-06-27

    ATF2 is an accelerator test facility modeled after the final focus beamline envisioned for the ILC. By the end of 2008, KEK plans to commission the ATF2 [1]. SLAC and OCEM collaborated on the design of 38 power systems for beamline magnets. The systems range in output power from 1.5 kW to 6 kW. Since high availability is essential for the success of the ILC, Collaborators employed an N+1 modular approach, allowing for redundancy and the use of a single power module rating. This approach increases the availability of the power systems. Common power modules reduces inventory and eases maintenance. Current stability requirements are as tight as 10 ppm. A novel, SLAC designed 20-bit Ethernet Power Supply Controller provides the required precision current regulation. In this paper, Collaborators present the power system design, the expected reliability, fault immunity features, and the methods for satisfying the control and monitoring challenges. Presented are test results and the status of the power systems.

  6. Solve: a non linear least-squares code and its application to the optimal placement of torsatron vertical field coils

    International Nuclear Information System (INIS)

    A computational method was developed which alleviates the need for lengthy parametric scans as part of a design process. The method makes use of a least squares algorithm to find the optimal value of a parameter vector. Optimal is defined in terms of a utility function prescribed by the user. The placement of the vertical field coils of a torsatron is such a non linear problem

  7. Transition of toroidal Alfven eigenmode to global Alfven eigenmode in CHS heliotron/torsatron plasmas heated by neutral beam injection

    International Nuclear Information System (INIS)

    A transition of a core localized type toroidal Alfven eigenmode with n 1 toroidal mode number to two n = 1 global Alfven eignemodes was observed in NBI-heated plasmas in the Compact Helical System (CHS) heliotron/torsatron. This transition phenomenon is interpreted based on the temporal evolution of the rotational transform near the plasma center caused by the increased in the beam-driven current. (author)

  8. Atf4 Regulates Obesity, Glucose Homeostasis, and Energy Expenditure

    OpenAIRE

    Seo, Jin; Fortuno, Edgardo S; Suh, Jae Myoung; Stenesen, Drew; Tang, Wei; Parks, Elizabeth J.; Adams, Christopher M.; Townes, Tim; Graff, Jonathan M.

    2009-01-01

    OBJECTIVE We evaluate a potential role of activating transcription factor 4 (Atf4) in invertebrate and mammalian metabolism. RESEARCH DESIGN AND METHODS With two parallel approaches—a fat body–specific green fluorescent protein enhancer trap screen in D. melanogaster and expression profiling of developing murine fat tissues—we identified Atf4 as expressed in invertebrate and vertebrate metabolic tissues. We assessed the functional relevance of the evolutionarily conserved expression by analyz...

  9. Effects of nonclassical ion losses on radial electric field in CHS torsatron/heliotron

    International Nuclear Information System (INIS)

    A selfconsistent analysis is discussed to determine the radial electric field and loss cone boundary in torsatron/heliotron plasmas under the influence of nonclassical ion losses. Effects of the loss cone loss, charge exchange loss of fast ions with neutrals, and the bipolar part of anomalous loss are taken into account. Analysis is applied to the NBI heated plasma in the CHS device. Comparison is made between theoretical results and experimental observations. The increased ion particle losses by the orbit loss and charge exchange loss with neutrals make the radial electric field more negative than the value of purely neoclassical calculation. The partition of the injection energy among the shine through, direct orbit loss , charge exchange loss and bulk heating is estimated by using the self-consistent electric field profile. The power loss of fast ions caused by the orbit loss or charge exchange process is by a factor of several tens to hundred greater than the reduction of the energy loss of bulk ions through the enhancement of radial electric field. Comparison with W7-A experiment is made, and the differences are discussed. (author)

  10. First results of multichord soft x-ray detection array on the U-3m torsatron

    International Nuclear Information System (INIS)

    A miniature pinhole camera array for spatially and temporally resolved measurements of soft X-ray plasma emission has been recently installed on the U-3M. The diagnostics has been tested in different types of the U-3M discharge. In low density frame antenna discharges with so-called ''H-like'' transition a fast SXR emission profile modification is observed. A phase shift of the SXR perturbation induced by the transition as well as different shapes of the perturbation is observed in different channels. The transition can be associated with MHD instability. Different shapes of the SXR emission profile has been observed in different discharge conditions. The SXR array is en excellent tool for study different types of the MHD activity. Different types of the low frequency MHD activity have been observed in the U-3M torsatron. The recently installed SXR diagnostics opens opportunity of detailed studies of the MHD activity together with its driver - the plasma pressure gradient. In the paper we are presented recent experimental results obtained with the use of SXP, without deep analysis these experiments

  11. Shafranov shift in low-aspect-ratio heliotron/torsatron CHS

    International Nuclear Information System (INIS)

    The MHD equilibrium properties of neutral-beam-heated plasmas have been experimentally investigated in the Compact Helical System (CHS), a low-aspect-ratio (Ap ∼ 5) heliotron/torsatron. This configuration is characterized by a strong breaking of helical symmetry. The radial profiles measured by various diagnostics have shown significant Shafranov shift due to plasma pressure. The deviation of the magnetic axis from its vacuum position has reached 50% of the minor radius. When the three-dimensional equilibrium code VMEC is used to reconstruct the equilibrium from the experimental data, the result is in good agreement with the experimentally observed Shafranov shift as well as the diamagnetic pressure in plasmas with ≤ 1.2% and β0 ≤ 3.3%. This β value corresponds to half of the conventional equilibrium β limit defined by the Shafranov shift reaching a value of half the minor radius. Although tangential neutral beam injection has caused pressure anisotropies p parallel/p perpendicular ≤ 3, the description of the equilibrium assuming isotropic pressure is consistent with the experiment. (author)

  12. The microwave system for ECRH experiments on TJ-1U torsatron

    International Nuclear Information System (INIS)

    For ECRH experiments on the TJ-1U torsatron a microwave system based on a Russian gyrotron was designed. This system delivers to plasma microwave power pulses of a maximum of 350 KW during 43 msecs at 28 GHz with 0.02% duty cycle. The main parts of this system are as follows: a high-voltage power supply, a gyrotron module and a quasi-optical transmission line. The power supply configuration is based on a high voltage power tetrode EBV 50/100 that provides the following functions: regulation, overcurrent limitation and fast switching. Pulses of a maximum of 50 A at 70 KV with a 0.1% accuracy of stabilized voltage during pulse can be obtained. The maximum time to switch the power supply off, in case of breakdown, is less than 20 microsecs. The gyrotron module is comprised of superconductive coils for resonant magnetic field generation and a Russian gyrotron. This kind of gyrotrons has a high flexibility in power control since it is possible to change the output power from 100 KW to 350 KW without deep cuts in regime. The gyrotron forms a Gaussian-like beam with linear polarization and a purity of 90% permitting to handle the output power in a quasi-optical transmission form. The quasi-optical line carrying microwave power from the gyrotron into the TJ-1U consists of four cylindrical copper-covered mirrors and features a transmission coefficient of more then 0.9. Radiative losses occur mainly at the gyrotron output and into the side lobes of the radiation pattern whereas ohmic losses into the copper mirrors are negligible. A Gaussian beam diameter of 4.3 cm (-10 dB power level) results at the TJ-1U window. (orig.)

  13. Initial results from model independent analysis of the KEK ATF

    International Nuclear Information System (INIS)

    Model Independent Analysis (MIA) has shown the potential to be a useful tool for diagnostics and optics verification. The Accelerator Test Facility (ATF) prototype damping ring at KEK has a diagnostic system with the ability to collect data allowing the application of MIA for analysis of the injection stability, and the storage ring optics and diagnostics. Understanding of all these issues will be important for improving the operational performance of a damping ring. We report here the results of a first attempt to apply MIA to the ATF

  14. SR monitor system for the ATF Damping Ring

    International Nuclear Information System (INIS)

    Preliminary results of the synchrotron radiation (SR) monitor system developed for the Damping Ring of the accelerator test facility in Tsukuba-KEK (KEK-ATF-DR) are described; The system consists of a two dimensional CCD camera and a double-sweep streak camera for observing the vertical and longitudinal shapes of bunched beams, respectively. (author)

  15. Human CHAC1 Protein Degrades Glutathione, and mRNA Induction Is Regulated by the Transcription Factors ATF4 and ATF3 and a Bipartite ATF/CRE Regulatory Element*

    Science.gov (United States)

    Crawford, Rebecca R.; Prescott, Eugenia T.; Sylvester, Charity F.; Higdon, Ashlee N.; Shan, Jixiu; Kilberg, Michael S.; Mungrue, Imran N.

    2015-01-01

    Using an unbiased systems genetics approach, we previously predicted a role for CHAC1 in the endoplasmic reticulum stress pathway, linked functionally to activating transcription factor 4 (ATF4) following treatment with oxidized phospholipids, a model for atherosclerosis. Mouse and yeast CHAC1 homologs have been shown to degrade glutathione in yeast and a cell-free system. In this report, we further defined the ATF4-CHAC1 interaction by cloning the human CHAC1 promoter upstream of a luciferase reporter system for in vitro assays in HEK293 and U2OS cells. Mutation and deletion analyses defined two major cis DNA elements necessary and sufficient for CHAC1 promoter-driven luciferase transcription under conditions of ER stress or ATF4 coexpression: the −267 ATF/cAMP response element (CRE) site and a novel −248 ATF/CRE modifier (ACM) element. We also examined the ability of the CHAC1 ATF/CRE and ACM sequences to bind ATF4 and ATF3 using immunoblot-EMSA and confirmed ATF4, ATF3, and CCAAT/enhancer-binding protein β binding at the human CHAC1 promoter in the proximity of the ATF/CRE and ACM using ChIP. To further validate the function of CHAC1 in a human cell model, we measured glutathione levels in HEK293 cells with enhanced CHAC1 expression. Overexpression of CHAC1 led to a robust depletion of glutathione, which was alleviated in a CHAC1 catalytic mutant. These results suggest an important role for CHAC1 in oxidative stress and apoptosis with implications for human health and disease. PMID:25931127

  16. Human CHAC1 Protein Degrades Glutathione, and mRNA Induction Is Regulated by the Transcription Factors ATF4 and ATF3 and a Bipartite ATF/CRE Regulatory Element.

    Science.gov (United States)

    Crawford, Rebecca R; Prescott, Eugenia T; Sylvester, Charity F; Higdon, Ashlee N; Shan, Jixiu; Kilberg, Michael S; Mungrue, Imran N

    2015-06-19

    Using an unbiased systems genetics approach, we previously predicted a role for CHAC1 in the endoplasmic reticulum stress pathway, linked functionally to activating transcription factor 4 (ATF4) following treatment with oxidized phospholipids, a model for atherosclerosis. Mouse and yeast CHAC1 homologs have been shown to degrade glutathione in yeast and a cell-free system. In this report, we further defined the ATF4-CHAC1 interaction by cloning the human CHAC1 promoter upstream of a luciferase reporter system for in vitro assays in HEK293 and U2OS cells. Mutation and deletion analyses defined two major cis DNA elements necessary and sufficient for CHAC1 promoter-driven luciferase transcription under conditions of ER stress or ATF4 coexpression: the -267 ATF/cAMP response element (CRE) site and a novel -248 ATF/CRE modifier (ACM) element. We also examined the ability of the CHAC1 ATF/CRE and ACM sequences to bind ATF4 and ATF3 using immunoblot-EMSA and confirmed ATF4, ATF3, and CCAAT/enhancer-binding protein β binding at the human CHAC1 promoter in the proximity of the ATF/CRE and ACM using ChIP. To further validate the function of CHAC1 in a human cell model, we measured glutathione levels in HEK293 cells with enhanced CHAC1 expression. Overexpression of CHAC1 led to a robust depletion of glutathione, which was alleviated in a CHAC1 catalytic mutant. These results suggest an important role for CHAC1 in oxidative stress and apoptosis with implications for human health and disease. PMID:25931127

  17. Ceapins inhibit ATF6α signaling by selectively preventing transport of ATF6α to the Golgi apparatus during ER stress

    Science.gov (United States)

    Gallagher, Ciara M; Walter, Peter

    2016-01-01

    The membrane-bound transcription factor ATF6α is activated by proteolysis during endoplasmic reticulum (ER) stress. ATF6α target genes encode foldases, chaperones, and lipid biosynthesis enzymes that increase protein-folding capacity in response to demand. The off-state of ATF6α is maintained by its spatial separation in the ER from Golgi-resident proteases that activate it. ER stress induces trafficking of ATF6α. We discovered Ceapins, a class of pyrazole amides, as selective inhibitors of ATF6α signaling that do not inhibit the Golgi proteases or other UPR branches. We show that Ceapins block ATF6α signaling by trapping it in ER-resident foci that are excluded from ER exit sites. Removing the requirement for trafficking by pharmacological elimination of the spatial separation of the ER and Golgi apparatus restored cleavage of ATF6α in the presence of Ceapins. Washout of Ceapins resensitized ATF6α to ER stress. These results suggest that trafficking of ATF6α is regulated by its oligomeric state. DOI: http://dx.doi.org/10.7554/eLife.11880.001

  18. Influence of plasma biasing on turbulence in the torsatron TJ-K

    International Nuclear Information System (INIS)

    Plasma confinement can be strongly improved by transport barriers. First in the ASDEX tokamak, spontaneous transitions from a low-confinement (L-mode) into a high-confinement regime (H-mode) have been observed. L-H transitions are accompanied by the formation of a transport barrier at the plasma edge. E x B shear flows have been considered as a candidate for trigger- ing the transport barrier. They are assumed to limit the radial correlation length of turbulent structures and, thus, reduce radial turbulent transport. Besides spontaneous L-H transitions, improved confinement regimes can also be achieved by externally induced electric fields. In the concept of plasma biasing, the plasma potential is locally modified by an inserted electrode. In this contribution, biasing is applied to the low-temperature plasma in the torsatron TJ-K in order to investigate the mechanism of transport reduction due to shear flows. The plasma is throughout accessible for probe diagnostics and the dimensionless parameters are similar to those at the edge of fusion plasmas. Turbulent structures are detected by means of an 8 x 8 Langmuir probe array in order to study the shear decorrelation mechanism. Different biasing schemes were tested to create sufficiently strong shear flows to have an impact on turbulent structures and radial transport. A clear effect was achieved with ring-like electrodes aligned on a flux surface. The plasma conditions and the fluctuations could strongly be influenced. Steepened density gradients and reduced fluctuation and transport levels were obtained when the shear was increased inside the confinement region. The direction of the poloidal propagation of turbulent structures changed from the electron-diamagnetic to the E x B-drift direction when strong radial electric fields were induced. The structures were found to be distorted, but a decrease of the radial correlation length was not observed. Transport reduction can be traced to enhanced stability reflected

  19. Role of ATF5 in the invasive potential of diverse human cancer cell lines.

    Science.gov (United States)

    Nukuda, Akihiro; Endoh, Hiroki; Yasuda, Motoaki; Mizutani, Takeomi; Kawabata, Kazushige; Haga, Hisashi

    2016-06-01

    Activating transcription factor 5 (ATF5) is a member of the ATF/cAMP response element-binding protein family. Our research group recently revealed that ATF5 expression increases the invasiveness of human lung carcinoma cells. However, the effects of ATF5 on the invasive potential of other cancer cells lines remain unclear. Therefore, in this study, we investigated the role of ATF5 in the invasive activity of diverse human cancer cell lines. Invasiveness was assessed using Matrigel invasion assays. ATF5 knockdown resulted in decreased invasiveness in seven of eight cancer cell lines tested. These results suggest that ATF5 promotes invasiveness in several cancer cell lines. Furthermore, the roles of ATF5 in the invasiveness were evaluated in three-dimensional (3D) culture conditions. In 3D collagen gel, HT-1080 and MDA-MB-231 cells exhibited high invasiveness, with spindle morphology and high invasion speed. In both cell lines, knockdown of ATF5 resulted in rounded morphology and decreased invasion speed. Next, we showed that ATF5 induced integrin-α2 and integrin-β1 expression and that the depletion of integrin-α2 or integrin-β1 resulted in round morphology and decreased invasion speed. Our results suggest that ATF5 promotes invasion by inducing the expression of integrin-α2 and integrin-β1 in several human cancer cell lines. PMID:27125458

  20. Determination of 2-dimensional temperature and density profiles of a plasma in the Auburn torsatron via computer control

    International Nuclear Information System (INIS)

    Early studies of the magnetic surfaces of the Auburn Torsatron indicated the presence of an X-point in the magnetic surfaces. Both theoretical calculations and experimental verification were performed in these studies. The plasma density distribution is believed to be determined by these magnetic surfaces. The 2-dimensional relative plasma density and electron temperature profiles over a cross-section of the plasma will verify that the X-point does have an influence on the distribution of the plasma. An electric double probe is used to measure the electron temperature and relative density at pre-defined points inside the plasma. The probe is on a moveable platform which is motor driven and positioned by a computer

  1. Characteristics of the three-half-turn-antenna-driven RF discharge in the Uragan-3M torsatron

    Energy Technology Data Exchange (ETDEWEB)

    Grigor’eva, L. I.; Chechkin, V. V., E-mail: chechkin@ipp.kharkov.ua; Moiseenko, V. E.; Grekov, D. L.; Pavlichenko, R. O.; Lozin, A. V.; Tarasov, I. K.; Kulaga, A. Ye.; Zamanov, N. V.; Tretiak, K. K.; Kozulya, M. M.; Beletskii, A. A.; Kasilov, A. A.; Mironov, Yu. K.; Romanov, V. S.; Voitsenya, V. S. [National Science Center Kharkiv Institute of Physics and Technology, Institute of Plasma Physics (Ukraine)

    2015-12-15

    In the ℓ = 3 Uragan-3M torsatron hydrogen plasma is produced by RF fields in the Alfvén range of frequencies (ω ≤ ω{sub ci}). The initial (target) plasma with the line-averaged density of units 10{sup 12} cm{sup −3} is produced by a frame antenna with a broad spectrum of generated parallel wavenumbers. After this, to heat the plasma and bring its density to ∼10{sup 13} cm{sup –3}, another, shorter wavelength three-half-turn antenna with large transverse currents is used. The behavior of the density, electron temperature, and loss of the plasma supported by the three-half-turn antenna is studied depending on the RF power fed to the antenna and initial values of the density and electron temperature supplied by the frame antenna.

  2. ATF neutral beam injection: optimization of beam alignment and aperturing

    International Nuclear Information System (INIS)

    The application of the existing Impurity Study Experiment (ISX-B) neutral beam injectors for the Advanced Toroidal Facility (ATF) is studied. It is determined that with the practical considerations of beam aperturing, ATF vacuum vessel complexity, and realistic beam modeling, the power absorbed by the plasma will be approximately 57% of the extracted neutral beam power, which corresponds to an injected power of about 1.5 MW. By reducing the beam divergence to a 10 Gaussian distribution, the absorbed power could be increased to 93%. The power delivered to the plasma is found to be a strong function of the beam divergence but only a weak function of the beam focal length. Shinethrough can be a serious problem if very low density startups are necessary. Preliminary calculations indicate that there will be no excessive fast-ion losses. 12 refs., 17 figs., 1 tab

  3. Cavity Beam Position Monitor System for ATF2

    Energy Technology Data Exchange (ETDEWEB)

    Boogert, Stewart; /Oxford U., JAI; Boorman, Gary; /Oxford U., JAI; Swinson, Christina; /Oxford U., JAI; Ainsworth, Robert; /Royal Holloway, U. of London; Molloy, Stephen; /Royal Holloway, U. of London; Aryshev, Alexander; /KEK, Tsukuba; Honda, Yosuke; /KEK, Tsukuba; Tauchi, Toshiaki; /KEK, Tsukuba; Terunuma, Nobuhiro; /KEK, Tsukuba; Urakawa, Junji; /KEK, Tsukuba; Frisch, Josef; /SLAC; May, Justin; /SLAC; McCormick, Douglas; /SLAC; Nelson, Janice; /SLAC; Smith, Tonee; /SLAC; White, Glen; /SLAC; Woodley, Mark; /SLAC; Heo, Ae-young; /Kyungpook Natl. U.; Kim, Eun-San; /Kyungpook Natl. U.; Kim, Hyoung-Suk; /Kyungpook Natl. U.; Kim, Youngim; /Kyungpook Natl. U. /University Coll. London /Kyungpook Natl. U. /Fermilab /Pohang Accelerator Lab.

    2012-07-09

    The Accelerator Test Facility 2 (ATF2) in KEK, Japan, is a prototype scaled demonstrator system for the final focus required for a future high energy lepton linear collider. The ATF2 beam-line is instrumented with a total of 38 C and S band resonant cavity beam position monitors (CBPM) with associated mixer electronics and digitizers. The current status of the BPM system is described, with a focus on operational techniques and performance. The ATF2 C-band system is performing well, with individual CBPM resolution approaching or at the design resolution of 50 nm. The changes in the CBPM calibration observed over three weeks can probably be attributed to thermal effects on the mixer electronics systems. The CW calibration tone power will be upgraded to monitor changes in the electronics gain and phase. The four S-band CBPMs are still to be investigated, the main problem associated with these cavities is a large cross coupling between the x and y ports. This combined with the large design dispersion in that degion makes the digital signal processing difficult, although various techniques exist to determine the cavity parameters and use these coupled signals for beam position determination.

  4. Study of Abnormal Vertical Emittance Growth in ATF Extraction Line

    Energy Technology Data Exchange (ETDEWEB)

    Alabau, M.; Faus-Golfe, A.; /Valencia U., IFIC; Alabau, M.; Bambade, P.; Brossard, J.; Le Meur, G.; Rimbault, C.; Touze, F.; /Orsay, LAL; Angal-Kalinin, D.; Jones, J.K.; /Daresbury; Appleby, R.; Scarfe, A.; /Manchester U.; Kuroda, S.; /KEK, Tsukuba; White, G.R.; Woodley, M.; /SLAC; Zimmermann, F.; /CERN

    2011-11-04

    Since several years, the vertical beam emittance measured in the Extraction Line (EXT) of the Accelerator Test Facility (ATF) at KEK, that will transport the electron beam from the ATF Damping Ring (DR) to the future ATF2 Final Focus beam line, is significantly larger than the emittance measured in the DR itself, and there are indications that it grows rapidly with increasing beam intensity. This longstanding problem has motivated studies of possible sources of this anomalous emittance growth. One possible contribution is non-linear magnetic fields in the extraction region experimented by the beam while passing off-axis through magnets of the DR during the extraction process. In this paper, simulations of the emittance growth are presented and compared to observations. These simulations include the effects of predicted non-linear field errors in the shared DR magnets and orbit displacements from the reference orbit in the extraction region. Results of recent measurements using closed orbit bumps to probe the relation between the extraction trajectory and the anomalous emittance growth are also presented.

  5. ATF4 is involved in the regulation of simulated microgravity induced integrated stress response

    Science.gov (United States)

    Li, Yingxian; Li, Qi; Wang, Xiaogang; Sun, Qiao; Wan, Yumin; Li, Yinghui; Bai, Yanqiang

    Objective: Many important metabolic and signaling pathways have been identified as being affected by microgravity, thereby altering cellular functions such as proliferation, differentiation, maturation and cell survival. It has been demonstrated that microgravity could induce all kinds of stress response such as endoplasmic reticulum stress and oxidative stress et al. ATF4 belongs to the ATF/CREB family of basic region leucine zipper transcription factors. ATF4 is induced by stress signals including anoxia/hypoxia, ER stress, amino acid deprivation and oxidative stress. ATF4 regulates the expression of genes involved in oxidative stress, amino acid synthesis, differentiation, metastasis and angiogenesis. The aim of this study was to examine the changes of ATF4 under microgravity, and to investigate the role of ATF4 in microgravity induced stress. MethodsMEF cells were cultured in clinostat to simulate microgravity. Reverse transcription polymerase chain reaction (RT-PCR) and western blotting were used to examine mRNA and protein levels of ATF4 expression under simulated microgravity in MEF cells. ROS levels were measured with the use of the fluorescent signal H2DCF-DA. GFP-XBP1 stably transfected cell lines was used to detect the extent of ER stress under microgravity by the intensity of GFP. Dual luciferase reporter assay was used to detect the activity of ATF4. Co-immunoprecipitation was performed to analyze protein interaction. Results: ATF4 protein levels in MEF cells increased under simulated microgravity. However, ATF4 mRNA levels were consistent. XBP1 splicing can be induced due to ER stress caused by simulated microgravity. At the same time, ROS levels were also increased. Increased ATF4 could promote the expression of CHOP, which is responsible for cell apoptosis. ATF4 also play an important role in cellular anti-oxidant stress. In ATF4 -/-MEF cells, the ROS levels after H2O2 treatment were obviously higher than that of wild type cells. HDAC4 was

  6. A key role for ATF3 in regulating mast cell survival and mediator release

    OpenAIRE

    Gilchrist, Mark; Henderson, William R.; Morotti, Andrew; Carrie D. Johnson; Nachman, Alex; Schmitz, Frank; Smith, Kelly D.; Aderem, Alan

    2010-01-01

    Activating transcription factor 3 (ATF3) is a basic leucine zipper transcription factor that plays a regulatory role in inflammation, cell division, and apoptosis. Mast cells (MCs) initiate many inflammatory responses and have a central role in allergy and allergic diseases. We report here that ATF3 has a central role in MC development and function. Bone marrow–derived MC populations from ATF3-deficient mice are unresponsive to interleukin-3 (IL-3)–induced maturation signals, and this correla...

  7. Improved antibody production in Chinese hamster ovary cells by ATF4 overexpression

    OpenAIRE

    Haredy, Ahmad M.; Nishizawa, Akitoshi; Honda, Kohsuke; Ohya, Tomoshi; Ohtake, Hisao; Omasa, Takeshi

    2013-01-01

    To improve antibody production in Chinese hamster ovary (CHO) cells, the humanized antibody-producing CHO DP-12-SF cell line was transfected with the gene encoding activating transcription factor 4 (ATF4), a central factor in the unfolded protein response. Overexpression of ATF4 significantly enhanced the production of antibody in the CHO DP-12-SF cell line. The specific IgG production rate of in the ATF4-overexpressing CHO-ATF4-16 cells was approximately 2.4 times that of the parental host c...

  8. ATF3 inhibits adipocyte differentiation of 3T3-L1 cells

    Energy Technology Data Exchange (ETDEWEB)

    Jang, Min Kyung; Kim, Cho Hee [School of Korean Medicine, Pusan National University, 30 Beom-eo ri, Mulguem-eup, Yangsan-si, Gyeongnam 609-735 (Korea, Republic of); Seong, Je Kyung [Department of Anatomy and Cell Biology, College of Veterinary Medicine, Seoul National University, Seoul 151-742 (Korea, Republic of); Jung, Myeong Ho, E-mail: jung0603@pusan.ac.kr [School of Korean Medicine, Pusan National University, 30 Beom-eo ri, Mulguem-eup, Yangsan-si, Gyeongnam 609-735 (Korea, Republic of)

    2012-04-27

    Highlights: Black-Right-Pointing-Pointer Overexpression of ATF3 inhibits adipocyte differentiation in 3T3-L1 cells. Black-Right-Pointing-Pointer Overexpression of ATF3 represses C/EBP{alpha} expression. Black-Right-Pointing-Pointer ATF3 directly binds to mouse C/EBP{alpha} promoter spanning from -1928 to -1907. Black-Right-Pointing-Pointer ATF3 may play a role in hypoxia-mediated inhibition of adipocyte differentiation. -- Abstract: ATF3 is a stress-adaptive gene that regulates proliferation or apoptosis under stress conditions. However, the role of ATF3 is unknown in adipocyte cells. Therefore, in this study, we investigated the functional role of ATF3 in adipocytes. Both lentivirus-mediated overexpression of ATF3 and stably-overexpressed ATF3 inhibited adipocyte differentiation in 3T3-L1 cells, as revealed by decreased lipid staining with oil red staining and reduction in adipogenic genes. Thapsigargin treatment and overexpression of ATF3 decreased C/EBP{alpha} transcript and repressed the activity of the 3.6-kb mouse C/EBP{alpha} promoter, demonstrating that ATF3 downregulates C/EBP{alpha} expression. Transfection studies using mutant constructs containing 5 Prime -deletions in the C/EBP{alpha} promoter revealed that a putative ATF/CRE element, GGATGTCA, is located between -1921 and -1914. Electrophoretic mobility shift assay and chromatin immunoprecipitation assay demonstrated that ATF3 directly binds to mouse C/EBP{alpha} promoter spanning from -1928 to -1907. Both chemical hypoxia-mimetics or physical hypoxia led to reduce the C/EBP{alpha} mRNA and repress the promoter activity of the C/EBP{alpha} gene, whereas increase ATF3 mRNA, suggesting that ATF3 may contribute to the inhibition of adipocyte differentiation in hypoxia through downregulation of C/EBP{alpha} expression. Collectively, these results demonstrate that ATF3 represses the C/EBP{alpha} gene, resulting in inhibition of adipocyte differentiation, and thus plays a role in hypoxia-mediated inhibition

  9. Glucose deprivation induces chemoresistance in colorectal cancer cells by increasing ATF4 expression

    Science.gov (United States)

    Hu, Ya-Ling; Yin, Yuan; Liu, He-Yong; Feng, Yu-Yang; Bian, Ze-Hua; Zhou, Le-Yuan; Zhang, Ji-Wei; Fei, Bo-Jian; Wang, Yu-Gang; Huang, Zhao-Hui

    2016-01-01

    AIM: To investigate the role of activating transcription factor 4 (ATF4) in glucose deprivation (GD) induced colorectal cancer (CRC) drug resistance and the mechanism involved. METHODS: Chemosensitivity and apoptosis were measured under the GD condition. Inhibition of ATF4 using short hairpin RNA in CRC cells under the GD condition and in ATF4-overexpressing CRC cells was performed to identify the role of ATF4 in the GD induced chemoresistance. Quantitative real-time RT-PCR and Western blot were used to detect the mRNA and protein expression of drug resistance gene 1 (MDR1), respectively. RESULTS: GD protected CRC cells from drug-induced apoptosis (oxaliplatin and 5-fluorouracil) and induced the expression of ATF4, a key gene of the unfolded protein response. Depletion of ATF4 in CRC cells under the GD condition can induce apoptosis and drug re-sensitization. Similarly, inhibition of ATF4 in the ATF4-overexpressing CRC cells reintroduced therapeutic sensitivity and apoptosis. In addition, increased MDR1 expression was observed in GD-treated CRC cells. CONCLUSION: These data indicate that GD promotes chemoresistance in CRC cells through up-regulating ATF4 expression. PMID:27468213

  10. Cadmium interferes with the degradation of ATF5 via a post-ubiquitination step of the proteasome degradation pathway

    International Nuclear Information System (INIS)

    ATF5 is a member of the CREB/ATF family of transcription factors. In the current study, using a transient transfection system to express FLAG epitope fusion proteins of ATF5, we have shown that CdCl2 or NaAsO3 increases the protein levels of ATF5 in cells, and that cadmium stabilizes the ATF5 protein. Proteasome inhibitors had a similar effect to cadmium on the cellular accumulation of ATF5. Proteasome inhibition led to an increase in ubiquitinated ATF5, while cadmium did not appear to reduce the extent of ATF5 ubiquitination. ATF5 contains a putative nuclear export signal within its N-terminus. We demonstrated that whereas deletion of N-terminal region resulted in a increase of ATF5 levels, this region does not appear to be involved in the ubiquitination of ATF5. These results indicate that ATF5 is targeted for degradation by the ubiquitin-proteasome pathway, and that cadmium slows the rate of ATF5 degradation via a post-ubiquitination mechanism.

  11. Activating Transcription Factor 3 (ATF3 and the Nervous System

    Directory of Open Access Journals (Sweden)

    Patrick Norval Anderson

    2012-02-01

    Full Text Available It has been recognised for over a century that the ability of axons to regenerate in peripheral nerves is fundamentally greater than that of axons in the brain, spinal cord or optic nerves [early literature was reviewed in (Ramon y Cajal, 1928]. One factor that contributes to the successful regeneration of the axons in peripheral nerves is the complex cell body response the neurons show to axotomy. That transcription factors must play an important role in enabling neurons to regrow their axons is implicit to the observation that several hundred genes are regulated in neurons during axonal regeneration (Costigan et al., 2002; Boeshore et al., 2004. In addition, similarly large numbers of genes are regulated in the non-neuronal cells present in injured peripheral nerves [especially Schwann cells (Barrette et al., 2010] and CNS tissue. Of the transcription factors that regulate these changes in gene expression, the function of c-jun is best understood but ATF-3 (also known as LRF-1, LRG-21, CRG-5 and TI-241 is also upregulated in most of the neurons (Fig. 1 and Schwann cells that express c-jun. Indeed, ATF-3 has become a standard marker for neurons axotomised by peripheral nerve injury (Tsuzuki et al., 2001; Yamanaka et al., 2005; Yano et al., 2008; Linda et al., 2011 and its expression by injured neurons is closely correlated with a regenerative response. None the less, surprisingly little is known about the functions of ATF3 in neurons or glia within the injured nervous system, especially when compared with those of its potential binding partner, c-Jun.

  12. Turn by Turn Measurements at the KEK-ATF

    CERN Document Server

    Renier, Y; Tomas, R; Wendt, M; Eddy, N; Kubo, K; Kuroda, S; Naito, T; Okugi, T; Terunuma, N; Urakawa, J

    2013-01-01

    The ATF damping ring has been upgraded with new read-out electronics for the beam position monitors (BPM), capable to acquire the beam orbits on a turn-by-turn basis, as well as in a high resolution averaging mode. The new BPM system allows to improve optic corrections and to achieve an even smaller vertical emittance (<2pm). Experimental results are presented based on turn-by-turn beam orbit measurements in the ring, for estimating the β functions and dispersion along the lattice. A fast method to measure spectral line amplitude in a few turns is also presented, including the evaluation of chromaticity.

  13. Antenna Test Facility (ATF): User Test Planning Guide

    Science.gov (United States)

    Lin, Greg

    2011-01-01

    Test process, milestones and inputs are unknowns to first-time users of the ATF. The User Test Planning Guide aids in establishing expectations for both NASA and non-NASA facility customers. The potential audience for this guide includes both internal and commercial spaceflight hardware/software developers. It is intended to assist their test engineering personnel in test planning and execution. Material covered includes a roadmap of the test process, roles and responsibilities of facility and user, major milestones, facility capabilities, and inputs required by the facility. Samples of deliverables, test article interfaces, and inputs necessary to define test scope, cost, and schedule are included as an appendix to the guide.

  14. 斑马鱼基因ATF4多克隆抗体的制备%Preparation of Polyclonal Antibody of ATF4 in Zebrafish

    Institute of Scientific and Technical Information of China (English)

    李发祥; 杨荣; 陈婷芳; 唐雄卓; 赵碧峰; 江志钢; 张义; 李永青; 吴秀山

    2012-01-01

    ATF4 , a member of the ATF/CREB transcription factor family which contains a bZIP domain, plays a important role in the embryonic development, cell proliferation and differentiation. Therefore, it is advisable to prepare an antibody for the heart development research in Zerbrafish. In this research, a ATF4-specific, hydrophilic nucleotide sequence (about 1 017 bp) was selected by using bioinformatics methods, and the sequence was amplified by PCR, the PCR product was inserted into the prokaryotic expression vector pET-28a and then transformed into Rosetta cells. After the sequence result of the recombinant plasmid pET-28a-ATF4 is verified to be right, the fusion protein was induced to express in Rosetta cells by IPTG. The mouse was immunized by injecting appropriate amount of fusion protein, and the ATF4 polyclonal antibody was obtained. The antibody' s titer and specification was identified. Our results showed that the ATF4 polyclonal antibody was practical and available for western-blotting analysis and immunohisto-chemistry.%ATF4是含有bZIP结构域的ATF/CREB转录因子家族成员,对胚胎的发育以及细胞的增殖、分化有重要的调节作用.制备ATF4的多克隆抗体对于研究其在斑马鱼心脏发育过程中的作用有重要的意义.研究首先通过生物信息学方法,选择ATF4基因中特异性强、具亲水性的一段核苷酸序列(1 017 bp),通过PCR扩增,将片段重组到原核表达载体pET-28a,然后转化人Rosetta菌株中.经测序鉴定正确后,用IPTG诱导表达融合蛋白,以该融合蛋白免疫小鼠,获得ATF4多克隆抗鼠血清.对该多抗血清抗体进行验证,具有很好特异性和较高效价,可以用作Western-blotting、免疫印迹等试验分析.

  15. Design of multichord Hα detector arrays for the U-3M torsatron and identification of rotating plasma perturbations

    Science.gov (United States)

    Dreval, M. B.; Shapoval, A. M.; Ozherelyev, F. I.; Makhov, M. M.

    2016-07-01

    An Hα camera has been designed and installed in the U-3M torsatron for spatially and temporally resolved measurements. This device provides fast measurements of the emission brightness profile in the noisy environment of the radio frequency (RF) heated plasma. Unusual topology of diagnostics and the data acquisition system are applied. All the system components, including digitizers, are assembled in a single unit. It allows the suppression of a low-frequency electromagnetic interference by eliminating the ground loops. And the suppression of RF noises is achieved by eliminating the signal interface cables and digital interface cables in the design. The Wi-Fi interface is used to prevent a ground loop in the data transfer stage. The achieved sensitivity of our diagnostics is high enough for measuring the Hα emission from the low-density (ne ≈ (1-2)ṡ1010 cm-3) plasma with a temporal resolution of about 20 μs in the noisy environment. Different types of Hα emission fluctuations within the frequency range of 1-5 kHz and poloidal mode numbers m = 0 and m = 5 have been observed in U-3M. A simple technique of the line-of-sight data analysis, based on the U-3M magnetic surface asymmetry, is proposed and used for the spatial localization of the rotating mode and for the determination of mode numbers and its poloidal rotation direction using a single Hα array.

  16. Atf3 mutant mice show reduced axon regeneration and impaired regeneration-associated gene induction after peripheral nerve injury.

    Science.gov (United States)

    Gey, Manuel; Wanner, Renate; Schilling, Corinna; Pedro, Maria T; Sinske, Daniela; Knöll, Bernd

    2016-08-01

    Axon injury in the peripheral nervous system (PNS) induces a regeneration-associated gene (RAG) response. Atf3 (activating transcription factor 3) is such a RAG and ATF3's transcriptional activity might induce 'effector' RAGs (e.g. small proline rich protein 1a (Sprr1a), Galanin (Gal), growth-associated protein 43 (Gap43)) facilitating peripheral axon regeneration. We provide a first analysis of Atf3 mouse mutants in peripheral nerve regeneration. In Atf3 mutant mice, facial nerve regeneration and neurite outgrowth of adult ATF3-deficient primary dorsal root ganglia neurons was decreased. Using genome-wide transcriptomics, we identified a neuropeptide-encoding RAG cluster (vasoactive intestinal peptide (Vip), Ngf, Grp, Gal, Pacap) regulated by ATF3. Exogenous administration of neuropeptides enhanced neurite growth of Atf3 mutant mice suggesting that these molecules might be effector RAGs of ATF3's pro-regenerative function. In addition to the induction of growth-promoting molecules, we present data that ATF3 suppresses growth-inhibiting molecules such as chemokine (C-C motif) ligand 2. In summary, we show a pro-regenerative ATF3 function during PNS nerve regeneration involving transcriptional activation of a neuropeptide-encoding RAG cluster. ATF3 is a general injury-inducible factor, therefore ATF3-mediated mechanisms identified herein might apply to other cell and injury types. PMID:27581653

  17. Atf3 mutant mice show reduced axon regeneration and impaired regeneration-associated gene induction after peripheral nerve injury

    Science.gov (United States)

    Gey, Manuel; Wanner, Renate; Schilling, Corinna; Pedro, Maria T.; Sinske, Daniela

    2016-01-01

    Axon injury in the peripheral nervous system (PNS) induces a regeneration-associated gene (RAG) response. Atf3 (activating transcription factor 3) is such a RAG and ATF3's transcriptional activity might induce ‘effector’ RAGs (e.g. small proline rich protein 1a (Sprr1a), Galanin (Gal), growth-associated protein 43 (Gap43)) facilitating peripheral axon regeneration. We provide a first analysis of Atf3 mouse mutants in peripheral nerve regeneration. In Atf3 mutant mice, facial nerve regeneration and neurite outgrowth of adult ATF3-deficient primary dorsal root ganglia neurons was decreased. Using genome-wide transcriptomics, we identified a neuropeptide-encoding RAG cluster (vasoactive intestinal peptide (Vip), Ngf, Grp, Gal, Pacap) regulated by ATF3. Exogenous administration of neuropeptides enhanced neurite growth of Atf3 mutant mice suggesting that these molecules might be effector RAGs of ATF3's pro-regenerative function. In addition to the induction of growth-promoting molecules, we present data that ATF3 suppresses growth-inhibiting molecules such as chemokine (C-C motif) ligand 2. In summary, we show a pro-regenerative ATF3 function during PNS nerve regeneration involving transcriptional activation of a neuropeptide-encoding RAG cluster. ATF3 is a general injury-inducible factor, therefore ATF3-mediated mechanisms identified herein might apply to other cell and injury types. PMID:27581653

  18. Application of the Ball-Pen Probe in Two Low-Temperature Magnetised Plasma Devices and in Torsatron TJ-K

    Czech Academy of Sciences Publication Activity Database

    Adámek, Jiří; Peterka, M.; Gyergyek, T.; Kudrna, P.; Ramisch, M.; Stroth, U.; Cavalier, Jordan; Tichý, M.

    2013-01-01

    Roč. 53, č. 1 (2013), s. 39-44. ISSN 0863-1042. [International Workshop on Electric Probes in Magnetized Plasmas/9./. Iasi, 21.09.2011-23.09.2011] R&D Projects: GA AV ČR KJB100430901; GA ČR GA202/07/0044 Institutional support: RVO:61389021 Keywords : Ball-pen probe * magnetron * torsatron * CASTOR tokamak * coefficient Subject RIV: BL - Plasma and Gas Discharge Physics Impact factor: 0.983, year: 2013 http://onlinelibrary.wiley.com/doi/10.1002/ctpp.201310007/pdf

  19. The transcription factor ATF3 acts as an oncogene in mouse mammary tumorigenesis

    Directory of Open Access Journals (Sweden)

    Thames Howard D

    2008-09-01

    Full Text Available Abstract Background Overexpression of the bZip transcription factor, ATF3, in basal epithelial cells of transgenic mice under the control of the bovine cytokeratin-5 (CK5 promoter has previously been shown to induce epidermal hyperplasia, hair follicle anomalies and neoplastic lesions of the oral mucosa including squamous cell carcinomas. CK5 is known to be expressed in myoepithelial cells of the mammary gland, suggesting the possibility that transgenic BK5.ATF3 mice may exhibit mammary gland phenotypes. Methods Mammary glands from nulliparous mice in our BK5.ATF3 colony, both non-transgenic and transgenic, were examined for anomalies by histopathology and immunohistochemistry. Nulliparous and biparous female mice were observed for possible mammary tumor development, and suspicious masses were analyzed by histopathology and immunohistochemistry. Human breast tumor samples, as well as normal breast tissue, were similarly analyzed for ATF3 expression. Results Transgenic BK5.ATF3 mice expressed nuclear ATF3 in the basal layer of the mammary ductal epithelium, and often developed squamous metaplastic lesions in one or more mammary glands by 25 weeks of age. No progression to malignancy was seen in nulliparous BK5.ATF3 or non-transgenic mice held for 16 months. However, biparous BK5.ATF3 mice developed mammary carcinomas with squamous metaplasia between 6 months and one year of age, reaching an incidence of 67%. Cytokeratin expression in the tumors was profoundly disturbed, including expression of CK5 and CK8 (characteristic of basal and luminal cells, respectively throughout the epithelial component of the tumors, CK6 (potentially a stem cell marker, CK10 (a marker of interfollicular epidermal differentiation, and mIRSa2 and mIRSa3.1 (markers of the inner root sheath of hair follicles. Immunohistochemical studies indicated that a subset of human breast tumors exhibit high levels of nuclear ATF3 expression. Conclusion Overexpression of ATF3 in CK5

  20. The transcription factor ATF3 acts as an oncogene in mouse mammary tumorigenesis

    International Nuclear Information System (INIS)

    Overexpression of the bZip transcription factor, ATF3, in basal epithelial cells of transgenic mice under the control of the bovine cytokeratin-5 (CK5) promoter has previously been shown to induce epidermal hyperplasia, hair follicle anomalies and neoplastic lesions of the oral mucosa including squamous cell carcinomas. CK5 is known to be expressed in myoepithelial cells of the mammary gland, suggesting the possibility that transgenic BK5.ATF3 mice may exhibit mammary gland phenotypes. Mammary glands from nulliparous mice in our BK5.ATF3 colony, both non-transgenic and transgenic, were examined for anomalies by histopathology and immunohistochemistry. Nulliparous and biparous female mice were observed for possible mammary tumor development, and suspicious masses were analyzed by histopathology and immunohistochemistry. Human breast tumor samples, as well as normal breast tissue, were similarly analyzed for ATF3 expression. Transgenic BK5.ATF3 mice expressed nuclear ATF3 in the basal layer of the mammary ductal epithelium, and often developed squamous metaplastic lesions in one or more mammary glands by 25 weeks of age. No progression to malignancy was seen in nulliparous BK5.ATF3 or non-transgenic mice held for 16 months. However, biparous BK5.ATF3 mice developed mammary carcinomas with squamous metaplasia between 6 months and one year of age, reaching an incidence of 67%. Cytokeratin expression in the tumors was profoundly disturbed, including expression of CK5 and CK8 (characteristic of basal and luminal cells, respectively) throughout the epithelial component of the tumors, CK6 (potentially a stem cell marker), CK10 (a marker of interfollicular epidermal differentiation), and mIRSa2 and mIRSa3.1 (markers of the inner root sheath of hair follicles). Immunohistochemical studies indicated that a subset of human breast tumors exhibit high levels of nuclear ATF3 expression. Overexpression of ATF3 in CK5-expressing cells of the murine mammary gland results in the

  1. Functional interaction of TCF4 with ATF5 to regulate the Wnt signaling pathway

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    Wnt signaling directs cell-fate choices during embryonic development and tissue tumorigenesis. T cell factor 4 (TCF4) plays a pivotal role in the Wnt signaling pathway. We demonstrate that a specific protein-protein interaction occurs between TCF4 and ATF5 (activating transcription factor 5) -- a new member of cAMP response element binding protein (CREB) with the yeast two-hybrid system. The N-terminal and DNA binding domain of TCF4 (TCF4ND, 1-495 aa) and the C-terminal spanning bZIP domain of ATF5 (162-282 aa) were found to be responsible for the interaction, and the C-terminal of ATF5 (ATF5/C) showed a much stronger interaction with TCF4ND than the full-length of ATF5 by detecting the ?-gal activity. Furthermore, overexpression of ATF5/C enhanced transcriptional activation by TCF4 proteins in luciferase assay by transient transfection. Taken together, these data suggest that ATF5 may function as a co-activator to potentiate the ability of TCF4 to activate transcription.

  2. Loss of ATF2 function leads to cranial motoneuron degeneration during embryonic mouse development.

    Directory of Open Access Journals (Sweden)

    Julien Ackermann

    Full Text Available The AP-1 family transcription factor ATF2 is essential for development and tissue maintenance in mammals. In particular, ATF2 is highly expressed and activated in the brain and previous studies using mouse knockouts have confirmed its requirement in the cerebellum as well as in vestibular sense organs. Here we present the analysis of the requirement for ATF2 in CNS development in mouse embryos, specifically in the brainstem. We discovered that neuron-specific inactivation of ATF2 leads to significant loss of motoneurons of the hypoglossal, abducens and facial nuclei. While the generation of ATF2 mutant motoneurons appears normal during early development, they undergo caspase-dependent and independent cell death during later embryonic and foetal stages. The loss of these motoneurons correlates with increased levels of stress activated MAP kinases, JNK and p38, as well as aberrant accumulation of phosphorylated neurofilament proteins, NF-H and NF-M, known substrates for these kinases. This, together with other neuropathological phenotypes, including aberrant vacuolisation and lipid accumulation, indicates that deficiency in ATF2 leads to neurodegeneration of subsets of somatic and visceral motoneurons of the brainstem. It also confirms that ATF2 has a critical role in limiting the activities of stress kinases JNK and p38 which are potent inducers of cell death in the CNS.

  3. Construction and Activity Assay of the Activating Transcription Factor 3 Reporter Vector pATF/CRE-luc

    Institute of Scientific and Technical Information of China (English)

    Jun-Qing XU; Jing-Lan DENG; You-Sheng WU; Han-Yan FU; Rui-Hua WANG; Jian ZHANG; Fan LU; Zhong-Liang ZHAO

    2006-01-01

    Activating transcription factor 3 (ATF3), a member of the activating transcription factor/cAMP responsive element binding protein (ATF/CREB) family of transcription factors, is induced by many physiological stresses. To investigate the activity of ATF/CREB in cells with physiological stresses, we developed a practical reporter vector, the plasmid pATF/CRE-luc, bearing activating transcription factor/cAMP responsive element (ATF/CRE) binding sites. This plasmid was constructed by inserting three repeats of the ATF/CRE binding element into the plasmid pG51uc, replacing the GAL-4 binding sites. The plasmids pACT/ATF3 and pATF/CRE-luc were transfected into HeLa and NIH3T3 cells, respectively, and the results showed that the expression of luciferase was increased in a dose-dependent manner on plasmid pACT/ATF3. The data suggested that the plasmid pATF/CRE-luc could be used as a sensitive and convenient reporter system of ATF3 activity.

  4. Localisation of beam offset jitter sources at ATF2

    CERN Document Server

    Pfingstner, J; Patecki, M; Schulte, D; Tomás, R

    2014-01-01

    For the commissioning and operation of modern particle accelerators, automated error detection and diagnostics methods are becoming increasingly important. In this paper, we present two such methods, which are capable of localising sources of beam offset jitter with a combination of correlation studies and so called degree of freedom plots. The methods were applied to the ATF2 beam line at KEK, where one of the major goals is the reduction of the beam offset jitter. Results of this localisation are shown in this paper. A big advantage of the presented method is its high robustness especially to varying optics parameters. Therefore, we believe that the developed beam offset jitter localisation methods can be easily applied to other accelerators.

  5. Plans for improvements to the ATF ECH system

    International Nuclear Information System (INIS)

    The Advanced Toroidal Facility (ATF) stellarator experiment at Oak Ridge National Laboratory (ORNL) uses electron cyclotron waves for plasma formation and heating. Although the existing systems are quite reliable and produce acceptable plasmas, a few deficiencies should be corrected. Therefore, several possible upgrades to the electron cyclotron heating (ECH) systems have been planned. Some of the desirable changes are (1) improving the launcher to make power deposition in the plasma more centralized,(2) improving the gyrotron power waveform monitoring diagnostics, (3) building a high-field launch system for higher density operation at 53-GHz (4) building a separate transmission line for the 35-GHz gyrotron, and (5) installing a higher frequency, higher power (84- or 110-GHz) gyrotron system for improved plasma density and temperature capability. This paper discusses options for these, improvements and conceptual designs

  6. Recent results on cleaning and conditioning the ATF vacuum system

    International Nuclear Information System (INIS)

    Techniques for cleaning and conditioning the vacuum vessel of the Advanced Toroidal Facility (ATF) and its internal components are described. The vacuum vessel cleaning technique combines baking to 150 degree C and glow discharges with hydrogen gas. Chromium gettering is used to further condition the system. The major internal components are the anodized aluminum baffles in the Thomson scattering system, a graphite-shielded ICRF antenna, two graphite limiters, and a diagnostic graphite plate. Three independent heating systems are used to bake some of the major components of the system. The major characteristics used for assessing cleanliness and conditioning progress are the maximum pressure attained during bakeout, the results of gas analysis, and revelant plasma parameters (e.g., time to radiative decay). Details of the various cleaning and conditioning procedures and results are presented

  7. ATF6α/β-mediated adjustment of ER chaperone levels is essential for development of the notochord in medaka fish.

    OpenAIRE

    Ishikawa, Tokiro; Okada, Tetsuya; Ishikawa-Fujiwara, Tomoko; Todo, Takeshi; Kamei, Yasuhiro; Shigenobu, Shuji; Tanaka, Minoru; Saito, Taro L; Yoshimura, Jun; Morishita, Shinichi; Toyoda, Atsushi; Sakaki, Yoshiyuki; Taniguchi, Yoshihito; Takeda, Shunichi; Mori, Kazutoshi

    2013-01-01

    ATF6α and ATF6β are membrane-bound transcription factors activated by regulated intramembrane proteolysis in response to endoplasmic reticulum (ER) stress to induce various ER quality control proteins. ATF6α- and ATF6β single-knockout mice develop normally, but ATF6α/β double knockout causes embryonic lethality, the reason for which is unknown. Here we show in medaka fish that ATF6α is primarily responsible for transcriptional induction of the major ER chaperone BiP and that ATF6α/β double kn...

  8. ATF6α/β-mediated adjustment of ER chaperone levels is essential for development of the notochord in medaka fish

    OpenAIRE

    Ishikawa, Tokiro; Okada, Tetsuya; Ishikawa-Fujiwara, Tomoko; Todo, Takeshi; Kamei, Yasuhiro; Shigenobu, Shuji; Tanaka, Minoru; Saito, Taro L; Yoshimura, Jun; Morishita, Shinichi; Toyoda, Atsushi; Sakaki, Yoshiyuki; Taniguchi, Yoshihito; Takeda, Shunichi; Mori, Kazutoshi

    2013-01-01

    ATF6α and ATF6β are membrane-bound transcription factors activated by regulated intramembrane proteolysis in response to endoplasmic reticulum (ER) stress to induce various ER quality control proteins. ATF6α- and ATF6β single-knockout mice develop normally, but ATF6α/β double knockout causes embryonic lethality, the reason for which is unknown. Here we show in medaka fish that ATF6α is primarily responsible for transcriptional induction of the major ER chaperone BiP and that ATF6α/β double kn...

  9. Divest yourself of a preconceived idea: transcription factor ATF6 is not a soluble protein!

    Science.gov (United States)

    Mori, Kazutoshi

    2010-05-01

    The unfolded protein response (UPR), an evolutionarily conserved transcriptional induction program that is coupled with intracellular signaling from the endoplasmic reticulum (ER) to the nucleus, is activated to cope with ER stress and to maintain the homeostasis of the ER. In 1996, we isolated a basic leucine zipper protein, which had been previously named activating transcription factor (ATF)6, as a candidate transcription factor responsible for the mammalian UPR. Subsequent analysis, however, was confounding. The problem was eventually tracked down to an unusual property of ATF6: rather than being a soluble nuclear protein, as expected for an active transcription factor, ATF6 was instead synthesized as a transmembrane protein embedded in the ER, which was activated by ER stress-induced proteolysis. ATF6 was thus unique: an ER stress sensor/transducer that is involved in all steps of the UPR, from the sensing step in the ER to the transcriptional activation step in the nucleus. PMID:20219975

  10. Piperonyl butoxide activates c-Jun and ATF-2 in the hepatocytes of mice

    Energy Technology Data Exchange (ETDEWEB)

    Muguruma, Masako; Moto, Mitsuyoshi; Mitsumori, Kunitoshi [Tokyo University of Agriculture and Technology, Laboratory of Veterinary Pathology, Faculty of Agriculture, Tokyo (Japan); Arai, Katsuhiko [Tokyo University of Agriculture and Technology, Department of Tissue Physiology, Faculty of Agriculture, Tokyo (Japan); Nishimura, Jihei; Dewa, Yasuaki [Tokyo University of Agriculture and Technology, Laboratory of Veterinary Pathology, Faculty of Agriculture, Tokyo (Japan); Gifu University, United Graduate School of Veterinary Sciences, Gifu (Japan)

    2008-10-15

    In order to clarify the possible mechanism of hepatocarcinogenesis induced by piperonyl butoxide, we attempted to identify the transcription factor activated by piperonyl butoxide in the male ICR mouse liver. Administration of 0.6% piperonyl butoxide for 24 h elevated the level of liver nuclear proteins that bind to an AP-1 consensus oligonucleotide, and these proteins demonstrated a supershift with the anti-c-Jun antibody. Additionally, immunoblot analysis revealed that piperonyl butoxide induced c-Jun phosphorylation within 8 h of administration, and phosphorylated ATF-2 was detected after 24 h of piperonyl butoxide treatment. Immunohistochemical analysis also demonstrated the presence of phosphorylated ATF-2 in the hepatocyte nuclei of mice fed with 0.6% piperonyl butoxide for 24 h. Furthermore, piperonyl butoxide induced ATF-2 phosphorylation in TLR-3, a mouse immortalized hepatocyte cell line. These results indicated that piperonyl butoxide activated c-Jun and ATF-2 in mouse hepatocytes during the early stage of hepatocarcinogenesis. (orig.)

  11. SAMS: The synchronization and monitoring system for ATF [Advanced Toroidal Facility] data acquisition

    International Nuclear Information System (INIS)

    SAMS performs much of the synchronization of the distributed data acquisition system for the Advanced Toroidal Facility (ATF). SAMS is responsible for propagating shot information and managing te data system directories and logical names. This paper describes how SAMS communicates with other processes, both within the VAX cluster that supports most of the ATF data acquisition and on VAXes that are connected to the cluster via DECnet. 3 refs

  12. ATF-2 immunoreactivity in post-mitotic and terminally differentiated human odontoblasts.

    Science.gov (United States)

    Keklikoglu, Nurullah; Akinci, Sevtap

    2015-09-01

    Activating transcription factor 2 (ATF-2/CRE-BP1; cAMP-responsive element binding protein 1) is a member of nuclear transcription factor activator protein-1 (AP-1) family. AP-1 regulates cellular processes including growth, proliferation, differentiation and apoptosis. However, biological relationship of cellular process to each member of the AP-1 family is not clear yet. The objective of the present study was to compare the ATF-2 immunoreactivity in the post-mitotic and terminally differentiated odontoblasts and in the pulpal fibroblasts which can be divided by mitosis when required. Fibroblasts at various stages of differentiation co-exist in the human dental pulp. ATF-2 was investigated immunohistochemically in 20 permanent human teeth. According to the findings obtained, the mean percentage of ATF-2 positive cells was 68.5 ± 19.2% in the odontoblasts and 22.8 ± 13.7% in the pulpal fibroblasts. The comparison of ATF-2 positivity revealed a statistically significant difference between odontoblasts and pulpal fibroblasts. These findings have suggested that ATF-2 is more associated with cell survival rather than cell proliferation, and revealed much of effectiveness in maintaining terminal differentiation than the various differentiation stages of the cells. PMID:25417007

  13. Development of Electronics for the ATF2 Interaction Point Region Beam Position Monitor

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Youngim; /Kyungpook Natl. U.; Heo, Ae-young; /Kyungpook Natl. U.; Kim, Eun-San; /Kyungpook Natl. U.; Boogert, Stewart; /Royal Holloway, U. of London; Honda, Yosuke; /KEK, Tsukuba; Tauchi, Toshiaki; /KEK, Tsukuba; Terunuma, Nobuhiro; /KEK, Tsukuba; May, Justin; /SLAC; McCormick, Douglas; /SLAC; Smith, Tonee; /SLAC

    2012-08-14

    Nanometer resolution beam position monitors have been developed to measure and control beam position stability at the interaction point region of ATF2. The position of the beam has to be measured to within a few nanometers at the interaction point. In order to achieve this performance, electronics for the low-Q IP-BPM was developed. Every component of the electronics have been simulated and checked on the bench and using the ATF2 beam. We will explain each component and define their working range. Then, we will show the performance of the electronics measured with beam signal. ATF2 is a final focus test beam line for ILC in the framework of the ATF international collaboration. The new beam line was constructed to extend the extraction line at ATF, KEK, Japan. The first goal of ATF2 is the acheiving of a 37 nm vertical beam size at focal point (IP). The second goal is to stabilize the beam at the focal point at a few nanometer level for a long period in order to ensure the high luminosity. To achieve these goals a high resolution IP-BPM is essential. In addition for feedback applications a low-Q system is desirable.

  14. Proceedings of the 2nd ATF international collaboration meeting

    International Nuclear Information System (INIS)

    Following the first one at SLAC in November 1996, the second ATF international collaboration meeting was held at KEK from June 12 and 13, 1997. In total 65 persons attended and 23 among them were from abroad as the first one held at SLAC November, 1996. While the main topic at the first meeting had been on the injection linac commissioning started in November 1995, this time its was on the damping ring which almost on schedule was put into operation in January 1997, after its 5 year long construction. Worldwide contributions, especially that of SLAC, were of vital importance in the design and construction of the ring. In the ring commissioning, however, ever more people from abroad have much enthusiastically taken part in various studies to achieve lower emittances. Thus it was the first task in the meeting to summarize the activities in these 6 months. Since a full system to measure the low emittances is to be completed in the shutdown of this summer, the other important task of the meeting for all attendants was to think very carefully about the work in the shutdown and study programs after it. (J.P.N.)

  15. Role of Disulfide Bridges Formed in the Luminal Domain of ATF6 in Sensing Endoplasmic Reticulum Stress▿

    OpenAIRE

    Nadanaka, Satomi; Okada, Tetsuya; Yoshida, Hiderou; MORI, Kazutoshi

    2006-01-01

    ATF6 is a membrane-bound transcription factor activated by proteolysis in response to endoplasmic reticulum (ER) stress to induce the transcription of ER chaperone genes. We show here that, owing to the presence of intra- and intermolecular disulfide bridges formed between the two conserved cysteine residues in the luminal domain, ATF6 occurs in unstressed ER in monomer, dimer, and oligomer forms. Disulfide-bonded ATF6 is reduced upon treatment of cells with not only the reducing reagent dith...

  16. Berberine, a natural isoquinoline alkaloid, induces NAG-1 and ATF3 expression in human colorectal cancer cells

    OpenAIRE

    Piyanuch, Rojsanga; Sukhthankar, Mugdha; Baek, Seung Joon

    2007-01-01

    Berberine is known to possess a wide variety of pharmacological activities, including pro-apoptotic activity. However, its molecular targets are not elucidated at present. NAG-1 and ATF3 are induced by several dietary compounds associated with pro-apoptotic activity. Berberine induces cell growth arrest, apoptosis, NAG-1, and ATF3 in human colorectal cancer cells. ATF3 induction by berberine is mediated in a p53-dependent manner, whereas NAG-1 induction by berberine is mediated by multiple si...

  17. Reconstruction of local emissivity profile from chord-integrated soft x-ray data in heliotron/torsatron plasmas by singular-value decomposition

    International Nuclear Information System (INIS)

    A reconstruction method for a local soft X-ray (SX) emissivity profile based on singular-value decomposition (SVD) was applied to the chord-integrated SX data obtained in the compact helical system (CHS) heliotron/torsatron. The numerical procedure for this method was simplified by introducing the data of equilibrium magnetic surfaces to analyze the experimental data efficiently. The applicability of the Akaide information criterion (AIC) was investigated for the determination of the optimal number of parameters characterizing a local emissivity profile. This method was applied to SX data for sawtoothing plasmas of the CHS. For these CHS data, the optimal number of parameters is determined from the spatial resolution of an SX detector array rather than the AIC. A characteristic feature of the off-axis or annular sawtooth crash was clearly derived with this technique. (author)

  18. Behaviour of the radiation of the suprathermal electrons at the Uragan-3M torsatron after rf heating off from ECE measurements

    International Nuclear Information System (INIS)

    The microwave radiometry is a well-known diagnostics to obtain the information on temporal evolution and radial profile of the electron temperature at U-3M torsatron plasma experiments. However, under low plasma density with this diagnostics we report on the large production of runaway electrons after RF heating pulse off. We notice a gradually increasing of the radiometer signal at the frequencies that match the second and third harmonics of electron cyclotron emission of the extraordinary mode. This effect could be explained with the existence of the ''runaway'' electrons in U-3M discharge. A phenomenological description of this process is presented, where the time evolution of the ECE radiation signal is compared to the electron density evolution

  19. Operational Experiences Tuning the ATF2 Final Focus Optics Towards Obtaining a 37nm Electron Beam IP Spot Size

    OpenAIRE

    White, G.; Seryi, A.; Woodley, M.; E. Marin; Kamiya, Y.; Bai, S.; Bolzon, B; Kubo, K.; Kuroda, S.; Okugi, T.; Tauchi, T.; Bambade, P.; Renier, Y.; Komamiya, S.; Oroku, M.

    2010-01-01

    The primary aim of the ATF2 research accelerator is to test a scaled version of the final focus optics planned for use in next-generation linear lepton colliders. ATF2 consists of a 1.3 GeV linac, damping ring providing low-emittance electron beams (

  20. THE FONT5 PROTOTYPE ILC INTRA-TRAIN FEEDBACK SYSTEM AT ATF2

    CERN Document Server

    Apsimon, R J; Burrows, P N; Christian, G B; Constance, B; Perry, C; Resta-Lopez, J

    2011-01-01

    We present the design and beam test results of a prototype beam-based digital feedback system for the Interaction Point of the International Linear Collider. A custom analogue front-end signal processor, FPGA-based digital signal processing boards, and kicker drive amplifier have been designed, built, deployed and tested with beam in the extraction line of the KEK Accelerator Test Facility (ATF2). The system was used to provide orbit correction to the train of bunches extracted from the ATF damping ring. The latency was measured to be approximately 140 ns.

  1. R and D status of the magnet system for ATF damping ring

    International Nuclear Information System (INIS)

    The ATF damping ring (DR) requires very strict conditions for the magnets system to realize a very low vertical normalized emittance less than 3x10-8 rm and a fast damping time. To obtain such a low emittance, the ATF-DR adopted a combined FOBO lattice and damping wigglers. Specifications of the magnet system have been almost fixed and some R and D magnets, which are a damping wiggler, a combined bending, quadrupoles and a sextupole magnet, have been manufactured and are waiting for precise field measurements. R and D status of these magnets are described. (author)

  2. Design of bunch compressing system with suppression of coherent synchrotron radiation for ATF upgrade

    Energy Technology Data Exchange (ETDEWEB)

    Jing, Yichao [Brookhaven National Lab. (BNL), Upton, NY (United States); Fedurin, Mikhail [Brookhaven National Lab. (BNL), Upton, NY (United States); Stratakis, Diktys [Brookhaven National Lab. (BNL), Upton, NY (United States)

    2015-05-03

    One of the operation modes for Accelerator Test Facility (ATF) upgrade is to provide high peak current, high quality electron beam for users. Such operation requires a bunch compressing system with a very large compression ratio. The CSR originating from the strong compressors generally could greatly degrade the quality of the electron beam. In this paper, we present our design for the entire bunch compressing system that will limit the effect of CSR on the e-beam’s quality. We discuss and detail the performance from the start to end simulation of such a compressor for ATF.

  3. The transcription factor ATF7 mediates lipopolysaccharide-induced epigenetic changes in macrophages involved in innate immunological memory.

    Science.gov (United States)

    Yoshida, Keisuke; Maekawa, Toshio; Zhu, Yujuan; Renard-Guillet, Claire; Chatton, Bruno; Inoue, Kentaro; Uchiyama, Takeru; Ishibashi, Ken-ichi; Yamada, Takuji; Ohno, Naohito; Shirahige, Katsuhiko; Okada-Hatakeyama, Mariko; Ishii, Shunsuke

    2015-10-01

    Immunological memory is thought to be mediated exclusively by lymphocytes. However, enhanced innate immune responses caused by a previous infection increase protection against reinfection, which suggests the presence of innate immunological memory. Here we identified an important role for the stress-response transcription factor ATF7 in innate immunological memory. ATF7 suppressed a group of genes encoding factors involved in innate immunity in macrophages by recruiting the histone H3K9 dimethyltransferase G9a. Treatment with lipopolysaccharide, which mimics bacterial infection, induced phosphorylation of ATF7 via the kinase p38, which led to the release of ATF7 from chromatin and a decrease in repressive histone H3K9me2 marks. A partially disrupted chromatin structure and increased basal expression of target genes were maintained for long periods, which enhanced resistance to pathogens. ATF7 might therefore be important in controlling memory in cells of the innate immune system. PMID:26322480

  4. CHAC1/MGC4504 is a novel proapoptotic component of the unfolded protein response, downstream of the ATF4-ATF3-CHOP cascade.

    Science.gov (United States)

    Mungrue, Imran N; Pagnon, Joanne; Kohannim, Omid; Gargalovic, Peter S; Lusis, Aldons J

    2009-01-01

    To understand pathways mediating the inflammatory responses of human aortic endothelial cells to oxidized phospholipids, we previously used a combination of genetics and genomics to model a coexpression network encompassing >1000 genes. CHAC1 (cation transport regulator-like protein 1), a novel gene regulated by ox-PAPC (oxidized 1-palmitoyl-2-arachidonyl-sn-3-glycero-phosphorylcholine), was identified in a co-regulated group of genes enriched for components of the ATF4 (activating transcription factor 4) arm of the unfolded protein response pathway. Herein, we characterize the role of CHAC1 and validate the network model. We first define the activation of CHAC1 mRNA by chemical unfolded protein response-inducers, but not other cell stressors. We then define activation of CHAC1 by the ATF4-ATF3-CHOP (C/EBP homologous protein), and not parallel XBP1 (X box-binding protein 1) or ATF6 pathways, using siRNA and/or overexpression plasmids. To examine the subset of genes downstream of CHAC1, we used expression microarray analysis to identify a list of 227 differentially regulated genes. We validated the activation of TNFRSF6B (tumor necrosis factor receptor superfamily, member 6b), a FASL decoy receptor, in cells treated with CHAC1 small interfering RNA. Finally, we showed that CHAC1 overexpression enhanced apoptosis, while CHAC1 small interfering RNA suppressed apoptosis, as determined by TUNEL, PARP (poly(ADP-ribose) polymerase) cleavage, and AIF (apoptosis-inducing factor) nuclear translocation. PMID:19109178

  5. An FPGA-based Bunch-by-Bunch Position and Angle Feedback System at ATF2

    CERN Document Server

    Christian, G B; Bett, D R; Burrows, P N; Constance, B; Davis, M R; Gerbershagen, A; Perry, C; Resta Lopez, J

    2011-01-01

    The FONT5 intra-train feedback system serves as a prototype for an interaction point beam-based feedback system for future electron-positron colliders, such as the International Linear Collider. The system has been tested on the KEK Accelerator Test Facility (ATF) and is deployed to stabilise the beam orbit at the ATF2. The goal of this system is to correct both position and angle jitter in the vertical plane, providing stability of ~1 micron at the entrance to the ATF2 final-focus system. The system comprises three stripline beam position monitors (BPMs) and two stripline kickers, custom low-latency analogue front-end BPM processors, a custom FPGA-based digital processing board with fast ADCs, and custom kicker-drive amplifiers. An overview of the hardware, and the latest results from beam tests at ATF2, will be presented. The total latency of the system with coupled position and angle feedback loops operating simultaneously was measured to be approximately 140 ns. The greatest degree of correction observed ...

  6. Tumor suppressor BTG1 promotes PRMT1-mediated ATF4 function in response to cellular stress

    Science.gov (United States)

    Tijchon, Esther; van Ingen Schenau, Dorette; van Emst, Liesbeth; Levers, Marloes; Palit, Sander A.L.; Rodenbach, Caroline; Poelmans, Geert; Hoogerbrugge, Peter M.; Shan, Jixiu; Kilberg, Michael S.; Scheijen, Blanca; van Leeuwen, Frank N.

    2016-01-01

    Cancer cells are frequently exposed to physiological stress conditions such as hypoxia and nutrient limitation. Escape from stress-induced apoptosis is one of the mechanisms used by malignant cells to survive unfavorable conditions. B-cell Translocation Gene 1 (BTG1) is a tumor suppressor that is frequently deleted in acute lymphoblastic leukemia and recurrently mutated in diffuse large B cell lymphoma. Moreover, low BTG1 expression levels have been linked to poor outcome in several solid tumors. How loss of BTG1 function contributes to tumor progression is not well understood. Here, using Btg1 knockout mice, we demonstrate that loss of Btg1 provides a survival advantage to primary mouse embryonic fibroblasts (MEFs) under stress conditions. This pro-survival effect involves regulation of Activating Transcription Factor 4 (ATF4), a key mediator of cellular stress responses. We show that BTG1 interacts with ATF4 and positively modulates its activity by recruiting the protein arginine methyl transferase PRMT1 to methylate ATF4 on arginine residue 239. We further extend these findings to B-cell progenitors, by showing that loss of Btg1 expression enhances stress adaptation of mouse bone marrow-derived B cell progenitors. In conclusion, we have identified the BTG1/PRMT1 complex as a new modifier of ATF4 mediated stress responses. PMID:26657730

  7. The transcription factor ATF3 is upregulated during chondrocyte differentiation and represses cyclin D1 and A gene transcription

    Directory of Open Access Journals (Sweden)

    James Claudine G

    2006-09-01

    Full Text Available Abstract Background Coordinated chondrocyte proliferation and differentiation are required for normal endochondral bone growth. Transcription factors binding to the cyclicAMP response element (CRE are known to regulate these processes. One member of this family, Activating Tanscription Factor 3 (ATF3, is expressed during skeletogenesis and acts as a transcriptional repressor, but the function of this protein in chondrogenesis is unknown. Results Here we demonstrate that Atf3 mRNA levels increase during mouse chondrocyte differentiation in vitro and in vivo. In addition, Atf3 mRNA levels are increased in response to cytochalasin D treatment, an inducer of chondrocyte maturation. This is accompanied by increased Atf3 promoter activity in cytochalasin D-treated chondrocytes. We had shown earlier that transcription of the cell cycle genes cyclin D1 and cyclin A in chondrocytes is dependent on CREs. Here we demonstrate that overexpression of ATF3 in primary mouse chondrocytes results in reduced transcription of both genes, as well as decreased activity of a CRE reporter plasmid. Repression of cyclin A transcription by ATF3 required the CRE in the cyclin A promoter. In parallel, ATF3 overexpression reduces the activity of a SOX9-dependent promoter and increases the activity of a RUNX2-dependent promoter. Conclusion Our data suggest that transcriptional induction of the Atf3 gene in maturing chondrocytes results in down-regulation of cyclin D1 and cyclin A expression as well as activation of RUNX2-dependent transcription. Therefore, ATF3 induction appears to facilitate cell cycle exit and terminal differentiation of chondrocytes.

  8. ATF3 upregulation in glia during Wallerian degeneration: differential expression in peripheral nerves and CNS white matter

    Directory of Open Access Journals (Sweden)

    Coffin Robert S

    2004-03-01

    Full Text Available Abstract Background Many changes in gene expression occur in distal stumps of injured nerves but the transcriptional control of these events is poorly understood. We have examined the expression of the transcription factors ATF3 and c-Jun by non-neuronal cells during Wallerian degeneration following injury to sciatic nerves, dorsal roots and optic nerves of rats and mice, using immunohistochemistry and in situ hybridization. Results Following sciatic nerve injury – transection or transection and reanastomosis – ATF3 was strongly upregulated by endoneurial, but not perineurial cells, of the distal stumps of the nerves by 1 day post operation (dpo and remained strongly expressed in the endoneurium at 30 dpo when axonal regeneration was prevented. Most ATF3+ cells were immunoreactive for the Schwann cell marker, S100. When the nerve was transected and reanastomosed, allowing regeneration of axons, most ATF3 expression had been downregulated by 30 dpo. ATF3 expression was weaker in the proximal stumps of the injured nerves than in the distal stumps and present in fewer cells at all times after injury. ATF3 was upregulated by endoneurial cells in the distal stumps of injured neonatal rat sciatic nerves, but more weakly than in adult animals. ATF3 expression in transected sciatic nerves of mice was similar to that in rats. Following dorsal root injury in adult rats, ATF3 was upregulated in the part of the root between the lesion and the spinal cord (containing Schwann cells, beginning at 1 dpo, but not in the dorsal root entry zone or in the degenerating dorsal column of the spinal cord. Following optic nerve crush in adult rats, ATF3 was found in some cells at the injury site and small numbers of cells within the optic nerve displayed weak immunoreactivity. The pattern of expression of c-Jun in all types of nerve injury was similar to that of ATF3. Conclusion These findings raise the possibility that ATF3/c-Jun heterodimers may play a role in

  9. ATF3 Mediates Anti-Cancer Activity of Trans-10, cis-12-Conjugated Linoleic Acid in Human Colon Cancer Cells

    OpenAIRE

    Kim, Kui-Jin; Lee, Jihye; Park, Yeonhwa; Lee, Seong-Ho

    2015-01-01

    Conjugated linoleic acids (CLA) are a family of isomers of linoleic acid. CLA increases growth arrest and apoptosis of human colorectal cancer cells through an isomer-specific manner. ATF3 belongs to the ATF/CREB family of transcription factors and is associated with apoptosis in colorectal cancer. The present study was performed to investigate the molecular mechanism by which t10, c12-CLA stimulates ATF3 expression and apoptosis in human colorectal cancer cells. t10, c12-CLA increased an apo...

  10. ATF4 mediation of NF1 functions in osteoblast reveals a nutritional basis for congenital skeletal dysplasiae

    OpenAIRE

    Elefteriou, Florent; Benson, M. Douglas; Sowa, Hideaki; Starbuck, Michael; Liu, Xiuyun; Ron, David; Parada, Luis F.; Karsenty, Gerard

    2006-01-01

    The transcription factor ATF4 enhances bone formation by favoring amino acid import and collagen synthesis in osteoblasts, a function requiring its phosphorylation by RSK2, the kinase inactivated in Coffin-Lowry Syndrome. Here, we show that in contrast, RSK2 activity, ATF4-dependent collagen synthesis, and bone formation are increased in mice lacking neurofibromin in osteoblasts (Nf1ob−/− mice). Independently of RSK2, ATF4 phosphorylation by PKA is enhanced in Nf1ob−/− mice, thereby increasin...

  11. Activating transcription factor-3 (ATF3) functions as a tumor suppressor in colon cancer and is up-regulated upon heat-shock protein 90 (Hsp90) inhibition

    International Nuclear Information System (INIS)

    Activating transcription factor-3 (ATF3) is involved in the complex process of cellular stress response. However, its exact role in cancer is discussed controversially because both tumor suppressive and oncogenic effects have been described. Here we followed-up on our previous observation that inhibition of Hsp90 may increase ATF3 expression and sought to determine the role of ATF3 in colon cancer. Regulation of ATF3 was determined in cancer cells using signaling inhibitors and a heat-shock protein-90 (Hsp90) antagonist. Human HCT116 cancer cells were stably transfected with an ATF3-shRNA or a luciferase-shRNA expression plasmid and alterations in cell motility were assessed in migration assays. The impact of ATF3 down-regulation on cancer growth and metastasis were investigated in a subcutaneous tumor model, a model of hepatic tumor growth and in a model of peritoneal carcinomatosis. Human colon cancer tissues were analyzed for ATF3 expression. The results show that therapeutic Hsp90 inhibition substantially up-regulates the expression of ATF3 in various cancer cells, including colon, gastric and pancreatic cancer. This effect was evident both in vitro and in vivo. RNAi mediated knock-down of ATF3 in HCT116 colon cancer cells significantly increased cancer cell migration in vitro. Moreover, in xenogenic mouse models, ATF3 knock-down promoted subcutaneous tumor growth and hepatic metastasis, as well as peritoneal carcinomatosis. Importantly, ATF3 expression was lower in human colon cancer specimens, as compared to corresponding normal surrounding tissues, suggesting that ATF3 may represent a down-regulated tumor suppressor in colon cancer. In conclusion, ATF3 down-regulation in colon cancer promotes tumor growth and metastasis. Considering that blocking Hsp90 induces ATF3 expression, Hsp90 inhibition may represent a valid strategy to treat metastatic colon cancer by up-regulating this anti-metastatic transcription factor

  12. On the characteristic difference of neoclassical bootstrap current and its effects on MHD equilibria between CHS heliotron/torsatron and CHS-qa quasi-axisymmetric stellarator

    International Nuclear Information System (INIS)

    The characteristic difference of neoclassical bootstrap current and its effects on MHD equilibria are described for the CHS heliotron/torsatron and the CHS-qa quasi-axisymmetric stellarator. The direction of bootstrap current strongly depends on collisionality in CHS, whereas it does not in CHS-qa because of quasi-axisymmetry. In the CHS configuration, it appears that enhanced bumpy (B01) and sideband components of helical ripple (B11) play an important role in reducing the magnetic geometrical factor, which is a key factor in evaluating the value of bootstrap current, and determining its polarity. The bootstrap current in CHS-qa is theoretically predicted to be larger than that in CHS and produces significant effects on the resulting rotational transform and magnetic shear. In the finite β plasmas, the magnetic well becomes deeper in both CHS and CHS-qa and its region is expanded in CHS. The existence of co-flowing bootstrap current makes the magnetic well shallow in comparison with that in currentless equilibrium. (author)

  13. Analysis of Turn-by-Turn Orbit Data and Dynamic Aperture Considerations for the ATF Damping Ring

    CERN Document Server

    Schmidt, F; Hayano, H; Kubo, K; Terunuma, N; Urakawa, J

    1999-01-01

    We describe an attempt to deduce the tune shift with amplitude and resonance driving terms for the ATF Damping Ring from turn-by-turn orbit data, and to compare measurement results with tracking simulations. Our analysis reveals a significant tune ripple, but no evidence for low-order nonlinearities. We thus conjecture that the ATF dynamic aperture is caused by a conspiracy of tune ripple and as yet unidentified higher-order nonlinear fields.

  14. Parameters Optimization for a Novel Vacuum Laser Acceleration Test at BNL-ATF

    CERN Document Server

    Shao, Lei; Zhou, Feng

    2005-01-01

    This paper presents a new VLA theory model which has revealed that the injection electrons with low energy and small incident angle relative to the laser beam are captured and significantly accelerated in a strong laser field. For the further step for verifying the novel-VLA mechanics, we propose to use the BNL-ATF Terawatt CO2 laser and a high-brightness electron beam to carry out a proof-of-principle beam experiment. Experiment setup including the laser injection optics and electron extraction system and beam diagnostics is presented. Extensive optimized simulation results with ATF practical parameters are also presented, which shows that even when the laser intensity is not very high, the net energy gain still can be seen obviously. This could be prospect for a new revolution of vacuum laser acceleration.

  15. 1.54 GeV ATF damping ring injector linear accelerator

    International Nuclear Information System (INIS)

    The Accelerator Test Facility (ATF) is under construction in the TRISTAN Assembly Hall to produce multi-bunch of electrons with ultra-low beam emittance. The ATF consists of a 1.54 GeV linac, beam transport line, 1.54 GeV damping ring, bunch compressor, final focus system and positron target test-stand. The 1.54 GeV linac consists of a low energy injector linac, accelerating linac and energy compensation system. The accelerating gradient of 33 MeV/m is produced at 200 MW input power. The 1.54 GeV linac accelerates 20 bunches of electrons with bunch separation of 2.8 ns. The accelerating structures, beam monitors and Q-magnets are aligned within ± 100 μm by active alignment system. The energy spectrum of multi-bunch is compressed to ± 0.16% by the energy compensation system. (author)

  16. Button-type beam-position monitor for the ATF damping ring

    International Nuclear Information System (INIS)

    Button-type beam-position monitors (BPMs) were fabricated for the ATF damping ring. The BPM was designed to achieve a position resolution of less than 5 μm; fabrication of the first 40 BPMs has been completed. For this BPM, a beam test was carried out at the 80-MeV injector part of the ATF LINAC. All of the bunch signals in the multi-bunch beam were clearly observed without any discharge. A calibration of the BPMs was also performed in order to check their offset from the electrical center to the mechanical center as well as their position detection sensitivity. The result shows good uniformity in position detection. (author)

  17. 1.54 GeV ATF injector linac for JLC

    International Nuclear Information System (INIS)

    The Accelerator Test Facility (ATF) is under construction in the TRISTAN Assembly Hall to produce multi-bunch electrons with vertical emittance of 3x10-8 mrad. The ATF consists of a 1.54 GeV injector linac, beam transport line, 1.54 GeV damping ring, bunch compressor, final focus system and positron target test-stand. The injector linac consists of a 80 MeV pre-injector linac, accelerating linac and energy compensation system. The accelerating gradient of 33 MeV/m is produced at 200 MW input power. The linac accelerates 20 bunches of electrons with bunch separation of 2.8 ns. The accelerating structures, beam monitors and Q-magnets are aligned within ±50 μm by active alignment system. The energy spectrum of multi-bunch is compressed to ±0.16% by the energy compensation system. (author)

  18. The first terawatt picosecond CO2 laser for advanced accelerator studies at the Brookhaven ATF

    International Nuclear Information System (INIS)

    The first terawatt picosecond C02 laser system is under development at the Brookhaven Accelerator Test Facility. Presently operational 1 Joule 100-ps ATF laser will be upgraded with a 10 atm amplifier capable of delivery ∼ 15 Joules of laser energy in a 3 ps pulse. We describe the design of the x-ray preionized 10 atm amplifier of a 10 liter active volume energized by a 1 MV, 200 kA transverse electric discharge. The amplifier, equipped with internal optics, permits the accommodation of a regenerative stage and a multi-pass booster in a relatively compact single discharge volume. The ATF terawatt C02 laser shall become operational in 1997 to serve for laser acceleration, x-ray generation and other strong-field physics experiments

  19. Quantitative phase retrieval with picosecond X-ray pulses from the ATF Inverse Compton Scattering source

    International Nuclear Information System (INIS)

    Quantitative phase retrieval is experimentally demonstrated using the Inverse Compton Scattering X-ray source available at the Accelerator Test Facility (ATF) in the Brookhaven National Laboratory. Phase-contrast images are collected using in-line geometry, with a single X-ray pulse of approximate duration of one picosecond. The projected thickness of homogeneous samples of various polymers is recovered quantitatively from the time-averaged intensity of transmitted X-rays. The data are in good agreement with the expectations showing that ATF Inverse Compton Scattering source is suitable for performing phase-sensitive quantitative X-ray imaging on the picosecond scale. The method shows promise for quantitative imaging of fast dynamic phenomena.

  20. Regression/eradication of gliomas in mice by a systemically-deliverable ATF5 dominant-negative peptide.

    Science.gov (United States)

    Cates, Charles C; Arias, Angelo D; Nakayama Wong, Lynn S; Lamé, Michael W; Sidorov, Maxim; Cayanan, Geraldine; Rowland, Douglas J; Fung, Jennifer; Karpel-Massler, Georg; Siegelin, Markus D; Greene, Lloyd A; Angelastro, James M

    2016-03-15

    Malignant gliomas have poor prognosis and urgently require new therapies. Activating Transcription Factor 5 (ATF5) is highly expressed in gliomas, and interference with its expression/function precipitates targeted glioma cell apoptosis in vitro and in vivo. We designed a novel deliverable truncated-dominant-negative (d/n) form of ATF5 fused to a cell-penetrating domain (Pen-d/n-ATF5-RP) that can be intraperitoneally/subcutaneously administered to mice harboring malignant gliomas generated; (1) by PDGF-B/sh-p53 retroviral transformation of endogenous neural progenitor cells; and (2) by human U87-MG xenografts. In vitro Pen-d/n-ATF5-RP entered into glioma cells and triggered massive apoptosis. In vivo, subcutaneously-administered Pen-d/n-ATF5-RP passed the blood brain barrier, entered normal brain and tumor cells, and then caused rapid selective tumor cell death. MRI verified elimination of retrovirus-induced gliomas within 8-21 days. Histopathology revealed growth-suppression of intracerebral human U87-MG cells xenografts. For endogenous PDGF-B gliomas, there was no recurrence or mortality at 6-12 months versus 66% mortality in controls at 6 months. Necropsy and liver-kidney blood enzyme analysis revealed no adverse effects on brain or other tissues. Our findings thus identify Pen-d/n-ATF5-RP as a potential therapy for malignant gliomas. PMID:26863637

  1. ATF4 mediation of NF1 functions in osteoblast reveals a nutritional basis for congenital skeletal dysplasiae.

    Science.gov (United States)

    Elefteriou, Florent; Benson, M Douglas; Sowa, Hideaki; Starbuck, Michael; Liu, Xiuyun; Ron, David; Parada, Luis F; Karsenty, Gerard

    2006-12-01

    The transcription factor ATF4 enhances bone formation by favoring amino acid import and collagen synthesis in osteoblasts, a function requiring its phosphorylation by RSK2, the kinase inactivated in Coffin-Lowry Syndrome. Here, we show that in contrast, RSK2 activity, ATF4-dependent collagen synthesis, and bone formation are increased in mice lacking neurofibromin in osteoblasts (Nf1(ob)(-/-) mice). Independently of RSK2, ATF4 phosphorylation by PKA is enhanced in Nf1(ob)(-/-) mice, thereby increasing Rankl expression, osteoclast differentiation, and bone resorption. In agreement with ATF4 function in amino acid transport, a low-protein diet decreased bone protein synthesis and normalized bone formation and bone mass in Nf1(ob)(-/-) mice without affecting other organ weight, while a high-protein diet overcame Atf4(-/-) and Rsk2(-/-) mice developmental defects, perinatal lethality, and low bone mass. By showing that ATF4-dependent skeletal dysplasiae are treatable by dietary manipulations, this study reveals a molecular connection between nutrition and skeletal development. PMID:17141628

  2. Signaling dynamics of palmitate-induced ER stress responses mediated by ATF4 in HepG2 cells

    Directory of Open Access Journals (Sweden)

    Cho Hyunju

    2013-01-01

    Full Text Available Abstract Background Palmitic acid, the most common saturated free fatty acid, has been implicated in ER (endoplasmic reticulum stress-mediated apoptosis. This lipoapotosis is dependent, in part, on the upregulation of the activating transcription factor-4 (ATF4. To better understand the mechanisms by which palmitate upregulates the expression level of ATF4, we integrated literature information on palmitate-induced ER stress signaling into a discrete dynamic model. The model provides an in silico framework that enables simulations and predictions. The model predictions were confirmed through further experiments in human hepatocellular carcinoma (HepG2 cells and the results were used to update the model and our current understanding of the signaling induced by palmitate. Results The three key things from the in silico simulation and experimental results are: 1 palmitate induces different signaling pathways (PKR (double-stranded RNA-activated protein kinase, PERK (PKR-like ER kinase, PKA (cyclic AMP (cAMP-dependent protein kinase A in a time dependent-manner, 2 both ATF4 and CREB1 (cAMP-responsive element-binding protein 1 interact with the Atf4 promoter to contribute to a prolonged accumulation of ATF4, and 3 CREB1 is involved in ER-stress induced apoptosis upon palmitate treatment, by regulating ATF4 expression and possibly Ca2+ dependent-CaM (calmodulin signaling pathway. Conclusion The in silico model helped to delineate the essential signaling pathways in palmitate-mediated apoptosis.

  3. Role of activated transcription factor 4 (ATF4) in learning and memory

    OpenAIRE

    Pasini

    2011-01-01

    The aim of this study is to understand the role of Activated Transcription Factor 4 (ATF4) in the processes of learning and memory. The topic of learning and memory has always aroused great interest from time immemorial and although a lot of researches have been focused on this subject for a long time, many mechanisms have not yet been fully understood. Identifying the players and the mechanisms involved in learning and memory is of utmost importance because deficits in these cognitive fu...

  4. Detection of Ground Motion effects on the beam trajectory at ATF2

    CERN Document Server

    Renier, Y; Tomas, R; Schulte, D

    2012-01-01

    The ATF2 experiment is currently demonstrating the feasibility of the beam delivery system for the future linear collider. The orbit feedback is very critical to obtain the nanometer vertical beam size at the interaction point and in the case of CLIC, ground motion effects on the beam must be corrected. In this respect, as a proof of principle of a ground motion feed forward, the ground motion effects on the beam trajectory are extracted from the beam position monitor readings.

  5. Farnesol activates the intrinsic pathway of apoptosis and the ATF4-ATF3-CHOP cascade of ER stress in human T lymphoblastic leukemia Molt4 cells.

    Science.gov (United States)

    Joo, Joung Hyuck; Ueda, Eiichiro; Bortner, Carl D; Yang, Xiao-Ping; Liao, Grace; Jetten, Anton M

    2015-10-01

    In this study, we demonstrate that treatment of T lymphoblastic leukemic Molt4 cells with farnesol activates the apoptosome via the intrinsic pathway of apoptosis. This induction was associated with changes in the level of intracellular potassium and calcium, the dissipation of the mitochondrial and plasma membrane potential, release of cytochrome c, activation of several caspases, and PARP cleavage. The induction of apoptosis by farnesol was inhibited by the addition of the pan-caspase inhibitor Z-VAD-fmk and by the exogenous expression of the anti-apoptotic protein Bcl2. Analysis of the gene expression profiles by microarray analysis revealed that farnesol increased the expression of several genes related to the unfolded protein response (UPR), including CHOP and CHAC1. This induction was associated with the activation of the PERK-eIF2α-ATF3/4 cascade, but not the XBP-1 branch of the UPR. Although farnesol induced activation of the ERK1/2, p38, and JNK pathways, inhibition of these MAPKs had little effect on farnesol-induced apoptosis or the induction of UPR-related genes. Our data indicate that the induction of apoptosis in leukemic cells by farnesol is mediated through a pathway that involves activation of the apoptosome via the intrinsic pathway and induction of the PERK-eIF2α-ATF3/4 cascade in a manner that is independent of the farnesol-induced activation of MAPKs. PMID:26275811

  6. Systems analysis of ATF3 in stress response and cancer reveals opposing effects on pro-apoptotic genes in p53 pathway.

    Directory of Open Access Journals (Sweden)

    Yujiro Tanaka

    Full Text Available Stress-inducible transcription factors play a pivotal role in cellular adaptation to environment to maintain homeostasis and integrity of the genome. Activating transcription factor 3 (ATF3 is induced by a variety of stress and inflammatory conditions and is over-expressed in many kinds of cancer cells. However, molecular mechanisms underlying pleiotropic functions of ATF3 have remained elusive. Here we employed systems analysis to identify genome-wide targets of ATF3 that is either induced by an alkylating agent methyl methanesulfonate (MMS or over-expressed in a prostate tumour cell line LNCaP. We show that stress-induced and cancer-associated ATF3 is recruited to 5,984 and 1,423 targets, respectively, in the human genome, 89% of which are common. Notably, ATF3 targets are highly enriched for not only ATF/CRE motifs but also binding sites of several other stress-inducible transcription factors indicating an extensive network of stress response factors in transcriptional regulation of target genes. Further analysis of effects of ATF3 knockdown on these targets revealed that stress-induced ATF3 regulates genes in metabolic pathways, cell cycle, apoptosis, cell adhesion, and signalling including insulin, p53, Wnt, and VEGF pathways. Cancer-associated ATF3 is involved in regulation of distinct sets of genes in processes such as calcium signalling, Wnt, p53 and diabetes pathways. Notably, stress-induced ATF3 binds to 40% of p53 targets and activates pro-apoptotic genes such as TNFRSF10B/DR5 and BBC3/PUMA. Cancer-associated ATF3, by contrast, represses these pro-apoptotic genes in addition to CDKN1A/p21. Taken together, our data reveal an extensive network of stress-inducible transcription factors and demonstrate that ATF3 has opposing, cell context-dependent effects on p53 target genes in DNA damage response and cancer development.

  7. Intranasal administration of aTf protects and repairs the neonatal white matter after a cerebral hypoxic-ischemic event.

    Science.gov (United States)

    Guardia Clausi, Mariano; Paez, Pablo M; Campagnoni, Anthony T; Pasquini, Laura A; Pasquini, Juana M

    2012-10-01

    Our previous studies showed that the intracerebral injection of apotransferrin (aTf) attenuates white matter damage and accelerates the remyelination process in a neonatal rat model of cerebral hypoxia-ischemia (HI) injury. However, the intracerebral injection of aTf might not be practical for clinical treatments. Therefore, the development of less invasive techniques capable of delivering aTf to the central nervous system would clearly aid in its effective clinical use. In this work, we have determined whether intranasal (iN) administration of human aTf provides neuroprotection to the neonatal mouse brain following a cerebral hypoxic-ischemic event. Apotransferrin was infused into the naris of neonatal mice and the HI insult was induced by right common carotid artery ligation followed by exposure to low oxygen concentration. Our results showed that aTf was successfully delivered into the neonatal HI brain and detected in the olfactory bulb, forebrain and posterior brain 30 min after inhalation. This treatment successfully reduced white matter damage, neuronal loss and astrogliosis in different brain regions and enhanced the proliferation and survival of oligodendroglial progenitor cells (OPCs) in the subventricular zone and corpus callosum (CC). Additionally, using an in vitro hypoxic model, we demonstrated that aTf prevents oligodendrocyte progenitor cell death by promoting their differentiation. In summary, these data suggest that iN administration of aTf has the potential to be used for clinical treatment to protect myelin and to induce remyelination in demyelinating hypoxic-ischemic events in the neonatal brain. PMID:22736466

  8. Binding of the transcription factor Atf1 to promoters serves as a barrier to phase nucleosome arrays and avoid cryptic transcription

    Science.gov (United States)

    García, Patricia; Paulo, Esther; Gao, Jun; Wahls, Wayne P.; Ayté, José; Lowy, Ernesto; Hidalgo, Elena

    2014-01-01

    Schizosaccharomyces pombe displays a large transcriptional response common to several stress conditions, regulated primarily by the transcription factor Atf1. Atf1-dependent promoters contain especially broad nucleosome depleted regions (NDRs) prior to stress imposition. We show here that basal binding of Atf1 to these promoters competes with histones to create wider NDRs at stress genes. Moreover, deletion of atf1 results in nucleosome disorganization specifically at stress coding regions and derepresses antisense transcription. Our data indicate that the transcription factor binding to promoters acts as an effective barrier to fix the +1 nucleosome and phase downstream nucleosome arrays to prevent cryptic transcription. PMID:25122751

  9. Phosphorylation-Independent Regulation of Atf1-Promoted Meiotic Recombination by Stress-Activated, p38 Kinase Spc1 of Fission Yeast

    Science.gov (United States)

    Gao, Jun; Davidson, Mari K.; Wahls, Wayne P.

    2009-01-01

    Background Stress-activated protein kinases regulate multiple cellular responses to a wide variety of intracellular and extracellular conditions. The conserved, multifunctional, ATF/CREB protein Atf1 (Mts1, Gad7) of fission yeast binds to CRE-like (M26) DNA sites. Atf1 is phosphorylated by the conserved, p38-family kinase Spc1 (Sty1, Phh1) and is required for many Spc1-dependent stress responses, efficient sexual differentiation, and activation of Rec12 (Spo11)-dependent meiotic recombination hotspots like ade6-M26. Methodology/Principal Findings We sought to define mechanisms by which Spc1 regulates Atf1 function at the ade6-M26 hotspot. The Spc1 kinase was essential for hotspot activity, but dispensable for basal recombination. Unexpectedly, a protein lacking all eleven MAPK phospho-acceptor sites and detectable phosphorylation (Atf1-11M) was fully proficient for hotspot recombination. Furthermore, tethering of Atf1 to ade6 in the chromosome by a heterologous DNA binding domain bypassed the requirement for Spc1 in promoting recombination. Conclusions/Significance The Spc1 protein kinase regulates the pathway of Atf1-promoted recombination at or before the point where Atf1 binds to chromosomes, and this pathway regulation is independent of the phosphorylation status of Atf1. Since basal recombination is Spc1-independent, the principal function of the Spc1 kinase in meiotic recombination is to correctly position Atf1-promoted recombination at hotspots along chromosomes. We also propose new hypotheses on regulatory mechanisms for shared (e.g., DNA binding) and distinct (e.g., osmoregulatory vs. recombinogenic) activities of multifunctional, stress-activated protein Atf1. PMID:19436749

  10. Observations on Tune and $\\beta$ Functions at the ATF Damping Ring

    CERN Document Server

    Potier, J P; Terunuma, N; Mimashi, T; Kubo, K; Korhonen, T T; Hayano, H; Okugi, T; Kashiwagi, S; Zimmermann, Frank

    1998-01-01

    The precise measurement of the transverse tunes and their spectra is a basic demand in accelerator commissioning. It provides a simple access to lattice characterisation and validation of the optical model. This contribution describes recent improvements of the tune monitor system at the Accelerator Test Facility Damping Ring (ATF-DR) and the performance achieved. We present preliminary measurement results of beta functions, chromaticity, and dispersion on a relaxed optics with 90 degree horizontal phase advance per cell and compare these with the theoretical predictions.

  11. Achievement of ultra-low emittance beam in the ATF damping ring

    CERN Document Server

    Honda, Y; Araki, S; Bane, Karl Leopold Freitag; Brachmann, A; Frisch, J; Fukuda, M; Hasegawa, K; Hayano, H; Hendrickson, L; Higashi, Y; Higo, T; Hirano, K; Hirose, T; Iida, K; Imai, T; Inoue, Y; Karataev, P; Kubo, K; Kurihara, Y; Kuriki, M; Kuroda, R; Kuroda, S; Luo, X; Matsuda, M; McCormick, D; Muto, T; Nakajima, K; Nelson, J; Nomura, M; Ohashi, A; Okugi, T; Omori, T; Ross, M; Sakai, H; Sakai, I; Sasao, N; Smith, S; Suzuki, T; Takano, M; Takashi, N; Taniguchi, T; Terunuma, N; Toge, N; Turner, J; Urakawa, J; Vogel, V; Wolski, A; Woodley, M; Yamazaki, I; Yamazaki, Y; Yocky, J; Young, A; Zimmermann, Frank

    2003-01-01

    We report on the smallest vertical emittance achieved in single-bunch-mode operation of the ATF. The emittances were measured with a laser-wire beam-profile monitor installed in the damping ring. The bunch length and the momentum spread of the beam were also recorded under the same conditions. The smallest vertical rms emittance measured is 4 pm in the limit of zero current. It increases by a factor of 1.5 for a bunch intensity of 10^10 electrons. There are no discrepancies between the measured data and the calculations of intra-beam scattering.

  12. Pancreatic β-cells activate a JunB/ATF3-dependent survival pathway during inflammation

    DEFF Research Database (Denmark)

    Gurzov, E N; Barthson, J; Marhfour, I;

    2012-01-01

    Destruction of insulin-producing pancreatic β-cells by local autoimmune inflammation is a hallmark of type 1 diabetes. Histochemical analysis of pancreases from non-obese diabetic mice indicated activation of the transcription factor JunB/AP-1 (activator protein-1) after autoimmune infiltration of...... primary β-cells and human islet cells against pro-inflammatory mediators. These results were confirmed in genetically modified islets derived from Ubi-JunB transgenic mice. Our findings identify ATF3 as a novel downstream target of JunB in the survival mechanism of β-cells under inflammatory stress....

  13. Development and quality assessments of commercial heat production of ATF FeCrAl tubes

    Energy Technology Data Exchange (ETDEWEB)

    Yamamoto, Yukinori [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

    2015-09-01

    Development and quality assessment of the 2nd generation ATF FeCrAl tube production with commercial manufacturers were conducted. The manufacturing partners include Sophisticated Alloys, Inc. (SAI), Butler, PA for FeCrAl alloy casting via vacuum induction melting, Oak Ridge National Laboratory (ORNL) for extrusion process to prepare the master bars/tubes to be tube-drawn, and Rhenium Alloys, Inc. (RAI), North Ridgeville, OH, for tube-drawing process. The masters bars have also been provided to Los Alamos National Laboratory (LANL) who works with Century Tubes, Inc., (CTI), San Diego, CA, as parallel tube production effort under the current program.

  14. Tests of the FONT3 Linear Collider Intra-Train Beam Feedback System at the ATF

    International Nuclear Information System (INIS)

    We report preliminary results of beam tests of the FONT3 Linear Collider intra-train position feedback system prototype at the Accelerator Test Facility at KEK. The feedback system incorporates a novel beam position monitor (BPM) processor with a latency below 5 nanoseconds, and a kicker driver amplifier with similar low latency. The 56 nanosecond-long bunchtrain in the ATF extraction line was used to test the prototype BPM processor. The achieved latency will allow a demonstration of intra-train feedback on timescales relevant even for the CLIC Linear Collider design

  15. Fabrication Control Plan for ORNL RH-LOCA ATF Test Specimens to be Irradiated in the ATR

    Energy Technology Data Exchange (ETDEWEB)

    Kevin G. Field; Richard Howard; Michael Teague

    2014-06-01

    The purpose of this fabrication plan is (1) to summarize the design of a set of rodlets that will be fabricated and then irradiated in the Advanced Test Reactor (ATR) and (2) provide requirements for fabrication and acceptance criteria for inspections of the Light Water Reactor (LWR) – Accident Tolerant Fuels (ATF) rodlet components. The functional and operational (F&OR) requirements for the ATF program are identified in the ATF Test Plan. The scope of this document only covers fabrication and inspections of rodlet components detailed in drawings 604496 and 604497. It does not cover the assembly of these items to form a completed test irradiation assembly or the inspection of the final assembly, which will be included in a separate INL final test assembly specification/inspection document. The controls support the requirements that the test irradiations must be performed safely and that subsequent examinations must provide valid results.

  16. Latest Performance Results from the FONT5 Intra-train Beam Position and Angle Feedback System at ATF2

    CERN Document Server

    Christian, G B; Bett, D R; Blaskovic Kraljevic, N; Burrows, P N; Davis, M R; Gerbershagen, A; Perry, C; Constance, B; Resta-Lopez, J

    2012-01-01

    A prototype Interaction Point beam-based feedback system for future electron-positron colliders, such as the International Linear Collider, has been designed and tested on the extraction line of the KEK Accelerator Test Facility (ATF). The FONT5 intra-train feedback system aims to stabilize the beam orbit by correcting both the position and angle jitter in the vertical plane on bunch-tobunch time scales, providing micron-level stability at the entrance to the ATF2 final-focus system. The system comprises three stripline beam position monitors (BPMs) and two stripline kickers, custom low-latency analogue front-end BPM processors, a custom FPGA-based digital processing board with fast ADCs, and custom kickerdrive amplifiers. The latest results from beam tests at ATF2 will be presented, including the system latency and correction performance.

  17. TGRL Lipolysis Products Induce Stress Protein ATF3 via the TGF-β Receptor Pathway in Human Aortic Endothelial Cells

    OpenAIRE

    Eiselein, Larissa; Nyunt, Tun; Lamé, Michael W.; Ng, Kit F.; Wilson, Dennis W.; Rutledge, John C; Hnin H Aung

    2015-01-01

    Studies have suggested a link between the transforming growth factor beta 1 (TGF-β1) signaling cascade and the stress-inducible activating transcription factor 3 (ATF3). We have demonstrated that triglyceride-rich lipoproteins (TGRL) lipolysis products activate MAP kinase stress associated JNK/c-Jun pathways resulting in up-regulation of ATF3, pro-inflammatory genes and induction of apoptosis in human aortic endothelial cells. Here we demonstrate increased release of active TGF-β at 15 min, p...

  18. Performance of the FONT3 Fast Analogue Intra-Train Beam-Based Feedback System at ATF

    International Nuclear Information System (INIS)

    We report results of beam tests of the FONT3 intra-train position feedback system prototype at the Accelerator Test Facility (ATF) at KEK. The feedback system incorporates a novel beam position monitor (BPM) processor with latency below 5 nanoseconds, and a kicker driver amplifier with similar low latency. The 56 nanosecond-long bunchtrain in the ATF extraction line was used to test the prototype feedback system. The achieved latency of 23ns provides a demonstration of intra-train feedback on very short timescales relevant even for the CLIC Linear Collider design

  19. A mode-transforming polarization-rotatable launcher for the ATF [Advanced Toroidal Facility] fusion experiment

    International Nuclear Information System (INIS)

    The Advanced Toroidal Facility (ATF) fusion energy experiment at the Oak Ridge National Laboratory (ORNL) requires high-power microwaves for startup and plasma heating. Power from a gyrotron oscillator tube at 53.2 GHz will be used to ionize and heat the plasma by the electron cyclotron heating (ECH) process. The confining magnetic field of the device is either 0.95 or 1.9T. The gyrotron tube generates 200 kW in the TE02 mode, which is transported in an overmoded 6.35-cm-diam circular waveguide to the ATF vacuum vessel. The launcher consists of a mode-converting Vlasov section, which converts the nonpolarized TE02 wave into a linearly polarized narrow beam. The beam reflects off a tiled spherical reflector grating and is focused at the center of the plasma. The polarization can be rotated to optimize the absorption efficiency by rotating the grating in the spherical reflector. Overall system efficiency is kept high by making the twist reflector large enough to catch the Vlasov converter sidelobe power, which is partially due to mode conversion in the waveguide system. The launcher design and laboratory measurements are discussed. 3 refs., 3 figs

  20. Preliminary neutronic assessment for ATF (Accident Tolerant Fuel) based on iron alloy

    Energy Technology Data Exchange (ETDEWEB)

    Abe, Alfredo, E-mail: ayabe@ipen.br [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Carluccio, Thiago; Piovezan, Pamela [Centro Tecnologico da Marinha em Sao Paulo (CTMSP), SP (Brazil). Departamento de Reatores; Giovedi, Claudia; Martins, Marcelo R. [Universidade de Sao Paulo (POLI/USP), SP (Brazil). Lab. de Analise, Avaliacao e Gerenciamento de Risco

    2015-07-01

    After Fukushima Daiichi nuclear accident in 2011, the nuclear fuel performance under accident condition became a very important issue and currently different research and development program are in progress toward to reliability and withstand under accident condition. These initiatives are known as ATF (Accident Tolerant Fuel) R and D program, which many countries with different research institutes, fuel vendors and others are nowadays involved. Accident Tolerant Fuel (ATF) can be defined as enhanced fuel which can tolerate loss of active cooling system capability for a considerably longer time period and the fuel/cladding system can be maintained without significant degradation and can also improve the fuel performance during normal operations and transients, as well as design-basis accident (DBA) and beyond design-basis (BDBA) accident. Different materials have being proposed as fuel cladding candidates considering thermo-mechanical properties and lower reaction kinetic with steam and slower hydrogen production. The aim of this work is to perform a neutronic assessment for several cladding candidates based on iron alloy considering a standard PWR fuel rod (fuel pellet and dimension). The purpose of the assessment is to address different parameters that might contribute for possible neutronic reactivity gain in order to overcome the penalty due to increase of neutron absorption in the cladding materials. All the neutronic assessment is performed using MCNP, Monte Carlo code. (author)

  1. Limited ATF4 Expression in Degenerating Retinas with Ongoing ER Stress Promotes Photoreceptor Survival in a Mouse Model of Autosomal Dominant Retinitis Pigmentosa

    Science.gov (United States)

    Bhootada, Yogesh; Kotla, Pravallika; Zolotukhin, Sergei; Gorbatyuk, Oleg; Bebok, Zsuzsanna; Athar, Mohammad; Gorbatyuk, Marina

    2016-01-01

    T17M rhodopsin expression in rod photoreceptors leads to severe retinal degeneration and is associated with the activation of ER stress related Unfolded Protein Response (UPR) signaling. Here, we show a novel role of a UPR transcription factor, ATF4, in photoreceptor cellular pathology. We demonstrated a pro-death role for ATF4 overexpression during autosomal dominant retinitis pigmentosa (ADRP). Based on our results in ATF4 knockout mice and adeno-associated viral (AAV) delivery of ATF4 to the retina, we validated a novel therapeutic approach targeting ATF4 over the course of retinal degeneration. In T17M rhodopsin retinas, we observed ATF4 overexpression concomitantly with reduction of p62 and elevation of p53 levels. These molecular alterations, together with increased CHOP and caspase-3/7 activity, possibly contributed to the mechanism of photoreceptor cell loss. Conversely, ATF4 knockdown retarded retinal degeneration in 1-month-old T17M Rhodopsin mice and promoted photoreceptor survival, as measured by scotopic and photopic ERGs and photoreceptor nuclei row counts. Similarly, ATF4 knockdown also markedly delayed retinal degeneration in 3-month-old ADRP animals. This delay was accompanied by a dramatic decrease in UPR signaling, the launching of anti-oxidant defense, initiation of autophagy, and improvement of rhodopsin biosynthesis which together perhaps combat the cellular stress associated with T17M rhodopsin. Our data indicate that augmented ATF4 signals during retinal degeneration plays a cytotoxic role by triggering photoreceptor cell death. Future ADRP therapy regulating ATF4 expression can be developed to treat retinal degenerative disorders associated with activated UPR. PMID:27144303

  2. Construction and initial operation of the Advanced Toroidal Facility

    International Nuclear Information System (INIS)

    The Advanced Toroidal Facility (ATF) torsatron was designed on a physics basis for access to the second stability regime and on an engineering basis for independent fabrication of high-accuracy components. The actual construction, assembly, and initial operation of ATF are compared with the characteristics expected during the design of ATF. 31 refs., 19 figs., 2 tabs

  3. 28 CFR 16.106 - Exemption of the Bureau of Alcohol, Tobacco, Firearms, and Explosives (ATF)-Limited Access.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Exemption of the Bureau of Alcohol, Tobacco, Firearms, and Explosives (ATF)-Limited Access. 16.106 Section 16.106 Judicial Administration... interpreted to require more detail as to the identity of sources of the records in these systems,...

  4. MiR-214 regulates the function of osteoblast under simulated microgravity by targeting ATF4

    Science.gov (United States)

    Li, Yingxian; Wang, Xiaogang; Li, Qi; Lv, Ke; Wan, Yumin; Li, Yinghui; Bai, Yanqiang

    Background: MicroRNAs (miRNAs) are small fragments of single-stranded RNA containing 18-24 nucleotides, and are generated from endogenous transcripts. MicroRNAs function in post-transcriptional gene silencing by targeting the 3'-untranslated region (UTR) of mRNAs, resulting in translational repression. Growing evidence shows that microRNAs (miRNAs) regu-late various developmental and homeostatic events in vertebrates and invertebrates. Osteoblast differentiation is a key step in proper skeletal development and acquisition of bone mass; How-ever, the physiological role of non-coding small RNAs, especially miRNAs, in osteoblast dif-ferentiation remains elusive. Methods: To study the potential involvement of miRNAs in osteoblast differentiation under stimulated microgravity, we analyzed the expression of 20 bone relative miRNAs using real time PCR platform to find particularly miRNAs whose expression is altered during osteoblast differentiation. TargetScan, miRBase and Miranda were used to predict the target gene of candidate miRNA. To investigate whether ATF4 can be directly targeted by miR-214, we engineered luciferase reporters that have either the wild-type 3'UTRs of these genes, or the mutant UTRs with a 6 base pair (bp) deletion in the target sites. Lastly, to address the in vivo role of miR-214 in bone formation, tail suspension mice model was used to simulate the change of osteoblast function and bone loss. Results: Recent studies have sug-gested that miRNAs might play a role in osteoblast differentiation and bone formation. Here, we identify miR-214 in MC3T3-E1 cells, which is a primary mouse osteoblasts cell line, to promote osteoblast differentiation by repressing Activating Transcription Factor4 (ATF4) ex-pression at the posttranscriptional level. What is more, miR-214 was found to be transcribed in C2C12 cells during bone morphogenetic protein 2-induced (BMP2-induced) osteogenesis, and overexpression of miR-214 attenuated BMP2-induced osteoblastogenesis

  5. Emittance reconstruction from measured beam sizes in ATF2 and perspectives for ILC

    Science.gov (United States)

    Faus-Golfe, A.; Navarro, J.; Fuster Martinez, N.; Resta Lopez, J.; Giner Navarro, J.

    2016-05-01

    The projected emittance (2D) and the intrinsic emittance (4D) reconstruction method by using the beam size measurements at different locations is analyzed in order to study analytically the conditions of solvability of the systems of equations involved in this process. Some conditions are deduced and discussed, and general guidelines about the locations of the measurement stations have been obtained to avoid unphysical results. The special case of the multi-Optical Transition Radiation system (m-OTR), made of four measurement stations, in the Extraction Line (EXT) of Accelerator Test Facility 2 (ATF2) has been simulated in much detail and compared with measurements. Finally a feasibility study of a multi-station system for fast transverse beam size measurement, emittance reconstruction and coupling correction in the Ring to Main Linac (RTML) of International Linear Collider (ILC) Diagnostic sections of the RTML has been discussed in detail.

  6. Measured Thermal and Fast Neutron Fluence Rates for ATF-1 Holders During ATR Cycle 157D

    Energy Technology Data Exchange (ETDEWEB)

    Smith, Larry Don [Idaho National Lab. (INL), Idaho Falls, ID (United States); Miller, David Torbet [Idaho National Lab. (INL), Idaho Falls, ID (United States)

    2016-03-01

    This report contains the thermal (2200 m/s) and fast (E>1MeV) neutron fluence rate data for the ATF-1 holders located in core for ATR Cycle 157D which were measured by the Radiation Measurements Laboratory (RML) as requested by the Power Reactor Programs (ATR Experiments) Radiation Measurements Work Order. This report contains measurements of the fluence rates corresponding to the particular elevations relative to the 80-ft. core elevation. The data in this report consist of (1) a table of the ATR power history and distribution, (2) a hard copy listing of all thermal and fast neutron fluence rates, and (3) plots of both the thermal and fast neutron fluence rates. The fluence rates reported are for the average power levels given in the table of power history and distribution.

  7. Wake-field and space charge effects on high brightness beams calculations and measured results for the laser driven photoelectrons at BNL-ATF

    International Nuclear Information System (INIS)

    We discuss the formalism used to study the effects of the interactions between the highly charged particles and the fields in the accelerating structure, including space charge and wake fields. Some of our calculations and numerical simulation results obtained for the Brookhaven National Laboratory (BNL) high-brightness photoelectron beam at the Accelerator Test Facility (ATF) and the measured data at ATF are also included

  8. Aspergillus nidulans transcription factor AtfA interacts with the MAPK SakA to regulate general stress responses, development and spore functions

    OpenAIRE

    Lara-Rojas, Fernando; Sánchez, Olivia; Kawasaki, Laura; Aguirre, Jesús

    2011-01-01

    Fungi utilize a phosphorelay system coupled to a MAP kinase module for sensing and processing environmental signals. In Aspergillus nidulans, response regulator SskA transmits osmotic and oxidative stress signals to the stress MAPK (SAPK) SakA. Using a genetic approach together with GFP tagging and molecular bifluorescence we show that SakA and ATF/CREB transcription factor AtfA define a general stress-signalling pathway that plays differential roles in oxidative stress responses during growt...

  9. Intervention of electroacupuncture on spinal p38 MAPK/ATF-2/VR-1 pathway in treating inflammatory pain induced by CFA in rats

    OpenAIRE

    Fang, Jian-Qiao; Du, Jun-Ying; Liang, Yi; Fang, Jun-Fan

    2013-01-01

    Background Previous studies have demonstrated that p38 MAPK signal transduction pathway plays an important role in the development and maintenance of inflammatory pain. Electroacupuncture (EA) can suppress the inflammatory pain. However, the relationship between EA effect and p38 MAPK signal transduction pathway in inflammatory pain remains poorly understood. It is our hypothesis that p38 MAPK/ATF-2/VR-1 and/or p38 MAPK/ATF-2/COX-2 signal transduction pathway should be activated by inflammato...

  10. Beam oscillation and long-term movement research in KEK-ATF using the digital BPM system 'Libera'

    International Nuclear Information System (INIS)

    We are performing fast and high resolution beam position measurement with a digital BPM system 'Libera' manufactured by Instrumentation Technologies for the purpose of establishing submicron level beam stability needed in cutting-edge accelerators. We performed a beam test at KEK-ATF damping ring to verify performance in ultra low emittance beam position measurement, comparing its results to ones of a bench tests that was performed to verify performance of Libera in stand-alone. Furthermore we researched both beam oscillation and long-term beam movement in KEK-ATF. The results of the performance tests and the measurement of beam oscillation and long-term beam movement are reported in this paper. (author)

  11. ATF3 upregulation in glia during Wallerian degeneration: differential expression in peripheral nerves and CNS white matter

    OpenAIRE

    Coffin Robert S; Mason Matthew RJ; Hossain-Ibrahim Kismet; Hunt David; Lieberman AR; Winterbottom Julia; Anderson PN

    2004-01-01

    Abstract Background Many changes in gene expression occur in distal stumps of injured nerves but the transcriptional control of these events is poorly understood. We have examined the expression of the transcription factors ATF3 and c-Jun by non-neuronal cells during Wallerian degeneration following injury to sciatic nerves, dorsal roots and optic nerves of rats and mice, using immunohistochemistry and in situ hybridization. Results Following sciatic nerve injury – transection or transection ...

  12. Inhibin beta E is upregulated by drug-induced endoplasmic reticulum stress as a transcriptional target gene of ATF4

    International Nuclear Information System (INIS)

    Inhibins and activins are gonadal peptide hormones of the transforming growth factor-β super family with important functions in the reproductive system. By contrast, the recently identified inhibin βE subunit, primarily expressed in liver cells, appears to exert functions unrelated to the reproductive system. Previously shown downregulation of inhibin βE in hepatoma cells and anti-proliferative effects of ectopic inhibin βE overexpression indicated growth-regulatory effects of inhibin βE. We observed a selective re-expression of the inhibin βE subunit in HepG2 hepatoblastoma cells, MCF7 breast cancer cells, and HeLa cervical cancer cells under endoplasmic reticulum stress conditions induced by tunicamycin, thapsigargin, and nelfinavir. Analysis of XPB1 splicing and ATF4 activation revealed that inhibin βE re-expression was associated with induction of the endoplasmic reticulum stress reaction by these drugs. Transfection of an ATF4 expression plasmid specifically induced inhibin βE expression in HeLa cells and indicates inhibin βE as a hitherto unidentified target gene of ATF4, a key transcription factor of the endoplasmic reticulum stress response. Therefore, the inhibin βE subunit defines not only a new player but also a possible new marker for drug-induced endoplasmic reticulum stress. -- Highlights: ► Endoplasmic reticulum stress induces inhibin beta E expression. ► Inhibin beta E is regulated by the transcription factor ATF4. ► Inhibin beta E expression can be used as a marker for drug-induced ER stress.

  13. The Yeast ATF1 Acetyltransferase Efficiently Acetylates Insect Pheromone Alcohols: Implications for the Biological Production of Moth Pheromones.

    Science.gov (United States)

    Ding, Bao-Jian; Lager, Ida; Bansal, Sunil; Durrett, Timothy P; Stymne, Sten; Löfstedt, Christer

    2016-04-01

    Many moth pheromones are composed of mixtures of acetates of long-chain (≥10 carbon) fatty alcohols. Moth pheromone precursors such as fatty acids and fatty alcohols can be produced in yeast by the heterologous expression of genes involved in insect pheromone production. Acetyltransferases that subsequently catalyze the formation of acetates by transfer of the acetate unit from acetyl-CoA to a fatty alcohol have been postulated in pheromone biosynthesis. However, so far no fatty alcohol acetyltransferases responsible for the production of straight chain alkyl acetate pheromone components in insects have been identified. In search for a non-insect acetyltransferase alternative, we expressed a plant-derived diacylglycerol acetyltransferase (EaDAcT) (EC 2.3.1.20) cloned from the seed of the burning bush (Euonymus alatus) in a yeast system. EaDAcT transformed various fatty alcohol insect pheromone precursors into acetates but we also found high background acetylation activities. Only one enzyme in yeast was shown to be responsible for the majority of that background activity, the acetyltransferase ATF1 (EC 2.3.1.84). We further investigated the usefulness of ATF1 for the conversion of moth pheromone alcohols into acetates in comparison with Ea DAcT. Overexpression of ATF1 revealed that it was capable of acetylating these fatty alcohols with chain lengths from 10 to 18 carbons with up to 27- and 10-fold higher in vivo and in vitro efficiency, respectively, compared to Ea DAcT. The ATF1 enzyme thus has the potential to serve as the missing enzyme in the reconstruction of the biosynthetic pathway of insect acetate pheromones from precursor fatty acids in yeast. PMID:26801935

  14. Inhibin beta E is upregulated by drug-induced endoplasmic reticulum stress as a transcriptional target gene of ATF4

    Energy Technology Data Exchange (ETDEWEB)

    Brüning, Ansgar, E-mail: ansgar.bruening@med.uni-muenchen.de; Matsingou, Christina; Brem, German Johannes; Rahmeh, Martina; Mylonas, Ioannis

    2012-10-15

    Inhibins and activins are gonadal peptide hormones of the transforming growth factor-β super family with important functions in the reproductive system. By contrast, the recently identified inhibin βE subunit, primarily expressed in liver cells, appears to exert functions unrelated to the reproductive system. Previously shown downregulation of inhibin βE in hepatoma cells and anti-proliferative effects of ectopic inhibin βE overexpression indicated growth-regulatory effects of inhibin βE. We observed a selective re-expression of the inhibin βE subunit in HepG2 hepatoblastoma cells, MCF7 breast cancer cells, and HeLa cervical cancer cells under endoplasmic reticulum stress conditions induced by tunicamycin, thapsigargin, and nelfinavir. Analysis of XPB1 splicing and ATF4 activation revealed that inhibin βE re-expression was associated with induction of the endoplasmic reticulum stress reaction by these drugs. Transfection of an ATF4 expression plasmid specifically induced inhibin βE expression in HeLa cells and indicates inhibin βE as a hitherto unidentified target gene of ATF4, a key transcription factor of the endoplasmic reticulum stress response. Therefore, the inhibin βE subunit defines not only a new player but also a possible new marker for drug-induced endoplasmic reticulum stress. -- Highlights: ► Endoplasmic reticulum stress induces inhibin beta E expression. ► Inhibin beta E is regulated by the transcription factor ATF4. ► Inhibin beta E expression can be used as a marker for drug-induced ER stress.

  15. Letter Report Documenting Progress of Second Generation ATF FeCrAl Alloy Fabrication

    Energy Technology Data Exchange (ETDEWEB)

    Yamamoto, Y. [ORNL; Yang, Y. [ORNL; Field, K. G. [ORNL; Terrani, K. [ORNL; Pint, B. A. [ORNL; Snead, L. L. [ORNL

    2014-06-10

    Development of the 2nd generation ATF FeCrAl alloy has been initiated, and a candidate alloy was selected for trial tube fabrication through hot-extrusion and gun-drilling processes. Four alloys based on Fe-13Cr-4.5Al-0.15Y in weight percent were newly cast with minor alloying additions of Mo, Si, Nb, and C to promote solid-solution and second-phase precipitate strengthening. The alloy compositions were selected with guidance from computational thermodynamic tools. The lab-scale heats of ~ 600g were arc-melted and drop-cast, homogenized, hot-forged and -rolled, and then annealed producing plate shape samples. An alloy with Mo and Nb additions (C35MN) processed at 800°C exhibits very fine sub-grain structure with the sub-grain size of 1-3μm which exhibited more than 25% better yield and tensile strengths together with decent ductility compared to the other FeCrAl alloys at room temperature. It was found that the Nb addition was key to improving thermal stability of the fine sub-grain structure. Optimally, grains of less than 30 microns are desired, with grains up to and order of magnitude in desired produced through Nb addition. Scale-up effort of the C35MN alloy was made in collaboration with a commercial cast company who has a capability of vacuum induction melting. A 39lb columnar ingot with ~81mm diameter and ~305mm height (with hot-top) was commercially cast, homogenized, hot-extruded, and annealed providing 10mm-diameter bar-shape samples with the fine sub-grain structure. This commercial heat proved consistent with materials produced at ORNL at the lab-scale. Tubes and end caps were machined from the bar sample and provided to another work package for the ATF-1 irradiation campaign in the milestone M3FT-14OR0202251.

  16. Proceedings of US-Japan heliotron-stellarator workshop: Volume 3

    International Nuclear Information System (INIS)

    This paper is the third of four volumes on the US-Japan Heliotron-Stellarator Workshop. It contains talks on the following: Heliotron EICRF Heating Experiment; CHS Heating Systems (NBI, ECH, ICH); ICH Program for ATF; ICRF Wave Propagation; the HBQM Heliac Work; configuration studies; compact torsatron studies; low aspect ratio torsatron design; optimized small stellarator designs; configuration studies for ATF; currents in ATF; currents in ATF; computations of 3-D equilibria with islands; magnetic surface mapping studies; magnetic field alignment and mapping on ATF; divertor experiments in IMS; PMI program and wall conditioning for ATF; hard X-ray suppression on ATF; plasma rotation and potential measurement; and status of heavy ion beam probe for ATF

  17. Beam-Based Alignment, Tuning and Beam Dynamics Studies for the ATF2 Extraction Line and Final Focus System

    International Nuclear Information System (INIS)

    Using a new extraction line currently under construction, the ATF2 experiment plans to test the novel compact final focus optics design with local chromaticity correction intended for use in future linear colliders. With a 1.3 GeV design beam of 30nm normalized vertical emittance extracted from the ATF damping ring, the primary goal is to achieve a vertical spot-size at the IP waist of 37nm. We discuss our planned strategy for tuning the ATF2 beam to meet the primary goal. Simulation studies have been performed to asses the effectiveness of the strategy, including 'static' (installation) errors and dynamical effects (ground-motion, mechanical vibration, ring extraction jitter etc.). We have simulated all steps in the tuning procedure, from initial orbit establishment to final IP spot-size tuning. Through a Monte Carlo study of 100's of simulation seeds we find we can achieve a spot-size within ∼10% of the design optics value in at least 75% of cases. We also ran a simulation to study the long-term performance with the use of beam-based feedbacks

  18. Mmu-miR-702 functions as an anti-apoptotic mirtron by mediating ATF6 inhibition in mice.

    Science.gov (United States)

    Zhang, Wei-Guang; Chen, Lin; Dong, Qin; He, Juan; Zhao, Han-Dong; Li, Feng-Lan; Li, Hui

    2013-12-01

    MicroRNAs (miRNAs) are a group of endogenous, small, noncoding RNAs that function as key post-transcriptional regulators. miRNAs are involved in many biological processes including apoptosis. In this study, mouse miR-702 (mmu-miR-702), a mirtron derived from the 13th intron of the Plod3 gene, was identified as a regulator of anti-apoptosis. mmu-miR-702 was down-regulated after treatment with the apoptosis-inducer isoproterenol both in vivo and in vitro. According to over-expression experiments, mmu-miR-702 inhibited apoptosis as well as the expression levels of a subset of apoptosis-related genes including activating transcription factor 6 (ATF6). An interaction between mmu-miR-702 and the ATF6 3'-UTR binding site was confirmed using luciferase reporter and western blot assays. This is the first report of ATF6 interaction with miRNA. Although the possible existence of miR-702 in the human genome is low, our results indicate that mirtrons also participate in the process of apoptosis and may provide a novel study strategy for apoptosis. PMID:24035931

  19. Analysis of Performance of Selected AFC, ATF Fuels, and Lanthanide Transport

    Energy Technology Data Exchange (ETDEWEB)

    Unal, Cetin [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Galloway, Jack D. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2015-09-29

    We started to look at the performance of ATF concept in LWRs late in FY14 and finish our studies in FY15. The work has been presented in AFC review meetings, ICAPP and TOPFUEL conferences. The final version of the work is accepted for publication in Nuclear Engineering and Science Journal (NES). The copy of ICAPP and NES papers are attached separately to this document as our milestone deliverables. We made an important progress in the modeling of lanthanide transport in FY15. This work produced an ANS Winter Meeting paper and GLOBAL 2015 paper. GLOBAL 2015 paper is also attached as deliverable of FY15. The work on the lanthanide transport is preliminary. We are exploring other potential mechanisms, in addition to “liquid-like” diffusion mechanisms, proposed by Robert Mariani [1] before we analyze data that will be taken by Ohio State University. This year, we concentrate on developing diffusion kernels and principles of modeling. Next year, this work will continue and analyze the Ohio State data and develop approaches to solve multicomponent diffusion. In addition to three papers we attached to this report, we have done some research on coupling and the development of gas release model for metallic fuels in FY15. They are also preliminary in nature; therefore, we give the summary of what we found rather than an extended report that will be done in FY16.

  20. Design parameters of the high gain harmonic generation experiment using Cornell undulator A at the ATF

    International Nuclear Information System (INIS)

    The authors present the design parameters of a high gain harmonic generation (HGHG) FEL experiment to be carried out at the accelerator test facility (ATF) at BNL, in collaboration with APS. This experiment is a proof-of-principle experiment for the DUV-FEL at BNL. In the HGHG experiment they plan to double the frequency of a CO2 seed laser by utilizing a 0.76 m long 9 period undulator (named the Mini Undulator), a 2 m long 60 period undulator (named the Cornell Undulator A), and a 0.3 m electromagnet chicane (the dispersive section). The first undulator will be used in conjunction with the CO2 seed laser to generate a ponderomotive force that will bunch the electron beam. The bunching will then be enhanced by the dispersion section. The second undulator, the Cornell Undulator A, tuned to the second harmonic of the seed laser will serve as the radiator. In the beginning of the radiator the bunched beam will produce coherent emission (characterized by a quadratic growth of the radiated power), then the radiation will be amplified exponentially. They plan to study the evolution of the various radiation growth mechanisms as well as the coherence of the doubled, exponentially amplified radiation

  1. Location and repair of air leaks in the ATF vacuum vessel

    International Nuclear Information System (INIS)

    On the basis of partial pressure rate-of-rise and base pressure measurements, it was determined that the Advanced Toroidal Facility (ATF) vacuum vessel had an air leak in the low 10-4 mbarx ell/s range. Pinpointing this leak by conventional helium leak-checking procedures was not possible, because large portions of the outside of the vessel are covered by the helical field coils and a structural shell. Various alternative leak detection schemes that were considered are summarized and their advantages and disadvantages noted. In the method ultimately employed, gum-rubber patches of various sizes ranging from 12.7 by 12.7 cm to 20.3 by 30.5 cm were positioned on the inside surfaces of the vessel and evacuated by the leak detector (LD). After roughly 5% of the surface was inspected in this way, a leak of >10-5 mbar xL/s was discovered and localized to an area of 5 by 5 cm. Dye penetrant applied to this area disclosed three pinholes. Two small slag pockets were discovered while these points were being ground out. After these were rewelded, no further leakage could be found in the repaired area. Global leak rates measured after the machine was reevacuated indicated that this leak was about 30% of the overall leak rate. 1 ref., 5 figs., 1 tab

  2. Metformin-induced inhibition of the mitochondrial respiratory chain increases FGF21 expression via ATF4 activation

    International Nuclear Information System (INIS)

    Highlights: •Metformin induces FGF21 expression in an AMPK independent manner. •Metformin enhances FGF21 expression by inhibiting mitochondrial complex I activity. •The PERK-eIF2α-ATF4 axis is required for metformin-induced FGF21 expression. •Metformin activates the ATF4-FGF21 axis in the liver of mouse. •Metformin increases serum FGF21 level in diabetic human subjects. -- Abstract: Fibroblast growth factor 21 (FGF21) is an endocrine hormone that exhibits anti-obesity and anti-diabetes effects. Because metformin is widely used as a glucose-lowering agent in patients with type 2 diabetes (T2D), we investigated whether metformin modulates FGF21 expression in cell lines, and in mice or human subjects. We found that metformin increased the expression and release of FGF21 in a diverse set of cell types, including rat hepatoma FaO, primary mouse hepatocytes, and mouse embryonic fibroblasts (MEFs). Intriguingly, AMP-activated protein kinase (AMPK) was dispensable for the induction of FGF21 by metformin. Mammalian target of rapamycin complex 1 (mTORC1) and peroxisome proliferator-activated receptor α (PPARα), which are additional targets of metformin, were not involved in metformin-induced FGF21 expression. Importantly, inhibition of mitochondrial complex I activity by metformin resulted in FGF21 induction through PKR-like ER kinase (PERK)-eukaryotic translation factor 2α (eIF2α)-activating transcription factor 4 (ATF4). We showed that metformin activated ATF4 and increased FGF21 expression in the livers of mice, which led to increased serum levels of FGF21. We also found that serum FGF21 level was increased in human subjects with T2D after metformin therapy for 6 months. In conclusion, our results indicate that metformin induced expression of FGF21 through an ATF4-dependent mechanism by inhibiting mitochondrial respiration independently of AMPK. Therefore, FGF21 induction by metformin might explain a portion of the beneficial metabolic effects of metformin

  3. Metformin-induced inhibition of the mitochondrial respiratory chain increases FGF21 expression via ATF4 activation

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Kook Hwan [Department of Medicine, Samsung Medical Center, Sungkyunkwan University School of Medicine, 50 Irwon-dong Gangnam-gu, Seoul 135-710 (Korea, Republic of); Samsung Advanced Institute for Health Sciences and Technology, Sungkyunkwan University School of Medicine, 50 Irwon-dong Gangnam-gu, Seoul 135-710 (Korea, Republic of); Jeong, Yeon Taek [Department of Medicine, Samsung Medical Center, Sungkyunkwan University School of Medicine, 50 Irwon-dong Gangnam-gu, Seoul 135-710 (Korea, Republic of); Kim, Seong Hun [Samsung Advanced Institute for Health Sciences and Technology, Sungkyunkwan University School of Medicine, 50 Irwon-dong Gangnam-gu, Seoul 135-710 (Korea, Republic of); Jung, Hye Seung; Park, Kyong Soo [Department of Internal Medicine, Seoul National University College of Medicine, 28 Yongon-dong Chongno-gu, Seoul 110-744 (Korea, Republic of); Lee, Hae-Youn [Department of Medicine, Samsung Medical Center, Sungkyunkwan University School of Medicine, 50 Irwon-dong Gangnam-gu, Seoul 135-710 (Korea, Republic of); Lee, Myung-Shik, E-mail: mslee0923@skku.edu [Department of Medicine, Samsung Medical Center, Sungkyunkwan University School of Medicine, 50 Irwon-dong Gangnam-gu, Seoul 135-710 (Korea, Republic of); Samsung Advanced Institute for Health Sciences and Technology, Sungkyunkwan University School of Medicine, 50 Irwon-dong Gangnam-gu, Seoul 135-710 (Korea, Republic of)

    2013-10-11

    Highlights: •Metformin induces FGF21 expression in an AMPK independent manner. •Metformin enhances FGF21 expression by inhibiting mitochondrial complex I activity. •The PERK-eIF2α-ATF4 axis is required for metformin-induced FGF21 expression. •Metformin activates the ATF4-FGF21 axis in the liver of mouse. •Metformin increases serum FGF21 level in diabetic human subjects. -- Abstract: Fibroblast growth factor 21 (FGF21) is an endocrine hormone that exhibits anti-obesity and anti-diabetes effects. Because metformin is widely used as a glucose-lowering agent in patients with type 2 diabetes (T2D), we investigated whether metformin modulates FGF21 expression in cell lines, and in mice or human subjects. We found that metformin increased the expression and release of FGF21 in a diverse set of cell types, including rat hepatoma FaO, primary mouse hepatocytes, and mouse embryonic fibroblasts (MEFs). Intriguingly, AMP-activated protein kinase (AMPK) was dispensable for the induction of FGF21 by metformin. Mammalian target of rapamycin complex 1 (mTORC1) and peroxisome proliferator-activated receptor α (PPARα), which are additional targets of metformin, were not involved in metformin-induced FGF21 expression. Importantly, inhibition of mitochondrial complex I activity by metformin resulted in FGF21 induction through PKR-like ER kinase (PERK)-eukaryotic translation factor 2α (eIF2α)-activating transcription factor 4 (ATF4). We showed that metformin activated ATF4 and increased FGF21 expression in the livers of mice, which led to increased serum levels of FGF21. We also found that serum FGF21 level was increased in human subjects with T2D after metformin therapy for 6 months. In conclusion, our results indicate that metformin induced expression of FGF21 through an ATF4-dependent mechanism by inhibiting mitochondrial respiration independently of AMPK. Therefore, FGF21 induction by metformin might explain a portion of the beneficial metabolic effects of metformin.

  4. Expression and purification of recombinant ATF-mellitin, a new type fusion protein targeting ovarian cancer cells, in P. pastoris.

    Science.gov (United States)

    Su, Manman; Chang, Weiqin; Zhang, Kun; Cui, Manhua; Wu, Shuying; Xu, Tianmin

    2016-02-01

    Melittin is well known to possess cytolytic activity with wide-spectrum lytic properties and its potential use as an agent to treat several types of cancer has been tested. Due to the non-specific toxicity, melittin can impair not only cancer cells but also normal tissue. Thus, tumor-targeted toxins may be helpful for developing novel anticancer therapeutics. The urokinase-type plasminogen activator (uPA) plays a central role in tissue remodelling events occurring in normal physiology and in pathophysiology, including cancer invasion and metastasis. Heartening findings showed that uPA receptor is predominantly expressed on many types of cancer. Therefore, the amino-terminal fragment (ATF) of uPA which was able to identify and bond with cancer cells was used as the cell-targeting domain to make up tumor-targeted toxin in this study. In the present study, pPICZαC-ATF-melittin eukaryotic expression vector was successfully constructed. After transformed into P. pastoris and induced by methanol, rATF-mellitin was detected by SDS-PAGE and western blot analysis. After induction with methanol, the expression level of rATF-mellitin was 312 mg/l in 80-l fermentor. rATF‑mellitin was purified to >95% purity using SP Sepharose ion exchange chromatography and source™ 30 RPC with 67.2% recovery. Cell proliferation assay showed that rATF-melittin inhibited growth of SKOV3 cells and had no cytotoxicity effect on normal cells. For the first time, we established a stable and effective rATF-mellitin P. pastoris expression system to obtain a high level of expression of secreted rATF-mellitin which was purified by a highly efficient purification procedure. PMID:26718643

  5. Fuel licensing process for an industrial use. ATF licensing process for an industrial use - Utility's perspective

    International Nuclear Information System (INIS)

    To develop and license a breakthrough nuclear fuel technology for commercial use is becoming challenging. All the former safety analysis design limits (SAFDLs) defined in the 1970's for the standard UO2-Zr fuels, might no longer be applicable. Identification of the appropriate safety analysis design limits For each type of innovative fuel, the developers will have to identify and investigate all the possible failure/ruins scenarios (not only those related to severe accidents but also those related to normal operation). In order to save time and to focus on the best options, those failure scenarios (which could be 'killers' for the ATF concept) have to be determined early enough in the development process. Based on the above failure scenarios, the developers will have to propose the licensing limits (and the experimental protocol to determine and to justify them). As mentioned earlier, the licensing limits should not be defined against the accidental conditions only. For the operators, the (good) in-reactor fuel behaviour is crucial. As an example, in the case of the new fuel concepts coming with an outer coating, it is important to include the analysis of the consequences of the loss of this protective outer layer in the licensing process due to a manufacturing defect or an inevitable in-reactor fretting wear. Obviously, the new/specific SAFDLs will have to be endorsed by the regulators (which could be a long process by itself). Identification of a commercial reactor to irradiate the first ATF A commercial NPP is not a material test reactor (MTR); irradiating lead test fuel rods (LTFRs) or lead test assemblies (LTAs) implies strict requirements regarding the manufacturing processes [which should not include chemicals (additives or solvents) potentially incompatible with the nuclear technical specifications], the compatibility with the hosting fuel core (in terms of geometry, enrichment, thermal hydraulic performances, etc.) and the robustness and the

  6. miR-214 protects erythroid cells against oxidative stress by targeting ATF4 and EZH2.

    Science.gov (United States)

    Gao, Ming; Liu, Yun; Chen, Yue; Yin, Chunyang; Chen, Jane-Jane; Liu, Sijin

    2016-03-01

    Nuclear factor (erythroid-derived 2) like 2 (Nrf2) is a key regulator in protecting cells against stress by targeting many anti-stress response genes. Recent evidence also reveals that Nrf2 functions partially by targeting mircroRNAs (miRNAs). However, the understanding of Nrf2-mediated cytoprotection through miRNA-dependent mechanisms is largely unknown. In the current study, we identified a direct Nrf2 targeting miRNA, miR-214, and demonstrated a protective role of miR-214 in erythroid cells against oxidative stresses generated by radiation, excess iron and arsenic (As) exposure. miR-214 expression was transcriptionally repressed by Nrf2 through a canonical antioxidant response element (ARE) within its promoter region, and this repression is ROS-dependence. The suppression of miR-214 by Nrf2 could antagonize oxidative stress-induced cell death in erythroid cells by two ways. First, miR-214 directly targeted ATF4, a crucial transcriptional factor involved in anti-stress responses, down regulation of miR-214 releases the repression of ATF4 translation and leads to increased ATF4 protein content. Second, miR-214 was able to prevent cell death by targeting EZH2, the catalytic core component of PRC2 complex that is responsible for tri-methylation reaction at lysine 27 (K27) of histone 3 (H3) (H3K27me3), by which As-induced miR-214 reduction resulted in an increased global H3K27me3 level and a compromised overexpression of a pro-apoptotic gene Bim. These two pathways downstream of miR-214 synergistically cooperated to antagonize erythroid cell death upon oxidative stress. Our combined data revealed a protective role of miR-214 signaling in erythroid cells against oxidative stress, and also shed new light on Nrf2-mediated cytoprotective machinery. PMID:26791102

  7. Comparison of ATF and TJ-II stellarator equilibria as computed by the 3-D VMEC and PIES codes

    International Nuclear Information System (INIS)

    A comparison is made of results from the PIES code, which determines the equilibrium properties of three-dimensional toroidal configurations by direct integration along the magnetic field lines, with those from the VMEC code, which uses an energy minimization in a flux representation to determine the equilibrium configuration, for two devices: the ATF stellarator at Oak Ridge and the TJ-11 heliac which is being built in Madrid. The results obtained from the two codes are in good agreement, providing additional validation for the codes

  8. Aspergillus nidulans transcription factor AtfA interacts with the MAPK SakA to regulate general stress responses, development and spore functions.

    Science.gov (United States)

    Lara-Rojas, Fernando; Sánchez, Olivia; Kawasaki, Laura; Aguirre, Jesús

    2011-04-01

    Fungi utilize a phosphorelay system coupled to a MAP kinase module for sensing and processing environmental signals. In Aspergillus nidulans, response regulator SskA transmits osmotic and oxidative stress signals to the stress MAPK (SAPK) SakA. Using a genetic approach together with GFP tagging and molecular bifluorescence we show that SakA and ATF/CREB transcription factor AtfA define a general stress-signalling pathway that plays differential roles in oxidative stress responses during growth and development. AtfA is permanently localized in the nucleus, while SakA accumulates in the nucleus in response to oxidative or osmotic stress signals or during normal spore development, where it physically interacts with AtfA. AtfA is required for expression of several genes, the conidial accumulation of SakA and the viability of conidia. Furthermore, SakA is active (phosphorylated) in asexual spores, remaining phosphorylated in dormant conidia and becoming dephosphorylated during germination. SakA phosphorylation in spores depends on certain (SskA) but not other (SrrA and NikA) components of the phosphorelay system. Constitutive phosphorylation of SakA induced by the fungicide fludioxonil prevents both, germ tube formation and nuclear division. Similarly, Neurospora crassa SakA orthologue OS-2 is phosphorylated in intact conidia and gets dephosphorylated during germination. We propose that SakA-AtfA interaction regulates gene expression during stress and conidiophore development and that SAPK phosphorylation is a conserved mechanism to regulate transitions between non-growing (spore) and growing (mycelia) states. PMID:21320182

  9. Brain-Specific Disruption of the eIF2α Kinase PERK Decreases ATF4 Expression and Impairs Behavioral Flexibility

    Directory of Open Access Journals (Sweden)

    Mimi A. Trinh

    2012-06-01

    Full Text Available Translational control depends on phosphorylation of eIF2α by PKR-like ER kinase (PERK. To examine the role of PERK in cognitive function, we selectively disrupted PERK expression in the adult mouse forebrain. In the prefrontal cortex (PFC of PERK-deficient mice, eIF2α phosphorylation and ATF4 expression were diminished and were associated with enhanced behavioral perseveration, decreased prepulse inhibition, reduced fear extinction, and impaired behavioral flexibility. Treatment with the glycine transporter inhibitor SSR504734 normalized eIF2α phosphorylation, ATF4 expression, and behavioral flexibility in PERK-deficient mice. Moreover, the expression levels of PERK and ATF4 were reduced in the frontal cortex of human patients with schizophrenia. Together, our findings reveal that PERK plays a critical role in information processing and cognitive function and that modulation of eIF2α phosphorylation and ATF4 expression may represent an effective strategy for treating behavioral inflexibility associated with several neurological disorders such as schizophrenia.

  10. The PERK/ATF4/LAMP3-arm of the unfolded protein response affects radioresistance by interfering with the DNA damage response

    NARCIS (Netherlands)

    Nagelkerke, A.; Bussink, J.; Kogel, A.J. van der; Sweep, F.C.; Span, P.N.

    2013-01-01

    BACKGROUND AND PURPOSE: Lysosome-associated membrane protein 3 (LAMP3) is induced by the PKR-like ER kinase (PERK)/activating transcription factor 4 (ATF4)-arm of the unfolded protein response (UPR) during hypoxia. LAMP3 has prognostic value in breast cancer patients treated with radiotherapy. Here,

  11. A Stress-Activated, p38 Mitogen-Activated Protein Kinase–ATF/CREB Pathway Regulates Posttranscriptional, Sequence-Dependent Decay of Target RNAs

    Science.gov (United States)

    Gao, Jun; Wagnon, Jacy L.; Protacio, Reine M.; Glazko, Galina V.; Beggs, Marjorie; Raj, Vinay

    2013-01-01

    Broadly conserved, mitogen-activated/stress-activated protein kinases (MAPK/SAPK) of the p38 family regulate multiple cellular processes. They transduce signals via dimeric, basic leucine zipper (bZIP) transcription factors of the ATF/CREB family (such as Atf2, Fos, and Jun) to regulate the transcription of target genes. We report additional mechanisms for gene regulation by such pathways exerted through RNA stability controls. The Spc1 (Sty1/Phh1) kinase-regulated Atf1-Pcr1 (Mts1-Mts2) heterodimer of the fission yeast Schizosaccharomyces pombe controls the stress-induced, posttranscriptional stability and decay of sets of target RNAs. Whole transcriptome RNA sequencing data revealed that decay is associated nonrandomly with transcripts that contain an M26 sequence motif. Moreover, the ablation of an M26 sequence motif in a target mRNA is sufficient to block its stress-induced loss. Conversely, engineered M26 motifs can render a stable mRNA into one that is targeted for decay. This stress-activated RNA decay (SARD) provides a mechanism for reducing the expression of target genes without shutting off transcription itself. Thus, a single p38-ATF/CREB signal transduction pathway can coordinately induce (promote transcription and RNA stability) and repress (promote RNA decay) transcript levels for distinct sets of genes, as is required for developmental decisions in response to stress and other stimuli. PMID:23732911

  12. The operation of the BNL/ATF gun-IV photocathode RF gun at the Advanced Photon Source

    International Nuclear Information System (INIS)

    At the Advanced Photon Source (APS) at Argonne National Laboratory (ANL), a free-electron laser (FEL) based on the self-amplified spontaneous emission (SASE) process is nearing completion. Recently, an rf photoinjector gun system was made available to the APS by Brookhaven National Laboratory/Accelerator Test Facility (BNL/ATF). It will be used to provide the high-brightness, low-emittance, and low-energy spread electron beam required by the SASE FEL theory. A Nd:Glass laser system, capable of producing a maximum of 500 microJ of UV in a 1-10 ps pulse at up to a 10-Hz repetition rate, serves as the photoinjector's drive laser. Here, the design, commissioning, and integration of this gun with the APS is discussed

  13. Development of a Turn-by-Turn Beam Position Monitoring System for Multiple Bunch Operation of the ATF Damping Ring

    CERN Document Server

    Burrows, P N; Kraljevic, N Blaskovic; Christian, G B; Davis, M R; Perry, C; Apsimon, R J; Constance, B; Gerbershagen, A; Resta-Lopez, J

    2012-01-01

    An FPGA-based monitoring system has been developed to study multi-bunch beam instabilities in the damping ring (DR) of the KEK Accelerator Test Facility (ATF). The system utilises a stripline beam position monitor (BPM) and single-stage down-mixing BPM processor. The system is designed to record the horizontal and/or vertical positions of up to three bunches in the DR with c. 150ns bunch spacing, or the head bunch of up to three trains in a multi-bunch mode with a bunch spacing of 5.6 ns. The FPGA firmware and data acquisition software allow the recording of turnby-turn data. An overview of the system and performance results will be presented.

  14. Beam emittance and the effects of the rf, space charge and wake fields: Application to the ATF photoelectron beam

    International Nuclear Information System (INIS)

    Laser driven photoelectron guns are of interest for use in new methods of accelerations, future development of Linear Colliders and new experiments such as Free Electron laser (IFEL). Such guns are potential source of low emittance-high current and short bunch length electron beams, where the emitted electrons are accelerated quickly to a relativistic energy by a strong rf, electric field in the cavity. We present a brief overview of the beam dynamic studies, e.g. emittance for the Brookhaven National Laboratory (BNL) ATF high brightness photocathode radio frequency gun (now in operation), and show the effects of the rf, Space Charge, and Wake fields on the photoelectrons. 4 refs., 7 figs

  15. Gamma-rays generation experiment with the optical resonant cavity for ILC polarized positron source at the KEK-ATF 1

    International Nuclear Information System (INIS)

    We performed a gamma-rays generation experiment by laser-Compton scattering at the KEK-ATF, aiming to develop a Compton based polarized positron source for linear colliders. In the experiment, laser pulses with a 357 MHz repetition rate were accumulated and their power was enhanced by up to 250 times in the Fabry-Perot optical resonant cavity. The control system for the laser pulse accumulation was improved because it had not been possible to accumulate in the optical resonant cavity until last summer. As a result, we succeeded in synchronizing the laser pulses and colliding them with the 1.3 GeV electron beam in the ATF ring while maintaining the laser pulse accumulation in the optical resonant cavity. (author)

  16. Scoping assessments of ATF impact on late-stage accident progression including molten core-concrete interaction

    Science.gov (United States)

    Farmer, M. T.; Leibowitz, L.; Terrani, K. A.; Robb, K. R.

    2014-05-01

    Simple scoping models that can be used to evaluate ATF performance under severe accident conditions have been developed. The methodology provides a fundamental technical basis (a.k.a. metric) based on the thermodynamic boundary for evaluating performance relative to that of traditional Zr-based claddings. The initial focus in this study was on UO2 fuel with the advanced claddings 310 SS, D9, FeCrAl, and SiC. The evaluation considered only energy release with concurrent combustible gas production from fuel-cladding-coolant interactions and, separately, molten core-concrete interactions at high temperatures. Other important phenomenological effects that can influence the rate and extent of cladding decomposition (e.g., eutectic interactions, degradation of other core constituents) were not addressed. For the cladding types addressed, potential combustible gas production under both in-vessel and ex-vessel conditions was similar to that for Zr. However, exothermic energy release from cladding oxidation was substantially less for iron-based alloys (by at least a factor of 4), and modestly less (by ∼20%) for SiC. Data on SiC-clad UO2 fuel performance under severe accident conditions are sparse in the literature; thus, assumptions on the nature of the cladding decomposition process were made in order to perform this initial screening evaluation. Experimental data for this system under severe accident conditions is needed for a proper evaluation and comparison to iron-based claddings.

  17. Scoping assessments of ATF impact on late-stage accident progression including molten core–concrete interaction

    International Nuclear Information System (INIS)

    Simple scoping models that can be used to evaluate ATF performance under severe accident conditions have been developed. The methodology provides a fundamental technical basis (a.k.a. metric) based on the thermodynamic boundary for evaluating performance relative to that of traditional Zr-based claddings. The initial focus in this study was on UO2 fuel with the advanced claddings 310 SS, D9, FeCrAl, and SiC. The evaluation considered only energy release with concurrent combustible gas production from fuel–cladding–coolant interactions and, separately, molten core–concrete interactions at high temperatures. Other important phenomenological effects that can influence the rate and extent of cladding decomposition (e.g., eutectic interactions, degradation of other core constituents) were not addressed. For the cladding types addressed, potential combustible gas production under both in-vessel and ex-vessel conditions was similar to that for Zr. However, exothermic energy release from cladding oxidation was substantially less for iron-based alloys (by at least a factor of 4), and modestly less (by ∼20%) for SiC. Data on SiC-clad UO2 fuel performance under severe accident conditions are sparse in the literature; thus, assumptions on the nature of the cladding decomposition process were made in order to perform this initial screening evaluation. Experimental data for this system under severe accident conditions is needed for a proper evaluation and comparison to iron-based claddings

  18. PERK-eIF2α-ATF4 pathway mediated by endoplasmic reticulum stress response is involved in osteodifferentiation of human periodontal ligament cells under cyclic mechanical force.

    Science.gov (United States)

    Yang, Shuang-Yan; Wei, Fu-Lan; Hu, Li-Hua; Wang, Chun-Ling

    2016-08-01

    To prevent excess accumulation of unfolded proteins in endoplasmic reticulum (ER), eukaryotic cells have signaling pathways from the ER to the cytosol or nucleus. These processes are known as the endoplasmic reticulum stress (ERS) response. Protein kinase R like endoplasmic reticulum kinase (PERK) is a major transducer of the ERS response and it directly phosphorylate α-subunit of eukaryotic initiation factor 2 (eIF2α), resulting in translational attenuation. Phosphorylated eIF2α specifically promoted the translation of the activating transcription factor 4 (ATF4). ATF4 is a known important transcription factor which plays a pivotal role in osteoblast differentiation and bone formation. Furthermore, ATF4 is a downstream target of PERK. Studies have shown that PERK-eIF2α-ATF4 signal pathway mediated by ERS was involved in osteoblastic differentiation of osteoblasts. We have known that orthodontic tooth movement is a process of periodontal ligament cells (PDLCs) osteodifferentiation and alveolar bone remodeling under mechanical force. However, the involvement of PERK-eIF2α-ATF4 signal pathway mediated by ERS in osteogenic differentiation of PDLCs under mechanical force has not been unclear. In our study, we applied the cyclic mechanical force at 10% elongation with 0.5Hz to mimic occlusal force, and explored whether PERK-eIF2α-ATF4 signaling pathway mediated by ERS involved in osteogenic differentiation of PDLCs under mechanical force. Firstly, cyclic mechanical force will induce ERS and intensify several osteoblast marker genes (ATF4, OCN, and BSP). Next, we found that PERK overexpression increased eIF2α phosphorylation and expression of ATF4, furthermore induced BSP, OCN expression, thus it will promote osteodifferentiation of hPDLCs; mechanical force could promote this effect. However, PERK(-/-) cells showed the opposite changes, which will inhibit osteodifferentiation of hPDLCs. Taken together, our study proved that PERK-eIF2α-ATF4 signaling pathway

  19. Glafenine-induced intestinal injury in zebrafish is ameliorated by μ-opioid signaling via enhancement of Atf6-dependent cellular stress responses.

    Science.gov (United States)

    Goldsmith, Jason R; Cocchiaro, Jordan L; Rawls, John F; Jobin, Christian

    2013-01-01

    Beside their analgesic properties, opiates exert beneficial effects on the intestinal wound healing response. In this study, we investigated the role of μ-opioid receptor (MOR) signaling on the unfolded protein response (UPR) using a novel zebrafish model of NSAID-induced intestinal injury. The NSAID glafenine was administered to zebrafish larvae at 5 days post-fertilization (dpf) for up to 24 hours in the presence or absence of the MOR-specific agonist DALDA. By analysis with histology, transmission electron microscopy and vital dye staining, glafenine-treated zebrafish showed evidence of endoplasmic reticulum and mitochondrial stress, with disrupted intestinal architecture and halted cell stress responses, alongside accumulation of apoptotic intestinal epithelial cells in the lumen. Although the early UPR marker BiP was induced with glafenine-induced injury, downstream atf6 and s-xbp1 expression were paradoxically not increased, explaining the halted cell stress responses. The μ-opioid agonist DALDA protected against glafenine-induced injury through induction of atf6-dependent UPR. Our findings show that DALDA prevents glafenine-induced epithelial damage through induction of effective UPR. PMID:22917923

  20. Armament Technology Facility (ATF)

    Data.gov (United States)

    Federal Laboratory Consortium — The Armament Technology Facility is a 52,000 square foot, secure and environmentally-safe, integrated small arms and cannon caliber design and evaluation facility....

  1. β-Catenin-independent activation of TCF1/LEF1 in human hematopoietic tumor cells through interaction with ATF2 transcription factors.

    Science.gov (United States)

    Grumolato, Luca; Liu, Guizhong; Haremaki, Tomomi; Mungamuri, Sathish Kumar; Mong, Phyllus; Akiri, Gal; Lopez-Bergami, Pablo; Arita, Adriana; Anouar, Youssef; Mlodzik, Marek; Ronai, Ze'ev A; Brody, Joshua; Weinstein, Daniel C; Aaronson, Stuart A

    2013-01-01

    The role of Wnt signaling in embryonic development and stem cell maintenance is well established and aberrations leading to the constitutive up-regulation of this pathway are frequent in several types of human cancers. Upon ligand-mediated activation, Wnt receptors promote the stabilization of β-catenin, which translocates to the nucleus and binds to the T-cell factor/lymphoid enhancer factor (TCF/LEF) family of transcription factors to regulate the expression of Wnt target genes. When not bound to β-catenin, the TCF/LEF proteins are believed to act as transcriptional repressors. Using a specific lentiviral reporter, we identified hematopoietic tumor cells displaying constitutive TCF/LEF transcriptional activation in the absence of β-catenin stabilization. Suppression of TCF/LEF activity in these cells mediated by an inducible dominant-negative TCF4 (DN-TCF4) inhibited both cell growth and the expression of Wnt target genes. Further, expression of TCF1 and LEF1, but not TCF4, stimulated TCF/LEF reporter activity in certain human cell lines independently of β-catenin. By a complementary approach in vivo, TCF1 mutants, which lacked the ability to bind to β-catenin, induced Xenopus embryo axis duplication, a hallmark of Wnt activation, and the expression of the Wnt target gene Xnr3. Through generation of different TCF1-TCF4 fusion proteins, we identified three distinct TCF1 domains that participate in the β-catenin-independent activity of this transcription factor. TCF1 and LEF1 physically interacted and functionally synergized with members of the activating transcription factor 2 (ATF2) family of transcription factors. Moreover, knockdown of ATF2 expression in lymphoma cells phenocopied the inhibitory effects of DN-TCF4 on the expression of target genes associated with the Wnt pathway and on cell growth. Together, our findings indicate that, through interaction with ATF2 factors, TCF1/LEF1 promote the growth of hematopoietic malignancies in the absence of

  2. Activation of the EIF2AK4-EIF2A/eIF2α-ATF4 pathway triggers autophagy response to Crohn disease-associated adherent-invasive Escherichia coli infection.

    Science.gov (United States)

    Bretin, Alexis; Carrière, Jessica; Dalmasso, Guillaume; Bergougnoux, Agnès; B'chir, Wafa; Maurin, Anne-Catherine; Müller, Stefan; Seibold, Frank; Barnich, Nicolas; Bruhat, Alain; Darfeuille-Michaud, Arlette; Nguyen, Hang Thi Thu

    2016-05-01

    The intestinal mucosa of Crohn disease (CD) patients is abnormally colonized by adherent-invasive E. coli (AIEC). Upon AIEC infection, autophagy is induced in host cells to restrain bacterial intracellular replication. The underlying mechanism, however, remains unknown. Here, we investigated the role of the EIF2AK4-EIF2A/eIF2α-ATF4 pathway in the autophagic response to AIEC infection. We showed that infection of human intestinal epithelial T84 cells with the AIEC reference strain LF82 activated the EIF2AK4-EIF2A-ATF4 pathway, as evidenced by increased phospho-EIF2AK4, phospho-EIF2A and ATF4 levels. EIF2AK4 depletion inhibited autophagy activation in response to LF82 infection, leading to increased LF82 intracellular replication and elevated pro-inflammatory cytokine production. Mechanistically, EIF2AK4 depletion suppressed the LF82-induced ATF4 binding to promoters of several autophagy genes including MAP1LC3B, BECN1, SQSTM1, ATG3 and ATG7, and this subsequently inhibited transcription of these genes. LF82 infection of wild-type (WT), but not eif2ak4(-/-), mice activated the EIF2AK4-EIF2A-ATF4 pathway, inducing autophagy gene transcription and autophagy response in enterocytes. Consequently, eif2ak4(-/-) mice exhibited increased intestinal colonization by LF82 bacteria and aggravated inflammation compared to WT mice. Activation of the EIF2AK4-EIF2A-ATF4 pathway was observed in ileal biopsies from patients with noninflamed CD, and this was suppressed in inflamed CD, suggesting that a defect in the activation of this pathway could be one of the mechanisms contributing to active disease. In conclusion, we show that activation of the EIF2AK4-EIF2A-ATF4 pathway upon AIEC infection serves as a host defense mechanism to induce functional autophagy to control AIEC intracellular replication. PMID:26986695

  3. SB203580 Modulates p38 MAPK Signaling and Dengue Virus-Induced Liver Injury by Reducing MAPKAPK2, HSP27, and ATF2 Phosphorylation.

    Science.gov (United States)

    Sreekanth, Gopinathan Pillai; Chuncharunee, Aporn; Sirimontaporn, Aunchalee; Panaampon, Jutatip; Noisakran, Sansanee; Yenchitsomanus, Pa-Thai; Limjindaporn, Thawornchai

    2016-01-01

    Dengue virus (DENV) infection causes organ injuries, and the liver is one of the most important sites of DENV infection, where viral replication generates a high viral load. The molecular mechanism of DENV-induced liver injury is still under investigation. The mitogen activated protein kinases (MAPKs), including p38 MAPK, have roles in the hepatic cell apoptosis induced by DENV. However, the in vivo role of p38 MAPK in DENV-induced liver injury is not fully understood. In this study, we investigated the role of SB203580, a p38 MAPK inhibitor, in a mouse model of DENV infection. Both the hematological parameters, leucopenia and thrombocytopenia, were improved by SB203580 treatment and liver transaminases and histopathology were also improved. We used a real-time PCR microarray to profile the expression of apoptosis-related genes. Tumor necrosis factor α, caspase 9, caspase 8, and caspase 3 proteins were significantly lower in the SB203580-treated DENV-infected mice than that in the infected control mice. Increased expressions of cytokines including TNF-α, IL-6 and IL-10, and chemokines including RANTES and IP-10 in DENV infection were reduced by SB203580 treatment. DENV infection induced the phosphorylation of p38MAPK, and its downstream signals including MAPKAPK2, HSP27 and ATF-2. SB203580 treatment did not decrease the phosphorylation of p38 MAPK, but it significantly reduced the phosphorylation of MAPKAPK2, HSP27, and ATF2. Therefore, SB203580 modulates the downstream signals to p38 MAPK and reduces DENV-induced liver injury. PMID:26901653

  4. The Role of the PERK/eIF2α/ATF4/CHOP Signaling Pathway in Tumor Progression During Endoplasmic Reticulum Stress

    Science.gov (United States)

    Rozpędek, W.; Pytel, D.; Mucha, B.; Leszczyńska, H.; Diehl, J. Alan; Majsterek, I.

    2016-01-01

    Hypoxia is a major hallmark of the tumor microenvironment that is strictly associated with rapid cancer progression and induction of metastasis. Hypoxia inhibits disulfide bond formation and impairs protein folding in the Endoplasmic Reticulum (ER). The stress in the ER induces the activation of Unfolded Protein Response (UPR) pathways via the induction of protein kinase RNA-like endoplasmic reticulum kinase (PERK). As a result, the level of phosphorylated Eukaryotic Initiation Factor 2 alpha (eIF2α) is markedly elevated, resulting in the promotion of a pro-adaptive signaling pathway by the inhibition of global protein synthesis and selective translation of Activating Transcription Factor 4 (ATF4). On the contrary, during conditions of prolonged ER stress, pro-adaptive responses fail and apoptotic cell death ensues. Interestingly, similar to the activity of the mitochondria, the ER may also directly activate the apoptotic pathway through ER stress-mediated leakage of calcium into the cytoplasm that leads to the activation of death effectors. Apoptotic cell death also ensues by ATF4-CHOP- mediated induction of several pro-apoptotic genes and suppression of the synthesis of anti-apoptotic Bcl-2 proteins. Advancing molecular insight into the transition of tumor cells from adaptation to apoptosis under hypoxia-induced ER stress may provide answers on how to overcome the limitations of current anti-tumor therapies. Targeting components of the UPR pathways may provide more effective elimination of tumor cells and as a result, contribute to the development of more promising anti-tumor therapeutic agents. PMID:27211800

  5. Structural pathology in a rodent model of osteoarthritis is associated with neuropathic pain: increased expression of ATF-3 and pharmacological characterisation.

    Science.gov (United States)

    Ivanavicius, Stefan P; Ball, Adrian D; Heapy, Chris G; Westwood, F Russell; Murray, Fraser; Read, Simon J

    2007-04-01

    Intra-articular injection of mono-iodoacetate (MIA) in the rat knee joint induces a histopathology with similarities to osteoarthritis (OA). Typically, a synovitis (days 1-3) is observed followed by thinning of articular cartilage and subsequent lesion of subchondral bone at days 8-14 onwards. Behaviourally, weight-bearing asymmetry is observed, which is sensitive to anti-inflammatory pharmacology at early but not later (days 14+) time points. As subchondral bone is densely innervated, an intriguing possibility is that focal bone pathology may cause neuropathy in this model. In male Wistar rats, activating transcription factor (ATF)-3-immunofluorescence was used as a marker of nerve injury in lumber (L)4 and L5 dorsal root ganglia of the ipsilateral knee. Significantly increased ATF-3-immunoreactivity following MIA treatment was measured in L5 on days 8 and 14 (P<0.05, Kruskal-Wallis and Mann-Whitney U-test), compared to saline controls. Furthermore, in an additional study animals were orally dosed vehicle (5 ml/kg), naproxen (0.3-10 mg/kg), celecoxib (1-10 mg/kg), amitriptyline (3-30 mg/kg) and gabapentin (10-100mg/kg) and evaluated for weight-bearing asymmetry on days 14, 21 and 28 post-MIA. Significant resolution of weight-bearing was observed at high and intermediate doses of amitriptyline and gabapentin at all time points (P<0.05, ANOVA, post-hoc Bonferroni's, vs pre-dose measurements). Transient and weak effects were observed with naproxen (10mg/kg) on days 14 and 28, whereas celecoxib showed no significant effects. Collectively, these data suggest that this putative model of OA is associated with an early phase neuropathy in the L5 innervation territory of the knee. PMID:17276007

  6. SB203580 Modulates p38 MAPK Signaling and Dengue Virus-Induced Liver Injury by Reducing MAPKAPK2, HSP27, and ATF2 Phosphorylation

    Science.gov (United States)

    Sreekanth, Gopinathan Pillai; Chuncharunee, Aporn; Sirimontaporn, Aunchalee; Panaampon, Jutatip; Noisakran, Sansanee; Yenchitsomanus, Pa-thai; Limjindaporn, Thawornchai

    2016-01-01

    Dengue virus (DENV) infection causes organ injuries, and the liver is one of the most important sites of DENV infection, where viral replication generates a high viral load. The molecular mechanism of DENV-induced liver injury is still under investigation. The mitogen activated protein kinases (MAPKs), including p38 MAPK, have roles in the hepatic cell apoptosis induced by DENV. However, the in vivo role of p38 MAPK in DENV-induced liver injury is not fully understood. In this study, we investigated the role of SB203580, a p38 MAPK inhibitor, in a mouse model of DENV infection. Both the hematological parameters, leucopenia and thrombocytopenia, were improved by SB203580 treatment and liver transaminases and histopathology were also improved. We used a real-time PCR microarray to profile the expression of apoptosis-related genes. Tumor necrosis factor α, caspase 9, caspase 8, and caspase 3 proteins were significantly lower in the SB203580-treated DENV-infected mice than that in the infected control mice. Increased expressions of cytokines including TNF-α, IL-6 and IL-10, and chemokines including RANTES and IP-10 in DENV infection were reduced by SB203580 treatment. DENV infection induced the phosphorylation of p38MAPK, and its downstream signals including MAPKAPK2, HSP27 and ATF-2. SB203580 treatment did not decrease the phosphorylation of p38 MAPK, but it significantly reduced the phosphorylation of MAPKAPK2, HSP27, and ATF2. Therefore, SB203580 modulates the downstream signals to p38 MAPK and reduces DENV-induced liver injury. PMID:26901653

  7. SB203580 Modulates p38 MAPK Signaling and Dengue Virus-Induced Liver Injury by Reducing MAPKAPK2, HSP27, and ATF2 Phosphorylation.

    Directory of Open Access Journals (Sweden)

    Gopinathan Pillai Sreekanth

    Full Text Available Dengue virus (DENV infection causes organ injuries, and the liver is one of the most important sites of DENV infection, where viral replication generates a high viral load. The molecular mechanism of DENV-induced liver injury is still under investigation. The mitogen activated protein kinases (MAPKs, including p38 MAPK, have roles in the hepatic cell apoptosis induced by DENV. However, the in vivo role of p38 MAPK in DENV-induced liver injury is not fully understood. In this study, we investigated the role of SB203580, a p38 MAPK inhibitor, in a mouse model of DENV infection. Both the hematological parameters, leucopenia and thrombocytopenia, were improved by SB203580 treatment and liver transaminases and histopathology were also improved. We used a real-time PCR microarray to profile the expression of apoptosis-related genes. Tumor necrosis factor α, caspase 9, caspase 8, and caspase 3 proteins were significantly lower in the SB203580-treated DENV-infected mice than that in the infected control mice. Increased expressions of cytokines including TNF-α, IL-6 and IL-10, and chemokines including RANTES and IP-10 in DENV infection were reduced by SB203580 treatment. DENV infection induced the phosphorylation of p38MAPK, and its downstream signals including MAPKAPK2, HSP27 and ATF-2. SB203580 treatment did not decrease the phosphorylation of p38 MAPK, but it significantly reduced the phosphorylation of MAPKAPK2, HSP27, and ATF2. Therefore, SB203580 modulates the downstream signals to p38 MAPK and reduces DENV-induced liver injury.

  8. THAP and ATF-2 regulated sterol carrier protein-2 promoter activities in the larval midgut of the yellow fever mosquito, Aedes aegypti.

    Science.gov (United States)

    Peng, Rong; Fu, Qiang; Hong, Huazhu; Schwaegler, Tyler; Lan, Que

    2012-01-01

    Expression of sterol carrier protein-2 (SCP-2) in Aedes aegypti shows a distinct temporal/spatial pattern throughout the life cycle. In order to identify the transcription factors responsible for the larval temporal/spatial regulation of AeSCP-2 transcription, AeSCP-2 promoter activities were studied in vivo via transient transfection of promoter/reporter gene assays. Regulatory sequences upstream -1.3 kb of the transcription start site of AeSCP-2 were found to be critical for the in vivo temporal/spatial promoter activity. Interestingly, the -1.6 kb promoter sequence efficiently drove the larval midgut-specific siRNA expression, indicating that the -1.6 kb upstream sequence is sufficient for temporal/spatial AeSCP-2 transcriptional activity. Four transcription factors were identified in the midgut nuclear extract from feeding larvae via labeled -1.6/-1.3 kb DNA probe pull-down and proteomic analysis. Co-transfection of the promoter/reporter gene with inducible siRNA expression of each transcription factor was performed to confirm the regulatory function of individual transcription factor on AeSCP-2 transcriptional activities in the larval midgut. The results indicate that two of the identified transcription factors, Thanatos-associated protein (THAP) and activating transcription factor-2 (ATF-2), antagonistically control AeSCP-2 transcriptional activity in the midgut of feeding larvae via the regulatory sequences between -1.6 to -1.3 kb 5' upstream of the transcription start site. In vivo expression knockdown of THAP and ATF-2 resulted in significant changes in developmental progression, which may be partially due to their effects on AeSCP-2 expression. PMID:23056538

  9. THAP and ATF-2 regulated sterol carrier protein-2 promoter activities in the larval midgut of the yellow fever mosquito, Aedes aegypti.

    Directory of Open Access Journals (Sweden)

    Rong Peng

    Full Text Available Expression of sterol carrier protein-2 (SCP-2 in Aedes aegypti shows a distinct temporal/spatial pattern throughout the life cycle. In order to identify the transcription factors responsible for the larval temporal/spatial regulation of AeSCP-2 transcription, AeSCP-2 promoter activities were studied in vivo via transient transfection of promoter/reporter gene assays. Regulatory sequences upstream -1.3 kb of the transcription start site of AeSCP-2 were found to be critical for the in vivo temporal/spatial promoter activity. Interestingly, the -1.6 kb promoter sequence efficiently drove the larval midgut-specific siRNA expression, indicating that the -1.6 kb upstream sequence is sufficient for temporal/spatial AeSCP-2 transcriptional activity. Four transcription factors were identified in the midgut nuclear extract from feeding larvae via labeled -1.6/-1.3 kb DNA probe pull-down and proteomic analysis. Co-transfection of the promoter/reporter gene with inducible siRNA expression of each transcription factor was performed to confirm the regulatory function of individual transcription factor on AeSCP-2 transcriptional activities in the larval midgut. The results indicate that two of the identified transcription factors, Thanatos-associated protein (THAP and activating transcription factor-2 (ATF-2, antagonistically control AeSCP-2 transcriptional activity in the midgut of feeding larvae via the regulatory sequences between -1.6 to -1.3 kb 5' upstream of the transcription start site. In vivo expression knockdown of THAP and ATF-2 resulted in significant changes in developmental progression, which may be partially due to their effects on AeSCP-2 expression.

  10. NEAMS-ATF M3 Milestone Report: Literature Review of Modeling of Radiation-Induced Swelling in Fe-Cr-Al Steels

    Energy Technology Data Exchange (ETDEWEB)

    Bai, Xianming [Idaho National Lab. (INL), Idaho Falls, ID (United States). Fuel Modeling and Simulation Dept.; Biner, Suleyman Bulent [Idaho National Lab. (INL), Idaho Falls, ID (United States). Fuel Modeling and Simulation Dept.; Jiang, Chao [Idaho National Lab. (INL), Idaho Falls, ID (United States). Fuel Modeling and Simulation Dept.

    2015-12-01

    Fe-Cr-Al steels are proposed as accident-tolerant-fuel (ATF) cladding materials in light water reactors due to their excellent oxidation resistance at high temperatures. Currently, the understanding of their performance in reactor environment is still limited. In this review, firstly we reviewed the experimental studies of Fe-Cr-Al based alloys with particular focus on the radiation effects in these alloys. Although limited data are available in literature, several previous and recent experimental studies have shown that Fe-Cr-Al based alloys have very good void swelling resistance at low and moderate irradiation doses but the growth of dislocation loops is very active. Overall, the behavior of radiation damage evolution is similar to that in Fe-Cr ferritic/martensitic alloys. Secondly, we reviewed the rate theory-based modeling methods for modeling the coevolution of voids and dislocation loops in materials under irradiation such as Frenkel pair three-dimensional diffusion model (FP3DM) and cluster dynamics. Finally, we summarized and discussed our review and proposed our future plans for modeling radiation damage in Fe-Cr-Al based alloys.

  11. Myxoma virus attenuates expression of activating transcription factor 4 (ATF4 which has implications for the treatment of proteasome inhibitor–resistant multiple myeloma

    Directory of Open Access Journals (Sweden)

    Dunlap KM

    2015-01-01

    Full Text Available Katherine M Dunlap, Mee Y Bartee, Eric Bartee Department of Microbiology and Immunology, Medical University of South Carolina, Charleston, SC, USA Abstract: The recent development of chemotherapeutic proteasome inhibitors, such as bortezomib, has improved the outcomes of patients suffering from the plasma cell malignancy multiple myeloma. Unfortunately, many patients treated with these drugs still suffer relapsing disease due to treatment-induced upregulation of the antiapoptotic protein Mcl1. We have recently demonstrated that an oncolytic poxvirus, known as myxoma, can rapidly eliminate primary myeloma cells by inducing cellular apoptosis. The efficacy of myxoma treatment on proteasome inhibitor–relapsed or –refractory myeloma, however, remains unknown. We now demonstrate that myxoma-based elimination of myeloma is not affected by cellular resistance to proteasome inhibitors. Additionally, myxoma virus infection specifically prevents expression of Mcl1 following induction of the unfolded protein response, by blocking translation of the unfolded protein response activating transcription factor (ATF4. These results suggest that myxoma-based oncolytic therapy represents an attractive option for myeloma patients whose disease is refractory to chemotherapeutic proteasome inhibitors due to upregulation of Mcl1. Keywords: drug resistance, oncolytic

  12. Novel dengue virus inhibitor 4-HPR activates ATF4 independent of protein kinase R-like Endoplasmic Reticulum Kinase and elevates levels of eIF2α phosphorylation in virus infected cells.

    Science.gov (United States)

    Fraser, J E; Wang, C; Chan, K W K; Vasudevan, S G; Jans, D A

    2016-06-01

    Infections by dengue virus (DENV) are increasing worldwide, with an urgent need for effective anti-DENV agents. We recently identified N-(4-hydroxyphenyl) retinamide (4-HPR), an anti-DENV agent effective against all 4 serotypes of DENV in cell culture, and in a lethal mouse model for DENV infection (Fraser et al., 2014b). Although identified as an inhibitor of DENV non-structural protein 5 (NS5) recognition by host nuclear import proteins, the precise impact and mode of action of 4-HPR in effecting DENV clearance remains to be defined. Significantly, concurrent with decreased viral RNA and infectious DENV in 4-HPR-treated cells, we previously observed specific up-regulation of transcripts representing the Protein Kinase R-like Endoplasmic Reticulum Kinase (PERK) arm of the unfolded protein response (UPR) pathway upon 4-HPR addition. Here we pursue these findings in detail, examining the role of specific PERK pathway components in DENV clearance. We demonstrate that 4-HPR-induced nuclear localization of Activating Transcription Factor 4 (ATF4), a pathway component downstream from PERK, occurs in a PERK-independent manner, implying activation instead occurs through Integrated Stress Response (ISR) kinases. Significantly, ATF4 does not appear to be required for the antiviral activity of 4-HPR, suggesting transcriptional events induced by ATF4 do not drive the 4-HPR-induced antiviral state. Instead, we demonstrate that 4-HPR induces phosphorylation of eukaryotic translation initiation factor 2α (eIF2α), a target of ISR kinases which controls translation attenuation, and confirm the importance of phosphorylated-eIF2α in DENV infection using guanabenz, a specific inhibitor of eIF2α dephosphorylation. This study provides the first detailed insight into the cellular effects modulated by 4-HPR in DENV-infected cells, critical to progressing 4-HPR towards the clinic. PMID:26965420

  13. Pelvic nerve injury causes a rapid decrease in expression of choline acetyltransferase and upregulation of c-Jun and ATF-3 in a distinct population of sacral preganglionic neurons

    Directory of Open Access Journals (Sweden)

    JanetRKeast

    2011-01-01

    Full Text Available Autonomic regulation of the urogenital organs is impaired by injuries sustained during pelvic surgery or compression of lumbosacral spinal nerves (e.g. cauda equina syndrome. To understand the impact of injury on both sympathetic and parasympathetic components of this nerve supply, we performed an experimental surgical and immunohistochemical study on adult male rats, where the structure of this complex part of the nervous system has been well defined. We performed unilateral transection of pelvic or hypogastric nerves and analysed relevant regions of lumbar and sacral spinal cord, up to four weeks after injury. Expression of c-Jun, the neuronal injury marker activating transcription factor-3 (ATF-3, and choline acetyltransferase (ChAT were examined. We found little evidence for chemical or structural changes in substantial numbers of functionally related but uninjured spinal neurons (e.g. in sacral preganglionic neurons after hypogastric nerve injury, failing to support the concept of compensatory events. The effects of injury were greatest in sacral cord, ipsilateral to pelvic nerve transection. Here, around half of all preganglionic neurons expressed c-Jun within one week of injury, and substantial ATF-3 expression also occurred, especially in neurons with complete loss of ChAT-immunoreactivity. There did not appear to be any death of retrogradely labelled neurons, in contrast to axotomy studies performed on other regions of spinal cord or sacral ventral root avulsion models. Each of the effects we observed occurred in only a subpopulation of preganglionic neurons at that spinal level, raising the possibility that distinct functional subgroups have different susceptibility to trauma-induced degeneration and potentially different regenerative abilities. Identification of the cellular basis of these differences may provide insights into organ-specific strategies for attenuating degeneration or promoting regeneration of these circuits after

  14. 异相睡眠剥夺对大鼠脑内质网应激相关蛋白ATF4表达的影响%Effects of rapid eye movement sleep deprivation on expression of activating transcription factor 4 in rat brain

    Institute of Scientific and Technical Information of China (English)

    江波; 赵忠新

    2008-01-01

    目的 研究异相睡眠(REM 睡眠)剥夺对大鼠海马及额叶内质网应激相关蛋白转录活化因子4(ATF4)表达的影响.方法 大鼠采用完全随机数字表法分为6组:空白对照组(CC组)、环境对照组(TC)、睡眠剥夺(SD)6h、12 h、1 d、3 d组,每组10只.采用改良多平台睡眠剥夺法建立REM 睡眠剥夺大鼠模型,免疫组织化学及Westemblot方法测定不同时间点大鼠额叶及海马ATF4蛋白的表达.结果 CC组大鼠海鸟及额叶均未检测出ATF4.TC组海马、额叶均有ATF4表达,SD组海马、额叶6 h时开始表达ATF4,12 h后达到高峰,1 d、3 d呈逐渐下降趋势.结论 REM睡眠剥夺可诱发内质网应激,睡眠剥夺后大鼠海马与额叶发生内质网应激的时间及发展趋势基本相同.%Objective To investigate the expression of endoplasmic reticulum stress-related protein activating transcription factor 4 (ATF4, also known as CAMP-response element protein 2) in rat brain after rapid eye movement (REM) sleep deprivation. Methods Using a modified multiple platform method, REM sleep deprivation for different time lengths was induced in 4 groups of rats (n=10, for 6, 12, 24, and 72 h, respectively), with 10 normal rats as the cage control and another 10 as the tank control groups. Immunohistochemistry and Western blotting were performed to detect ATF4 protein expression in the hippocampus and frontal lobe of the rats. Results No ATF4 was detected in the cage control group. ATF4 expression was detected in the brain tissues of the rats in the tank control group, and the expression peaked after REM sleep deprivation for 12 h, followed by gradual declination as the sleep deprivation was prolonged to 24 and 72 h. Conclusion REM sleep deprivation can induce endoplasmic reticulum stress. The timing of endoplasmic reticulum stress onset and the course of its development following sleep deprivation are almost identical in the frontal lobe and hippocampus of rats.

  15. Bee Venom Accelerates Wound Healing in Diabetic Mice by Suppressing Activating Transcription Factor-3 (ATF-3) and Inducible Nitric Oxide Synthase (iNOS)-Mediated Oxidative Stress and Recruiting Bone Marrow-Derived Endothelial Progenitor Cells.

    Science.gov (United States)

    Badr, Gamal; Hozzein, Wael N; Badr, Badr M; Al Ghamdi, Ahmad; Saad Eldien, Heba M; Garraud, Olivier

    2016-10-01

    Multiple mechanisms contribute to impaired diabetic wound healing including impaired neovascularization and deficient endothelial progenitor cell (EPC) recruitment. Bee venom (BV) has been used as an anti-inflammatory agent for the treatment of several diseases. Nevertheless, the effect of BV on the healing of diabetic wounds has not been studied. Therefore, in this study, we investigated the impact of BV on diabetic wound closure in a type I diabetic mouse model. Three experimental groups were used: group 1, non-diabetic control mice; group 2, diabetic mice; and group 3, diabetic mice treated with BV. We found that the diabetic mice exhibited delayed wound closure characterized by a significant decrease in collagen production and prolonged elevation of inflammatory cytokines levels in wounded tissue compared to control non-diabetic mice. Additionally, wounded tissue in diabetic mice revealed aberrantly up-regulated expression of ATF-3 and iNOS followed by a marked elevation in free radical levels. Impaired diabetic wound healing was also characterized by a significant elevation in caspase-3, -8, and -9 activity and a marked reduction in the expression of TGF-β and VEGF, which led to decreased neovascularization and angiogenesis of the injured tissue by impairing EPC mobilization. Interestingly, BV treatment significantly enhanced wound closure in diabetic mice by increasing collagen production and restoring the levels of inflammatory cytokines, free radical, TGF-β, and VEGF. Most importantly, BV-treated diabetic mice exhibited mobilized long-lived EPCs by inhibiting caspase activity in the wounded tissue. Our findings reveal the molecular mechanisms underlying improved diabetic wound healing and closure following BV treatment. J. Cell. Physiol. 231: 2159-2171, 2016. © 2016 Wiley Periodicals, Inc. PMID:26825453

  16. Mechanism of the induction of endoplasmic reticulum stress by the anti-cancer agent, di-2-pyridylketone 4,4-dimethyl-3-thiosemicarbazone (Dp44mT): Activation of PERK/eIF2α, IRE1α, ATF6 and calmodulin kinase.

    Science.gov (United States)

    Merlot, Angelica M; Shafie, Nurul H; Yu, Yu; Richardson, Vera; Jansson, Patric J; Sahni, Sumit; Lane, Darius J R; Kovacevic, Zaklina; Kalinowski, Danuta S; Richardson, Des R

    2016-06-01

    The endoplasmic reticulum (ER) plays a major role in the synthesis, maturation and folding of proteins and is a critical calcium (Ca(2+)) reservoir. Cellular stresses lead to an overwhelming accumulation of misfolded proteins in the ER, leading to ER stress and the activation of the unfolded protein response (UPR). In the stressful tumor microenvironment, the UPR maintains ER homeostasis and enables tumor survival. Thus, a novel strategy for cancer therapeutics is to overcome chronically activated ER stress by triggering pro-apoptotic pathways of the UPR. Considering this, the mechanisms by which the novel anti-cancer agent, Dp44mT, can target the ER stress response pathways were investigated in multiple cell-types. Our results demonstrate that the cytotoxic chelator, Dp44mT, which forms redox-active metal complexes, significantly: (1) increased ER stress-associated pro-apoptotic signaling molecules (i.e., p-eIF2α, ATF4, CHOP); (2) increased IRE1α phosphorylation (p-IRE1α) and XBP1 mRNA splicing; (3) reduced expression of ER stress-associated cell survival signaling molecules (e.g., XBP1s and p58(IPK)); (4) increased cleavage of the transcription factor, ATF6, which enhances expression of its downstream targets (i.e., CHOP and BiP); and (5) increased phosphorylation of CaMKII that induces apoptosis. In contrast to Dp44mT, the iron chelator, DFO, which forms redox-inactive iron complexes, did not affect BiP, p-IRE1α, XBP1 or p58(IPK) levels. This study highlights the ability of a novel cancer therapeutic (i.e., Dp44mT) to target the pro-apoptotic functions of the UPR via cellular metal sequestration and redox stress. Assessment of ER stress-mediated apoptosis is fundamental to the understanding of the pharmacology of chelation for cancer treatment. PMID:27059255

  17. Investigation of three-dimensional turbulent structures in the torsatron TJ-K

    International Nuclear Information System (INIS)

    In this work, for the first time, the three-dimensional nature of drift waves has been verified experimentally inside the confinement region of the toroidal plasma in TJ-K. The perpendicular dynamics of turbulence has been studied with the focus on the poloidal wavenumber spectra and the scaling of the turbulent structure with the drift scale. To this end, a 64 tip Langmuir probe array has been used, which is poloidally positioned on a flux surface. For the first time, the parallel dynamics of turbulence has been investigated in the core of a toroidally confined plasma. In contrast to previous experiments, multi-probe measurements were carried out to get simultaneous information on the shape and the propagation direction of the turbulent structures. The results for the parallel wave number and the parallel propagation velocity have been compared with results from the simulation code GEM3. It is demonstrated that the propagation in the direction parallel to the magnetic field is affected by Alfven dynamics. Together, these results strongly confirm previous investigations, which have demonstrated the importance of drift-wave turbulence in TJ-K and therefore also in fusion edge plasma. (orig.)

  18. University of Wisconsin torsatron/stellarator laboratory program final report, January 1, 1986--January 31, 1994

    International Nuclear Information System (INIS)

    This document reports work performed in the final period of the referenced grant number, from January 1992 through January 1994. Prior work under this grant number has been reported in previous reports of this series. Measurements of the radial electric field, flow velocity, and momentum decay times were made in the IMS stellarator to examine the effects of in-neutral collisions and viscosity showing the importance of the collision effects. A new neoclassical model including these effects has been developed and applied to this analysis. Fluctuation-induced transport studies have also been performed with a full 2-D poloidal cross-section analysis. Electrode biasing was used to induce rotation into the plasma. The data shows the fluctuation-induced transport to be poloidally asymmetric and dependent upon the location of the electron cyclotron resonance layer and the electrode biasing. The induced plasma ploidal flow changes the nominally outward fluctuation-induced transport to be inward by changing the phase relationship of the density and potential oscillations. The amplitude of the fluctuations is, in general, not reduced by the sheared poloidal flows. Computed Reynolds stress flows are comparable to those measured, but uncertainties in the data and its analysis on this drive mechanism for poloidal flow does not permit the authors to make definitive conclusions

  19. Effect of anomalous plasma transport on radial electric field in torsatron/heliotron

    International Nuclear Information System (INIS)

    Anomalous cross field plasma fluxes induced by the electric field fluctuations has been evaluated in a rotating plasma with shear flow in a helical system. The plasma rotation frequency due to the radial electric field makes the Doppler frequency shift which does not explicitly affect the cross field flux. The anomalous ion flux is evaluated by the ion curvature drift resonance continuum in the test particle model. The curvature drift resonance induces a new force term '/ which did not make large influence in the ion flux. The shear flow term in the anomalous flux combined with the electric field in neoclassical flux reduces to a first order differential equation which governs the radial profile of the electric field. A general exact analytical solution for the differential equation is derived and a simple approximate solution for the radial electric field is also given. Numerical results indicate that the shear flow effect is important for the anomalous cross field flux and for determination of the radial electric field particularly in the peripheral region. (author)

  20. Propagation and absorption of Ion Bernstein waves in U-2M torsatron by ray tracing technique

    International Nuclear Information System (INIS)

    Ion Bernstein modes with frequencies higher than the ion cyclotron frequency are planned to be applied to produce and heat the Uragan-2M plasma. This brief report gives the propagation and absorption ray-tracing studies of these waves in the Uragan-2M device, taking into account the three-dimensional non-uniformities of the plasma parameters and the magnetic field. 4 refs, 5 figs

  1. 直连式高空台试验中真空度与次流作用力校准的一种新方法%A New Measurement Method for the Action of the Secondary Flow and Vacuum in Direct-Connect ATF

    Institute of Scientific and Technical Information of China (English)

    刘志友; 吴锋; 仇钎

    2013-01-01

    Regarding the problems of measuring or calibrating both the vacuum-acting force and secondary flow-acting force coefficients with the accustomed method for a specific engine ATF test, through the analy⁃sis of the action on engine thrust measurement system of both air flow for cell-cooling and differential pres⁃sure between outdoor-cell and indoor-cell, a new measurement method is put forward which derived from their action mechanisms and the dependence relation between both acting force and engine gross thrust. Moreover, the new method can be used under lesser restricted condition and less cost in contrast to the rou⁃tine way. So there is certain reference value for engineering application.%  针对某发动机高空台试验难以用加装堵板的常规方法测定真空度与次流作用力系数的情况,通过高空舱内冷却空气流动与高空舱内外压差对发动机测力系统作用的分析,介绍了高空舱内真空度和次流对发动机台架测量推力影响的作用机理,并从真空度作用力和次流作用力与发动机总推力的关系出发,经理论推导提出了一种确定真空度与次流作用力系数的新方法。该方法使用限制条件少,试验经济性好,具有较强的工程应用参考价值。

  2. Design description of the Advanced Toroidal Facility

    International Nuclear Information System (INIS)

    The Advanced Toroidal Facility (ATF) is a large torsatron being designed at Oak Ridge National Laboratory (ORNL) to replace the Impurity Study Experiment (ISX-B) tokamak. ATF will have a major radius of 2.1 m and an average plasma minor radius of 0.3 m. Major components of the device include the coil sets, structure, and vacuum vessel. The coil sets are designed for broad operating envelopes, including the capability to drive up to 100 kA of plasma current, to produce helical axis configurations, and to operate continuously at one-half the baseline currents. The ATF structure consists of a 40-mm-thick stainless steel toroidal shell encasing the helical coil set. The shell is constructed from 24 identical upper and lower segments, with 12 pairs of intermediate panels to provide access to the helical field (HF) coil joints. The lower portion of the shell also serves as an assembly fixture for the HF coil set. The vacuum vessel is a highly contoured 6-mm-thick stainless steel shell closely fitting the bore and sidewalls of the HF coil winding to provide maximum volume for the plasma. Forty-eight large ports allow good access for diagnostics and neutral beam injection

  3. Design of a Nanometer Beam Size Monitor for ATF2

    CERN Document Server

    Suehara, Taikan; Yamanaka, Takashi; Yoda, Hakutaro; Nakamura, Tomoya; Kamiya, Yoshio; Honda, Yosuke; Kume, Tatsuya; Tauchi, Toshiaki; Sanuki, Tomoyuki; Komamiya, Sachio

    2008-01-01

    We developed an electron beam size monitor for extremely small beam sizes. It uses a laser interference fringe for a scattering target with the electron beam. Our target performance is < 2 nm systematic error for 37 nm beam size and < 10% statistical error in a measurement using 90 electron bunches for 25 - 6000 nm beam size. A precise laser interference fringe control system using an active feedback function is incorporated to the monitor to achieve the target performance. We describe an overall design, implementations, and performance estimations of the monitor.

  4. Staged electron laser accelerator (STELLA) experiment at brookhaven ATF

    Energy Technology Data Exchange (ETDEWEB)

    Pogorelsky, I.V.; Steenbergen, A. van; Gallardo, J.C. [Brookhaven National Lab., Upton, NY (United States)] [and others

    1998-03-01

    The STELLA experiment is being prepared at the BNL Accelerator Test Facility (STF). The goal of the experiment is to demonstrate quasi-monochromatic inverse Cherenkov acceleration (ICA) of electrons bunched to the laser wavelength period. Microbunches on the order of 2 {mu}m in length separated by 10.6 {mu}m will be produced using an inverse free electron laser (IFEL) accelerator driven by a CO{sub 2} laser. The design and simulations for two phases of this experiment including demonstration of 10 MeV and 100 MeV acceleration are presented. (author)

  5. Optical alignment and diagnostics for the ATF microundulator FEL oscillator

    International Nuclear Information System (INIS)

    The microundulator FEL oscillator has a wiggler period of 8.8 mm, and is designed for initial lasing at 0.5 microns with a 50 MeV electron beam. The design and performance of the optical diagnostics and alignment are discussed. A HeNe coalignment laser is mode-matched to the resonator cavity for transverse alignment. Interference fringes are observed in the cavity with a pellicle, allowing an alignment tolerance of +/- 10 micro-radians. The same pellicle is used to produce transition radiation by the electron beam. This enables precise transverse alignment of the electron beam to the resonator axis. The HeNe laser is also used to align the wiggler by backlighting its bore. This method aligns the wiggler to the optic axis to a tolerance of +/- 50 microns. A frequency-doubled,pulsed Nd:YAG laser that produces the electron bunch train is also mode-matched to the FEL cavity. The cavity length is adjusted to resonate with this pulse train. Light from the FEL is transported to the diagnostic room using two separate paths: one for the single pass spontaneous emission, and the second for the multipass cavity output. Several diagnostics (CCD camera, photodiode, photomultiplier tube, joulemeter, spectrometer, and streak camera) are used to characterize the light. These instruments measure light energy per micropulse ranging from 10 femto-Joules to 10 micro-Joules

  6. Improved models of β-limit, anomalous transport and radial electric field with loss cone loss in Heliotron/torsatron

    International Nuclear Information System (INIS)

    Theoretical study is made on the physics mechanisms which determine the beta-limit, the anomalous transport, and the radial electric field and loss cone. New theory is developed to analyze the stability boundary against the interchange mode in high-aspect-ratio toroidal helical plasmas, taking into account the transport processes. The stability β-limit is given at finite β-value, and the dependences on the plasma parameters and on the transport coefficient are investigated. It is found that the current-diffusive interchange mode is more important than the resistive mode in hot plasmas. The β-limit is predicted in the range of experimental observation for the anomalous transport. The dynamics of the pressure gradient and mode amplitude around this stability boundary are analysed. As the heating power is increased, the dynamics changes from the monotonous saturation, through the saturation with overshoot, and to the sawtoothing. Using the mean-field theory approach of statistical physics for the microscopic current-diffusive interchange mode, the anomalous transport theory is developed. The expression of the thermal transport coefficient is obtained. The pressure gradient, not the temperature itself, enhances the transport coefficient. Comparison with experimental observations from various aspects is made, and the model explains experimental observations. The method to obtain the self-consistent picture of the radial electric field Er and the loss cone loss is explored. The structure of Er and the loss cone are obtained, and it is confirmed that the direct ion loss makes Er near edge more negative. Effects of other nonclassical loss are also evaluated. (author)

  7. Transverse Laser Beam Shaping in High Brightness Electron Gun at ATF

    CERN Document Server

    Roychowdhury, S

    2005-01-01

    The brightness of electron beams from a photo injector is influenced by the transverse and longitudinal distribution of the laser beam illuminating the cathode. Previous studies at Brookhaven Accelerator Test Facility have shown that formation of an ideal e-beam with lowest transverse emittance requires uniform circular distribution of the emitted electrons. The use of the uniformly distributed power of the laser beam may not lead to that of the emitted electrons because of the non-uniform quantum efficiency. A proper shaping of the laser beam can compensate for this non-uniformity. In this paper we describe the use of digital light processing (DLP) technique based on digital mirror device (DMD) for spatial modulation of the laser beam, for measurements of the quantum efficiency map, and for creating the desirable e-beam density profiles. A DMD is aμelectronic mechanical system (MEMS) comprising of millions of highly reflectiveμmirrors controlled by underlying electronics. We present exper...

  8. ATF2 knockdown reinforces oxidative stress-induced apoptosis in TE7 cancer cells

    OpenAIRE

    Walluscheck, Diana; Poehlmann, Angela; Hartig, Roland; Lendeckel, Uwe; Schönfeld, Peter; Hotz-Wagenblatt, Agnes; Reissig, Kathrin; Bajbouj, Khuloud; Roessner, Albert; Schneider-Stock, Regine

    2013-01-01

    Cancer cells showing low apoptotic effects following oxidative stress-induced DNA damage are mainly affected by growth arrest. Thus, recent studies focus on improving anti-cancer therapies by increasing apoptosis sensitivity. We aimed at identifying a universal molecule as potential target to enhance oxidative stress-based anti-cancer therapy through a switch from cell cycle arrest to apoptosis. A cDNA microarray was performed with hydrogen peroxide-treated oesophageal squamous epithelial can...

  9. What the EWSR1-ATF1 Fusion has Taught Us About Hyalinizing Clear Cell Carcinoma

    OpenAIRE

    Tanguay, Jeff; Weinreb, Ilan

    2013-01-01

    Hyalinizing clear cell carcinoma (HCCC) is a unique low-grade tumor composed of cords and nests of clear cells in a hyalinized stroma that was first reported by Milchgrub et al. It was recognized as a separate entity from clear cell variants of epithelial-myoepithelial carcinoma, myoepithelial carcinoma and mucoepidermoid carcinoma. HCCC is included in a long list of clear cell-containing tumors of salivary gland, as well as odontogenic tumors and metastases (renal cell carcinoma). Up until n...

  10. ORMDL3 is an inducible lung epithelial gene regulating metalloproteases, chemokines, OAS, and ATF6

    OpenAIRE

    Miller, Marina; Tam, Arvin B.; Cho, Jae Youn; Doherty, Taylor A.; Pham, Alexa; Khorram, Naseem; Rosenthal, Peter; Mueller, James L.; Hoffman, Hal M.; Suzukawa, Maho; Niwa, Maho; Broide, David H.

    2012-01-01

    Orosomucoid like 3 (ORMDL3) has been strongly linked with asthma in genetic association studies, but its function in asthma is unknown. We demonstrate that in mice ORMDL3 is an allergen and cytokine (IL-4 or IL-13) inducible endoplasmic reticulum (ER) gene expressed predominantly in airway epithelial cells. Allergen challenge induces a 127-fold increase in ORMDL3 mRNA in bronchial epithelium in WT mice, with lesser 15-fold increases in ORMDL-2 and no changes in ORMDL-1. Studies of STAT-6–defi...

  11. Past Visits Present: TCF/LEFs Partner with ATFs for β-Catenin-Independent Activity

    OpenAIRE

    Grumolato, Luca; Liu, Guizhong; Haremaki, Tomomi; Mungamuri, Sathish Kumar; Mong, Phyllus; Akiri, Gal; Lopez-Bergami, Pablo; Arita, Adriana; Anouar, Youssef; Mlodzik, Marek; Ronai, Ze'ev A.; Brody, Joshua; Weinstein, Daniel C.; Aaronson, Stuart A.

    2013-01-01

    The role of Wnt signaling in embryonic development and stem cell maintenance is well established and aberrations leading to the constitutive up-regulation of this pathway are frequent in several types of human cancers. Upon ligand-mediated activation, Wnt receptors promote the stabilization of β-catenin, which translocates to the nucleus and binds to the T-cell factor/lymphoid enhancer factor (TCF/LEF) family of transcription factors to regulate the expression of Wnt target genes. When not bo...

  12. Elastic Modulus Measurement of ORNL ATF FeCrAl Alloys

    Energy Technology Data Exchange (ETDEWEB)

    Thompson, Zachary T. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Terrani, Kurt A. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Yamamoto, Yukinori [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

    2015-10-01

    Elastic modulus and Poisson’s ratio for a number of wrought FeCrAl alloys, intended for accident tolerant fuel cladding application, are determined via resonant ultrasonic spectroscopy. The results are reported as a function of temperature from room temperature to 850°C. The wrought alloys were in the fully annealed and unirradiated state. The elastic modulus for the wrought FeCrAl alloys is at least twice that of Zr-based alloys over the temperature range of this study. The Poisson’s ratio of the alloys was 0.28 on average and increased very slightly with increasing temperature.

  13. MicroRNA-34c Enhances Murine Male Germ Cell Apoptosis through Targeting ATF1

    OpenAIRE

    Liang, Xiaoxuan; Zhou, Doudou; Wei, Chao; Luo, Haoshu; Liu, Jiali; Fu, Rui; Cui, Sheng

    2012-01-01

    Background MicroRNAs (miRNAs) play vital regulatory roles in many cellular processes. The expression of miRNA (miR)-34c is highly enriched in adult mouse testis, but its roles and underlying mechanisms of action are not well understood. Methodology/Principal Findings In the present study, we show that miR-34c is detected in mouse pachytene spermatocytes and continues to be highly expressed in spermatids. To explore the specific functions of miR-34c, we have established an in vivo model by tra...

  14. Development of improved ATF engineering alloy - Mechanical testing of Phase 2 alloy

    Energy Technology Data Exchange (ETDEWEB)

    Anderoglu, Osman [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Lovato, Manuel L. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Maloy, Stuart Andrew [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2015-06-15

    In this report we present the results on the tensile testing of phase 2 FeCrAl alloys (Mo and Nb added for high temperature strength) developed at Oak Ridge National Laboratory. We also compare FeCrAl with MA956 which is an ODS FeCrAl.

  15. Boric Acid Causes ER Stress and Activates the eIF2alpha/ATF4 and ATF6 Branches of the Unfolded Protein Response in Prostate Cancer Cells and Using Toxicology in the Public Interest

    OpenAIRE

    Kobylewski, Sarah Ellen

    2012-01-01

    Nutritional chemoprevention is a growing area in the field of toxicology. What we do and do not eat has a major impact on the development of cancer. However, it is difficult to show a causal relationship between a natural product and cancer prevention because mechanistic biochemical data are often missing and animals studies can be inconclusive. Both determining and elucidating molecular mechanisms that modulate pathological endpoints are necessary components in the risk assessment process...

  16. Interaction between Drosophila bZIP proteins Atf3 and Jun prevents replacement of epithelial cells during metamorphosis

    Czech Academy of Sciences Publication Activity Database

    Sekyrová, Petra; Bohmann, D.; Jindra, Marek; Uhlířová, M.

    2010-01-01

    Roč. 137, č. 1 (2010), s. 141-150. ISSN 0950-1991 R&D Projects: GA MŠk 2B06129 Institutional research plan: CEZ:AV0Z50070508 Keywords : epithelial cell replacement * cell adhesion * epidermis Subject RIV: EA - Cell Biology Impact factor: 6.898, year: 2010

  17. 75 FR 47254 - Elimination of Firearms Transaction Record, ATF Form 4473 (Low Volume) (2008R-21P)

    Science.gov (United States)

    2010-08-05

    ... provisions of the Gun Control Act of 1968 (``the Act''), 18 U.S.C. chapter 44. Among other things, the Act..., there have been several legislative amendments to the Gun Control Act, which have resulted in...

  18. Finding ATF4/p75NTR/IL-8 Signal Pathway in Endothelial–Mesenchymal Transition by Safrole Oxide

    OpenAIRE

    Ge, Di; Jing, Qingchuan; Zhao, Wenbo; Yue, Hongwei; Su, Le; Zhang, ShangLi; Zhao, Jing

    2014-01-01

    Targeting the endothelial-to-mesenchymal transition (EndoMT) may be a novel therapeutic strategy for cancer and various diseases induced by fibrosis. We aimed to identify a small chemical molecule as an inducer of EndoMT and find a new signal pathway by using the inducer. Safrole oxide (SFO), 50 µg/ml, could most effectively induce EndoMT within 12 h. To understand the underlying molecular mechanism, we performed microarray, quantitative real-time PCR and western blot analysis to find key fac...

  19. An ATF/CREB site is the major regulatory element in the human herpesvirus 6 DNA polymerase promoter.

    OpenAIRE

    Agulnick, A D; Thompson, J R; Ricciardi, R P

    1994-01-01

    Human herpesvirus 6 (HHV-6) is a recently described T-cell pathogen whose medical relevance and molecular biology are just beginning to be addressed. As a first look at the regulation of viral genes, control of the HHV-6 DNA polymerase promoter was examined. Polymerase gene transcription in HHV-6-infected cells was found to initiate from a single site located 115 bases upstream of the translation start codon. A polymerase promoter-chloramphenicol acetyltransferase reporter gene construct fail...

  20. Local shear in general magnetic stellarator geometry

    International Nuclear Information System (INIS)

    There has been relatively little work on microturbulence in stellarators. Bhattacharjee et al. gave a purely numerical illustration of linear instability for the simplest cold ion electrostatic drift wave using a general magnetic geometry ballooning mode representation. This approach was recently extended by N. Dominguez et al. with emphasis on analytic formulas derived from a single stellarator harmonic and a treatment of dissipative helical well trapped electron modes. Neither paper treats the puzzling question: How are high-m modes radially localized in stellarators with weak or no global shear? Since diffusion is likely proportional to the square of radial mode widths, this is as important as determining the growth rate. This paper argues that modes are localized by local shear not global shear. Local shear arises from the fact that the helical ripple from the external coils providing the stellarator transform increase with radius. The authors note that local curvature from the helical ripple can localize the modes along the field lines. Thus they argue that stellarators with no global shear and favorable average curvature (W7-AS) should have the same basic transport as torsatrons (Heliotron and ATF) with global shear and average unfavorable curvature. In detail they derive a complete along the field line nonlinear ballooning mode formalism in magnetic coordinates for general stellarator geometry. They apply this to the case of a single helical harmonic. For illustration, they derive a formula for diffusion from collisionless helically trapped electrons modes proportional to the square of the local shear. The model diffusion matches the universal gyroBohm LHD stellarator scaling

  1. Prostaglandin F2a activates stress response signaling and induces expression of activating transcription factor 3 (ATF3) in bovine large luteal cells

    Science.gov (United States)

    The pulsatile uterine secretion of prostaglandin F2 alpha (PGF) triggers the regression of the corpus luteum (CL). Recent studies have explored global changes in gene expression in response to PGF that may contribute to structural and functional regression of the CL. Activating transcription facto...

  2. Contributing to the design of accident tolerant fuels by applying the TRANSURANUS fuel performance code. Contribution to the design of ATF by means of TRANSURANUS

    International Nuclear Information System (INIS)

    The TRANSURANUS fuel performance code is used by safety authorities, industry, research centre and universities in the EU and across the globe. Accordingly, only a very brief overview was provided about the structure of the code and the corresponding input requirements before summarising the needs for simulating new cladding materials such as those considered in the framework of the workshop by means of TRANSURANUS. Two concrete examples were then provided. The first deals with the implementation of the material properties from the CEA for SiC based cladding in the frame of the GoFASTR Project, which is funded by the EU. The second deals with material properties for T91, which have been implemented in the framework of a collaboration agreement between Politecnico di Milano and JRC-ITU. In order to illustrate the impact of replacing one cladding by another, an example irradiation has been selected, and some of the relevant cladding properties shown as a function of irradiation time when considering SiC-based cladding, T91 cladding, compared to standard zircaloy and stainless steel cladding. Finally, it was pointed out that despite the fact that the fuel performance codes may be very useful for the current scoping studies based on available material properties, there are limitations in terms of material properties under representative irradiation conditions, or in terms of representativeness for heterogeneous and anisotropic materials such as Complex Matrix Composite cladding materials (e.g. the so-called sandwiched SiCf-SiC material). More experimental data are therefore required for more refined and reliable predictions

  3. Hypoxia stimulates migration of breast cancer cells via the PERK/ATF4/LAMP3-arm of the unfolded protein response

    NARCIS (Netherlands)

    Nagelkerke, A.; Bussink, J.; Mujcic, H.; Wouters, B.G.; Lehmann, S.; Sweep, F.C.; Span, P.N.

    2013-01-01

    ABSTRACT: INTRODUCTION: The hypoxia-inducible factor (HIF)-1 pathway can stimulate tumor cell migration and metastasis. Furthermore, hypoxic tumors are associated with a poor prognosis. Besides the HIF-1 pathway, the unfolded protein response (UPR) is also induced by hypoxic conditions. The PKR-like

  4. Fuel behaviour in the case of severe accidents and potential ATF designs. Fuel Behavior in Severe Accidents and Potential Accident Tolerance Fuel Designs

    International Nuclear Information System (INIS)

    This presentation reviews the conditions of fuel rods under severe loss of coolant conditions, approaches that may increase coping time for plant operators to recover, requirements of advanced fuel cladding to increase tolerance in accident conditions, potential candidate alloys for accident-tolerant fuel cladding and a novel design of molybdenum (Mo) -based fuel cladding. The current Zr-alloy fuel cladding will lose all its mechanical strength at 750-800 deg. C, and will react rapidly with high-pressure steam, producing significant hydrogen and exothermic heat at 700-1000 deg. C. The metallurgical properties of Zr make it unlikely that modifications of the Zr-alloy will improve the behaviour of Zr-alloys at temperatures relevant to severe accidents. The Mo-based fuel cladding is designed to (1) maintain fuel rod integrity, and reduce the release rate of hydrogen and exothermic heat in accident conditions at 1200-1500 deg. C. The EPRI research has thus far completed the design concepts, demonstration of feasibility of producing very thin wall (0.2 mm) Mo tubes. The feasibility of depositing a protective coating using various techniques has also been demonstrated. Demonstration of forming composite Mo-based cladding via mechanical reduction has been planned

  5. Differences in Enzymatic Properties of the Saccharomyces kudriavzevii and Saccharomyces uvarum Alcohol Acetyltransferases and Their Impact on Aroma-Active Compounds Production

    Science.gov (United States)

    Stribny, Jiri; Querol, Amparo; Pérez-Torrado, Roberto

    2016-01-01

    Higher alcohols and acetate esters belong to the most important yeast secondary metabolites that significantly contribute to the overall flavor and aroma profile of fermented products. In Saccharomyces cerevisiae, esterification of higher alcohols is catalyzed mainly by the alcohol acetyltransferases encoded by genes ATF1 and ATF2. Previous investigation has shown other Saccharomyces species, e.g., S. kudriavzevii and S. uvarum, to vary in aroma-active higher alcohols and acetate esters formation when compared to S. cerevisiae. Here, we aimed to analyze the enzymes encoded by the ATF1 and ATF2 genes from S. kudriavzevii (SkATF1, SkATF2) and S. uvarum (SuATF1, SuATF2). The heterologous expression of the individual ATF1 and ATF2 genes in a host S. cerevisiae resulted in the enhanced production of several higher alcohols and acetate esters. Particularly, an increase of 2-phenylethyl acetate production by the strains that harbored ATF1 and ATF2 genes from S. kudriavzevii and S. uvarum was observed. When grown with individual amino acids as the nitrogen source, the strain that harbored SkATF1 showed particularly high 2-phenylethyl acetate production and the strains with introduced SkATF2 or SuATF2 revealed increased production of isobutyl acetate, isoamyl acetate, and 2-phenylethyl acetate compared to the reference strains with endogenous ATF genes. The alcohol acetyltransferase activities of the individual Atf1 and Atf2 enzymes measured in the cell extracts of the S. cerevisiae atf1 atf2 iah1 triple-null strain were detected for all the measured substrates. This indicated that S. kudriavzevii and S. uvarum Atf enzymes had broad range substrate specificity as S. cerevisiae Atf enzymes. Individual Atf1 enzymes exhibited markedly different kinetic properties since SkAtf1p showed c. twofold higher and SuAtf1p c. threefold higher Km for isoamyl alcohol than ScAtf1p. Together these results indicated that the differences found among the three Saccharomyces species during the

  6. Physical mechanism determining the radial electric field and its radial structure in a toroidal plasma

    International Nuclear Information System (INIS)

    Radial structures of plasma rotation and radial electric field are experimentally studied in tokamak, heliotron/torsatron and stellarator devices. The perpendicular and parallel viscosities are measured. The parallel viscosity, which is dominant in determining the toroidal velocity in heliotron/torsatron and stellarator devices, is found to be neoclassical. On the other hand, the perpendicular viscosity, which is dominant in dictating the toroidal rotation in tokamaks, is anomalous. Even without external momentum input, both a plasma rotation and a radial electric field exist in tokamaks and heliotrons/torsatrons. The observed profiles of the radial electric field do not agree with the theoretical prediction based on neoclassical transport. This is mainly due to the existence of anomalous perpendicular viscosity. The shear of the radial electric field improves particle and heat transport both in bulk and edge plasma regimes of tokamaks. (author) 95 refs

  7. Activating Transcription Factor 4 Confers a Multidrug Resistance Phenotype to Gastric Cancer Cells through Transactivation of SIRT1 Expression

    OpenAIRE

    Hongwu Zhu; Limin Xia; Yongguo Zhang; Honghong Wang; Wenjing Xu; Hao Hu; Jing Wang; Jing Xin; Yi Gang; Sumei Sha; Bin Xu; Daiming Fan; Yongzhan Nie; Kaichun Wu

    2012-01-01

    BACKGROUND: Multidrug resistance (MDR) in gastric cancer remains a major challenge to clinical treatment. Activating transcription factor 4 (ATF4) is a stress response gene involved in homeostasis and cellular protection. However, the expression and function of ATF4 in gastric cancer MDR remains unknown. In this study, we investigate whether ATF4 play a role in gastric cancer MDR and its potential mechanisms. METHODOLOGY/PRINCIPAL FINDINGS: We demonstrated that ATF4 overexpression confered th...

  8. Activating transcription factor 3 is a negative regulator of allergic pulmonary inflammation

    OpenAIRE

    Gilchrist, Mark; Henderson, William R.; Clark, April E.; Simmons, Randi M.; Ye, Xin; Smith, Kelly D.; Aderem, Alan

    2008-01-01

    We recently demonstrated the pivotal role of the transcription factor (TF) activating TF 3 (ATF3) in dampening inflammation. We demonstrate that ATF3 also ameliorates allergen-induced airway inflammation and hyperresponsiveness in a mouse model of human asthma. ATF3 expression was increased in the lungs of mice challenged with ovalbumin allergen, and this was associated with its recruitment to the promoters of genes encoding Th2-associated cytokines. ATF3-deficient mice developed significantl...

  9. The p-eIF2α/ATF4 pathway links endoplasmic reticulum stress to autophagy following the production of reactive oxygen species in mouse spermatocyte-derived cells exposed to dibutyl phthalate.

    Science.gov (United States)

    Zhang, Guowei; Ling, Xi; Liu, Kaijun; Wang, Zhi; Zou, Peng; Gao, Jianfang; Cao, Jia; Ao, Lin

    2016-07-01

    Dibutyl phthalate (DBP) is a widely used plasticizer that has been shown to induce germ cell apoptosis-related testicular atrophy and cause reproductive toxicity. Our previous results indicated that endoplasmic reticulum (ER) stress-activated autophagy served as a self-defense mechanism against DBP-induced germ cell apoptosis. However, the specific pathways that link ER stress and autophagy remain unclear. Here, we showed that exposure to DBP enhanced autophagic flux in mouse spermatocyte-derived GC-2 cells and that the eukaryotic translation initiation factor 2/activating transcription factor 4 pathway mediated ER stress-related autophagy independent of the mTOR and Beclin-1 pathways. Moreover, we demonstrated that DBP treatment led to the generation of reactive oxygen species (ROS) and that the inhibition of ROS by melatonin abrogated both ER stress and autophagy. The results indicated that excessive ROS production might be involved in DBP-induced ER stress and autophagy in GC-2 cells. Thus, ROS may serve as upstream mediators of ER stress and autophagy in DBP-treated GC-2 cells. PMID:27002192

  10. Suppression of magnetic surface breaking by simple extra coils in a finite beta equilibrium of helical system

    International Nuclear Information System (INIS)

    A simple method is proposed to suppress actively the breaking of magnetic surfaces which occurs in l = 2 Heliotron/Torsatron equilibria, by which fairly high beta equilibria with clearly nested magnetic surfaces can be realized without changing other physical properties such as the rotational transform profile and the well depth. (author)

  11. Poloidal rotation velocity measurement in toroidal plasmas via microwave reflectometry

    International Nuclear Information System (INIS)

    Results of experiment modeling backscattering of microwaves from rotating plasma layer perturbed by fluctuations are presented. It was shown that auto- and crosscorrelation of reflected power have a periodicity equal to rotation period. Such periodicity was observed by microwave reflectometry in experiments on RF plasma production on U-3M torsatron and was used for measurement of plasma poloidal rotation velocity. (author)

  12. Activating transcription factor 4 regulates osteoclast differentiation in mice

    OpenAIRE

    Cao, Huiling; Yu, Shibing; Yao, Zhi; Galson, Deborah L; Jiang, Yu; Zhang, Xiaoyan; Fan, Jie; Lu, Binfeng; Guan, Youfei; Luo, Min; Lai, Yumei; Zhu, Yibei; Kurihara, Noriyoshi; Patrene, Kenneth; Roodman, G. David

    2010-01-01

    Activating transcription factor 4 (ATF4) is a critical transcription factor for osteoblast (OBL) function and bone formation; however, a direct role in osteoclasts (OCLs) has not been established. Here, we targeted expression of ATF4 to the OCL lineage using the Trap promoter or through deletion of Atf4 in mice. OCL differentiation was drastically decreased in Atf4–/– bone marrow monocyte (BMM) cultures and bones. Coculture of Atf4–/– BMMs with WT OBLs or a high concentration of RANKL failed ...

  13. AcEST: DK954201 [AcEST

    Lifescience Database Archive (English)

    Full Text Available tion sp|Q9SM50|HY5_SOLLC Transcription factor HY5 OS=Solanum lycopersicum Align length 121 Score (bit) 117.0 E-value 4.0e-26 Repo...5R9C9|ATF7_PONAB Cyclic AMP-dependent transcription factor A... 54 1e-06 sp|Q8R0S...1|ATF7_MOUSE Cyclic AMP-dependent transcription factor A... 54 1e-06 sp|P17544|ATF7_HUMAN Cyclic AMP-depende...tein 3-... 49 2e-05 sp|Q00969|ATF2_RAT Cyclic AMP-dependent transcription factor ATF... 49 2e-05 sp|P16951|ATF2_MOUSE Cyclic AMP-dep...endent transcription factor A... 49 2e-05 sp|P15336|ATF2_HUMAN Cyclic AMP-depende

  14. Activating transcription factor 6 is necessary and sufficient for alcoholic fatty liver disease in zebrafish.

    Directory of Open Access Journals (Sweden)

    Deanna L Howarth

    Full Text Available Fatty liver disease (FLD is characterized by lipid accumulation in hepatocytes and is accompanied by secretory pathway dysfunction, resulting in induction of the unfolded protein response (UPR. Activating transcription factor 6 (ATF6, one of three main UPR sensors, functions to both promote FLD during acute stress and reduce FLD during chronic stress. There is little mechanistic understanding of how ATF6, or any other UPR factor, regulates hepatic lipid metabolism to cause disease. We addressed this using zebrafish genetics and biochemical analyses and demonstrate that Atf6 is necessary and sufficient for FLD. atf6 transcription is significantly upregulated in the liver of zebrafish with alcoholic FLD and morpholino-mediated atf6 depletion significantly reduced steatosis incidence caused by alcohol. Moreover, overexpression of active, nuclear Atf6 (nAtf6 in hepatocytes caused FLD in the absence of stress. mRNA-Seq and qPCR analyses of livers from five day old nAtf6 transgenic larvae revealed upregulation of genes promoting glyceroneogenesis and fatty acid elongation, including fatty acid synthase (fasn, and nAtf6 overexpression in both zebrafish larvae and human hepatoma cells increased the incorporation of 14C-acetate into lipids. Srebp transcription factors are key regulators of lipogenic enzymes, but reducing Srebp activation by scap morpholino injection neither prevented FLD in nAtf6 transgenics nor synergized with atf6 knockdown to reduce alcohol-induced FLD. In contrast, fasn morpholino injection reduced FLD in nAtf6 transgenic larvae and synergistically interacted with atf6 to reduce alcoholic FLD. Thus, our data demonstrate that Atf6 is required for alcoholic FLD and epistatically interacts with fasn to cause this disease, suggesting triglyceride biogenesis as the mechanism of UPR induced FLD.

  15. In Vitro Anticancer Activity of Phlorofucofuroeckol A via Upregulation of Activating Transcription Factor 3 against Human Colorectal Cancer Cells

    Directory of Open Access Journals (Sweden)

    Hyun Ji Eo

    2016-03-01

    Full Text Available Phlorofucofuroeckol A (PFF-A, one of the phlorotannins found in brown algae, has been reported to exert anti-cancer property. However, the molecular mechanism for the anti-cancer effect of PFF-A has not been known. Activating transcription factor 3 (ATF3 has been reported to be associated with apoptosis in colorectal cancer. The present study was performed to investigate the molecular mechanism by which PFF-A stimulates ATF3 expression and apoptosis in human colorectal cancer cells. PFF-A decreased cell viability through apoptosis of human colorectal cancer cells. PFF-A increased ATF3 expression through regulating transcriptional activity. The responsible cis-element for ATF3 transcriptional activation by PFF-A was cAMP response element binding protein (CREB, located between positions −147 and −85 of the ATF3 promoter. Inhibition of p38, c-Jun N-terminal kinases (JNK, glycogen synthase kinase (GSK 3β, and IκB kinase (IKK-α blocked PFF-A-mediated ATF3 expression. ATF3 knockdown by ATF3 siRNA attenuated the cleavage of poly (ADP-ribose polymerase (PARP by PFF-A, while ATF3 overexpression increased PFF-A-mediated cleaved PARP. These results suggest that PFF-A may exert anti-cancer property through inducing apoptosis via the ATF3-mediated pathway in human colorectal cancer cells.

  16. Activating Transcription Factor 3 regulates in part the enhanced tumour cell cytotoxicity of the histone deacetylase inhibitor M344 and cisplatin in combination

    Directory of Open Access Journals (Sweden)

    St Germain Carly

    2010-09-01

    Full Text Available Abstract Background Activating Transcription Factor (ATF 3 is a key regulator of the cellular integrated stress response whose expression has also been correlated with pro-apoptotic activities in tumour cell models. Combination treatments with chemotherapeutic drugs, such as cisplatin, and histone deacetylase (HDAC inhibitors have been demonstrated to enhance tumour cell cytotoxicity. We recently demonstrated a role for ATF3 in regulating cisplatin-induced apoptosis and others have shown that HDAC inhibition can also induce cellular stress. In this study, we evaluated the role of ATF3 in regulating the co-operative cytotoxicity of cisplatin in combination with an HDAC inhibitor. Results The HDAC inhibitor M344 induced ATF3 expression at the protein and mRNA level in a panel of human derived cancer cell lines as determined by Western blot and quantitative RT-PCR analyses. Combination treatment with M344 and cisplatin lead to increased induction of ATF3 compared with cisplatin alone. Utilizing the MTT cell viability assay, M344 treatments also enhanced the cytotoxic effects of cisplatin in these cancer cell lines. The mechanism of ATF3 induction by M344 was found to be independent of MAPKinase pathways and dependent on ATF4, a known regulator of ATF3 expression. ATF4 heterozygote (+/- and knock out (-/- mouse embryonic fibroblast (MEF as well as chromatin immunoprecipitation (ChIP assays were utilized in determining the mechanistic induction of ATF3 by M344. We also demonstrated that ATF3 regulates the enhanced cytotoxicity of M344 in combination with cisplatin as evidenced by attenuation of cytotoxicity in shRNAs targeting ATF3 expressing cells. Conclusion This study identifies the pro-apoptotic factor, ATF3 as a novel target of M344, as well as a mediator of the co-operative effects of cisplatin and M344 induced tumour cell cytotoxicity.

  17. Simultaneous saccharification and fermentation of Agave tequilana fructans by Kluyveromyces marxianus yeasts for bioethanol and tequila production.

    Science.gov (United States)

    Flores, Jose-Axel; Gschaedler, Anne; Amaya-Delgado, Lorena; Herrera-López, Enrique J; Arellano, Melchor; Arrizon, Javier

    2013-10-01

    Agave tequilana fructans (ATF) constitute a substrate for bioethanol and tequila industries. As Kluyveromyces marxianus produces specific fructanases for ATF hydrolysis, as well as ethanol, it can perform simultaneous saccharification and fermentation. In this work, fifteen K. marxianus yeasts were evaluated to develop inoculums with fructanase activity on ATF. These inoculums were added to an ATF medium for simultaneous saccharification and fermentation. All the yeasts, showed exo-fructanhydrolase activity with different substrate specificities. The yeast with highest fructanase activity in the inoculums showed the lowest ethanol production level (20 g/l). Five K. marxianus strains were the most suitable for the simultaneous saccharification and fermentation of ATF. The volatile compounds composition was evaluated at the end of fermentation, and a high diversity was observed between yeasts, nevertheless all of them produced high levels of isobutyl alcohol. The simultaneous saccharification and fermentation of ATF with K. marxianus strains has potential for industrial application. PMID:23941710

  18. Glomerular tubular balance: mediation by luminal hypotonicity.

    Science.gov (United States)

    Häberle, D A; Müller, U; Nagel, W

    1989-01-01

    Late proximal rat tubular segments were microperfused with slightly hypo- or hypertonic artificial late proximal tubular fluid (ATF) at low (11-13 nl/min) or high (30-38 nl/min) perfusion rates. Volume reabsorption, net chloride and solute reabsorption were measured as a function of length. In addition, the transepithelial resistance and voltage (Vte) were measured as a function of the applied osmotic gradient. Hypertonic solutions equilibrated to isotonicity by solute outflow rather than water influx. With hypertonic ATF the lumen positive Vte was decreased compared with free flow or with hypotonic ATF. The resistance was not significantly different between the different groups. In contrast to hypotonic ATF, hypertonic or isotonic ATF was not significantly reabsorbed. In addition, hypotonic ATF maintained its hypotonicity along the perfused segments. Its reabsorption was flow-dependent. Hypotonicity appeared to enhance solute reabsorption. PMID:2725432

  19. Proceedings of US-Japan heliotron-stellarator workshop: Volume 1

    International Nuclear Information System (INIS)

    This paper is the first of four volumes on the US-Japan Heliotron-Stellarator workshop. It contains talks on the Heliotron E experiment, the compact helical system (CHS) program, the status of the ATF project, the status of the W VII-AS, the status of the TJ-II program, the ATF experimental plans, the ATF diagnostics, the compact Helical system, and the CHS experimental program and diagnostics

  20. Crystal structure of the urokinase receptor in a ligand-free form

    DEFF Research Database (Denmark)

    Xu, Xiang; Gårdsvoll, Henrik; Yuan, Cai; Lin, Lin; Ploug, Michael; Huang, Mingdong

    2012-01-01

    -terminal fragment (ATF) to 3.2 Å. The structure of uPAR(H47C/N259C) in complex with ATF resembles the wild-type uPAR·ATF complex, demonstrating that these mutations do not perturb the uPA binding properties of uPAR. The present structure of uPAR(H47C/N259C) provides the first structural definition of uPAR in its...

  1. Proceedings of US-Japan heliotron-stellarator workshop: Volume 1

    Energy Technology Data Exchange (ETDEWEB)

    1987-01-01

    This paper is the first of four volumes on the US-Japan Heliotron-Stellarator workshop. It contains talks on the Heliotron E experiment, the compact helical system (CHS) program, the status of the ATF project, the status of the W VII-AS, the status of the TJ-II program, the ATF experimental plans, the ATF diagnostics, the compact Helical system, and the CHS experimental program and diagnostics. (LSP)

  2. Preliminary safety analysis of the PWR with accident-tolerant fuels during severe accident conditions

    International Nuclear Information System (INIS)

    Highlights: • Analysis of severe accident scenarios for a PWR fueled with ATF system is performed. • A large-break LOCA without ECCS is analyzed for the PWR fueled with ATF system. • Extended SBO cases are discussed for the PWR fueled with ATF system. • The accident-tolerance of ATF system for application in PWR is illustrated. - Abstract: Experience gained in decades of nuclear safety research and previous nuclear accidents direct to the investigation of passive safety system design and accident-tolerant fuel (ATF) system which is now becoming a hot research point in the nuclear energy field. The ATF system is aimed at upgrading safety characteristics of the nuclear fuel and cladding in a reactor core where active cooling has been lost, and is preferable or comparable to the current UO2–Zr system when the reactor is in normal operation. By virtue of advanced materials with improved properties, the ATF system will obviously slow down the progression of accidents, allowing wider margin of time for the mitigation measures to work. Specifically, the simulation and analysis of a large break loss of coolant accident (LBLOCA) without ECCS and extended station blackout (SBO) severe accident are performed for a pressurized water reactor (PWR) loaded with ATF candidates, to reflect the accident-tolerance of ATF

  3. Modular stellarator reactor: a fusion power plant

    International Nuclear Information System (INIS)

    A comparative analysis of the modular stellarator and the torsatron concepts is made based upon a steady-state ignited, DT-fueled, reactor embodiment of each concept for use as a central electric-power station. Parametric tradeoff calculations lead to the selection of four design points for an approx. 4-GWt plant based upon Alcator transport scaling in l = 2 systems of moderate aspect ratio. The four design points represent high-aspect ratio. The four design points represent high-(0.08) and low-(0.04) beta versions of the modular stellarator and torsatron concepts. The physics basis of each design point is described together with supporting engineering and economic analyses. The primary intent of this study is the elucidation of key physics and engineering tradeoffs, constraints, and uncertainties with respect to the ultimate power reactor embodiment

  4. Different approaches to the thermonuclear fusion problem

    International Nuclear Information System (INIS)

    Some alternative approaches to the problem of a controlled fusion are given in brief. Advantages, shortcomings and problems are considered while developing the following approaches: a corrugated torus, an astron, toroidal Z-pinch, a stellarator, a torsatron, a tormak, a topolotron, a surmak, fusion in a target, irradiated by an electron beam, a dense plasma focus, a compressed linear and fusion in a laser heating solenoid

  5. Design study of the large helical device

    International Nuclear Information System (INIS)

    The Large Helical Device (LHD) is a Heliotron/torsatron type superconducting helical fusion device, which is scheduled to be constructed by the newly established National Institute for Fusion Science as the major joint-university fusion research project. This report describes the design study of the LHD. Our goal is demonstration of high energy confinement and high β in the helical device, which is a necessary step toward a helical reactor system. (author)

  6. Active trajectory control for a heavy ion beam probe on the compact helical system

    International Nuclear Information System (INIS)

    A 200 keV heavy ion beam probe (HIBP) on the Compact Helical System torsatron/heliotron uses a newly proposed method in order to control complicated beam trajectories in non-axisymmetrical devices. As a result, the HIBP has successfully measured potential profiles of the toroidal helical plasma. The article will describe the results of the potential profile measurements, together with the HIBP hardware system and procedures to realize the method. (author)

  7. Transport barriers in helical systems

    International Nuclear Information System (INIS)

    There are some publications with indications that the formation of transport barriers in toroidal devices could take place in the vicinity of low order rational surfaces (RS). It is necessary to note that the environs of RS have very important peculiarities. In particular, a stochastic layer of magnetic field lines forms instead of separaterix which must separate the island surfaces from the adjacent to them non-island surfaces in stellarator magnetic configurations. The attempt to realize the formation of transport barriers near RS and to study their influence on the RF discharge plasma confinement was undertaken in presented experiments on the U-3M torsatron. The presupposition was made that the radial electric field profile would have sharp change on the width of stochastic layer near RS in the case of collisionless longitudinal motion of electrons in this layer. Experimental data obtained on the U-3M torsatron during the formation of interior and edge transport barriers are in a good agreement with this presupposition. The results of experiments on the U-3M torsatron are discussed in comparison with data of other helical systems. It is shown that the number of dependences (the threshold power and density, the time of barrier formation, the localization of radial electric field shear layer) are in a good agreement for all these systems. In conclusion, the common features of formation of transport barriers in non- axisymmetric and non-axisymmetric systems are discussed. (author)

  8. 77 FR 27001 - Proposed Establishment of the Ancient Lakes of Columbia Valley Viticultural Area

    Science.gov (United States)

    2012-05-08

    ... by T.D. ATF-190, which published in the Federal Register (49 FR 44895) on November 13, 1984. T.D. ATF... sandy Quincy fine sand...... Pits Shin very cobbly ashy loam. loam. 2 Esquatzel silt loam.... Malaga.......... Prosser very fine Adkins very fine sandy Malaga stony sandy sandy loam. loam. loam. To the north of...

  9. Activating transcription factor-3 induction is involved in the anti-inflammatory action of berberine in RAW264.7 murine macrophages.

    Science.gov (United States)

    Bae, Young-An; Cheon, Hyae Gyeong

    2016-07-01

    Berberine is an isoquinoline alkaloid found in Rhizoma coptidis, and elicits anti-inflammatory effects through diverse mechanisms. Based on previous reports that activating transcription factor-3 (ATF-3) acts as a negative regulator of LPS signaling, the authors investigated the possible involvement of ATF-3 in the anti-inflammatory effects of berberine. It was found berberine concentration-dependently induced the expressions of ATF-3 at the mRNA and protein levels and concomitantly suppressed the LPS-induced productions of proinflammatory cytokines (TNF-α, IL-6, and IL-1β). In addition, ATF-3 knockdown abolished the inhibitory effects of berberine on LPS-induced proinflammatory cytokine production, and prevented the berberine-induced suppression of MAPK phosphorylation, but had little effect on AMPK phosphorylation. On the other hand, the effects of berberine, that is, ATF-3 induction, proinflammatory cytokine inhibition, and MAPK inactivation, were prevented by AMPK knockdown, suggesting ATF-3 induction occurs downstream of AMPK activation. The in vivo administration of berberine to mice with LPS-induced endotoxemia increased ATF-3 expression and AMPK phosphorylation in spleen and lung tissues, and concomitantly reduced the plasma and tissue levels of proinflammatory cytokines. These results suggest berberine has an anti-inflammatory effect on macrophages and that this effect is attributable, at least in part, to pathways involving AMPK activation and ATF-3 induction. PMID:27382358

  10. 77 FR 33630 - Residency Requirements for Aliens Acquiring Firearms (2011R-23P)

    Science.gov (United States)

    2012-06-07

    ... for Aliens Acquiring Firearms (2011R-23P) AGENCY: Bureau of Alcohol, Tobacco, Firearms, and Explosives... (ATF) by removing the 90-day State residency requirement for aliens lawfully present in the United... permit ATF to impose a regulatory requirement that aliens lawfully present in the United States...

  11. 75 FR 3160 - Commerce in Explosives-Storage of Shock Tube With Detonators (2005R-3P)

    Science.gov (United States)

    2010-01-20

    ... and industry on a number of proposals to amend the regulations in part 555 (Notice No. 968, 68 FR 4406... ATF Notice No. 2 (68 FR 37109, June 23, 2003). ATF received approximately 1,640 comments in response... of Alcohol, Tobacco, Firearms, and Explosives 27 CFR Part 555 RIN 1140-AA30 Commerce in...

  12. A 55,000-60,000 Mr receptor protein for urokinase-type plasminogen activator. Identification in human tumor cell lines and partial purification

    DEFF Research Database (Denmark)

    Nielsen, L S; Kellerman, G M; Behrendt, N;

    1988-01-01

    The iodinated Mr approximately equal to 15,000 amino-terminal fragment (ATF) of the urokinase-type plasminogen activator (u-PA) molecule bound specifically to the cell surface of all of seven cultured human tumor cell lines studied. Cross-linking of iodinated ATF to the cell surface using a bifun...

  13. 75 FR 67663 - Labeling Imported Wines With Multistate Appellations (2008R-265P)

    Science.gov (United States)

    2010-11-03

    ... predecessor agency, the Bureau of Alcohol, Tobacco and Firearms (ATF), in T.D. ATF-53 (43 FR 37675), published... Alcohol and Tobacco Tax and Trade Bureau 27 CFR Part 4 RIN 1513-AB58 Labeling Imported Wines With... the wine labeling regulations to allow the labeling of imported wines with multistate appellations...

  14. 76 FR 52862 - Time for Payment of Certain Excise Taxes, and Quarterly Excise Tax Payments for Small Alcohol...

    Science.gov (United States)

    2011-08-24

    ..., 1995, ATF published a temporary rule (T.D. ATF-365) in the Federal Register at 60 FR 33665, to... Federal Register (71 FR 5598) a temporary rule, T.D. TTB-41, that amended 27 CFR parts 19, 24, 25, 26, and... January 20, 2011, TTB published in the Federal Register (76 FR 3502) a temporary rule, T.D. TTB-89,...

  15. Interrogation of Related Clinical Pan-Azole-Resistant Aspergillus fumigatus Strains: G138C, Y431C, and G434C Single Nucleotide Polymorphisms in cyp51A, Upregulation of cyp51A, and Integration and Activation of Transposon Atf1 in the cyp51A Promoter ▿ †

    OpenAIRE

    Albarrag, Ahmed M.; Anderson, Michael J.; Howard, Susan J.; Robson, Geoff D.; Warn, Peter A.; Sanglard, Dominique; David W Denning

    2011-01-01

    Multiple Aspergillus fumigatus isolates from a patient with two aspergillomas complicating chronic pulmonary aspergillosis were pan-azole resistant. Microsatellite typing was identical for all isolates despite major phenotypic and some growth rate differences. Three different cyp51A mutations were found (G138C, Y431C, and G434C), of which the first two were demonstrated by heterologous expression in a hypersusceptible Saccharomyces cerevisiae strain to be at least partly responsible for eleva...

  16. Status of the visible Free-Electron Laser at the Brookhaven Accelerator Test Facility

    International Nuclear Information System (INIS)

    The 500 nm Free-Electron Laser (ATF) of the Brookhaven National Laboratory is reviewed. We present an overview of the ATF, a high-brightness, 50-MeV, electron accelerator and laser complex which is a users' facility for accelerator and beam physics. A number of laser acceleration and FEL experiments are under construction at the ATF. The visible FEL experiment is based on a novel superferric 8.8 mm period undulator. The electron beam parameters, the undulator, the optical resonator, optical and electron beam diagnostics are discussed. The operational status of the experiment is presented. 22 refs., 7 figs

  17. Peripheral plasma characteristics near LCMS in URAGAN-3M

    International Nuclear Information System (INIS)

    The study of peripheral plasma parameters and of physical processes in this plasma will enable in particular to find out the mechanisms responsible for particle and energy transport from the confinement volume. The investigating of main peripheral plasma parameters in the URAGAN-3M (U-3M) torsatron was carried out when the bulk plasma was produced and heated in ICR conditions. The radial density, electron temperature, and floating potential profiles near the last closed magnetic surface (LCMS) have been measured at the active stage of the discharge. In particular, the effect of RF fields on generation of an additional positive potential near the LCMS has been shown. 11 refs, 4 figs

  18. Theoretical prediction of bootstrap current in the large helical device with unbalanced helical coil currents

    International Nuclear Information System (INIS)

    The Large Helical Device (LHD), which is a heliotron/torsatron device with two helical coils, is designed so that the current in each helical coil can be controlled independently. Unbalancing these currents leads to spatial axis configurations. The bootstrap current is found to be strongly affected by any imbalance between these currents. When the ratio of the currents in the two helical coils is small enough, a bootstrap current flows in a direction so as to decrease the rotational transform because of the enhancement of the bumpiness component of the magnetic field as well as of the spatial axis component. This leads to improved stability. (author). 17 refs, 9 figs

  19. Development and Testing of Atomic Beam-Based Plasma Edge Diagnostics in the CIEMAT Fusion Devices

    International Nuclear Information System (INIS)

    In this report the development of plasma edge diagnostic based on atomic beam techniques fir their application in the CIEMAT fusion devices is described. The characterisation of the beams in laboratory experiments at the CSIC, together with first results in the Torsatron TJ-II are reported. Two types of beam diagnostics have been developed: a thermal (effusive) Li and a supersonic, pulsed He beams. This work has been carried out in collaboration between the institutions mentioned above under partial financial support by EURATOM. (Author) 17 refs

  20. Advanced fusion concepts: project summaries

    International Nuclear Information System (INIS)

    This report contains descriptions of the activities of all the projects supported by the Advanced Fusion Concepts Branch of the Office of Fusion Energy, US Department of Energy. These descriptions are project summaries of each of the individual projects, and contain the following: title, principle investigators, funding levels, purpose, approach, progress, plans, milestones, graduate students, graduates, other professional staff, and recent publications. Information is given for each of the following programs: (1) reverse-field pinch, (2) compact toroid, (3) alternate fuel/multipoles, (4) stellarator/torsatron, (5) linear magnetic fusion, (6) liners, and (7) Tormac

  1. Creation of low density starting plasma with small frame antenna at Uragan-3M device

    International Nuclear Information System (INIS)

    Deficient shot-to-shot stability of Uragan-3M discharges makes difficult to reproduce experimental results over the period of experimental session. An efficient way of reducing difference between shots is creation of initial low density plasma before the main discharge to start up. A RF pre-ionization in the same frequency range as that of the main discharge is used in the Uragan-3M torsatron. The pre-ionization provides stable discharges during the whole experimental campaign. The main parameters of the pre-ionization plasma are measured and discussed

  2. Modular coils: a promising toroidal-reactor-coil system

    International Nuclear Information System (INIS)

    The concept of modular coils originated from a need to find reactor-relevant stellarator windings, but its usefulness can be extended to provide an externally applied, additional rotational transform in tokamaks. Considerations of (1) basic principles of modular coils, (2) types of coils, (3) types of configurations (general, helically symmetric, helically asymmetric, with magnetic well, with magnetic hill), (4) types of rotational transform profile, and (5) structure and origin of ripples are given. These results show that modular coils can offer a wide range of vacuum magnetic field configurations, some of which cannot be obtained with the classical stellarator or torsatron coil configuration

  3. Plasma exposure tests of a carbon fiber/epoxy composite

    International Nuclear Information System (INIS)

    An experiment was conducted to test the exposure of a vacuum chamber made of a carbon fiber/epoxy composite to a plasma environment. In previous tests this material(CE 339, made by Ferro Corp.) has shown good vacuum properties and has also demonstrated the capability to withstand high energy electron beams in tests at the Naval Research Laboratory. Based on these promising results, the Torsatron Group at Auburn University conducted plasma exposure tests on a section of carbon fiber/epoxy composite pipe furnished by Oak Ridge National Laboratory. 1 ref, 2 figs

  4. Advanced fusion concepts: project summaries

    Energy Technology Data Exchange (ETDEWEB)

    None

    1980-12-01

    This report contains descriptions of the activities of all the projects supported by the Advanced Fusion Concepts Branch of the Office of Fusion Energy, US Department of Energy. These descriptions are project summaries of each of the individual projects, and contain the following: title, principle investigators, funding levels, purpose, approach, progress, plans, milestones, graduate students, graduates, other professional staff, and recent publications. Information is given for each of the following programs: (1) reverse-field pinch, (2) compact toroid, (3) alternate fuel/multipoles, (4) stellarator/torsatron, (5) linear magnetic fusion, (6) liners, and (7) Tormac. (MOW)

  5. 75 FR 1085 - Commerce in Explosives; List of Explosive Materials (2009R-18T)

    Science.gov (United States)

    2010-01-08

    ... 31, 2008 (Docket No. ATF 28N, 73 FR 80428). Notice of List of Explosive Materials Pursuant to 18 U.S... tetrazene hydrate]. Tetrazole explosives. Tetryl . Tetrytol. Thickened inorganic oxidizer salt...

  6. 76 FR 64974 - Commerce in Explosives; List of Explosive Materials (2011R-18T)

    Science.gov (United States)

    2011-10-19

    ... Explosive Materials dated November 17, 2010 (Docket No. ATF 42N, 75 FR 70291). Notice of List of Explosive... tetrazene hydrate]. Tetrazole explosives. Tetryl . Tetrytol. Thickened inorganic oxidizer salt...

  7. 78 FR 64246 - Commerce in Explosives; List of Explosives Materials

    Science.gov (United States)

    2013-10-28

    ... supersedes the List of Explosives Materials dated September 20, 2012 (Docket No. ATF 47N, 77 FR 58410.... Tetrazene [tetracene, tetrazine, 1(5-tetrazolyl)-4-guanyl tetrazene hydrate]. Tetrazole explosives....

  8. 76 FR 35016 - Agency Information Collection Activities; Proposed Collection; Comments Requested: Investigator...

    Science.gov (United States)

    2011-06-15

    ... Collection; Comments Requested: Investigator Integrity Questionnaire ACTION: 30-Day Notice and request for... Form/Collection: Investigator Integrity Questionnaire. (3) Agency form number, if any, and the... ATF utilizes the services of contract investigators to conduct security/suitability investigations...

  9. Rice8987 g_array: cDNA information: 6215 [

    Lifescience Database Archive (English)

    Full Text Available g_6215 EH1840 >ATF28M20_6(AL031004|pid:g3281853) Arabidopsis thaliana DNA chromosome 4, BAC clon ... icago sativa, PID:g2582800; Contains Mitochondrial energy ... transfer proteins signature [PEEGAKRLMM], Protein ...

  10. Rice8987 g_array: cDNA information: 6747 [

    Lifescience Database Archive (English)

    Full Text Available g_6747 SA0156 >ATF28M20_6(AL031004|pid:g3281853) Arabidopsis thaliana DNA chromosome 4, BAC clon ... icago sativa, PID:g2582800; Contains Mitochondrial energy ... transfer proteins signature [PEEGAKRLMM], Protein ...

  11. Rice8987 g_array: cDNA information: 1242 [

    Lifescience Database Archive (English)

    Full Text Available g_1242 CE0624 >ATF28M20_6(AL031004|pid:g3281853) Arabidopsis thaliana DNA chromosome 4, BAC clon ... icago sativa, PID:g2582800; Contains Mitochondrial energy ... transfer proteins signature [PEEGAKRLMM], Protein ...

  12. 75 FR 9827 - Proposed Expansion of the Santa Maria Valley Viticultural Area (2008R-287P)

    Science.gov (United States)

    2010-03-04

    ... predecessor agency, published T.D. ATF-89 in the Federal Register (46 FR 39811), establishing the Santa Maria...-northwest in a straight line approximately 6 miles onto the Sisquoc quadrangle map to the Gato Ridge...

  13. Engineering an allosteric transcription factor to respond to new ligands.

    Science.gov (United States)

    Taylor, Noah D; Garruss, Alexander S; Moretti, Rocco; Chan, Sum; Arbing, Mark A; Cascio, Duilio; Rogers, Jameson K; Isaacs, Farren J; Kosuri, Sriram; Baker, David; Fields, Stanley; Church, George M; Raman, Srivatsan

    2016-02-01

    Genetic regulatory proteins inducible by small molecules are useful synthetic biology tools as sensors and switches. Bacterial allosteric transcription factors (aTFs) are a major class of regulatory proteins, but few aTFs have been redesigned to respond to new effectors beyond natural aTF-inducer pairs. Altering inducer specificity in these proteins is difficult because substitutions that affect inducer binding may also disrupt allostery. We engineered an aTF, the Escherichia coli lac repressor, LacI, to respond to one of four new inducer molecules: fucose, gentiobiose, lactitol and sucralose. Using computational protein design, single-residue saturation mutagenesis or random mutagenesis, along with multiplex assembly, we identified new variants comparable in specificity and induction to wild-type LacI with its inducer, isopropyl β-D-1-thiogalactopyranoside (IPTG). The ability to create designer aTFs will enable applications including dynamic control of cell metabolism, cell biology and synthetic gene circuits. PMID:26689263

  14. Steam Oxidation of FeCrAl and SiC in the Severe Accident Test Station (SATS)

    Energy Technology Data Exchange (ETDEWEB)

    Pint, Bruce A. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Unocic, Kinga A. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Terrani, Kurt A. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

    2015-08-01

    Numerous research projects are directed towards developing accident tolerant fuel (ATF) concepts that will enhance safety margins in light water reactors (LWR) during severe accident scenarios. In the U.S. program, the high temperature steam oxidation performance of ATF solutions has been evaluated in the Severe Accident Test Station (SATS) at Oak Ridge National Laboratory (ORNL) since 2012 [1-3] and this facility continues to support those efforts in the ATF community. Compared to the current UO2/Zr-based alloy fuel system, alternative cladding materials can offer slower oxidation kinetics and a smaller enthalpy of oxidation that can significantly reduce the rate of heat and hydrogen generation in the core during a coolant-limited severe accident [4-5]. Thus, steam oxidation behavior is a key aspect of the evaluation of ATF concepts. This report summarizes recent work to measure steam oxidation kinetics of FeCrAl and SiC specimens in the SATS.

  15. Activating transcription factor 3 is not up-regulated in hypospadias patients in Japan

    OpenAIRE

    Toshiaki Takahashi; Akihiro Shimotakahara; Katsumi Miyahara; Geoffrey J Lane; Atsuyuki Yamataka

    2013-01-01

    Background: The aetiology of hypospadias is largely uncharacterized. Some of the researchers have advocated that activating transcription factor 3 (ATF3), an oestrogen-responsive transcription factor, is up-regulated in patients with hypospadias. The purpose is to evaluate the universality of this fact; we studied the expression of ATF3 protein in prepuce tissue obtained from hypospadias and phimosis patients living in metropolitan Tokyo. Materials and Methods: Prepuce tissue was obtained fro...

  16. Parathyroid Hormone Increases Activating Transcription Factor 4 Expression and Activity in Osteoblasts: Requirement for Osteocalcin Gene Expression

    OpenAIRE

    Yu, Shibing; Franceschi, Renny T; Luo, Min; Zhang, Xiaoyan; Jiang, Di; Lai, Yumei; Jiang, Yu; Zhang, Jian; Xiao, Guozhi

    2008-01-01

    PTH is an important peptide hormone regulator of calcium homeostasis and osteoblast function. However, its mechanism of action in osteoblasts is poorly understood. Our previous study demonstrated that PTH activates mouse osteocalcin (Ocn) gene 2 promoter through the osteoblast-specific element 1 site, a recently identified activating transcription factor-4 (ATF4) -binding element. In the present study, we examined effects of PTH on ATF4 expression and activity as well as the requirement for A...

  17. STELLA experiment—microbunch diagnostic

    Science.gov (United States)

    He, P.; Liu, Y.; Cline, D. B.; Babzien, M.; Gallardo, J. C.; Kusche, K. P.; Pogorelsky, I. V.; Skaritka, J.; van Steenbergen, A.; Yakimenko, V.; Kimura, W. D.

    1999-07-01

    A microbunch diagnostic system is built at the Accelerator Test Facility (ATF) of Brookhaven National Laboratory for monitoring microbunches (10-fs bunch length) produced by the Inverse Free Electron Laser accelerator in Staged Electron Laser Acceleration experiment. It is similar to one already demonstrated at the ATF. With greatly improved beam optics conditions higher order harmonic coherent transition radiation will be measurable to determine the microbunch length and shape.

  18. Psychological Stress, Cocaine and Natural Reward Each Induce Endoplasmic Reticulum Stress Genes in Rat Brain

    OpenAIRE

    Pavlovsky, Ashly A.; Boehning, Darren; Li, Dingge; Zhang, Yafang; Fan, Xiuzhen; Green, Thomas A

    2013-01-01

    Our prior research has shown that the transcription of endoplasmic reticulum (ER) stress transcription factors Activating Transcription Factor 3 (ATF3) and ATF4 are induced by amphetamine and restraint stress in rat striatum. However, presently it is unknown the full extent of ER stress responses to psychological stress or cocaine, and which of the three ER stress pathways is activated. The current study examines transcriptional responses of key ER stress target genes subsequent to psychologi...

  19. Present status and first results of the final focus beam line at the KEK Accelerator Test Facility

    CERN Document Server

    Bambade, P; Amann, J; Angal-Kalinin, D; Apsimon, R; Araki, S; Aryshev, A; Bai, S; Bellomo, P; Bett, D; Blair, G; Bolzon, B; Boogert, S; Boorman, G; Burrows, P N; Christian, G; Coe, P; Constance, B; Delahaye, J P; Deacon, L; Elsen, E; Faus-Golfe, A; Fukuda, M; Gao, J; Geffroy, N; Gianfelice-Wendt, E; Guler, H; Hayano, H; Heo, A Y; Honda, Y; Huang, J Y; Hwang, W H; Iwashita, Y; Jeremie, A; Jones, J; Kamiya, Y; Karataev, P; Kim, E S; Kim, H S; Kim, S H; Komamiya, S; Kubo, K; Kume, T; Kuroda, S; Lam, B; Lyapin, A; Masuzawa, M; McCormick, D; Molloy, S; Naito, T; Nakamura, T; Nelson, J; Okamoto, D; Okugi, T; Oroku, M; Park, Y J; Parker, B; Paterson, E; Perry, C; Pivi, M; Raubenheimer, T; Renier, Y; Resta-Lopez, J; Rimbault, C; Ross, M; Sanuki, T; Scarfe, A; Schulte, D; Seryi, A; Spencer, C; Suehara, T; Sugahara, R; Swinson, C; Takahashi, T; Tauchi, T; Terunuma, N; Tomas, R; Urakawa, J; Urner, D; Verderi, M; Wang, M H; Warden, M; Wendt, M; White, G; Wittmer, W; Wolski, A; Woodley, M; Yamaguchi, Y; Yamanaka, T; Yan, Y; Yoda, H; Yokoya, K; Zhou, F; Zimmermann, F

    2010-01-01

    ATF2 is a final-focus test beam line which aims to focus the low emittance beam from the ATF damping ring to a vertical size of about 37 nm and to demonstrate nanometer level beam stability. Several advanced beam diagnostics and feedback tools are used. In December 2008, construction and installation were completed and beam commissioning started, supported by an international team of Asian, European, and U.S. scientists. The present status and first results are described.

  20. Comparative characteristics of the radioprotective effect of some radioprotectors on chromosomal changes in human peripheral blood

    International Nuclear Information System (INIS)

    Comparative in vitro study of the radioprotective capabilities of the preparation Adeturon and its constituting ptotectors (AET and ATF-2Na) and the mechanical mixture of AET and ATF-2Na on radiation injury to hereditary structures of peripheral human blood lymphocytes was carried out. To this end, 15 minutes before irradiation the whole peripheral human blood was added 200 mcg/ml AET, 550 mcg/ml ATF-2Na, mechanical combination of 542 mcg/ml ATF-2Na and 245 mcg/ml AET, respectively Adeturon in a dose of 550 mcg/ml. The quantitative proportions between AET and ATF-2Na in the mechanical mixture, respectively when administered alone, were the same as in Adeturon. Cytogenetic analysis of metaphase figures was carried out after 51 hours' cultivation. It was found that AET and the mechanical combination had no radioprotective effect upon irradiation with 93 rad. Only Adeturone displayed a distinct radioprotective effect to this dose. The radioprotective effect of AET to gamma-irradiation with doses from 188 to 372 rad was the same as that of the mechanical combination. After irradiation with 558 rad the radioprotective effect of the mechanical combination was inferior to that of AET alone. ATF-2Na, administered alone or in combination with AET, produced no radioprotective effect. Highest were the radioprotective capabilities of Adeturone. For the different chromosomal injuries its radioprotective effect was from 1.6 to 4.7 times higher than that of AET or the mechanical mixture of AET and ATF-2Na. It is therefore concluded that the radioprotective effect of Adeturone is a consequence of molecular binding between AET and ATF-2Na. (A.B.)

  1. Endoplasmic reticulum stress in periimplantation embryos

    OpenAIRE

    Michalak, Marek; Gye, Myung Chan

    2015-01-01

    Stress coping mechanisms are critical to minimize or overcome damage caused by ever changing environmental conditions. They are designed to promote cell survival. The unfolded protein response (UPR) pathway is mobilized in response to the accumulation of unfolded proteins, ultimately in order to regain endoplasmic reticulum (ER) homeostasis. Various elements of coping responses to ER stress including Perk, Ask1, Bip, Chop, Gadd34, Ire1, Atf4, Atf6, and Xbp1 have been identified and were found...

  2. Proceedings of US-Japan heliotron-stellarator workshop: Volume 2

    International Nuclear Information System (INIS)

    This paper is the second of four volumes on the US-Japan Heliotron-Stellarator workshop. It contains talks on the following: Ripple Transport at Arbitrary Collision Frequency, Transport Scaling in the Collisionless-Detrapping Regime, Transport Analysis for Heliotron E, Transport Analysis for ATF, Simulation Analysis of Heating and Transport, Analysis of W VII-A Data, Numerical Study of Fast Ion Confinement, Benchmarks of NBI Codes for Stellarators, ECH Commissioning and Plans for ATF, and ECH and ICH Startup Analysis

  3. Present Status And First Results of the Final Focus Beam Line at the KEK Accelerator Test Facility

    Energy Technology Data Exchange (ETDEWEB)

    Bambade, P.; /Orsay /KEK, Tsukuba; Alabau Pons, M.; /Valencia U., IFIC; Amann, J.; /SLAC; Angal-Kalinin, D.; /Daresbury; Apsimon, R.; /Oxford U., JAI; Araki, S.; Aryshev, A.; /KEK, Tsukuba; Bai, S.; /Beijing, Inst. High Energy Phys.; Bellomo, P.; /SLAC; Bett, D.; /Oxford U., JAI; Blair, G.; /Royal Holloway, U. of London; Bolzon, B.; /Savoie U.; Boogert, S.; Boorman, G.; /Royal Holloway, U. of London; Burrows, P.N.; Christian, G.; Coe, P.; Constance, B.; /Oxford U., JAI; Delahaye, Jean-Pierre; /CERN; Deacon, L.; /Royal Holloway, U. of London; Elsen, E.; /DESY /Valencia U., IFIC /KEK, Tsukuba /Beijing, Inst. High Energy Phys. /Savoie U. /Fermilab /Ecole Polytechnique /KEK, Tsukuba /Kyungpook Natl. U. /KEK, Tsukuba /Pohang Accelerator Lab. /Kyoto U., Inst. Chem. Res. /Savoie U. /Daresbury /Tokyo U. /Royal Holloway, U. of London /Kyungpook Natl. U. /Pohang Accelerator Lab. /Tokyo U. /KEK, Tsukuba /SLAC /University Coll. London /KEK, Tsukuba /SLAC /Royal Holloway, U. of London /KEK, Tsukuba /Tokyo U. /SLAC /Tohoku U. /KEK, Tsukuba /Tokyo U. /Pohang Accelerator Lab. /Brookhaven /SLAC /Oxford U., JAI /SLAC /Orsay /KEK, Tsukuba /Oxford U., JAI /Orsay /Fermilab /Tohoku U. /Manchester U. /CERN /SLAC /Tokyo U. /KEK, Tsukuba /Oxford U., JAI /Hiroshima U. /KEK, Tsukuba /CERN /KEK, Tsukuba /Oxford U., JAI /Ecole Polytechnique /SLAC /Oxford U., JAI /Fermilab /SLAC /Liverpool U. /SLAC /Tokyo U. /SLAC /Tokyo U. /KEK, Tsukuba /SLAC /CERN

    2011-11-11

    ATF2 is a final-focus test beam line which aims to focus the low emittance beam from the ATF damping ring to a vertical size of about 37 nm and to demonstrate nanometer level beam stability. Several advanced beam diagnostics and feedback tools are used. In December 2008, construction and installation were completed and beam commissioning started, supported by an international team of Asian, European, and U.S. scientists. The present status and first results are described.

  4. Intermedin/adrenomedullin 2 is a stress-inducible gene controlled by activating transcription factor 4.

    Science.gov (United States)

    Kovaleva, Irina E; Garaeva, Alisa A; Chumakov, Peter M; Evstafieva, Alexandra G

    2016-09-15

    Intermedin or adrenomedullin 2 is a set of calcitonin-related peptides with a putative tumor angiogenesis promoting activity that are formed by proteolytic processing of the ADM2 gene product. It has been proposed that the ADM2 gene is regulated by the estrogen response element (ERE) and hypoxia response elements (HRE) found within its promoter region. In the present study we reveal a functional mechanism by which ADM2 participates in the unfolded protein response (UPR) and in responses to the mitochondrial respiration chain inhibition. We show that the ADM2 gene is controlled by activating transcription factor 4 (ATF4), the principal regulator of the integrated stress response (ISR). The upregulation of ADM2 mRNA could be prevented by the pharmacological ISR inhibitor ISRIB and by the downregulation of ATF4 with specific shRNA, while ectopic expression of ATF4 cDNA resulted in a notable increase in ADM2 gene transcription. A potential ATF4-binding site was identified in the coding region of the ADM2 gene and the requirement of this site during the ATF4-mediated ADM2 gene promoter activation was validated by the luciferase reporter assay. Mutagenesis of the putative ATF4-response element prevented the induction of luciferase activity in response to ATF4 overproduction, as well as in response to mitochondrial electron transfer chain inhibition by piericidin A and ER stress induction by tunicamycin and brefeldin A. Since ADM2 was shown to inhibit ATF4 expression during myocardial ER stress, a feedback mechanism could be proposed for the ADM2 regulation under ER stress conditions. PMID:27328454

  5. Beam test of multi-bunch energy compensation system in the accelerator test facility at KEK

    International Nuclear Information System (INIS)

    A beam test of the multi-bunch energy compensation system (ECS) was performed using the ΔF method with the 2856±4.327 HMz accelerating structures in the accelerator test facility (ATF) at KEK. The 1.54 GeV S-band linac of the ATF was designed to accelerate a multi-bunch beam the consists of 20 bunches with 2.8 ns spacing. The multi-bunch beam with 2.0 x 1010 electrons/bunch has an energy deviation of about 8.5% at the end of the linac due to transient beam loading without ECS. The ATF linac is the injector of the ATF damping ring (DR), whose energy acceptance is ±0.5%. The beam loading compensation system is necessary in the ATF linac for the successful injection of multi-bunch into DR. The rf system of the linac consists of 8 regular rf units with the SLED system and 2 ECS rf units without the SLED system. The accelerating structures of the regular units are driven at 2856 MHz and the 2 ECS structures are operated with slightly different rf frequencies of 2856±4.327 MHz. In the beam test, we have succeeded in compressing the multi-bunch energy spread within the energy acceptance of the DR using ΔF ECS. The principle of the beam loading compensation system of KEK-ATF and the experimental results are described in this paper. (author)

  6. Convective Heat Transfer Coefficients of Automatic Transmission Fluid Jets with Implications for Electric Machine Thermal Management: Preprint

    Energy Technology Data Exchange (ETDEWEB)

    Bennion, Kevin; Moreno, Gilberto

    2015-09-29

    Thermal management for electric machines (motors/ generators) is important as the automotive industry continues to transition to more electrically dominant vehicle propulsion systems. Cooling of the electric machine(s) in some electric vehicle traction drive applications is accomplished by impinging automatic transmission fluid (ATF) jets onto the machine's copper windings. In this study, we provide the results of experiments characterizing the thermal performance of ATF jets on surfaces representative of windings, using Ford's Mercon LV ATF. Experiments were carried out at various ATF temperatures and jet velocities to quantify the influence of these parameters on heat transfer coefficients. Fluid temperatures were varied from 50 degrees C to 90 degrees C to encompass potential operating temperatures within an automotive transaxle environment. The jet nozzle velocities were varied from 0.5 to 10 m/s. The experimental ATF heat transfer coefficient results provided in this report are a useful resource for understanding factors that influence the performance of ATF-based cooling systems for electric machines.

  7. Confinement physic study in a small low-aspect-ratio helical device CHS

    International Nuclear Information System (INIS)

    The configuration parameter of the plasma position relative to the center of the helical coil winding is very effective one for controlling the MHD stability and the trapped particle confinement in Heliotron/Torsatron systems. But these two characteristics are contradictory to each other in this parameter. The inward shifted configuration is favorable for the drift-orbit-optimization but it is predicted unstable with the Mercier criterion. Various physics problems, such as electric field structure, plasma rotation and MHD phenomena, have been studied in CHS with a compromising intermediate position. With this standard configuration, CHS has supplied experimental results for understanding general toroidal confinement physics and low-aspect-ratio helical systems. In the recent experiments, it was found that the wide range of inward shifted configurations gives stable plasma discharges without any restriction to the special pressure profile. Such enhanced range of operation made it possible to study experimentally the drift-orbit-optimized configuration in the Heliotron/Torsatron systems. The effect of configuration improvement was studied with plasmas in a low collisionality regime. (author)

  8. Activating transcription factor 4 and X box binding protein 1 of Litopenaeus vannamei transcriptional regulated white spot syndrome virus genes Wsv023 and Wsv083.

    Directory of Open Access Journals (Sweden)

    Xiao-Yun Li

    Full Text Available In response to endoplasmic reticulum (ER stress, the signaling pathway termed unfolded protein response (UPR is activated. To investigate the role of UPR in Litopenaeus vannamei immunity, the activating transcription factor 4 (designated as LvATF4 which belonged to a branch of the UPR, the [protein kinase RNA (PKR-like ER kinase, (PERK]-[eukaryotic initiation factor 2 subunit alpha (eIF2α] pathway, was identified and characterized. The full-length cDNA of LvATF4 was 1972 bp long, with an open reading frame of 1299 bp long that encoded a 432 amino acid protein. LvATF4 was highly expressed in gills, intestines and stomach. For the white spot syndrome virus (WSSV challenge, LvATF4 was upregulated in the gills after 3 hpi and increased by 1.9-fold (96 hpi compared to the mock-treated group. The LvATF4 knock-down by RNA interference resulted in a lower cumulative mortality of L. vannamei under WSSV infection. Reporter gene assays show that LvATF4 could upregulate the expression of the WSSV gene wsv023 based on the activating transcription factor/cyclic adenosine 3', 5'-monophosphate response element (ATF/CRE. Another transcription factor of L. vannamei, X box binding protein 1 (designated as LvXBP1, has a significant function in [inositol-requiring enzyme-1(IRE1 - (XBP1] pathway. This transcription factor upregulated the expression of the WSSV gene wsv083 based on the UPR element (UPRE. These results suggest that in L. vannamei UPR signaling pathway transcription factors are important for WSSV and might facilitate WSSV infection.

  9. Economic Evaluation Guide for alternative transportation fuels

    Energy Technology Data Exchange (ETDEWEB)

    de Percin, D.; Werner, J.F. Jr.

    1992-12-31

    The production of this Economic Evaluation Guide is one activity of AVFCAP. The guide is intended for use by project managers and fleet operators in the public sector. Public fleets have been identified as one of the most likely areas where ATFs will first gain widespread use, because of existing and impending state and federal legislative mandates, as well as for practical reasons such as centralized servicing and refueling. The purpose of this guide is to provide balanced decision-support information to project managers who are considering conducting, or currently managing, ATF demonstration programs. Information for this guide was gathered as part of a related AVFCAP activity, the development of an Information Resource Database. Economic issues related to the development and implementation of ATF programs at the local government level are extremely complex, and require an analysis of federal policies and national and international economics that is generally beyond the scope of local government project managers. The intent of this guide is to examine the information available on the economic evaluation of ATFs, and identify key elements that will help local governments realistically assess the potential costs and savings of an ATF program. The guide also discusses how these various economic factors are related, and how local government priorities affect how different factors are weighed.

  10. Economic Evaluation Guide for alternative transportation fuels

    Energy Technology Data Exchange (ETDEWEB)

    de Percin, D.; Werner, J.F. Jr.

    1992-01-01

    The production of this Economic Evaluation Guide is one activity of AVFCAP. The guide is intended for use by project managers and fleet operators in the public sector. Public fleets have been identified as one of the most likely areas where ATFs will first gain widespread use, because of existing and impending state and federal legislative mandates, as well as for practical reasons such as centralized servicing and refueling. The purpose of this guide is to provide balanced decision-support information to project managers who are considering conducting, or currently managing, ATF demonstration programs. Information for this guide was gathered as part of a related AVFCAP activity, the development of an Information Resource Database. Economic issues related to the development and implementation of ATF programs at the local government level are extremely complex, and require an analysis of federal policies and national and international economics that is generally beyond the scope of local government project managers. The intent of this guide is to examine the information available on the economic evaluation of ATFs, and identify key elements that will help local governments realistically assess the potential costs and savings of an ATF program. The guide also discusses how these various economic factors are related, and how local government priorities affect how different factors are weighed.

  11. Measurement of impulse peak insertion loss from two acoustic test fixtures and four hearing protector conditions with an acoustic shock tube

    Directory of Open Access Journals (Sweden)

    William J Murphy

    2015-01-01

    Full Text Available Impulse peak insertion loss (IPIL was studied with two acoustic test fixtures and four hearing protector conditions at the E-A-RCAL Laboratory. IPIL is the difference between the maximum estimated pressure for the open-ear condition and the maximum pressure measured when a hearing protector is placed on an acoustic test fixture (ATF. Two models of an ATF manufactured by the French-German Research Institute of Saint-Louis (ISL were evaluated with high-level acoustic impulses created by an acoustic shock tube at levels of 134 decibels (dB, 150 dB, and 168 dB. The fixtures were identical except that the E-A-RCAL ISL fixture had ear canals that were 3 mm longer than the National Institute for Occupational Safety and Health (NIOSH ISL fixture. Four hearing protection conditions were tested: Combat Arms earplug with the valve open, ETYPlugs ® earplug, TacticalPro headset, and a dual-protector ETYPlugs earplug with TacticalPro earmuff. The IPILs measured for the E-A-RCAL fixture were 1.4 dB greater than the National Institute for Occupational Safety and Health (NIOSH ISL ATF. For the E-A-RCAL ISL ATF, the left ear IPIL was 2.0 dB greater than the right ear IPIL. For the NIOSH ATF, the right ear IPIL was 0.3 dB greater than the left ear IPIL.

  12. Small molecule proteostasis regulators that reprogram the ER to reduce extracellular protein aggregation

    Science.gov (United States)

    Plate, Lars; Cooley, Christina B; Chen, John J; Paxman, Ryan J; Gallagher, Ciara M; Madoux, Franck; Genereux, Joseph C; Dobbs, Wesley; Garza, Dan; Spicer, Timothy P; Scampavia, Louis; Brown, Steven J; Rosen, Hugh; Powers, Evan T; Walter, Peter; Hodder, Peter; Wiseman, R Luke; Kelly, Jeffery W

    2016-01-01

    Imbalances in endoplasmic reticulum (ER) proteostasis are associated with etiologically-diverse degenerative diseases linked to excessive extracellular protein misfolding and aggregation. Reprogramming of the ER proteostasis environment through genetic activation of the Unfolded Protein Response (UPR)-associated transcription factor ATF6 attenuates secretion and extracellular aggregation of amyloidogenic proteins. Here, we employed a screening approach that included complementary arm-specific UPR reporters and medium-throughput transcriptional profiling to identify non-toxic small molecules that phenocopy the ATF6-mediated reprogramming of the ER proteostasis environment. The ER reprogramming afforded by our molecules requires activation of endogenous ATF6 and occurs independent of global ER stress. Furthermore, our molecules phenocopy the ability of genetic ATF6 activation to selectively reduce secretion and extracellular aggregation of amyloidogenic proteins. These results show that small molecule-dependent ER reprogramming, achieved through preferential activation of the ATF6 transcriptional program, is a promising strategy to ameliorate imbalances in ER function associated with degenerative protein aggregation diseases. DOI: http://dx.doi.org/10.7554/eLife.15550.001 PMID:27435961

  13. ORNL Analysis of Operational and Safety Performance for Candidate Accident Tolerant Fuel and Cladding Concepts

    International Nuclear Information System (INIS)

    Enhanced accident-tolerant fuels (ATFs) are being developed by the US Department of Energy Office of Nuclear Energy Fuel Cycle Research and Development Program to replace standard Zircaloy cladding and/or UO2 fuel in light water reactors. Proposed ATF concepts seek to reduce severe accident (SA) risks by increasing the coping time available to operators for accident response, reducing the extent and rate of heat and hydrogen production from steam oxidation, or enhancing fission product retention. Candidate ATF concepts require analyses to demonstrate adequate performance during normal operation and worthwhile improvements in SA scenarios. Two key ATF areas are being developed at Oak Ridge National Laboratory: (1) alternate cladding materials, including advanced iron-chromium-aluminium (FeCrAl) alloys and silicon carbide (SiC) composites, and (2) fully ceramic microencapsulated (FCM) fuel, which uses coated fuel particles embedded in an SiC matrix. Reactor physics analyses examining candidate ATF clad materials in a pressurized water reactor (PWR), with preliminary assessments of combinations of fuel enrichment and cladding thickness required to match existing cycle lengths and economic factors such as fuel costs, are presented. SA analyses including updated analyses of how FeCrAl cladding and channel box impact SA scenarios in a boiling water reactor (BWR) are also discussed. (author)

  14. Up-regulation of activating transcription factor 4 induces severe loss of dopamine nigral neurons in a rat model of Parkinson's disease.

    Science.gov (United States)

    Gully, Joseph C; Sergeyev, Valeriy G; Bhootada, Yogesh; Mendez-Gomez, Hector; Meyers, Craig A; Zolotukhin, Sergey; Gorbatyuk, Marina S; Gorbatyuk, Oleg S

    2016-08-01

    Activating transcription factor 4 (ATF4) is a member of the PERK signaling pathway, which directly binds endoplasmic reticulum stress target genes and plays a crucial role in both adaptations to stress and activation of apoptosis. Previous publications demonstrated conflicting evidence on the role of ATF4 in the pathogenesis of neurodegenerative disorders. In this study, we used recombinant adeno-associate virus (rAAV)-mediated gene transfer to investigate if the sustained up-regulation of ATF4 launches a pro-survival or pro-death trend in the dopamine (DA) cells of the substantia nigra pars compacta in a rat model of Parkinson-like neurodegeneration induced by human alpha-synuclein (αS) overexpression. We showed that ATF4 does not protect nigral DA neurons against an αS-induced pathology. Moreover, the rAAV-mediated overexpression of ATF4 resulted in severe nigra-striatal degeneration via activation of caspases 3/7. PMID:27233218

  15. Rapid ester biosynthesis screening reveals a high activity alcohol-O-acyltransferase (AATase) from tomato fruit.

    Science.gov (United States)

    Lin, Jyun-Liang; Zhu, Jie; Wheeldon, Ian

    2016-05-01

    Ethyl and acetate esters are naturally produced in various yeasts, plants, and bacteria. The biosynthetic pathways that produce these esters share a common reaction step, the condensation of acetyl/acyl-CoA with an alcohol by alcohol-O-acetyl/acyltransferase (AATase). Recent metabolic engineering efforts exploit AATase activity to produce fatty acid ethyl esters as potential diesel fuel replacements as well as short- and medium-chain volatile esters as fragrance and flavor compounds. These efforts have been limited by the lack of a rapid screen to quantify ester biosynthesis. Enzyme engineering efforts have also been limited by the lack of a high throughput screen for AATase activity. Here, we developed a high throughput assay for AATase activity and used this assay to discover a high activity AATase from tomato fruit, Solanum lycopersicum (Atf-S.l). Atf1-S.l exhibited broad specificity towards acyl-CoAs with chain length from C4 to C10 and was specific towards 1-pentanol. The AATase screen also revealed new acyl-CoA substrate specificities for Atf1, Atf2, Eht1, and Eeb1 from Saccharomyces cerevisiae, and Atf-C.m from melon fruit, Cucumis melo, thus increasing the pool of characterized AATases that can be used in ester biosynthesis of ester-based fragrance and flavor compounds as well as fatty acid ethyl ester biofuels. PMID:26814045

  16. Low viscosity automatic transmission fluids with enhanced friction durability

    Institute of Scientific and Technical Information of China (English)

    Kenji Yatsunami; Samuel H. Tersigni; TANG Hong- zhi; Lee D. Saathoff; Christopher S. Cleveland; Mark Jones

    2009-01-01

    This study focused on the development of a new low viscosity automatic transmission fluid (ATF) with enhanced friction durability to meet the needs of new step type automatic transmissions. Recent high fuel prices encourage increased efficiency in the driveline, including the transmission. Reduction in fluid viscosity and wider use of slip control in torque con-verter clutches are two ways to practically improve fuel efficiency. Increased torque and more shifting is seen with a variety of new transmission hardware platforms, such as wet starting clutches, dual clutches and seven - or eight - speed ATs.This suggests the need for enhanced levels of friction durability from the ATF. The new challenge from this hardware for the ATF formulator lies in the need to simultaneously meet the wear, friction durability and torque capacity requirements at low viscosity in a cost- effective manner. This report introduced a new low viscosity fluid that represents a different commercial ATF formulation style. The new chemistry employs a low viscosity for increased fuel economy, while easily doubling the friction durability of current conven-tional ATFs and offering higher torque and better EP.

  17. A Taiwanese Propolis Derivative Induces Apoptosis through Inducing Endoplasmic Reticular Stress and Activating Transcription Factor-3 in Human Hepatoma Cells

    Directory of Open Access Journals (Sweden)

    Fat-Moon Suk

    2013-01-01

    Full Text Available Activating transcription factor-(ATF- 3, a stress-inducible transcription factor, is rapidly upregulated under various stress conditions and plays an important role in inducing cancer cell apoptosis. NBM-TP-007-GS-002 (GS-002 is a Taiwanese propolin G (PPG derivative. In this study, we examined the antitumor effects of GS-002 in human hepatoma Hep3B and HepG2 cells in vitro. First, we found that GS-002 significantly inhibited cell proliferation and induced cell apoptosis in dose-dependent manners. Several main apoptotic indicators were found in GS-002-treated cells, such as the cleaved forms of caspase-3, caspase-9, and poly(ADP-ribose polymerase (PARP. GS-002 also induced endoplasmic reticular (ER stress as evidenced by increases in ER stress-responsive proteins including glucose-regulated protein 78 (GRP78, growth arrest- and DNA damage-inducible gene 153 (GADD153, phosphorylated eukaryotic initiation factor 2α (eIF2α, phosphorylated protein endoplasmic-reticular-resident kinase (PERK, and ATF-3. The induction of ATF-3 expression was mediated by mitogen-activated protein kinase (MAPK signaling pathways in GS-002-treated cells. Furthermore, we found that GS-002 induced more cell apoptosis in ATF-3-overexpressing cells. These results suggest that the induction of apoptosis by the propolis derivative, GS-002, is partially mediated through ER stress and ATF-3-dependent pathways, and GS-002 has the potential for development as an antitumor drug.

  18. Comparison of different estimation methods of accident atmospheric dispersion factors for a representative inland nuclear power plant

    International Nuclear Information System (INIS)

    The applicability of atmospheric diffusion models in complex terrains and low wind speed conditions was discussed in this paper. The accident atmospheric dispersion factors (ATFs) of Taohuajiang nuclear power plant were calculated by using two methods: the probabilistic method recommended by the U.S. Nuclear regulatory Commission (NRC) and the three dimensional objective diagnostic wind field model coupled with Lagrangian trajectory puff model to simulate the 8760 hourly emissions of radioactive nuclides. The results indicate that the maximum hourly accident ATFs calculated by the probabilistic method are conservative in exclusion area boundary (EAB). However, in some directions, accident ATFs calculated using probabilistic method is smaller than that using Lagrangian puff model, as well as some accident ATFs in remote sectors are larger than those in close sectors. Moreover, results calculated by probabilistic method are smaller in long-term release situation. Therefore, accident ATFs obtained according to the regulatory guides may not conservative in some cases, and atmospheric diffusion model should be selected carefully when a nuclear plant is located at a site with complex environmental conditions. (authors)

  19. Characterization of key triacylglycerol biosynthesis processes in rhodococci.

    Science.gov (United States)

    Amara, Sawsan; Seghezzi, Nicolas; Otani, Hiroshi; Diaz-Salazar, Carlos; Liu, Jie; Eltis, Lindsay D

    2016-01-01

    Oleaginous microorganisms have considerable potential for biofuel and commodity chemical production. Under nitrogen-limitation, Rhodococcus jostii RHA1 grown on benzoate, an analog of lignin depolymerization products, accumulated triacylglycerols (TAGs) to 55% of its dry weight during transition to stationary phase, with the predominant fatty acids being C16:0 and C17:0. Transcriptomic analyses of RHA1 grown under conditions of N-limitation and N-excess revealed 1,826 dysregulated genes. Genes whose transcripts were more abundant under N-limitation included those involved in ammonium assimilation, benzoate catabolism, fatty acid biosynthesis and the methylmalonyl-CoA pathway. Of the 16 atf genes potentially encoding diacylglycerol O-acyltransferases, atf8 transcripts were the most abundant during N-limitation (~50-fold more abundant than during N-excess). Consistent with Atf8 being a physiological determinant of TAG accumulation, a Δatf8 mutant accumulated 70% less TAG than wild-type RHA1 while atf8 overexpression increased TAG accumulation 20%. Genes encoding type-2 phosphatidic acid phosphatases were not significantly expressed. By contrast, three genes potentially encoding phosphatases of the haloacid dehalogenase superfamily and that cluster with, or are fused with other Kennedy pathway genes were dysregulated. Overall, these findings advance our understanding of TAG metabolism in mycolic acid-containing bacteria and provide a framework to engineer strains for increased TAG production. PMID:27126051

  20. Enhanced Accident Tolerant LWR Fuels: Metrics Development

    Energy Technology Data Exchange (ETDEWEB)

    Shannon Bragg-Sitton; Lori Braase; Rose Montgomery; Chris Stanek; Robert Montgomery; Lance Snead; Larry Ott; Mike Billone

    2013-09-01

    The Department of Energy (DOE) Fuel Cycle Research and Development (FCRD) Advanced Fuels Campaign (AFC) is conducting research and development on enhanced Accident Tolerant Fuels (ATF) for light water reactors (LWRs). This mission emphasizes the development of novel fuel and cladding concepts to replace the current zirconium alloy-uranium dioxide (UO2) fuel system. The overall mission of the ATF research is to develop advanced fuels/cladding with improved performance, reliability and safety characteristics during normal operations and accident conditions, while minimizing waste generation. The initial effort will focus on implementation in operating reactors or reactors with design certifications. To initiate the development of quantitative metrics for ATR, a LWR Enhanced Accident Tolerant Fuels Metrics Development Workshop was held in October 2012 in Germantown, MD. This paper summarizes the outcome of that workshop and the current status of metrics development for LWR ATF.

  1. Emittance Studies of the BNL/SLAC/UCLA 1.6 Cell Photocathode RF Gun

    Energy Technology Data Exchange (ETDEWEB)

    Palmer, D.T.; /SLAC; Wang, X.J.; /Brookhaven; Miller, R.H.; /SLAC; Babzien, M.; Ben-Zvi, I.; /Brookhaven; Pellegrini, C.; /UCLA; Sheehan, J.; Skaritka, J.; /Brookhaven; Winick, H.; /SLAC; Woodle, M.; Yakimenko, V.; /Brookhaven

    2011-09-09

    The symmetrized 1.6 cell S-band photocathode gun developed by the BNL/SLAC/UCLA collaboration is in operation at the Brookhaven Accelerator Test Facility (ATF). A novel emittance compensation solenoid magnet has also been designed, built and is in operation at the ATF. These two subsystems form an emittance compensated photoinjector used for beam dynamics, advanced acceleration and free electron laser experiments at the ATF. The highest acceleration field achieved on the copper cathode is 150 MV/m, and the guns normal operating field is 130 MV/m. The maximum rf pulse length is 3 {mu}s. The transverse emittance of the photoelectron beam were measured for various injection parameters. The 1 nC emittance results are presented along with electron bunch length measurements that indicated that at above the 400 pC, space charge bunch lengthening is occurring. The thermal emittance, {epsilon}{sub o}, of the copper cathode has been measured.

  2. Severe Accident Scoping Simulations of Accident Tolerant Fuel Concepts for BWRs

    Energy Technology Data Exchange (ETDEWEB)

    Robb, Kevin R. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

    2015-08-01

    Accident-tolerant fuels (ATFs) are fuels and/or cladding that, in comparison with the standard uranium dioxide Zircaloy system, can tolerate loss of active cooling in the core for a considerably longer time period while maintaining or improving the fuel performance during normal operations [1]. It is important to note that the currently used uranium dioxide Zircaloy fuel system tolerates design basis accidents (and anticipated operational occurrences and normal operation) as prescribed by the US Nuclear Regulatory Commission. Previously, preliminary simulations of the plant response have been performed under a range of accident scenarios using various ATF cladding concepts and fully ceramic microencapsulated fuel. Design basis loss of coolant accidents (LOCAs) and station blackout (SBO) severe accidents were analyzed at Oak Ridge National Laboratory (ORNL) for boiling water reactors (BWRs) [2]. Researchers have investigated the effects of thermal conductivity on design basis accidents [3], investigated silicon carbide (SiC) cladding [4], as well as the effects of ATF concepts on the late stage accident progression [5]. These preliminary analyses were performed to provide initial insight into the possible improvements that ATF concepts could provide and to identify issues with respect to modeling ATF concepts. More recently, preliminary analyses for a range of ATF concepts have been evaluated internationally for LOCA and severe accident scenarios for the Chinese CPR1000 [6] and the South Korean OPR-1000 [7] pressurized water reactors (PWRs). In addition to these scoping studies, a common methodology and set of performance metrics were developed to compare and support prioritizing ATF concepts [8]. A proposed ATF concept is based on iron-chromium-aluminum alloys (FeCrAl) [9]. With respect to enhancing accident tolerance, FeCrAl alloys have substantially slower oxidation kinetics compared to the zirconium alloys typically employed. During a severe accident, Fe

  3. Polysaccharide-rich fraction of Agaricus brasiliensis enhances the candidacidal activity of murine macrophages

    Directory of Open Access Journals (Sweden)

    Priscila Raquel Martins

    2008-05-01

    Full Text Available A polysaccharide-rich fraction (ATF of medicinal mushroom Agaricus brasiliensis was evaluated on the candidacidal activity, H2O2 and nitric oxide (NO production, and expression of mannose receptors by murine peritoneal macrophages. Mice received three intraperitoneal (i.p. injections of ATF and after 48 h their peritoneal resident macrophages were assayed against Candida albicans yeast forms. The treatment increased fungicidal activity and it was associated with higher levels of H2O2, whereas NO production was not affected. We also found that the treatment enhances mannose receptor expression by peritoneal macrophages, which are involved in the attachment and phagocytosis of non-opsonized microorganisms. Treatment of animals with ATF was able to enhance the clearance of C. albicans during the first 6 h after the experimental i.p. infection. Our results suggest that this extract can increase host resistance against some infectious agents through the stimulation of microbicidal activity of macrophages.

  4. Electric Motor Thermal Management for Electric Traction Drives (Presentation)

    Energy Technology Data Exchange (ETDEWEB)

    Bennion, K.; Cousineau, J.; Moreno, G.

    2014-09-01

    Thermal constraints place significant limitations on how electric motors ultimately perform. Finite element analysis and computational fluid dynamics modeling approaches are being increasingly utilized in the design and analysis of electric motors. As the models become more sophisticated, it is important to have detailed and accurate knowledge of material thermal properties and convective heat transfer coefficients. In this work, the thermal properties and inter-lamination thermal contact resistances were measured for different stator lamination materials. Also, convective heat transfer coefficients of automatic transmission fluid (ATF) jets were measured to better understand the heat transfer of ATF impinging on motor copper windings. Experiments were carried out at various ATF temperatures and jet velocities to quantify the influence of these parameters on heat transfer coefficients.

  5. The p16-specific reactivation and inhibition of cell migration through demethylation of CpG islands by engineered transcription factors.

    Science.gov (United States)

    Zhang, Baozhen; Xiang, Shengyan; Zhong, Qiming; Yin, Yanru; Gu, Liankun; Deng, Dajun

    2012-10-01

    Methylation of CpG islands inactivates transcription of tumor suppressor genes including p16 (CDKN2A). Inhibitors of DNA methylation and histone deacylation are recognized as useful cancer therapeutic chemicals through reactivation of the expression of methylated genes. However, these inhibitors are not target gene-specific, so that they lead to serious side effects as regular cytotoxic chemotherapy agents. To explore the feasibility of methylated gene-specific reactivation by artificial transcription factors, we engineered a set of Sp1-like seven-finger zinc-finger proteins (7ZFPs) targeted to a 21-bp sequence of the p16 promoter and found that these 7ZFPs could bind specifically to the target p16 promoter probe. Then the p16-specific artificial transcription factors (p16ATFs) were made from these 7ZFPs and the transcription activator VP64. Results showed that transient transfection of some p16ATFs selectively up-regulated the endogenous p16 expression in the p16-active 293T cells. Moreover, the transient transfection of the representative p16ATF-6I specifically reactivated p16 expression in the p16-methylated H1299 and AGS cells pretreated with a nontoxic amount of 5'-aza-deoxycytidine (20 and 80 nM, respectively). In addition, stable transfection of the p16ATF induced demethylation of p16 CpG island and trimethylation of histone H3K4, and inhibited recruitment of DNA methyltransferase 1 and trimethylation of H3K9 and H3K27 in the p16 promoter in H1299 cells without 5'-aza-deoxycytidine pretreatment. Notably, inhibition of cell migration and invasion was observed in these p16-reactivated cells induced by transient and stable p16ATF transfection. These results demonstrate that p16ATF not only specifically reactivates p16 expression through demethylation of CpG islands, but also restores methylated p16 function. PMID:22738793

  6. Prevention of Paclitaxel-induced allodynia by Minocycline: Effect on loss of peripheral nerve fibers and infiltration of macrophages in rats

    Directory of Open Access Journals (Sweden)

    Xin Wen-Jun

    2010-11-01

    Full Text Available Abstract Background Although paclitaxel is a frontline antineoplastic agent for treatment of solid tumors, the paclitaxel-evoked pain syndrome is a serious problem for patients. There is currently no valid drug to prevent or treat the paclitaxel-induced allodynia, partly due to lack of understanding regarding the cellular mechanism. Studies have shown that minocycline, an inhibitor of microglia/macrophage, prevented neuropathic pain and promoted neuronal survival in animal models of neurodegenerative disease. Recently, Cata et al also reported that minocycline inhibited allodynia induced by low-dose paclitaxel (2 mg/kg in rats, but the mechanism is still unclear. Results Here, we investigate by immunohistochemistry the change of intraepidermal nerve fiber (IENF in the hind paw glabrous skin, expression of macrophage and activating transcription factor 3 (ATF3 in DRG at different time points after moderate-dose paclitaxel treatment (cumulative dose 24 mg/kg; 3 × 8 mg/kg in rats. Moreover, we observe the effect of minocycline on the IENF, macrophages and ATF3. The results showed that moderate-dose paclitaxel induced a persisted, gradual mechanical allodynia, which was accompanied by the loss of IENF in the hind paw glabrous skin and up-regulation of macrophages and ATF3 in DRG in rats. The expressions of ATF3 mainly focus on the NF200-positive cells. More importantly, we observed that pretreatment of minocycline at dose of 30 mg/kg or 50 mg/kg, but not 5 mg/kg, prevented paclitaxel-evoked allodynia. The evidence from immunohistochemistry showed that 30 mg/kg minocycline rescued the degeneration of IENF, attenuated infiltration of macrophages and up-regulation of ATF3 induced by paclitaxel treatment in rats. Conclusions Minocycline prevents paclitaxel-evoked allodynia, likely due to its inhibition on loss of IENF, infiltration of macrophages and up-regulation of ATF3 in rats. The finding might provide potential target for preventing paclitaxel

  7. Psychological stress, cocaine and natural reward each induce endoplasmic reticulum stress genes in rat brain.

    Science.gov (United States)

    Pavlovsky, A A; Boehning, D; Li, D; Zhang, Y; Fan, X; Green, T A

    2013-08-29

    Our prior research has shown that the transcription of endoplasmic reticulum (ER) stress transcription factors activating transcription factor 3 (ATF3) and ATF4 are induced by amphetamine and restraint stress in rat striatum. However, presently the full extent of ER stress responses to psychological stress or cocaine, and which of the three ER stress pathways is activated is unknown. The current study examines transcriptional responses of key ER stress target genes subsequent to psychological stress or cocaine. Rats were subjected to acute or repeated restraint stress or cocaine treatment and mRNA was isolated from dorsal striatum, medial prefrontal cortex and nucleus accumbens brain tissue. ER stress gene mRNA expression was measured using quantitative polymerase chain reaction (PCR) and RNA sequencing. Restraint stress and cocaine-induced transcription of the classic ER stress-induced genes (BIP, CHOP, ATF3 and GADD34) and of two other ER stress components x-box binding protein 1 (XBP1) and ATF6. In addition, rats living in an enriched environment (large group cage with novel toys changed daily) exhibited rapid induction of GADD34 and ATF3 after 30 min of exploring novel toys, suggesting these genes are also involved in normal non-pathological signaling. However, environmental enrichment, a paradigm that produces protective addiction and depression phenotypes in rats, attenuated the rapid induction of ATF3 and GADD34 after restraint stress. These experiments provide a sensitive measure of ER stress and, more importantly, these results offer good evidence of the activation of ER stress mechanisms from psychological stress, cocaine and natural reward. Thus, ER stress genes may be targets for novel therapeutic targets for depression and addiction. PMID:23644055

  8. A Scoping Analysis Of The Impact Of SiC Cladding On Late-Phase Accident Progression Involving Core–Concrete Interaction

    Energy Technology Data Exchange (ETDEWEB)

    Farmer, M. T. [Argonne National Lab. (ANL), Argonne, IL (United States)

    2015-11-01

    The overall objective of the current work is to carry out a scoping analysis to determine the impact of ATF on late phase accident progression; in particular, the molten core-concrete interaction portion of the sequence that occurs after the core debris fails the reactor vessel and relocates into containment. This additional study augments previous work by including kinetic effects that govern chemical reaction rates during core-concrete interaction. The specific ATF considered as part of this study is SiC-clad UO2.

  9. STELLA Experiment: Hardware issues

    International Nuclear Information System (INIS)

    The Staged Electron Laser Acceleration (STELLA) experiment is currently being assembled and tested at the BNL Accelerator Test Facility (ATF). The existing BNL inverse free electron laser (IFEL) has been positioned upstream of the inverse Cerenkov acceleration (ICA) experiment on Beamline no. 1. This beamline also features new quadrupoles and a new spectrometer capable of a ±20% energy acceptance. A new laser beam transport system has been installed to permit accurate control of the laser phase for the laser beams sent to the IFEL and ICA devices. Detection of the microbunches are performed using a coherent transition radiation (CTR) diagnostic similar to one already demonstrated at the ATF

  10. Optimization of parameters for the inline-injection system at Brookhaven Accelerator Test Facility

    Energy Technology Data Exchange (ETDEWEB)

    Parsa, Z. [Brookhaven National Lab., Upton, NY (United States); Ko, S.K. [Ulsan Univ. (Korea, Republic of)

    1995-10-01

    We present some of our parameter optimization results utilizing code PARMLEA, for the ATF Inline-Injection System. The new solenoid-Gun-Solenoid -- Drift-Linac Scheme would improve the beam quality needed for FEL and other experiments at ATF as compared to the beam quality of the original design injection system. To optimize the gain in the beam quality we have considered various parameters including the accelerating field gradient on the photoathode, the Solenoid field strengths, separation between the gun and entrance to the linac as well as the (type size) initial charge distributions. The effect of the changes in the parameters on the beam emittance is also given.

  11. Proceedings of the SLAC/KEK linear collider workshop on damping ring

    International Nuclear Information System (INIS)

    Since the SLAC/KEK joint meeting was first held at SLAC in March 1987, we have had such a meeting annually with the present one the 6th. This meeting is planned to discuss the damping ring issue in particular. We have ever stressed the importance of study of damping rings and considered construction of a test damping ring as key issue for the ATF project, since we started construction of the ATF in 1987. In 1991 we had large-scale reconstruction of a building to make a shielded area where a 1.54 GeV injector linac for the ring is to be installed. (J.P.N.)

  12. Preliminary assessment of the impact of candidate accident-tolerant fuels/cladding on the predicted reactor behaviour at normal operating conditions and under DB (LOCA and RIA) and BDB (STSBO and LTSBO) accident conditions

    International Nuclear Information System (INIS)

    Currently, the United States Department of Energy (DOE) has initiated the study of advanced accident-tolerant fuel/cladding (ATF) configurations that exhibit 1) slower reaction kinetics with steam, 2) lower enthalpy of oxidation, 3) less susceptibility to unfavourable core material interactions, and 4) provision of additional barriers to fission product release. Whenever changes, whether minor or major, are made to commercial NPP fuel/cladding systems; then the effect of these changes must be evaluated on all phases of the fuel/cladding lifetime (from fabrication through operation through eventual storage and reprocessing). This presentation focuses on preliminary assessments of several potential ATFs on the impact of these materials on predicted reactor behaviour 1) at normal operating conditions, 2) under postulated design basis (DB) accidents (LOCAs and RIAs), and 3) under beyond design basis (BDB) accident conditions [for short- and long-term station blackouts(SBO)]. These preliminary reactor response predictions are compared against the responses of UO2/Zr cores. For the ATFs evaluated, during normal operation, the most significant features are much lower fuel centerline temperatures and fission gas releases; and for LOCAs the peak cladding temperatures are lower with significantly lower hydrogen generation rates and for a RIA the ATF ejected worth is very similar to the UO2 ejected worth. The use of higher melting/lower hydrogen producing core components (ATFs) will not preclude a BDB accident. Without core cooling the severe accident will march-on; however, the ATFs do allow an increase in margin (time) to initiation of core component degradation - although this may be measured in minutes rather than hours. The ATF core responses (with oxidation kinetics about two orders of magnitude lower than that for Zr) are nearly the same as for components with no oxidation (for a STSBO, the increased time to vessel dry-out is approximately 4.5 hours). There is a need

  13. Heat Stress Induces Apoptosis through a Ca2+-Mediated Mitochondrial Apoptotic Pathway in Human Umbilical Vein Endothelial Cells

    OpenAIRE

    Li Li; Hongping Tan; Zhengtao Gu; Zhifeng Liu; Yan Geng; Yunsong Liu; Huasheng Tong; Youqing Tang; Junmin Qiu; Lei Su

    2014-01-01

    Background Heat stress can be acutely cytotoxic, and heat stress-induced apoptosis is a prominent pathological feature of heat-related illnesses, although the precise mechanisms by which heat stress triggers apoptosis are poorly defined. Methods The percentages of viability and cell death were assessed by WST-1 and LDH release assays. Apoptosis was assayed by DNA fragmentation and caspase activity. Expression of cleaved PARP, Apaf-1, phospho-PERK, Phospho-eIF2a, ATF4, XBP-1s, ATF6, GRP78, pho...

  14. Measurements of photoneutron spectra from thick Pb target bombarded by 1.2 and 2.0 GeV electrons

    International Nuclear Information System (INIS)

    Photoneutron spectra were measured using the TOF method when thick targets were bombarded by high-energy electrons. At the ATF Linac in KEK, 1.2 GeV electrons bombarded a thick Pb target. At the injection Linac of the Pohang Accelerator Laboratory, 2.04 GeV electrons were used. The detector was 5.6 m distant from the target. Several detectors were tested. Neutrons toward 90 degrees from the target were measured up to 150 MeV at the ATF, and 200 MeV at PAL. Calculations of neutron energy spectra were also done using PICA3 and EGS4. (author)

  15. Modeling of compact loop antennas

    Science.gov (United States)

    Baity, F. W.

    1987-09-01

    A general compact loop antenna model which treats all elements of the antenna as lossy transmission lines has been developed. In addition to capacitively tuned resonant double loop (RDL) antennas, the model treats sub-tuned RDL antennas. Calculations using the model have been compared with measurements on full-scale mock-ups of RDL antennas for ATF and TFTR in order to refine the transmission line parameters. Results from the model are presented for RDL antenna designs for ATF, TFTR, Tore Supra, and the Compact Ignition Tokamak (CIT).

  16. Modeling of compact loop antennas

    International Nuclear Information System (INIS)

    A general compact loop antenna model which treats all elements of the antenna as lossy transmission lines has been developed. In addition to capacitively-tuned resonant double loop (RDL) antennas the model treats stub-tuned resonant double loop antennas. Calculations using the model have been compared with measurements on full-scale mockups of resonant double loop antennas for ATF and TFTR in order to refine the transmission line parameters. Results from the model are presented for RDL antenna designs for ATF, TFTR, Tore Supra, and for the Compact Ignition Tokamak

  17. Modeling of compact loop antennas

    International Nuclear Information System (INIS)

    A general compact loop antenna model which treats all elements of the antenna as lossy transmission lines has been developed. In addition to capacitively tuned resonant double loop (RDL) antennas, the model treats sub-tuned RDL antennas. Calculations using the model have been compared with measurements on full-scale mock-ups of RDL antennas for ATF and TFTR in order to refine the transmission line parameters. Results from the model are presented for RDL antenna designs for ATF, TFTR, Tore Supra, and the Compact Ignition Tokamak

  18. NOVA TEHNOLOGIJA ADITIVA OTPORNIH NA TRENJE I NJIHOVA PRIMJENA U AUTOMATSKIM PRIJENOSNICIMA

    OpenAIRE

    Tersigni, Samuel H.; Saathoff, Lee D.; Cleveland, Christopher

    2010-01-01

    Ovaj rad prikazuje razvoj tehnologije novih aditiva koja omogućuje formulaciju fluida za automatske prijenosnike (ATF-Automatic Transmission Fluids) na osnovi mineralnih ulja sa značajno poboljšanom otpornošću na trenje. U radu se uspoređuju performance trenja tehnologije novih aditiva kod komercijalno dostupnih ATF-a u Europi, Aziji i Sjevernoj Americi pri industrijski standardnim testovima trenja kao što su SAE No’2 rig (SAE No'2 mjerna oprema) i Low Velocity Friction Apparatus (aparatura z...

  19. Design of the ILC Prototype FONT4 Digital Intra-Train Beam-Based Feedback System

    International Nuclear Information System (INIS)

    We present the design of the FONT4 digital intra-train beam position feedback system prototype and preliminary results of initial beam tests at the Accelerator Test Facility (ATF) at KEK. The feedback system incorporates a fast analogue beam position monitor (BPM) front-end signal processor, a digital feedback board, and a kicker driver amplifier. The short bunchtrain, comprising 3 electron bunches separated by c. 150ns, in the ATF extraction line was used to test components of the prototype feedback system

  20. Endoplasmic Reticulum Stress-Induced Activation of Activating Transcription Factor 6 Decreases Insulin Gene Expression via Up-Regulation of Orphan Nuclear Receptor Small Heterodimer Partner

    OpenAIRE

    Seo, Hye-Young; Kim, Yong Deuk; Lee, Kyeong-Min; Min, Ae-Kyung; Kim, Mi-Kyung; Kim, Hye-Soon; Won, Kyu-Chang; Park, Joong-Yeol; Lee, Ki-Up; Choi, Hueng-Sik; Park, Keun-Gyu; Lee, In-Kyu

    2008-01-01

    The highly developed endoplasmic reticulum (ER) structure of pancreatic β-cells is a key factor in β-cell function. Here we examined whether ER stress-induced activation of activating transcription factor (ATF)-6 impairs insulin gene expression via up-regulation of the orphan nuclear receptor small heterodimer partner (SHP; NR0B2), which has been shown to play a role in β-cell dysfunction. We examined whether ER stress decreases insulin gene expression, and this process is mediated by ATF6. A...

  1. Estimativa da degradabilidade ruminal de quatro genótipos de sorgo (Sorghum bicolor (L. Moench utilizando a técnica in situ - DOI: 10.4025/actascianimsci.v27i4.1150 Estimation of ruminal degradability of four genotypes of sorghum (Sorghum bicolor (L. Moench using in situ technique - DOI: 10.4025/actascianimsci.v27i4.1150

    Directory of Open Access Journals (Sweden)

    Eloísa de Oliveira Simões Saliba

    2005-03-01

    Full Text Available O experimento foi conduzido com o objetivo de avaliar a degradabilidade in situ da matéria seca (MS, da fibra em detergente neutro (FDN e da fibra em detergente ácido (FDA do material original de quatro genótipos de sorgo (ATF53*9929036; ATF54*9929036; CMSXS217*9929012 e VOLUMAX. Foram utilizadas 4 vacas Holandesas providas de fistula ruminal alimentadas com silagem de sorgo “ad libitun” e dois quilos de concentrado. O delineamento experimental foi o de blocos inteiramente ao acaso, com quatro repetições (animais, em arranjo de parcelas subdivididas. Os genótipos constituíram as parcelas e os tempos de digestão as sub-parcelas. O genótipo VOLUMAX foi o que apresentou a maior degradabilidade efetiva (DE da MS (56,22; 53,35 e 50,90% em relação aos demais em todas as taxas de passagem (2, 5 e 8%/h respectivamente e os genótipos ATF53*992903 e ATF54*9929036 obtiveram a maior DE da FDN (32,17 e 33,47%, respectivamente e FDA (34,81 e 35,50%, respectivamente para uma taxa de passagem de 2%/hThis experiment was carried out to evaluate “in situ” degradability of dry matter, neutral detergent fiber (NDF and acid detergent fiber (ADF of four sorghum genotypes (ATF53*9929036; ATF54*9929036; 217*9929012 and VOLUMAX. Four Holstein cows with ruminal fistula were fed on sorghum silage “ad libitum”, and 2.0 kg of concentrate. The animals were alloted in a randomized block design, with four replicates, in a split plot arrangement. The genotypes were considered the parcels and the incubation time the sub-parcels. The higher effective dry matter degradability were found in VOLUMAX genotype, (56.22; 53.35 and 50.90% for all passage rates, (2; 5 and 8%/h, respectively. The genotypes ATF53*992903 and ATF54*9929036 showed higher NDF effective degradability, 32.17 and 33.47% respectively, and ADF effective degradability, 34.81 and 35.50%, at 2%/h passage rate

  2. Interseismic Deformation of the Altyn Tagh Fault Determined by Interferometric Synthetic Aperture Radar (InSAR) Measurements

    OpenAIRE

    Sen Zhu; Caijun Xu; Yangmao Wen; Yang Liu

    2016-01-01

    The Altyn Tagh Fault (ATF) is one of the major left-lateral strike-slip faults in the northeastern area of the Tibetan Plateau. In this study, the interseismic deformation across the ATF at 85°E was measured using 216 interferograms from 33 ENVISAT advanced synthetic aperture radar images on a descending track acquired from 2003 to 2010, and 66 interferograms from 15 advanced synthetic aperture radar images on an ascending track acquired from 2005 to 2010. To retrieve the pattern of interseis...

  3. Recent progress in stellarator reactor conceptual design

    International Nuclear Information System (INIS)

    The Stellarator/Torsatron/Heliotron (S/T/H) class of toroidal magnetic fusion reactor designs continues to offer a distinct and in several ways superior approach to eventual commercial competitiveness. Although no major, integrated conceptual reactor design activity is presently underway, a number of international research efforts suggest avenues for the substantial improvement of the S/T/H reactor embodiment, which derive from recent experimental and theoretical progress and are responsive to current trends in fusion-reactor projection to set the stage for a third generation of designs. Recent S/T/H reactor design activity is reviewed and the impact of the changing technical and programmatic context on the direction of future S/T/H reactor design studies is outlined

  4. Geometrical effects of the magnetic field on the neoclassical flow, current and rotation in general toroidal systems

    International Nuclear Information System (INIS)

    In order to clarify geometrical effects of the magnetic field on neoclassical theory, the neoclassical parallel particle flow, heat flux, current and plasma rotation of a multispecies plasma in general toroidal systems are examined in several collisionality regimes. The quantitative and qualitative differences between axisymmetric (tokamaks) and non-axisymmetric toroidal systems (stellarator, heliotron/torsatron) appear mainly through a geometrical factor which prescribes the parallel flow due to the gradients of the density, temperature, and electrostatic potential. In axisymmetric toroidal systems the geometrical factor reduces to the same expression in all collisionality regimes due to axisymmetry. By contrast, in non-axisymmetric toroidal systems, it changes drastically depending on the magnetic fieled structure and the collisionality regime. Thus, the poloidal flow has the radial electric field dependence. When the geometrical factor is very small, the ion parallel flow almost vanishes and the ion rotation consists of the diamagnetic and E vector x B vector flows (perpendicular flows). (author)

  5. Plasma physics and controlled nuclear fusion research 1994. V. 1. Proceedings of the fifteenth international conference

    International Nuclear Information System (INIS)

    This volume contains (i) the traditional Artsimovich Memorial Lecture; (ii) nine presentations giving an overview of toroidal confinement systems (TFTR, JT-60U, JET, DIII-D, TORE SUPRA, Alcator C-Mod, JFT-2M and T-10 tokamaks and the Wendelstein 7-AS stellarator), (iii) twenty-three presentations on core plasma physics (mostly on charged-particle transport and improved confinement regimes), (iv) eight presentations on plasma heating and current drive, (v) twelve presentations on divertors and edge physics, (vi) thirteen on concept optimization (shaping of magnetic field configuration, control of plasma profiles and of disruptions, a.o.), and (vii) six on helical systems (stellarators, including torsatron/heliotron). Refs, figs and tabs

  6. Equilibrium and stability of helical systems

    International Nuclear Information System (INIS)

    For the purpose of preparing basic data for designing a new large helical system, we have made a numerical survey of equilibrium and linear stabilities of l = 2 torsatron/heliotron. We try to find out optimum configuration in a wide parameter space where the coil aspect ratio γc is changed as well as the pitch period number M. We determine the parameter region within which a high β current-less plasma is obtained from the view points of both the equilibrium and stability limits. Moreover, we execute a sensitivity analysis of various parameters on the stability, such as the vertical field, the quadruple field, the pressure profile, the shape of the helical coil, and the pitch modulation. We find each parameter gives strong influence on the stability. (author)

  7. Alternative approaches to plasma confinement

    Science.gov (United States)

    Roth, J. R.

    1978-01-01

    The paper discusses 20 plasma confinement schemes each representing an alternative to the tokamak fusion reactor. Attention is given to: (1) tokamak-like devices (TORMAC, Topolotron, and the Extrap concept), (2) stellarator-like devices (Torsatron and twisted-coil stellarators), (3) mirror machines (Astron and reversed-field devices, the 2XII B experiment, laser-heated solenoids, the LITE experiment, the Kaktus-Surmac concept), (4) bumpy tori (hot electron bumpy torus, toroidal minimum-B configurations), (5) electrostatically assisted confinement (electrostatically stuffed cusps and mirrors, electrostatically assisted toroidal confinement), (6) the Migma concept, and (7) wall-confined plasmas. The plasma parameters of the devices are presented and the advantages and disadvantages of each are listed.

  8. Massachusetts Institute of Technology, Plasma Fusion Center, technical research programs

    Energy Technology Data Exchange (ETDEWEB)

    1982-02-01

    Research programs have produced significant results on four fronts: (1) the basic physics of high-temperature fusion plasmas (plasma theory, RF heating, development of advanced diagnostics and small-scale experiments on the Versator tokamak and Constance mirror devices); (2) major confinement results on the Alcator A and C tokamaks, including pioneering investigations of the equilibrium, stability, transport and radiation properties of fusion plasmas at high densities, temperatures and magnetic fields; (3) development of a new and innovative design for axisymmetric tandem mirrors with inboard thermal barriers, with initial operation of the TARA tandem mirror experimental facility scheduled for 1983; and (4) a broadly based program of fusion technology and engineering development that addresses problems in several critical subsystem areas (e.g., magnet systems, superconducting materials development, environmental and safety studies, advanced gyrotron development for RF heating, preconceptual design studies of torsatrons and stellarators, and advanced tokamak design and reactor studies).

  9. Self-sustained turbulence and L-mode confinement in toroidal plasmas. 2

    International Nuclear Information System (INIS)

    Theory of the anomalous transport coefficient in toroidal helical systems (such as stellarators, torsatron and Heliotron devices) is developed. The theoretical formalism of self-sustained turbulence is applied to the interchange mode turbulence and ballooning mode turbulence. The nonlinear destabilization of microscopic modes by the current diffusivity is the key for the anomalous transport. A general form of the anomalous transport coefficient in toroidal plasmas is derived. The intrinsic importance of the pressure gradient, collisionless skin depth and Alfven transit time is confirmed. The geometrical factors which characterize the magnetic configurations are also obtained. The theory is extended to study the influence of parallel compressibility. The ion viscosities of the perpendicular and parallel momenta, electron viscosity and energy diffusion coefficient are obtained. The comparison with experimental results is also given. (author)

  10. Discovery of electric pulsation in a toroidal helical plasma

    International Nuclear Information System (INIS)

    A self-organized pulsation in electrostatic potential has been discovered in a low density plasma of CHS heliotron/torsatron with combined ECH+NBI heating. The potential profiles repeat transition between two distinctive states (Δφ(0) - 0.5Te - 0.6kV) in a constant external magnetic field when there is a continuous supply of particles and energy. Each transition, which occurs on microseconds time scale that is much faster than the diffusive one of milliseconds, is accompanied with drastic changes in density and temperature profiles. This discovery clearly demonstrates that spontaneously generated 'electric' field can affect transports and other properties of 'magnetically' confined plasmas. (author)

  11. Goals and status of HSX: a helically symmetric stellarator

    International Nuclear Information System (INIS)

    The Helically Symmetry Experiment (HSX) is a quasi-helically symmetric (QHS) stellarator being constructed at the University of Wisconsin-Madison Torsatron Stellarator Laboratory, and the first experimental test of the QHS approach. HSX has a single dominant helical component to the magnetic field spectrum, with neoclassical transport 1-2 orders of magnitude lower than conventional stellarators in the low collisionality regime. Auxiliary coils will be used to add a toroidal mirror mode to destroy the symmetry, with only small changes in the rotational transform profile. The ASTRA code predict factors of two between Te(0) for these two spectral cases. The mirror mode also causes a large increase in direct loss orbits and increases viscous damping as compared to the QHS mode. (author)

  12. Fusion theory and computations

    International Nuclear Information System (INIS)

    It is proposed to carry out theoretical studies of the equilibrium, stability, transport and heating properties of high-temperature fusion plasmas. Continued emphasis will be placed on the effective interface of fusion theory and computations with the local Alcator, Versator, Constance and Torex experimental programs. The proposed research includes but will not be limited to the following types of studies: (a) investigation of RF heating of toroidal plasmas, (b) investigation of the MHD equilibrium and stability properties of tokamak plasmas, (c) develop the basic understanding of a wide variety of non-linear and turbulent phenomena, including stochastic magnetic fields, clumps and nonlinear saturation of linear instabilities, (d) investigate the effects of ambipolar fields on transport and stability properties of toroidal plasmas. Investigate high-beat stability properties of tandem-mirror systems, and (e) investigation of the MHD equilibrium and stability properties of Torsatron/Stellarator configurations

  13. Creep and locking of a low-angle normal fault: Insights from the Altotiberina fault in the Northern Apennines (Italy)

    Science.gov (United States)

    Anderlini, L.; Serpelloni, E.; Belardinelli, M. E.

    2016-05-01

    While low-angle normal faults have been recognized worldwide from geological studies, whether these structures are active or capable of generating big earthquakes is still debated. We provide new constraints on the role and modes of the Altotiberina fault (ATF) in accommodating extension in the Northern Apennines. We model GPS velocities to study block kinematics, faults slip rates and interseismic coupling of the ATF, which is active and accounts, with its antithetic fault, for a large part of the observed chain normal 3 mm/yr tectonic extension. A wide portion of the ATF creeps at the long-term slip rate (1.7 ± 0.3 mm/yr), but the shallow locked portions are compatible with M > 6.5 earthquakes. We suggest that positive stress accumulation due to ATF creep is most likely released by more favorable oriented splay faults, whose rupture may propagate downdip along low-angle normal fault surface and reduce the probability of occurrence of a seismic rupture of the shallower locked portion.

  14. 76 FR 77696 - Establishment of the Naches Heights Viticultural Area

    Science.gov (United States)

    2011-12-14

    ... Valley viticultural area was established by T.D. ATF-190, published in the Federal Register (49 FR 44895... elevations to the west create a rain shadow effect that protects the Naches Heights plateau from Pacific... the Federal Register (76 FR 30060) on May 24, 2011. In that notice, TTB requested comments from...

  15. 77 FR 36433 - Proposed Establishment of the Elkton Oregon Viticultural Area

    Science.gov (United States)

    2012-06-19

    ... Federal Register on March 29, 1984 (49 FR 12246). According to T.D. ATF-170, the Umpqua Valley... (69 FR 70889). The Southern Oregon viticultural area boundary encompasses the established Umpqua.... To the west, the Coast Range casts a rain shadow on the south and east parts of the Southern...

  16. Preliminary chelation and dissolution effects of oxalic acid and disodium oxalate on polymeric 123-superconductors

    International Nuclear Information System (INIS)

    The polymeric 123-superconductor material was selectively etched by exposure to aqueous solutions of oxalic acid and disodium oxalate. Superconductivity decreased with time. XPS, AES, FTIR and ATF show that the amount of copper at the surface is decreased, shows the presence of bound oxalate and shows a decrease in peaks associated with superconductivity for the sample treated with oxalate

  17. 77 FR 70741 - Agency Information Collection Extension

    Science.gov (United States)

    2012-11-27

    ... addition of a new vehicle classification code to allow EIA to capture data on plug-in hybrid electric... code ``EVC-PH'' to capture data on plug-in hybrid electric vehicles (PHEV). PHEVs are considered... fuel (ATF) use in the U.S. These data serve as market analysis tools for federal/state agencies,...

  18. 78 FR 58049 - Proposed Establishment of the Adelaida District, Creston District, El Pomar District, Paso Robles...

    Science.gov (United States)

    2013-09-20

    ... alluvial calcareous soils soils with silty sandy, and terrace soils, of residual and clay loam gravelly..., at 74 FR 3425). Overview of the Paso Robles Viticultural Area The Paso Robles viticultural area... with Monterey County (see T.D. ATF-148, published in the Federal Register on October 4, 1983, at 48...

  19. Astrometric telescope facility. Preliminary systems definition study. Volume 3: Cost estimate

    Science.gov (United States)

    Sobeck, Charlie (Editor)

    1987-01-01

    The results of the Astrometric Telescope Facility (ATF) Preliminary System Definition Study conducted in the period between March and September 1986 are described. The main body of the report consists primarily of the charts presented at the study final review which was held at NASA Ames Research Center on July 30 and 31, 1986. The charts have been revised to reflect the results of that review. Explanations for the charts are provided on the adjoining pages where required. Note that charts which have been changed or added since the review are dated 10/1/86; unchanged charts carry the review date 7/30/86. In addition, a narrative summary is presented of the study results and two appendices. The first appendix is a copy of the ATF Characteristics and Requirements Document generated as part of the study. The second appendix shows the inputs to the Space Station Mission Requirements Data Base submitted in May 1986. The report is issued in three volumes. Volume 1 contains an executive summary of the ATF mission, strawman design, and study results. Volume 2 contains the detailed study information. Volume 3 has the ATF cost estimate, and will have limited distribution.

  20. Rice8987 g_array: cDNA information: 2363 [

    Lifescience Database Archive (English)

    Full Text Available g_2363 CB2034 >ATF6H11_11(AL021684|pid:g2827709) Arabidopsis thaliana DNA chromosome 5, BAC clon ... y to nuclear matrix constituent protein 1 (NMCP1); Daucus ... carota; PATCHX:D1021240. DPlate 005 F10 C26288 AU1 ...

  1. Rice8987 g_array: cDNA information: 4225 [

    Lifescience Database Archive (English)

    Full Text Available g_4225 CB0587 >ATF6H11_11(AL021684|pid:g2827709) Arabidopsis thaliana DNA chromosome 5, BAC clon ... y to nuclear matrix constituent protein 1 (NMCP1); Daucus ... carota; PATCHX:D1021240. DPlate 002 A06 AU176396 A ...

  2. Laser Wire and Beam Position Monitor tests

    CERN Document Server

    Boogert, S T; Lyapin, A; Nevay, L; Snuverink, J

    2013-01-01

    This subtask involved two main activities; Firstly the development and subsequent usage of high resolution beam position monitors (BPM) for the International Linear Collider (ILC) and Compact Linear Collider projects (CLIC); and secondly the development of a laser-wire (LW) transverse beam size measurement systems. This report describes the technical progress achieved at a large-scale test ILC compatible BPM system installed at the Accelerator Test Facility 2 (ATF2). The ATF2 is an energy-scaled demonstration system for the final focus systems required to deliver the particle beams to collision at the ILC and CLIC. The ATF2 cavity beam position monitor system is one of the largest of its kind and rivals systems used at free electron lasers. The ATF2 cavity beam position system has achieved a position resolutionof 250 nm (with signal attuenation) and 27 nm (without attenuation). The BPM system has been used routinely for lattice diagnostics, beam based alignment and wakefield measurements. Extensive experience...

  3. Bioleaching of two different types of chalcopyrite by Acidithiobacillus ferrooxidans

    Science.gov (United States)

    Dong, Ying-bo; Lin, Hai; Fu, Kai-bin; Xu, Xiao-fang; Zhou, Shan-shan

    2013-02-01

    Two different types of chalcopyrite (pyritic chalcopyrite and porphyry chalcopyrite) were bioleached with Acidithiobacillus ferrooxidans ATF6. The bioleaching of the pyritic chalcopyrite and porphyry chalcopyrite is quite different. The copper extraction reaches 46.96% for the pyritic chalcopyrite after 48-d leaching, but it is only 14.50% for the porphyry chalcopyrite. Proper amounts of initial ferrous ions can improve the efficiency of copper extraction for the two different types of chalcopyrite. The optimum dosage of ferrous ions for the pyritic chalcopyrite and porphyry chalcopyrite is different. The adsorption of ATF6 on the pyritic chalcopyrite and porphyry chalcopyrite was also studied in this paper. It is found that ATF6 is selectively adsorbed by the two different types of chalcopyrite; the higher adsorption onto the pyritic chalcopyrite than the porphyry chalcopyrite leads to the higher copper dissolution rate of the pyritic chalcopyrite. In addition, the zeta-potential of chalcopyrite before and after bioleaching further confirms that ATF6 is more easily adsorbed onto the pyritic chalcopyrite.

  4. Activating transcription factor 3 is not up-regulated in hypospadias patients in Japan

    Directory of Open Access Journals (Sweden)

    Toshiaki Takahashi

    2013-01-01

    Full Text Available Background: The aetiology of hypospadias is largely uncharacterized. Some of the researchers have advocated that activating transcription factor 3 (ATF3, an oestrogen-responsive transcription factor, is up-regulated in patients with hypospadias. The purpose is to evaluate the universality of this fact; we studied the expression of ATF3 protein in prepuce tissue obtained from hypospadias and phimosis patients living in metropolitan Tokyo. Materials and Methods: Prepuce tissue was obtained from outer foreskin at the time of surgery, quickly prepared for paraffin-embedded sectioning and stained immunohistochemically for ATF3. Two researchers blindly evaluated immunoreactivity and scored it semi-quantitatively as nil = 0, weak = 1, or strong = 2, to give a final staining intensity score (SIS. Subjects were 18 hypospadias patients and 17 phimosis patients (as controls who had surgery between January, 2009 and March, 2010. Results: All subjects lived in metropolitan Tokyo, Japan. Mean ages at surgery were 2.9 ± 1.0 and 3.9 ± 2.4 years, respectively (P > 0.05. SIS was not statistically different between hypospadias patients (1.4 ± 0.5 and controls (1.5 ± 0.5, (P > 0.05. Conclusions: Our data suggest that ATF3 is not highly associated with hypospadias in metropolitan Tokyo. Differences in ethnicity might have influenced our results.

  5. Rice8987 g_array: cDNA information: 2411 [

    Lifescience Database Archive (English)

    Full Text Available g_2411 CG0194 >ATF19H22_3(AL035679|pid:g4539312) Arabidopsis thaliana DNA chromosome 4, BAC clon ... 778, T76313, H76773, T76734 are in 3' untranslated region ; EST T42894 covers intron in 5' untranslated regio ...

  6. Probe data: 6247 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-008440-1AR RED C26839 C96955 C50194 CG0194 >ATF19H22_3(AL035679|pid:g4539312) Arabidopsis th ... 778, T76313, H76773, T76734 are in 3' untranslated region ; EST T42894 covers intron in 5' untranslated regio ...

  7. Rice8987Corresponding Table(f_g_primer): g_2411 [

    Lifescience Database Archive (English)

    Full Text Available g_2411 3UTR_2411 CG0194 C26839 C96955 >ATF19H22_3(AL035679|pid:g4539312) Arabidopsis thaliana DN ... 778, T76313, H76773, T76734 are in 3' untranslated region ; EST T42894 covers intron in 5' untranslated regio ...

  8. 78 FR 2363 - Notification of Deletion of a System of Records; Automated Trust Funds Database

    Science.gov (United States)

    2013-01-11

    ... Agriculture (USDA) published in the Federal Register (73 FR 23414- 23416, Docket No. APHIS-2008-0026) a system of records notice establishing the Automated Trust Funds (ATF) database system of records. The...; ] DEPARTMENT OF AGRICULTURE Office of the Secretary Notification of Deletion of a System of Records;...

  9. Lipotoxic brain microvascular injury is mediated by activating transcription factor 3-dependent inflammatory and oxidative stress pathways.

    Science.gov (United States)

    Aung, Hnin Hnin; Altman, Robin; Nyunt, Tun; Kim, Jeffrey; Nuthikattu, Saivageethi; Budamagunta, Madhu; Voss, John C; Wilson, Dennis; Rutledge, John C; Villablanca, Amparo C

    2016-06-01

    Dysfunction of the cerebrovasculature plays an important role in vascular cognitive impairment (VCI). Lipotoxic injury of the systemic endothelium in response to hydrolyzed triglyceride-rich lipoproteins (TGRLs; TGRL lipolysis products) or a high-fat Western diet (WD) suggests similar mechanisms may be present in brain microvascular endothelium. We investigated the hypothesis that TGRL lipolysis products cause lipotoxic injury to brain microvascular endothelium by generating increased mitochondrial superoxide radical generation, upregulation of activating transcription factor 3 (ATF3)-dependent inflammatory pathways, and activation of cellular oxidative stress and apoptotic pathways. Human brain microvascular endothelial cells were treated with human TGRL lipolysis products that induced intracellular lipid droplet formation, mitochondrial superoxide generation, ATF3-dependent transcription of proinflammatory, stress response, and oxidative stress genes, as well as activation of proapoptotic cascades. Male apoE knockout mice were fed a high-fat/high-cholesterol WD for 2 months, and brain microvessels were isolated by laser capture microdissection. ATF3 gene transcription was elevated 8-fold in the hippocampus and cerebellar brain region of the WD-fed animals compared with chow-fed control animals. The microvascular injury phenotypes observed in vitro and in vivo were similar. ATF3 plays an important role in mediating brain microvascular responses to acute and chronic lipotoxic injury and may be an important preventative and therapeutic target for endothelial dysfunction in VCI. PMID:27087439

  10. A laser-wire system for the International Linear Collider

    Indian Academy of Sciences (India)

    Nicolas Delerue; Sudhir Dixit; Fred Gannaway; David Howell; Myriam Qurshi; Grahame Blair; Stewart Boogert; Gary Boorman; Chafik Driouichi; Lawerence Deacon; Alexander Aryshev; Pavel Karataev; Nobuhiro Terunnuma; Junji urakawa; Axel Brachmann; Joe Frisch; Marc Ross

    2007-12-01

    A new laser-wire has been installed in the extraction line of the ATF at KEK. It aims at demonstrating that laser-wires can be used to measure micrometre scale beam size. In parallel, studies have been made to specify a laser suitable for the ILC laser-wires.

  11. Metrics for the evaluation of light water reactor accident tolerant fuel

    International Nuclear Information System (INIS)

    The safe, reliable and economic operation of the nation’s nuclear power reactor fleet has always been a top priority for the nuclear industry. Continual improvement of technology, including advanced materials and nuclear fuels, remains central to the industry’s success. Enhancing the accident tolerance of LWRs became a topic of serious discussion following the 2011 Great East Japan Earthquake, resulting tsunami, and subsequent damage to the Fukushima Daiichi nuclear power plant complex. The overall goal of accident tolerant fuel (ATF) development is to identify alternative fuel system technologies to further enhance the safety, competitiveness, and economics of commercial nuclear power. The complex multiphysics behavior of LWR nuclear fuel in the integrated reactor system makes defining specific material or design improvements difficult; as such, establishing desirable performance attributes is critical in guiding the design and development of fuels and cladding with enhanced accident tolerance. The U.S. Department of Energy is sponsoring multiple teams to develop ATF concepts within multiple national laboratories, universities, and the nuclear industry. Concepts under investigation offer both evolutionary and revolutionary changes to the current nuclear fuel system. This paper summarizes technical evaluation methodology proposed in the U.S. to aid in the optimization and down-selection of candidate ATF designs. This methodology will continue to be refined via input from the research community and industry, such that it is available to support the planned down-selection of ATF concepts in 2016. (author)

  12. Activating transcription factor 6 derepression mediates neuroprotection in Huntington disease.

    Science.gov (United States)

    Naranjo, José R; Zhang, Hongyu; Villar, Diego; González, Paz; Dopazo, Xose M; Morón-Oset, Javier; Higueras, Elena; Oliveros, Juan C; Arrabal, María D; Prieto, Angela; Cercós, Pilar; González, Teresa; De la Cruz, Alicia; Casado-Vela, Juan; Rábano, Alberto; Valenzuela, Carmen; Gutierrez-Rodriguez, Marta; Li, Jia-Yi; Mellström, Britt

    2016-02-01

    Deregulated protein and Ca2+ homeostasis underlie synaptic dysfunction and neurodegeneration in Huntington disease (HD); however, the factors that disrupt homeostasis are not fully understood. Here, we determined that expression of downstream regulatory element antagonist modulator (DREAM), a multifunctional Ca2+-binding protein, is reduced in murine in vivo and in vitro HD models and in HD patients. DREAM downregulation was observed early after birth and was associated with endogenous neuroprotection. In the R6/2 mouse HD model, induced DREAM haplodeficiency or blockade of DREAM activity by chronic administration of the drug repaglinide delayed onset of motor dysfunction, reduced striatal atrophy, and prolonged life span. DREAM-related neuroprotection was linked to an interaction between DREAM and the unfolded protein response (UPR) sensor activating transcription factor 6 (ATF6). Repaglinide blocked this interaction and enhanced ATF6 processing and nuclear accumulation of transcriptionally active ATF6, improving prosurvival UPR function in striatal neurons. Together, our results identify a role for DREAM silencing in the activation of ATF6 signaling, which promotes early neuroprotection in HD. PMID:26752648

  13. 49 CFR 40.225 - What form is used for an alcohol test?

    Science.gov (United States)

    2010-10-01

    ... WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Testing Sites, Forms, Equipment and Supplies Used in Alcohol... foreign-language version of the ATF approved by ODAPC. You may use such a non-English language form only in a situation where both the employee and BAT/STT understand and can use the form in that language....

  14. Rice8987 g_array: cDNA information: 196 [

    Lifescience Database Archive (English)

    Full Text Available g_0196 EB0676 >ATF10M23_3(AL035440|pid:g4455192) Arabidopsis thaliana DNA chromosome 4, BAC clon ... weak similarity to hypothetical protein PFB0835c - malaria , PID:g3845289; contains EST gb:T42321, R65259, Aa7 ...

  15. Probe data: 4637 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-008940-1AR RED C71953 AU172434 EB0676 >ATF10M23_3(AL035440|pid:g4455192) Arabidopsis thalian ... weak similarity to hypothetical protein PFB0835c - malaria , PID:g3845289; contains EST gb:T42321, R65259, Aa7 ...

  16. GenBank blastx search result: AK063950 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK063950 001-123-F04 AL022312.7 Human DNA sequence from clone RP5-1104E15 on chromosome 22q12.3- ... e ATF4 gene for activating transcription factor 4 (tax -responsive enhancer element B67) and the 5' end of ...

  17. Rice8987 g_array: cDNA information: 562 [

    Lifescience Database Archive (English)

    Full Text Available g_0562 CH3511 >ATF1C12_20(AL022224|pid:g2982445) Arabidopsis thaliana DNA chromosome 4, BAC clon ... nscription initiation factor IID beta chain, fruit fly , Pir2:B49453; contains EST gb:T46756. DPlate 024 A ...

  18. Shikonin Suppresses Skin Carcinogenesis via Inhibiting Cell Proliferation.

    Science.gov (United States)

    Li, Wenjuan; Zhang, Chunjing; Ren, Amy; Li, Teena; Jin, Rong; Li, Guohong; Gu, Xin; Shi, Runhua; Zhao, Yunfeng

    2015-01-01

    The M2 isoform of pyruvate kinase M2 (PKM2) has been shown to be up-regulated in human skin cancers. To test whether PKM2 may be a target for chemoprevention, shikonin, a natural product from the root of Lithospermum erythrorhizon and a specific inhibitor of PKM2, was used in a chemically-induced mouse skin carcinogenesis study. The results revealed that shikonin treatment suppressed skin tumor formation. Morphological examinations and immunohistochemical staining of the skin epidermal tissues suggested that shikonin inhibited cell proliferation without inducing apoptosis. Although shikonin alone suppressed PKM2 activity, it did not suppress tumor promoter-induced PKM2 activation in the skin epidermal tissues at the end of the skin carcinogenesis study. To reveal the potential chemopreventive mechanism of shikonin, an antibody microarray analysis was performed, and the results showed that the transcription factor ATF2 and its downstream target Cdk4 were up-regulated by chemical carcinogen treatment; whereas these up-regulations were suppressed by shikonin. In a promotable skin cell model, the nuclear levels of ATF2 were increased during tumor promotion, whereas this increase was inhibited by shikonin. Furthermore, knockdown of ATF2 decreased the expression levels of Cdk4 and Fra-1 (a key subunit of the activator protein 1. In summary, these results suggest that shikonin, rather than inhibiting PKM2 in vivo, suppresses the ATF2 pathway in skin carcinogenesis. PMID:25961580

  19. 19 CFR 19.38 - Supervision of exportation.

    Science.gov (United States)

    2010-04-01

    ... cigarettes and cigars from ATF export bonded warehouses (see 27 CFR part 290) in conjunction with exportation... 19 Customs Duties 1 2010-04-01 2010-04-01 false Supervision of exportation. 19.38 Section 19.38... Supervision of exportation. (a) Sales ticket withdrawals. Conditionally duty-free merchandise withdrawn...

  20. Rice8987 g_array: cDNA information: 7998 [RMOS[Archive

    Lifescience Database Archive (English)

    Full Text Available g_7998 ST1133 >ATF9D16_10(AL035394|pid:g4454032) Arabidopsis thaliana DNA chromosome 4, BAC clon ... project); similarity to chS-Rex-b - Gallus gallus (chicken ), gb:L10333; contains EST gb:W43040, N65866, Aa597 ...

  1. Rice8987Corresponding Table(f_g_primer): g_3069 [RMOS[Archive

    Lifescience Database Archive (English)

    Full Text Available g_3069 3UTR_3069 EE1520 C91775 AU094763 >ATF9D16_10(AL035394|pid:g4454032) Arabidopsis thaliana ... project); similarity to chS-Rex-b - Gallus gallus (chicken ), gb:L10333; contains EST gb:W43040, N65866, Aa597 ...

  2. EST data: 4399 [RED

    Lifescience Database Archive (English)

    Full Text Available EE1520 C91775 AU094763 DPlate 046 G10 GCAGCTGCATACTGTCGTAG CAAGGGGCCCCCTTAAAAAC >ATF9D16_10(AL03 ... project); similarity to chS-Rex-b - Gallus gallus (chicken ), gb:L10333; contains EST gb:W43040, N65866, Aa597 ...

  3. Rice8987 g_array: cDNA information: 635 [RMOS[Archive

    Lifescience Database Archive (English)

    Full Text Available g_0635 EB2435 >ATF9D16_10(AL035394|pid:g4454032) Arabidopsis thaliana DNA chromosome 4, BAC clon ... project); similarity to chS-Rex-b - Gallus gallus (chicken ), gb:L10333; contains EST gb:W43040, N65866, Aa597 ...

  4. Rice8987 g_array: cDNA information: 3069 [RMOS[Archive

    Lifescience Database Archive (English)

    Full Text Available g_3069 EE1520 >ATF9D16_10(AL035394|pid:g4454032) Arabidopsis thaliana DNA chromosome 4, BAC clon ... project); similarity to chS-Rex-b - Gallus gallus (chicken ), gb:L10333; contains EST gb:W43040, N65866, Aa597 ...

  5. Rice8987 g_array: cDNA information: 4011 [RMOS[Archive

    Lifescience Database Archive (English)

    Full Text Available g_4011 CH1819 >ATF9D16_10(AL035394|pid:g4454032) Arabidopsis thaliana DNA chromosome 4, BAC clon ... project); similarity to chS-Rex-b - Gallus gallus (chicken ), gb:L10333; contains EST gb:W43040, N65866, Aa597 ...

  6. Rice8987 g_array: cDNA information: 3711 [RMOS[Archive

    Lifescience Database Archive (English)

    Full Text Available g_3711 EB2463 >ATF9D16_10(AL035394|pid:g4454032) Arabidopsis thaliana DNA chromosome 4, BAC clon ... project); similarity to chS-Rex-b - Gallus gallus (chicken ), gb:L10333; contains EST gb:W43040, N65866, Aa597 ...

  7. Rice8987 g_array: cDNA information: 7407 [RMOS[Archive

    Lifescience Database Archive (English)

    Full Text Available g_7407 RA0688 >ATF9D16_10(AL035394|pid:g4454032) Arabidopsis thaliana DNA chromosome 4, BAC clon ... project); similarity to chS-Rex-b - Gallus gallus (chicken ), gb:L10333; contains EST gb:W43040, N65866, Aa597 ...

  8. 77 FR 33625 - Firearms Disabilities for Certain Nonimmigrant Aliens (2001R-332P)

    Science.gov (United States)

    2012-06-07

    ... firearms disabilities for nonimmigrant aliens (67 FR 5422). On that same date, ATF also published in the Federal Register a proposed rule soliciting comments on the interim regulations (Notice No. 935, 67 FR... States.'' 67 FR 5424. In short, the permit process is designed to ensure that the nonimmigrant aliens...

  9. JNK contributes to the tumorigenic potential of human cholangiocarcinoma cells through the mTOR pathway regulated GRP78 induction.

    Science.gov (United States)

    Feng, Chunhong; He, Kai; Zhang, Chunyan; Su, Song; Li, Bo; Li, Yuxiao; Duan, Chun-Yan; Chen, Shaokun; Chen, Run; Liu, Youping; Li, Hong; Wei, Mei; Xia, Xianming; Dai, Rongyang

    2014-01-01

    Less is known about the roles of c-Jun N-terminal kinase (JNK) in cholangiocarcinoma (CCA). Here, we report that JNK exerts its oncogenic action in human CCA cells, partially due to the mammalian target of rapamycin (mTOR) pathway regulated glucose-regulated protein 78 (GRP78) induction. In human CCA cells, the phosphorylation of eukaryotic initiation factor alpha (eIF2α) results in the accumulation of activating transcription factor 4 (ATF4) and GRP78 independent of unfolded protein response (UPR). Suppression of GRP78 expression decreases the proliferation and invasion of human CCA cells. It's notable that mTOR is required for eIF2α phosphorylation-induced ATF4 and GRP78 expression. Importantly, JNK promotes eIF2α/ATF4-mediated GRP78 induction through regulating the activity of mTOR. Thus, our study implicates JNK/mTOR signaling plays an important role in cholangiocarcinogenesis, partially through promoting the eIF2α/ATF4/GRP78 pathway. PMID:24587347

  10. 77 FR 51698 - Authorization To Seize Property Involved in Drug Offenses for Administrative Forfeiture (2012R-9P)

    Science.gov (United States)

    2012-08-27

    ... its regulations to allow the Director of the Bureau of Alcohol, Tobacco, Firearms, and Explosives (ATF... Programs and Services, Bureau of Alcohol, Tobacco, Firearms, and Explosives, U.S. Department of Justice, 99... can be perfected in 60-90 days for minimal cost, including the statutorily required advertisement...

  11. Rice8987Corresponding Table(f_g_primer): g_6215 [

    Lifescience Database Archive (English)

    Full Text Available g_6215 3UTR_6215 EH1840 AU031552 AU031553 >ATF28M20_6(AL031004|pid:g3281853) Arabidopsis thalian ... icago sativa, PID:g2582800; Contains Mitochondrial energy ... transfer proteins signature [PEEGAKRLMM], Protein ...

  12. Effects of chronic renal failure rat serum on histone acetyltransferase p300 and activation of activating transcription factor 4 of arterial smooth muscle cells cultured in vitro

    Institute of Scientific and Technical Information of China (English)

    张耀全

    2014-01-01

    Objective To investigate the effects of the rat serum with chronic renal failure(CRF)on ubiquitin-proteasome pathway,histone acetyltransferase p300 and activation of activating transcription factor 4(ATF4)of rat arterial vascular smooth muscle cells(VSMCs)cultured in vitro,and explore the possible mechanism.Methods Objective To establish the rat model of

  13. Comments on ‘Straka, T.J.; Layton, P.A. Natural Resources Management: Life Cycle Assessment and Forest Certification and Sustainability Issues. Sustainability 2010, 2, 604–623’

    Directory of Open Access Journals (Sweden)

    Ben Gunneberg

    2010-08-01

    Full Text Available Unreferenced statement on page 608: “A fundamental difference between FSC and PEFC is the stakeholders. While FSC was founded mainly by environmental groups, PEFC had strong forest industry and trade groups among its founders. This is one reason FSC is not a member of PEFC. Both the ATFS and SFI are recognized by PEFC as acceptable standards”.

  14. 77 FR 16671 - Labeling Imported Wines With Multistate Appellations

    Science.gov (United States)

    2012-03-22

    ... FR 37672), published August 23, 1978. The preamble of T.D. ATF-53 stated that the regulations... 75 FR 67663 proposing to amend Sec. 4.25 to permit the use of multistate appellations for imported... Alcohol and Tobacco Tax and Trade Bureau 27 CFR Part 4 RIN 1513-AB58 Labeling Imported Wines...

  15. Interaction of Restin with transcription factors

    Institute of Scientific and Technical Information of China (English)

    WU; Yousheng; LU; Fan; QI; Yinxin; WANG; Ruihua; ZHANG; Jia

    2005-01-01

    Restin, a member of melanoma-associated antigen superfamily gene, was first cloned from differentiated leukemia cell induced by all trans-retinoic acid, and was able to inhibit cell proliferation, but the molecular mechanism was not clear. Since Restin was localized in cell nucleus, and its homolog member, Necdin (neuronal growth suppressor factor), could interact with transcription factors p53 and E2F1, we proposed that Restin might also function as Necdin through interacting with some transcription factors. In this study, transcription factors p53, AP1,ATFs and E2Fs were cloned and used in the mammalian two-hybrid system to identify their interaction with Restin. The results showed that only ATF3 had a strong interaction with Restin. It is interesting to know that ATF3 was an important transcription factor for G1 cell cycle initiation in physiological stress response. It was possible that the inhibition of cell proliferation by Restin might be related with the inhibition of ATF3 activity.

  16. Effect of injury on S1 dorsal root ganglia in an experimental model of neuropathic faecal incontinence.

    LENUS (Irish Health Repository)

    Peirce, C

    2011-08-01

    An experimental model of neuropathic faecal incontinence has recently been established. This study aimed to quantify and compare the effect of crush and compression injury on first-order sensory neurones of the inferior rectal nerve (IRN) using a nuclear marker of axonal injury, activating transcription factor (ATF) 3.

  17. Closed orbit response to quadrupole strength variation

    Energy Technology Data Exchange (ETDEWEB)

    Wolski, Andrzej; Zimmermann, Frank

    2004-01-20

    We derive two formulae relating the variation in closed orbit in a storage ring to variations in quadrupole strength, neglecting nonlinear and dispersive effects. These formulae correct results previously reported [1,2,3]. We compare the results of the formulae applied to the ATF with simulations using MAD, and consider their application to beam-based alignment.

  18. Metrics for the Evaluation of Light Water Reactor Accident Tolerant Fuel

    Energy Technology Data Exchange (ETDEWEB)

    Shannon M. Bragg-Sitton

    2001-09-01

    The safe, reliable and economic operation of the nation’s nuclear power reactor fleet has always been a top priority for the nuclear industry. Continual improvement of technology, including advanced materials and nuclear fuels, remains central to the industry’s success. Enhancing the accident tolerance of LWRs became a topic of serious discussion following the 2011 Great East Japan Earthquake, resulting tsunami, and subsequent damage to the Fukushima Daiichi nuclear power plant complex. The overall goal of accident tolerant fuel (ATF) development is to identify alternative fuel system technologies to further enhance the safety, competitiveness, and economics of commercial nuclear power. The complex multiphysics behavior of LWR nuclear fuel in the integrated reactor system makes defining specific material or design improvements difficult; as such, establishing desirable performance attributes is critical in guiding the design and development of fuels and cladding with enhanced accident tolerance. The U.S. Department of Energy is sponsoring multiple teams to develop ATF concepts within multiple national laboratories, universities, and the nuclear industry. Concepts under investigation offer both evolutionary and revolutionary changes to the current nuclear fuel system. This paper summarizes technical evaluation methodology proposed in the U.S. to aid in the optimization and down-selection of candidate ATF designs. This methodology will continue to be refined via input from the research community and industry, such that it is available to support the planned down-selection of ATF concepts in 2016.

  19. Probe data: 5088 [RED

    Lifescience Database Archive (English)

    Full Text Available R10-035910-1AR RED D24257 AU173175 RA1590 >ATF23E12_14(AL022604|pid:g3080420) Arabidopsis thalia ... lone F23E12 (ESSAII project); strong similarity to sugar ... transporter, Arabidopsis thaliana, db_xref=PID:g14 ... 95273; Contains Sugar ... transport proteins signatures [SGGVADWLGRRPMLILS] ...

  20. Rice8987 g_array: cDNA information: 8566 [RMOS[Archive

    Lifescience Database Archive (English)

    Full Text Available g_8566 RA1590 >ATF23E12_14(AL022604|pid:g3080420) Arabidopsis thaliana DNA chromosome 4, BAC clo ... ne F23E12 (ESSAII project); strong similarity to sugar ... transporter, Arabidopsis thaliana, db_xref=PID:g14 ... 95273; Contains Sugar ... transport proteins signatures [SGGVADWLGRRPMLILS] ...

  1. EST data: 6139 [RED

    Lifescience Database Archive (English)

    Full Text Available RA1590 D24257 AU173175 DPlate 063 C12 GTTACAGGGAGAAGAATTCC GTGATCAATCAGATTGCTGG >ATF23E12_14(AL0 ... lone F23E12 (ESSAII project); strong similarity to sugar ... transporter, Arabidopsis thaliana, db_xref=PID:g14 ... 95273; Contains Sugar ... transport proteins signatures [SGGVADWLGRRPMLILS] ...

  2. Probe data: 5473 [RED

    Lifescience Database Archive (English)

    Full Text Available R10-035910-1AR RED D48171 AU174043 SS4246 >ATF23E12_14(AL022604|pid:g3080420) Arabidopsis thalia ... lone F23E12 (ESSAII project); strong similarity to sugar ... transporter, Arabidopsis thaliana, db_xref=PID:g14 ... 95273; Contains Sugar ... transport proteins signatures [SGGVADWLGRRPMLILS] ...

  3. Rice8987 g_array: cDNA information: 8710 [RMOS[Archive

    Lifescience Database Archive (English)

    Full Text Available g_8710 SS4246 >ATF23E12_14(AL022604|pid:g3080420) Arabidopsis thaliana DNA chromosome 4, BAC clo ... ne F23E12 (ESSAII project); strong similarity to sugar ... transporter, Arabidopsis thaliana, db_xref=PID:g14 ... 95273; Contains Sugar ... transport proteins signatures [SGGVADWLGRRPMLILS] ...

  4. EST data: 8011 [RED

    Lifescience Database Archive (English)

    Full Text Available SS4246 D48171 AU174043 DPlate 083 C06 TATCCTAAGCTCCAAAATCC GACTAGTTGCTCGGATCAAG >ATF23E12_14(AL0 ... lone F23E12 (ESSAII project); strong similarity to sugar ... transporter, Arabidopsis thaliana, db_xref=PID:g14 ... 95273; Contains Sugar ... transport proteins signatures [SGGVADWLGRRPMLILS] ...

  5. Rice8987Corresponding Table(f_g_primer): g_8710 [RMOS[Archive

    Lifescience Database Archive (English)

    Full Text Available g_8710 3UTR_8710 SS4246 D48171 AU174043 >ATF23E12_14(AL022604|pid:g3080420) Arabidopsis thaliana ... lone F23E12 (ESSAII project); strong similarity to sugar ... transporter, Arabidopsis thaliana, db_xref=PID:g14 ... 95273; Contains Sugar ... transport proteins signatures [SGGVADWLGRRPMLILS] ...

  6. Rice8987Corresponding Table(f_g_primer): g_8566 [RMOS[Archive

    Lifescience Database Archive (English)

    Full Text Available g_8566 3UTR_8566 RA1590 D24257 AU173175 >ATF23E12_14(AL022604|pid:g3080420) Arabidopsis thaliana ... lone F23E12 (ESSAII project); strong similarity to sugar ... transporter, Arabidopsis thaliana, db_xref=PID:g14 ... 95273; Contains Sugar ... transport proteins signatures [SGGVADWLGRRPMLILS] ...

  7. Probe data: 1484 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-005160-1AR RED AU068643 AU068642 C30624 CE0624 >ATF28M20_6(AL031004|pid:g3281853) Arabidopsi ... icago sativa, PID:g2582800; Contains Mitochondrial energy ... transfer proteins signature [PEEGAKRLMM], Protein ...

  8. Probe data: 450 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-005160-1AR RED AU031552 AU031553 E61840 EH1840 >ATF28M20_6(AL031004|pid:g3281853) Arabidopsi ... icago sativa, PID:g2582800; Contains Mitochondrial energy ... transfer proteins signature [PEEGAKRLMM], Protein ...

  9. Reinstate the Damaged VEGF Signaling Pathway with VEGF-activating Transcription Factor

    Institute of Scientific and Technical Information of China (English)

    Yao-guo Yang; Heng Guan; Chang-wei Liu; Yong-jun Li

    2009-01-01

    Objective To investigate the role of vascular endothelial growth factor-activating transcriptional factor(VEGF-ATF)on the VEGF signaling pathway in diabetes mellitus.Methods Totally,20 C57BL/6 mice fed with high fat diet was induced into diabetes mellitus.Ten diabetes mellitus mice received a lower limb muscle injection with VEGF-ATF plasmid,and another ten were as control.VEGF-ATF is an engineered transcription factor designed to increase VEGF expression.Three days later,mice were sacrificed and the injected gastrocnemius was used for analysis.VEGF mRNA and protein expressions were examined by real-time PCR and ELISA respectively.VEGF receptor 2 mRNA expression was tested with RT-PCR.Phosphorylated Akt,Akt,endothelial nitric oxide synthase(eNOS),and phosphorylated eNOS were assessed by western blot.Results At 3 days post-injection,in mice with diabetes mellitus,VEGF gene transfer increased VEGF mRNA copies and VEGF protein expression in injected muscles compared with control;and reinstated the impaired VEGF signaling pathway with increasing the ratios of phosphorylated Akt/Akt and phosphorylated eNOS/eNOS.However,it did not affect the expression of VEGF receptor 2 mRNA.Conclusion Gene transfer with VEGF-ATF is able to reinstate the impaired VEGF downstream pathway,and potentially promote therapeutic angiogenesis in mice with diabetes mcllitus.

  10. Rice8987 g_array: cDNA information: 2726 [RMOS[Archive

    Lifescience Database Archive (English)

    Full Text Available g_2726 CB2680 >ATF17M5_25(AL035678|pid:g4490316) Arabidopsis thaliana DNA chromosome 4, BAC clon ... R:G2290202; Contains Eukaryotic and viral aspartyl proteases ... active site [LDLDTGSDLTWL]. DPlate 008 C04 C26608 ...

  11. Probe data: 539 [RED

    Lifescience Database Archive (English)

    Full Text Available R06-015880-1AR RED D24296 AU031777 R01679 RA1679 >ATF17M5_25(AL035678|pid:g4490316) Arabidopsis ... R:G2290202; Contains Eukaryotic and viral aspartyl proteases ... active site [LDLDTGSDLTWL]. ...

  12. Rice8987 g_array: cDNA information: 8932 [RMOS[Archive

    Lifescience Database Archive (English)

    Full Text Available g_8932 RA1679 >ATF17M5_25(AL035678|pid:g4490316) Arabidopsis thaliana DNA chromosome 4, BAC clon ... R:G2290202; Contains Eukaryotic and viral aspartyl proteases ... active site [LDLDTGSDLTWL]. DPlate 064 B06 D24296 ...

  13. Rice8987 g_array: cDNA information: 7430 [RMOS[Archive

    Lifescience Database Archive (English)

    Full Text Available g_7430 RA3021 >ATF23E12_9(AL022604|pid:g3080415) Arabidopsis thaliana DNA chromosome 4, BAC clon ... PIR2:S71773; Contains Eukaryotic thiol (cysteine) proteases ... active sites [QGQCGSCWAFST][LDHGVAAVGYG]; contains ...

  14. Probe data: 2573 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-050030-1AR RED C26608 AU100748 C12680 CB2680 >ATF17M5_25(AL035678|pid:g4490316) Arabidopsis ... R:G2290202; Contains Eukaryotic and viral aspartyl proteases ... active site [LDLDTGSDLTWL]. ...

  15. Rice8987 g_array: cDNA information: 1773 [RMOS[Archive

    Lifescience Database Archive (English)

    Full Text Available g_1773 EB1626 >ATF23E12_9(AL022604|pid:g3080415) Arabidopsis thaliana DNA chromosome 4, BAC clon ... PIR2:S71773; Contains Eukaryotic thiol (cysteine) proteases ... active sites [QGQCGSCWAFST][LDHGVAAVGYG]; contains ...

  16. Probe data: 629 [RED

    Lifescience Database Archive (English)

    Full Text Available R05-000860-1AR RED D39203 AU031981 RA3021 >ATF23E12_9(AL022604|pid:g3080415) Arabidopsis thalian ... PIR2:S71773; Contains Eukaryotic thiol (cysteine) proteases ... active sites [QGQCGSCWAFST][LDHGVAAVGYG]; contains ...

  17. The Brookhaven Accelerator Test Facility

    International Nuclear Information System (INIS)

    The Accelerator Test Facility (ATF), presently under construction at Brookhaven National laboratory, is described. It consists of a 50-MeV electron beam synchronizable to a high-peak power CO2 laser. The interaction of electrons with the laser field will be probed, with some emphasis on exploring laser-based acceleration techniques. 5 refs., 2 figs

  18. Probe data: 5046 [RED

    Lifescience Database Archive (English)

    Full Text Available R06-046030-1AR RED AU173086 AU173087 RA0369 >ATF18F4_17(AL021637|pid:g2827661) Arabidopsis thali ... one F18F4 (ESSAII project); Protein sequence is in conflict ... with the conceptual translation; 5-substituted hyd ...

  19. Rice8987 g_array: cDNA information: 7023 [

    Lifescience Database Archive (English)

    Full Text Available g_7023 RA0369 >ATF18F4_17(AL021637|pid:g2827661) Arabidopsis thaliana DNA chromosome 4, BAC clon ... e F18F4 (ESSAII project); Protein sequence is in conflict ... with the conceptual translation; 5-substituted hyd ...

  20. Rice8987Corresponding Table(f_g_primer): g_6585 [

    Lifescience Database Archive (English)

    Full Text Available g_6585 3UTR_6585 EH0928 AU065261 AU095249 >ATF18F4_17(AL021637|pid:g2827661) Arabidopsis thalian ... one F18F4 (ESSAII project); Protein sequence is in conflict ... with the conceptual translation; 5-substituted hyd ...

  1. Rice8987Corresponding Table(f_g_primer): g_7023 [

    Lifescience Database Archive (English)

    Full Text Available g_7023 3UTR_7023 RA0369 AU173086 AU173087 >ATF18F4_17(AL021637|pid:g2827661) Arabidopsis thalian ... one F18F4 (ESSAII project); Protein sequence is in conflict ... with the conceptual translation; 5-substituted hyd ...

  2. EST data: 5888 [RED

    Lifescience Database Archive (English)

    Full Text Available RA0369 AU173086 AU173087 DPlate 061 H04 ACAGCATCCCCACCTTCGTC GATGCGACGACAGATTGGTC >ATF18F4_17(AL ... one F18F4 (ESSAII project); Protein sequence is in conflict ... with the conceptual translation; 5-substituted hyd ...

  3. Rice8987 g_array: cDNA information: 6585 [

    Lifescience Database Archive (English)

    Full Text Available g_6585 EH0928 >ATF18F4_17(AL021637|pid:g2827661) Arabidopsis thaliana DNA chromosome 4, BAC clon ... e F18F4 (ESSAII project); Protein sequence is in conflict ... with the conceptual translation; 5-substituted hyd ...

  4. Probe data: 2355 [RED

    Lifescience Database Archive (English)

    Full Text Available R06-046030-1AR RED AU065261 AU095249 EH0928 >ATF18F4_17(AL021637|pid:g2827661) Arabidopsis thali ... one F18F4 (ESSAII project); Protein sequence is in conflict ... with the conceptual translation; 5-substituted hyd ...

  5. An Integrated Real-Time Beamforming and Postfiltering System for Nonstationary Noise Environments

    Directory of Open Access Journals (Sweden)

    Gannot Sharon

    2003-01-01

    Full Text Available We present a novel approach for real-time multichannel speech enhancement in environments of nonstationary noise and time-varying acoustical transfer functions (ATFs. The proposed system integrates adaptive beamforming, ATF identification, soft signal detection, and multichannel postfiltering. The noise canceller branch of the beamformer and the ATF identification are adaptively updated online, based on hypothesis test results. The noise canceller is updated only during stationary noise frames, and the ATF identification is carried out only when desired source components have been detected. The hypothesis testing is based on the nonstationarity of the signals and the transient power ratio between the beamformer primary output and its reference noise signals. Following the beamforming and the hypothesis testing, estimates for the signal presence probability and for the noise power spectral density are derived. Subsequently, an optimal spectral gain function that minimizes the mean square error of the log-spectral amplitude (LSA is applied. Experimental results demonstrate the usefulness of the proposed system in nonstationary noise environments.

  6. Activating transcription factor 6 derepression mediates neuroprotection in Huntington disease

    Science.gov (United States)

    Naranjo, José R.; Zhang, Hongyu; Villar, Diego; González, Paz; Dopazo, Xose M.; Morón-Oset, Javier; Higueras, Elena; Oliveros, Juan C.; Arrabal, María D.; Prieto, Angela; Cercós, Pilar; González, Teresa; De la Cruz, Alicia; Casado-Vela, Juan; Rábano, Alberto; Valenzuela, Carmen; Gutierrez-Rodriguez, Marta; Li, Jia-Yi; Mellström, Britt

    2016-01-01

    Deregulated protein and Ca2+ homeostasis underlie synaptic dysfunction and neurodegeneration in Huntington disease (HD); however, the factors that disrupt homeostasis are not fully understood. Here, we determined that expression of downstream regulatory element antagonist modulator (DREAM), a multifunctional Ca2+-binding protein, is reduced in murine in vivo and in vitro HD models and in HD patients. DREAM downregulation was observed early after birth and was associated with endogenous neuroprotection. In the R6/2 mouse HD model, induced DREAM haplodeficiency or blockade of DREAM activity by chronic administration of the drug repaglinide delayed onset of motor dysfunction, reduced striatal atrophy, and prolonged life span. DREAM-related neuroprotection was linked to an interaction between DREAM and the unfolded protein response (UPR) sensor activating transcription factor 6 (ATF6). Repaglinide blocked this interaction and enhanced ATF6 processing and nuclear accumulation of transcriptionally active ATF6, improving prosurvival UPR function in striatal neurons. Together, our results identify a role for DREAM silencing in the activation of ATF6 signaling, which promotes early neuroprotection in HD. PMID:26752648

  7. 75 FR 81846 - Expansion of the Santa Maria Valley Viticultural Area

    Science.gov (United States)

    2010-12-29

    ..., published T.D. ATF-89 in the Federal Register at 46 FR 39811 (August 5, 1981), establishing the Santa Maria... the proposed expansion of the Santa Maria Valley viticultural area in the Federal Register at 75 FR... within the expansion area. Both stations are nestled along foothills, slightly above the valley floor....

  8. Progress on the Westinghouse Accident Tolerant Fuel Programme

    International Nuclear Information System (INIS)

    The Westinghouse led team on accident tolerant fuel (ATF) has made significant progress over the last decade on the development of economically attractive cladding and fuel options to utility customers that have the potential for increased tolerance for beyond design basis accidents. Since the occurrence of the Fukushima Daiichi accident in 2011, Westinghouse has become increasingly focused on ATF development and has accelerated the programme with support from the Department of Energy (DOE). The Westinghouse ATF designs have been motivated by significantly enhanced accident tolerance, simplified designs for future Nuclear Steam Supply Systems (NSSS), and substantially improved fuel cycle costs. To date, Westinghouse, working with its partners, has a basic concept for silicon carbide (SiC) ceramic cladding and advanced pellet designs and has also performed early tests to show viability of the chosen concepts. The Westinghouse ATF concepts include: deposition of oxidation resistant titanium-aluminium-carbide (Ti2AlC) coatings on zirconium alloy as a mid-term cladding product and SiC composites as the long-term cladding product. Regarding fuels, uranium silicide (U3Si2) pellets are being developed as a mid-term fuel product, and waterproofed uranium nitride (U15N) as the long-term fuel product. The Westinghouse ATF Program, in conjunction with its partner General Atomics, continues to advance SiC technology in the areas of fabrication, testing, and modelling. High temperature oxidation tests are ongoing at the Massachusetts Institute of Technology (MIT) to evaluate accident tolerance of this cladding. While initial efforts regarding the deposition of oxidation resistant coatings on zirconium alloy cladding did not perform as desired, the University of Wisconsin is continuing to optimize deposition parameters. Critical work also continues in the area of advanced pellet development on both U3Si2 and waterproofed uranium nitride fuels at Idaho National Laboratory (INL

  9. MK3 controls Polycomb target gene expression via negative feedback on ERK

    Directory of Open Access Journals (Sweden)

    Prickaerts Peggy

    2012-08-01

    Full Text Available Abstract Background Gene-environment interactions are mediated by epigenetic mechanisms. Polycomb Group proteins constitute part of an epigenetic cellular transcriptional memory system that is subject to dynamic modulation during differentiation. Molecular insight in processes that control dynamic chromatin association and dissociation of Polycomb repressive complexes during and beyond development is limited. We recently showed that MK3 interacts with Polycomb repressive complex 1 (PRC1. The functional relevance of this interaction, however, remained poorly understood. MK3 is activated downstream of mitogen- and stress-activated protein kinases (M/SAPKs, all of which fulfill crucial roles during development. We here use activation of the immediate-early response gene ATF3, a bona fide PRC1 target gene, as a model to study how MK3 and its effector kinases MAPK/ERK and SAPK/P38 are involved in regulation of PRC1-dependent ATF3 transcription. Results Our current data show that mitogenic signaling through ERK, P38 and MK3 regulates ATF3 expression by PRC1/chromatin dissociation and epigenetic modulation. Mitogenic stimulation results in transient P38-dependent H3S28 phosphorylation and ERK-driven PRC1/chromatin dissociation at PRC1 targets. H3S28 phosphorylation by itself appears not sufficient to induce PRC1/chromatin dissociation, nor ATF3 transcription, as inhibition of MEK/ERK signaling blocks BMI1/chromatin dissociation and ATF3 expression, despite induced H3S28 phosphorylation. In addition, we establish that concomitant loss of local H3K27me3 promoter marking is not required for ATF3 activation. We identify pERK as a novel signaling-induced binding partner of PRC1, and provide evidence that MK3 controls ATF3 expression in cultured cells via negative regulatory feedback on M/SAPKs. Dramatically increased ectopic wing vein formation in the absence of Drosophila MK in a Drosophila ERK gain-of-function wing vein patterning model, supports the

  10. Two additive mechanisms impair the differentiation of 'substrate-selective' p38 inhibitors from classical p38 inhibitors in vitro

    Directory of Open Access Journals (Sweden)

    Seidl Kelly M

    2010-03-01

    Full Text Available Abstract Background The success of anti-TNF biologics for the treatment of rheumatoid arthritis has highlighted the importance of understanding the intracellular pathways that regulate TNF production in the quest for an orally-available small molecule inhibitor. p38 is known to strongly regulate TNF production via MK2. The failure of several p38 inhibitors in the clinic suggests the importance of other downstream pathways in normal cell function. Recent work has described a 'substrate-selective' p38 inhibitor that is able to preferentially block the activity of p38 against one substrate (MK2 versus another (ATF2. Using a combined experimental and computational approach, we have examined this mechanism in greater detail for two p38 substrates, MK2 and ATF2. Results We found that in a dual (MK2 and ATF2 substrate assay, MK2-p38 interaction reduced the activity of p38 against ATF2. We further constructed a detailed kinetic mechanistic model of p38 phosphorylation in the presence of multiple substrates and successfully predicted the performance of classical and so-called 'substrate-selective' p38 inhibitors in the dual substrate assay. Importantly, it was found that excess MK2 results in a stoichiometric effect in which the formation of p38-MK2-inhibitor complex prevents the phosphorylation of ATF2, despite the preference of the compound for the p38-MK2 complex over the p38-ATF2 complex. MK2 and p38 protein expression levels were quantified in U937, Thp-1 and PBMCs and found that [MK2] > [p38]. Conclusion Our integrated mechanistic modeling and experimental validation provides an example of how systems biology approaches can be applied to drug discovery and provide a basis for decision-making with limited chemical matter. We find that, given our current understanding, it is unlikely that 'substrate-selective' inhibitors of p38 will work as originally intended when placed in the context of more complex cellular environments, largely due to a

  11. Genetic Interactions Due to Constitutive and Inducible Gene Regulation Mediated by the Unfolded Protein Response in C. elegans.

    Directory of Open Access Journals (Sweden)

    2005-09-01

    Full Text Available The unfolded protein response (UPR is an adaptive signaling pathway utilized to sense and alleviate the stress of protein folding in the endoplasmic reticulum (ER. In mammals, the UPR is mediated through three proximal sensors PERK/PEK, IRE1, and ATF6. PERK/PEK is a protein kinase that phosphorylates the alpha subunit of eukaryotic translation initiation factor 2 to inhibit protein synthesis. Activation of IRE1 induces splicing of XBP1 mRNA to produce a potent transcription factor. ATF6 is a transmembrane transcription factor that is activated by cleavage upon ER stress. We show that in Caenorhabditis elegans, deletion of either ire-1 or xbp-1 is synthetically lethal with deletion of either atf-6 or pek-1, both producing a developmental arrest at larval stage 2. Therefore, in C. elegans, atf-6 acts synergistically with pek-1 to complement the developmental requirement for ire-1 and xbp-1. Microarray analysis identified inducible UPR (i-UPR genes, as well as numerous constitutive UPR (c-UPR genes that require the ER stress transducers during normal development. Although ire-1 and xbp-1 together regulate transcription of most i-UPR genes, they are each required for expression of nonoverlapping sets of c-UPR genes, suggesting that they have distinct functions. Intriguingly, C. elegans atf-6 regulates few i-UPR genes following ER stress, but is required for the expression of many c-UPR genes, indicating its importance during development and homeostasis. In contrast, pek-1 is required for induction of approximately 23% of i-UPR genes but is dispensable for the c-UPR. As pek-1 and atf-6 mainly act through sets of nonoverlapping targets that are different from ire-1 and xbp-1 targets, at least two coordinated responses are required to alleviate ER stress by distinct mechanisms. Finally, our array study identified the liver-specific transcription factor CREBh as a novel UPR gene conserved during metazoan evolution.

  12. 4D modelling of the Alto Tiberina Fault system (Northern Apennines, Italy)

    Science.gov (United States)

    De Donatis, Mauro; Susini, Sara; Mirabella, Francesco; Lupattelli, Andrea; Barchi, Massimiliano

    2014-05-01

    The Alto Tiberina Fault (ATF) in the Northern Apennines of Italy is a low-angle normal fault dipping to the East and accommodating up to 10 km of extension. The fault is ~70 km long and is the detachment for the SW-dipping Gubbio normal fault. The ATF fault system has been dramatically exhumed and the ATF footwall has evolved in a horst bounded to the east by ATF synthetic faults and to the west by the Corciano west-dipping normal fault. The fault has been widely studied over the last years in order to understand its mechanical behaviour, its present-day deformation rate and its seismological role. By using a wide data-set including subsurface data (seismic reflection profiles and boreholes) and surface geological data (new maps of the CARG project of Italy), we have reconstructed the 3D geometry of both the fault and of the main lithostratigraphic boundaries at the fault hanging-wall and foot-wall. The CARG map data were integrated by local observations and mapping using mobile GIS software (BeeGIS) and Android app (Geopaparazzi). Surface data were combined with seismic reflection profiles and wells interpretation and other data from available literature. The large amount of information were combined in MOVE software (Midland Valley Exploration ltd). Our reconstruction allows to i) build up a three-dimensional geological model of the subsurface including the main faults and lithostratigraphic boundaries; ii) identify a set of east-west trending faults the role of which was previously underestimated; iii) test a 3D-restoration of extension for the visualization of the time evolution and for the validation of the structural reconstruction. The restored structures are the main normal faults in the region. The sequential restoration was performed by taking into account the timing of deformation as derived from the literature. The model was sequentially restored according to the following chronological order from the latest to the oldest: 1a) last deformational event

  13. Advanced InSAR and GPS measurements for the detection of surface movements along the Alto Tiberina (Italy) normal fault system: data modeling and future perspectives

    Science.gov (United States)

    Anderlini, L.; Polcari, M.; Bignami, C.; Pepe, A.; Solaro, G.; Serpelloni, E.; Moro, M.; Albano, M.; Chiaraluce, L.; Stramondo, S.

    2014-12-01

    The Alto Tiberina fault (ATF) is a low-angle (east-dipping at 15°), 70 km long normal fault (LANF) located in the Umbria-Marche Apennines (central Italy), an area characterized by a SW-NE oriented extension occurring at rates of ~2 mm/yr. Active extension is precisely measured by a dense distribution of GPS stations belonging to several networks, thanks also to additional sites recently installed in the framework of the INGV national RING network and of the ATF observatory. Advanced Interferometry SAR (A-InSAR) techniques play today a key role in Earth Sciences thanks to their capability to detect and monitor slow surface movements over wide areas. A-InSAR techniques, along with in-situ ground measurements, can provide suitable information on the causes of interseismic (seismic, creep) movements. Large datasets of SAR images of European (ERS 1-2 and ENVISAT) and Italian (COSMO-SKyMed) satellites have been used to retrieve surface velocity maps and relevant time series from 1992 to 2014, along both ascending and descending orbits. A network of artificial Corner Reflectors has also been deployed in the proximity of some GPS sites in order to calibrate the processing results of the COSMO-SkyMed SAR data-set and to derive velocity maps. We use an elastic Block Modeling (BM) approach in order to model GPS data by considering the major fault systems as bounds of rotating blocks, while estimating geodetic fault slip-rates.,Thanks to the latest imaging of its deep structure obtained from seismic profiles, the ATF is represented as a complex rough surface with the goal of evaluating the distribution of interseismic fault coupling. The preliminary results obtained show firstly that the observed extension is partially accommodated by interseismic deformation on the ATF, highlighting the important role of this LANF inside an active tectonic contest. Secondarily, using the ATF surface "topography", we found for the resolved areas an interesting correlation between

  14. Measurements of emittance growth through the achromatic bend at the BNL Accelerator Test Facility

    International Nuclear Information System (INIS)

    Measurements of emittance growth in a high peak current beam as it passes through an achromatic double bend are summarized. Experiments were performed using the ATF at Brookhaven National Laboratory by X.J. Wang and D. Kehne as a collaboration resulting from the proposal attached at the end of the document. The ATF consists off an RF gun (1 MeV), two sections of linac (40-75 MeV), a diagnostic section immediately following the linac, a 20 degree bend magnet, a variable aperture slit at a high dispersion point, 5 quadrupoles, then another 20 degree bend followed by another diagnostic section. The TRANSPORT deck describing the region from the end of the linac to the end of the diagnostic line following the achromatic bends is attached to the end of this document. Printouts of the control screens are also attached

  15. Fermentation of Apple Juice with a Selected Yeast Strain Isolated from the Fermented Foods of Himalayan Regions and Its Organoleptic Properties.

    Science.gov (United States)

    Kanwar, S S; Keshani

    2016-01-01

    Twenty-three Saccharomyces cerevisiae strains isolated from different fermented foods of Western Himalayas have been studied for strain level and functional diversity in our department. Among these 23 strains, 10 S. cerevisiae strains on the basis of variation in their brewing traits were selected to study their organoleptic effect at gene level by targeting ATF1 gene, which is responsible for ester synthesis during fermentation. Significant variation was observed in ATF1 gene sequences, suggesting differences in aroma and flavor of their brewing products. Apple is a predominant fruit in Himachal Pradesh and apple cider is one of the most popular drinks all around the world hence, it was chosen for sensory evaluation of six selected yeast strains. Organoleptic studies and sensory analysis suggested Sc21 and Sc01 as best indigenous strains for soft and hard cider, respectively, indicating their potential in enriching the local products with enhanced quality. PMID:27446050

  16. Lipid-soluble cigarette smoking particles induce expression of inflammatory and extracellular-matrix-related genes in rat cerebral arteries

    DEFF Research Database (Denmark)

    Vikman, Petter; Xu, Cang-Bao; Edvinsson, Lars

    2009-01-01

    AIMS: Cigarette smoking is one of the strongest risk factors for stroke. However, the underlying molecular mechanisms that smoke leads to the pathogenesis of stroke are incompletely understood. METHODS: Dimethyl sulfoxide (DMSO)-soluble (lipid-soluble) cigarette smoking particles (DSP) were...... downstream transcription factors (ATF-2, Elk-1 and c-Jun) were examined. RESULTS: We observed that compared with control (DMSO-treated cerebral arteries), the cerebral arteries treated by DSP exhibited enhanced expression of MMP13 and AT(1) receptors, but not of AT(2) receptors, at both mRNA and protein...... factor ATF-2 and Elk-1. However, ERK 1/2 and SAPK/JNK activities were markedly expressed in the control (organ culture per se with DMSO), and DSP failed to further enhance the activation of ERK 1/2 and SAPK/JNK in the cerebral arteries. CONCLUSIONS: DSP induces cerebral vessel inflammation with...

  17. Cavity beam position monitor system for the Accelerator Test Facility 2

    CERN Document Server

    Kim, Y I; Aryshev, A; Boogert, S T; Boorman, G; Frisch, J; Heo, A; Honda, Y; Hwang, W H; Huang, J Y; Kim, E -S; Kim, S H; Lyapin, A; Naito, T; May, J; McCormick, D; Mellor, R E; Molloy, S; Nelson, J; Park, S J; Park, Y J; Ross, M; Shin, S; Swinson, C; Smith, T; Terunuma, N; Tauchi, T; Urakawa, J; White, G R

    2013-01-01

    The Accelerator Test Facility 2 (ATF2) is a scaled demonstrator system for final focus beam lines of linear high energy colliders. This paper describes the high resolution cavity beam position monitor (BPM) system, which is a part of the ATF2 diagnostics. Two types of cavity BPMs are used, C-band operating at 6.423 GHz, and S-band at 2.888 GHz with an increased beam aperture. The cavities, electronics, and digital processing are described. The resolution of the C-band system with attenuators was determined to be approximately 250 nm and 1 m for the S-band system. Without attenuation the best recorded C-band cavity resolution was 27 nm.

  18. Microarray expression analysis of genes involved in innate immune memory in peritoneal macrophages

    Directory of Open Access Journals (Sweden)

    Keisuke Yoshida

    2016-03-01

    Full Text Available Immunological memory has been believed to be a feature of the adaptive immune system for long period, but recent reports suggest that the innate immune system also exhibits memory-like reaction. Although evidence of innate immune memory is accumulating, no in vivo experimental data has clearly implicated a molecular mechanism, or even a cell-type, for this phenomenon. In this study of data deposited into Gene Expression Omnibus (GEO under GSE71111, we analyzed the expression profile of peritoneal macrophages isolated from mice pre-administrated with toll-like receptor (TLR ligands, mimicking pathogen infection. In these macrophages, increased expression of a group of innate immunity-related genes was sustained over a long period of time, and these genes overlapped with ATF7-regulated genes. We conclude that ATF7 plays an important role in innate immune memory in macrophages.

  19. Electric Motor Thermal Management R&D; NREL (National Renewable Energy Laboratory)

    Energy Technology Data Exchange (ETDEWEB)

    Bennion, Kevin

    2015-06-09

    Thermal constraints place significant limitations on how electric motors ultimately perform. Without the ability to remove heat, the motor cannot operate without sacrificing performance, efficiency, and reliability. Finite element analysis and computational fluid dynamics modeling approaches are being increasingly utilized in the design and analysis of electric motors. As the models become more sophisticated, it is important to have detailed and accurate knowledge of both the passive thermal performance and the active cooling performance. In this work, we provide an overview of research characterizing both passive and active thermal elements related to electric motor thermal management. To better characterize the passive thermal performance, work is being performed to measure motor material thermal properties and thermal contact resistances. The active cooling performance of automatic transmission fluid (ATF) jets is also being measured to better understand the heat transfer coefficients of ATF impinging on motor copper windings.

  20. The effect of emotions on risk perception: Experimental evaluation of the affective tendencies framework

    Directory of Open Access Journals (Sweden)

    Drače Saša

    2012-01-01

    Full Text Available The aim of this study was to assess the role of specific emotions on risk perception providing a more stringent experimental test of the Appraisal Tendencies Framework (ATF. Consistent with expectations, angry and happy participants made more optimistic risk estimates than participants who were made sad. As hypothesized by ATF, happiness and anger also led people to somewhat higher certainty appraisals than sadness. However, this change in perception did not mediate the impact of emotions on risk estimates. Taken together, our results provide the evidence for causal role of specific emotions in risk perception and contribute to literature showing that the effects of emotion on judgment are not solely due to the valence of the experienced emotion. However, they also suggest that the processes underlying emotion effects remain in need for further specifications.

  1. Antec starts serial production; Antec startet Serienfertigung

    Energy Technology Data Exchange (ETDEWEB)

    Iken, J.

    2001-01-12

    Thuringian producer Antec Solar has produced CdTe modules to near maturity. Serial production is envisaged for January 2001. The CdTe modules will be marketed under the name ATF (Advanced Thin Film Technology). Full production capacityis expected for mid-2002. [German] Die Fertigung von Cadmium-Tellurid-Modulen (CdTe) beim thueringischen Unternehmen Antec Solar steht vor der Serienreife. Die Nullserie wurde Anfang November gestartet und erfolgreich abgeschlossen: 'Die Produktion ist angelaufen, die ersten Module sind gefertigt'. Der Start der Serienproduktion ist fuer Anfang Januar 2001 vorgesehen. Die volle Produktionskapazitaet fuer die CdTe-Module, die Antec unter dem Namen ATF (Advanced Thin Film Technology) vermarkten will, soll Mitte naechsten Jahres erreicht werden. (orig./AKF)

  2. Kinetics and mechanism of uncatalyzed and ruthenium(III)-catalyzed oxidation of formamidine derivative by hexacyanoferrate(III) in aqueous alkaline medium

    Indian Academy of Sciences (India)

    AHMED FAWZY

    2016-05-01

    The catalytic effect of ruthenium(III) on the oxidation of N,N-dimethyl-N-(4H-1,2,4-triazol-3-yl) formamidine (ATF) by hexacyanoferrate(III) (HCF) was studied spectrophotometrically in aqueous alkalinemedium. Both uncatalyzed and catalyzed reactions showed first order kinetics with respect to [HCF],whereas the reaction orders with respect to [ATF] and $[OH^{-}]$ were apparently less than unity over the concentrationrange studied. A first order dependence with respect to $[Ru^{III}]$ was obtained. Increasing ionic strengthincreased the rate of uncatalyzed reaction and decreased the rate of the catalyzed one Plausible mechanisticschemes of oxidation reactions have been proposed. In both cases, the final oxidation products are identifiedas aminotriazole, dimethyl amine and carbon dioxide. The rate laws associated with the reaction mechanismsare derived. The reaction constants involved in the different steps of the mechanisms were calculated. Theactivation and thermodynamic parameters have been computed and discussed.

  3. Adenovirus-induced alterations in host cell gene expression prior to the onset of viral gene expression.

    Science.gov (United States)

    Granberg, Fredrik; Svensson, Catharina; Pettersson, Ulf; Zhao, Hongxing

    2006-09-15

    In this report, we have studied gene expression profiles in human primary lung fibroblasts (IMR-90) during the very early phase of an adenovirus infection. Eight out of twelve genes with known functions encoded transcription factors linked to two major cellular processes; inhibition of cell growth (ATF3, ATF4, KLF4, KLF6 and ELK3) and immune response (NR4A1 and CEBPB), indicating that the earliest consequences of an adenovirus infection are growth arrest and induction of an immune response. A time course analysis showed that the induction of these immediate-early response genes was transient and suppressed after the onset of the adenovirus early gene expression. PMID:16860366

  4. Estimates of CSR Instability Thresholds for Various Storage Rings

    CERN Document Server

    Zimmermann, Frank

    2010-01-01

    We review the key predictions and conditions by several authors for the onset of longitudinal instabilities due to coherent synchrotron radiation (CSR), and evaluate them numerically for various storage rings, namely the KEKB High Energy Ring (HER) & Low Energy Ring (LER), SuperKEKB HER & LER, old and new designs of the SuperKEKB Damping Ring (DR), SuperB HER & LER, CLIC DR (2009 and 2010 design parameters), SLC DR, and ATF DR. We show that the theoretical uncertainty in the instability onset is at least at the level of 20-30% in bunch intensity. More importantly, we present some doubts about the general applicability for many of these storage rings of some commonly used formulae. To cast further light on these questions, an experiment at lower beam energy on the ATF Damping Ring is proposed.

  5. Manipulations of Double Electron Beams within One RF Period for Seeded SM-LWFA Experiment

    CERN Document Server

    Zhou, Feng; Cline, David B; Kimura, Wayne D; Yakimenko, Vitaly

    2005-01-01

    Although seeded SM-LWFA only requires one electron beam to initiate the laser wakefield, it would be highly desirable to have a second electron beam traveling after the first one to probe the accelerated electrons. To create and preserve significant amount of wakefield in the STELLA SM-LWFA experiment, the first e-beam needs to be tiny (<40 microns FWHM) in size and short in length within the plasma. To probe the wakefield which is damped within 10 ps for certain plasma density, the separation between the first and second beams needs to be within one RF period and the second e-beam must have smaller energy spread and smaller size. Design of double beams in one RF period to meet the strict requirements and the preliminary beam study at BNL-ATF facility are presented. The scheme of double beams with ATF bunch compressor is also discussed.

  6. Results of the High Resolution OTR Measurements at KEK and comparison with simulations

    CERN Document Server

    Bolzon, B; Mazzoni, S; Welsch, C P; Karataev, P; Kruchinin, K; Aryshev, A

    2013-01-01

    Optical Transition Radiation (OTR) is emitted when a charged particle crosses the interface between two media with different dielectric properties. It has become a standard tool for beam imaging and transverse beam size measurements. At the KEK Accelerator Test Facility 2 (ATF2), OTR is used at the beginning of the final focus system to measure micrometre beam size using the visibility of the OTR Point Spread Function (PSF). In order to study in detail the PSF and improve the resolution of the monitor, a novel simulation tool has been developed. Based on the physical optic propagation mode of ZEMAX, the propagation of the OTR electric field can be simulated very precisely up to the image plane, taking into account aberrations and diffraction. This contribution presents the comparison between Zemax simulations and measurements performed at ATF2.

  7. Dynamic Evaluation of the Contact Characteristics and Three-Dimensional Motion for the Ankle Joint with Lateral Ligament Injuries

    Science.gov (United States)

    Kawakami, Kensaku; Omori, Go; Terashima, Shojiro; Sakamoto, Makoto; Hara, Toshiaki

    The purpose of this study was to clarify the dynamic changes in contact pressure distribution and three-dimensional ankle joint motion before and after lateral ligament injuries. Five fresh and frozen intact cadaveric ankles were examined. Each ankle was mounted on a specially designed frame that preserved five degrees of freedom motion. The direct linear transformation technique was used to measure the three-dimensional ankle motion, and a pressure-sensitive conductive rubber sensor was inserted into the talocrural joint space to determine the contact pressure distribution. The contact area on the talus for intact ankle moved anteriorly and laterally with increasing dorsiflexion. An area of high pressure was observed in the medial aspect of the articular surface after the ligament was cut. Supination significantly increased after a combined anterior talofibular ligament (ATF) and calcaneofibular ligament (CF) were cut in comparison with after only an ATF was cut, and no significant differences were observed in motional properties under each experimental condition.

  8. Fully ceramic microencapsulated fuels. Characteristics and potential LWR applications

    International Nuclear Information System (INIS)

    This paper summarizes the characteristics of the fully ceramic microencapsulated (FCM) fuel concept and two potential light water reactor (LWR) applications of FCM fuels: for actinide management and as an accident tolerant fuel (ATF). Recent progress in FCM fuel development includes production of uranium mononitride kernels, fabrication of FCM pellets and pins, and irradiation testing of matrix samples and FCM pellets. Potential applications of FCM fuel in LWRs appear promising based upon studies performed by several organizations; however, further efforts are needed to investigate various design aspects in further detail and explore promising new areas of research such as new fuel pin and assembly designs or alternate materials of interest. Current challenges in FCM fuel development and LWR applications for FCM fuels include low heavy metal fuel loading densities and increased uncertainties in analysis due to several different factors. Overall, LWR FCM concepts appear feasible for both actinide management and as an ATF. (author)

  9. The stabilisation of final focus system

    Indian Academy of Sciences (India)

    P A Coe; D Urner; A Reichold

    2007-12-01

    The StaFF (stabilisation of final focus) system will use interferometers to monitor the relative positions and orientations of several key components in the beam-delivery and interaction region. Monitoring the relative positions of the ILC final focus quadrupole magnets will be the most demanding application, where mutual and beam-relative stability will have a direct impact on machine luminosity. Established, laser-based frequency scanning interferometry (FSI) and fixed-frequency interferometry (FFI) offer positional resolution at length scales of the laser wavelength (1500 nm to 1560 nm) and a thousandth of the wavelength, respectively. As part of the ATF at KEK, StaFF will use interferometers to measure lines of a geodetic network to record relative motion between two beam position monitors. Interferometers are being designed and tested in Oxford prior to deployment at the ATF.

  10. Standards for bullets and casings

    Directory of Open Access Journals (Sweden)

    J.F Song

    2002-11-01

    The Office of Law Enforcement Standards (OLES at the National Institute of Standards and Technology (NIST manages research in many different disciplines of forensic science. One of these projects supports the National Integrated Ballistics Information Network (NIBIN. NIST digitized six bullet signatures from samples provided by the Bureau of Alcohol, Tobacco, and Firearms (ATF and the Federal Bureau of Investigation (FBI. Using these signatures as a virtual standard, NIST’s Instrument Shop manufactured 20 reference materials (RM 8240 standard bullets using a numerically-controlled diamond turning machine. Test results show high reproducibility of the bullet signatures on standard bullets. NIST has also developed a new parameter for bullet signature comparisons, using autocorrelation functions, and proposed a diagram for tracing local ballistics measurements to the National Laboratory Center of the ATF and to the FBI. Using an electro-forming process, NIST has manufactured prototype standard casings and test results show high reproducibility for the casing signatures.

  11. RNA sequence reveals mouse retinal transcriptome changes early after axonal injury.

    Science.gov (United States)

    Yasuda, Masayuki; Tanaka, Yuji; Ryu, Morin; Tsuda, Satoru; Nakazawa, Toru

    2014-01-01

    Glaucoma is an ocular disease characterized by progressive retinal ganglion cell (RGC) death caused by axonal injury. However, the underlying mechanisms involved in RGC death remain unclear. In this study, we investigated changes in the transcriptome profile following axonal injury in mice (C57BL/6) with RNA sequencing (RNA-seq) technology. The experiment group underwent an optic nerve crush (ONC) procedure to induce axonal injury in the right eye, and the control group underwent a sham procedure. Two days later, we extracted the retinas and performed RNA-seq and a pathway analysis. We identified 177 differentially expressed genes with RNA-seq, notably the endoplasmic reticulum (ER) stress-related genes Atf3, Atf4, Atf5, Chac1, Chop, Egr1 and Trb3, which were significantly upregulated. The pathway analysis revealed that ATF4 was the most significant upstream regulator. The antioxidative response-related genes Hmox1 and Srxn1, as well as the immune response-related genes C1qa, C1qb and C1qc, were also significantly upregulated. To our knowledge, this is the first reported RNA-seq investigation of the retinal transcriptome and molecular pathways in the early stages after axonal injury. Our results indicated that ER stress plays a key role under these conditions. Furthermore, the antioxidative defense and immune responses occurred concurrently in the early stages after axonal injury. We believe that our study will lead to a better understanding of and insight into the molecular mechanisms underlying RGC death after axonal injury. PMID:24676137

  12. RNA sequence reveals mouse retinal transcriptome changes early after axonal injury.

    Directory of Open Access Journals (Sweden)

    Masayuki Yasuda

    Full Text Available Glaucoma is an ocular disease characterized by progressive retinal ganglion cell (RGC death caused by axonal injury. However, the underlying mechanisms involved in RGC death remain unclear. In this study, we investigated changes in the transcriptome profile following axonal injury in mice (C57BL/6 with RNA sequencing (RNA-seq technology. The experiment group underwent an optic nerve crush (ONC procedure to induce axonal injury in the right eye, and the control group underwent a sham procedure. Two days later, we extracted the retinas and performed RNA-seq and a pathway analysis. We identified 177 differentially expressed genes with RNA-seq, notably the endoplasmic reticulum (ER stress-related genes Atf3, Atf4, Atf5, Chac1, Chop, Egr1 and Trb3, which were significantly upregulated. The pathway analysis revealed that ATF4 was the most significant upstream regulator. The antioxidative response-related genes Hmox1 and Srxn1, as well as the immune response-related genes C1qa, C1qb and C1qc, were also significantly upregulated. To our knowledge, this is the first reported RNA-seq investigation of the retinal transcriptome and molecular pathways in the early stages after axonal injury. Our results indicated that ER stress plays a key role under these conditions. Furthermore, the antioxidative defense and immune responses occurred concurrently in the early stages after axonal injury. We believe that our study will lead to a better understanding of and insight into the molecular mechanisms underlying RGC death after axonal injury.

  13. Transcriptional and post-translational regulation of mouse cation transport regulator homolog 1.

    Science.gov (United States)

    Oh-Hashi, Kentaro; Nomura, Yuki; Shimada, Kiyo; Koga, Hisashi; Hirata, Yoko; Kiuchi, Kazutoshi

    2013-08-01

    Recently, cation transport regulator homolog 1 (Chac1) has been identified as a novel pro-apoptotic factor in cells under endoplasmic reticulum (ER) stress. Of the three major ER stress sensors, it is suggested that ATF4 participates in the transcriptional regulation of Chac1 gene expression. The precise characterization of the Chac1 promoter, however, has not yet been elucidated. In this study, we detected the induction of Chac1 mRNA expression using DNA array analysis and RT-PCR of thapsigargin (Tg)-inducible genes in Neuro2a cells. Chac1 mRNA expression was also induced immediately following treatment with tunicamycin (Tm) and brefeldin A. Characterization of the mouse Chac1 promoter activity using a luciferase reporter assay revealed that the CREB/ATF element and amino acid response element in the mouse Chac1 promoter are functional and respond to Tm stimulation and ATF4 overexpression. Mutations in either element in the Chac1 promoter did not inhibit the responsiveness of this promoter to Tm and ATF4; however, mutations in both of these elements dramatically decreased the basal activity and response to ER stress stimuli. In addition to the transcriptional regulation, we found that Chac1 protein expression was only detected in the presence of MG132, a proteasome inhibitor, even though mouse Chac1 gene was transiently overexpressed in Neuro2a cells. Taken together, we are the first to demonstrate the transcriptional and post-translational regulation of Chac1 expression in a neuronal cell line. PMID:23615711

  14. Fabrication and installation of the vacuum vessel for the Advanced Toroidal Facility

    International Nuclear Information System (INIS)

    The vacuum vessel for the Advanced Toroidal Facility (ATF) has been completed and installed in the facility. The vessel fabrication has involved many unique methods to correct unanticipated problems. The primary fabrication concern has been to correct for dimensional inconsistency so that the vessel would fit into the closely nested helical coil set. The vessel has been installed and the remainder of the facility components are being assembled

  15. Accelerator physics and modeling: Proceedings

    International Nuclear Information System (INIS)

    This report contains papers on the following topics: Physics of high brightness beams; radio frequency beam conditioner for fast-wave free-electron generators of coherent radiation; wake-field and space-charge effects on high brightness beams. Calculations and measured results for BNL-ATF; non-linear orbit theory and accelerator design; general problems of modeling for accelerators; development and application of dispersive soft ferrite models for time-domain simulation; and bunch lengthening in the SLC damping rings

  16. Report on Reactor Physics Assessment of Candidate Accident Tolerant Fuel Cladding Materials in LWRs

    Energy Technology Data Exchange (ETDEWEB)

    Powers, Jeffrey J. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); George, Nathan [Univ. of Tennessee, Knoxville, TN (United States); Maldonado, G. Ivan [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Worrall, Andrew [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

    2015-08-28

    This work focuses on ATF concepts being researched at Oak Ridge National Laboratory (ORNL), expanding on previous studies of using alternate cladding materials in pressurized water reactors (PWRs). The neutronic performance of two leading alternate cladding materials were assessed in boiling water reactors (BWRs): iron-chromium-aluminum (FeCrAl) cladding, and silicon carbide (SiC)-based composite cladding. This report fulfills ORNL Milestone M3FT-15OR0202332 within the fiscal year 2015 (FY15)

  17. Ionization Chambers for Monitoring in High-Intensity Charged Particle Beams

    OpenAIRE

    McDonald, J.; Naples, D.; Velissaris, C.; Erwin, A.; Ping, H.; Viren, B.; Diwan, M.

    2002-01-01

    Radiation-hard ionization chambers were tested using an intense electron beam from the accelerator test facility (ATF) at the Brookhaven National Laboratory (BNL). The detectors were designed to be used as the basic element for monitoring muons in the Main Injector Neutrino beamline (NuMI) at the Fermi National Accelerator Laboratory (FNAL). Measurements of linearity of response, voltage dependence, and the onset of ionization saturation as a function of gap voltage were performed.

  18. Proceedings of the CAP meetings, November 1990--February 1991

    International Nuclear Information System (INIS)

    This report contains viewgraph material on the following topics: on beam emittance -- application to ATF; a review of Brookhaven Accelerator Test Facility (AFT); on development of a superconducting RFQ at Stony Brook University; development of new methods for charged particle acceleration at Yerevan Physics Institute; theory of high gain free electron laser; on ultra violet free electron laser at BNL; high luminosity at SSC; and nonlinear dynamics studies of accelerators

  19. Developments in Reactor and Economic Modelling Considering the Performance of Accident Tolerant Fuels

    International Nuclear Information System (INIS)

    Accident tolerant fuel (ATF) technology is being developed to enhance the safety performance of nuclear fuels and cladding. The development and testing of ATF materials by NNL through its Nuclear Fuel Centre of Excellence is being complemented by parallel developments in fuel performance modelling, in addition to reactor physics and economic calculations to optimise ATF fuel. An approach for preliminary optimisation of ATF fuel pin and cladding parameters, in typical commercial PWRs is described, including an initial optimisation of uranium nitride (UN) fuel pellet dimensions and enrichment (combined with zirconium cladding) and for silicon carbide composite (SiC) clad fuel (combined with uranium oxide fuel (UO2)). In order to optimise pin reactivity, pellet diameter is less for UN compared with UO2. A lower feed enrichment was required to give an equilibrium energy output close to the equivalent UO2 fuel. Modelling this design indicates that there is a potential economic benefit, through lower fuel assembly costs, when using optimised UN fuel compared with standard UO2 PWR fuel. For standard UO2 fuel, full core calculations have examined the reactivity benefit when replacing zircaloy clad for SiC. Calculations assume idealised SiC clad thicknesses similar to those used with current zircaloy clads. An economic analysis, considering current cost estimates of SiC clad manufacture, indicates SiC clad fuel assembly costs are significantly increased. However, there remains scope for offsetting these increased fuel costs through optimised reactor operation by taking advantage of the reduced parasitic neutron absorption or higher temperature tolerance of SiC clad. An initial assessment is also undertaken of how the performance of the higher density uranium nitride fuel compares against key PWR safety measures: considering pin power peaking, shutdown margin, moderator temperature coefficients, boron reactivity worth, delayed neutron fractions and boration limits. All

  20. Brookhaven Accelerator Test Facility photocathode gun and transport beamline

    International Nuclear Information System (INIS)

    We present an analysis of the electron beam emitted from a laser driven photocathode injector (Gun, operating at 2856 MHZ), through a Transport beamline, to the LINAC entrance for the Brookhaven Accelerator Test Facility (ATF). The beam parameters including beam energy, and emittance are calculated. Some of our results, are tabulated and the phase plots of the beam parameters, from Cathode, through the Transport line elements, to the LINAC entrance, are shown

  1. Quercetin reduces eIF2α phosphorylation by GADD34 induction.

    Science.gov (United States)

    Hayakawa, Miki; Itoh, Masanori; Ohta, Kazunori; Li, Shimo; Ueda, Masashi; Wang, Miao-xing; Nishida, Emika; Islam, Saiful; Suzuki, Chihiro; Ohzawa, Kaori; Kobori, Masuko; Inuzuka, Takashi; Nakagawa, Toshiyuki

    2015-09-01

    The production of amyloid β (Aβ) in the brain from Aβ precursor protein (APP) through γ-secretase is important for the pathogenesis of Alzheimer's disease (AD). Our previous studies have demonstrated that autophagy impairment and endoplasmic reticulum stress increase presenilin 1 expression and enhance γ-secretase activity through the phosphorylation of eukaryotic translation initiation factor 2α (eIF2α) and the translation of activating transcription factor 4 (ATF4). However, the inhibitory molecules for γ-secretase are largely unknown. Here, we demonstrate that the levels of ATF4 expression are increased in the brain of APP23 AD model mice; furthermore, these levels enhanced in the brain of APP23 mice crossed with obese and diabetic db/db (Lepr(db/db)) mice. A polyhydroxylated flavonoid, quercetin, suppressed presenilin 1 expression and Aβ secretion in autophagy-impaired cells by the induction of growth arrest and DNA damaged-inducible gene (GADD) 34, which mediates eIF2α dephosphorylation, leading to decreased ATF4 expression. GADD34 induction was observed in the brain of wild-type mice, and APP23 mice fed quercetin in their diet. After the long-term feeding of quercetin, deterioration in memory assessed by freezing behavior was delayed in APP23 mice. These results indicate that quercetin may reduce eIF2α phosphorylation and ATF4 expression through GADD34 induction in the brain, leading to the improvement of memory in aged mice and the delay of deterioration in memory at the early stage of AD in AD model mice. PMID:26070242

  2. Modulation of the Akt Pathway Reveals a Novel Link with PERK/eIF2α, which Is Relevant during Hypoxia

    OpenAIRE

    Blaustein, Matías; Pérez-Munizaga, Daniela; Sánchez, Manuel Alejandro; Urrutia, Carolina; Grande, Alicia; Risso, Guillermo; Srebrow, Anabella; Alfaro, Jennifer; Colman-Lerner, Alejandro

    2013-01-01

    The unfolded protein response (UPR) and the Akt signaling pathway share several regulatory functions and have the capacity to determine cell outcome under specific conditions. However, both pathways have largely been studied independently. Here, we asked whether the Akt pathway regulates the UPR. To this end, we used a series of chemical compounds that modulate PI3K/Akt pathway and monitored the activity of the three UPR branches: PERK, IRE1 and ATF6. The antiproliferative and antiviral drug ...

  3. Heat stress induces apoptosis through a Ca²⁺-mediated mitochondrial apoptotic pathway in human umbilical vein endothelial cells.

    Directory of Open Access Journals (Sweden)

    Li Li

    Full Text Available Heat stress can be acutely cytotoxic, and heat stress-induced apoptosis is a prominent pathological feature of heat-related illnesses, although the precise mechanisms by which heat stress triggers apoptosis are poorly defined.The percentages of viability and cell death were assessed by WST-1 and LDH release assays. Apoptosis was assayed by DNA fragmentation and caspase activity. Expression of cleaved PARP, Apaf-1, phospho-PERK, Phospho-eIF2a, ATF4, XBP-1s, ATF6, GRP78, phospho-IP3R, RYR and SERCA was estimated by Western blot. The effect of calcium overload was determined using flow cytometric analysis with the fluorescent probe Fluo-3/AM. The generation of ROS (O2-, H2O2, NO was labeled by confocal laser scanning microscopy images of fluorescently and flow cytometry.In this study, we found that heat stress in HUVEC cells activated initiators of three major unfolded protein response (UPR signaling transduction pathways: PERK-eIF2a-ATF4, IRE1-XBP-1S and ATF6 to protect against ER stress, although activation declined over time following cessation of heat stress. Furthermore, we show that intense heat stress may induce apoptosis in HUVEC cells through the calcium-mediated mitochondrial apoptotic pathway, as indicated by elevation of cytoplasmic Ca2+, expression of Apaf-1, activation of caspase-9 and caspase-3, PARP cleavage, and ultimately nucleosomal DNA fragmentation; Reactive oxygen species (ROS appear to act upstream in this process. In addition, we provide evidence that IP3R upregulation may promote influx of Ca2+ into the cytoplasm after heat stress.Our findings describe a novel mechanism for heat stress-induced apoptosis in HUVEC cells: following elevation of cytoplasm Ca2+, activation of the mitochondrial apoptotic pathway via the IP3R upregulation, with ROS acting as an upstream regulator of the process.

  4. Development of Co-Pilgering Process for Manufacturing Double Clad Tubes for Accident Tolerant Fuel

    International Nuclear Information System (INIS)

    Accident Tolerant Fuels (ATF) are those that, in comparison with the standard UO2 - Zr system, can tolerate loss of active cooling in the core for a considerably longer time period (depending on the accident scenario), while maintaining or improving the fuel performance during normal operations. ATF cladding development efforts focus on materials with more benign steam reaction. For this, advanced steels (e.g. FeCrAl), refractory metals (e.g. Mo), ceramic cladding (SiC), Innovative alloys with dopants, zirconium alloy with coating or sleeve are being developed. Single material like zirconium alloy as clad may not be compatible with both fuel and coolant at elevated temperatures in accident scenario. Double clad tube is one of the prime concepts which has to be explored to develop ATF cladding. Two different clad materials- one oxidant resistant (like FeCrAl) and the other, fuel compatible (like Zr-4) constitute together as outer and inner tube to form ATF cladding. Bonding two different tubes in controlled thickness ratios and with almost no gap in between is utmost difficult. Different types of processes are available for production of double clad tubes such as coating, co-extrusion, co- drawing, internal expansion/external compaction, explosive bonding, co-pilgering etc,. Nuclear Fuel Complex (NFC), India has successfully demonstrated manufacturing of double clad tube by co-pilgering process where in outer cladding is of modified 9Cr-1Mo Steel and inner liner is of zircaloy-4. Considering different deformation behaviour of above materials during pilgering, fabrication of double clad tube is very critical. Optimization of tube dimensions like outer diameter and wall thickness at pre and final stages during pilgering is very important to achieve the required overall tube dimension and bonding between the tubes. This paper gives the methodology of manufacture of Double Clad Tubes by pilgering and the bonding between the two materials achieved in this process

  5. Seleção de linhagens de sorgo granífero eficientes e responsivas à aplicação de fósforo

    Directory of Open Access Journals (Sweden)

    Fabricio Rodrigues

    2014-08-01

    Full Text Available O objetivo deste trabalho foi selecionar linhagens de sorgo simultaneamente responsivas ao fósforo e com elevada eficiência produtiva quanto a esse nutriente. Foram avaliadas 36 linhagens endogâmicas, em delineamento de blocos ao acaso, com duas repetições. Os caracteres usados para avaliação da eficiência produtiva foram produtividade média e eficiências de absorção, de utilização e de uso de fósforo, com e sem adubação fosfatada. Para análise da responsividade ao nutriente, foram avaliados caracteres de produtividade relativa e de eficiências de recuperação aparente, fisiológica e agronômica. Há variabilidade genética entre as linhagens quanto às eficiências de absorção, de utilização e de uso do fósforo, e quanto à responsividade ao nutriente, o que sugere a possibilidade de produção de híbridos destinados a nichos de mercado diferentes. As linhagens mais responsivas foram P9401, BR007B, BR008B, SC414-12E e SC566, e as mais eficientes, sob baixa disponibilidade de fósforo, foram ATF40B, SC566, BR005R, CMSXS225 e BR012 (R6. As linhagens ATF40B, ATF54 (f61, ATF54 (f596, QL3 e SC566 apresentaram melhor desempenho simultâneo das diferentes eficiências avaliadas e da responsividade ao fósforo. Apenas a avaliação do caráter produtividade, sob diferentes disponibilidades de fósforo, já permite identificar linhagens eficientes e responsivas ao fósforo.

  6. Advanced Fuels Campaign FY 2014 Accomplishments Report

    Energy Technology Data Exchange (ETDEWEB)

    Lori Braase; W. Edgar May

    2014-10-01

    The overall goal of ATF development is to identify alternative fuel system technologies to further enhance the safety, competitiveness, and economics of commercial nuclear power. The complex multiphysics behavior of LWR nuclear fuel in the integrated reactor system makes defining specific material or design improvements difficult; as such, establishing desirable performance attributes is critical in guiding the design and development of fuels and cladding with enhanced accident tolerance.

  7. Challenges and Opportunities for Commercialization of Enhanced Accident Tolerant Fuel or Light Water Reactors: A Utility-Informed Perspective

    International Nuclear Information System (INIS)

    There is consensus within the global research and development (R&D) community that the barriers to deployment of accident tolerant fuel (ATF) for commercial use in the near-future are too high and carry too much risk for any one organization to succeed alone. International collaboration is needed to leverage existing and new resources and expertise. Efforts are now underway to bring key entities together to share experiences and identify gaps and opportunities to leverage resources. In the wake of Fukushima Daiichi, momentum and funding currently exist in many countries for R&D targeting enhanced accident tolerance fuel (and other non-fuel reactor components) for Generation II/III/III+ light-water reactors (LWRs) with the goal of fundamentally changing severe accident outcomes while also maintaining or even improving fuel and reactor system performance under normal operations. While funding and interest are relatively high at present, the long time frames required for implementing substantial changes to in-core components and fuel designs demand a stable and sustained R&D focus. Likewise, the geographic dispersion and scarcity of key experimental and test facilities further highlight the need for coordination of experimental programmes and testing whenever possible and appropriate. Success in ATF development will come with the investment by, engagement of, and collaboration among the many key entities involved in the arduous path from early research through commercial deployment. As utilities are the ultimate customer for any new technology targeting enhanced performance and accident tolerance for LWRs, a clear understanding of nuclear plant operator needs and constraints is essential for the success of the global ATF R&D enterprise. Ultimately, the safety and performance benefits from ATF related investment will be realized only to the extent that new technologies are widely adopted and deployed in operating reactors. (author)

  8. Axotomy of tributaries of the pelvic and pudendal nerves induces changes in the neurochemistry of mouse dorsal root ganglion neurons and the spinal cord.

    Science.gov (United States)

    McCarthy, Carly J; Tomasella, Eugenia; Malet, Mariana; Seroogy, Kim B; Hökfelt, Tomas; Villar, Marcelo J; Gebhart, G F; Brumovsky, Pablo R

    2016-05-01

    Using immunohistochemical techniques, we characterized changes in the expression of several neurochemical markers in lumbar 4-sacral 2 (L4-S2) dorsal root ganglion (DRG) neuron profiles (NPs) and the spinal cord of BALB/c mice after axotomy of the L6 and S1 spinal nerves, major tributaries of the pelvic (targeting pelvic visceral organs) and pudendal (targeting perineum and genitalia) nerves. Sham animals were included. Expression of cyclic AMP-dependent transcription factor 3 (ATF3), calcitonin gene-related peptide (CGRP), transient receptor potential cation channel subfamily V, member 1 (TRPV1), tyrosine hydroxylase (TH) and vesicular glutamate transporters (VGLUT) types 1 and -2 was analysed seven days after injury. L6-S1 axotomy induced dramatic de novo expression of ATF3 in many L6-S1 DRG NPs, and parallel significant downregulations in the percentage of CGRP-, TRPV1-, TH- and VGLUT2-immunoreactive (IR) DRG NPs, as compared to their expression in uninjured DRGs (contralateral L6-S1-AXO; sham mice); VGLUT1 expression remained unaltered. Sham L6-S1 DRGs only showed a small ipsilateral increase in ATF3-IR NPs (other markers were unchanged). L6-S1-AXO induced de novo expression of ATF3 in several lumbosacral spinal cord motoneurons and parasympathetic preganglionic neurons; in sham mice the effect was limited to a few motoneurons. Finally, a moderate decrease in CGRP- and TRPV1-like-immunoreactivities was observed in the ipsilateral superficial dorsal horn neuropil. In conclusion, injury of a mixed visceral/non-visceral nerve leads to considerable neurochemical alterations in DRGs matched, to some extent, in the spinal cord. Changes in these and potentially other nociception-related molecules could contribute to pain due to injury of nerves in the abdominopelvic cavity. PMID:25749859

  9. Proteus mirabilis fimbriae: identification, isolation, and characterization of a new ambient-temperature fimbria.

    OpenAIRE

    Massad, G; Bahrani, F K; Mobley, H L

    1994-01-01

    Urinary tract infections involving Proteus mirabilis may lead to complications including bladder and kidney stones, acute pyelonephritis, and bacteremia. This bacterium produces a number of fimbriae, two of which, MR/P fimbria and P. mirabilis fimbria, have been shown to contribute to the ability of this pathogen to colonize the bladder and kidney. We have now purified and characterized a previously undescribed fimbria of P. mirabilis, named ambient-temperature fimbria (ATF). Electron microsc...

  10. Genome-wide screening of regulators of catalase expression: role of a transcription complex and histone and tRNA modification complexes on adaptation to stress

    OpenAIRE

    Garc??a Rodr??guez, Patricia; Encinar del Dedo, Javier; Ayt?? del Olmo, Jos??; Hidalgo Hernando, Elena

    2016-01-01

    In response to environmental cues, the mitogen-activated protein kinase Sty1-driven signaling cascade activates hundreds of genes to induce a robust anti-stress cellular response in fission yeast. Thus, upon stress imposition Sty1 transiently accumulates in the nucleus where it up-regulates transcription through the Atf1 transcription factor. Several regulators of transcription and translation have been identified as important to mount an integral response to oxidative stress, such as the Spt...

  11. The Second National Ballistics Imaging Comparison (NBIC-2)

    OpenAIRE

    Vorburger, TV; Yen, J; Song, JF; Thompson, RM; Renegar, TB; Zheng, A.; Tong, M; Ols, M

    2015-01-01

    In response to the guidelines issued by the American Society of Crime Laboratory Directors/Laboratory Accreditation Board (ASCLD/LAB-International) to establish traceability and quality assurance in U.S. crime laboratories, NIST and the ATF initiated a joint project, entitled the National Ballistics Imaging Comparison (NBIC). The NBIC project aims to establish a national traceability and quality system for ballistics identifications in crime laboratories utilizing ATF’s National Integrated Ba...

  12. Paleoseismology of the Xorxol Segment of the Central Altyn Tagh Fault, Xinjiang, China

    Directory of Open Access Journals (Sweden)

    Z. Y. Qiao

    2003-06-01

    Full Text Available Although the Altyn Tagh Fault (ATF is thought to play a key role in accommodating India-Eurasian convergence, little is known about its earthquake history. Studies of this strike-slip fault are important for interpretation of the role of faulting versus distributed deformation in the accommodation of the India- Eurasia collision. In addition, the > 1200 km long fault represents one of the most important and exemplary intracontinental strike-slip faults in the world. We mapped fault trace geometry and interpreted paleoseismic trench exposures to characterize the seismogenic behavior of the ATF. We identified 2 geometric segment boundaries in a 270 km long reach of the central ATF. These boundaries define the westernmost Wuzhunxiao, the Central Pingding, and the easternmost Xorxol (also written as Suekuli or Suo erkuli segments. In this paper, we present the results from the Camel paleoseismic site along the Xorxol Segment at 91.759°E, 38.919°N. There evidence for the last two earthquakes is clear and 14C dates from layers exposed in the excavation bracket their ages. The most recent earthquake occurred between 1456 and 1775 cal A.D. and the penultimate event was between 60 and 980 cal A.D. Combining the Camel interpretations with our published results for the central ATF, we conclude that multiple earthquakes with shorter rupture lengths (?? 50 km rather than complete rupture of the Xorxol Segment better explain the paleoseismic data. We found 2-3 earthquakes in the last 2-3 kyr. When coupled with typical amounts of slip per event (5-10 m, the recurrence times are tentatively consistent with 1-2 cm/yr slip rates. This result favors models that consider the broader distribution of collisional deformation, rather than those with northward motion of India into Asia absorbed along a few faults bounding rigid blocks.

  13. Load Mitigation and Optimal Power Capture for Variable Speed Wind Turbine in Region 2

    OpenAIRE

    Saravanakumar Rajendran; Debashisha Jena

    2015-01-01

    This paper proposes the two nonlinear controllers for variable speed wind turbine (VSWT) operating at below rated wind speed. The objective of the controller is to maximize the energy capture from the wind with reduced oscillation on the drive train. The conventional controllers such as aerodynamic torque feedforward (ATF) and indirect speed control (ISC) are adapted initially, which introduce more power loss, and the dynamic aspects of WT are not considered. In order to overcome the above dr...

  14. The influence of applied tensile stress on power loss in Co-rich amorphous Co-Fe-Si-B ribbons with induced magnetic anisotropy

    DEFF Research Database (Denmark)

    Nielsen, H; Nielsen, K; Nielsen, Otto V

    1982-01-01

    The influence on power loss PTof applied tensile stress σ in amorphous (Co0.89Fe0.11)72Mo3Si15B10(lambda_{s} > 0) and Co73Mo2Si15B10(lambda_{s} <0) ribbons with different induced magnetic anisotropy Kuis reported. The losses are measured under sinusoidal flux conditions atf = 50Hz,J_{max} = 0.57T...

  15. Study on the Explicit Formula of the Triangular Flat Shell Element Based on the Analytical Trial Functions for Anisotropy Material

    OpenAIRE

    Xiang-Rong Fu; Li-Na Ge; Ge Tian; Ming-Wu Yuan

    2013-01-01

    This paper presents a novel way to formulate the triangular flat shell element. The basic analytical solutions of membrane and bending plate problem for anisotropy material are studied separately. Combining with the conforming displacement along the sides and hybrid element strategy, the triangular flat shell elements based on the analytical trial functions (ATF) for anisotropy material are formulated. By using the explicit integral formulae of the triangular element, the matrices used in pro...

  16. Exploring Policy Options to include Petroleum, Natural Gas and Electricity under the Proposed Goods and Services Tax (GST)Regime in India.

    OpenAIRE

    Mukherjee, Sacchidananda; Rao, R. Kavita

    2014-01-01

    The study analyses the impact of keeping crude petroleum, natural gas, motor spirit (gasoline/ petrol), high speed diesel (diesel), aviation turbine fuel (ATF) and electricity out of the Value Added Tax (VAT) scheme. Specifically, the study finds that keeping these items out of the input tax credit mechanism (either partially or fully) would result in cascading. Through an input-output framework, this study proposes some alternatives to the proposed design of GST and assesses the implications...

  17. BNL ACCELERATOR TEST FACILITY CONTROL SYSTEM UPGRADE.

    Energy Technology Data Exchange (ETDEWEB)

    MALONE,R.; BEN-ZVI,I.; WANG,X.; YAKIMENKO,V.

    2001-06-18

    Brookhaven National Laboratory's Accelerator Test Facility (ATF) has embarked on a complete upgrade of its decade old computer system. The planned improvements affect every major component: processors (Intel Pentium replaces VAXes), operating system (Linux/Real-Time Linux supplants OpenVMS), and data acquisition equipment (fast Ethernet equipment replaces CAMAC serial highway.) This paper summarizes the strategies and progress of the upgrade along with plans for future expansion.

  18. LONGITUDINAL DENSITY MODULATION OF UNSTABLE BUNCHES EMITTING COHERENT IR.

    Energy Technology Data Exchange (ETDEWEB)

    PODOBEDOV,B.; CARR,G.L.; KRAMER,S.L.; MURPHY,J.B.

    2001-06-18

    Brookhaven National Laboratory's Accelerator Test Facility (ATF) has embarked on a complete upgrade of its decade old computer system. The planned improvements affect every major component: processors (Intel Pentium replaces VAXes), operating system (Linux/Real-Time Linux supplants OpenVMS), and data acquisition equipment (fast Ethernet equipment replaces CAMAC serial highway.) This paper summarizes the strategies and progress of the upgrade along with plans for future expansion.

  19. Validation of Genotyping-By-Sequencing Analysis in Populations of Tetraploid Alfalfa by 454 Sequencing.

    Directory of Open Access Journals (Sweden)

    Solen Rocher

    Full Text Available Genotyping-by-sequencing (GBS is a relatively low-cost high throughput genotyping technology based on next generation sequencing and is applicable to orphan species with no reference genome. A combination of genome complexity reduction and multiplexing with DNA barcoding provides a simple and affordable way to resolve allelic variation between plant samples or populations. GBS was performed on ApeKI libraries using DNA from 48 genotypes each of two heterogeneous populations of tetraploid alfalfa (Medicago sativa spp. sativa: the synthetic cultivar Apica (ATF0 and a derived population (ATF5 obtained after five cycles of recurrent selection for superior tolerance to freezing (TF. Nearly 400 million reads were obtained from two lanes of an Illumina HiSeq 2000 sequencer and analyzed with the Universal Network-Enabled Analysis Kit (UNEAK pipeline designed for species with no reference genome. Following the application of whole dataset-level filters, 11,694 single nucleotide polymorphism (SNP loci were obtained. About 60% had a significant match on the Medicago truncatula syntenic genome. The accuracy of allelic ratios and genotype calls based on GBS data was directly assessed using 454 sequencing on a subset of SNP loci scored in eight plant samples. Sequencing depth in this study was not sufficient for accurate tetraploid allelic dosage, but reliable genotype calls based on diploid allelic dosage were obtained when using additional quality filtering. Principal Component Analysis of SNP loci in plant samples revealed that a small proportion (<5% of the genetic variability assessed by GBS is able to differentiate ATF0 and ATF5. Our results confirm that analysis of GBS data using UNEAK is a reliable approach for genome-wide discovery of SNP loci in outcrossed polyploids.

  20. Results from DR and Instrumentation Test Facilities

    CERN Document Server

    Urakawa, Junji

    2005-01-01

    The KEK Accelerator Test Facility (ATF) is a 1.3GeV storage ring capable of producing ultra-low emittance electron beams and has a beam extraction line for ILC R&D. The ATF has proven to be an ideal place for researches with small, stable beams. 2x1010 single bunch and low current 20 bunch-train with 2.8nsec bunch spacing have been extracted to develop Nano-Cavity BPM’s, FONT, Nano Beam Orbit handling (FEATHER), Optical Diffraction Radiation (ODR) monitor, a precision multi-bunch laser-based beam profile monitor and polarized positron beam generation via backward-Compton scattering by the international collaboration. A set of three cavity BPM's is installed in the ATF extraction line on a set of extremely stiff supports. The KEK group installed another set of three BPM's, with their own support mechanism. The full set of 6 will prove extremely useful. In the DR (Damping Ring), we are researching the fast ion instability, micro-wave instability with four sets of damping wiggler and developing pul...

  1. Preliminary Assessment of Accident Tolerant Fuel Performance at Normal and Accident Conditions

    International Nuclear Information System (INIS)

    The interest for improving the safety of light water reactors (LWRs) fuel designs, which has significantly grown after the Fukushima Daiichi Accident, has driven the U.S. Department of Energy (DOE) to fund three industry-led programs to facilitate the development of accident tolerant fuels (ATF) for LWRs. Westinghouse is leading one of them and engaged in developing a combined accident resistant cladding and high density fuel pellet. It is important to develop and apply fuel performance codes and other computational methods to model the novel fuel forms to better understand the in-core performance and to guide new fuel designs. In this paper, a preliminary assessment on the performance of various ATF concepts during normal and accident conditions is presented. These concepts include various combinations of accident tolerant fuel and cladding materials: UN/SiC, U3Si2/SiC, UN/Coated Zircaloy, and U3Si2/Coated Zircaloy. The properties of the new materials were collected from literature and their irradiation data will be selected from various test reactor experiments. The impact of ATF properties on design basis accidents and beyond design basis accident is also discussed. (author)

  2. Ship detection for high resolution optical imagery with adaptive target filter

    Science.gov (United States)

    Ju, Hongbin

    2015-10-01

    Ship detection is important due to both its civil and military use. In this paper, we propose a novel ship detection method, Adaptive Target Filter (ATF), for high resolution optical imagery. The proposed framework can be grouped into two stages, where in the first stage, a test image is densely divided into different detection windows and each window is transformed to a feature vector in its feature space. The Histograms of Oriented Gradients (HOG) is accumulated as a basic feature descriptor. In the second stage, the proposed ATF highlights all the ship regions and suppresses the undesired backgrounds adaptively. Each detection window is assigned a score, which represents the degree of the window belonging to a certain ship category. The ATF can be adaptively obtained by the weighted Logistic Regression (WLR) according to the distribution of backgrounds and targets of the input image. The main innovation of our method is that we only need to collect positive training samples to build the filter, while the negative training samples are adaptively generated by the input image. This is different to other classification method such as Support Vector Machine (SVM) and Logistic Regression (LR), which need to collect both positive and negative training samples. The experimental result on 1-m high resolution optical images shows the proposed method achieves a desired ship detection performance with higher quality and robustness than other methods, e.g., SVM and LR.

  3. Gas6 induces cancer cell migration and epithelial–mesenchymal transition through upregulation of MAPK and Slug

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Yunhee [Department of Chemistry, Korea Advanced Institute of Science and Technology, Daejeon (Korea, Republic of); Immunotherapy Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon (Korea, Republic of); Lee, Mira [Immunotherapy Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon (Korea, Republic of); Kim, Semi, E-mail: semikim@kribb.re.kr [Department of Chemistry, Korea Advanced Institute of Science and Technology, Daejeon (Korea, Republic of); Immunotherapy Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon (Korea, Republic of)

    2013-04-26

    Highlights: •We investigated the molecular mechanisms underlying Gas6-mediated cancer cell migration. •Gas6 treatment and subsequent Axl activation induce cell migration and EMT via upregulation of Slug. •Slug expression mediated by Gas6 is mainly through c-Jun and ATF-2 in an ERK1/2 and JNK-dependent manner. •The Gas6/Axl-Slug axis may be exploited as a target for anti-cancer metastasis therapy. -- Abstract: Binding of Gas6 to Axl (Gas6/Axl axis) alters cellular functions, including migration, invasion, proliferation, and survival. However, the molecular mechanisms underlying Gas6-mediated cell migration remain poorly understood. In this study, we found that Gas6 induced the activation of JNK and ERK1/2 signaling in cancer cells expressing Axl, resulting in the phosphorylation of activator protein-1 (AP-1) transcription factors c-Jun and ATF-2, and induction of Slug. Depletion of c-Jun or ATF-2 by siRNA attenuated the Gas6-induced expression of Slug. Slug expression was required for cell migration and E-cadherin reduction/vimentin induction induced by Gas6. These results suggest that Gas6 induced cell migration via Slug upregulation in JNK- and ERK1/2-dependent mechanisms. These data provide an important insight into the molecular mechanisms mediating Gas6-induced cell migration.

  4. The BNL Accelerator Test Facility and experimental program

    International Nuclear Information System (INIS)

    The Accelerator Test Facility (ATF) at BNL is a users' facility for experiments in Accelerator and Beam Physics. The ATF provides high brightness electron beams and high power laser pulses synchronized to the electron beam, suitable for studies of new methods of high gradient acceleration and state of the art free electron lasers. The electrons are produced by a laser photocathode rf gun and accelerated to 50 to 100 MeV by two traveling wave accelerator sections. The lasers include a 10 mJ, 10 ps Nd:YAG laser and a 100 mJ, 10 ps CO2 laser. A number of users from National Laboratories, universities and industry take part in experiments at the ATF. The experimental program includes various acceleration schemes, Free-Electron Laser experiments and a program on the development of high brightness electron beams. The AFT's experimental program commenced in early 1991 at an energy of about 4 MeV. The full program, with 50 MeV and the High power laser will begin operation this year. 28 refs., 4 figs

  5. The Mitochondrial Unfolded Protein Response Protects against Anoxia in Caenorhabditis elegans

    Science.gov (United States)

    Peña, Salvador; Sherman, Teresa; Brookes, Paul S.; Nehrke, Keith

    2016-01-01

    The mitochondrial unfolded protein response (UPRmt) is a surveillance pathway that defends proteostasis in the “powerhouse” of the cell. Activation of the UPRmt protects against stresses imposed by reactive oxygen species, respiratory chain deficits, and pathologic bacteria. Consistent with the UPRmt’s role in adaption, we found that either its pharmacological or genetic activation by ethidium bromide (EtBr) or RNAi of the mitochondrial AAA-protease spg-7 was sufficient to reduce death in an anoxia-based Caenorhabditis elegans model of ischemia-reperfusion injury. The UPRmt-specific transcription factor atfs-1 was necessary for protection and atfs-1 gain-of-function (gf) mutants were endogenously protected from both death and dysfunction. Neurons exhibited less axonal degeneration following non-lethal anoxia-reperfusion (A-R) when the UPRmt was pre-activated, and consistent with the concept of mitochondrial stress leading to cell non-autonomous (ie. “remote”) effects, we found that restricted activation of the UPRmt in neurons decreased A-R death. However, expression of the atfs-1(gf) mutant in neurons, which resulted in a robust activation of a neuronal UPRmt, did not upregulate the UPRmt in distal tissues, nor did it protect the worms from A-R toxicity. These findings suggest that remote signaling requires additional component(s) acting downstream of de facto mitochondrial stress. PMID:27459203

  6. Single ingestion of soy β-conglycinin induces increased postprandial circulating FGF21 levels exerting beneficial health effects.

    Science.gov (United States)

    Hashidume, Tsutomu; Kato, Asuka; Tanaka, Tomohiro; Miyoshi, Shoko; Itoh, Nobuyuki; Nakata, Rieko; Inoue, Hiroyasu; Oikawa, Akira; Nakai, Yuji; Shimizu, Makoto; Inoue, Jun; Sato, Ryuichiro

    2016-01-01

    Soy protein β-conglycinin has serum lipid-lowering and anti-obesity effects. We showed that single ingestion of β-conglycinin after fasting alters gene expression in mouse liver. A sharp increase in fibroblast growth factor 21 (FGF21) gene expression, which is depressed by normal feeding, resulted in increased postprandial circulating FGF21 levels along with a significant decrease in adipose tissue weights. Most increases in gene expressions, including FGF21, were targets for the activating transcription factor 4 (ATF4), but not for peroxisome proliferator-activated receptor α. Overexpression of a dominant-negative form of ATF4 significantly reduced β-conglycinin-induced increases in hepatic FGF21 gene expression. In FGF21-deficient mice, β-conglycinin effects were partially abolished. Methionine supplementation to the diet or primary hepatocyte culture medium demonstrated its importance for activating liver or hepatocyte ATF4-FGF21 signaling. Thus, dietary β-conglycinin intake can impact hepatic and systemic metabolism by increasing the postprandial circulating FGF21 levels. PMID:27312476

  7. Pichia pastoris as a host for secretion of toxic saporin chimeras.

    Science.gov (United States)

    Lombardi, Alessio; Bursomanno, Sara; Lopardo, Teresa; Traini, Roberta; Colombatti, Marco; Ippoliti, Rodolfo; Flavell, David J; Flavell, Sopsamorn U; Ceriotti, Aldo; Fabbrini, Maria Serena

    2010-01-01

    Most of the targeting moieties, such as antibody fragments or growth factor domains, used to construct targeted toxins for anticancer therapy derive from secretory proteins. These normally fold in the oxidative environment of the endoplasmic reticulum, and hence their folding in bacterial cells can be quite inefficient. For instance, only low amounts of properly folded antimetastatic chimera constituted by the amino-terminal fragment of human urokinase (ATF) fused to the plant ribosome-inactivating protein saporin could be recovered. ATF-saporin was instead secreted efficiently when expressed in eukaryotic cells protected from autointoxication with neutralizing anti-saporin antibodies. Pichia pastoris is a microbial eukaryotic host where these domains can fold into a transport-competent conformation and reach the extracellular medium. We show here that despite some host toxicity codon-usage optimization greatly increased the expression levels of active saporin but not those of an active-site mutant SAP-KQ in GS115 (his4) strain. The lack of any toxicity associated with expression of the latter confirmed that toxicity is due to saporin catalytic activity. Nevertheless, GS115 (his4) cells in flask culture secreted 3.5 mg/L of a histidine-tagged ATF-saporin chimera showing an IC(50) of 6 x 10(-11) M against U937 cells, thus demonstrating the suitability of this expression platform for secretion of toxic saporin-based chimeras. PMID:19786581

  8. Genes and Gene Networks Involved in Sodium Fluoride-Elicited Cell Death Accompanying Endoplasmic Reticulum Stress in Oral Epithelial Cells

    Directory of Open Access Journals (Sweden)

    Yoshiaki Tabuchi

    2014-05-01

    Full Text Available Here, to understand the molecular mechanisms underlying cell death induced by sodium fluoride (NaF, we analyzed gene expression patterns in rat oral epithelial ROE2 cells exposed to NaF using global-scale microarrays and bioinformatics tools. A relatively high concentration of NaF (2 mM induced cell death concomitant with decreases in mitochondrial membrane potential, chromatin condensation and caspase-3 activation. Using 980 probe sets, we identified 432 up-regulated and 548 down-regulated genes, that were differentially expressed by >2.5-fold in the cells treated with 2 mM of NaF and categorized them into 4 groups by K-means clustering. Ingenuity® pathway analysis revealed several gene networks from gene clusters. The gene networks Up-I and Up-II included many up-regulated genes that were mainly associated with the biological function of induction or prevention of cell death, respectively, such as Atf3, Ddit3 and Fos (for Up-I and Atf4 and Hspa5 (for Up-II. Interestingly, knockdown of Ddit3 and Hspa5 significantly increased and decreased the number of viable cells, respectively. Moreover, several endoplasmic reticulum (ER stress-related genes including, Ddit3, Atf4 and Hapa5, were observed in these gene networks. These findings will provide further insight into the molecular mechanisms of NaF-induced cell death accompanying ER stress in oral epithelial cells.

  9. Activation of Satellite Glial Cells in Rat Trigeminal Ganglion after Upper Molar Extraction

    International Nuclear Information System (INIS)

    The neurons in the trigeminal ganglion (TG) are surrounded by satellite glial cells (SGCs), which passively support the function of the neurons, but little is known about the interactions between SGCs and TG neurons after peripheral nerve injury. To examine the effect of nerve injury on SGCs, we investigated the activation of SGCs after neuronal damage due to the extraction of the upper molars in rats. Three, 7, and 10 days after extraction, animals were fixed and the TG was removed. Cryosections of the ganglia were immunostained with antibodies against glial fibrillary acidic protein (GFAP), a marker of activated SGCs, and ATF3, a marker of damaged neurons. After tooth extraction, the number of ATF3-immunoreactive (IR) neurons enclosed by GFAP-IR SGCs had increased in a time-dependent manner in the maxillary nerve region of the TG. Although ATF3-IR neurons were not detected in the mandibular nerve region, the number of GFAP-IR SGCs increased in both the maxillary and mandibular nerve regions. Our results suggest that peripheral nerve injury affects the activation of TG neurons and the SGCs around the injured neurons. Moreover, our data suggest the existence of a neuronal interaction between maxillary and mandibular neurons via SGC activation

  10. Electric Motor Thermal Management R&D (Presentation)

    Energy Technology Data Exchange (ETDEWEB)

    Bennion, K.

    2014-11-01

    Thermal constraints place significant limitations on how electric motors ultimately perform. Without the ability to remove heat, the motor cannot operate without sacrificing performance, efficiency, and reliability. Finite element analysis and computational fluid dynamics modeling approaches are being increasingly utilized in the design and analysis of electric motors. As the models become more sophisticated, it is important to have detailed and accurate knowledge of both the passive thermal performance and the active cooling performance. In this work, we provide an overview of research characterizing both passive and active thermal elements related to electric motor thermal management. To better characterize the passive thermal performance, the effective thermal properties and inter-lamination thermal contact resistances were measured for different stator lamination materials. The active cooling performance of automatic transmission fluid (ATF) jets was also measured to better understand the heat transfer coefficients of ATF impinging on motor copper windings. Ford's Mercon LV was the ATF evaluated in this study. The presentation provides an overview of prior work with a focus on describing future plans for research to be performed during FY15.

  11. Evaluation of a Bladder Cancer Cluster in a Population of Criminal Investigators with the Bureau of Alcohol, Tobacco, Firearms and Explosives—Part 1: The Cancer Incidence

    Directory of Open Access Journals (Sweden)

    Susan R. Davis

    2012-01-01

    Full Text Available This study investigated a bladder cancer cluster in a cohort of employees, predominately criminal investigators, participating in a medical surveillance program with the United States Bureau of Alcohol, Tobacco, Firearms and Explosives (ATF between 1995 and 2007. Standardized incidence ratios (SIRs were used to compare cancer incidences in the ATF population and the US reference population. Seven cases of bladder cancer (five cases verified by pathology report at time of analysis were identified among a total employee population of 3,768 individuals. All cases were white males and criminal investigators. Six of seven cases were in the 30 to 49 age range at the time of diagnosis. The SIRs for white male criminal investigators undergoing examinations were 7.63 (95% confidence interval = 3.70–15.75 for reported cases and 5.45 (2.33–12.76 for verified cases. White male criminal investigators in the ATF population are at statistically significant increased risk for bladder cancer.

  12. Late Cenozoic sedimentary process and its response to the slip history of the central Altyn Tagh fault, NW China

    Institute of Scientific and Technical Information of China (English)

    陈正乐; 张岳桥; 陈宣华; 王小凤; A.S.Ramon; W.B.Zack

    2001-01-01

    The ENE-striking Altyn Tagh fault (ATF), extending along the northern edge of the Tibetan Plateau, is one of the major important strike-slip faults, and has been known as one of the key areas to debate the eastward extrusion and crustral shortening models of the Tibetan Plateau during and after India-Asia collision. This paper mainly presents new evidence of Late Cenozoic sedimentary process to reconstruct the slip history of the ATF during the Late Cenozoic. Field measurements and laboratory analyses of the sedimentary characteristics in the Late Cenozoic basins in the central Altyn Tagh fault suggest that Late Cenozoic sedimentary sequence should be divided into three units according to facies changes. The paleo-topography reconstruction shows that the sedimentation in these basins was tightly related with the fault, indicating that the ATF has experienced at least three stages of strike slipping in the Late Cenozoic. New geological data from the Late Cenozoic sedimentary basins and the formation of th

  13. Searches for skin injury-related genes induced by ionizing radiation

    International Nuclear Information System (INIS)

    This review describes investigations concerning the skin and radiation exposure, and molecular effects of radiation on the skin partly based on authors' studies on searches in the title and for signaling cascade. Depending on the dose and its rate, radiation induces injuries like erythema, edema, alopecia, erosion, ulcer and cancer. Comprehensive analysis of the skin injury-related genes is now possible on the human genome chips (DNA micro-array) and on RNA/protein obtained from exposed epidermal keratinocytes and dermal fibroblasts using such molecular biological means as reverse transcription polymerase chain reaction (RT-PCR), Northern/Western blotting and cyto/histochemistry. Authors have actually revealed that mRNA of ATF3, which regulates the gene transcription, is increased depending on the dose in the exposed human keratinocytes, and ATF3 is accumulated in the nucleus. Authors have also studied the up- and down-streams of signaling cascade of ATF3 to show phosphorylations of p53 and H2AX at exposure to high dose radiation in cells above and in intact mouse. Basic findings in the skin like above can be useful in future for estimation of exposed dose and for risk assessment as well as the present hematological findings. (T.I)

  14. In vacuum diamond sensor scanner for beam halo measurements in the beam line at the KEK Accelerator Test Facility

    CERN Document Server

    Liu, Shan; Cornebise, Patrick; Faus-Golfe, Angeles; Fuster-Martínez, Nuria; Griesmayer, Erich; Guler, Hayg; Kubytskyi, Viacheslav; Sylvia, Christophe; Toshiaki, Tauchi; Terunuma, Nobuhiro; Bambade, Philip

    2015-01-01

    The investigation of beam halo transverse distributions is important for the understanding of beam losses and the control of backgrounds in Future Linear Colliders (FLC). A novel in vacuum diamond sensor (DSv) scanner with four strips has been designed and developed for the investigation of the beam halo transverse distributions and also for the diagnostics of Compton recoil electrons after the interaction point (IP) of ATF2, a low energy (1.3 GeV) prototype of the final focus system for the ILC and CLIC linear collider projects. Using the DSv, a dynamic range of $\\sim10^6$ has been successfully demonstrated and confirmed for the first time by simultaneous beam core ($\\sim10^9$ electrons) and beam halo ($\\sim10^3$ electrons) measurements at ATF2. This report presents the characterization, performance studies and tests of the diamond sensors using an $\\alpha$ source as well as using the electron beams at PHIL, a low energy ($< 10$ MeV) photo-injector at LAL, and at ATF2. First beam halo measurement results ...

  15. Hypothesis for the mechanics and seismic behaviour of low-angle normal faults: the example of the Altotiberina fault Northern Apennines

    Directory of Open Access Journals (Sweden)

    C. Collettini

    2002-06-01

    Full Text Available Widespread mapping of low-angle normal faults in areas of former continental extension continues to prompt debate as to whether such structures may be seismically active at very low dips (? <30 °in the upper continental crust.The Northern Apennines provide an example where an active low-angle normal fault (Altotiberina fault, ATFcan be studied.A set of commercial seismic reflection profiles plus deep boreholes have been used to constrain the geometry of the fault at depth.These data have been integrated with a microseismic survey showing that part of the microseismicity (M <3.0is consistent with the geometry of the ATF as imaged by depth converted seismic reflection profiles.Frictional fault mechanics under Byerlee ?s friction coefficient and vertical ? 1 (constrained from the inversion of the focal mechanismsdefines the peculiar condition for reactivation of the ATF:small values of differential stress,? 1 ?? 3 <28 MPa,relatively high value of tensile strength of the fault surrounding rocks (T ~10 MPaand tensile fluid overpressure P f >? 3 (i.e.? v >0.93.The short-lived attainment of P f >? 3 along small fault portions,in an area characterised by large amounts of CO2,account for the microseismic activity located along the ATF,which occurs on rupture surfaces in the range of 10 ??10 ? 3 km 2..

  16. Severe Accident Test Station Activity Report

    Energy Technology Data Exchange (ETDEWEB)

    Pint, Bruce A [ORNL; Terrani, Kurt A [ORNL

    2015-06-01

    Enhancing safety margins in light water reactor (LWR) severe accidents is currently the focus of a number of international R&D programs. The current UO2/Zr-based alloy fuel system is particularly susceptible since the Zr-based cladding experiences rapid oxidation kinetics in steam at elevated temperatures. Therefore, alternative cladding materials that offer slower oxidation kinetics and a smaller enthalpy of oxidation can significantly reduce the rate of heat and hydrogen generation in the core during a coolant-limited severe accident. In the U.S. program, the high temperature steam oxidation performance of accident tolerant fuel (ATF) cladding solutions has been evaluated in the Severe Accident Test Station (SATS) at Oak Ridge National Laboratory (ORNL) since 2012. This report summarizes the capabilities of the SATS and provides an overview of the oxidation kinetics of several candidate cladding materials. A suggested baseline for evaluating ATF candidates is a two order of magnitude reduction in the steam oxidation resistance above 1000ºC compared to Zr-based alloys. The ATF candidates are categorized based on the protective external oxide or scale that forms during exposure to steam at high temperature: chromia, alumina, and silica. Comparisons are made to literature and SATS data for Zr-based alloys and other less-protective materials.

  17. Performance study of four mirror laser resonator for 6 μm minimum beam size using green laser oscillator

    International Nuclear Information System (INIS)

    The Accelerator Test Facility (ATF) was constructed at KEK to study low emittance beam physics and to develop the technologies associated with it. In ATF damping ring, electron beam size is measured with laser wire system based on Compton scattering. A new four mirror laser wire system is developed for this purpose. This system has many advantages over two mirror laser wire system. Four mirror resonator reduces the sensitivity towards misalignment as compare to two mirror resonator. Measured Finesse of resonator is more than 4000. Optical cavity has enhancement factor of 1900. Inside ATF damping ring, electron beam has very small size of 10 μm in vertical direction. To measure electron beam profile, very thin laser beam size is needed. Laser waist size, around 6 μm in sagittal plane is achieved in between two concave mirrors. Special type of mirror alignment scheme is used to make a compact four mirror optical cavity. Laser resonator is designed to work in vacuum environment with a complex mirror holder design. We report the performance studies of such four mirror resonator using 532 nm CW laser oscillator in this research. (author)

  18. Electric Motor Thermal Management R&D. Annual Report

    Energy Technology Data Exchange (ETDEWEB)

    Bennion, Kevin [National Renewable Energy Lab. (NREL), Golden, CO (United States)

    2016-04-01

    With the push to reduce component volumes, lower costs, and reduce weight without sacrificing performance or reliability, the challenges associated with thermal management increase for power electronics and electric motors. Thermal management for electric motors will become more important as the automotive industry continues the transition to more electrically dominant vehicle propulsion systems. The transition to more electrically dominant propulsion systems leads to higher-power duty cycles for electric drive systems. Thermal constraints place significant limitations on how electric motors ultimately perform, and as thermal management improves, there will be a direct trade-off between motor performance, efficiency, cost, and the sizing of electric motors to operate within the thermal constraints. The goal of this research project is to support broad industry demand for data, analysis methods, and experimental techniques to improve and better understand motor thermal management. Work in FY15 focused on two areas related to motor thermal management: passive thermal performance and active convective cooling. Passive thermal performance emphasized the thermal impact of materials and thermal interfaces among materials within an assembled motor. The research tasks supported the publication of test methods and data for thermal contact resistances and direction-dependent thermal conductivity within an electric motor. Active convective cooling focused on measuring convective heat-transfer coefficients using automatic transmission fluid (ATF). Data for average convective heat transfer coefficients for direct impingement of ATF jets was published. Also, experimental hardware for mapping local-scale and stator-scale convective heat transfer coefficients for ATF jet impingement were developed.

  19. LIGHT WATER REACTOR ACCIDENT TOLERANT FUELS IRRADIATION TESTING

    Energy Technology Data Exchange (ETDEWEB)

    Carmack, William Jonathan [Idaho National Laboratory; Barrett, Kristine Eloise [Idaho National Laboratory; Chichester, Heather Jean MacLean [Idaho National Laboratory

    2015-09-01

    The purpose of Accident Tolerant Fuels (ATF) experiments is to test novel fuel and cladding concepts designed to replace the current zirconium alloy uranium dioxide (UO2) fuel system. The objective of this Research and Development (R&D) is to develop novel ATF concepts that will be able to withstand loss of active cooling in the reactor core for a considerably longer time period than the current fuel system while maintaining or improving the fuel performance during normal operations, operational transients, design basis, and beyond design basis events. It was necessary to design, analyze, and fabricate drop-in capsules to meet the requirements for testing under prototypic LWR temperatures in Idaho National Laboratory's Advanced Test Reactor (ATR). Three industry led teams and one DOE team from Oak Ridge National Laboratory provided fuel rodlet samples for their new concepts for ATR insertion in 2015. As-built projected temperature calculations were performed on the ATF capsules using the BISON fuel performance code. BISON is an application of INL’s Multi-physics Object Oriented Simulation Environment (MOOSE), which is a massively parallel finite element based framework used to solve systems of fully coupled nonlinear partial differential equations. Both 2D and 3D models were set up to examine cladding and fuel performance.

  20. Physics models in the toroidal transport code PROCTR

    Energy Technology Data Exchange (ETDEWEB)

    Howe, H.C.

    1990-08-01

    The physics models that are contained in the toroidal transport code PROCTR are described in detail. Time- and space-dependent models are included for the plasma hydrogenic-ion, helium, and impurity densities, the electron and ion temperatures, the toroidal rotation velocity, and the toroidal current profile. Time- and depth-dependent models for the trapped and mobile hydrogenic particle concentrations in the wall and a time-dependent point model for the number of particles in the limiter are also included. Time-dependent models for neutral particle transport, neutral beam deposition and thermalization, fusion heating, impurity radiation, pellet injection, and the radial electric potential are included and recalculated periodically as the time-dependent models evolve. The plasma solution is obtained either in simple flux coordinates, where the radial shift of each elliptical, toroidal flux surface is included to maintain an approximate pressure equilibrium, or in general three-dimensional torsatron coordinates represented by series of helical harmonics. The detailed coupling of the plasma, scrape-off layer, limiter, and wall models through the neutral transport model makes PROCTR especially suited for modeling of recycling and particle control in toroidal plasmas. The model may also be used in a steady-state profile analysis mode for studying energy and particle balances starting with measured plasma profiles.