
Sample records for astatine 220

  1. Radiochemistry of astatine

    International Nuclear Information System (INIS)

    Ruth, T.J.; Dombsky, M.; D'Auria, J.M.; Ward, T.E.


    This monograph is a review of the literature through 1987 and covers the methods of producing the radioisotopes of astatine and the inorganic, nuclear, and organic chemistry of astatine. The discussion is limited to chemical and physical chemical properties of astatine. The monograph, after the introduction, is divided into chapters titled: production methods, nuclear spectroscopy, chemistry of astatine, separation and isolation (dry and wet), and selected procedures. 209 refs., 15 figs., 7 tabs

  2. Formation and decomposition of astatine molecules

    International Nuclear Information System (INIS)

    Takahashi, Naruto; Ishikuro, Mituhiro; Baba Hiroshi


    A method determining the boiling points of elementary astatine and astatine iodide has been developed (K. Otozai and N. Takahashi, Radio. Chim. Acta 31, (1982) 201). Further, it was concluded from the simple rule among the boiling point of elementary halogens and interhalogen compounds that elementary astatine might exist in diatomic molecules as the other halogens. In the present work the reaction mechanisms of elementary astatine with radioactive iodine and organic solvents were studied by means of radiogaschromatography in order to obtain further experimental evidences for diatomic astaine molecules. The following conclusions were obtained by the analysis of reaction kinetics. Two astatine atoms are lost from the elementary astatine fraction per each radioactive decay of astatine. The astatine radical or hot atom liberated by the decay of the complementary astatine atom immediately reacts with iodine or organic solvents. Thus formed astatine compounds decompose in turn due to the decay of astatine

  3. Organic astatine compounds, their preparation and properties

    Energy Technology Data Exchange (ETDEWEB)

    Vasaros, L; Berei, K


    Aromatic astatine compounds of possible medical application were prepared by high energy substitutions, by astatine-halogen, and by electrophil astatine-hydrogen substitutions at the Joint Institute of Nuclear Researches, Dubna. Physico-chemical properties of organic astatine compounds such as boiling point and evaporation heat, and the refraction and dissociation energy of carbon-astatine bonds were determined experimentally by gas chromatography. The results are compared with extrapolated data. (V.N.). 41 refs.; 7 figs.; 5 tables.

  4. Bibliography of astatine chemistry and biomedical applications

    International Nuclear Information System (INIS)

    Berei, K.; Vasaros, L.


    An overall bibliography is presented on astatine chemistry and on the biomedical applications of its 211 At isotope. The references were grouped in the following chapters: General reviews; Discovery, Natural Occurence; Nuclear Data; Preparation, Handling, Radiation Risk; Physico-chemical Properties; Astatine Compounds and Chemical Reactions; Biological Effects and Applications. Entries are sorted alphabetically by authors name in each chapter, and cross-references to other chapters are provided if appropriate. (R.P.)

  5. Recent advances in the organic chemistry of astatine

    International Nuclear Information System (INIS)

    Berei, K.; Vasaros, L.


    Investigation on the chemical behaviour of astatine in the last decade are surveyed. The survey covers the physical and chemical properties of astatine, synthesis and identification of organic astatine compounds, their physicochemical properties. A special chapter is devoted to biomedical applications, including inorganic 211 At species, 211 At-labelled proteins and drugs. An extensive bibliography of the related literature is given. (N.T.) 129 refs.; 12 figs.; 14 tabs

  6. Experimental and computational evidence of halogen bonds involving astatine (United States)

    Guo, Ning; Maurice, Rémi; Teze, David; Graton, Jérôme; Champion, Julie; Montavon, Gilles; Galland, Nicolas


    The importance of halogen bonds—highly directional interactions between an electron-deficient σ-hole moiety in a halogenated compound and an acceptor such as a Lewis base—is being increasingly recognized in a wide variety of fields from biomedicinal chemistry to materials science. The heaviest halogens are known to form stronger halogen bonds, implying that if this trend continues down the periodic table, astatine should exhibit the highest halogen-bond donating ability. This may be mitigated, however, by the relativistic effects undergone by heavy elements, as illustrated by the metallic character of astatine. Here, the occurrence of halogen-bonding interactions involving astatine is experimentally evidenced. The complexation constants of astatine monoiodide with a series of organic ligands in cyclohexane solution were derived from distribution coefficient measurements and supported by relativistic quantum mechanical calculations. Taken together, the results show that astatine indeed behaves as a halogen-bond donor—a stronger one than iodine—owing to its much more electrophilic σ-hole.

  7. Thermogravimetric determination of the enthalpy of astatine and radon adsorption on palladium surfaces

    International Nuclear Information System (INIS)

    Eichler, B.; Son Chun, K.


    In order to investigate the adsorption of astatine and radon on a palladium surface some on- and off-line thermochromatographic experiments were carried out with 210 At and 220 Rn tracers. The partial molar adsorption enthalpy for zero covering was found to be ΔH/sub a//sup 0, loc./(At) = -(15S +- 10) kJ mole -1 and ΔH/sub a//sup 0, mob./(Rn) = -(37 +- 4) kJ mole -1 . The results are compared with theoretical and experimental values for other elements of the sixth period. The adsorption behaviour of At is in conformity with that of the p-metals on a palladium surface. (author)

  8. The reaction of astatine with aromatic diazonium compounds

    International Nuclear Information System (INIS)

    Visser, G.W.M.; Diemer, E.L.


    Astatine reacts prefrentially with that type of aromatic diazonium salt that decomposes via a radical reaction channel (homolytic breakage of the C-N bond). The dediazonation with p-aminobenzoic acid and p-toluidine as model compounds was investigated through estatin produced in the 209 Bi(α,2n) 211 At reaction. (author)

  9. Measurement of the first ionization potential of astatine by laser ionization spectroscopy (United States)

    Rothe, S.; Andreyev, A. N.; Antalic, S.; Borschevsky, A.; Capponi, L.; Cocolios, T. E.; De Witte, H.; Eliav, E.; Fedorov, D. V.; Fedosseev, V. N.; Fink, D. A.; Fritzsche, S.; Ghys, L.; Huyse, M.; Imai, N.; Kaldor, U.; Kudryavtsev, Yuri; Köster, U.; Lane, J. F. W.; Lassen, J.; Liberati, V.; Lynch, K. M.; Marsh, B. A.; Nishio, K.; Pauwels, D.; Pershina, V.; Popescu, L.; Procter, T. J.; Radulov, D.; Raeder, S.; Rajabali, M. M.; Rapisarda, E.; Rossel, R. E.; Sandhu, K.; Seliverstov, M. D.; Sjödin, A. M.; Van den Bergh, P.; Van Duppen, P.; Venhart, M.; Wakabayashi, Y.; Wendt, K. D. A.


    The radioactive element astatine exists only in trace amounts in nature. Its properties can therefore only be explored by study of the minute quantities of artificially produced isotopes or by performing theoretical calculations. One of the most important properties influencing the chemical behaviour is the energy required to remove one electron from the valence shell, referred to as the ionization potential. Here we use laser spectroscopy to probe the optical spectrum of astatine near the ionization threshold. The observed series of Rydberg states enabled the first determination of the ionization potential of the astatine atom, 9.31751(8) eV. New ab initio calculations are performed to support the experimental result. The measured value serves as a benchmark for quantum chemistry calculations of the properties of astatine as well as for the theoretical prediction of the ionization potential of superheavy element 117, the heaviest homologue of astatine. PMID:23673620

  10. Automated astatination of biomolecules - a stepping stone towards multicenter clinical trials

    DEFF Research Database (Denmark)

    Aneheim, Emma; Albertsson, Per; Bäck, Tom


    To facilitate multicentre clinical studies on targeted alpha therapy, it is necessary to develop an automated, on-site procedure for conjugating rare, short-lived, alpha-emitting radionuclides to biomolecules. Astatine-211 is one of the few alpha-emitting nuclides with appropriate chemical...... vector, which can guide the radiation to the cancer cells. Consequently, an appropriate method is required for coupling the nuclide to the vector. To increase the availability of astatine-211 radiopharmaceuticals for targeted alpha therapy, their production should be automated. Here, we present a method...... challenging, alpha-emitting radionuclide. In this work, we describe the process platform, and we demonstrate the production of both astaine-211, for preclinical use, and astatine-211 labelled antibodies....

  11. Synthesis and Evaluation of Astatinated N-[2-(Maleimido)ethyl]-3-(trimethylstannyl)benzamide Immunoconjugates

    DEFF Research Database (Denmark)

    Aneheim, Emma; Gustafsson, Anna; Albertsson, Per


    Effective treatment of metastasis is a great challenge in the treatment of different types of cancers. Targeted alpha therapy utilizes the short tissue range (50-100 μm) of α particles, making the method suitable for treatment of disseminated occult cancers in the form of microtumors or even single...... to the antibody arbitrarily on lysine residues. By instead coupling astatine to disulfide bridges in the antibody structure, the immunoreactivity of the antibody conjugates could possibly be increased. Here, the disulfide-based conjugation was performed using a new coupling reagent, maleimidoethyl 3......-(trimethylstannyl)benzamide (MSB), and evaluated for chemical stability in vitro. The immunoconjugates were subsequently astatinated, resulting in both high radiochemical yield and high specific activity. The MSB-conjugate was shown to be stable with a long shelf life prior to the astatination. In a comparison...

  12. Some aspects of the organic, biological and inorganic chemistry of astatine

    International Nuclear Information System (INIS)

    Visser, G.W.M.


    Astatine has no stable isotopes and the radioactive isotopes with half-lives sufficiently long for chemical experiments ( 209 At, 210 At, 211 At) must be produced artificially with a cyclotron or with a high energy accelerator by spallation of Th. This thesis deals with the synthesis and chemistry of At-compounds and the determination of some of their properties. (C.F.)

  13. Direct astatination of a tumour-binding protein, human epidermal growth factor, using nido-carborane as a prosthetic group

    International Nuclear Information System (INIS)

    Sjoestroem, A.; Carlsson, J.; Lundqvist, H.; Koziorowski, J.


    A method for direct astatine labeling of proteins has been investigated. Binding sites for astatine were created by coupling of a nido-carborane derivative to a protein, the human epidermal growth factor (hEGF), using two different conjugation methods - by glutaraldehyde cross-linking or by introduction of sulfohydryl groups by Traut's reagent with subsequent linking of ANC-1 with m-maleimidobenzoyl-N-hydroxysulfosuccinimide ester. The conjugates were astatinated using the Chloramine-T method in high yield. The best labeling was obtained by the glutaraldehyde conjugate with an average yield of 68 ± 9%. In vitro stability tests indicated that the glutaraldehyde conjugated label was as stable as hEGF labeled with astatobenzoate. (author)

  14. Estimation of the chemical form and the boiling point of elementary astatine by radiogas-chromatography

    International Nuclear Information System (INIS)

    Otozai, K.; Takahashi, N.


    After astatine (0) was mixed with 131 I 2 containing carrier I 2 , the sample was analyzed by means of radiogaschromatography and the peaks due to I 2 , AtI and At 2 were observed. Further, the boiling points were estimated from the retention volume in terms of the semi-empirical theory on gas chromatography. The boiling points of I 2 , AtI and At 2 were 457 +- 2,486 +- 2 and 503 +- 3K, respectively. The boiling point of At 2 obtained in the present work is far smaller than that expected by the extrapolation of lighter halogens. (orig.)

  15. Direct astatination of a tumour-binding protein, human epidermal growth factor, using nido-carborane as a prosthetic group

    Czech Academy of Sciences Publication Activity Database

    Sjostrom, A.; Tolmachev, V.; Lebeda, Ondřej; Koziorowski, J.; Carlsson, J.; Lundqvist, H.


    Roč. 256, č. 7 (2003), s. 191-197 ISSN 0236-5731 R&D Projects: GA AV ČR KSK4055109 Keywords : neutron-capture therapy * astatine-211 Subject RIV: CH - Nuclear ; Quantum Chemistry Impact factor: 0.472, year: 2003

  16. 211At-Rh(16-S4-diol) complex as a precursor for astatine radiopharmaceuticals

    International Nuclear Information System (INIS)

    Pruszynski, M.; Bilewicz, A.


    211 At is one of the most promising radionuclides in α-radioimmunotherapy (α-RIT). Unfortunately, biomolecules labeled by direct electrophilic astatination are unstable due to the rapid loss of 211 At under both in vitro and in vivo conditions. The present paper describes the results of our studies on attaching At - to the rhodium(III) complex with thioether ligand: 1,5,9,13-etrathiacyclohexadecane-3,11-diol (16-S4-diol). Rh 3+ was chosen as a moderately soft metal cation which should form very strong bonds with soft At - anions, but first of all because of the kinetic inertness of low spin rhodium(III) d 6 complexes. The 16-S4-diol ligand was selected due to formation of stable complexes with Rh 3+ . The experiments related to optimization of the reaction conditions were performed with the 131 I, basing on a chemical similarity of I - to At - . The experiments with 211 At were then carried out under the conditions found optimal for I - . The preliminary results are promising, and indicate a possibility for astatination of biomolecules by using the 211 At-Rh(16-S4-diol) complex

  17. Complexation study on no-carrier-added astatine with insulin: A candidate radiopharmaceutical

    Energy Technology Data Exchange (ETDEWEB)

    Lahiri, Susanta [Chemical Sciences Division, Saha Institute of Nuclear Physics, 1/AF Bidhannagar, Kolkata 700 064 (India)], E-mail:; Roy, Kamalika [Chemical Sciences Division, Saha Institute of Nuclear Physics, 1/AF Bidhannagar, Kolkata 700 064 (India); Sen, Souvik [Berhampur Sadar Hospital, Berhampur, Murshidabad 742 101 (India)


    No-carrier-added astatine radionuclides produced in the {sup 7}Li-irradiated lead matrix were separated from bulk lead nitrate target by complexing At with insulin, followed by dialysis. The method offers simultaneous separation of At from lead as well as its complexation with insulin. The At-insulin complex might be a potential radiopharmaceutical in the treatment of hepatocellular carcinoma. The stability of At-insulin complex was checked by dialysis against deionized water and Ringer lactate (RL) solution. It has been found that the half-life of At-insulin complex is about {approx}12 h, when dialyzed against deionized water and is only 6 h, when dialyzed against RL solution having the same composition as blood serum. The 6 h half-life of this Insulin-At complex is perfect for killing cancer cells from external cell surfaces as the half-life of internalization of insulin molecule inside the cell is 7-12 h.

  18. Laser photodetachment of radioactive ions: towards the determination of the electronegativity of astatine

    CERN Multimedia

    Rothe, Sebastian; Welander, Jakob Emanuel; Chrysalidis, Katerina; Day Goodacre, Thomas; Fedosseev, Valentine; Fiotakis, Spyridon; Forstner, Oliver; Heinke, Reinhard Matthias; Johnston, Karl; Kron, Tobias; Koester, Ulli; Liu, Yuan; Marsh, Bruce; Ringvall Moberg, Annie; Rossel, Ralf Erik; Seiffert, Christoph; Studer, Dominik; Wendt, Klaus; Hanstorp, Dag


    Negatively charged ions are mainly stabilized through the electron correlation effect. A measure of the stability of a negative ion is the electron affinity, which the energy gain by attaching an electron to a neutral atom. This fundamental quantity is, due to the almost general lack of bound excited states, the only atomic property that can be determined with high accuracy for negative ions. We will present the results of the first laser photodetachment studies of radioactive negative ions at CERN-ISOLDE. The photodetachment threshold for the radiogenic iodine isotope 128I was measured successfully, demonstrating the performance of the upgraded GANDALPH experimental beam line. The first detection of photo-detached astatine atoms marks a milestone towards the determination of the EA of this radioactive element.

  19. Determination of the electron affinity of astatine and polonium by laser photodetachment

    CERN Multimedia

    We propose to conduct the first electron affinity (EA) measurements of the two elements astatine (At) and polonium (Po). Collinear photo-detachment spectroscopy will allow us to measure these quantities with an uncertainty limited only by the spectral line width of the laser. We plan to use negative ion beams of the two radioactive elements At and Po, which are only accessible on-line and at ISOLDE. The feasibility of our proposed method and the functionality of the experimental setup have been demonstrated at ISOLDE in off-line tests by the clear observation of the photo-detachment threshold for stable iodine. This proposal is based on our Letter of Intent I-148.

  20. Complexation study on no-carrier-added astatine with insulin: A candidate radiopharmaceutical

    International Nuclear Information System (INIS)

    Lahiri, Susanta; Roy, Kamalika; Sen, Souvik


    No-carrier-added astatine radionuclides produced in the 7 Li-irradiated lead matrix were separated from bulk lead nitrate target by complexing At with insulin, followed by dialysis. The method offers simultaneous separation of At from lead as well as its complexation with insulin. The At-insulin complex might be a potential radiopharmaceutical in the treatment of hepatocellular carcinoma. The stability of At-insulin complex was checked by dialysis against deionized water and Ringer lactate (RL) solution. It has been found that the half-life of At-insulin complex is about ∼12 h, when dialyzed against deionized water and is only 6 h, when dialyzed against RL solution having the same composition as blood serum. The 6 h half-life of this Insulin-At complex is perfect for killing cancer cells from external cell surfaces as the half-life of internalization of insulin molecule inside the cell is 7-12 h

  1. DEC VT220

    CERN Multimedia


    The DEC (Digital Equipment Corporation) VT220 is a text terminal which uses an redesigned keyboard(LK201). The VT220 improved on the earlier VT100 series of terminals with much smaller physical packaging and and a much faster microprocessor.

  2. Validering av Evolution 220


    Krakeli, Tor-Arne


    - Det har blitt kjøpt inn et nytt spektrofotometer (Evolution 220, Thermo Scientific) til BioLab Nofima. I den forbindelsen har det blitt utført en validering som involverer kalibreringsstandarder fra produsenten og en test på normal distribusjon (t-test) på to metoder (Total fosfor, Tryptofan). Denne valideringen fant Evolution 220 til å være et akseptabelt alternativ til det allerede benyttede spektrofotometeret (Helios Beta). På bakgrunn av noen instrumentbegrensninger må de aktuelle an...

  3. Astatine-211 Radiochemistry: The Development Of Methodologies For High Activity Level Radiosynthesis

    International Nuclear Information System (INIS)

    Zalutsky, Michael R.


    Targeted radionuclide therapy is emerging as a viable approach for cancer treatment because of its potential for delivering curative doses of radiation to malignant cell populations while sparing normal tissues. Alpha particles such as those emitted by 211At are particularly attractive for this purpose because of their short path length in tissue and high energy, making them highly effective in killing cancer cells. The current impact of targeted radiotherapy in the clinical domain remains limited despite the fact that in many cases, potentially useful molecular targets and labeled compounds have already been identified. Unfortunately, putting these concepts into practice has been impeded by limitations in radiochemistry methodologies. A critical problem is that the synthesis of therapeutic radiopharmaceuticals provides additional challenges in comparison to diagnostic reagents because of the need to perform radio-synthesis at high levels of radioactivity. This is particularly important for α-particle emitters such as 211At because they deposit large amounts of energy in a highly focal manner. The overall objective of this project is to develop convenient and reproducible radiochemical methodologies for the radiohalogenation of molecules with the α-particle emitter 211At at the radioactivity levels needed for clinical studies. Our goal is to address two problems in astatine radiochemistry: First, a well known characteristic of 211At chemistry is that yields for electrophilic astatination reactions decline as the time interval after radionuclide isolation from the cyclotron target increases. This is a critical problem that must be addressed if cyclotrons are to be able to efficiently supply 211At to remote users. And second, when the preparation of high levels of 211At-labeled compounds is attempted, the radiochemical yields can be considerably lower than those encountered at tracer dose. For these reasons, clinical evaluation of promising 211At-labeled targeted


    Energy Technology Data Exchange (ETDEWEB)



    Targeted radionuclide therapy is emerging as a viable approach for cancer treatment because of its potential for delivering curative doses of radiation to malignant cell populations while sparing normal tissues. Alpha particles such as those emitted by 211At are particularly attractive for this purpose because of their short path length in tissue and high energy, making them highly effective in killing cancer cells. The current impact of targeted radiotherapy in the clinical domain remains limited despite the fact that in many cases, potentially useful molecular targets and labeled compounds have already been identified. Unfortunately, putting these concepts into practice has been impeded by limitations in radiochemistry methodologies. A critical problem is that the synthesis of therapeutic radiopharmaceuticals provides additional challenges in comparison to diagnostic reagents because of the need to perform radio-synthesis at high levels of radioactivity. This is particularly important for {alpha}-particle emitters such as 211At because they deposit large amounts of energy in a highly focal manner. The overall objective of this project is to develop convenient and reproducible radiochemical methodologies for the radiohalogenation of molecules with the {alpha}-particle emitter 211At at the radioactivity levels needed for clinical studies. Our goal is to address two problems in astatine radiochemistry: First, a well known characteristic of 211At chemistry is that yields for electrophilic astatination reactions decline as the time interval after radionuclide isolation from the cyclotron target increases. This is a critical problem that must be addressed if cyclotrons are to be able to efficiently supply 211At to remote users. And second, when the preparation of high levels of 211At-labeled compounds is attempted, the radiochemical yields can be considerably lower than those encountered at tracer dose. For these reasons, clinical evaluation of promising 211At

  5. Part I: $\\beta$-delayed fission, laser spectroscopy and shape-coexistence studies with astatine beams; Part II: Delineating the island of deformation in the light gold isotopes by means of laser spectroscopy

    CERN Document Server

    Andreyev, Andrei


    Part I: $\\beta$-delayed fission, laser spectroscopy and shape-coexistence studies with astatine beams; Part II: Delineating the island of deformation in the light gold isotopes by means of laser spectroscopy

  6. In vitro evaluation of the astatinated chimeric monoclonal antibody U36, a potential candidate for treatment of head and neck squamous cell carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Nestor, M.; Anniko, M. [Uppsala University, Unit of Otolaryngology and Head and Neck Surgery, Department of Surgical Sciences, Uppsala (Sweden); Persson, M. [Uppsala University, Unit of Urology, Department of Surgical Sciences, Uppsala (Sweden); Uppsala University, Unit of Biomedical Radiation Science, Department of Oncology, Radiology and Clinical Immunology, Uppsala (Sweden); Dongen, G.A.M.S. van [Vrije Universiteit Medical Center, Department of Otolaryngology/Head and Neck Surgery, Amsterdam (Netherlands); Jensen, H.J. [Righshospitalet, PET and Cyclotron Unit, Department of Clinical Physiology and Nuclear Medicine, Copenhagen (Denmark); Lundqvist, H.; Tolmachev, V. [Uppsala University, Unit of Biomedical Radiation Science, Department of Oncology, Radiology and Clinical Immunology, Uppsala (Sweden)


    The purpose of this study was to analyse the properties of the astatinated chimeric MAb (cMAb) U36 as a conjugate to selectively target and eradicate head and neck squamous cell carcinoma (HNSCC). cMAb U36 was labelled with {sup 211}At via the linker N-succinimidyl 4-(trimethylstannyl)benzoate (SPMB). The quality of the conjugate was extensively evaluated for binding and internalisation capacity, and compared with {sup 125}I-SPMB-cMAb U36. The cellular toxicity of the astatinated conjugate was assessed in two types of in vitro growth assay and compared with {sup 131}I-labelled cMAb U36 (directly labelled). Comparisons between {sup 211}At-cMAb U36 and {sup 125}I-cMAb U36 demonstrated an optimal functional capacity of the labelled products. Immunoreactivity and affinity assays showed high immunoreactive fractions (>93%), and an affinity in good agreement between the astatinated and iodinated antibodies. For both conjugates, specific binding to HNSCC cells could be demonstrated, as well as some internalisation. Retention of the astatinated conjugate was just slightly lower than for the iodinated conjugate and still reasonable for therapeutic use (31{+-}2% vs 42.6{+-}1.0% at 22 h), demonstrating no adverse effects from astatination of the antibody. Studies on cellular toxicity demonstrated a dose-dependent and antigen-specific cellular toxicity for {sup 211}At-cMAb U36, with about 10% cell survival at 50 decays per cell. The {sup 131}I-labelled conjugate was not as efficient, with a surviving cell fraction of about 50% at 55 decays per cell. (orig.)

  7. In vitro evaluation of the astatinated chimeric monoclonal antibody U36, a potential candidate for treatment of head and neck squamous cell carcinoma

    International Nuclear Information System (INIS)

    Nestor, M.; Anniko, M.; Persson, M.; Dongen, G.A.M.S. van; Jensen, H.J.; Lundqvist, H.; Tolmachev, V.


    The purpose of this study was to analyse the properties of the astatinated chimeric MAb (cMAb) U36 as a conjugate to selectively target and eradicate head and neck squamous cell carcinoma (HNSCC). cMAb U36 was labelled with 211 At via the linker N-succinimidyl 4-(trimethylstannyl)benzoate (SPMB). The quality of the conjugate was extensively evaluated for binding and internalisation capacity, and compared with 125 I-SPMB-cMAb U36. The cellular toxicity of the astatinated conjugate was assessed in two types of in vitro growth assay and compared with 131 I-labelled cMAb U36 (directly labelled). Comparisons between 211 At-cMAb U36 and 125 I-cMAb U36 demonstrated an optimal functional capacity of the labelled products. Immunoreactivity and affinity assays showed high immunoreactive fractions (>93%), and an affinity in good agreement between the astatinated and iodinated antibodies. For both conjugates, specific binding to HNSCC cells could be demonstrated, as well as some internalisation. Retention of the astatinated conjugate was just slightly lower than for the iodinated conjugate and still reasonable for therapeutic use (31±2% vs 42.6±1.0% at 22 h), demonstrating no adverse effects from astatination of the antibody. Studies on cellular toxicity demonstrated a dose-dependent and antigen-specific cellular toxicity for 211 At-cMAb U36, with about 10% cell survival at 50 decays per cell. The 131 I-labelled conjugate was not as efficient, with a surviving cell fraction of about 50% at 55 decays per cell. (orig.)

  8. High-efficiency astatination of antibodies using N-iodosuccinimide as the oxidising agent in labelling of N-succinimidyl 3-(trimethylstannyl)benzoate

    International Nuclear Information System (INIS)

    Lindegren, S.; Andersson, H.; Baeck, T.; Jacobsson, L.; Karlsson, B.; Skarnemark, G.


    Monoclonal antibodies C215, reactive with colorectal carcinomas, and MOv18, reactive with most of the ovarian carcinomas, were radiohalogenated with [ 211 At]astatine. The radiohalogen was conjugate coupled to antibodies via the intermediate labelling reagent N-succinimidyl-3-(trimethylstannyl)benzoate (m-MeATE) in a two-step, single-pot reaction. Optimisation of the labelling of the reagent was achieved using N-iodosuccinimide, NIS, as the oxidising agent. The yields ranged from 69-95% in the labelling of 0.1-1.0 nmole of the m-MeATE precursor. Subsequent conjugation to antibodies resulted in yields of 58±7%. In vitro binding to tumour cells showed that the immunoreactivity of both antibodies was retained after astatine labelling

  9. An all-solid state laser system for the laser ion source RILIS and in-source laser spectroscopy of astatine at ISOLDE, CERN

    CERN Document Server

    Rothe, Sebastian; Nörtershäuser, W

    This doctoral thesis describes the extension of the resonance ionization laser ion source RILIS at ISOLDE, CERN, by the addition of an all-solid state tuneable titanium: sapphire (Ti:Sa) laser system to complement the well-established system of dye lasers. Synchronous operation of the so called Dual RILIS system of Ti:Sa and dye lasers was investigated and the potential for increased ion beam intensity, reliability, and reduced setup time has been demonstrated. In-source resonance ionization spectroscopy was performed at ISOLDE, CERN, and at ISAC, TRIUMF, radioactive ion beam facilities to develop an efficient and selective three-colour ionization scheme for the purely radioactive element astatine. A LabVIEW based monitoring, control and measurement system was conceived which enabled, in conjunction with Dual RILIS operation, the spectroscopy of high lying Rydberg states, from which the ionization potential of the astatine atom was determined for the first time experimentally.

  10. An all-solid state laser system for the laser ion sources RILIS and in-source laser spectroscopy of astatine at ISOLDE/CERN

    International Nuclear Information System (INIS)

    Rothe, Sebastian


    This doctoral thesis describes the extension of the resonance ionization laser ion source RILIS at CERN/ISOLDE by the addition of an all-solid state tunable titanium:sapphire (Ti:Sa) laser system to complement the well-established system of dye lasers. Synchronous operation of the so called Dual RILIS system of Ti:Sa and dye lasers was investigated and the potential for increased ion beam intensity, reliability, and reduced setup time has been demonstrated. In-source resonance ionization spectroscopy was performed at ISOLDE/CERN and at ISAC/TRIUMF radioactive ion beam facilities to develop an efficient and selective three-colour ionization scheme for the purely radioactive element astatine. A LabVIEW based monitoring, control and measurement system was conceived which enabled, in conjunction with Dual RILIS operation, the spectroscopy of high lying Rydberg states, from which the ionization potential of the astatine atom was determined for the first time experimentally.

  11. An all-solid state laser system for the laser ion sources RILIS and in-source laser spectroscopy of astatine at ISOLDE/CERN

    Energy Technology Data Exchange (ETDEWEB)

    Rothe, Sebastian


    This doctoral thesis describes the extension of the resonance ionization laser ion source RILIS at CERN/ISOLDE by the addition of an all-solid state tunable titanium:sapphire (Ti:Sa) laser system to complement the well-established system of dye lasers. Synchronous operation of the so called Dual RILIS system of Ti:Sa and dye lasers was investigated and the potential for increased ion beam intensity, reliability, and reduced setup time has been demonstrated. In-source resonance ionization spectroscopy was performed at ISOLDE/CERN and at ISAC/TRIUMF radioactive ion beam facilities to develop an efficient and selective three-colour ionization scheme for the purely radioactive element astatine. A LabVIEW based monitoring, control and measurement system was conceived which enabled, in conjunction with Dual RILIS operation, the spectroscopy of high lying Rydberg states, from which the ionization potential of the astatine atom was determined for the first time experimentally.

  12. Radiobiological Effects of Alpha-Particles from Astatine-211: From DNA Damage to Cell Death

    Energy Technology Data Exchange (ETDEWEB)

    Claesson, Kristina


    In recent years, the use of high linear energy transfer (LET) radiation for radiotherapeutic applications has gained increased interest. Astatine-211 (211At) is an alpha-particle emitting radionuclide, promising for targeted radioimmunotherapy of isolated tumor cells and microscopic clusters. To improve development of safe radiotherapy using 211At it is important to increase our knowledge of the radiobiological effects in cells. During radiotherapy, both tumors and adjacent normal tissue will be irradiated and therefore, it is of importance to understand differences in the radio response between proliferating and resting cells. The aim of this thesis was to investigate effects in fibroblasts with different proliferation status after irradiation with alpha-particles from 211At or X-rays, from inflicted DNA damage, to cellular responses and biological consequences. Throughout this work, irradiation was performed with alpha-particles from 211A or X-rays. The induction and repair of double-strand breaks (DSBs) in human normal fibroblasts were investigated using pulsed-field gel electrophoresis and fragment analysis. The relative biological effectiveness (RBE) of 211At for DSB induction varied between 1.4 and 3.1. A small increase of DSBs was observed in cycling cells compared to stationary cells. The repair kinetics was slower after 211At and more residual damage was found after 24 h. Comparison between cells with different proliferation status showed that the repair was inefficient in cycling cells with more residual damage, regardless of radiation quality. Activation of cell cycle arrests was investigated using immunofluorescent labeling of the checkpoint kinase Chk2 and by measuring cell cycle distributions with flow cytometry analysis. After alpha-particle irradiation, the average number of Chk2-foci was larger and the cells had a more affected cell cycle progression for several weeks compared with X-irradiated cells, indicating a more powerful arrest after 211At

  13. 49 CFR 179.220-10 - Welding. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Welding. 179.220-10 Section 179.220-10... Specifications for Non-Pressure Tank Car Tanks (Classes DOT-111AW and 115AW) § 179.220-10 Welding. (a) All joints... of this subchapter). Welding procedures, welders, and fabricators shall be approved. (b) Radioscopy...

  14. 46 CFR 129.220 - Basic safety. (United States)


    ... 46 Shipping 4 2010-10-01 2010-10-01 false Basic safety. 129.220 Section 129.220 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE SUPPLY VESSELS ELECTRICAL INSTALLATIONS General Requirements § 129.220 Basic safety. (a) Electrical equipment and installations must be suitable...

  15. 9 CFR 354.220 - Buildings. (United States)


    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Buildings. 354.220 Section 354.220... CERTIFICATION VOLUNTARY INSPECTION OF RABBITS AND EDIBLE PRODUCTS THEREOF Buildings and Plant Facilities § 354.220 Buildings. The buildings shall be of sound construction and kept in good repair, and shall be of...

  16. 21 CFR 189.220 - Flectol H. (United States)


    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Flectol H. 189.220 Section 189.220 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN... Addition to Human Food Through Food-Contact Surfaces § 189.220 Flectol H. (a) Flectol H is the chemical 1,2...

  17. 7 CFR 220.3 - Administration. (United States)


    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Administration. 220.3 Section 220.3 Agriculture... CHILD NUTRITION PROGRAMS SCHOOL BREAKFAST PROGRAM § 220.3 Administration. (a) Within the Department, FNS shall act on behalf of the Department in the administration of the Program covered by this part. Within...

  18. 49 CFR 220.2 - Preemptive effect. (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Preemptive effect. 220.2 Section 220.2 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION, DEPARTMENT OF TRANSPORTATION RAILROAD COMMUNICATIONS General § 220.2 Preemptive effect. Link to an amendment...

  19. 7 CFR 1280.220 - Collections. (United States)


    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Collections. 1280.220 Section 1280.220 Agriculture... INFORMATION ORDER Lamb Promotion, Research, and Information Order Assessments § 1280.220 Collections. (a) Each first handler and each exporter responsible for the collection of assessments under this subpart shall...

  20. 36 CFR 223.220 - Quantity determination. (United States)


    ... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Quantity determination. 223.220 Section 223.220 Parks, Forests, and Public Property FOREST SERVICE, DEPARTMENT OF AGRICULTURE SALE AND DISPOSAL OF NATIONAL FOREST SYSTEM TIMBER Special Forest Products § 223.220 Quantity determination...

  1. 7 CFR 58.220 - Drying systems. (United States)


    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Drying systems. 58.220 Section 58.220 Agriculture....220 Drying systems. (a) Spray dryers. Spray dryers shall be of a continuous discharge type and all... filter system shall comply with the applicable requirements of the 3-A Accepted Practices for Milk and...

  2. 49 CFR 220.7 - Penalty. (United States)


    ..., or has caused death or injury, a penalty not to exceed $100,000 per violation may be assessed; and... 49 Transportation 4 2010-10-01 2010-10-01 false Penalty. 220.7 Section 220.7 Transportation Other... TRANSPORTATION RAILROAD COMMUNICATIONS General § 220.7 Penalty. Any person (including but not limited to a...

  3. 46 CFR 121.220 - Cooking equipment. (United States)


    ... 46 Shipping 4 2010-10-01 2010-10-01 false Cooking equipment. 121.220 Section 121.220 Shipping... SYSTEMS AND EQUIPMENT Cooking and Heating § 121.220 Cooking equipment. (a) Doors on a cooking appliance... cooking appliance must be installed to prevent movement in heavy seas. (c) For a grill or similar type of...

  4. 46 CFR 184.220 - Cooking equipment. (United States)


    ... 46 Shipping 7 2010-10-01 2010-10-01 false Cooking equipment. 184.220 Section 184.220 Shipping...) VESSEL CONTROL AND MISCELLANEOUS SYSTEMS AND EQUIPMENT Cooking and Heating § 184.220 Cooking equipment. (a) Doors on a cooking appliance must be provided with hinges and locking devices to prevent...

  5. 14 CFR 13.220 - Discovery. (United States)


    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Discovery. 13.220 Section 13.220... INVESTIGATIVE AND ENFORCEMENT PROCEDURES Rules of Practice in FAA Civil Penalty Actions § 13.220 Discovery. (a) Initiation of discovery. Any party may initiate discovery described in this section, without the consent or...

  6. 45 CFR 148.220 - Excepted benefits. (United States)


    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false Excepted benefits. 148.220 Section 148.220 Public... FOR THE INDIVIDUAL HEALTH INSURANCE MARKET Preemption; Excepted Benefits § 148.220 Excepted benefits... provision of the benefits described in paragraphs (a) and (b) of this section (or any combination of the...

  7. 30 CFR 220.032 - Inventories. (United States)


    ... operations. The accumulation of surplus stocks shall be avoided by proper materiel control, inventory and... physical inventory that has not been credited to NPSL operations under § 220.015(a)(2) shall be credited to... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Inventories. 220.032 Section 220.032 Mineral...

  8. Final Report for research grant "Development of Methods for High Specific Activity Labeling of Biomolecules Using Astatine-211 in Different Oxidation States"

    Energy Technology Data Exchange (ETDEWEB)

    Wilbur, D. Scott [Univ. of Washington, Seattle, WA (United States)


    The overall objective of this research effort was to develop methods for labeling biomolecules with higher oxidation state species of At-211. This was to be done in an effort to develop reagents that had higher in vivo stability than the present carbon-bonded At-211-labeled compounds. We were unsuccessful in that effort, as none of the approaches studied provided reagents that were stable to in vivo deastatination. However, we gained a lot of information about At-211 in higher oxidation states. The studies proved to be very difficult as small changes in pH and other conditions appeared to change the nature of the species that obtained (by HPLC retention time analyses), with many of the species being unidentifiable. The fact that there are no stable isotopes of astatine, and the chemistry of the nearest halogen iodine is quite different, made it very difficult to interpret results of some experiments. With that said, we believe that a lot of valuable information was obtained from the studies. The research effort evaluated: (1) methods for chemical oxidation of At-211, (2) approaches to chelation of oxidized At-211, and (3) approaches to oxidation of astatophenyl compounds. A major hurdle that had to be surmounted to conduct the research was the development of HPLC conditions to separate and identify the various oxidized species formed. Attempts to develop conditions for separation of iodine and astatine species by normal and reversed-phase TLC and ITLC were not successful. However, we were successful in developing conditions (from a large number of attempts) to separate oxidized forms of iodine ([I-125]iodide, [I-125]iodate and [I-125]periodate) and astatine ([At-211]astatide, [At-211]astatate, [At-211]perastatate, and several unidentified At-211 species). Information on the basic oxidation and characterization of At-211 species is provided under Objective 1. Conditions were developed to obtain new At-211 labeling method where At-211 is chelated with the DOTA and

  9. 38 CFR 52.220 - Transportation. (United States)


    ... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Transportation. 52.220... FOR ADULT DAY HEALTH CARE OF VETERANS IN STATE HOMES Standards § 52.220 Transportation. Transportation... management must provide or contract for transportation to enable participants, including persons with...

  10. 49 CFR 220.3 - Application. (United States)


    ... general railroad system of transportation; or (2) Rapid transit operations in an urban area that are not... 49 Transportation 4 2010-10-01 2010-10-01 false Application. 220.3 Section 220.3 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION, DEPARTMENT OF...

  11. 24 CFR 91.220 - Action plan. (United States)


    ... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Action plan. 91.220 Section 91.220 Housing and Urban Development Office of the Secretary, Department of Housing and Urban Development..., evaluate and reduce lead-based paint hazards, reduce the number of poverty-level families, develop...

  12. 12 CFR 19.220 - Scope. (United States)


    ... 12 Banks and Banking 1 2010-01-01 2010-01-01 false Scope. 19.220 Section 19.220 Banks and Banking COMPTROLLER OF THE CURRENCY, DEPARTMENT OF THE TREASURY RULES OF PRACTICE AND PROCEDURE Procedures for... the OCC pursuant to section 38 of the Federal Deposit Insurance Act and this part. ...

  13. 20 CFR 220.35 - Introduction. (United States)


    ... term is defined in the Social Security Act. In making these decisions the Board must apply the... Services in making disability decisions under the Social Security Act. Regulations of the Social Security... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Introduction. 220.35 Section 220.35 Employees...

  14. 40 CFR 86.220-94 - [Reserved (United States)


    ... 40 Protection of Environment 18 2010-07-01 2010-07-01 false [Reserved] 86.220-94 Section 86.220-94 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) CONTROL OF... Year Gasoline-Fueled New Light-Duty Vehicles, New Light-Duty Trucks and New Medium-Duty Passenger...

  15. 24 CFR 220.804 - Insurance premiums. (United States)


    ... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Insurance premiums. 220.804 Section... and Obligations-Projects Insured Project Improvement Loans § 220.804 Insurance premiums. (a) First premium. The lender, upon the initial endorsement of the loan for insurance, shall pay to the Commissioner...

  16. Dicty_cDB: SLH220 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLH220 (Link to dictyBase) - - - Contig-U15409-1 SLH220F (Link to Original site) SLH2...20F 510 - - - - - - Show SLH220 Library SL (Link to library) Clone ID SLH220 (Link Representative seq. ID SLH22...0F (Link to Original site) Representative DNA sequence >SLH220 (SLH220Q) /CSM/SL/SLH2-A/SLH220Q.Seq.d/ GAAGA...gnificant alignments: (bits) Value SLH220 (SLH220Q) /CSM/SL/SLH2-A/SLH220Q.Seq.d/

  17. Dicty_cDB: SFL220 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 0Z (Link to Original site) Representative DNA sequence >SFL220 (SFL220Q) /CSM/SF/SFL2-A/SFL220Q.Seq.d/ XXXXXXXXXXGTCCANATTTCCATANA...end seq. - 3' end seq. ID SFL220Z 3' end seq. >SFL220Z.Seq ----------GTCCANATTTCCATANATGTGTTTAAAAACGTGGNGGNA

  18. Dicty_cDB: VHK220 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VH (Link to library) VHK220 (Link to dictyBase) - - - - - (Link to Original site) VHK2...20F 530 - - - - - - Show VHK220 Library VH (Link to library) Clone ID VHK220 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID - (Link to Original site) Representative DNA sequence >VHK2...20 (VHK220Q) /CSM/VH/VHK2-A/VHK220Q.Seq.d/ AACTCTCGAGTGCAAAAAAAGTAAAGTACAAAATGGTTAATTTCA

  19. Environmental thoron (220Rn): a review

    International Nuclear Information System (INIS)

    Ramachandran, T.V.


    Ever since studies on uranium miners established the presence of a positive risk coefficient for the occurrence of lung cancer in miners exposed to elevated levels of 222 Rn and its progeny, there was a great upsurge of interest in the measurement of 222 Rn in the environment and considerable data is generated on the levels of 222 Rn in the environment across the worlds and is periodically reported by UNSCEAR. In contrast to this, data pertaining to 220 Rn in indoors and workplace environment is scare due to the general perception that its levels are negligible due to its shorter half life, and subsequently its contribution to the total inhalation dose is ignored, in the presence of other significant sources of natural radiation. Many locations have higher levels of natural background radiation due to elevated levels of primordial radio nuclides in the soil and their decay products like radon ( 222 Rn), and thoron ( 220 Rn) in the environment. It is estimated inhalation of 222 Rn, 220 Rn and their short lived progenies contribute more than 54 % of the total natural background radiation dose received by the general population. This component is not adequately estimated for any country so far on a national level. 220 Rn problem will also be a problem in industries which uses thorium nitrate. Including India lamps using thoriated gas mantles are being still used for indoor and outdoor lighting and hawkers in rural as well as urban areas. Considering the fact that large amount of thorium nitrate is being handled by these industries, contribution to the inhalation dose of workers from 220 Rn gas emanated and build up of the progeny in ambient air may also be quite significant. In this article current status of 220 Rn levels in the indoor environment workplaces as well as in other industries where large amount of 232 Th is being handled are being summarized. (author)

  20. 36 CFR 220.4 - General requirements. (United States)


    ... natural and physical environment and the relationship of people with that environment (see 40 CFR 1508.14... for environmental assessments, findings of no significant impact and categorical exclusions (FSM 1950... ENVIRONMENTAL POLICY ACT (NEPA) COMPLIANCE § 220.4 General requirements. (a) Proposed actions subject to the...

  1. 2 CFR 220.15 - Policy. (United States)


    ... Agreements OFFICE OF MANAGEMENT AND BUDGET CIRCULARS AND GUIDANCE Reserved COST PRINCIPLES FOR EDUCATIONAL INSTITUTIONS (OMB CIRCULAR A-21) § 220.15 Policy. The principles in this part are designed to provide that the... accounting principles, except where restricted or prohibited by law. Agencies are not expected to place...

  2. 7 CFR 220.17 - Prohibitions. (United States)


    ..., curriculum, instructions, methods of instruction, and materials of instruction in any school as a condition... CHILD NUTRITION PROGRAMS SCHOOL BREAKFAST PROGRAM § 220.17 Prohibitions. (a) In carrying out the... limited to, laws relating to taxation, welfare, and public assistance programs. Expenditure of funds from...

  3. Environmental thoron (220Rn): a review

    International Nuclear Information System (INIS)

    Ramachandran, T.V.


    Studies on natural background radiation is a topic, which evoked curiosity and concern between the scientist and layman alike in recent years due to the shift in focus of health effects due to exposure of radiation from acute high level to chronic low level. Ever since studies on uranium miners established the presence of a positive risk coefficient for the occurrence of lung cancer in miners exposed to elevated levels of 222 Rn and its progeny, there was a great upsurge of interest in the measurement of 222 Rn in the environment. Subsequently, considerable data is being generated on the levels of 222 Rn in the environment across the worlds and is being periodically reported by UNSCEAR reports. In contrast to this, data pertaining to 220 Rn in indoors and workplace environment is scare due to the general perception that its levels are negligible due to its shorter half life, and subsequently its contribution to the total inhalation dose is ignored, in the presence of other significant sources of natural radiation. This may not be true from the recent studies resulted in observing high 220 Rn levels in living environments and work places in various countries and it is increasingly felt that it may be necessary to have data on 220 Rn levels in environment for obtaining a complete picture of inhalation dose. Globally many locations have higher levels of natural background radiation due to elevated levels of primordial radio nuclides in the soil and their decay products, like radon ( 222 Rn), and thoron ( 220 Rn) in the environment. Of late, technologically enhanced naturally occurring radioactive material has also contributed to the burden of background radiation. It is estimated inhalation of 222 Rn, 220 Rn and their short lived progenies contribute more than 54 % of the total natural background radiation dose received by the general population. Due to this it was necessary to supplement the external component with inhalation component. This component is not

  4. 36 CFR 220.7 - Environmental assessment and decision notice. (United States)


    ... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Environmental assessment and decision notice. 220.7 Section 220.7 Parks, Forests, and Public Property FOREST SERVICE, DEPARTMENT OF AGRICULTURE NATIONAL ENVIRONMENTAL POLICY ACT (NEPA) COMPLIANCE § 220.7 Environmental assessment and decision notice. (a) Environmental assessment...

  5. 7 CFR 3052.220 - Frequency of audits. (United States)


    ... 7 Agriculture 15 2010-01-01 2010-01-01 false Frequency of audits. 3052.220 Section 3052.220 Agriculture Regulations of the Department of Agriculture (Continued) OFFICE OF THE CHIEF FINANCIAL OFFICER, DEPARTMENT OF AGRICULTURE AUDITS OF STATES, LOCAL GOVERNMENTS, AND NON-PROFIT ORGANIZATIONS Audits § 3052.220...

  6. 20 CFR 220.63 - Conflict of interest. (United States)


    ... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Conflict of interest. 220.63 Section 220.63 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE RAILROAD RETIREMENT ACT DETERMINING DISABILITY Consultative Examinations § 220.63 Conflict of interest. All implications of possible conflict of...

  7. 24 CFR 220.811 - Date of default. (United States)


    ... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Date of default. 220.811 Section... and Obligations-Projects Insured Project Improvement Loans § 220.811 Date of default. For the purposes of §§ 220.800 et seq., the date of default shall be considered as: (a) The date of the first...

  8. 24 CFR 220.812 - Notice of default. (United States)


    ... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Notice of default. 220.812 Section... and Obligations-Projects Insured Project Improvement Loans § 220.812 Notice of default. (a) If the default as defined in § 220.810 is not cured within the 30 day grace period, the lender shall, within 30...

  9. 29 CFR 99.220 - Frequency of audits. (United States)


    ... 29 Labor 1 2010-07-01 2010-07-01 true Frequency of audits. 99.220 Section 99.220 Labor Office of the Secretary of Labor AUDITS OF STATES, LOCAL GOVERNMENTS, AND NON-PROFIT ORGANIZATIONS Audits § 99.220 Frequency of audits. Except for the provisions for biennial audits provided in paragraphs (a) and...

  10. 12 CFR 220.6 - Good faith account. (United States)


    ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Good faith account. 220.6 Section 220.6 Banks... BY BROKERS AND DEALERS (REGULATION T) § 220.6 Good faith account. In a good faith account, a creditor...) Securities entitled to good faith margin—(1) Permissible transactions. A creditor may effect and finance...

  11. 46 CFR 402.220 - Registration of pilots. (United States)


    ... 46 Shipping 8 2010-10-01 2010-10-01 false Registration of pilots. 402.220 Section 402.220 Shipping... ORDERS Registration of Pilots § 402.220 Registration of pilots. (a) Each applicant pilot must complete the number of round trips specified in this section prior to registration as a U.S. registered pilot...

  12. 46 CFR 401.220 - Registration of pilots. (United States)


    ... 46 Shipping 8 2010-10-01 2010-10-01 false Registration of pilots. 401.220 Section 401.220 Shipping... Registration of Pilots § 401.220 Registration of pilots. (a) The Director shall determine the number of pilots... waters of the Great Lakes and to provide for equitable participation of United States Registered Pilots...

  13. 7 CFR 220.1 - General purpose and scope. (United States)


    ... 7 Agriculture 4 2010-01-01 2010-01-01 false General purpose and scope. 220.1 Section 220.1 Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE CHILD NUTRITION PROGRAMS SCHOOL BREAKFAST PROGRAM § 220.1 General purpose and scope. This part...

  14. 49 CFR 220.38 - Communication equipment failure. (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Communication equipment failure. 220.38 Section 220.38 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD... § 220.38 Communication equipment failure. (a) Any radio or wireless communication device found not to be...

  15. 7 CFR 220.5 - Method of payment to States. (United States)


    ... reimbursement to School Food Authorities through presentation by designated State officials of a payment Voucher... 7 Agriculture 4 2010-01-01 2010-01-01 false Method of payment to States. 220.5 Section 220.5... AGRICULTURE CHILD NUTRITION PROGRAMS SCHOOL BREAKFAST PROGRAM § 220.5 Method of payment to States. Funds to be...

  16. 36 CFR 2.20 - Skating, skateboards, and similar devices. (United States)


    ... 36 Parks, Forests, and Public Property 1 2010-07-01 2010-07-01 false Skating, skateboards, and similar devices. 2.20 Section 2.20 Parks, Forests, and Public Property NATIONAL PARK SERVICE, DEPARTMENT OF THE INTERIOR RESOURCE PROTECTION, PUBLIC USE AND RECREATION § 2.20 Skating, skateboards, and...

  17. 49 CFR 220.301 - Purpose and application. (United States)


    ... being distracted by the inappropriate use of electronic devices, such as mobile telephones (cell phones... 49 Transportation 4 2010-10-01 2010-10-01 false Purpose and application. 220.301 Section 220.301..., DEPARTMENT OF TRANSPORTATION RAILROAD COMMUNICATIONS Electronic Devices § 220.301 Purpose and application. (a...

  18. 40 CFR 300.220 - Related Title III issues. (United States)


    ... 40 Protection of Environment 27 2010-07-01 2010-07-01 false Related Title III issues. 300.220 Section 300.220 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SUPERFUND, EMERGENCY... PLAN Planning and Preparedness § 300.220 Related Title III issues. Other related Title III requirements...

  19. 24 CFR 220.801 - Initial insurance endorsement. (United States)


    ... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Initial insurance endorsement. 220.801 Section 220.801 Housing and Urban Development Regulations Relating to Housing and Urban... AREAS Contract Rights and Obligations-Projects Insured Project Improvement Loans § 220.801 Initial...

  20. 12 CFR 220.132 - Credit to brokers and dealers. (United States)


    ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Credit to brokers and dealers. 220.132 Section 220.132 Banks and Banking FEDERAL RESERVE SYSTEM (CONTINUED) BOARD OF GOVERNORS OF THE FEDERAL RESERVE SYSTEM CREDIT BY BROKERS AND DEALERS (REGULATION T) Interpretations § 220.132 Credit to brokers and...

  1. 43 CFR 17.220 - Preschool, elementary, and secondary education. (United States)


    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Preschool, elementary, and secondary education. 17.220 Section 17.220 Public Lands: Interior Office of the Secretary of the Interior NONDISCRIMINATION IN FEDERALLY ASSISTED PROGRAMS OF THE DEPARTMENT OF THE INTERIOR Nondiscrimination on the Basis of Handicap § 17.220 Preschool, elementary,...

  2. CompTIA A+ complete study guide exams 220-801 and 220-802

    CERN Document Server

    Docter, Quentin; Skandier, Toby


    CompTIA Authorized, fully updated Study Guide for the leading IT certification: CompTIA A+ CompTIA A+ is the de facto certification for IT technicians. Some vendors even require employees to achieve certification as part of their job training. This book prepares you for both required exams: 220-801 and 220-802. Totally updated to cover the 2012 exams, this popular prep guide covers all the exam objectives. Readers will also have access to additional study tools, including the Sybex Test Engine with bonus practice exams, electronic flashcards, and a glossary of important terms in searchable PD

  3. Factorisation of RSA-220 with CADO-NFS


    Bai , Shi; Gaudry , Pierrick; Kruppa , Alexander; Thomé , Emmanuel; Zimmermann , Paul


    We give details of the factorization of RSA-220 with CADO-NFS. This is a new record computation with this open-source software. We report on the factorization of RSA-220 (220 decimal digits), which is the 3rd largest integer factorization with the General Number Field Sieve (GNFS), after the factorization of RSA-768 (232 digits) in December 2009 [3], and that of 3 697 + 1 (221 digits) in February 2015 by NFS@home.

  4. TG 220 MW hydraulic control system diagnostics

    International Nuclear Information System (INIS)

    Svabcik, A.


    The TG power output control system comprises a hydraulic and an electronic part. TG speed, power output or the main steam header pressure (HPK) depend on the steam flow at the turbine inlet. The steam admission into the turbine is controlled by four control valves and one by-pass valve in case of the HP part and by four capture flap valves in case of the LP part. The task of the SKODA K-220 MW turbine protection and control systems is to provide both the turbine speed and power output control to the setpoint value. Diagnostic measurements were aimed at getting an overview of both technical and functional states of all power output control elements. Principally, it can be stated that some deficiencies of a design nature originating from the manufacturer's factory were revealed and some other deficiencies related to hydraulic control elements functionality were identified more closely by the new method. 5 figs

  5. TG 220 MW hydraulic control system diagnostics

    Energy Technology Data Exchange (ETDEWEB)

    Svabcik, A [Atomova Elektraren Bohunice, Jaslovske Bohunice (Slovakia)


    The TG power output control system comprises a hydraulic and an electronic part. TG speed, power output or the main steam header pressure (HPK) depend on the steam flow at the turbine inlet. The steam admission into the turbine is controlled by four control valves and one by-pass valve in case of the HP part and by four capture flap valves in case of the LP part. The task of the SKODA K-220 MW turbine protection and control systems is to provide both the turbine speed and power output control to the setpoint value. Diagnostic measurements were aimed at getting an overview of both technical and functional states of all power output control elements. Principally, it can be stated that some deficiencies of a design nature originating from the manufacturer`s factory were revealed and some other deficiencies related to hydraulic control elements functionality were identified more closely by the new method. 5 figs.

  6. Soil as a source of indoor 220Rn

    International Nuclear Information System (INIS)

    Li, Y.; Schery, S.D.; Turk, B.


    Two suggestions for sources of indoor 220Rn (thoron) have appeared in the literature: (1) building materials and outside air, and (2) soil beneath the house. Due to the difficulty of 220Rn measurement and limited data, both suggestions lack sufficient supporting evidence. We have investigated sources of indoor 220Rn in seven occupied houses in northern New Mexico, U.S. A two-filter system was used to measure indoor 220Rn levels continuously, and 220Rn progeny were measured with single filters and specialized alpha-track detectors. The amount of 220Rn entry from soil was curtailed by cutting off soil gas flow to the indoor air with subfloor depressurization mitigation systems. Four of the houses showed significant reductions in 220Rn with mitigation systems on. The average effect for these houses was to reduce indoor 220Rn levels by 70%. The other three houses had no clear reductions but in one of these houses, the mitigation system was not effective for stopping soil gas flow. Our results provide some of the most clear evidence to date supporting soil as an important source of indoor 220Rn

  7. 20 CFR 404.220 - Average-monthly-wage method. (United States)


    ... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Average-monthly-wage method. 404.220 Section... INSURANCE (1950- ) Computing Primary Insurance Amounts Average-Monthly-Wage Method of Computing Primary Insurance Amounts § 404.220 Average-monthly-wage method. (a) Who is eligible for this method. You must...

  8. 49 CFR 220.23 - Publication of radio information. (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Publication of radio information. 220.23 Section... § 220.23 Publication of radio information. Each railroad shall designate where radio base stations are.... The publication shall indicate the periods during which base and wayside radio stations are...

  9. 24 CFR 220.810 - Definition of default. (United States)


    ... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Definition of default. 220.810... Contract Rights and Obligations-Projects Insured Project Improvement Loans § 220.810 Definition of default... note or security instrument and such default continues for a period of 30 days, the note or security...

  10. 33 CFR 2.20 - Territorial sea baseline. (United States)


    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Territorial sea baseline. 2.20... JURISDICTION Jurisdictional Terms § 2.20 Territorial sea baseline. Territorial sea baseline means the line.... Normally, the territorial sea baseline is the mean low water line along the coast of the United States...

  11. 42 CFR 403.220 - Supplemental Health Insurance Panel. (United States)


    ... 42 Public Health 2 2010-10-01 2010-10-01 false Supplemental Health Insurance Panel. 403.220... Programs § 403.220 Supplemental Health Insurance Panel. (a) Membership. The Supplemental Health Insurance... determines whether or not a State regulatory program for Medicare supplemental health insurance policies...

  12. 20 CFR 220.132 - Physical exertion requirements. (United States)


    ... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Physical exertion requirements. 220.132 Section 220.132 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE RAILROAD RETIREMENT... of walking and standing is often necessary in carrying out job duties. Jobs are sedentary if walking...

  13. 2 CFR 801.220 - What contracts and subcontracts, in addition to those listed in 2 CFR 180.220, are covered... (United States)


    ... 2 Grants and Agreements 1 2010-01-01 2010-01-01 false What contracts and subcontracts, in addition to those listed in 2 CFR 180.220, are covered transactions? 801.220 Section 801.220 Grants and... DEBARMENT AND SUSPENSION Covered Transactions § 801.220 What contracts and subcontracts, in addition to...

  14. 75 FR 36471 - Seventh Meeting-RTCA Special Committee 220: Automatic Flight Guidance and Control (United States)


    ... Committee 220: Automatic Flight Guidance and Control AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Notice of RTCA Special Committee 220: Automatic Flight Guidance and Control meeting. SUMMARY: The... Committee 220: Automatic Flight Guidance and [[Page 36472

  15. 24 CFR 180.220 - Separation of functions. (United States)


    ... AND BUSINESS OPPORTUNITY CONSOLIDATED HUD HEARING PROCEDURES FOR CIVIL RIGHTS MATTERS Administrative Law Judge § 180.220 Separation of functions. No officer, employee, or agent of the Federal Government...

  16. Near-infrared light and the morphology of Arp 220

    International Nuclear Information System (INIS)

    Smith, J.; Grasdalen, G.L.; Gehrz, R.D.; Hackwell, J.A.; Dietz, R.D.


    This paper presents 2.2 micron imaging and a near-IR energy distribution for the luminous galaxy Arp 220. In the near-IR, Arp 220 appears as a single isolated galaxy with the projected axial symmetry of either a face-on disk or spheroid. The near-IR images contradict the original interpretation of the galaxy as the ongoing collision of two galaxies. No single component morphology can explain the galaxy adequately; this paper explains it as a hybrid galaxy form related to the class of radio galaxies with dust lanes. Some radio galaxies have properties in common with Arp 220. Hot stars are probable sources for heating of the diffuse dust in Arp 220 and perhaps some portion of a nuclear component. Heating by a nonstellar source of ultraviolet radiation is possible at the nucleus. 31 references

  17. 7 CFR 220.7 - Requirements for participation. (United States)


    ... items such a grade, purchase units, style, condition, weight, ingredients, formulations, and delivery... citations affecting § 220.7, see the List of CFR Sections Affected, which appears in the Finding Aids...

  18. An assessment method of dose equivalent due to indoor 220Rn progeny by using 220Rn concentration measured at a 20 cm distance from wall

    International Nuclear Information System (INIS)

    Iida, T.; Ikebe, Y.; Okamoto, K.; Guo, Q.; Yamasaki, T.


    A pair of passive cup monitors with a different air exchange openings was developed for measuring simultaneously 222 Rn and 220 Rn concentrations. Indoor 220 Rn concentrations were very high in traditional Japanese dwellings with soil walls. The 220 Rn concentration decreases exponentially with the distance from wall. The effective diffusion coefficient of 220 Rn in dwelling and the exhalation rate of 220 Rn from wall were evaluated from the distribution of the 220 Rn concentrations. Then, indoor 220 Rn progeny concentration could be estimated from the 220 Rn concentration at a 20 cm distance from wall. From the results of the surveys. the average annual effective dose equivalent due to 220 Rn progeny was expected to be 0.67 mSv/year in the traditional Japanese dwellings. (author)

  19. 10 CFR 600.220 - Standards for financial management systems. (United States)


    ... financial reporting requirements of the grant or subgrant. (2) Accounting records. Grantees and subgrantees... advances to the grantees. (c) An awarding agency may review the adequacy of the financial management system... 10 Energy 4 2010-01-01 2010-01-01 false Standards for financial management systems. 600.220...

  20. 20 CFR 220.142 - General information about work activity. (United States)


    ... gainful activity. (e) Time spent in work. While the time the claimant spends in work is important, the... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false General information about work activity. 220... of whether the claimant spends more time or less time at the job than workers who are not impaired...

  1. 9 CFR 93.220 - Inspection at port of entry. (United States)


    ... CERTAIN ANIMALS, BIRDS, FISH, AND POULTRY, AND CERTAIN ANIMAL, BIRD, AND POULTRY PRODUCTS; REQUIREMENTS FOR MEANS OF CONVEYANCE AND SHIPPING CONTAINERS Poultry Mexico 8 § 93.220 Inspection at port of entry. (a) All poultry offered for entry from Mexico, including such poultry intended for movement through...

  2. 49 CFR 179.220-11 - Postweld heat treatment. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Postweld heat treatment. 179.220-11 Section 179... Postweld heat treatment. (a) Postweld heat treatment of the inner container is not a specification requirement. (b) Postweld heat treatment of the cylindrical portions of the outer shell to which the anchorage...

  3. 24 CFR 220.830 - Debenture interest rate. (United States)


    ... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Debenture interest rate. 220.830... rate. Debentures shall bear interest from the date of issue, payable semiannually on the first day of... rates of interest will be published twice each year as a notice in the Federal Register. [47 FR 26125...

  4. 40 CFR 1065.220 - Fuel flow meter. (United States)


    ... follows: (1) Use the actual value of calculated raw exhaust flow rate in the following cases: (i) For... ENGINE-TESTING PROCEDURES Measurement Instruments Flow-Related Measurements § 1065.220 Fuel flow meter. (a) Application. You may use fuel flow in combination with a chemical balance of carbon (or oxygen...

  5. 50 CFR 600.220 - Oath of office. (United States)


    ..., DEPARTMENT OF COMMERCE MAGNUSON-STEVENS ACT PROVISIONS Council Membership § 600.220 Oath of office. Link to... United States of America by carrying out the business of the Council for the greatest overall benefit of... conduct prescribed by the Secretary of Commerce. This oath is given freely and without mental reservation...

  6. 2 CFR 220.40 - Relationship to previous issuance. (United States)


    ...) The Attachment to the circular, entitled “Principles For Determining Costs Applicable to Grants... attachment to the circular, entitled “CASB's Cost Accounting Standards (CAS),” Attachment A, CASB's Cost... Section 220.40 Grants and Agreements OFFICE OF MANAGEMENT AND BUDGET CIRCULARS AND GUIDANCE Reserved COST...

  7. 30 CFR 90.220 - Status change reports. (United States)


    ... MANDATORY HEALTH STANDARDS-COAL MINERS WHO HAVE EVIDENCE OF THE DEVELOPMENT OF PNEUMOCONIOSIS Sampling Procedures § 90.220 Status change reports. If there is a change in the status of a part 90 miner that affects the respirable dust sampling requirements of this part (such as entering a terminated, injured or ill...

  8. 30 CFR 70.220 - Status change reports. (United States)


    ... MANDATORY HEALTH STANDARDS-UNDERGROUND COAL MINES Sampling Procedures § 70.220 Status change reports. (a) If there is a change in operational status that affects the respirable dust sampling requirements of this... produced. (iii) Abandoned—the work of all miners has been terminated and production activity has ceased. (2...

  9. 41 CFR 101-29.220 - Market research and analysis. (United States)


    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Market research and... PRODUCT DESCRIPTIONS 29.2-Definitions § 101-29.220 Market research and analysis. Market research and... to determine whether they meet user needs and to identify the market practices of firms engaged in...

  10. 24 CFR 220.802 - Final insurance endorsement. (United States)


    ... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Final insurance endorsement. 220... insurance endorsement. When all advances of loan proceeds have been made, and all the terms and conditions... on the original credit instrument the total of advances he has approved for insurance and again...

  11. 27 CFR 28.220 - Notice of return. (United States)


    ... OF THE TREASURY LIQUORS EXPORTATION OF ALCOHOL Exportation of Wine With Benefit of Drawback § 28.220 Notice of return. If an exporter desires to return wine to a bonded wine cellar or wholesale liquor... wine cellar from which withdrawn; (b) Date and serial number of the Form 1582-A (5120.24) on which the...

  12. 20 CFR 725.220 - Determination of relationship; child. (United States)


    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Determination of relationship; child. 725.220... Determination of relationship; child. For purposes of determining whether an individual may qualify for benefits as the child of a deceased miner, the provisions of § 725.208 shall be applicable. As used in this...

  13. 7 CFR 220.14 - Claims against school food authorities. (United States)


    ..., DEPARTMENT OF AGRICULTURE CHILD NUTRITION PROGRAMS SCHOOL BREAKFAST PROGRAM § 220.14 Claims against school food authorities. (a) State agencies shall disallow any portion of a claim and recover any payment made... FNSRO, when FNSRO disallows a claim or a portion of a claim, or makes a demand for refund of an alleged...

  14. Thoron (220Rn) in the indoor environment and work places (United States)

    Ramachandran, T. V.; Sahoo, B. K.


    Ever since studies on uranium miners established the presence of a positive risk coefficient for the occurrence of lung cancer in miners exposed to elevated levels of 222Rn and its progeny, there was a great upsurge of interest in the measurement of 222Rn in the environment. Subsequently, considerable data is being generated on the levels of 222Rn in the environment across the worlds and is being periodically reported by UNSCEAR reports. In contrast to this, data pertaining to 220Rn in indoors and workplace environment is scaree due to the genral perception that its levels are negligible due to its shorter half life, and subsequently its contribution to the total inhalation dose is ignored, in the presence of other significant sources of natural radiation. This may not be true. Globally many locations have higher levels of natural background radiation due to elevated levels of primordial radio nuclides in the soil and their decay products like radon (222Rn), and thoron (220Rn) in the environment. Of late, technologically enhanced naturally occurring radioactive material has also contributed to the burden of background radiation. It is estimated that inhalation of 222Rn, 220Rn and their short lived progenies contribute more than 54% of the total natural background radiation dose received by the general population. 220Rn problem exists in industries which use thorium nitrate. Including India, lamps using thoriated gas mantles are still being used for indoor and outdoor lighting and by hawkers in rural as well as urban areas. Considering the fact that large amount of thorium nitrate is being handled by these industries, contribution to the inhalation dose of workers from 220Rn gas emanated and build up of the progeny in ambient air may also be quite significant. In this paper current status of 220Rn levels in the indoor environment and workplaces as well as in other industries where large amount of 232Th is being handled is being summarized. Methods of measurement and

  15. Thoron (220Rn) in the indoor environment and work places

    International Nuclear Information System (INIS)

    Ramchandran, T.V.; Sahoo, B.K.


    Ever since studies on uranium miners established the presence of a positive risk coefficient for the occurrence of lung cancer in miners exposed to elevated levels of 222 Rn and its progeny, there was a great upsurge of interest in the measurement of 222 Rn in the environment. Subsequently, considerable data is being generated on the levels of 222 Rn in the environment across the worlds and is being periodically reported by UNSCEAR reports. In contrast to this, data pertaining to 220 Rn in indoors and workplace environment is scaree due to the general perception that its levels are negligible due to its shorter half life, and subsequently its contribution to the total inhalation dose is ignored, in the presence of other significant sources of natural radiation. This may not be true. Globally many locations have higher levels of natural background radiation due to elevated levels of primordial radio nuclides in the soil and their decay products like radon ( 222 Rn), and thoron ( 220 Rn) in the environment. Of late, technologically enhanced naturally occurring radioactive material has also contributed to the burden of background radiation. It is estimated that inhalation of 222 Rn, 220 Rn and their short lived progenies contribute more than 54% of the total natural background radiation dose received by the general population. 220 Rn problem exists in industries which use thorium nitrate. Including India, lamps using thoriated gas mantles are still being used for indoor and outdoor lighting and by hawkers in rural as well as urban areas. Considering the fact that large amount of thorium nitrate is being handled by these industries, contribution to the inhalation dose of workers from 220 Rn gas emanated and build up of the progeny in ambient air may also be quite significant. In this paper current status of 220 Rn levels in the indoor environment and workplaces as well as in other industries where large amount of 232 Th is being handled is being summarized. Methods of

  16. 25 CFR 1000.220 - What regulations apply to self-governance Tribes? (United States)


    ... 25 Indians 2 2010-04-01 2010-04-01 false What regulations apply to self-governance Tribes? 1000.220 Section 1000.220 Indians OFFICE OF THE ASSISTANT SECRETARY, INDIAN AFFAIRS, DEPARTMENT OF THE...-DETERMINATION AND EDUCATION ACT Waiver of Regulations § 1000.220 What regulations apply to self-governance...

  17. 76 FR 22163 - Tenth Meeting: RTCA Special Committee 220: Automatic Flight Guidance and Control (United States)


    ... 220: Automatic Flight Guidance and Control AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Notice of RTCA Special Committee 220 meeting: Automatic Flight Guidance and Control. SUMMARY: The FAA is... hereby given for a Special Committee 220, Automatic Flight Guidance and Control. Agenda Tuesday May 10...

  18. 75 FR 15770 - Sixth Meeting-RTCA Special Committee 220: Automatic Flight Guidance and Control (United States)


    ... 220: Automatic Flight Guidance and Control AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Notice of RTCA Special Committee 220: Automatic Flight Guidance and Control meeting. SUMMARY: The FAA is... hereby given for a Special Committee 220: Automatic Flight Guidance and Control meeting. The agenda will...

  19. 75 FR 80886 - Ninth Meeting-RTCA Special Committee 220: Automatic Flight Guidance and Control (United States)


    ... 220: Automatic Flight Guidance and Control AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Notice of RTCA Special Committee 220: Automatic Flight Guidance and Control meeting. SUMMARY: The FAA is... for a Special Committee 220: Automatic Flight Guidance and Control meeting. The agenda will include...

  20. 75 FR 59326 - Eighth Meeting-RTCA Special Committee 220: Automatic Flight Guidance and Control (United States)


    ... Committee 220: Automatic Flight Guidance and Control AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Notice of RTCA Special Committee 220: Automatic Flight Guidance and Control meeting. SUMMARY: The... Special Committee 220: Automatic Flight Guidance and Control meeting. The agenda will include: Welcome...

  1. 75 FR 3959 - Fifth Meeting-RTCA Special Committee 220: Automatic Flight Guidance and Control (United States)


    ... 220: Automatic Flight Guidance and Control AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Notice of RTCA Special Committee 220: Automatic Flight Guidance and Control meeting. SUMMARY: The FAA is issuing this notice to advise the public of a meeting of RTCA Special Committee 220: Automatic Flight...

  2. 50 CFR 665.220 - Hawaii coral reef ecosystem fisheries. [Reserved (United States)


    ... 50 Wildlife and Fisheries 9 2010-10-01 2010-10-01 false Hawaii coral reef ecosystem fisheries. [Reserved] 665.220 Section 665.220 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL... PACIFIC Hawaii Fisheries § 665.220 Hawaii coral reef ecosystem fisheries. [Reserved] ...

  3. 42 CFR 412.220 - Special treatment of certain hospitals located in Puerto Rico. (United States)


    ... Puerto Rico. 412.220 Section 412.220 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT... SERVICES Prospective Payment System for Inpatient Operating Costs for Hospitals Located in Puerto Rico § 412.220 Special treatment of certain hospitals located in Puerto Rico. Subpart G of this part sets...

  4. 32 CFR 37.220 - How involved should the Government program official be in the project? (United States)


    ... official be in the project? 37.220 Section 37.220 National Defense Department of Defense OFFICE OF THE... Technology Investment Agreements § 37.220 How involved should the Government program official be in the project? (a) TIAs are used to carry out cooperative relationships between the Federal Government and the...

  5. 46 CFR 185.220 - Records of a voyage resulting in a marine casualty. (United States)


    ....220 Section 185.220 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) SMALL PASSENGER VESSELS (UNDER 100 GROSS TONS) OPERATIONS Marine Casualties and Voyage Records § 185.220 Records of a... officer, or person responsible for the custody thereof, shall make these records available upon request...

  6. 46 CFR 122.220 - Records of a voyage resulting in a marine casualty. (United States)


    ....220 Section 122.220 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) SMALL PASSENGER... OPERATIONS Marine Casualties and Voyage Records § 122.220 Records of a voyage resulting in a marine casualty... custody thereof, shall make these records available upon request, to a duly authorized investigating...

  7. 47 CFR 25.220 - Non-conforming transmit/receive earth station operations. (United States)


    ... 47 Telecommunication 2 2010-10-01 2010-10-01 false Non-conforming transmit/receive earth station operations. 25.220 Section 25.220 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) COMMON CARRIER SERVICES SATELLITE COMMUNICATIONS Technical Standards § 25.220 Non-conforming transmit/receive...

  8. 33 CFR 96.220 - What makes up a safety management system? (United States)


    ... system? 96.220 Section 96.220 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY VESSEL OPERATING REGULATIONS RULES FOR THE SAFE OPERATION OF VESSELS AND SAFETY MANAGEMENT SYSTEMS Company and Vessel Safety Management Systems § 96.220 What makes up a safety management system? (a) The...

  9. 20 CFR 220.131 - Work which exists in the national economy. (United States)


    ... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Work which exists in the national economy. 220.131 Section 220.131 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE RAILROAD RETIREMENT ACT DETERMINING DISABILITY Vocational Considerations § 220.131 Work which exists in the national economy. (a) General. The Board considers...

  10. 5 CFR 591.220 - How does OPM calculate energy utility cost indexes? (United States)


    ... cost indexes? 591.220 Section 591.220 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS ALLOWANCES AND DIFFERENTIALS Cost-of-Living Allowance and Post Differential-Nonforeign Areas Cost-Of-Living Allowances § 591.220 How does OPM calculate energy utility cost indexes? (a) OPM...

  11. 20 CFR 220.184 - If the annuitant becomes disabled by another impairment(s). (United States)


    ... impairment(s). 220.184 Section 220.184 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE... Activity or Medical Improvement § 220.184 If the annuitant becomes disabled by another impairment(s). If a new severe impairment(s) begins in or before the month in which the last impairment(s) ends, the Board...

  12. 40 CFR 415.220 - Applicability; description of the titanium dioxide production subcategory. (United States)


    ... titanium dioxide production subcategory. 415.220 Section 415.220 Protection of Environment ENVIRONMENTAL... SOURCE CATEGORY Titanium Dioxide Production Subcategory § 415.220 Applicability; description of the titanium dioxide production subcategory. This subpart applies to discharges to waters of the United States...

  13. 49 CFR 220.49 - Radio communication used in shoving, backing or pushing movements. (United States)


    ... pushing movements. 220.49 Section 220.49 Transportation Other Regulations Relating to Transportation... Wireless Communication Procedures § 220.49 Radio communication used in shoving, backing or pushing movements. When radio communication is used in connection with the shoving, backing or pushing of a train...

  14. Thoron (220Rn) in the indoor atmospheric environment

    International Nuclear Information System (INIS)

    Ramachandran, T.V.


    Naturally occurring background radiation is a topic, which has evoked curiosity and concern between the scientist and layman alike in recent years due to the shift in focus of health effects due to exposure of radiation from acute high level to chronic low level. Many locations around the world have higher levels of natural background radiation due to elevated levels of primordial radio nuclides in the soil and their decay products like radon ( 222 Rn), and thoron ( 220 Rn) in the environment. Of late, technologically enhanced naturally occurring radioactive material has also contributed to the burden of background radiation. It has been estimated that inhalation of 222 Rn, 2 20 Rn and their short lived progenies contribute more than 54% of the total natural background radiation dose received by the general population. In the Indian context, in an earlier national survey, the external gamma radiation dose rates have been more or less well mapped using thermo luminescent dosimeters covering more than 214 locations, which has yielded a national average of 775 mGy/y. Of this, nearly 48.7% contribution of the dose rate is from 40 K and the rest from the uranium (33.6%) and thorium (17.7%) series. A good database pertaining to the country wide levels of uranium, thorium and potassium in geological materials also exists. Thus, there exists a good database on the total external gamma radiation level across the country. Since the contribution from inhalation of 222 Rn, 220 Rn and their short lived progenies contributes more than 54% of the total background radiation dose, it was necessary to supplement the external component with inhalation component. This component is not adequately estimated for the country so far on national level. With this in mind, a national survey has been executed by this center involving a large number of universities and other allied research institutions from different parts of the country for the estimation of inhalation component of the dose

  15. Supplementary shutdown system of 220 MWe standard PHWR in India

    International Nuclear Information System (INIS)

    Muktibodh, U.C.


    The design objective of the shutdown system is to make the reactor subcritical and hold it in that state for an extended period of time. This objective must be realised under all anticipated operational occurrences and postulated abnormal conditions even during most reactive state of the core. PHWR design criteria for shutdown stipulates requirement of two independent diverse and fast acting shutdown systems, either of which acting alone should meet the above objectives. This requirement would normally call for a large number of reactivity mechanism penetrations into the calandria. From the point of view of space availability at the reactivity mechanism area on top of calandria, for the relatively small core of 220 MWe PHWRs, and ease of maintenance realisation of the total worth by either of the shutdown systems acting alone was difficult. To overcome this engineering constraint and at the same time to satisfy the design criteria, a unique approach to meet the reactivity demands for shutdown was adopted. The reactivity requirements of the shutdown consists of fast and slow reactivity changes. For the shutdown system of 220 MWe PHWRs, the approach of realizing fast reactivity changes with dual redundant, diverse, fast acting shutdown systems aided by a slow acting shutdown system to counter delayed reactivity changes was conceived. The supplementary slow acting shutdown system is called upon to act after actuation of either of the two redundant fast acting systems and is referred to as Liquid Poison Injection System (LPIS). The system adds bulk amount of neutron poison (boric acid), equivalent to 45 mk, directly into the moderator through two nozzles in calandria using pneumatic pressure. This paper describes the design of LPIS as envisaged for the standardised 220 MWe PHWRs. (author)

  16. Two-dimensional 220 MHz Fourier transform EPR imaging

    International Nuclear Information System (INIS)

    Placidi, Giuseppe; Brivati, John A.; Alecci, Marcello; Testa, Luca; Sotgiu, Antonello


    In the last decade radiofrequency continuous-wave EPR spectrometers have been developed to detect and localize free radicals in vivo. Only recently, pulsed radiofrequency EPR spectrometers have been described for imaging applications with small samples. In the present work, we show the first two-dimensional image obtained at 220 MHz on a large phantom (40 ml) that simulates typical conditions of in vivo EPR imaging. This pulsed EPR apparatus has the potential to make the time required for three-dimensional imaging compatible with the biological half-life of normally used paramagnetic probes. (author)

  17. 220 Names/Faces 220 Dolch Words Are Too Many for Students with Memories Like Mine. AVKO "Great Idea" Reprint Series No. 601. (United States)

    McCabe, Don

    This booklet discusses a procedure to assist students experiencing difficulty in learning the "Dolch Basic Sight Vocabulary of 220 Words" and rearranges a list of 220 words to make it easier for students to learn. The procedure discussed in the booklet is based on the "word family" approach, in which words like "all call,…

  18. Reagents for Astatination of Biomolecules. 5. Evaluation of hydrazone linkers in 211At- and 125I-labeled closo-decaborate(2-) conjugates of Fab′ as a means of decreasing kidney retention (United States)

    Wilbur, D. Scott; Chyan, Ming-Kuan; Hamlin, Donald K.; Nguyen, Holly; Vessella, Robert L.


    Evaluation of monoclonal antibody (MAb) fragments (e.g. Fab′, Fab or engineered fragments) as cancer-targeting reagents for therapy with the α-particle emitting radionuclide astatine-211 (211At) has been hampered by low in vivo stability of the label and a propensity of these proteins localize to kidneys. Fortunately, our group has shown that the low stability of the 211At label, generally a meta- or para-[211At]astatobenzoyl conjugate, on MAb Fab′ fragments can be dramatically improved by use of closo-decaborate(2-) conjugates. However, the higher stability of radiolabeled MAb Fab′ conjugates appears to result in retention of the radioactivity in kidneys. This investigation was conducted to evaluate whether the retention of radioactivity in kidney might be decreased by the use of acid-cleavable hydrazone between the Fab′ and the radiolabeled closo-decaborate(2-) moiety. Five conjugation reagents containing sulfhydryl-reactive maleimide groups, a hydrazone functionality and a closo-decaborate(2-) moiety were prepared. In four of the five conjugation reagents, a discrete polyethylene glycol (PEG) linker was used, and one substituent adjacent to the hydrazone was varied (phenyl, benzoate, anisole or methyl) to provide varying acid-sensitivity. In the initial studies, the five maleimido-closo-decaborate(2-) conjugation reagents were radioiodinated (125I or 131I), then conjugated with an anti-PSMA Fab′ (107-1A4 Fab′). Biodistributions of the five radioiodinated Fab′ conjugates were obtained in nude mice at 1, 4 and 24 h post injection (pi). In contrast to closo-decaborate(2-) conjugated to 107-1A4 Fab′ through a non-cleavable linker, two conjugates containing either a benzoate or a methyl substituent on the hydrazone functionality displayed clearance rates from kidney, liver and spleen that were similar to those obtained with directly radioiodinated Fab′ (i.e. no conjugate). The maleimido-closo-decaborate(2-) conjugation reagent containing a benzoate

  19. Synthetic Biology Open Language (SBOL Version 2.2.0

    Directory of Open Access Journals (Sweden)

    Cox Robert Sidney


    Full Text Available Synthetic biology builds upon the techniques and successes of genetics, molecular biology, and metabolic engineering by applying engineering principles to the design of biological systems. The field still faces substantial challenges, including long development times, high rates of failure, and poor reproducibility. One method to ameliorate these problems would be to improve the exchange of information about designed systems between laboratories. The synthetic biology open language (SBOL has been developed as a standard to support the specification and exchange of biological design information in synthetic biology, filling a need not satisfied by other pre-existing standards. This document details version 2.2.0 of SBOL that builds upon version 2.1.0 published in last year’s JIB special issue. In particular, SBOL 2.2.0 includes improved description and validation rules for genetic design provenance, an extension to support combinatorial genetic designs, a new class to add non-SBOL data as attachments, a new class for genetic design implementations, and a description of a methodology to describe the entire design-build-test-learn cycle within the SBOL data model.

  20. Synthetic Biology Open Language (SBOL) Version 2.2.0

    KAUST Repository

    Cox, Robert Sidney; Madsen, Curtis; McLaughlin, James Alastair; Nguyen, Tramy; Roehner, Nicholas; Bartley, Bryan; Beal, Jacob; Bissell, Michael; Choi, Kiri; Clancy, Kevin; Grunberg, Raik; Macklin, Chris; Misirli, Goksel; Oberortner, Ernst; Pocock, Matthew; Samineni, Meher; Zhang, Michael; Zhang, Zhen; Zundel, Zach; Gennari, John H.; Myers, Chris; Sauro, Herbert; Wipat, Anil


    Synthetic biology builds upon the techniques and successes of genetics, molecular biology, and metabolic engineering by applying engineering principles to the design of biological systems. The field still faces substantial challenges, including long development times, high rates of failure, and poor reproducibility. One method to ameliorate these problems would be to improve the exchange of information about designed systems between laboratories. The synthetic biology open language (SBOL) has been developed as a standard to support the specification and exchange of biological design information in synthetic biology, filling a need not satisfied by other pre-existing standards. This document details version 2.2.0 of SBOL that builds upon version 2.1.0 published in last year's JIB special issue. In particular, SBOL 2.2.0 includes improved description and validation rules for genetic design provenance, an extension to support combinatorial genetic designs, a new class to add non-SBOL data as attachments, a new class for genetic design implementations, and a description of a methodology to describe the entire design-build-test-learn cycle within the SBOL data model.

  1. Synthetic Biology Open Language (SBOL) Version 2.2.0. (United States)

    Cox, Robert Sidney; Madsen, Curtis; McLaughlin, James Alastair; Nguyen, Tramy; Roehner, Nicholas; Bartley, Bryan; Beal, Jacob; Bissell, Michael; Choi, Kiri; Clancy, Kevin; Grünberg, Raik; Macklin, Chris; Misirli, Goksel; Oberortner, Ernst; Pocock, Matthew; Samineni, Meher; Zhang, Michael; Zhang, Zhen; Zundel, Zach; Gennari, John H; Myers, Chris; Sauro, Herbert; Wipat, Anil


    Synthetic biology builds upon the techniques and successes of genetics, molecular biology, and metabolic engineering by applying engineering principles to the design of biological systems. The field still faces substantial challenges, including long development times, high rates of failure, and poor reproducibility. One method to ameliorate these problems would be to improve the exchange of information about designed systems between laboratories. The synthetic biology open language (SBOL) has been developed as a standard to support the specification and exchange of biological design information in synthetic biology, filling a need not satisfied by other pre-existing standards. This document details version 2.2.0 of SBOL that builds upon version 2.1.0 published in last year's JIB special issue. In particular, SBOL 2.2.0 includes improved description and validation rules for genetic design provenance, an extension to support combinatorial genetic designs, a new class to add non-SBOL data as attachments, a new class for genetic design implementations, and a description of a methodology to describe the entire design-build-test-learn cycle within the SBOL data model.

  2. Synthetic Biology Open Language (SBOL) Version 2.2.0

    KAUST Repository

    Cox, Robert Sidney


    Synthetic biology builds upon the techniques and successes of genetics, molecular biology, and metabolic engineering by applying engineering principles to the design of biological systems. The field still faces substantial challenges, including long development times, high rates of failure, and poor reproducibility. One method to ameliorate these problems would be to improve the exchange of information about designed systems between laboratories. The synthetic biology open language (SBOL) has been developed as a standard to support the specification and exchange of biological design information in synthetic biology, filling a need not satisfied by other pre-existing standards. This document details version 2.2.0 of SBOL that builds upon version 2.1.0 published in last year\\'s JIB special issue. In particular, SBOL 2.2.0 includes improved description and validation rules for genetic design provenance, an extension to support combinatorial genetic designs, a new class to add non-SBOL data as attachments, a new class for genetic design implementations, and a description of a methodology to describe the entire design-build-test-learn cycle within the SBOL data model.

  3. 25 CFR 166.220 - What are the basic steps for acquiring a permit through negotiation? (United States)


    ... 25 Indians 1 2010-04-01 2010-04-01 false What are the basic steps for acquiring a permit through negotiation? 166.220 Section 166.220 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR LAND AND WATER GRAZING PERMITS Permit Requirements Obtaining A Permit § 166.220 What are the basic steps for acquiring a permit through negotiation? The...


    International Nuclear Information System (INIS)

    Batejat, Fabien; Conway, John E.; Hurley, Rossa; Parra, Rodrigo; Diamond, Philip J.; Lonsdale, Colin J.; Lonsdale, Carol J.


    We present 2 cm and 3.6 cm wavelength very long baseline interferometry images of the compact radio continuum sources in the nearby ultra-luminous infrared galaxy Arp220. Based on their radio spectra and variability properties, we confirm these sources to be a mixture of supernovae (SNe) and supernova remnants (SNRs). Of the 17 detected sources we resolve 7 at both wavelengths. The SNe generally only have upper size limits. In contrast all the SNRs are resolved with diameters ≥0.27 pc. This size limit is consistent with them having just entered their Sedov phase while embedded in an interstellar medium (ISM) of density 10 4 cm -3 . These objects lie on the diameter-luminosity correlation for SNRs (and so also on the diameter-surface brightness relation) and extend these correlations to very small sources. The data are consistent with the relation L∝D -9/4 . Revised equipartition arguments adjusted to a magnetic field to a relativistic particle energy density ratio of 1% combined with a reasonable synchrotron-emitting volume filling factor of 10% give estimated magnetic field strengths in the SNR shells of ∼15-50 mG. The SNR shell magnetic fields are unlikely to come from compression of ambient ISM fields and must instead be internally generated. We set an upper limit of 7 mG for the ISM magnetic field. The estimated energy in relativistic particles, 2%-20% of the explosion kinetic energy, is consistent with estimates from models that fit the IR-radio correlation in compact starburst galaxies.

  5. Operating results of 220 MW SKODA saturated steam turbines

    International Nuclear Information System (INIS)

    Drahy, J.


    One of the steam turbines produced by the SKODA Works, the 220 MW steam turbine for saturated admission steam of a speed of 3000 r.p.m. is described; it is used in nuclear power plants with 400 MW PWR type reactors. 16 units of 8 turbines each have been in operation in the Jaslovske Bohunice and Dukovany power plants with the total period of operation of all machines exceeding 750,000 hours. The 220 MW steam turbine consists of a two-flow high-pressure section and of two identical two-flow low-pressure sections. The pressure of saturated steam at the inlet of the high-pressure section is 4.32 MPa (the corresponding temperature of the saturation limit being 255 degC) and during the expansion in the high-pressure section it drops to 0.6 MPa; steam moisture reaches 12%. In a separator and two-stage reheater using blend steam, the steam is freed of the moisture and is reheated to a temperature of 217 degC. Some operational problems are discussed, as are the loss of the material of the stator parts of the high-pressure section due to corrosion-erosion wear and corrosion-erosion wear of the guide wheels of the high-pressure section, and measures are presented carried out for the reduction of the corrosion-erosion effects of wet steam. One of the serious problems were the fatigue fractures of the blades of the 4th high-pressure stage, which appeared after 20 000 to 24 000 hours of operation in the dented tee-root. The guide wheels of the 4th stage were substituted by new guide wheels with uniform pitch of the channels and with increased number of guide blades. Also discussed are the dynamic behavior of the low-pressure section of the bridge structure, the operating reliability and the heat off-take for water heating of long-distance heating systems. (Z.S.) 9 figs

  6. 76 FR 38742 - Eleventh Meeting: RTCA Special Committee 220: Automatic Flight Guidance and Control (United States)


    ... Committee 220: Automatic Flight Guidance and Control AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Notice of RTCA Special Committee 220 Meeting: Automatic Flight Guidance and Control. SUMMARY: The..., Automatic Flight Guidance and Control. Agenda Tuesday August 9-Thursday, August 11, 2011 Tuesday, August 9...

  7. 76 FR 50809 - Eleventh Meeting: RTCA Special Committee 220: Automatic Flight Guidance and Control (United States)


    ... Committee 220: Automatic Flight Guidance and Control AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Correction of Notice of RTCA Special Committee 220 meeting: Automatic Flight Guidance and Control...: Automatic Flight Guidance and Control DATES: The meeting will be held September 13-15, 2011, from 9 a.m. to...

  8. 45 CFR 400.220 - Counting time-eligibility of refugees. (United States)


    ... 45 Public Welfare 2 2010-10-01 2010-10-01 false Counting time-eligibility of refugees. 400.220 Section 400.220 Public Welfare Regulations Relating to Public Welfare OFFICE OF REFUGEE RESETTLEMENT, ADMINISTRATION FOR CHILDREN AND FAMILIES, DEPARTMENT OF HEALTH AND HUMAN SERVICES REFUGEE RESETTLEMENT PROGRAM...

  9. 22 CFR 1006.220 - Are any procurement contracts included as covered transactions? (United States)


    ... covered transactions? 1006.220 Section 1006.220 Foreign Relations INTER-AMERICAN FOUNDATION GOVERNMENTWIDE... the consent of a(n) Inter-American Foundation official. In that case, the contract, regardless of the... appendix to this part. (3) The contract is for federally-required audit services. ...

  10. 22 CFR 1508.220 - Are any procurement contracts included as covered transactions? (United States)


    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Are any procurement contracts included as covered transactions? 1508.220 Section 1508.220 Foreign Relations AFRICAN DEVELOPMENT FOUNDATION.... (3) The contract is for federally-required audit services. ...

  11. 20 CFR 405.220 - Decision by the Federal reviewing official. (United States)


    ... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Decision by the Federal reviewing official. 405.220 Section 405.220 Employees' Benefits SOCIAL SECURITY ADMINISTRATION ADMINISTRATIVE REVIEW... Medical and Vocational Expert System before making a decision. At all times, the Federal reviewing...

  12. 40 CFR 80.220 - What are the downstream standards for GPA gasoline? (United States)


    ... 40 Protection of Environment 16 2010-07-01 2010-07-01 false What are the downstream standards for GPA gasoline? 80.220 Section 80.220 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... downstream location other than at a retail outlet or wholesale purchaser-consumer facility, and during the...

  13. Heterozygous KIDINS220/ARMS nonsense variants cause spastic paraplegia, intellectual disability, nystagmus, and obesity

    NARCIS (Netherlands)

    Josifova, Dragana J.; Monroe, Glen R.; Tessadori, Federico; de Graaff, Esther; van der Zwaag, Bert; Mehta, Sarju G.; Harakalova, Magdalena; Duran, Karen J.; Savelberg, Sanne M. C.; Nijman, Isaäc J.; Jungbluth, Heinz; Hoogenraad, Casper C.; Bakkers, Jeroen; Knoers, Nine V.; Firth, Helen V.; Beales, Philip L.; van Haaften, Gijs; van Haelst, Mieke M.


    We identified de novo nonsense variants in KIDINS220/ARMS in three unrelated patients with spastic paraplegia, intellectual disability, nystagmus, and obesity (SINO). KIDINS220 is an essential scaffold protein coordinating neurotrophin signal pathways in neurites and is spatially and temporally

  14. 20 CFR 670.220 - Are we responsible for the protection and maintenance of center facilities? (United States)


    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Are we responsible for the protection and maintenance of center facilities? 670.220 Section 670.220 Employees' Benefits EMPLOYMENT AND TRAINING ADMINISTRATION, DEPARTMENT OF LABOR THE JOB CORPS UNDER TITLE I OF THE WORKFORCE INVESTMENT ACT Site Selection...

  15. 20 CFR 220.130 - Work experience as a vocational factor. (United States)


    ... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Work experience as a vocational factor. 220.130 Section 220.130 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE RAILROAD... amount of walking, standing, sitting, lifting and carrying the claimant did during the work day, as well...

  16. 20 CFR 220.11 - Definitions as used in this subpart. (United States)


    ... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Definitions as used in this subpart. 220.11 Section 220.11 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE RAILROAD RETIREMENT ACT..., mobility, endurance and capacity to perform physically demanding tasks, such as standing, walking, lifting...

  17. 20 CFR 220.102 - Non-severe impairment(s), defined. (United States)


    ... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Non-severe impairment(s), defined. 220.102 Section 220.102 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE RAILROAD RETIREMENT... these include— (1) Physical functions such as walking, standing, sitting, lifting, pushing, pulling...

  18. Kidins220/ARMS as a functional mediator of multiple receptor signalling pathways. (United States)

    Neubrand, Veronika E; Cesca, Fabrizia; Benfenati, Fabio; Schiavo, Giampietro


    An increasing body of evidence suggests that several membrane receptors--in addition to activating distinct signalling cascades--also engage in substantial crosstalk with each other, thereby adjusting their signalling outcome as a function of specific input information. However, little is known about the molecular mechanisms that control their coordination and integration of downstream signalling. A protein that is likely to have a role in this process is kinase-D-interacting substrate of 220 kDa [Kidins220, also known as ankyrin repeat-rich membrane spanning (ARMS), hereafter referred to as Kidins220/ARMS]. Kidins220/ARMS is a conserved membrane protein that is preferentially expressed in the nervous system and interacts with the microtubule and actin cytoskeleton. It interacts with neurotrophin, ephrin, vascular endothelial growth factor (VEGF) and glutamate receptors, and is a common downstream target of several trophic stimuli. Kidins220/ARMS is required for neuronal differentiation and survival, and its expression levels modulate synaptic plasticity. Kidins220/ARMS knockout mice show developmental defects mainly in the nervous and cardiovascular systems, suggesting a crucial role for this protein in modulating the cross talk between different signalling pathways. In this Commentary, we summarise existing knowledge regarding the physiological functions of Kidins220/ARMS, and highlight some interesting directions for future studies on the role of this protein in health and disease.

  19. 18 CFR 2.20 - Good faith requests for transmission services and good faith responses by transmitting utilities. (United States)


    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Good faith requests for transmission services and good faith responses by transmitting utilities. 2.20 Section 2.20 Conservation of... Power Act § 2.20 Good faith requests for transmission services and good faith responses by transmitting...

  20. 20 CFR 220.37 - When a child's disability determination is governed by the regulations of the Social Security... (United States)


    ...) Inclusion as a disabled child in the employee's annuity rate under the social security overall minimum. (2... governed by the regulations of the Social Security Administration. 220.37 Section 220.37 Employees... Disability Determinations Governed by the Regulations of the Social Security Administration § 220.37 When a...

  1. 27 CFR 28.220a - Responsibility for return of wine withdrawn for export with benefit of drawback. (United States)


    ... of wine withdrawn for export with benefit of drawback. 28.220a Section 28.220a Alcohol, Tobacco... EXPORTATION OF ALCOHOL Exportation of Wine With Benefit of Drawback § 28.220a Responsibility for return of wine withdrawn for export with benefit of drawback. The exporter shall be responsible for arranging the...

  2. Measurement of airborne concentrations of radon-220 daughter products by alpha-particle spectrometry

    International Nuclear Information System (INIS)

    Kerr, G.D.; Ryan, M.T.; Perdue, P.T.


    The decay of naturally occurring uranium-238 and thorium-232 produces radon-222 and radon-220 isotopes which can escape into the atmosphere. If these radon gases become concentrated in air, their daughter products may present an inhalation hazard to man. The airborne concentrations of radon-222 can usually be measured very accurately in the presence of normal airborne concentrations of radon-220 and its daughters. In contrast, the measurements of the airborne concentrations of radon-220 daughters are usually complicated by the presence of radon-222 and its daughters even at normally occurring airborne concentrations. The complications involved in these measurements can be overcome in most situations by using an alpha particle spectrometer to distinguish the activity of radon-222 daughters from that due to radon-220 daughters collected on a filter. A practical spectrometer for field measurements of alpha particle activity on a filter is discussed

  3. Energy and exergy evaluation of a 220MW thermal power plant ...

    African Journals Online (AJOL)

    Energy and exergy evaluation of a 220MW thermal power plant. ... Nigerian Journal of Technology ... At the variation of environmental or dead state temperature, ther e were no appreciable changes in the values of exergy efficiency of the ...

  4. [The maximum heart rate in the exercise test: the 220-age formula or Sheffield's table?]. (United States)

    Mesquita, A; Trabulo, M; Mendes, M; Viana, J F; Seabra-Gomes, R


    To determine in the maximum cardiac rate in exercise test of apparently healthy individuals may be more properly estimated through 220-age formula (Astrand) or the Sheffield table. Retrospective analysis of clinical history and exercises test of apparently healthy individuals submitted to cardiac check-up. Sequential sampling of 170 healthy individuals submitted to cardiac check-up between April 1988 and September 1992. Comparison of maximum cardiac rate of individuals studied by the protocols of Bruce and modified Bruce, in interrupted exercise test by fatigue, and with the estimated values by the formulae: 220-age versus Sheffield table. The maximum cardiac heart rate is similar with both protocols. This parameter in normal individuals is better predicted by the 220-age formula. The theoretic maximum cardiac heart rate determined by 220-age formula should be recommended for a healthy, and for this reason the Sheffield table has been excluded from our clinical practice.

  5. Determining chance coincidence, survival factor and decay factor in 220Rn delayed coincidence measurement

    International Nuclear Information System (INIS)

    Huang Derong; Yan Yongjun; Zhou Jianliang; Qiu Shoukang


    The method and calculation formulas to determine the chance coincidence in the 220 Rn coincidence measurement are introduced in this paper. The poisson distribution is introduced to correct the chance coincidence. The relative deviation of the true coincidence between the method and the Giffin's is within 5% after the correction of the cohance coincidence. The measurement of 220 Rn is done by comparative measurement with RAD7. The results shows that 220 Rn can be measured by the method with a relative deviation of 14%. Mean while, for the 220 Rn flow regime is difficult to meet the condition of calculation formulas, a solution to solve the survival factor and decay factor is proposed and the error come from the useage of theoretical calculation formula is avoided. (authors)

  6. Primary measuring of equipment factor of 222Rn/220Rn indoor

    International Nuclear Information System (INIS)

    Liu Yanyang; Liu Fudong; Wang Chunhong; Sheng Mingwei


    The activity concentration of 222 Rn, 220 Rn and their progenies of certain working places and dwellings in Baotou city were measured simultaneously. Based on these results, the equipment factor of 222 Rn is 0.35 for working places and 0.43 for dwellings, while equipment factor of 220 Rn measured at 20 cm distance from wall is 0.030 for both working places and dwellings. Preliminary results show that the temporal change of 220 Rn equilibrium equivalent concentration is same as 222 Rn which is high in midnight and low in afternoon,and significant difference between instant and accumulated measure result of 222 Rn, 220 Rn activity concentration is found, with the factor of 2.1 and 1.7. (authors)

  7. Development of an aerosol chamber for calibration of 220Rn progeny detectors (United States)

    Sorimachi, Atsuyuki; Ishikawa, Tetsuo; Tokonami, Shinji


    This paper describes an aerosol chamber system that can be used for calibrations and performance experiments of passive 220Rn progeny detectors. For the purpose of this study, an aerosol generation system using carnauba wax as the aerosol material was mounted into the 220Rn chamber. We used the chamber to measure characteristics of the equilibrium factor (F) of 220Rn and unattached fraction (fp) of 220Rn progeny, which are important parameters for dose estimation. The first experiment showed that continuous and stable generation of the unattached and aerosol-attached 220Rn progeny concentrations was obtained. We observed that the spatial distributions in the chamber of the vertical profiles of the unattached and aerosol-attached 220Rn progeny concentrations were homogeneous, as were the particle number concentration and count median diameter. The values of F and fp and their characteristics observed in this study were in the same range as the values reported from indoor measurements. We found that the characteristics of F and fp were dependent on the aerosol conditions (particle diameter and particle number concentration).

  8. Dynamic interaction of p220NPAT and CBP/p300 promotes S-phase entry

    International Nuclear Information System (INIS)

    Wang, Aiyan; Ikura, Tsuyoshi; Eto, Kazuhiro; Ota, Masato S.


    Cajal bodies contain cyclin E/cdk2 and the substrate p220 NPAT to regulate the transcription of histones, which is essential for cell proliferation, however, recent mouse knockout studies indicate that cyclin E and cdk2 are dispensable for these events. Because the CBP/p300 histone acetyltransferase are also known to be involved in cell proliferation, we examined the molecular and functional interactions of p220 NPAT with the CBP/p300 at the G1/S boundary as cell cycle regulators. The subnuclear localization of p220 NPAT and CBP/p300 proteins showed that their foci partially overlapped in a cell cycle dependent manner. Overexpression of p220 NPAT and CBP/p300 cooperatively enhanced G1/S transition and DNA synthesis even without cdk2 phosphorylation site. Finally, molecular alignment analysis indicated that p220 NPAT contains several potential substrate sites for CBP/p300. Overall, our findings demonstrate that p220 NPAT and CBP/p300 form a transient complex at the G1/S boundary to play cooperative roles to promote the S-phase entry

  9. Astatine-211 labeling. A study towards automatic production of astatinated antibodies

    International Nuclear Information System (INIS)

    Emma Aneheim; Per Albertsson; Sture Lindegren; Holger Jensen


    Targeted alpha therapy is especially interesting for therapy of microscopic cancer tumors due to short path length and high linear energy transfer of the alpha particles. One of the most promising nuclides for targeted alpha therapy is 211 At. To facilitate larger clinical studies using 211 At, the current manual synthesis of radiolabeled antibodies would benefit from being transferred into an automated method. In this work, successful modifications of the manual synthesis have been performed in order to adapt it to automation. The automatic synthesis has also been tested using the modified synthesis method. (author)

  10. Study on a charcoal-based monitor for Rn-220 in air

    International Nuclear Information System (INIS)

    Yu Yiqiao; Solomon, S.B.


    Activated charcoal has been used in both passive monitors (Cohen, Pondy et al. 1987) and active monitors (Solomon and Gan, 1989) for the measurements of 222 Rn in air. Cooled, charcoal-impregnated filters, viewed in-situ by a solid state alpha detector, have been used for 220 Rn-in-breath studies. In general, γ ray counting of 220 Rn samples collected on activated charcoal has not been used. This paper describes the development and calibration of a charcoal based monitor designed to measure 220 Rn levels down to a lower limit of 10 Bq m -3 over sampling periods of 4 to 15 h. The activity of 212 Pb (10.6 h) produced from 220 Rn (55.6 s) collected in an activated charcoal-based sampler is 1/700 the total 220 Rn activity. A typical Hp-Ge detector has a MDL for a two-hours count of approximately 0.1 Bq of 212 Pb for the 239 keV γ-ray. For a MDL of 10 Bq·m -3 of 220 Rn in air, a volume of at least 7 m 3 must be sampled, assuming no breakthrough. The present charcoal-based 220 Rn monitor is designed to maximize the path length through the activated charcoal while sufficient cross-sectional area is retained to allow flow rates up to 0.03 m 3 ·kg -1 is packed into a specially designed aluminum container. The container is modeled on a Marinelli beaker to maximize the counting efficiency, while the sample flow through the chambers of the monitor is optimized to maintain radial symmetry. experiments demonstrated that 94% of 220 Rn was adsorbed by the charcoal in the monitor under a flow rate of 0.03 m 3 ·min -1 at 25 degree C and 85%. RH in 15 h. The monitor is designed to fit over a 70 mm diameter Hp-Ge detector. Preliminary measurements of 220 Rn in two buildings and a cave, using the active monitors and 'grabing' samples under a flow rate of 0.03 m 3 ·min -1 and a period of 4 h, indicated concentrations of between 18.6 and 142.0 Bq·m 3

  11. Sub-arcsecond imaging of the water emission in Arp 220⋆ ⋆⋆ (United States)

    König, S.; Martín, S.; Muller, S.; Cernicharo, J.; Sakamoto, K.; Zschaechner, L. K.; Humphreys, E. M. L.; Mroczkowski, T.; Krips, M.; Galametz, M.; Aalto, S.; Vlemmings, W. H. T.; Ott, J.; Meier, D. S.; Fuente, A.; García-Burillo, S.; Neri, R.


    Aims Extragalactic observations of water emission can provide valuable insights into the excitation of the interstellar medium. In particular they allow us to investigate the excitation mechanisms in obscured nuclei, i.e. whether an active galactic nucleus or a starburst dominate. Methods We use sub-arcsecond resolution observations to tackle the nature of the water emission in Arp 220. ALMA Band 5 science verification observations of the 183 GHz H2O 313−220 line, in conjunction with new ALMA Band 7 H2O 515−422 data at 325 GHz, and supplementary 22 GHz H2O 616 − 523 VLA observations, are used to better constrain the parameter space in the excitation modelling of the water lines. Results We detect 183 GHz H2O and 325 GHz water emission towards the two compact nuclei at the center of Arp 220, being brighter in Arp 220 West. The emission at these two frequencies is compared to previous single-dish data and does not show evidence of variability. The 183 and 325 GHz lines show similar spectra and kinematics, but the 22 GHz profile is significantly different in both nuclei due to a blend with an NH3 absorption line. Conclusions Our findings suggest that the most likely scenario to cause the observed water emission in Arp 220 is a large number of independent masers originating from numerous star-forming regions. PMID:29151605

  12. Decreased expression of thyroid receptor-associated protein 220 in temporal lobe tissue of patients with refractory epilepsy

    International Nuclear Information System (INIS)

    Li Jinmei; Wang Xuefeng; Xi Zhiqin; Gong Yun; Liu Fengying; Sun Jijun; Wu Yuan; Luan Guoming; Wang Yuping; Li Yunlin; Zhang Jianguo; Lu Yong; Li Hongwei


    Purpose: TRAP220 (thyroid hormone receptor-associated protein) functions as a coactivator for nuclear receptors and stimulates transcription by recruiting the TRAP mediator complex to hormone responsive promoter regions. Thus, TRAP220 enhances the function of thyroid/steroid hormone receptors such as thyroid hormone and oestrogen receptors. This study investigated the expression of TRAP220 mRNA and protein level in epileptic brains comparing with human control. Methods: We examined the expression of TRAP220 mRNA and protein levels in temporal lobes from patients with chronic pharmacoresistant epilepsy who have undergone surgery. Results: Expression of TRAP220 mRNA and protein was shown to be decreased significantly in the temporal cortex of the patients with epilepsy. Conclusions: Our work showed that a decrease in TRAP220 mRNA and protein levels may be involved in the pathophysiology of epilepsy and may be associated with impairment of the brain caused by frequent seizures

  13. 49 CFR 173.220 - Internal combustion engines, self-propelled vehicles, mechanical equipment containing internal... (United States)


    ... and vehicles with certain electronic equipment when transported by aircraft or vessel. When an... vehicles, mechanical equipment containing internal combustion engines, and battery powered vehicles or... Than Class 1 and Class 7 § 173.220 Internal combustion engines, self-propelled vehicles, mechanical...


    African Journals Online (AJOL)

    This article explores the reception of Galatians 2:20 in the Patristic period, and ... theological framework in which later generations placed the communities wherein ... quality of reality – and in Christ that is as perfect as eternal life can ever be.

  15. 40 CFR 1051.220 - How do I amend the maintenance instructions in my application? (United States)


    ... paragraph (b) would cover adding instructions to increase the frequency of a maintenance step for engines in... AGENCY (CONTINUED) AIR POLLUTION CONTROLS CONTROL OF EMISSIONS FROM RECREATIONAL ENGINES AND VEHICLES Certifying Engine Families § 1051.220 How do I amend the maintenance instructions in my application? You may...

  16. 40 CFR 1048.220 - How do I amend the maintenance instructions in my application? (United States)


    ... step for engines in severe-duty applications. (c) You need not request approval if you are making only... ENGINES Certifying Engine Families § 1048.220 How do I amend the maintenance instructions in my... certification for an engine family if you want to change the emission-related maintenance instructions in a way...

  17. 46 CFR 199.220 - Survival craft and rescue boat embarkation arrangements. (United States)


    ... 46 Shipping 7 2010-10-01 2010-10-01 false Survival craft and rescue boat embarkation arrangements... APPLIANCES AND ARRANGEMENTS LIFESAVING SYSTEMS FOR CERTAIN INSPECTED VESSELS Additional Requirements for Passenger Vessels § 199.220 Survival craft and rescue boat embarkation arrangements. (a) Survival craft...


    International Nuclear Information System (INIS)

    Taniguchi, Y.; Matsubayashi, K.; Kajisawa, M.; Shioya, Y.; Ideue, Y.; Ohyama, Y.; Nagao, T.; Murayama, T.; Koda, J.


    We present our new deep optical imaging and long-slit spectroscopy for Arp 220, the archetypical ultra luminous infrared galaxy in the local universe. Our sensitive Hα imaging has newly revealed large-scale Hα absorption, i.e., post-starburst regions in this merger. One is found in the eastern superbubble and the other is in the two tidal tails that are clearly revealed in our deep optical imaging. The size of the Hα absorption region in the eastern bubble is 5 kpc × 7.5 kpc, and the observed Hα equivalent widths are ∼2 Å ± 0.2 Å. The sizes of the northern and southern Hα-absorption tidal tails are ∼5 kpc × 10 kpc and ∼6 kpc × 20 kpc, respectively. The observed Hα equivalent widths range from 4 Å to 7 Å. In order to explain the presence of the two post-starburst tails, we suggest a possible multiple-merger scenario for Arp 220 in which two post-starburst disk-like structures merged into one, causing the two tails. This favors Arp 220 as a multiple merging system composed of four or more galaxies arising from a compact group of galaxies. Taking our new results into account, we discuss a star formation history in the last 1 Gyr in Arp 220.

  19. Conformational studies on pertrimethylsilyl derivatives of some mono- and disaccharides by 220 MHz PMR spectroscopy

    NARCIS (Netherlands)

    Vliegenthart, J.F.G.; Streefkerk, D.G.; Bie, M.J.A. de


    The complete interpretation of 220 MHz PMR spectra and the accurate chemical shifts and coupling constants, obtained after computer simulation of the spectra, of a number of TMS-mono and -disaccharides are given. By means of an adapted Karplus equation the conformation of the derivatives has been

  20. 46 CFR 130.220 - Design of equipment for cooking and heating. (United States)


    ... 46 Shipping 4 2010-10-01 2010-10-01 false Design of equipment for cooking and heating. 130.220... Design of equipment for cooking and heating. (a) Doors on each cooking appliance must be provided with heavy-duty hinges and locking-devices to prevent accidental opening in heavy weather. (b) Each cooking...

  1. Measurement of 222Rn and 220Rn exhalation rate from soil samples of Kumaun Hills, India (United States)

    Semwal, Poonam; Singh, Kuldeep; Agarwal, T. K.; Joshi, Manish; Pant, Preeti; Kandari, Tushar; Ramola, R. C.


    The source terms, i.e., exhalation and emanation from soil and building materials are the primary contributors to the radon (222Rn)/thoron (220Rn) concentration levels in the dwellings, while the ecological constraints like ventilation rate, temperature, pressure, humidity, etc., are the influencing factors. The present study is focused on Almora District of Kumaun, located in Himalayan belt of Uttarakhand, India. For the measurement of 222Rn and 220Rn exhalation rates, 24 soil samples were collected from different locations. Gamma radiation level was measured at each of these locations. Chamber technique associated with Smart Rn Duo portable monitor was employed for the estimation of 222Rn and 220Rn exhalation rates. Radionuclides (226Ra, 232Th and 40K) concentrations were also measured in soil samples using NaI(Tl) scintillation based gamma ray spectrometry. The mass exhalation rate for 222Rn was varying between 16 and 54 mBq/kg/h, while the 220Rn surface exhalation rate was in the range of 0.65-6.43 Bq/m2/s. Measured gamma dose rate for the same region varied from 0.10 to 0.31 µSv/h. Inter-correlation of exhalation rates and intra-correlation with background gamma levels were studied.

  2. 36 CFR 220.5 - Environmental impact statement and record of decision. (United States)


    ... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Environmental impact..., DEPARTMENT OF AGRICULTURE NATIONAL ENVIRONMENTAL POLICY ACT (NEPA) COMPLIANCE § 220.5 Environmental impact statement and record of decision. (a) Classes of actions normally requiring environmental impact statements...

  3. 30 CFR 220.015 - Pricing of materiel purchases, transfers, and dispositions. (United States)


    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Pricing of materiel purchases, transfers, and... CONTINENTAL SHELF OIL AND GAS LEASES § 220.015 Pricing of materiel purchases, transfers, and dispositions. (a... shall be priced under the provisions for tubular goods pricing in paragraph (a)(2)(i)(A) of this section...

  4. 30 CFR 220.014 - Allocation of joint costs and credits. (United States)


    ... allocation principles apply in allocating joint costs: (1) G & G. G & G shall be allocated on a line mile per... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Allocation of joint costs and credits. 220.014... MANAGEMENT ACCOUNTING PROCEDURES FOR DETERMINING NET PROFIT SHARE PAYMENT FOR OUTER CONTINENTAL SHELF OIL AND...

  5. 30 CFR 220.020 - Calculation of the allowance for capital recovery. (United States)


    ... recovery factor. The negative product of this calculation shall be debited to the NPSL capital account as... the capital recovery factor, and shall be debited to the NPSL capital account as specified in § 220... credits related to any time period after the end of the capital recovery period. ...

  6. 20 CFR 220.134 - Medical-vocational guidelines in appendix 2 of this part. (United States)


    ... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Medical-vocational guidelines in appendix 2... THE RAILROAD RETIREMENT ACT DETERMINING DISABILITY Vocational Considerations § 220.134 Medical-vocational guidelines in appendix 2 of this part. (a) The Dictionary of Occupational Titles includes...

  7. 20 CFR 220.57 - Types of purchased examinations and selection of sources. (United States)


    ... RAILROAD RETIREMENT ACT DETERMINING DISABILITY Consultative Examinations § 220.57 Types of purchased examinations and selection of sources. (a) Additional evidence needed for disability determination. The types... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Types of purchased examinations and selection...

  8. 20 CFR 220.27 - What is needed to show an impairment. (United States)


    ... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false What is needed to show an impairment. 220.27... is needed to show an impairment. A physical or mental impairment must result from anatomical... diagnostic techniques. A physical or mental impairment must be established by medical evidence consisting of...

  9. Calibration of gamma cell 220 excel irradiator using Fricke and alanine dosimeters

    International Nuclear Information System (INIS)

    Rushdi, M. A. H.


    Using of gamma cell 220 excel irradiators is widely spread in many countries. This type of irradiators is being used for research purposes. Gamma cell 220 excel was provided by the International Atomic Energy Agency (IAEA) to the radiation processing laboratory of Sudan Atomic Energy Commission (SAEC). It is a self-contained gamma irradiator and self shielded, this makes it operates safely. Dose calibration for this cell is important for samples irradiation. In this work, a dosimetry system for the GC220E of SAEC was established using Fricke dosimeter. Fricke dosimeter has a confidence 95% in the rang not exceed 400 Gy. To establish routine dosimetry at high doses up to 5000 Gy, alanine dosimeter was used. This range can demonstrate the ability of GC220E to deliver known controllable doses in reproducible manner for high doses. The irradiation specifications often include a lower and upper limit of absorbed dose or central target dose. Absorbed dose mapping was carried out by both dosimeters to determine the magnitude and locations of D.max and D.min in the irradiation chamber. The results are in good agreement with dose distribution given in the machine manual. A comparison between the tow dosimeters was done and explained.(Author)

  10. 12 CFR 220.101 - Transactions of customers who are brokers or dealers. (United States)


    ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Transactions of customers who are brokers or... OF THE FEDERAL RESERVE SYSTEM CREDIT BY BROKERS AND DEALERS (REGULATION T) Interpretations § 220.101 Transactions of customers who are brokers or dealers. The Board has recently considered certain questions...

  11. 3C 220.3: A Radio Galaxy Lensing a Submillimeter Galaxy

    NARCIS (Netherlands)

    Haas, Martin; Leipski, Christian; Barthel, Peter; Wilkes, Belinda J.; Vegetti, Simona; Bussmann, R. Shane; Willner, S. P.; Westhues, Christian; Ashby, Matthew L. N.; Chini, Rolf; Clements, David L.; Fassnacht, Christopher D.; Horesh, Assaf; Klaas, Ulrich; Koopmans, Léon V. E.; Kuraszkiewicz, Joanna; Lagattuta, David J.; Meisenheimer, Klaus; Stern, Daniel; Wylezalek, Dominika


    Herschel Space Observatory photometry and extensive multiwavelength follow-up have revealed that the powerful radio galaxy (PRG) 3C 220.3 at z = 0.685 acts as a gravitational lens for a background submillimeter galaxy (SMG) at z = 2.221. At an observed wavelength of 1 mm, the SMG is lensed into

  12. 40 CFR 280.220 - Ownership of an underground storage tank or underground storage tank system or facility or... (United States)


    ... tank or underground storage tank system or facility or property on which an underground storage tank or underground storage tank system is located. 280.220 Section 280.220 Protection of Environment ENVIRONMENTAL... underground storage tank or underground storage tank system or facility or property on which an underground...

  13. 20 CFR 220.178 - Determining medical improvement and its relationship to the annuitant's ability to do work. (United States)


    ... relationship to the annuitant's ability to do work. 220.178 Section 220.178 Employees' Benefits RAILROAD... improvement and its relationship to the annuitant's ability to do work. (a) General. Paragraphs (a), (b), and... ability to work and medical improvement that is related to the ability to work. How the Board will arrive...

  14. 77 FR 68768 - Electricity Market Transparency Provisions of Section 220 of the Federal Power Act; Notice of... (United States)


    ... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. RM10-12-000] Electricity Market Transparency Provisions of Section 220 of the Federal Power Act; Notice of Technical Conference...., Washington, DC 20426. \\1\\ Electricity Market Transparency Provisions of Section 220 of the Federal Power Act...

  15. 20 CFR 627.220 - Coordination with programs under title IV of the Higher Education Act including the Pell grant... (United States)


    ... the Higher Education Act including the Pell grant program. 627.220 Section 627.220 Employees' Benefits... of the Higher Education Act including the Pell grant program. (a) Coordination. Financial assistance programs under title IV of the Higher Education Act of 1965, as amended (HEA) (the Pell Grant program, the...

  16. 42 CFR 413.220 - Methodology for calculating the per-treatment base rate under the ESRD prospective payment system... (United States)


    ... rate under the ESRD prospective payment system effective January 1, 2011. 413.220 Section 413.220...-treatment base rate under the ESRD prospective payment system effective January 1, 2011. (a) Data sources. The methodology for determining the per treatment base rate under the ESRD prospective payment system...

  17. 32 CFR 220.11 - Special rules for automobile liability insurance and no-fault automobile insurance. (United States)


    ... and no-fault automobile insurance. 220.11 Section 220.11 National Defense Department of Defense... insurance and no-fault automobile insurance. (a) Active duty members covered. In addition to Uniformed.... 1095 and this part. (c) Exclusion of automobile liability insurance and no-fault automobile insurance...

  18. Molecular characterization of the virulent infectious hematopoietic necrosis virus (IHNV strain 220-90

    Directory of Open Access Journals (Sweden)

    LaPatra Scott E


    Full Text Available Abstract Background Infectious hematopoietic necrosis virus (IHNV is the type species of the genus Novirhabdovirus, within the family Rhabdoviridae, infecting several species of wild and hatchery reared salmonids. Similar to other rhabdoviruses, IHNV has a linear single-stranded, negative-sense RNA genome of approximately 11,000 nucleotides. The IHNV genome encodes six genes; the nucleocapsid, phosphoprotein, matrix protein, glycoprotein, non-virion protein and polymerase protein genes, respectively. This study describes molecular characterization of the virulent IHNV strain 220-90, belonging to the M genogroup, and its phylogenetic relationships with available sequences of IHNV isolates worldwide. Results The complete genomic sequence of IHNV strain 220-90 was determined from the DNA of six overlapping clones obtained by RT-PCR amplification of genomic RNA. The complete genome sequence of 220-90 comprises 11,133 nucleotides (GenBank GQ413939 with the gene order of 3'-N-P-M-G-NV-L-5'. These genes are separated by conserved gene junctions, with di-nucleotide gene spacers. An additional uracil nucleotide was found at the end of the 5'-trailer region, which was not reported before in other IHNV strains. The first 15 of the 16 nucleotides at the 3'- and 5'-termini of the genome are complementary, and the first 4 nucleotides at 3'-ends of the IHNV are identical to other novirhadoviruses. Sequence homology and phylogenetic analysis of the glycoprotein genes show that 220-90 strain is 97% identical to most of the IHNV strains. Comparison of the virulent 220-90 genomic sequences with less virulent WRAC isolate shows more than 300 nucleotides changes in the genome, which doesn't allow one to speculate putative residues involved in the virulence of IHNV. Conclusion We have molecularly characterized one of the well studied IHNV isolates, 220-90 of genogroup M, which is virulent for rainbow trout, and compared phylogenetic relationship with North American

  19. 213 220

    Indian Academy of Sciences (India)


    Steenbeck, M., Krause, F. 1966, Z. Naturforsch, 21a, 1285. Taylor, J. B. 1974, Phys. Rev. Lett, 33(19), 1139. Taylor, J. B. 1986, Rev. Mod. Phys., 58(3), 741. Wang, J. 1999, Fundamentals of Cosmic Physics, 20, 251. Yamada, M. 1999, in Magnetic Helicity in Space and Laboratory Plasmas, (ed.) M. R. Brown,. R. C. Canfield ...

  20. GUM approach to uncertainty estimations for online 220Rn concentration measurements using Lucas scintillation cell

    International Nuclear Information System (INIS)

    Sathyabama, N.


    It is now widely recognized that, when all of the known or suspected components of errors have been evaluated and corrected, there still remains an uncertainty, that is, a doubt about how well the result of the measurement represents the value of the quantity being measured. Evaluation of measurement data - Guide to the expression of Uncertainty in Measurement (GUM) is a guidance document, the purpose of which is to promote full information on how uncertainty statements are arrived at and to provide a basis for the international comparison of measurement results. In this paper, uncertainty estimations following GUM guidelines have been made for the measured values of online thoron concentrations using Lucas scintillation cell to prove that the correction for disequilibrium between 220 Rn and 216 Po is significant in online 220 Rn measurements

  1. Internal services simulation control in 220/110kV power transformer station Mintia (United States)

    Ciulica, D.; Rob, R.


    The main objectives in developing the electric transport and distribution networks infrastructure are satisfying the electric energy demand, ensuring the continuity of supply to customers, minimizing electricity losses in the transmission and distribution networks of public interest. This paper presents simulations in functioning of the internal services system 400/230 V ac in the 220/110 kV power transformer station Mintia. Using simulations in Visual Basic, the following premises are taken into consideration. All the ac consumers of the 220/110 kV power transformer station Mintia will be supplied by three 400/230 V transformers for internal services which can mutual reserve. In case of damaging at one transformer, the others are able to assume the entire consumption using automatic release of reserves. The simulation program studies three variants in which the continuity of supply to customers are ensured. As well, by simulations, all the functioning situations are analyzed in detail.

  2. Relationship of 220Rn and 222Rn progeny levels in Canadian underground U mines

    International Nuclear Information System (INIS)

    Bigu, J.


    Radon-222 and 220 Rn progeny are found in some Canadian underground U mines. Because both can contribute to lung dose, their experimental determinations are important. The relationship between 222 Rn progeny Working Level [WL(Rn)] and 220 Rn progeny Working Level [WL(Tn)] has been investigated in U mines. Experimental measurements extended from 1981 to 1986 and consisted of about 700 measurements of each WL(Rn) and WL(Tn). The data were analyzed by standard linear and power-function regression analysis. A power-function relationship between WL(Rn) and WL(Tn) seemed to fit the experimental data best. The relationship obtained permits the calculation of WL(Tn) from experimental values of WL(Rn). The relationship is useful for lung-dose-calculation purposes and in mine-ventilation-engineering calculations

  3. Manufacturing of 380/220 V 63 A power supply panel on UO2 kernel coating unit

    International Nuclear Information System (INIS)

    Triyono; Mudjiman, Supardjono; Hidayat, Nur


    The panel 380/220 Volts voltage source current 63 Amperes relay AC output on UO 2 kernel coating unit has been manufactured. The activities include: installation and function panel test. The electrical installation of load includes : 220 Volts temperature monitor/controller, 220 Volts scraber pump, 220 Volts vacuum pump, 220 Volts solenoid valve gas and 380 Volts induction furnace. The component of installation includes: 380 Volts earth leakage circuit breaker, 380 Volts relay AC, 220 Volts magnetic circuit breaker, 100/5 Amperes current transformator ratio, voltmeter, ampermeter and push button normally open-close and temperature monitor/control in the box size 70x50x20 cm. The testing of voltage source has been unload and full load to determine the performance of the tool. The result of manufacture and function test voltage source 380/220 Volts at the UO 2 kernel coating unit showed that: the voltage source can work without load and full load safely. The load includes: voltage 380-382 Volts current 4-4,1 Amperes of induction furnace, voltage 223 Volts current 0,5 Amperes of vacuum pump, voltage 223 Volts current 4 Amperes of scraber pump, voltage 223 Volts current 0,3 Amperes of solenoid valve gas and 222 Volts current 0,03 Amperes temperature monitor/control. (author)

  4. A 220 MVA turbo-generator for the TCV tokamak power supplies

    International Nuclear Information System (INIS)

    Perez, A.; Canay, I.M.; Simond, J.-J.; Morf, J.-J; Pahud, J.-D; Seysen, R.


    A new 220 MVA, 120 Hz, 4 pole turbo-generator will be used as a pulsed power source to supply the toroidal and poloidal power supplies of the TCV tokamak, which is being built at the Ecole Polytechnique Federale de Lausanne in Switzerland. The paper describes the particular requirements of the TCV poloidal power supplies and the main electrical and mechanical features of the turbo-generator and its principal auxillaries. (author). 6 figs.; 1 tab

  5. 33 CFR 334.220 - Chesapeake Bay, south of Tangier Island, Va.; naval firing range. (United States)


    ... ENGINEERS, DEPARTMENT OF THE ARMY, DEPARTMENT OF DEFENSE DANGER ZONE AND RESTRICTED AREA REGULATIONS § 334.220 Chesapeake Bay, south of Tangier Island, Va.; naval firing range. (a) The danger zone. Beginning... to latitude 37°45′00″, longitude 76°09′48″; thence to latitude 37°45′00″, longitude 76°08′51″; and...

  6. B220 analysis with the local lymph node assay: proposal for a more flexible prediction model. (United States)

    Betts, Catherine J; Dearman, Rebecca J; Kimber, Ian; Ryan, Cindy A; Gerberick, G Frank; Lalko, Jon; Api, Anne Marie


    The mouse local lymph node assay (LLNA) has been developed and validated for the identification of chemicals that have the potential to induce skin sensitisation. In common with other predictive test methods the accuracy of the LLNA is not absolute and experience has revealed that a few chemicals, including for instance a minority of skin irritants, may elicit false-positive reactions in the assay. To improve further the performance of the LLNA, and to eliminate or reduce false-positives, there has been interest in an adjunct method in which the ability of chemicals to cause increases in the frequency of B220(+) lymphocytes in skin-draining lymph nodes is measured. Previous studies suggest that the use of B220 analyses aligned with the standard LLNA may serve to distinguish further between contact allergens and skin irritants. In the original predictive model, chemicals were regarded as being skin sensitisers if they were able to induce a 1.25-fold or greater increase in the percentage of B220(+) cells within lymph nodes compared with concurrent vehicle controls. Although this first prediction model has proven useful, in the light of more recent experience, and specifically as a consequence of some variability observed in the frequency of B220(+) lymphocytes in nodes taken from vehicle control-treated animals, it is timely now to reconsider and refine the model. As a result a new prediction model is proposed in which reliance on the use of absolute thresholds is reduced, and in which small changes in control values can be better accommodated. (c) 2007 John Wiley & Sons, Ltd.


    Energy Technology Data Exchange (ETDEWEB)

    Scoville, Nick; Manohar, Swarnima; Murchikova, Lena [California Institute of Technology, MC 249-17, 1200 East California Boulevard, Pasadena, CA 91125 (United States); Sheth, Kartik [North American ALMA Science Center, National Radio Astronomy Observatory, 520 Edgemont Road, Charlottesville, VA 22901 (United States); Walter, Fabian; Zschaechner, Laura [Max-Planck-Institut fur Astronomie, Konigstuhl 17, D-69117 Heidelberg (Germany); Yun, Min [Department of Astronomy, University of Massachusetts, Amherst, MA 01003 (United States); Koda, Jin [Department of Physics and Astronomy, Stony Brook University, Stony Brook, NY 11794 (United States); Sanders, David; Barnes, Joshua [Institute for Astronomy, 2680 Woodlawn Drive, University of Hawaii, Honolulu, Hawaii, HI 96822 (United States); Thompson, Todd [Department of Astronomy, The Ohio State University, 140 West 18th Avenue, Columbus, OH 43210 (United States); Robertson, Brant; Tacconi, Linda; Narayanan, Desika [Department of Astronomy and Steward Observatory, University of Arizona, Tucson AZ 85721 (United States); Genzel, Reinhard; Davies, Richard [Max-Planck-Institut fur extraterrestrische Physik (MPE), Giessenbachstrasse, D-85748 Garching (Germany); Hernquist, Lars [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Brown, Robert [National Radio Astronomy Observatory, 520 Edgemont Road, Charlottesville, VA 22901 (United States); Hayward, Christopher C. [TAPIR 350-17, California Institute of Technology, 1200 East California Boulevard, Pasadena, CA 91125 (United States); Kartaltepe, Jeyhan [National Optical Astronomy Observatory, 950 North Cherry Avenue, Tucson, AZ 85719 (United States); and others


    We report ALMA Band 7 (350 GHz) imaging at 0.''4-0.''6 resolution and Band 9 (696 GHz) at ∼0.''25 resolution of the luminous IR galaxies Arp 220 and NGC 6240. The long wavelength dust continuum is used to estimate interstellar medium masses for Arp 220 east and west and NGC 6240 of 1.9, 4.2, and 1.6 × 10{sup 9} M {sub ☉}within radii of 69, 65, and 190 pc. The HCN emission was modeled to derive the emissivity distribution as a function of radius and the kinematics of each nuclear disk, yielding dynamical masses consistent with the masses and sizes derived from the dust emission. In Arp 220, the major dust and gas concentrations are at radii less than 50 pc in both counter-rotating nuclear disks. The thickness of the disks in Arp 220 estimated from the velocity dispersion and rotation velocities are 10-20 pc and the mean gas densities are n{sub H{sub 2}}∼10{sup 5} cm{sup –3} at R <50 pc. We develop an analytic treatment for the molecular excitation (including photon trapping), yielding volume densities for both the HCN and CS emission with n {sub H2} ∼ 2 × 10{sup 5} cm{sup –3}. The agreement of the mean density from the total mass and size with that required for excitation suggests that the volume is essentially filled with dense gas, i.e., it is not cloudy or like swiss cheese.


    International Nuclear Information System (INIS)

    Scoville, Nick; Manohar, Swarnima; Murchikova, Lena; Sheth, Kartik; Walter, Fabian; Zschaechner, Laura; Yun, Min; Koda, Jin; Sanders, David; Barnes, Joshua; Thompson, Todd; Robertson, Brant; Tacconi, Linda; Narayanan, Desika; Genzel, Reinhard; Davies, Richard; Hernquist, Lars; Brown, Robert; Hayward, Christopher C.; Kartaltepe, Jeyhan


    We report ALMA Band 7 (350 GHz) imaging at 0.''4-0.''6 resolution and Band 9 (696 GHz) at ∼0.''25 resolution of the luminous IR galaxies Arp 220 and NGC 6240. The long wavelength dust continuum is used to estimate interstellar medium masses for Arp 220 east and west and NGC 6240 of 1.9, 4.2, and 1.6 × 10 9 M ☉ within radii of 69, 65, and 190 pc. The HCN emission was modeled to derive the emissivity distribution as a function of radius and the kinematics of each nuclear disk, yielding dynamical masses consistent with the masses and sizes derived from the dust emission. In Arp 220, the major dust and gas concentrations are at radii less than 50 pc in both counter-rotating nuclear disks. The thickness of the disks in Arp 220 estimated from the velocity dispersion and rotation velocities are 10-20 pc and the mean gas densities are n H 2 ∼10 5  cm –3 at R <50 pc. We develop an analytic treatment for the molecular excitation (including photon trapping), yielding volume densities for both the HCN and CS emission with n H2 ∼ 2 × 10 5  cm –3 . The agreement of the mean density from the total mass and size with that required for excitation suggests that the volume is essentially filled with dense gas, i.e., it is not cloudy or like swiss cheese

  9. Rehabilitation of broken-down chamber for the Gammacell-220 Irradiation Facility

    International Nuclear Information System (INIS)

    Emi-Reynolds, G.; Banini, G.K.; Ennison, I.


    The broken-down chamber of the gammacell-220 irradiation facility used for the calibration of dosimeters at the National Nuclear Research has been repaired. This repair work involved the identification of suitable components for the aluminum welding capable of ensuring double welding of the inside and outside joints of the chamber. Of paramount importance is the ability of the welded joint to physically sustain the safety column which is made of 26.9 kg of reinforce lead. The wielding was also expected to ensure that the shape of the chamber is retained after installation, apart from allowing uninhibited movement of the chamber which carries samples to be taken into the belly of the gamma cell for irradiation. The Ferrous ammonium sulfate (Fricke) solution was used as the dosimetry standard to check the gamma dose after restoration of the equipment. This report presents information on the procedure and justification for undertaking the repairs of this unit. By this successful repairs and putting into operation of the Gammacell-220, the maintenance team at the Center have demonstrated their ability to undertake similar works on the Gammacell-220 in the future even to other countries in the sub-region. (author). 2 refs., 2 figs


    Directory of Open Access Journals (Sweden)

    Alina Crina CIUBOTARIU


    Full Text Available Corrosion in the marine environment is an important issue because the costs causes by marine corrosion increased year upon year. It is necessary a correctly approach to materials selection, protection and corrosion control to reduce this burden of wasted materials, wasted energy and wasted money. Many different types of corrosion attack can be observed to structures, ships and other equipment used in sea water service. Shipping containers are exposed to various corrosive mediums like as airborne salt, industrial pollutants, rain and saltwater. Transport damage during loading onto and unloading off trucks, train beds and ships breaches the paint coating which further contributes to corrosion. The result is shortened container life and high costs for container repair or replacement. The paper intends to evaluate, by gravimetric method, the corrosion rate and corrosion penetration rate of two types of carbon steel DX51D and S220GD. Carbon steel DX51D and hot-dip galvanized steel S220GD are used in marine and industrial applications for buildings cargo vessels, container ships and oil tankers. For testing it was used different corrosive environments: 5% NaOH solution; 5% HCL solution and 0.5M NaCl solution. The samples were immersed in 400mL of testing solution for exposure period of 28 days. Periodically at 3 days, 7 days, 14 days, 21 days and 28 days was measured de mass loss and evaluate the corrosion rate and corrosion stability coefficient. The steel DX51D was stable in 5% NaOH solution for 28 days, the values of corrosion stability coefficient was 7 after 3 days and 6 after 28 days of immersion in corrosive medium. In 5% HCL solution steels DX51D and S220GD was completely corroded in 21 days with a corrosion stability coefficient equal with 9 for 7 days and 8 for 21 days of immersion in corrosive solution. It was observed a good resistance for 3 days in 0.5M NaCl solution with a corrosion stability coefficient equal with 5, but after that

  11. Molecular Dissection of the 8 Phase Transcriptional Program Controlled by Cyclin E-P220 NPAT Signaling Pathway

    National Research Council Canada - National Science Library

    Nalepa, Grzegorz; Harper, Jeffrey


    .... Recent studies suggest a role for cyclin E/Cdk2 in activation of histone transcription during S phase via the Cajal body-associated protein p22ONPAT, and in addition, p220 can promote S-phase entry...

  12. Thoron (RN-220) interference in the determination of RN-222 exhalation rate of soils

    Energy Technology Data Exchange (ETDEWEB)

    Amaral, Déric S.; Farias, Emerson E.G.; Santos, Mariana L.O.; Silva, Karolayne E.M.; Hazin, Clovis A.; França, Elvis J., E-mail: [Centro Regional de Ciências Nucleares do Nordeste (CRCN-NE/CNEN-PE), Recife, PE (Brazil); Souza Neto, João A., E-mail: [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Departamento de Geologia


    The transport of Rn-222 from the soil to the atmosphere known as exhalation is influenced by meteorological conditions and soil geophysical parameters. In closed and poorly ventilated rooms, this radioactive gas can reach high activity concentrations, in which the energy of alpha particles released by this radionuclide and its progeny is the second leading cause of lung cancer. Soil exhalation rate is an important parameter for assessing human health risks associated with radon. For radon determination using an exhalation chamber, an ionization chamber detector is used to count the electrical pulses generated by the interaction between the alpha particles produced by Rn-222 and its progeny and the air inside the chamber. In this work, the interference of thoron (Rn-220) in the determination of soil exhalation rate of Rn-222 was studied. For this, the RadonBOX exhalation chamber and the AlphaGuard ionization chamber detector were utilized for analyzing the same soil during two hours on different days under similar meteorological conditions. From zero up to approximately 2,400 s, the radon activity concentrations decreased. After 40 minutes, the radon concentrations started to increase, thereby allowing the calculation of soil exhalation rate. This initial decreasing could be explained by a high Rn-220 than Rn-222 presence in the soil, in which, because of its short half-life, after 40 minutes, most thoron present in the chamber has undergone so that the main alpha emitter become Rn-222. In order to confirm this, Rn-220 activity was estimated by the Ra-228 concentration in the soil determined after 30 days using High Resolution Gamma-Ray Spectrometry with HPGe detectors. Therefore, the thoron interference in the determination of soil radon exhalation rate was considered negligible after 40 minutes of measurement time for the analyzed soil. (author)


    Energy Technology Data Exchange (ETDEWEB)

    Wilson, C. D. [Department of Physics and Astronomy, McMaster University, Hamilton, ON L8S 4M1 (Canada); Rangwala, N.; Glenn, J.; Maloney, P. R. [Center for Astrophysics and Space Astronomy, 389-UCB, University of Colorado, Boulder, CO 80303 (United States); Spinoglio, L.; Pereira-Santaella, M. [Istituto di Astrofisica e Planetologia Spaziali, INAF-IAPS, Via Fosso del Cavaliere 100, I-00133 Roma (Italy)


    We present new images of Arp 220 from the Atacama Large Millimeter/submillimeter Array with the highest combination of frequency (691 GHz) and resolution (0.''36 × 0.''20) ever obtained for this prototypical ultraluminous infrared galaxy. The western nucleus is revealed to contain warm (200 K) dust that is optically thick (τ{sub 434} {sub μm} = 5.3), while the eastern nucleus is cooler (80 K) and somewhat less opaque (τ{sub 434} {sub μm} = 1.7). We derive full width at half-maximum diameters of 76 × ≤ 70 pc and 123 × 79 pc for the western and eastern nucleus, respectively. The two nuclei combined account for (83{sub −38}{sup +65} (calibration) {sub −34}{sup +0} (systematic))% of the total infrared luminosity of Arp 220. The luminosity surface density of the western nucleus (log (σT{sup 4})=14.3±0.2{sub −0.7}{sup +0} in units of L {sub ☉} kpc{sup –2}) appears sufficiently high to require the presence of an active galactic nucleus (AGN) or a ''hot starburst'', although the exact value depends sensitively on the brightness distribution adopted for the source. Although the role of any central AGN remains open, the inferred mean gas column densities of (0.6-1.8) × 10{sup 25} cm{sup –2} mean that any AGN in Arp 220 must be Compton-thick.

  14. Sistem Monitoring Pendeteksi Kebocoran LPG berbasis Mikrokontroller ATmega16 menggunakan RF APC220

    Directory of Open Access Journals (Sweden)



    Full Text Available Abstrak Penggunaan LPG sebagai bahan bakar alternatif pengganti bahan bakar minyak dirasakan lebih efektif dan praktis. Namun kandungan senyawa di dalamnya memiliki efek yang negatif jika menguap di udara bebas. Sistem detektor gas LPG dapat menjadi salah satu solusi untuk mengetahui lebih dini terjadinya kebocoran gas. Implementasi sistem detektor gas LPG pada penelitian ini berupa sistem monitoring nirkabel yang dilengkapi alarm sebagai indikasi jika terjadi kebocoran gas. Sistem terdiri dari bagian Remote Controller dan Master Controller. Remote Controller menggunakan mikrokontroler ATMega16 yang terintegrasi dengan sensor MQ5, LCD dan transceiver RF APC220. Sedangkan Master Controller berupa komputer (PC yang dapat menampilkan kondisi ruangan yang dideteksi oleh bagian Remote Controller. Sistem berhasil mendeteksi gas LPG dan menampilkan kadar konsentrasinya dalam rentang 200 sampai dengan 1000 ppm. Ketika kadar konsentrasi gas mencapai 5000 ppm, alarm aktif secara otomatis dan memberikan status waspada. Pengiriman data secara nirkabel dengan adanya sejumlah penghalang berhasil dilakukan sampai jarak 200 m. Kata kunci: Sistem Monitoring, Remote Controller, Master Controller, LPG, RF APC220   Abstract The use of LPG as a fuel alternative to fossil fuels may be more effective and practical. Neverfluless its compound has a negative effect if it evaporates to the air. LPG gas detector system may be one solution to determine the early occurrence of gas leak. The detector system implementation in this study was a wireless monitoring system that had alarm to indicate if there was the gas leak. The system consisted of the Remote Controller and the Master Controller. Remote Controller used ATmega16 microcontroller integrated with MQ5 sensor, LCD and RF transceiver APC220. While the Master Controller in the form of a computer (PC that could display a room condition was detected by the Remote Controller section. LPG gas system successfully detected

  15. Improved automated analysis of radon (222Rn) and thoron (220Rn) in natural waters. (United States)

    Dimova, Natasha; Burnett, William C; Lane-Smith, Derek


    Natural radon ((222)Rn) and thoron ((220)Rn) can be used as tracers of various chemical and physical processes in the environment. We present here results from an extended series of laboratory experiments intended to improve the automated analysis of (222)Rn and (220)Rn in water using a modified RAD AQUA (Durridge Inc.) system. Previous experience with similar equipment showed that it takes about 30-40 min for the system to equilibrate to radon-in-water concentration increases and even longer for the response to return to baseline after a sharp spike. While the original water/gas exchanger setup was built only for radon-in-water measurement, our goal here is to provide an automated system capable of high resolution and good sensitivity for both radon- and thoron-in-water detections. We found that faster water flow rates substantially improved the response for both isotopes while thoron is detected most efficiently at airflow rates of 3 L/min. Our results show that the optimum conditions for fastest response and sensitivity for both isotopes are at water flow rates up to 17 L/min and an airflow rate of 3 L/min through the detector. Applications for such measurements include prospecting for naturally occurring radioactive material (NORM) in pipelines and locating points of groundwater/surface water interaction.

  16. Cre-expressing neurons in the cortical white matter of Ntsr1-Cre GN220 mice. (United States)

    Sundberg, Sofie C; Granseth, Björn


    Genetically modified mouse strains that express Cre-recombinase in specific neuronal sub-populations have become widely used tools for investigating neuronal function. The Ntsr1-Cre GN220 mouse expresses this enzyme in corticothalamic neurons in layer 6 of cerebral cortex. We observed that about 7% of Cre-expressing cells in the primary visual cortex are found within the white matter bordering layer 6. By using the immunohistochemical marker for layer 6 neurons, Forkhead box protein 2 (FoxP2), and fluorescently conjugated latex beads injected into the dorsal lateral geniculate nucleus, we show that about half of these cells are similar to and could belong to the layer 6 corticothalamic neuron population. The other half seems to be a distinct white matter (WM) neuron sub-population that we estimate to constitute 2-4% of the total cortical Cre-expressing population. Staining for the neuronal marker Neuronal nuclei (NeuN) revealed that about 15-40% of WM neurons are Cre-expressing. Thus, the potential contribution from WM neurons needs to be considered when interpreting the results from experiments using the Ntsr1-Cre GN220 mouse for investigating corticothalamic neuronal function. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. Simultaneous determination of Rn-220 and Rn-222 concentrations in atmospheres by cellulose nitrate ionographic detectors

    International Nuclear Information System (INIS)

    Lobao, N.


    A method for the indoor determination of airborne radon and radon daughters is described, based in the utilization of cellulose nitrate (CN) ionographic detectors (LR-115-Kodak-Pathe) These track-etching detectors are coupled to an air sample and to a difusion chamber respectively. In the first system ambient air is pulled through a fiber glass filter for collection of airborne radon daughters (Flow: 230 ml/min). In the second system, the cellulose nitrate detectors is coupled/min). In the second system, the cellulose nitrate detectors is coupled to a difusion chamber electrostatic precipitator arrangement. Here the CN detector will register only the alpha particles given off by the decay products of Rn-222 formed within the sensitive volume of electrostatic precipitator. The construction of calibration curves for the two systems using adequate steady-state concentrations of Rn-220 and Rn-222 in an exposure chamber (1 cubic meter), will allow the use of the system for measurement of measurement of averaged integrated radon concentrations. The CN attached to the CN attached to the air sampler is exposed in the reference atmosphere with and without a mylar filter for discrimination of alpha particles with different energies Field sampling indicated however, that efficiency of the two systems are still low for the measurement of environmental levels of Rn-220 and Rn-222 within houses of the AENR, recommendations for efficienty improvement of the system are proposed [pt

  18. Dense-gas properties in Arp 220 revealed by isotopologue lines (United States)

    Wang, Junzhi; Zhang, Zhi-Yu; Zhang, Jiangshui; Shi, Yong; Fang, Min


    We present observations of isotopologue lines of dense-gas tracers at 3 mm and 1 mm towards the nearest ultra-luminous infrared galaxy Arp 220. The 3-mm and 1-mm observations were performed with the Institut de Radioastronomie Millimétrique 30-m telescope and the Atacama Pathfinder Experiment 12-m telescope, respectively. We detected H13CN and HN13C in 1-0 and 3-2, and HC15N 1-0, among which HC15N 1-0 and HN13C 1-0 are detected in Arp 220 for the first time. The H13CO+ 1-0 and 3-2 lines are unlikely to be detected because of the confusion of SiO lines. We find that the ratio of the line brightness temperatures of HN13C 3-2/1-0 is 2.4, which is significantly higher than that of H13CN 3-2/1-0 (0.73). This indicates that HN13C and HNC molecules are in denser regions than H13CN and HCN molecules. With the line ratio of H13CN 1-0 and HC15N 1-0, the 14N/15N ratio was estimated to be 440^{+140}_{-82}, which is larger than that of the local interstellar medium.

  19. Joint determination of the concentrations of the 222Rn and 220Rn decay products in air

    International Nuclear Information System (INIS)

    Terent'ev, M.V.


    The authors describe a modification of the Kuznets and Markov methods normally employed for the determination of radon 220 and 222 daughter alpha product concentration in air in which an air sample is taken for 10 minutes on a filter at a flow rate of 10-40 liters per minute. After the conclusion of sampling the filter activity is measured for another 10 minutes. In order to then determine the latent energy of the radon 222 daughter products and to bring into account the radon 220 daughter products in the total activity measurements of the filter are taken for a second time for 30 minutes five hours after initial sampling. The level of latent energy of the combined daughter products are calculated by an equation which incorporates alpha particle detection efficiency, aerosol retention efficiency in the filter, and the Kuznets coefficients, and analyzes the separate and combined contributions of both daughter products from both sampling periods. A statistical analysis employing the Markov method is also depicted in modified form and is recommended when a more rapid analysis of air radioactivity is mandated

  20. Laser driven single shock compression of fluid deuterium from 45 to 220 GPa

    Energy Technology Data Exchange (ETDEWEB)

    Hicks, D; Boehly, T; Celliers, P; Eggert, J; Moon, S; Meyerhofer, D; Collins, G


    The compression {eta} of liquid deuterium between 45 and 220 GPa under laser-driven shock loading has been measured using impedance matching to an aluminum (Al) standard. An Al impedance match model derived from a best fit to absolute Hugoniot data has been used to quantify and minimize the systematic errors caused by uncertainties in the high-pressure Al equation of state. In deuterium below 100 GPa results show that {eta} {approx_equal} 4.2, in agreement with previous impedance match data from magnetically-driven flyer and convergent-explosive shock wave experiments; between 100 and 220 GPa {eta} reaches a maximum of {approx}5.0, less than the 6-fold compression observed on the earliest laser-shock experiments but greater than expected from simple extrapolations of lower pressure data. Previous laser-driven double-shock results are found to be in good agreement with these single-shock measurements over the entire range under study. Both sets of laser-shock data indicate that deuterium undergoes an abrupt increase in compression at around 110 GPa.

  1. Chandra Observations of Extended X-Ray Emission in ARP 220 (United States)

    McDowell, J. C.; Clements, D. L.; Lamb, S. A.; Shaked, S.; Hearn, N. C.; Colina, L.; Mundell, C.; Borne, K.; Baker, A. C.; Arribas, S.


    We resolve the extended X-ray emission from the prototypical ultraluminous infrared galaxy Arp 220. Extended, faint, edge-brightened, soft X-ray lobes outside the optical galaxy are observed to a distance of 1CL 15 kpc on each side of the nuclear region. Bright plumes inside the optical isophotes coincide with the optical line emission and extend 1 1 kpc from end to end across the nucleus. The data for the plumes cannot be fitted by a single-temperature plasma and display a range of temperatures from 0.2 to 1 keV. The plumes emerge from bright, diffuse circumnuclear emission in the inner 3 kpc centered on the Ha peak, which is displaced from the radio nuclei. There is a close morphological correspondence between the Ha and soft X-ray emission on all spatial scales. We interpret the plumes as a starburst-driven superwind and discuss two interpretations of the emission from the lobes in the context of simulations of the merger dynamics of Arp 220.

  2. Scientific Opinion on Flavouring Group Evaluation 220 Revision 3 (FGE.220Rev3): Consideration of genotoxic potential for α,β-unsaturated 3(2H)-Furanones from subgroup 4.4 of FGE.19

    DEFF Research Database (Denmark)

    Beltoft, Vibe Meister; Nørby, Karin Kristiane

    The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to evaluate the genotoxic potential of 10 flavouring substances from FGE.19 subgroup 4.4, in the Flavouring Group Evaluation 220 (FGE.220). FGE.220 is subdivided...... into two subgroups: subgroup 4.4a containing [FL-no: 13.089, 13.117, 13.119, 13.157 and 13.175] and subgroup 4.4b containing [13.010, 13.084 and 13.085, 13.099 and 13.176]. For both subgroups the Panel concluded that the genotoxicity alert could not be ruled out based on the data available and accordingly...... additional genotoxicity data were requested. In FGE.220, Revision 1, the Panel concluded that for the substances in subgroup 4.4b there is no concern for genotoxicity. In FGE.220, Revision 2, the Panel evaluated genotoxicity studies on two representative substances of subgroup 4.4a: 2,5-dimethylfuran-3(2H...

  3. EFSA CEF Panel (EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids), 2013. Scientific Opinion on Flavouring Group Evaluation 220, Revision 2 (FGE.220Rev1): α,β-Unsaturated ketones and precursors from chemical subgroup 4.4 of FGE.19: 3(2H)-Furanones

    DEFF Research Database (Denmark)

    Beltoft, Vibe Meister; Binderup, Mona-Lise; Lund, Pia

    The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to evaluate the genotoxic potential of 10 flavouring substances from subgroup 4.4 of FGE.19 in the Flavouring Group Evaluation 220 (FGE.220). FGE.220 is subdivided int...

  4. Effects of air conditioning, dehumidification and natural ventilation on indoor concentrations of 222Rn and 220Rn

    International Nuclear Information System (INIS)

    Lee, Thomas K.C.; Yu, K.N.


    A bedroom was selected for detailed measurements on 220 Rn and 222 Rn concentrations and environmental parameters including CO 2 concentration, temperature and relative humidity. To simulate different sealing conditions, five conditions were artificially created in the sampling period of 25 consecutive days. It was concluded that natural ventilation is the most efficient way to lower the 222 Rn levels, while air conditioning is the next. Dehumidification provides only a marginal reduction of 222 Rn levels. The 220 Rn concentrations are not affected by natural ventilation, air conditioner or dehumidification, and were all around 10 Bq m -3 . There are no significant correlations between the 220 Rn and 222 Rn concentrations and environmental conditions such as CO 2 concentrations, temperature, relative humidity and pressure

  5. Astatine-211 labelled proteins and their stability in vivo

    International Nuclear Information System (INIS)

    Yi Changhou; Jin Jannan; Zhang Shuyuan; Wang Ketai; Zhang Dayuan; Zhou Maolun


    211 At or 131 I labelled proteins, e.g. 211 At-IgG or 211 At-BSA (bovine serum albumin) were prepared by 211 At reaction with the diazo-compound of para-aminobenzoic acid, which is then conjugated with IgG or BSA via an acylation reaction. The 211 At-carbon bond was found metabolically stable under in vivo conditions. For the labelling of proteins with 211 At or 131 I, other methods of direct oxidation are also described. The results show that for the labelling of proteins with 211 At, high rate of incorporation can be obtained with hydrogen peroxide as oxidant, but the labelling of proteins with 131 I is more favourable with the strong oxidant Chloramine-T. (author) 12 refs.; 6 figs

  6. Designing and overproducing a tandem epitope of gp350/220 that shows a potential to become an EBV vaccine

    Directory of Open Access Journals (Sweden)



    Full Text Available Background: Epstein-Barr virus (EBV can cause cancer in people from around the world. There is no EBV vaccine available for use on a global scale. However, emerging evidence suggests that the epitope on the gp350/220 capsid protein may be developed into an EBV vaccine. Nevertheless, the production of small, single epitope is challenging of stability issues and possible alteration of peptide structure. In this study, a tandem epitope was developed consisting of three single epitopes, aimed to improve stability, antigenicity and preserve epitope structure. Materials and methods: A tandem epitope was designed using bioinformatics based on the epitope structure of the gp350/220 protein. The tandem epitope structure was analyzed using a protein folding method with Abalone software, which was further refined via YASARA force field and molecular repairing using a FoldX method. Immunogenicity was examined with Epitopia software, whereas allergen properties were tested using AlgPred. The pattern of the tandem epitope binding with anti-gp350/220 antibodies was performed using Z-dock and snugDock. The tandem epitope was then overproduced in E. coli strain BL21 as a host cell. Result: Our model demonstrated a successfully designed and overproduced tandem epitope. The tandem epitope demonstrated a similar structure compared with the epitope of whole protein gp350/220. Our epitope also demonstrated non-allergen and antigenicity properties, and possessed antibody binding patterns consistent with whole protein gp350/220. Conclusion and recommendation: These data suggest a novel tandem epitope composed of three similar epitopes demonstrates antigenicity, structure, and binding properties consistent with whole protein gp350/220. We also demonstrate successful production of the tandem epitope using E. coli strain BL21 as a host. Future in vivo experimental animal research is necessary to test the ability of this tandem epitope to stimulate antibody production

  7. Attached, unattached fraction of progeny concentrations and equilibrium factor for dose assessments from {sup 222}Rn and {sup 220}Rn

    Energy Technology Data Exchange (ETDEWEB)

    Singh, Parminder; Saini, Komal; Bajwa, Bikramjit Singh [Guru Nanak Dev University, Department of Physics, Amritsar, Punjab (India); Mishra, Rosaline; Sahoo, Bijay Kumar [Bhabha Atomic Research Centre, Radiological Physics and Advisory Division, Mumbai (India)


    In this study, measurements of indoor radon ({sup 222}Rn), thoron ({sup 220}Rn) and their equilibrium equivalent concentration (EEC) were carried out in 96 dwellings from 22 different villages situated in Hamirpur district, Himachal Pradesh, India, by using LR-115 type II-based pinhole twin cup dosimeters and deposition-based progeny sensors (DRPS/DTPS). The annual average indoor {sup 222}Rn and {sup 220}Rn concentrations observed in these dwellings were 63.82 and 89.59 Bq/m{sup 3}, respectively, while the average EEC (attached + unattached) for {sup 222}Rn and {sup 220}Rn was 29.28 and 2.74 Bq/m{sup 3}. For {sup 222}Rn (f{sub Rn}) and {sup 220}Rn (f{sub Tn}), the average values of unattached fraction were 0.11 and 0.09, respectively. The equilibrium factors for radon (F{sub Rn}) and thoron (F{sub Tn}) varied from 0.12 to 0.77 with an average of 0.50, and from 0.01 to 0.34 with an average of 0.05, respectively. The annual inhalation dose due to mouth and nasal breathing was calculated using dose conversion factors and unattached fractions. The indoor annual effective doses for {sup 222}Rn (AEDR) and {sup 220}Rn (AEDT) were found to be 1.92 and 0.83 mSv a{sup -1}, respectively. The values of {sup 222}Rn/{sup 220}Rn concentrations and annual effective doses obtained in the present study are within the safe limits as recommended by the International Commission on Radiological Protection for indoor dwelling exposure conditions. (orig.)

  8. rsfMRI effects of KB220Z™ on Neural Pathways in Reward Circuitry of Abstinent Genotyped Heroin Addicts (United States)

    Blum, Kenneth; Liu, Yijun; Wang, Wei; Wang, Yarong; Zhang, Yi; Oscar-Berman, Marlene; Smolen, Andrew; Febo, Marcelo; Han, David; Simpatico, Thomas; Cronjé, Frans J; Demetrovics, Zsolt; Gold, Mark S.


    Recently Willuhn et al. reported that cocaine use and even non-substance related addictive behavior, increases, as dopaminergic function is reduced. Chronic cocaine exposure has been associated with decreases in D2/D3 receptors, also associated with lower activation to cues in occipital cortex and cerebellum in a recent PET study from Volkow’s group. Therefore, treatment strategies, like dopamine agonist therapy, that might conserve dopamine function may be an interesting approach to relapse prevention in psychoactive drug and behavioral addictions. To this aim, we evaluated the effect of KB220Z™ on reward circuitry of ten heroin addicts undergoing protracted abstinence, an average 16.9 months. In a randomized placebo-controlled crossover study of KB220Z™ five subjects completed a triple blinded–experiment in which the subject, the person administering the treatment and the person evaluating the response to treatment were blinded as to which treatment any particular subject was receiving. In addition, nine subjects total were genotyped utilizing the GARSRX™ test. We preliminarily report that KB220Z ™ induced an increase in BOLD activation in caudate-accumbens-dopaminergic pathways compared to placebo following one-hour acute administration. Furthermore, KB220Z™ also reduced resting state activity in the putamen of abstinent heroin addicts. In the second phase of this pilot study of all ten abstinent heroin-dependent subjects, three brain regions of interest (ROIs) we observed to be significantly activated from resting state by KB220Z compared to placebo (P addiction by direct or indirect dopaminergic interaction. Due to small sample size, we caution definitive interpretation of these preliminary results and confirmation with additional research and ongoing rodent and human studies of KB220Z, is required. PMID:25526228

  9. Comparison of methods and instruments for 222Rn/220Rn progeny measurement

    International Nuclear Information System (INIS)

    Liu Yanyang; Shang Bing; Wu Yunyun; Zhou Qingzhi


    In this paper, comparisons were made among three methods of measurement (grab measurement, continuous measurement and integrating measurement) and also measurement of different instruments for a radon/thoron mixed chamber. Taking the optimized five-segment method as a comparison criterion, for the equilibrium-equivalent concentration of 222 Rn, measured results of Balm and 24 h integrating detectors are 31% and 29% higher than the criterion, the results of Wl x, however, is 20% lower; and for 220 Rn progeny, the results of Fiji-142, Kf-602D, BWLM and 24 h integrating detector are 86%, 18%, 28% and 36% higher than the criterion respectively, except that of WLx, which is 5% lower. For the differences shown, further research is needed. (authors)

  10. MOA-2013-BLG-220Lb: Massive planetary companion to galactic-disk host

    Energy Technology Data Exchange (ETDEWEB)

    Yee, J. C.; Gould, A.; Gaudi, B. S. [Department of Astronomy, Ohio State University, 140 West 18th Avenue, Columbus, OH 43210 (United States); Han, C.; Choi, J.-Y.; Hwang, K.-H.; Jung, Y. K. [Department of Physics, Chungbuk National University, Cheongju 361-763 (Korea, Republic of); Skowron, J.; Udalski, A. [Warsaw University Observatory, Al. Ujazdowskie 4, 00-478 Warszawa (Poland); Bond, I. A. [Institute of Information and Mathematical Sciences, Massey University, Private Bag 102-904, North Shore Mail Centre, Auckland (New Zealand); Hundertmark, M. [SUPA, School of Physics and Astronomy, University of St Andrews, North Haugh, St Andrews KY16 9SS (United Kingdom); Monard, L. A. G. [Klein Karoo Observatory, Centre for Backyard Astrophysics, Calitzdorp (South Africa); Porritt, I. [Turitea Observatory, Palmerston North (New Zealand); Nelson, P. [Ellinbank Observatory, Ellinbank, Victoria (Australia); Bozza, V. [Dipartimento di Fisica " E. R. Caianiello," Università degli Studi di Salerno, Via S. Allende, I-84081 Baronissi (Italy); Albrow, M. D. [Department of Physics and Astronomy, University of Canterbury, Private Bag 4800, Christchurch 8020 (New Zealand); Christie, G. W. [Auckland Observatory, Auckland (New Zealand); DePoy, D. L. [Department of Physics and Astronomy, Texas A and M University, College Station, TX 77843-4242 (United States); Lee, C.-U. [Korea Astronomy and Space Science Institute, 776 Daedukdae-ro, Yuseong-gu, Daejeon 305-348 (Korea, Republic of); McCormick, J. [Farm Cove Observatory, Centre for Backyard Astrophysics, Pakuranga, Auckland (New Zealand); Collaboration: μFUN Collaboration),; MOA Collaboration),; OGLE Collaboration),; RoboNet Collaboration),; and others


    We report the discovery of MOA-2013-BLG-220Lb, which has a super-Jupiter mass ratio q = 3.01 ± 0.02 × 10{sup –3} relative to its host. The proper motion, μ = 12.5 ± 1 mas yr{sup –1}, is one of the highest for microlensing planets yet discovered, implying that it will be possible to separately resolve the host within ∼7 yr. Two separate lines of evidence imply that the planet and host are in the Galactic disk. The planet could have been detected and characterized purely with follow-up data, which has important implications for microlensing surveys, both current and into the Large Synoptic Survey Telescope (LSST) era.

  11. Use of artificial neural network in estimating channel power distribution of a 220 MWe PHWR

    International Nuclear Information System (INIS)

    Dubey, B.P.; Chandra, A.K.; Govindarajan, G.; Jagannathan, V.; Kataria, S.K.


    Knowledge of the distribution of power in all the 306 channels of a Pressurised Heavy Water Reactor (PHWR) as a result of the movement of one or more of the four regulating rods is important from the operation and maintenance point view of the reactor. Conventional computer codes available for this purpose take several minutes to calculate the channel power distribution on PC-AT/486. An Artificial Neural network (ANN), based on the RPROP algorithm has been developed and employed in predicting channel power distribution of a 220 MWe Indian PHWR as a result of a perturbation caused by the movement of one or more of the four regulating rods of the reactor. The ANN based system produces the result of an analysis much faster than that produced by a conventional computer code usually employed for this application. The ANN based system is rugged, accurate and fast, and therefore, has potential to be used in real-time applications. (author)

  12. Cobalt-60 total body irradiation dosimetry at 220 cm source-axis distance

    International Nuclear Information System (INIS)

    Glasgow, G.P.; Mill, W.B.


    Adults with acute leukemia are treated with cyclophosphamide and total body irradiation (TBI) followed by autologous marrow transplants. For TBI, patients seated in a stand angled 45 0 above the floor are treated for about 2 hours at 220 cm source-axis distance (SAD) with sequential right and left lateral 87 cm x 87 cm fields to a 900 rad mid-pelvic dose at about 8 rad/min using a 5000 Ci cobalt unit. Maximum (lateral) to minimum (mid-plane) dose ratios are: hips--1.15, shoulders--1.30, and head--1.05, which is shielded by a compensator filter. Organ doses are small intestine, liver and kidneys--1100 rad, lung--1100 to 1200 rad, and heart--1300 rad. Verification dosimetry reveals the prescribed dose is delivered to within +-5%. Details of the dosimetry of this treatment are presented

  13. The effectiveness of heat pumps as part of CCGT-190/220 Tyumen CHP-1

    Directory of Open Access Journals (Sweden)

    Tretyakova Polina


    Full Text Available The article considers the possibility of increasing the energy efficiency of CCGT-190/220 Tyumen CHP-1 due to the utilization of low-grade heat given off in the condenser unit of the steam turbine. To assess the effectiveness of the proposed system, the indexes of thermal efficiency are given. As a result of a research the following conclusions are received: The heat-transfer agent heat pump, when heated uses low-grade heat TPP and increases heat output, but consumes the electricity. Using a heat pump is effective for a small temperature difference between the condenser and the evaporator. Good example is heating water before chemical treatment. This method is more efficient than using a replacement boiler and it is used in steam selection.

  14. A study on the risk from indoor radon 220 and radon 222 exposures

    International Nuclear Information System (INIS)

    Rannou, A.


    The hazards from radon (radon 220 and 222) in dwelling atmospheres have been studied. In the first part devoted to the present state of the problem, an analysis is made of the formation mechanisms and the evolution of radon and its daughters indoors. The main physical and dosimetric quantities required for the risk evaluation are defined. The theoretical and experimental analysis of the methods of measurements of radon and its daughters used in the measurement campaign are considered in the second part. The progress and the result of the national survey are developed in the third part. The effects of several factors on indoor levels are discussed. The conclusions of a particular study in the Finistere ''department'' are presented. The data collected make it possible to assess the mean exposure of man to natural radiation [fr

  15. The measurement of thoron (220Rn) concentration in indoor air continuously using pylon model WLx

    International Nuclear Information System (INIS)

    Hasnel Sofyan


    The concentration of thoron ( 220 Rn) in particular location can be higher than radon ( 220 Rn), however, its presence is always neglected. This might be due to the difficulties in calibration and discrimination between radon and thoron. From biokinetic and dosimetric model, it has been known that the dominant contribution of thoron to the effective dose is in the lungs. UNSCEAR estimates the doses contribution of thoron and its progenies is between 5-10% of the annual dose received by the general public and the risk level is 4.4 times greater than radon and progenies. Therefore, it is necessary to study the thoron concentration in indoor air and workplaces. Radon-thoron concentration in indoor air can be determined by direct methods using Pylon Model WLx device and passive methods using Solid State Nuclear Track Detector (SSNTDs). In this research the measurement of thoron was carried out continuously using Pylon Model WLx equipment that is sensitive to radon for 24, 65, 72, 116 and 154 hours in different rooms. The measurement result showed that the mean value of thoron working level (WL) concentration obtained in room-1 was 2.53 ± 0.67 Bq/m 3 with maximum and minimum of thoron concentrations were 3.37 and 2.22 Bq/m 3 respectively. From the measurement in different locations, it was obtained that the largest and smallest average concentrations of thoron progenies were 0.83 ± 0.23 Bq/m 3 and 0.29 ± 0.64 Bq/m 3 , while the maximum and minimum concentration values were 7.80 Bq/m 3 and 0.01 Bq/m 3 respectively. Pylon Model WLx device is not enables to be used for longer and large scale survey area concurrently, so the SSNTDs which is sensitive to the emission of alpha particles and can measure cumulative thoron concentrations is required. (author)

  16. Evolution of the design of fuel handling control system in 220 MWe Indian PHWRs

    International Nuclear Information System (INIS)

    Dhruvanarayana, L.; Gupta, H.; Bharathkumar, M.


    Following two CANDU type reactors at Rajasthan (RAPS-1 and 2), three nuclear power stations, each of two units of 220 MWe has been in operation at Rajasthan (RAPS-1 and 2). Madras (MAPS-1 and 2). Narora (NAPS-1 and 2) and Kakrapar (KAPS-1 and 2). Two more stations, also of 220 MWe capacity, are under construction at Rajasthan (RAPP-3 and 4) and Kaiga (Kaiga-1 and 2). These are natural uranium fuelled pressurized heavy water cooled and heavy water moderated reactors (PHWRs). The two units at Rajasthan viz RAPS-1 and 2, were built with the technical collaboration with Canada, and the rest of the units have been designed and built indigenously, incorporating a number of modifications, particularly in the on-power refuelling system. The evolution of the design of the Fuel Handling Control systems of these reactors, taking into consideration operational needs, safety aspects and maintainability are highlighted in this paper. A combination of hydraulic and electronic control has been provided to enable the operations. In RAPS-1 and 2, hardwired electronic controls were provided, while in MAPS-1 and 2, the hardwired system was improved. From NAPS onwards, a computerized control system with hardwired interlock logic has been provided. New devices like coarse-fine potentiometers, special oil filled potentiometer assembly, rectilinear potentiometers etc., were specified from NAPS onwards. Positioning logic is computerized providing flexibility and expendability. Digital panel meters and indicating lamps have been provided for manual mode operations, while CRT (cathode-ray tube) monitors help in computer mode operations. Hydraulic controls which comprise D 2 0 hydraulics, H 2 0 hydraulics and oil hydraulics have been improved from NAPS onwards. Hydraulic panels have been relocated in accessible areas to reduce radiation doses and for better maintainability. All electric drives including X and Y drives were modified as hydraulic drives for better control. New types of valves

  17. A new method for the determination of radium-228, thorium-228, and radium-224 in groundwaters via thoron (radon-220)

    International Nuclear Information System (INIS)

    Smith, M.R.; Lautensleger, A.W.; Laul, J.C.


    An improved method for determining radium and thorium from the 232 Th decay series has been developed which measures the activity of 220 Rn as an assay of its parents. Although some ingrowth corrections and minor separation procedures for Th are required, the results to date show that the dynamic counting of 220 Rn via de-emanation and alpha counting by the alpha-scintillation method is preferable. The method for lower limit detection depends on the emanation rate. (author) 3 refs.; 6 figs

  18. Evaluation of the ID220 single photon avalanche diode for extended spectral range of photon time-of-flight spectroscopy

    DEFF Research Database (Denmark)

    Nielsen, Otto Højager Attermann; Dahl, Anders Bjorholm; Anderson-Engels, Stefan

    This paper describe the performance of the ID220 single photon avalanche diode for single photon counting, and investigates its performance for photon time-of-flight (PToF) spectroscopy. At first this report will serve as a summary to the group for PToF spectroscopy at the Department of Physics...

  19. 12 CFR 220.122 - “Deep in the money put and call options” as extensions of credit. (United States)


    ... fall in excess of 30 percent, but the risk of such a decline is extremely slight. (j) Like any other... effect counted twice, § 220.3(d)(5) requires that in computing the customer's adjusted debit balance... right would be exercised. But even if the price fell, unlike the situation with a normal option, the...

  20. 33 CFR 162.220 - Hoover Dam, Lake Mead, and Lake Mohave (Colorado River), Ariz.-Nev. (United States)


    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Hoover Dam, Lake Mead, and Lake... REGULATIONS § 162.220 Hoover Dam, Lake Mead, and Lake Mohave (Colorado River), Ariz.-Nev. (a) Lake Mead and... the axis of Hoover Dam and that portion of Lake Mohave (Colorado River) extending 4,500 feet...

  1. 20 CFR 661.220 - What are the requirements for the submission of the State Workforce Investment Plan? (United States)


    ... TRAINING ADMINISTRATION, DEPARTMENT OF LABOR STATEWIDE AND LOCAL GOVERNANCE OF THE WORKFORCE INVESTMENT SYSTEM UNDER TITLE I OF THE WORKFORCE INVESTMENT ACT State Governance Provisions § 661.220 What are the... incomplete, or which does not contain sufficient information to determine whether it is consistent with the...

  2. 12 CFR 220.118 - Time of payment for mutual fund shares purchased in a special cash account. (United States)


    ... recognize the fact that, when an issue of securities is to be issued at some fixed future date, a security... (CONTINUED) BOARD OF GOVERNORS OF THE FEDERAL RESERVE SYSTEM CREDIT BY BROKERS AND DEALERS (REGULATION T...). (b) Section 220.4(c)(2) provides as follows: In case a customer purchases a security (other than an...

  3. Simultaneous quantification of MTC-220 and its metabolites in beagle dog plasma by liquid chromatography-tandem mass spectrometry. (United States)

    Liu, Xin; Zhao, Manman; Mi, Jiaqi; Liu, Zhihao; Hu, Jinping; Sheng, Li; Wang, Baolian; Li, Dan; Yang, Shuang; Li, Yan


    A sensitive LC-ESI-MS/MS method for simultaneous determination of MTC-220 and its metabolites (paclitaxel and MDA-linker) in dog plasma has been developed and validated. After addition of docetaxel (internal standard), plasma samples containing MTC-220, paclitaxel and MDA-linker were prepared based on a simple protein precipitation by adding two volumes of acetonitrile. The separation was performed on a ZorbaxSB-C18 column (3.5μm, 2.1mm×100mm) at a flow rate of 0.2ml/min, using acetonitrile/water containing 0.1% formic acid (v/v) as mobile phase. The detection was performed on a triple quadrupole tandem mass spectrometer equipped with electrospray ionization (ESI) by selected reaction monitoring (SRM). The MS/MS ion transit ions monitored were 1444.4→623.8 for MTC-220, 876.4→307.9 for paclitaxel, 631.2→531.2 for MDA-linker and 830.2→549.1 for the internal standard. Linear detection responses were obtained for MTC-220, paclitaxel and MDA-linker ranging from 10 to 5000, 5 to 2500 and 5 to 500ng/ml, respectively. The lower limits of quantitation (LLOQs) for MTC-220, paclitaxel and MDA-linker were 10, 5 and 5ng/ml, respectively. The intra-day and inter-day precisions (RSD, %) of the three analytes do not exceed 10.9% except for LLOQs (≤17.50), and the accuracy (RE, %) were within ±17.5% for LLOQs and ±12.6% for the others. The average recoveries of three compounds were greater than 85.0%. The analytes were proved to be stable during all sample storage, preparation and analytic procedures. The validated method was successfully applied to pharmacokinetic studies of MTC-220 and its metabolites in beagle dogs after intravenous infusion of MTC-220 at 2.5mg/kg. Copyright © 2014 Elsevier B.V. All rights reserved.


    International Nuclear Information System (INIS)

    Ott, Jürgen; Henkel, Christian; Weiß, Axel; Braatz, James A.


    We present Australia Telescope Compact Array (ATCA) and Robert C. Byrd Green Bank Telescope (GBT) observations of ammonia (NH 3 ) and the 1.2 cm radio continuum toward the ultraluminous infrared galaxy merger Arp 220. We detect the NH 3 (1,1), (2,2), (3,3), (4,4), (5,5), and (6,6) inversion lines in absorption against the unresolved, (62 ± 9) mJy continuum source at 1.2 cm. The peak apparent optical depths of the ammonia lines range from ∼0.05 to 0.18. The absorption lines are well described by single-component Gaussians with central velocities in between the velocities of the eastern and western cores of Arp 220. Therefore, the ammonia likely traces gas that encompasses both cores. The absorption depth of the NH 3 (1,1) line is significantly shallower than expected based on the depths of the other transitions. The shallow (1,1) profile may be caused by contamination from emission by a hypothetical, cold (∼ 14 cm –2 . This layer would have to be located behind or away from the radio continuum sources to produce the contaminating emission. The widths of the ammonia absorption lines are ∼120-430 km s –1 , in agreement with those of other molecular tracers. We cannot confirm the extremely large line widths of up to ∼1800 km s –1 previously reported for this galaxy. Using all of the ATCA detections except for the shallow (1,1) line, we determine a rotational temperature of (124 ± 19) K, corresponding to a kinetic temperature of T kin = (186 ± 55) K. Ammonia column densities depend on the excitation temperature. For excitation temperatures of 10 K and 50 K, we estimate N(NH 3 ) = (1.7 ± 0.1) × 10 16 cm –2 and (8.4 ± 0.5) × 10 16 cm –2 , respectively. The relation scales linearly for possible higher excitation temperatures. Our observations are consistent with an ortho-to-para-ammonia ratio of unity, implying that the ammonia formation temperature exceeds ∼30 K. In the context of a model with a molecular ring that connects the two nuclei in Arp

  5. 3C 220.3: A radio galaxy lensing a submillimeter galaxy

    Energy Technology Data Exchange (ETDEWEB)

    Haas, Martin; Westhues, Christian; Chini, Rolf [Astronomisches Institut, Ruhr Universität, Bochum (Germany); Leipski, Christian; Klaas, Ulrich; Meisenheimer, Klaus [Max-Planck-Institut für Astronomie, Heidelberg (Germany); Barthel, Peter; Koopmans, Léon V. E. [Kapteyn Astronomical Institute, University of Groningen (Netherlands); Wilkes, Belinda J.; Bussmann, R. Shane; Willner, S. P.; Ashby, Matthew L. N.; Kuraszkiewicz, Joanna [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA (United States); Vegetti, Simona [Max-Planck-Institut für Astrophysik, Garching (Germany); Clements, David L. [Imperial College, London (United Kingdom); Fassnacht, Christopher D. [University of California, Davis, CA (United States); Horesh, Assaf [Division of Physics, Mathematics, and Astronomy, California Institute of Technology, Pasadena, CA (United States); Lagattuta, David J. [Centre for Astrophysics and Supercomputing, Swinburne University of Technology, Hawthorn (Australia); Stern, Daniel; Wylezalek, Dominika, E-mail: [Jet Propulsion Laboratory, California Institute of Technology, Pasadena, CA (United States)


    Herschel Space Observatory photometry and extensive multiwavelength follow-up have revealed that the powerful radio galaxy (PRG) 3C 220.3 at z = 0.685 acts as a gravitational lens for a background submillimeter galaxy (SMG) at z = 2.221. At an observed wavelength of 1 mm, the SMG is lensed into three distinct images. In the observed near infrared, these images are connected by an arc of ∼1''.8 radius forming an Einstein half-ring centered near the radio galaxy. In visible light, only the arc is apparent. 3C 220.3 is the only known instance of strong galaxy-scale lensing by a PRG not located in a galaxy cluster and therefore it offers the potential to probe the dark matter content of the radio galaxy host. Lens modeling rejects a single lens, but two lenses centered on the radio galaxy host A and a companion B, separated by 1''.5, provide a fit consistent with all data and reveal faint candidates for the predicted fourth and fifth images. The model does not require an extended common dark matter halo, consistent with the absence of extended bright X-ray emission on our Chandra image. The projected dark matter fractions within the Einstein radii of A (1''.02) and B (0''.61) are about 0.4 ± 0.3 and 0.55 ± 0.3. The mass to i-band light ratios of A and B, M/L{sub i}∼8±4 M{sub ⊙} L{sub ⊙}{sup −1}, appear comparable to those of radio-quiet lensing galaxies at the same redshift in the CfA-Arizona Space Telescope LEns Survey, Lenses Structure and Dynamics, and Strong Lenses in the Legacy Survey samples. The lensed SMG is extremely bright with observed f(250 μm) = 440 mJy owing to a magnification factor μ ∼ 10. The SMG spectrum shows luminous, narrow C IV λ1549 Å emission, revealing that the SMG houses a hidden quasar in addition to a violent starburst. Multicolor image reconstruction of the SMG indicates a bipolar morphology of the emitted ultraviolet (UV) light suggestive of cones through which UV light escapes a

  6. Evolution of the design of fuel handling control system in 220 MWe Indian PHWRs

    Energy Technology Data Exchange (ETDEWEB)

    Dhruvanarayana, L; Gupta, H; Bharathkumar, M [Nuclear Power Corporation of India Ltd., Mumbai (India)


    Following two CANDU type reactors at Rajasthan (RAPS-1 and 2), three nuclear power stations, each of two units of 220 MWe has been in operation at Rajasthan (RAPS-1 and 2). Madras (MAPS-1 and 2). Narora (NAPS-1 and 2) and Kakrapar (KAPS-1 and 2). Two more stations, also of 220 MWe capacity, are under construction at Rajasthan (RAPP-3 and 4) and Kaiga (Kaiga-1 and 2). These are natural uranium fuelled pressurized heavy water cooled and heavy water moderated reactors (PHWRs). The two units at Rajasthan viz RAPS-1 and 2, were built with the technical collaboration with Canada, and the rest of the units have been designed and built indigenously, incorporating a number of modifications, particularly in the on-power refuelling system. The evolution of the design of the Fuel Handling Control systems of these reactors, taking into consideration operational needs, safety aspects and maintainability are highlighted in this paper. A combination of hydraulic and electronic control has been provided to enable the operations. In RAPS-1 and 2, hardwired electronic controls were provided, while in MAPS-1 and 2, the hardwired system was improved. From NAPS onwards, a computerized control system with hardwired interlock logic has been provided. New devices like coarse-fine potentiometers, special oil filled potentiometer assembly, rectilinear potentiometers etc., were specified from NAPS onwards. Positioning logic is computerized providing flexibility and expendability. Digital panel meters and indicating lamps have been provided for manual mode operations, while CRT (cathode-ray tube) monitors help in computer mode operations. Hydraulic controls which comprise D{sub 2}0 hydraulics, H{sub 2}0 hydraulics and oil hydraulics have been improved from NAPS onwards. Hydraulic panels have been relocated in accessible areas to reduce radiation doses and for better maintainability. All electric drives including X and Y drives were modified as hydraulic drives for better control. New types of


    Energy Technology Data Exchange (ETDEWEB)

    Tunnard, R.; Greve, T. R. [Department of Physics and Astronomy, University College London, Gower Street, London WC1E 6BT (United Kingdom); Garcia-Burillo, S.; Fuente, A.; Usero, A.; Planesas, P. [Observatorio Astronómico Nacional, Observatorio de Madrid, Alfonso XII, 3, E-28014 Madrid (Spain); Carpio, J. Graciá; Hailey-Dunsheath, S.; Sturm, E. [Max-Planck-Institute for Extraterrestrial Physics (MPE), Giessenbachstraße 1, D-85748 Garching (Germany); Fischer, J. [Naval Research Laboratory, Remote Sensing Division, 4555 Overlook Ave SW, Washington, DC 20375 (United States); González-Alfonso, E.; Neri, R., E-mail: [Universidad de Alcalá de Henares, Departamento de Física y Matemáticas, Campus Universitario, E-28871 Alcalá de Henares, Madrid (Spain)


    We present the results of interferometric spectral line observations of Arp 220 at 3.5 mm and 1.2 mm from the Plateau de Bure Interferometer, imaging the two nuclear disks in H{sup 13}CN(1-0) and (3-2), H{sup 13}CO{sup +}(1-0) and (3-2), and HN{sup 13}C(3-2) as well as SiO(2-1) and (6-5), HC{sup 15}N(3-2), and SO(6{sub 6}-5{sub 5}). The gas traced by SiO(6-5) has a complex and extended kinematic signature including a prominent P Cygni profile, almost identical to previous observations of HCO{sup +}(3-2). Spatial offsets 0.''1 north and south of the continuum center in the emission and absorption of the SiO(6-5) P Cygni profile in the western nucleus (WN) imply a bipolar outflow, delineating the northern and southern edges of its disk and suggesting a disk radius of ∼40 pc, consistent with that found by ALMA observations of Arp 220. We address the blending of SiO(6-5) and H{sup 13}CO{sup +}(3-2) by considering two limiting cases with regards to the H{sup 13}CO{sup +} emission throughout our analysis. Large velocity gradient modeling is used to constrain the physical conditions of the gas and to infer abundance ratios in the two nuclei. Our most conservative lower limit on the [H{sup 13}CN]/[H{sup 13}CO{sup +}] abundance ratio is 11 in the WN, compared with 0.10 in the eastern nucleus (EN). Comparing these ratios to the literature we argue on chemical grounds for an energetically significant active galactic nucleus in the WN driving either X-ray or shock chemistry, and a dominant starburst in the EN.

  8. 42 CFR 484.220 - Calculation of the adjusted national prospective 60-day episode payment rate for case-mix and... (United States)


    ... address changes to the case-mix that are a result of changes in the coding or classification of different...-day episode payment rate for case-mix and area wage levels. 484.220 Section 484.220 Public Health... Calculation of the adjusted national prospective 60-day episode payment rate for case-mix and area wage levels...

  9. 43 CFR 43.220 - By when must I publish my drug-free workplace statement and establish my drug-free awareness... (United States)


    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false By when must I publish my drug-free workplace statement and establish my drug-free awareness program? 43.220 Section 43.220 Public Lands: Interior Office of the Secretary of the Interior GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE WORKPLACE (FINANCIAL ASSISTANCE) Requirements for Recipients...

  10. 29 CFR 1472.220 - By when must I publish my drug-free workplace statement and establish my drug-free awareness... (United States)


    ... 29 Labor 4 2010-07-01 2010-07-01 false By when must I publish my drug-free workplace statement and establish my drug-free awareness program? 1472.220 Section 1472.220 Labor Regulations Relating to Labor (Continued) FEDERAL MEDIATION AND CONCILIATION SERVICE GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE WORKPLACE (FINANCIAL ASSISTANCE) Requirements...

  11. 41 CFR 105-74.220 - By when must I publish my drug-free workplace statement and establish my drug-free awareness... (United States)


    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false By when must I publish my drug-free workplace statement and establish my drug-free awareness program? 105-74.220 Section 105-74.220 Public Contracts and Property Management Federal Property Management Regulations System...

  12. Diverse IgG serum response to novel glycopeptide epitopes detected within immunodominant stretches of Epstein-Barr virus glycoprotein 350/220

    DEFF Research Database (Denmark)

    D'Arrigo, Isotta; Cló, Emiliano; Bergström, Tomas


    /220 and demonstrate a remarkable variability between individual samples with respect to their reactivity patterns to peptides and glycopeptides. The study provides additional insights into the complex B-cell response towards the EBV gp350/220 envelope protein, which may have implications for diagnostic and vaccine...

  13. 30 CFR 250.220 - If I propose activities in the Alaska OCS Region, what planning information must accompany the EP? (United States)


    ... Region, what planning information must accompany the EP? 250.220 Section 250.220 Mineral Resources... activities in the Alaska OCS Region, what planning information must accompany the EP? If you propose exploration activities in the Alaska OCS Region, the following planning information must accompany your EP: (a...

  14. 12 CFR 250.220 - Whether member bank acting as trustee is prohibited by section 20 of the Banking Act of 1933 from... (United States)


    ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Whether member bank acting as trustee is prohibited by section 20 of the Banking Act of 1933 from acquiring majority of shares of mutual fund. 250.220 Section 250.220 Banks and Banking FEDERAL RESERVE SYSTEM (CONTINUED) BOARD OF GOVERNORS OF THE FEDERAL...

  15. Evaluation of transmission methodology and attenuation correction for the microPET Focus 220 animal scanner

    International Nuclear Information System (INIS)

    Lehnert, Wencke; Meikle, Steven R; Siegel, Stefan; Newport, Danny; Banati, Richard B; Rosenfeld, Anatoly B


    An accurate, low noise estimate of photon attenuation in the subject is required for quantitative microPET studies of molecular tracer distributions in vivo. In this work, several transmission-based measurement techniques were compared, including coincidence mode with and without rod windowing, singles mode with two different energy sources ( 68 Ge and 57 Co), and postinjection transmission scanning. In addition, the effectiveness of transmission segmentation and the propagation of transmission bias and noise into the emission images were examined. The 57 Co singles measurements provided the most accurate attenuation coefficients and superior signal-to-noise ratio, while 68 Ge singles measurements were degraded due to scattering from the object. Scatter correction of 68 Ge transmission data improved the accuracy for a 10 cm phantom but over-corrected for a mouse phantom. 57 Co scanning also resulted in low bias and noise in postinjection transmission scans for emission activities up to 20 MBq. Segmentation worked most reliably for transmission data acquired with 57 Co but the minor improvement in accuracy of attenuation coefficients and signal-to-noise may not justify its use, particularly for small subjects. We conclude that 57 Co singles transmission scanning is the most suitable method for measured attenuation correction on the microPET Focus 220 animal scanner

  16. Theoretical models for designing a 220-GHz folded waveguide backward wave oscillator

    International Nuclear Information System (INIS)

    Cai Jin-Chi; Chen Huai-Bi; Hu Lin-Lin; Ma Guo-Wu; Chen Hong-Bin; Jin Xiao


    In this paper, the basic equations of beam-wave interaction for designing the 220 GHz folded waveguide (FW) backward wave oscillator (BWO) are described. On the whole, these equations are mainly classified into small signal model (SSM), large signal model (LSM), and simplified small signal model (SSSM). Using these linear and nonlinear one-dimensional (1D) models, the oscillation characteristics of the FW BWO of a given configuration of slow wave structure (SWS) can be calculated by numerical iteration algorithm, which is more time efficient than three-dimensional (3D) particle-in-cell (PIC) simulation. The SSSM expressed by analytical formulas is innovatively derived for determining the initial values of the FW SWS conveniently. The dispersion characteristics of the FW are obtained by equivalent circuit analysis. The space charge effect, the end reflection effect, the lossy wall effect, and the relativistic effect are all considered in our models to offer more accurate results. The design process of the FW BWO tube with output power of watt scale in a frequency range between 215 GHz and 225 GHz based on these 1D models is demonstrated. The 3D PIC method is adopted to verify the theoretical design results, which shows that they are in good agreement with each other. (paper)

  17. Poly β-Hydroxybutyrate Production by Bacillus subtilis NG220 Using Sugar Industry Waste Water (United States)

    Singh, Gulab; Kumari, Anish; Mittal, Arpana; Yadav, Anita; Aggarwal, Neeraj K.


    The production of poly β-hydroxybutyrate (PHB) by Bacillus subtilis NG220 was observed utilizing the sugar industry waste water supplemented with various carbon and nitrogen sources. At a growth rate of 0.14 g h−1 L−1, using sugar industry waste water was supplemented with maltose (1% w/v) and ammonium sulphate (1% w/v); the isolate produced 5.297 g/L of poly β-hydroxybutyrate accumulating 51.8% (w/w) of biomass. The chemical nature of the polymer was confirmed with nuclear magnetic resonance, Fourier transform infrared, and GC-MS spectroscopy whereas thermal properties were monitored with differential scanning calorimetry. In biodegradability study, when PHB film of the polymer (made by traditional solvent casting technique) was subjected to degradation in various natural habitats like soil, compost, and industrial sludge, it was completely degraded after 30 days in the compost having 25% (w/w) moisture. So, the present study gives insight into dual benefits of conversion of a waste material into value added product, PHB, and waste management. PMID:24027767

  18. A preliminary investigation of 222Rn and 220Rn levels in non-uranium mines in China

    International Nuclear Information System (INIS)

    Shang Bing; Cui Hongxing; Wu Yunyun; Zhang Qingzhao; Su Xu


    Objective: To measure levels of 222 Rn and 220 Rn in typical non-uranium mines, China, and to estimate dose from the occupational radon exposure in the miners. Methods: Using typical sampling scheme, 44 mines were selected in 12 provinces, which can be classified into 4 categories and 17 types of mines. The radon-thoron discriminative detectors were used to measure 222 Rn and 220 Rn concentrations in mines. Result: The concentration of 222 Rn or 220 Rn was log-normally distributed. The arithmetic mean (AM) concentration and geometric mean (GM) concentration of 222 Rn and 220 Rn in 25 metal mines (n=147) were estimated to be (1211 ±2359) Bq/m 3 (AM) and (311 ± 5.5) Bq/m 3 (GM), and (269 ±700) Bq/m 3 (AM) and (71 ± 4.4)Bq/m 3 (GM), respectively. The mean concentrations of 222 Rn and 220 Rn in 18 non-metal mines (n=118) were (98 ± 207) Bq/m 3 (AM) and(55 ± 2.5) Bq/m 3 (GM), and (60 ± 76) Bq/m 3 (AM) and (38 ± 2.4) Bq/m 3 (GM) respectively. In total, we measured 222 Rn concentration in 44 underground mines, 6 of them, accounted for 15%, with the mean radon concentration exceeding 1000 Bqm -3 (limit of workplace in China). Approximately 7% of radon concentration in mines measured were higher than 3700 Bq/m 3 (current limit in uranium mine in China), some points even exceeded 10 000 Bq/m 3 . Based on this typical measurements, the equilibrium factor for 222 Rn was estimated to be 0.33 ± 0.15 in underground mines and 0.47 ±0.18 in nearby houses. Equilibrium factor for 220 Rn ranged from 0.001 to 0.032. Using the data obtained in this typical survey, the average annual effective dose of underground miners exposed to radon and thoron was estimated to be 8.15 mSv/a. Conclusions: High levels of 222 Rn exists in metal mines, such as copper, tin, lead and zinc, gold, and aluminum mines among others. More study and administrative measures are needed to address the radiation protection of workers occupationally exposed to high radon in mines. (authors)


    Energy Technology Data Exchange (ETDEWEB)

    Barcos-Muñoz, L.; Evans, A. S.; Privon, G. C.; Stierwalt, S. [Department of Astronomy, University of Virginia, 530 McCormick Road, Charlottesville, VA 22904 (United States); Leroy, A. K.; Condon, J.; Reichardt, A. [National Radio Astronomy Observatory, 520 Edgemont Road, Charlottesville, VA 22904 (United States); Armus, L. [Spitzer Science Center, California Institute of Technology, MC 220-6, 1200 East California Boulevard, Pasadena, CA 91125 (United States); Mazzarella, J. M.; Murphy, E. J. [Infrared Processing and Analysis Center, MS 100-22, California Institute of Technology, Pasadena, CA 91125 (United States); Meier, D. S. [New Mexico Institute of Mining and Technology, 801 Leroy Place, Socorro, NM 87801 (United States); Momjian, E.; Ott, J. [National Radio Astronomy Observatory, P.O. Box O, 1003 Lopezville Road, Socorro, NM 87801 (United States); Sakamoto, K. [Academia Sinica, Institute of Astronomy and Astrophysics, P.O. Box 23-141, Taipei 10617, Taiwan (China); Sanders, D. B. [Institute for Astronomy, University of Hawaii, 2680 Woodlawn Drive, Honolulu, HI 96816 (United States); Schinnerer, E.; Walter, F. [Max-Planck-Institut für Astronomie, Königstuhl 17, D-69117 Heidelberg (Germany); Surace, J. A. [Spitzer Science Center, MS 314-6, California Institute of Technology, Pasadena, CA 91125 (United States); Thompson, T. A., E-mail: [Department of Astronomy and Center for Cosmology and Astro-Particle Physics, The Ohio State University, Columbus, OH 43210 (United States)


    We present new Karl G. Jansky Very Large Array radio continuum images of the nuclei of Arp 220, the nearest ultra-luminous infrared galaxy. These new images have both the angular resolution to study the detailed morphologies of the two nuclei that power the galaxy merger and sensitivity to a wide range of spatial scales. At 33 GHz, we achieve a resolution of 0.''081 × 0.''063 (29.9 × 23.3 pc) and resolve the radio emission surrounding both nuclei. We conclude from the decomposition of the radio spectral energy distribution that a majority of the 33 GHz emission is synchrotron radiation. The spatial distributions of radio emission in both nuclei are well described by exponential profiles. These have deconvolved half-light radii (R {sub 50d}) of 51 and 35 pc for the eastern and western nuclei, respectively, and they match the number density profile of radio supernovae observed with very long baseline interferometry. This similarity might be due to the fast cooling of cosmic rays electrons caused by the presence of a strong (∼mG) magnetic field in this system. We estimate extremely high molecular gas surface densities of 2.2{sub −1.0}{sup +2.1}×10{sup 5} (east) and 4.5{sub −1.9}{sup +4.5}×10{sup 5} (west) M {sub ☉} pc{sup –2}, corresponding to total hydrogen column densities of N {sub H} = 2.7{sub −1.2}{sup +2.7}×10{sup 25} (east) and 5.6{sub −2.4}{sup +5.5}×10{sup 25} cm{sup –2} (west). The implied gas volume densities are similarly high, n{sub H{sub {sub 2}}}∼3.8{sub −1.6}{sup +3.8}×10{sup 4} (east) and ∼11{sub −4.5}{sup +12}×10{sup 4} cm{sup –3} (west). We also estimate very high luminosity surface densities of Σ{sub IR}∼4.2{sub −0.7}{sup +1.6}×10{sup 13} (east) and Σ{sub IR}∼9.7{sub −2.4}{sup +3.7}×10{sup 13} (west) L{sub ⊙} kpc{sup −2}, and star formation rate surface densities of Σ{sub SFR} ∼ 10{sup 3.7} {sup ±} {sup 0.1} (east) and Σ{sub SFR} ∼ 10{sup 4.1} {sup ±} {sup 0.1}(west) M

  20. Seasonal and spatial variations in Rn-222 and Rn-220 in soil gas, and implications for indoor radon levels

    International Nuclear Information System (INIS)

    Sharman, G.


    Rn-222 enters dwellings as a component of soil gas drawn from the soil by mass flow driven by the pressure difference between the house and soil beneath. In a site on Northampton Sand Ironstone (Aalenian), a preferred path of emanation (hotspot) was found. A difference of 63 Bq L -1 Rn-222 was recorded in July between this point and another 3 m away. Rn-222 in this hotspot shows 12% less variation annually than the surrounding rock. During winter, Rn-222 values within 1.6 m of the house were 44% lower than those at more than 4 m away. Rn-222 showed a 99.5% negative correlation with wind run, showing that on this soil wind pressure can significantly reduce radon in the soil at 500 mm depth. Rn-220 in soil gas correlated positively at the 99.5% level with grass and air temperatures. Rn-220 was not associated with the hotspot. (Author)

  1. Excitation Potentials and Shell Corrections for the Elements Z2=20 to Z2=30

    DEFF Research Database (Denmark)

    Andersen, H.H.; Sørensen, H.; Vadja, P.


    Excitation potentials and shell corrections for the elements Z 2=20 to Z2=30 are evaluated from experimental stopping-power data for 5-12-MeV protons and deuterons. Use is made of Walske's K- and L-shell corrections and shell corrections calculated by Bonderup (1967) on the basis of the Thomas-Fe...... are found by means of Bonderup's shell corrections. Within the Z2 interval treated here, it is found that I/Z2 increases with increasing Z2, contrary to the general trend through the periodic system of elements......Excitation potentials and shell corrections for the elements Z 2=20 to Z2=30 are evaluated from experimental stopping-power data for 5-12-MeV protons and deuterons. Use is made of Walske's K- and L-shell corrections and shell corrections calculated by Bonderup (1967) on the basis of the Thomas...

  2. The influence of soil water status on Oryza Sativa Var. MR220 in KADA rice agroecosystem

    International Nuclear Information System (INIS)

    Nashriyah Mat; Ismail Che Haron; Mazleha Maskin; Mohd Razi Ismail


    A study to determine the influence of soil water status on rice plant Oryza sativa var. MR220 after panicle initiation stage was carried out at Ladang Merdeka Mulong Lating in the Kemubu Agricultural Development Authority (KADA) area, Kelantan. Five water management treatments imposed on direct seeded rice were; T1. Continuous flooding, T2. Early flooding up to panicle initiation stage followed by saturated (F55-saturated), T3. Early flooding for the first month followed by saturated (F-30 saturated), T4. Continuous saturated, and T5. Continuous field capacity condition throughout the growth stage. The treatments were arranged in Randomized Complete Block Design (RCBD) with four replicates. Results showed significant differences in soil moisture content in the order of T1>T2>T3>T4>T5. Significant differences were also observed in rice plant water content at 68 DAS (days after seeding) in the order of T2>T3>T4>T1>T5. Moisture content also showed significant differences between replicates in the order of R1>R2>R3>R4 and R2>R1>R3>R4; in rice plant and ricefield soil, respectively. Results however showed no significant difference in leaf stomatal conductance due to water stress. Rice plant moisture, soil moisture and leaf stomatal conductance showed no interaction. Published results show that even though overall crop yield was reduced by sheath blight and panicle blast incidence that occur at later stage in 2004-2005 field trials, highest grain yields were obtained from T2 (off season) and T4 (main season). Saturated condition seems to be the most suitable method of growing rice under minimal water input in KADA rice agroecosystem. (Author)

  3. Distinction of [220] and [204] textures of Cu(In,Ga)Se{sub 2} film and their growth behaviors depending on substrate nature and Na incorporation

    Energy Technology Data Exchange (ETDEWEB)

    Cho, Dae-Hyung, E-mail: [IT Components and Materials Industry Technology Research Department, Electronics and Telecommunications Research Institute (ETRI), 218 Gajeongno, Yuseong-gu, Daejeon 305-700 (Korea, Republic of); Kim, Jeha [Department of Solar & Energy Engineering, Cheongju University, 298 Daeseongro, Sangdang-gu, Cheongju, Chungbuk 360-764 (Korea, Republic of); Chung, Yong-Duck [IT Components and Materials Industry Technology Research Department, Electronics and Telecommunications Research Institute (ETRI), 218 Gajeongno, Yuseong-gu, Daejeon 305-700 (Korea, Republic of); Korea University of Science and Technology (UST), 217 Gajeongno, Yuseong-gu, Daejeon 305-350 (Korea, Republic of)


    For better understanding of the structural property of polycrystalline tetragonal Cu(In,Ga)Se{sub 2} (CIGS) thin films grown on soda-lime glass, it is necessary to characterize the [220]- and [204]-oriented textures clearly that are related to the different physical properties. However, the distinction between the [220]- and [204]-oriented textures is very difficult because of their nearly identical plane spacings and atomic arrangements. Using X-ray diffraction techniques of high resolution θ–2θ scanning and reciprocal space mapping, we distinguished the [220]- and [204]-oriented textures of CIGS films and observed that the behaviors of [220] and [204] textures independently depended on both substrate nature and Na presence. We report the Na- and substrate-related dependence of the physical properties of the CIGS film was attributed to the independent growth behaviors of the [220] and [204] textures in the CIGS. - Highlights: • We investigated [220]- and [204]-oriented textures of Cu(In,Ga)Se{sub 2} (CIGS) films. • X-ray diffraction methods distinguished two textures. • The growth behaviors were influenced by underlying substrate and Na. • The [220] and [204] textures in CIGS should be differentially observed.

  4. VizieR Online Data Catalog: Spectrum of VY CMa in 220.65-224.25GHz range (Kaminski+, 2013) (United States)

    Kaminski, T.; Gottlieb, C. A.; Menten, K. M.; Patel, N. A.; Young, K. H.; Brunken, S.; Muller, H. S. P.; McCarthy, M. C.; Winters, J. M.; Decin, L.


    A spectrum of VY Canis Majoris obtained with the Plateau de Bure Interferometer on 22 April and 13 October 2012 in the frequency range 220.65-224.25GHz. The interferometer was used in its D configuration with six antennas and the synthesized beam was 4.9x2.2-arcsec. The spectrum was extracted from the central pixel of the map obtained with the gridding of 0.65-arcsec. (2 data files).

  5. [The jokes are vectors of stereotypes. Example of the medical profession from 220 jokes]. (United States)

    Maurin, Damien; Pacault, Clément; Galès, Brieuc


    Sociological studies have shown the link between humor and unconscious ideas that we have of the society in which we evolve. We conducted a survey to answer the question: "What were the stereotypes of our medical profession that emerge from a transcript of jokes collected in a medical population?" Recruitment of the source population (doctors and medical students) was done through different personal and professional mailing lists, Twitter, Facebook, medical press. The inclusion period was six weeks (from June 6 to July 14, 2013). Each physician recruited received the link to our blog: which contained a link to the questionnaire. Physicians responded to the following proposition: "tell the joke involving doctors you laugh the most". Analysis of jokes was made by three investigators. Firstly, two investigators (DM and CP) and pooled of results to generate a stereotype for each joke. Then a triangulation was made with a third investigator (BG), to determine the final stereotype. Five hundred and twelve jokes have been collected on the site and 448 were included in the analysis, representing 220 jokes. The gender of respondents was 284 men (63%) and 164 women (37%), a ratio of 1.7. One hundred and fifty-six different stereotypes were classified into six themes: 46 stereotypes 'the vicissitudes of the medical profession'; 45 'hospital', the war of the block; 34 'personality traits doctor'; 14 'psychiatrist'; 12 'physician and sexuality'; 5 'medical studies and carabin woes'. Anesthetists were represented as lazy, inveterate coffee drinkers and less awakened than their sleeping patients. Surgeons were seen as megalomaniacal, tyrannical with other professions, operating without thinking, as their brain down to a neuron. Medical students appeared docile and absurd. Psychiatrists were as crazy as their patients, sometimes passing them to the consultation and looking only at their past relationship. Other stereotypes of doctors were used

  6. X-Ray Emission from the Nuclear Region of Arp 220 (United States)

    Paggi, Alessandro; Fabbiano, Giuseppina; Risaliti, Guido; Wang, Junfeng; Karovska, Margarita; Elvis, Martin; Maksym, W. Peter; McDowell, Jonathan; Gallagher, Jay


    We present an imaging and spectral analysis of the nuclear region of the ultraluminous infrared galaxy merger of Arp 220, using deep Chandra-ACIS observations summing up to ˜ 300 {{ks}}. Narrowband imaging with subpixel resolution of the innermost nuclear region reveals two distinct Fe-K emitting sources, coincident with the infrared and radio nuclear clusters. These sources are separated by 1‧ (˜380 pc). The X-ray emission is extended and elongated in the eastern (E) nucleus, like the disk emission observed in millimeter radio images, suggesting a starburst dominance in this region. We estimate an Fe-K equivalent width of ≳ 1 {keV} for both sources and observe 2-10 keV luminosities of ˜ 2× {10}40 {{erg}} {{{s}}}-1 (western, W) and ˜ 3× {10}40 {{erg}} {{{s}}}-1 (E). In the 6-7 keV band the emission from these regions is dominated by the 6.7 keV Fe xxv line, suggesting a contribution from collisionally ionized gas. The thermal energy content of this gas is consistent with the kinetic energy injection in the interstellar medium by SNe II. However, nuclear winds from a hidden active galactic nucleus (AGN) (\\upsilon ˜ 2000 {{km}} {{{s}}}-1) cannot be excluded. The 3σ upper limits on the neutral Fe-Kα flux of the nuclear regions correspond to the intrinsic AGN 2-10 keV luminosities of < 1× {10}42 {{erg}} {{{s}}}-1 (W) and < 0.4× {10}42 {{erg}} {{{s}}}-1 (E). For typical AGN spectral energy distributions the bolometric luminosities are < 3× {10}43 {{erg}} {{{s}}}-1 (W) and < 8× {10}43 {{erg}} {{{s}}}-1 (E), and black hole masses of < 1× {10}5 {M}⊙ (W) and < 5× {10}5 {M}⊙ (E) are evaluated for Eddington limited AGNs with a standard 10% efficiency.

  7. Election Districts and Precincts, PrecinctPoly-The data set is a polygon feature consisting of 220 segments representing voter precinct boundaries., Published in 1991, Davis County Government. (United States)

    NSGIC Local Govt | GIS Inventory — Election Districts and Precincts dataset current as of 1991. PrecinctPoly-The data set is a polygon feature consisting of 220 segments representing voter precinct...

  8. Dimensional verification and location of the reactive static compensator in 220 kV; Verificacion del dimensionamiento y ubicacion del compensador estatico de reactivos en 220 kV

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez Krekeler, Ubaldo [Administracion Nacional de Electricidad (ANDE), Asuncion (Paraguay)]. E-mail:; Cardozo Sanchez, Freddy [Mirant Americas (United States)


    This work presents a determination verification of the compensation range and the location of reactive static compensator (RSC) in 220 kV. The verification is accomplished by analyses of the RSC effects in relation to the losses, loading and system voltage stability. The needed compensation range is investigated in full details, whereas that the required conversion level is directly related to this range. It is concluded that the RSC installation, foreseen for 2002, might be postponed for 2005/10 still without reinforcements in 500 kV. The Limpio substation seems to be the more suitable location in relation to the most analysed cases.

  9. Impact of SSSC on Measured Impedance in Single Phase to Ground Fault Condition on 220 kV Transmission Line

    Directory of Open Access Journals (Sweden)

    Mohamed ZELLAGUI


    Full Text Available This paper presents and compares the impact of SSSC on measured impedance for single phase to ground fault condition. The presence of Static Synchronous SSSC on a transmission line has a great influence on the ZRelay in distance protection. The protection of the high voltage 220 kV single circuit transmission line in eastern Algerian electrical transmission networks is affected in the case with resistance fault RF. The paper investigate the effect of Static Synchronous Series Compensator (SSSC on the measured impedance (Relay taking into account the distance fault point (n and fault resistance (RF. The resultants simulation is performed in MATLAB software environment.

  10. Measurements of octupole collectivity in $^{220,222}$Rn and $^{222,224}$Ra using Coulomb excitation

    CERN Multimedia

    Kruecken, R; Larsen, A; Hurst, A M; Voulot, D; Grahn, T; Clement, E; Wadsworth, R; Gernhaeuser, R A; Siem, S; Huyse, M L; Iwanicki, J S


    We propose to exploit the unique capability of ISOLDE to provide post-accelerated $^{220,222}$Rn and $^{222,224}$Ra ion beams from the REX facility to enable the Coulomb excitation of the first 3$^{-}$ states in these nuclei. By measuring the $\\gamma$-ray yields of the E1 decays from the 3$^{-}$ state using the MINIBALL array we can obtain the transition matrix elements. This will give quantitative information about octupole correlations in these nuclei. We require 22 shifts to fulfil the aims of the experiment.

  11. Empleo de la Tarjeta Amarilla y el Formato NOM220 para las notificaciones de sospechas de reacciones adversas a medicamentos

    Directory of Open Access Journals (Sweden)

    Lourdes Cristina Carrillo-Alarcón

    Full Text Available Introducción: la notificación de reacciones adversas a medicamentos es una obligación a nivel mundial. Aunque se han establecido muchas metodologías para esta acción, en la actualidad existen problemas. Objetivo: determinar la frecuencia de sospecha de reacciones adversas a la administración de medicamentos en pacientes y comparar la accesibilidad del llenado del formato de la NOM220 de la Secretaría de Salud y la Tarjeta Amarilla propuesta por la Organización Mundial de la Salud. Métodos: estudio transversal y observacional. Participaron 50 médicos responsables de las clínicas de diabetes del Estado de Hidalgo. Inicialmente, los médicos fueron capacitados para identificar las sospechas de reacciones adversas a la administración de medicamentos en los pacientes atendidos. Se realizó un diseño cruzado, en el que el 50 % de los médicos utilizaron por tres meses el formato de la NOM220 y 50 % la Tarjeta Amarilla. Después intercambiaron formatos y los utilizaron durante los tres meses siguientes. Al cabo de este periodo, respondieron un cuestionario para determinar la utilidad, claridad, tiempo de llenado y practicidad de ambos formatos. Se realizó estadística descriptiva y análisis bivariado para determinar los factores asociados a las sospecha de reacciones adversas a medicamentos, con el software SPSS (versión 17. Resultados: se registraron 46 sospechas de reacciones adversas a medicamentos en 46 pacientes con el formato de la NOM220 y 78 sospechas de reacciones adversas a medicamentos con la Tarjeta Amarilla en 78 pacientes. Todas las sospechas de reacciones adversas a la administración de medicamentos fueron tipo A. Los médicos recomiendan la utilización de la Tarjeta Amarilla, consideran claro el formato, sencillo, legible, fácil de llenar, entendible y accesible (p< 0,05. Conclusiones: los resultados permiten proponer la Tarjeta Amarilla como una alternativa más accesible para la notificación de sospechas de

  12. Kidins220/ARMS depletion is associated with the neural-to Schwann-like transition in a human neuroblastoma cell line model. (United States)

    Rogers, Danny A; Schor, Nina F


    Peripheral neuroblastic tumors exist as a heterogeneous mixture of neuroblastic (N-type) cells and Schwannian stromal (S-type) cells. These stromal cells not only represent a differentiated and less aggressive fraction of the tumor, but also have properties that can influence the further differentiation of nearby malignant cells. In vitro neuroblastoma cultures exhibit similar heterogeneity with N-type and S-type cells representing the neuroblastic and stromal portions of the tumor, respectively, in behavior, morphology, and molecular expression patterns. In this study, we deplete kinase D-interacting substrate of 220kD (Kidins220) with an shRNA construct and thereby cause morphologic transition of the human SH-SY5Y neuroblastoma cell line from N-type to S-type. The resulting cells have similar morphology and expression profile to SH-EP1 cells, a native S-type cell line from the same parent cell line, and to SH-SY5Y cells treated with BrdU, a treatment that induces S-type morphology. Specifically, both Kidins220-deficient SH-SY5Y cells and native SH-EP1 cells demonstrate down-regulation of the genes DCX and STMN2, markers for the neuronal lineage. We further show that Kidins220, DCX and STMN2 are co-down-regulated in cells of S-type morphology generated by methods other than Kidins220 depletion. Finally, we report that the association of low Kidins220 expression with S-type morphology and low DCX and STMN2 expression is demonstrated in spontaneously occurring human peripheral neuroblastic tumors. We propose that Kidins220 is critical in N- to S-type transition of neural crest tumor cells. Copyright © 2013 Elsevier Inc. All rights reserved.

  13. Demonstration of a High-Order Mode Input Coupler for a 220-GHz Confocal Gyrotron Traveling Wave Tube (United States)

    Guan, Xiaotong; Fu, Wenjie; Yan, Yang


    A design of high-order mode input coupler for 220-GHz confocal gyrotron travelling wave tube is proposed, simulated, and demonstrated by experimental tests. This input coupler is designed to excite confocal TE 06 mode from rectangle waveguide TE 10 mode over a broadband frequency range. Simulation results predict that the optimized conversion loss is about 2.72 dB with a mode purity excess of 99%. Considering of the gyrotron interaction theory, an effective bandwidth of 5 GHz is obtained, in which the beam-wave coupling efficiency is higher than half of maximum. The field pattern under low power demonstrates that TE 06 mode is successfully excited in confocal waveguide at 220 GHz. Cold test results from the vector network analyzer perform good agreements with simulation results. Both simulation and experimental results illustrate that the reflection at input port S11 is sensitive to the perpendicular separation of two mirrors. It provides an engineering possibility for estimating the assembly precision.

  14. Effectiveness of the Top-Down Nanotechnology in the Production of Ultrafine Cement (~220 nm

    Directory of Open Access Journals (Sweden)

    Byung-Wan Jo


    Full Text Available The present investigation is dealing with the communition of the cement particle to the ultrafine level (~220 nm utilizing the bead milling process, which is considered as a top-down nanotechnology. During the grinding of the cement particle, the effect of various parameters such as grinding time (1–6 h and grinding agent (methanol and ethanol on the production of the ultrafine cement has also been investigated. Performance of newly produced ultrafine cement is elucidated by the chemical composition, particle size distribution, and SEM and XRD analyses. Based on the particle size distribution of the newly produced ultrafine cement, it was assessed that the size of the cement particle decreases efficiently with increase in grinding time. Additionally, it is optimized that the bead milling process is able to produce 90% of the cement particle <350 nm and 50% of the cement particle < 220 nm, respectively, after 6.3 h milling without affecting the chemical phases. Production of the ultrafine cement utilizing this method will promote the construction industries towards the development of smart and sustainable construction materials.

  15. Three dimensional reconstruction of activity profiles in 220 liters radioactive waste packages containing super-compacted 100 liters drums

    International Nuclear Information System (INIS)

    Van Velzen, L.P.M.; Maes, J.


    The 3DRedact project's main objective is the development of a non-destructive assay (NDA) system that can replace emission computer tomography (ECT) and transmission computer tomography (TCT) for the routine characterization of decayed radioactive waste 220 liters drums. The existing fast NDA scan system has been extended with a transmission system that fulfils the requirements of fast scan measurements. The design parameters and engineering are described. As a consequence of this extension the analyze program HOLIS had to be updated, so that HOLIS can make full advantage of the transmission data generated by the analysis of a 220 liters waste drum, containing different super compacted drums. The achievements of the new HOLIS version are presented. As a first assessment, based on the presented tests results, the accuracy of the calculated coordinates of hotspots can be assessed for all coordinates ± 1 cm and for the activity of the hot-spot ± 5 %. These accuracies are within the predefined requirements e.g. coordinates uncertainty ± 2 cm and activity less than 10 %. Further, additional safety systems have been installed to improve a healthy and save working environment. (authors)

  16. Measurement of 222Rn, 220Rn and their decay products in high background radiation area in Yangjiang

    International Nuclear Information System (INIS)

    Yuan Yongling


    The investigators have measured concentrations of Rn-222, rn-220 and their decay products in high background radiation area (HBRA) and the neighboring control area (CA), as well as the equilibrium factor F for Rn-222. The average concentrations of Rn-222 in the air indoors and outdoors in the HBRA are 42.6 and 17.3 Bq/m 3 respectively, and CA, 13.2 and 11.7 Bq/m 3 , respectively. The average α-potential energy concentrations for daughters of Rn-222 indoors and outdoors in HBRA are 0.109 and 0.051 μJ/m 3 , CA, 0.045 and 0.041 μJ/m 3 , respectively. The average α-potential energy values for daughters of Rn-220 indoor and outdoor in HBRA are 0.249 and 0.053 μJ/m 3 , CA, 0.051 and 0.025 μJ/m 3 , respectively. With regard to equilibrium factor F for Rn-222, the authors have also measured 52 points of 10 hamlets in HBRA (indoor 31, outdoor 21), 9 points of 2 hamlets in CA (indoor 5, outdoor 4), respectively. These figures are 0.46, 0.53, 0.62 and 0.64, respectively

  17. Changing profile of infective endocarditis: a clinicopathologic study of 220 patients in a single medical center from 1998 through 2009. (United States)

    Li, Li; Wang, Hongyue; Wang, Linlin; Pu, Jielin; Zhao, Hong


    The epidemiologic profile of infective endocarditis has changed substantially over the past few years, especially in industrialized countries. Our study evaluates the clinical and pathologic characteristics of infective endocarditis patients treated by cardiac surgery in China during a 12-year period. We retrospectively evaluated 220 surgically treated infective endocarditis patients and analyzed their changes from the beginning of 1998 through 2009. The mean age of the patients increased from 36.9 to 42.7 years during those 12 years (P=0.036). The chief predisposing disease was congenital heart disease (32.8%), rather than rheumatic heart disease (13.2%); this rate did not change significantly during the 12 years. The prevalent congenital lesion was bicuspid aortic valve, the rate of which (55.6%) increased significantly over the 3 time intervals studied (P=0.016). The frequency of infective endocarditis after non-dental surgical and nonsurgical intervention was significantly greater (23.3%) during 1998 through 2001, compared with the 2 intervals that followed (9%; P=0.019). Streptococcus viridans was the most frequent causative agent overall (25.6%). Forty-seven of the 220 patients (21.4%) carried the clinical diagnosis of some other form of heart disease before surgery, but at surgery they were found to have infective endocarditis as the fundamental disease process. Of 47 patients, 33 (70.2%) had either very small or no vegetations but had focal necrosis and inflammation of valve tissue that supported the diagnosis of infective endocarditis.

  18. Características e desempenho agronômico no Paraná da cultivar de trigo BRS 220 Characteristics and agronomic performance in Paraná State of wheat cultivar BRS 220

    Directory of Open Access Journals (Sweden)

    Manoel Carlos Bassoi


    Full Text Available A cultivar BRS 220, indicada para todas as regiões tritícolas do Paraná, apresenta elevado potencial de rendimento, ampla adaptação e é dotada de força de glúten que a inclui na classe de trigo pão. É resistente às ferrugens e moderadamente resistente às manchas foliares, à brusone e ao vírus-do-mosaico. É moderadamente suscetível à giberela e ao oídio. Apresenta ciclo de precoce a médio, altura média de planta, boa resistência ao acamamento e moderada tolerância ao alumínio tóxico. É moderadamente tolerante à debulha e suscetível à germinação pré-colheita. Apresentou, nos cinco anos de experimentação, média de rendimento de grãos da ordem de 4.853 kg ha-1, na região 6, 3.794 kg ha-1, na região 7, e 4.039 kg ha-1, na região 8, superando a média das cultivares testemunhas em 5%, 13% e 8%, respectivamente.The cultivar BRS 220, recommended for all wheat growing regions in the Paraná State, has shown a high yield potential, wide adaptation and resistance to the main diseases, presenting a gluten suitable for baking. The cultivar belongs to medium maturity group and presents medium height, high resistance to lodging, moderate tolerance to toxic aluminium, moderate tolerance to natural dehiscence but it is susceptible to preharvest sprouting (PHS. In the experimentation over five years, BRS 220 presented a grain yield average of 4,853 kg ha-1 in the region 6, 3,794 kg ha-1 in the region 7 and 4,039 kg ha-1 in the region 8, surpassing 5%, 13% and 8% the average of the local cultivars, respectively.

  19. Measurements of Rn-222, Rn-220 and their decay products in the environmental air of the high background radiation areas in Yangjiang, China

    International Nuclear Information System (INIS)

    Yuan Yongling; Shen Tong; Morishima, Hiroshige; Koga, Taeko; Wei Luxin; Sugahara, Tsutomu


    For the renewal of dose estimation from internal irradiation in the high background radiation areas (HBRA) of Yangjiang, the measurements of radon, thoron and their decay products in the environmental air were conducted, including: integrating measurements of Rn-222 and Rn-220 concentrations; equilibrium factor F for Rn-222 and alpha-potential energy value of Rn-220; external gamma radiation in places where radon measurements were undertaken; cumulative exposure to indoor radon for each family in a case-control study on lung cancer. The Rn-Tn cup monitor method was used for the integrating measurement of Rn-222 and Rn-220 concentration. An alpha track detector was used for the integration measurement of Rn-222 concentration in the case-control study on lung cancer. The results of measurements show that although the investigated areas are located between the Equator and the Tropic of Cancer, and that people live in well-ventilated dwellings, the concentrations of radon, especially of Rn-220 are significantly higher in the indoor air of HBRA than those in the control area. The value of equilibrium factors for Rn-222, the alpha potential energy of decay products from Rn-222 and Rn-220 are determined. (author)

  20. Vitelline coat of Unio elongatulus: III. Glycan chain analysis of the 220- and 180-kD components by means of lectins. (United States)

    Focarelli, R; Leotta, F; Lampariello, R; Rosati, F


    Lectins of different binding specificity were used to analyze the oligosaccharide chains of the 220- and 180-kD proteins of the Unio elongatulus egg vitelline coat (vc). The lectins ConA and RCA1 reacted with both glycoproteins, and four other lectins reacted with one or other vc components. The lectin from Galanthus nivalis, which recognizes terminal mannose residues of N-linked high mannose type oligosaccharide chains, bound specifically to the 180-kD protein. Binding sites for this lectin were found throughout the vc of the differentiating oocyte and the mature egg. Lectins specific for the O-linked oligosaccharide chains, such as AIA and PNA, reacted only with the 220-kD protein species. Binding sites for these lectins were found only in the crater region. The presence of fucosyl residues on the glycan chains was investigated with lectins from Lotus tetragonolobus and Aleuria aurantia. The latter was positive on both glycoproteins, whereas LTA was only positive to the 220-kD species. The binding sites of both these lectins were in the same areas as those of PNA and AIA. These results suggest that while the 180-kD protein is part of the entire vc structure, the 220-kD protein is prevalently accumulated in the crater region. Since this is where sperm recognition and interaction take place, it has been suggested the 220-kD protein acts as a ligand molecule in the sperm-egg interaction.

  1. Voltage and reactive power in the 380/220 kV power network of the new German Laender - state and prospects. Spannung und Blindleistung im 380/220-kV-Verbundnetz der neuen Bundeslaender - Stand und Ausblick

    Energy Technology Data Exchange (ETDEWEB)

    Behnke, M; Luettig, K; Radtke, H [Verbundnetz Elektroenergie AG, Berlin (Germany)


    With the preparation for restoring a German power network after nearly 40 years of separate development of the EES of the former DDR, the voltage/reactive power regulation must be examined and evaluated in the conditions of: - parting the connections to the present VES partners Poland and Czechoslovakia with the option of rectification - taking up parallel operation with the adjacent network undertakings of the old West German Laender (Preussen Elektra AG and Bayernwerke AG), ie: combined operation with DVG (superregional network of old West German Laender) and UCPTE (European electrical energy union). The aim is to configure this in the 380/220 kV network of the new German Laender, so that with a regionally compensated reactive power system, the voltage can be kept steady much better at times of heavy and light load, and the network losses can be reduced. (orig./GL).

  2. Energy-dependent etching-related impacts on CR-39 alpha detection efficiency for the Rn-222 and Rn-220 decay chains (United States)

    Tan, Y.; Yuan, H.; Kearfott, K. J.


    CR-39 detectors are widely used to measure environmental levels of Rn-222, Rn-220 and their progeny. Prior research reported the CR-39 detection efficiency for alpha particles from Rn-222, Rn-220 and their progeny under a variety of etching conditions. This paper provides an explanation for interesting observations included in that work, namely that the critical incidence angle decreases with the increasing particle energy and the detection efficiency for 8.78 MeV alpha particles is zero. This paper explains these phenomena from a consideration of the interaction of alpha particles with the CR-39 detectors and the physics of etching dynamics. The proposed theory provides a rationale for an approach to optimizing the etching conditions of CR-39 detector for measuring Rn-222, Rn-220 and their progenies.

  3. Design of real-time monitoring and control system of 222Rn/220Rn sampling for radon chamber

    International Nuclear Information System (INIS)

    Wu Rongyan; Zhao Xiuliang; Zhang Meiqin; Yu Hong


    This paper describes the design of 222 Rn/ 220 Rn sampling monitoring and control system based on single-chip microcomputer of series Intel51. The hardware design involves the choosing and usage of sensors-chips, A/D conversion-chip, USB interface-chip, keyboard-chip, digital display-chip, photoelectric coupling isolation-chips and drive circuit-chips of the direct current pump. Software design is composed by software of Personal Computer (PC) and software of Single Chip Microcomputer (SCM). The data acquisition and conversion and the flux control of direct current pump are realized by using soft of Visual Basic and assemble language. The program flow charts are given. Furthermore, we improved the stability of the direct current pump by means of PID Control Algorithms. (authors)

  4. First electrons from the new 220 TW Frascati Laser for Acceleration and Multidisciplinary Experiments (FLAME) at Frascati National Laboratories (LNF)

    International Nuclear Information System (INIS)

    Levato, T.; Calvetti, M.; Anelli, F.; Batani, D.; Benocci, R.; Cacciotti, L.; Cecchetti, C.A.; Cerafogli, O.; Chimenti, P.; Clozza, A.; Drenska, N.; Esposito, A.; Faccini, R.; Fioravanti, S.; Gamucci, A.; Gatti, C.; Giulietti, A.; Giulietti, D.; Labate, L.; Lollo, V.


    A new era of laser based plasma accelerators is emerging following the commissioning of many high power laser facilities around the world. Extremely short (tens of fs) laser pulses with energy of multi-joules level are available at these newly built facilities. Here we describe the new 220 TW FLAME facility. In particular we discuss the laser system general layout, the main measurements on the laser pulse parameters, the underground target area. Finally we give an overview of the first results of the Self-Injection Test Experiment (SITE), obtained at a low laser energy. This initial low laser energy experimental campaign was necessary for the validation of the radio-protection shielding (Esposito, 2011 [1]) we discuss here. With respect to our preliminary configuration, with a pulse duration of 30 fs and a focusing optic of F/15, we discuss here the minimum laser energy requirements for electron acceleration and the forward transmitted optical radiation

  5. Quantum efficiency of cesium iodide photocathodes in the 120-220 nm spectral range traceable to a primary detector standard

    CERN Document Server

    Rabus, H; Richter, M; Ulm, G; Friese, J; Gernhäuser, R; Kastenmüller, A; Maier-Komor, P; Zeitelhack, K


    Differently prepared CsI samples have been investigated in the 120-220 nm spectral range for their quantum efficiency, spatial uniformity and the effect of radiation aging. The experiments were performed at the PTB radiometry laboratory at the Berlin synchrotron radiation facility BESSY. A calibrated GaAsP Schottky photodiode was used as transfer detector standard to establish traceability to the primary detector standard, because this type of photodiode - unlike silicon p-on-n photodiodes - proved to be of sufficiently stable response when exposed to vacuum ultraviolet radiation. The paper reviews the experimental procedures that were employed to characterize and calibrate the GaAsP photodiode and reports the results that were obtained on the investigated CsI photocathodes.

  6. Pro-dopamine regulator, KB220Z, attenuates hoarding and shopping behavior in a female, diagnosed with SUD and ADHD. (United States)

    McLaughlin, Thomas; Blum, Kenneth; Steinberg, Bruce; Modestino, Edward J; Fried, Lyle; Baron, David; Siwicki, David; Braverman, Eric R; Badgaiyan, Rajendra D


    Background Addictive-like behaviors (e.g., hoarding and shopping) may be the result of the cumulative effects of dopaminergic and other neurotransmitter genetic variants as well as elevated stress levels. We, therefore, propose that dopamine homeostasis may be the preferred goal in combating such challenging and unwanted behaviors, when simple dopaminergic activation through potent agonists may not provide any resolution. Case presentation C.J. is a 38-year-old, single, female, living with her mother. She has a history of substance use disorder as well as attention deficit hyperactivity disorder, inattentive type. She had been stable on buprenorphine/naloxone combination and amphetamine, dextroamphetamine mixed salts for many years when unexpectedly she lost her job for oversleeping and not calling into work. KB200z (a pro-dopamine compound) was added to her regimen for complaints of low drive and motivation. After taking this nutraceutical for 4 weeks, she noticed a marked improvement in her mental status and many behaviors. She noted that her shopping and hoarding addictions had appreciably decreased. Furthermore, her lifelong history of terrifying lucid dreams was eliminated. Finally, she felt more in control; her locus of control shifted from external to more internal. Discussion The hypothesis is that C.J.'s reported, behavioral, and psychological benefits resulted from the pro-dopamine-regulating effect of KB220Z across the brain reward system. Conclusions This effect, we surmise, could be the result of a new dopamine balance, across C.J.'s brain reward system. Dopamine homeostasis is an effect of KB220Z seen in both animal and human placebo-controlled fMRI experiments.

  7. Use of Activated Charcoal for 220Rn Adsorption for Operations Associated with the Uranium Deposit in the Auxiliary Charcoal Bed at the Molten Salt Reactor Experiment Facility

    International Nuclear Information System (INIS)

    Coleman, R.L.


    Measurements have been collected with the purpose of evaluating the effectiveness of activated charcoal for the removal of 220 Rn from process off-gas at the Molten Salt Reactor Experiment (MSRE) at Oak Ridge National Laboratory. A series of bench-scale tests were performed at superficial flow velocities of 10, 18, 24, and 33 cm/s (20, 35, 47, and 65 ft/min) with a continuous input concentration of 220 Rn in the range of 9 x 10 3 pCi/L. In addition, two tests were performed at the MSRE facility by flowing helium through the auxiliary charcoal bed uranium deposit. These tests were performed so that the adsorptive effectiveness could be evaluated with a relatively high concentration of 220 Rn. In addition to measuring the effectiveness of activated charcoal as a 220 Rn adsorption media, the source term for available 220 Rn in the deposit is actually available for removal and that the relative activity of fission gases is very small when compared to 220 Rn. The measurement data were then used to evaluate the expected effectiveness of a proposed charcoal adsorption bed consisting of a right circular cylinder having a diameter of 43 cm and a length of 91 cm (17 in. I.D. x 3 ft.). The majority of the measurement data predicts an overall 220Rn activity reduction factor of about 1 x 10 9 for such a design; however, two measurements collected at a flow velocity of 18 cm/s (35 ft/min) indicated that the reduction factor could be as low as 1 x 10 6 . The adsorptive capacity of the proposed trap was also evaluated to determine the expected life prior to degradation of performance. Taking a conservative vantage point during analysis, it was estimated that the adsorption effectiveness should not begin to deteriorate until a 220 Rn activity on the order of 10 10 Ci has been processed. It was therefore concluded that degradation of performance would likely occur as the result of causes other than filling by radon progeny

  8. 41 CFR 102-41.220 - Is drug paraphernalia forfeited under 21 U.S.C. 863 available for transfer to other Federal... (United States)


    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Is drug paraphernalia... Management Federal Property Management Regulations System (Continued) FEDERAL MANAGEMENT REGULATION PERSONAL... Personal Property Requiring Special Handling Drug Paraphernalia § 102-41.220 Is drug paraphernalia...

  9. 12 CFR 220.128 - Treatment of simultaneous long and short positions in the same margin account when put or call... (United States)


    ... OF GOVERNORS OF THE FEDERAL RESERVE SYSTEM CREDIT BY BROKERS AND DEALERS (REGULATION T... Board was recently asked whether under Regulation T, “Credit by Brokers and Dealers” (12 CFR part 220...) The amount of any margin customarily required by the creditor in connection with his endorsement or...

  10. IL-15 inhibits pre-B cell proliferation by selectively expanding Mac-1+B220+ NK cells

    International Nuclear Information System (INIS)

    Nakajima, Shinsuke; Hida, Shigeaki; Taki, Shinsuke


    Natural killer (NK) cells are the cells critical for inhibition of repopulation of allogenic bone marrow cells. However, it is not well known if NK cells affect autologous lymphopoiesis. Here, we observed that NK cells could inhibit pre-B cell proliferation in vitro driven by interleukin (IL)-7 in a manner dependent on IL-15. Interestingly, the great majority of expanding NK cells were Mac-1 + B220 + , a recently identified potent interferon (IFN)-γ producer. Indeed, IFN-γ was produced in those cultures, and pre-B cells lacking IFN-γ receptors, but not those lacking type I IFN receptors, were resistant to such an inhibition. Furthermore, even NK cells from mice lacking β2-microglobulin, which were known to be functionally dampened, inhibited pre-B cell proliferation as well. Thus, activated NK cells, which were expanded selectively by IL-15, could potentially regulate B lymphopoiesis through IFN-γ beyond the selection imposed upon self-recognition

  11. Monte Carlo simulation of semiconductor detector response to "2"2"2Rn and "2"2"0Rn environments

    International Nuclear Information System (INIS)

    Irlinger, J.; Trinkl, S.; Wielunksi, M.; Tschiersch, J.; Rühm, W.


    A new electronic radon/thoron monitor employing semiconductor detectors based on a passive diffusion chamber design has been recently developed at the Helmholtz Zentrum München (HMGU). This device allows for acquisition of alpha particle energy spectra, in order to distinguish alpha particles originating from radon and radon progeny decays, as well as those originating from thoron and its progeny decays. A Monte-Carlo application is described which uses the Geant4 toolkit to simulate these alpha particle spectra. Reasonable agreement between measured and simulated spectra were obtained for both "2"2"0Rn and "2"2"2Rn, in the energy range between 1 and 10 MeV. Measured calibration factors could be reproduced by the simulation, given the uncertainties involved in the measurement and simulation. The simulated alpha particle spectra can now be used to interpret spectra measured in mixed radon/thoron atmospheres. The results agreed well with measurements performed in both radon and thoron gas environments. It is concluded that the developed simulation allows for an accurate prediction of calibration factors and alpha particle energy spectra. - Highlights: • A method was developed to simulate alpha particle spectra from radon/thoron decay. • New monitor features alpha-particle-spectroscopy based on silicon detectors. • A method is presented to quantify radon/thoron concentrations in mixed atmospheres. • The calibration factor can be simulated for various environmental parameters.

  12. Measurement of charged particle yields from PMMA irradiated by a 220 MeV/u12Cbeam

    CERN Document Server

    Piersanti, L; Bini, FU. Rome La Sapienza (main); Collamati, F; De Lucia, E; Durante, M; Faccini, R; Ferroni, F; Fiore, S; Iarocci, E; La Tessa, C; Marafini, M; Mattei, I; Patera, V; Ortega, P G; Sarti, A; Schuy, C; Sciubba, A; Vanstalle, M; Voena, C


    The radiation used in hadrontherapy treatments interacts with the patient body producing secondary particles, either neutral or charged, that can be used for dose and Bragg peak monitoring and to provide a fast feedback on the treatment plans. Recent results obtained from the authors on simplified setups (mono-energetic primary beams interacting with homogeneous tissue like target) have already indicated the correlation that exists between the flux of these secondaries coming from the target (e.g. protons and photons) and the position of the primary beam Bragg peak. In this paper, the measurements of charged particle fluxes produced by the interaction of a 220 MeV/u carbon ion beam at GSI, Darmstadt, with a polymethyl methacrylate target are reported. The emission region of protons (p), deuterons (d) and tritons (t) has been characterized using a drift chamber while the particle time-of-flight, used to compute the kinetic energy spectra, was measured with a LYSO scintillator.The energy released in the LYSO cr...

  13. Average configuration of the distant (less than 220-earth-radii) magnetotail - Initial ISEE-3 magnetic field results (United States)

    Slavin, J. A.; Tsurutani, B. T.; Smith, E. J.; Jones, D. E.; Sibeck, D. G.


    Magnetic field measurements from the first two passes of the ISEE-3 GEOTAIL Mission have been used to study the structure of the trans-lunar tail. Good agreement was found between the ISEE-3 magnetopause crossings and the Explorer 33, 35 model of Howe and Binsack (1972). Neutral sheet location was well ordered by the hinged current sheet models based upon near earth measurements. Between X = -20 and -120 earth radii the radius of the tail increases by about 30 percent while the lobe field strength decreases by approximately 60 percent. Beyond X = -100 to -1200 earth radii the tail diameter and lobe field magnitude become nearly constant at terminal values of approximately 60 earth radii and 9 nT, respectively. The distance at which the tail was observed to cease flaring, 100-120 earth radii, is in close agreement with the predictions of the analytic tail model of Coroniti and Kennel (1972). Overall, the findings of this study suggest that the magnetotail retains much of its near earth structure out to X = -220 earth radii.

  14. 6,220 institutionalised people with intellectual disability referred for visual assessment between 1993 and 2003: overview and trends. (United States)

    van Isterdael, C E D; Stilma, J S; Bezemer, P D; Tijmes, N T


    To summarise the results of visual performance tests and other data of institutionalised people with intellectual disability referred to a visual advisory centre (VAC) between 1993 and 2003, and to determine trends in these data. A retrospective medical record review was undertaken of 6,220 consecutive people examined ophthalmologically according to a standard protocol by one VAC that specialised in visual assessment and treatment of people with intellectual disability, between 1993 and 2003. chi2 test for linear trend was used and linear regression coefficients were calculated. The proportion of people aged > or =50 years increased from 19.3% to 34.2% between 1995 and 2003 (pdisability decreased from 80.0% to 52.6% (pvisual impairment or blindness decreased from 70.9% to 22.9% (pvisual disorders decreased from 89.6% to 75.3% (pdisability were identified in 58.4% people; 20.8% had Down's syndrome. Many ocular diagnoses were found, indicating the need for ophthalmological monitoring. Specialised centres are helpful, because assessment and treatment of people with intellectual disability is complicated and time consuming. Protocols for efficient referral will have to be developed. A major task lies ahead to improve the treatment rates of refractive errors, cataract and strabismus, and to find specific causes of intellectual disability.

  15. Evaluation of ultimate load bearing capacity of the primary containment of a typical first generation 220 MWe Indian PHWRs

    International Nuclear Information System (INIS)

    Singh, A.K.; Ray, I.; Roy, R.; Garg, R.P.; Verma, U.S.P.


    This paper presents the analysis of the Inner Containment Structure (ICS) of a typical first generation 220 MWe Indian PHWR for the purpose of evaluating its ultimate load bearing capacity (ULBC) beyond postulated design basis accident (DBA) scenario. The first generation ICS of Indian PHWRs are made of cylindrical wall capped with prestressed/reinforced cellular containment slab, which is connected monolithically to outer containment (OC) Wall to provide clamping effect during postulated DBA scenario. This paper discusses the simulation of construction sequence in analytical model, which is a very important aspect from point of view of capturing the residual stresses generated in the structure. The methodology adopted for the non-linear analysis of the prestressed concrete ICS including the various issues, viz. behaviour of concrete under compression and tension, tension stiffening, cracked shear modulus etc. have also been discussed in this paper. The effect of accident temperature on ULBC has been studied and discussed in this paper. This paper also discusses the study of mesh sensitivity of the finite element (FE) discretisation on ULBC of ICS in the non-linear range. Based on the detailed analysis, the factor of safety of the ICS beyond postulated DBA scenario has been evaluated. (authors)

  16. EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids (CEF); Scientific Opinion on Flavouring Group Evaluation 220, Revision 1 (FGE.220Rev1): alpha,beta-Unsaturated ketones and precursors from chemical subgroup 4.4 of FGE.19: 3(2H)-Furanones

    DEFF Research Database (Denmark)

    Larsen, John Christian; Nørby, Karin Kristiane; Beltoft, Vibe Meister

    in the Member States. In particular, the Panel was asked to evaluate flavouring substances using the Procedure as referred to in the Commission Regulation (EC) No 1565/2000. The present revision of FGE.220, FGE.220Rev1, concerns the evaluation of additional data submitted by Industry in response...... was alleviated, since one of the substances, for which positive genotoxicity data in mice were obtained, was not carcinogenic in a valid chronic assay in rats. Therefore, no further genotoxicity tests in somatic cells were required. However, some evidence was also available that this substance might elicit...... was requested. In March 2009 the Flavouring Industry submitted new data in reply to the above requested data for subgroup 4.4b of FGE.220. These data have now been examined by the Panel which has concluded the following. The results of a valid rat fertility and dominant lethal study have shown...

  17. Development of a PIN diode based on-line measurement system for Radon (222Rn) and Thoron (220Rn) in environment

    International Nuclear Information System (INIS)

    Ashokkumar, P.; Chaudhury, Probal; Sumesh, C.G.; Sahoo, B.K.; Gaware, J.J.; Mayya, Y.S.


    Radon, thoron and their progenies are universally present in outdoor air, and can reach higher levels in indoor air due to poor ventilation. Several instruments have been developed for accurate measurement of radon and thoron in the environment. Semiconductor detector based system employing spectroscopic method has been proved to be the best among them. A PIN diode based electrostatic collection type online real-time instrument has been developed in Bhabha Atomic Research Centre for simultaneous measurement of radon and thoron in an environment while both 222 Rn and 220 Rn are present. This system can be used for determination of radon and thoron concentrations at residence or workplace. Furthermore, since the 222 Rn and 220 Rn are differentiated from each other through spectroscopy, this monitor can be used even in a mixed radon/thoron environment

  18. Relationship between open-circuit voltage in Cu(In,Ga)Se2 solar cell and peak position of (220/204) preferred orientation near its absorber surface

    International Nuclear Information System (INIS)

    Chantana, J.; Minemoto, T.; Watanabe, T.; Teraji, S.; Kawamura, K.


    Cu(In,Ga)Se 2 (CIGS) absorbers with various Ga/III, Ga/(In+Ga), profiles are prepared by the so-called “multi-layer precursor method” using multi-layer co-evaporation of material sources. It is revealed that open-circuit voltage (V OC ) of CIGS solar cell is primarily dependent on averaged Ga/III near the surface of its absorber. This averaged Ga/III is well predicted by peak position of (220/204) preferred orientation of CIGS film near its surface investigated by glancing-incidence X-ray diffraction with 0.1° incident angle. Finally, the peak position of (220/204) preferred orientation is proposed as a measure of V OC before solar cell fabrication

  19. Process simulation of co-firing torrefied biomass in a 220 MWe coal-fired power plant

    International Nuclear Information System (INIS)

    Li, Jun; Zhang, Xiaolei; Pawlak-Kruczek, Halina; Yang, Weihong; Kruczek, Pawel; Blasiak, Wlodzimierz


    Highlights: • The performances of torrefaction based co-firing power plant are simulated by using Aspen Plus. • Mass loss properties and released gaseous components have been studied during biomass torrefaction processes. • Mole fractions of CO 2 and CO account for 69–91% and 4–27% in total torrefied gases. • The electrical efficiency reduced when increasing either torrefaction temperature or substitution ratio of biomass. - Abstract: Torrefaction based co-firing in a pulverized coal boiler has been proposed for large percentage of biomass co-firing. A 220 MWe pulverized coal-power plant is simulated using Aspen Plus for full understanding the impacts of an additional torrefaction unit on the efficiency of the whole power plant, the studied process includes biomass drying, biomass torrefaction, mill systems, biomass/coal devolatilization and combustion, heat exchanges and power generation. Palm kernel shells (PKS) were torrefied at same residence time but 4 different temperatures, to prepare 4 torrefied biomasses with different degrees of torrefaction. During biomass torrefaction processes, the mass loss properties and released gaseous components have been studied. In addition, process simulations at varying torrefaction degrees and biomass co-firing ratios have been carried out to understand the properties of CO 2 emission and electricity efficiency in the studied torrefaction based co-firing power plant. According to the experimental results, the mole fractions of CO 2 and CO account for 69–91% and 4–27% in torrefied gases. The predicted results also showed that the electrical efficiency reduced when increasing either torrefaction temperature or substitution ratio of biomass. A deep torrefaction may not be recommended, because the power saved from biomass grinding is less than the heat consumed by the extra torrefaction process, depending on the heat sources

  20. Design and development of improved ballscrew and control circuit for reactivity mechanisms of 220 MWe PHWR operating stations

    International Nuclear Information System (INIS)

    Jain, A.K.; Rama Mohan, N.; Mathew, Jimmy; Mathur, M.K.; Roy, S.; Ingle, V.J.; Ghoshal, B.; Ashok Kumar, B.; Patil, D.C.; Dwivedi, K.P.; Bhambra, H.S.


    There has been persistent failure of Ballscrews used for Reactivity Mechanism in standardised 220 MWe PHWR units. The detailed review of failures indicated that on one hand the number of demands for operation of Absorber Rod and Regulating Rod had increased due to use of digital circuit in the drive control system as compared analog circuits used earlier. On the other hand, the existing design of ballscrew had some inherent weaknesses to withstand the loads generated during starting and stopping of the regulating rods. To solve these problems two-pronged approach was adopted. The control problem was traced to overshooting of the servomotor of Absorber Rod and Regulating Rod to the full speed at the time of starting and thereafter, settling to the required speed. This sudden overshooting produces a jerk in the drive mechanism. A modified circuit has been evolved to solve this problem. Also, Changing the dead band and gain of control circuits have reduced the number of rod movements. A 'new design' of Ballscrew assembly was finalised by NPCIL with a view to withstand the severe loads generated during starting and stopping of the regulating rods and to achieve enhanced service life under water-lubrication condition. Based on this design, prototype assemblies were successfully manufactured by two Indian manufacturers. The design was cleared for manufacturing of the bulk production of Ballscrew assemblies after evaluation of its performance during rigorous 'Acceptance Testing'. Two ballscrews of new design were installed in the KGS-1 reactor and are operating since July 2005. This paper covers operational feedback including ballscrew failures in various units, Design/Development of Modified Reactivity Mechanism Ballscrews and Control Circuit based on analysis of underlying causes of failures and feedback on performance of new design. (author)

  1. Solitary fibrous tumor of the central nervous system: a 15-year literature survey of 220 cases (August 1996-July 2011).

    LENUS (Irish Health Repository)

    Bisceglia, Michele


    We reviewed the world literature on solitary fibrous tumors of the central nervous system from August 1996 to July 2011, focusing on both clinicopathological features and diagnostic findings. The anatomical distribution of the 220 cases reported so far reveals that most are intracranial and just over one-fifth are intraspinal. In decreasing frequency, intracranial tumors involve the supratentorial and infratentorial compartments, the pontocerebellar angle, the sellar and parasellar regions, and the cranial nerves. Intraspinal tumors are mainly located in the thoracic and cervical segments. Although most solitary fibrous tumors of the central nervous system are dural based, a small subset presents as subpial, intraparenchymal, intraventricular, or as tumors involving the nerve rootlets with no dural connection. Preoperative imaging and intraoperative findings suggest meningioma, schwannoma or neurofibroma, hemangiopericytoma, or pituitary tumors. Immunohistochemistry is critical to establish a definitive histopathological diagnosis. Vimentin, CD34, BCL2, and CD99 are the most consistently positive markers. The usual histologic type generally behaves in a benign manner if complete removal is achieved. Recurrence is anticipated when resection is subtotal or when the tumor exhibits atypical histology. The proliferative index as assessed by MIB1 labeling is of prognostic significance. Occasionally, tumors featuring conventional morphology may recur, perhaps because of minimal residual disease left behind during surgical extirpation. Rare extracranial metastases and tumor-related deaths are on record. Surgery is the treatment of choice. Stereotactic and external beam radiation therapy may be indicated for postsurgical tumor remnants and for unresectable recurrences. Long-term active surveillance of the patients is mandatory.

  2. Comparison of outdoor activity size distributions of 220 Rn and 222 Rn progeny and their Influences on lung dosimetry distributions

    International Nuclear Information System (INIS)

    Mohamed, A.; El-Hussein, A.; Ahmed, A.


    In the case of internally deposited radionuclides, direct measurement of the energy absorbed from ionizing radiation emitted by the decaying radionuclides is rarely, if ever, possible. Therefore, one must rely on dosimetric models to obtain estimates of the spatial and temporal patterns of energy deposition in human lung. T These models always need some information about the parameters of activity size distributions of thoron and radon progeny. In the present work, the attached and unattached activity size distributions of thoron and radon progeny were measured in outdoor air of El-Minia, Egypt. The attached samples were collected using a low pressure Berner cascade impactor technique, while a constructed screen diffusion b attery was used for collecting the unattached samples. Most of the attached activities for 222 Rn and 220 Rn progeny were associated with the aerosol particles of the accumulation mode. The activity size distribution of thoron progeny was found to be shifted to slightly smaller particle size, compared to radon progeny. An analytical method has been developed to compute the local energy deposition of 2l2 Bi alpha particles in a target volume of 1 jam spheres located at different depths in bronchial epithelium. In order to reach the target, alpha particles travel either through tissue alone (near-wall dose) or through air and tissue (far-wall dose). It was found that the contribution of near-wall dose is higher than that of the far wall dose. While the depth-dose distributions for nuclides uniformly distributed within the epithelium are practically constant with

  3. Annual effective dose equivalents arising from inhalation of 222Rn, 220Rn and their decay products in high background radiation area in China

    International Nuclear Information System (INIS)

    Zhang Zhonghou


    The author presents the data of on-the-sport investigations in the high background radiation area in Yangjiang County in 1975 and 1981. Monazite sand is contained in the soil of this area. The average concentrations of 222 Rn in the air indoors and out doors of the high background radiation area are 31.8 and 16.4 Bqm -3 respectively, which are equal to 2.9 and 1.5 times the average concentrations in the control area. The average concentrations of 220 Rn in the air indoors and outdoors of the high background area are 167.5 and 18.4 Bqm -3 , corresponding to 9.6 and 4.8 times those of the control area respectively. The average potential alpha energy concentrations for daughters of 222 Rn indoors and outdoors are 0.1 and 0.097 μJm -3 , which are equal to 2.6 and 2.2 times those of the control are respectively. The average potential alpha energy concentrations for daughters of 220 Rn indoors and outdoors are 0.255 and 0.053 μJm -3 , corresponding to 3.7 and 2.7 times those of the control area respectively. The average annual effective dose equivalents arising from inhalation of 222 Rn, 220 Rn and their decay products in high background radiation area are estimated to be 2.8 mSv per caput, in which 40.5% arise from 220 Rn and its decay products. This result is about 3 times that in the neighboring control area

  4. C22:0- and C24:0-dihydroceramides confer mixed cytotoxicity in T-cell acute lymphoblastic leukemia cell lines.

    Directory of Open Access Journals (Sweden)

    Michael W Holliday

    Full Text Available We previously reported that fenretinide (4-HPR was cytotoxic to acute lymphoblastic leukemia (ALL cell lines in vitro in association with increased levels of de novo synthesized dihydroceramides, the immediate precursors of ceramides. However, the cytotoxic potentials of native dihydroceramides have not been defined. Therefore, we determined the cytotoxic effects of increasing dihydroceramide levels via de novo synthesis in T-cell ALL cell lines and whether such cytotoxicity was dependent on an absolute increase in total dihydroceramide mass versus an increase of certain specific dihydroceramides. A novel method employing supplementation of individual fatty acids, sphinganine, and the dihydroceramide desaturase-1 (DES inhibitor, GT-11, was used to increase de novo dihydroceramide synthesis and absolute levels of specific dihydroceramides and ceramides. Sphingolipidomic analyses of four T-cell ALL cell lines revealed strong positive correlations between cytotoxicity and levels of C22:0-dihydroceramide (ρ = 0.74-0.81, P ≤ 0.04 and C24:0-dihydroceramide (ρ = 0.84-0.90, P ≤ 0.004, but not between total or other individual dihydroceramides, ceramides, or sphingoid bases or phosphorylated derivatives. Selective increase of C22:0- and C24:0-dihydroceramide increased level and flux of autophagy marker, LC3B-II, and increased DNA fragmentation (TUNEL assay in the absence of an increase of reactive oxygen species; pan-caspase inhibition blocked DNA fragmentation but not cell death. C22:0-fatty acid supplemented to 4-HPR treated cells further increased C22:0-dihydroceramide levels (P ≤ 0.001 and cytotoxicity (P ≤ 0.001. These data demonstrate that increases of specific dihydroceramides are cytotoxic to T-cell ALL cells by a caspase-independent, mixed cell death mechanism associated with increased autophagy and suggest that dihydroceramides may contribute to 4-HPR-induced cytotoxicity. The targeted increase of specific acyl chain dihydroceramides

  5. Inhalation exposures due to radon and thoron ((222)Rn and (220)Rn): Do they differ in high and normal background radiation areas in India? (United States)

    Mishra, Rosaline; Sapra, B K; Prajith, R; Rout, R P; Jalaluddin, S; Mayya, Y S


    In India, High Background Radiation Areas (HBRAs) due to enhanced levels of naturally occurring radionuclides in soil (thorium and, to a lesser extent, uranium), are located along some parts of the coastal tracts viz. the coastal belt of Kerala, Tamilnadu and Odisha. It is conjectured that these deposits will result in higher emissions of radon isotopes ((222)Rn and (220)Rn) and their daughter products as compared to Normal Background Radiation Areas (NBRAs). While the annual external dose rates contributed by gamma radiations in these areas are about 5-10 times higher, the extent of increase in the inhalation dose rates attributable to (222)Rn and (220)Rn and their decay products is not well quantified. Towards this, systematic indoor surveys were conducted wherein simultaneous measurements of time integrated (222)Rn and (220)Rn gas and their decay product concentrations was carried out in around 800 houses in the HBRAs of Kerala and Odisha to estimate the inhalation doses. All gas measurements were carried out using pin-hole cup dosimeters while the progeny measurements were with samplers and systems based on the Direct radon/thoron Progeny sensors (DRPS/DTPS). To corroborate these passive measurements of decay products concentrations, active sampling was also carried out in a few houses. The results of the surveys provide a strong evidence to conclude that the inhalation doses due to (222)Rn and (220)Rn gas and their decay products in these HBRAs are in the same range as observed in the NBRAs in India. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Design and evaluation of protein expression in a recombinant plasmid encoding epitope gp 350/220 of the Epstein-Barr virus (EBV) (United States)

    Himmah, Karimatul; Dluha, Nurul; Anyndita, Nadya V. M.; Rifa'i, Muhaimin; Widodo


    The Epstein - Barr virus (EBV) causes severe infections that may lead to cancers such as nasopharyngeal carcinoma. Development of effective EBV vaccines is necessary to prevent the virus spreading throughout the community. TheEBV has a surface protein gp 350/220, which serves as an antigen to help interact with host cells. Epitopes of the protein can potentially serve as bases for a vaccine. In a previous study, we have found a conserved epitope of gp 350/220 from all strains EBV through an in silico approach. The aim of this study is to design and overproduce a recombinant peptide of epitope gp 350/220 in E. coli. DNA encoding the conserved epitope was synthesized and cloned into plasmid pET-22b(+); the recombinant plasmid was transformed into E. coli strains DH5α and BL21. The transformed plasmid DNA was isolated and confirmed by restriction using XbaI and PstI enzymes followed by DNA sequencing. Protein expression was induced by isopropyl-D-thiogalactopyranoside (IPTG) with final concentrations of 0.1, 0.2, 1, and 2 mM in consecutive times. An osmotic shock method was used to isolate protein from periplasmic fraction of E. coli DH5α and BL21. The SDS-PAGE analysis was carried out to detect peptide target (3.4 kDa). Based on this result, the induction process did not work properly, and thus needs further investigation.

  7. What Lurks in ULIRGs?—Probing the Chemistry and Excitation of Molecular Gas in the Nuclei of Arp 220 and NGC 6240

    Energy Technology Data Exchange (ETDEWEB)

    Manohar, Swarnima; Scoville, Nick [California Institute of Technology, MC 249-17, 1200 East California Boulevard, Pasadena, CA 91125 (United States)


    We have imaged the dense star-forming regions of Arp 220 and NGC 6240 in the 3 mm band transitions of CO, HCN, HCO{sup +}, HNC, and CS at 0.″5–0.″8 resolution using CARMA. Our data set images all these lines at similar resolutions and high sensitivity, and can be used to derive line ratios of faint high excitation lines. In both the nuclei of Arp 220, the HCN/HNC ratios suggest chemistry of X-ray Dominated Regions (XDRs)—a likely signature of an active galactic nucleus. In NGC 6240, there is no evidence of XDR type chemistry, but there the bulk of the molecular gas is concentrated between the nuclei rather than on them. We calculated molecular H{sub 2} densities from excitation analysis of each of the molecular species. It appears that the abundances of HNC and HCO{sup +} in Ultra Luminous Infrared Galaxies may be significantly different from those in galactic molecular clouds. The derived H{sub 2} volume densities are ∼5 × 10{sup 4} cm{sup −3} in the Arp 220 nuclei and ∼10{sup 4} cm{sup −3} in NGC 6240.

  8. Development of an integrated sampler based on direct 222Rn/220Rn progeny sensors in flow-mode for estimating unattached/attached progeny concentration

    International Nuclear Information System (INIS)

    Mishra, Rosaline; Sapra, B.K.; Mayya, Y.S.


    A flow-mode integrated sampler consisting of a wire-mesh and filter-paper array along with passive solid state nuclear track detectors has been developed for estimating unattached and attached fraction of 222 Rn/ 220 Rn progeny concentration. The essential element of this sampler is the direct 222 Rn/ 220 Rn progeny sensor (DRPS/DTPS), which is an absorber-mounted-LR115 type nuclear track detector that selectively registers the alpha particles emitted from the progeny deposited on its surface. During sampling at a specified flow-rate, the unattached progeny is captured on the wire-mesh; while the attached progeny gets transmitted and is captured on the filter-paper. The alpha particles emitted by the deposited progeny atoms are registered on the sensors placed at a specified distance facing the wire-mesh and the filter-paper, respectively. The various steps involved in the development of this flow-mode direct progeny sampler such as the optimization of the sampling rate and the distance between the sensor and the deposition substrate are discussed. The sensitivity factor of the DTPS-loaded sampler for 220 Rn progeny deposited on the wire-mesh and filter-paper is found to be 23.77 ± 0.64 (track cm -2 h -1 ) (Bq m -3 ) -1 and 22.30 ± 0.18 (track cm -2 h -1 ) (Bq m -3 ) -1 , respectively; while that of DRPS-loaded sampler for 222 Rn progeny deposition, is 3.03 ± 0.14 (track cm -2 h -1 ) (Bq m -3 ) -1 and 2.08 ± 0.07 (track cm -2 h -1 ) (Bq m -3 ) -1 , respectively. The highlight of this flow-mode sampler is its high sensitivity and that it utilizes the passive technique for estimating the unattached and attached progeny concentration, thus doing away with the alpha counting procedures.

  9. Repellent and deterrent effects of SS220, Picaridin, and Deet suppress human blood feeding by Aedes aegypti, Anopheles stephensi, and Phlebotomus papatasi. (United States)

    Klun, Jerome A; Khrimian, Ashot; Debboun, Mustapha


    A series of behavioral tests with Aedes aegypti (L.), Anopheles stephensi Liston, mosquitoes, and the sand fly Phlebotomus papatasi Scopoli in the presence of Deet, SS220, and Picaridin topically applied to the skin of human volunteers showed that the insects were deterred from feeding on and repelled from surfaces emanating the compounds. When offered a 12- or 24-cm2 area of skin, one-half treated with compound and one-half untreated, the insects fed almost exclusively on untreated skin. The sand flies and mosquitoes did not at any time physically contact chemically treated surfaces. When treated and untreated skin areas were covered with cloth, insects contacted, landed, and bit only through cloth covering untreated skin. These observations provided evidence that the compounds deterred feeding and repelled insects from treated surfaces primarily as a result of olfactory sensing. When cloth, one-half untreated and one-half treated with chemical, was placed over untreated skin, insects only touched and specifically bit through the untreated cloth. This showed that the activity of the chemicals does not involve a chemical x skin interaction. In the presence of any of the three chemicals, no matter how they were presented to the insects, overall population biting activity was reduced by about one-half relative to controls. This reduction showed a true repellent effect for the compounds. Results clearly showed that Deet, SS220, and Picaridin exert repellent and deterrent effects upon the behavior of mosquitoes and sand flies. Heretofore, the combined behavioral effects of these compounds upon mosquito and sand fly behavior were unknown. Moreover, protection afforded by Deet, SS220, and Picaridin against the feeding of these three disease vectors on humans is mechanistically a consequence of the two chemical effects.

  10. Putative dopamine agonist (KB220Z) attenuates lucid nightmares in PTSD patients: role of enhanced brain reward functional connectivity and homeostasis redeeming joy. (United States)

    McLaughlin, Thomas; Blum, Kenneth; Oscar-Berman, Marlene; Febo, Marcelo; Agan, Gozde; Fratantonio, James L; Simpatico, Thomas; Gold, Mark S


    Lucid dreams are frequently pleasant and training techniques have been developed to teach dreamers to induce them. In addition, the induction of lucid dreams has also been used as a way to ameliorate nightmares. On the other hand, lucid dreams may be associated with psychiatric conditions, including Post-Traumatic Stress Disorder (PTSD) and Reward Deficiency Syndrome-associated diagnoses. In the latter conditions, lucid dreams can assume an unpleasant and frequently terrifying character. We present two cases of dramatic alleviation of terrifying lucid dreams in patients with PTSD. In the first case study, a 51-year-old, obese woman, diagnosed with PTSD and depression, had attempted suicide and experienced terrifying lucid nightmares linked to sexual/physical abuse from early childhood by family members including her alcoholic father. Her vivid "bad dreams" remained refractory in spite of 6 months of treatment with Dialectical Behavioral Therapy (DBT) and standard pharmaceutical agents which included prazosin, clonidie and Adderall. The second 39-year-old PTSD woman patient had also suffered from lucid nightmares. The medication visit notes reveal changes in the frequency, intensity and nature of these dreams after the complex putative dopamine agonist KB220Z was added to the first patient's regimen. The patient reported her first experience of an extended period of happy dreams. The second PTSD patient, who had suffered from lucid nightmares, was administered KB220Z to attenuate methadone withdrawal symptoms and incidentally reported dreams full of happiness and laughter. These cases are discussed with reference to the known effects of KB220Z including enhanced dopamine homeostasis and functional connectivity of brain reward circuitry in rodents and humans. Their understanding awaits intensive investigation involving large-population, double-blinded studies.

  11. The behavior of ZrO_2/20%Y_2O_3 and Al_2O_3 coatings deposited on aluminum alloys at high temperature regime

    International Nuclear Information System (INIS)

    Pintilei, G.L.; Crismaru, V.I.; Abrudeanu, M.; Munteanu, C.; Baciu, E.R.; Istrate, B.; Basescu, N.


    Highlights: • In both the ZrO_2/20%Y_2O_3 and Al_2O_3 coatings the high temperature caused a decrease of pores volume and a lower thickness of the interface between successive splats. • The NiCr bond layer in the sample with a ZrO_2/20%Y_2O_3 suffered a fragmentation due to high temperature exposure and thermal expansion which can lead to coating exfoliation. • The NiCr bond layer in the sample with an Al_2O_3 coating showed an increase of pore volume due to high temperature. - Abstract: Aluminum alloy present numerous advantages like lightness, high specific strength and diversity which recommend them to a high number of applications from different fields. In extreme environments the protection of aluminum alloys is difficult and requires a high number of requirements like high temperature resistance, thermal fatigue resistance, corrosion fatigue resistance and galvanic corrosion resistance. To obtain these characteristics coatings can be applied to the surfaces so they can enhance the mechanical and chemical properties of the parts. In this paper two coatings were considered for deposition on an AA2024 aluminum alloy, ZrO_2/20%Y_2O_3 and Al_2O_3. To obtain a better adherence of the coating to the base material an additional bond layer of NiCr is used. Both the coatings and bond layer were deposited by atmospheric plasma spraying on the samples. The samples were subjected to a temperature of 500 °C and after that slowly cooled to room temperature. The samples were analyzed by electron microscopy and X-ray diffraction to determine the morphological and phase changes that occurred during the temperature exposure. To determine the stress level in the parts due to thermal expansion a finite element analysis was performed in the same conditions as the tests.


    Directory of Open Access Journals (Sweden)



    Full Text Available The Transmission Power Lines of new generation are described in the article (single- compact, double-circuit compact, double-circuit Controlled Self-compensating High Voltage Transmission Power Lines (CSHVL. Basic principles of creation, design elements and comparative characteristics of the transmission lines of the new generation are described, the advantages of its are showed. Methodical approaches to the choosing of a new generation of transmission lines and facilities management FACTS are formulated. Methodical approaches to the choice of options for transmission lines 220 kV and facilities management are shown.

  13. A Naturally Occurring Mutation K220T in the Pleiotropic Activator PrfA of Listeria Monocytogenes Results in a Loss of Virulence Due to Decreasing DNA-Binding Affinity

    Energy Technology Data Exchange (ETDEWEB)

    Velge,P.; Herler, M.; Johansson, J.; Roches, S.; Temoin, S.; Fedorov, A.; Gracieux, P.; Almo, S.; Goebel, W.; Cossart, P.


    The sequencing of prfA, encoding the transcriptional regulator of virulence genes, in 26 low-virulence field Listeria monocytogenes strains showed that eight strains exhibited the same single amino-acid substitution: PrfAK220T. These strains exhibited no expression of PrfA-regulated proteins and thus no virulence. This substitution inactivated PrfA, since expression of the PrfAK220T mutant gene in an EGD{Delta}prfA strain did not restore the haemolytic and phosphatidylcholine phospholipase C activities, in contrast to the wild-type prfA gene. The substitution of the lysine at position 220 occurred in the helix H. However, the data showed that the PrfAK220T protein is dimerized just as well as its wild-type counterpart, but does not bind to PrfA-boxes. PrfAK220T did not form a PrfA-DNA complex in electrophoretic mobility shift assays, but low concentrations of CI complexes (PrfAK220T-RNA polymerase-DNA complex) were formed by adding RNA polymerase, suggesting that PrfA interacted with RNA polymerase in solution in the absence of DNA. Formation of some transcriptionally active complexes was confirmed by in vitro runoff transcription assays and quantitative RT-PCR. Crystallographic analyses described the structure of native PrfA and highlighted the key role of allosteric changes in the activity of PrfA and especially the role of the Lys220 in the conformation of the helix-turn-helix (HTH) motif.

  14. Early Intervention of Intravenous KB220IV- Neuroadaptagen Amino-Acid Therapy (NAAT)™ Improves Behavioral Outcomes in a Residential Addiction Treatment Program: A Pilot Study (United States)

    Miller, Merlene; Chen, Amanda LC; Stokes, Stan D.; Silverman, Susan; Bowirrat, Abdalla; Manka, Matthew; Manka, Debra; Miller, David K.; Perrine, Kenneth; Chen, Thomas JH; Bailey, John A.; Downs, William; Waite, Roger L.; Madigan, Margaret A.; Braverman, Eric R.; Damle, Uma; Kerner, Mallory; Giordano, John; Morse, Siobhan; Oscar-Berman, Marlene; Barh, Debmalya; Blum, Kenneth


    Substance use disorders (SUD) are inheritable and the culprit is hypodopaminergic function regulated by reward genes. We evaluated a natural dopaminergic agonist; KB220 intravenous (IV) and oral variants, to improve dopaminergic function in SUD. Our pilot experiment found a significant reduction of chronic symptoms, measured by the Chronic Abstinence Symptom Severity (CASS) Scale. The combined group (IV and oral) did significantly better than the oral-only group over the first week and 30-day follow-up period. Next, the combination was given to129 subjects and three factors; Emotion, Somatic, and Impaired Cognition, with eigenvalues greater than one were extracted for baseline CASS-Revised (CASS-R) variables. Paired sample t-tests for pre and post-treatment scales showed significant declines (p = .00001) from pre- to post-treatment: t = 19.1 for Emotion, t = 16.1 for Somatic, and t = 14.9 for Impaired Cognition. In a two-year follow-up of 23 subjects who underwent KB220IV therapy (at least five IV treatments over seven days) plus orals for 30+ days: 21 (91%) were sober at six months, 19 (82%) having no relapse; 19 (82%) were sober at one year, 18 (78%) having no relapse; and 21 (91%) were sober two-years post-treatment, 16 (70%) having no relapse. We await additional research and advise caution in interpreting these encouraging results. PMID:23457891

  15. Natural 222Rn and 220Rn indicate the impact of the Water–Sediment Regulation Scheme (WSRS) on submarine groundwater discharge in the Yellow River estuary, China

    International Nuclear Information System (INIS)

    Xu, Bochao; Xia, Dong; Burnett, William C.; Dimova, Natasha T.; Wang, Houjie; Zhang, Longjun; Gao, Maosheng; Jiang, Xueyan; Yu, Zhigang


    Highlights: • 220 Rn and 222 Rn were combined to locate intensive SGD sites. • Influence of WSRS to SGD was found for the first time. • SGD was a dominant nutrient pathway in the Yellow River estuary. - Abstract: Submarine groundwater discharge (SGD) in estuaries brings important influences to coastal ecosystems. In this study, we observed significant SGD in the Yellow River estuary, including a fresh component, during the Water–Sediment Regulation Scheme (WSRS) period. We used the 222 Rn and 220 Rn isotope pair to locate sites of significant SGD within the study area. Three apparent SGD locations were found during a non-WSRS period, one of which became much more pronounced, according to the remarkably elevated radon levels, during the WSRS. Increased river discharge (from 245 m 3 s −1 to 3560 m 3 s −1 ) and the elevated river water level (from 11 m to 13 m) during the WSRS led to a higher hydraulic head, enhancing groundwater discharge in the estuary. Our results suggest that high river discharge (>3000 m 3 s −1 ) might be necessary for elevated fresh submarine groundwater discharging (FSGD). Vertical profiles of salinity, DO and turbidity anomalies along the benthic boundary layer also indicated significant FSGD in the estuary during the WSRS. Nutrient concentrations had positive correlations with 222 Rn during a 24-h observation, which indicates that SGD is a dominant nutrient pathway in this area

  16. Final Report for grant entitled "Production of Astatine-211 for U.S. Investigators"

    Energy Technology Data Exchange (ETDEWEB)

    Wilbur, Daniel Scott


    Alpha-particle emitting radionuclides hold great promise in the therapy of cancer, but few alpha-emitters are available to investigators to evaluate. Of the alpha-emitters that have properties amenable for use in humans, 211At is of particular interest as it does not have alpha-emitting daughter radionuclides. Thus, there is a high interest in having a source of 211At for sale to investigators in the US. Production of 211At is accomplished on a cyclotron using an alpha-particle beam irradiation of bismuth metal. Unfortunately, there are few cyclotrons available that can produce an alpha particle beam for that production. The University of Washington has a cyclotron, one of three in the U.S., that is currently producing 211At. In the proposed studies, the things necessary for production and shipment of 211At to other investigators will be put into place at UW. Of major importance is the efficient production and isolation of 211At in a form that can be readily used by other investigators. In the studies, production of 211At on the UW cyclotron will be optimized by determining the best beam energy and the highest beam current to maximize 211At production. As it would be very difficult for most investigators to isolate the 211At from the irradiated target, the 211At-isolation process will be optimized and automated to more safely and efficiently obtain the 211At for shipment. Additional tasks to make the 211At available for distribution include obtaining appropriate shipping vials and containers, putting into place the requisite standard operating procedures for Radiation Safety compliance at the levels of 211At activity to be produced / shipped, and working with the Department of Energy, Isotope Development and Production for Research and Applications Program, to take orders, make shipments and be reimbursed for costs of production and shipment.

  17. Reaction of aromatic diazonium salts with carrier-free radioiodine and astatine, evidence for complex formation

    International Nuclear Information System (INIS)

    Meyer, G.J.; Roessler, K.; Stoecklin, G.


    Systematic studies of the astatodiazoniation reaction and a comparison with iododediazoniation under comparable conditions are reported. The yields for all astatohalobenzenes and -toluenes were nearly constant and unaffected by the nature of the diazonium compound, its isomeric form, and the number of isomers used at the same time. Only astatofluorobenzenes were obtained at higher yields. An electron-transfer mechanism is proposed for dediazoniation at these low halide concentration levels. At sufficient thermal excitation levels the electron transfer leads to the dissociation of nitrogen, while the phenyl and halogen radicals recombine. The isomer distribution found for some of the derivatives from dediazoniation may also be due to steric effects

  18. Astatine-211-labeled biotin conjugates resistant to biotinidase for use in pretargeted radioimmunotherapy

    International Nuclear Information System (INIS)

    Foulon, Catherine F.; Alston, Kevin L.; Zalutsky, Michael R.


    We report herein the preparation and biological evaluation of two radioastatinated biotin conjugates, (3-[ 211 At]astatobenzoyl)norbiotinamide and ((5-[ 211 At]astato-3-pyridinyl)carbonyl)norbiotinamide. Both conjugates were stable in the presence of human serum and cerebrospinal fluid as well as murine serum, indicating a resistance to degradation to biotinidase. The normal tissue clearance of (3-[ 211 At]astatobenzoyl)norbiotinamide and ((5-[ 211 At]astato-3-pyridinyl)carbonyl)norbiotinamide was rapid, as observed previously with their iodo analogues. Also reported are the first syntheses of N-succinimidyl 5-[ 211 At]astato-3-pyridinecarboxylate and 3-[ 211 At]astatoaniline, two reagents of potential utility for labeling proteins and peptides with 211 At

  19. Microdosimetry of astatine-211 and comparison with that of iodine-125

    International Nuclear Information System (INIS)

    Unak, T.


    211 At is an alpha and Auger emitter radionuclide and has been frequently used for labeling of different kind of chemical agents. 125 I is also known as an effective Auger emitter. The radionuclides which emit short range and high LET radiations such as alpha particles and Auger electrons have high radiotoxic effectiveness on the living systems. The microdosimetric data are suitable to clarify the real radiotoxic effectiveness and to get the detail of diagnostic and therapeutic application principles of these radionuclides. In this study, the energy and dose absorptions by cell nucleus from alpha particles and Auger electrons emitted by 211 At have been calculated using a Monte Carlo calculation program (code: UNMOC). For these calculations two different model corresponding to the cell nucleus have been used and the data obtained were compared with the data earlier obtained for 125 I. As a result, the radiotoxicity of 211 At is in the competition with 125 I. In the case of a specific agent labelled with 211 At or 125 I is incorporated into the cell or cell nucleus, but non-bound to DNA or not found very close to it, 211 At should considerably be much more radiotoxic than 125 I, but in the case of the labelled agent is bound to DNA or take a place very close to it, the radiotoxicity of 125 I should considerably be higher than 211 At. (author)

  20. Evaluation of Novel Wet Chemistry Separation and Purification Methods to Facilitate Automation of Astatine-211 Isolation

    International Nuclear Information System (INIS)

    Wilbur, Daniel Scott


    This research is a collaborative effort between the research groups of the PIs, Dr. D. Scott Wilbur in the Department of Radiation Oncology at the University of Washington (UW) and Matthew O'Hara at the Pacific Northwest National Laboratory (PNNL). In this report only those studies conducted at UW and the budget information from UW will be reported. A separate progress and financial report will be provided by PNNL. This final report outlines the experiments (Tasks) conducted and results obtained at UW from July 1, 2013 thru June 30, 2016 (2-year project with 1 year no-cost extension). The report divides the information on the experiments and results obtained into the 5 specific objectives of the research efforts and the Tasks within those objectives. This format is used so that it is easy to see what has been accomplished in each area. A brief summary of the major findings from the studies is provided below. Summary of Major Findings from Research/Training Activities at UW: Anion and cation exchange columns did not provide adequate 211 At capture and/or extraction results under conditions studied to warrant further evaluation; PEG-Merrifield resins containing mPEG350, mPEG750, mPEG2000 and mPEG5000 were synthesized and evaluated; All of the mPEG resins with different sized mPEG moieties conjugated gave similar 211 At capture (>95%) from 8M HCl solutions and release with conc. NH 4 OH (~50-80%), but very low quantities were released when NaOH was used as an eluent; Capture and release of 211 At when loading [ 211 At]astatate appeared to be similar to that of [ 211 At]astatide on PEG columns, but further studies need to be conducted to confirm that; Capture of 211 At on PEG columns was lower (e.g. 80-90%) from solutions of 8M HNO 3 , but higher capture rates (e.g. 99%) can be obtained when 10M HNO 3 is mixed with an equal quantity of 8M HCl; Addition of reductants to the 211 At solutions did not appear to change the percent capture, but may have an effect on the % extracted; There was some indication that the PEG-Merrifield resins could be saturated (perhaps with Bi) resulting in lower capture percentages, but more studies need to be done to confirm that; A target dissolution chamber, designed and built at PNNL, works well with syringe pumps so it can be used in an automated system; Preliminary semi-automated 211 At isolation studies have been conducted with full-scale target dissolution and 211 At isolation using a PEG column on the Hamilton automated system gave low overall recoveries, but HNO 3 was used (rather than HCl) for loading the 211 At and flow rates were not optimized; Results obtained using PEG columns are high enough to warrant further development on a fully automated system; Results obtained also indicate that additional studies are warranted to evaluate other types of columns for 211 At separation from bismuth, which allow use of HNO 3 /HCl mixtures for loading and NaOH for eluting 211 At. Such a column could greatly simplify the overall isolation process and make it easier to automate.

  1. The potential of 211Astatine for NIS-mediated radionuclide therapy in prostate cancer

    International Nuclear Information System (INIS)

    Willhauck, Michael J.; Sharif Samani, Bibi-Rana; Goeke, Burkhard; Wolf, Ingo; Senekowitsch-Schmidtke, Reingard; Stark, Hans-Juergen; Meyer, Geerd J.; Knapp, Wolfram H.; Morris, John C.; Spitzweg, Christine


    We reported recently the induction of selective iodide uptake in prostate cancer cells (LNCaP) by prostate-specific antigen (PSA) promoter-directed sodium iodide symporter (NIS) expression that allowed a significant therapeutic effect of 131 I. In the current study, we studied the potential of the high-energy alpha-emitter 211 At, also transported by NIS, as an alternative radionuclide after NIS gene transfer in tumors with limited therapeutic efficacy of 131 I due to rapid iodide efflux. We investigated uptake and therapeutic efficacy of 211 At in LNCaP cells stably expressing NIS under the control of the PSA promoter (NP-1) in vitro and in vivo. NP-1 cells concentrated 211 At in a perchlorate-sensitive manner, which allowed a dramatic therapeutic effect in vitro. After intrapertoneal injection of 211 At (1 MBq), NP-1 tumors accumulated approximately 16% ID/g 211 At (effective half-life 4.6 h), which resulted in a tumor-absorbed dose of 1,580 ± 345 mGy/MBq and a significant tumor volume reduction of up to 82 ± 19%, while control tumors continued their growth exponentially. A significant therapeutic effect of 211 At has been demonstrated in prostate cancer after PSA promoter-directed NIS gene transfer in vitro and in vivo suggesting a potential role for 211 At as an attractive alternative radioisotope for NIS-targeted radionuclide therapy, in particular in smaller tumors with limited radionuclide retention time. (orig.)

  2. Sci-Thur AM: YIS – 01: New technologies for astatine-211 targeted alpha therapy research

    Energy Technology Data Exchange (ETDEWEB)

    Crawford, Jason; Yang, Hua; Schaffer, Paul; Ruth, Thomas [University of Victoria, Victoria, BC (Canada); TRIUMF, Vancouver, BC (Canada)


    Purpose: The short-range, densely ionizing α-particles emitted by {sup 211}At (t{sub 1/2}=7.2h) are well suited for the treatment of diffuse microscopic disease, using cancer targeting biomolecules. {sup 211}At availability is limited by the rarity of α-cyclotrons required for standard production. Image-based dosimetry is also limited for {sup 211}At, which emits low intensity X-rays. Our goal was to leverage state-of-the-art infrastructure at TRIUMF to produce and evaluate two related isotopes, {sup 211}Rn (t{sub 1/2}=14.6h, 73% decay to {sup 211}At) as a generator for {sup 211}At, and {sup 209}At (t{sub 1/2}=5.4h, X-ray/gamma-ray emitter) as a novel 211At surrogate for preclinical imaging studies. Methods: Produced by spallation of uranium with 480 MeV protons, mass separated ion beams of short-lived francium isotopes were implanted into NaCl targets where {sup 211}Rn or {sup 209}At were produced by radioactive decay, in situ. {sup 211}Rn was transferred to dodecane from which {sup 211}At was efficiently extracted and evaluated for clinical applicability. High energy SPECT/CT was evaluated for measuring {sup 209}At activity distributions in mice and phantoms. Results: Our small scale {sup 211}Rn/{sup 211}At generator system provided high purity {sup 211}At samples. The methods are immediately scalable to the level of radioactivity required for in vivo experiments with {sup 211}At. {sup 209}At-based high energy SPECT imaging was determined suitable for pursuing image-based dosimetry in mouse tumour models. In the future, we will utilize quantitative {sup 209}At-SPECT for image-based dose calculations. Conclusion: These early studies provided a foundation for future endeavours with {sup 211}At-based α-therapy. Canada is now significantly closer to clinical targeted α-therapy of cancer.

  3. Targeted radionuclide therapy with astatine-211: Oxidative dehalogenation of astatobenzoate conjugates. (United States)

    Teze, David; Sergentu, Dumitru-Claudiu; Kalichuk, Valentina; Barbet, Jacques; Deniaud, David; Galland, Nicolas; Maurice, Rémi; Montavon, Gilles


    211 At is a most promising radionuclide for targeted alpha therapy. However, its limited availability and poorly known basic chemistry hamper its use. Based on the analogy with iodine, labelling is performed via astatobenzoate conjugates, but in vivo deastatination occurs, particularly when the conjugates are internalized in cells. Actually, the chemical or biological mechanism responsible for deastatination is unknown. In this work, we show that the C-At "organometalloid" bond can be cleaved by oxidative dehalogenation induced by oxidants such as permanganates, peroxides or hydroxyl radicals. Quantum mechanical calculations demonstrate that astatobenzoates are more sensitive to oxidation than iodobenzoates, and the oxidative deastatination rate is estimated to be about 6 × 10 6 faster at 37 °C than the oxidative deiodination one. Therefore, we attribute the "internal" deastatination mechanism to oxidative dehalogenation in biological compartments, in particular lysosomes.

  4. Production of Astatine-211 at the Duke University Medical Center for its regional distribution

    Energy Technology Data Exchange (ETDEWEB)

    Zalutsky, Michael [Duke University Medical Center, Durham, NC (United States)


    Systemic targeted radiation therapy and radioimmunotherapy continue to be important tools in the treatment of certain cancers. Because of their high energy and short path length, alpha particle emitters such as 211At are more effective than either external beam x- ray or in vivo beta radiation in delivering potentially curative doses of radiation. The limited clinical trials that have been conducted to date have yielded encouraging responses in some patients, e.g., malignant brain tumors. In order to escalate the additional necessary research and development in radiochemistry, radiobiology and efficacy evaluation of alpha particle radiotherapeutics, it is universally agreed that access to an affordable, reliable supply of 211At is warranted. In conjunction with the Department of Energy's intent to enhance stable and radioactive isotope availability for research applications, it is the primary objective of this project to improve 211At production and purification capabilities at Duke so that this radionuclide can be supplied to researchers at other institutions throughout the US.The most widely used 211At production method involves the α,2n reaction on Bismuth using a cyclotron with beams ≤ 28 MeV. Yields can be enhanced with use of an internal target that allows for a higher alpha fluence plus efficient heat dissipation in the target. Both of these items are in place at Duke; however, in order to support production for multi-institutional use, irradiation campaigns in excess of 50 µAp and four hours duration will be needed. Further, post-irradiation processing equipment is lacking that will enable the distribution process. Financial support is sought for i) a shielded, ventilated processing/containment hood; ii) development of a post-irradiation target retrieval system; iii) fabrication of a 211At distillation and recovery module and iv) a performance review and, where needed, an enhancement of seven major subsystems that comprise the CS-30 Cyclotron. With these modifications in place, routine production of ≥200 mCi of At-211 should be readily achievable, given our methodological development of At-211 target preparation, internal target irradiation and dry distillation to recover the radionuclide.

  5. Use of interhalogen exchange for preparation of astatine-benzene and iodo-benzene

    International Nuclear Information System (INIS)

    Kolachkovski, A.; Khalkin, V.A.


    Experimental testing of interhalogen exchange between the solid and liquid phases has been carried out at 155 deg C with particular reference to a NaOH-Na 131 I-BrPh system. Iodine transition rate is dependent on the process duration and alkali amount. The relative amounts of 131 IPh resultant from the reaction of interhalogen exchange is evaluated by paper chromatography. The results obtained may be considered as those which provide experimental support for the assumed efficiency of the production of 131 IPh based on the reaction of interhalogen exchange to yield 70-80% 131 IPh

  6. Preparation and evaluation of an astatine-211-labeled sigma receptor ligand for alpha radionuclide therapy

    International Nuclear Information System (INIS)

    Ogawa, Kazuma; Mizuno, Yoshiaki; Washiyama, Kohshin; Shiba, Kazuhiro; Takahashi, Naruto; Kozaka, Takashi; Watanabe, Shigeki; Shinohara, Atsushi; Odani, Akira


    Introduction: Sigma receptors are overexpressed in a variety of human tumors, making them potential targets for radionuclide receptor therapy. We have previously synthesized and evaluated 131 I-labeled (+)-2-[4-(4-iodophenyl)piperidino]cyclohexanol [(+)-[ 131 I]pIV], which has a high affinity for sigma receptors. Therefore, (+)-[ 131 I]pIV significantly inhibited tumor cell proliferation in tumor-bearing mice. In the present study, we report the synthesis and the in vitro and in vivo characterization of (+)-[ 211 At]pAtV, an 211 At-labeled sigma receptor ligand, that has potential use in alpha-radionuclide receptor therapy. Methods: The radiolabeled sigma receptor ligand (+)-[ 211 At]pAtV was prepared using a standard halogenation reaction generating a 91% radiochemical yield with 98% purity after HPLC purification. The partition coefficient of (+)-[ 211 At]pAtV was measured. Cellular uptake experiments and in vivo biodistribution experiments were performed using a mixed solution of (+)-[ 211 At]pAtV and (+)-[ 125 I]pIV; the human prostate cancer cell line DU-145, which expresses high levels of the sigma receptors, and DU-145 tumor-bearing mice. Results: The lipophilicity of (+)-[ 211 At]pAtV was similar to that of (+)-[ 125 I]pIV. DU-145 cellular uptake and the biodistribution patterns in DU-145 tumor-bearing mice at 1 h post-injection were also similar between (+)-[ 211 At]pAtV and (+)-[ 125 I]pIV. Namely, (+)-[ 211 At]pAtV demonstrated high uptake and retention in tumor via binding to sigma receptors. Conclusion: These results indicate that (+)-[ 211 At]pAtV could function as an new agent for alpha-radionuclide receptor therapy.

  7. Preparation and evaluation of an astatine-211-labeled sigma receptor ligand for alpha radionuclide therapy. (United States)

    Ogawa, Kazuma; Mizuno, Yoshiaki; Washiyama, Kohshin; Shiba, Kazuhiro; Takahashi, Naruto; Kozaka, Takashi; Watanabe, Shigeki; Shinohara, Atsushi; Odani, Akira


    Sigma receptors are overexpressed in a variety of human tumors, making them potential targets for radionuclide receptor therapy. We have previously synthesized and evaluated (131)I-labeled (+)-2-[4-(4-iodophenyl)piperidino]cyclohexanol [(+)-[(131)I]pIV], which has a high affinity for sigma receptors. Therefore, (+)-[(131)I]pIV significantly inhibited tumor cell proliferation in tumor-bearing mice. In the present study, we report the synthesis and the in vitro and in vivo characterization of (+)-[(211)At]pAtV, an (211)At-labeled sigma receptor ligand, that has potential use in alpha-radionuclide receptor therapy. The radiolabeled sigma receptor ligand (+)-[(211)At]pAtV was prepared using a standard halogenation reaction generating a 91% radiochemical yield with 98% purity after HPLC purification. The partition coefficient of (+)-[(211)At]pAtV was measured. Cellular uptake experiments and in vivo biodistribution experiments were performed using a mixed solution of (+)-[(211)At]pAtV and (+)-[(125)I]pIV; the human prostate cancer cell line DU-145, which expresses high levels of the sigma receptors, and DU-145 tumor-bearing mice. The lipophilicity of (+)-[(211)At]pAtV was similar to that of (+)-[(125)I]pIV. DU-145 cellular uptake and the biodistribution patterns in DU-145 tumor-bearing mice at 1h post-injection were also similar between (+)-[(211)At]pAtV and (+)-[(125)I]pIV. Namely, (+)-[(211)At]pAtV demonstrated high uptake and retention in tumor via binding to sigma receptors. These results indicate that (+)-[(211)At]pAtV could function as an new agent for alpha-radionuclide receptor therapy. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. Virus-cell fusion inhibitory activity of novel analogue peptides based on the HP (2-20) derived from N-terminus of Helicobacter pylori Ribosomal Protein L1. (United States)

    Woo, Eun-Rhan; Lee, Dong Gun; Chang, Young-Su; Park, Yoonkyung; Hahm, Kyung-Soo


    HP (2-20) (AKKVFKRLEKLFSKIQNDK) is the antibacterial sequence derived from N-terminus of Helicobacter pylori Ribosomal Protein L1 (RPL1). It has a broad-spectrum microbicidal activity in vitro that is thought to be related to the membrane-disruptive properties of the peptide. Based on the putative membrane-targeted mode of action, we postulated that HP (2-20) might be possessed virus-cell fusion inhibitory activity. To develop the novel virus-cell fusion inhibitory peptides, several analogues with amino acid substitution were designed to increase or decrease only net hydrophobic region. In particular, substitution of Gln and Asp for hydrophobic amino acid, Trp at position 17 and 19 of HP (2-20) (Anal 3) caused a dramatic increase in virus-cell fusion inhibitory activity without hemolytic effect.

  9. Soil scientific supervision of 220/38 kV cable circuits of the power station 'Eemscentrale' in the Dutch province Groningen: Part 2

    International Nuclear Information System (INIS)

    Langevoord, J.; Kraeima, A.F.


    Recently, five underground cable circuits were completed at the site of the EPON (an energy utility for the north-eastern part of the Netherlands) title power station, consisting of two 220 kV and two 380 kV connections with a total length of 24 km. In a previous article, attention is paid to theoretical aspects of heat transfer of cables for underground electricity transport, the research method of the soil scientific survey, and the results of the survey for the design of the cable connection, to be made by NKF (cable manufacturer) and for the final execution of the cable design. In this article attention will be paid to soil scientific marginal conditions and soil scientific supervision during the realization. 1 fig., 2 tabs., 2 refs


    Energy Technology Data Exchange (ETDEWEB)

    Rangwala, Naseem; Maloney, Philip R.; Glenn, Jason; Kamenetzky, Julia [Center for Astrophysics and Space Astronomy, University of Colorado, 1255 38th street, Boulder, CO 80303 (United States); Wilson, Christine D.; Mentuch, Erin; Schirm, Maximilien R. P. [Department of Physics and Astronomy, McMaster University, Hamilton, Ontario, L8S 4M1 (Canada); Rykala, Adam [School of Physics and Astronomy, Cardiff University, Queens Buildings The Parade, Cardiff CF24 3AA (United Kingdom); Isaak, Kate [ESA Astrophysics Missions Division, ESTEC, PO Box 299, 2200 AG Noordwijk (Netherlands); Baes, Maarten [Sterrenkundig Observatorium, Universiteit Gent, Krijgslaan 281 S9, B-9000 Gent (Belgium); Bendo, George J. [UK ALMA Regional Centre Node, Jordell Bank Center for Astrophysics, School of Physics and Astronomy, University of Manchester, Oxford Road, Manchester M13 9PL (United Kingdom); Boselli, Alessandro [Laboratoire d' Astrophysique de Marseille, UMR6110 CNRS, 38 rue F. Joliot-Curie, F-13388 Marseille (France); Bradford, Charles M. [JPL, Pasadena, CA 91109 (United States); Clements, D. L. [Astrophysics Group, Imperial College, Blackett Laboratory, Prince Consort Road, London SW7 2AZ (United Kingdom); Cooray, Asantha [Department of Physics and Astronomy, University of California, Irvine, CA 92697 (United States); Fulton, Trevor; Imhof, Peter [Blue Sky Spectroscopy Inc, Suite 9-740 4th Avenue South, Lethbridge, Alberta T1J 0N9 (Canada); Madden, Suzanne C.; Sauvage, Marc [CEA, Laboratoire AIM, Irfu/SAp, Orme des Merisiers, F-91191 Gif-sur-Yvette (France); Sacchi, Nicola [Istituto di Fisica dello Spazio Interplanetario, INAF, Via del Fosso del Cavaliere 100, I-00133 Roma (Italy); and others


    We present Herschel Spectral and Photometric Imaging Receiver Fourier Transform Spectrometer (Herschel SPIRE-FTS) observations of Arp 220, a nearby ultra-luminous infrared galaxy. The FTS provides continuous spectral coverage from 190 to 670 {mu}m, a wavelength region that is either very difficult to observe or completely inaccessible from the ground. The spectrum provides a good measurement of the continuum and detection of several molecular and atomic species. We detect luminous CO (J = 4-3 to 13-12) and water rotational transitions with comparable total luminosity {approx}2 Multiplication-Sign 10{sup 8} L{sub Sun }; very high-J transitions of HCN (J = 12-11 to 17-16) in absorption; strong absorption features of rare species such as OH{sup +}, H{sub 2}O{sup +}, and HF; and atomic lines of [C I] and [N II]. The modeling of the continuum shows that the dust is warm, with T = 66 K, and has an unusually large optical depth, with {tau}{sub dust} {approx} 5 at 100 {mu}m. The total far-infrared luminosity of Arp 220 is L{sub FIR} {approx} 2 Multiplication-Sign 10{sup 12} L{sub Sun }. Non-LTE modeling of the extinction corrected CO rotational transitions shows that the spectral line energy distribution of CO is fit well by two temperature components: cold molecular gas at T {approx} 50 K and warm molecular gas at T {approx} 1350{sup +280}{sub -100} K (the inferred temperatures are much lower if CO line fluxes are not corrected for dust extinction). These two components are not in pressure equilibrium. The mass of the warm gas is 10% of the cold gas, but it dominates the CO luminosity. The ratio of total CO luminosity to the total FIR luminosity is L{sub CO}/L{sub FIR} {approx} 10{sup -4} (the most luminous lines, such as J = 6-5, have L{sub CO,J=6-5}/L{sub FIR} {approx} 10{sup -5}). The temperature of the warm gas is in excellent agreement with the observations of H{sub 2} rotational lines. At 1350 K, H{sub 2} dominates the cooling ({approx}20 L{sub Sun} M{sup -1}{sub

  11. UV spectroscopy of Titan's atmosphere, planetary organic chemistry and prebiological synthesis. II - Interpretation of new IUE observations in the 220-335 nm range (United States)

    Courtin, Regis; Wagener, Richard; Mckay, Christopher P.; Caldwell, John; Fricke, Karl-Heinrich


    The theoretical model developed by McKay et al. (1989) to characterize the size distribution, thermal structure, and chemical composition of the stratospheric haze of Titan is applied to new 220-335-nm albedo measurements obtained with the long-wavelength prime camera of the IUE during August 1987. Data and model predictions are presented in extensive graphs and discussed in detail. It is shown that a simple model with particles of one size at a given altitude does not accurately reproduce the observed features in all spectral regions, but that good general agreement is obtained using a model with a uniformly mixed layer at 150-600 km and a bimodal distribution of small 'polymer' haze particles (radius less than 20 nm) and larger haze particles (radius 100-500 nm). The number densities implied by this model require, however, a mechanism such as electrostatic charging or reaction kinetics to inhibit coagulation of the smaller particles.

  12. Intracranial inertial cavitation threshold and thermal ablation lesion creation using MRI-guided 220-kHz focused ultrasound surgery: preclinical investigation. (United States)

    Xu, Zhiyuan; Carlson, Carissa; Snell, John; Eames, Matt; Hananel, Arik; Lopes, M Beatriz; Raghavan, Prashant; Lee, Cheng-Chia; Yen, Chun-Po; Schlesinger, David; Kassell, Neal F; Aubry, Jean-Francois; Sheehan, Jason


    In biological tissues, it is known that the creation of gas bubbles (cavitation) during ultrasound exposure is more likely to occur at lower rather than higher frequencies. Upon collapsing, such bubbles can induce hemorrhage. Thus, acoustic inertial cavitation secondary to a 220-kHz MRI-guided focused ultrasound (MRgFUS) surgery is a serious safety issue, and animal studies are mandatory for laying the groundwork for the use of low-frequency systems in future clinical trials. The authors investigate here the in vivo potential thresholds of MRgFUS-induced inertial cavitation and MRgFUS-induced thermal coagulation using MRI, acoustic spectroscopy, and histology. Ten female piglets that had undergone a craniectomy were sonicated using a 220-kHz transcranial MRgFUS system over an acoustic energy range of 5600-14,000 J. For each piglet, a long-duration sonication (40-second duration) was performed on the right thalamus, and a short sonication (20-second duration) was performed on the left thalamus. An acoustic power range of 140-300 W was used for long-duration sonications and 300-700 W for short-duration sonications. Signals collected by 2 passive cavitation detectors were stored in memory during each sonication, and any subsequent cavitation activity was integrated within the bandwidth of the detectors. Real-time 2D MR thermometry was performed during the sonications. T1-weighted, T2-weighted, gradient-recalled echo, and diffusion-weighted imaging MRI was performed after treatment to assess the lesions. The piglets were killed immediately after the last series of posttreatment MR images were obtained. Their brains were harvested, and histological examinations were then performed to further evaluate the lesions. Two types of lesions were induced: thermal ablation lesions, as evidenced by an acute ischemic infarction on MRI and histology, and hemorrhagic lesions, associated with inertial cavitation. Passive cavitation signals exhibited 3 main patterns identified as

  13. Design and operation of an automated beta-particle counting system for the measurement of 220Rn (and 222Rn) progeny

    International Nuclear Information System (INIS)

    Bigu, J.


    A fully automated system of the continuous (active) type has been designed for the unattended quantification of 222 Rn progeny and 220 Rn progeny in calibration and test facilities, as well as working and living environments. The system uses a β-particle detector and associated electronic circuitry, in conjunction with an in-house microprocessor-based processing interface card and a personal computer, operated by specially developed in-house software. The system represents a significant improvement over systems using α-particle detectors because of its enhanced flexibility of design and virtual elimination of plate-out effects in the sampling head, and of self-absorption phenomena in the sampling filter. The β-particle system was tested and calibrated in a Radon and Thoron Test Facility of the walk-in type under a variety of experimental conditions. (author)

  14. Role of higher-multipole deformations and noncoplanarity in the decay of the compound nucleus *220Th within the dynamical cluster-decay model (United States)

    Hemdeep, Chopra, Sahila; Kaur, Arshdeep; Kaushal, Pooja; Gupta, Raj K.


    Background: The formation and decay of the *220Th compound nucleus (CN) formed via some entrance channels (16O+204Pb,40Ar+180Hf,48Ca+172Yb,82Se+138Ba ) at near barrier energies has been studied within the dynamical cluster-decay model (DCM) [Hemdeep et al. Phys. Rev. C 95, 014609 (2017), 10.1103/PhysRevC.95.044603], for quadrupole deformations (β2 i) and "optimum" orientations (θopt) of the two nuclei or decay fragments lying in the same plane (coplanar nuclei, Φ =0∘ ). Purpose: We aim to investigate the role of higher-multipole deformations, the octupole (β3 i) and hexadecupole (β4 i), and "compact" orientations (θc i) together with the noncoplanarity degree of freedom (Φc) in the noncompound nucleus (nCN) cross section, already observed in the above mentioned study with quadrupole deformations (β2 i) alone, the Φ =0∘ case. Methods: The dynamical cluster-decay model (DCM), based on the quantum mechanical fragmentation theory (QMFT), is used to analyze the decay channel cross sections σx n for various experimentally studied entrance channels. The parameter Ra (equivalently, the neck length Δ R in Ra=R1+R2+Δ R ), which fixes both the preformation and penetration paths, is used to best fit both unobserved (1 n ,2 n ) and observed (3 n -5 n ) decay channel cross sections, keeping the root-mean-square (r.m.s) deviation to the minimum, which allows us to predict the nCN effects, if any, and fusion-fission (ff) cross sections in various reactions at different CN excitation energies E*. Results: For the decay of CN *220Th, the mass fragmentation potential V (Ai ) and preformation yields P0( Ai ) show an asymmetric fission mass distribution, in agreement with one observed in experiments, independent of adding or not adding (β3 i,β4 i ), and irrespective of large changes (by 36° and 34°), respectively, in "compact" orientations θc i and noncoplanarity Φc, and also in the potential energy surface V (Ai ) in light mass (1 n -5 n ) decays. Whereas the 3 n

  15. Soil scientific survey of 220/38 kV cable circuits of the power station 'Eemscentrale' in the Dutch province Groningen; Theoretical backgrounds, research method and results

    International Nuclear Information System (INIS)

    Langevoord, J.; Van Loon, L.J.M.


    Recently, five underground cable circuits were completed at the site of the EPON (an energy utility for the north-eastern part of the Netherlands) title power station, consisting of two 220 kV and two 380 kV connections with a total length of 24 km. Soil scientific in situ investigations and laboratory tests were carried out in advance to collect data, on the basis of which thermal resistivity and critical thermal conditions could be calculated. It was demonstrated by the calculated results that no de-hydrated zones occurred around the cable for design criteria conditions. Optimal cable bed conditions could be achieved, using some of the sand excavated from the trench. In this article, attention will be paid to theoretical aspects of heat transfer of cables for underground electricity transport, the research method of the soil scientific survey, and the results of the survey for the design of the cable connection, to be made by NKF (cable manufacturer) and for the final execution of the cable design. In the second article, to be published in a next issue of this magazine, attention will be paid to soil scientific marginal conditions and soil scientific supervision during the realization. 9 figs., 6 tabs., 9 refs

  16. neutron multiplicity measurements on 220 l waste drums containing Pu in the range 0.1-1 g 240Pueff with the time interval analysis method

    International Nuclear Information System (INIS)

    Baeten, P.; Bruggeman, M.; Carchon, R.; De Boeck, W.


    Measurement results are presented for the assay of plutonium in 220 l waste drums containing Pu-masses in the range 0.1-1 g 240 Pu eff obtained with the time interval analysis (TIA) method. TIA is a neutron multiplicity method based on the concept of one- and two-dimensional Rossi-alpha distributions. The main source of measurement bias in neutron multiplicity measurements at low count-rates is the impredictable variation of the high-multiplicity neutron background of spallation neutrons induced by cosmic rays. The TIA-method was therefore equipped with a special background filter, which is designed and optimized to reduce the influence of these spallation neutrons by rejecting the high-multiplicity events. The measurement results, obtained with the background correction filter outlined in this paper, prove the repeatability and validity of the TIA-method and show that multiplicity counting with the TIA-technique is applicable for masses as low as 0.1 g 240 Pu eff even at a detection efficiency of 12%. (orig.)

  17. Rediscovery of the 220-year-old holotype of the Banded Iguana, Brachylophus fasciatus (Brongniart, 1800) in the Paris Natural History Museum (United States)

    Ineich, Ivan; Fisher, Robert N.


    The Paris Natural History Museum herpetological collection (MNHN-RA) has seven historical specimens of Brachylophus spp. collected late in the 18th and early in the 19th centuries. Brachylophus fasciatus was described in 1800 by Brongniart but its type was subsequently considered as lost and never present in MNHN-RA collections. We found that 220 year old holotype among existing collections, registered without any data, and we show that it was donated to MNHN-RA from Brongniart’s private collection after his death in 1847. It was registered in the catalogue of 1851 but without any data or reference to its type status. According to the coloration (uncommon midbody saddle-like dorsal banding pattern) and morphometric data given in its original description and in the subsequent examination of the type in 1802 by Daudin and in 1805 by Brongniart we found that lost holotype in the collections. Another MNHN-RA specimen has Horn Islands (Wallis and Futuna) as the collection location but we show that most of the collections given to MNHN-RA by its collector, Louis Arnoux, have mixed localities in the MNHN-RA catalogues. We thus conclude that the locality is wrong and that the species never inhabited those islands located west of Western Samoa and north-east of Fiji.


    International Nuclear Information System (INIS)

    Jimenez, A.; Garcia, R. A.


    Gravity modes in the Sun have been the object of a long and difficult search in recent decades. Thanks to the data accumulated with the last generation of instruments (BiSON, GONG, and three helioseismic instruments aboard the Solar and Heliospheric Observatory (SOHO)), scientists have been able to find signatures of their presence. However, the individual detection of such modes remains evasive. In this article, we study the signal at 220.7 μHz which is a peak that is present in most of the helioseismic data of the last 10 years. This signal has already been identified as being a component of a g-mode candidate detected in the GOLF Doppler velocity signal. The nature of this peak is studied in particular using the VIRGO/SPM instrument aboard SOHO. First we analyze all the available instrumental data of VIRGO and SOHO (housekeeping) to reject any possible instrumental origin. No relation was found, implying that the signal has a solar origin. Using Monte Carlo simulations, we find, with more than 99% confidence level, that the signal found in VIRGO/SPM is very unlikely to be due to pure noise.

  19. Cre-expressing neurons in visual cortex of Ntsr1-Cre GN220 mice are corticothalamic and are depolarized by acetylcholine. (United States)

    Sundberg, Sofie Charlotte; Lindström, Sarah Helen; Sanchez, Gonzalo Manuel; Granseth, Björn


    The Ntsr1-Cre GN220 mouse expresses Cre-recombinase in corticothalamic (CT) neurons in neocortical layer 6. It is not known if the other major types of pyramidal neurons in this layer also express this enzyme. By electrophysiological recordings in slices and histological analysis of the uptake of retrogradely transported beads we show that Cre-positive neurons are CT and not corticocortical or corticoclaustral types. Furthermore, we show that Ntsr1-Cre-positive cells are immuno-positive for the nuclear transcription factor Forkhead box protein P2 (FoxP2). We conclude that Cre-expression is limited to a specific type of pyramidal neuron: CT. However, it appears as not all CT neurons are Cre-expressing; there are indications that the penetrance of the gene is about 90%. We demonstrate the utility of assigning a specific identity to individual neurons by determining that the CT neurons are potently modulated by acetylcholine acting on both nicotinic and muscarinic acetylcholine receptors. These results corroborate the suggested function of these neurons in regulating the gain of thalamocortical transfer of sensory information depending on attentional demand and state of arousal. © 2017 Wiley Periodicals, Inc.

  20. Numerical analysis of loads effect on combustion performance and NO{sub x} emissions of a 220 MW pulverized coal boiler

    Energy Technology Data Exchange (ETDEWEB)

    Li, Jun; Yang, Weihong; Blasiak, Wlodzimierz [Royal Institute of Technology (KTH), Stockholm (Sweden). Div. of Energy and Furnace Technology; Jankowski, Radoslaw; Kotecki, Michal; Szewczyk, Dariusz [Industrial Combustion Systems (ICS) Company, Poznan (Poland); Brzdekiewicz, Artur [Remak-Rozruch SA, Opole (Poland)


    This paper presents numerical study on the combustion performance and NO{sub x} emissions of a 220 MW pulverized coal boiler. Three different loads have been simulated with combusting coal, 200, 170 and 140 MW, respectively. In order to get as precise as possible numerical analysis results, two-step simulation method has been adopted in this work, namely, air supply system simulation and furnace simulation. After air supply system simulation, the results have been taken as the initial and boundary conditions for furnace simulation. The comparison between the measured values and predicted results from 200 MW case shows much better agreement. According to the simulation results, the adopted two-step simulation method is reasonable and suitable for predicting the characters of the flow and combustion process. It is concluded that the distributions of temperature, O{sub 2} and CO concentration inside furnace with different loads shows good similarly. The total NOx emissions decreased with the boiler load reducing, and fuel NO{sub x} has the same trend as total NO{sub x}, and fuel NO{sub x} account for about 66% in total NO{sub x} in all the three cases. More important, thermal NO{sub x} slowly decreased with the rise of boiler load. More detailed results presented in this paper enhance the understanding of combustion processes and complex flow patterns of front-wall pulverized coal boilers.

  1. 220Radon (Thoron) and progeny exposures in the front-end of nuclear fuel cycle activities with special reference to radioactive minerals, thorium and rare earths processing

    International Nuclear Information System (INIS)

    Pillai, P.M.B.


    Radon is a major Source of radiation exposure both at home and work places due to its universal presence. The International Commission on Radiological Protection has always treated the radioactive noble gas radon ( 222 Rn) and its isotope thoron ( 220 Rn) as a separate subject. ICRP Publication 65 (ICRP, 1993) summarizes the current knowledge of health effects of inhaled radon and its decay products and gives recommendations/guidelines for the control of exposures due to high radon levels encountered in dwellings and work places. A major departure from earlier publications on the subject is the entirely epidemiological considerations for developing the recommendations. In work place monitoring the progeny concentrations are of primary concern than the gases themselves. However radon/thoron gas measurements may also be used provided reliable information on the equilibrium factors are available. Though many developments have taken place and many options are available for individual monitoring for radon (mainly progeny) exposures of occupational workers, a viable personal dosimeter for individual monitoring for thoron daughters is yet to materialize. The doses are mostly estimated by making use of work place monitoring data in combination with occupancy factors

  2. Design of a neutron interrogation cell based on an electron accelerator and performance assessment on 220 liter nuclear waste mock-up drums

    International Nuclear Information System (INIS)

    Sari, A.; Carrel, F.; Laine, F.; Lyoussi, A.


    Radiological characterization of nuclear waste drums is an important task for the nuclear industry. The amount of actinides, such as 235 U or 239 Pu, contained in a package can be determined using non-destructive active methods based on the fission process. One of these techniques, known as neutron interrogation, uses a neutron beam to induce fission reactions on the actinides. Optimization of the neutron flux is an important step towards improving this technique. Electron accelerators enable to achieve higher neutron flux intensities than the ones delivered by deuterium-tritium generators traditionally used on neutron interrogation industrial facilities. In this paper, we design a neutron interrogation cell based on an electron accelerator by MCNPX simulation. We carry out photoneutron interrogation measurements on uranium samples placed at the center of 220 liter nuclear waste drums containing different types of matrices. We quantify impact of the matrix on the prompt neutron signal, on the ratio between the prompt and delayed neutron signals, and on the interrogative neutron half-life time. We also show that characteristics of the conversion target of the electron accelerator enable to improve significantly measurement performances. (authors)

  3. Fifty Years in the Development of a Glutaminergic-Dopaminergic Optimization Complex (KB220) to Balance Brain Reward Circuitry in Reward Deficiency Syndrome: A Pictorial (United States)

    Blum, K; Febo, M; Badgaiyan, RD


    Dopamine along with other chemical messengers like serotonin, cannabinoids, endorphins and glutamine, play significant roles in brain reward processing. There is a devastating opiate/opioid epidemicin the United States. According to the Centers for Disease Control and Prevention (CDC), at least 127 people, young and old, are dying every day due to narcotic overdose and alarmingly heroin overdose is on the rise. The Food and Drug Administration (FDA) has approved some Medication-Assisted Treatments (MATs) for alcoholism, opiate and nicotine dependence, but nothing for psychostimulant and cannabis abuse. While these pharmaceuticals are essential for the short-term induction of “psychological extinction,” in the long-term caution is necessary because their use favors blocking dopaminergic function indispensable for achieving normal satisfaction in life. The two institutions devoted to alcoholism and drug dependence (NIAAA & NIDA) realize that MATs are not optimal and continue to seek better treatment options. We review, herein, the history of the development of a glutaminergic-dopaminergic optimization complex called KB220 to provide for the possible eventual balancing of the brain reward system and the induction of “dopamine homeostasis.” This complex may provide substantial clinical benefit to the victims of Reward Deficiency Syndrome (RDS) and assist in recovery from iatrogenically induced addiction to unwanted opiates/opioids and other addictive behaviors. PMID:27840857

  4. Rediscovery of the 220-year-old holotype of the Banded Iguana, Brachylophus fasciatus (Brongniart, 1800) in the Paris Natural History Museum. (United States)

    Ineich, Ivan; Fisher, Robert N


    The Paris Natural History Museum herpetological collection (MNHN-RA) has seven historical specimens of Brachylophus spp. collected late in the 18th and early in the 19th centuries. Brachylophus fasciatus was described in 1800 by Brongniart but its type was subsequently considered as lost and never present in MNHN-RA collections. We found that 220 year old holotype among existing collections, registered without any data, and we show that it was donated to MNHN-RA from Brongniart's private collection after his death in 1847. It was registered in the catalogue of 1851 but without any data or reference to its type status. According to the coloration (uncommon midbody saddle-like dorsal banding pattern) and morphometric data given in its original description and in the subsequent examination of the type in 1802 by Daudin and in 1805 by Brongniart we found that lost holotype in the collections. Another MNHN-RA specimen has Horn Islands (Wallis and Futuna) as the collection location but we show that most of the collections given to MNHN-RA by its collector, Louis Arnoux, have mixed localities in the MNHN-RA catalogues. We thus conclude that the locality is wrong and that the species never inhabited those islands located west of Western Samoa and north-east of Fiji.

  5. The behavior of ZrO2/20%Y2O3 and Al2O3 coatings deposited on aluminum alloys at high temperature regime (United States)

    Pintilei, G. L.; Crismaru, V. I.; Abrudeanu, M.; Munteanu, C.; Baciu, E. R.; Istrate, B.; Basescu, N.


    Aluminum alloy present numerous advantages like lightness, high specific strength and diversity which recommend them to a high number of applications from different fields. In extreme environments the protection of aluminum alloys is difficult and requires a high number of requirements like high temperature resistance, thermal fatigue resistance, corrosion fatigue resistance and galvanic corrosion resistance. To obtain these characteristics coatings can be applied to the surfaces so they can enhance the mechanical and chemical properties of the parts. In this paper two coatings were considered for deposition on an AA2024 aluminum alloy, ZrO2/20%Y2O3 and Al2O3. To obtain a better adherence of the coating to the base material an additional bond layer of NiCr is used. Both the coatings and bond layer were deposited by atmospheric plasma spraying on the samples. The samples were subjected to a temperature of 500 °C and after that slowly cooled to room temperature. The samples were analyzed by electron microscopy and X-ray diffraction to determine the morphological and phase changes that occurred during the temperature exposure. To determine the stress level in the parts due to thermal expansion a finite element analysis was performed in the same conditions as the tests.

  6. Size-dependent disproportionation (in 2-20 nm regime) and hybrid Bond Valence derived interatomic potentials for BaTaO2N (United States)

    Anbalagan, Kousika; Thomas, Tiju


    Interatomic potentials for complex materials (like ceramic systems) are important for realistic molecular dynamics (MD) simulations. Such simulations are relevant for understanding equilibrium, transport and dynamical properties of materials, especially in the nanoregime. Here we derive a hybrid interatomic potential (based on bond valence (BV) derived Morse and Coulomb terms), for modeling a complex ceramic, barium tantalum oxynitride (BaTaO2N). This material has been chosen due to its relevance for capacitive and photoactive applications. However, the material presents processing challenges such as the emergence of non-stoichiometric phases during processing, demonstrating complex processing-property correlations. This makes MD investigations of this material both scientifically and technologically relevant. The BV based hybrid potential presented here has been used for simulating sintering of BaTaO2N nanoparticles ( 2-20 nm) under different conditions (using the relevant canonical ensemble). Notably, we show that sintering of particles of diameter 10 nm in size results in the formation of a cluster of tantalum and oxygen atoms at the interface of the BaTaO2N particles. This is in agreement with the experimental reports. The results presented here suggest that the potential proposed can be used to explore dynamical properties of BaTaO2N and related systems. This work will also open avenues for development of nanoscience-enabled aid-free sintering approaches to this and related materials.

  7. The luminescence dating chronology of a deep core from Bosten Lake (NW China) in arid central Asia reveals lake evolution over the last 220 ka

    DEFF Research Database (Denmark)

    Li, Guoqiang; Duan, Yanwu; Huang, Xiaozhong


    The lacustrine deposits of lakes in arid central Asia (ACA) potentially record palaeoclimatic changes on orbital and suborbital time scales, but such changes are still poorly understood due to the lack of reliable chronologies. Bosten Lake, the largest freshwater inland lake in China, is located...... in the southern Tianshan Mountains in central ACA. A 51.6-m-deep lacustrine succession was retrieved from the lake and 30 samples from the succession were used for luminescence dating to establish a chronology based on multi-grain quartz OSL and K-feldspar post-IR IRSL (pIRIR290) dating. Quartz OSL ages were only....... A stable deep lake occurred at c. 220, 210–180, c. 165, 70–60, 40–30 and 20–5 ka, while shallow levels occurred at c. 215, 180–165, 100–70, 60–40 and 30–20 ka. Bosten Lake levels decreased by at least ~29 m and possibly the lake even dried up between c. 160 and c. 100 ka. We suggest that the water...

  8. Measurements of the np total cross section difference ΔσL at 1.59,1.79 and 2.20 GeV

    International Nuclear Information System (INIS)

    Sharov, V.I.; Zaporozhets, S.A.


    New results of the neutron-proton spin-dependent total cross section difference Δσ L (np) at the neutron beam kinetic energies 1.59,1.79 and 2.20 GeV are presented. Measurements were performed at the Synchrophasotron of the Laboratory of High Energies of the Joint Institute for Nuclear Research in Dubna. A quasi-monochromatic neutron beam was produced by break-up of extracted polarized deuterons. Neutrons were transmitted through a large polarized proton target. Measurements were performed either with a parallel or an antiparallel beam and target polarizations, both oriented along the beam momentum. The results at the two higher energies were measured with two opposite beam and target polarization directions. Only one target polarization direction was available at 1.59 GeV. The present measurements agree well with existing data. A fast decrease of the -Δσ L (np) values with increasing energy above 1.1 GeV was confirmed. The new results are also compared with model predictions and with phase shift analysis fits. The Δσ L quantities for the isosinglet state I=0, deduced from the measured Δσ L (np) values and known Δσ L (pp) data, are given. (orig.)

  9. Relationship between open-circuit voltage in Cu(In,Ga)Se{sub 2} solar cell and peak position of (220/204) preferred orientation near its absorber surface

    Energy Technology Data Exchange (ETDEWEB)

    Chantana, J., E-mail:; Minemoto, T. [Department of Electrical and Electronic Engineering, Ritsumeikan University, 1-1-1 Nojihigashi, Kusatsu, Shiga 525-8577 (Japan); Watanabe, T.; Teraji, S.; Kawamura, K. [Environment and Energy Research Center, Nitto Denko Corporation, 2-8 Yamadaoka, Suita, Osaka 565-0871 (Japan)


    Cu(In,Ga)Se{sub 2} (CIGS) absorbers with various Ga/III, Ga/(In+Ga), profiles are prepared by the so-called “multi-layer precursor method” using multi-layer co-evaporation of material sources. It is revealed that open-circuit voltage (V{sub OC}) of CIGS solar cell is primarily dependent on averaged Ga/III near the surface of its absorber. This averaged Ga/III is well predicted by peak position of (220/204) preferred orientation of CIGS film near its surface investigated by glancing-incidence X-ray diffraction with 0.1° incident angle. Finally, the peak position of (220/204) preferred orientation is proposed as a measure of V{sub OC} before solar cell fabrication.

  10. Gamma ray multiplicity study associated at fast fission in Ne + Re at 220 MeV and Ar + Ho at 315 MeV collisions

    International Nuclear Information System (INIS)

    Martin, V.


    Angular momentum transfer to fission fragments has been studied with the measurement of gamma-ray deexcitation in the 220 MeV Ne + Re and 315 MeV Ar + Ho systems. These reactions lead to the same fusion nucleus with the same excitation energy. The critical angular momentum for fission in the Ne + Re system is close to the angular momentum where the fission barrier of the fusion nucleus vanishes. In the Ar + Ho system, the critical angular momentum is much more larger than the angular momentum and the fast fission process is then expected to occur in that system. The measurement of the widths of the fission fragment mass distribution strengthens this hypothesis: the width is equal to 42 ± 2 u.m.a in the Ne + Re system and 56 ± 4 u.m.a in the Ar + Ho system. The results obtained by measuring the gamma-ray multiplicity associated with the fission modes show that the spin transferred to the fragments is large and confirm the excitation of some collective rotational modes in the exit channel such as bending and wriggling modes. The evolution of the gamma-ray multiplicity as a function of the total kinetic energy shows a marked behaviour in the two systems: in the Ne + Re system, the multiplicity decreases when the kinetic energy increases in the Ar + Ho system the multiplicity increases when the kinetic energy increases. The information extracted from these results show that the mass distribution associated with the fast fission process has a symetric shape, but this information is not sufficient to isolate unambiguously the partial wave domain associated with the conventional fission and the fast fission phenomena, respectively [fr


    Energy Technology Data Exchange (ETDEWEB)

    Brogan, C. L.; Hunter, T. R.; Indebetouw, R. [NRAO, 520 Edgemont Rd, Charlottesville, VA 22903 (United States); Cyganowski, C. J. [SUPA, School of Physics and Astronomy, University of St. Andrews, North Haugh, St. Andrews KY16 9SS (United Kingdom); Chandler, C. J. [NRAO, P.O. Box 0, Socorro, NM 87801 (United States); Friesen, R., E-mail: [Dunlap Institute for Astronomy and Astrophysics, University of Toronto, Toronto, Ontario, M5S 3H4 (Canada)


    We present Very Large Array and Atacama Large Millimeter/submillimeter Array imaging of the deeply embedded protostellar cluster NGC 6334I from 5 cm to 1.3 mm at angular resolutions as fine as 0.″17 (220 au). The dominant hot core MM1 is resolved into seven components at 1.3 mm, clustered within a radius of 1000 au. Four of the components have brightness temperatures >200 K, radii ∼300 au, minimum luminosities ∼10{sup 4} L {sub ⊙}, and must be centrally heated. We term this new phenomenon a “hot multi-core.” Two of these objects also exhibit compact free–free emission at longer wavelengths, consistent with a hypercompact H ii region (MM1B) and a jet (MM1D). The spatial kinematics of the water maser emission centered on MM1D are consistent with it being the origin of the high-velocity bipolar molecular outflow seen in CO. The close proximity of MM1B and MM1D (440 au) suggests a proto-binary or a transient bound system. Several components of MM1 exhibit steep millimeter spectral energy distributions indicative of either unusual dust spectral properties or time variability. In addition to resolving MM1 and the other hot core (MM2) into multiple components, we detect five new millimeter and two new centimeter sources. Water masers are detected for the first time toward MM4A, confirming its membership in the protocluster. With a 1.3 mm brightness temperature of 97 K coupled with a lack of thermal molecular line emission, MM4A appears to be a highly optically thick 240  L {sub ⊙} dust core, possibly tracing a transient stage of massive protostellar evolution. The nature of the strongest water maser source CM2 remains unclear due to its combination of non-thermal radio continuum and lack of dust emission.

  12. Reliability and measurement error of sagittal spinal motion parameters in 220 patients with chronic low back pain using a three-dimensional measurement device. (United States)

    Mieritz, Rune M; Bronfort, Gert; Jakobsen, Markus D; Aagaard, Per; Hartvigsen, Jan


    A basic premise for any instrument measuring spinal motion is that reliable outcomes can be obtained on a relevant sample under standardized conditions. The purpose of this study was to assess the overall reliability and measurement error of regional spinal sagittal plane motion in patients with chronic low back pain (LBP), and then to evaluate the influence of body mass index, examiner, gender, stability of pain, and pain distribution on reliability and measurement error. This study comprises a test-retest design separated by 7 to 14 days. The patient cohort consisted of 220 individuals with chronic LBP. Kinematics of the lumbar spine were sampled during standardized spinal extension-flexion testing using a 6-df instrumented spatial linkage system. Test-retest reliability and measurement error were evaluated using interclass correlation coefficients (ICC(1,1)) and Bland-Altman limits of agreement (LOAs). The overall test-retest reliability (ICC(1,1)) for various motion parameters ranged from 0.51 to 0.70, and relatively wide LOAs were observed for all parameters. Reliability measures in patient subgroups (ICC(1,1)) ranged between 0.34 and 0.77. In general, greater (ICC(1,1)) coefficients and smaller LOAs were found in subgroups with patients examined by the same examiner, patients with a stable pain level, patients with a body mass index less than below 30 kg/m(2), patients who were men, and patients in the Quebec Task Force classifications Group 1. This study shows that sagittal plane kinematic data from patients with chronic LBP may be sufficiently reliable in measurements of groups of patients. However, because of the large LOAs, this test procedure appears unusable at the individual patient level. Furthermore, reliability and measurement error varies substantially among subgroups of patients. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. Investigation of mixed ion fields in the forward direction for 220.5 MeV/u helium ion beams: comparison between water and PMMA targets (United States)

    Aricò, G.; Gehrke, T.; Jakubek, J.; Gallas, R.; Berke, S.; Jäkel, O.; Mairani, A.; Ferrari, A.; Martišíková, M.


    Currently there is a rising interest in helium ion beams for radiotherapy. For benchmarking of the physical beam models used in treatment planning, there is a need for experimental data on the composition and spatial distribution of mixed ion fields. Of particular interest are the attenuation of the primary helium ion fluence and the build-up of secondary hydrogen ions due to nuclear interactions. The aim of this work was to provide such data with an enhanced precision. Moreover, the validity and limits of the mixed ion field equivalence between water and PMMA targets were investigated. Experiments with a 220.5 MeV/u helium ion pencil beam were performed at the Heidelberg Ion-Beam Therapy Center in Germany. The compact detection system used for ion tracking and identification was solely based on Timepix position-sensitive semiconductor detectors. In comparison to standard techniques, this system is two orders of magnitude smaller, and provides higher precision and flexibility. The numbers of outgoing helium and hydrogen ions per primary helium ion as well as the lateral particle distributions were quantitatively investigated in the forward direction behind water and PMMA targets with 5.2-18 cm water equivalent thickness (WET). Comparing water and PMMA targets with the same WET, we found that significant differences in the amount of outgoing helium and hydrogen ions and in the lateral particle distributions arise for target thicknesses above 10 cm WET. The experimental results concerning hydrogen ions emerging from the targets were reproduced reasonably well by Monte Carlo simulations using the FLUKA code. Concerning the amount of outgoing helium ions, significant differences of 3-15% were found between experiments and simulations. We conclude that if PMMA is used in place of water in dosimetry, differences in the dose distributions could arise close to the edges of the field, in particular for deep seated targets. The results presented in this publication are

  14. Controlling the opto-electronic properties of nc-SiOx:H films by promotion of 〈220〉 orientation in the growth of ultra-nanocrystallites at the grain boundary (United States)

    Das, Debajyoti; Samanta, Subhashis


    A systematic development of undoped nc-SiOx:H thin films from (SiH4 + CO2) plasma diluted by a combination of H2 and He has been investigated through structural, optical and electrical characterization and correlation. Gradual inclusion of O into a highly crystalline silicon network progressively produces a two-phase structure where Si-nanocrystals (Si-nc) are embedded into the a-SiOx:H matrix. However, at the intermediate grain boundary region the growth of ultra-nanocrystallites controls the effectiveness of the material. The ultra-nanocrystallites are the part and portion of crystallinity accommodating the dominant fraction of thermodynamically preferred 〈220〉 crystallographic orientation, most favourable for stacked layer device performance. Atomic H plays a dominant role in maintaining an improved nanocrystalliny in the network even during O inclusion, while He in its excited state (He*) maintains a good energy balance at the grain boundary and produces a significant fraction of ultra-nanocrystalline component which has been demonstrated to organize the energetically favourable 〈220〉 crystallographic orientation in the network. The nc-SiOx:H films, maintaining proportionally good electrical conductivity over an wide range of optical band gap, remarkably low microstructure factor and simultaneous high crystalline volume fraction dominantly populated by ultra-nanocrystallites of 〈220〉 crystallographic orientation mostly at the grain boundary, have been obtained in technologically most popular 13.56 MHz PECVD SiH4 plasma even at a low substrate temperature ∼250 °C, convenient for device fabrication.

  15. Scaling of water vapor in the meso-gamma (2-20km) and lower meso-beta (20-50km) scales from tall tower time series (United States)

    Pressel, K. G.; Collins, W.; Desai, A. R.


    Deficiencies in the parameterization of boundary layer clouds in global climate models (GCMs) remains one of the greatest sources of uncertainty in climate change predictions. Many GCM cloud parameterizations, which seek to include some representation of subgrid-scale cloud variability, do so by making assumptions regarding the subgrid-scale spatial probability density function (PDF) of total water content. Properly specifying the form and parameters of the total water PDF is an essential step in the formulation of PDF based cloud parameterizations. In the cloud free boundary layer, the PDF of total water mixing ratio is equivalent to the PDF of water vapor mixing ratio. Understanding the PDF of water vapor mixing ratio in the cloud free atmosphere is a necessary step towards understanding the PDF of water vapor in the cloudy atmosphere. A primary challenge in empirically constraining the PDF of water vapor mixing ratio is a distinct lack of a spatially distributed observational dataset at or near cloud scale. However, at meso-beta (20-50km) and larger scales, there is a wealth of information on the spatial distribution of water vapor contained in the physically retrieved water vapor profiles from the Atmospheric Infrared Sounder onboard NASA`s Aqua satellite. The scaling (scale-invariance) of the observed water vapor field has been suggested as means of using observations at satellite observed (meso-beta) scales to derive information about cloud scale PDFs. However, doing so requires the derivation of a robust climatology of water vapor scaling from in-situ observations across the meso- gamma (2-20km) and meso-beta scales. In this work, we present the results of the scaling of high frequency (10Hz) time series of water vapor mixing ratio as observed from the 447m WLEF tower located near Park Falls, Wisconsin. Observations from a tall tower offer an ideal set of observations with which to investigate scaling at meso-gamma and meso-beta scales requiring only the

  16. Overvoltages transferred from a network of 220 kV to 15.65 kV level of the step-up transformer in HPP 'Bajina Bašta'

    Directory of Open Access Journals (Sweden)

    Vukelja Petar


    Full Text Available The paper presents the results of research in lightning surge waves and switching overvoltages transferred from a network of 220 kV to the 15.65 kV level of the step-up transformer in HPP 'Bajina Bašta'. Analysis of survey results lead to conclusion that transferred overvoltages can endanger 15.65 kV transformer windings and stator winding insulation. It was therefore suggested for the protection of the 15.65 kV isolation to install metal oxide surge arresters at a suitable place between the power generator bus bars and earthing.

  17. 211 At-labeled agents for alpha-immunotherapy: On the in vivo stability of astatine-agent bonds


    Ayed , Tahra ,; Pilmé , Julien; Tézé , David; Bassal , Fadel ,; Barbet , Jacques ,; Chérel , Michel; Champion , Julie ,; Maurice , Rémi; Montavon , Gilles ,; Galland , Nicolas ,


    International audience; The application of 211 At to targeted cancer therapy is currently hindered by the rapid deastatination that occurs in vivo. As the deastatination mechanism is unknown, we tackled this issue from the viewpoint of the intrinsic properties of At-involving chemical bonds. An apparent correlation has been evidenced between in vivo stability of 211 At-labeled compounds and the AtÀR (R ¼ C, B) bond enthalpies obtained from relativistic quantum mechanical calculations. Further...

  18. Preparation and biological evaluation of an astatine-211 labeled biotin conjugate: Biotinyl-3-[211At]astatoanilide

    International Nuclear Information System (INIS)

    Foulon, Catherine F.; Schoultz, Bent W.; Zalutsky, Michael R.


    Biotinyl-3-[ 211 At]astatoanilide ([ 211 At]AtBA) was prepared in more than 80% yield by destannylation. In vitro, [ 211 At]AtBA exhibited a high affinity for streptavidin, and was stable after incubation in human serum, cerebrospinal fluid and distilled water, whereas it was rapidly degraded in mouse serum. HPLC analysis showed that the main degradation pathway in mouse serum was the cleavage of [ 211 At]astatoaniline. In mice, [ 211 At]AtBA and its 125 I-labeled analogue cleared rapidly from most tissues; however, there was some evidence for dehalogenation of both tracers

  19. Evaluation of Novel Wet Chemistry Separation and Purification Methods to Facilitate Automation of Astatine-­211 Isolation

    Energy Technology Data Exchange (ETDEWEB)

    Wilbur, Daniel Scott [Univ. of Washington, Seattle, WA (United States)


    This research is a collaborative effort between the research groups of the PIs, Dr. D. Scott Wilbur in the Department of Radiation Oncology at the University of Washington (UW) and Matthew O’Hara at the Pacific Northwest National Laboratory (PNNL). In this report only those studies conducted at UW and the budget information from UW will be reported. A separate progress and financial report will be provided by PNNL. This final report outlines the experiments (Tasks) conducted and results obtained at UW from July 1, 2013 thru June 30, 2016 (2-­year project with 1 year no-­cost extension). The report divides the information on the experiments and results obtained into the 5 specific objectives of the research efforts and the Tasks within those objectives. This format is used so that it is easy to see what has been accomplished in each area. A brief summary of the major findings from the studies is provided below. Summary of Major Findings from Research/Training Activities at UW: Anion and cation exchange columns did not provide adequate 211At capture and/or extraction results under conditions studied to warrant further evaluation; PEG-­Merrifield resins containing mPEG350, mPEG750, mPEG2000 and mPEG5000 were synthesized and evaluated; All of the mPEG resins with different sized mPEG moieties conjugated gave similar 211At capture (>95%) from 8M HCl solutions and release with conc. NH4OH (~50-­80%), but very low quantities were released when NaOH was used as an eluent; Capture and release of 211At when loading [211At]astatate appeared to be similar to that of [211At]astatide on PEG columns, but further studies need to be conducted to confirm that; Capture of 211At on PEG columns was lower (e.g. 80-­90%) from solutions of 8M HNO3, but higher capture rates (e.g. 99%) can be obtained when 10M HNO3 is mixed with an equal quantity of 8M HCl; Addition of reductants to the 211At solutions did not appear to change the percent capture, but may have an effect on the % extracted; There was some indication that the PEG-­Merrifield resins could be saturated (perhaps with Bi) resulting in lower capture percentages, but more studies need to be done to confirm that; A target dissolution chamber, designed and built at PNNL, works well with syringe pumps so it can be used in an automated system; Preliminary semi-­automated 211At isolation studies have been conducted with full-scale target dissolution and 211At isolation using a PEG column on the Hamilton automated system gave low overall recoveries, but HNO3 was used (rather than HCl) for loading the 211At and flow rates were not optimized; Results obtained using PEG columns are high enough to warrant further development on a fully automated system; Results obtained also indicate that additional studies are warranted to evaluate other types of columns for 211At separation from bismuth, which allow use of HNO3/HCl mixtures for loading and NaOH for eluting 211At. Such a column could greatly simplify the overall isolation process and make it easier to automate.

  20. Magnetron-sputter epitaxy of β-FeSi2(220)/Si(111) and β-FeSi2(431)/Si(001) thin films at elevated temperatures

    International Nuclear Information System (INIS)

    Liu Hongfei; Tan Chengcheh; Chi Dongzhi


    β-FeSi 2 thin films have been grown on Si(111) and Si(001) substrates by magnetron-sputter epitaxy at 700 °C. On Si(111), the growth is consistent with the commonly observed orientation of [001]β-FeSi 2 (220)//[1-10]Si(111) having three variants, in-plane rotated 120° with respect to one another. However, on Si(001), under the same growth conditions, the growth is dominated by [-111]β-FeSi 2 (431)//[110]Si(001) with four variants, which is hitherto unknown for growing β-FeSi 2 . Photoelectron spectra reveal negligible differences in the valance-band and Fe2p core-level between β-FeSi 2 grown on Si(111) and Si(001) but an apparent increased Si-oxidization on the surface of β-FeSi 2 /Si(001). This phenomenon is discussed and attributed to the Si-surface termination effect, which also suggests that the Si/Fe ratio on the surface of β-FeSi 2 (431)/Si(001) is larger than that on the surface of β-FeSi 2 (220)/Si(111).

  1. 222Rn and 220Rn concentrations measured in various natural honey samples by using nuclear track detectors and resulting radiation doses to the members of the rural populations in Morocco

    International Nuclear Information System (INIS)

    Misdaq, M. A.; Mortassim, A.


    Radon ( 222 Rn) and thoron ( 220 Rn) concentrations were measured in sixteen natural honey material samples collected from different regions in Morocco by using CR-39 and LR-115 type II solid state nuclear track detectors (SSNTDs). The concentrations of these radionuclides were also measured in nectar solutions corresponding to the studied honey samples. The measured concentrations of 222 Rn and 220 Rn in honey samples ranged from (2.3 ± 0.2) to (8.1 ± 0.6) Bq.l -1 and (1.8 ± 0.1) to (3.9 ± 0.3) Bq.l -1 , respectively. Committed equivalent doses due to annual intakes of 222 Rn were evaluated in the human gastrointestinal tract compartments of adult members of the Moroccan populations from the ingestion of studied honey samples. The influence of the target tissue mass and activities due to 222 Rn on the annual committed equivalent doses in the compartments of the human gastrointestinal tract was investigated. (authors)

  2. A simulation of the transport and fate of radon-220 derived from thorium-232 low-level waste in the near-surface zone of the Radioactive Waste Management Site in Area 5 of the Nevada Test Site

    International Nuclear Information System (INIS)

    Lindstrom, F.T.; Cawlfield, D.E.; Donahue, M.E.; Emer, D.F.; Shott, G.J.


    US Department of Energy (DOE) Order 5820.2A (DOE, 1988) requires performance assessment of all new and existing low-level radioactive waste (LLW) disposal sites. An integral part of performance assessment is estimating the fluxes of radioactive gases such as radon-220 and radon-222. Mathematical models, which point out data needs and therefore drive site characterization, provide a logical means of performing the required flux estimations. Thorium-232 Waste, consisting largely of thorium hydroxide and thorium oxides, has been approved for disposal in shallow trenches and pits at the LLW Radioactive Waste Management Site in Area 5 of the Nevada Test Site. A sophisticated gas transport model, CASCADR8 (Lindstrom et al., 1992), was used to simulate the transport and fate of radon-220 from its source of origin nine feet below a closure cap of native soil, through the dry alluvial earth, to its point of release to the atmosphere. CASCADR8 is an M-chain gas-phase radionuclide transport and fate model. It has been tailored to the site-specific needs of the dry desert environment of southern Nevada. It is based on the mass balance principle for each radionuclide and uses gas-phase diffusion as well as barometric pressure-induced advection as its main modes of transport

  3. Induction of Mitochondrial Changes Associated with Oxidative Stress on Very Long Chain Fatty Acids (C22:0, C24:0, or C26:0-Treated Human Neuronal Cells (SK-NB-E

    Directory of Open Access Journals (Sweden)

    Amira Zarrouk


    Full Text Available In Alzheimer's disease, lipid alterations point towards peroxisomal dysfunctions. Indeed, a cortical accumulation of saturated very long chain fatty acids (VLCFAs: C22:0, C24:0, C26:0, substrates for peroxisomal β-oxidation, has been found in Alzheimer patients. This study was realized to investigate the effects of VLCFAs at the mitochondrial level since mitochondrial dysfunctions play crucial roles in neurodegeneration. On human neuronal SK-NB-E cells treated with C22:0, C24:0, or C26:0 (0.1–20 μM; 48 h, an inhibition of cell growth and mitochondrial dysfunctions were observed by cell counting with trypan blue, MTT assay, and measurement of mitochondrial transmembrane potential (Δψm with DiOC6(3. A stimulation of oxidative stress was observed with DHE and MitoSOX used to quantify superoxide anion production on whole cells and at the mitochondrial level, respectively. With C24:0 and C26:0, by Western blotting, lower levels of mitochondrial complexes III and IV were detected. After staining with MitoTracker and by transmission electron microscopy used to study mitochondrial topography, mass and morphology, major changes were detected in VLCFAs treated-cells: modification of the cytoplasmic distribution of mitochondria, presence of large mitochondria, enhancement of the mitochondrial mass. Thus, VLCFAs can be potential risk factors contributing to neurodegeneration by inducing neuronal damages via mitochondrial dysfunctions.

  4. The behavior of ZrO{sub 2}/20%Y{sub 2}O{sub 3} and Al{sub 2}O{sub 3} coatings deposited on aluminum alloys at high temperature regime

    Energy Technology Data Exchange (ETDEWEB)

    Pintilei, G.L., E-mail: [Pitesti University, Faculty of Mechanics and Technology, Str. Targu din Vale nr.1, 110040 Pitesti, Arges (Romania); Technical University “Gheorghe Asachi” of Iasi, Faculty of Mechanics, Bld D. Mangeron nr. 61, 700050 Iasi (Romania); Crismaru, V.I. [Technical University “Gheorghe Asachi” of Iasi, Faculty of Mechanics, Bld D. Mangeron nr. 61, 700050 Iasi (Romania); Abrudeanu, M. [Pitesti University, Faculty of Mechanics and Technology, Str. Targu din Vale nr.1, 110040 Pitesti, Arges (Romania); Munteanu, C. [Technical University “Gheorghe Asachi” of Iasi, Faculty of Mechanics, Bld D. Mangeron nr. 61, 700050 Iasi (Romania); Baciu, E.R. [University of Medicine and Pharmacy “Gr.T.Popa”, Department Implantology, Removable Restorations, Technology, Str. Universitatii nr. 16, 700115 Iasi (Romania); Istrate, B.; Basescu, N. [Technical University “Gheorghe Asachi” of Iasi, Faculty of Mechanics, Bld D. Mangeron nr. 61, 700050 Iasi (Romania)


    Highlights: • In both the ZrO{sub 2}/20%Y{sub 2}O{sub 3} and Al{sub 2}O{sub 3} coatings the high temperature caused a decrease of pores volume and a lower thickness of the interface between successive splats. • The NiCr bond layer in the sample with a ZrO{sub 2}/20%Y{sub 2}O{sub 3} suffered a fragmentation due to high temperature exposure and thermal expansion which can lead to coating exfoliation. • The NiCr bond layer in the sample with an Al{sub 2}O{sub 3} coating showed an increase of pore volume due to high temperature. - Abstract: Aluminum alloy present numerous advantages like lightness, high specific strength and diversity which recommend them to a high number of applications from different fields. In extreme environments the protection of aluminum alloys is difficult and requires a high number of requirements like high temperature resistance, thermal fatigue resistance, corrosion fatigue resistance and galvanic corrosion resistance. To obtain these characteristics coatings can be applied to the surfaces so they can enhance the mechanical and chemical properties of the parts. In this paper two coatings were considered for deposition on an AA2024 aluminum alloy, ZrO{sub 2}/20%Y{sub 2}O{sub 3} and Al{sub 2}O{sub 3}. To obtain a better adherence of the coating to the base material an additional bond layer of NiCr is used. Both the coatings and bond layer were deposited by atmospheric plasma spraying on the samples. The samples were subjected to a temperature of 500 °C and after that slowly cooled to room temperature. The samples were analyzed by electron microscopy and X-ray diffraction to determine the morphological and phase changes that occurred during the temperature exposure. To determine the stress level in the parts due to thermal expansion a finite element analysis was performed in the same conditions as the tests.

  5. Internal Tandem Duplication in FLT3 Attenuates Proliferation and Regulates Resistance to the FLT3 Inhibitor AC220 by Modulating p21Cdkn1a and Pbx1 in Hematopoietic Cells.

    Directory of Open Access Journals (Sweden)

    Mariko Abe

    Full Text Available Internal tandem duplication (ITD mutations in the Fms-related tyrosine kinase 3 (FLT3 gene (FLT3-ITD are associated with poor prognosis in patients with acute myeloid leukemia (AML. Due to the development of drug resistance, few FLT3-ITD inhibitors are effective against FLT3-ITD+ AML. In this study, we show that FLT3-ITD activates a novel pathway involving p21Cdkn1a (p21 and pre-B cell leukemia transcription factor 1 (Pbx1 that attenuates FLT3-ITD cell proliferation and is involved in the development of drug resistance. FLT3-ITD up-regulated p21 expression in both mouse bone marrow c-kit+-Sca-1+-Lin- (KSL cells and Ba/F3 cells. The loss of p21 expression enhanced growth factor-independent proliferation and sensitivity to cytarabine as a consequence of concomitantly enriching the S+G2/M phase population and significantly increasing the expression of Pbx1, but not Evi-1, in FLT3-ITD+ cells. This enhanced cell proliferation following the loss of p21 was partially abrogated when Pbx1 expression was silenced in FLT3-ITD+ primary bone marrow colony-forming cells and Ba/F3 cells. When FLT3-ITD was antagonized with AC220, a selective inhibitor of FLT3-ITD, p21 expression was decreased coincident with Pbx1 mRNA up-regulation and a rapid decline in the number of viable FLT3-ITD+ Ba/F3 cells; however, the cells eventually became refractory to AC220. Overexpressing p21 in FLT3-ITD+ Ba/F3 cells delayed the emergence of cells that were refractory to AC220, whereas p21 silencing accelerated their development. These data indicate that FLT3-ITD is capable of inhibiting FLT3-ITD+ cell proliferation through the p21/Pbx1 axis and that treatments that antagonize FLT3-ITD contribute to the subsequent development of cells that are refractory to a FLT3-ITD inhibitor by disrupting p21 expression.

  6. Macrocluster desorption effect caused by single MCI: charges of gold clusters (2-20 nm) desorbed due to electronic processes induced by fission fragment bombardment in nanodispersed gold targets

    International Nuclear Information System (INIS)

    Baranov, I.; Jarmiychuk, S.; Kirillov, S.; Novikov, A.; Obnorskii, V.; Pchelintsev, A.; Wien, K.; Reimann, C.


    In this work the charge state of the negatively charged gold nanocluster ions (2-20 nm) that were desorbed from nanodispersed gold islet targets by 252 Cf fission fragments via electronic processes is studied. Mean cluster charge was calculated as a ratio of mean cluster mass to mean mass-to-charge ratio . Cluster masses were measured by means of a collector technique employing transmission electron microscopy and scanning force microscopy, while m/q was measured by means of a tandem TOF-spectrometer. It is shown that the nanocluster ions are mostly multiply charged (2-16e) and the charge increases non-linearly with the cluster size. The results are discussed

  7. A novel missense variant (Gln220Arg) of GNB4 encoding guanine nucleotide-binding protein, subunit beta-4 in a Japanese family with autosomal dominant motor and sensory neuropathy. (United States)

    Miura, Shiroh; Morikawa, Takuya; Fujioka, Ryuta; Noda, Kazuhito; Kosaka, Kengo; Taniwaki, Takayuki; Shibata, Hiroki


    Dominant intermediate Charcot-Marie-Tooth disease F (CMTDIF) is an autosomal dominant hereditary form of Charcot-Marie-Tooth disease (CMT) caused by variations in the guanine nucleotide-binding protein, subunit beta-4 gene (GNB4). We examined two Japanese familial cases with CMT. Case 1 was a 49-year-old male whose chief complaint was slowly progressive gait disturbance and limb dysesthesia that appeared at the age of 47. On neurological examination, he showed hyporeflexia or areflexia, distal limb muscle weakness, and distal sensory impairment with lower dominancy. Nerve conduction studies demonstrated demyelinating sensorimotor neuropathy with reduced action potentials in the lower limbs. Case 2 was an 80-year-old man, Case 1's father, who reported difficulty in riding a bicycle at the age of 76. On neurological examination, he showed areflexia in the upper and lower limbs. Distal sensory impairment in the lower limbs was also observed. Nerve conduction studies revealed mainly axonal involvement. Exome sequencing identified a novel heterozygous nonsynonymous variant (NM_021629.3:c.659T > C [p.Gln220Arg]) in GNB4 exon 8, which is known to be responsible for CMT. Sanger sequencing confirmed that both patients are heterozygous for the variation, which causes an amino acid substitution, Gln220Arg, in the highly conserved region of the WD40 domain of GNB4. The frequency of this variant in the Exome Aggregation Consortium Database was 0.000008247, and we confirmed its absence in 502 Japanese control subjects. We conclude that this novel GNB4 variant is causative for CMTDIF in these patients, who represent the first record of the disease in the Japanese population. Copyright © 2017. Published by Elsevier Masson SAS.

  8. A Massive Molecular Gas Reservoir in the Z = 2.221 Type-2 Quasar Host Galaxy SMM J0939+8315 Lensed by the Radio Galaxy 3C220.3 (United States)

    Leung, T. K. Daisy; Riechers, Dominik A.


    We report the detection of CO(J = 3 \\to 2) line emission in the strongly lensed submillimeter galaxy (SMG) SMM J0939+8315 at z = 2.221, using the Combined Array for Research in Millimeter-wave Astronomy. SMM J0939+8315 hosts a type-2 quasar, and is gravitationally lensed by the radio galaxy 3C220.3 and its companion galaxy at z = 0.685. The 104 GHz continuum emission underlying the CO line is detected toward 3C220.3 with an integrated flux density of Scont = 7.4 ± 1.4 mJy. Using the CO(J = 3 \\to 2) line intensity of ICO(3-2) = (12.6 ± 2.0) Jy km s-1, we derive a lensing- and excitation-corrected CO line luminosity of {L}{{CO(1-0)}}\\prime = (3.4 ± 0.7) × 1010 (10.1/μL) K km s-1 pc2 for the SMG, where μL is the lensing magnification factor inferred from our lens modeling. This translates to a molecular gas mass of Mgas = (2.7 ± 0.6) × 1010 (10.1/μL) M⊙. Fitting spectral energy distribution models to the (sub)-millimeter data of this SMG yields a dust temperature of T = 63.1{}-1.3+1.1 K, a dust mass of Mdust = (5.2 ± 2.1) × 108 (10.1/μL) M⊙, and a total infrared luminosity of LIR = (9.1 ± 1.2) ×1012 (10.1/μL) L⊙. We find that the properties of the interstellar medium of SMM J0939+8315 overlap with both SMGs and type-2 quasars. Hence, SMM J0939+8315 may be transitioning from a starbursting phase to an unobscured quasar phase as described by the “evolutionary link” model, according to which this system may represent an intermediate stage in the evolution of present-day galaxies at an earlier epoch.

  9. The influence of the nature of soil and plant and pollution on the 238U, 232Th, 222Rn and 220Rn concentrations in various natural honey samples using nuclear track detectors: impact on the adult consumers

    International Nuclear Information System (INIS)

    Misdaq, M.A.; Mortassim, A.


    238 U and 232 Th concentrations as well as 222 Rn and 220 Rn α-activities per unit volume were measured in various natural honey samples collected from different regions in Morocco using CR-39 and LR-115 type II solid state nuclear track detectors (SSNTDs). These radionuclides were also measured in soils, plant flowers and nectar solutions corresponding to the honey samples studied. In addition, these radionuclides were measured in different imported honey samples. The measured 238 U, 232 Th, 222 Rn and 220 Rn concentrations ranged from (1.5 ± 0.1) mBq kg -1 to (10.6 ± 0.6) mBq kg -1 , (1.1 ± 0.1) mBq kg -1 to (4.2 ± 0.2) mBq kg -1 , (1.5 ± 0.1) Bq kg -1 to (10.6 ± 0.6) Bq kg -1 and (1.1 ± 0.1) Bq kg -1 to (4.2 ± 0.2) Bq kg -1 for the honey samples studied, respectively. Annual 238 U, 232 Th and 222 Rn intakes by Moroccan adults from the consumption of honey were assessed. The influence of the nature of soil and plant on the 238 U and 232 Th contents of the studied honey samples was investigated. These measurements were completed by an investigation of the 238 U and 232 Th transfer between soils and plant flowers and that between plant flowers and honey, and also by the investigation of the influence of pollution due to different material dusts on 238 U, 232 Th and 222 Rn in the honey samples studied. Committed equivalent doses due to the annual intake of 238 U, 232 Th and 222 Rn were evaluated in the organs of adult members of the Moroccan rural population from the ingestion of the honey samples. The maximum total committed effective dose due to 238 U, 232 Th and 222 Rn from the ingestion of natural honey by the Moroccan rural population was found to be equal to 0.64 μSνy -1 . (author)

  10. Ultrasensitive, simple and solvent-free micro-assay for determining sulphite preservatives (E220-228) in foods by HS-SDME and UV-vis micro-spectrophotometry. (United States)

    Gómez-Otero, E; Costas, M; Lavilla, I; Bendicho, C


    A new method based on headspace single-drop microextraction in combination with UV-vis micro-spectrophotometry has been developed for the ultrasensitive determination of banned sulphite preservatives (E220-228) in fruits and vegetables. Sample acidification was used for SO2 generation, which is collected onto a 5,5'-dithiobis-(2-nitrobenzoic acid) microdrop for spectrophotometric measurement. A careful study of this reaction was necessary, including conditions for SO2 generation from different sulphating salts, drop pH, 5,5'-dithiobis-(2-nitrobenzoic acid) concentration and potential interference effects. Variables influencing mass transfer (stirring, sample volume and addition of salt) and microextraction time were also studied. A simple sulphite extraction was carried out, and problems caused by oxidation during the extraction process were addressed. A high enrichment factor (380) allows the determination of low levels of free SO2 in fruits and vegetables (limit of detection 0.06 μg g(-1), limit of quantification 0.2 μg g(-1)) with an adequate precision (repeatability, relative standard deviation 5 %). In addition, the sulphiting process was studied through the monitoring of residual SO2 in a vegetal sample, thus showing the importance of a sensitive tool for SO2 detection at low levels.

  11. Measurements of 222Rn, 220Rn, and CO2 Emissions in Natural CO2 Fields in Wyoming: MVA Techniques for Determining Gas Transport and Caprock Integrity

    Energy Technology Data Exchange (ETDEWEB)

    Kaszuba, John [Univ. of Wyoming, Laramie, WY (United States); Sims, Kenneth [Univ. of Wyoming, Laramie, WY (United States)


    An integrated field-laboratory program evaluated the use of radon and CO2 flux measurements to constrain source and timescale of CO2 fluxes in environments proximate to CO2 storage reservoirs. By understanding the type and depth of the gas source, the integrity of a CO2 storage reservoir can be assessed and monitored. The concept is based on correlations of radon and CO2 fluxes observed in volcanic systems. This fundamental research is designed to advance the science of Monitoring, Verification, and Accounting (MVA) and to address the Carbon Storage Program goal of developing and validating technologies to ensure 99 percent storage performance. Graduate and undergraduate students conducted the research under the guidance of the Principal Investigators; in doing so they were provided with training opportunities in skills required for implementing and deploying CCS technologies. Although a final method or “tool” was not developed, significant progress was made. The field program identified issues with measuring radon in environments rich in CO2. Laboratory experiments determined a correction factor to apply to radon measurements made in CO2-bearing environments. The field program also identified issues with radon and CO2-flux measurements in soil gases at a natural CO2 analog. A systematic survey of radon and CO2 flux in soil gases at the LaBarge CO2 Field in Southwest Wyoming indicates that measurements of 222Rn (radon), 220Rn (thoron), and CO2 flux may not be a robust method for monitoring the integrity of a CO2 storage reservoir. The field program was also not able to correlate radon and CO2 flux in the CO2-charged springs of the Thermopolis hydrothermal system. However, this part of the program helped to motivate the aforementioned laboratory experiments that determined

  12. Structural and Tectonic Composition and Origins of the Magnesite Deposit within the Dúbravský Massif near Jelšava, based on studies at the 220 m elev. Level (Western Carpathians

    Directory of Open Access Journals (Sweden)

    Julián Kondela


    Full Text Available Magnesite deposit Jelsava – Dubravsky Massif represents one of the foremost deposits in Europe, even in the world, in terms of itsreserves size. A geological exploration and development of new blocks between the elevation levels of 220m and 320 m allowed moredetailed studies of structural and tectonic development within the deposit, which yielded new results. As the mining continues deeper,it becomes essential to understand details of the youngest extension phase of the deposit deformation. This stage, combined withthe earlier deformation stages, completes the deposit’s complex structural development which significantly influences the distributionof mined raw materials, the stability of mine workings and the mining operations’ safety. This paper summarizes individual structuresstudied and their characteristics. A special attention was devoted to youngest structures, which most likely developed duringthe Neo-Alpine stage. These structures completed the current block composition of the deposit and thus are the proof that even the oldestunits within the Western Carpathians bear signs of the youngest deformation stages.

  13. Ring opening of 2-aza-3-borabicyclo[2.2.0]hex-5-ene, the Dewar form of 1,2-dihydro-1,2-azaborine: stepwise versus concerted mechanisms

    Directory of Open Access Journals (Sweden)

    Holger F. Bettinger


    Full Text Available The ring opening of the Dewar form of 1,2-dihydro-1,2-azaborine, 2-aza-3-borabicyclo[2.2.0]hex-5-ene (3 is investigated by theoretical methods by using multiconfiguration SCF (CASSCF and coupled cluster theory [CCSD(T] with basis sets up to polarised quadruple-zeta quality. The title compound was previously reported to form photochemically in cryogenic noble gas matrices from 1,2-dihydro-1,2-azaborine (4. Four reaction paths for the thermal ring opening of 3 to 4 could be identified. These are the conventional disrotatory and conrotatory electrocyclic ring-opening pathways where the BN unit is only a bystander. Two more favourable paths are stepwise and involve 1,3-boron–carbon interactions. The lowest energy barrier for the isomerisation reaction, 22 kcal mol−1, should be high enough for an experimental observation in solution. However, in solution the dimerisation of 3 is computed to have a very low barrier (3 kcal mol−1, and thus 3 is expected to be a short-lived reactive intermediate.

  14. Measurement of charge- and mass-changing cross sections for 4He+12C collisions in the energy range 80-220 MeV/u for applications in ion beam therapy (United States)

    Horst, Felix; Schuy, Christoph; Weber, Uli; Brinkmann, Kai-Thomas; Zink, Klemens


    4He ions are considered to be used for hadron radiotherapy due to their favorable physical and radiobiological properties. For an accurate dose calculation the fragmentation of the primary 4He ions occurring as a result of nuclear collisions must be taken into account. Therefore precise nuclear reaction models need to be implemented in the radiation transport codes used for dose calculation. A fragmentation experiment using thin graphite targets was conducted at the Heidelberg Ion Beam Therapy Center (HIT) to obtain new and precise 4He-nucleus cross section data in the clinically relevant energy range. Measured values for the charge-changing cross section, mass-changing cross section, as well as the inclusive 3He production cross section for 4He+12C collisions at energies between 80 and 220 MeV /u are presented. These data are compared to the 4He-nucleus reaction model by DeVries and Peng as well as to the parametrizations by Tripathi et al. and by Cucinotta et al., which are implemented in the treatment planning code trip98 and several other radiation transport codes.

  15. 7 CFR 220.2 - Definitions. (United States)


    ... department of education. Yogurt means commercially prepared coagulated milk products obtained by the fermentation of specific bacteria, that meet milk fat or milk solid requirements and to which flavoring foods... Definition and Standard of Identity for yogurt, lowfat yogurt, and nonfat yogurt, 21 CFR 131.200, 21 CFR 131...

  16. Gender | Page 220 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    ... is at once a learning process, a means of taking action, and a catalyst for empowerment. ... Popular participation, local democracy, grassroots organization ... Through Agenda 21, the global action plan for sustainable development into the ...

  17. 12 CFR 220.3 - General provisions. (United States)


    ... when cash or securities are used for purposes of meeting requirements in another account. (2... corrective action. (i) Foreign currency. (1) Freely convertible foreign currency may be treated at its U.S. dollar equivalent, provided the currency is marked-to-market daily. (2) A creditor may extend credit...

  18. 20 CFR 220.133 - Skill requirements. (United States)


    ..., products, processes, or services are involved. (3) Degrees of transferability. There are degrees of... close attention to watching machine processes; (2) Inspecting, testing, or otherwise looking for... measurements; (5) Reading blueprints or other specifications; (6) Making necessary computations or mechanical...

  19. 49 CFR 220.5 - Definitions. (United States)


    ... pictures; read a book or other written material; play a game; navigate the Internet; navigate the physical... to a radio broadcast other than a radio broadcast by a railroad; play or listen to music; execute a...

  20. 12 CFR 220.4 - Margin account. (United States)


    ... Banking FEDERAL RESERVE SYSTEM (CONTINUED) BOARD OF GOVERNORS OF THE FEDERAL RESERVE SYSTEM CREDIT BY... securities. The required margin on a net long or net short commitment in a when-issued security is the margin...) Interest charged on credit maintained in the margin account; (ii) Premiums on securities borrowed in...

  1. Publications | Page 220 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Effect of Pb, Zn, Cu and Ni on the embryonic and larval stages of S. ... must be located as close as possible to the basic emergency obstetric care. ... East Lombok District government issued a policy of health development through inpatient.

  2. 40 CFR 68.220 - Audits. (United States)


    ... oversight. (c) Exemption from audits. A stationary source with a Star or Merit ranking under OSHA's... violation of subpart G of this part and this section unless the owner or operator revises the RMP prepared...

  3. 36 CFR 220.3 - Definitions. (United States)


    ... to, the terms defined at 40 CFR parts 1500-1508. Adaptive management. A system of management practices based on clearly identified intended outcomes and monitoring to determine if management actions... about natural resource systems is sometimes uncertain. Decision document. A record of decision, decision...

  4. 30 CFR 220.002 - Definitions. (United States)


    ... operating capacity. G & G means geological, geophysical, geochemical and other similar investigations... docking installations, communication facilities, and navigation aids. Outside party means any person who...

  5. 32 CFR 220.8 - Reasonable charges. (United States)


    ... CHAMPUS Diagnosis Related Group (DRG) payment system rates under 32 CFR 199.14(a)(1). Certain adjustments are made to reflect differences between the CHAMPUS payment system and the Third Party Collection Program billing system. Among these are to include in the inpatient hospital service charges adjustments...

  6. 2 CFR 220.20 - Applicability. (United States)


    ... and Agreements OFFICE OF MANAGEMENT AND BUDGET CIRCULARS AND GUIDANCE Reserved COST PRINCIPLES FOR... of Appendix A to this part in determining the costs incurred for such work. The principles shall also... with an educational institution shall require the FFRDC to comply with the Cost Accounting Standards...

  7. 45 CFR 2541.220 - Allowable costs. (United States)


    ... accounting standards that comply with cost principles acceptable to the Federal agency. ... the grantee or subgrantee. (b) Applicable cost principles. For each kind of organization, there is a set of Federal principles for determining allowable costs. Allowable costs will be determined in...

  8. 7 CFR 220.21 - Program information. (United States)


    ..., District of Columbia, Maryland, New Jersey, Pennsylvania, Puerto Rico, Virginia, Virgin Islands, and West Virginia: Mid-Atlantic Regional Office, FNS, U.S. Department of Agriculture, 300 Corporate Boulevard...

  9. 36 CFR 220.6 - Categorical exclusions. (United States)


    ...) Approving, on an annual basis, the intermittent use and occupancy by a State-licensed outfitter or guide... of southern pine; and (iv) Prescribed burning to reduce natural fuel build-up and improve plant vigor... development activities, associated with or adjacent to a new oil and/or gas field or area, so long as the...

  10. 30 CFR 220.033 - Audits. (United States)


    ... Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR MINERALS REVENUE MANAGEMENT ACCOUNTING... conducted any more frequently than once every year except upon a showing of fraud or willful...) Exceptions to the accounting by the lessee, whether in favor of the government or the lessee, shall be noted...

  11. 7 CFR 220.16 - Procurement standards. (United States)


    ... nature. Matters concerning violation of law are to be referred to the local, State or Federal authority... § 3016.60(b) and (c) of this title are followed. The school food authority may use its own procurement procedures which reflect applicable State and local laws and regulations, provided that procurements made...

  12. 20 CFR 220.46 - Medical evidence. (United States)


    ...) Laboratory findings (such as blood pressure, x-rays); (4) Diagnosis (statement of disease or injury based on... records of a medical facility. Generally, the copy or summary should be certified as accurate by the custodian or by any authorized employee of the Railroad Retirement Board, Social Security Administration...

  13. Gender | Page 220 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Language French ... Language French ... ainsi qu'à améliorer la qualité des sols et à intensifier les cultures fruitières. ... Language French ... Language French ... In India's remote mountainous Nagaland region, food security was boosted and ...

  14. 40 CFR 220.2 - Definitions. (United States)


    ... of 1972, as amended (33 U.S.C. 1401); (b) FWPCA means the Federal Water Pollution Control Act, as... matter of any kind or description, including, but not limited to, dredged material, solid waste, incinerator residue, garbage, sewage, sewage sludge, munitions, radiological, chemical, and biological warfare...

  15. 28 CFR 54.220 - Admissions. (United States)


    ... Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) NONDISCRIMINATION ON THE BASIS OF SEX IN...) Admissions to educational institutions prior to June 24, 1973, are not covered by these Title IX regulations... §§ 54.300 through 54.310, each administratively separate unit shall be deemed to be an educational...

  16. 30 CFR 220.013 - Unallowable costs. (United States)


    ...)); (c) Depreciation, depletion, amortization, or any other charge for capital recovery for materiel... employee move that is for the primary benefit of the lessee's non-NPSL operations; (h) The lessee's own cost of administering employee benefit plans; (i) The cost of acquiring or constructing shore base...

  17. 20 CFR 220.64 - Program integrity. (United States)


    ... for reasons bearing on professional competence, professional conduct, or financial integrity; who has surrendered such a license while formal disciplinary proceedings involving professional conduct were pending...


    African Journals Online (AJOL)

    time services to the banks and easy movement of financial instrument transfers. It would be ..... Akujuobi, L.E. (2006) Corporate Finance, Owerri: Springfield Publishers Ltd. Alade ... (2001) Fundamentals of Applied Quantitative Techniques for.

  19. 12 CFR 220.2 - Definitions. (United States)


    ... of the corporation, and the affiliation has been approved by the creditor's examining authority. Cash... involving options or warrants in which the customer's risk is limited and all elements of the transaction are subject to contemporaneous exercise if: (1) The amount at risk is held in the account in cash...

  20. Publications | Page 220 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Meeting report : Country Project Inception Workshop, 28th February 2012, Garden Hotel,Machakos, Kenya (restricted access) ... and a half years, which focused on the small-scale fishing industry of Trinidad and Tobago with particular emphasis on examining the potential of mobile technology as an enabler of social and.

  1. Solid-State Chemistry as a Formation Mechanism for C 4N 2 Ice and Possibly the Haystack (220 cm -1 ice emission feature) in Titan's Stratosphere as Observed by Cassini CIRS (United States)

    Anderson, Carrie; Samuelson, Robert E.; McLain, Jason L.; Nna Mvondo, Delphine; Romani, Paul; Flasar, F. Michael


    A profusion of organic ices containing hydrocarbons, nitriles, and combinations of their mixtures comprise Titan's complex stratospheric cloud systems, and are typically formed via vapor condensation. These ice particles are then distributed throughout the mid-to-lower stratosphere, with an increased abundance near the winter poles (see Anderson et al., 2016). The cold temperatures and the associated strong circumpolar winds that isolate polar air act in much the same way as on Earth, giving rise to compositional anomalies and stratospheric clouds that provide heterogeneous chemistry sites.Titan's C4N2 ice emission feature at 478 cm-1 and "the Haystack," a strong unidentified stratospheric ice emission feature centered at 220 cm-1, share a common characteristic. Even though both are distinctive ice emission features evident in Cassini Composite InfraRed (CIRS) far-IR spectra, no associated vapor emission features can be found in Titan's atmosphere. Without a vapor phase, solid-state chemistry provides an alternate mechanism beside vapor condensation for producing these observed stratospheric ices.Anderson et al., (2016) postulated that C4N2 ice formed in Titan's stratosphere via the solid-state photochemical reaction HCN + HC3N → C4N2 + H2 can occur within extant HCN-HC3N composite ice particles. Such a reaction, and potentially similar reactions that may produce the Haystack ice, are specific examples of solid-state chemistry in solar system atmospheres. This is in addition to the reaction HCl + ClONO2 → HNO3 + Cl2, which is known to produce HNO3 coatings on terrestrial water ice particles, a byproduct of the catalytic chlorine chemistry that produces ozone holes in Earth's polar stratosphere (see for example, Molina et al., 1987 Soloman, 1999).A combination of radiative transfer modeling of CIRS far-IR spectra, coupled with optical constants derived from thin film transmittance spectra of organic ice mixtures obtained in our Spectroscopy for Planetary ICes

  2. Series of selenoid valve pneumatic AC 220 volts with disposable contra angle as a replacement for micromotor in preclinic laboratory (experimental study on the health ministry of health polytechnic course D-III department of dental nursing Tasikmalaya

    Directory of Open Access Journals (Sweden)

    Hadiyat Miko


    Full Text Available To report on the essential performance characteristics of disposable air turbine handpiece and on aspect of their convenience and safety for preclinical use. The disposable handpiece is not recommended drilling in oral cavity. We use for student practical  in Operative Dentistry at preclinic laboratory. The other side micromotor low speed handpiece used as bur device on the phantom, the problem usually found in preclinik laboratory on practical conservation with the use of micromotor frequent damage to the handpiece (contra angel. Micromotor tend to heat up faster and have a low-speed, so it took a long time to complete the drilling, using the micromotor tend to be less safe because of the power generated from the flow of electricity at any time could damage. The price of  micromotor also is quite expensive. The limitations of the budget funds for maintenance, repair and procurement of mikromotor also became a problem. Based on these problems, the research team made a solution in the form of a replacement tool (substitute micromotor with the aim to resolve the existing problems as well as creating practices preclinic more effectively and efficiently. The use of a simple drill tool in the form of a series of Pneumatic Valve 220 volt (include electric compressor and Selenoid Disposible Handpiece Contra-angles as a new innovation in the laboratory of Dental Nursing. Majors preclinik Health Polytechnic Tasikmalaya  have been applied for last 3 years and have been able to more efficient cost of procurement tool of 70%. This disposible tool is apparently able to drill up to 20 times preparasicavity. This research uses descriptive method. Data collection techniques are used through the question form or questionnaire. Population and sample the study is a students collage 2nd years D-III of department of dental nursing Health Polytechnic Tasikmalaya. From the results of research that the majority of students expressed pleased and satisfied. This

  3. Inactivation of human osteosarcoma cells in vitro by 211At-TP-3 monoclonal antibody: Comparison with astatine-211 and external-beam X rays

    International Nuclear Information System (INIS)

    Larsen, R.H.; Bruland, O.S.; Hoff, P.; Alstad, J.; Lindmo, T.; Rofstad, E.K.


    The potential usefulness of α-particle radioimmunotherapy in the treatment of osteosarcoma was studied in vitro by using the monoclonal antibody TP-3 and cells of three human osteosarcoma cell lines (OHS, SAOS and KPDX) differing in antigen expression. Cell survival curves were established after treatment with (a) 211 At-TP-3 of different specific activities, (b) 211 At-labeled bovine serum albumin (BSA), (c) free 211 At and (d) external-beam X rays. The three osteosarcoma cell lines showed similar survival curves, whether treated with external-beam X rays, 211 At-BSA or free 211 At. The D o 's were lower for free 211 At than for 211 At-BSA. The survival curves for 211 At-TP-3 treatment, on the other hand, differed significantly among the cell lines, suggesting that sensitivity to 211 At-TP-3 treatment was governed by cellular properties other than sensitivity to external-beam X rays. The cellular property most important for sensitivity to 211 At-TP-3 treatment was the antigen expression. Cell inactivation after 211 At-TP-3 treatment increased substantially with increasing specific activity of the 211 At-TP-3. At high specific activities, the cytotoxic effect of 211 At-TP-3 was significantly higher than that of 211 At-BSA. In conclusion, 211 At-TP-3 has the potential to give clinically favorable therapeutic ratios in the treatment of osteosarcoma. 39 refs., 5 figs., 2 tabs

  4. Mongrel: Essays. William Dicey. Cape Town: Umuzi, 2016. 220 pp ...

    African Journals Online (AJOL)

    ey has become the literary executor of the work of a sort of doppelgänger: Michael. D'Arcy has unaccountably disappeared. Dicey's discussion of D'Arcy's works, including a voluminous exploration of. Cape Town's central thoroughfare, en- titled Main Road, sounds fascinating. One is sent scampering to Kalahari or Loot for.

  5. 20 CFR 220.177 - Terms and definitions. (United States)


    ... by reason of a physical or mental impairment(s). “Regular employment” is defined in this part as... and abilities acquired in these jobs will continue to apply to the current workplace. Thus, if the... would then determine if this medical improvement is related to the annuitant's ability to work. (b...

  6. 49 CFR 220.11 - Requirements for roadway workers. (United States)


    ... more annual employee work hours: (1) Maintenance-of-way equipment operating without locomotive... each other. (2) Each maintenance-of-way work group shall have intra-group communications capability... to provide on-track safety for a roadway work group or groups, and each lone worker, shall be...

  7. 20 CFR 220.179 - Exceptions to medical improvement. (United States)


    ... techniques or evalutions will come to the Board's attention by several methods. In reviewing cases, the Board... been made (e.g., the evidence in file such as pulmonary function study values was misread or an... documented by EEG evidence and by a detailed description of a typical seizure pattern. As history of either...

  8. 20 CFR 220.129 - Education as a vocational factor. (United States)


    ... mean that the claimant is uneducated or lacks these abilities. Past work experience and the kinds of... years before the claimant's impairment(s) began, or unused skills and knowledge that were a part of the...” also includes how well the claimant is able to communicate in English since this ability is often...

  9. 12 CFR 220.12 - Supplement: margin requirements. (United States)


    ..., warrant on a securities index or foreign currency or a long position in an option: 50 percent of the... the account, provided that any long call to be used as margin in connection with a short sale of the.... (f) Put or call on a security, certificate of deposit, securities index or foreign currency or a...

  10. 20 CFR 220.14 - Weighing of evidence. (United States)


    ... DISABILITY Disability Under the Railroad Retirement Act for Work in an Employee's Regular Railroad Occupation... consistent history of conditions between treating physicians and other health care providers. (b) Factors...

  11. 43 CFR 46.220 - How to designate lead agencies. (United States)


    ... document will meet their needs for adoption and application to their related decision(s). (b) In some cases...) In some cases, the Responsible Official may establish a joint lead relationship among several Federal... agencies. (a) In most cases, the Responsible Official should designate one Federal agency as the lead with...

  12. 20 CFR 220.128 - Age as a vocational factor. (United States)


    ... economy, the Board will find that he or she is not disabled. Appendix 2 of this part explains in detail... new work situation. In some circumstances, the Board considers age 45 a handicap in adapting to a new... adjust to a significant number of jobs in the national economy. (d) Person of advanced age. The Board...

  13. 7 CFR 1951.220 - General servicing actions. (United States)


    ... relatively large portion of the total value of the security property. The approval official will require a... Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING SERVICE, RURAL BUSINESS...) PROGRAM REGULATIONS (CONTINUED) SERVICING AND COLLECTIONS Servicing of Community and Direct Business...

  14. 20 CFR 220.145 - Impairment-related work expenses. (United States)


    ...; medication used to allay the side effects of certain treatments; radiation treatment or chemotherapy for cancer patients; corrective surgery for spinal impairments; electroencephalograms and brain scans related... examinations, optician services (unrelated to a disabling visual impairment) and dental examinations. (6...

  15. 24 CFR 220.814 - Election of action. (United States)


    ... INSURANCE AND INSURED IMPROVEMENT LOANS FOR URBAN RENEWAL AND CONCENTRATED DEVELOPMENT AREAS Contract Rights... estate mortgage, deed of trust, conditional sales contract, chattel mortgage, lien, judgment, or any...

  16. New excitation equipment for 220 MW generators in Kozloduy NPP

    International Nuclear Information System (INIS)

    Tomerlin, D.


    Rehabilitation on the excitation equipment for Generator 5, Reactor Unit 3, in Kozloduy NPP was completed in November 2000. ABB's Static Excitation System based on UNITROL 5000 technology has been chosen by the Bulgarian National Utility and Kozloduy NPP to substitute the original Russian excitation system equipment with electro-magnetic voltage regulators. The substitution is in a rehabilitation package of four excitation system equipment for Generator 5 and 6 of Reactor Unit 3 and Generator 7 and 8 of Reactor Unit 4 after a short overview of the original excitation system this paper describes the new Static Excitation System UNITROL 5000 including configuration with block diagram, its main features and merits such as modes of operation, limiter, special control functions and diagnostic facilities. Furthermore, new facilities, which are implemented in UNITROL 5000, such as dynamic current distribution among the thyristors working in parallel as well as the start-up from the residual magnetism are mentioned. Special functions including a so-called free-running mode of operation and automatic change over sequence from new excitation system to the stand-by excitation system, which is DC exciter machine, are described. Some records of the transient responses performed during the commissioning and a photograph of a manufactured system are provided. (author)

  17. Chapter 8: Using GTR 220 to build stakeholder collaboration (United States)

    C. Thomas


    Since 2008, Sierra Forest Legacy, a nonprofit conservation organization, has increased its participation in the design of projects on national forest lands in the Sierra Nevada. Our interest has been to engage scientists, managers, and other stakeholders in the design of projects that integrate the best available scientific information. Our second interest has been to...

  18. 24 CFR 572.220 - Implementation grants-matching requirements. (United States)


    ... amount of the implementation grant shall be provided from non-Federal sources to carry out the... exempt from taxation by the United States, the contribution is the present discounted cash value of the... homebuyer, based on a discount rate equal to the interest rate on the borrowed funds; (B) If the loan is...

  19. 40 CFR 220.1 - Purpose and scope. (United States)


    ...) In the case of a vessel or aircraft registered in the United States or flying the United States flag... requirements of the Act. (c) Exclusions—(1) Fish wastes. This subchapter H does not apply to, and no permit... waters of fish wastes unless such dumping occurs in: (i) Harbors or other protected or enclosed coastal...

  20. 7 CFR 65.220 - Processed food item. (United States)


    ... extruding). Examples of items excluded include teriyaki flavored pork loin, roasted peanuts, breaded chicken... OF BEEF, PORK, LAMB, CHICKEN, GOAT MEAT, PERISHABLE AGRICULTURAL COMMODITIES, MACADAMIA NUTS, PECANS... includes cooking (e.g., frying, broiling, grilling, boiling, steaming, baking, roasting), curing (e.g...

  1. 7 CFR 220.15 - Management evaluations and audits. (United States)


    ... violations of criminal law or civil fraud statutes. (Secs. 805 and 819, Pub. L. 97-35, 95 Stat. 521-535 (42 U... school. (c) In conducting management evaluations, reviews, or audits in a fiscal year, the State agency... establish, through State law, regulation or procedure, an alternate disregard threshold that does not exceed...

  2. All projects related to | Page 220 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Labour Market Inequality in Brazil and India: A Comparative Brazil, Russia, India ... to examine the factors behind wage inequality in their countries and propose .... Resources, URBAN AREAS, WATER BORNE DISEASES, WOMEN, Gender.

  3. 12 CFR 220.1 - Authority, purpose, and scope. (United States)


    ... principal purpose is to regulate extensions of credit by brokers and dealers; it also covers related... account and four special purpose accounts in which to record all financial relations between a customer... part does not apply to: (i) Financial relations between a customer and a creditor to the extent that...

  4. 40 CFR 52.220 - Identification of plan. (United States)


    ... (Mojave Desert AQMD only). (xx) Mariposa County APCD. (A) Previously approved on September 22, 1972 in.... (viii) Mariposa County APCD. (A) Rules 101, 102, 201, 202, 203 (a-f, h, i, and k), 204-216, 301-303, 305...

  5. 7 CFR 220.12 - Competitive food services. (United States)


    ... submit a petition to FNS requesting that an individual food be exempted from a category of foods of... submit a petition to FNS requesting that foods in a particular category of foods be classified as meeting... the food category in easily understood language, list examples of the foods contained in the category...

  6. 20 CFR 220.114 - Evaluation of symptoms, including pain. (United States)


    ...) Precipitating and aggravating factors; (iv) The type, dosage, effectiveness, and side effects of any medication... alleged functional limitations and restrictions due to pain or other symptoms can reasonably be accepted... a determination as to the intensity, persistence, or functionally limiting effects of the claimant's...

  7. 30 CFR 71.220 - Status change reports. (United States)


    ... MANDATORY HEALTH STANDARDS-SURFACE COAL MINES AND SURFACE WORK AREAS OF UNDERGROUND COAL MINES Sampling... respirable dust sampling requirements of this part, the operator shall report the change in operational...—no material is being produced. (iii) Abandoned—the work of all miners has been terminated and...

  8. 30 CFR 220.030 - Maintenance of records. (United States)


    ... such records as are necessary to determine for each NPSL: (1) The volume and disposition of all oil and gas production saved, removed or sold for each month; (2) The value of all oil and gas production... ACCOUNTING PROCEDURES FOR DETERMINING NET PROFIT SHARE PAYMENT FOR OUTER CONTINENTAL SHELF OIL AND GAS LEASES...

  9. 30 CFR 220.031 - Reporting and payment requirements. (United States)


    ... disposition of all oil and gas production saved, removed or sold; (2) The production revenue; (3) The amount... MANAGEMENT ACCOUNTING PROCEDURES FOR DETERMINING NET PROFIT SHARE PAYMENT FOR OUTER CONTINENTAL SHELF OIL AND...

  10. 20 CFR 220.135 - Exertional and nonexertional limitations. (United States)


    ... levels (strength demands) which is contained in the Dictionary of Occupational Titles published by the... medical-vocational guidelines in appendix 2 of this part in making this determination, depending on...

  11. Alkalinity Analysis. Training Module (United States)

    Bonte, John L.; Davidson, Arnold C.

    This document is an instructional module package prepared in objective form for use by an instructor familiar with the acid-base titrimetric procedure for determining the hydroxide, carbonate and bicarbonate alkalinity of a water sample. Included are objectives, an instructor guide, student handouts and transparency masters. A video tape is also…

  12. 20 CFR 220.101 - Evaluation of mental impairments. (United States)


    ... and presenting the findings in a clear, concise, and consistent manner. (b) Use of the procedure to record pertinent findings and rate the degree of functional loss. (1) This procedure requires the Board to record the pertinent signs, symptoms, findings, functional limitations, and effects of treatment...

  13. MPACT Theory Manual, Version 2.2.0

    Energy Technology Data Exchange (ETDEWEB)

    Downar, Thomas [Univ. of Michigan, Ann Arbor, MI (United States); Collins, Benjamin S. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Gehin, Jess C. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Godfrey, Andrew T. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Jabaay, Daniel [Univ. of Michigan, Ann Arbor, MI (United States); Kelley, Blake W. [Univ. of Michigan, Ann Arbor, MI (United States); Clarno, Kevin T. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Kim, Kang [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Kochunas, Brendan [Univ. of Michigan, Ann Arbor, MI (United States); Larsen, Edward W. [Univ. of Michigan, Ann Arbor, MI (United States); Liu, Yuxuan [Univ. of Michigan, Ann Arbor, MI (United States); Liu, Zhouyu [Univ. of Michigan, Ann Arbor, MI (United States); Martin, William R. [Univ. of Michigan, Ann Arbor, MI (United States); Palmtag, Scott [Core Physics, Inc., Cary, NC (United States); Rose, Michael [Univ. of Michigan, Ann Arbor, MI (United States); Saller, Thomas [Univ. of Michigan, Ann Arbor, MI (United States); Stimpson, Shane [Univ. of Michigan, Ann Arbor, MI (United States); Trahan, Travis [Univ. of Michigan, Ann Arbor, MI (United States); Wang, J. W. [Univ. of Michigan, Ann Arbor, MI (United States); Wieselquist, William A. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Young, Mitchell [Univ. of Michigan, Ann Arbor, MI (United States); Zhu, Ang [Univ. of Michigan, Ann Arbor, MI (United States)


    This theory manual describes the three-dimensional (3-D) whole-core, pin-resolved transport calculation methodology employed in the MPACT code. To provide sub-pin level power distributions with sufficient accuracy, MPACT employs the method of characteristics (MOC) solutions in the framework of a 3-D coarse mesh finite difference (CMFD) formulation. MPACT provides a 3D MOC solution, but also a 2D/1D solution in which the 2D planar solution is provided by MOC and the axial coupling is resolved by one-dimensional (1-D) lower order (diffusion or P3) solutions. In Chapter 2 of the manual, the MOC methodology is described for calculating the regional angular and scalar fluxes from the Boltzmann transport equation. In Chapter 3, the 2D/1D methodology is described, together with the description of the CMFD iteration process involving dynamic homogenization and solution of the multigroup CMFD linear system. A description of the MPACT depletion algorithm is given in Chapter 4, followed by a discussion of the subgroup and ESSM resonance processing methods in Chapter 5. The final Chapter 6 describes a simplified thermal hydraulics model in MPACT.

  14. 7 CFR 220.13 - Special responsibilities of State agencies. (United States)


    ... applicable, shall be responsible for monitoring the net cash resources of the nonprofit school food service... determination of school food service net cash resources, and shall include any criteria for approval of net cash...

  15. 42 CFR 93.220 - Public Health Service or PHS. (United States)


    ... for Toxic Substances and Disease Registry, Centers for Disease Control and Prevention, Food and Drug... Health, and the Substance Abuse and Mental Health Services Administration, and the offices of the...

  16. 21 CFR 556.220 - 3,5-Dinitrobenzamide. (United States)


    ... latter should be analyzed as soon as thawed. For fibrous meats (for example, muscle, skin) put through a meat grinder before mincing. 2. Weight 100 ±0.5 grams of each replicate sample in a 150-milliliter...

  17. Measurement of size distribution for 220Rn progeny attached aerosols

    International Nuclear Information System (INIS)

    Zhang Lei; Guo Qiuju; Zhuo Weihai


    The size distribution of radioactive aerosols is a very important factor for evaluating the inner exposure dose contributed by radon and thoron progeny in environments. In order to measure the size distribution of thoron progeny attached radioactive aerosols, a device was developed using wire screens. The count median diameter (CMD) and the geometric standard deviation (GSD) of attached radioactive aerosols were calculated by collecting ThB and using CR-39 as detector. Field measurement results at Yangjiang City in Guangdong Province show that the CMDs distribute between 30 and 130 nm, and the GSDs are between 1.9 and 3.3. It also shows that the more humid country, the smaller CMDs, and the ventilation has great influence on the size distribution of aerosols. The CMDs of adobe house are smaller than that of the concrete houses. (authors)

  18. 40 CFR 158.220 - Experimental use permit data requirements for product performance. (United States)


    ..., birds, bats, canids, and skunks) that may directly or indirectly transmit diseases to humans. However... Note No. Efficacy of antimicrobial agents 91-8 Products for treating water systems NR NR CR NR NR NR NR...

  19. 29 CFR 1952.220 - Description of the plan as initially approved. (United States)


    ... respecting safety and health of employees in all workplaces of the State with the exception of employees of... requirements of the Occupational Safety and Health Act of 1970 and is consistent with the Constitution and laws...) The plan description documents including the Tennessee Occupational Safety and Health Act, the...

  20. A modification of the Daisy II - 220 technique for the determination of ...

    African Journals Online (AJOL)


    digestibility using rumen fluid/cellulase have been used extensively in laboratories worldwide. These techniques use individual digestion containers shaken twice daily and a two-stage 48 h digestion. Due to the individual sample handling, filtration and washing steps performed, the introduction of human error and amount ...

  1. 7 CFR Appendix C to Part 220 - Child Nutrition (CN) Labeling Program (United States)


    ... product label that contains a CN label statement and CN logo as defined in paragraph 3 (b) and (c) below... statement” as defined in paragraph 3(c). EC17SE91.003 (c) The “CN label statement” includes the following... alternate product toward the meat/meat alternate, bread/bread alternate, and/or vegetable/fruit component of...

  2. 77 FR 61895 - Electricity Market Transparency Provisions of Section 220 of the Federal Power Act (United States)


    ... Determination 105 b. Resale of Financial Transmission Rights in 109 Secondary Markets i. NOPR 109 ii. Comments... by non-public utilities, with non-public utilities accounting for 60 and 70 percent of wholesale... that the Commission's market-based rate program is based on a theory of regulation through competition...

  3. 20 CFR Appendix 2 to Part 220 - Medical-Vocational Guidelines (United States)


    ... the “Dictionary of Occupational Titles” and the “Occupational Outlook Handbook,” published by the... communicate in the English language, a finding of disabled is warranted. On the other hand, age is a more... even where the individual is illiterate or unable to communicate in English. However, a finding of...

  4. Clinical and laboratory findings in 220 children with recurrent abdominal pain

    NARCIS (Netherlands)

    Gijsbers, C. F. M.; Benninga, M. A.; Büller, H. A.


    Aim: To investigate the clinical and laboratory findings in children with recurrent abdominal pain (RAP). Methods: Consecutive patients with RAP (Apley criteria), age 4-16 years, referred to a secondary medical centre were evaluated by a standardized history, physical examination and laboratory

  5. Liquid poison injection system (LPIS) for KAIGA 1, 2 and RAPP 3, 4, 220 MWe PHWRs

    International Nuclear Information System (INIS)

    Soni, K.L.; Aparna; Mohan, L.R.; Nema, M.K.; Mahajan, S.C.


    LPIS is the modified version of existing Bulk Addition Mode (BAM) of the Automatic Liquid Poison Addition System (ALPAS). This BAM mode of ALPAS serves as slow acting supplementary shutdown system to PSS or SS as the case may be and hence it becomes a part of reactor safety system. The system (LPIS) has been envisaged to perform similar functions of ALPAS mode BAM. Now this is a self standing system. This feature of the system eliminates need of Gravity Addition of Boron System (GRAB). As the concept evolved is to be introduced for first time for the power reactors (from KAIGA-1, 2 and RAPP-3, 4 onwards), it has become necessary to check and verify its working by carrying out the necessary experimental and developmental work

  6. 28 CFR 2.20 - Paroling policy guidelines: Statement of general policy. (United States)


    ... Offenses Subchapter D—Sexual Offenses Subchapter E—Offenses Involving Aircraft Subchapter F—Communication... purpose of the kidnaping is for ransom or terrorism, grade as Category Eight; (b) If a person is held... Seven; (d) Otherwise, grade as Category Seven. (e) Exception: If not for ransom or terrorism, and no...

  7. Formation of Mg2C3 phase in N220 nanocarbon containing low ...

    Indian Academy of Sciences (India)


    Aug 18, 2017 ... Chinese supplier, Magus Marketing, India) with size fractions. 3.0–1.0 mm ... Total mixing time was 45 min, ... by taking the oxygen from the MgO and leaving the Mg (g) .... [1] Mohoamed E and Ewais M 2004 J. Ceram. Soc.

  8. 26 CFR 22.0 - Certain elections under the Economic Recovery Tax Act of 1981. (United States)


    ... invalid. (b) Election of special use valuation for qualified real property. This paragraph applies to the election of special use valuation for qualified real property under section 2032A(d)(1) of the Code, as... the Code, (iii) Specifies the property with respect to which the election is made, and (iv) Provides...

  9. 43 CFR 2.20 - When will bureaus grant discretionary fee waivers? (United States)


    ..., and Indian tribes, when to do so without charge is an appropriate courtesy, or when the recipient is... business custom (e.g., furnishing personal reference data to prospective employers of former Department...

  10. Evaluation in the resonance range of nuclei with a mass number above 220

    International Nuclear Information System (INIS)

    Ribon, P.


    The author discusses the problems posed by the evaluation of neutron data for fissile or fertile nuclei in the range of resolved or unresolved resonances. It appears to take several years until the data of an experiment are used by the reactor physicists. If one wants to have recent data at one's disposal, one cannot have recourse to evaluated-data libraries. Moreover, the existing parameter sets are only fragmentary. A new evaluation is, therefore, necessary for nearly all of these nuclei, but it cannot be based upon different parameter sets; these are indeed contradictory, and the evaluator will have to go back to the original data. The author shows for the set of σ f of 235 U, that a careful comparison of the data shows up unsuspected local defects. Some examples illustrate the deviation between analyses carried out by different methods and between the results on the established divergences. The parameters or cross-sections are far from being known with the precision one would desire. This fact gives rise to anomalies in the interpretation of data necessary for understanding and simulation in the range of unresolved resonances. But the introduction of concepts connected with sub-threshold fission noticeably furthers this understanding. Therefore a comparison of the methods of analysis must be made in more and more accurate measurements (evaluation and correction of systematic errors). (author) [fr

  11. 30 CFR 220.011 - Schedule of allowable direct and allocable joint costs and credits. (United States)


    ..., DEPARTMENT OF THE INTERIOR MINERALS REVENUE MANAGEMENT ACCOUNTING PROCEDURES FOR DETERMINING NET PROFIT SHARE... NPSL operations are allowable provided that such employees work “full time” on some particular aspect... incidental expenses of the employee and members of his immediate family and transportation of his household...

  12. 75 FR 4805 - Electricity Market Transparency Provisions of Section 220 of the Federal Power Act (United States)


    ... Commission's jurisdiction for other purposes. \\1\\ At present, all public utilities, including power marketers... role.\\21\\ Because numerous market participants that are excluded from the Commission's section 205 jurisdiction do not file EQRs, a jurisdictional seller's market presence (i.e., its role in price formation) is...

  13. 20 CFR 220.126 - Relationship of ability to do work and residual functional capacity. (United States)


    ... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Relationship of ability to do work and... Relationship of ability to do work and residual functional capacity. (a) If the claimant can do his or her previous work (his or her usual work or other applicable past work), the Board will determine he or she is...

  14. Recommended ALIs and DACs for 10 CFR part 220: A consistent numerical set

    Energy Technology Data Exchange (ETDEWEB)

    Eckerman, K.F.


    Appendix B to 10 CFR Part 20 contains numerical data for controlling the intake of radionuclides in the workplace or in the environment. These data, derived from the recommendations of the International Commission on Radiological Protection (ICRP), do not provide a numerically consistent basis for demonstrating compliance with the limitation on dose stated in the regulation. This situation is largely a consequence of the numerical procedures used by the ICRP which did not maintain, in a strict numerical sense, the hierarchial relationship among the radiation protection quantities. In this work recommended values of the quantities in Appendix B to CFR Part 20 are developed using the dose coefficients of the applicable ICRP publications and a numerical procedure which ensures that the tabulated quantities are numerically consistent.

  15. 40 CFR 266.220 - What does a storage and treatment conditional exemption do? (United States)


    ... (CONTINUED) SOLID WASTES (CONTINUED) STANDARDS FOR THE MANAGEMENT OF SPECIFIC HAZARDOUS WASTES AND SPECIFIC TYPES OF HAZARDOUS WASTE MANAGEMENT FACILITIES Conditional Exemption for Low-Level Mixed Waste Storage... exemption exempts your low-level mixed waste from the regulatory definition of hazardous waste in 40 CFR 261...

  16. Management of 220 adolescents and adults with complications of hypospadias repair during childhood

    Directory of Open Access Journals (Sweden)

    Adam S. Howe


    Conclusion: Complications of childhood hypospadias repair may present later in life as some urethroplasties deteriorate with time. We now recommend to parents of children with repaired proximal hypospadias to come for follow-up as their child transitions to adolescence.

  17. Radiation Protection Act promulgated on May 19, 1988, SFS 1988: 220

    International Nuclear Information System (INIS)


    This Act entered into force on 1 July 1988 and supersedes the previous Radiation Protection Act (SFS 1958: 110). The objective of the new Act is to protect humans, animals and the environment from the harmful effects of ionizing as well as non-ionizing radiation. As previously, the main responsibility for public radiation protection will rest with one central radiation protection authority. The general obligations with regard to radiation protection place a greater responsibility than in the past on persons carrying out activities involving radiation. The Act also contains rules governing decommissioning of technical equipment which could generate radiation. Basically, the same requirements still apply regarding licensing of activities involving ionizing radiation, with certain extensions covering, inter alia, also production and transportation of radioactive material. Under the Act, it is now possible to adjust the licensing and supervisory procedures to the level of danger of the radiation source and the need for adequate competence, etc., and finally, more effective supervision is provided for. (NEA) [fr

  18. 7 CFR Appendix A to Part 220 - Alternate Foods for Meals (United States)


    ... have been met if reasonable overages of the vitamins and minerals, within the limits of good... vitamins or minerals which occur naturally in an ingredient at such concentration that the level specified will be substantially exceeded in the final product. Such excess will be permitted but no lable claim...

  19. 7 CFR Appendix B to Part 220 - Categories of Foods of Minimal Nutritional Value (United States)


    ... of 60° F. It either contains no alcohol or only such alcohol, not in excess of 0.5 percent by weight... food such as vitamins, minerals and protein. (2) Water ices. As defined by 21 CFR 135.160 Food and Drug...

  20. Optimization of bent perfect Si(220)-crystal monochromator for residual strain/stress instrument - Part II

    Czech Academy of Sciences Publication Activity Database

    Moon, MK; Mikula, Pavol; Hong, K.P.


    Roč. 368, - (2005), s. 70-75 ISSN 0921-4526 R&D Projects: GA ČR GA202/03/0891 Institutional research plan: CEZ:AV0Z10480505 Keywords : neutron diffraction * focusing * neutron diffraction Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 0.796, year: 2005

  1. Optimization of bent perfect Si(220)-crystal monochromator for residual strain/stress instrument - Part II

    Czech Academy of Sciences Publication Activity Database

    Moon, MK.; Em, Vt.; Lee, C.H.; Mikula, Pavol; Hong, KP; Choi, YH; Cheon, JK; Nam, UW; Kong, KN; Jin, KC


    Roč. 368, 1 2 3 4 (2005), s. 70-75 ISSN 0921-4526 R&D Projects: GA ČR(CZ) GA202/03/0891 Institutional research plan: CEZ:AV0Z10480505 Keywords : neutron monochromator * residual stress measurement * neutron diffractometers Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 0.796, year: 2005

  2. 20 CFR Appendix 3 to Part 220 - Railroad Retirement Board Occupational Disability Standards (United States)


    ... history of back pain under medical treatment for at least one year, and B. A history of back pain unresponsive to therapy for at least one year, and C. A history of back pain with functional limitations for at... from population-based registries in Connecticut, New Mexico, Utah, Hawaii, Atlanta, Detroit, Seattle...

  3. 29 CFR 825.220 - Protection for employees who request leave or otherwise assert FMLA rights. (United States)


    ... (other than health benefits), the same benefits would be required to be provided to an employee on unpaid..., restraining, or denying the exercise of (or attempts to exercise) any rights provided by the Act. (2) An..., restraining, or denying the exercise of rights provided by the Act. An employer may be liable for compensation...

  4. Evaluation of recycled hot mix asphalt concrete on Route 220 : final report. (United States)


    This report describes the performance of an approximately 8-mi section of roadway on which the rod two layers of asphalt concrete were milled, recycled through a conventional asphalt batch plant, and relaid. The recycled mix consisted of about 40% re...

  5. Installation report : evaluation of recycled hot mix asphaltic concrete on Route 220. (United States)


    This report describes a project in which the bituminous pavement on an approximately 8-mi. (13-km) section of roadway was removed, recycled through a conventional asphalt batch plant, and relaid. The project was accomplished with little difficulty an...

  6. Analysis of international intercomparisons results organized by Japan for integrating 222Rn-220Rn detectors

    International Nuclear Information System (INIS)

    Wu Yunyun; Cui Hongxing; Zhang Qingzhao; Shang Bing; Su Xu


    Objective: To guarantee the quality of measurements with the radon-thoron discriminative detectors of our laboratory. Methods: LD-P radon-thoron discriminative detector participated in the international intercomparison for integrating radon/thoron detectors organized by National Institute of Radiological Science (NIRS, Japan). Detectors were sent to NIRS for exposure. Radon intercomparison was conducted with radon chamber providing three levels of exposure: low, medium and high levels. Thoron intercomparison was carried out at thoron chamber, which also provided three levels of exposure: low, medium and high levels. Detectors were posted back to our laboratory for etching and analysis after exposure. Then the measured values were submitted to NIRS. Finally the reference values were informed of us. Results: The relative percent difference (RPD) between the measured value and the reference value for radon was -13.8%, -14.4% and -17.1% at low, medium and high levels respectively, and that of thoron were -14.4%, 8.9% and -3.2% at three levels respectively. Conclusions: Both radon and thoron measurement of our detectors rank as 'Category Ⅰ' in the 4th international intercomparisons for integrating radon/thoron detectors with the NIRS radon/thoron chambers. (authors)

  7. 20 CFR 220.112 - Conclusions by physicians concerning the claimant's disability. (United States)


    ... medically determinable physical or mental impairment which can be expected to result in death or which has... may have to consider such factors as age, education and past work experience. Such vocational factors... opinion by a treating source will be conclusive as to the medical issues of the nature and severity of a...

  8. Upgradation of design features of primary coolant pumps of Indian 220 MWe PHWR

    International Nuclear Information System (INIS)

    Sharma, S.S.; Mhetre, S.G.; Manna, M.M.


    Evolution in the design features of Primary Coolant Pump (PCP) had started in fifties for catering to stringent specification requirements of reactor coolant systems of larger capacity reactors of various kinds. Primary coolant pumps of PWR and PHWR are employed for circulating radioactive, pressurized hot water in a circuit consisting of reactor (heat source) and steam generator (heat sink). As primary coolant pump capacity decides the station capacity, larger capacity primary coolant pumps have been evolved. Since primary coolant pump pressure containing parts are part of Primary Heat Transport system envelope, the parts are designed, manufactured, inspected and tested in accordance with the applicable system guidelines. Flywheel is mounted on the motor shaft for increasing mass moment of inertia of pump motor rotor to meet the coast down requirements of reactor cooling system under Class-IV electrical power supply failure. Due to limited accessibility of the PCP (PCP installed in shut down accessible area), quick maintenance, condition monitoring, reliable shaft seal system/bearing system aspects have been of great concern to reactor owners and pump manufacturers. In this paper upgradation of design features of RAPS, MAPS and NAPS primary coolant pumps have been covered. (author). 4 figs., 1 tab

  9. 76 FR 24187 - Electricity Market Transparency Provisions of Section 220 of the Federal Power Act (United States)


    ... pipelines to post information regarding no-notice service.\\23\\ \\21\\ Transparency Provisions of Section 23 of... and any broker or exchange they use. This information would provide greater transparency regarding... the Commission explained in the Transparency NOI, obtaining EQR information from non-public utilities...

  10. 76 FR 79754 - Twelfth Meeting: RTCA Special Committee 220, Automatic Flight Guidance and Control (United States)


    ... technologies Administrative items (meeting schedule, location, and next meeting agenda) Any other business... 2 status--progress, issues and plan Review of WG 3 status--progress, issues and plans Review action.... Issued in Washington, DC, on December 15, 2011. Robert L. Bostiga, Manager, Business Operations Branch...

  11. 12 CFR 220.113 - Necessity for prompt payment and delivery in special cash accounts. (United States)


    ...). (b) It appears that in a typical case the supervisors of the retirement system meet only once or... accept delivery and pay for the securities before some date more than seven business days after the date... creditor (broker-dealer) in good faith” that the customer will “promptly make full cash payment for the...

  12. 24 CFR 220.821 - Items to be filed on submitting claim. (United States)


    ... filed on submitting claim. Within 30 days after the filing of the notice of intention to file claim, or... principal of the mortgage indebtedness; (h) All records, ledger cards, documents, books, papers and accounts...

  13. 20 CFR 645.220 - What activities are allowable under this part? (United States)


    ...) Occupational skills training; (3) English as a second language training; and (4) Mentoring. (f) Job retention... job retention and support services funded with WtW monies while they are participating in WIA activities. Job retention and support services can be provided with WtW funds only if they are not otherwise...

  14. 33 CFR 104.220 - Company or vessel personnel with security duties. (United States)


    ... measures; (e) Crowd management and control techniques; (f) Security related communications; (g) Knowledge...) Methods of physical screening of persons, personal effects, baggage, cargo, and vessel stores; and (m) The...

  15. Thoron (220Rn) decay products removal in poorly ventilated environments using unipolar ionizers: Dosimetric implications

    International Nuclear Information System (INIS)

    Joshi, M.; Sapra, B.K.; Khan, A.; Kothalkar, P.; Mayya, Y.S.


    Ionizers are proven to be effective in reducing the activity concentration of radon/thoron decay products in workplace environments. However, limited studies have been conducted on understanding the mechanism of removal and the related size dependency. This study demonstrates the feasibility of reducing the activity concentrations in small chambers and in room environments up to a factor of about 7. Field experiments in an uncontrolled ventilation area such as a thorium oxalate storage shed have also shown promising results with a possible concentration reduction by a factor of 4. However, these reductions have been necessarily associated with an increase (3-5 times) in the unattached fraction of the decay products which is a significant contributor to the lung dose. Owing to this, aspersions have been cast on the capability of the ionizers in reducing the effective dose. An attempt has been made here to estimate the effective doses over a wide range of parameters such as the initial unattached fraction, activity reduction ratio and the change in the unattached fraction, which get altered due to the use of ionizers. The study proves that for realistically achievable activity reduction ratios of about 3-5 with the employment of ionizers, the inhalation dose in workplace environments can be reduced by a factor of at least 4, as indicated by model calculations.

  16. 49 CFR Appendix C to Part 220 - Schedule of Civil Penalties 1 (United States)


    ... a willful violation. The Administrator reserves the right to assess a penalty of up to $100,000 for... right to assess a penalty of up to $100,000 for any violation where circumstances warrant. See 49 CFR... correspond to any subsection designation(s). For convenience, penalty citations will cite the CFR section and...

  17. 49 CFR 220.309 - Permitted uses; exceptions to other restrictions. (United States)


    ... performing a duty for the railroad. (c) An electronic device to take a photograph of a safety hazard or a...) FEDERAL RAILROAD ADMINISTRATION, DEPARTMENT OF TRANSPORTATION RAILROAD COMMUNICATIONS Electronic Devices... an electronic device to refer to a railroad rule, special instruction, timetable, or other directive...

  18. The CCFM Monte Carlo Generator CASCADE version 2.2.0

    Energy Technology Data Exchange (ETDEWEB)

    Jung, H. [DESY, Hamburg (Germany); Antwerp Univ. (Belgium); Baranov, S. [Lebedev Physics Inst. (Russian Federation); Deak, M. [Madrid Univ. (ES). Inst. de Fisica Teorica UAM/CSIC] (and others)


    CASCADE is a full hadron level Monte Carlo event generator for ep, {gamma}p and p anti p and pp processes, which uses the CCFM evolution equation for the initial state cascade in a backward evolution approach supplemented with off - shell matrix elements for the hard scattering. A detailed program description is given, with emphasis on parameters the user wants to change and common block variables which completely specify the generated events. (orig.)

  19. Thoron ({sup 220}Rn) decay products removal in poorly ventilated environments using unipolar ionizers: Dosimetric implications

    Energy Technology Data Exchange (ETDEWEB)

    Joshi, M.; Sapra, B.K.; Khan, A.; Kothalkar, P.; Mayya, Y.S., E-mail: [Radiological Physics and Advisory Division, Bhabha Atomic Research Centre, Mumbai, 400085 (India)


    Ionizers are proven to be effective in reducing the activity concentration of radon/thoron decay products in workplace environments. However, limited studies have been conducted on understanding the mechanism of removal and the related size dependency. This study demonstrates the feasibility of reducing the activity concentrations in small chambers and in room environments up to a factor of about 7. Field experiments in an uncontrolled ventilation area such as a thorium oxalate storage shed have also shown promising results with a possible concentration reduction by a factor of 4. However, these reductions have been necessarily associated with an increase (3-5 times) in the unattached fraction of the decay products which is a significant contributor to the lung dose. Owing to this, aspersions have been cast on the capability of the ionizers in reducing the effective dose. An attempt has been made here to estimate the effective doses over a wide range of parameters such as the initial unattached fraction, activity reduction ratio and the change in the unattached fraction, which get altered due to the use of ionizers. The study proves that for realistically achievable activity reduction ratios of about 3-5 with the employment of ionizers, the inhalation dose in workplace environments can be reduced by a factor of at least 4, as indicated by model calculations.

  20. 12 CFR 220.117 - Exception to 90-day rule in special cash account. (United States)


    ... profit. On Day 8 customer delivered his check for the cost of the purchase to the creditor (member firm... any check or draft drawn on a bank which in the ordinary course of business is payable on presentation...(f), if controlling, would permit the exception to undermine, to some extent, the effectiveness of...

  1. energy and exergy evaluation of a 220mw thermal power plant

    African Journals Online (AJOL)


    The outcomes of this work provide the exergy consumption and distribution profiles of the thermal power plant ... power plant with post-combustion CO2 capture. The once-through boiler exhibited the highest exergy destruction of all the plants ...

  2. MPACT VERA Input User s Manual, Version 2.2.0

    Energy Technology Data Exchange (ETDEWEB)

    Collins, Benjamin S. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Downar, Thomas [Univ. of Michigan, Ann Arbor, MI (United States); Fitzgerald, Andrew [Univ. of Michigan, Ann Arbor, MI (United States); Gehin, Jess C. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Godfrey, Andrew T. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Graham, Aaron [Univ. of Michigan, Ann Arbor, MI (United States); Jabaay, Daniel [Univ. of Michigan, Ann Arbor, MI (United States); Kelley, Blake W. [Univ. of Michigan, Ann Arbor, MI (United States); Kim, Kang [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Kochunas, Brendan [Univ. of Michigan, Ann Arbor, MI (United States); Kulesza, Joel A. [Univ. of Michigan, Ann Arbor, MI (United States); Larsen, Edward W. [Univ. of Michigan, Ann Arbor, MI (United States); Liu, Yuxuan [Univ. of Michigan, Ann Arbor, MI (United States); Liu, Zhouyu [Univ. of Michigan, Ann Arbor, MI (United States); Martin, William R. [Univ. of Michigan, Ann Arbor, MI (United States); Nelson, Adam G. [Univ. of Michigan, Ann Arbor, MI (United States); Palmtag, Scott [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Rose, Michael [Univ. of Michigan, Ann Arbor, MI (United States); Saller, Thomas [Univ. of Michigan, Ann Arbor, MI (United States); Stimpson, Shane G. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Trahan, Travis [Univ. of Michigan, Ann Arbor, MI (United States); Wang, J. W. [Univ. of Michigan, Ann Arbor, MI (United States); Wieselquist, William A. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Young, Mitchell [Univ. of Michigan, Ann Arbor, MI (United States); Zhu, Ang [Univ. of Michigan, Ann Arbor, MI (United States)


    The MPACT (Michigan PArallel Charactistics based Transport) code is designed to perform high-fidelity light water reactor (LWR) analysis using whole-core pin-resolved neutron transport calculations on modern parallel-computing hardware. The code consists of several libraries which provide the functionality necessary to solve steady-state eigenvalue problems. Several transport capabilities are available within MPACT including both 2-D and 3-D Method of Characteristics (MOC). A three-dimensional whole core solution based on the 2D-1D solution method provides the capability for full core depletion calculations.

  3. MPACT Standard Input User s Manual, Version 2.2.0

    Energy Technology Data Exchange (ETDEWEB)

    Collins, Benjamin S. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Downar, Thomas [Univ. of Michigan, Ann Arbor, MI (United States); Fitzgerald, Andrew [Univ. of Michigan, Ann Arbor, MI (United States); Gehin, Jess C. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Godfrey, Andrew T. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Graham, Aaron [Univ. of Michigan, Ann Arbor, MI (United States); Jabaay, Daniel [Univ. of Michigan, Ann Arbor, MI (United States); Kelley, Blake W. [Univ. of Michigan, Ann Arbor, MI (United States); Kim, Kang [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Kochunas, Brendan [Univ. of Michigan, Ann Arbor, MI (United States); Kulesza, Joel A. [Univ. of Michigan, Ann Arbor, MI (United States); Larsen, Edward W. [Univ. of Michigan, Ann Arbor, MI (United States); Liu, Yuxuan [Univ. of Michigan, Ann Arbor, MI (United States); Liu, Zhouyu [Univ. of Michigan, Ann Arbor, MI (United States); Martin, William R. [Univ. of Michigan, Ann Arbor, MI (United States); Nelson, Adam G. [Univ. of Michigan, Ann Arbor, MI (United States); Palmtag, Scott [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Rose, Michael [Univ. of Michigan, Ann Arbor, MI (United States); Saller, Thomas [Univ. of Michigan, Ann Arbor, MI (United States); Stimpson, Shane G. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Trahan, Travis [Univ. of Michigan, Ann Arbor, MI (United States); Wang, J. W. [Univ. of Michigan, Ann Arbor, MI (United States); Wieselquist, William A. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Young, Mitchell [Univ. of Michigan, Ann Arbor, MI (United States); Zhu, Ang [Univ. of Michigan, Ann Arbor, MI (United States)


    The MPACT (Michigan PArallel Charactistics based Transport) code is designed to perform high-fidelity light water reactor (LWR) analysis using whole-core pin-resolved neutron transport calculations on modern parallel-computing hardware. The code consists of several libraries which provide the functionality necessary to solve steady-state eigenvalue problems. Several transport capabilities are available within MPACT including both 2-D and 3-D Method of Characteristics (MOC). A three-dimensional whole core solution based on the 2D-1D solution method provides the capability for full core depletion calculations.

  4. 12 CFR 220.123 - Partial delayed issue contracts covering nonconvertible bonds. (United States)


    ... market conditions made it difficult or impossible, in a number of instances, to place an entire issue..., is involved. (e) Sections 3(a) (13) and (14) of the Securities Exchange Act of 1934 provide that an...

  5. The correlation between the ultraviolet lambda 220 feature and the diffuse lambda 4430 band

    International Nuclear Information System (INIS)

    Nandy, K.; Thompson, G.I.


    Observations of the ultraviolet feature which occurs close to 2200 A are presented for over 60 stars for which interstellar lambda 4430 data are available in the literature. Observational material used here is obtained from the ultraviolet spectra taken with the Sky Survey telescope (S2/68) in the ESRO TD1 satellite. The equivalent widths of the lambda 2200 feature have been determined from ultraviolet extinction at 2190 and 2500 A, and the relation between the equivalent width of the ultraviolet feature and the central depth of the lambda 4430 band has been determined. It is found that they are well correlated and the correlation coefficient, including allowance for errors, is greater than 0.9; this indicates that the carriers for the lambda 2200 feature and diffuse band lambda 4430 coexist in the interstellar medium. (author)

  6. 20 CFR 220.144 - Evaluation guides for a self-employed claimant. (United States)


    ... income. After the claimant's normal business expenses are deducted from the claimant's gross income to... the claimant's activities and their value to the claimant's business to decide whether the claimant...'s work activity on the value to the business of the claimant's services regardless of whether the...

  7. 7 CFR 2.20 - Under Secretary for Natural Resources and Environment. (United States)


    ... Comp., p. 351, and the National Contingency Plan, 40 CFR part 300. (iii) Represent USDA in contacts... to believe are being committed in that employee's presence or view, or for a felony with a warrant or...

  8. 7 CFR 220.8 - Nutrition standards and menu planning approaches for breakfasts. (United States)


    ...: (A) Grains/breads; and/or (B) Meat/meat alternate. (2) Quantities for the traditional food-based menu... potatoes to meet the grain/bread requirement. (h) What are the requirements for alternate menu planning... versus serve; (C) How such procedures will reduce plate waste; and (D) How a reasonable level of calories...

  9. Geomagnetic Absolute Mean Values at Hourly Intervals from 220 Observatories Worldwide (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This file is comprised of absolute mean hourly values of the geomagnetic components D, H and Z or X, Y and Z. These values, on magnetic tape, are available from...

  10. Study of the attachment between the decay products of 220Rn and monodisperse aerosols

    International Nuclear Information System (INIS)

    Kruger, J.


    Attachment can be described in terms of one of two theories, viz. the diffusion theory or the kinetic theory. The diffusion theory is based on the transport of radioactive atoms by means of the process of diffusion. An attachment proportional to the radius R of the aerosol particles for the size range used in these experiments, is predicted by this theory. The kinetic theory is based on intermolecular collisions as described by the kinetic theory of gasses. This theory predicts an attachment that is proportional to R 2 . Both these relationships have been established by other researchers. However, the author believes that they have not taken several important parameters into consideration in their experiments, several such parameters were also not properly controlled in their experiments. In the present investigation the attachment flux for the attachment of thorium B atoms (of an approximate concentration of 4x10 3 atoms/cm 3 ) to monodisperes polystyrene aerosols (of a radius from 0,5 to 2,5 μm) in the concentration range 1-30 particles/cm 3 , was directly measured. Steps were taken to prevent the formation of radiolytic nuclei, and all the relevant parameters were measured during the experiments. The attachment between the radioactive atoms and the aerosols was found to be directly proportional to the particle concentration N, as well as to R 2 . The sticking probability of atoms to a particle was found to be of the order of 0,1. The results show that the attachment was found; this was attributed to the attachment of radioactive atoms to agglomerate vapour molecules

  11. 24 CFR 220.806 - Pro rata refund of insurance premium. (United States)


    ... refund of insurance premium. Upon termination of loan insurance contract by a payment in full or by a... equal to the pro rata portion of the current annual loan insurance premium theretofore paid which is... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Pro rata refund of insurance...

  12. Design, construction and integration of hybrid drive components in commercial vehicles. The MAN hybrid drive truck TGL 12.220; Auslegung, Aufbau und Integration von Hybrid-Antriebskomponenten im Nutzfahrzeug. Der MAN Hybrid-Verteiler-Lkw TGL 12.220

    Energy Technology Data Exchange (ETDEWEB)

    Kerschl, Stefan; Hipp, Eberhand; Doebereiner, Rolf [MAN Nutzfahrzeuge AG, Muenchen (Germany)


    In contrast to the passenger car the drive train of commercial vehicles is designed basically in view of a maximum efficiency, because the fuel consumption has a determining portion in the vehicle operating expenses of the operators. The pay load of the vehicle also has a high value, in particular in the small and middle segment from 8 t of total weight. In view of pollutant issues the environmental zones which may be also driven by commercial vehicles only from a certain pollutant class were already furnished by many local authority districts. Additional demands for a purely, emission free electric short distance operation can result from suitable emission editions in bigger towns in future. MAN Nutzfahrzeuge AG meet these topical challenges with the development of a hybriddelivery truck of the 12 t - class. At this the aim is to meet to the demands after low CO{sub 2} issue and purely electric operation by a powerful battery system and the recuperation of brake energy. For the integration of the hybrid components in the vehicle it was respected to preserve the pay load of the vehicle without limiting the functionality. The dimensioning of the hybrid drive train for a delivery truck vehicle, the vehicle integration and the effects on the lifecycle economics are lighted up in the following. (orig.)

  13. The Mounting process and dielectric tests of the Parque Caballero armored substation in SF6(220 Kv); Montaje y pruebas dielectricas de la estacion blindada en gas SF6 (220 kV) 'Parque Caballero'

    Energy Technology Data Exchange (ETDEWEB)

    Decoud, Carlos; Bobadilla, Alberto [ANDE - Administracion Nacional de Electricidad, Assuncion (Paraguay)


    This document approaches the aspects referring to the mounting and also dielectric tests for the Parque Caballero armored substation in SF6. This type of installation represents a innovation regarding substations in urban centres. The most relevant items in relation to the mounting process are shown in a summarized way, as well as the aspects related to dielectric tests executed during the substation commissioning.

  14. Effectiveness of Acoustic and Conceptual Retrieval Cues in Memory for Words at Two Grade Levels. Technical Report No. 220. (United States)

    Ghatala, Elizabeth S.; Hurlbut, Nancy L.

    The effectiveness of two types of retrieval cues was assessed with second- and sixth-grade children. After a single presentation of a list of words, the children first recalled as many of the words as they could. Following free recall, children in each grade were given either conceptual (category names for words on the input lists) or acoustic…

  15. Alleviation of Water Stress Effects on MR220 Rice by Application of Periodical Water Stress and Potassium Fertilization

    Directory of Open Access Journals (Sweden)

    Nurul Amalina Mohd Zain


    Full Text Available The use of periodical water stress and potassium fertilization may enhance rice tolerance to drought stress and improve the crop’s instantaneous water use efficiency without much yield reduction. This study was conducted to assess the effects of different periodical water stress combined with potassium fertilization regimes on growth, yield, leaf gas exchanges and biochemical changes in rice grown in pots and compare them with standard local rice grower practices. Five treatments including (1 standard local grower’s practice (control, 80CF = 80 kg K2O/ha + control flooding; (2 120PW15 = 120 kg K2O/ha + periodical water stress for 15 days; (3 120DS15V = 120 kg K2O/ha + drought stress for 15 days during the vegetative stage; (4 120DS25V = 120 kg K2O/ha + drought stress for 25 days and (5 120DS15R = 120 kg K2O/ha + drought stress for 15 days during the reproductive stage, were evaluated in this experiment. Control and 120PW15 treatments were stopped at 100 DAS, and continuously saturated conditions were applied until harvest. It was found that rice under 120PW15 treatment showed tolerance to drought stress evidenced by increased water use efficiency, peroxidase (POX, catalase (CAT and proline levels, maximum efficiency of photosystem II (fv/fm and lower minimal fluorescence (fo, compared to other treatments. Path coefficient analysis revealed that most of parameters contribute directly rather than indirectly to rice yield. In this experiment, there were four factors that are directly involved with rice yield: grain soluble sugar, photosynthesis, water use efficiency and total chlorophyll content. The residual factors affecting rice yield are observed to be quite low in the experiment (0.350, confirming that rice yield was mostly influenced by the parameters measured during the study.

  16. 77 FR 27417 - Foreign-Trade Zone 220-Sioux Falls, SD; Notification of Proposed Production Activity, Rosenbauer... (United States)


    ... is used for the production of emergency vehicles and firefighting equipment (pumps, tankers, rescue... drives, DC motors, static converters, rechargeable flashlights, flashlight parts, electrical foam..., LLC, (Emergency Vehicles/Firefighting Equipment), Lyons, SD The Sioux Falls Development Foundation...

  17. Can a single pain rating replace a multiple pain rating in third molar surgery studies? Analysis of 220 patients

    NARCIS (Netherlands)

    Martin, W.J.J.M.; Heymans, M.W.; Skorpil, N.E.; Forouzanfar, T.


    This study describes the comparison of multiple and single pain ratings in patients after surgical removal of the third molar. Correlation and agreement analysis were performed between the average pain intensity measured three times a day over a period of 7 days and one single pain rating

  18. SU-E-T-220: A Web-Based Research System for Outcome Analysis of NSCLC Treated with SABR. (United States)

    Le, A; Yang, Y; Michalski, D; Heron, D; Huq, M


    To establish a web-based software system, an electronic patient record (ePR), to consolidate and evaluate clinical data, dose delivery and treatment outcomes for non small cell lung cancer (NSCLC) patients treated with hypofractionated stereotactic ablative radiation therapy (SABR) across institutions. The new trend of information technology in medical imaging and informatics is towards the development of an electronic patient record (ePR), in which all health and medical information of each patient are organized under the patient's name and identification number. The system has been developed using the Wamp Server, a package of Apache web server, PHP and MySQL database to facilitate patient data input and management, and evaluation of patient clinical data and dose delivery across institution using web technology. The data of each patient to be recorded in the database include pre-treatment clinical data, treatment plan in DICOM-RT format and follow-up data. The pre-treatment data include demographics data, pathology condition, cancer staging. The follow-up data include the survival status, local tumor control condition and toxicity. The clinical data are entered to the system through the web page while the treatment plan data will be imported from the treatment planning system (TPS) using DICOM communication. The collection of data of NSCLC patients treated with SABR stored in the ePR is always accessible and can be retrieved and processed in the future. The core of the ePR is the database which integrates all patient data in one location. The web-based DICOM RT ePR system utilizes the current state-of-the-art medical informatics approach to investigate the combination and consolidation of patient data and outcome results. This will allow clinically-driven data mining for dose distributions and resulting treatment outcome in connection with biological modeling of the treatment parameters to quantify the efficacy of SABR in treating NSCLC patients. © 2012 American Association of Physicists in Medicine.


    This SOP describes the method for collecting soil samples from the child's outdoor play area to measure for persistent organic pollutants. Soil samples are collected by scraping up the top 0.5 cm of soil in a 0.095 m2 (1 ft2) area in the middle of the child's play area.

  20. Three-Dimensional Evolution of Erupted Flux Ropes from the Sun (2-20 Solar Radii) to 1 AU (United States)


    public release; distribution unlimited 13. SUPPLEMENTARY NOTES Preprint, Solar Phys., 2013 14. ABSTRACT 15. SUBJECT TERMS 16. SECURITY ...NASA GSFC (USA), RAL and University of Birmingham (UK), MPS(Germany), CSL (Belgium), IOTA and IAS (France). References Brueckner, G.E., Howard, R.A