WorldWideScience

Sample records for astrobiologist scouting red

  1. The Internet Scout Project.

    Science.gov (United States)

    Calcari, Susan

    1997-01-01

    Describes the Internet Scout Project which provides Internet users, particularly those in higher education, with current, selective, and well-annotated pointers to information about resources, network tools, and Internet news items. Offered through regular e-mail updates, titles include The Scout Report, The Scout Report Signpost, Net-Happenings,…

  2. The Stochastic Scouting Problem

    NARCIS (Netherlands)

    Barros, A.I.; Evers, L.

    2012-01-01

    Efficiently scouting talented sports players is of key importance in the commercially oriented sports world. Besides being able to recognize talent, it is important to plan the scouting activities given the available time, in order to maximize the potential for scouting talented players. This proble

  3. Mars Scouts: An Overview

    OpenAIRE

    Matousek, Steve

    2001-01-01

    The Mars Program institutes the Mars Scout Missions in order to address science goals in the program not otherwise covered in the baseline Mars plan. Mars Scout missions will be Principal-Investigator (PI) led science missions. Analogous to the Discovery Program, PI led investigations optimize the use of limited resources to accomplish the best focused science and allow the flexibility to quickly respond to discoveries at Mars. Scout missions also require unique investments in technology and ...

  4. National Boy Scout Jamboree

    Science.gov (United States)

    1989-01-01

    This video looks at a NASA sponsored exhibit at the National Boy Scout Jamboree in Fredricksburg, VA. Boy Scouts are shown interacting with NASA researchers and astronauts and touring mockups of Space Station Freedom and Apollo 11. NASA's program to encourage the researchers of tomorrow is detailed.

  5. Robotics Vision for a Scouting Rover - PRoViScout

    Science.gov (United States)

    Paar, G.; Woods, M.; Pullan, D.; Proviscout Team

    2011-10-01

    The FP7-SPACE Project ProViScout (Planetary Robotics Vision Scout, scheduled from April 2010 to September 2012) aims to demonstrate the feasibility of vision-based autonomous sample identification & selection in combination with vision-based navigation for a long range scouting/exploration mission on a terrestrial planet along with the robotic elements required. The paper gives an overview of the PRoViScout technical and scientific objectives, envisaged solutions and achievements so far.

  6. Proyecto Friend Scout

    OpenAIRE

    MARTÍNEZ BROSETA, ANDRÉS FRANCISCO

    2014-01-01

    El proyecto es una aplicación para sistemas operativos Android que permite compartir tu localización geográfica con tus amigos. Se compone de la aplicación Android, de una base de datos que se encuentra en un servidor contratado y de los mecanismos necesarios para la comunicación entre éstos. Martínez Broseta, AF. (2014). Proyecto Friend Scout. http://hdl.handle.net/10251/39410. Archivo delegado

  7. US Cub Scouts visit CERN

    CERN Document Server

    2001-01-01

    A group of young American Cub Scouts from Den 10, Pack 130 (based in Geneva) at the Microcosm last Saturday. On their trip to CERN, which included the first Visits Service tour of the ATLAS construction site, the scouts were able to satisfy most of the requirements for the Cub Scout engineering badge. From left to right: Edouard Vincent, Ariel Litke, Alexander Richter, Antoine Vidal de Saint Phalle, Jason Iredale and Daniel Reghelini.

  8. SCOUT Nozzle Data Book

    Science.gov (United States)

    Shieds, S.

    1976-01-01

    Available analyses and material property information are summarized relevant to the design of four rocket motor nozzles currently incorporated in the four solid propellant rocket stages of the NASA SCOUT launch vehicle. The nozzles discussed include those for the following motors: (1) first stage - Algol IIIA; (2) second stage - Castor IIA; (3) third stage - Antares IIA; and (4) fourth stage - Altair IIIA. Separate sections for each nozzle provide complete data packages. Information on the Antares IIB motor which had limited usage as an alternate motor for the third stage is included.

  9. The Scout Launch Vehicle System

    OpenAIRE

    Tanck, Pamela; Williams, James

    1988-01-01

    SCOUT, a four-stage, solid-rocket launch vehicle originally developed by LTV Missiles and Electronics Group, is completing its third decade of service. NASA-Langley started the program in 1958 with the intent of providing a simple, low-cost, reliable launch vehicle for orbital, probe and re-entry missions. On July 1, 1960, the first SCOUT vehicle was launched. Since SCOUT became operational in 1963, there have been 88 launches of which 84 were successful, representing a reliability record of ...

  10. Organizing small-scale scout trip abroad

    OpenAIRE

    Rautala, Camilla

    2016-01-01

    This thesis was commissioned by the Guides and Scouts of Finland (Suomen Partiolaiset – Finlands Scouter ry.) The thesis describes the organising process of a small-scale scout trip to the members of commissioning company. The Guides and Scouts of Finland directs the scout movement in Finland. The small-scale trips to national camps support the organisation’s objectives of educating world citizens. The objective of this thesis project was to plan and implemented well-organised trip to Bal...

  11. Involving Handicapped Cub Scouts: Instructor's Guide. Cub Scout Leader Development.

    Science.gov (United States)

    Boy Scouts of America, New Brunswick, NJ.

    The Instructor's Guide is intended for use in training adult leaders to foster understanding and involvement of the handicapped in Cub Scout activities. Suggestions are offered for organizing two leadership training sessions which include defining types of handicaps leaders may encounter, conducting buzz group discussions on similarities between…

  12. Solids Accumulation Scouting Studies

    Energy Technology Data Exchange (ETDEWEB)

    Duignan, M. R.; Steeper, T. J.; Steimke, J. L.

    2012-09-26

    The objective of Solids Accumulation activities was to perform scaled testing to understand the behavior of remaining solids in a Double Shell Tank (DST), specifically AW-105, at Hanford during multiple fill, mix, and transfer operations. It is important to know if fissionable materials can concentrate when waste is transferred from staging tanks prior to feeding waste treatment plants. Specifically, there is a concern that large, dense particles containing plutonium could accumulate in poorly mixed regions of a blend tank heel for tanks that employ mixing jet pumps. At the request of the DOE Hanford Tank Operations Contractor, Washington River Protection Solutions, the Engineering Development Laboratory of the Savannah River National Laboratory performed a scouting study in a 1/22-scale model of a waste staging tank to investigate this concern and to develop measurement techniques that could be applied in a more extensive study at a larger scale. Simulated waste tank solids: Gibbsite, Zirconia, Sand, and Stainless Steel, with stainless steel particles representing the heavier particles, e.g., plutonium, and supernatant were charged to the test tank and rotating liquid jets were used to mix most of the solids while the simulant was pumped out. Subsequently, the volume and shape of the mounds of residual solids and the spatial concentration profiles for the surrogate for heavier particles were measured. Several techniques were developed and equipment designed to accomplish the measurements needed and they included: 1. Magnetic particle separator to remove simulant stainless steel solids. A device was designed and built to capture these solids, which represent the heavier solids during a waste transfer from a staging tank. 2. Photographic equipment to determine the volume of the solids mounds. The mounds were photographed as they were exposed at different tank waste levels to develop a composite of topographical areas. 3. Laser rangefinders to determine the volume of

  13. PRoViScout: a planetary scouting rover demonstrator

    Science.gov (United States)

    Paar, Gerhard; Woods, Mark; Gimkiewicz, Christiane; Labrosse, Frédéric; Medina, Alberto; Tyler, Laurence; Barnes, David P.; Fritz, Gerald; Kapellos, Konstantinos

    2012-01-01

    Mobile systems exploring Planetary surfaces in future will require more autonomy than today. The EU FP7-SPACE Project ProViScout (2010-2012) establishes the building blocks of such autonomous exploration systems in terms of robotics vision by a decision-based combination of navigation and scientific target selection, and integrates them into a framework ready for and exposed to field demonstration. The PRoViScout on-board system consists of mission management components such as an Executive, a Mars Mission On-Board Planner and Scheduler, a Science Assessment Module, and Navigation & Vision Processing modules. The platform hardware consists of the rover with the sensors and pointing devices. We report on the major building blocks and their functions & interfaces, emphasizing on the computer vision parts such as image acquisition (using a novel zoomed 3D-Time-of-Flight & RGB camera), mapping from 3D-TOF data, panoramic image & stereo reconstruction, hazard and slope maps, visual odometry and the recognition of potential scientifically interesting targets.

  14. The Scout Launch Vehicle program

    Science.gov (United States)

    Foster, L. R., Jr.; Urash, R. G.

    1981-01-01

    The Scout Launch Vehicle Program to utilize solid propellant rockets by the DOD and to provide a reliable, low cost vehicle for scientific and applications aircraft is discussed. The program's history is reviewed and a vehicle description is given. The Vandenberg Air Force Base and the San Marco launch sites are described, and capabilities such as payload weight, orbital inclinations, payload volume and mission integration time spans are discussed. Current and future plans for improvement, including larger heat shields and individual rocket motors are also reviewed.

  15. Science Education in the Boy Scouts of America

    Science.gov (United States)

    Hintz, Rachel Sterneman

    2009-01-01

    This study of science education in the Boy Scouts of America focused on males with Boy Scout experience. The mixed-methods study topics included: merit badge standards compared with National Science Education Standards, Scout responses to open-ended survey questions, the learning styles of Scouts, a quantitative assessment of science content…

  16. Near-Earth Asteroid Scout

    Science.gov (United States)

    McNutt, Leslie; Johnson, Les; Clardy, Dennon; Castillo-Rogez, Julie; Frick, Andreas; Jones, Laura

    2014-01-01

    Near-Earth Asteroids (NEAs) are an easily accessible object in Earth's vicinity. Detections of NEAs are expected to grow in the near future, offering increasing target opportunities. As NASA continues to refine its plans to possibly explore these small worlds with human explorers, initial reconnaissance with comparatively inexpensive robotic precursors is necessary. Obtaining and analyzing relevant data about these bodies via robotic precursors before committing a crew to visit a NEA will significantly minimize crew and mission risk, as well as maximize exploration return potential. The Marshall Space Flight Center (MSFC) and Jet Propulsion Laboratory (JPL) are jointly examining a mission concept, tentatively called 'NEA Scout,' utilizing a low-cost CubeSats platform in response to the current needs for affordable missions with exploration science value. The NEA Scout mission concept would be a secondary payload on the Space Launch System (SLS) Exploration Mission 1 (EM-1), the first planned flight of the SLS and the second un-crewed test flight of the Orion Multi-Purpose Crew Vehicle (MPCV).

  17. iScout: An Intelligent Scout for Accessing and Navigating Large Image Sets in a PACS

    OpenAIRE

    Weathermon, Adam; Tsui, Jonathan; Rohling, Robert

    2004-01-01

    A new software tool for PACS, called iScout (intelligent scout), has been developed and optimized for a radiology workstation. The purpose of iScout is to display an overview of a large image series, allowing the user to select images for priority downloading from a PACS server to a PACS workstation. This allows radiologists to reduce the delays that are associated with downloading hundreds or even thousands of images. Several schemes that semiautomatically manage the download process are pre...

  18. Mars Scout 2007 - a current status

    Science.gov (United States)

    Matousek, Steve

    2003-01-01

    The Mars Program institutes the Mars Scout Missions in order to address science goals in the program not otherwise covered in baseline Mars plans. Mars Scout missions will be Principal-Investigator (PI) led science missions. Analogous to the Discovery Program, PI-led investigations optimize the use of limited resources to accomplish focused science and allow the flexibility to quickly respond to discoveries at Mars. Scout missions also require unique investments in technology and reliance upon Mars-based infrastructure such as telecom relay orbiters. Scouts utilize a two-step competitive process for selection. In Dec, 2002, the Step 2 selections by NASA were announced and then approximately five month studies will result in a selection for flight around August, 2003 for a mission to be launched in 2007.

  19. Web information system of scouts organization

    OpenAIRE

    Pirnovar , Nik

    2015-01-01

    Scout associations require a lot of administrative work from the members of their executive committee. At the moment there are no computer supported solutions or systems, which would make work easier and automatize certain processes. Based on what already existed solutions and the interview we had with representatives of Scout association of Slovenia (ZTS), we designed a modern web-based information system, which will enable easier work and comprehensive overview of all the activities of the...

  20. Scouting out a Progressive Role Model: Here Come the Girl Scouts!

    Science.gov (United States)

    Cushman, Mary

    2014-01-01

    Shana Corey's picture book, "Here Come the Girl Scouts!: The Amazing All-True Story of Juliette 'Daisy' Gordon Low and Her Great Adventure" describes Low's life as one of excitement, boldness, and fun. The "birthday" of Girl Scouts falls conveniently near the middle of Women's History Month, on March…

  1. Live ultrasound volume reconstruction using scout scanning

    Science.gov (United States)

    Meyer, Amelie; Lasso, Andras; Ungi, Tamas; Fichtinger, Gabor

    2015-03-01

    Ultrasound-guided interventions often necessitate scanning of deep-seated anatomical structures that may be hard to visualize. Visualization can be improved using reconstructed 3D ultrasound volumes. High-resolution 3D reconstruction of a large area during clinical interventions is challenging if the region of interest is unknown. We propose a two-stage scanning method allowing the user to perform quick low-resolution scouting followed by high-resolution live volume reconstruction. Scout scanning is accomplished by stacking 2D tracked ultrasound images into a low-resolution volume. Then, within a region of interest defined in the scout scan, live volume reconstruction can be performed by continuous scanning until sufficient image density is achieved. We implemented the workflow as a module of the open-source 3D Slicer application, within the SlicerIGT extension and building on the PLUS toolkit. Scout scanning is performed in a few seconds using 3 mm spacing to allow region of interest definition. Live reconstruction parameters are set to provide good image quality (0.5 mm spacing, hole filling enabled) and feedback is given during live scanning by regularly updated display of the reconstructed volume. Use of scout scanning may allow the physician to identify anatomical structures. Subsequent live volume reconstruction in a region of interest may assist in procedures such as targeting needle interventions or estimating brain shift during surgery.

  2. The Implementation of Character Education through Scout Activities

    Science.gov (United States)

    Mislia; Mahmud, Alimuddin; Manda, Darman

    2016-01-01

    This research aims at describing the factors influencing the extracurricular activities especially scouting. This research also aims at describing the Scouts skills that can form the students' character. This research is also to describe the strategies for the formation of the students' character through scout activities. This research was a…

  3. Scout trajectory error propagation computer program

    Science.gov (United States)

    Myler, T. R.

    1982-01-01

    Since 1969, flight experience has been used as the basis for predicting Scout orbital accuracy. The data used for calculating the accuracy consists of errors in the trajectory parameters (altitude, velocity, etc.) at stage burnout as observed on Scout flights. Approximately 50 sets of errors are used in Monte Carlo analysis to generate error statistics in the trajectory parameters. A covariance matrix is formed which may be propagated in time. The mechanization of this process resulted in computer program Scout Trajectory Error Propagation (STEP) and is described herein. Computer program STEP may be used in conjunction with the Statistical Orbital Analysis Routine to generate accuracy in the orbit parameters (apogee, perigee, inclination, etc.) based upon flight experience.

  4. The formation of physical culture traditions in Ukrainian scouting

    Directory of Open Access Journals (Sweden)

    Oleg Kemin

    2014-12-01

    Full Text Available Purpose: determine the features of formation of the Ukrainian Scouting and Scout body training system. Material and Methods: the studied problems studied by theoretical analysis and synthesis of scientific literature, organizing, logical conclusions. Results: we analyzed healthforming means and methods that were established by the founders of the scout movement in Ukraine and abroad. Conclusions: it was figured out that scout methods of physical development are formed on profound scientific and methodological works of famous Ukrainian pedagogues and scholars, who were the founders of the scout movement in Ukraine.

  5. Scout launch vehicle, phases 4 and 5

    Science.gov (United States)

    Mccracken, D. C.; Leiss, A.; Horrocks, E. R.; Turpen, N. H.

    1974-01-01

    The historical data of the Scout launch vehicle program for Phases IV and V (vehicles 138 through 177) is presented for the FY 1966 through FY 1971 time period. Technical data and accounting information are detailed to provide a total picture of the program.

  6. Scouts behave as streakers in honeybee swarms

    Science.gov (United States)

    Greggers, Uwe; Schöning, Caspar; Degen, Jacqueline; Menzel, Randolf

    2013-08-01

    Harmonic radar tracking was used to record the flights of scout bees during takeoff and initial flight path of two honeybee swarms. One swarm remained intact and performed a full flight to a destination beyond the range of the harmonic radar, while a second swarm disintegrated within the range of the radar and most of the bees returned to the queen. The initial stretch of the full flight is characterized by accelerating speed, whereas the disintegrating swarm flew steadily at low speed. The two scouts in the swarm displaying full flight performed characteristic flight maneuvers. They flew at high speed when traveling in the direction of their destination and slowed down or returned over short stretches at low speed. Scouts in the disintegrating swarm did not exhibit the same kind of characteristic flight performance. Our data support the streaker bee hypothesis proposing that scout bees guide the swarm by traveling at high speed in the direction of the new nest site for short stretches of flight and slowing down when reversing flight direction.

  7. Transforming an icon: Girl Scouts of America.

    Science.gov (United States)

    Tompkins, Michelle; Inzunza, Victor

    2008-01-01

    The Girl Scouts is four years away from celebrating its centennial and has helped nurture courage, confidence, and character in more than fifty million girls. There are a quarter million troops, but mission, program, fundraising, and branding occur at the national level. These exciting programs are described here. PMID:18551845

  8. Measure Landscape Diversity with Logical Scout Agents

    Science.gov (United States)

    Wirth, E.; Szabó, G.; Czinkóczky, A.

    2016-06-01

    The Common Agricultural Policy reform of the EU focuses on three long-term objectives: viable food production, sustainable management of natural resources and climate action with balanced territorial development. To achieve these goals, the EU farming and subsidizing policies (EEA, 2014) support landscape heterogeneity and diversity. Current paper introduces an agent-based method to calculate the potential of landscape diversity. The method tries to catch the nature of heterogeneity using logic and modelling as opposed to the traditional statistical reasoning. The outlined Random Walk Scouting algorithm registers the land cover crossings of the scout agents to a Monte Carlo integral. The potential is proportional with the composition and the configuration (spatial character) of the landscape. Based on the measured points a potential map is derived to give an objective and quantitative basis to the stakeholders (policy makers, farmers).

  9. Preservation watch : what to monitor and how scout can help

    OpenAIRE

    Faria, Luís

    2013-01-01

    Apresentação efetuada no "Digital Preservation Advanced Practitioner Training", em Glasgow, Reino Unido, 2013 This training session is about Scout. Scout is a digital preservation watch system that allows you to be notified whenever some significant event in the world can bring you harm or profit. Scout gathers information from all around the world and curates it using link data technology. Then you can define questions that cross-link information. The system frequently monitors the your q...

  10. Mars Scout: Micromissions to Investigate Martian Environments

    Science.gov (United States)

    Cabrol, N. A.; Ori, G. G.; Grin, E. A.; Sims, M. H.; Marinangeli, L.; McKay, C.; Marshall, J.; Thomas, H.; Rabbette, M.; Landheim, R.

    2000-01-01

    Environments can be local, regional, or global. They can include one or more geological, morphological, climatological, and biological types. An environment also represents all the interactions that take place in the identified boundaries. Current planned missions to Mars in the Surveyor Program assume a good knowledge of the Martian environment that we do not have because it cannot be obtained only from orbit. There is a missing step between orbital data and the complex Surveyor missions to be landed that needs to be filled. The Ames/IRSPS Scout Mission Concept originally proposed in February 1999 filled this gap by landing a series of small (less than 10 kgs. each) scout missions. The Mars Environment Scout Mission Concept is being developed to explore the possibility of sending a series of small, simple, and inexpensive stations to the surface of Mars. The objective(s) would be to document either: (a) the environmental diversity of Mars, (b) a specific Martian environment, and/or (c) a region of interest. This type of mission will provide critical information about environments that is currently not available, and could also be used as precursors helping the design, preparation, and planning of more complex future missions to come.

  11. "Wild Scouts": Swedish Scouting Preparing Responsible Citizens for the Twenty-First Century

    Science.gov (United States)

    Westberg Brostrom, Anna

    2013-01-01

    The aim of this article is to analyze the Swedish scout program. Socialization is used as a theoretical tool in the analysis. The method is inspired by critical discourse analysis. What are children and young people being prepared for, how is it accomplished, and by whom? The findings reveal two discourses: doing things as an investment for the…

  12. Scout 2008 Version 1.0 User Guide

    Science.gov (United States)

    The Scout 2008 version 1.0 software package provides a wide variety of classical and robust statistical methods that are not typically available in other commercial software packages. A major part of Scout deals with classical, robust, and resistant univariate and multivariate ou...

  13. Lunar Scout Two spacecraft gravity experiment

    Science.gov (United States)

    Cheng, Andrew F.

    1993-01-01

    Measurement of the gravity field of the Moon has a high science priority because of its implications for the internal structure and thermal history of the Moon, and it has a high priority for future exploration activities because of the influence of lunar gravity on spacecraft navigation and orbit maintenance. The current state of knowledge in the lunar gravity field (and the uncertainty in the knowledge) is based primarily on data accumulated from the Lunar Orbiter and Apollo programs. Data are sparse and emphasize the equatorial band (+/- 30 deg) on the near side of the Moon. There are no tracking data on the far side and only the Lunar Orbiter 5 provides a small amount of high inclination data. A host of gravity models developed from different combinations of tracking data have large discrepancies in their predictions of spacecraft motion and orbit lifetimes. There are also large disagreements in the Mercator projections of the gravity acceleration from each model, especially on the far side, where the contours tend to have no obvious relationship with the local topography. The science and engineering requirements for global gravity field mapping will be satisfied with continuous radio metric tracking of Lunar Scout 1 in a low polar orbit using the Deep Space Network and Lunar Scout 2 in a high elliptical orbit. The gravity field of the Moon will be mapped during the Scout Program using a two spacecraft concept. In the two spacecraft concept, one spacecraft is placed in a high altitude eccentric orbit while the second spacecraft is in a low altitude polar orbit. The gravity experiment requires a radio frequency that will permit two-way Doppler tracking between the spacecraft and the Deep Space Network (DSN). Both spacecraft carry NASA standard transponder systems for data transmission to Earth as well as for tracking and orbit determination. Data sufficient to produce a gravity field map could be acquired within one month with this system.

  14. Phoenix - The First Mars Scout Mission

    Science.gov (United States)

    Goldstein, Barry; Shotwell, Robert

    2008-01-01

    As the first of the new Mars Scouts missions, the Phoenix project was selected by NASA in August of 2003. Four years later, almost to the day, Phoenix was launched from Cape Canaveral Air Station and successfully injected into an interplanetary trajectory on its way to Mars. On May 25, 2008 Phoenix conducted the first successful powered decent on Mars in over 30 years. This paper will highlight some of the key changes since the 2008 IEEE paper of the same name, as well as performance through cruise, landing at the north pole of Mars and some of the preliminary results of the surface mission.

  15. Gamma ray spectrometer for Lunar Scout 2

    Science.gov (United States)

    Moss, C. E.; Burt, W. W.; Edwards, B. C.; Martin, R. A.; Nakano, George H.; Reedy, R. C.

    1993-01-01

    We review the current status of the Los Alamos program to develop a high-resolution gamma-ray spectrometer for the Lunar Scout-II mission, which is the second of two Space Exploration Initiative robotic precursor missions to study the Moon. This instrument will measure gamma rays in the energy range of approximately 0.1 - 10 MeV to determine the composition of the lunar surface. The instrument is a high-purity germanium crystal surrounded by an CsI anticoincidence shield and cooled by a split Stirling cycle cryocooler. It will provide the abundance of many elements over the entire lunar surface.

  16. User's operating procedures. Volume 2: Scout project financial analysis program

    Science.gov (United States)

    Harris, C. G.; Haris, D. K.

    1985-01-01

    A review is presented of the user's operating procedures for the Scout Project Automatic Data system, called SPADS. SPADS is the result of the past seven years of software development on a Prime mini-computer located at the Scout Project Office, NASA Langley Research Center, Hampton, Virginia. SPADS was developed as a single entry, multiple cross-reference data management and information retrieval system for the automation of Project office tasks, including engineering, financial, managerial, and clerical support. This volume, two (2) of three (3), provides the instructions to operate the Scout Project Financial Analysis program in data retrieval and file maintenance via the user friendly menu drivers.

  17. Boy Scout Medical Record System for Blue Ridge Mountain Council

    OpenAIRE

    Kurlak, John; Whelan, Pat; Greer, Zack; De La Barra, Mauricio

    2012-01-01

    We developed a web site for the Blue Ridge Mountain Council of the Boy Scouts of America. The website serves as a medical record system. For this semester project, our team decided to partner with the Boy Scouts of America in Pulaski County. Our coordinator, Gregory W. Harmon, works for the Boy Scouts and manages all of their camping facilities. Since they serve over 120,000 users per day, they were looking for ways to improve their medical recording procedures for filing injuries and a...

  18. Developmental Trajectories of Youth Character: A Five-Wave Longitudinal Study of Cub Scouts and Non-Scout Boys.

    Science.gov (United States)

    Wang, Jun; Ferris, Kaitlyn A; Hershberg, Rachel M; Lerner, Richard M

    2015-12-01

    Youth development programs, such as the Boy Scouts of America, aim to develop positive attributes in youth (e.g., character virtues, prosocial behaviors, and positive civic actions), which are necessary for individuals and societies to flourish. However, few developmental studies have focused on how specific positive attributes develop through participation in programs such as the Boy Scouts of America. As part of the Character and Merit Project, this article examined the developmental trajectories of character and other positive attributes, which are of focal concern of the Boy Scouts of America and the developmental literature. Data were collected from 1398 Scouts (M = 8.59 years, SD = 1.29 years, Range 6.17-11.92 years) and 325 non-Scout boys (M = 9.06 years, SD = 1.43 years, Range 6.20-11.81 years) over five waves of testing across a two-and-half-year period. Latent growth-curve analyses of self-report survey data examined the developmental trajectories of the attributes. Older youth rated themselves lower than younger participants on helpfulness, reverence, thriftiness, and school performance. However, all youth had moderately high self-ratings on all the attributes. Across waves, Scouts' self-ratings increased significantly for cheerfulness, helpfulness, kindness, obedience, trustworthiness, and hopeful future expectations. Non-Scout boys' self-ratings showed no significant change for any attributes except for a significant decrease in religious reverence among non-Scout boys from religious institutions. We discuss implications for positive youth development and for the role of the Boy Scouts of America programming in character development. PMID:26280400

  19. Mars Scout: An Astrobiology Micromission to Investigate Martian Environments

    Science.gov (United States)

    Cabrol, N. A.; Ori, G. G.; Grin, E. A.; Marinangeli, L.; McKay, C. P.; Marshall, J.; Thomas, H. J.; Rabette, M.; Sims, M.; Landheim, R.

    2000-01-01

    The Mars Scout Mission Concept explores the possibility of sending a series of small, simple, and cheap stations at the surface of Mars which will provide the critical information about environments that are missing today.

  20. Improvised Scout Bee Movements in Artificial Bee Colony

    Directory of Open Access Journals (Sweden)

    Tarun Kumar Sharma

    2014-01-01

    Full Text Available In the basic Artificial Bee Colony (ABC algorithm, if the fitness value associated with a food source is not improved for a certain number of specified trials then the corresponding bee becomes a scout to which a random value is assigned for finding the new food source. Basically, it is a mechanism of pulling out the candidate solution which may be entrapped in some local optimizer due to which its value is not improving. In the present study, we propose two new mechanisms for the movements of scout bees. In the first method, the scout bee follows a non-linear interpolated path while in the second one, scout bee follows Gaussian movement. Numerical results and statistical analysis of benchmark unconstrained, constrained and real life engineering design problems indicate that the proposed modifications enhance the performance of ABC.

  1. Pragmatic inspiration for the organization of scout education

    OpenAIRE

    POLANSKÝ, Tomáš

    2011-01-01

    The thesis deals with the matching between the methods of pragmatic pedagogy and the new educational program of Scout Association.. The theoretical part describes the development of pragmatism in America, and the continuity of philosophical and pedagogical trends, pragmatism in Europe and in the Czech Republic. It explains the development of Woodcraft movement in the coherence with pragmatic pedagogy. It describes the basic educational methods of Scout organization; make it clear what the new...

  2. SCOUT: information retrieval from full-text medical literature.

    OpenAIRE

    Purcell, G. P.; Mar, D. D.

    1992-01-01

    SCOUT is an expert system designed to aid the practicing physician in searching a full-text database of biomedical literature for information in the domain of oncology. In the clinical setting, an information-retrieval system needs to provide only a few relevant documents that address a patient-specific query. SCOUT models the expertise of an oncologist and an information specialist in a probabilistic inference system; it applies expert heuristics both in selecting the best source of informat...

  3. Evaluating Boy Scout Geology Education, A Pilot Study

    Science.gov (United States)

    Hintz, R. S.; Thomson, B.

    2008-12-01

    This study investigated geology knowledge acquisition by Boy Scouts through use of the Boy Scout Geology Merit Handbook. In this study, boys engaged in hands-on interactive learning following the requirements set forth in the Geology Merit Badge Handbook. The purposes of this study were to determine the amount of geology content knowledge engendered in adolescent males through the use of the Geology Merit Badge Handbook published by the Boy Scouts of America; to determine if single sex, activity oriented, free-choice learning programs can be effective in promoting knowledge development in young males; and to determine if boys participating in the Scouting program believed their participation helped them succeed in school. Members of a local Boy Scout Troop between the ages of 11 and 18 were invited to participate in a Geology Merit Badge program. Boys who did not already possess the badge were allowed to self-select participation. The boys' content knowledge of geology, rocks, and minerals was pre- and post-tested. Boys were interviewed about their school and Scouting experiences; whether they believed their Scouting experiences and work in Merit Badges contributed to their success in school. Contributing educational theories included single-sex education, informal education with free-choice learning, learning styles, hands-on activities, and the social cognitive theory concept of self-efficacy. Boys who completed this study seemed to possess a greater knowledge of geology than they obtained in school. If boys who complete the Boy Scout Geology Merit Badge receive additional geological training, their field experiences and knowledge acquired through this learning experience will be beneficial, and a basis for continued scaffolding of geologic knowledge.

  4. Concept for Mars Volcanic Emission Life Scout

    Science.gov (United States)

    2004-01-01

    This artist's rendition depicts a concept for a Mars orbiter that would scrutinize the martian atmosphere for chemical traces of life or environments supportive of life that might be present anywhere on the planet. The concept is named the Mars Volcanic Emission and Life Scout, or Marvel. It would equip a Mars orbiter with two types of instruments proven useful in studying Earth's atmosphere from Earth orbit. One, a solar occultation infrared spectrometer, would look sideways through Mars' atmosphere toward the setting or rising Sun for an extremely sensitive reading of what chemicals are in the air that sunlight passes through before hitting the instrument. The other, a submillimeter spectrometer would survey the atmosphere continuously, including during dust storms and polar night, to seek localized surface sources of the chemicals of interest. The infrared spectrometer has very high sensitivity for one chemical of great interest: methane, which is produced by many types of microbes, as well as by some volcanic sources. The submillimeter spectrometer has very high sensitivity for water vapor. Localized concentrations of water vapor in the atmosphere could identify places where subsurface water sources may be venting.

  5. 78 FR 19065 - Requested Administrative Waiver of the Coastwise Trade Laws: Vessel SCOUT; Invitation for Public...

    Science.gov (United States)

    2013-03-28

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF TRANSPORTATION Maritime Administration Requested Administrative Waiver of the Coastwise Trade Laws: Vessel SCOUT... of the vessel SCOUT is: Intended Commercial Use of Vessel: ``Charter, up to 6...

  6. 78 FR 23822 - Requested Administrative Waiver of the Coastwise Trade Laws: Vessel SCOUT; Invitation for Public...

    Science.gov (United States)

    2013-04-22

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF TRANSPORTATION Maritime Administration Requested Administrative Waiver of the Coastwise Trade Laws: Vessel SCOUT... of the vessel SCOUT is: Intended Commercial Use of Vessel: ``6 passenger day charters''....

  7. Engendering Children of the Resistance: Models of Gender and Scouting in China, 1919–1937

    Directory of Open Access Journals (Sweden)

    Margaret Mih Tillman

    2014-12-01

    Full Text Available In the 1920s and 1930s, Chinese adapted scouting, which had originally been developed to masculinize British youth as future colonial troops. While Chinese families and teachers valued scouting as a form of outdoor recreation, Chiang Kai-shek and the Guomindang after 1927 connected scouting to preparation for military training. In addition to fostering masculinity among boys, the Chinese Scouting Association also directed Girl Scouts with new models of patriotic girlhood. The Guomindang promoted the distinct femininity of the Girl Scouts and channeled girls’ patriotism into nursing. As China entered World War II, Girl Scouts became significant symbols of patriotism in an increasingly militarized children’s culture. The Guomindang showcased Yang Huimin, a Girl Scout and heroine in the Battle of Sihang Warehouse, as a spokesperson for the Nationalist cause, but it could not fully control her public image.

  8. Test Plan - Solids Accumulation Scouting Studies

    Energy Technology Data Exchange (ETDEWEB)

    Duignan, M. R.; Steeper, T. J.; Steimke, J. L.; Fowley, M. D.

    2012-05-10

    This plan documents the highlights of the Solids Accumulations Scouting Studies test; a project, from Washington River Protection Solutions (WRPS), that began on February 1, 2012. During the last 12 weeks considerable progress has been made to design and plan methods that will be used to estimate the concentration and distribution of heavy fissile solids in accumulated solids in the Hanford double-shell tank (DST) 241-AW-105 (AW-105), which is the primary goal of this task. This DST will be one of the several waste feed delivery staging tanks designated to feed the Pretreatment Facility (PTF) of the Waste Treatment and Immobilization Plant (WTP). Note that over the length of the waste feed delivery mission AW-105 is currently identified as having the most fill empty cycles of any DST feed tanks, which is the reason for modeling this particular tank. At SRNL an existing test facility, the Mixing Demonstration Tank, which will be modified for the present work, will use stainless steel particles in a simulant that represents Hanford waste to perform mock staging tanks transfers that will allow solids to accumulate in the tank heel. The concentration and location of the mock fissile particles will be measured in these scoping studies to produce information that will be used to better plan larger scaled tests. Included in these studies is a secondary goal of developing measurement methods to accomplish the primary goal. These methods will be evaluated for use in the larger scale experiments. Included in this plan are the several pretest activities that will validate the measurement techniques that are currently in various phases of construction. Aspects of each technique, e.g., particle separations, volume determinations, topographical mapping, and core sampling, have been tested in bench-top trials, as discussed herein, but the actual equipment to be employed during the full test will need evaluation after fabrication and integration into the test facility.

  9. Test Plan - Solids Accumulation Scouting Studies

    International Nuclear Information System (INIS)

    This plan documents the highlights of the Solids Accumulations Scouting Studies test; a project, from Washington River Protection Solutions (WRPS), that began on February 1, 2012. During the last 12 weeks considerable progress has been made to design and plan methods that will be used to estimate the concentration and distribution of heavy fissile solids in accumulated solids in the Hanford double-shell tank (DST) 241-AW-105 (AW-105), which is the primary goal of this task. This DST will be one of the several waste feed delivery staging tanks designated to feed the Pretreatment Facility (PTF) of the Waste Treatment and Immobilization Plant (WTP). Note that over the length of the waste feed delivery mission AW-105 is currently identified as having the most fill empty cycles of any DST feed tanks, which is the reason for modeling this particular tank. At SRNL an existing test facility, the Mixing Demonstration Tank, which will be modified for the present work, will use stainless steel particles in a simulant that represents Hanford waste to perform mock staging tanks transfers that will allow solids to accumulate in the tank heel. The concentration and location of the mock fissile particles will be measured in these scoping studies to produce information that will be used to better plan larger scaled tests. Included in these studies is a secondary goal of developing measurement methods to accomplish the primary goal. These methods will be evaluated for use in the larger scale experiments. Included in this plan are the several pretest activities that will validate the measurement techniques that are currently in various phases of construction. Aspects of each technique, e.g., particle separations, volume determinations, topographical mapping, and core sampling, have been tested in bench-top trials, as discussed herein, but the actual equipment to be employed during the full test will need evaluation after fabrication and integration into the test facility

  10. Girl Scout Badge Day as a service learning experience.

    Science.gov (United States)

    Schmidt, Nola A; Brown, Janet M

    2008-01-01

    Acquiring clinical experiences for students is a major challenge for nurse educators. One of the most difficult areas in which to secure clinical experiences is pediatric nursing; yet, nurse educators have a responsibility to create innovative strategies to assure that students have experience with pediatric clients. The purpose of this paper is to describe Girl Scout Badge Day (GSBD), a teaching strategy rooted in service learning. The strategy incorporates the three essential elements that distinguish service learning from other learning: experiential learning, reflection, and reciprocal learning. During this clinical experience, students provide health promotion education to scouts who subsequently earn badge requirements. Students are provided experiential learning as they implement the role of the teacher and reflect on the core values of nursing. In this paper, the specifics of implementing GSBD are presented and lessons learned are discussed. Benefits for students, scouts, troop leaders, and faculty are identified and improvements are suggested. PMID:18976233

  11. The Internet Scout Project(ISP)研究%A Study of the Internet Scout Project

    Institute of Scientific and Technical Information of China (English)

    潘燕桃

    2000-01-01

    着重对The Internet Scout Project(以下简称ISP)提供的11项信息服务中的侦察报告、侦察报告路标和侦察工具箱等进行分析研究。认为侦察报告具有内容专深、更新及时等特点;侦察报告路标是对因特网资源进行标引和编目,重新组织成为有序的、可有效检索的成功例证;侦察工具箱能够满足用户畅游因特网的不同需求。

  12. Lunar scout: A Project Artemis proposal

    Science.gov (United States)

    1992-01-01

    The results of a student project to design a lunar lander in the context of a specifically defined mission are presented. The Lunar Scout will be launched from Cape Canaveral, Florida onboard a Delta II launch vehicle. The Delta II will carry the lander and its payload to a 1367 km orbit. Once it reaches that altitude, a STAR 48A solid rocket motor will kick the spacecraft into a lunar trajectory. After burnout of the lunar insertion motor, it will be jettisoned from the spacecraft. The flight from the earth to the moon will take approximately 106.4 hours. During this time the battery, which was fully charged prior to launch, will provide all power to the spacecraft. Every hour, the spacecraft will use its sun sensors and star trackers to update its position, maintain some stabilization and relay it back to earth using the dipole antennas. At the start of its lunar trajectory, the spacecraft will fire one of its 1.5 N thrusters to spin in at a very small rate. The main reason for this is to prevent one side of the spacecraft from overheating in the sun. When the spacecraft nears the moon, it will orient itself for the main retro burn. At an altitude of 200 km, a 4400 N bipropellant liquid thruster will ignite to slow the spacecraft. During the burn, the radar altimeter will be turned on to guide the spacecraft. The main retro rocket will slow the lander to 10 m/s at an approximate altitude of 40 km above the moon. From there, the space craft will use four 4.5 N hydrazine vertical thrusters and 1.5 N horizontal thrusters to guide the spacecraft to a soft landing. Once on the ground, the lander will shutoff the radar and attitude control systems. After the debris from the impact has settled, the six solar panels will be deployed to begin recharging the batteries and to power up the payload. The feedhorn antenna will then rotate to fix itself on the earth. Once it moves, it will stay in that position for the spacecraft's lifetime. The payload will then be activated to

  13. Seeding Social Norms about Energy Conservation among Girl Scouts

    Science.gov (United States)

    Bernstein, Debra; Puttick, Gillian

    2014-01-01

    Three studies examined whether a social norm message (SNM) to Girl Scouts who had completed an energy conservation program would impact behavior and attitudes. Studies 1 and 2 were conducted with girls recently completing the program, study 3 was conducted with girls completing the program one year earlier. Results suggest that the SNM may impact…

  14. Quick Overview Scout 2008 Version 1.0

    Science.gov (United States)

    The Scout 2008 version 1.0 statistical software package has been updated from past DOS and Windows versions to provide classical and robust univariate and multivariate graphical and statistical methods that are not typically available in commercial or freeware statistical softwar...

  15. Speaking Spanish like a Boy Scout: Language Socialization, Resistance, and Reproduction in a Heritage Language Scout Troop

    Science.gov (United States)

    Guardado, Martin

    2009-01-01

    This article offers a critical analysis of the language socialization of Spanish-speaking families in a Scout group in Metro Vancouver. Using tools of discourse analysis, the article examines the language use patterns of the participants, particularly focusing on the language ideologies to which they oriented themselves and the identities indexed…

  16. Scouting For Approval: Lessons on Medical Device Regulation in an Era of Crowdfunding from Scanadu's "Scout".

    Science.gov (United States)

    Smith, Colleen

    2015-01-01

    Internet crowdfunding, a new and increasingly popular method of raising capital to develop products and businesses, has recently come into conflict with the Food and Drug Administration's (FDA's) regulation of medical devices. This Article examines the issues that arise when companies pre-sell medical devices via crowdfunding campaigns before gaining FDA approval of the devices. Because Internet crowdfunding has only been in use for a few years, little has been written about it academically, particularly about its interaction with FDA regulations. The rising interest in crowdfunding, coupled with the downturn in investment in the American medical device industry, make this a salient issue that is ripe for FDA review. This Article uses the crowdfunding campaign Scanadu, a medical device company, conducted in 2013 to raise money to develop its in-home diagnostic device, the "Scout," as a starting point for this analysis. Because it is extremely costly to develop a device and obtain FDA approval, medical device companies should be able to utilize crowdfunding to raise the necessary capital. However, because of the possible dangers medical devices pose, FDA needs to review the risks created by allowing companies to crowdfund medical devices and should issue guidance to help companies comply with FDA regulations while still allowing them to take advantage of the benefits of crowdfunding. This guidance should ensure the continued commitment to consumer safety that is at the core of FDA regulation. PMID:26292478

  17. Gradient Scouting in Reversed-Phase HPLC Revisited

    Science.gov (United States)

    Alcazar, A.; Jurado, J. M.; Gonzalez, A. G.

    2011-01-01

    Gradient scouting is the best way to decide the most suitable elution mode in reversed-phase high-performance liquid chromatography (RP-HPLC). A simple rule for this decision involves the evaluation of the ratio [delta]t/t[subscript G] (where [delta]t is the difference in the retention time between the last and the first peak and t[subscript G] is…

  18. Cognitive Scout Node for Communication in Disaster Scenarios

    OpenAIRE

    Rajesh K. Sharma; Anastasia Lavrenko; Dirk Kolb; Thomä, Reiner S.

    2012-01-01

    The cognitive radio (CR) concept has appeared as a promising technology to cope with the spectrum scarcity caused by increased spectrum demand due to the emergence of new applications. CR can be an appropriate mean to establish self-organization and situation awareness at the radio interface, which is highly desired to manage unexpected situations that may happen in a disaster scenario. The scout node proposed in this paper is an extended concept based on a powerful CR node in a heterogene...

  19. Missed Lung Cancers on the Scout View: Do We Look Every Time?

    OpenAIRE

    Sarfraz Ahmed Nazir; Rachel Benamore; Fergus Gleeson

    2013-01-01

    Scout views are digital radiographs obtained to aid planning of the subsequent computed tomography (CT) examination. Review of these scout views may provide additional information not demonstrated on the axial images, but such reviews may not necessarily be performed routinely, especially in the context of abdominopelvic CT studies. We illustrate the value of the scout images by presenting a series of representative cases of missed pulmonary neoplasms in five patients who originally underwent...

  20. Missed Lung Cancers on the Scout View: Do We Look Every Time?

    Directory of Open Access Journals (Sweden)

    Sarfraz Ahmed Nazir

    2013-01-01

    Full Text Available Scout views are digital radiographs obtained to aid planning of the subsequent computed tomography (CT examination. Review of these scout views may provide additional information not demonstrated on the axial images, but such reviews may not necessarily be performed routinely, especially in the context of abdominopelvic CT studies. We illustrate the value of the scout images by presenting a series of representative cases of missed pulmonary neoplasms in five patients who originally underwent such examinations.

  1. SCOUT: A Fast Monte-Carlo Modeling Tool of Scintillation Camera Output

    OpenAIRE

    Hunter, William C. J.; Barrett, Harrison H.; Lewellen, Thomas K.; Miyaoka, Robert S.; Muzi, John P.; Li, Xiaoli; McDougald, Wendy; MacDonald, Lawrence R.

    2010-01-01

    We have developed a Monte-Carlo photon-tracking and readout simulator called SCOUT to study the stochastic behavior of signals output from a simplified rectangular scintillation-camera design. SCOUT models the salient processes affecting signal generation, transport, and readout. Presently, we compare output signal statistics from SCOUT to experimental results for both a discrete and a monolithic camera. We also benchmark the speed of this simulation tool and compare it to existing simulation...

  2. SCOUT: a fast Monte-Carlo modeling tool of scintillation camera output†

    OpenAIRE

    Hunter, William C. J.; Barrett, Harrison H.; Muzi, John P.; McDougald, Wendy; MacDonald, Lawrence R.; Miyaoka, Robert S.; Lewellen, Thomas K.

    2013-01-01

    We have developed a Monte-Carlo photon-tracking and readout simulator called SCOUT to study the stochastic behavior of signals output from a simplified rectangular scintillation-camera design. SCOUT models the salient processes affecting signal generation, transport, and readout of a scintillation camera. Presently, we compare output signal statistics from SCOUT to experimental results for both a discrete and a monolithic camera. We also benchmark the speed of this simulation tool and compare...

  3. Old-fashioned charm and newfangled electronics make today's oil scouts formidable figures

    International Nuclear Information System (INIS)

    A profile of oil scouting, a secretive trade within the petroleum industry, was presented. Scouting began as early as 1949 when, in a fiercely competitive industry, a scout had to gain any information anyway he could regarding a competitor's drilling activity. Scouts were particularly useful when the industry was new because it was profitable to pay a field scout to watch a competitor's well from a hilltop with binoculars. If a scout informed their company that a given lease looked promising, the company would snap up that lease and the scout earned his wages many times over. Today's oil scout is more likely to be an independent consultant than a company employee. Their equipment ranges from devices such as parabolic microphones, wireless transmitters, night vision goggles, de-bugging devices, tools for listening through solid objects, and cell phone monitors. Acquired information can be invaluable and can prevent companies from making expensive mistakes, particularly in take-over situations. Estimates range from 100 to 150 independent scouts in Alberta. 2 figs

  4. Characterization of Genomic Variants Associated with Scout and Recruit Behavioral Castes in Honey Bees Using Whole-Genome Sequencing

    OpenAIRE

    Southey, Bruce R.; Ping Zhu; Carr-Markell, Morgan K.; Liang, Zhengzheng S.; Amro Zayed; Ruiqiang Li; Robinson, Gene E.; Rodriguez-Zas, Sandra L.

    2016-01-01

    Among forager honey bees, scouts seek new resources and return to the colony, enlisting recruits to collect these resources. Differentially expressed genes between these behaviors and genetic variability in scouting phenotypes have been reported. Whole-genome sequencing of 44 Apis mellifera scouts and recruits was undertaken to detect variants and further understand the genetic architecture underlying the behavioral differences between scouts and recruits. The median coverage depth in recruit...

  5. The Control of Sexuality in the Early British Boy Scouts Movement

    Science.gov (United States)

    Pryke, Sam

    2005-01-01

    This article looks at the way in which the early (1907-1922) British Boy Scouts movement attempted to control sexuality through archival examination of the organization's preoccupation with preventing masturbation or, as it was generally referred to, "self abuse". Having briefly outlined the origination and nature of the Scouts, it considers why…

  6. Art, Boys, and the Boy Scout Movement: Lord Baden-Powell

    Science.gov (United States)

    Chalmers, F. Graeme; Dancer, Andrea A.

    2007-01-01

    Robert Stephenson Smyth Baden-Powell (1857-1941), founder of the Boy Scout Movement in 1907, was a British military hero during the Boer War. Within an ethos and era of empire-building, athleticism, soldier-heroes and the pursuit of "manliness," Baden-Powell valued the arts and adapted his artistic skill to his wartime and Scouting activities. His…

  7. 78 FR 38452 - Price for the 2013 Girl Scouts of the USA Young Collector Set

    Science.gov (United States)

    2013-06-26

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF THE TREASURY United States Mint Price for the 2013 Girl Scouts of the USA Young Collector Set AGENCY: United States... of $54.95 for the 2013 Girl Scouts of the USA Young Collector Set. FOR FURTHER INFORMATION...

  8. Safety of a Scout Dose Preceding Hepatic Radioembolization with 166Ho Microspheres

    NARCIS (Netherlands)

    Prince, Jip F; van Rooij, Rob; Bol, Gijsbert H; de Jong, Hugo W A M; van den Bosch, Maurice A A J; Lam, Marnix G E H

    2015-01-01

    UNLABELLED: Before (166)Ho radioembolization, a small batch of the same type of microspheres is administered as a scout dose instead of the conventional (99m)Tc-macroaggregated albumin ((99m)Tc-MAA). The (166)Ho scout dose provides a more accurate and precise lung shunt assessment. However, in contr

  9. Improvised Scout Bee Movements in Artificial Bee Colony

    OpenAIRE

    Tarun Kumar Sharma; Millie Pant

    2014-01-01

    In the basic Artificial Bee Colony (ABC) algorithm, if the fitness value associated with a food source is not improved for a certain number of specified trials then the corresponding bee becomes a scout to which a random value is assigned for finding the new food source. Basically, it is a mechanism of pulling out the candidate solution which may be entrapped in some local optimizer due to which its value is not improving. In the present study, we propose two new mechanisms for the movements ...

  10. Thermal Design Validation of the Mars Scout Phoenix Payload

    Science.gov (United States)

    Tsuyuki, Glenn T.; Lee, Chern-Jiin

    2007-01-01

    This slide presentation reviews the validation of the thermal design for the Mars Scout Phoenix Payload. It includes a description of the Phoenix Mission, the science objectives, the timeline, and the flight system and payloads that were on the lander. The initial responsibility for the development and validation the thermal design was with the developers. This process lacked overall system engineering, there was a difference of thermal expertise, and the number of institutions involved complicated the interactions. The revised approach for payload thermal design validation is described.

  11. THE VASCULAR FLORA OF HALE SCOUT RESERVATION: LEFLORE COUNTY, OKLAHOMA

    OpenAIRE

    Bruce W. Hoagland; Amy K. Buthod

    2010-01-01

    The Hale Scout Reservation is located in the Ouachita Mountains of southeastern Oklahoma, a region of high plant diversity in the state. A vascular plant inventory yielded 463 species of vascular plants in 288 genera and 99 families. The largest families were the Asteraceae (with 65 species) and Poaceae (56). The flora consisted of 120 annuals, 1 biennial, and 342 perennials. Forty-two non-native species were collected, representing 8.8% of the flora. Sixteen species tracked by the Oklahoma N...

  12. Design and Development of NEA Scout Solar Sail Deployer Mechanism

    Science.gov (United States)

    Sobey, Alexander R.; Lockett, Tiffany Russell

    2016-01-01

    The 6U (approx.10 cm x 20 cm x 30 cm) cubesat Near Earth Asteroid (NEA) Scout1, projected for launch in September 2018 aboard the maiden voyage of the Space Launch System, will utilize a solar sail as its main method of propulsion throughout its approx.3-year mission to a Near Earth Asteroid. Due to the extreme volume constraints levied onto the mission, an acutely compact solar sail deployment mechanism has been designed to meet the volume and mass constraints, as well as provide enough propulsive solar sail area and quality in order to achieve mission success. The design of such a compact system required the development of approximately half a dozen prototypes in order to identify unforeseen problems, advance solutions, and build confidence in the final design product. This paper focuses on the obstacles of developing a solar sail deployment mechanism for such an application and the lessons learned from a thorough development process. The lessons presented will have significant applications beyond the NEA Scout mission, such as the development of other deployable boom mechanisms and uses for gossamer-thin films in space.

  13. Scout-view assisted interior micro-CT

    Science.gov (United States)

    Sharma, Kriti Sen; Holzner, Christian; Vasilescu, Dragoş M.; Jin, Xin; Narayanan, Shree; Agah, Masoud; Hoffman, Eric A.; Yu, Hengyong; Wang, Ge

    2013-06-01

    Micro computed tomography (micro-CT) is a widely-used imaging technique. A challenge of micro-CT is to quantitatively reconstruct a sample larger than the field-of-view (FOV) of the detector. This scenario is characterized by truncated projections and associated image artifacts. However, for such truncated scans, a low resolution scout scan with an increased FOV is frequently acquired so as to position the sample properly. This study shows that the otherwise discarded scout scans can provide sufficient additional information to uniquely and stably reconstruct the interior region of interest. Two interior reconstruction methods are designed to utilize the multi-resolution data without significant computational overhead. While most previous studies used numerically truncated global projections as interior data, this study uses truly hybrid scans where global and interior scans were carried out at different resolutions. Additionally, owing to the lack of standard interior micro-CT phantoms, we designed and fabricated novel interior micro-CT phantoms for this study to provide means of validation for our algorithms. Finally, two characteristic samples from separate studies were scanned to show the effect of our reconstructions. The presented methods show significant improvements over existing reconstruction algorithms.

  14. Scout-view assisted interior micro-CT

    International Nuclear Information System (INIS)

    Micro computed tomography (micro-CT) is a widely-used imaging technique. A challenge of micro-CT is to quantitatively reconstruct a sample larger than the field-of-view (FOV) of the detector. This scenario is characterized by truncated projections and associated image artifacts. However, for such truncated scans, a low resolution scout scan with an increased FOV is frequently acquired so as to position the sample properly. This study shows that the otherwise discarded scout scans can provide sufficient additional information to uniquely and stably reconstruct the interior region of interest. Two interior reconstruction methods are designed to utilize the multi-resolution data without significant computational overhead. While most previous studies used numerically truncated global projections as interior data, this study uses truly hybrid scans where global and interior scans were carried out at different resolutions. Additionally, owing to the lack of standard interior micro-CT phantoms, we designed and fabricated novel interior micro-CT phantoms for this study to provide means of validation for our algorithms. Finally, two characteristic samples from separate studies were scanned to show the effect of our reconstructions. The presented methods show significant improvements over existing reconstruction algorithms. (paper)

  15. Design and Development of NEA Scout Solar Sail Deployer Mechanism

    Science.gov (United States)

    Sobey, Alexander R.; Lockett, Tiffany Russell

    2016-01-01

    The 6U (approximately 10cm x 20cm x 30cm) cubesat Near Earth Asteroid (NEA) Scout1, projected for launch in September 2018 aboard the maiden voyage of the Space Launch System (SLS), will utilize a solar sail as its main method of propulsion throughout its approximately 3 year mission to a Near Earth Asteroid (NEA). Due to the extreme volume constraints levied onto the mission, an acutely compact solar sail deployment mechanism has been designed to meet the volume and mass constraints, as well as provide enough propulsive solar sail area and quality in order to achieve mission success. The design of such a compact system required the development of approximately half a dozen prototypes in order to identify unforeseen problems, advance solutions, and build confidence in the final design product. This paper focuses on the obstacles of developing a solar sail deployment mechanism for such an application and the lessons learned from a thorough development process. The lessons presented will have significant applications beyond the NEA Scout mission, such as the development of other deployable boom mechanisms and uses for gossamer-thin films in space.

  16. You Can Beat the Market: Estimating the Return on Investment for National Hockey League (NHL) Team Scouting using a Draft Value Pick Chart for the NHL

    OpenAIRE

    Schuckers, Michael; Argeris, Steve

    2014-01-01

    Scouting is a major part of talent acquisition for any professional sports team. In the National Hockey League (NHL), the market for scouting is set by the NHLs Central Scouting Service which develops a ranking of draft eligible players. In addition to the Central Scouting rankings, NHL teams use their own internal scouting to augment their knowledge of eligible players and develop their own rankings. Using a novel statistical approach we show in this paper that the additional information pos...

  17. Development of the Algol III solid rocket motor for SCOUT.

    Science.gov (United States)

    Felix, B. R.; Mcbride, N. M.

    1971-01-01

    The design and performance of a motor developed for the first stage of the NASA SCOUT-D and E launch vehicles are discussed. The motor delivers a 30% higher total impulse and a 35 to 45% higher payload mass capability than its predecessor, the Algol IIB. The motor is 45 in. in diameter, has a length-to-diameter ratio of 8:1 and delivers an average 100,000-lb thrust for an action time of 72 sec. The motor design features a very high volumetrically loaded internal-burning charge of 17% aluminized polybutadiene propellant, a plasma-welded and heat-treated steel alloy case, and an all-ablative plastic nose liner enclosed in a steel shell. The only significant development problem was the grain design tailoring to account for erosive burning effects which occurred in the high-subsonic-Mach-number port. The tests performed on the motor are described.

  18. Phoenix Mars Scout Parachute Flight Behavior and Observations

    Science.gov (United States)

    Adams, Douglas S.; Witkowski, Allen; Kandis, Mike

    2011-01-01

    The data returned from the successful Phoenix Mars Scout mission are analyzed in order to determine characteristics and behaviors of the supersonic parachute that was used to slow the entry body during its descent to the surface. At least one significant drag reduction event was observed when the vehicle was traveling at Mach 1.6; this is consistent with previously reported terrestrial high altitude testing and is likely associated with an area oscillation of the parachute. The parachute is shown to possess some lateral instability relative to the anti-velocity vector that is also at a level that is consistent with the same historic data. Ramifications of the lateral instability and, in particular, the unsteadiness in the parachute drag are discussed as energizing elements of the entry body wrist mode. The apparent coefficient of drag for the parachute is calculated and shown to have relatively small variations on an average basis over the supersonic portion of flight.

  19. Scout Missions and Future Exploration of the Martian Poles

    Science.gov (United States)

    McBride, K. S.

    2003-01-01

    NASA's Mars Exploration Program, (MEP) complemented by missions in operation by ESA and the Japanese space agency, is revolutionizing the study of Mars as a planet and potential home for life, past, present or future. Within the MEP there are a number of significant opportunities for the study of the Mars polar regions--from the ongoing Mars Global Surveyor and Odyssey missions, the upcoming Mars Reconnaissance Orbiter, and the soon-to-be-defined Mars Science Laboratory. As an internal complement to the Mars missions being developed by JPL for the MEP, Mars Scout investigations can provide substantial future opportunities to study the polar regions of Mars. These relatively small, PI-led missions provide substantial flexibility within the overall MEP, providing the capability to respond to scientific targets of opportunity in Mars science, with special-interest small missions, or to be developed to respond to instrument opportunities for missions developed by international partners.

  20. THE VASCULAR FLORA OF HALE SCOUT RESERVATION: LEFLORE COUNTY, OKLAHOMA

    Directory of Open Access Journals (Sweden)

    Bruce W. Hoagland

    2010-12-01

    Full Text Available The Hale Scout Reservation is located in the Ouachita Mountains of southeastern Oklahoma, a region of high plant diversity in the state. A vascular plant inventory yielded 463 species of vascular plants in 288 genera and 99 families. The largest families were the Asteraceae (with 65 species and Poaceae (56. The flora consisted of 120 annuals, 1 biennial, and 342 perennials. Forty-two non-native species were collected, representing 8.8% of the flora. Sixteen species tracked by the Oklahoma Natural Heritage Inventory were present: Amorpha ouachitensis (S1, Aristolochia serpentaria (S1, Baptisia nuttalliana (S2, Brachyelytrum erectum (S1, Brasenia schreberi (S1, Carex ouachitana (S1, Chionanthus virginicus (S2, Clematis crispa (S1, Didiplis diandra (S1S2, Galium arkansanum (S2, Houstonia ouachitana (S1, Juncus repens (S1, Modiola caroliniana (S2, Monotropa hypopithys (S1, Muhlenbergia bushii (S1, and Ribes cynosbati (S2 (Oklahoma Natural Heritage Inventory, 2010.

  1. Energy behaviours of northern California Girl Scouts and their families

    International Nuclear Information System (INIS)

    Climate change is likely the most critical societal challenge to the futures of today's children. Mitigation will require a concerted effort to change household energy behaviour—electricity use, transportation and food consumption patterns. A first step to changing behaviour is to better understand current behaviour and its intrapersonal (knowledge and attitudes), interpersonal (norms, communication and behaviour) and contextual (demographics and geography) correlates. To date, our understanding of the energy behaviours of children is limited. To begin to fill this gap, we report the results of a survey on the electricity, transportation and food-related energy behaviours of 323 fourth- and fifth-grade girls and their parents in 31 Girl Scout troops in Northern California. Our findings show positive attitudes and perceived norms toward energy-saving behaviours among child and adult respondents, but low or moderate levels of knowledge, communication, and behaviour, particularly for behaviours that require adult assistance. Girls’ choices about electricity behaviours appear to be governed by intrapersonal and interpersonal influences, while transportation behaviour is constrained by geographic context. Food-related behaviour, particularly meat consumption, was not readily modelled. Policy and education-related implications for future interventions aimed at enhancing children's energy-saving behaviours are discussed. - Highlights: • We surveyed 323 fourth and fifth grade Girl Scouts and parents about energy behaviours. • We asked about electricity, transportation and food behaviour and its correlates. • Girls’ electricity behaviours are linked to intrapersonal and interpersonal influences. • Girls’ transportation behaviour is constrained by geographic context. • Girls’ food behaviour, particularly meat consumption, was not readily modelled

  2. SCOUT: a fast Monte-Carlo modeling tool of scintillation camera output

    Science.gov (United States)

    Hunter, William C. J.; Barrett, Harrison H.; Muzi, John P.; McDougald, Wendy; MacDonald, Lawrence R.; Miyaoka, Robert S.; Lewellen, Thomas K.

    2013-06-01

    We have developed a Monte-Carlo photon-tracking and readout simulator called SCOUT to study the stochastic behavior of signals output from a simplified rectangular scintillation-camera design. SCOUT models the salient processes affecting signal generation, transport, and readout of a scintillation camera. In this work, we compare output signal statistics from SCOUT to experimental results for both a discrete and a monolithic camera. We also benchmark the speed of this simulation tool and compare it to existing simulation tools. We find this modeling tool to be relatively fast and predictive of experimental results. Depending on the modeled camera geometry, we found SCOUT to be 4 to 140 times faster than other modeling tools.

  3. SCOUT: a fast Monte-Carlo modeling tool of scintillation camera output

    International Nuclear Information System (INIS)

    We have developed a Monte-Carlo photon-tracking and readout simulator called SCOUT to study the stochastic behavior of signals output from a simplified rectangular scintillation-camera design. SCOUT models the salient processes affecting signal generation, transport, and readout of a scintillation camera. In this work, we compare output signal statistics from SCOUT to experimental results for both a discrete and a monolithic camera. We also benchmark the speed of this simulation tool and compare it to existing simulation tools. We find this modeling tool to be relatively fast and predictive of experimental results. Depending on the modeled camera geometry, we found SCOUT to be 4 to 140 times faster than other modeling tools. (paper)

  4. Scout and Guides, Key Users of Astronomy & Planetary Sciences Outreach that Support Education

    Science.gov (United States)

    Brumfitt, A.; Thompson, L.

    Few people outside of the Scouting and Guide movement would appreciate that these world wide organisations have an active youth membership of over 40 million children and young adults. These two organisations rely on external specialist expert knowledge for the effective delivery of their education and award schemes. The high membership and established program delivery pathways make these organisations excellent vehicles for outreach programs. In particular Scouts and Guides are able to introduce astronomy and planetary sciences into their informal education programs at a timing that best suits the child and not one constrained by the schedule of formal education. It is the global voluntary nature of membership of these organisations that make them extremely effective learning vehicles. The members both youth and leader are highly motivated. These two organisations have a structured education program for youth members based on both individual pursuits or targets and group projects. The organisations has as part of their infra structure benchmarks for the measure of excellence in achievement and education at all levels. Scouts and Guides are a way of encompassing knowledge and lighting candles for life long learning. Scouts and guides address all year groups of formal education from primary through to tertiary levels, from cubs and brownies through various levels to Rovers and Rangers. Space is seen as relevant to Scouting and Guides, the Guide movement UK has recently adopted a "Go for it" challenge award for youth members to investigate space science. Similar awards exist in the Scouting movement in Europe, USA and Australia. The ready adoption of Space science fits well with scouting principles as Space is perceived as the "New Frontier of Discovery". In October 2007, Scouts and Guides from Europe will gather at Tidbinbilla deep space Tracking Station, Australia for the first Scout and Guide International Space Camp. The model used for this camp was based on a

  5. Social Talent Scouting: A New Opportunity for the Identification of Football Players?

    OpenAIRE

    Radicchi Elena; Mozzachiodi Michele

    2016-01-01

    This paper investigates the diffusion of digital technologies within the football talent scouting process. A qualitative exploration based on open discussions and unstructured interviews with professionals involved in the football system (coaches, scouts, players’ agents, etc.) provides insights about how new technologies are used for recruiting athletes. The findings, which are mainly in the context of Italian football, indicate a cultural and generational gap in the use of new digital tools...

  6. ProteomeScout: a repository and analysis resource for post-translational modifications and proteins

    OpenAIRE

    Matlock, Matthew K.; Holehouse, Alex S.; Kristen M Naegle

    2014-01-01

    ProteomeScout (https://proteomescout.wustl.edu) is a resource for the study of proteins and their post-translational modifications (PTMs) consisting of a database of PTMs, a repository for experimental data, an analysis suite for PTM experiments, and a tool for visualizing the relationships between complex protein annotations. The PTM database is a compendium of public PTM data, coupled with user-uploaded experimental data. ProteomeScout provides analysis tools for experimental datasets, incl...

  7. Evaluation of the Littoral Combat Ship (LCS) and SPARTAN SCOUT as Information Operations (IO) assets

    OpenAIRE

    Bromley, Joseph M.

    2005-01-01

    Approved for public release, distribution is unlimited This thesis will address the planned configuration of Lockheed Martin's Flight Zero, Module Spiral Alpha Littoral Combat Ship (LCS) and the ongoing development of the SPARTAN SCOUT, one of the Navy's Unmanned Surface Vessels (USV). Technology currently available as well as developmental technologies will be recommended for implementation in order to make the LCS and SCOUT assets to Information Operations (IO) objectives. Specific techn...

  8. Comparison of standardized clinical evaluation of wounds using ruler length by width and Scout length by width measure and Scout perimeter trace.

    Science.gov (United States)

    Langemo, Diane; Spahn, James; Spahn, Thomas; Pinnamaneni, V Chowdry

    2015-03-01

    The study objective was to examine precision in wound measurement using a recently Food and Drug Administration-approved Scout (WoundVision, LLC, Indianapolis, Indiana) device to measure wound length (L) and width (W). Wound perimeter and a ruler measurement of L and W were also made. Images of 40 actual patient wounds were measured using the Scout device. All 3 techniques (length, width, perimeter) demonstrated acceptable within and between reader precision; however, the best precision was in wound perimeter measurement. PMID:25679463

  9. Characterization of Genomic Variants Associated with Scout and Recruit Behavioral Castes in Honey Bees Using Whole-Genome Sequencing.

    Directory of Open Access Journals (Sweden)

    Bruce R Southey

    Full Text Available Among forager honey bees, scouts seek new resources and return to the colony, enlisting recruits to collect these resources. Differentially expressed genes between these behaviors and genetic variability in scouting phenotypes have been reported. Whole-genome sequencing of 44 Apis mellifera scouts and recruits was undertaken to detect variants and further understand the genetic architecture underlying the behavioral differences between scouts and recruits. The median coverage depth in recruits and scouts was 10.01 and 10.7 X, respectively. Representation of bacterial species among the unmapped reads reflected a more diverse microbiome in scouts than recruits. Overall, 1,412,705 polymorphic positions were analyzed for associations with scouting behavior, and 212 significant (p-value 1000 bp apart from each other. A number of these variants were mapped to ncRNA LOC100578102, solute carrier family 12 member 6-like gene, and LOC100576965 (meprin and TRAF-C homology domain containing gene. Functional categories represented among the genes corresponding to significant variants included: neuronal function, exoskeleton, immune response, salivary gland development, and enzymatic food processing. These categories offer a glimpse into the molecular support to the behaviors of scouts and recruits. The level of association between genomic variants and scouting behavior observed in this study may be linked to the honey bee's genomic plasticity and fluidity of transition between castes.

  10. Characterization of Genomic Variants Associated with Scout and Recruit Behavioral Castes in Honey Bees Using Whole-Genome Sequencing.

    Science.gov (United States)

    Southey, Bruce R; Zhu, Ping; Carr-Markell, Morgan K; Liang, Zhengzheng S; Zayed, Amro; Li, Ruiqiang; Robinson, Gene E; Rodriguez-Zas, Sandra L

    2016-01-01

    Among forager honey bees, scouts seek new resources and return to the colony, enlisting recruits to collect these resources. Differentially expressed genes between these behaviors and genetic variability in scouting phenotypes have been reported. Whole-genome sequencing of 44 Apis mellifera scouts and recruits was undertaken to detect variants and further understand the genetic architecture underlying the behavioral differences between scouts and recruits. The median coverage depth in recruits and scouts was 10.01 and 10.7 X, respectively. Representation of bacterial species among the unmapped reads reflected a more diverse microbiome in scouts than recruits. Overall, 1,412,705 polymorphic positions were analyzed for associations with scouting behavior, and 212 significant (p-value 1000 bp apart from each other. A number of these variants were mapped to ncRNA LOC100578102, solute carrier family 12 member 6-like gene, and LOC100576965 (meprin and TRAF-C homology domain containing gene). Functional categories represented among the genes corresponding to significant variants included: neuronal function, exoskeleton, immune response, salivary gland development, and enzymatic food processing. These categories offer a glimpse into the molecular support to the behaviors of scouts and recruits. The level of association between genomic variants and scouting behavior observed in this study may be linked to the honey bee's genomic plasticity and fluidity of transition between castes. PMID:26784945

  11. Concept for Mars Volcanic Emission Life Scout (3-D)

    Science.gov (United States)

    2004-01-01

    This artist's rendition depicts a concept for a Mars orbiter that would scrutinize the martian atmosphere for chemical traces of life or environments supportive of life that might be present anywhere on the planet. The illustration is presented as a three-dimensional stereo view. The concept is named the Mars Volcanic Emission and Life Scout, or Marvel. It would equip a Mars orbiter with two types of instruments proven useful in studying Earth's atmosphere from Earth orbit. One, a solar occultation infrared spectrometer, would look sideways through Mars' atmosphere toward the setting or rising Sun for an extremely sensitive reading of what chemicals are in the air that sunlight passes through before hitting the instrument. The other, a submillimeter spectrometer would survey the atmosphere continuously, including during dust storms and polar night, to seek localized surface sources of the chemicals of interest. The infrared spectrometer has very high sensitivity for one chemical of great interest: methane, which is produced by many types of microbes, as well as by some volcanic sources. The submillimeter spectrometer has very high sensitivity for water vapor. Localized concentrations of water vapor in the atmosphere could identify places where subsurface water sources may be venting.

  12. Data Scouting for Low-Mass Dijet Resonances

    CERN Document Server

    Thomas, Scott William

    2013-01-01

    We present the results of further investigation into a novel data analysis technique called "data scouting". This technique allows us probe below the lower dijet mass limit, which is imposed by bandwidth limitations on the high-level trigger (HLT) at large luminosities. By introducing a new trigger at HLT which runs a reduced version of the offline analysis and saves only a very small amount of data per event, we obtain a trigger rate approximately $10^3$ times larger than the corresponding rate for full event storage. After appropriate selection cuts, identifying each jet from this trigger with a corresponding jet reconstructed offline allows a direct comparison between jets. We find that the transverse momentum $p_t$ of the HLT jets is dependent on both the jet $p_t$ and on the pseudorapidity $\\eta$, and quantify this relationship by fitting a crystal ball function to the fractional difference for various combinations of $p_t$ and $\\eta$. This function can now be incorporated into the Monte Carlo simulation...

  13. Energy behaviours of northern California Girl Scouts and their families

    Energy Technology Data Exchange (ETDEWEB)

    Boudet, H; Ardoin, NM; Flora, J; Armel, KC; Desai, M; Robinson, TN

    2014-10-01

    Climate change is likely the most critical societal challenge to the futures of today's children. Mitigation will require a concerted effort to change household energy behaviour electricity use, transportation and food consumption patterns. A first step to changing behaviour is to better understand current behaviour and its intrapersonal (knowledge and attitudes), interpersonal (norms, communication and behaviour) and contextual (demographics and geography) correlates. To date, our understanding of the energy behaviours of children is limited. To begin to fill this gap, we report the results of a survey on the electricity, transportation and food-related energy behaviours of 323 fourth- and fifth-grade girls and their parents in 31 Girl Scout troops in Northern California. Our findings show positive attitudes and perceived norms toward energy-saving behaviours among child and adult respondents, but low or moderate levels of knowledge, communication, and behaviour, particularly for behaviours that require adult assistance. Girls' choices about electricity behaviours appear to be governed by intrapersonal and interpersonal influences, while transportation behaviour is constrained by geographic context. Food-related behaviour, particularly meat consumption, was not readily modelled. Policy and education-related implications for future interventions aimed at enhancing children's energy-saving behaviours are discussed. (C) 2014 Elsevier Ltd. All rights reserved.

  14. A careful evaluation of scout CT lateral radiograph may prevent unreported vertebral fractures

    International Nuclear Information System (INIS)

    Objectives: Our purpose was to review scout CT lateral radiographs to reveal osteoporotic vertebral fractures unreported by radiologists and to explore scout CT as a potential diagnostic tool in the detection of vertebral fractures. Methods: We considered 500 patients (303 males, 197 females, age 64.6 ± 13.5 year-old). Our investigation was firstly focused on scout CT lateral images to detect vertebral fractures with a combined semiquantitative and quantitative diagnostic approach. Findings addressed to vertebral fracture were subsequently confirmed by multiplanar sagittal CT reconstructions. Whenever a vertebral fracture was discovered the radiologist report was read and a collection of patient anamnesis followed to understand whether fractures were already known. Results: In 44/500 patients (8.8%) the evaluation on scout CT was incomplete or limited for patient/technical-based conditions, and 15 were excluded from the analysis. In 67/485 patients (13.8%) 99 vertebral fractures were detected. Among 67 fractured patients only 18 (26.9%) were previously diagnosed by radiologists. However, in the clinical history of 32 patients vertebral fractures were already known. Conclusions: The perception and sensibility to vertebral fractures among radiologists are still poor when the assessment of the spine is not the aim of the examination. Short time spent for the evaluation of scout CT lateral radiographs could improve our accuracy

  15. A careful evaluation of scout CT lateral radiograph may prevent unreported vertebral fractures

    Energy Technology Data Exchange (ETDEWEB)

    Bazzocchi, Alberto; Spinnato, Paolo [Imaging Division, Clinical Department of Radiological and Histocytopathological Sciences, University of Bologna, Sant’Orsola – Malpighi Hospital, Via Massarenti 9, 40138 Bologna (Italy); Albisinni, Ugo [Department of Radiology, Rizzoli Orthopaedic Institute, Via Pupilli 1, 40136 Bologna (Italy); Battista, Giuseppe [Imaging Division, Clinical Department of Radiological and Histocytopathological Sciences, University of Bologna, Sant’Orsola – Malpighi Hospital, Via Massarenti 9, 40138 Bologna (Italy); Rossi, Cristina [Section of Radiological Sciences, Department of Clinic Sciences, University of Parma, Via Gramsci 14, 43100 Parma (Italy); Guglielmi, Giuseppe, E-mail: g.guglielmi@unifg.it [Department of Radiology, University of Foggia, Viale Luigi Pinto 1, 71100 Foggia (Italy); Department of Radiology, Scientific Institute “Casa Sollievo della Sofferenza” Hospital, Viale Cappuccini 1, 71013 San Giovanni Rotondo, Foggia (Italy)

    2012-09-15

    Objectives: Our purpose was to review scout CT lateral radiographs to reveal osteoporotic vertebral fractures unreported by radiologists and to explore scout CT as a potential diagnostic tool in the detection of vertebral fractures. Methods: We considered 500 patients (303 males, 197 females, age 64.6 ± 13.5 year-old). Our investigation was firstly focused on scout CT lateral images to detect vertebral fractures with a combined semiquantitative and quantitative diagnostic approach. Findings addressed to vertebral fracture were subsequently confirmed by multiplanar sagittal CT reconstructions. Whenever a vertebral fracture was discovered the radiologist report was read and a collection of patient anamnesis followed to understand whether fractures were already known. Results: In 44/500 patients (8.8%) the evaluation on scout CT was incomplete or limited for patient/technical-based conditions, and 15 were excluded from the analysis. In 67/485 patients (13.8%) 99 vertebral fractures were detected. Among 67 fractured patients only 18 (26.9%) were previously diagnosed by radiologists. However, in the clinical history of 32 patients vertebral fractures were already known. Conclusions: The perception and sensibility to vertebral fractures among radiologists are still poor when the assessment of the spine is not the aim of the examination. Short time spent for the evaluation of scout CT lateral radiographs could improve our accuracy.

  16. EVALUASI PROGRAM TALENT SCOUTING GURU SMK TAHUN 2013 DIREKTORAT P2TK DIKMEN KEMDIKBUD

    Directory of Open Access Journals (Sweden)

    Roudlotus Sholikhah

    2014-11-01

    Full Text Available Penelitian ini bertujuan untuk mengetahui: (1 relevansi pelaksanaan Program Talent Scouting Guru SMK tahun 2013 ditinjau dari aspek konteks; (2 kesesuaian pelaksanaan Program Talent Scouting Guru SMK tahun 2013 ditinjau dari aspek input; (3 efektifitas pelaksanaan Program Talent Scouting Guru SMK tahun 2013 ditinjau dari aspek proses; dan (4 pencapaian hasil pelaksanaan Program Talent Scouting Guru SMK tahun 2013 ditinjau dari aspek produk. Jenis penilitian ini adalah evaluasi program dengan model evaluasi CIPP (Context, Input, Process, Product. Hasil penelitian: (1 pencapaian relevansi program termasuk dalam kategori “sangat relevan” dengan persentase pencapaian 85%; (2 kesesuaian input SMK sasaran program, peserta program dan penyelenggara program termasuk dalam kategori “sesuai” dengan persentase pencapaian 76,38%; (3 keefektifan proses sosialisasi, seleksi dan pembekalan, proses pelaksanaan program serta proses monitoring dan pelaporan termasuk dalam kategori “efektif” dengan persentase pencapaian 74,52%; (4 pencapaian produk teaching dan non teaching termasuk dalam kategori “sangat tercapai” dengan persentase pencapaian 84,35%.Kata kunci: Program Talent Scouting Guru SMK, Evaluasi, CIPP.

  17. iScout low cost UGS system: overview of enhancements and performance characterization

    Science.gov (United States)

    Winston, Mark; Klug, Rob; Plummer, Thomas; Knobler, Ron

    2008-04-01

    McQ developed for the U.S. Army Research Laboratory (ARL) a very low-cost iScout® sensor system for detecting people in buildings and caves after military clearing operations to prevent their reuse by adversaries. The mission applications have expanded to include typical field operations such as Force Protection and facility security. To meet a broader mission capability, McQ significantly enhanced the performance of the iScout® Unattended Ground Sensor (UGS) system. The enhanced performance includes improvements to the seismic, acoustic, magnetic, and passive infrared sensor processing algorithms and multimodal fusion to improve target classification. Additional features are a new radio frequency (RF) network architecture, built-in global positioning system (GPS) for automatic sensor position reporting, a new rugged watertight case, and an extremely low power consumption electronics design. McQ will describe these enhancements and present data characterizing the performance of the enhanced iScout® sensors.

  18. iScout low-cost ad-hoc networked sensor enhancements

    Science.gov (United States)

    Winston, Mark A.

    2007-04-01

    McQ has developed a family of state of the art miniaturized low cost unattended ground sensors (UGS). The iScout TM sensors are designed for indoor and outdoor intrusion detection and battle damage assessment. McQ has developed an enhanced version of the iScout TM sensor that is a very flexible platform capable of performing in a variety of applications. Sensors are equipped with mesh radios and integrated seismic, acoustic, infrared, and magnetic transducers. Typical sensor sizes are similar to that of a deck of playing cards. Intended for high volume production, these are tactically useful sensors that can be manufactured in high volumes at a low cost. This paper will provide an overview of the iScout TM sensor systems, features, and performance.

  19. Organ dose calculation in CT based on scout image data and automatic image registration

    Energy Technology Data Exchange (ETDEWEB)

    Kortesniemi, Mika; Salli, Eero; Seuri, Raija [HUS Helsinki Medical Imaging Center, Univ. of Helsinki, Helsinki (Finland)], E-mail: mika.kortesniemi@hus.fi

    2012-10-15

    Background Computed tomography (CT) has become the main contributor of the cumulative radiation exposure in radiology. Information on cumulative exposure history of the patient should be available for efficient management of radiation exposures and for radiological justification. Purpose To develop and evaluate automatic image registration for organ dose calculation in CT. Material and Methods Planning radiograph (scout) image data describing CT scan ranges from 15 thoracic CT examinations (9 men and 6 women) and 10 abdominal CT examinations (6 men and 4 women) were co-registered with the reference trunk CT scout image. 2-D affine transformation and normalized correlation metric was used for image registration. Longitudinal (z-axis) scan range coordinates on the reference scout image were converted into slice locations on the CT-Expo anthropomorphic male and female models, following organ and effective dose calculations. Results The average deviation of z-location of studied patient images from the corresponding location in the reference scout image was 6.2 mm. The ranges of organ and effective doses with constant exposure parameters were from 0 to 28.0 mGy and from 7.3 to 14.5 mSv, respectively. The mean deviation of the doses for fully irradiated organs (inside the scan range), partially irradiated organs and non-irradiated organs (outside the scan range) was 1%, 5%, and 22%, respectively, due to image registration. Conclusion The automated image processing method to registrate individual chest and abdominal CT scout radiograph with the reference scout radiograph is feasible. It can be used to determine the individual scan range coordinates in z-direction to calculate the organ dose values. The presented method could be utilized in automatic organ dose calculation in CT for radiation exposure tracking of the patients.

  20. Scout: An Impact Analysis Tool for Building Energy-Efficiency Technologies

    Energy Technology Data Exchange (ETDEWEB)

    Harris, Chioke; Langevin, Jared; Roth, Amir; Phelan, Patrick; Parker, Andrew; Ball, Brian; Brackney, Larry

    2016-08-26

    Evaluating the national impacts of candidate U.S. building energy-efficiency technologies has historically been difficult for organizations with large energy efficiency portfolios. In particular, normalizing results from technology-specific impact studies is time-consuming when those studies do not use comparable assumptions about the underlying building stock. To equitably evaluate its technology research, development, and deployment portfolio, the U.S. Department of Energy's Building Technologies Office has developed Scout, a software tool that quantitatively assesses the energy and CO2 impacts of building energy-efficiency measures on the national building stock. Scout efficiency measures improve upon the unit performance and/or lifetime operational costs of an equipment stock baseline that is determined from the U.S. Energy Information Administration Annual Energy Outlook (AEO). Scout measures are characterized by a market entry and exit year, unit performance level, cost, and lifetime. To evaluate measures on a consistent basis, Scout uses EnergyPlus simulation on prototype building models to translate measure performance specifications to whole-building energy savings; these savings impacts are then extended to a national scale using floor area weighting factors. Scout represents evolution in the building stock over time using AEO projections for new construction, retrofit, and equipment replacements, and competes technologies within market segments under multiple adoption scenarios. Scout and its efficiency measures are open-source, as is the EnergyPlus whole building simulation framework that is used to evaluate measure performance. The program is currently under active development and will be formally released once an initial set of measures has been analyzed and reviewed.

  1. Organ dose calculation in CT based on scout image data and automatic image registration

    International Nuclear Information System (INIS)

    Background Computed tomography (CT) has become the main contributor of the cumulative radiation exposure in radiology. Information on cumulative exposure history of the patient should be available for efficient management of radiation exposures and for radiological justification. Purpose To develop and evaluate automatic image registration for organ dose calculation in CT. Material and Methods Planning radiograph (scout) image data describing CT scan ranges from 15 thoracic CT examinations (9 men and 6 women) and 10 abdominal CT examinations (6 men and 4 women) were co-registered with the reference trunk CT scout image. 2-D affine transformation and normalized correlation metric was used for image registration. Longitudinal (z-axis) scan range coordinates on the reference scout image were converted into slice locations on the CT-Expo anthropomorphic male and female models, following organ and effective dose calculations. Results The average deviation of z-location of studied patient images from the corresponding location in the reference scout image was 6.2 mm. The ranges of organ and effective doses with constant exposure parameters were from 0 to 28.0 mGy and from 7.3 to 14.5 mSv, respectively. The mean deviation of the doses for fully irradiated organs (inside the scan range), partially irradiated organs and non-irradiated organs (outside the scan range) was 1%, 5%, and 22%, respectively, due to image registration. Conclusion The automated image processing method to registrate individual chest and abdominal CT scout radiograph with the reference scout radiograph is feasible. It can be used to determine the individual scan range coordinates in z-direction to calculate the organ dose values. The presented method could be utilized in automatic organ dose calculation in CT for radiation exposure tracking of the patients

  2. Social Talent Scouting: A New Opportunity for the Identification of Football Players?

    Directory of Open Access Journals (Sweden)

    Radicchi Elena

    2016-06-01

    Full Text Available This paper investigates the diffusion of digital technologies within the football talent scouting process. A qualitative exploration based on open discussions and unstructured interviews with professionals involved in the football system (coaches, scouts, players’ agents, etc. provides insights about how new technologies are used for recruiting athletes. The findings, which are mainly in the context of Italian football, indicate a cultural and generational gap in the use of new digital tools that creates a mismatch between young promising athletes (demand side and “senior” team professionals (supply side.

  3. Den upproriska skötsamheten : Att vara ung och scout

    OpenAIRE

    Westberg, Anna

    2007-01-01

    The aim of this thesis is to describe children’s own perspectives on being scouts and to describe the scout movement as a cultural phenomenon. The thesis is based on interviews with 34 members of the movement and studies of archive material and contemporary documents. It is also based on a social constructivist view of knowledge. The results show that the movement seems to lack profile and is decentralised and secularised from the children’s point of view. They say that the movement’s history...

  4. MTD(f), A Minimax Algorithm Faster Than NegaScout

    OpenAIRE

    Plaat, Aske

    2014-01-01

    MTD(f) is a new minimax search algorithm, simpler and more efficient than previous algorithms. In tests with a number of tournament game playing programs for chess, checkers and Othello it performed better, on average, than NegaScout/PVS (the AlphaBeta variant used in practically all good chess, checkers, and Othello programs). One of the strongest chess programs of the moment, MIT's parallel chess program Cilkchess uses MTD(f) as its search algorithm, replacing NegaScout, which was used in S...

  5. Citizenship and Children's Identity in "The Wonderful Adventures of Nils" and "Scouting for Boys"

    Science.gov (United States)

    Sundmark, Bjorn

    2009-01-01

    "The Wonderful Adventures of Nils" (1906-1907) by Selma Lagerlof and "Scouting for Boys" (1908) by Robert Baden-Powell are characteristic of their time and their respective national and cultural contexts--the Swedish nation state of the early twentieth century and the British Empire. Taking its cue from recent theories on citizenship and…

  6. OpenScout: Competence based management education with community-improved open educational resources

    OpenAIRE

    Kalz, Marco

    2010-01-01

    Kalz, M. (2010, 9-11 June). OpenScout: Competence based management education with community-improved open educational resources. Presentation provided during the Edineb Conference 2010 - Advances in Business Education and Training: Crossing borders in Education and Work-based Learning, London, UK: Thames Valley University. Want to embed these slides? Look here: http://slidesha.re/b7po0R

  7. Effects of Goal Setting on Dietary and Physical Activity Changes in the Boy Scout Badge Projects

    Science.gov (United States)

    Latif, Hira; Watson, Kathy; Nguyen, Nga; Thompson, Debbe; Baranowski, Janice; Jago, Russell; Cullen, Karen W.; Baranowski, Tom

    2011-01-01

    Background: This study evaluates the relationship of goal setting to low-fat vegetable (LV) and fruit/100% juice (FJ) consumption and physical activity (PA) change. Methods: A total of 473 10- to 14-year-old Boy Scouts from Houston took part in a 9-week intervention. A two-group (LV and FJ or PA) intervention design was used with each group…

  8. Assessment of Prosocial-Altruistic Behavior of Members and Non-Members of the Scout Movement

    Science.gov (United States)

    Ruiz-Olivares, Rosario; Pino, M. Jose; Herruzo, Javier

    2013-01-01

    The aim of this study is to evaluate the differences in prosocial altruistic behavior between children and young students who belong to the scout movement and those who do not belong to this or any other similar movement. The prosocial altruistic behavior has been assessed with questionnaires for the school: self-evaluation, teacher, classmate,…

  9. 76 FR 71564 - ScanScout, Inc.; Analysis of Proposed Consent Order To Aid Public Comment

    Science.gov (United States)

    2011-11-18

    ... were false or misleading. Part I of the proposed order prohibits ScanScout \\2\\ from misrepresenting (1... effectuate the consumer's opt out choice or to limit the number of times an advertisement is displayed. \\2... advertisement that the company serves, it must include a hyperlink that takes users directly to the...

  10. Leadership Skills Training for Youths through the Exploring Program of Boy Scouts of America.

    Science.gov (United States)

    Geiger, Brian F.; Willis, A. Sandra

    This paper describes the Leadership Opportunity Forums for high school students sponsored by the Explorer's Post of the Birmingham Area Council of the Boy Scouts of America. The goal of the forum was to increase student leadership behaviors through informational sessions, needs assessment, informal discussions, shared meals, outdoor physical…

  11. OpenScout: Competence based management education with community-improved open educational resources

    NARCIS (Netherlands)

    Kalz, Marco

    2010-01-01

    Kalz, M. (2010, 9-11 June). OpenScout: Competence based management education with community-improved open educational resources. Presentation provided during the Edineb Conference 2010 - Advances in Business Education and Training: Crossing borders in Education and Work-based Learning, London, UK: T

  12. Scout Rover Applications for Forward Acquisition of Soil and Terrain Data

    Science.gov (United States)

    Sonsalla, R.; Ahmed, M.; Fritsche, M.; Akpo, J.; Voegele, T.

    2014-04-01

    As opposed to the present mars exploration missions future mission concepts ask for a fast and safe traverse through vast and varied expanses of terrain. As seen during the Mars Exploration Rover (MER) mission the rovers suffered a lack of detailed soil and terrain information which caused Spirit to get permanently stuck in soft soil. The goal of the FASTER1 EU-FP7 project is to improve the mission safety and the effective traverse speed for planetary rover exploration by determining the traversability of the terrain and lowering the risk to enter hazardous areas. To achieve these goals, a scout rover will be used for soil and terrain sensing ahead of the main rover. This paper describes a highly mobile, and versatile micro scout rover that is used for soil and terrain sensing and is able to co-operate with a primary rover as part of the FASTER approach. The general reference mission idea and concept is addressed within this paper along with top-level requirements derived from the proposed ESA/NASA Mars Sample Return mission (MSR) [4]. Following the mission concept and requirements [3], a concept study for scout rover design and operations has been performed [5]. Based on this study the baseline for the Coyote II rover was designed and built as shown in Figure 1. Coyote II is equipped with a novel locomotion concept, providing high all terrain mobility and allowing to perform side-to-side steering maneuvers which reduce the soil disturbance as compared to common skid steering [6]. The rover serves as test platform for various scout rover application tests ranging from locomotion testing to dual rover operations. From the lessons learned from Coyote II and for an enhanced design, a second generation rover (namely Coyote III) as shown in Figure 2 is being built. This rover serves as scout rover platform for the envisaged FASTER proof of concept field trials. The rover design is based on the test results gained by the Coyote II trials. Coyote III is equipped with two

  13. Trails, Other, scouts trail districts, Published in 2006, 1:24000 (1in=2000ft) scale, Tooele County.

    Data.gov (United States)

    NSGIC GIS Inventory (aka Ramona) — This Trails, Other dataset, published at 1:24000 (1in=2000ft) scale, was produced all or in part from Other information as of 2006. It is described as 'scouts trail...

  14. Trails, Other, scouts trail districts poly, Published in 2006, 1:24000 (1in=2000ft) scale, Tooele County.

    Data.gov (United States)

    NSGIC GIS Inventory (aka Ramona) — This Trails, Other dataset, published at 1:24000 (1in=2000ft) scale, was produced all or in part from Other information as of 2006. It is described as 'scouts trail...

  15. Will the integration of a Girl Scout STEM workshop improve the interest and confidence of underserved millenial students in STEM?

    Science.gov (United States)

    Mayberry, Jestine

    This study addressed how the impact of Girl Scout workshop would improve the interest and confidence of millennial students in Science, Technology, Engineering, and Math (STEM) careers. This study sought to determine if a three-week Girl Scout curriculum would impact urban female students' interest in STEM, confidence in science, and motivation to pursue STEM careers. The curriculum included hands-on STEM activities along with a guest speaker. The Girl Scouts completed the Test of Science-Related Attitudes (TOSRA) to determine their attitude toward science. Girl Scouts, parents, and troop leaders completed a post-workshop survey based on their experience. Chi Square tests, frequencies, and an ANOVA were run to analyze the results, which indicated an increase in interest and confidence.

  16. NEA Scout and Lunar Flashlight: Two NearTerm Interplanetary CubeSat Missions

    Science.gov (United States)

    Johnson, Les

    2015-01-01

    NASA is developing two small satellite missions as part of the Advanced Exploration Systems (AES) Program, both of which will use a solar sail to enable their scientific objectives. Solar sails reflect sunlight from a large, mirror-like sail made of a lightweight, highly reflective material to provide thrust. This continuous photon pressure provides propellantless thrust, allowing for very high delta V maneuvers in space. Lunar Flashlight, managed by the NASA Jet Propulsion Laboratory, will search for and map volatiles in permanently shadowed lunar craters using a solar sail as a gigantic mirror to steer sunlight into them, then examine the reflected light with a spectrometer. The Lunar Flashlight spacecraft will also use the solar sail to maneuver into a lunar polar orbit. The mission will demonstrate a low-cost capability to explore, locate and estimate the size and composition of ice deposits on the Moon. The Near Earth Asteroid (NEA) Scout mission, managed by the NASA Marshall Space Flight Center will survey and image a Near Earth Asteroid for possible future human exploration using a smallsat propelled by a solar sail. Detections of NEAs are expected to grow in the near future, offering increasing target opportunities. Obtaining and analyzing relevant data about these bodies via robotic precursors before committing a crew to visit them is essential. The NEA Scout spacecraft is nearly identical to the one being developed for Lunar Flashlight, with the science instrument package being the primary difference. The NEA Scout solar sail will provide the primary propulsion taking the 6U cubesat from near the Earth to its final asteroid destination and the Lunar Flashlight sail will provide the propulsion necessary for its spacecraft to enter lunar orbit. Both projects will use an 85 m2 solar sail developed by NASA MSFC. The NEA Scout and Lunar Flashlight flight systems are based on a 6U cubesat form factor, with a stowed envelope of 10 x 20 x 30 cm and a mass of less

  17. An operational manpower analysis of the RQ-8 Fire Scout Vertical Take-Off Unmanned Aerial Vehicle (VTUAV)

    OpenAIRE

    Stracker, Matthew C.

    2007-01-01

    In August of 2001 the Secretary of the Navy announced the Navy would expand the work and experimentation in unmanned vehicle systems. After the events of September 11 this was accelerated with the increased urgency to combat terrorism and asymmetric threats. The U.S. Navy is currently undergoing testing and evaluation of the Fire Scout Vertical Take-Off Unmanned Aerial Vehicle (VTUAV) and its integration into the fleet. An in depth analysis of the Fire Scout's manpower requirements is necessa...

  18. Exploration and exploitation of food sources by social insect colonies: a revision of the scout-recruit concept

    OpenAIRE

    Biesmeijer, J.C.; de Vries, Han

    2001-01-01

    Social insect colonies need to explore and exploit multiple food sources simultaneously and efficiently. At the individual level, this colony-level behaviour has been thought to be taken care of by two types of individual: scouts that independently search for food, and recruits that are directed by nest mates to a food source. However, recent analyses show that this strict division of labour between scouts and recruits is untenable. Therefore, a modified concept is presented here that compris...

  19. A Cost Benefit Analysis of Fire Scout Vertical Takeoff and Landing Tactical Unmanned Aerial Vehicle (VTUAV) Operator Alternatives

    OpenAIRE

    Heiss, Kevin L.

    2012-01-01

    A cultural debate exists to determine if the MQ-8B Fire Scout Vertical Takeoff and Landing Tactical Unmanned Aerial Vehicle (VTUAV) should be operated by rated pilots, commissioned officers, or enlisted personnel. Each military service has historically treated this issue differently. The U.S. Navy currently requires rated pilots to fly Fire Scout, the U.S. Army and Marine Corps allow enlisted personnel to fly their Shadow Unmanned Aerial Vehicle (UAV), and the Air Force only allows rated pilo...

  20. The Scout Report Signpost因特网编目分析研究%The Scout Report Signpost:an Analysis of the Cataloging of Internet Resources

    Institute of Scientific and Technical Information of China (English)

    潘燕桃

    2000-01-01

    The Scout Repon Signpost(SRS)是利用现有的分类主题工具,采用题名、主要URL、评述日期、责任说明等13个项目对因特网资源进行编目的成功例证.举例分析了13个著录项目,指出目前仍然存在缺乏标准权威的编目规则,难以确定日期信息等问题.参考文献12.

  1. A group-randomized controlled trial for health promotion in Girl Scouts: Healthier Troops in a SNAP (Scouting Nutrition & Activity Program

    Directory of Open Access Journals (Sweden)

    Behrens Timothy K

    2010-02-01

    Full Text Available Abstract Background Girl Scouting may offer a viable channel for health promotion and obesity prevention programs. This study evaluated the effectiveness of an intervention program delivered through Girl Scout Junior troops that was designed to foster healthful troop meeting environments and increase obesity prevention behaviors at home. Methods Seven Girl Scout troops were randomized to intervention (n = 3, with 34 girls or standard-care control (n = 4, with 42 girls conditions. Girls ranged in age from 9 to 13 years (mean 10.5 years. Intervention troop leaders were trained to implement policies promoting physical activity (PA and healthful eating opportunities at troop meetings, and to implement a curriculum promoting obesity-prevention behaviors at home. The primary outcome variable was child body mass index (BMI z-score. Secondary outcomes included accelerometer-assessed PA levels in troop meetings, direct observations of snack offerings, time spent in physically active meeting content, and leader encouragement of PA and healthful eating. Results The intervention was delivered with good fidelity, and intervention troops provided greater opportunities for healthful eating and PA (x2 = 210.8, p 2 = 23.46, p 2 = 18.14, p 2 = 9.63, p = .002 compared to control troop leaders. Most effects of the intervention on individual-level variables of girls and parents were not significantly different from the control condition, including the primary outcome of child BMI z-score (F1, 5 = 0.42, p = .544, parent BMI (F1, 5 = 1.58, p = .264, and related behavioral variables. The notable exception was for objectively assessed troop PA, wherein girls in intervention troops accumulated significantly less sedentary (x2 = 6.3, p = .011, significantly more moderate (x2 = 8.2, p = .004, and more moderate-to-vigorous physical activity, (x2 = 18.4, p Conclusions Implementing a health promotion curriculum and supporting policies to provide more healthful environments in

  2. El scouting como método de observación en el baloncesto

    OpenAIRE

    Antia Martín-Carrillo, Aitor

    2014-01-01

    En el mundo del deporte profesional, hoy en día, la información es poder. Cuanta más información logremos obtener sobre los rivales, más fácil será preparar los enfrentamientos y salir victoriosos de ellos. El estudio de las virtudes y carencias del rival se define mediante un término anglosajón scouting y ha conseguido que se convierta en una palabra muy familiar en el baloncesto actual. El scouting no es más ni menos que la observación sistemática del juego. Este método estructura la inform...

  3. Outbreak of leptospirosis during a scout camp in the Luxembourg Belgian province, Belgium, summer 2012.

    Science.gov (United States)

    Mori, M; VAN Esbroeck, M; Depoorter, S; Decaluwe, W; Vandecasteele, S J; Fretin, D; Reynders, M

    2015-06-01

    An outbreak of leptospirosis occurred in the South of Belgium, during August 2012, in teenagers who participated in two consecutive adventure scout camps near the Semois river. Among the symptomatic patient population (ten scouts), clinical manifestations included headache (70%), myalgia (50%), fever (50%), bilateral conjunctival injection (50%), general malaise (30%), vomiting (20%), anorexia (20%) and cough (20%). Some of the cases presented elevated blood creatinine (40%), or proteinuria (30%). Three patients were confirmed by serology and one by polymerase chain reaction. Potential risk factors included direct contact with a muskrat and indirect contact with potentially contaminated environments including the river water. Prospective environmental investigation carried out near the river banks 2 weeks after the outbreak identified Ondatra zibethicus (muskrat) as one Leptospira sp. reservoir. PMID:25311398

  4. Discrete Particle Swarm Optimization with Scout Particles for Library Materials Acquisition

    Directory of Open Access Journals (Sweden)

    Yi-Ling Wu

    2013-01-01

    Full Text Available Materials acquisition is one of the critical challenges faced by academic libraries. This paper presents an integer programming model of the studied problem by considering how to select materials in order to maximize the average preference and the budget execution rate under some practical restrictions including departmental budget, limitation of the number of materials in each category and each language. To tackle the constrained problem, we propose a discrete particle swarm optimization (DPSO with scout particles, where each particle, represented as a binary matrix, corresponds to a candidate solution to the problem. An initialization algorithm and a penalty function are designed to cope with the constraints, and the scout particles are employed to enhance the exploration within the solution space. To demonstrate the effectiveness and efficiency of the proposed DPSO, a series of computational experiments are designed and conducted. The results are statistically analyzed, and it is evinced that the proposed DPSO is an effective approach for the studied problem.

  5. Birth Order and its Effect on the Attainment of The Eagle Scout Status

    OpenAIRE

    Moesser, Kevin Randy

    1980-01-01

    The effects of birth order on achievement have been under investigation continually resulting in reported prominence of first born children in various areas of achievement. The purpose of this study was to provide further investigation into the effects of birth order on the achievement hypothesis using the attainment of the Eagle Scout Award as the dependent variable. Five hypotheses were formulated from a review of literature which included: (1) boys in the first born position are more likel...

  6. Comparison of Computed Tomography Scout Based Reference Point Localization to Conventional Film and Axial Computed Tomography

    International Nuclear Information System (INIS)

    Identification of source positions after implantation is an important step in brachytherapy planning. Reconstruction is traditionally performed from films taken by conventional simulators, but these are gradually being replaced in the clinic by computed tomography (CT) simulators. The present study explored the use of a scout image–based reconstruction algorithm that replaces the use of traditional film, while exhibiting low sensitivity to metal-induced artifacts that can appear in 3D CT methods. In addition, the accuracy of an in-house graphical software implementation of scout-based reconstruction was compared with seed location reconstructions for 2 phantoms by conventional simulator and CT measurements. One phantom was constructed using a planar fixed grid of 1.5-mm diameter ball bearings (BBs) with 40-mm spacing. The second was a Fletcher-Suit applicator embedded in Styrofoam (Dow Chemical Co., Midland, MI) with one 3.2-mm-diameter BB inserted into each of 6 surrounding holes. Conventional simulator, kilovoltage CT (kVCT), megavoltage CT, and scout-based methods were evaluated by their ability to calculate the distance between seeds (40 mm for the fixed grid, 30–120 mm in Fletcher-Suit). All methods were able to reconstruct the fixed grid distances with an average deviation of <1%. The worst single deviations (approximately 6%) were exhibited in the 2 volumetric CT methods. In the Fletcher-Suit phantom, the intermodality agreement was within approximately 3%, with the conventional sim measuring marginally larger distances, with kVCT the smallest. All of the established reconstruction methods exhibited similar abilities to detect the distances between BBs. The 3D CT-based methods, with lower axial resolution, showed more variation, particularly with the smaller BBs. With a software implementation, scout-based reconstruction is an appealing approach because it simplifies data acquisition over film-based reconstruction without requiring any specialized

  7. Acquisition, preprocessing, and reconstruction of ultralow dose volumetric CT scout for organ-based CT scan planning

    International Nuclear Information System (INIS)

    Purpose: Traditionally, 2D radiographic preparatory scan images (scout scans) are used to plan diagnostic CT scans. However, a 3D CT volume with a full 3D organ segmentation map could provide superior information for customized scan planning and other purposes. A practical challenge is to design the volumetric scout acquisition and processing steps to provide good image quality (at least good enough to enable 3D organ segmentation) while delivering a radiation dose similar to that of the conventional 2D scout. Methods: The authors explored various acquisition methods, scan parameters, postprocessing methods, and reconstruction methods through simulation and cadaver data studies to achieve an ultralow dose 3D scout while simultaneously reducing the noise and maintaining the edge strength around the target organ. Results: In a simulation study, the 3D scout with the proposed acquisition, preprocessing, and reconstruction strategy provided a similar level of organ segmentation capability as a traditional 240 mAs diagnostic scan, based on noise and normalized edge strength metrics. At the same time, the proposed approach delivers only 1.25% of the dose of a traditional scan. In a cadaver study, the authors’ pictorial-structures based organ localization algorithm successfully located the major abdominal-thoracic organs from the ultralow dose 3D scout obtained with the proposed strategy. Conclusions: The authors demonstrated that images with a similar degree of segmentation capability (interpretability) as conventional dose CT scans can be achieved with an ultralow dose 3D scout acquisition and suitable postprocessing. Furthermore, the authors applied these techniques to real cadaver CT scans with a CTDI dose level of less than 0.1 mGy and successfully generated a 3D organ localization map

  8. Acquisition, preprocessing, and reconstruction of ultralow dose volumetric CT scout for organ-based CT scan planning

    Energy Technology Data Exchange (ETDEWEB)

    Yin, Zhye, E-mail: yin@ge.com; De Man, Bruno [Image Reconstruction Laboratory, GE Global Research, Niskayuna, New York 12309 (United States); Yao, Yangyang; Wu, Mingye [X-ray and CT Laboratory, GE Global Research, Shanghai 201203 (China); Montillo, Albert [Biomedical Image Processing Laboratory, GE Global Research, Niskayuna, New York 12309 (United States); Edic, Peter M. [CT, X-ray and Functional Imaging, GE Global Research, Niskayuna, New York 12309 (United States); Kalra, Mannudeep [Thoracic and Cardiac Imaging, Massachusetts General Hospital, Boston, Massachusetts 02114 (United States)

    2015-05-15

    Purpose: Traditionally, 2D radiographic preparatory scan images (scout scans) are used to plan diagnostic CT scans. However, a 3D CT volume with a full 3D organ segmentation map could provide superior information for customized scan planning and other purposes. A practical challenge is to design the volumetric scout acquisition and processing steps to provide good image quality (at least good enough to enable 3D organ segmentation) while delivering a radiation dose similar to that of the conventional 2D scout. Methods: The authors explored various acquisition methods, scan parameters, postprocessing methods, and reconstruction methods through simulation and cadaver data studies to achieve an ultralow dose 3D scout while simultaneously reducing the noise and maintaining the edge strength around the target organ. Results: In a simulation study, the 3D scout with the proposed acquisition, preprocessing, and reconstruction strategy provided a similar level of organ segmentation capability as a traditional 240 mAs diagnostic scan, based on noise and normalized edge strength metrics. At the same time, the proposed approach delivers only 1.25% of the dose of a traditional scan. In a cadaver study, the authors’ pictorial-structures based organ localization algorithm successfully located the major abdominal-thoracic organs from the ultralow dose 3D scout obtained with the proposed strategy. Conclusions: The authors demonstrated that images with a similar degree of segmentation capability (interpretability) as conventional dose CT scans can be achieved with an ultralow dose 3D scout acquisition and suitable postprocessing. Furthermore, the authors applied these techniques to real cadaver CT scans with a CTDI dose level of less than 0.1 mGy and successfully generated a 3D organ localization map.

  9. Eye redness

    Science.gov (United States)

    Bloodshot eyes; Red eyes; Scleral infection; Conjunctival infection ... There are many causes of a red eye or eyes. Some are medical emergencies and some are a cause for concern, but not an emergency. Others are nothing to worry about. ...

  10. Great Scouts! CyberGuides for Subject Searching on the Web. Discover the Internet That Speaks to Your Specific Information Needs.

    Science.gov (United States)

    Paul, Nora; Williams, Margot; Hane, Paula, J., Ed.

    This guide profiles the best of the Internet's "scout sites"--Web sites that provide access to the most important online sources of information on specific subjects. Scout sites act as Web directories, offering researchers an alternative to search engines by providing organized collections of links to the most appropriate and useful Web sites for…

  11. Early response to sibutramine in patients not meeting current label criteria: preliminary analysis of SCOUT lead-in period

    DEFF Research Database (Denmark)

    Caterson, Ian; Coutinho, Walmir; Finer, Nick;

    2010-01-01

    with sibutramine confirms its good tolerability and efficacy in patients who meet current label criteria. Preliminary data from high-risk patients for whom sibutramine is currently contraindicated suggest a low discontinuation rate and few serious adverse events but confirmation from the SCOUT outcome data......The Sibutramine Cardiovascular Outcomes (SCOUT) trial protocol defines a patient population predominantly outside current European Union label criteria. This article explores responses to sibutramine during the 6-week, single-blind, lead-in period between patients who conformed to the label...... requirements ("conformers") and those who did not ("nonconformers"). SCOUT is an ongoing, randomized, double-blind, placebo-controlled outcome trial in overweight/obese patients at high risk of a cardiovascular event. In total, 10,742 patients received sibutramine and weight management during the lead...

  12. Scout: short-arc orbit analysis and hazard assessment for newly discovered asteroids

    Science.gov (United States)

    Farnocchia, Davide; Chesley, Steven R.; Micheli, Marco

    2016-05-01

    It typically takes a few days for a newly discovered asteroid to be officially recognized as a real object. This time is needed to collect additional data and make sure the observations belong to an actual asteroid rather than being an artifact or corresponding to an artificial object. However, asteroids could experience an Earth close approach or even an impact only a few days or less after the discovery observations, as in the cases of 2008 TC3 and 2014 AA, i.e., the only two asteroids discovered before an Earth impact. In such cases, a rapid identification of the close approach or impact dramatically improves the chances of securing the asteroid's trajectory with additional observations prior to impact. Scout is an automated system that provides an orbital and hazard assessment for new potential asteroid discoveries within minutes after the observations are available. Since the time interval covered by the observations is generally short, perhaps only a few hours or even less, there are severe degeneracies in the orbit estimation process. To overcome these degeneracies Scout relies on systematic ranging, a technique that scans the poorly constrained space of topocentric range and range rate, while the plane-of-sky position and motion are directly tied to the recorded observations. This scan allows us to identify the possible orbits and the regions corresponding to collision solutions, as well as potential impact times and locations. From the probability distribution of the observation errors, Scout derives a probability distribution in the orbital space and in turn estimates several metrics of interest, e.g., probability of an Earth impact, of a close approach to Earth, and of being a mission-accessible target.

  13. Report of scouting study on precipitation of strontium, plutonium, and americium from Hanford complexant concentrate waste

    International Nuclear Information System (INIS)

    A laboratory scouting test was conducted of precipitation methods for reducing the solubility of radionuclides in complexant concentrate (CC) waste solution. The results show that addition of strontium nitrate solution is effective in reducing the liquid phase activity of 90Sr (Strontium) in CC waste from tank 107-AN by 94% when the total strontium concentration is adjusted to 0.1 M. Addition of ferric nitrate solution effective in reducing the 241Am (Americium) activity in CC waste by 96% under the conditions described in the report. Ferric nitrate was also marginally effective in reducing the solubility of 239/240Pu (Plutonium) in CC waste

  14. Diary of a National Scout. P. J. du Toit 1900-1902.

    Directory of Open Access Journals (Sweden)

    Jan Ploeger

    2012-02-01

    Full Text Available This book is the second in the new series of works edited and published by the Institute for Historical Research of the Human Sciences Research Council under direction of Dr C. M. Bakkes. The first book, Die Dagboek van H. C. Bredell, cast new light on President Kruger's years in exile; in the new publication some insight is given into the tensions and struggles in the mind of the writer, who orginally fought with the Boers but later went over to the British and actively supported them as a National Scout.

  15. Automated material map generation from MRI scout pairs for preclinical PET attenuation correction

    OpenAIRE

    Bandi, P.; Zsoter, N.; Koncz, P.; Babos, M.; Hobor, S*; Mathe, D.; Papp, L.

    2012-01-01

    A novel method is presented to perform material map segmentation from preclinical MRI for corresponding PET attenuation correction. MRI does not provide attenuation ratio, hence segmenting a material map from it is challenging. Furthermore the MRI images often suffer from ghost artifacts. On the contrary MRI has no radiation dose. Our method operated with fast spin echo scout pairs that had perpendicular frequency directions. This way the direction of the gh...

  16. Assessing the suitability of GIS as an aid for Location Scouting in Low-Budget Filmmaking

    OpenAIRE

    Fuller, Callum

    2010-01-01

    The purpose of this analysis was to assess the suitability of GIS as an aid for location scouting in low-budget filmmaking, with Edinburgh serving as the target area. The main aspect of the project was to create a web based map service to act as a guide for the service user, rather than be a definitive resource. The key to satisfying the target audience of low-budget filmmakers was to gather their input to inform user requirements. Similar services within Edinburgh were researched and no s...

  17. Bringing Astronomy Activities and Science Content to Girls Locally and Nationally: A Girl Scout and NIRCam Collaboration

    Science.gov (United States)

    Higgins, M. L.; Lebofsky, L. A.; McCarthy, D. W.; Lebofsky, N.

    2013-04-01

    In 2003, the University of Arizona's (UA) NIRCam EPO team (NASA James Webb Space Telescope's Near-Infrared Camera) and the Girl Scouts of Southern Arizona began a long-term collaboration to bring STEM and astronomy activities and concepts to adult Girl Scout volunteers and staff and, in turn, their councils and girls, i.e., to train the trainers. Nationally, our goal is to reach adult volunteers and staff in all 112 councils. To date, this program has reached nearly 240 adults from 78 councils in 41 states, DC, Guam, and Japan, bringing together adult volunteers and staff, UA graduate students, and NIRCam scientists and educators to experience Arizona's dark skies.

  18. Lunar scout missions: Galileo encounter results and application to scientific problems and exploration requirements

    Science.gov (United States)

    Head, J. W.; Belton, M.; Greeley, R.; Pieters, C.; Mcewen, A.; Neukum, G.; Mccord, T.

    1993-01-01

    The Lunar Scout Missions (payload: x-ray fluorescence spectrometer, high-resolution stereocamera, neutron spectrometer, gamma-ray spectrometer, imaging spectrometer, gravity experiment) will provide a global data set for the chemistry, mineralogy, geology, topography, and gravity of the Moon. These data will in turn provide an important baseline for the further scientific exploration of the Moon by all-purpose landers and micro-rovers, and sample return missions from sites shown to be of primary interest from the global orbital data. These data would clearly provide the basis for intelligent selection of sites for the establishment of lunar base sites for long-term scientific and resource exploration and engineering studies. The two recent Galileo encounters with the Moon (December, 1990 and December, 1992) illustrate how modern technology can be applied to significant lunar problems. We emphasize the regional results of the Galileo SSI to show the promise of geologic unit definition and characterization as an example of what can be done with the global coverage to be obtained by the Lunar Scout Missions.

  19. Science requirements for PRoViScout, a robotics vision system for planetary exploration

    Science.gov (United States)

    Hauber, E.; Pullan, D.; Griffiths, A.; Paar, G.

    2011-10-01

    The robotic exploration of planetary surfaces, including missions of interest for geobiology (e.g., ExoMars), will be the precursor of human missions within the next few decades. Such exploration will require platforms which are much more self-reliant and capable of exploring long distances with limited ground support in order to advance planetary science objectives in a timely manner. The key to this objective is the development of planetary robotic onboard vision processing systems, which will enable the autonomous on-site selection of scientific and mission-strategic targets, and the access thereto. The EU-funded research project PRoViScout (Planetary Robotics Vision Scout) is designed to develop a unified and generic approach for robotic vision onboard processing, namely the combination of navigation and scientific target selection. Any such system needs to be "trained", i.e. it needs (a) scientific requirements which the system needs to address, and (b) a data base of scientifically representative target scenarios which can be analysed. We present our preliminary list of science requirements, based on previous experience from landed Mars missions.

  20. Documentation of German Real Estate Market Data - Sample of Real Estate Advertisements on the Internet Platform ImmobilienScout24

    OpenAIRE

    Phillip an de Meulen; Martin Micheli; Sandra Schaffner

    2014-01-01

    This data report presents a dataset on residential real estate prices in Germany provided by ImmobilienScout24 and introduces real estate price indices of labor market regions. The dataset consists of online adverts of houses and apartments that are available for rent or sale.[...

  1. Exploration and exploitation of food sources by social insect colonies: a revision of the scout-recruit concept

    NARCIS (Netherlands)

    Biesmeijer, J.C.; Vries, Han de

    2001-01-01

    Social insect colonies need to explore and exploit multiple food sources simultaneously and efficiently. At the individual level, this colony-level behaviour has been thought to be taken care of by two types of individual: scouts that independently search for food, and recruits that are directed by

  2. The Lunar Scout Program: An international program to survey the Moon from orbit for geochemistry, mineralogy, imagery, geodesy, and gravity

    Science.gov (United States)

    Morrison, Donald A. (Editor)

    1994-01-01

    The Lunar Scout Program was one of a series of attempts by NASA to develop and fly an orbiting mission to the moon to collect geochemical, geological, and gravity data. Predecessors included the Lunar Observer, the Lunar Geochemical Orbiter, and the Lunar Polar Orbiter - missions studied under the auspices of the Office of Space Science. The Lunar Scout Program, however, was an initiative of the Office of Exploration. It was begun in late 1991 and was transferred to the Office of Space Science after the Office of Exploration was disbanded in 1993. Most of the work was done by a small group of civil servants at the Johnson Space Center; other groups also responsible for mission planning included personnel from the Charles Stark Draper Laboratories, the Lawrence Livermore National Laboratory, Boeing, and Martin Marietta. The Lunar Scout Program failed to achieve new start funding in FY 93 and FY 94 as a result of budget downturns, the de-emphasis of the Space Exploration Initiative, and the fact that lunar science did not rate as high a priority as other planned planetary missions, and was cancelled. The work done on the Lunar Scout Program and other lunar orbiter studies, however, represents assets that will be useful in developing new approaches to lunar orbit science.

  3. Early response to sibutramine in patients not meeting current label criteria: preliminary analysis of SCOUT lead-in period

    DEFF Research Database (Denmark)

    Caterson, Ian; Coutinho, Walmir; Finer, Nick;

    2010-01-01

    pulse rate increases; median 1.5 bpm (nonconformers) vs. 3.0 bpm (conformers). There was a low incidence of serious adverse events (conformers: 1.0%; nonconformers: 2.8%) and ~93% of patients in both groups completed the 6-week period. The SCOUT lead-in period evaluating weight management...

  4. The Optimization Model for Multi-platform Scouting Mines%多平台侦察水雷优化模型

    Institute of Scientific and Technical Information of China (English)

    张年春; 刘翔; 毕绳金

    2012-01-01

    针对侦察水雷作战特点,运用最优化理论解决多平台侦察水雷问题.建立多平台侦察水雷优化模型,并通过基于效能指标的单类平台侦察水雷作战模型和基于二分法的最大侦察搜索区域宽度解算模型,得到各类平台的效量需求及其最佳侦察线路配置等关键参数的最优解,较好地满足了侦察水雷作战需求.%Based on the characteristics for scouting mines operation, multi-platform scouting mines can be realized by using optimization theory. A multi-platform optimization model for scouting mine operation is established. Furthermore, with the help of an operation model for single-platform scouting mines based on efficiency index and a solution model for maximum scouting area based on dichotomy, the optimum value of some key parameters, such as the quantity of each platform and the best scouting strip etc. ? can be calculated by this optimization model, which satisfied the operational requirement for scouting mines.

  5. Computed tomography scout views vs. conventional radiography in body-packers – Delineation of body-packs and radiation dose in a porcine model

    Energy Technology Data Exchange (ETDEWEB)

    Ziegeler, Edvard, E-mail: edvard.ziegeler@campus.lmu.de [Institute for Clinical Radiology, Ludwig-Maximilians-University Hospital Munich, Nussbaumstraße 20, 80336 Munich (Germany); Grimm, Jochen M., E-mail: jochen.grimm@med.lmu.de [Institute for Clinical Radiology, Ludwig-Maximilians-University Hospital Munich, Nussbaumstraße 20, 80336 Munich (Germany); Wirth, Stefan, E-mail: tefan.wirth@med.lmu.de [Institute for Clinical Radiology, Ludwig-Maximilians-University Hospital Munich, Nussbaumstraße 20, 80336 Munich (Germany); Uhl, Michael, E-mail: michael.uhl@polizei.bayern.de [Bavarian State Criminal Police Office, Maillingerstrasse 15, 80636 Munich (Germany); Reiser, Maximilian F., E-mail: Maximilian.Reiser@med.lmu.de [Institute for Clinical Radiology, Ludwig-Maximilians-University Hospital Munich, Nussbaumstraße 20, 80336 Munich (Germany); Scherr, Michael K., E-mail: Michael.Scherr@med.lmu.de [Institute for Clinical Radiology, Ludwig-Maximilians-University Hospital Munich, Nussbaumstraße 20, 80336 Munich (Germany)

    2012-12-15

    Objective: To compare abdominal computed tomography (CT) scout views with conventional radiography regarding radiation dose and delineation of drug packages in a porcine body-packer model. Materials and methods: Nine samples of illicit drugs packed in ovoid plastic containers were consecutively placed in the rectum of a 121.5 kg pig cadaver. Antero-posterior and lateral scout views were obtained at 120 kVp and 80 mA, 150 mA and 200 mA, respectively, using a 64-row MDCT. Scout views were compared with conventional abdominal antero-posterior radiographs (77 kV and 106 ± 13 mAs). Visibility of three body pack characteristics (wrapping, content, shape) was rated independently by two radiologists and summarized to a delineation score ranging from 0 to 9 with a score ≥6 representing sufficient delineation. Mean delineation scores were calculated for each conventional radiography and single plane scout view separately and for a combined rating of antero-posterior and lateral scout views. Results: Even the lowest single plane scout view delineation score (5.3 ± 2.0 for 80 mA lateral; 0.4 mSv; sensitivity = 44%) was significantly higher than for conventional radiographs (3.1 ± 2.5, p < 0.001; 2.4 ± 0.3 mSv; sensitivity = 11%). Combined reading of antero-posterior and lateral scout views 80 mA yielded sufficient delineation (6.2 ± 1.4; 0.8 mSv; sensitivity = 56%). Conclusions: All CT scout views showed significantly better delineation ratings and sensitivity than conventional radiographs. Scout views in two planes at 80 mA provided a sufficient level of delineation and a sensitivity five times higher than conventional radiography at less than one third of the radiation dose. In case of diagnostic insecurity, CT can be performed without additional logistical effort.

  6. Computed tomography scout views vs. conventional radiography in body-packers – Delineation of body-packs and radiation dose in a porcine model

    International Nuclear Information System (INIS)

    Objective: To compare abdominal computed tomography (CT) scout views with conventional radiography regarding radiation dose and delineation of drug packages in a porcine body-packer model. Materials and methods: Nine samples of illicit drugs packed in ovoid plastic containers were consecutively placed in the rectum of a 121.5 kg pig cadaver. Antero-posterior and lateral scout views were obtained at 120 kVp and 80 mA, 150 mA and 200 mA, respectively, using a 64-row MDCT. Scout views were compared with conventional abdominal antero-posterior radiographs (77 kV and 106 ± 13 mAs). Visibility of three body pack characteristics (wrapping, content, shape) was rated independently by two radiologists and summarized to a delineation score ranging from 0 to 9 with a score ≥6 representing sufficient delineation. Mean delineation scores were calculated for each conventional radiography and single plane scout view separately and for a combined rating of antero-posterior and lateral scout views. Results: Even the lowest single plane scout view delineation score (5.3 ± 2.0 for 80 mA lateral; 0.4 mSv; sensitivity = 44%) was significantly higher than for conventional radiographs (3.1 ± 2.5, p < 0.001; 2.4 ± 0.3 mSv; sensitivity = 11%). Combined reading of antero-posterior and lateral scout views 80 mA yielded sufficient delineation (6.2 ± 1.4; 0.8 mSv; sensitivity = 56%). Conclusions: All CT scout views showed significantly better delineation ratings and sensitivity than conventional radiographs. Scout views in two planes at 80 mA provided a sufficient level of delineation and a sensitivity five times higher than conventional radiography at less than one third of the radiation dose. In case of diagnostic insecurity, CT can be performed without additional logistical effort.

  7. MICHAEL GORBOVY AS AN ORGANIZER OF THE SCOUTING MOVEMENT IN GUTSULSCHINA (THE BEGINNING OF THE XX CENTURY

    Directory of Open Access Journals (Sweden)

    Iryna Didukh

    2015-04-01

    Full Text Available The Ukrainian scouting movement on western Ukrainian territories reached the highest level during the interwar period. Despite the relative integrity it had its own features in Galicia, Volyn', on Bukovyna, Transcarpathia. As living conditions turned out to be peaceful, old plast centres started to form in schools. "Plast" in Galicia was an example of inheritance and incentive to the development on other western Ukrainian territories and in emigration. The figure of famous Hutsul plastun Michael Gorbovy (1896 – 1941 is very interesting and multidimensional. Indeed, it is a symbolic name in the history of Ukrainian scout organization. He was a member of many national public organizations. With his name economic and cooperative activities of "Plast" in Gutsulschina are connected. He was the organizer of craft departments of "Plast". The unicity of this disjoint person is expressed in his great love for Ukraine and responsibility for its future. Gorbovy considered physical, moral and national-patriotic education of children and youth as his main task. He strived to spread the idea of Ukrainian scouting among wide groups of people. For this work on 22th of May, 1924 he was awarded with a plast title of a scoutmaster. Michael Gorbovy formed national consciousness, high spirituality, love of God and Ukraine among youth for the "great aim" which is to build an independent Ukrainian nation. Experts qualify current spiritual and moral state of the Ukrainian society as "crisis". School is not able to fill the educational vacuum which has appeared after the elimination of the Pioneer and Komsomol organizations. No new alternative children's institutions have been suggested. In such a difficult situation the experience of the activity of the Ukrainian scouting movement may be useful. Creative and practical achievements of "Plast" leaders as key figures and main carriers of the plast's educational methods are especially important. These include a figure of

  8. Talent Scout

    Science.gov (United States)

    Dolezalek, Holly

    2010-01-01

    Most companies need a steady stream of talent to enter, then move up in, the organization. But at most companies, the care and feeding of that talent stream is often a bit fragmented; recruitment is largely an HR function, while succession planning--to the extent there is any--is left in the hands of executive leadership. Development of the…

  9. A Wide-Angle Camera for the Mobile Asteroid Surface Scout (MASCOT) on Hayabusa-2

    Science.gov (United States)

    Schmitz, N.; Koncz, A.; Jaumann, R.; Hoffmann, H.; Jobs, D.; Kachlicki, J.; Michaelis, H.; Mottola, S.; Pforte, B.; Schroeder, S.; Terzer, R.; Trauthan, F.; Tschentscher, M.; Weisse, S.; Ho, T.-M.; Biele, J.; Ulamec, S.; Broll, B.; Kruselburger, A.; Perez-Prieto, L.

    2014-04-01

    JAXA's Hayabusa-2 mission, an asteroid sample return mission, is scheduled for launch in December 2014, for a rendezvous with the C-type asteroid 1999 JU3 in 2018. MASCOT, the Mobile Asteroid Surface Scout [1], is a small lander, designed to deliver ground truth for the orbiter remote measurements, support the selection of sampling sites, and provide context for the returned samples.MASCOT's main objective is to investigate the landing site's geomorphology, the internal structure, texture and composition of the regolith (dust, soil and rocks), and the thermal, mechanical, and magnetic properties of the surface. MASCOT comprises a payload of four scientific instruments: camera, radiometer, magnetometer and hyper-spectral microscope. The camera (MASCOT CAM) was designed and built by DLR's Institute of Planetary Research, together with Airbus DS Germany.

  10. Scout fourth stage attitude and velocity control (AVC) system feasibility study

    Science.gov (United States)

    Byars, L. B.

    1975-01-01

    The feasibility of incorporating a guidance system in the Scout fourth stage to achieve a significant improvement in expected payload delivery accuracy is studied. The technical investigations included the determination of the AVC equipment performance requirements, establishment of qualification and acceptance test levels, generation of layouts illustrating design approaches for the upper D and payload transition sections to incorporate the hardware, and the preparation of a vendor bid package. Correction concepts, utilizing inertial velocity and attitude, were identified and evaluated. Fourth stage attitude adjustments as determined from inertial velocity variation through the first three stages and a final velocity correction based upon the measured in-plane component errors at injection were employed. Results show radical reductions in apogee-perigee deviations.

  11. Playing the Part: Hungarian Boy Scouts and the Performance of Trauma in Interwar Hungary

    Directory of Open Access Journals (Sweden)

    Steven Jobbitt

    2011-01-01

    Full Text Available In 1920, the historic Kingdom of Hungary was dismembered according to the dictates of the Treaty of Trianon. Resulting in the loss of two-thirds of the nation’s pre-World War I territory, and one-third of its prewar population, Trianon has long stood as a symbol for Hungarian suffering and trauma in the twentieth century. Historians of modern Hungary have given much consideration to Trianon, with serious attention being paid to what some have called the Trianon syndrome, or the Trianon trauma. Arguing that interwar Hungarian culture and politics need to be understood in light of the menacing psychological shadow cast by Trianon, a number of historians have suggested that the people of Hungary were traumatized spontaneously and universally by the dismemberment of the nation and the suffering that followed. This paper argues that, though this may indeed have been the case on a raw emotional level, careful consideration needs to be given to the overlapping political and pedagogical functions of the Trianon trauma, especially as this trauma found expression in repeated public “performances” of the Trianon tragedy. Focusing on the revisionist performances of Hungarian boy scouts between the wars, and in particular on the personal papers of the Hungarian geographer and boy scout leader Ferenc Fodor, this paper draws a direct link between trauma and performance in the interwar period, and argues that, though trauma was indeed central to Hungarian cultural politics, it functioned as much as a pedagogical strategy as it did a psychological reality.

  12. Documentation of German real estate market data: Sample of real estate advertisements on the internet platform ImmobilienScout24, 2007-2013

    OpenAIRE

    an de Meulen, Philipp; Micheli, Martin; Schaffner, Sandra

    2014-01-01

    This data report presents a dataset on residential real estate prices in Germany provided by ImmobilienScout24 and introduces real estate price indices of labor market regions. The dataset consists of online adverts of houses and apartments that are available for rent or sale. The dataset complements already existing datasets in two ways: First, it is available almost without any time lag, allowing the analysis of most recent developments. Second, the high market share of ImmobilienScout24 re...

  13. Red Sirius

    International Nuclear Information System (INIS)

    A hypothesis is proposed explaining the assumption that Sirius changes its colour from red in the second century to pale blue in the tenth century A.D. The hypothesis is based on the possibility of transformation of a Sirius satellite (Sirius B) from a red giant in the past to a white dwarf in the present. Such a transformation would have been accompanied by an explosion of Sirius B, which is clearly visible from the Earth. The fact that the increase in Sirius brightness by 4-5 units is not reflected in historical chronicles is attributed to the degradation of sciences in Europe in 4-10 centuries

  14. Pharmacophore modeling for COX-1 and-2 inhibitors with LigandScout in comparison to Discovery Studio

    OpenAIRE

    Temml, V; Kaserer, T.; Kutil, Z. (Zsófia); Landa, P. (Přemysl); Vaněk, T. (Tomáš); Schuster, D.

    2014-01-01

    Pharmacophore modeling has become an integrated tool in drug discovery. However, no prospective study compares the performance of the available software. Methods: The two widely used pharmacophore modeling and screening software programs Discovery Studio and LigandScout were used to generate, validate, and prospectively apply COX-1 and -2 models. Selected virtual hits were tested in cell-free enzymatic assays. The correct retrieval of active compounds was compared. Results: In the enzymatic t...

  15. "A Modest Manliness": The Boy Scouts of America and the Making of Modern Masculinity, 1910-1930

    OpenAIRE

    Jordan, Benjamin René

    2009-01-01

    This dissertation examines an enormously influential organization that gave shape to normative American assumptions about the relationship between gender, race, citizenship, and the environment in the early twentieth century. The Boy Scouts of America \\[BSA\\] garnered a broad range of popular and government support for promising to teach a universal model of character and leading citizenship to all boys. However, many officials doubted that non-white, working class immigrant, and rural boys w...

  16. Thoracic pathologies on scout views and bolus tracking slices for computed tomographic cerebral angiography

    Energy Technology Data Exchange (ETDEWEB)

    Groth, M.; Fiehler, J.; Buhk, J.H. [University Medical Center Hamburg-Eppendorf (Germany). Dept. of Diagnostic and Interventional Neuroradiology; Henes, F.O. [University Medical Center Hamburg-Eppendorf (Germany). Dept. of Diagnostic and Interventional Radiology

    2015-08-15

    To evaluate the incidence of additional thoracic pathologic findings (TPF) detected on scout views and corresponding bolus tracking slices (SVBT) for computed tomographic cerebral angiography (CTCA) and to test the reliability and accuracy of these findings. The study collective included 505 consecutive patients who underwent multidetector CTCA. Appendant SVBT of all patients were reviewed for any pathologic findings and patient medical reports were analyzed, if any medical treatment was initiated for the detected pathologic findings. In 18 patients thoracic CT scans were performed in the same session. These were additionally reviewed by two blinded observers to test for intra- and interobserver reliability as well as for accuracy of detecting thoracic pathologies on SVBT. TPF were detected in 165 (33 %) SVBT. The five most common pathologic findings were: pleural effusion, 12 %; pneumonia, 8 %; atelectasis/dystelecatsis, 6 %; pericardial effusion, 2 % and elevated diaphragm, 1 %. For 48 % of these findings medical treatment was initiated. SVBT showed a sensitivity of 53 %, a specificity of 99 %, a positive predictive value of 89 %, a negative predictive value of 94 % and accuracy of 94 % for the detection of TPF. The intraobserver reliability was very good and the interobserver reliability showed moderate agreement. SVBT for CTCA should be reviewed with care by radiologists, since additional TPF can affect patient management. Nevertheless, despite a high specificity of SVBT for detecting TPF, an only moderate sensitivity has to be taken into account.

  17. Mars 2007 Phoenix Scout Mission Organic Free Blank: Method to Distinguish Mars Organics from Terrestrial Organics

    Science.gov (United States)

    Ming, D. W.; Morris, R. V.; Woida, R.; Sutter, B.; Lauer, H. V.; Shinohara, C.; Golden, D. C.; Boynton, W. V.; Arvidson, R. E.; Stewart, R. L.; Tamppari, L. K.; Gross, M.; Smith, P.

    2008-01-01

    The Mars 2007 Phoenix Scout Mission successfully launched on August 4, 2007, for a 10-month journey to Mars. The Phoenix spacecraft is scheduled to land on May 25, 2008. The primary mission objective is to study the history of water and evaluate the potential for past and present habitability in Martian arctic ice-rich soil [1]. Phoenix will land near 68 N latitude on polygonal terrain presumably created by ice layers that are expected to be a few centimeters under loose soil materials [2,3]. The Phoenix Mission will assess the potential for habitability by searching for organic molecules in ice or icy soils at the landing site. Organic molecules are necessary building blocks for life, although their presence in the ice or soil does not indicate life itself. Phoenix will search for organic molecules by heating soil/ice samples in the Thermal and Evolved-Gas Analyzer (TEGA, [4]). TEGA consists of 8 differential scanning calorimeter (DSC) ovens integrated with a magnetic-sector mass spectrometer with a mass range of 2-140 daltons [4]. Endothermic and exothermic reactions are recorded by the TEGA DSC as samples are heated from ambient to approx.1000 C. Evolved gases, including organic molecules and fragments if present, are simultaneously measured by the mass spectrometer during heating.

  18. Evolution of a Mars Airplane Concept for the ARES Mars Scout Mission

    Science.gov (United States)

    Smith, Stephen C.; Guynn, Mark D.; Smith, Stephen C.; Parks, Robert W.; Gelhausen, Paul A.

    2004-01-01

    ARES (Aerial Regional-scale Environmental Survey of Mars) is a proposed Mars Scout mission using an airplane to provide high-value science measurements in the areas of atmospheric chemistry, surface geology and mineralogy, and crustal magnetism. The use of an airplane for robotic exploration of Mars has been studied for over 25 years. There are, however, significant challenges associated with getting an airplane to Mars and flying through the thin, carbon dioxide Martian atmosphere. The traditional wisdom for aircraft design does not always apply for this type of vehicle and geometric, aerodynamic, and mission constraints result in a limited feasible design space. The ARES airplane design is the result of a concept exploration and evolution involving a number of trade studies, downselects, and design refinements. Industry, university, and NASA partners initially proposed a number of different concepts, drawing heavily on past Mars airplane design experience. Concept downselects were conducted with qualitative evaluation and high level analyses, focused on the most important parameters for the ARES mission. Following a successful high altitude test flight of the basic configuration, additional design refinement led to the current design. The resulting Mars airplane concept enables the high-value science objectives of the ARES mission to be accomplished while also fulfilling the desire for a simple, low-risk design.

  19. CRISTA-NF measurements during the AMMA-SCOUT-O3 aircraft campaign

    Directory of Open Access Journals (Sweden)

    F. Stroh

    2010-03-01

    Full Text Available The Cryogenic Infrared Spectrometers and Telescopes for the Atmosphere – New Frontiers (CRISTA-NF instrument successfully participated in the AMMA-SCOUT-O3 measurement campaign in July and August 2006. The instrument is mounted on the high-flying Russian research aircraft M55-Geophysica and measures limb-emissions in the mid-infrared region in the altitude range of about 6 to 21 km. We present a new retrieval scheme that was developed to obtain atmospheric temperature and trace gas fields with high vertical resolution (up to 500 m. Retrieval results are shown for temperature, water vapor (H2O, ozone (O3, nitric acid (HNO3, peroxyacetyl nitrate (PAN, carbon tetrachloride (CCl4, and aerosol extinction. Comparisons of temperature, O3, and H2O observations with corresponding in situ measurements on-board M55-Geophysica show reasonable agreement. In particular, CRISTA-NF observations in the vicinity of the aircraft resemble horizontal variations found in the in situ measurements better than corresponding ECMWF fields.

  20. CRISTA-NF measurements during the AMMA-SCOUT-O3 aircraft campaign

    Directory of Open Access Journals (Sweden)

    K. Weigel

    2010-10-01

    Full Text Available The Cryogenic Infrared Spectrometers and Telescopes for the Atmosphere – New Frontiers (CRISTA-NF instrument participated in the AMMA-SCOUT-O3 measurement campaign in July and August 2006. The instrument is mounted on the high-flying Russian research aircraft M55-Geophysica and measures limb-emissions in the mid-infrared region in the tangent altitude range of about 6 to 21 km. We present a new retrieval setup which is based on 9 integrated spectral windows allowing to retrieve an extended set of trace gases and temperature fields with high vertical resolution (up to 500 m. Retrieval results are shown for temperature, water vapor (H2O, ozone (O3, nitric acid (HNO3, peroxyacetyl nitrate (PAN, carbon tetrachloride (CCl4, and aerosol extinction. Comparisons of temperature, O3, and H2O observations with corresponding in situ measurements on-board M55-Geophysica show reasonable agreement. In particular, CRISTA-NF observations in the vicinity of the aircraft resemble horizontal variations found in the in situ measurements better than corresponding ECMWF fields.

  1. Red Alive

    Directory of Open Access Journals (Sweden)

    Reynaldo Thompson Lopez

    2010-01-01

    Full Text Available Red Alive is an installation consisting of video, sound and an aquarium containing a beta fish in it. The idea came out by observing the peculiar behavior of the small creature that fights to death with other fishes of his kind that are in his proximity. Its character and physical appearance are good reasons to capture it in a video recording since its color and sensual movements contrast with its aggressive instinct. The conduct of such fish is similar in many aspects to those of humans.

  2. Red Alive

    OpenAIRE

    Reynaldo Thompson Lopez

    2010-01-01

    Red Alive is an installation consisting of video, sound and an aquarium containing a beta fish in it. The idea came out by observing the peculiar behavior of the small creature that fights to death with other fishes of his kind that are in his proximity. Its character and physical appearance are good reasons to capture it in a video recording since its color and sensual movements contrast with its aggressive instinct. The conduct of such fish is similar in many aspects to those of humans.

  3. Biodistribution, radiation dosimetry and scouting of {sup 90}Y-ibritumomab tiuxetan therapy in patients with relapsed B-cell non-Hodgkin's lymphoma using {sup 89}Zr-ibritumomab tiuxetan and PET

    Energy Technology Data Exchange (ETDEWEB)

    Rizvi, Saiyada N.F.; Lingen, Arthur van; Hoekstra, Otto S. [VU University Medical Center, Department of Nuclear Medicine and PET Research, PO Box 7057, Amsterdam (Netherlands); Visser, Otto J.; Zijlstra, Josee M.; Huijgens, Peter C. [VU University Medical Center, Department of Haematology, Amsterdam (Netherlands); Vosjan, Maria J.W.D.; Dongen, Guus A.M.S. van [VU University Medical Center, Department of Otolaryngology and Head and Neck Surgery, Amsterdam (Netherlands); Lubberink, Mark [VU University Medical Center, Department of Nuclear Medicine and PET Research, PO Box 7057, Amsterdam (Netherlands); Uppsala University, and Medical Physics, Uppsala University Hospital, Department of Nuclear Medicine and PET, Uppsala (Sweden)

    2012-03-15

    Positron emission tomography (PET) with {sup 89}Zr-ibritumomab tiuxetan can be used to monitor biodistribution of {sup 90}Y-ibritumomab tiuxetan as shown in mice. The aim of this study was to assess biodistribution and radiation dosimetry of {sup 90}Y-ibritumomab tiuxetan in humans on the basis of {sup 89}Zr-ibritumomab tiuxetan imaging, to evaluate whether co-injection of a therapeutic amount of {sup 90}Y-ibritumomab tiuxetan influences biodistribution of {sup 89}Zr-ibritumomab tiuxetan and whether pre-therapy scout scans with {sup 89}Zr-ibritumomab tiuxetan can be used to predict biodistribution of {sup 90}Y-ibritumomab tiuxetan and the dose-limiting organ during therapy. Seven patients with relapsed B-cell non-Hodgkin's lymphoma scheduled for autologous stem cell transplantation underwent PET scans at 1, 72 and 144 h after injection of {proportional_to}70 MBq {sup 89}Zr-ibritumomab tiuxetan and again 2 weeks later after co-injection of 15 MBq/kg or 30 MBq/kg {sup 90}Y-ibritumomab tiuxetan. Volumes of interest were drawn over liver, kidneys, lungs, spleen and tumours. Ibritumomab tiuxetan organ absorbed doses were calculated using OLINDA. Red marrow dosimetry was based on blood samples. Absorbed doses to tumours were calculated using exponential fits to the measured data. The highest {sup 90}Y absorbed dose was observed in liver (3.2 {+-} 1.8 mGy/MBq) and spleen (2.9 {+-} 0.7 mGy/MBq) followed by kidneys and lungs. The red marrow dose was 0.52 {+-} 0.04 mGy/MBq, and the effective dose was 0.87 {+-} 0.14 mSv/MBq. Tumour absorbed doses ranged from 8.6 to 28.6 mGy/MBq. Correlation between predicted pre-therapy and therapy organ absorbed doses as based on {sup 89}Zr-ibritumomab tiuxetan images was high (Pearson correlation coefficient r = 0.97). No significant difference between pre-therapy and therapy tumour absorbed doses was found, but correlation was lower (r = 0.75). Biodistribution of {sup 89}Zr-ibritumomab tiuxetan is not influenced by simultaneous

  4. Weight and blood pressure response to weight management and sibutramine in diabetic and non-diabetic high-risk patients: an analysis from the 6-week lead-in period of the sibutramine cardiovascular outcomes (SCOUT) trial

    DEFF Research Database (Denmark)

    Van Gaal, L F; Caterson, I D; Coutinho, W;

    2010-01-01

    To assess treatment responses to sibutramine and weight management in diabetic patients during the lead-in period of the Sibutramine Cardiovascular OUTcomes (SCOUT) trial.......To assess treatment responses to sibutramine and weight management in diabetic patients during the lead-in period of the Sibutramine Cardiovascular OUTcomes (SCOUT) trial....

  5. Use of computed tomography scout film and Hounsfield unit of computed tomography scan in predicting the radio-opacity of urinary calculi in plain kidney, ureter and bladder radiographs

    Directory of Open Access Journals (Sweden)

    Michael E. Chua

    2014-01-01

    Conclusion: Urolithiases identified on the CT-scout film were also seen as radiopaque on the KUB radiograph while those stones not visible on the CT-scout film, but above the optimal HU cut-off value of 630 are also likely to be radiopaque.

  6. The SCOUT-O3 Darwin Aircraft Campaign: rationale and meteorology

    Directory of Open Access Journals (Sweden)

    D. Brunner

    2009-01-01

    Full Text Available An aircraft measurement campaign involving the Russian high-altitude aircraft M55 Geophysica and the German DLR Falcon was conducted in Darwin, Australia in November and December 2005 as part of the European integrated project SCOUT-O3. The overall objectives of the campaign were to study the transport of trace gases through the tropical tropopause layer (TTL, mechanisms of dehydration close to the tropopause, and the role of deep convection in these processes. In this paper a detailed roadmap of the campaign is presented, including rationales for each flight, and an analysis of the local and large-scale meteorological context in which they were embedded. The campaign took place during the pre-monsoon season which is characterized by a pronounced diurnal evolution of deep convection including a mesoscale system over the Tiwi Islands north of Darwin known as "Hector". This allowed studying in detail the role of deep convection in structuring the tropical tropopause region, in situ sampling convective overshoots above storm anvils, and probing the structure of anvils and cirrus clouds by Lidar and a suite of in situ instruments onboard the two aircraft. The large-scale flow during the first half of the campaign was such that local flights, away from convection, sampled air masses downstream of the "cold trap" region over Indonesia. Abundant cirrus clouds enabled the study of active dehydration, in particular during two TTL survey flights. The campaign period also encompassed a Rossby wave breaking event transporting stratospheric air to the tropical middle troposphere and an equatorial Kelvin wave modulating tropopause temperatures and hence the conditions for dehydration.

  7. MASCOT—The Mobile Asteroid Surface Scout Onboard the Hayabusa2 Mission

    Science.gov (United States)

    Ho, Tra-Mi; Baturkin, Volodymyr; Grimm, Christian; Grundmann, Jan Thimo; Hobbie, Catherin; Ksenik, Eugen; Lange, Caroline; Sasaki, Kaname; Schlotterer, Markus; Talapina, Maria; Termtanasombat, Nawarat; Wejmo, Elisabet; Witte, Lars; Wrasmann, Michael; Wübbels, Guido; Rößler, Johannes; Ziach, Christian; Findlay, Ross; Biele, Jens; Krause, Christian; Ulamec, Stephan; Lange, Michael; Mierheim, Olaf; Lichtenheldt, Roy; Maier, Maximilian; Reill, Josef; Sedlmayr, Hans-Jürgen; Bousquet, Pierre; Bellion, Anthony; Bompis, Olivier; Cenac-Morthe, Celine; Deleuze, Muriel; Fredon, Stephane; Jurado, Eric; Canalias, Elisabet; Jaumann, Ralf; Bibring, Jean-Pierre; Glassmeier, Karl Heinz; Hercik, David; Grott, Matthias; Celotti, Luca; Cordero, Federico; Hendrikse, Jeffrey; Okada, Tatsuaki

    2016-04-01

    On December 3rd, 2014, the Japanese Space Agency (JAXA) launched successfully the Hayabusa2 (HY2) spacecraft to its journey to Near Earth asteroid (162173) Ryugu. Aboard this spacecraft is a compact landing package, MASCOT (Mobile Asteroid surface SCOuT), which was developed by the German Aerospace Centre (DLR) in collaboration with the Centre National d'Etudes Spatiales (CNES). Similar to the famous predecessor mission Hayabusa, Hayabusa2, will also study an asteroid and return samples to Earth. This time, however, the target is a C-type asteroid which is considered to be more primitive than (25143) Itokawa and provide insight into an even earlier stage of our Solar System. Upon arrival at asteroid Ryugu in 2018, MASCOT will be released from the HY2 spacecraft and gently descend by free fall from an altitude of about 100 m to the surface of the asteroid. After a few bounces, the lander will come to rest at the surface and perform its scientific investigations of the surface structure and mineralogical composition, the thermal behaviour and the magnetic properties by operating its four scientific instruments. Those include an IR imaging spectrometer (MicrOmega, IAS Paris), a camera (MASCAM, DLR Berlin), a radiometer (MARA, DLR Berlin) and a magnetometer (MASMAG, TU Braunschweig). In order to allow optimized payload operations the thermal design of MASCOT is required to cope with the contrasting requirements of the 4-year cruise in cold environment versus the hot conditions on the surface of the asteroid. Operations up to 2 asteroid days (˜16 hours) based on a primary battery are currently envisaged. A mobility mechanism allows locomotion on the surface. The mechanism is supported by an attitude and motion sensing system and an intelligent autonomy manager, which is implemented in the onboard software that enables MASCOT to operate fully independently when ground intervention is not available.

  8. The SCOUT-O3 Darwin Aircraft Campaign: rationale and meteorology

    Directory of Open Access Journals (Sweden)

    D. Brunner

    2008-09-01

    Full Text Available An aircraft measurement campaign involving the Russian high-altitude aircraft M55 Geophysica and the German DLR Falcon was conducted in Darwin, Australia in November and December 2005 as part of the European integrated project SCOUT-O3. The overall objectives of the campaign were to study the transport of trace gases through the tropical tropopause layer (TTL, mechanisms of dehydration close to the tropopause, and the role of deep convection in these processes. In this paper a detailed roadmap of the campaign is presented, including rationales for each flight, and an analysis of the local and large-scale meteorological context in which they were embedded. The campaign took place during the pre-monsoon season which is characterized by a pronounced diurnal evolution of deep convection including a mesoscale system over the Tiwi Islands north of Darwin known as "Hector". This allowed studying in detail the role of deep convection in structuring the tropical tropopause region, in situ sampling convective overshoots above storm anvils, and probing the structure of anvils and cirrus clouds by Lidar and a suite of in situ instruments onboard the two aircraft. The large-scale flow during the first half of the campaign was such that local flights, away from convection, sampled air masses downstream of the "cold trap" region over Indonesia. Abundant cirrus clouds enabled the study of active dehydration, in particular during two TTL survey flights. The campaign period also encompassed a Rossby wave breaking event transporting stratospheric air to the tropical middle troposphere and an equatorial Kelvin wave modulating tropopause temperatures and hence the conditions for dehydration.

  9. The Near Earth Object (NEO) Scout Spacecraft: A Low-cost Approach to In-situ Characterization of the NEO Population

    Science.gov (United States)

    Woeppel, Eric A.; Balsamo, James M.; Fischer, Karl J.; East, Matthew J.; Styborski, Jeremy A.; Roche, Christopher A.; Ott, Mackenzie D.; Scorza, Matthew J.; Doherty, Christopher D.; Trovato, Andrew J.; Volk, Christopher P.; Koontz, Steven L.; Bevilacqua, Riccardo; Swenson, Charles

    2014-01-01

    This paper describes a microsatellite spacecraft with supporting mission profile and architecture, designed to enable preliminary in-situ characterization of a significant number of Near Earth Objects (NEOs) at reasonably low cost. The spacecraft will be referred to as the NEO-Scout. NEO-Scout spacecraft are to be placed in Geosynchronous Equatorial Orbit (GEO), cis-lunar space, or on earth escape trajectories as secondary payloads on launch vehicles headed for GEO or beyond, and will begin their mission after deployment from the launcher. A distinguishing key feature of the NEO-Scout system is to design the spacecraft and mission timeline so as to enable rendezvous with and landing on the target NEO during NEO close approach (<0.3 AU) to the Earth-Moon system using low-thrust/high-impulse propulsion systems. Mission durations are on the order 100 to 400 days. Mission feasibility and preliminary design analysis are presented, along with detailed trajectory calculations.

  10. Seeing Red

    Science.gov (United States)

    2008-01-01

    This New Horizons image of Jupiter's volcanic moon Io was taken at 13:05 Universal Time during the spacecraft's Jupiter flyby on February 28, 2007. It shows the reddish color of the deposits from the giant volcanic eruption at the volcano Tvashtar, near the top of the sunlit crescent, as well as the bluish plume itself and the orange glow of the hot lava at its source. The relatively unprocessed image on the left provides the best view of the volcanic glow and the plume deposits, while the version on the right has been brightened to show the much fainter plume, and the Jupiter-lit night side of Io. New Horizons' color imaging of Io's sunlit side was generally overexposed because the spacecraft's color camera, the super-sensitive Multispectral Visible Imaging Camera (MVIC), was designed for the much dimmer illumination at Pluto. However, two of MVIC's four color filters, the blue and 'methane' filter (a special filter designed to map methane frost on the surface of Pluto at an infrared wavelength of 0.89 microns), are less sensitive than the others, and thus obtained some well-exposed views of the surface when illumination conditions were favorable. Because only two color filters are used, rather than the usual three, and because one filter uses infrared light, the color is only a rough approximation to what the human eye would see. The red color of the Tvashtar plume fallout is typical of Io's largest volcanic plumes, including the previous eruption of Tvashtar seen by the Galileo and Cassini spacecraft in 2000, and the long-lived Pele plume on the opposite side of Io. The color likely results from the creation of reddish three-atom and four-atom sulfur molecules (S3 and S4) from plume gases rich in two-atom sulfur molecules (S2 After a few months or years, the S3 and S4 molecules recombine into the more stable and familiar yellowish form of sulfur consisting of eight-atom molecules (S8), so these red deposits are only seen around recently-active Io volcanos

  11. El valor didáctico del escultismo. Una propuesta educativa basada en el método scout.

    OpenAIRE

    Rodríguez Aldama, Sergio

    2015-01-01

    Este Trabajo de Fin de Grado pretende dar una mayor importancia a las actividades educativas que se realizan fuera del entorno escolar, concretamente en el ámbito de la educación no formal. Por otra parte pretende dar a conocer la metodología educativa presente en el movimiento scout través de una propuesta práctica en la que los niños elaboran su propia acampada con el acompañamiento de los adultos. La naturaleza y el entorno constituyen el terreno ideal donde desarrollar conocimientos, habi...

  12. Levels of Cognitive Processes in a Non-Formal Science Education Program: Scouting's Science Merit Badges and the Revised Bloom's Taxonomy

    Science.gov (United States)

    Vick, Matthew; Garvey, Michael P.

    2011-01-01

    The United States Boy Scout merit badge program provides non-formal educational experiences for boys from ages 10-17. This study analyzes the objectives of the twenty-three science related merit badges using the lens of the revised Bloom's taxonomy. Merit badges requirements serve as objectives for this program. The verbs in the requirements were…

  13. Differential changes in serum uric acid concentrations in sibutramine promoted weight loss in diabetes: results from four weeks of the lead-in period of the SCOUT trial

    DEFF Research Database (Denmark)

    Andersson, Charlotte; Weeke, Peter; Brendorp, Bente;

    2009-01-01

    . METHODS AND RESULTS: Data from a four week single-blind lead-in period of the Sibutramine Cardiovascular OUTcomes (SCOUT) study were analyzed. 2584 patients (24%) had diabetes mellitus (DM) only, 1748 (16%) had cardiovascular disease (CVD) only and 6397 (60%) had both DM + CVD. Uric acid concentrations...

  14. An introduction to the SCOUT-AMMA stratospheric aircraft, balloons and sondes campaign inWest Africa, August 2006: rationale and roadmap

    NARCIS (Netherlands)

    Cairo, F.; Kerstel, E.R.T.; Roeckmann, T.

    2010-01-01

    A multi-platform field measurement campaign involving aircraft and balloons took place overWest Africa between 26 July and 25 August 2006, in the frame of the concomitant AMMA Special Observing Period and SCOUT-O3 African tropical activities. Specifically aiming at sampling the upper troposphere and

  15. 美国童子军的课程制度%T he Curriculum System of the Boy Scouts of America

    Institute of Scientific and Technical Information of China (English)

    傅丽纯

    2015-01-01

    The purpose of the Boy Scouts of America is to train youth in character development , responsible citizenship ,and physical and psychological health . The traditional curricula of the Boy Scouts of America include cub scouting , boy scouting , and venturing , all of which are activity curricula . The curricula aim at cultivating the ability of youth to do things for themselves and others in the process of“learning by doing” .%美国童子军的主要目标是促进青少年品德发展、公民素养训练和促进个人身心健康。美国童子军的传统课程包括幼儿童子军课程、童子军课程、探险童子军课程。这些课程都属于活动课程。此类课程强调让青少年在“做中学”中提高其为自己做事和他人做事的能力。

  16. An introduction to the SCOUT-AMMA stratospheric aircraft, balloons and sondes campaign in West Africa, August 2006 : rationale and roadmap

    NARCIS (Netherlands)

    Cairo, F.; Pommereau, J. P.; Law, K. S.; Schlager, H.; Garnier, A.; Fierli, F.; Ern, M.; Streibel, M.; Arabas, S.; Borrmann, S.; Berthelier, J. J.; Blom, C.; Christensen, T.; D'Amato, F.; Di Donfrancesco, G.; Deshler, T.; Diedhiou, A.; Durry, G.; Engelsen, O.; Goutail, F.; Harris, N. R. P.; Kerstel, E. R. T.; Khaykin, S.; Konopka, P.; Kylling, A.; Larsen, N.; Lebel, T.; Liu, X.; MacKenzie, A. R.; Nielsen, J.; Oulanowski, A.; Parker, D. J.; Pelon, J.; Polcher, J.; Pyle, J. A.; Ravegnani, F.; Riviere, E. D.; Robinson, A. D.; Rockmann, T.; Schiller, C.; Simoes, F.; Stefanutti, L.; Stroh, F.; Some, L.; Siegmund, P.; Sitnikov, N.; Vernier, J. P.; Volk, C. M.; Voigt, C.; von Hobe, M.; Viciani, S.; Yushkov, V.

    2010-01-01

    A multi-platform field measurement campaign involving aircraft and balloons took place over West Africa between 26 July and 25 August 2006, in the frame of the concomitant AMMA Special Observing Period and SCOUT-O-3 African tropical activities. Specifically aiming at sampling the upper troposphere a

  17. A Manual of Mosquito Control Projects and Committee Assignments for 4-H and Scouts Biology Class Projects, Organized Community Service Programs, and Individuals Interested in Environmental Management.

    Science.gov (United States)

    Hart, Richard A.

    The mosquito control projects presented in this manual were prepared from an educational viewpoint and are intended for use by students in 4-H and Scouts and as a supplement to high school and college biology course work. The major emphasis of the projects is on integrated pest management, an approach utilizing cost-effective control methods which…

  18. Effects of a behaviour change intervention for Girl Scouts on child and parent energy-saving behaviours

    Science.gov (United States)

    Boudet, Hilary; Ardoin, Nicole M.; Flora, June; Armel, K. Carrie; Desai, Manisha; Robinson, Thomas N.

    2016-08-01

    Energy education programmes for children are hypothesized to have great potential to save energy. Such interventions are often assumed to impact child and family behaviours. Here, using a cluster-randomized controlled trial with 30 Girl Scout troops in Northern California, we assess the efficacy of two social cognitive theory-based interventions focused on residential and food-and-transportation energy-related behaviours of Girl Scouts and their families. We show that Girl Scouts and parents in troops randomly assigned to the residential energy intervention significantly increased their self-reported residential energy-saving behaviours immediately following the intervention and after more than seven months of follow-up, compared with controls. Girl Scouts in troops randomly assigned to the food-and-transportation energy intervention significantly increased their self-reported food-and-transportation energy-saving behaviours immediately following the intervention, compared with controls, but not at follow-up. The results demonstrate that theory-based, child-focused energy interventions have the potential to increase energy-saving behaviours among both children and their parents.

  19. Tracer measurements in the tropical tropopause layer during the AMMA/SCOUT-O3 aircraft campaign

    Directory of Open Access Journals (Sweden)

    C. D. Homan

    2010-04-01

    Full Text Available We present airborne in situ measurements made during the AMMA (African Monsoon Multidisciplinary Analysis/SCOUT-O3 campaign between 31 July and 17 August 2006 on board the M55 Geophysica aircraft, based in Ouagadougou, Burkina Faso. CO2 and N2O were measured with the High Altitude Gas Analyzer (HAGAR, CO was measured with the Cryogenically Operated Laser Diode (COLD instrument, and O3 with the Fast Ozone ANalyzer (FOZAN.

    We analyse the data obtained during five local flights to study the dominant transport processes controlling the tropical tropopause layer (TTL, here ~350–375 K and lower stratosphere above West-Africa: deep convection up to the level of main convective outflow, overshooting of deep convection, and horizontal inmixing across the subtropical tropopause. Besides, we examine the morphology of the stratospheric subtropical barrier.

    Except for the flight of 13 August, distinct minima in CO2 mixing ratios indicate convective outflow of boundary layer air in the TTL. The CO2 profiles show that the level of main convective outflow was mostly located at potential temperatures between 350 and 360 K, and for 11 August reached up to 370 K.

    While the CO2 minima indicate quite significant convective influence, the O3 profiles suggest that the observed convective signatures were mostly not fresh, but of older origin (several days or more. When compared with the mean O3 profile measured during a previous campaign over Darwin in November 2005, the O3 minimum at the main convective outflow level was less pronounced over Ouagadougou. Furthermore O3 mixing ratios were much higher throughout the whole TTL and, unlike over Darwin, rarely showed low values observed in the regional boundary layer.

    Signatures of irreversible mixing following overshooting of convective air were scarce in the tracer data. Some

  20. NOx production by lightning in Hector: first airborne measurements during SCOUT-O3/ACTIVE

    Directory of Open Access Journals (Sweden)

    D. Brunner

    2009-11-01

    Full Text Available During the SCOUT-O3/ACTIVE field phase in November–December 2005, airborne in situ measurements were performed inside and in the vicinity of thunderstorms over northern Australia with several research aircraft (German Falcon, Russian M55 Geophysica, and British Dornier-228. Here a case study from 19 November is presented in detail on the basis of airborne trace gas measurements (NO, NOy, CO, O3 and stroke measurements from the German LIghtning Location NETwork (LINET, set up in the vicinity of Darwin during the field campaign. The anvil outflow from three different types of thunderstorms was probed by the Falcon aircraft: (1 a continental thunderstorm developing in a tropical airmass near Darwin, (2 a mesoscale convective system (MCS, known as Hector, developing within the tropical maritime continent (Tiwi Islands, and (3 a continental thunderstorm developing in a subtropical airmass ~200 km south of Darwin. For the first time detailed measurements of NO were performed in the Hector outflow. The highest NO mixing ratios were observed in Hector with peaks up to 7 nmol mol−1 in the main anvil outflow at ~11.5–12.5 km altitude. The mean NOx (=NO+NO2 mixing ratios during these penetrations (~100 km width varied between 2.2 and 2.5 nmol mol−1. The NOx contribution from the boundary layer (BL, transported upward with the convection, to total anvil-NOx was found to be minor (x (LNOx in the well-developed Hector system was estimated to 0.6–0.7 kg(N s−1. The highest average stroke rate of the probed thunderstorms was observed in the Hector system with 0.2 strokes s−1 (here only strokes with peak currents ≥10 kA contributing to LNOx were considered. The LNOx mass flux and the stroke rate were combined to estimate the LNOx production rate in the different thunderstorm types. For a better comparison with other studies, LINET strokes were scaled with Lightning Imaging Sensor (LIS flashes. The LNOx production rate per LIS flash was estimated

  1. Stratospheric water vapour budget and convection overshooting the tropopause: modelling study from SCOUT-AMMA

    Directory of Open Access Journals (Sweden)

    X. M. Liu

    2010-09-01

    Full Text Available The aim of this paper is to study the impacts of overshooting convection at a local scale on the water distribution in the tropical UTLS. Overshooting convection is assumed to be one of the processes controlling the entry of water vapour mixing ratio in the stratosphere by injecting ice crystals above the tropopause which later sublimate and hydrate the lower stratosphere. For this purpose, we quantify the individual impact of two cases of overshooting convection in Africa observed during SCOUT-AMMA: the case of 4 August 2006 over Southern Chad which is likely to have influenced the water vapour measurements by micro-SDLA and FLASH-B from Niamey on 5 August, and the case of a mesoscale convective system over Aïr on 5 August 2006. We make use of high resolution (down to 1 km horizontally nested grid simulations with the three-dimensional regional atmospheric model BRAMS (Brazilian Regional Atmospheric Modelling System. In both cases, BRAMS succeeds in simulating the main features of the convective activity, as well as overshooting convection, though the exact position and time of the overshoots indicated by MSG brightness temperature difference is not fully reproduced (typically 1° displacement in latitude compared with the overshoots indicated by brightness temperature difference from satellite observations for both cases, and several hours shift for the Aïr case on 5 August 2006. Total water budgets associated with these two events show a significant injection of ice particles above the tropopause with maximum values of about 3.7 ton s−1 for the Chad case (4 August and 1.4 ton s−1 for the Aïr case (5 August, and a total upward cross tropopause transport of about 3300 ton h−1 for the Chad case and 2400 ton h−1 for the Aïr case in the third domain of simulation. The order of magnitude of these modelled fluxes is lower but comparable with similar studies in other tropical areas based on

  2. Search for Resonances Decaying to Dijet Final States at $\\sqrt{s} = 8$ TeV with Scouting Data

    CERN Document Server

    CMS Collaboration

    2015-01-01

    A search for resonances decaying to dijet final states is performed in pp collisions at a center-of-mass energy $\\sqrt{s}=8$ TeV. Using a loose online data selection and a reduced data format collected with a novel technique called $\\textit{data scouting}$, the search extends to low-mass values, testing previously unprobed low couplings. No evidence for a signal is found. The result is interpreted as upper limits on the production cross section as a function of the resonance mass. These limits are translated into an upper limit on the resonance coupling, allowing a comparison with results obtained in the same mass region at lower collision energies.

  3. The Near Earth Object Scout Spacecraft: A Low Cost Approach to in-situ Characterization of the NEO Population

    Science.gov (United States)

    Koontz, Steven L.; Condon, Gerald; Graham, Lee; Bevilacqua, Ricardo

    2014-01-01

    In this paper we describe a micro/nano satellite spacecraft and a supporting mission profile and architecture designed to enable preliminary in-situ characterization of a significant number of Near Earth Objects (NEOs) at reasonable cost. The spacecraft will be referred to as the NEO Scout. NEO Scout spacecraft are to be placed in GTO, GEO, or cis-lunar space as secondary payloads on launch vehicles headed for GTO or beyond and will begin their mission after deployment from the launcher. A distinguishing key feature of the NEO scout system is to design the mission timeline and spacecraft to rendezvous with and land on the target NEOs during close approach to the Earth-Moon system using low-thrust/high- impulse propulsion systems. Mission feasibility and preliminary design analysis are presented along with detailed trajectory calculations. The use of micro/nano satellites in low-cost interplanetary exploration is attracting increasing attention and is the subject of several annual workshops and published design studies (1-4). The NEO population consists of those asteroids and short period comets orbiting the Sun with a perihelion of 1.3 astronomical units or less (5-8). As of July 30, 2013 10065 Near-Earth objects have been discovered. The spin rate, mass, density, surface physical (especially mechanical) properties, composition, and mineralogy of the vast majority of these objects are highly uncertain and the limited available telescopic remote sensing data imply a very diverse population (5-8). In-situ measurements by robotic spacecraft are urgently needed to provide the characterization data needed to support hardware and mission design for more ambitious human and robotic NEO operations. Large numbers of NEOs move into close proximity with the Earth-Moon system every year (9). The JPL Near-Earth Object Human Space Flight Accessible Targets Study (NHATS) (10) has produced detailed mission profile and delta V requirements for various NEO missions ranging from 30

  4. His Majesty Carl XVI Gustav, King of Sweden, Honorary President of the World Scout Foundation, and about 80 fellows, on the occasion of the 48th World Baden-Powell Fellowship Event on Saturday, 18th September 2004

    CERN Document Server

    Patrice Loiez

    2004-01-01

    His Majesty Carl XVI Gustav, King of Sweden, Honorary President of the World Scout Foundation, and about 80 fellows, on the occasion of the 48th World Baden-Powell Fellowship Event on Saturday, 18th September 2004

  5. Red Bull Crisis

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    Additives make Red Bull the first company to test China’s new Food Safety Law "Drink Red Bull when you feel sleepy or tired" is a famous advertising slogan well-known to Chinese. But a recent German

  6. American Red Cross

    Science.gov (United States)

    ... to Help Sand Fire Evacuees » 90% of the Red Cross Workforce are Volunteers Learn More. Search for ... Volunteer» Digital Advocates» SEARCH FOR OPENINGS Shop the Red Cross Store Be Prepared and Ready to Respond ...

  7. Red Wine Over China

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    The color red dominates Chinese life and now growing interest in red wine maintains that trend and ushers in a new fashionable addition to local culture There was a time when trying to find a good red wine in China was a difficult affair. But as with all

  8. A comparative analysis of the Army MQ-8B Fire Scout Vertical Takeoff Unmanned Aerial Vehicle (VTUAV) AND Navy MQ-8B manpower and training requirements

    OpenAIRE

    Raymer, Michael K.

    2009-01-01

    Approved for public release, distribution unlimited The recent increased urgency to combat terrorism and asymmetric threats, combined with the environment in which field troops are forced to operate has created a unique demand for non-standard war fighting capabilities. Beginning in 2004, the U.S. Navy, in a joint effort with the U.S. Army, began jointly testing and evaluating the Northrop Grumman MQ-8B Fire Scout Vertical Take Off Unmanned Aerial Vehicle (VTUAV). This platform has sho...

  9. 微小型侦察机器人遥在控制系统%Telepresence Control System for Microminiature Scout Robot

    Institute of Scientific and Technical Information of China (English)

    姜明; 李科杰; 黄祖光

    2001-01-01

    微小型侦察机器人遥在(telepresence)控制系统有机地把视觉临场感技术和机器人遥在控制技术结合在一起,显著地提高了遥在控制系统的性能。%Telepresence control system for scout robot is described. Vision telepresence technology and the Telepresence control technology are integrated in the system.

  10. Hydrogen peroxide and central redox theory for aerobic life: A tribute to Helmut Sies: Scout, trailblazer, and redox pioneer.

    Science.gov (United States)

    Jones, Dean P

    2016-04-01

    When Rafael Radi and I wrote about Helmut Sies for the Redox Pioneer series, I was disappointed that the Editor restricted us to the use of "Pioneer" in the title. My view is that Helmut was always ahead of the pioneers: He was a scout discovering paths for exploration and a trailblazer developing strategies and methods for discovery. I have known him for nearly 40 years and greatly enjoyed his collegiality as well as brilliance in scientific scholarship. He made monumental contributions to 20th century physiological chemistry beginning with his first measurement of H2O2 in rat liver. While continuous H2O2 production is dogma today, the concept of H2O2 production in mammalian tissues was largely buried for half a century. He continued this leadership in research on oxidative stress, GSH, selenium, and singlet oxygen, during the timeframe when physiological chemistry and biochemistry transitioned to contemporary 21st century systems biology. His impact has been extensive in medical and health sciences, especially in nutrition, aging, toxicology and cancer. I briefly summarize my interactions with Helmut, stressing our work together on the redox code, a set of principles to link mitochondrial respiration, bioenergetics, H2O2 metabolism, redox signaling and redox proteomics into central redox theory. PMID:27095208

  11. Inquiring into Red/Red Inquiring

    Directory of Open Access Journals (Sweden)

    Ken Gale

    2013-05-01

    Full Text Available This layered account of an inquiry into ‘red’ emerged out of a collective biography workshop. In the middle of the Wiltshire countryside, an international and interdisciplinary group of scholars gathered together to write and make other things and marks on paper that asked questions of, and into, the spaces between words, people, things and their environments. We did not set out to workshop or write into or paint ‘red’ but, rather, it was red that slipped in, uninvited, and painted and wrote us. Red arose as a blush or a stain seeping amongst us that became referenced obliquely by material objects, metaphors and fairytales. The stain spread, became noticeable through our weekend together and beyond it, creating another (bright red artery vein of connection to write with.

  12. Experimental information: 1096 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_24_4_3 RED Cy3 Cy5 Zenpei Shimatnai Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Jasmonic acid,JA two-dye methods 2 ...

  13. Experimental information: 1083 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_22_6_5 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... Fisheries Hormonal Hormonal Rice Expression Database ,RED,Time course,Gibberellin,GA3 two-dye methods 20 ...

  14. Experimental information: 1079 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_21_12_11 RED Cy3 Cy5 Zenpei Shimatani Society for Techno-Innovation of Agriculture, Forestr ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Abscisic acid,ABA two-dye methods ...

  15. Experimental information: 1101 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_24_14_13 RED Cy3 Cy5 Zenpei Shimatnai Society for Techno-Innovation of Agriculture, Forestr ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Jasmonic acid,JA two-dye methods 2 ...

  16. Experimental information: 1091 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_23_8_7 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Brassinosteroide,Br two-dye method ...

  17. Experimental information: 1092 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_23_10_9 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Brassinosteroide,Br two-dye method ...

  18. Experimental information: 1077 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_21_8_7 RED Cy3 Cy5 Zenpei Shimatani Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Abscisic acid,ABA two-dye methods ...

  19. Experimental information: 1082 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_22_4_3 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... Fisheries Hormonal Hormonal Rice Expression Database ,RED,Time course,Gibberellin,GA3 two-dye methods 20 ...

  20. Experimental information: 1097 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_24_6_5 RED Cy3 Cy5 Zenpei Shimatnai Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Jasmonic acid,JA two-dye methods 2 ...

  1. Experimental information: 1100 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_24_12_11 RED Cy3 Cy5 Zenpei Shimatnai Society for Techno-Innovation of Agriculture, Forestr ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Jasmonic acid,JA two-dye methods 2 ...

  2. Experimental information: 1085 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_22_10_9 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... Fisheries Hormonal Hormonal Rice Expression Database ,RED,Time course,Gibberellin,GA3 two-dye methods 20 ...

  3. Experimental information: 1088 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_23_2_1 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Brassinosteroide,Br two-dye method ...

  4. Experimental information: 1090 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_23_6_5 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Brassinosteroide,Br two-dye method ...

  5. Experimental information: 1076 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_21_6_5 RED Cy3 Cy5 Zenpei Shimatani Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Abscisic acid,ABA two-dye methods ...

  6. Experimental information: 1099 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_24_10_9 RED Cy3 Cy5 Zenpei Shimatnai Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Jasmonic acid,JA two-dye methods 2 ...

  7. Experimental information: 1084 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_22_8_7 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Gibberellin,GA3 two-dye methods 20 ...

  8. Experimental information: 1087 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_22_14_13 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry an ... d Fisheries Hormonal Hormonal Rice Expression Database ,RED,Time course,Gibberellin,GA3 two-dye methods 20 ...

  9. Experimental information: 1094 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_23_14_13 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry an ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Brassinosteroide,Br two-dye method ...

  10. Experimental information: 1089 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_23_4_3 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Brassinosteroide,Br two-dye method ...

  11. Experimental information: 1075 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_21_4_3 RED Cy3 Cy5 Zenpei Shimatani Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Abscisic acid,ABA two-dye methods ...

  12. Experimental information: 1080 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_21_14_13 RED Cy3 Cy5 Zenpei Shimatani Society for Techno-Innovation of Agriculture, Forestr ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Abscisic acid,ABA two-dye methods ...

  13. Experimental information: 1098 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_24_8_7 RED Cy3 Cy5 Zenpei Shimatnai Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Jasmonic acid,JA two-dye methods 2 ...

  14. Experimental information: 1095 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_24_2_1 RED Cy3 Cy5 Zenpei Shimatnai Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Jasmonic acid,JA two-dye methods 2 ...

  15. Experimental information: 1086 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_22_12_11 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry an ... d Fisheries Hormonal Hormonal Rice Expression Database ,RED,Time course,Gibberellin,GA3 two-dye methods 20 ...

  16. Experimental information: 1078 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_21_10_9 RED Cy3 Cy5 Zenpei Shimatani Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Abscisic acid,ABA two-dye methods ...

  17. Experimental information: 1081 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_22_2_1 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Gibberellin,GA3 two-dye methods 20 ...

  18. Experimental information: 1074 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_21_2_1 RED Cy3 Cy5 Zenpei Shimatani Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Abscisic acid,ABA two-dye methods ...

  19. Experimental information: 1093 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_23_12_11 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry an ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Brassinosteroide,Br two-dye method ...

  20. Probe data: 5652 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-002330-1AR RED D41273 AU174297 ST3645 >AGU83687_1(U83687|pid:g1835701) Apium graveolens NADP ... H-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  1. Next generation red teaming

    CERN Document Server

    Dalziel, Henry

    2015-01-01

    Red Teaming is can be described as a type of wargaming.In private business, penetration testers audit and test organization security, often in a secretive setting. The entire point of the Red Team is to see how weak or otherwise the organization's security posture is. This course is particularly suited to CISO's and CTO's that need to learn how to build a successful Red Team, as well as budding cyber security professionals who would like to learn more about the world of information security. Teaches readers how to dentify systemic security issues based on the analysis of vulnerability and con

  2. Inteligencia de red

    OpenAIRE

    Barba Martí, Antonio; Hesselbach Serra, Xavier

    2002-01-01

    Bibliografia Actualmente existe una necesidad cada vez mayor de ofrecer servicios de red avanzados, que proporcionen un alto valor añadido al cliente. Eso es ya posible gracias a las nuevas capacidades de computación añadidas a los nodos de red, que proporcionan inteligencia y facilitan la gestión de red a los operadores y proveedores de servicios. En este texto, se presentan las nuevas redes inteligentes basadas en señalización número 7, los nuevos servicios sobre Internet (voz sobre IP, ...

  3. Experimental information: 225 [RED

    Lifescience Database Archive (English)

    Full Text Available 2202_21_1_2 RED Cy3 Cy3 Masaaki Umeda The University of Tokyo Cell ... cycle Transgenic Cell ... cycle T ... ransgenic cell ... division,cell ... cycle,cyclin,CDK,transgenic plant on ...

  4. Experimental information: 226 [RED

    Lifescience Database Archive (English)

    Full Text Available 2202_21_1_3 RED Cy3 Cy3 Masaaki Umeda The University of Tokyo Cell ... cycle Transgenic Cell ... cycle T ... ransgenic cell ... division,cell ... cycle,cyclin,CDK,transgenic plant on ...

  5. Probe data: 2827 [RED

    Lifescience Database Archive (English)

    Full Text Available R06-035040-2AR RED C72992 AU101214 E02619 EB2619 >(P35339) EXOPOLYGALACTURONASE PRECURSOR (EC 3. ... 2.1.67) (EXOPG) (PECTINASE ) (GALACTURAN 1,4-ALPHA-GALACTURONIDASE). &S30067(S ...

  6. Probe data: 6229 [RED

    Lifescience Database Archive (English)

    Full Text Available R03-061580-1AR RED AU108708 C96917 C50119 CG0119 >(P52424) PHOSPHORIBOSYLFORMYLGLYCINAMIDINE CYC ... LO-LIGASE PRECURSOR (EC 6.3.3.1) (AIR S) (PHOSPHORIBOSYL-AMINOIMIDAZOLE SYNTHETASE) (AIR ...

  7. Experimental information: 1043 [RED

    Lifescience Database Archive (English)

    Full Text Available 2112_21_11_12 RED Cy3 Cy5 Toru Fujiwara Agricultural and Life Sciences, The University of Tokyo ... Nutrient Metabolism Nutrient Metabolism sulfur nutrition ,root,O-acetyl-L-serine,gluthatione,time course two ...

  8. Experimental information: 1038 [RED

    Lifescience Database Archive (English)

    Full Text Available 2112_21_1_2 RED Cy3 Cy5 Toru Fujiwara Agricultural and Life Sciences, The University of Tokyo Nu ... trient Metabolism Nutrient Metabolism sulfur nutrition ,root,O-acetyl-L-serine,gluthatione,time course two ...

  9. Experimental information: 1040 [RED

    Lifescience Database Archive (English)

    Full Text Available 2112_21_5_6 RED Cy3 Cy5 Toru Fujiwara Agricultural and Life Sciences, The University of Tokyo Nu ... trient Metabolism Nutrient Metabolism sulfur nutrition ,root,O-acetyl-L-serine,gluthatione,time course two ...

  10. Experimental information: 1042 [RED

    Lifescience Database Archive (English)

    Full Text Available 2112_21_9_10 RED Cy3 Cy5 Toru Fujiwara Agricultural and Life Sciences, The University of Tokyo N ... utrient Metabolism Nutrient Metabolism sulfur nutrition ,root,O-acetyl-L-serine,gluthatione,time course two ...

  11. Experimental information: 1039 [RED

    Lifescience Database Archive (English)

    Full Text Available 2112_21_3_4 RED Cy3 Cy5 Toru Fujiwara Agricultural and Life Sciences, The University of Tokyo Nu ... trient Metabolism Nutrient Metabolism sulfur nutrition ,root,O-acetyl-L-serine,gluthatione,time course two ...

  12. Experimental information: 1041 [RED

    Lifescience Database Archive (English)

    Full Text Available 2112_21_7_8 RED Cy3 Cy5 Toru Fujiwara Agricultural and Life Sciences, The University of Tokyo Nu ... trient Metabolism Nutrient Metabolism sulfur nutrition ,root,O-acetyl-L-serine,gluthatione,time course two ...

  13. Probe data: 3426 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-002330-1AR RED C26646 AU108627 C12762 CB2762 >AGU83687_1(U83687|pid:g1835701) Apium graveole ... ns NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  14. Probe data: 779 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-002330-1AR RED D48175 AU032804 S14252 SS4252 >AGU83687_1(U83687|pid:g1835701) Apium graveole ... ns NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  15. Probe data: 3773 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-002330-1AR RED AU163183 AU163184 S00625 ST0625 >AGU83687_1(U83687|pid:g1835701) Apium graveo ... lens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  16. A Mobile Asteroid Surface Scout (MASCOT) for the Hayabusa 2 Mission to 1999 JU3: The Scientific Approach

    Science.gov (United States)

    Jaumann, Ralf; Bibring, Jean-Piere; Glassmeier, Karl-Heiz; Grott, Mathias; Ho, Tra-Mi; Ulamec, Stefan; Schmitz, Nicole; Auster, Ulrich; Biele, Jens; Kuninaka, Hitoshi; Okada, Tatsuaki; Yoshikawa, Makoto; Watanabe, Sei-ichiro; Fujimoto, Masaki; Spohn, Tilman; Koncz, Aalexander; Hercik, Davis; Michaelis, Harald

    2015-04-01

    MASCOT, a Mobile Asteroid Surface Scout, will support JAXA's Hayabusa 2 mission to investigate the C-type asteroid 1999 JU3 (1). The German Aer-ospace Center (DLR) develops MASCOT with contributions from CNES (France) (2,3,4). Main objective is to in-situ map the asteroid's geomorphol-ogy, the intimate mixture, texture and composition of the regolith (dust, soil and rocks), and the thermal, mechanical, and magnetic properties of the sur-face in order to provide ground truth for the orbiter remote measurements, support the selection of sampling sites, and provide context information for the returned samples. MASCOT comprises a payload of four scientific in-struments: camera, radiometer, magnetometer and hyperspectral microscope. C- and D-type asteroids hold clues to the origin of the solar system, the for-mation of planets, the origins of water and life on Earth, the protection of Earth from impacts, and resources for future human exploration. C- and D-types are dark and difficult to study from Earth, and have only been glimpsed by spacecraft. While results from recent missions (e.g., Hayabusa, NEAR (5, 6, 7)) have dramatically increased our understanding of asteroids, important questions remain open. For example, characterizing the properties of asteroid regolith in-situ would deliver important ground truth for further understanding telescopic and orbital observations and samples of such asteroids. MASCOT will descend and land on the asteroid and will change its own position up to two times by hopping. This enables measurements during descent, at the landing and hopping positions #1-3, and during hopping. Hayabusa 2 together with MASCOT launched December 3rd 2014, will arrive at 1999JU3 in 2018 and return samples back to Earth in 2020. References: (1) Vilas, F., Astronomical J. 1101-1105, 2008; (2) Ulamec, S., et al., Acta Astronautica, Vol. 93, pp. 460-466; (3) Jaumann et al., 45th LPSC, #1812, Houston; (4) Ho et al., 45th LPSC, #2535, Houston; (5) Spe-cial Issue

  17. Galaxy Zoo: Passive Red Spirals

    CERN Document Server

    Masters, Karen L; Romer, A Kathy; Nichol, Robert C; Bamford, Steven P; Schawinski, Kevin; Lintott, Chris J; Andreescu, Dan; Campbell, Heather C; Crowcroft, Ben; Doyle, Isabelle; Edmondson, Edward M; Murray, Phil; Raddick, M Jordan; Slosar, Anze; Szalay, Alexander S; Vandenberg, Jan

    2009-01-01

    We study the spectroscopic properties and environments of red spiral galaxies found by the Galaxy Zoo project. By carefully selecting face-on, disk dominated spirals we construct a sample of truly passive disks (not dust reddened, nor dominated by old stellar populations in a bulge). As such, our red spirals represent an interesting set of possible transition objects between normal blue spirals and red early types. We use SDSS data to investigate the physical processes which could have turned these objects red without disturbing their morphology. Red spirals prefer intermediate density regimes, however there are no obvious correlations between red spiral properties and environment - environment alone is not sufficient to determine if a galaxy will become a red spiral. Red spirals are a small fraction of spirals at low masses, but dominate at large stellar masses - massive galaxies are red independent of morphology. We confirm that red spirals have older stellar populations and less recent star formation than ...

  18. SEA-based dynamic assessment of artillery air power scout efficiency%基于SEA的炮兵空中力量侦察效能动态评估

    Institute of Scientific and Technical Information of China (English)

    薛向锋; 侯智斌; 孙彦飞

    2012-01-01

    With status continuous promotion of the air scout force applied to Artillery, the real-time, scientificalness and rationality of scout efficiency assessment will affect war course directly. Based on the SEA method, the calibration for three main performances of artillery air-power scout efficiency are proposed. The SEA model for evaluating the dynamic efficiency of artillery air-power system is established under the war conditions. The foundation for the reasonable application of the artillery air-power scout and for commander to make decision timely and right was established.%随着空中侦察力量在炮兵侦察中的地位不断提升,其效能评估的实时性、科学性以及合理性将直接影响到战争进程.基于SEA方法,提出了针对炮兵空中力量侦察效能的三个主要性能度量,结合具体战场环境的军事想定,建立了炮兵空中力量侦察效能的动态评估模型,为炮兵空中侦察力量的合理运用、指挥员做出正确决策指挥奠定了坚实的基础.

  19. Red giant seismology: Observations

    Directory of Open Access Journals (Sweden)

    Mosser B.

    2013-03-01

    Full Text Available The CoRoT and Kepler missions provide us with thousands of red-giant light curves that allow a very precise asteroseismic study of these objects. Before CoRoT and Kepler, the red-giant oscillation patterns remained obscure. Now, these spectra are much more clear and unveil many crucial interior structure properties. For thousands of red giants, we can derive from seismic data precise estimates of the stellar mass and radius, the evolutionary status of the giants (with a clear difference between clump and RGB stars, the internal differential rotation, the mass loss, the distance of the stars... Analyzing this amount of information is made easy by the identification of the largely homologous red-giant oscillation patterns. For the first time, both pressure and mixed mode oscillation patterns can be precisely depicted. The mixed-mode analysis allows us, for instance, to probe directly the stellar core. Fine details completing the red-giant oscillation pattern then provide further information on the interior structure, including differential rotation.

  20. 技术搜索对企业开放式创新影响的理论述评%A Theoretic Review of the Impact of Technology Scouting on Open Innovation in Firms

    Institute of Scientific and Technical Information of China (English)

    闫春

    2013-01-01

    Abstract Based on literal analysis, the article distinguished technology scouting and other relevant terms, especially the similarity and difference between technology scouting and competitive technology intelligence (CTI), and clarified the particularity of technology scou-ting. Then, the categorization of methods of technology scouting and its procedure phases were discussed, including the changes and trends of means of technology scouting under the background of open innovation. After that, the thesis mainly epurated two conclusions about how technology scouting impacts firms’ open innovation: technology scouting can promote open innovation, but it can bring a two-side impact on open innovation performance, which are positive and negative respectively. In the end, taking the comment on extant research progress as basis, the thesis put forward two research themes deserving to carry out further exploration in future%  在文献分析的基础上,辨析了技术搜索及与之相关的其他概念,尤其是技术搜索与技术竞争情报(CTI)在概念与内涵上的异同,明晰了开放式创新背景下技术搜索的独特性。之后讨论了技术搜索的方法分类与流程阶段划分,并对开放式创新背景下技术搜索方式的变革趋势进行了归纳。然后,重点提炼出技术搜索对企业开放式创新影响的两个结论:技术搜索对开放式创新有促进作用,可是其对创新绩效却有着积极与消极双重影响。最后,在评论现有研究进展的基础上对未来有待进一步深入探索的两个研究主题进行了展望。

  1. Little Red Riding Hood

    Institute of Scientific and Technical Information of China (English)

    胡蓉

    2011-01-01

    你一定看过并知道小红帽(Little Red Riding Hood)的故事吧!下面是英语版的小红帽,你看过吗? Once upon a time,people liked a little girl very much.Her red hood(头巾 ) fit her, so people called her Little Red Riding Hood. One day,her mother said, "Take a piece of cake and a bottle ofwine to your grandmother.She is ill and weak.These will do her good.Donot run off the road,or you may fall and break the bottle,and then yourgrandmother will get nothing.OK! Go at once."

  2. Red rover: inside the story of robotic space exploration, from genesis to the mars rover curiosity

    CERN Document Server

    Wiens, Roger

    2013-01-01

    In its eerie likeness to Earth, Mars has long captured our imaginations—both as a destination for humankind and as a possible home to extraterrestrial life. It is our twenty-first century New World; its explorers robots, shipped 350 million miles from Earth to uncover the distant planet’s secrets.Its most recent scout is Curiosity—a one-ton, Jeep-sized nuclear-powered space laboratory—which is now roving the Martian surface to determine whether the red planet has ever been physically capable of supporting life. In Red Rover, geochemist Roger Wiens, the principal investigator for the ChemCam laser instrument on the rover and veteran of numerous robotic NASA missions, tells the unlikely story of his involvement in sending sophisticated hardware into space, culminating in the Curiosity rover's amazing journey to Mars.In so doing, Wiens paints the portrait of one of the most exciting scientific stories of our time: the new era of robotic space exploration. Starting with NASA’s introduction of the Discovery...

  3. Impact of image noise levels, scout scan dose and lens shield on image quality and radiation exposure in z-axis dose-modulated neck MSCT on 16- and 64-slice Toshiba Aquilion scanners

    International Nuclear Information System (INIS)

    Objective: Assessing the impact of image noise (IN) levels, scout scan dose and lens shield use on image quality and radiation exposure in neck multislice CT (MSCT) when using z-axis dose modulation (DM). Methods: Neck MSCT phantom studies with/without z-axis DM were performed by using different IN levels (S.D. 7.5-30 HU) and scout scan tube currents (7.5-50 mA) on Toshiba Aquilion scanners (16-/64-slice). Image quality indices were evaluated by two radiologists and radiation exposure parameters calculated. Cadaveric phantom measurements elucidated lens shield interactions with DM efficacy. The lowest dose scan protocol with diagnostic image quality was introduced into the clinical imaging routine and retrospectively evaluated in 20 age-matched patients undergoing neck MSCT with/without DM. Results: The highest image noise level in DM neck studies with comparable image quality to standard neck CT amounted to 20 HU, resulting in a mean tube current of 50 mAs (CTDIw 6.3 mGy). DM reduced effective dose by 35% and organ dose figures (lens, thyroid) by 33%. Scout scan dose lowering to 20 mA resulted in an effective dose (ED) decrease of 0.06 mSv (5%). Avoiding lens shield placement during scout scan effected an organ dose decrease of 20%. Overall contour sharpness and image contrast did not differ significantly (DM/without DM) whereas image noise was rated higher in DM neck CT studies (p < 0.05). Conclusions: z-Axis dose modulation, as assessed on 16- and 64-slice Toshiba Aquilion scanners, is effective and mandatory in neck MSCT. DM efficacy can be enhanced by optimising scout scan doses and lens shield use.

  4. BallFinder SCOUTE

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    在宽阔的高尔夫球场上玩上一次高尔夫球是让很多人羡慕的事,不过,谁体会过当初学者把球一次次打进一堆草堆后辛苦寻找的麻烦。这个问题很快能被解决了。

  5. Scouting's Explorer Program

    Science.gov (United States)

    Claerhout, John M.

    1970-01-01

    This article suggests the relationship which the Explorer program could have with colleges, employers, and the students and employees of the future. Exploring as a process of finding out can help young people find their identity, personally and vocationally, and enable college carrer counselors to expand on a sound foundation of vocational…

  6. Probe data: 5037 [RED

    Lifescience Database Archive (English)

    Full Text Available R12-044780-1AR RED AU173063 AU173064 RA0155 >XLU37373_1(U37373|pid:g1234787) Xenopus laevis tail ... -specific thyroid ... hormone up-regulated (gene 5) mRNA, complete cds; ... up-regulated by thyroid ... hormone in tadpoles; expressed specifically in the ...

  7. Probe data: 5576 [RED

    Lifescience Database Archive (English)

    Full Text Available R03-047910-1AR RED AU174190 AU174191 ST1070 >XLU37373_1(U37373|pid:g1234787) Xenopus laevis tail ... -specific thyroid ... hormone up-regulated (gene 5) mRNA, complete cds; ... up-regulated by thyroid ... hormone in tadpoles; expressed specifically in the ...

  8. Probe data: 6197 [RED

    Lifescience Database Archive (English)

    Full Text Available R07-048110-1AR RED D22267 C96749 C10642 CB0642 >TAU87163_1(U87163|pid:g2306768) Triticum aestivu ... eta subunit mRNA, complete cds; assignment of open reading ... frame based on alignment with other plant eIF2 sub ...

  9. Probe data: 2895 [RED

    Lifescience Database Archive (English)

    Full Text Available R03-021800-1AR RED C19773 AU101326 E10917 EC0917 >TAU87163_1(U87163|pid:g2306768) Triticum aesti ... eta subunit mRNA, complete cds; assignment of open reading ... frame based on alignment with other plant eIF2 sub ...

  10. Probe data: 5564 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-057040-1AR RED D39512 AU174175 ST0896 >SPAC19A8_12(Z98974|pid:g2388911) S.pombe chromosome I ... ar eg. to YNL118C, PSU1_YEAST, P53550, involved in respiration , (970aa), fasta scores, opt:776, E():0, (29.1% ide ...

  11. Probe data: 5495 [RED

    Lifescience Database Archive (English)

    Full Text Available R09-031940-1R RED D48735 AU174075 SS5125 >SPBC215_13(AL033534|pid:g3873550) S.pombe chromosome I ... 932 aa), fasta scores: opt: 694, E():8e-27, (41.8% identity ... in 457 aa). ...

  12. Probe data: 2587 [RED

    Lifescience Database Archive (English)

    Full Text Available R11-011010-4R RED AU062718 AU100766 C30311 CE0311 >AE000959_10(AE000959|pid:g2648442) Archaeoglo ... similar to GB:X79560 SP:P46464 PID:517390 percent identity : 61.98; identified by sequence similarity; putativ ...

  13. Probe data: 3857 [RED

    Lifescience Database Archive (English)

    Full Text Available R06-042830-1AR RED AU064223 AU164111 ED0143 >AE001019_19(AE001019|pid:g2649345) Archaeoglobus fu ... similar to GB:L77117 SP:Q60179 PID:1591690 percent identity : 39.38; identified by sequence similarity; putativ ...

  14. Probe data: 3925 [RED

    Lifescience Database Archive (English)

    Full Text Available R03-019390-1AR RED AU164858 AU164859 EH1645 >AP000005_67(AP000005|pid:g3257577) Pyrococcus horik ... position (5/7); similar to owl:HPAE0006332 percent identity :27.451 in 212aa; Swiss_Prot:P44659 percent identit ...

  15. Probe data: 3184 [RED

    Lifescience Database Archive (English)

    Full Text Available R05-006300-1AR RED D48993 AU101824 S15595 SS5595 >AE001130_3(AE001130|pid:g2688094) Borrelia bur ... SP:P17580 GB:M24503 PID:290500 PID:551840 percent identity : 38.99; identified by sequence similarity; putativ ...

  16. Probe data: 5521 [RED

    Lifescience Database Archive (English)

    Full Text Available R03-030160-1AR RED AU174105 AU174106 SS6038 >ATNAP16KD_1(Z96936|pid:g2765837) Arabidopsis thalia ... ociated protein NAP16kDa; pos. 112 to 116 sequence identity ... to nitrilase isoform 1 and 2. ...

  17. Probe data: 5482 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-017290-1AR RED AU174055 AU174056 SS4954 >AE000956_15(AE000956|pid:g2648379) Archaeoglobus fu ... e genome; similar to PID:1045016 SP:Q51790 percent identity : 31.21; identified by sequence similarity; putativ ...

  18. Probe data: 364 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-031580-1AR RED AU075434 AU031062 E60705 EH0705 >AF036618_1(AF036618|pid:g2708624) Arabidopsi ... thaliana acetyl-CoA synthetase mRNA, complete cds; identity ... based on similarity to known acetyl-CoA synthetase ...

  19. Probe data: 252 [RED

    Lifescience Database Archive (English)

    Full Text Available R09-033840-1AR RED AU162299 AU030444 E51070 EG1070 >AE000968_9(AE000968|pid:g2648586) Archaeoglo ... similar to GB:L77117 SP:Q57665 PID:1498988 percent identity : 60.92; identified by sequence similarity; putativ ...

  20. Probe data: 4505 [RED

    Lifescience Database Archive (English)

    Full Text Available R01-017940-1AR RED AU166950 AU166951 CH0192 >AE001265_11(AE001265|pid:g3323304) Treponema pallid ... the complete genome; similar to GP:606359 percent identity : 29.47; identified by sequence similarity; putativ ...

  1. Probe data: 1244 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-038610-1AR RED AU057404 AU057405 S21415 SA1415 >SPAC57A7_5(Z95396|pid:g2104440) S.pombe chro ... 5 aa), fasta scores: opt: 199, E():0.00029, (20.5% identity ... in 366 aa). ...

  2. Probe data: 5087 [RED

    Lifescience Database Archive (English)

    Full Text Available R07-015750-1AR RED D24254 AU173174 RA1586 >AE001048_5(AE001048|pid:g2649798) Archaeoglobus fulgi ... e genome; similar to GB:L77117 PID:1591676 percent identity : 48.77; identified by sequence similarity; putativ ...

  3. Probe data: 1808 [RED

    Lifescience Database Archive (English)

    Full Text Available R01-015680-1AR RED C72327 AU078752 EB1437 >AE000949_5(AE000949|pid:g2648274) Archaeoglobus fulgi ... of 172 of the complete genome; similar to percent identity : 28.02; identified by sequence similarity; putativ ...

  4. Probe data: 5456 [RED

    Lifescience Database Archive (English)

    Full Text Available R08-023200-1AR RED D47972 AU174021 SS3803 >AE001011_18(AE001011|pid:g2649239) Archaeoglobus fulg ... the complete genome; similar to SP:P24297 percent identity : 67.92; identified by sequence similarity; putativ ...

  5. Probe data: 4990 [RED

    Lifescience Database Archive (English)

    Full Text Available R12-008240-1AR RED AU064916 AU172911 EF0791 >AF052429_1(AF052429|pid:g2981214) Zea mays photosys ... tem I complex PsaN subunit precursor (psaN) mRNA, nuclear ... gene encoding chloroplast protein, partial cds; nu ...

  6. Probe data: 581 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-011070-2AR RED AU031849 AU031850 R02164 RA2164 >XLU69669_1(U69669|pid:g1850344) Xenopus laev ... is nuclear ... pore complex-associated protein TPR (tpr) mRNA, pa ... rtial cds; nuclear ... pore complex-associated protein; translocated prom ...

  7. Probe data: 6247 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-008440-1AR RED C26839 C96955 C50194 CG0194 >ATF19H22_3(AL035679|pid:g4539312) Arabidopsis th ... 778, T76313, H76773, T76734 are in 3' untranslated region ; EST T42894 covers intron in 5' untranslated regio ...

  8. Probe data: 5314 [RED

    Lifescience Database Archive (English)

    Full Text Available R03-013800-1AR RED AU065355 AU173508 RA3452 >DOG01_1(D43756|pid:g1304047) Dog gene for fibrinoge ... n A-alpha-chain, partial cds (C-terminal region ); carboxy-terminal region . ...

  9. Probe data: 5984 [RED

    Lifescience Database Archive (English)

    Full Text Available RED AU174977 AU174976 FL0119 >OLRKLP2_1(U72725|pid:g2586083) Oryza longistaminata receptor kinas ... e-like protein gene, family ... member A1, complete cds; Xa21 gene family ... member A ... of microsatellite region; disease resistance gene family ... member. ...

  10. Probe data: 5952 [RED

    Lifescience Database Archive (English)

    Full Text Available RED AU174907 AU174908 FL0036 >OLRKLP2_1(U72725|pid:g2586083) Oryza longistaminata receptor kinas ... e-like protein gene, family ... member A1, complete cds; Xa21 gene family ... member A ... of microsatellite region; disease resistance gene family ... member. ...

  11. Probe data: 991 [RED

    Lifescience Database Archive (English)

    Full Text Available R06-046410-1AR RED AU162658 AU056152 S20333 SA0333 >CAN012165_1(AJ012165|pid:g3808101) Capsicum ... for chloroplast protease (CACP)from the AAA atpase family ; AAA atpase family . ...

  12. Probe data: 2696 [RED

    Lifescience Database Archive (English)

    Full Text Available R07-042870-1AR RED AU101001 AU101000 C62681 CH2681 >AF078103_1(AF078103|pid:g4218945) Homo sapie ... ns developmentally regulated GTP-binding protein (DRG ) mRNA, complete cds. &HSA005940_1(AJ005940|pid:g41 ...

  13. Probe data: 2995 [RED

    Lifescience Database Archive (English)

    Full Text Available R11-007900-2AR RED AU030559 AU101484 E51237 EG1237 >AF020193_1(AF020193|pid:g2895198) Glycine ma ... x DNA ... polymerase delta (Pol delta) mRNA, complete cds; D ... NA-dependent DNA ... polymerase. ...

  14. Probe data: 3754 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-042000-1AR RED D48054 AU162984 SS3984 >CELZC13_4(U67953|pid:g1519683) Caenorhabditis elegans ... ity to EGF-like domain cysteine pattern signature (PS :PS 00022); coded for by C. elegans cDNA yk70d5.3; c ...

  15. Probe data: 4083 [RED

    Lifescience Database Archive (English)

    Full Text Available R08-045490-1AR RED AU077699 AU166249 E50587 EG0587 >MEU72662_12(U72662|pid:g2160684) Methylobact ... tative ABC transporter ATP-binding subunit (abcC), methanol ... dyhydrogenase large subunit homolog (mxaF'), cytoc ...

  16. Probe data: 4655 [RED

    Lifescience Database Archive (English)

    Full Text Available R03-018670-1AR RED C72142 AU172460 EB1070 >TDU89271_1(U89271|pid:g1877482) Tripsacum dactyloides ... short-chain alcohol dehydrogenase (gynomonoecious sex ... form 1) gene, allele gsf1, complete cds; similar t ...

  17. Probe data: 5077 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-043650-1AR RED AU173162 AU173163 RA1507 >AF057183_1(AF057183|pid:g3264596) Zea mays putative ... nscript 1 (HIT1); induced by submergence, hypoxia, mechanical ... impedence, and 40% O2 conditions. ...

  18. Probe data: 487 [RED

    Lifescience Database Archive (English)

    Full Text Available R05-018490-1AR RED D23861 AU031673 R00448 RA0448 >OSU30479_1(U30479|pid:g1041712) Oryza sativa e ... 3 (Os-EXP3) mRNA, complete cds; induces extension (creep ) in plant cell walls; former gene name RiExD. ...

  19. Probe data: 3148 [RED

    Lifescience Database Archive (English)

    Full Text Available R12-043420-1AR RED D47342 AU101752 S12658 SS2658 >(P38076) CYSTEINE SYNTHASE (EC 4.2.99.8) (O -AC ... ETYLSERINE SULFHYDRYLASE) (O -ACETYLSERINE (THIO L)-LYASE) (CSASE). &JS0762(JS076 ...

  20. Probe data: 3928 [RED

    Lifescience Database Archive (English)

    Full Text Available R03-053360-1AR RED AU164935 AU164936 E61827 EH1827 >(Q43317) CYSTEINE SYNTHASE (EC 4.2.99.8) (O - ... ACETYLSERINE SULFHYDRYLASE) (O -ACETYLSERINE (THIO L)-LYASE) (CSASE). &CNAPCCS7_1(D ...

  1. Probe data: 4200 [RED

    Lifescience Database Archive (English)

    Full Text Available R03-028920-1AR RED AU062597 AU166443 CB2410 >EBV_10(V01555|pid:g1334843) Epstein-Barr virus (EBV ... stoid cell line immortalized with human EBV from a mononucleosis ... patient; BWRF1 reading frame 8; Protein sequence i ...

  2. Probe data: 4637 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-008940-1AR RED C71953 AU172434 EB0676 >ATF10M23_3(AL035440|pid:g4455192) Arabidopsis thalian ... weak similarity to hypothetical protein PFB0835c - malaria , PID:g3845289; contains EST gb:T42321, R65259, Aa7 ...

  3. Probe data: 6350 [RED

    Lifescience Database Archive (English)

    Full Text Available R11-026990-1AR RED C97557 C97558 C60385 CH0385 >HTU32872_1(U32872|pid:g1463038) Human T-cell lym ... photropic virus type 2 rex and tax ... genes, partial cds, clone SP2; putative. &HTU32875 ...

  4. Probe data: 2820 [RED

    Lifescience Database Archive (English)

    Full Text Available R03-000280-1AR RED C72958 AU101205 E02550 EB2550 >S39445(S39445;A42119) DNA-directed RNA polymer ... ase (EC 2.7.7.6) II chain 9, 15K - fruit fly ... (Drosophila melanogaster) &S66940_1(S66940|pid:g45 ...

  5. Probe data: 3103 [RED

    Lifescience Database Archive (English)

    Full Text Available R09-032390-1AR RED D39322 AU101671 R03330 RA3330 >ATT5C23_17(AL049500|pid:g4539465) Arabidopsis ... e 4, BAC clone T5C23 (ESSA project); similarity to Fly ... Fas-associated factor (FFAF), Drosophila melanogas ...

  6. Probe data: 3422 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-049940-1AR RED C96862 AU108608 C12691 CB2691 >ZMU43082_1(U43082|pid:g1421730) Zea mays T cyt ... oplasm male ... sterility restorer factor 2 (rf2) mRNA, complete c ... +B73; putative aldehyde dehydrogenase; T cytoplasm male ... sterility. ...

  7. Probe data: 1384 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-049940-1AR RED AU068083 AU068084 C11828 CB1828 >ZMU43082_1(U43082|pid:g1421730) Zea mays T c ... ytoplasm male ... sterility restorer factor 2 (rf2) mRNA, complete c ... +B73; putative aldehyde dehydrogenase; T cytoplasm male ... sterility. ...

  8. Probe data: 5862 [RED

    Lifescience Database Archive (English)

    Full Text Available R06-016110-1AR RED AU174691 AU174690 FE0214 >ZMU43082_1(U43082|pid:g1421730) Zea mays T cytoplas ... m male ... sterility restorer factor 2 (rf2) mRNA, complete c ... +B73; putative aldehyde dehydrogenase; T cytoplasm male ... sterility. ...

  9. Probe data: 635 [RED

    Lifescience Database Archive (English)

    Full Text Available R01-039520-1AR RED D39230 AU031992 R03072 RA3072 >ZMU43082_1(U43082|pid:g1421730) Zea mays T cyt ... oplasm male ... sterility restorer factor 2 (rf2) mRNA, complete c ... +B73; putative aldehyde dehydrogenase; T cytoplasm male ... sterility. ...

  10. Probe data: 2296 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-049940-1AR RED C19367 AU094406 E10314 EC0314 >ZMU43082_1(U43082|pid:g1421730) Zea mays T cyt ... oplasm male ... sterility restorer factor 2 (rf2) mRNA, complete c ... +B73; putative aldehyde dehydrogenase; T cytoplasm male ... sterility. ...

  11. Probe data: 3192 [RED

    Lifescience Database Archive (English)

    Full Text Available R06-016110-1AR RED AU101840 AU101841 S15881 SS5881 >ZMU43082_1(U43082|pid:g1421730) Zea mays T c ... ytoplasm male ... sterility restorer factor 2 (rf2) mRNA, complete c ... +B73; putative aldehyde dehydrogenase; T cytoplasm male ... sterility. ...

  12. Probe data: 1631 [RED

    Lifescience Database Archive (English)

    Full Text Available R01-039510-1AR RED AU075853 AU075854 S20436 SA0436 >ZMU43082_1(U43082|pid:g1421730) Zea mays T c ... ytoplasm male ... sterility restorer factor 2 (rf2) mRNA, complete c ... +B73; putative aldehyde dehydrogenase; T cytoplasm male ... sterility. ...

  13. Probe data: 2872 [RED

    Lifescience Database Archive (English)

    Full Text Available R04-052870-1AR RED C73509 AU101290 E04274 EB4274 >AF023159_1(AF023159|pid:g3057120) Zea mays starch ... ULL1 (dull1) mRNA, complete cds; similar to potato starch ... synthase SSIII; likely to be the maize starch ... synt ...

  14. Probe data: 173 [RED

    Lifescience Database Archive (English)

    Full Text Available R04-032560-4R RED AU030096 AU030097 E50621 EG0621 >ZMU65948_1(U65948|pid:g2340108) Zea mays starch ... ch branching enzyme IIa (Sbe2a) mRNA, partial cds; starch ... branching enzyme isozyme SBEIIa. ...

  15. Probe data: 3220 [RED

    Lifescience Database Archive (English)

    Full Text Available R09-025420-1AR RED AU032971 AU101898 S00086 ST0086 >D88434_1(D88434|pid:g4519507) Malus domestic ... a mRNA for protein abundantly expressed during apple ... fruit development, complete cds; similar to Garden ...

  16. Probe data: 4872 [RED

    Lifescience Database Archive (English)

    Full Text Available R03-007550-2AR RED AU172766 AU172767 EE0037 >F9D12_1(AF077407|pid:g3319342) Arabidopsis thaliana ... BAC F9D12; similar to mit ochondrial carrier proteins (Pfam: mit _carr.hmm, sc ...

  17. Probe data: 1918 [RED

    Lifescience Database Archive (English)

    Full Text Available R06-001500-1AR RED AU031498 AU082419 E61744 EH1744 >ATU20347_1(U20347|pid:g790583) Arabidopsis t ... responding to this gene accumulates in response to ozone ... stress and pathogen (bacterial) infection; putativ ...

  18. Probe data: 1601 [RED

    Lifescience Database Archive (English)

    Full Text Available R06-043000-1AR RED C26746 AU075577 C12957 CB2957 >HSU49082_1(U49082|pid:g1840045) Human transpor ... ter protein (g17) mRNA, complete cds; member of a new ... family of transporter protein genes; resides in th ...

  19. Probe data: 3050 [RED

    Lifescience Database Archive (English)

    Full Text Available R05-046640-1AR RED AU031556 AU101584 E61844 EH1844 >HS1119A7_2(AL022313|pid:g4200328) Human DNA ... iation factor EIF3-P66 subunit, EST, GSS, STS, CpG island , complete sequence; &HSU54558_1(U54558|pid:g235137 ...

  20. Probe data: 3094 [RED

    Lifescience Database Archive (English)

    Full Text Available R12-040640-1AR RED D24605 AU101660 R02241 RA2241 >AF099082_1(AF099082|pid:g4176766) Homo sapiens ... xenotropic and polytropic murine retrovirus ... receptor (XPR1) mRNA, complete cds; related to yea ...

  1. EST data: 8680 [RED

    Lifescience Database Archive (English)

    Full Text Available ST3645 D41273 AU174297 DPlate 090 H05 AAAAGCCCCCATTATTGTTC AGGAGGAGAGATTGCAGGAG >AGU83687_1(U836 ... 835701) Apium graveolens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  2. EST data: 8002 [RED

    Lifescience Database Archive (English)

    Full Text Available SS4252 D48175 AU032804 S14252 4 G DPlate 083 B05 CGCAAATACACGAAATATAG TGCTTGATGAATTATGAGTC >AGU8 ... 835701) Apium graveolens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  3. EST data: 8329 [RED

    Lifescience Database Archive (English)

    Full Text Available ST0625 AU163183 AU163184 S00625 4 G DPlate 086 A10 ACTTGGCAGGCTGGTTGGTG GAGTGGTTTGGGTCCGTTTC >AG ... 835701) Apium graveolens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  4. Probe data: 66 [RED

    Lifescience Database Archive (English)

    Full Text Available R07-032820-1AR RED AU166075 AU029521 EE1034 >AF020814_1(AF020814|pid:g2997591) Pisum sativum glu ... cose-6-phosphate /phosphate -translocator precursor (GPT) mRNA, nucle ... n, complete cds; metabolite transporter; glucose-6-phosphate ... is the precursor for starch synthesis in many plas ...

  5. Probe data: 6267 [RED

    Lifescience Database Archive (English)

    Full Text Available R08-034590-1AR RED AU108817 C97061 C51323 CG1323 >(Q43272) NADP-DEPENDENT GLYCERALDEHYDE-3-PHOSPHATE ... (EC 1.2.1.9) (NON-PHOSPHORYLATING GLYCERALDEHYDE 3-PHOSPHATE ... DEHYDROGENASE) (GLYCERALDEHYDE-3-PHOSPHATE ... DEHYDRO ... GENASE (NADP+)) (TRIOSEPHOSPHATE ... DEHYDROGENASE). &S43833(S43833) &ZMRNAGAPN_1(X7532 ...

  6. Probe data: 783 [RED

    Lifescience Database Archive (English)

    Full Text Available R08-034590-1AR RED D48732 AU032835 S15122 SS5122 >(Q43272) NADP-DEPENDENT GLYCERALDEHYDE-3-PHOSPHATE ... (EC 1.2.1.9) (NON-PHOSPHORYLATING GLYCERALDEHYDE 3-PHOSPHATE ... DEHYDROGENASE) (GLYCERALDEHYDE-3-PHOSPHATE ... DEHYDRO ... GENASE (NADP+)) (TRIOSEPHOSPHATE ... DEHYDROGENASE). &S43833(S43833) &ZMRNAGAPN_1(X7532 ...

  7. Probe data: 3500 [RED

    Lifescience Database Archive (English)

    Full Text Available R04-059760-1AR RED C27462 AU160841 CG1937 >AF020814_1(AF020814|pid:g2997591) Pisum sativum gluco ... se-6-phosphate /phosphate -translocator precursor (GPT) mRNA, nucle ... n, complete cds; metabolite transporter; glucose-6-phosphate ... is the precursor for starch synthesis in many plas ...

  8. Canadian Red Cross.

    Science.gov (United States)

    Lavender, Colleen

    2008-01-01

    The Canadian Red Cross is guided by its Fundamental Principles--humanity, impartiality, neutrality, independence, voluntary service, unity, and universality--and organized in a traditional geographic hierarchical structure. Among the characteristics that have contributed to its success are a budgeting process that starts at the local level, measurement of program outcomes, and coordinated fundraising activities at the regional level. PMID:18551842

  9. Probe data: 1164 [RED

    Lifescience Database Archive (English)

    Full Text Available R06-003380-1AR RED AU078263 AU056903 S20966 SA0966 >HVSCOAT_1(L37299|pid:g609504) Helicoverpa ar ... tics, makes tube-like structures when expressed in bacteria , unstable when expressed in baculovirus, start cod ...

  10. Probe data: 5088 [RED

    Lifescience Database Archive (English)

    Full Text Available R10-035910-1AR RED D24257 AU173175 RA1590 >ATF23E12_14(AL022604|pid:g3080420) Arabidopsis thalia ... lone F23E12 (ESSAII project); strong similarity to sugar ... transporter, Arabidopsis thaliana, db_xref=PID:g14 ... 95273; Contains Sugar ... transport proteins signatures [SGGVADWLGRRPMLILS] ...

  11. Probe data: 5473 [RED

    Lifescience Database Archive (English)

    Full Text Available R10-035910-1AR RED D48171 AU174043 SS4246 >ATF23E12_14(AL022604|pid:g3080420) Arabidopsis thalia ... lone F23E12 (ESSAII project); strong similarity to sugar ... transporter, Arabidopsis thaliana, db_xref=PID:g14 ... 95273; Contains Sugar ... transport proteins signatures [SGGVADWLGRRPMLILS] ...

  12. Probe data: 4686 [RED

    Lifescience Database Archive (English)

    Full Text Available R04-036560-1AR RED AU063886 AU172500 EB1608 >F9D12_15(AF077407|pid:g3319354) Arabidopsis thalian ... a BAC F9D12; contains similarity to sugar ... transporters (Pfam: sugar _tr.hmm, score: 395.39); ...

  13. Sample information: 2201 [RED

    Lifescience Database Archive (English)

    Full Text Available 2201 2 T Cell cycle Oryza sativa (rice) C5924 (Ghaiya) Rice cell (Oc cells from rice root) culture ... red in AA medium 0 Root t 30 min culture ... (cell cycle)|Rice Oc cells were transferred to a n ... ew culture ... medium and collected after 30min ...

  14. Probe data: 2199 [RED

    Lifescience Database Archive (English)

    Full Text Available R01-053030-1AR RED C27281 AU092509 C51502 CG1502 >(P29677) MITOCHONDRIAL PROCESSING PEPTIDASE AL ... PHA SUBUNIT PREC URSOR (EC ... 3.4.24.64) (ALPHA-MPP) (UBIQUINOL-CYTOCHR ... OME C ... REDUCTASE SUBUNIT II) (EC ... 1.10.2.2). &S23558(S235 ...

  15. Probe data: 438 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-055920-1AR RED AU095379 AU031455 E61595 EH1595 >(Q42876) CHLOROPLAST AMINOPEPTIDASE 1 PREC UR ... SOR (EC ... 3.4.11.1) (LEUCINE AMINOPEPTIDASE) (LAP) (LEUCYL A ... MINOPEPTIDASE) (PROLINE AMINOPEPTIDASE) (EC ... 3.4.11.5) (PROLYL AMINOPEPTIDASE). &S57812(S57812) ...

  16. Probe data: 621 [RED

    Lifescience Database Archive (English)

    Full Text Available R11-008840-1AR RED D39164 AU031950 R02794 RA2794 >(P52588) PROTEIN DISULFIDE ISOMERASE PREC URSOR ... (PDI) (EC ... 5.3.4.1) / DOLICHYL- DIPHOSPHOOLIGOSACCHARIDE-PROT ... EIN GLYCOTRANSFERASE (EC ... 2.4.1.119) (GLYCOSYLATION SITE-BINDING CHAIN) (GSB ...

  17. Probe data: 4096 [RED

    Lifescience Database Archive (English)

    Full Text Available R12-025080-1AR RED AU166273 AU166274 CB0250 >(P07814) MULTIFUNCTIONAL AMINOACYL-TRNA SYNTHETASE ... (CONTAINS: GLUTAMYL-TRNA SYNTHETASE (EC ... 6.1.1.17) (GLUTAMATE--TRNA LIGASE), AND PROLYL-TRN ... A SYNTHETASE (EC ... 6.1.1.15) (PROLINE--TRNA LIGASE)). &HSGTS_1(X54326 ...

  18. Probe data: 6356 [RED

    Lifescience Database Archive (English)

    Full Text Available R01-072960-1AR RED C28243 C97586 C60441 CH0441 >(Q42942) URIDINE 5'-MONOPHOSPHATE SYNTHASE (UMP ... SYNTHASE) (OROTATE PHOSPHORIBOSYLTRANSFERASE (EC ... 2.4.2.10) AND OROTIDINE 5'-PHOSPHATE DEC ARBOXYLASE ... (EC ... 4.1.1.23)) (FRAGMENT). &NTU22260_1(U22260|pid:g747 ...

  19. Probe data: 1484 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-005160-1AR RED AU068643 AU068642 C30624 CE0624 >ATF28M20_6(AL031004|pid:g3281853) Arabidopsi ... icago sativa, PID:g2582800; Contains Mitochondrial energy ... transfer proteins signature [PEEGAKRLMM], Protein ...

  20. Probe data: 450 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-005160-1AR RED AU031552 AU031553 E61840 EH1840 >ATF28M20_6(AL031004|pid:g3281853) Arabidopsi ... icago sativa, PID:g2582800; Contains Mitochondrial energy ... transfer proteins signature [PEEGAKRLMM], Protein ...

  1. Probe data: 539 [RED

    Lifescience Database Archive (English)

    Full Text Available R06-015880-1AR RED D24296 AU031777 R01679 RA1679 >ATF17M5_25(AL035678|pid:g4490316) Arabidopsis ... R:G2290202; Contains Eukaryotic and viral aspartyl proteases ... active site [LDLDTGSDLTWL]. ...

  2. Probe data: 67 [RED

    Lifescience Database Archive (English)

    Full Text Available R08-035600-3AR RED AU029523 AU029522 EE1035 >F6N15_22(AF069299|pid:g3193320) Arabidopsis thalian ... tains similarity to the subtilase family of serine proteases ... (Pfam: subtilase.hmm, score: 47.57); strong simila ...

  3. Probe data: 2573 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-050030-1AR RED C26608 AU100748 C12680 CB2680 >ATF17M5_25(AL035678|pid:g4490316) Arabidopsis ... R:G2290202; Contains Eukaryotic and viral aspartyl proteases ... active site [LDLDTGSDLTWL]. ...

  4. Probe data: 4726 [RED

    Lifescience Database Archive (English)

    Full Text Available R03-005800-1AR RED C72916 AU172547 EB2461 >ATT25K17_14(AL049171|pid:g4539429) Arabidopsis thalia ... e, Arabidopsis thaliana, AF055848; Contains Serine proteases , subtilase family, active sites [GTSMSCPHVAG]. ...

  5. Probe data: 629 [RED

    Lifescience Database Archive (English)

    Full Text Available R05-000860-1AR RED D39203 AU031981 RA3021 >ATF23E12_9(AL022604|pid:g3080415) Arabidopsis thalian ... PIR2:S71773; Contains Eukaryotic thiol (cysteine) proteases ... active sites [QGQCGSCWAFST][LDHGVAAVGYG]; contains ...

  6. Probe data: 3935 [RED

    Lifescience Database Archive (English)

    Full Text Available R04-031750-1AR RED AU165241 AU165240 C62825 CH2825 >(P49727) UBIQUINOL-CYTOCHROME C REDUCTASE IRON ... ON-SULFUR SUBUNIT PRECURSOR (EC 1.10.2.2) (RIESKE IRON -SULFUR PROTEIN) (RISP). &A41607(A41607) &MZERFESPA ...

  7. Probe data: 1697 [RED

    Lifescience Database Archive (English)

    Full Text Available R10-029050-2AR RED AU077497 AU077496 C51971 CG1971 >(P48600) EUKARYOTIC TRANSLATION INITIATION F ... (EIF-4E) (EIF4E) (MRNA CAP-BINDING PROTEIN) (EIF-(ISO )4F 25 KD SUBUNIT) (EIF-(ISO )4F P28 SUBUNIT). &JC53 ...

  8. Probe data: 6548 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-004920-4AR RED C73633 C99436 E20022 ED0022 >S72415_5(S72415|pid:g632873) putative protein ki ... sequence comes from Fig. 2. Protein sequence is in conflict ... with the conceptual translation; mismatches(518-52 ...

  9. Probe data: 5046 [RED

    Lifescience Database Archive (English)

    Full Text Available R06-046030-1AR RED AU173086 AU173087 RA0369 >ATF18F4_17(AL021637|pid:g2827661) Arabidopsis thali ... one F18F4 (ESSAII project); Protein sequence is in conflict ... with the conceptual translation; 5-substituted hyd ...

  10. Probe data: 4866 [RED

    Lifescience Database Archive (English)

    Full Text Available R07-030880-3AR RED C91611 AU172758 ED0945 >S62928_1(S62928|pid:g386431) PRB1M=PRB1 medium length ... equence comes from Fig. 3A. Protein sequence is in conflict ... with the conceptual translation; mismatch(177[R- & ...

  11. Probe data: 3457 [RED

    Lifescience Database Archive (English)

    Full Text Available R03-022440-3AR RED C27097 AU108766 CG0974 >S58544_1(S58544|pid:g299703) 75 kda infertility-relat ... sequence comes from Fig. 4. Protein sequence is in conflict ... with the conceptual translation; mismatches(46[R- ...

  12. Probe data: 1379 [RED

    Lifescience Database Archive (English)

    Full Text Available R11-043720-4R RED AU166370 AU068062 C11732 CB1732 >AMTAM1TR_1(X57297|pid:g1345502) A. majus TAM1 ... gene for TNP1 and TNP2; Protein sequence is in conflict ... with the conceptual translation; no ATG start codo ...

  13. Probe data: 988 [RED

    Lifescience Database Archive (English)

    Full Text Available R01-019390-1AR RED AU056143 AU056144 S20327 SA0327 >HSPM5_1(X57398|pid:g1335273) Human mRNA for ... pM5 protein; Protein sequence is in conflict ... with the conceptual translation.. &S21977(S21977) ...

  14. Probe data: 1072 [RED

    Lifescience Database Archive (English)

    Full Text Available R01-066870-1AR RED AU162697 AU056522 S20655 SA0655 >ATATAF1_1(X74755|pid:g1345506) A.thaliana AT ... AF1 mRNA; Protein sequence is in conflict ... with the conceptual translation.. &S37101(S37101) ...

  15. Probe data: 4820 [RED

    Lifescience Database Archive (English)

    Full Text Available R05-004160-1AR RED C19333 AU172698 EC0269 >S72926_1(S72926|pid:g633890) Hordeum vulgare glucose ... sequence comes from Fig. 1. Protein sequence is in conflict ... with the conceptual translation.. ...

  16. Probe data: 5707 [RED

    Lifescience Database Archive (English)

    Full Text Available R09-000620-2R RED AU161807 AU174368 ST5674 >S81497_1(S81497|pid:g1336726) lysosomal acid lipase= ... sequence comes from Fig. 2. Protein sequence is in conflict ... with the conceptual translation; mismatches(82[G- ...

  17. Probe data: 2355 [RED

    Lifescience Database Archive (English)

    Full Text Available R06-046030-1AR RED AU065261 AU095249 EH0928 >ATF18F4_17(AL021637|pid:g2827661) Arabidopsis thali ... one F18F4 (ESSAII project); Protein sequence is in conflict ... with the conceptual translation; 5-substituted hyd ...

  18. Probe data: 862 [RED

    Lifescience Database Archive (English)

    Full Text Available R03-008820-1AR RED AU055750 AU055751 S20035 SA0035 >S75487_1(S75487|pid:g913445) adh3a=alcohol d ... rom Fig. 2. Map location 4. Protein sequence is in conflict ... with the conceptual translation; mismatch(46[R- &V ...

  19. Probe data: 3193 [RED

    Lifescience Database Archive (English)

    Full Text Available R04-033600-2AR RED C24862 AU101846 S16003 SS6003 >IT U51741_1(U51741|pid:g1272351) Ipomoea trifid ... eceptor protein kinase 2 (IRK2) mRNA, partial cds; it ... is unknown whether kinase domain is translated; ge ...

  20. Probe data: 3966 [RED

    Lifescience Database Archive (English)

    Full Text Available R09-031370-1AR RED C72012 AU165393 EB0781 >AC002329_15(AC002329|pid:g2262170) DNA sequence of Ar ... 9); glycosyl hydrolase family I signature found at residues ... 329 to 337 [SLLLENGAA]. ...

  1. Probe data: 3897 [RED

    Lifescience Database Archive (English)

    Full Text Available R06-022230-4R RED D23831 AU164531 RA0286 >AC002329_18(AC002329|pid:g2262173) DNA sequence of Ara ... nucleotide-disulphide oxidoreductases located from residues ... 197 to 219 [CAVCD...IGGGD]. ...

  2. An introduction to the SCOUT-AMMA stratospheric aircraft, balloons and sondes campaign in West Africa, August 2006: rationale and roadmap

    Directory of Open Access Journals (Sweden)

    F. Cairo

    2010-03-01

    Full Text Available A multi-platform field measurement campaign involving aircraft and balloons took place over West Africa between 26 July and 25 August 2006, in the frame of the concomitant AMMA Special Observing Period and SCOUT-O3 African tropical activities.

    Specifically aiming at sampling the upper troposphere and lower stratosphere, the high-altitude research aircraft M55 Geophysica was deployed in Ouagadougou (12.3° N, 1.7° W, Burkina Faso, in conjunction with the German D-20 Falcon, while a series of stratospheric balloons and sonde flights were conducted from Niamey (13.5° N, 2.0° E, Niger.

    Altogether, these measurements were intended to provide experimental evidence for a better understanding of large scale transport, assessing the effect of lightning on NOx production, and studying the impact of intense mesoscale convective systems on water, aerosol, dust and chemical species in the upper troposphere and lower stratosphere. The M55 Geophysica carried out five local and four transfer flights between southern Europe and the Sahel and back, while eight stratospheric balloons and twenty-nine sondes were flown from Niamey.

    These experiments allowed a characterization of the tropopause and lower stratosphere of the region. The paper provides an overview of SCOUT-AMMA campaign activities together with a description of the meteorology of the African monsoon and the situation prevailing during the flights and a brief summary of the observations accomplished.

  3. Infra-red material structures

    International Nuclear Information System (INIS)

    A process for modifying properties of infra-red materials in or for use in infra-red windows and other structures, in which the infra-red material is subjected to ion implantation whereby ions of an elemental dopant are implanted into the infra-red material under vacuum conditions. Heat diffusion may improve the depth of ion penetration. Specified materials are germanium, zinc sulphide, cadmium mercury telluride, calcium lanthanum sulphide and zinc selenide; specified dopants are boron, carbon and silicon. (author)

  4. Registration of 'Red Ruby' Wheat

    Science.gov (United States)

    Red Ruby’ soft red winter wheat (Triticum aestivum L.) was developed by the Michigan Agricultural Experiment Station and released in 2007 via an exclusive licensing agreement through Michigan State University (MSU) Technologies. Red Ruby was selected from the cross Pioneer ‘2552’/Pioneer ‘2737W’ ma...

  5. Human red cell acetyltransferase

    International Nuclear Information System (INIS)

    Acetyltransferase was isolated by histone-Sepharose affinity chromatography from human cord blood red cells. The enzyme was detected only in very young red cells. The semipurified enzyme and [14C]acetyl-CoA were used to acetylate isolated Hb F tetramer and α and γ subunits. The in vitro acetylated products were characterized by globin chain separation by CM-cellulose chromatography and tryptic peptide analysis by reverse-phase HPLC. Acetylation of both the γ-chains and the α-chains could occur within the Hb F tetramer. Acetylation also could take place on intact subunits. It appears that some Hb F/sub Ic/ could be formed in the cells by utilizing Hb F or free γ-chains as acetylation substrate

  6. Probe data: 2561 [RED

    Lifescience Database Archive (English)

    Full Text Available R08-000680-1AR RED C26504 AU100736 CB2477 >SPAC4F8_3(Z98530|pid:g2330820) S.pombe chromosome I c ... orf, (250aa), fasta scores, opt:691, E():0, (47.2% identity ... in 246 aa overlap), also similar to C.elegans Q232 ... 6E11, (258aa), fasta scores, opt:632,E():0, (40.2% identity ... in 249 aa overlap). ...

  7. Probe data: 2942 [RED

    Lifescience Database Archive (English)

    Full Text Available R01-031330-1AR RED C74139 AU101397 E30485 EE0485 >SPBC3B9_12(AL022070|pid:g2950478) S.pombe chro ... (219aa), fasta scores, opt:182, E():1e-29, (29.8% identity ... in 215 aa overlap), also similar eg. to C. elegans ... 224aa), fasta scores, opt:303, E():1.2e-26, (41.4% identity ... in 111 aa overlap). ...

  8. Probe data: 5856 [RED

    Lifescience Database Archive (English)

    Full Text Available R10-024200-4R RED AU174678 AU174679 FE0202 >AP000002_62(AP000002|pid:g3256770) Pyrococcus horiko ... nt. position (2/7); similar to PIR:S44960 percent identity :40.645 in 320aa; PIR:S69807 percent identity :41.10 ... 0 in 319aa; owl:MTY13D1217 percent identity :39.171 in 224aa. &H71145(H71145) ...

  9. Probe data: 5450 [RED

    Lifescience Database Archive (English)

    Full Text Available R04-032550-1AR RED D47635 AU174014 SS3251 >AC002534_10(AC002534|pid:g2392772) Arabidopsis thalia ... products; the lack of similarity in the N-terminal region ... between T32N15.11 and bacterial PheA gene products ... re located from residue 279 to 301 [YNLQI..RFLML] (region ... includes a conserved threonine found to be essenti ...

  10. Probe data: 1459 [RED

    Lifescience Database Archive (English)

    Full Text Available R09-012590-1AR RED AU166582 AU068404 CE0184 >DMSEG0007_4(AL033125|pid:g4185888) Drosophila melan ... e.; 2-match_species=Drosophila melanogaster (fruit fly ); 2-method=blastn;1.4.9; 2-method_score=2580.00; 2 ... e.; 3-match_species=Drosophila melanogaster (fruit fly ); 3-method=blastn;1.4.9; 3-method_score=3101.00; 4 ...

  11. EST data: 731 [RED

    Lifescience Database Archive (English)

    Full Text Available CB2762 C26646 AU108627 C12762 4 G DPlate 008 C08 5' AAC AAT AAT GGG GGC TTT TC 3' 5' TTA TTG ATT ... 835701) Apium graveolens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  12. Deep Red (Profondo Rosso)

    CERN Multimedia

    Cine Club

    2015-01-01

    Wednesday 29 April 2015 at 20:00 CERN Council Chamber    Deep Red (Profondo Rosso) Directed by Dario Argento (Italy, 1975) 126 minutes A psychic who can read minds picks up the thoughts of a murderer in the audience and soon becomes a victim. An English pianist gets involved in solving the murders, but finds many of his avenues of inquiry cut off by new murders, and he begins to wonder how the murderer can track his movements so closely. Original version Italian; English subtitles

  13. Red DirCom

    OpenAIRE

    Joan Costa

    2007-01-01

    Catorce países congregados de manera activa, a través de una plataforma de encuentro donde se comparten conocimiento y experiencias en la gestión estratégica de la comunicación en las organizaciones. La red reconoce en el DirCom una figura clave del desarrollo corporativo en el nuevo contexto de los negocios, impulsa la exigencia ética a través de la formación y consolida la proyección profesional para posicionar la gestión integral del DirCom en Iberoamérica.

  14. Red de sensores SIPIA

    OpenAIRE

    Mercado, Gustavo; Ortiz Uriburu, Gisela; Diedrichs, Ana; Borgo, Roberto; Gonzalez Antivilo, Francisco; Tromer, Sebastián; Ledezma, Nicolás; Aguirre, Matías; Panella, Cristian; Tabacchi, Germán; Martí, Juan; Grünwaldt, Guillermo; Rigoni, Ignacio; Antón, Gabriel; Chamorro, Fernando

    2012-01-01

    El proyecto consiste en el análisis, implementación y evaluación de una red de sensores inalámbricos basada en la norma IEEE 802.15.4, aplicada al entorno agropecuario en el ámbito de agricultura de precisión, con participación de tanto ingenieros electrónicos e informáticos como de ingenieros e investigadores agrónomos, Se propone entonces el estudio de estas tecnologías en el contexto de un grupo de investigaciones que permita: • La colaboración interinstitucional e interdisciplinaria en...

  15. Probe data: 305 [RED

    Lifescience Database Archive (English)

    Full Text Available R08-039710-1AR RED AU030739 AU030740 EH0171 >PTU27116_1(U27116|pid:g857578) Po pulus tremulo ides ... caffeo yl-Co A 3-O -methyltransferase mRNA, co mplete cds; S- ... adenyo syl-methio nine caffeo yl-Co A 3-O -methyltransferase; ... similar to ... Swiss-Pro t Accessio n Number P28034; similar to ... pro ... teins enco ded by GenBank accessio n Numbers U20736, U13151, an ...

  16. Big Red Telephone, Gone

    Institute of Scientific and Technical Information of China (English)

    Toni Piech

    2006-01-01

    @@ The Chinese big red telephones looked exactly as Iimagined the ones servicing the direct emergen line between the Kreml and the White House duing the cold-war era would have look like. But here in China, every kio seemed to have such a device in t1990s, and anyone could use it for ju 0.2 yuan. The government did not juinstall public phones on street corner but they let small-business owners pa ticipate in telecommunication. Supply and demand were juggled by a kind of Hutong capitalism.

  17. Red DirCom

    Directory of Open Access Journals (Sweden)

    Joan Costa

    2007-01-01

    Full Text Available Catorce países congregados de manera activa, a través de una plataforma de encuentro donde se comparten conocimiento y experiencias en la gestión estratégica de la comunicación en las organizaciones. La red reconoce en el DirCom una figura clave del desarrollo corporativo en el nuevo contexto de los negocios, impulsa la exigencia ética a través de la formación y consolida la proyección profesional para posicionar la gestión integral del DirCom en Iberoamérica.

  18. Alaistaitokartoitus, Red Events Oy

    OpenAIRE

    Latva, Mariikka

    2013-01-01

    Tämän tutkimuksellisen opinnäytetyön tarkoituksena oli kartoittaa tapahtuma-alan yrityksen Red Events Oy:n vuokratyöntekijöiden mielipiteitä heidän omista alaistaidoistaan. Työn tavoitteena oli saada kartoituksen tulosten pohjalta mahdollisia kehittämisehdotuksia. Opinnäytetyön tietoperusta muodostui alaistaidoista ja psykologisesta sopimuksesta. Psykologisen sopimuksen osa-alueista esiteltiin työn kannalta merkittävimmät, joita olivat vuorovaikutus, palautteen antaminen ja vastaanottam...

  19. Probe data: 5759 [RED

    Lifescience Database Archive (English)

    Full Text Available R10-026870-1AR RED AU174436 AU174437 EA0016 >C ELC 46G7_4(U97593|pid:g1946975) C aenorhabditis eleg ... ans c osmid C 46G7; weak similarity to human ataxin-1 X792 ... 04 (NID:g529662); c oded for by C . elegans c DNA yk153d2.5; c oded for by ... C . elegans c DNA yk95h11.5; c oded for by C . elegans c ... DNA yk5a4.5; c oded for by C . elegans c DNA yk11g5.5; c oded for by ...

  20. Probe data: 331 [RED

    Lifescience Database Archive (English)

    Full Text Available R04-032990-1AR RED AU030864 AU030865 E60359 EH0359 >C ELB0546_1(AF038604|pid:g2702370) C aenorhabd ... itis elegans c osmid B0546; c ontains similarity to Drosophila ovar ... ian tumor loc us protein (GB:X13693); c oded for by C . elegans c DN ... A yk389b1.5; c oded for by C . elegans c DNA yk332a1.5; c oded for by ... C . elegans c DNA yk314b10.5; c oded for by C . elegans ...

  1. Probe data: 739 [RED

    Lifescience Database Archive (English)

    Full Text Available R05-012910-1AR RED C 23575 AU032457 SS0091 >C ELH17B01_3(AF040646|pid:g2746826) C aenorhabditis ele ... gans c osmid H17B01; c oded for by C . elegans c DNA yk169c 10 ... .3; c oded for by C . elegans c DNA yk125b6.3; c oded for by ... C . elegans c DNA yk71e8.3; c oded for by C . elegans c D ... NA C EESD11FB; c oded for by C . elegans c DNA C EESD11F; c o ...

  2. Analysis of RED ONE Digital Cinema Camera and RED Workflow

    OpenAIRE

    Foroughi Mobarakeh, Taraneh

    2009-01-01

    RED Digital Cinema is a rather new company that has developed a camera that has shaken the world of the film industry, the RED One camera. RED One is a digital cinema camera with the characteristics of a 35mm film camera. With a custom made 12 megapixel CMOS sensor it offers images with a filmic look that cannot be achieved with many other digital cinema cameras. With a new camera comes a new set of media files to work with, which brings new software applications supporting them. RED Digital ...

  3. Red Tape, Corruption and Finance

    OpenAIRE

    Keith Blackburn; Rashmi Sarmah

    2006-01-01

    We study the effects of red tape and corruption in a model of occupational choice, entry regulation and imperfect capital markets. Red tape is the set of rules and regulations that private agents are obliged to comply with in order to engage in entrepreneurial activity. Corruption is the payment of bribes to public officials for the purpose of circumventing red tape. Capital market imperfections are the asymmetries of information between borrowers and lenders about the returns to entrepreneur...

  4. Probe data: 1422 [RED

    Lifescience Database Archive (English)

    Full Text Available R05-049390-1AR RED AU068280 AU068281 C 12919 C B2919 >C ELR148_1(AF025467|pid:g2429509) C aenorhabdi ... tis elegans c osmid R148; c ontains similarity to drosophila DNA-b ... inding protein K10 (NID:g8148); c oded for by C . elegans c DNA yk118e11.5; c oded for b ... y C . elegans c DNA yk64h11.5; c oded for by C . elegans c ... DNA yk172f2.5; c oded for by C . elegans c DNA yk79b6.5; c oded for by ...

  5. Probe data: 6469 [RED

    Lifescience Database Archive (English)

    Full Text Available R07-038020-1AR RED C 99062 C 99063 E04404 EB4404 >C ELC 35E7_7(AF067216|pid:g3158466) C aenorhabditis ... elegans c osmid C 35E7; c oded for by C . elegans c DNA yk109g4.5 ... ; c oded for by C . elegans c DNA yk399b8.5; c oded for by ... C . elegans c DNA yk394b7.5; c oded for by C . elegans c ... DNA yk476g9.5; c oded for by C . elegans c DNA yk290c 12.5; c oded for b ...

  6. Search for Narrow Resonances in Dijet Final States at sqrt[s]=8  TeV with the Novel CMS Technique of Data Scouting.

    Science.gov (United States)

    Khachatryan, V; Sirunyan, A M; Tumasyan, A; Adam, W; Asilar, E; Bergauer, T; Brandstetter, J; Brondolin, E; Dragicevic, M; Erö, J; Flechl, M; Friedl, M; Frühwirth, R; Ghete, V M; Hartl, C; Hörmann, N; Hrubec, J; Jeitler, M; König, A; Krätschmer, I; Liko, D; Matsushita, T; Mikulec, I; Rabady, D; Rad, N; Rahbaran, B; Rohringer, H; Schieck, J; Strauss, J; Treberer-Treberspurg, W; Waltenberger, W; Wulz, C-E; Mossolov, V; Shumeiko, N; Suarez Gonzalez, J; Alderweireldt, S; De Wolf, E A; Janssen, X; Knutsson, A; Lauwers, J; Van De Klundert, M; Van Haevermaet, H; Van Mechelen, P; Van Remortel, N; Van Spilbeeck, A; Abu Zeid, S; Blekman, F; D'Hondt, J; Daci, N; De Bruyn, I; Deroover, K; Heracleous, N; Lowette, S; Moortgat, S; Moreels, L; Olbrechts, A; Python, Q; Tavernier, S; Van Doninck, W; Van Mulders, P; Van Parijs, I; Brun, H; Caillol, C; Clerbaux, B; De Lentdecker, G; Delannoy, H; Fasanella, G; Favart, L; Goldouzian, R; Grebenyuk, A; Karapostoli, G; Lenzi, T; Léonard, A; Luetic, J; Maerschalk, T; Marinov, A; Randle-Conde, A; Seva, T; Vander Velde, C; Vanlaer, P; Yonamine, R; Zenoni, F; Zhang, F; Cimmino, A; Cornelis, T; Dobur, D; Fagot, A; Garcia, G; Gul, M; Mccartin, J; Poyraz, D; Salva, S; Schöfbeck, R; Tytgat, M; Van Driessche, W; Yazgan, E; Zaganidis, N; Beluffi, C; Bondu, O; Brochet, S; Bruno, G; Caudron, A; Ceard, L; De Visscher, S; Delaere, C; Delcourt, M; Forthomme, L; Francois, B; Giammanco, A; Jafari, A; Jez, P; Komm, M; Lemaitre, V; Magitteri, A; Mertens, A; Musich, M; Nuttens, C; Piotrzkowski, K; Quertenmont, L; Selvaggi, M; Vidal Marono, M; Wertz, S; Beliy, N; Aldá Júnior, W L; Alves, F L; Alves, G A; Brito, L; Correa Martins Junior, M; Hensel, C; Moraes, A; Pol, M E; Rebello Teles, P; Belchior Batista Das Chagas, E; Carvalho, W; Chinellato, J; Custódio, A; Da Costa, E M; Da Silveira, G G; De Jesus Damiao, D; De Oliveira Martins, C; Fonseca De Souza, S; Huertas Guativa, L M; Malbouisson, H; Matos Figueiredo, D; Mora Herrera, C; Mundim, L; Nogima, H; Prado Da Silva, W L; Santoro, A; Sznajder, A; Tonelli Manganote, E J; Vilela Pereira, A; Ahuja, S; Bernardes, C A; Dogra, S; Fernandez Perez Tomei, T R; Gregores, E M; Mercadante, P G; Moon, C S; Novaes, S F; Padula, Sandra S; Romero Abad, D; Ruiz Vargas, J C; Aleksandrov, A; Hadjiiska, R; Iaydjiev, P; Rodozov, M; Stoykova, S; Sultanov, G; Vutova, M; Dimitrov, A; Glushkov, I; Litov, L; Pavlov, B; Petkov, P; Fang, W; Ahmad, M; Bian, J G; Chen, G M; Chen, H S; Chen, M; Chen, Y; Cheng, T; Du, R; Jiang, C H; Leggat, D; Liu, Z; Romeo, F; Shaheen, S M; Spiezia, A; Tao, J; Wang, C; Wang, Z; Zhang, H; Zhao, J; Asawatangtrakuldee, C; Ban, Y; Li, Q; Liu, S; Mao, Y; Qian, S J; Wang, D; Xu, Z; Avila, C; Cabrera, A; Chaparro Sierra, L F; Florez, C; Gomez, J P; González Hernández, C F; Ruiz Alvarez, J D; Sanabria, J C; Godinovic, N; Lelas, D; Puljak, I; Ribeiro Cipriano, P M; Antunovic, Z; Kovac, M; Brigljevic, V; Ferencek, D; Kadija, K; Micanovic, S; Sudic, L; Attikis, A; Mavromanolakis, G; Mousa, J; Nicolaou, C; Ptochos, F; Razis, P A; Rykaczewski, H; Finger, M; Finger, M; Carrera Jarrin, E; Elgammal, S; Mohamed, A; Mohammed, Y; Salama, E; Calpas, B; Kadastik, M; Murumaa, M; Perrini, L; Raidal, M; Tiko, A; Veelken, C; Eerola, P; Pekkanen, J; Voutilainen, M; Härkönen, J; Karimäki, V; Kinnunen, R; Lampén, T; Lassila-Perini, K; Lehti, S; Lindén, T; Luukka, P; Peltola, T; Tuominiemi, J; Tuovinen, E; Wendland, L; Talvitie, J; Tuuva, T; Besancon, M; Couderc, F; Dejardin, M; Denegri, D; Fabbro, B; Faure, J L; Favaro, C; Ferri, F; Ganjour, S; Ghosh, S; Givernaud, A; Gras, P; Hamel de Monchenault, G; Jarry, P; Kucher, I; Locci, E; Machet, M; Malcles, J; Rander, J; Rosowsky, A; Titov, M; Zghiche, A; Abdulsalam, A; Antropov, I; Baffioni, S; Beaudette, F; Busson, P; Cadamuro, L; Chapon, E; Charlot, C; Davignon, O; Granier de Cassagnac, R; Jo, M; Lisniak, S; Miné, P; Naranjo, I N; Nguyen, M; Ochando, C; Ortona, G; Paganini, P; Pigard, P; Regnard, S; Salerno, R; Sirois, Y; Strebler, T; Yilmaz, Y; Zabi, A; Agram, J-L; Andrea, J; Aubin, A; Bloch, D; Brom, J-M; Buttignol, M; Chabert, E C; Chanon, N; Collard, C; Conte, E; Coubez, X; Fontaine, J-C; Gelé, D; Goerlach, U; Le Bihan, A-C; Merlin, J A; Skovpen, K; Van Hove, P; Gadrat, S; Beauceron, S; Bernet, C; Boudoul, G; Bouvier, E; Carrillo Montoya, C A; Chierici, R; Contardo, D; Courbon, B; Depasse, P; El Mamouni, H; Fan, J; Fay, J; Gascon, S; Gouzevitch, M; Grenier, G; Ille, B; Lagarde, F; Laktineh, I B; Lethuillier, M; Mirabito, L; Pequegnot, A L; Perries, S; Popov, A; Sabes, D; Sordini, V; Vander Donckt, M; Verdier, P; Viret, S; Toriashvili, T; Lomidze, D; Autermann, C; Beranek, S; Feld, L; Heister, A; Kiesel, M K; Klein, K; Lipinski, M; Ostapchuk, A; Preuten, M; Raupach, F; Schael, S; Schomakers, C; Schulte, J F; Schulz, J; Verlage, T; Weber, H; Zhukov, V; Brodski, M; Dietz-Laursonn, E; Duchardt, D; Endres, M; Erdmann, M; Erdweg, S; Esch, T; Fischer, R; Güth, A; Hebbeker, T; Heidemann, C; Hoepfner, K; Knutzen, S; Merschmeyer, M; Meyer, A; Millet, P; Mukherjee, S; Olschewski, M; Padeken, K; Papacz, P; Pook, T; Radziej, M; Reithler, H; Rieger, M; Scheuch, F; Sonnenschein, L; Teyssier, D; Thüer, S; Cherepanov, V; Erdogan, Y; Flügge, G; Hoehle, F; Kargoll, B; Kress, T; Künsken, A; Lingemann, J; Nehrkorn, A; Nowack, A; Nugent, I M; Pistone, C; Pooth, O; Stahl, A; Aldaya Martin, M; Asin, I; Beernaert, K; Behnke, O; Behrens, U; Bin Anuar, A A; Borras, K; Campbell, A; Connor, P; Contreras-Campana, C; Costanza, F; Diez Pardos, C; Dolinska, G; Eckerlin, G; Eckstein, D; Eichhorn, T; Gallo, E; Garay Garcia, J; Geiser, A; Gizhko, A; Grados Luyando, J M; Gunnellini, P; Harb, A; Hauk, J; Hempel, M; Jung, H; Kalogeropoulos, A; Karacheban, O; Kasemann, M; Keaveney, J; Kieseler, J; Kleinwort, C; Korol, I; Lange, W; Lelek, A; Leonard, J; Lipka, K; Lobanov, A; Lohmann, W; Mankel, R; Melzer-Pellmann, I-A; Meyer, A B; Mittag, G; Mnich, J; Mussgiller, A; Ntomari, E; Pitzl, D; Placakyte, R; Raspereza, A; Roland, B; Sahin, M Ö; Saxena, P; Schoerner-Sadenius, T; Seitz, C; Spannagel, S; Stefaniuk, N; Trippkewitz, K D; Van Onsem, G P; Walsh, R; Wissing, C; Blobel, V; Centis Vignali, M; Draeger, A R; Dreyer, T; Erfle, J; Garutti, E; Goebel, K; Gonzalez, D; Görner, M; Haller, J; Hoffmann, M; Höing, R S; Junkes, A; Klanner, R; Kogler, R; Kovalchuk, N; Lapsien, T; Lenz, T; Marchesini, I; Marconi, D; Meyer, M; Niedziela, M; Nowatschin, D; Ott, J; Pantaleo, F; Peiffer, T; Perieanu, A; Pietsch, N; Poehlsen, J; Sander, C; Scharf, C; Schleper, P; Schlieckau, E; Schmidt, A; Schumann, S; Schwandt, J; Stadie, H; Steinbrück, G; Stober, F M; Stöver, M; Tholen, H; Troendle, D; Usai, E; Vanelderen, L; Vanhoefer, A; Vormwald, B; Barth, C; Baus, C; Berger, J; Butz, E; Chwalek, T; Colombo, F; De Boer, W; Dierlamm, A; Fink, S; Friese, R; Giffels, M; Gilbert, A; Haitz, D; Hartmann, F; Heindl, S M; Husemann, U; Katkov, I; Kornmayer, A; Lobelle Pardo, P; Maier, B; Mildner, H; Mozer, M U; Müller, T; Müller, Th; Plagge, M; Quast, G; Rabbertz, K; Röcker, S; Roscher, F; Schröder, M; Sieber, G; Simonis, H J; Ulrich, R; Wagner-Kuhr, J; Wayand, S; Weber, M; Weiler, T; Williamson, S; Wöhrmann, C; Wolf, R; Anagnostou, G; Daskalakis, G; Geralis, T; Giakoumopoulou, V A; Kyriakis, A; Loukas, D; Topsis-Giotis, I; Agapitos, A; Kesisoglou, S; Panagiotou, A; Saoulidou, N; Tziaferi, E; Evangelou, I; Flouris, G; Foudas, C; Kokkas, P; Loukas, N; Manthos, N; Papadopoulos, I; Paradas, E; Filipovic, N; Bencze, G; Hajdu, C; Hidas, P; Horvath, D; Sikler, F; Veszpremi, V; Vesztergombi, G; Zsigmond, A J; Beni, N; Czellar, S; Karancsi, J; Molnar, J; Szillasi, Z; Bartók, M; Makovec, A; Raics, P; Trocsanyi, Z L; Ujvari, B; Bahinipati, S; Choudhury, S; Mal, P; Mandal, K; Nayak, A; Sahoo, D K; Sahoo, N; Swain, S K; Bansal, S; Beri, S B; Bhatnagar, V; Chawla, R; Gupta, R; Bhawandeep, U; Kalsi, A K; Kaur, A; Kaur, M; Kumar, R; Mehta, A; Mittal, M; Singh, J B; Walia, G; Kumar, Ashok; Bhardwaj, A; Choudhary, B C; Garg, R B; Keshri, S; Kumar, A; Malhotra, S; Naimuddin, M; Nishu, N; Ranjan, K; Sharma, R; Sharma, V; Bhattacharya, R; Bhattacharya, S; Chatterjee, K; Dey, S; Dutt, S; Dutta, S; Ghosh, S; Majumdar, N; Modak, A; Mondal, K; Mukhopadhyay, S; Nandan, S; Purohit, A; Roy, A; Roy, D; Roy Chowdhury, S; Sarkar, S; Sharan, M; Thakur, S; Behera, P K; Chudasama, R; Dutta, D; Jha, V; Kumar, V; Mohanty, A K; Netrakanti, P K; Pant, L M; Shukla, P; Topkar, A; Aziz, T; Dugad, S; Kole, G; Mahakud, B; Mitra, S; Mohanty, G B; Sur, N; Sutar, B; Banerjee, S; Bhowmik, S; Dewanjee, R K; Ganguly, S; Guchait, M; Jain, Sa; Kumar, S; Maity, M; Majumder, G; Mazumdar, K; Parida, B; Sarkar, T; Wickramage, N; Chauhan, S; Dube, S; Kapoor, A; Kothekar, K; Rane, A; Sharma, S; Bakhshiansohi, H; Behnamian, H; Chenarani, S; Eskandari Tadavani, E; Etesami, S M; Fahim, A; Khakzad, M; Mohammadi Najafabadi, M; Naseri, M; Paktinat Mehdiabadi, S; Rezaei Hosseinabadi, F; Safarzadeh, B; Zeinali, M; Felcini, M; Grunewald, M; Abbrescia, M; Calabria, C; Caputo, C; Colaleo, A; Creanza, D; Cristella, L; De Filippis, N; De Palma, M; Fiore, L; Iaselli, G; Maggi, G; Maggi, M; Miniello, G; My, S; Nuzzo, S; Pompili, A; Pugliese, G; Radogna, R; Ranieri, A; Selvaggi, G; Silvestris, L; Venditti, R; Abbiendi, G; Battilana, C; Bonacorsi, D; Braibant-Giacomelli, S; Brigliadori, L; Campanini, R; Capiluppi, P; Castro, A; Cavallo, F R; Chhibra, S S; Codispoti, G; Cuffiani, M; Dallavalle, G M; Fabbri, F; Fanfani, A; Fasanella, D; Giacomelli, P; Grandi, C; Guiducci, L; Marcellini, S; Masetti, G; Montanari, A; Navarria, F L; Perrotta, A; Rossi, A M; Rovelli, T; Siroli, G P; Tosi, N; Albergo, S; Chiorboli, M; Costa, S; Di Mattia, A; Giordano, F; Potenza, R; Tricomi, A; Tuve, C; Barbagli, G; Ciulli, V; Civinini, C; D'Alessandro, R; Focardi, E; Gori, V; Lenzi, P; Meschini, M; Paoletti, S; Sguazzoni, G; Viliani, L; Benussi, L; Bianco, S; Fabbri, F; Piccolo, D; Primavera, F; Calvelli, V; Ferro, F; Lo Vetere, M; Monge, M R; Robutti, E; Tosi, S; Brianza, L; Dinardo, M E; Fiorendi, S; Gennai, S; Ghezzi, A; Govoni, P; Malvezzi, S; Manzoni, R A; Marzocchi, B; Menasce, D; Moroni, L; Paganoni, M; Pedrini, D; Pigazzini, S; Ragazzi, S; Tabarelli de Fatis, T; Buontempo, S; Cavallo, N; De Nardo, G; Di Guida, S; Esposito, M; Fabozzi, F; Iorio, A O M; Lanza, G; Lista, L; Meola, S; Merola, M; Paolucci, P; Sciacca, C; Thyssen, F; Azzi, P; Bacchetta, N; Benato, L; Bisello, D; Boletti, A; Carlin, R; Carvalho Antunes De Oliveira, A; Checchia, P; Dall'Osso, M; De Castro Manzano, P; Dorigo, T; Dosselli, U; Gasparini, F; Gasparini, U; Gozzelino, A; Lacaprara, S; Margoni, M; Meneguzzo, A T; Pazzini, J; Pozzobon, N; Ronchese, P; Simonetto, F; Torassa, E; Tosi, M; Zanetti, M; Zotto, P; Zucchetta, A; Zumerle, G; Braghieri, A; Magnani, A; Montagna, P; Ratti, S P; Re, V; Riccardi, C; Salvini, P; Vai, I; Vitulo, P; Alunni Solestizi, L; Bilei, G M; Ciangottini, D; Fanò, L; Lariccia, P; Leonardi, R; Mantovani, G; Menichelli, M; Saha, A; Santocchia, A; Androsov, K; Azzurri, P; Bagliesi, G; Bernardini, J; Boccali, T; Castaldi, R; Ciocci, M A; Dell'Orso, R; Donato, S; Fedi, G; Giassi, A; Grippo, M T; Ligabue, F; Lomtadze, T; Martini, L; Messineo, A; Palla, F; Rizzi, A; Savoy-Navarro, A; Spagnolo, P; Tenchini, R; Tonelli, G; Venturi, A; Verdini, P G; Barone, L; Cavallari, F; Cipriani, M; D'imperio, G; Del Re, D; Diemoz, M; Gelli, S; Jorda, C; Longo, E; Margaroli, F; Meridiani, P; Organtini, G; Paramatti, R; Preiato, F; Rahatlou, S; Rovelli, C; Santanastasio, F; Amapane, N; Arcidiacono, R; Argiro, S; Arneodo, M; Bartosik, N; Bellan, R; Biino, C; Cartiglia, N; Costa, M; Covarelli, R; Degano, A; Demaria, N; Finco, L; Kiani, B; Mariotti, C; Maselli, S; Migliore, E; Monaco, V; Monteil, E; Obertino, M M; Pacher, L; Pastrone, N; Pelliccioni, M; Pinna Angioni, G L; Ravera, F; Romero, A; Ruspa, M; Sacchi, R; Shchelina, K; Sola, V; Solano, A; Staiano, A; Traczyk, P; Belforte, S; Candelise, V; Casarsa, M; Cossutti, F; Della Ricca, G; La Licata, C; Schizzi, A; Zanetti, A; Kim, D H; Kim, G N; Kim, M S; Lee, S; Lee, S W; Oh, Y D; Sekmen, S; Son, D C; Yang, Y C; Kim, H; Lee, A; Brochero Cifuentes, J A; Kim, T J; Cho, S; Choi, S; Go, Y; Gyun, D; Ha, S; Hong, B; Jo, Y; Kim, Y; Lee, B; Lee, K; Lee, K S; Lee, S; Lim, J; Park, S K; Roh, Y; Almond, J; Kim, J; Oh, S B; Seo, S H; Yang, U K; Yoo, H D; Yu, G B; Choi, M; Kim, H; Kim, H; Kim, J H; Lee, J S H; Park, I C; Ryu, G; Ryu, M S; Choi, Y; Goh, J; Kim, D; Kwon, E; Lee, J; Yu, I; Dudenas, V; Juodagalvis, A; Vaitkus, J; Ahmed, I; Ibrahim, Z A; Komaragiri, J R; Md Ali, M A B; Mohamad Idris, F; Wan Abdullah, W A T; Yusli, M N; Zolkapli, Z; Casimiro Linares, E; Castilla-Valdez, H; De La Cruz-Burelo, E; Heredia-De La Cruz, I; Hernandez-Almada, A; Lopez-Fernandez, R; Mejia Guisao, J; Sanchez-Hernandez, A; Carrillo Moreno, S; Vazquez Valencia, F; Pedraza, I; Salazar Ibarguen, H A; Uribe Estrada, C; Morelos Pineda, A; Krofcheck, D; Butler, P H; Ahmad, A; Ahmad, M; Hassan, Q; Hoorani, H R; Khan, W A; Qazi, S; Shoaib, M; Waqas, M; Bialkowska, H; Bluj, M; Boimska, B; Frueboes, T; Górski, M; Kazana, M; Nawrocki, K; Romanowska-Rybinska, K; Szleper, M; Zalewski, P; Bunkowski, K; Byszuk, A; Doroba, K; Kalinowski, A; Konecki, M; Krolikowski, J; Misiura, M; Olszewski, M; Walczak, M; Bargassa, P; Beirão Da Cruz E Silva, C; Di Francesco, A; Faccioli, P; Ferreira Parracho, P G; Gallinaro, M; Hollar, J; Leonardo, N; Lloret Iglesias, L; Nemallapudi, M V; Rodrigues Antunes, J; Seixas, J; Toldaiev, O; Vadruccio, D; Varela, J; Vischia, P; Bunin, P; Gavrilenko, M; Golutvin, I; Gorbounov, N; Gorbunov, I; Karjavin, V; Kozlov, G; Lanev, A; Malakhov, A; Matveev, V; Moisenz, P; Palichik, V; Perelygin, V; Savina, M; Shmatov, S; Shulha, S; Skatchkov, N; Smirnov, V; Zarubin, A; Chtchipounov, L; Golovtsov, V; Ivanov, Y; Kim, V; Kuznetsova, E; Murzin, V; Oreshkin, V; Sulimov, V; Vorobyev, A; Andreev, Yu; Dermenev, A; Gninenko, S; Golubev, N; Karneyeu, A; Kirsanov, M; Krasnikov, N; Pashenkov, A; Tlisov, D; Toropin, A; Epshteyn, V; Gavrilov, V; Lychkovskaya, N; Popov, V; Pozdnyakov, I; Safronov, G; Spiridonov, A; Toms, M; Vlasov, E; Zhokin, A; Chadeeva, M; Danilov, M; Zhemchugov, E; Andreev, V; Azarkin, M; Dremin, I; Kirakosyan, M; Leonidov, A; Rusakov, S V; Terkulov, A; Baskakov, A; Belyaev, A; Boos, E; Dubinin, M; Dudko, L; Ershov, A; Gribushin, A; Klyukhin, V; Kodolova, O; Lokhtin, I; Miagkov, I; Obraztsov, S; Petrushanko, S; Savrin, V; Snigirev, A; Azhgirey, I; Bayshev, I; Bitioukov, S; Elumakhov, D; Kachanov, V; Kalinin, A; Konstantinov, D; Krychkine, V; Petrov, V; Ryutin, R; Sobol, A; Troshin, S; Tyurin, N; Uzunian, A; Volkov, A; Adzic, P; Cirkovic, P; Devetak, D; Milosevic, J; Rekovic, V; Alcaraz Maestre, J; Calvo, E; Cerrada, M; Chamizo Llatas, M; Colino, N; De La Cruz, B; Delgado Peris, A; Escalante Del Valle, A; Fernandez Bedoya, C; Fernández Ramos, J P; Flix, J; Fouz, M C; Garcia-Abia, P; Gonzalez Lopez, O; Goy Lopez, S; Hernandez, J M; Josa, M I; Navarro De Martino, E; Pérez-Calero Yzquierdo, A; Puerta Pelayo, J; Quintario Olmeda, A; Redondo, I; Romero, L; Soares, M S; de Trocóniz, J F; Missiroli, M; Moran, D; Cuevas, J; Fernandez Menendez, J; Gonzalez Caballero, I; Palencia Cortezon, E; Sanchez Cruz, S; Vizan Garcia, J M; Cabrillo, I J; Calderon, A; Castiñeiras De Saa, J R; Curras, E; Fernandez, M; Garcia-Ferrero, J; Gomez, G; Lopez Virto, A; Marco, J; Martinez Rivero, C; Matorras, F; Piedra Gomez, J; Rodrigo, T; Ruiz-Jimeno, A; Scodellaro, L; Trevisani, N; Vila, I; Vilar Cortabitarte, R; Abbaneo, D; Auffray, E; Auzinger, G; Bachtis, M; Baillon, P; Ball, A H; Barney, D; Bloch, P; Bocci, A; Bonato, A; Botta, C; Camporesi, T; Castello, R; Cepeda, M; Cerminara, G; D'Alfonso, M; d'Enterria, D; Dabrowski, A; Daponte, V; David, A; De Gruttola, M; De Guio, F; De Roeck, A; Di Marco, E; Dobson, M; Dordevic, M; Dorney, B; du Pree, T; Duggan, D; Dünser, M; Dupont, N; Elliott-Peisert, A; Fartoukh, S; Franzoni, G; Fulcher, J; Funk, W; Gigi, D; Gill, K; Girone, M; Glege, F; Gundacker, S; Guthoff, M; Hammer, J; Harris, P; Hegeman, J; Innocente, V; Janot, P; Kirschenmann, H; Knünz, V; Kortelainen, M J; Kousouris, K; Krammer, M; Lecoq, P; Lourenço, C; Lucchini, M T; Magini, N; Malgeri, L; Mannelli, M; Martelli, A; Meijers, F; Mersi, S; Meschi, E; Moortgat, F; Morovic, S; Mulders, M; Neugebauer, H; Orfanelli, S; Orsini, L; Pape, L; Perez, E; Peruzzi, M; Petrilli, A; Petrucciani, G; Pfeiffer, A; Pierini, M; Racz, A; Reis, T; Rolandi, G; Rovere, M; Ruan, M; Sakulin, H; Sauvan, J B; Schäfer, C; Schwick, C; Seidel, M; Sharma, A; Silva, P; Simon, M; Sphicas, P; Steggemann, J; Stoye, M; Takahashi, Y; Treille, D; Triossi, A; Tsirou, A; Veckalns, V; Veres, G I; Wardle, N; Zagozdzinska, A; Zeuner, W D; Bertl, W; Deiters, K; Erdmann, W; Horisberger, R; Ingram, Q; Kaestli, H C; Kotlinski, D; Langenegger, U; Rohe, T; Bachmair, F; Bäni, L; Bianchini, L; Casal, B; Dissertori, G; Dittmar, M; Donegà, M; Eller, P; Grab, C; Heidegger, C; Hits, D; Hoss, J; Kasieczka, G; Lecomte, P; Lustermann, W; Mangano, B; Marionneau, M; Martinez Ruiz Del Arbol, P; Masciovecchio, M; Meinhard, M T; Meister, D; Micheli, F; Musella, P; Nessi-Tedaldi, F; Pandolfi, F; Pata, J; Pauss, F; Perrin, G; Perrozzi, L; Quittnat, M; Rossini, M; Schönenberger, M; Starodumov, A; Takahashi, M; Tavolaro, V R; Theofilatos, K; Wallny, R; Aarrestad, T K; Amsler, C; Caminada, L; Canelli, M F; Chiochia, V; De Cosa, A; Galloni, C; Hinzmann, A; Hreus, T; Kilminster, B; Lange, C; Ngadiuba, J; Pinna, D; Rauco, G; Robmann, P; Salerno, D; Yang, Y; Doan, T H; Jain, Sh; Khurana, R; Konyushikhin, M; Kuo, C M; Lin, W; Lu, Y J; Pozdnyakov, A; Yu, S S; Kumar, Arun; Chang, P; Chang, Y H; Chang, Y W; Chao, Y; Chen, K F; Chen, P H; Dietz, C; Fiori, F; Hou, W-S; Hsiung, Y; Liu, Y F; Lu, R-S; Miñano Moya, M; Paganis, E; Psallidas, A; Tsai, J F; Tzeng, Y M; Asavapibhop, B; Singh, G; Srimanobhas, N; Suwonjandee, N; Adiguzel, A; Cerci, S; Damarseckin, S; Demiroglu, Z S; Dozen, C; Dumanoglu, I; Girgis, S; Gokbulut, G; Guler, Y; Gurpinar, E; Hos, I; Kangal, E E; Onengut, G; Ozdemir, K; Sunar Cerci, D; Tali, B; Topakli, H; Zorbilmez, C; Bilin, B; Bilmis, S; Isildak, B; Karapinar, G; Yalvac, M; Zeyrek, M; Gülmez, E; Kaya, M; Kaya, O; Yetkin, E A; Yetkin, T; Cakir, A; Cankocak, K; Sen, S; Vardarlı, F I; Grynyov, B; Levchuk, L; Sorokin, P; Aggleton, R; Ball, F; Beck, L; Brooke, J J; Burns, D; Clement, E; Cussans, D; Flacher, H; Goldstein, J; Grimes, M; Heath, G P; Heath, H F; Jacob, J; Kreczko, L; Lucas, C; Meng, Z; Newbold, D M; Paramesvaran, S; Poll, A; Sakuma, T; Seif El Nasr-Storey, S; Senkin, S; Smith, D; Smith, V J; Bell, K W; Belyaev, A; Brew, C; Brown, R M; Calligaris, L; Cieri, D; Cockerill, D J A; Coughlan, J A; Harder, K; Harper, S; Olaiya, E; Petyt, D; Shepherd-Themistocleous, C H; Thea, A; Tomalin, I R; Williams, T; Baber, M; Bainbridge, R; Buchmuller, O; Bundock, A; Burton, D; Casasso, S; Citron, M; Colling, D; Corpe, L; Dauncey, P; Davies, G; De Wit, A; Della Negra, M; Dunne, P; Elwood, A; Futyan, D; Haddad, Y; Hall, G; Iles, G; Lane, R; Laner, C; Lucas, R; Lyons, L; Magnan, A-M; Malik, S; Mastrolorenzo, L; Nash, J; Nikitenko, A; Pela, J; Penning, B; Pesaresi, M; Raymond, D M; Richards, A; Rose, A; Seez, C; Tapper, A; Uchida, K; Vazquez Acosta, M; Virdee, T; Zenz, S C; Cole, J E; Hobson, P R; Khan, A; Kyberd, P; Leslie, D; Reid, I D; Symonds, P; Teodorescu, L; Turner, M; Borzou, A; Call, K; Dittmann, J; Hatakeyama, K; Liu, H; Pastika, N; Charaf, O; Cooper, S I; Henderson, C; Rumerio, P; Arcaro, D; Avetisyan, A; Bose, T; Gastler, D; Rankin, D; Richardson, C; Rohlf, J; Sulak, L; Zou, D; Benelli, G; Berry, E; Cutts, D; Ferapontov, A; Garabedian, A; Hakala, J; Heintz, U; Jesus, O; Laird, E; Landsberg, G; Mao, Z; Narain, M; Piperov, S; Sagir, S; Spencer, E; Syarif, R; Breedon, R; Breto, G; Burns, D; Calderon De La Barca Sanchez, M; Chauhan, S; Chertok, M; Conway, J; Conway, R; Cox, P T; Erbacher, R; Flores, C; Funk, G; Gardner, M; Ko, W; Lander, R; Mclean, C; Mulhearn, M; Pellett, D; Pilot, J; Ricci-Tam, F; Shalhout, S; Smith, J; Squires, M; Stolp, D; Tripathi, M; Wilbur, S; Yohay, R; Cousins, R; Everaerts, P; Florent, A; Hauser, J; Ignatenko, M; Saltzberg, D; Takasugi, E; Valuev, V; Weber, M; Burt, K; Clare, R; Ellison, J; Gary, J W; Hanson, G; Heilman, J; Jandir, P; Kennedy, E; Lacroix, F; Long, O R; Malberti, M; Olmedo Negrete, M; Paneva, M I; Shrinivas, A; Wei, H; Wimpenny, S; Yates, B R; Branson, J G; Cerati, G B; Cittolin, S; D'Agnolo, R T; Derdzinski, M; Gerosa, R; Holzner, A; Kelley, R; Klein, D; Letts, J; Macneill, I; Olivito, D; Padhi, S; Pieri, M; Sani, M; Sharma, V; Simon, S; Tadel, M; Vartak, A; Wasserbaech, S; Welke, C; Wood, J; Würthwein, F; Yagil, A; Zevi Della Porta, G; Bhandari, R; Bradmiller-Feld, J; Campagnari, C; Dishaw, A; Dutta, V; Flowers, K; Franco Sevilla, M; Geffert, P; George, C; Golf, F; Gouskos, L; Gran, J; Heller, R; Incandela, J; Mccoll, N; Mullin, S D; Ovcharova, A; Richman, J; Stuart, D; Suarez, I; West, C; Yoo, J; Anderson, D; Apresyan, A; Bendavid, J; Bornheim, A; Bunn, J; Chen, Y; Duarte, J; Mott, A; Newman, H B; Pena, C; Spiropulu, M; Vlimant, J R; Xie, S; Zhu, R Y; Andrews, M B; Azzolini, V; Calamba, A; Carlson, B; Ferguson, T; Paulini, M; Russ, J; Sun, M; Vogel, H; Vorobiev, I; Cumalat, J P; Ford, W T; Jensen, F; Johnson, A; Krohn, M; Mulholland, T; Stenson, K; Wagner, S R; Alexander, J; Chaves, J; Chu, J; Dittmer, S; Mirman, N; Nicolas Kaufman, G; Patterson, J R; Rinkevicius, A; Ryd, A; Skinnari, L; Sun, W; Tan, S M; Tao, Z; Thom, J; Tucker, J; Wittich, P; Winn, D; Abdullin, S; Albrow, M; Apollinari, G; Banerjee, S; Bauerdick, L A T; Beretvas, A; Berryhill, J; Bhat, P C; Bolla, G; Burkett, K; Butler, J N; Cheung, H W K; Chlebana, F; Cihangir, S; Cremonesi, M; Elvira, V D; Fisk, I; Freeman, J; Gottschalk, E; Gray, L; Green, D; Grünendahl, S; Gutsche, O; Hare, D; Harris, R M; Hasegawa, S; Hirschauer, J; Hu, Z; Jayatilaka, B; Jindariani, S; Johnson, M; Joshi, U; Klima, B; Kreis, B; Lammel, S; Linacre, J; Lincoln, D; Lipton, R; Liu, T; Lopes De Sá, R; Lykken, J; Maeshima, K; Marraffino, J M; Maruyama, S; Mason, D; McBride, P; Merkel, P; Mrenna, S; Nahn, S; Newman-Holmes, C; O'Dell, V; Pedro, K; Prokofyev, O; Rakness, G; Ristori, L; Sexton-Kennedy, E; Soha, A; Spalding, W J; Spiegel, L; Stoynev, S; Strobbe, N; Taylor, L; Tkaczyk, S; Tran, N V; Uplegger, L; Vaandering, E W; Vernieri, C; Verzocchi, M; Vidal, R; Wang, M; Weber, H A; Whitbeck, A; Acosta, D; Avery, P; Bortignon, P; Bourilkov, D; Brinkerhoff, A; Carnes, A; Carver, M; Curry, D; Das, S; Field, R D; Furic, I K; Konigsberg, J; Korytov, A; Ma, P; Matchev, K; Mei, H; Milenovic, P; Mitselmakher, G; Rank, D; Shchutska, L; Sperka, D; Thomas, L; Wang, J; Wang, S; Yelton, J; Linn, S; Markowitz, P; Martinez, G; Rodriguez, J L; Ackert, A; Adams, J R; Adams, T; Askew, A; Bein, S; Diamond, B; Hagopian, S; Hagopian, V; Johnson, K F; Khatiwada, A; Prosper, H; Santra, A; Weinberg, M; Baarmand, M M; Bhopatkar, V; Colafranceschi, S; Hohlmann, M; Kalakhety, H; Noonan, D; Roy, T; Yumiceva, F; Adams, M R; Apanasevich, L; Berry, D; Betts, R R; Bucinskaite, I; Cavanaugh, R; Evdokimov, O; Gauthier, L; Gerber, C E; Hofman, D J; Kurt, P; O'Brien, C; Sandoval Gonzalez, I D; Turner, P; Varelas, N; Wu, Z; Zakaria, M; Zhang, J; Bilki, B; Clarida, W; Dilsiz, K; Durgut, S; Gandrajula, R P; Haytmyradov, M; Khristenko, V; Merlo, J-P; Mermerkaya, H; Mestvirishvili, A; Moeller, A; Nachtman, J; Ogul, H; Onel, Y; Ozok, F; Penzo, A; Snyder, C; Tiras, E; Wetzel, J; Yi, K; Anderson, I; Blumenfeld, B; Cocoros, A; Eminizer, N; Fehling, D; Feng, L; Gritsan, A V; Maksimovic, P; Osherson, M; Roskes, J; Sarica, U; Swartz, M; Xiao, M; Xin, Y; You, C; Al-Bataineh, A; Baringer, P; Bean, A; Bowen, J; Bruner, C; Castle, J; Kenny, R P; Kropivnitskaya, A; Majumder, D; Mcbrayer, W; Murray, M; Sanders, S; Stringer, R; Tapia Takaki, J D; Wang, Q; Ivanov, A; Kaadze, K; Khalil, S; Makouski, M; Maravin, Y; Mohammadi, A; Saini, L K; Skhirtladze, N; Toda, S; Lange, D; Rebassoo, F; Wright, D; Anelli, C; Baden, A; Baron, O; Belloni, A; Calvert, B; Eno, S C; Ferraioli, C; Gomez, J A; Hadley, N J; Jabeen, S; Kellogg, R G; Kolberg, T; Kunkle, J; Lu, Y; Mignerey, A C; Shin, Y H; Skuja, A; Tonjes, M B; Tonwar, S C; Apyan, A; Barbieri, R; Baty, A; Bi, R; Bierwagen, K; Brandt, S; Busza, W; Cali, I A; Demiragli, Z; Di Matteo, L; Gomez Ceballos, G; Goncharov, M; Gulhan, D; Hsu, D; Iiyama, Y; Innocenti, G M; Klute, M; Kovalskyi, D; Krajczar, K; Lai, Y S; Lee, Y-J; Levin, A; Luckey, P D; Marini, A C; Mcginn, C; Mironov, C; Narayanan, S; Niu, X; Paus, C; Roland, C; Roland, G; Salfeld-Nebgen, J; Stephans, G S F; Sumorok, K; Tatar, K; Varma, M; Velicanu, D; Veverka, J; Wang, J; Wang, T W; Wyslouch, B; Yang, M; Zhukova, V; Benvenuti, A C; Chatterjee, R M; Dahmes, B; Evans, A; Finkel, A; Gude, A; Hansen, P; Kalafut, S; Kao, S C; Klapoetke, K; Kubota, Y; Lesko, Z; Mans, J; Nourbakhsh, S; Ruckstuhl, N; Rusack, R; Tambe, N; Turkewitz, J; Acosta, J G; Oliveros, S; Avdeeva, E; Bartek, R; Bloom, K; Bose, S; Claes, D R; Dominguez, A; Fangmeier, C; Gonzalez Suarez, R; Kamalieddin, R; Knowlton, D; Kravchenko, I; Meier, F; Monroy, J; Siado, J E; Snow, G R; Stieger, B; Alyari, M; Dolen, J; George, J; Godshalk, A; Harrington, C; Iashvili, I; Kaisen, J; Kharchilava, A; Kumar, A; Parker, A; Rappoccio, S; Roozbahani, B; Alverson, G; Barberis, E; Baumgartel, D; Chasco, M; Hortiangtham, A; Massironi, A; Morse, D M; Nash, D; Orimoto, T; Teixeira De Lima, R; Trocino, D; Wang, R-J; Wood, D; Bhattacharya, S; Hahn, K A; Kubik, A; Low, J F; Mucia, N; Odell, N; Pollack, B; Schmitt, M H; Sung, K; Trovato, M; Velasco, M; Dev, N; Hildreth, M; Hurtado Anampa, K; Jessop, C; Karmgard, D J; Kellams, N; Lannon, K; Marinelli, N; Meng, F; Mueller, C; Musienko, Y; Planer, M; Reinsvold, A; Ruchti, R; Rupprecht, N; Smith, G; Taroni, S; Valls, N; Wayne, M; Wolf, M; Woodard, A; Alimena, J; Antonelli, L; Brinson, J; Bylsma, B; Durkin, L S; Flowers, S; Francis, B; Hart, A; Hill, C; Hughes, R; Ji, W; Liu, B; Luo, W; Puigh, D; Rodenburg, M; Winer, B L; Wulsin, H W; Cooperstein, S; Driga, O; Elmer, P; Hardenbrook, J; Hebda, P; Luo, J; Marlow, D; Medvedeva, T; Mooney, M; Olsen, J; Palmer, C; Piroué, P; Stickland, D; Tully, C; Zuranski, A; Malik, S; Barker, A; Barnes, V E; Benedetti, D; Folgueras, S; Gutay, L; Jha, M K; Jones, M; Jung, A W; Jung, K; Miller, D H; Neumeister, N; Radburn-Smith, B C; Shi, X; Sun, J; Svyatkovskiy, A; Wang, F; Xie, W; Xu, L; Parashar, N; Stupak, J; Adair, A; Akgun, B; Chen, Z; Ecklund, K M; Geurts, F J M; Guilbaud, M; Li, W; Michlin, B; Northup, M; Padley, B P; Redjimi, R; Roberts, J; Rorie, J; Tu, Z; Zabel, J; Betchart, B; Bodek, A; de Barbaro, P; Demina, R; Duh, Y T; Ferbel, T; Galanti, M; Garcia-Bellido, A; Han, J; Hindrichs, O; Khukhunaishvili, A; Lo, K H; Tan, P; Verzetti, M; Chou, J P; Contreras-Campana, E; Gershtein, Y; Gómez Espinosa, T A; Halkiadakis, E; Heindl, M; Hidas, D; Hughes, E; Kaplan, S; Kunnawalkam Elayavalli, R; Kyriacou, S; Lath, A; Nash, K; Saka, H; Salur, S; Schnetzer, S; Sheffield, D; Somalwar, S; Stone, R; Thomas, S; Thomassen, P; Walker, M; Foerster, M; Heideman, J; Riley, G; Rose, K; Spanier, S; Thapa, K; Bouhali, O; Castaneda Hernandez, A; Celik, A; Dalchenko, M; De Mattia, M; Delgado, A; Dildick, S; Eusebi, R; Gilmore, J; Huang, T; Juska, E; Kamon, T; Krutelyov, V; Mueller, R; Pakhotin, Y; Patel, R; Perloff, A; Perniè, L; Rathjens, D; Rose, A; Safonov, A; Tatarinov, A; Ulmer, K A; Akchurin, N; Cowden, C; Damgov, J; Dragoiu, C; Dudero, P R; Faulkner, J; Kunori, S; Lamichhane, K; Lee, S W; Libeiro, T; Undleeb, S; Volobouev, I; Wang, Z; Delannoy, A G; Greene, S; Gurrola, A; Janjam, R; Johns, W; Maguire, C; Melo, A; Ni, H; Sheldon, P; Tuo, S; Velkovska, J; Xu, Q; Arenton, M W; Barria, P; Cox, B; Goodell, J; Hirosky, R; Ledovskoy, A; Li, H; Neu, C; Sinthuprasith, T; Sun, X; Wang, Y; Wolfe, E; Xia, F; Clarke, C; Harr, R; Karchin, P E; Lamichhane, P; Sturdy, J; Belknap, D A; Dasu, S; Dodd, L; Duric, S; Gomber, B; Grothe, M; Herndon, M; Hervé, A; Klabbers, P; Lanaro, A; Levine, A; Long, K; Loveless, R; Ojalvo, I; Perry, T; Pierro, G A; Polese, G; Ruggles, T; Savin, A; Sharma, A; Smith, N; Smith, W H; Taylor, D; Verwilligen, P; Woods, N

    2016-07-15

    A search for narrow resonances decaying into dijet final states is performed on data from proton-proton collisions at a center-of-mass energy of 8 TeV, corresponding to an integrated luminosity of 18.8  fb^{-1}. The data were collected with the CMS detector using a novel technique called data scouting, in which the information associated with these selected events is much reduced, permitting collection of larger data samples. This technique enables CMS to record events containing jets at a rate of 1 kHz, by collecting the data from the high-level-trigger system. In this way, the sensitivity to low-mass resonances is increased significantly, allowing previously inaccessible couplings of new resonances to quarks and gluons to be probed. The resulting dijet mass distribution yields no evidence of narrow resonances. Upper limits are presented on the resonance cross sections as a function of mass, and compared with a variety of models predicting narrow resonances. The limits are translated into upper limits on the coupling of a leptophobic resonance Z_{B}^{'} to quarks, improving on the results obtained by previous experiments for the mass range from 500 to 800 GeV. PMID:27472109

  7. Search for Narrow Resonances in Dijet Final States at √{s }=8 TeV with the Novel CMS Technique of Data Scouting

    Science.gov (United States)

    Khachatryan, V.; Sirunyan, A. M.; Tumasyan, A.; Adam, W.; Asilar, E.; Bergauer, T.; Brandstetter, J.; Brondolin, E.; Dragicevic, M.; Erö, J.; Flechl, M.; Friedl, M.; Frühwirth, R.; Ghete, V. M.; Hartl, C.; Hörmann, N.; Hrubec, J.; Jeitler, M.; König, A.; Krätschmer, I.; Liko, D.; Matsushita, T.; Mikulec, I.; Rabady, D.; Rad, N.; Rahbaran, B.; Rohringer, H.; Schieck, J.; Strauss, J.; Treberer-Treberspurg, W.; Waltenberger, W.; Wulz, C.-E.; Mossolov, V.; Shumeiko, N.; Suarez Gonzalez, J.; Alderweireldt, S.; De Wolf, E. A.; Janssen, X.; Knutsson, A.; Lauwers, J.; Van De Klundert, M.; Van Haevermaet, H.; Van Mechelen, P.; Van Remortel, N.; Van Spilbeeck, A.; Abu Zeid, S.; Blekman, F.; D'Hondt, J.; Daci, N.; De Bruyn, I.; Deroover, K.; Heracleous, N.; Lowette, S.; Moortgat, S.; Moreels, L.; Olbrechts, A.; Python, Q.; Tavernier, S.; Van Doninck, W.; Van Mulders, P.; Van Parijs, I.; Brun, H.; Caillol, C.; Clerbaux, B.; De Lentdecker, G.; Delannoy, H.; Fasanella, G.; Favart, L.; Goldouzian, R.; Grebenyuk, A.; Karapostoli, G.; Lenzi, T.; Léonard, A.; Luetic, J.; Maerschalk, T.; Marinov, A.; Randle-conde, A.; Seva, T.; Vander Velde, C.; Vanlaer, P.; Yonamine, R.; Zenoni, F.; Zhang, F.; Cimmino, A.; Cornelis, T.; Dobur, D.; Fagot, A.; Garcia, G.; Gul, M.; Mccartin, J.; Poyraz, D.; Salva, S.; Schöfbeck, R.; Tytgat, M.; Van Driessche, W.; Yazgan, E.; Zaganidis, N.; Beluffi, C.; Bondu, O.; Brochet, S.; Bruno, G.; Caudron, A.; Ceard, L.; De Visscher, S.; Delaere, C.; Delcourt, M.; Forthomme, L.; Francois, B.; Giammanco, A.; Jafari, A.; Jez, P.; Komm, M.; Lemaitre, V.; Magitteri, A.; Mertens, A.; Musich, M.; Nuttens, C.; Piotrzkowski, K.; Quertenmont, L.; Selvaggi, M.; Vidal Marono, M.; Wertz, S.; Beliy, N.; Aldá Júnior, W. L.; Alves, F. L.; Alves, G. A.; Brito, L.; Correa Martins Junior, M.; Hensel, C.; Moraes, A.; Pol, M. E.; Rebello Teles, P.; Belchior Batista Das Chagas, E.; Carvalho, W.; Chinellato, J.; Custódio, A.; Da Costa, E. M.; Da Silveira, G. G.; De Jesus Damiao, D.; De Oliveira Martins, C.; Fonseca De Souza, S.; Huertas Guativa, L. M.; Malbouisson, H.; Matos Figueiredo, D.; Mora Herrera, C.; Mundim, L.; Nogima, H.; Prado Da Silva, W. L.; Santoro, A.; Sznajder, A.; Tonelli Manganote, E. J.; Vilela Pereira, A.; Ahuja, S.; Bernardes, C. A.; Dogra, S.; Fernandez Perez Tomei, T. R.; Gregores, E. M.; Mercadante, P. G.; Moon, C. S.; Novaes, S. F.; Padula, Sandra S.; Romero Abad, D.; Ruiz Vargas, J. C.; Aleksandrov, A.; Hadjiiska, R.; Iaydjiev, P.; Rodozov, M.; Stoykova, S.; Sultanov, G.; Vutova, M.; Dimitrov, A.; Glushkov, I.; Litov, L.; Pavlov, B.; Petkov, P.; Fang, W.; Ahmad, M.; Bian, J. G.; Chen, G. M.; Chen, H. S.; Chen, M.; Chen, Y.; Cheng, T.; Du, R.; Jiang, C. H.; Leggat, D.; Liu, Z.; Romeo, F.; Shaheen, S. M.; Spiezia, A.; Tao, J.; Wang, C.; Wang, Z.; Zhang, H.; Zhao, J.; Asawatangtrakuldee, C.; Ban, Y.; Li, Q.; Liu, S.; Mao, Y.; Qian, S. J.; Wang, D.; Xu, Z.; Avila, C.; Cabrera, A.; Chaparro Sierra, L. F.; Florez, C.; Gomez, J. P.; González Hernández, C. F.; Ruiz Alvarez, J. D.; Sanabria, J. C.; Godinovic, N.; Lelas, D.; Puljak, I.; Ribeiro Cipriano, P. M.; Antunovic, Z.; Kovac, M.; Brigljevic, V.; Ferencek, D.; Kadija, K.; Micanovic, S.; Sudic, L.; Attikis, A.; Mavromanolakis, G.; Mousa, J.; Nicolaou, C.; Ptochos, F.; Razis, P. A.; Rykaczewski, H.; Finger, M.; Finger, M.; Carrera Jarrin, E.; Elgammal, S.; Mohamed, A.; Mohammed, Y.; Salama, E.; Calpas, B.; Kadastik, M.; Murumaa, M.; Perrini, L.; Raidal, M.; Tiko, A.; Veelken, C.; Eerola, P.; Pekkanen, J.; Voutilainen, M.; Härkönen, J.; Karimäki, V.; Kinnunen, R.; Lampén, T.; Lassila-Perini, K.; Lehti, S.; Lindén, T.; Luukka, P.; Peltola, T.; Tuominiemi, J.; Tuovinen, E.; Wendland, L.; Talvitie, J.; Tuuva, T.; Besancon, M.; Couderc, F.; Dejardin, M.; Denegri, D.; Fabbro, B.; Faure, J. L.; Favaro, C.; Ferri, F.; Ganjour, S.; Ghosh, S.; Givernaud, A.; Gras, P.; Hamel de Monchenault, G.; Jarry, P.; Kucher, I.; Locci, E.; Machet, M.; Malcles, J.; Rander, J.; Rosowsky, A.; Titov, M.; Zghiche, A.; Abdulsalam, A.; Antropov, I.; Baffioni, S.; Beaudette, F.; Busson, P.; Cadamuro, L.; Chapon, E.; Charlot, C.; Davignon, O.; Granier de Cassagnac, R.; Jo, M.; Lisniak, S.; Miné, P.; Naranjo, I. N.; Nguyen, M.; Ochando, C.; Ortona, G.; Paganini, P.; Pigard, P.; Regnard, S.; Salerno, R.; Sirois, Y.; Strebler, T.; Yilmaz, Y.; Zabi, A.; Agram, J.-L.; Andrea, J.; Aubin, A.; Bloch, D.; Brom, J.-M.; Buttignol, M.; Chabert, E. C.; Chanon, N.; Collard, C.; Conte, E.; Coubez, X.; Fontaine, J.-C.; Gelé, D.; Goerlach, U.; Le Bihan, A.-C.; Merlin, J. A.; Skovpen, K.; Van Hove, P.; Gadrat, S.; Beauceron, S.; Bernet, C.; Boudoul, G.; Bouvier, E.; Carrillo Montoya, C. A.; Chierici, R.; Contardo, D.; Courbon, B.; Depasse, P.; El Mamouni, H.

    2016-07-01

    A search for narrow resonances decaying into dijet final states is performed on data from proton-proton collisions at a center-of-mass energy of 8 TeV, corresponding to an integrated luminosity of 18.8 fb-1 . The data were collected with the CMS detector using a novel technique called data scouting, in which the information associated with these selected events is much reduced, permitting collection of larger data samples. This technique enables CMS to record events containing jets at a rate of 1 kHz, by collecting the data from the high-level-trigger system. In this way, the sensitivity to low-mass resonances is increased significantly, allowing previously inaccessible couplings of new resonances to quarks and gluons to be probed. The resulting dijet mass distribution yields no evidence of narrow resonances. Upper limits are presented on the resonance cross sections as a function of mass, and compared with a variety of models predicting narrow resonances. The limits are translated into upper limits on the coupling of a leptophobic resonance ZB' to quarks, improving on the results obtained by previous experiments for the mass range from 500 to 800 GeV.

  8. Search for narrow resonances in dijet final states at $\\sqrt{s}= $ 8 TeV with the novel CMS technique of data scouting

    CERN Document Server

    AUTHOR|(CDS)2072000; Sirunyan, Albert M; Tumasyan, Armen; Adam, Wolfgang; Aşılar, Ece; Bergauer, Thomas; Brandstetter, Johannes; Brondolin, Erica; Dragicevic, Marko; Erö, Janos; Flechl, Martin; Friedl, Markus; Fruehwirth, Rudolf; Ghete, Vasile Mihai; Hartl, Christian; Hörmann, Natascha; Hrubec, Josef; Jeitler, Manfred; König, Axel; Krätschmer, Ilse; Liko, Dietrich; Matsushita, Takashi; Mikulec, Ivan; Rabady, Dinyar; Rad, Navid; Rahbaran, Babak; Rohringer, Herbert; Schieck, Jochen; Strauss, Josef; Treberer-Treberspurg, Wolfgang; Waltenberger, Wolfgang; Wulz, Claudia-Elisabeth; Mossolov, Vladimir; Shumeiko, Nikolai; Suarez Gonzalez, Juan; Alderweireldt, Sara; De Wolf, Eddi A; Janssen, Xavier; Knutsson, Albert; Lauwers, Jasper; Van De Klundert, Merijn; Van Haevermaet, Hans; Van Mechelen, Pierre; Van Remortel, Nick; Van Spilbeeck, Alex; Abu Zeid, Shimaa; Blekman, Freya; D'Hondt, Jorgen; Daci, Nadir; De Bruyn, Isabelle; Deroover, Kevin; Heracleous, Natalie; Lowette, Steven; Moortgat, Seth; Moreels, Lieselotte; Olbrechts, Annik; Python, Quentin; Tavernier, Stefaan; Van Doninck, Walter; Van Mulders, Petra; Van Parijs, Isis; Brun, Hugues; Caillol, Cécile; Clerbaux, Barbara; De Lentdecker, Gilles; Delannoy, Hugo; Fasanella, Giuseppe; Favart, Laurent; Goldouzian, Reza; Grebenyuk, Anastasia; Karapostoli, Georgia; Lenzi, Thomas; Léonard, Alexandre; Luetic, Jelena; Maerschalk, Thierry; Marinov, Andrey; Randle-conde, Aidan; Seva, Tomislav; Vander Velde, Catherine; Vanlaer, Pascal; Yonamine, Ryo; Zenoni, Florian; Zhang, Fengwangdong; Cimmino, Anna; Cornelis, Tom; Dobur, Didar; Fagot, Alexis; Garcia, Guillaume; Gul, Muhammad; Mccartin, Joseph; Poyraz, Deniz; Salva Diblen, Sinem; Schöfbeck, Robert; Tytgat, Michael; Van Driessche, Ward; Yazgan, Efe; Zaganidis, Nicolas; Beluffi, Camille; Bondu, Olivier; Brochet, Sébastien; Bruno, Giacomo; Caudron, Adrien; Ceard, Ludivine; De Visscher, Simon; Delaere, Christophe; Delcourt, Martin; Forthomme, Laurent; Francois, Brieuc; Giammanco, Andrea; Jafari, Abideh; Jez, Pavel; Komm, Matthias; Lemaitre, Vincent; Magitteri, Alessio; Mertens, Alexandre; Musich, Marco; Nuttens, Claude; Piotrzkowski, Krzysztof; Quertenmont, Loic; Selvaggi, Michele; Vidal Marono, Miguel; Wertz, Sébastien; Beliy, Nikita; Aldá Júnior, Walter Luiz; Alves, Fábio Lúcio; Alves, Gilvan; Brito, Lucas; Correa Martins Junior, Marcos; Hensel, Carsten; Moraes, Arthur; Pol, Maria Elena; Rebello Teles, Patricia; Belchior Batista Das Chagas, Ewerton; Carvalho, Wagner; Chinellato, Jose; Custódio, Analu; Da Costa, Eliza Melo; Da Silveira, Gustavo Gil; De Jesus Damiao, Dilson; De Oliveira Martins, Carley; Fonseca De Souza, Sandro; Huertas Guativa, Lina Milena; Malbouisson, Helena; Matos Figueiredo, Diego; Mora Herrera, Clemencia; Mundim, Luiz; Nogima, Helio; Prado Da Silva, Wanda Lucia; Santoro, Alberto; Sznajder, Andre; Tonelli Manganote, Edmilson José; Vilela Pereira, Antonio; Ahuja, Sudha; Bernardes, Cesar Augusto; Dogra, Sunil; Tomei, Thiago; De Moraes Gregores, Eduardo; Mercadante, Pedro G; Moon, Chang-Seong; Novaes, Sergio F; Padula, Sandra; Romero Abad, David; Ruiz Vargas, José Cupertino; Aleksandrov, Aleksandar; Hadjiiska, Roumyana; Iaydjiev, Plamen; Rodozov, Mircho; Stoykova, Stefka; Sultanov, Georgi; Vutova, Mariana; Dimitrov, Anton; Glushkov, Ivan; Litov, Leander; Pavlov, Borislav; Petkov, Peicho; Fang, Wenxing; Ahmad, Muhammad; Bian, Jian-Guo; Chen, Guo-Ming; Chen, He-Sheng; Chen, Mingshui; Chen, Ye; Cheng, Tongguang; Du, Ran; Jiang, Chun-Hua; Leggat, Duncan; Liu, Zhenan; Romeo, Francesco; Shaheen, Sarmad Masood; Spiezia, Aniello; Tao, Junquan; Wang, Chunjie; Wang, Zheng; Zhang, Huaqiao; Zhao, Jingzhou; Asawatangtrakuldee, Chayanit; Ban, Yong; Li, Qiang; Liu, Shuai; Mao, Yajun; Qian, Si-Jin; Wang, Dayong; Xu, Zijun; Avila, Carlos; Cabrera, Andrés; Chaparro Sierra, Luisa Fernanda; Florez, Carlos; Gomez, Juan Pablo; González Hernández, Carlos Felipe; Ruiz Alvarez, José David; Sanabria, Juan Carlos; Godinovic, Nikola; Lelas, Damir; Puljak, Ivica; Ribeiro Cipriano, Pedro M; Antunovic, Zeljko; Kovac, Marko; Brigljevic, Vuko; Ferencek, Dinko; Kadija, Kreso; Micanovic, Sasa; Sudic, Lucija; Attikis, Alexandros; Mavromanolakis, Georgios; Mousa, Jehad; Nicolaou, Charalambos; Ptochos, Fotios; Razis, Panos A; Rykaczewski, Hans; Finger, Miroslav; Finger Jr, Michael; Carrera Jarrin, Edgar; Elgammal, Sherif; Mohamed, Amr; Mohammed, Yasser; Salama, Elsayed; Calpas, Betty; Kadastik, Mario; Murumaa, Marion; Perrini, Lucia; Raidal, Martti; Tiko, Andres; Veelken, Christian; Eerola, Paula; Pekkanen, Juska

    2016-01-01

    A search for narrow resonances decaying into dijet final states is performed on data from proton-proton collisions at a center-of-mass energy of 8 TeV, corresponding to an integrated luminosity of 18.8 fb$^{-1}$. The data were collected with the CMS detector using a novel technique called data scouting, in which the information associated with these selected events is much reduced, permitting collection of larger data samples. This technique enables CMS to record events containing jets at a rate of 1 kHz, by collecting the data from the high-level-trigger system. In this way, the sensitivity to low-mass resonances is increased significantly, allowing previously inaccessible couplings of new resonances to quarks and gluons to be probed. The resulting dijet mass distribution yields no evidence of narrow resonances. Upper limits are presented on the resonance cross sections as a function of mass, and compared with a variety of models predicting narrow resonances. The limits are translated into upper limits on th...

  9. Differential changes in serum uric acid concentrations in sibutramine promoted weight loss in diabetes: results from four weeks of the lead-in period of the SCOUT trial

    Directory of Open Access Journals (Sweden)

    Caterson Ian D

    2009-10-01

    Full Text Available Abstract Background and aims Elevated levels of serum uric acid are associated with an increased risk of cardiovascular morbidity and mortality. The response of uric acid to weight loss therapy (lifestyle plus sibutramine in an overweight and obese cardiovascular high risk population was studied. Methods and results Data from a four week single-blind lead-in period of the Sibutramine Cardiovascular OUTcomes (SCOUT study were analyzed. 2584 patients (24% had diabetes mellitus (DM only, 1748 (16% had cardiovascular disease (CVD only and 6397 (60% had both DM + CVD. Uric acid concentrations (mean ± standard deviation at screening were significantly higher among patients with CVD compared to patients without CVD (p Conclusion A four week daily intake of sibutramine and life style changes was associated with significant reductions in mean uric acid levels. Changes in renal glucose load in diabetes seem to counteract a potential uricosuric effect of sibutramine. Trial Registration The trial is registered at ClinicalTrial.gov number: NCT00234832.

  10. An overview of the SCOUT-AMMA stratospheric aircraft, balloons and sondes campaign in West Africa, August 2006: rationale, roadmap and highlights

    Directory of Open Access Journals (Sweden)

    F. Cairo

    2009-09-01

    Full Text Available A multi-platform field measurement campaign involving aircraft and balloons took place over West Africa between 26 July and 25 August 2006, in the frame of the concomitant AMMA Special Observing Period and SCOUT-O3 African tropical activities.

    Specifically aiming at sampling the upper troposphere and lower stratosphere, the high-altitude research aircraft M55 Geophysica was deployed in Ouagadougou (12.3° N, 1.7° W, Burkina Faso, in conjunction with the German D-20 Falcon, while a series of stratospheric balloon and sonde flights were conducted from Niamey (13.5° N, 2.0° E, Niger.

    The stratospheric aircraft and balloon flights intended to gather experimental evidence for a better understanding of large scale transport, assessing the effect of lightning on NOx production, and studying the impact of intense mesoscale convective systems on water, aerosol, dust and chemical species in the upper troposphere and lower stratosphere. The M55 Geophysica carried out five local and four transfer flights between southern Europe and the Sahel and back, while eight stratospheric balloons and twenty-nine sondes were flown from Niamey.

    These experiments allowed a characterization of the tropopause and lower stratosphere of the region. We provide here an overview of the campaign activities together with a description of the general meteorological situation during the flights and a summary of the observations accomplished.

  11. Search for narrow resonances in dijet final states at $\\sqrt(s)=$ 8 TeV with the novel CMS technique of data scouting

    Energy Technology Data Exchange (ETDEWEB)

    Khachatryan, Vardan; et al.

    2016-07-14

    A search for narrow resonances decaying into dijet final states is performed on data from proton-proton collisions at a center-of-mass energy of 8 TeV, corresponding to an integrated luminosity of 18.8 inverse femtobarns. The data were collected with the CMS detector using a novel technique called data scouting, in which the information associated with these selected events is much reduced, permitting collection of larger data samples. This technique enables CMS to record events containing jets at a rate of 1 kHz, by collecting the data from the high-level-trigger system. In this way, the sensitivity to low-mass resonances is increased significantly, allowing previously inaccessible couplings of new resonances to quarks and gluons to be probed. The resulting dijet mass distribution yields no evidence of narrow resonances. Upper limits are presented on the resonance cross sections as a function of mass, and compared with a variety of models predicting narrow resonances. The limits are translated into upper limits on the coupling of a leptophobic resonance Z'[B] to quarks, improving on the results obtained by previous experiments for the mass range from 500 to 800 GeV.

  12. The Red and the Yellow

    Institute of Scientific and Technical Information of China (English)

    QiuJianghong

    2004-01-01

    THE China film market is based on the so-called battle of the yellow, green and red.Yellow is American Kodak,green Japanese Fuji color, and red China's Lucky film, local counterweight to the two world-famous foreigners.

  13. Romantic red: red enhances men's attraction to women.

    Science.gov (United States)

    Elliot, Andrew J; Niesta, Daniela

    2008-11-01

    In many nonhuman primates, the color red enhances males' attraction to females. In 5 experiments, the authors demonstrate a parallel effect in humans: Red, relative to other achromatic and chromatic colors, leads men to view women as more attractive and more sexually desirable. Men seem unaware of this red effect, and red does not influence women's perceptions of the attractiveness of other women, nor men's perceptions of women's overall likeability, kindness, or intelligence. The findings have clear practical implications for men and women in the mating game and, perhaps, for fashion consultants, product designers, and marketers. Furthermore, the findings document the value of extending research on signal coloration to humans and of considering color as something of a common language, both within and across species. PMID:18954199

  14. Red meat and colorectal cancer

    Directory of Open Access Journals (Sweden)

    Nuri Faruk Aykan

    2015-12-01

    Full Text Available Colorectal cancer (CRC is the third most common cancer in men and the second in women worldwide. More than half of cases occur in more developed countries. The consumption of red meat (beef, pork, lamb, veal, mutton is high in developed countries and accumulated evidence until today demonstrated a convincing association between the intake of red meat and especially processed meat and CRC risk. In this review, meta-analyses of prospective epidemiological studies addressed to this association, observed link of some subtypes of red meat with CRC risk, potential carcinogenic compounds, their mechanisms and actual recommendations of international guidelines are presented.

  15. The Analysis of A Red,Red Rose

    Institute of Scientific and Technical Information of China (English)

    姬丽霞

    2009-01-01

    A Red, Red Rose was written by the great farmer poet of Scotland, Robert Burns. This love poem has been recited by people for more than two centuries. The poet praised his lover's beauty and expressed his love to her with enthusiasm. This paper will analyze this immortal love song from the points of phonological patterns, figure of speech and cohesion to help readers know it better.

  16. Red Blood Cell Antibody Identification

    Science.gov (United States)

    ... limited. Home Visit Global Sites Search Help? RBC Antibody Identification Share this page: Was this page helpful? Also known as: Alloantibody Identification; Antibody ID, RBC; RBC Ab ID Formal name: Red ...

  17. Less red tape; Weniger Bremskloetze

    Energy Technology Data Exchange (ETDEWEB)

    Ristau, Oliver

    2011-07-01

    Since July 2009, the PV Legal initiative funded by the European Commission has brought greater transparency and less red tape to photovoltaic projects in Europe. The remaining obstacles will be resolved by the new initiative, PV Grid.

  18. Proyecto de red para ONG

    OpenAIRE

    Ruiz López, David

    2013-01-01

    Proyecto de una red de comunicaciones para una ONG en la Comunidad de Madrid. Projecte d'una xarxa de comunicacions per a una ONG a la Comunidad de Madrid. Bachelor thesis for the Telecommunication Technologies program on Telematics.

  19. Estimation of gadolinium-induced T1-shortening with measurement of simple signal intensity ratio between the cochlea and brain parenchyma on 3D-FLAIR. Correlation with T1 measurement by TI scout sequence

    International Nuclear Information System (INIS)

    The purpose of this study was to T1-shortening of labyrinthine fluid on 3-dimensional fluid-attenuated inversion recovery (3D-FLAIR) has been reported in many inner ear disorders. Although semi-quantitative assessment by simple signal intensity ratio between cochlear fluid and brain tissue has been tried, its feasibility using a multi-channel phased-array head coil with an inherently inhomogenous sensitivity distribution has not been fully evaluated. We evaluated the feasibility of measuring simple signal intensity ratio by correlating rapid T1 measurements using an inversion time (TI) scout sequence. We evaluated 10 patients with Meniere's disease and 4 patients with sudden deafness. Nine of the patients with Meniere's disease received a unilateral intratympanic injection of gadolinium-diethylenetriamine pentaacetic acid (Gd-DTPA); the tenth patient received bilateral injections. The 4 patients with sudden deafness received a double-dose intravenous injection. Magnetic resonance (MR) images were obtained 24 hours after intratympanic injections and 4 hours after intravenous injections at 3 tesla using a 32-channel head coil. We measured the ratio (CM ratio) between the signal intensity of the perilymph in the cochlea (C) and that of the medulla oblongata (M) and correlated it with the null-point inversion time (TInull) obtained with the TI scout sequence. The TI scout consisted of 85 images obtained with TI values between 132.5 and 3087.5 ms at increments of 37.5 ms. The correlation coefficient between TInull and the natural logarithm of the CM ratio was -0.88 (P<0.01). There was significant negative linear correlation. Measurement of the simple signal intensity ratio between the cochlea and the medulla can be used for semi-quantitative analysis of 3D-FLAIR. The results of this study may facilitate clinical research of inner-ear disease using 3D-FLAIR. (author)

  20. Red meat and colorectal cancer

    OpenAIRE

    Nuri Faruk Aykan

    2015-01-01

    Colorectal cancer (CRC) is the third most common cancer in men and the second in women worldwide. More than half of cases occur in more developed countries. The consumption of red meat (beef, pork, lamb, veal, mutton) is high in developed countries and accumulated evidence until today demonstrated a convincing association between the intake of red meat and especially processed meat and CRC risk. In this review, meta-analyses of prospective epidemiological studies addressed to this association...

  1. Red Tide off Texas Coast

    Science.gov (United States)

    2002-01-01

    Red tides (algae) bloomed late this summer along a 300-mile stretch of Texas' Gulf Coast, killing millions of fish and shellfish as well as making some people sick. State officials are calling this the worst red tide bloom in 14 years. The algae produces a poison that paralyzes fish and prevents them from breathing. There is concern that the deadly algae could impact or even wipe out this year's oyster harvest in Texas, which usually peaks during the Thanksgiving and Christmas holidays. The red tides were first observed off the Texas coast in mid-August and have been growing steadily in size ever since. Red tides tend to bloom and subside rapidly, depending upon changes in wind speed and direction, water temperature, salinity, and rainfall patterns (as the algae doesn't do as well in fresher water). This true-color image of the Texas Gulf Coast was acquired on September 29, 2000, by the Moderate-resolution Imaging Spectroradiometer (MODIS) flying aboard NASA's Terra spacecraft. The red tide can be seen as the dark reddish discoloration in the ocean running southwest to northeast along the coast. In this scene, the bloom appears to be concentrated north and east of Corpus Christi, just off Matagorda Island. The image was made at 500-meter resolution using a combination of MODIS' visible bands 1 (red), 4 (green), and 3 (blue). The city of Houston can be seen clearly as the large, greyish cluster of pixels to the north and west of Galveston Bay, which is about mid-way up the coastline in this image. Also visible in this image are plumes of smoke, perhaps wildfires, both to the north and northeast of Houston. For more information about red tides, refer to the Texas Red Tide Web site. Image courtesy Andrey Savtchenko, MODIS Data Support Team, and the MODIS Ocean Team, NASA's Goddard Space Flight Center

  2. Biodistribution, radiation dosimetry and scouting of 90Y-ibritumomab tiuxetan therapy in patients with relapsed B-cell non-Hodgkin’s lymphoma using 89Zr-ibritumomab tiuxetan and PET

    OpenAIRE

    Rizvi, Saiyada N. F.; Visser, Otto J.; Vosjan, Maria J. W. D.; Lingen, Arthur van; Hoekstra, Otto S.; Zijlstra, Josée M.; Huijgens, Peter C; van Dongen, Guus A. M. S.; Lubberink, Mark

    2012-01-01

    Purpose Positron emission tomography (PET) with 89Zr-ibritumomab tiuxetan can be used to monitor biodistribution of 90Y-ibritumomab tiuxetan as shown in mice. The aim of this study was to assess biodistribution and radiation dosimetry of 90Y-ibritumomab tiuxetan in humans on the basis of 89Zr-ibritumomab tiuxetan imaging, to evaluate whether co-injection of a therapeutic amount of 90Y-ibritumomab tiuxetan influences biodistribution of 89Zr-ibritumomab tiuxetan and whether pre-therapy scout sc...

  3. Análisis de la accesibilidad del portal OpenScout para la búsqueda, etiquetación y difusión de OERs en redes sociales

    OpenAIRE

    Iniesto, Francisco; Rodrigo, Covadonga

    2013-01-01

    El presente artículo describe las posibilidades de trabajo colaborativo desde el punto de vista de la accesibilidad que ofrece el portal OpenScout para la adaptación multicultural de contenido educativo en abierto REAs. Para ello se han analizado en detalle el grado de accesibilidad que ofrecen las herramientas de compartición y reutilización de los recursos así como los aspectos de integración del portal con el uso de las redes sociales

  4. The Cyborg Astrobiologist: Matching of Prior Textures by Image Compression for Geological Mapping and Novelty Detection

    CERN Document Server

    McGuire, P C; Bruner, K R; Gross, C; Ormö, J; Smosna, R A; Walter, S; Wendt, L

    2013-01-01

    (abridged) We describe an image-comparison technique of Heidemann and Ritter that uses image compression, and is capable of: (i) detecting novel textures in a series of images, as well as of: (ii) alerting the user to the similarity of a new image to a previously-observed texture. This image-comparison technique has been implemented and tested using our Astrobiology Phone-cam system, which employs Bluetooth communication to send images to a local laptop server in the field for the image-compression analysis. We tested the system in a field site displaying a heterogeneous suite of sandstones, limestones, mudstones and coalbeds. Some of the rocks are partly covered with lichen. The image-matching procedure of this system performed very well with data obtained through our field test, grouping all images of yellow lichens together and grouping all images of a coal bed together, and giving a 91% accuracy for similarity detection. Such similarity detection could be employed to make maps of different geological unit...

  5. The Cyborg Astrobiologist: Porting from a wearable computer to the Astrobiology Phone-cam

    OpenAIRE

    Bartolo, Alexandra; McGuire, Patrick C.; Camilleri, Kenneth P; Spiteri, Christopher; Borg, Jonathan C.; Farrugia, Philip J.; Ormo, Jens; Gomez-Elvira, Javier; Rodriguez-Manfredi, Jose Antonio; Diaz-Martinez, Enrique; Ritter, Helge; Haschke, Robert; Oesker, Markus; Ontrup, Joerg

    2007-01-01

    We have used a simple camera phone to significantly improve an `exploration system' for astrobiology and geology. This camera phone will make it much easier to develop and test computer-vision algorithms for future planetary exploration. We envision that the `Astrobiology Phone-cam' exploration system can be fruitfully used in other problem domains as well.

  6. The Cyborg Astrobiologist: porting from a wearable computer to the Astrobiology Phone-cam

    Science.gov (United States)

    Bartolo, Alexandra; McGuire, Patrick C.; Camilleri, Kenneth P.; Spiteri, Christopher; Borg, Jonathan C.; Farrugia, Philip J.; Ormö, Jens; Gómez-Elvira, Javier; Rodriguez-Manfredi, José Antonio; Díaz-Martínez, Enrique; Ritter, Helge; Haschke, Robert; Oesker, Markus; Ontrup, Jörg

    2007-08-01

    We have used a simple camera phone to significantly improve an `exploration system' for astrobiology and geology. This camera phone will make it much easier to develop and test computer-vision algorithms for future planetary exploration. We envision that the `Astrobiology Phone-cam' exploration system can be fruitfully used in other problem domains as well.

  7. Combustion of Organic Molecules by the Thermal Decomposition of Perchlorate Salts: Implications for Organics at the Mars Phoenix Scout Landing Site

    Science.gov (United States)

    Ming, D.W.; Morris, R.V.; Niles, B.; Lauer, H.V.; Archer, P.D.; Sutter, B.; Boynton, W.V.; Golden, D.C.

    2009-01-01

    The Mars 2007 Phoenix Scout Mission successfully landed on May 25, 2008 and operated on the northern plains of Mars for 150 sols. The primary mission objective was to study the history of water and evaluate the potential for past and present habitability in Martian arctic ice-rich soil [1]. Phoenix landed near 68 N latitude on polygonal terrain created by ice layers that are a few centimeters under loose soil materials. The Phoenix Mission is assessing the potential for habitability by searching for organic molecules in the ice or icy soils at the landing site. Organic molecules are necessary building blocks for life, although their presence in the ice or soil does not indicate life itself. Phoenix searched for organic molecules by heating soil/ice samples in the Thermal and Evolved-Gas Analyzer (TEGA, [2]). TEGA consists of 8 differential scanning calorimeter (DSC) ovens integrated with a magnetic-sector mass spectrometer with a mass range of 2-140 daltons [2]. Endothermic and exothermic reactions are recorded by the TEGA DSC as samples are heated from ambient to 1000 C. Evolved gases, including any organic molecules and their fragments, are simultaneously measured by the mass spectrometer during heating. Phoenix TEGA data are still under analysis; however, no organic fragments have been identified to date in the evolved gas analysis (EGA). The MECA Wet Chemistry Lab (WCL) discovered a perchlorate salt in the Phoenix soils and a mass 32 peak evolved between 325 and 625 C for one surface sample dubbed Baby Bear [3]. The mass 32 peak is attributed to evolved O2 generated during the thermal decomposition of the perchlorate salt. Perchlorates are very strong oxidizers when heated, so it is possible that organic fragments evolved in the temperature range of 300-600 C were combusted by the O2 released during the thermal decomposition of the perchlorate salt. The byproduct of the combustion of organic molecules is CO2. There is a prominent release of CO2 between 200

  8. Betelgeuse and the red supergiants

    CERN Document Server

    van Loon, Jacco Th

    2013-01-01

    Betelgeuse is one of the most magnificent stars in the sky, and one of the nearest red supergiants. Astronomers gathered in Paris in the Autumn of 2012 to decide what we know about its structure, behaviour, and past and future evolution, and how to place this in the general context of the class of red supergiants. Here I reflect on the discussions and propose a synthesis of the presented evidence. I believe that, in those four days, we have achieved to solve a few riddles.

  9. sujetos a Efectos de Red

    Directory of Open Access Journals (Sweden)

    José Luis Arroyo Barrigüete

    2005-01-01

    Full Text Available El objetivo del presente artículo es analizar una de las principales características de la Economía Digital: las Externalidades de Red. Dichas Externalidades inducen en los mercados una realimentación positiva que lleva en muchos casos a situaciones prácticamente monopolísticas. Se identificarán aquellas capacidades internas de las empresas que resultan críticas para lograr el éxito en presencia de Efectos de Red así como las principales estrategias que es posible desarrollar en este contexto.

  10. White Wedding and Red Wedding

    Institute of Scientific and Technical Information of China (English)

    李梦遥

    2010-01-01

    @@ The most obvious difference between western wedding and Chinese wedding tradition lies in the main color of the ceremony.Western wedding is known as the white wedding in some sense,for its main color is white from bride's gown(礼服)to the decoration of the wedding hall.While,traditional Chinese wedding ceremony is full of the color of red.

  11. The Temperatures of Red Supergiants

    NARCIS (Netherlands)

    Davies, Ben; Kudritzki, Rolf-Peter; Plez, Bertrand; Trager, Scott; Lançon, Ariane; Gazak, Zach; Bergemann, Maria; Evans, Chris; Chiavassa, Andrea

    2013-01-01

    We present a re-appraisal of the temperatures of red supergiants (RSGs) using their optical and near-infrared spectral energy distributions (SEDs). We have obtained data of a sample of RSGs in the Magellanic Clouds using VLT+XSHOOTER, and we fit MARCS model atmospheres to different regions of the sp

  12. The Temperatures of Red Supergiants

    NARCIS (Netherlands)

    Davies, Ben; Kudritzki, Rolf-Peter; Plez, Bertrand; Trager, Scott; Lancon, Ariane; Gazak, Zach; Bergemann, Maria; Evans, Chris; Chiavassa, Andrea

    2013-01-01

    We present a re-appraisal of the temperatures of Red Supergiants (RSGs) using their optical and near-infrared spectral energy distributions (SEDs). We have obtained data of a sample of RSGs in the Magellanic Clouds using VLT+XSHOOTER, and we fit MARCS model atmospheres to different regions of the sp

  13. Control of poultry red mites

    DEFF Research Database (Denmark)

    Kilpinen, Ole; Steenberg, Tove

    2008-01-01

    The poultry red mite (PRM), Dermanyssus gallinae, is the most important ectoparasite in European egg production. The mites hide in cracks and crevices in the near vicinity of the resting places of the birds, coming out to feed mainly during the night. Under favourable conditions the population can...

  14. Advances in Red VCSEL Technology

    Directory of Open Access Journals (Sweden)

    Klein Johnson

    2012-01-01

    Full Text Available Red VCSELs offer the benefits of improved performance and lower power consumption for medical and industrial sensing, faster printing and scanning, and lower cost, higher speed interconnects based upon plastic optical fiber (POF. However, materials challenges make it more difficult to achieve the desired performance than at the well-developed wavelength of 850 nm. This paper will describe the state of the art of red VCSEL performance and the results of development efforts to achieve improved output power and a broader temperature range of operation. It will also provide examples of the applications of red VCSELs and the benefits they offer. In addition, the packaging flexibility offered by VCSELs, and some examples of non-Hermetic package demonstrations will be discussed. Some of the red VCSEL performance demonstrations include output power of 14 mW CW at room temperature, a record maximum temperature of 115∘C for CW operation at an emission wavelength of 689 nm, time to 1% failure at room temperature of approximately 200,000 hours, lifetime in a 50∘C, 85% humidity environment in excess of 3500 hours, digital data rate of 3 Gbps, and peak pulsed array power of greater than 100 mW.

  15. Red blood cells, sickle cell (image)

    Science.gov (United States)

    Sickle cell anemia is an inherited blood disease in which the red blood cells produce abnormal pigment (hemoglobin). ... abnormal hemoglobin causes deformity of the red blood cells into crescent or sickle-shapes, as seen in this photomicrograph.

  16. Near Earth Asteroid Scout Project

    Data.gov (United States)

    National Aeronautics and Space Administration — In considering targets for human asteroid missions, there are several major factors that will make a significant difference in assessment of mission risks that...

  17. The Pascal Mars Scout Mission

    Science.gov (United States)

    Haberle, R. M.; Fonda, Mark (Technical Monitor)

    2002-01-01

    Except for Earth, Mars is the planet most amenable to surface-based climate studies. Its surface is accessible, and the kind of observations that are needed, such as meteorological measurements from a long-lived global network, are readily achievable. Weather controls the movement of dust, the exchange of water between the surface and atmosphere, and the cycling of CO2 between the poles. We know there is a weather signal, we know how to measure it, and we know how to interpret it. Pascal seeks to understand the long-term global behavior of near-surface weather systems on Mars, how they interact with its surface, and, therefore, how they control its climate system. To achieve this, Pascal delivers 18 Science Stations to the surface of the planet that operate for three Mars years (5.6 Earth years). The network has stations operating in the tropics, midlatitudes, and polar regions of both hemispheres. During entry, descent, and landing, each Pascal probe acquires deceleration measurements to determine thermal structure, and descent images to characterize local terrain. On the surface, each Science Station takes daily measurements of pressure, opacity, temperature, wind speed, and water vapor concentration and monthly panoramic images of the landing environment. These data will characterize the planet's climate system and how atmosphere-surface interactions control it. The Pascal mission is named after 17th century French Scientist, Blaise Pascal, who pioneered measurements of atmospheric pressure. Pressure is the most critical measurement because it records the "heartbeat" of the planet's general circulation and climate system.

  18. 7 CFR 29.1053 - Red (R).

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Red (R). 29.1053 Section 29.1053 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... Type 92) § 29.1053 Red (R). A brownish red....

  19. 27 CFR 9.167 - Red Mountain

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Red Mountain 9.167 Section... Mountain (a) Name. The name of the viticultural area described in this section is “Red Mountain.” (b) Approved maps. The appropriate map for determining the boundaries of the Red Mountain viticultural area...

  20. 21 CFR 184.1121 - Red algae.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Red algae. 184.1121 Section 184.1121 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN... Substances Affirmed as GRAS § 184.1121 Red algae. (a) Red algae are seaweeds of the species...

  1. “AmaRosa,” a red skinned, red fleshed fingerling with high phytonutrient value

    Science.gov (United States)

    AmaRosa is a mid season specialty potato with red skin and red flesh. This selection is unique among commercially available potato varieties in that plants set a large number of smooth, small, fingerling-shaped tubers with red skin and red flesh. AmaRosa tubers have higher total anthocyanin and hyd...

  2. 76 FR 22033 - Safety Zone; Red River Safety Zone, Red River, MN

    Science.gov (United States)

    2011-04-20

    ... SECURITY Coast Guard 33 CFR Part 165 RIN 1625-AAOO Safety Zone; Red River Safety Zone, Red River, MN AGENCY... Safety Unit Duluth, MN is establishing a temporary safety zone on the Red River, MN. This safety zone is... entering all navigable waters of the Red River in the State of Minnesota north of a line drawn...

  3. Red nodule on the breast

    Directory of Open Access Journals (Sweden)

    Roberta Colucci

    2012-01-01

    Full Text Available A 63-year-old woman living in the countryside referred to our department with a 2-month history of a red nodule localized on the right breast. Histological examination, immunohistochemical analyses and serologic evaluation conducted with ELISA and Western blot were performed. Clinical diagnosis of borrelial lymphocytoma was not possible solely on the clinical presentation of a classical nodular form without lymphoadenopathy. An absence of a referred prior tick bite and a previous or concomitant erythema migrans at clinical presentation rendered a more challenging diagnosis. The fact that the patient lived in the countryside, the appearance of the breast nodule in September, and serologic, histologic, and immunohistochemical analysis facilitated the diagnosis of borrelial lymphocytoma. We report this case to highlight the importance of an investigation of Lyme borreliosis when a patient living in the countryside presents with a red nodule of the nipple and areola.

  4. Water vapor budget associated to overshoots in the tropical stratosphere: mesoscale modelling study of 4–5 August 2006 during SCOUT-AMMA

    Directory of Open Access Journals (Sweden)

    X. M. Liu

    2010-02-01

    Full Text Available The aim of this paper is to study the impacts of overshooting convection at a local scale on the water distribution in the tropical UTLS. Overshooting convection is likely to be one of the key processes controlling the entry of water vapour amount in the stratosphere by injecting ice crystals above the tropopause which later sublimate and hydrate the lower stratosphere. For this purpose, we quantify the individual impact of two overshooting cases in Africa observed during SCOUT-AMMA: the case of 4 August 2006 over Southern Chad which is likely to have influenced the water vapour measurements by micro-SDLA and FLASH-B from Niamey on 5 August, and the case of a mesoscale convective system over Aϊr on 5 August 2006. We make use of high resolution (down to 1 km horizontally three nested grid simulations with the three-dimensional regional atmospheric model BRAMS (Brazilian Regional Atmospheric Modelling System. In both cases, BRAMS succeeds in simulating the main features of the convective activity, as well as overshooting convection, thought the exact position and time of the overshoots indicated by MSG brightness temperature difference is not fully reproduced (typically 1° in latitude compared with the overshoots indicated by brightness temperature difference from satellite observations for both cases, and several hours shift the Aϊr case on 5 August 2006. Total water budgets associated with these two events show a significant injection of ice particles above the tropopause with maximum values of about 3.7 ton s−1 for the Chad case (4 August and 1.4 ton s−1 for the Aϊr case (5 August, and a total cross tropopause transport of about 3300 ton h−1 for the Chad case and 2400 ton h−1 for the Aϊr case in the third domain of simulation. The order of magnitude of these modelled fluxes is lower but comparable with similar studies in other tropical areas based on models. These two estimations exhibit

  5. Right turn on red (RTOR)

    OpenAIRE

    Vovk, Žiga

    2013-01-01

    The subject of this thesis is introducing the principle of law permitting right turn on red (in further RTOR) and seeking procedures for better level of service in traffic intersections. In the first part, the work talks about history and usage of the RTOR around the world. Afterwards it focuses on research data from and about traffic accidents, benefits and disadvantages, and dangerous situations occurred because of the RTOR. Thesis concludes with principles of RTOR adjusted for Slovenia inc...

  6. The structure of the chromophore within DsRed, a red fluorescent protein from coral

    OpenAIRE

    Gross, Larry A.; Baird, Geoffrey S.; Hoffman, Ross C.; Baldridge, Kim K; Tsien, Roger Y.

    2000-01-01

    DsRed, a brilliantly red fluorescent protein, was recently cloned from Discosoma coral by homology to the green fluorescent protein (GFP) from the jellyfish Aequorea. A core question in the biochemistry of DsRed is the mechanism by which the GFP-like 475-nm excitation and 500-nm emission maxima of immature DsRed are red-shifted to the 558-nm excitation and 583-nm emission maxima of mature DsRed. After digestion of mature DsRed with lysyl endopeptidase, high-resolut...

  7. The weight lowering effect of sibutramine and its impact on serum lipids in cardiovascular high risk patients with and without type 2 diabetes mellitus - an analysis from the SCOUT lead-in period

    Directory of Open Access Journals (Sweden)

    James Philip T

    2010-02-01

    Full Text Available Abstract Background Obesity, type 2 diabetes mellitus (T2D and unhealthy blood lipid profile are strongly associated with the risk of developing cardiovascular disease (CVD. We examined whether blood lipid changes with short term administration of the weight lowering drug, sibutramine and lifestyle modification in obese and overweight high-risk patients was associated with T2D status at screening. Methods The Sibutramine Cardiovascular OUTcomes (SCOUT trial included obese and overweight patients at increased risk of cardiovascular events. All patients received guidance on diet and exercise plus once-daily 10 mg sibutramine during the 6-week, single blind lead-in period. Multivariable regression models were used to investigate factors associated with changes in lipid levels during the first four weeks of treatment. Results A total of 10 742 patients received at least one dose of sibutramine during the 6-week lead-in period of SCOUT. After four weeks, patients experienced mean reductions in low density lipoprotein (LDL-C 0.19 mmol/L, high density lipoprotein (HDL-C 0.019 mmol/L, very low density lipoprotein (VLDL-C 0.08 mmol/L, total cholesterol (TC 0.31 mmol/L and triglycerides 0.24 mmol/L (p 2 decrease in BMI in patients with T2D was associated with -0.09 mmol/L in LDL-C (P Conclusion Short term weight management with sibutramine therapy in obese or overweight high-risk patients induced significant mean reductions for all lipids. Those without T2D benefited most. Patients with hyperlipidaemia and the less obese patients also had greater falls in LDL-C and TC during weight loss. The trial is registered at ClinicalTrial.gov number: NCT00234832.

  8. La red sobre trabajo infantil peligroso (Red Tip

    Directory of Open Access Journals (Sweden)

    Walter Varillas

    2003-01-01

    Full Text Available En el mundo, aproximadamente 351.7 millones de niños entre 5 y 17 años realizaban algún tipo de actividad económica, de ellos 170.5 millones (48.5% realizaban algún tipo de trabajo considerado peligroso. Un alto porcentaje se encuentra en la agricultura, otros en minas, manufacturas, ladrilleras, predominantemente en la economía informal. El Convenio 138 (cobre la edad mínima de admisión en el empleo de la OIT y el Convenio 182 (sobre las peores formas de trabajo infantil, definen como trabajo infantil peligroso el que puede afectar la salud, seguridad y moralidad de los menores. Estudios específicos sobre los menores muestran su susceptibilidad particular frente a los riesgos laborales, aumentando la peligrosidad para su normal desarrollo y crecimiento: "los niños no son adultos pequeños". Los profesionales de la seguridad y salud en el trabajo pueden colaborar con los profesionales y las organizaciones especializadas en el trabajo infantil, en la definición y caracterización de lo que significa el trabajo infantil peligroso. Para ello se ha conformado la Red sobre Trabajo Infantil Peligroso (Red TIP, con la finalidad de articular estos dos espacios, orientados a eliminar el trabajo infantil peligroso y rescatar al menor y devolverle la oportunidad de sonreír ahora y en el futuro.

  9. Red de Empresas: Empresas Virtuales

    OpenAIRE

    Romina Anahí Lucanera

    2010-01-01

    En este trabajo se resumen algunos aportes teóricos sobre el nuevo paradigma organizacional: Empresa-Red. La suma relevancia adquirida por el mismo, producto de los constantes y rápidos cambios del entorno, obliga a las organizaciones a obtener ventajas competitivas mediante estrategias de cooperación entre ellas. En este trabajo se explican brevemente el concepto, la fundamentación, el diseño, la clasifi cación, los componentes y el comportamiento de las empresas virtuales, por ser éstas las...

  10. Unripe red fruits may be aposematic

    OpenAIRE

    Lev-Yadun, Simcha; Ne'eman, Gidi; Izhaki, Ido

    2009-01-01

    The unripe fruits of certain species are red. Some of these species disperse their seeds by wind (Nerium oleander, Anabasis articulata), others by adhering to animals with their spines (Emex spinosa) or prickles (Hedysarum spinosissimum). Certainly neither type uses red coloration as advertisement to attract the seed dispersing agents. Fleshy-fruited species (Rhamnus alaternus, Rubus sanguineus and Pistacia sp.), which disperse their seeds via frugivores, change fruit color from green to red ...

  11. The Red-Blue Transportation Problem

    OpenAIRE

    Vancroonenburg, Wim; Della Croce, Federico; Goossens, Dries; Spieksma, Frits

    2014-01-01

    This paper considers the Red-Blue Transportation Problem (Red-Blue TP), a generalization of the transportation problem where supply nodes are partitioned into two sets and so-called exclusionary constraints are imposed. We encountered a special case of this problem in a hospital context, where patients need to be assigned to rooms. We establish the problem's complexity, and we compare two integer programming formulations. Furthermore, a maximization variant of Red-Blue TP is presented, for...

  12. European red list of vascular plants

    OpenAIRE

    Abeli, Th.; Acevedo Rodríguez, A.; Aguiar, Carlos

    2011-01-01

    The European Red List is a review of the conservation status of c. 6,000 European species (mammals, reptiles, amphibians, dragonflies, butterflies, freshwater fishes, and selected groups of beetles, molluscs, and vascular plants) according to IUCN regional Red Listing guidelines. It identifies those species that are threatened with extinction at the regional level – in order that appropriate conservation action can be taken to improve their status. This Red List public...

  13. Public Perceptions of Florida Red Tide Risks

    OpenAIRE

    Kuhar, Sara E.; Nierenberg, Kate; Kirkpatrick, Barbara; Tobin, Graham A.

    2009-01-01

    This research integrates theoretical frameworks of risk perception, social amplification of risk, and the role of place-specific contexts in order to explore the various perceptions surrounding Florida red tides. Florida red tides are naturally occurring events that are increasing in frequency, duration, and severity. This has implications for public health, the local economy, and ecosystem health. While many of the negative impacts of Florida red tides are not easily controlled, some of the ...

  14. Infra Red 3D Computer Mouse

    DEFF Research Database (Denmark)

    Harbo, Anders La-Cour; Stoustrup, Jakob

    2000-01-01

    The infra red 3D mouse is a three dimensional input device to a computer. It works by determining the position of an arbitrary object (like a hand) by emitting infra red signals from a number of locations and measuring the reflected intensities. To maximize stability, robustness, and use of bandw......The infra red 3D mouse is a three dimensional input device to a computer. It works by determining the position of an arbitrary object (like a hand) by emitting infra red signals from a number of locations and measuring the reflected intensities. To maximize stability, robustness, and use...

  15. Red Sesbania Distribution - lines [ds81

    Data.gov (United States)

    California Department of Resources — This layer conatains line data for the red sesbania (Sesbania punicea) database. The database represents historic and current observations by various individuals of...

  16. Red Sesbania Distribution - points [ds80

    Data.gov (United States)

    California Department of Resources — This layer contains point data for the red sesbania (Sesbania punicea) database. The database represents historic and current observations by various individuals of...

  17. Pure red cell aplasia and associated thymoma

    Directory of Open Access Journals (Sweden)

    Cristian Rosu

    2011-04-01

    Full Text Available Pure red cell aplasia is a rare cause of anemia, caused by an absence of red blood cell precursors in the bone marrow. It is usually a paraneoplastic syndrome, associated most commonly with large-cell granular lymphocyte leukemia but also thymoma. For patients who present both pure red cell aplasia and thymoma, thymectomy leads to an initial remission of the aplasia in 30% of cases. However, sustained remission may require the addition of medications such as corticosteroids, cyclospo­rine, or cyclophosphamide. We present a case of pure red cell aplasia associated with a thymoma in an otherwise healthy 80 year-old woman.

  18. La red sobre trabajo infantil peligroso (Red Tip The hazardous child labor network (Red Tip

    Directory of Open Access Journals (Sweden)

    Walter Varillas

    2003-01-01

    Full Text Available En el mundo, aproximadamente 351.7 millones de niños entre 5 y 17 años realizaban algún tipo de actividad económica, de ellos 170.5 millones (48.5% realizaban algún tipo de trabajo considerado peligroso. Un alto porcentaje se encuentra en la agricultura, otros en minas, manufacturas, ladrilleras, predominantemente en la economía informal. El Convenio 138 (cobre la edad mínima de admisión en el empleo de la OIT y el Convenio 182 (sobre las peores formas de trabajo infantil, definen como trabajo infantil peligroso el que puede afectar la salud, seguridad y moralidad de los menores. Estudios específicos sobre los menores muestran su susceptibilidad particular frente a los riesgos laborales, aumentando la peligrosidad para su normal desarrollo y crecimiento: "los niños no son adultos pequeños". Los profesionales de la seguridad y salud en el trabajo pueden colaborar con los profesionales y las organizaciones especializadas en el trabajo infantil, en la definición y caracterización de lo que significa el trabajo infantil peligroso. Para ello se ha conformado la Red sobre Trabajo Infantil Peligroso (Red TIP, con la finalidad de articular estos dos espacios, orientados a eliminar el trabajo infantil peligroso y rescatar al menor y devolverle la oportunidad de sonreír ahora y en el futuro.In the world, approximately 351.7 millions children between 5 and 17 years old work. Of them, 170,5 millions (48.5% work at the hazardous child labor forms. A high percentage is in agriculture, others in mines, manufactures, brick makers, predominantly in informal economy. The 138 Convention of ILO and the 182 Convention, define as hazardous child labor activities that can affect the health, safety and morality of the children. Studies on the children at work point out their particular susceptibility to some occupational risks, increasing the danger for their normal development and growth. "They are not little adults". The occupational health

  19. Cadmium uptake by rat red blood cells

    International Nuclear Information System (INIS)

    Rat red blood cells were employed to study the uptake of cadmium (109Cd). Suspensions of red blood cells were exposed to Cd concentrations (both bound and free) observed following in vivo Cd administration. Cd uptake was biphasic with an initial rapid phase (0C was one-fourth of that at 370C. The metabolic inhibitors: sodium fluoride (1mM), potassium cyanide (1mM) and carbonyl cyanide-m-chlorophenyl hydrazone (2μM) and the Na+-K+-ATPase inhibitor, ouabain (1mM) did not reduce Cd (50μM) uptake into red blood cells. This suggests that the uptake of Cd into red blood cells was not an active process. Incubation of Cd (10μM) with an equimolar concentration of Zn did not alter uptake of Cd into red blood cells, but at 5 and 10 times higher concentrations of Zn, Cd uptake was enhanced 5-fold. Mercury at one-tenth and equimolar concentrations of Cd increased Cd uptake by red blood cells 2-fold. N-Ethylmaleimide (0.5-5mM), which irreversibly inactivates membrane sulfhydryl groups, decreased Cd uptake. The data indicate that Cd uptake into rat red blood cells occurs by passive transport and that alterations of sulfhydryls of red blood cell membrane may modulate the process. (author)

  20. Red River Basin Mapping 2008-2010

    Data.gov (United States)

    Federal Emergency Management Agency, Department of Homeland Security — This LiDAR data covers the Red River Basin with portions of ND, MN, SD and flows into Canada. The US Red River Basin boudnary covers 40,860 sqmi,with the additional...

  1. Big Red: A Development Environment for Bigraphs

    DEFF Research Database (Denmark)

    Faithfull, Alexander John; Perrone, Gian David; Hildebrandt, Thomas

    2013-01-01

    We present Big Red, a visual editor for bigraphs and bigraphical reactive systems, based upon Eclipse. The editor integrates with several existing bigraph tools to permit simulation and model-checking of bigraphical models. We give a brief introduction to the bigraphs formalism, and show how these...... concepts manifest within the tool using a small motivating example bigraphical model developed in Big Red....

  2. Public perceptions of Florida red tide risks.

    Science.gov (United States)

    Kuhar, Sara E; Nierenberg, Kate; Kirkpatrick, Barbara; Tobin, Graham A

    2009-07-01

    This research integrates theoretical frameworks of risk perception, social amplification of risk, and the role of place-specific contexts in order to explore the various perceptions surrounding Florida red tides. Florida red tides are naturally occurring events that are increasing in frequency, duration, and severity. This has implications for public health, the local economy, and ecosystem health. While many of the negative impacts of Florida red tides are not easily controlled, some of the secondary impacts may be mitigated through individuals' responses. However, public perception and consequent reactions to Florida red tides have not been investigated. This research uses questionnaire surveys, and semi-structured interviews, to explore the various perceptions of the risk surrounding red tides. Surveys and interviews were conducted along two Florida west coast beaches. The results indicate that the underlying foundations of the social amplification of the risk framework are applicable to understanding how individuals form perceptions of risk relative to red tide events. There are key differences between the spatial locations of individuals and corresponding perceptions, indicating that place-specific contexts are essential to understanding how individuals receive and interpret risk information. The results also suggest that individuals may be lacking efficient and up-to-date information about Florida red tides and their impacts because of inconsistent public outreach. Overall, social and spatial factors appear to be influential as to whether individuals amplify or attenuate the risks associated with Florida red tides. PMID:19392675

  3. 33 CFR 117.135 - Red River.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Red River. 117.135 Section 117.135 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY BRIDGES DRAWBRIDGE OPERATION REGULATIONS Specific Requirements Arkansas § 117.135 Red River. The draws of the bridges...

  4. 33 CFR 117.491 - Red River.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Red River. 117.491 Section 117.491 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY BRIDGES DRAWBRIDGE OPERATION REGULATIONS Specific Requirements Louisiana § 117.491 Red River. (a) The draw of the Union...

  5. 76 FR 23485 - Safety Zone; Red River

    Science.gov (United States)

    2011-04-27

    ... SECURITY Coast Guard 33 CFR Part 165 RIN 1625-AA00 Safety Zone; Red River AGENCY: Coast Guard, DHS. ACTION... Red River in the State of North Dakota, including those portions of the river bordered by Richland... across latitude 46 20'00'' N, extending the entire width of the river. This safety zone is needed...

  6. Internal rotation of red giants by asteroseismology

    Directory of Open Access Journals (Sweden)

    Christensen-Dalsgaard J.

    2013-03-01

    Full Text Available We present an asteroseismic approach to study the dynamics of the stellar interior in red giant stars by asteroseismic inversion of the splittings induced by the stellar rotation on the oscillation frequencies. We show preliminary results obtained for the red giant KIC4448777 observed by the space mission Kepler.

  7. 21 CFR 640.10 - Red Blood Cells.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 7 2010-04-01 2010-04-01 false Red Blood Cells. 640.10 Section 640.10 Food and... ADDITIONAL STANDARDS FOR HUMAN BLOOD AND BLOOD PRODUCTS Red Blood Cells § 640.10 Red Blood Cells. The proper name of this product shall be Red Blood Cells. The product is defined as red blood cells...

  8. White dwarf-red dwarf binaries in the Galaxy

    NARCIS (Netherlands)

    Besselaar, E.J.M. van den

    2007-01-01

    This PhD thesis shows several studies on white dwarf - red dwarf binaries. White dwarfs are the end products of most stars and red dwarfs are normal hydrogen burning low-mass stars. White dwarf - red dwarf binaries are both blue (white dwarf) and red (red dwarf). Together with the fact that they are

  9. Red, Rank, and Romance in Women Viewing Men

    Science.gov (United States)

    Elliot, Andrew J.; Niesta Kayser, Daniela; Greitemeyer, Tobias; Lichtenfeld, Stephanie; Gramzow, Richard H.; Maier, Markus A.; Liu, Huijun

    2010-01-01

    In many nonhuman species of vertebrates, females are attracted to red on male conspecifics. Red is also a signal of male status in many nonhuman vertebrate species, and females show a mating preference for high-status males. These red-attraction and red-status links have been found even when red is displayed on males artificially. In the present…

  10. Remote Sensing of Arctic Environmental Conditions and Critical Infrastructure using Infra-Red (IR) Cameras and Unmanned Air Vehicles (UAVs)

    Science.gov (United States)

    Hatfield, M. C.; Webley, P.; Saiet, E., II

    2014-12-01

    Remote Sensing of Arctic Environmental Conditions and Critical Infrastructure using Infra-Red (IR) Cameras and Unmanned Air Vehicles (UAVs) Numerous scientific and logistical applications exist in Alaska and other arctic regions requiring analysis of expansive, remote areas in the near infrared (NIR) and thermal infrared (TIR) bands. These include characterization of wild land fire plumes and volcanic ejecta, detailed mapping of lava flows, and inspection of lengthy segments of critical infrastructure, such as the Alaska pipeline and railroad system. Obtaining timely, repeatable, calibrated measurements of these extensive features and infrastructure networks requires localized, taskable assets such as UAVs. The Alaska Center for Unmanned Aircraft Systems Integration (ACUASI) provides practical solutions to these problem sets by pairing various IR sensors with a combination of fixed-wing and multi-rotor air vehicles. Fixed-wing assets, such as the Insitu ScanEagle, offer long reach and extended duration capabilities to quickly access remote locations and provide enduring surveillance of the target of interest. Rotary-wing assets, such as the Aeryon Scout or the ACUASI-built Ptarmigan hexcopter, provide a precision capability for detailed horizontal mapping or vertical stratification of atmospheric phenomena. When included with other ground capabilities, we will show how they can assist in decision support and hazard assessment as well as giving those in emergency management a new ability to increase knowledge of the event at hand while reducing the risk to all involved. Here, in this presentation, we illustrate how UAV's can provide the ideal tool to map and analyze the hazardous events and critical infrastructure under extreme environmental conditions.

  11. Red algae and their use in papermaking.

    Science.gov (United States)

    Seo, Yung-Bum; Lee, Youn-Woo; Lee, Chun-Han; You, Hack-Chul

    2010-04-01

    Gelidialian red algae, that contain rhizoidal filaments, except the family Gelidiellaceae were processed to make bleached pulps, which can be used as raw materials for papermaking. Red algae consist of rhizoidal filaments, cortical cells usually reddish in color, and medullary cells filled with mucilaginous carbohydrates. Red algae pulp consists of mostly rhizoidal filaments. Red algae pulp of high brightness can be produced by extracting mucilaginous carbohydrates after heating the algae in an aqueous medium and subsequently treating the extracted with bleaching chemicals. In this study, we prepared paper samples from bleached pulps obtained from two red algae species (Gelidium amansii and Gelidium corneum) and compared their properties to those of bleached wood chemical pulps. PMID:20022488

  12. RED TACTON HUMAN AREA NETWORKING

    Directory of Open Access Journals (Sweden)

    Priyanka Kakade

    2013-04-01

    Full Text Available All the user-friendly services require technologies that enable communication between people and objects in close proximity. This paper describes a model of human area networking technology that enables communication by touching, a technology we call Red Tacton. Human area networking technology for communication between mobile terminals and between terminals that are embedded in the environment has become important. When cables are used for communication between terminals, the routing of the cables is clearly inconvenient. When very weak radio signals are used for the communication, data speeds are reduced by packet collision and other such problems in crowded places such as exhibition sites and security risk from unwanted signal interception is another problem. Technology for solving such problems includes the use of the person body as a signal path for communication. A transmission path is formed automatically when a person comes into contact with a device and communication between mobile terminals begins. Here, the human body acts as a transmission medium supporting IEEE 802.3 half duplex communication at 10Mbit/s.

  13. A red-letter day !

    CERN Multimedia

    2008-01-01

    Today is a red-letter day for the LHC and CERN as a beam of protons has travelled around the LHC ring for the very first time! The start of LHC operation marks the end of a long period in which you have given your all, and this first particle beam circulating in the accelerator now paves the way for discoveries that will open up a whole new field of knowledge. The history of the LHC began in 1984 with a debate on the possible objectives of a future accelerator, based on the state of our knowledge at that time. The CERN Council then approved the single-stage construction of the LHC in 1996, giving the go-ahead for the work that has now reached completion. For the past twelve years, physicists, engineers and technicians from CERN and its associated institutes have been engaged in constructing the three pillars of the LHC: the accelerator (including the upgrade of the existing accelerator chain), the four experiments, and the computing ...

  14. Red quasars not so dusty

    CERN Document Server

    Benn, C R; Carballo, R; González-Serrano, J I; Sánchez, S F

    1997-01-01

    Webster et al (1995) claimed that up to 80% of QSOs may be obscured by dust. They inferred the presence of this dust from the remarkably broad range of B-K optical-infrared colours of a sample of flat-spectrum PKS radio QSOs. If such dust is typical of QSOs, it will have rendered invisible most of those which would otherwise been have detected by optical surveys. We used the William Herschel Telescope on La Palma to obtain K infrared images of 54 B3 radio quasars selected at low frequency (mainly steep-spectrum), and we find that although several have very red optical-infrared colours, most of these can be attributed to an excess of light in K rather than a dust-induced deficit in B. We present evidence that some of the infrared excess comes from the light of stars in the host galaxy (some, as previously suggested, comes from synchrotron radiation associated with flat-spectrum radio sources). The B-K colours of the B3 QSOs provide no evidence for a large reddened population. Either the Webster et al QSOs are ...

  15. Uptake of carnitine by red blood cells

    Energy Technology Data Exchange (ETDEWEB)

    Campa, M.; Borum, P.

    1986-05-01

    A significant amount of blood carnitine (70% of cord blood and 40% of blood from healthy adults) is partitioned into the red blood cell compartment of whole blood. Data indicate that the plasma compartment and the red blood cell compartment of whole blood represent different metabolic pools of carnitine. There are no data to indicate that red blood cells synthesize carnitine, but our understanding of the uptake of carnitine by red blood cells is negligible. Red blood cells were obtained from healthy adults, washed twice with normal saline, and used for uptake experiments. When the cells were incubated at 37/sup 0/C in the presence of /sup 14/C-carnitine, radioactivity was found both in the soluble cytosolic and membrane fractions of the cells following lysis. The uptake was dependent upon the time of incubation, temperature of incubation, and carnitine concentration in the incubation medium. Washed red blood cell membranes incubated with /sup 14/C-carnitine showed specific binding of radioactivity. These data are consistent with the hypothesis that red blood cells have an uptake mechanism for L-carnitine.

  16. Uptake of carnitine by red blood cells

    International Nuclear Information System (INIS)

    A significant amount of blood carnitine (70% of cord blood and 40% of blood from healthy adults) is partitioned into the red blood cell compartment of whole blood. Data indicate that the plasma compartment and the red blood cell compartment of whole blood represent different metabolic pools of carnitine. There are no data to indicate that red blood cells synthesize carnitine, but our understanding of the uptake of carnitine by red blood cells is negligible. Red blood cells were obtained from healthy adults, washed twice with normal saline, and used for uptake experiments. When the cells were incubated at 370C in the presence of 14C-carnitine, radioactivity was found both in the soluble cytosolic and membrane fractions of the cells following lysis. The uptake was dependent upon the time of incubation, temperature of incubation, and carnitine concentration in the incubation medium. Washed red blood cell membranes incubated with 14C-carnitine showed specific binding of radioactivity. These data are consistent with the hypothesis that red blood cells have an uptake mechanism for L-carnitine

  17. Decadal stability of Red Sea mangroves

    Science.gov (United States)

    Almahasheer, Hanan; Aljowair, Abdulaziz; Duarte, Carlos M.; Irigoien, Xabier

    2016-02-01

    Across the Earth, mangroves play an important role in coastal protection, both as nurseries and carbon sinks. However, due to various human and environmental impacts, the coverage of mangroves is declining on a global scale. The Red Sea is in the northern-most area of the distribution range of mangroves. Little is known about the surface covered by mangroves at this northern limit or about the changes experienced by Red Sea mangroves. We sought to study changes in the coverage of Red Sea mangroves by using multi-temporal Landsat data (1972, 2000 and 2013). Interestingly, our results show that there has been no decline in mangrove stands in the Red Sea but rather a slight increase. The area covered by mangroves is about 69 Km2 along the African shore and 51 Km2 along the Arabian Peninsula shore. From 1972 to 2013, the area covered by mangroves increased by about 0.29% y-1. We conclude that the trend exhibited by Red Sea mangroves departs from the general global decline of mangroves. Along the Red Sea, mangroves expanded by 12% over the 41 years from 1972 to 2013. Losses to Red Sea mangroves, mostly due to coastal development, have been compensated by afforestation projects.

  18. Decadal Stability of Red Sea Mangroves

    KAUST Repository

    Almahasheer, Hanan

    2015-12-15

    Across the Earth, mangroves play an important role in coastal protection, both as nurseries and carbon sinks. However, due to various human and environmental impacts, the coverage of mangroves is declining on a global scale. The Red Sea is in the northern-most area of the distribution range of mangroves. Little is known about the surface covered by mangroves at this northern limit or about the changes experienced by Red Sea mangroves. We sought to study changes in the coverage of Red Sea mangroves by using multi-temporal Landsat data (1972, 2000 and 2013). Interestingly, our results show that there has been no decline in mangrove stands in the Red Sea but rather a slight increase. The area covered by mangroves is about 69 Km2 along the African shore and 51 Km2 along the Arabian Peninsula shore. From 1972 to 2013, the area covered by mangroves increased by about 0.29% y-1. We conclude that the trend exhibited by Red Sea mangroves departs from the general global decline of mangroves. Along the Red Sea, mangroves expanded by 12% over the 41 years from 1972 to 2013. Losses to Red Sea mangroves, mostly due to coastal development, have been compensated by afforestation projects.

  19. Florida Red Tide Perception: Residents versus Tourists.

    Science.gov (United States)

    Nierenberg, Kate; Byrne, Margaret; Fleming, Lora E; Stephan, Wendy; Reich, Andrew; Backer, Lorraine C; Tanga, Elvira; Dalpra, Dana R; Kirkpatrick, Barbara

    2010-09-01

    The west coast of Florida has annual blooms of the toxin-producing dinoflagellate, Karenia brevis with Sarasota, FL considered the epicenter for these blooms. Numerous outreach materials, including Frequently Asked Question (FAQ) cards, exhibits for local museums and aquaria, public beach signs, and numerous websites have been developed to disseminate information to the public about this natural hazard. In addition, during intense onshore blooms, a great deal of media attention, primarily via newspaper (print and web) and television, is focused on red tide. However to date, the only measure of effectiveness of these outreach methods has been counts of the number of people exposed to the information, e.g., visits to a website or number of FAQ cards distributed. No formal assessment has been conducted to determine if these materials meet their goal of informing the public about Florida red tide. Also, although local residents have the opinion that they are very knowledgeable about Florida red tide, this has not been verified empirically. This study addressed these issues by creating and administering an evaluation tool for the assessment of public knowledge about Florida red tide. A focus group of Florida red tide outreach developers assisted in the creation of the evaluation tool. The location of the evaluation was the west coast of Florida, in Sarasota County. The objective was to assess the knowledge of the general public about Florida red tide. This assessment identified gaps in public knowledge regarding Florida red tides and also identified what information sources people want to use to obtain information on Florida red tide. The results from this study can be used to develop more effective outreach materials on Florida red tide. PMID:20824108

  20. Gestión de red

    OpenAIRE

    Barba Martí, Antonio

    1999-01-01

    Esta obra pretende introducir al lector en el mundo de la gestión de red dando una visión general de las arquitecturas y entornos de gestión existentes. Últimamente, aspectos como el control, la gestión de red o la gestión de servicios están obteniendo una mayor importancia para los operadores de red. Una de las razones fundamentales estriba en que los clientes cada vez más exigen una mayor calidad de servicio a un menor precio. De esta forma, se ha desatado una competencia entre operadores p...

  1. Red cell transfusion and the immune system.

    Science.gov (United States)

    Hart, S; Cserti-Gazdewich, C M; McCluskey, S A

    2015-01-01

    Understanding the complex immunological consequences of red cell transfusion is essential if we are to use this valuable resource wisely and safely. The decision to transfuse red cells should be made after serious considerations of the associated risks and benefits. Immunological risks of transfusion include major incompatibility reactions and transfusion-related acute lung injury, while other immunological insults such as transfusion-related immunomodulation are relatively underappreciated. Red cell transfusions should be acknowledged as immunological exposures, with consequences weighed against expected benefits. This article reviews immunological consequences and the emerging evidence that may inform risk-benefit considerations in clinical practice. PMID:25440393

  2. THE TEMPERATURES OF RED SUPERGIANTS

    Energy Technology Data Exchange (ETDEWEB)

    Davies, Ben [Astrophysics Research Institute, Liverpool John Moores University, Egerton Wharf, Birkenhead CH41 1LD (United Kingdom); Kudritzki, Rolf-Peter; Gazak, Zach [Institute for Astronomy, University of Hawaii, 2680 Woodlawn Drive, Honolulu, HI 96822 (United States); Plez, Bertrand [Laboratoire Univers et Particules de Montpellier, Universite Montpellier 2, CNRS, F-34095 Montpellier (France); Trager, Scott [Kapteyn Institute, University of Groningen, P.O. Box 800, 9700-AV Groningen (Netherlands); Lancon, Ariane [Observatoire Astronomique and CNRS UMR 7550, Universite de Strasbourg, F-67000 Strasbourg (France); Bergemann, Maria [Max-Planck-Institute for Astrophysics, Karl-Schwarzschild-Str. 1, D-85741 Garching (Germany); Evans, Chris [UK Astronomy Technology Centre, Royal Observatory Edinburgh, Blackford Hill, Edinburgh EH9 3HJ (United Kingdom); Chiavassa, Andrea [CNRS Laboratoire Lagrange, Universite de Nice Sophia-Antipolis, Observatoire de la Cote d' Azur, BP 4229, F-06304 Nice Cedex 4 (France)

    2013-04-10

    We present a re-appraisal of the temperatures of red supergiants (RSGs) using their optical and near-infrared spectral energy distributions (SEDs). We have obtained data of a sample of RSGs in the Magellanic Clouds using VLT+XSHOOTER, and we fit MARCS model atmospheres to different regions of the spectra, deriving effective temperatures for each star from (1) the TiO bands, (2) line-free continuum regions of the SEDs, and (3) the integrated fluxes. We show that the temperatures derived from fits to the TiO bands are systematically lower than the other two methods by several hundred kelvin. The TiO fits also dramatically overpredict the flux in the near-IR, and imply extinctions which are anomalously low compared to neighboring stars. In contrast, the SED temperatures provide good fits to the fluxes at all wavelengths other than the TiO bands, are in agreement with the temperatures from the flux integration method, and imply extinctions consistent with nearby stars. After considering a number of ways to reconcile this discrepancy, we conclude that three-dimensional effects (i.e., granulation) are the most likely cause, as they affect the temperature structure in the upper layers where the TiO lines form. The continuum, however, which forms at much deeper layers, is apparently more robust to such effects. We therefore conclude that RSG temperatures are much warmer than previously thought. We discuss the implications of this result for stellar evolution and supernova progenitors, and provide relations to determine the bolometric luminosities of RSGs from single-band photometry.

  3. Dipeptides from the red alga Acanthopora spicifera

    Digital Repository Service at National Institute of Oceanography (India)

    Wahidullah, S.; DeSouza, L.; Kamat, S.Y.

    An investigation of red alga Acanthophora spicifera afforded the known peptide, aurantiamide acetate and a new diastereoisomer of this dipeptide (dia-aurantiamide acetate). This is a first report of aurantiamide acetate from a marine source...

  4. PUNGENT AND COLOUR COMPOUNDS OF RED PEPPERS

    Directory of Open Access Journals (Sweden)

    Çetin KADAKAL

    2001-03-01

    Full Text Available The capcaicinoid amount of red peppers from Solanacea family is used for the evaluation of quality and classification in many countries. Capsaicin is the major pungent principle (69 % of capsaicinoids. The others are dihidrocapsaicin (22 %, nordihidrocapsaicin (7 %, homocapsaicin (1 % and homodihidrocapsaicin (1 %. As in most foods, the carotenoids of red peppers are also important compounds. Carotenoids are typical colour pigments and some of them have vitamin A activity. Major carotenoids of ripe fruit of red peppers are capsanthin, capsorubin, ß-carotene and zeaxanthin. Capcaicinoid and carotenoid contents of red peppers grown in many different regions of the world, their properties and roles on the human health were given in this review.

  5. Red Wine Polyphenols for Cancer Prevention

    Directory of Open Access Journals (Sweden)

    Yuanjiang Pan

    2008-05-01

    Full Text Available Conventional cancer therapies, the second leading cause of death worldwide, result in serious side effects and, at best, merely extend the patient's lifespan by a few years. Searching for effective prevention is of high priority in both basic and clinical sciences. In recent decades natural products have been considered to be an important source of cancer chemopreventive agents. Red wine polyphenols, which consisted of various powerful antioxidants such as flavonoids and stilbenes, have been implicated in cancer prevention and that promote human health without recognizable side effects. Since resveratrol, a major component of red wine polyphenols, has been studied and reviewed extensively for its chemopreventive activity to interfere with the multi-stage carcinogenesis, this review focuses on recent progress in studies on cancer chemopreventive activities of red wine polyphenol extracts and fractions as well as other red wine polyphenols, like procyanidin B5 analogues and myricetin.

  6. Comparative metagenomics of the Red Sea

    KAUST Repository

    Mineta, Katsuhiko

    2016-01-26

    Metagenome produces a tremendous amount of data that comes from the organisms living in the environments. This big data enables us to examine not only microbial genes but also the community structure, interaction and adaptation mechanisms at the specific location and condition. The Red Sea has several unique characteristics such as high salinity, high temperature and low nutrition. These features must contribute to form the unique microbial community during the evolutionary process. Since 2014, we started monthly samplings of the metagenomes in the Red Sea under KAUST-CCF project. In collaboration with Kitasato University, we also collected the metagenome data from the ocean in Japan, which shows contrasting features to the Red Sea. Therefore, the comparative metagenomics of those data provides a comprehensive view of the Red Sea microbes, leading to identify key microbes, genes and networks related to those environmental differences.

  7. Raoul Kurvitz esitleb : "Armastusest" & "RED" / Heie Treier

    Index Scriptorium Estoniae

    Treier, Heie, 1963-

    2000-01-01

    Näitus "Armastusest" Vaal-galeriis, näituse avamine toimus kunstniku performance'iga. Sõnumina mainitakse Raoul Kurvitza kuraatoriprojekti "RED" Mustpeade Maja valges saalis, loetletud eksponeeritud kunstnikud

  8. Design of tailing dam using red mud

    Science.gov (United States)

    Rout, Subrat; Sahoo, Tapaswini; Das, Sarat

    2013-06-01

    Red mud, waste industrial product from aluminum industries produced approximately 75 million tonnes every year with less than half of this is used. Storage of this unutilized red mud takes vast tracts of usable land and pollutes, land, air and water. Construction of high embankments, under passes, flyovers, tailing dams uses vast tract of natural resources (top soil) is also matter of concern as its takes thousands of years to form the natural soil. This paper discusses use of red mud for construction of tailing dam based on laboratory findings and finite element analysis. The geotechnical properties such as plasticity, compaction, permeability, shear strength characteristics and dispersion of red mud are presented. Stability and seepage analysis of tailing dams as per finite element analysis using the above geotechnical parameters is presented.

  9. Avoiding Anemia: Boost Your Red Blood Cells

    Science.gov (United States)

    ... link, please review our exit disclaimer . Subscribe Avoiding Anemia Boost Your Red Blood Cells If you’re ... and sluggish, you might have a condition called anemia. Anemia is a common blood disorder that many ...

  10. Host compounds for red phosphorescent OLEDs

    Science.gov (United States)

    Xia, Chuanjun; Cheon, Kwang -Ohk

    2015-08-25

    Novel compounds containing a triphenylene moiety linked to an .alpha..beta. connected binaphthyl ring system are provided. These compounds have surprisingly good solubility in organic solvents and are useful as host compounds in red phosphorescent OLEDs.

  11. Red in the Face: Understanding Rosacea

    Science.gov (United States)

    ... exit disclaimer . Subscribe Red in the Face Understanding Rosacea Some people think of a rosy complexion as ... more troubling—a long-lasting skin disorder called rosacea. Rosacea (pronounced ro-ZAY-she-ah) may start ...

  12. NOAA NCCOS: New England Red Tide Research

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Alexandrium blooms are one of several algal bloom types often called "red tides," but more correctly referred to as Harmful Algal Blooms (HABs). Alexandrium...

  13. Red Rock Lakes Wildlife Refuge : Reports : 1939

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This report for Red Rock Lakes National Wildlife Refuge during 1939 contains and inventory of migratory waterfowl, as well as weather reports, and general remarks...

  14. Metagenomic studies of the Red Sea.

    Science.gov (United States)

    Behzad, Hayedeh; Ibarra, Martin Augusto; Mineta, Katsuhiko; Gojobori, Takashi

    2016-02-01

    Metagenomics has significantly advanced the field of marine microbial ecology, revealing the vast diversity of previously unknown microbial life forms in different marine niches. The tremendous amount of data generated has enabled identification of a large number of microbial genes (metagenomes), their community interactions, adaptation mechanisms, and their potential applications in pharmaceutical and biotechnology-based industries. Comparative metagenomics reveals that microbial diversity is a function of the local environment, meaning that unique or unusual environments typically harbor novel microbial species with unique genes and metabolic pathways. The Red Sea has an abundance of unique characteristics; however, its microbiota is one of the least studied among marine environments. The Red Sea harbors approximately 25 hot anoxic brine pools, plus a vibrant coral reef ecosystem. Physiochemical studies describe the Red Sea as an oligotrophic environment that contains one of the warmest and saltiest waters in the world with year-round high UV radiations. These characteristics are believed to have shaped the evolution of microbial communities in the Red Sea. Over-representation of genes involved in DNA repair, high-intensity light responses, and osmoregulation were found in the Red Sea metagenomic databases suggesting acquisition of specific environmental adaptation by the Red Sea microbiota. The Red Sea brine pools harbor a diverse range of halophilic and thermophilic bacterial and archaeal communities, which are potential sources of enzymes for pharmaceutical and biotechnology-based application. Understanding the mechanisms of these adaptations and their function within the larger ecosystem could also prove useful in light of predicted global warming scenarios where global ocean temperatures are expected to rise by 1-3°C in the next few decades. In this review, we provide an overview of the published metagenomic studies that were conducted in the Red Sea, and

  15. Red and lateritic soils : world scenario

    OpenAIRE

    Volkoff, Boris

    1998-01-01

    Calcareous, neutral and acid red soils, red lateritic soils, latosols and lateritic soils sensu lato are defined on the basis of their mineralogical composition and profile development. Their geographical distribution is discussed. Their origin is interpreted, considering successively palaeoclimates and continental drifts, tectonic movements and land-form development since the Early Tertiary period and the soil transformation during the Quaternary period. Finally, it is shown that in the trop...

  16. Causes of Red Eye-Uveitis

    OpenAIRE

    Selçuk Sızmaz

    2012-01-01

    Uveitis, being an important cause of ocular morbidity, must be taken into consideration in the differential diagnosis and the management of patients with red eye. Uveitis entities can demonstrate variable clinical features. Patients presenting with uveitis must undergo careful systemic evaluation for exact diagnosis and treatment. Studies for standardization of uveitis with variable clinical pictures are emerging. Acute anterior uveitis and panuveitis can cause red eye. The purpose o...

  17. Red flags in prospective contractors' financial statements.

    OpenAIRE

    Lee, Man-ying, Nicole

    1992-01-01

    Approved for public release; distribution is unlimited. This thesis attempts to identify warning signals in the contractors financial statement, or 'red flags', which may be used to identify those prospective contractors who are likely to become delinquent in the performance of their contracts. A 'red flags' list compiled from the current literature was sent to financial analysts in the thirty-eight Financial Service Branches, Defense Contract Management Command Area Offices(FSDCMAOs) to d...

  18. Organic red meat development in Wales

    OpenAIRE

    Bassett, Anna

    2003-01-01

    Much of the recent expansion of organic farming in Wales in associated with red meat production. Of the 56,621 hectares that will be fully organic by 2004, probably 80% is permanent grassland (assumption from Soil Association OFFR, 2002), the majority of which will be associated with beef and lamb production. The following factors suggest that the development of a strategy (which may encompass several sub strategies) for the red meat sector in Wales, to include production, processing, retaili...

  19. Red Teaming of Advanced Information Assurance Concepts

    International Nuclear Information System (INIS)

    Red Teaming is an advanced form of assessment that can be used to identify weaknesses in a variety of cyber systems. it is especially beneficial when the target system is still in development when designers can readily affect improvements. This paper discusses the red team analysis process and the author's experiences applying this process to five selected Information Technology Office (ITO) projects. Some detail of the overall methodology, summary results from the five projects, and lessons learned are contained within this paper

  20. Red de Bibliotecas y Archivos del CSIC

    OpenAIRE

    CSIC - Unidad de Recursos de Información Científica para la Investigación (URICI); Álvarez Díez, Luis Raúl; Pérez, Carmen

    2015-01-01

    Documento extraído de la entrada en Wikipedia. Contiene datos básicos de la Red de Bibliotecas y Archivos del CSIC, la historia de la Red, la Unidad de Recursos de Información Científica para la Investigación (URICI), las Bibliotecas del CSIC, los Archivos CSIC, Digital.CSIC (repositorio institucional del CSIC), estadísticas y enlaces externos.

  1. Multiple ways to become red: Pigment identification in red feathers using spectrometry

    OpenAIRE

    Toral, G.M.; Figuerola, Jordi; Negro, Juan J.

    2008-01-01

    Red hues are a challenge in studies on the evolution of bird coloration, as multiple pigments such as carotenoids, pheomelanin, psittacofulvins, porphyrins, turacin, haemoglobin and even exogenous iron-oxides, may confer red colors. Determining the pigment type is paramount and here we investigate the differences in spectrum reflectance for six pigments resulting in red colorations in feathers of different species, with a focus on discriminating among melanins and carotenoids. Pig...

  2. A note on the largest number of red nodes in red-black trees

    OpenAIRE

    Wu, Yingjie; Zhu, Daxin; Wang, Lei; Wang, Xiaodong

    2014-01-01

    In this paper, we are interested in the number of red nodes in red-black trees. We first present an $O(n^2\\log n)$ time dynamic programming solution for computing $r(n)$, the largest number of red internal nodes in a red-black tree on $n$ keys. Then the algorithm is improved to some $O(\\log n)$ time recursive and nonrecursive algorithms. Based on these improved algorithms we finally find a closed-form solution of $r(n)$.

  3. The Red Sea Modeling and Forecasting System

    KAUST Repository

    Hoteit, Ibrahim

    2015-04-01

    Despite its importance for a variety of socio-economical and political reasons and the presence of extensive coral reef gardens along its shores, the Red Sea remains one of the most under-studied large marine physical and biological systems in the global ocean. This contribution will present our efforts to build advanced modeling and forecasting capabilities for the Red Sea, which is part of the newly established Saudi ARAMCO Marine Environmental Research Center at KAUST (SAMERCK). Our Red Sea modeling system compromises both regional and nested costal MIT general circulation models (MITgcm) with resolutions varying between 8 km and 250 m to simulate the general circulation and mesoscale dynamics at various spatial scales, a 10-km resolution Weather Research Forecasting (WRF) model to simulate the atmospheric conditions, a 4-km resolution European Regional Seas Ecosystem Model (ERSEM) to simulate the Red Sea ecosystem, and a 1-km resolution WAVEWATCH-III model to simulate the wind driven surface waves conditions. We have also implemented an oil spill model, and a probabilistic dispersion and larval connectivity modeling system (CMS) based on a stochastic Lagrangian framework and incorporating biological attributes. We are using the models outputs together with available observational data to study all aspects of the Red Sea circulations. Advanced monitoring capabilities are being deployed in the Red Sea as part of the SAMERCK, comprising multiple gliders equipped with hydrographical and biological sensors, high frequency (HF) surface current/wave mapping, buoys/ moorings, etc, complementing the available satellite ocean and atmospheric observations and Automatic Weather Stations (AWS). The Red Sea models have also been equipped with advanced data assimilation capabilities. Fully parallel ensemble-based Kalman filtering (EnKF) algorithms have been implemented with the MITgcm and ERSEM for assimilating all available multivariate satellite and in-situ data sets. We

  4. Red Tide Frequency Analysis Using the Extreme Value Theory

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    In recent years, the red tide erupted frequently, and caused a great economic loss. At present, most literatures emphasize the academic research on the growth mechanism of red tide alga. In order to find out the characters of red tide in detail and improve the precision of forecast, this paper gives some new approaches to dealing with the red tide. By the extreme values, we deal with the red tide frequency analysis and get the estimation of T-times red tide level U(T), which is the level once the consistence of red tide alga exceeds on the average in a period of T times.

  5. 7X performance results - final report : ASCI Red vs Red Storm.

    Energy Technology Data Exchange (ETDEWEB)

    Dinge, Dennis C. (Cray Inc., Albuquerque, NM); Davis, Michael E. (Cray Inc., Albuquerque, NM); Haskell, Karen H.; Ballance, Robert A.; Gardiner, Thomas Anthony; Stevenson, Joel O.; Noe, John P.

    2011-04-01

    The goal of the 7X performance testing was to assure Sandia National Laboratories, Cray Inc., and the Department of Energy that Red Storm would achieve its performance requirements which were defined as a comparison between ASCI Red and Red Storm. Our approach was to identify one or more problems for each application in the 7X suite, run those problems at multiple processor sizes in the capability computing range, and compare the results between ASCI Red and Red Storm. The first part of this report describes the two computer systems, the applications in the 7X suite, the test problems, and the results of the performance tests on ASCI Red and Red Storm. During the course of the testing on Red Storm, we had the opportunity to run the test problems in both single-core mode and dual-core mode and the second part of this report describes those results. Finally, we reflect on lessons learned in undertaking a major head-to-head benchmark comparison.

  6. Red mud characterization using nuclear analytical techniques

    International Nuclear Information System (INIS)

    Red mud is a toxic waste left as a byproduct in aluminum production Bayer process. Since it contains significant concentrations of other chemical elements interesting for industry, including REE, it is also potential secondary ore source. Recent events in some countries have shown that red mud presents a serious environmental hazard if not properly stored. The subject of our study is the red mud from an ex-aluminum plant in Obrovac, Croatia, left from processing of bauxite mined during late 70's and early 80's at the eastern Adriatic coast and since than stored in open concrete basins for more than 30 years. We have used energy dispersive x-ray fluorescence analysis (both tube and radioactive source excitation), fast neutron activation analysis and passive gamma spectrometry to identify a number of elements present in the red mud, their concentration levels and radioactivity in the red mud. The high concentrations of Al, Si, Ca, Ti and Fe have been measured. Chemical elements Sc, Cr, Mn, Co, Ni, Cu, Zn, Ga, As, Se, Br, Y, La, Ce, Pr, Nd, Sm, Eu, Gd, Tb, Dy, Ho, Er, Tm, Pb, Th and U were found in lower concentrations. No significant levels of radioactivity have been measured. (authors)

  7. Features of Red Sea Water Masses

    KAUST Repository

    Kartadikaria, Aditya

    2015-04-01

    Features of Red Sea water mass can be divided into three types but best to be grouped into two different classes that are split at the potential density line σθ=27.4. The surface water (0-50 m) and the intermediate water (50-200 m) have nearly identical types of water mass. They appear as a maxima salinity layer for the water mass that has σθ > 26.0, and as a minimum salinity layer for water mass that has σθ < 26.0. These types of water masses are strongly affected by mixing that is controlled by seasonal variability, fresh water intrusion of the Gulf of Aden Intermediate Water (GAIW), and eddies variability. Two types of mixing; isopycnal and diapycnal mixing are part of important physical phenomena that explain the change of water mass in the Red Sea. The isopycnal mixing occurs at the neutral potential density line, connecting the Red Sea with its adjacent channel, the Gulf of Aden. Diapycnal mixing is found as a dominant mixing mode in the surface of the Red Sea Water and mainly due to energetic eddy activity. Density gradients, across which diapycnal mixing occurs, in the Red Sea are mainly due to large variations in salinity. The isolation of an extreme haline water mass below the thermocline contributes to the generation of the latitudinal shift and low diapycnal mixing. This finding further explains the difference of spatial kinetic mixing between the RSW and the Indian Ocean basin.

  8. Chlorine-Free Red-Burning Pyrotechnics.

    Science.gov (United States)

    Sabatini, Jesse J; Koch, Ernst-Christian; Poret, Jay C; Moretti, Jared D; Harbol, Seth M

    2015-09-01

    The development of a red, chlorine-free pyrotechnic illuminant of high luminosity and spectral purity was investigated. Red-light emission based solely on transient SrOH(g) has been achieved by using either 5-amino-1H-tetrazole or hexamine to deoxidize the combustion flame of a Mg/Sr(NO3 )2 /Epon-binder composition and reduce the amount of both condensed and gaseous SrO, which emits undesirable orange-red light. The new formulations were found to possess high thermal onset temperatures. Avoiding chlorine in these formulations eliminates the risk of the formation of PCBs, PCDDs, and PCDFs. This finding, hence, will have a great impact on both military pyrotechnics and commercial firework sectors. PMID:26333055

  9. Genome of the red alga Porphyridium purpureum.

    Science.gov (United States)

    Bhattacharya, Debashish; Price, Dana C; Chan, Cheong Xin; Qiu, Huan; Rose, Nicholas; Ball, Steven; Weber, Andreas P M; Arias, Maria Cecilia; Henrissat, Bernard; Coutinho, Pedro M; Krishnan, Anagha; Zäuner, Simone; Morath, Shannon; Hilliou, Frédérique; Egizi, Andrea; Perrineau, Marie-Mathilde; Yoon, Hwan Su

    2013-01-01

    The limited knowledge we have about red algal genomes comes from the highly specialized extremophiles, Cyanidiophyceae. Here, we describe the first genome sequence from a mesophilic, unicellular red alga, Porphyridium purpureum. The 8,355 predicted genes in P. purpureum, hundreds of which are likely to be implicated in a history of horizontal gene transfer, reside in a genome of 19.7 Mbp with 235 spliceosomal introns. Analysis of light-harvesting complex proteins reveals a nuclear-encoded phycobiliprotein in the alga. We uncover a complex set of carbohydrate-active enzymes, identify the genes required for the methylerythritol phosphate pathway of isoprenoid biosynthesis, and find evidence of sexual reproduction. Analysis of the compact, function-rich genome of P. purpureum suggests that ancestral lineages of red algae acted as mediators of horizontal gene transfer between prokaryotes and photosynthetic eukaryotes, thereby significantly enriching genomes across the tree of photosynthetic life. PMID:23770768

  10. Red-giant stars in eccentric binaries

    Directory of Open Access Journals (Sweden)

    Beck P. G.

    2015-01-01

    Full Text Available The unparalleled photometric data obtained by NASA’s Kepler Space Telescope has led to improved understanding of red-giant stars and binary stars. We discuss the characterization of known eccentric system, containing a solar-like oscillating red-giant primary component. We also report several new binary systems that are candidates for hosting an oscillating companion. A powerful approach to study binary stars is to combine asteroseimic techniques with light curve fitting. Seismology allows us to deduce the properties of red giants. In addition, by modeling the ellipsoidal modulations we can constrain the parameters of the binary system. An valuable independent source are ground-bases, high-resolution spectrographs.

  11. Recovery of rare earths from red mud

    International Nuclear Information System (INIS)

    The prospect for the recovery of rare earths from red mud, the bauxite tailings from the production of alumina is examined. The Jamaican red mud by far has the higher trace concentrations of lanthanum, cerium, neodymium, and yttrium. Scandium is also present. The dissolution of the rare earth is a major extraction problem because of the large volume of other materials. The recovery processes that have been proposed include the production of co-products such as iron, alumina, and titanium concentrates, with the rare earths going with the titanium. In this paper a critical examination of the possible processes are presented with the recommended research projects to be carried out

  12. Red cell hemolysis during processing and storage

    OpenAIRE

    Sawant R; Jathar S; Rajadhyaksha S; Kadam P

    2007-01-01

    Introduction: Apart from the visual assessment, measurement of plasma hemoglobin in the supernatant from red cell units provides an objective measure of the extent of hemolysis during storage. Study Design and Methods: Packed red cells (N=50), 25 units each in triple (CPD-A1 and SAGM) and quadruple (CPD-A1 and ADSOL) blood bags were evaluated for plasma hemoglobin by the tetramethylbenzidiene (TMB) method on day 1, 7, 14, 21 and 28 of collection. The hemoglobin, hematocrit, MCV, LDH and po...

  13. Causes of Red Eye-Uveitis

    Directory of Open Access Journals (Sweden)

    Selçuk Sızmaz

    2012-12-01

    Full Text Available Uveitis, being an important cause of ocular morbidity, must be taken into consideration in the differential diagnosis and the management of patients with red eye. Uveitis entities can demonstrate variable clinical features. Patients presenting with uveitis must undergo careful systemic evaluation for exact diagnosis and treatment. Studies for standardization of uveitis with variable clinical pictures are emerging. Acute anterior uveitis and panuveitis can cause red eye. The purpose of this current study is to summarize the clinical features and laboratory investigations that could help the differential diagnosis of acute anterior uveitis and panuveitis cases. (Turk J Ophthalmol 2012; 42: Supplement 57-62

  14. Pseudoepitheliomatous Hyperplasia in a Red Pigment Tattoo

    Science.gov (United States)

    Kazlouskaya, Viktoryia

    2015-01-01

    Red pigment tattoos are known to cause pseudoepitheliomatous hyperplasia in the skin, frequently simulating squamous cell carcinoma or keratoacanthoma. Herein, the authors present two additional cases of red pigment tattoo pseudoepitheliomatous hyperplasia in which they noted a lichenoid tissue reaction. They reviewed the previously published cases and observed a lichenoid reaction in the histopathological images similar to hypertrophic lichen planus. The authors suggest that these reactions might best be referred to as “lichenoid reaction with pseudoepitheliomatous hyperplasia” or “hypertrophic lichen planus-like reaction.” Accordingly, recognition of an inflammatory component may allow additional treatment options. PMID:26705448

  15. Kepler Asteroseismology of Red-giant Stars

    DEFF Research Database (Denmark)

    Christensen-Dalsgaard, J.

    2012-01-01

    The Kepler mission, launched in March 2009, has revolutionized asteroseismology, providing detailed observations of thousands of stars. This has allowed in-depth analyses of stars ranging from compact hot subdwarfs to red giants, and including the detection of solar-like oscillations in hundreds of...... stars on or near the main sequence. Here I mainly consider solar-like oscillations in red giants, where Kepler observations are yielding results of a perhaps unexpected richness. In addition to giving a brief overview of the observational and numerical results for these stars, I present a simple...

  16. Biotreatment of red water with fungal systems

    Energy Technology Data Exchange (ETDEWEB)

    Tsai, TenLin S.; Turner, R.J.; Sanville, C.J.

    1990-01-01

    Red water generated during the manufacture of trinitrotoluene (TNT) is an environmental concern because it contaminates ground surfaces and groundwaters. Past methods for the management of this hazardous waste stream did not meet pollution compliance or were not cost effective. Biodegradation of TNT by bacteria has been reported, but no conclusive evidence supports its biotransformation to harmless products or its complete mineralization. The lignin peroxidase (ligninase) secreted by the white rot fungus (Phanerochaete chrysosporium) has been shown to degrade a broad spectrum of organic pollutants. In this study, the efficacy of treating red water with the P. chrysosporium system was investigated.

  17. Brand image and identity of Red Bull

    OpenAIRE

    Kubátová, Karolína

    2009-01-01

    The thesis is focused on a comparison of the image perception and brand identity of Red Bull. The theoretical part explains the difference between the concepts of identity and brand image, how the brand sees itself and how it is perceived from the perspective of consumers. Further information is also given in the context of the topic. This analysis yields a comparison between the brand's identity and the inaccuracies in the perceptions of the brand image, and reveals the real image of Red Bull.

  18. Late Devonian red tide and mass extinction

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    Molecular stratigraphical, carbonate carbon isotopic, stratigraphical and paleontological data show that algal booming, eutrophication, anoxia, hypersalinity, positive ( 13C excursion and biomass decreasing occurred in the offshore carbonate environments of the Frasnian-Famennian (F-F) transition, which hints that red tide might frequently take place in the F-F transition of Guangxi, South China. We suggest that the mass extinction of the reef ecosystems and the shallow-water marine organisms in the F-F transition of the lower-middle latitudes may be related to the frequent occurrence of red tide in that time.

  19. Computer Assisted Diagnoses for Red Eye (CADRE)

    OpenAIRE

    Muhammad Zubair Asghar; Abdur Rashid Khan; Muhammad Junaid Asghar

    2009-01-01

    This paper introduces an expert System (ES) named as “CADRE-Computer Assisted Diagnoses for Red Eye. Mostly the remote areas of the population are deprived of the facilities of having experts in eye disease. So it is the need of the day to store the expertise of Eye specialists in computers through using ES technology. This ES is a rule-based Expert System that assists in red-eye diagnosis and treatment. The knowledge acquired from literature review and human experts of the specific domain wa...

  20. ESR analysis of irradiated red peppers and commercial red peppers in Japan

    International Nuclear Information System (INIS)

    ESR analysis of γ-ray irradiated and being treated with different processing red pepper was studied. All the red peppers were commercial expect irradiated one. Processing treatment of red pepper was sun drying, mechanical processing (heating sterilization and powdering treatment). All the samples were weighted and analyzed. The ESR spectrum of the red pepper is composed of a singlet at g=2.00. This signal was originated from organic free radical. It is suggested the effect of heating treatment on the radical formation is not so large and powdering treatment will promote the radical formation of red pepper. ESR singlet signal of the irradiated red pepper showed the large signal intensity and the dose-dependence. The singlet signal intensity of irradiated powder sample showed the almost same value as compared with that of the powder sample with heating treatment. Relaxation times (T1 and T2) of the singlet signal were calculated. The relaxation behavior and relaxation times of the irradiated sample were different from that of the non-irradiated sample. The value of T1, the spin lattice relaxation time, of irradiated sample was increased and T2, the spin-spin relaxation time, of irradiated sample was decreased. We concluded that the radical formation of the red pepper is mainly depended on the powdering treatment and irradiation. (author)

  1. RED Alert – Early warning or detection of global re-emerging infectious disease (RED)

    Energy Technology Data Exchange (ETDEWEB)

    Deshpande, Alina [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2016-07-13

    This is the PDF of a presentation for a webinar given by Los Alamos National Laboratory (LANL) on the early warning or detection of global re-emerging infectious disease (RED). First, there is an overview of LANL biosurveillance tools. Then, information is given about RED Alert. Next, a demonstration is given of a component prototype. RED Alert is an analysis tool that can provide early warning or detection of the re-emergence of an infectious disease at the global level, but through a local lens.

  2. Infra-red fixed points in supersymmetry

    Indian Academy of Sciences (India)

    B Ananthanarayan

    2000-07-01

    Model independent constraints on supersymmetric models emerge when certain couplings are drawn towards their infra-red (quasi) fixed points in the course of their renormalization group evolution. The general principles are first reviewed and the conclusions for some recent studies of theories with -parity and baryon and lepton number violations are summarized.

  3. Aspergillosis in a red-crowned crane

    Science.gov (United States)

    Stroud, R.K.; Duncan, R.M.

    1983-01-01

    An unusual form of pulmonary aspergillosis in a red-crowned crane (Grus japonensis) is described in this report. The major lesion is unique because it closely resembles a lesion referred to as an aspergilloma. An aspergilloma is a single large granulomatous lesion that resembles a tumor and is caused by fungi of the genus Aspergillus.

  4. Optical Data Storage in Acid Red Dyes

    Science.gov (United States)

    Sankar, Deepa; Palanisamy, P. K.

    High-density optical data storage is a current field gaining importance where research work is done in abundance to bring about holographic CDs to light. Dye-doped gelatin films are promising candidates as recording materials for holographic data storage because of the ease of preparation and low cost. In this report we suggest some acid red dyes as useful recording materials for optical data storage. Acid red dyes namely Acid Red 73 and Acid Red 114 that are completely water-soluble are used to sensitize gelatin thin films for data storage. These dyes have their absorption peak around 514 nm. Two coherent beams of Argon ion laser (514.5 nm) are used to form the grating in the dye-sensitized gelatin films. The grating formed is found to be permanent. The diffraction efficiency of each material as a function of different parameters like dye concentration, writing beam intensities and their ratios and spatial frequency has been studied and presented. An attempt to store data in the sample has been made.

  5. Red blood cell transfusion in septic shock

    DEFF Research Database (Denmark)

    Rosland, Ragnhild G; Hagen, Marte U; Haase, Nicolai;

    2014-01-01

    BACKGROUND: Treating anaemia with red blood cell (RBC) transfusion is frequent, but controversial, in patients with septic shock. Therefore we assessed characteristics and outcome associated with RBC transfusion in this group of high risk patients. METHODS: We did a prospective cohort study at 7...

  6. Infra-red fixed points in supersymmetry

    International Nuclear Information System (INIS)

    Model independent constraints on supersymmetric models emerge when certain couplings are drawn towards their infra-red (quasi) fixed points in the course of their renormalization group evolution. The general principles are first reviewed and the conclusions for some recent studies of theories with R-parity and baryon and lepton number violations are summarized. (author)

  7. The FIRST-2MASS Red Quasar Survey

    Energy Technology Data Exchange (ETDEWEB)

    Glikman, E; Helfand, D J; White, R L; Becker, R H; Gregg, M D; Lacy, M

    2007-06-28

    Combining radio observations with optical and infrared color selection--demonstrated in our pilot study to be an efficient selection algorithm for finding red quasars--we have obtained optical and infrared spectroscopy for 120 objects in a complete sample of 156 candidates from a sky area of 2716 square degrees. Consistent with our initial results, we find our selection criteria--J-K > 1.7,R-K > 4.0--yield a {approx} 50% success rate for discovering quasars substantially redder than those found in optical surveys. Comparison with UVX- and optical color-selected samples shows that {approx}> 10% of the quasars are missed in a magnitude-limited survey. Simultaneous two-frequency radio observations for part of the sample indicate that a synchrotron continuum component is ruled out as a significant contributor to reddening the quasars spectra. We go on to estimate extinctions for our objects assuming their red colors are caused by dust. Continuum fits and Balmer decrements suggest E(B-V) values ranging from near zero to 2.5 magnitudes. Correcting the K-band magnitudes for these extinctions, we find that for K {le} 14.0, red quasars make up between 25% and 60% of the underlying quasar population; owing to the incompleteness of the 2MASS survey at fainter K-band magnitudes, we can only set a lower limit to the radio-detected red quasar population of > 20-30%.

  8. Red Cooperativa de Tejido Humano del NCI

    Science.gov (United States)

    Bioespecímenes de calidad son un recurso de investigación oncológica. Uno de los programas de bioespecímenes que han operado por más tiempo es la Red Cooperativa de Tejido Humano, ara descubrimientos básicos e investigación inicial de transferencia.

  9. Recounting "Red Star over China"

    Institute of Scientific and Technical Information of China (English)

    2011-01-01

    Dear readers, When Itake to writing this editor's letter, a classic book name flashes into my mind while the whole country is exploded with rising heat and jubilant dances, and red songs that rippled .to schools, factories, government departments and n

  10. Sherry Red Owl, Stands at Dawn Woman

    Science.gov (United States)

    Crazy Bull, Cheryl

    2014-01-01

    This article introduces Sherry Red Owl, also known as "Stands at Dawn Woman," because she greets each day as a new opportunity and has spent her life working at new things. She worked at Sinte Gleska University (SGU) during its founding years, taught at an elementary school when few Native teachers were employed in the school systems,…

  11. Film Guide for "The Red Kite".

    Science.gov (United States)

    Hughes, A. O.

    1969-01-01

    Aspects to consider in studying the film "The Red Kite" are (1) a synopsis of the story, which concerns a young father's musings about life and death; (2) the film's structure, which focuses on the father's encounters in a store, on a bus, in his home, at a party, and finally on a hill while flying the kite; (3) possible themes, such as "human…

  12. in the red fox () in Slovenia

    OpenAIRE

    Rataj, Aleksandra Vergles; Bidovec, Andrej; Žele, Diana; Vengušt, Gorazd

    2010-01-01

    Using the parasitological washing out method, we examined the intestines of 428 red foxes () for the presence of (Leuckart 1863) and found that the overall prevalence was 2.6% (confidence interval 95% 1.3-4.5%). This is the first extended research reporting on the presence of in the Slovenian fox population.

  13. Observations of the summer Red Sea circulation

    Science.gov (United States)

    Sofianos, Sarantis S.; Johns, William E.

    2007-06-01

    Aiming at exploring and understanding the summer circulation in the Red Sea, a cruise was conducted in the basin during the summer of 2001 involving hydrographic, meteorological, and direct current observations. The most prominent feature, characteristic of the summer circulation and exchange with the Indian Ocean, is a temperature, salinity, and oxygen minimum located around a depth of 75 m at the southern end of the basin, associated with Gulf of Aden Intermediate Water inflowing from the Gulf of Aden during the summer season as an intruding subsurface layer. Stirring and mixing with ambient waters lead to marked increases in temperature (from 16.5 to almost 33°C) and salinity (from 35.7 to more than 38 psu) in this layer by the time it reaches midbasin. The observed circulation presents a very vigorous pattern with strong variability and intense features that extend the width of the basin. A permanent cyclone, detected in the northern Red Sea, verifies previous observations and modeling studies, while in the central sector of the basin a series of very strong anticyclones were observed with maximum velocities exceeding 1 m/s. The three-layer flow pattern, representative of the summer exchange between the Red Sea and the Gulf of Aden, is observed in the strait of Bab el Mandeb. In the southern part of the basin the layer flow is characterized by strong banking of the inflows and outflows against the coasts. Both surface and intermediate water masses involved in the summer Red Sea circulation present prominent spatial variability in their characteristics, indicating that the eddy field and mixing processes play an important role in the summer Red Sea circulation.

  14. Red salmon investigations: Kodiak red salmon studies, plan of operations, April 1966 to April 1967

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — The broad objective of the Karluk research program is to study those aspects of the life cycle and ecology of red salmon pertinent to explaining the long-term...

  15. A COMPLEX IDENTITY: RED COLOR-CODING IN ALAI'S RED POPPIES

    Directory of Open Access Journals (Sweden)

    Alexandra Draggeim

    2015-03-01

    Full Text Available Alai's Red Poppies presents a complex depiction of Tibetan identity that is at odds with the romanticized portrayal of the Tibetan minority in Chinese government media as well as with the standard historical positioning of Old Tibet as feudal and primitive. The color red is an ongoing theme that recurs throughout the novel, from the original introduction of the red poppies, to their spread throughout the area surrounding the Maichi chiefdom and, finally, to the chiefdom's downfall, offering insight not only into the complexity of Sino-Tibetan relations, but also into tension between Tibetan self-perception and popular image. Using a color frequently associated with Red China to highlight diverse cultural themes, Alai's work provides us a valuable window into marginal Tibetan realms outside of Central Tibet.

  16. Red and far red sun-induced chlorophyll fluorescence as a measure of plant photosynthesis

    OpenAIRE

    M. Rossini; L. Nedbal; Luis Guanter; A. Ač; L. Alonso; A. Burkart; S. Cogliati; R. Colombo; A. Damm; M. Drusch; J. Hanus; R. Janoutova; T. Julitta; P. Kokkalis; J. Moreno

    2015-01-01

    Remote estimation of Sun-induced chlorophyll fluorescence emitted by terrestrial vegetation can provide an unparalleled opportunity to track spatiotemporal variations of photosynthetic efficiency. Here we provide the first direct experimental evidence that the two peaks of the chlorophyll fluorescence spectrum can be accurately mapped from high-resolution radiance spectra and that the signal is linked to variations in actual photosynthetic efficiency. Red and far red fluorescence measured usi...

  17. A Preliminary Exploration of the Metrical Musicality in Robert Burns’s A Red, Red Rose

    Institute of Scientific and Technical Information of China (English)

    罗军; 刘芹

    2013-01-01

    The musicality of poetry is a project that has been in great need of scholars’attentions and studies due to its charming typicality, which has been a rarely-visited for a long time. To get away with this intellectual sterility and poverty, and highlight the aesthetic universality of the musicality in poetic texts, this paper aims to give a preliminary exploration of the metrical musical-ity in A Red, Red Rose.

  18. Growth and replication of red rain cells at 121°C and their red fluorescence

    Science.gov (United States)

    Gangappa, Rajkumar; Wickramasinghe, Chandra; Wainwright, Milton; Kumar, A. Santhosh; Louis, Godfrey

    2010-09-01

    We have shown that the red cells found in the Red Rain (which fell on Kerala, India, in 2001) survive and grow after incubation for periods of up to two hours at 121°C . Under these conditions daughter cells appear within the original mother cells and the number of cells in the samples increases with length of exposure to 121°C. No such increase in cells occurs at room temperature, suggesting that the increase in daughter cells is brought about by exposure of the Red Rain cells to high temperatures. This is an independent confirmation of results reported earlier by two of the present authors, claiming that the cells can replicate under high pressure at temperatures upto 300°C. The flourescence behaviour of the red cells is shown to be in remarkable correspondence with the extended red emission observed in the Red Rectagle planetary nebula and other galactic and extragalactic dust clouds, suggesting, though not proving an extraterrestrial origin.

  19. Growth and replication of red rain cells at 121 oC and their red fluorescence

    CERN Document Server

    Gangappa, Rajkumar; Wainwright, Milton; Kumar, A Santhosh; Louis, Godfrey

    2010-01-01

    We have shown that the red cells found in the Red Rain (which fell on Kerala, India, in 2001) survive and grow after incubation for periods of up to two hours at 121 oC . Under these conditions daughter cells appear within the original mother cells and the number of cells in the samples increases with length of exposure to 121 oC. No such increase in cells occurs at room temperature, suggesting that the increase in daughter cells is brought about by exposure of the Red Rain cells to high temperatures. This is an independent confirmation of results reported earlier by two of the present authors, claiming that the cells can replicate under high pressure at temperatures up to 300 oC. The flourescence behaviour of the red cells is shown to be in remarkable correspondence with the extended red emission observed in the Red Rectangle planetary nebula and other galactic and extragalactic dust clouds, suggesting, though not proving, an extraterrestrial origin.

  20. Red, Itchy Rash? Get the Skinny on Dermatitis

    Science.gov (United States)

    ... External link, please review our exit disclaimer . Subscribe Red, Itchy Rash? Get the Skinny on Dermatitis You’ ... unusual. Why does your skin break out in red blotches like that? More important, is there anything ...