Process development studies for the production of β-glucosidase from Aspergillus phoenicis
Energy Technology Data Exchange (ETDEWEB)
Howell, Mary Jane [Univ. of California, Berkeley, CA (United States); Wilke, C. R. [Univ. of California, Berkeley, CA (United States)
1978-09-01
This work is concerned with the production of β-glucosidase from Aspergillus phoenicis for use in the enzymatic hydrolysis of cellulose. Kinetic growth data indicate that two distinct periods of growth exist. The observed growth kinetics result from a biochemical differentiation of the filament which is independent of the substrate concentration. The optimum temperature for cell mass and β-glucosidase production was found to be 30°C. The optimum pH for β-glucosidase production is 5 and the highest specific cell growth rate was observed when the growth medium was controlled at pH 4.5. The most economical substrate was 0.75 g/l of Solka Floc, a spruce wood pulp, plus 0.25 g/l of Trichoderma viride cellulase, required because A. phoenicis does not produce all the enzymes required to solubilize cellulose. When freeze-dried A. phoenicis enzyme was added to the hydrolysis of acid treated corn stover by Tricoderma viride cellulase, the total sugar yield was increased by 4 g/l of hydrolysate over the yield of 20 g/l obtained without β-glucosidase addition. In addition, the cellobiose, which accounted for about 10% of the sugar concentration, was converted to glucose, a more widely useable product. Preliminary designs of several processes for the production of β-glucosidase were made. The most economical processes were continuous production schemes. Ball milling was the most cost effective method, but the use of an elevated temperature stage was economical enough to warrant further study. The cost of production of β-glucosidase was found to be too high to justify its addition to a process for enzymatically hydrolyzing cellulose at this time.
Directory of Open Access Journals (Sweden)
Vivian Machado Benassi
2012-09-01
Full Text Available Aspergillus phoenicis is an interesting heat tolerant fungus that can synthesize enzymes with several applications in the food industry due to its great hydrolytic potential. In this work, the fungus produced high enzymatic levels when cultivated on inexpensive culture media consisting of flakes from different origins such as cassava flour, wheat fibre, crushed soybean, agro-industrial wastes, starch, glucose or maltose. Several enzymatic systems were produced from these carbon sources, but amylase was the most evident, followed by pectinase and xylanase. Traces of CMCases, avicelase, lipase, β-xylosidase, β-glucosidase and α-glucosidase activities were also detected. Amylases were produced on rye flakes, starch, oat flakes, corn flakes, cassava flour and wheat fibre. Significant amylolytic levels were produced in the culture medium with glucose or when this sugar was exhausted, suggesting an enzyme in the constitutive form. Cassava flour, rye, oats, barley and corn flakes were also used as substrates in the hydrolytic reactions, aiming to verify the liberation potential of reducing sugars. Corn flakes induced greater liberation of reducing sugars as compared to the others. Thin layer chromatography of the reaction end products showed that the hydrolysis of cassava flour liberated maltooligosaccharides, but cassava flour and corn, rye, oats and barley flakes were hydrolyzed to glucose. These results suggested the presence of glucoamylase and α-amylase as part of the enzymatic pool of A. phoencis.Aspergillus phoenicis é um fungo termotolerante interessante, uma vez que pode sintetizar enzimas com diversas aplicações em indústrias alimentícias em função de seu grande potencial de hidrólise. Neste trabalho, verificou-se que esse fungo produziu níveis enzimáticos elevados, quando o mesmo foi cultivado em meio de cultura de baixo custo, constituído de flocos de diferentes origens, como farinha de mandioca, fibra de trigo, soja
Directory of Open Access Journals (Sweden)
Daniel Júnior de Andrade
2013-03-01
Full Text Available A adição de fertilizantes foliares à calda acaricida é frequentemente empregada na citricultura com o intuito de reduzir os custos das aplicações. Todavia, as implicações desta prática, na maioria dos casos, são desconhecidas. O objetivo do trabalho foi avaliar o efeito de caldas acaricidas em mistura com fertilizantes foliares e preparadas com diferentes águas no controle do ácaro B. phoenicis. Foram realizados dois experimentos em laboratório, nos anos de 2009 e 2010, utilizando-se de frutos de laranja para conter ácaros Brevipalpus phoenicis. Um dos experimentos constou de três bioensaios, nos quais se procurou verificar o efeito das misturas entre fertilizantes foliares e os acaricidas cyhexatin, propargite e acrinatrhrin sobre B. phoenicis. No outro experimento, além de verificar o efeito das misturas de fertilizantes com os acaricidas propargite e acrinatrhrin, buscou-se também avaliar o efeito de águas coletadas em diferentes fontes utilizadas no preparo das caldas sobre B. phoenicis. Os resultados evidenciaram que a aplicação dos fertilizantes foliares cloreto de zinco, cloreto de manganês, ureia e a mistura de fosfito de potássio + ureia + cloreto de zinco não afetaram a ação dos acaricidas cyhexatin, propargite e acrinathrin sobre o controle de B. phoenicis. As misturas dos cloretos de zinco e de manganês com o sulfato de magnésio e a adição de fosfito de potássio diminuíram a eficiência dos acaricidas propargite e acrinathrin, não devendo, a princípio, ser adicionadas numa mesma aplicação. Águas provenientes dos municípios paulistas de Itápolis, Pirangi e Pirassununga interferiram na ação dos acaricidas propargite e acrinathin sobre B. phoenicis, sendo que a água coletada em Itápolis apresentou resultados superiores em termos de eficiência. Verificaram-se alterações dos valores de pH e da condutividade elétrica após a adição de alguns dos fertilizantes à calda acaricida.The addition
Directory of Open Access Journals (Sweden)
Ana Paula Fernandes
2010-03-01
Full Text Available O ácaro Brevipalpus phoenicis é encontrado nos cafezais do Brasil desde a década de 50. Responsável por perdas indiretas por ser o vetor de uma doença virótica requer constantes medidas de controle, sendo a mais utilizada baseada na pulverização de acaricidas. Avaliou-se a mortalidade do ácaro B. phoenicis em função da cobertura de calda aplicada em plantas de café, com dois tipos de ramais utilizados em pulverizadores de jato transportado e quatro volumes de aplicação. O produto utilizado para o trabalho foi o acaricida abamectina (Vertimec 18 CE® na dose de 0,4 L/ha. Os tratamentos utilizados foram a aplicação do acaricida abamectina, nos volumes de 250, 400, 550 e 700 L/ha, com dois tipos de ramais de bicos. Em cada tratamento foram avaliadas a eficiência de controle de B. phoenicis, a deposição e a cobertura da calda nas plantas de café. O delineamento experimental utilizado foi em blocos casualizados, com oito tratamentos mais uma testemunha e quatro repetições. A análise estatística foi realizada no esquema fatorial 2x4+1. Verificou-se que não houve diferenças significativas no número de ácaros encontrados entre os tratamentos. Para a deposição de calda, observou-se um aumento em função do volume de aplicação, sendo que a parte superior das plantas apresentou maior deposição de produto. A duplicação dos ramais resultou em um aumento significativo da eficiência de controle de B. phoenicis comparado ao ramal convencional e à testemunha, independe do volume de aplicação entre os limites avaliados.Efficiency of different spraying lances and spraying volumes on the control of Brevipalpus phoenicis in coffee crops. The mite Brevipalpus phoenicis is found on coffee plantations in Brazil since the 1950's. Responsible for indirect losses due to its role as vector of a virus disease, this mite species often requires control measures, the most common based on mitecide spraying. It was evaluated the mortality
Directory of Open Access Journals (Sweden)
Daniel Júnior de Andrade
2010-03-01
Full Text Available O ácaro Brevipalpus phoenicis é uma das principais pragas dos citros por ser vetor do "Citrus Leprosis Virus" (CiLV, agente causal da leprose, uma das mais graves doenças da citricultura. Objetivou-se avaliar o efeito tóxico de produtos à base de abamectina sobre o ácaro B. phoenicis. Foram realizados um experimento de ação direta e três de ação residual no Laboratório de Acarologia do Departamento de Proteção de Plantas (Fitossanidade da FCAV - UNESP, Jaboticabal-SP. O delineamento adotado nos bioensaios foi o inteiramente casualizado, onde 10 tratamentos foram repetidos 7 vezes, sendo cada repetição composta por um fruto de laranja. Os tratamentos estudados (mL p.c./100 L de água foram: Acaramik a 20; 30; 40 e 50 mL; Vertimec a 30 e 40 mL; Abamectin Nortox a 30 e 40 mL; Tricofol a 77 mL e uma testemunha sem aplicação. Utilizaram-se frutos com presença de verrugose, que foram lavados e parcialmente parafinados, deixando-se uma área sem parafina, que foi circundada com cola entomológica para contenção dos ácaros. Transferiram-se 20 ácaros adultos B. phoenicis para cada fruto. No bioensaio de ação direta, a transferência foi realizada antes das aplicações e, nos bioensaios de ação residual, aos 5; 10 e 15 dias após a aplicação dos produtos. A aplicação dos produtos sobre os frutos foi realizada em Torre de Potter. Os resultados obtidos nos bioensaios evidenciaram que os melhores tratamentos foram: Tricofol a 77 mL, Acaramik a 40 e 50 mL e Vertimec a 40 mL. De forma geral, os produtos testados podem ser utilizados no controle do ácaro B. phoenicis.The mite Brevipalpus phoenicis (Geijskes, 1939 (Acari: Tenuipalpidae is one of the most important pests in Brazil citrus plantation, because it is the virus "Citrus Leprosis Virus" (CiLV vector, one of the most serious citrus plantation diseases. The purpose of this experiment was to evaluate the toxical effect of abamectin in the mite B. phoenicis. It was performed
Energy Technology Data Exchange (ETDEWEB)
Hagiwara, Yohsuke; Tateno, Masaru [Graduate School of Pure and Applied Sciences, University of Tsukuba, Tennodai 1-1-1, Tsukuba Science City, Ibaraki 305-8571 (Japan); Ohta, Takehiro [Center for Computational Sciences, University of Tsukuba, Tennodai 1-1-1, Tsukuba Science City, Ibaraki 305-8577 (Japan)], E-mail: tateno@ccs.tsukuba.ac.jp
2009-02-11
An interface program connecting a quantum mechanics (QM) calculation engine, GAMESS, and a molecular mechanics (MM) calculation engine, AMBER, has been developed for QM/MM hybrid calculations. A protein-DNA complex is used as a test system to investigate the following two types of QM/MM schemes. In a 'subtractive' scheme, electrostatic interactions between QM/MM regions are truncated in QM calculations; in an 'additive' scheme, long-range electrostatic interactions within a cut-off distance from QM regions are introduced into one-electron integration terms of a QM Hamiltonian. In these calculations, 338 atoms are assigned as QM atoms using Hartree-Fock (HF)/density functional theory (DFT) hybrid all-electron calculations. By comparing the results of the additive and subtractive schemes, it is found that electronic structures are perturbed significantly by the introduction of MM partial charges surrounding QM regions, suggesting that biological processes occurring in functional sites are modulated by the surrounding structures. This also indicates that the effects of long-range electrostatic interactions involved in the QM Hamiltonian are crucial for accurate descriptions of electronic structures of biological macromolecules.
Gkionis, Konstantinos; Kruse, Holger; Šponer, Jiří
2016-04-12
Modern dispersion-corrected DFT methods have made it possible to perform reliable QM studies on complete nucleic acid (NA) building blocks having hundreds of atoms. Such calculations, although still limited to investigations of potential energy surfaces, enhance the portfolio of computational methods applicable to NAs and offer considerably more accurate intrinsic descriptions of NAs than standard MM. However, in practice such calculations are hampered by the use of implicit solvent environments and truncation of the systems. Conventional QM optimizations are spoiled by spurious intramolecular interactions and severe structural deformations. Here we compare two approaches designed to suppress such artifacts: partially restrained continuum solvent QM and explicit solvent QM/MM optimizations. We report geometry relaxations of a set of diverse double-quartet guanine quadruplex (GQ) DNA stems. Both methods provide neat structures without major artifacts. However, each one also has distinct weaknesses. In restrained optimizations, all errors in the target geometries (i.e., low-resolution X-ray and NMR structures) are transferred to the optimized geometries. In QM/MM, the initial solvent configuration causes some heterogeneity in the geometries. Nevertheless, both approaches represent a decisive step forward compared to conventional optimizations. We refine earlier computations that revealed sizable differences in the relative energies of GQ stems computed with AMBER MM and QM. We also explore the dependence of the QM/MM results on the applied computational protocol.
International Nuclear Information System (INIS)
Machi, Andre R.; Arthur, Valter
2013-01-01
Brevipalpus phoenicis mite are controlled across of solutions acaricides, which are chemicals and leave residues in addition there is the difficulty of an effective pulverization due to the small size of the mite, the objective of this study was to evaluate of the influence of oxygen combined with gamma radiation on B.phoenicis as alternative control. Were used 70 mites per arena in 9 reps on 3 treatments at doses of 0 (control), 200 and 300 Gy. For irradiation, the leaves containing the mites, were cut and placed on bottles with bladder tied with ribbons and strings, before was put pure oxygen and the bottle was then sealed, these were taken to a gamma irradiator of Cobalt 60-type Gammacell 220, under a dose rate of 0.381 kGy/hour located in the CENA/USP. Was evaluated daily (eggs, nymphs and adults) of the mites observed viability, fertility and mortality across of the analysis of variance design with completely randomized design using the Statistical Analysis System (SAS) version 9.2® and by the Tukey test, the verification of means. After 22 days of irradiation the hatchability in 200 Gy dose was 41% after 3 days and 57% in control dose, this differed statistically of the other doses, where the nymphs arrived to the adult stage, which did not occurred in the 200 Gy dose and higher due to mutations, generated by the gamma radiation. In 300 Gy not was observed the presence of nymphs and eggs, being the sterilizing dose for all stages of the B.phoenicis. (author)
Energy Technology Data Exchange (ETDEWEB)
Machi, Andre R., E-mail: rica_machi@hotmail.com [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN- SP), Sao Paulo, SP (Brazil); Arthur, Valter, E-mail: arthur@cena.usp.br [Centro de Energia na Agricultura (CENA/USP), Piracicaba, SP (Brazil)
2013-07-01
Brevipalpus phoenicis mite are controlled across of solutions acaricides, which are chemicals and leave residues in addition there is the difficulty of an effective pulverization due to the small size of the mite, the objective of this study was to evaluate of the influence of oxygen combined with gamma radiation on B.phoenicis as alternative control. Were used 70 mites per arena in 9 reps on 3 treatments at doses of 0 (control), 200 and 300 Gy. For irradiation, the leaves containing the mites, were cut and placed on bottles with bladder tied with ribbons and strings, before was put pure oxygen and the bottle was then sealed, these were taken to a gamma irradiator of Cobalt 60-type Gammacell 220, under a dose rate of 0.381 kGy/hour located in the CENA/USP. Was evaluated daily (eggs, nymphs and adults) of the mites observed viability, fertility and mortality across of the analysis of variance design with completely randomized design using the Statistical Analysis System (SAS) version 9.2® and by the Tukey test, the verification of means. After 22 days of irradiation the hatchability in 200 Gy dose was 41% after 3 days and 57% in control dose, this differed statistically of the other doses, where the nymphs arrived to the adult stage, which did not occurred in the 200 Gy dose and higher due to mutations, generated by the gamma radiation. In 300 Gy not was observed the presence of nymphs and eggs, being the sterilizing dose for all stages of the B.phoenicis. (author)
Quantum mechanics/coarse-grained molecular mechanics (QM/CG-MM).
Sinitskiy, Anton V; Voth, Gregory A
2018-01-07
Numerous molecular systems, including solutions, proteins, and composite materials, can be modeled using mixed-resolution representations, of which the quantum mechanics/molecular mechanics (QM/MM) approach has become the most widely used. However, the QM/MM approach often faces a number of challenges, including the high cost of repetitive QM computations, the slow sampling even for the MM part in those cases where a system under investigation has a complex dynamics, and a difficulty in providing a simple, qualitative interpretation of numerical results in terms of the influence of the molecular environment upon the active QM region. In this paper, we address these issues by combining QM/MM modeling with the methodology of "bottom-up" coarse-graining (CG) to provide the theoretical basis for a systematic quantum-mechanical/coarse-grained molecular mechanics (QM/CG-MM) mixed resolution approach. A derivation of the method is presented based on a combination of statistical mechanics and quantum mechanics, leading to an equation for the effective Hamiltonian of the QM part, a central concept in the QM/CG-MM theory. A detailed analysis of different contributions to the effective Hamiltonian from electrostatic, induction, dispersion, and exchange interactions between the QM part and the surroundings is provided, serving as a foundation for a potential hierarchy of QM/CG-MM methods varying in their accuracy and computational cost. A relationship of the QM/CG-MM methodology to other mixed resolution approaches is also discussed.
Quantum mechanics/coarse-grained molecular mechanics (QM/CG-MM)
Sinitskiy, Anton V.; Voth, Gregory A.
2018-01-01
Numerous molecular systems, including solutions, proteins, and composite materials, can be modeled using mixed-resolution representations, of which the quantum mechanics/molecular mechanics (QM/MM) approach has become the most widely used. However, the QM/MM approach often faces a number of challenges, including the high cost of repetitive QM computations, the slow sampling even for the MM part in those cases where a system under investigation has a complex dynamics, and a difficulty in providing a simple, qualitative interpretation of numerical results in terms of the influence of the molecular environment upon the active QM region. In this paper, we address these issues by combining QM/MM modeling with the methodology of "bottom-up" coarse-graining (CG) to provide the theoretical basis for a systematic quantum-mechanical/coarse-grained molecular mechanics (QM/CG-MM) mixed resolution approach. A derivation of the method is presented based on a combination of statistical mechanics and quantum mechanics, leading to an equation for the effective Hamiltonian of the QM part, a central concept in the QM/CG-MM theory. A detailed analysis of different contributions to the effective Hamiltonian from electrostatic, induction, dispersion, and exchange interactions between the QM part and the surroundings is provided, serving as a foundation for a potential hierarchy of QM/CG-MM methods varying in their accuracy and computational cost. A relationship of the QM/CG-MM methodology to other mixed resolution approaches is also discussed.
Systematic Quantum Mechanical Region Determination in QM/MM Simulation.
Karelina, Maria; Kulik, Heather J
2017-02-14
Hybrid quantum mechanical-molecular mechanical (QM/MM) simulations are widely used in enzyme simulation. Over ten convergence studies of QM/MM methods have revealed over the past several years that key energetic and structural properties approach asymptotic limits with only very large (ca. 500-1000 atom) QM regions. This slow convergence has been observed to be due in part to significant charge transfer between the core active site and the surrounding protein environment, which cannot be addressed by improvement of MM force fields or the embedding method employed within QM/MM. Given this slow convergence, it becomes essential to identify strategies for the most atom-economical determination of optimal QM regions and to gain insight into the crucial interactions captured only in large QM regions. Here, we extend and develop two methods for quantitative determination of QM regions. First, in the charge shift analysis (CSA) method, we probe the reorganization of electron density when core active site residues are removed completely, as determined by large-QM region QM/MM calculations. Second, we introduce the highly parallelizable Fukui shift analysis (FSA), which identifies how core/substrate frontier states are altered by the presence of an additional QM residue in smaller initial QM regions. We demonstrate that the FSA and CSA approaches are complementary and consistent on three test case enzymes: catechol O-methyltransferase, cytochrome P450cam, and hen eggwhite lysozyme. We also introduce validation strategies and test the sensitivities of the two methods to geometric structure, basis set size, and electronic structure methodology. Both methods represent promising approaches for the systematic, unbiased determination of quantum mechanical effects in enzymes and large systems that necessitate multiscale modeling.
Structural analysis of recombinant human protein QM
International Nuclear Information System (INIS)
Gualberto, D.C.H.; Fernandes, J.L.; Silva, F.S.; Saraiva, K.W.; Affonso, R.; Pereira, L.M.; Silva, I.D.C.G.
2012-01-01
Full text: The ribosomal protein QM belongs to a family of ribosomal proteins, which is highly conserved from yeast to humans. The presence of the QM protein is necessary for joining the 60S and 40S subunits in a late step of the initiation of mRNA translation. Although the exact extra-ribosomal functions of QM are not yet fully understood, it has been identified as a putative tumor suppressor. This protein was reported to interact with the transcription factor c-Jun and thereby prevent c-Jun actives genes of the cellular growth. In this study, the human QM protein was expressed in bacterial system, in the soluble form and this structure was analyzed by Circular Dichroism and Fluorescence. The results of Circular Dichroism showed that this protein has less alpha helix than beta sheet, as described in the literature. QM protein does not contain a leucine zipper region; however the ion zinc is necessary for binding of QM to c-Jun. Then we analyzed the relationship between the removal of zinc ions and folding of protein. Preliminary results obtained by the technique Fluorescence showed a gradual increase in fluorescence with the addition of increasing concentration of EDTA. This suggests that the zinc is important in the tertiary structure of the protein. More studies are being made for better understand these results. (author)
2010-01-01
... 7 Agriculture 3 2010-01-01 2010-01-01 false Color. 58.329 Section 58.329 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards, Inspections....329 Color. Coloring, when used shall be Annatto or any color which is approved by the U.S. Food and...
Relative Free Energies for Hydration of Monovalent Ions from QM and QM/MM Simulations.
Lev, Bogdan; Roux, Benoît; Noskov, Sergei Yu
2013-09-10
Methods directly evaluating the hydration structure and thermodynamics of physiologically relevant cations (Na(+), K(+), Cl(-), etc.) have wide ranging applications in the fields of inorganic, physical, and biological chemistry. All-atom simulations based on accurate potential energy surfaces appear to offer a viable option for assessing the chemistry of ion solvation. Although MD and free energy simulations of ion solvation with classical force fields have proven their usefulness, a number of challenges still remain. One of them is the difficulty of force field benchmarking and validation against structural and thermodynamic data obtained for a condensed phase. Hybrid quantum mechanical/molecular mechanical (QM/MM) models combined with sampling algorithms have the potential to provide an accurate solvation model and to incorporate the effects from the surrounding, which is often missing in gas-phase ab initio computations. Herein, we report the results from QM/MM free energy simulations of Na(+)/K(+) and Cl(-)/Br(-) hydration where we simultaneously characterized the relative thermodynamics of ion solvation and changes in the solvation structure. The Flexible Inner Region Ensemble Separator (FIRES) method was used to impose a spatial separation between QM region and the outer sphere of solvent molecules treated with the CHARMM27 force field. FEP calculations based on QM/MM simulations utilizing the CHARMM/deMon2k interface were performed with different basis set combinations for K(+)/Na(+) and Cl(-)/Br(-) perturbations to establish the dependence of the computed free energies on the basis set level. The dependence of the computed relative free energies on the size of the QM and MM regions is discussed. The current methodology offers an accurate description of structural and thermodynamic aspects of the hydration of alkali and halide ions in neat solvents and can be used to obtain thermodynamic data on ion solvation in condensed phase along with underlying
International Nuclear Information System (INIS)
Umino, Satoru; Takahashi, Hideaki; Morita, Akihiro
2016-01-01
In a recent work, we developed a method [H. Takahashi et al., J. Chem. Phys. 143, 084104 (2015)] referred to as exchange-core function (ECF) approach, to compute exchange repulsion E ex between solute and solvent in the framework of the quantum mechanical (QM)/molecular mechanical (MM) method. The ECF, represented with a Slater function, plays an essential role in determining E ex on the basis of the overlap model. In the work of Takahashi et al. [J. Chem. Phys. 143, 084104 (2015)], it was demonstrated that our approach is successful in computing the hydrogen bond energies of minimal QM/MM systems including a cationic QM solute. We provide in this paper the extension of the ECF approach to the free energy calculation in condensed phase QM/MM systems by combining the ECF and the QM/MM-ER approach [H. Takahashi et al., J. Chem. Phys. 121, 3989 (2004)]. By virtue of the theory of solutions in energy representation, the free energy contribution δμ ex from the exchange repulsion was naturally formulated. We found that the ECF approach in combination with QM/MM-ER gives a substantial improvement on the calculation of the hydration free energy of a hydronium ion. This can be attributed to the fact that the ECF reasonably realizes the contraction of the electron density of the cation due to the deficit of an electron.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Feeding. 3.29 Section 3.29 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE ANIMAL WELFARE... Hamsters Animal Health and Husbandry Standards § 3.29 Feeding. (a) Guinea pigs and hamsters shall be fed...
2015-01-01
The reliability of free energy simulations (FES) is limited by two factors: (a) the need for correct sampling and (b) the accuracy of the computational method employed. Classical methods (e.g., force fields) are typically used for FES and present a myriad of challenges, with parametrization being a principle one. On the other hand, parameter-free quantum mechanical (QM) methods tend to be too computationally expensive for adequate sampling. One widely used approach is a combination of methods, where the free energy difference between the two end states is computed by, e.g., molecular mechanics (MM), and the end states are corrected by more accurate methods, such as QM or hybrid QM/MM techniques. Here we report two new approaches that significantly improve the aforementioned scheme; with a focus on how to compute corrections between, e.g., the MM and the more accurate QM calculations. First, a molecular dynamics trajectory that properly samples relevant conformational degrees of freedom is generated. Next, potential energies of each trajectory frame are generated with a QM or QM/MM Hamiltonian. Free energy differences are then calculated based on the QM or QM/MM energies using either a non-Boltzmann Bennett approach (QM-NBB) or non-Boltzmann free energy perturbation (NB-FEP). Both approaches are applied to calculate relative and absolute solvation free energies in explicit and implicit solvent environments. Solvation free energy differences (relative and absolute) between ethane and methanol in explicit solvent are used as the initial test case for QM-NBB. Next, implicit solvent methods are employed in conjunction with both QM-NBB and NB-FEP to compute absolute solvation free energies for 21 compounds. These compounds range from small molecules such as ethane and methanol to fairly large, flexible solutes, such as triacetyl glycerol. Several technical aspects were investigated. Ultimately some best practices are suggested for improving methods that seek to connect
Czech Academy of Sciences Publication Activity Database
Rebroš, M.; Pilniková, A.; Šimčíková, Daniela; Weignerová, Lenka; Stloukal, R.; Křen, Vladimír; Rosenberg, M.
2013-01-01
Roč. 31, č. 6 (2013), s. 329-334 ISSN 1024-2422 R&D Projects: GA MŠk(CZ) 7E11010 Institutional support: RVO:61388971 Keywords : alpha-L-rhamnosidase * Aspergillus terreus * Immobilization Subject RIV: CE - Biochemistry Impact factor: 1.093, year: 2013
Energy Technology Data Exchange (ETDEWEB)
Umino, Satoru; Takahashi, Hideaki, E-mail: hideaki@m.tohoku.ac.jp; Morita, Akihiro [Department of Chemistry, Graduate School of Science, Tohoku University, Sendai, Miyagi 980-8578 (Japan)
2016-08-28
In a recent work, we developed a method [H. Takahashi et al., J. Chem. Phys. 143, 084104 (2015)] referred to as exchange-core function (ECF) approach, to compute exchange repulsion E{sub ex} between solute and solvent in the framework of the quantum mechanical (QM)/molecular mechanical (MM) method. The ECF, represented with a Slater function, plays an essential role in determining E{sub ex} on the basis of the overlap model. In the work of Takahashi et al. [J. Chem. Phys. 143, 084104 (2015)], it was demonstrated that our approach is successful in computing the hydrogen bond energies of minimal QM/MM systems including a cationic QM solute. We provide in this paper the extension of the ECF approach to the free energy calculation in condensed phase QM/MM systems by combining the ECF and the QM/MM-ER approach [H. Takahashi et al., J. Chem. Phys. 121, 3989 (2004)]. By virtue of the theory of solutions in energy representation, the free energy contribution δμ{sub ex} from the exchange repulsion was naturally formulated. We found that the ECF approach in combination with QM/MM-ER gives a substantial improvement on the calculation of the hydration free energy of a hydronium ion. This can be attributed to the fact that the ECF reasonably realizes the contraction of the electron density of the cation due to the deficit of an electron.
Directory of Open Access Journals (Sweden)
Mariangela Alves
2007-08-01
Full Text Available O objetivo deste trabalho foi avaliar a forma de ação de duas preparações de extrato pirolenhoso aplicadas diretamente sobre Brevipalpus phoenicis, que é o ácaro vetor da leprose dos citros, um dos principais problemas da citricultura Paulista. Para o experimento, foram utilizados ácaros adultos mantidos numa criação-estoque no laboratório de Acarologia da UNESP - Universidade Estadual Paulista, em Jaboticabal-SP. Os tratamentos foram constituídos por duas diferentes preparações (destilado e decantado de extrato pirolenhoso de eucalipto nas proporções EP:água de 1:600; 1:300 (normalmente recomendadas; 1:150; 1:75; 1:38; 1:19 e de água (testemunha, com 7 repetições. Cada parcela foi constituída de 10 ácaros mantidos sobre um fruto de laranja, em arena de 2,5 cm de diâmetro, delimitada com cola adesiva tipo Tanglefoot®. As aplicações foram efetuadas em Torre de Potter, pulverizando-se 2 mL por fruto das soluções correspondentes aos diferentes tratamentos. Os frutos foram mantidos em sala climatizada a 27±1ºC, e as avaliações foram realizadas 24 e 48 horas após a aplicação dos tratamentos, determinando-se o número de ácaros mortos (mortalidade e retidos na barreira adesiva (repelência. Os dois tipos de extrato pirolenhoso testados não apresentaram repelência significativa sobre Brevipalpus phoenicis; ambos induziram mortalidade significativa somente para concentrações acima de 1:150, com efeito mais pronunciado para o destilado; há um aumento na mortalidade de 24 para 48 horas após a aplicação; a ação protetora preconizada pela aplicação de baixas doses (1:300 a 1:600 nas plantas não é devida à mortalidade e repelência pelo contato direto do extrato pirolenhoso sobre os ácaros.The aim of this work was to evaluate the acaricide and repellent effects of two different pyroligneous extract preparations (PE applied directly on Brevipalpus phoenicis. This mite is the vector or citrus leprosies, which
Directory of Open Access Journals (Sweden)
Ozana M. de A. Maia
2006-09-01
Full Text Available A ocorrência de três espécies acarinas fitófagas é relatada pela primeira vez sobre folhas de Ipomoea cairica. As espécies Brevipalpus phoenicis (Geijskes, Tetranychus urticae (Koch e Polyphagotarsonemus latus (Banks, foram coletadas sobre folhas de I. cairica nas imediações da Universidade Federal do Paraná, Curitiba, Paraná, Brasil, em 20 de janeiro de 2005.The first occurrence of three phytophagus mites on Ipomoea cairica, is reported. The species Brevipalpus phoenicis (Geijskes, Tetranychus urticae (Koch and Polyphagotarsonemus latus (Banks were caught on leaves of I. cairica, around Universidade Federal do Paraná, Curitiba, Paraná, Brazil, in January 20th, 2005.
QM/MM investigations of organic chemistry oriented questions.
Schmidt, Thomas C; Paasche, Alexander; Grebner, Christoph; Ansorg, Kay; Becker, Johannes; Lee, Wook; Engels, Bernd
2014-01-01
About 35 years after its first suggestion, QM/MM became the standard theoretical approach to investigate enzymatic structures and processes. The success is due to the ability of QM/MM to provide an accurate atomistic picture of enzymes and related processes. This picture can even be turned into a movie if nuclei-dynamics is taken into account to describe enzymatic processes. In the field of organic chemistry, QM/MM methods are used to a much lesser extent although almost all relevant processes happen in condensed matter or are influenced by complicated interactions between substrate and catalyst. There is less importance for theoretical organic chemistry since the influence of nonpolar solvents is rather weak and the effect of polar solvents can often be accurately described by continuum approaches. Catalytic processes (homogeneous and heterogeneous) can often be reduced to truncated model systems, which are so small that pure quantum-mechanical approaches can be employed. However, since QM/MM becomes more and more efficient due to the success in software and hardware developments, it is more and more used in theoretical organic chemistry to study effects which result from the molecular nature of the environment. It is shown by many examples discussed in this review that the influence can be tremendous, even for nonpolar reactions. The importance of environmental effects in theoretical spectroscopy was already known. Due to its benefits, QM/MM can be expected to experience ongoing growth for the next decade.In the present chapter we give an overview of QM/MM developments and their importance in theoretical organic chemistry, and review applications which give impressions of the possibilities and the importance of the relevant effects. Since there is already a bunch of excellent reviews dealing with QM/MM, we will discuss fundamental ingredients and developments of QM/MM very briefly with a focus on very recent progress. For the applications we follow a similar
Age and helium content of the eclipsing binary AI Phoenicis
International Nuclear Information System (INIS)
VandenBerg, D.A.; Hrivnak, B.J.
1985-01-01
Comparisons of new theoretical isochrones for heavy-element abundances Z = 0.0169 (solar) and Z = 0.04 with recently published parameters of AI Phoenicis suggest that this system has an age of approximately (3.6 +- 0.7) x 10 9 yr and a helium content of Y = 0.38 +- 0.05. The indicated uncertainty is largely due to the lack of precise knowledge about the metallicity of the binary, since the fits to the data by both sets of isochrones are exceedingly good. The high helium content, which is required in order to reproduce the observed mass-luminosity relation, is suggested to be comparable with the values generally derived for binaries if the latter are adjusted to take into account the effect of the new Los Alamos opacities
2010-10-01
... 46 Shipping 7 2010-10-01 2010-10-01 false Storm rails. 169.329 Section 169.329 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS SAILING SCHOOL VESSELS Construction and Arrangement Rails and Guards § 169.329 Storm rails. Suitable storm rails or hand grabs must be...
QM/MM free energy simulations: recent progress and challenges
Lu, Xiya; Fang, Dong; Ito, Shingo; Okamoto, Yuko; Ovchinnikov, Victor
2016-01-01
Due to the higher computational cost relative to pure molecular mechanical (MM) simulations, hybrid quantum mechanical/molecular mechanical (QM/MM) free energy simulations particularly require a careful consideration of balancing computational cost and accuracy. Here we review several recent developments in free energy methods most relevant to QM/MM simulations and discuss several topics motivated by these developments using simple but informative examples that involve processes in water. For chemical reactions, we highlight the value of invoking enhanced sampling technique (e.g., replica-exchange) in umbrella sampling calculations and the value of including collective environmental variables (e.g., hydration level) in metadynamics simulations; we also illustrate the sensitivity of string calculations, especially free energy along the path, to various parameters in the computation. Alchemical free energy simulations with a specific thermodynamic cycle are used to probe the effect of including the first solvation shell into the QM region when computing solvation free energies. For cases where high-level QM/MM potential functions are needed, we analyze two different approaches: the QM/MM-MFEP method of Yang and co-workers and perturbative correction to low-level QM/MM free energy results. For the examples analyzed here, both approaches seem productive although care needs to be exercised when analyzing the perturbative corrections. PMID:27563170
2010-10-01
... 46 Shipping 4 2010-10-01 2010-10-01 false Fire pumps. 109.329 Section 109.329 Shipping COAST GUARD... of Safety Equipment § 109.329 Fire pumps. The master or person in charge shall insure that at least one of the fire pumps required in § 108.415 is ready for use on the fire main system at all times. ...
Li, Qian; Loman, Abdullah Al; Coffman, Anthony M; Ju, Lu-Kwang
2017-04-20
Soybean hull consists mainly of three major plant carbohydrates, i.e., cellulose, hemicellulose and pectin. It is inexpensive and a good potential substrate for carbohydrase production because it is capable of inducing a complete spectrum of activities to hydrolyze complex biomass. Aspergillus is known for carbohydrase production but no studies have evaluated and compared, among Aspergillus species and strains, the soybean hull induced production of various carbohydrases. In this study, A. aculeatus, A. cinnamomeus, A. foetidus, A. phoenicis and 11 A. niger strains were examined together with T. reesei Rut C30, another known carbohydrase producer. The carbohydrases evaluated included pectinase, polygalacturonase, xylanase, cellulase, α-galactosidase and sucrase. Growth morphology and pH profiles were also followed. Among Aspergillus strains, morphology was found to correlate with both carbohydrase production and pH decrease profile. Filamentous strains gave higher carbohydrase production while causing slower pH decrease. The enzyme broths produced were also tested for separation of soy flour carbohydrate and protein. Defatted soy flour contains about 53% protein and 32% carbohydrate. The enzymatic treatment can increase protein content and remove indigestible oligo-/poly-saccharides, and improve use of soy flour in feed and food. Protease production by different strains was therefore also compared for minimizing protein degradation. A. niger NRRL 322 and A. foetidus NRRL 341 were found to be the most potent strains that produced maximal carbohydrases and minimal protease under soybean hull induction. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Paulo Rebelles Reis
2005-06-01
Full Text Available O ácaro Brevipalpus phoenicis (Geijskes é importante em cafeeiro (Coffea spp. por ser o vetor do vírus da mancha-anular, doença responsável por queda de folhas e má qualidade da bebida do café, e o ácaro-vermelho Oligonychus ilicis (McGregor por reduzir a área foliar de fotossíntese. Ácaros da família Phytoseiidae, de várias espécies, são eficientes predadores associados aos ácaros-praga. Conduziu-se este trabalho com o objetivo de estudar o controle dos ácaros-praga com spirodiclofen e azocyclotin, e o impacto sobre fitoseídeos. Em laboratório foram estudados os efeitos ovicida, tópico, residual, tópico mais residual e a seletividade fisiológica aos fitoseídeos; em casa-de-vegetação foi avaliada a persistência no controle às duas espécies de ácaros-praga; e em campo foi avaliada a eficiência apenas no controle de B. phoenicis. Os bioensaios foram realizados em arenas de folhas destacadas. O efeito ovicida foi avaliado em ovos no início e final de incubação. Os efeitos residual, tópico e tópico mais residual foram avaliados pela mortalidade de larvas, ninfas e adultos aos oito dias, e a persistência até 30 dias após a aplicação. A seletividade aos fitoseídeos foi avaliada, pelo efeito na mortalidade e reprodução de fêmeas adultas, em teste residual em superfície de vidro. Spirodiclofen e azocyclotin (SC mostraram eficiente ação ovicida, principalmente para ovos de B. phoenicis no início de incubação. Para ovos de O. ilicis, somente o spirodiclofen apresentou efeito ovicida. Em geral, os efeitos tópico e residual associados melhoraram a eficiência dos produtos no controle das fases pós-embrionárias de ambas as espécies. O spirodiclofen apresentou seletividade aos ácaros predadores, já o azocyclotin foi nocivo. Em campo, ambos os acaricidas mostram-se altamente eficientes na redução de todas as fases pós-embrionárias do ácaro B. phoenicis, principalmente nas folhas.The mite Brevipalpus
On the difference between additive and subtractive QM/MM calculations
Cao, Lili; Ryde, Ulf
2018-04-01
The combined quantum mechanical (QM) and molecular mechanical (MM) approach (QM/MM) is a popular method to study reactions in biochemical macromolecules. Even if the general procedure of using QM for a small, but interesting part of the system and MM for the rest is common to all approaches, the details of the implementations vary extensively, especially the treatment of the interface between the two systems. For example, QM/MM can use either additive or subtractive schemes, of which the former is often said to be preferable, although the two schemes are often mixed up with mechanical and electrostatic embedding. In this article, we clarify the similarities and differences of the two approaches. We show that inherently, the two approaches should be identical and in practice require the same sets of parameters. However, the subtractive scheme provides an opportunity to correct errors introduced by the truncation of the QM system, i.e. the link atoms, but such corrections require additional MM parameters for the QM system. We describe and test three types of link-atom correction, viz. for van der Waals, electrostatic and bonded interactions. The calculations show that electrostatic and bonded link-atom corrections often give rise to problems in the geometries and energies. The van der Waals link-atom corrections are quite small and give results similar to a pure additive QM/MM scheme. Therefore, both approaches can be recommended.
On the Difference Between Additive and Subtractive QM/MM Calculations
Directory of Open Access Journals (Sweden)
Lili Cao
2018-04-01
Full Text Available The combined quantum mechanical (QM and molecular mechanical (MM approach (QM/MM is a popular method to study reactions in biochemical macromolecules. Even if the general procedure of using QM for a small, but interesting part of the system and MM for the rest is common to all approaches, the details of the implementations vary extensively, especially the treatment of the interface between the two systems. For example, QM/MM can use either additive or subtractive schemes, of which the former is often said to be preferable, although the two schemes are often mixed up with mechanical and electrostatic embedding. In this article, we clarify the similarities and differences of the two approaches. We show that inherently, the two approaches should be identical and in practice require the same sets of parameters. However, the subtractive scheme provides an opportunity to correct errors introduced by the truncation of the QM system, i.e., the link atoms, but such corrections require additional MM parameters for the QM system. We describe and test three types of link-atom correction, viz. for van der Waals, electrostatic, and bonded interactions. The calculations show that electrostatic and bonded link-atom corrections often give rise to problems in the geometries and energies. The van der Waals link-atom corrections are quite small and give results similar to a pure additive QM/MM scheme. Therefore, both approaches can be recommended.
A simple and effective solution to the constrained QM/MM simulations
Takahashi, Hideaki; Kambe, Hiroyuki; Morita, Akihiro
2018-04-01
It is a promising extension of the quantum mechanical/molecular mechanical (QM/MM) approach to incorporate the solvent molecules surrounding the QM solute into the QM region to ensure the adequate description of the electronic polarization of the solute. However, the solvent molecules in the QM region inevitably diffuse into the MM bulk during the QM/MM simulation. In this article, we developed a simple and efficient method, referred to as the "boundary constraint with correction (BCC)," to prevent the diffusion of the solvent water molecules by means of a constraint potential. The point of the BCC method is to compensate the error in a statistical property due to the bias potential by adding a correction term obtained through a set of QM/MM simulations. The BCC method is designed so that the effect of the bias potential completely vanishes when the QM solvent is identical with the MM solvent. Furthermore, the desirable conditions, that is, the continuities of energy and force and the conservations of energy and momentum, are fulfilled in principle. We applied the QM/MM-BCC method to a hydronium ion(H3O+) in aqueous solution to construct the radial distribution function (RDF) of the solvent around the solute. It was demonstrated that the correction term fairly compensated the error and led the RDF in good agreement with the result given by an ab initio molecular dynamics simulation.
Lifescience Database Archive (English)
Full Text Available SS (Link to library) SSD329 (Link to dictyBase) - - - Contig-U16581-1 SSD329F (Link... to Original site) SSD329F 444 - - - - - - Show SSD329 Library SS (Link to library) Clone ID SSD329 (Link to dict...yBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig Contig-U16581-1 Original site URL http://dict...A Score E Sequences producing significant alignments: (bits) Value N D16417 |D16417.1 Dictyostelium discoide... DNA sequence. 50 0.027 1 BM028890 |BM028890.1 IpSkn01670 Skin cDNA library Ictal
Combined quantum and molecular mechanics (QM/MM).
Friesner, Richard A
2004-12-01
We describe the current state of the art of mixed quantum mechanics/molecular mechanics (QM/MM) methodology, with a particular focus on modeling of enzymatic reactions. Over the past decade, the effectiveness of these methods has increased dramatically, based on improved quantum chemical methods, advances in the description of the QM/MM interface, and reductions in the cost/performance of computing hardware. Two examples of pharmaceutically relevant applications, cytochrome P450 and class C β-lactamase, are presented.: © 2004 Elsevier Ltd . All rights reserved.
Extended representations of observables and states for a noncontextual reinterpretation of QM
International Nuclear Information System (INIS)
Garola, Claudio; Sozzo, Sandro
2012-01-01
A crucial and problematical feature of quantum mechanics (QM) is nonobjectivity of properties. The ESR model restores objectivity reinterpreting quantum probabilities as conditional on detection and embodying the mathematical formalism of QM into a broader noncontextual (hence local) framework. We propose here an improved presentation of the ESR model containing a more complete mathematical representation of the basic entities of the model. We also extend the model to mixtures showing that the mathematical representations of proper mixtures do not coincide with the mathematical representation of mixtures provided by QM, while the representation of improper mixtures does. This feature of the ESR model entails that some interpretative problems raising in QM when dealing with mixtures are avoided. From an empirical point of view, the predictions of the ESR model depend on some parameters which may be such that they are very close to the predictions of QM in most cases. But the nonstandard representation of proper mixtures allows us to propose the scheme of an experiment that could check whether the predictions of QM or the predictions of the ESR model are correct. (paper)
QM Automata: A New Class of Restricted Quantum Membrane Automata.
Giannakis, Konstantinos; Singh, Alexandros; Kastampolidou, Kalliopi; Papalitsas, Christos; Andronikos, Theodore
2017-01-01
The term "Unconventional Computing" describes the use of non-standard methods and models in computing. It is a recently established field, with many interesting and promising results. In this work we combine notions from quantum computing with aspects of membrane computing to define what we call QM automata. Specifically, we introduce a variant of quantum membrane automata that operate in accordance with the principles of quantum computing. We explore the functionality and capabilities of the QM automata through indicative examples. Finally we suggest future directions for research on QM automata.
Energy Technology Data Exchange (ETDEWEB)
Sorensen, Anette; Ahring, Birgitte K.; Lubeck, Mette; Ubhayasekera, Wimal; Bruno, Kenneth S.; Culley, David E.; Lubeck, Peter S.
2012-08-20
A newly discovered fungal species, Aspergillus saccharolyticus, was found to produce a culture broth rich in beta-glucosidase activity. In this present work, the main beta-glucosidase of A. saccharolyticus responsible for the efficient hydrolytic activity was identified, isolated, and characterized. Ion exchange chromatography was used to fractionate the culture broth, yielding fractions with high beta-glucosidase activity and only one visible band on an SDS-PAGE gel. Mass spectrometry analysis of this band gave peptide matches to beta-glucosidases from aspergilli. Through a PCR approach using degenerate primers and genome walking, a 2919 base pair sequence encoding the 860 amino acid BGL1 polypeptide was determined. BGL1 of A. saccharolyticus has 91% and 82% identity with BGL1 from Aspergillus aculeatus and BGL1 from Aspergillus niger, respectively, both belonging to Glycoside hydrolase family 3. Homology modeling studies suggested beta-glucosidase activity with preserved retaining mechanism and a wider catalytic pocket compared to other beta-glucosidases. The bgl1 gene was heterologously expressed in Trichoderma reesei QM6a, purified, and characterized by enzyme kinetics studies. The enzyme can hydrolyze cellobiose, pNPG, and cellodextrins. The enzyme showed good thermostability, was stable at 50°C, and at 60°C it had a half-life of approximately 6 hours.
Efficient approach to obtain free energy gradient using QM/MM MD simulation
International Nuclear Information System (INIS)
Asada, Toshio; Koseki, Shiro; Ando, Kanta
2015-01-01
The efficient computational approach denoted as charge and atom dipole response kernel (CDRK) model to consider polarization effects of the quantum mechanical (QM) region is described using the charge response and the atom dipole response kernels for free energy gradient (FEG) calculations in the quantum mechanical/molecular mechanical (QM/MM) method. CDRK model can reasonably reproduce energies and also energy gradients of QM and MM atoms obtained by expensive QM/MM calculations in a drastically reduced computational time. This model is applied on the acylation reaction in hydrated trypsin-BPTI complex to optimize the reaction path on the free energy surface by means of FEG and the nudged elastic band (NEB) method
On the problem of completeness of QM: von Neumann against Einstein, Podolsky, and Rosen
Khrennikov, Andrei
2008-01-01
We performed a comparative analysis of the arguments of Einstein, Podolsky and Rosen -- EPR, 1935 (against the completeness of QM) and the theoretical formalism of QM (due to von Neumann, 1932). We found that the EPR considerations do not match at all with the von Neumann's theory. Thus EPR did not criticize the real theoretical model of QM. The root of EPR's paradoxical conclusion on incompleteness of QM is the misuse of von Neumann's projection postulate. EPR applied this postulate to obser...
10 CFR 1023.329 - Payment of award.
2010-01-01
... official. The agency will pay the amount awarded to the applicant within 60 days. ... 10 Energy 4 2010-01-01 2010-01-01 false Payment of award. 1023.329 Section 1023.329 Energy DEPARTMENT OF ENERGY (GENERAL PROVISIONS) CONTRACT APPEALS Procedures Relating to Awards Under the Equal...
9 CFR 113.329 - Newcastle Disease Vaccine.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Newcastle Disease Vaccine. 113.329 Section 113.329 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF.... Challenge virus shall be provided or approved by Animal and Plant Health Inspection Service. (4) If at least...
Analysis of Peer Review Comments: QM Recommendations and Feedback Intervention Theory
Schwegler, Andria F.; Altman, Barbara W.
2015-01-01
Because feedback is a critical component of the continuous improvement cycle of the Quality Matters (QM) peer review process, the present research analyzed the feedback that peer reviewers provided to course developers after a voluntary, nonofficial QM peer review of online courses. Previous research reveals that the effects of feedback on…
Development and application of QM/MM methods to study the solvation effects and surfaces
Energy Technology Data Exchange (ETDEWEB)
Dibya, Pooja Arora [Iowa State Univ., Ames, IA (United States)
2010-01-01
Quantum mechanical (QM) calculations have the advantage of attaining high-level accuracy, however QM calculations become computationally inefficient as the size of the system grows. Solving complex molecular problems on large systems and ensembles by using quantum mechanics still poses a challenge in terms of the computational cost. Methods that are based on classical mechanics are an inexpensive alternative, but they lack accuracy. A good trade off between accuracy and efficiency is achieved by combining QM methods with molecular mechanics (MM) methods to use the robustness of the QM methods in terms of accuracy and the MM methods to minimize the computational cost. Two types of QM combined with MM (QM/MM) methods are the main focus of the present dissertation: the application and development of QM/MM methods for solvation studies and reactions on the Si(100) surface. The solvation studies were performed using a discreet solvation model that is largely based on first principles called the effective fragment potential method (EFP). The main idea of combining the EFP method with quantum mechanics is to accurately treat the solute-solvent and solvent-solvent interactions, such as electrostatic, polarization, dispersion and charge transfer, that are important in correctly calculating solvent effects on systems of interest. A second QM/MM method called SIMOMM (surface integrated molecular orbital molecular mechanics) is a hybrid QM/MM embedded cluster model that mimics the real surface.3 This method was employed to calculate the potential energy surfaces for reactions of atomic O on the Si(100) surface. The hybrid QM/MM method is a computationally inexpensive approach for studying reactions on larger surfaces in a reasonably accurate and efficient manner. This thesis is comprised of four chapters: Chapter 1 describes the general overview and motivation of the dissertation and gives a broad background of the computational methods that have been employed in this work
Maia, Ozana Maria de Andrade [UNESP; Oliveira, Carlos Amadeu Leite de [UNESP
2006-01-01
Objetivou-se avaliar a potencialidade de algumas plantas freqüentes em pomares cítricos de hospedar o vírus da leprose, transmitido por Brevipalpus phoenicis (Geijskes). Foram utilizadas as seguintes plantas: Hibiscus sp. L., Malvaviscus mollis DC., Grevillea robusta A. Cunn., Mimosa caesalpiniaefolia Benth., Bixa orellana L., Commelina benghalensis L., Bidens pilosa L., Sida cordifolia L. e Ageratum conyzoides L.. Duas criações-estoque do ácaro foram realizadas, sendo uma sobre frutos com si...
Acevedo, Orlando; Jorgensen, William L
2010-01-19
Application of combined quantum and molecular mechanical (QM/MM) methods focuses on predicting activation barriers and the structures of stationary points for organic and enzymatic reactions. Characterization of the factors that stabilize transition structures in solution and in enzyme active sites provides a basis for design and optimization of catalysts. Continued technological advances allowed for expansion from prototypical cases to mechanistic studies featuring detailed enzyme and condensed-phase environments with full integration of the QM calculations and configurational sampling. This required improved algorithms featuring fast QM methods, advances in computing changes in free energies including free-energy perturbation (FEP) calculations, and enhanced configurational sampling. In particular, the present Account highlights development of the PDDG/PM3 semi-empirical QM method, computation of multi-dimensional potentials of mean force (PMF), incorporation of on-the-fly QM in Monte Carlo (MC) simulations, and a polynomial quadrature method for efficient modeling of proton-transfer reactions. The utility of this QM/MM/MC/FEP methodology is illustrated for a variety of organic reactions including substitution, decarboxylation, elimination, and pericyclic reactions. A comparison to experimental kinetic results on medium effects has verified the accuracy of the QM/MM approach in the full range of solvents from hydrocarbons to water to ionic liquids. Corresponding results from ab initio and density functional theory (DFT) methods with continuum-based treatments of solvation reveal deficiencies, particularly for protic solvents. Also summarized in this Account are three specific QM/MM applications to biomolecular systems: (1) a recent study that clarified the mechanism for the reaction of 2-pyrone derivatives catalyzed by macrophomate synthase as a tandem Michael-aldol sequence rather than a Diels-Alder reaction, (2) elucidation of the mechanism of action of fatty
Energy Technology Data Exchange (ETDEWEB)
Yang Zhenyu [State Key Laboratory of Nonlinear Mechanics (LNM), Institute of Mechanics, Chinese Academy of Sciences, Beijing 100080(China); Zhao Yapu [State Key Laboratory of Nonlinear Mechanics (LNM), Institute of Mechanics, Chinese Academy of Sciences, Beijing 100080 (China)]. E-mail: yzhao@lnm.imech.ac.cn
2006-05-15
The hybrid quantum mechanics (QM) and molecular mechanics (MM) method is employed to simulate the His-tagged peptide adsorption to ionized region of nickel surface. Based on the previous experiments, the peptide interaction with one Ni ion is considered. In the QM/MM calculation, the imidazoles on the side chain of the peptide and the metal ion with several neighboring water molecules are treated as QM part calculated by 'GAMESS', and the rest atoms are treated as MM part calculated by 'TINKER'. The integrated molecular orbital/molecular mechanics (IMOMM) method is used to deal with the QM part with the transitional metal. By using the QM/MM method, we optimize the structure of the synthetic peptide chelating with a Ni ion. Different chelate structures are considered. The geometry parameters of the QM subsystem we obtained by QM/MM calculation are consistent with the available experimental results. We also perform a classical molecular dynamics (MD) simulation with the experimental parameters for the synthetic peptide adsorption on a neutral Ni(1 0 0) surface. We find that half of the His-tags are almost parallel with the substrate, which enhance the binding strength. Peeling of the peptide from the Ni substrate is simulated in the aqueous solvent and in vacuum, respectively. The critical peeling forces in the two environments are obtained. The results show that the imidazole rings are attached to the substrate more tightly than other bases in this peptide.
Energy Technology Data Exchange (ETDEWEB)
Kamerlin, Shina C. L.; Haranczyk, Maciej; Warshel, Arieh
2009-03-01
Hybrid quantum mechanical / molecular mechanical (QM/MM) approaches have been used to provide a general scheme for chemical reactions in proteins. However, such approaches still present a major challenge to computational chemists, not only because of the need for very large computer time in order to evaluate the QM energy but also because of the need for propercomputational sampling. This review focuses on the sampling issue in QM/MM evaluations of electrostatic energies in proteins. We chose this example since electrostatic energies play a major role in controlling the function of proteins and are key to the structure-function correlation of biological molecules. Thus, the correct treatment of electrostatics is essential for the accurate simulation of biological systems. Although we will be presenting here different types of QM/MM calculations of electrostatic energies (and related properties), our focus will be on pKa calculations. This reflects the fact that pKa of ionizable groups in proteins provide one of the most direct benchmarks for the accuracy of electrostatic models of macromolecules. While pKa calculations by semimacroscopic models have given reasonable results in many cases, existing attempts to perform pKa calculations using QM/MM-FEP have led to large discrepancies between calculated and experimental values. In this work, we accelerate our QM/MM calculations using an updated mean charge distribution and a classical reference potential. We examine both a surface residue (Asp3) of the bovine pancreatic trypsin inhibitor, as well as a residue buried in a hydrophobic pocket (Lys102) of the T4-lysozyme mutant. We demonstrate that by using this approach, we are able to reproduce the relevant sidechain pKas with an accuracy of 3 kcal/mol. This is well within the 7 kcal/mol energy difference observed in studies of enzymatic catalysis, and is thus sufficient accuracy to determine the main contributions to the catalytic energies of enzymes. We also provide an
40 CFR 90.329 - Catalyst thermal stress test.
2010-07-01
... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Catalyst thermal stress test. 90.329... Equipment Provisions § 90.329 Catalyst thermal stress test. (a) Oven characteristics. The oven used for thermally stressing the test catalyst must be capable of maintaining a temperature of 500 ±5 °C and 1000 ±10...
40 CFR 91.329 - Catalyst thermal stress test.
2010-07-01
... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Catalyst thermal stress test. 91.329....329 Catalyst thermal stress test. (a) Oven characteristics. The oven used for termally stressing the test catalyst must be capable of maintaining a temperature of 500 ±5 °C and 1000 ±10 °C. (b) Evaluation...
17 CFR 32.9 - Fraud in connection with commodity option transactions.
2010-04-01
... 17 Commodity and Securities Exchanges 1 2010-04-01 2010-04-01 false Fraud in connection with commodity option transactions. 32.9 Section 32.9 Commodity and Securities Exchanges COMMODITY FUTURES TRADING COMMISSION REGULATION OF COMMODITY OPTION TRANSACTIONS § 32.9 Fraud in connection with commodity...
Common QA/QM Criteria for Multinational Vendor Inspection
International Nuclear Information System (INIS)
2014-01-01
This VICWG document provides the 'Common QA/QM Criteria' which will be used in Multinational Vendor Inspection. The 'Common QA/QM Criteria' provides the basic consideration when performing the Vendor Inspection. These criteria has been developed in conformity with International Codes and Standards such as IAEA, ISO and so on that MDEP member countries adopted. The purpose of the VICWG is to establish areas of co-operation in the Vendor Inspection practices among MDEP member countries as described in the MDEP issue-specific Terms of Reference (ToR). As part of this, from the beginning, a survey was performed to understand and to identify areas of commonality and differences between regulatory practices of member countries in the area of vendor inspection. The VICWG also collaborated by performing Witnessed Inspections and Joint Inspections. Through these activities, it was recognized that member countries commonly apply the IAEA safety standard (GS-R-3) to the vendor inspection criteria, and almost ail European member countries apply the ISO standard (ISO9001). In the US, the NRC regulatory requirement in 10 CFR, Part 50, Appendix B is used. South Korea uses the same criteria as in the US. As a result of the information obtained, a comparison table between codes and standards (IAEAGS-R-3, ISO 9001:2008.10CFR50 Appendix Band ASME NQA-1) has been developed in order to inform the development of 'Common QA/QM Criteria'. The result is documented in Table 1, 'MDEP CORE QA/QM Requirement and Comparison between Codes and Standards'. In addition, each country's criteria were compared with the US 10CFR50 Appendix B as a template. Table 2 shows VICWG Survey on Quality Assurance Program Requirements. Through these activities above, we considered that the core requirements should be consistent with both IAEA safety standard and ISO standard, and considered that the common requirements in the US 10CFR50 Appendix B used to the survey
STELLAR PULSATIONS AND PERIOD CHANGES IN THE SX PHOENICIS STAR XX CYGNI
International Nuclear Information System (INIS)
Yang, X. H.; Fu, J. N.; Zha, Q.
2012-01-01
Time-series photometric observations were made for the SX Phoenicis star XX Cyg between 2007 and 2011 at the Xinglong Station of National Astronomical Observatories of China. With the light curves derived from the new observations, we do not detect any secondary maximum in the descending portion of the light curves of XX Cyg, as reported in some previous work. Frequency analysis of the light curves confirms a fundamental frequency f 0 = 7.4148 cycles day –1 and up to 19 harmonics, 11 of which are newly detected. However, no secondary mode of pulsation is detected from the light curves. The O–C diagram, produced from 46 newly determined times of maximum light combined with those derived from the literature, reveals a continuous period increase with the rate of (1/P)(dP/dt) = 1.19(13) × 10 –8 yr -1 . Theoretical rates of period change due to the stellar evolution were calculated with a modeling code. The result shows that the observed rate of period change is fully consistent with period change caused by evolutionary behavior predicted by standard theoretical models.
Final report of APMP.QM-S6: clenbuterol in porcine meat
Sin, D. W.-M.; Ho, C.; Yip, Y.-C.
2016-01-01
At the CCQM Organic Analysis Working Group (OAWG) Meeting held in April 2012 and the APMP TCQM Meeting held in November 2012, an APMP supplementary comparison (APMP.QM-S6) on the determination of clenbuterol in porcine meat was supported by the OAWG and APMP TCQM. This comparison was organized by the Government Laboratory, Hong Kong. In order to accommodate a wider participation, a pilot study (APMP.QM-P22) was run in parallel to APMP.QM-S6. This study provided the means for assessing the measurement capabilities for determination of low-polarity measurands in a procedure that requires extraction, clean-up, analytical separation, and selective detection in a food matrix. A total of 7 institutes registered for the supplementary comparison and 6 of them submitted their results. 4 results were included for SCRV calculation. All participating laboratories applied Isotope Dilution Liquid Chromatography-Tandem Mass Spectrometry (ID-LCMS/MS) technique with clenbuterol-d9 as internal standard spiked for quantitation in this programme. KEY WORDS FOR SEARCH APMP.QM-S6 and Clenbuterol Main text To reach the main text of this paper, click on Final Report. Note that this text is that which appears in Appendix B of the BIPM key comparison database kcdb.bipm.org/. The final report has been peer-reviewed and approved for publication by the CCQM, according to the provisions of the CIPM Mutual Recognition Arrangement (CIPM MRA).
Species in the genus Aspergillus possess versatile metabolic activities that impact our daily life both positively and negatively. Aspergillus flavus and Aspergillus oryzae are closely related fungi. While the former is able to produce carcinogenic aflatoxins and is an etiological agent of aspergill...
9 CFR 329.6 - Articles or livestock subject to judicial seizure and condemnation.
2010-01-01
... judicial seizure and condemnation. 329.6 Section 329.6 Animals and Animal Products FOOD SAFETY AND... PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION DETENTION; SEIZURE AND CONDEMNATION; CRIMINAL OFFENSES § 329.6 Articles or livestock subject to judicial seizure and condemnation. Any carcass...
Directory of Open Access Journals (Sweden)
Luis Henrique S. Guimarães
2006-12-01
Full Text Available Many enzymes produced by fungi have relevant biotechnological applications in several industrial areas. The purpose of this study was to collect and isolate filamentous fungi from soil and humus, plants and sugar cane bagasse of different regions of the São Paulo state. Forty isolates were examined for their ability to produce xylanase, glucose-oxidase, alkaline phosphatase, acid phosphatase, phytase, pectinase and amylase. Among these, twenty three isolates exhibited enzymatic potential. The xylanases produced by two of these isolates (Aspergillus caespitosus and A. phoenicis showed good potential for pulp bleaching. Among seventeen isolates, at least three produced high levels of glucose-oxidase, being Rhizopus stolonifer and A. versicolor the best producer strains. A. caespitosus, Mucor rouxii, and nine others still not identified were the best producers of phosphatases in submerged fermentation. Pectinase was best produced by IF II and C-8 belong R. stolonifer. Significant levels of amylase were produced by Paecilomyces variotii and A. phoenicis. A remarkable enzyme producer was Rhizopus microsporus var. rhizopodiformis that produced high levels of amylase, alkaline and acid phosphatases, and pectinase. Some morphological structures of this fungus were illustrated using light microscopy (LM and scanning electron microscopy (SEM. This study contributes to catalogue soil fungi isolated in the state of São Paulo, and provides additional information to support future research about the industrial potential of these microorganisms that may produce enzymes and, eventually, also secondary metabolites with anti-microbial or anti-parasitic activities.Muitas enzimas produzidas por fungos têm relevantes aplicações em diferentes áreas industriais. O objetivo desse trabalho foi coletar e isolar fungos filamentosos do solo e humus, plantas e bagaço de cana de açúcar de diferentes regiões do Estado de São Paulo. Quarenta isolados foram
Aspergillus saccharolyticus sp. nov., a new black Aspergillus species isolated in Denmark
DEFF Research Database (Denmark)
Sørensen, Annette; Lübeck, Peter S.; Lübeck, Mette
2011-01-01
A novel species, Aspergillus saccharolyticus sp. nov., belonging to the Aspergillus section Nigri group is described. This species was isolated in Denmark from treated hardwood. Its taxonomic status was determined using a polyphasic taxonomic approach including phenotypic (morphology and extrolite...... Aspergillus species that is morphologically similar to Aspergillus japonicus and Aspergillus aculeatus, but has a totally different extrolite profile compared to any known Aspergillus species. The type strain of A. saccharolyticus sp. nov. is CBS 127449T ( = IBT 28509T)....
2010-01-01
... interest as defined in § 329.1(c). (a) Premiums, whether in the form of merchandise, credit, or cash, given... the balance in a demand deposit account and the duration of the account balance shall not be considered the payment of interest on a demand deposit account and shall not be subject to the limitations in...
Tamiya, Hiroyuki; Ochiai, Eri; Kikuchi, Kazuyo; Yahiro, Maki; Toyotome, Takahito; Watanabe, Akira; Yaguchi, Takashi; Kamei, Katsuhiko
2015-05-01
The incidence of Aspergillus infection has been increasing in the past few years. Also, new Aspergillus fumigatus-related species, namely Aspergillus lentulus, Aspergillus udagawae, and Aspergillus viridinutans, were shown to infect humans. These fungi exhibit marked morphological similarities to A. fumigatus, albeit with different clinical courses and antifungal drug susceptibilities. The present study used liquid chromatography/time-of-flight mass spectrometry to identify the secondary metabolites secreted as virulence factors by these Aspergillus species and compared their antifungal susceptibility. The metabolite profiles varied widely among A. fumigatus, A. lentulus, A. udagawae, and A. viridinutans, producing 27, 13, 8, and 11 substances, respectively. Among the mycotoxins, fumifungin, fumiquinazoline A/B and D, fumitremorgin B, gliotoxin, sphingofungins, pseurotins, and verruculogen were only found in A. fumigatus, whereas auranthine was only found in A. lentulus. The amount of gliotoxin, one of the most abundant mycotoxins in A. fumigatus, was negligible in these related species. In addition, they had decreased susceptibility to antifungal agents such as itraconazole and voriconazole, even though metabolites that were shared in the isolates showing higher minimum inhibitory concentrations than epidemiological cutoff values were not detected. These strikingly different secondary metabolite profiles may lead to the development of more discriminative identification protocols for such closely related Aspergillus species as well as improved treatment outcomes. Copyright © 2015 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.
Sodt, Alexander J; Mei, Ye; König, Gerhard; Tao, Peng; Steele, Ryan P; Brooks, Bernard R; Shao, Yihan
2015-03-05
In combined quantum mechanical/molecular mechanical (QM/MM) free energy calculations, it is often advantageous to have a frozen geometry for the quantum mechanical (QM) region. For such multiple-environment single-system (MESS) cases, two schemes are proposed here for estimating the polarization energy: the first scheme, termed MESS-E, involves a Roothaan step extrapolation of the self-consistent field (SCF) energy; whereas the other scheme, termed MESS-H, employs a Newton-Raphson correction using an approximate inverse electronic Hessian of the QM region (which is constructed only once). Both schemes are extremely efficient, because the expensive Fock updates and SCF iterations in standard QM/MM calculations are completely avoided at each configuration. They produce reasonably accurate QM/MM polarization energies: MESS-E can predict the polarization energy within 0.25 kcal/mol in terms of the mean signed error for two of our test cases, solvated methanol and solvated β-alanine, using the M06-2X or ωB97X-D functionals; MESS-H can reproduce the polarization energy within 0.2 kcal/mol for these two cases and for the oxyluciferin-luciferase complex, if the approximate inverse electronic Hessians are constructed with sufficient accuracy.
Woods, Christopher J; Shaw, Katherine E; Mulholland, Adrian J
2015-01-22
The applicability of combined quantum mechanics/molecular mechanics (QM/MM) methods for the calculation of absolute binding free energies of conserved water molecules in protein/ligand complexes is demonstrated. Here, we apply QM/MM Monte Carlo simulations to investigate binding of water molecules to influenza neuraminidase. We investigate five different complexes, including those with the drugs oseltamivir and peramivir. We investigate water molecules in two different environments, one more hydrophobic and one hydrophilic. We calculate the free-energy change for perturbation of a QM to MM representation of the bound water molecule. The calculations are performed at the BLYP/aVDZ (QM) and TIP4P (MM) levels of theory, which we have previously demonstrated to be consistent with one another for QM/MM modeling. The results show that the QM to MM perturbation is significant in both environments (greater than 1 kcal mol(-1)) and larger in the more hydrophilic site. Comparison with the same perturbation in bulk water shows that this makes a contribution to binding. The results quantify how electronic polarization differences in different environments affect binding affinity and also demonstrate that extensive, converged QM/MM free-energy simulations, with good levels of QM theory, are now practical for protein/ligand complexes.
Dimerization of the Glucan Phosphatase Laforin Requires the Participation of Cysteine 329
Sánchez-Martín, Pablo; Raththagala, Madushi; Bridges, Travis M.; Husodo, Satrio; Gentry, Matthew S.; Sanz, Pascual; Romá-Mateo, Carlos
2013-01-01
Laforin, encoded by a gene that is mutated in Lafora Disease (LD, OMIM 254780), is a modular protein composed of a carbohydrate-binding module and a dual-specificity phosphatase domain. Laforin is the founding member of the glucan-phosphatase family and regulates the levels of phosphate present in glycogen. Multiple reports have described the capability of laforin to form dimers, although the function of these dimers and their relationship with LD remains unclear. Recent evidence suggests that laforin dimerization depends on redox conditions, suggesting that disulfide bonds are involved in laforin dimerization. Using site-directed mutagenesis we constructed laforin mutants in which individual cysteine residues were replaced by serine and then tested the ability of each protein to dimerize using recombinant protein as well as a mammalian cell culture assay. Laforin-Cys329Ser was the only Cys/Ser mutant unable to form dimers in both assays. We also generated a laforin truncation lacking the last three amino acids, laforin-Cys329X, and this truncation also failed to dimerize. Interestingly, laforin-Cys329Ser and laforin-Cys329X were able to bind glucans, and maintained wild type phosphatase activity against both exogenous and biologically relevant substrates. Furthermore, laforin-Cys329Ser was fully capable of participating in the ubiquitination process driven by a laforin-malin complex. These results suggest that dimerization is not required for laforin phosphatase activity, glucan binding, or for the formation of a functional laforin-malin complex. Cumulatively, these results suggest that cysteine 329 is specifically involved in the dimerization process of laforin. Therefore, the C329S mutant constitutes a valuable tool to analyze the physiological implications of laforin’s oligomerization. PMID:23922729
QM/MM Calculations with deMon2k
Directory of Open Access Journals (Sweden)
Dennis R. Salahub
2015-03-01
Full Text Available The density functional code deMon2k employs a fitted density throughout (Auxiliary Density Functional Theory, which offers a great speed advantage without sacrificing necessary accuracy. Powerful Quantum Mechanical/Molecular Mechanical (QM/MM approaches are reviewed. Following an overview of the basic features of deMon2k that make it efficient while retaining accuracy, three QM/MM implementations are compared and contrasted. In the first, deMon2k is interfaced with the CHARMM MM code (CHARMM-deMon2k; in the second MM is coded directly within the deMon2k software; and in the third the Chemistry in Ruby (Cuby wrapper is used to drive the calculations. Cuby is also used in the context of constrained-DFT/MM calculations. Each of these implementations is described briefly; pros and cons are discussed and a few recent applications are described briefly. Applications include solvated ions and biomolecules, polyglutamine peptides important in polyQ neurodegenerative diseases, copper monooxygenases and ultra-rapid electron transfer in cryptochromes.
Berraud-Pache, Romain; Garcia-Iriepa, Cristina; Navizet, Isabelle
2018-01-01
In less than half a century, the hybrid QM/MM method has become one of the most used technique to model molecules embedded in a complex environment. A well-known application of the QM/MM method is for biological systems. Nowadays, one can understand how enzymatic reactions work or compute spectroscopic properties, like the wavelength of emission. Here, we have tackled the issue of modeling chemical reactions inside proteins. We have studied a bioluminescent system, fireflies, and deciphered if a keto-enol tautomerization is possible inside the protein. The two tautomers are candidates to be the emissive molecule of the bioluminescence but no outcome has been reached. One hypothesis is to consider a possible keto-enol tautomerization to treat this issue, as it has been already observed in water. A joint approach combining extensive MD simulations as well as computation of key intermediates like TS using QM/MM calculations is presented in this publication. We also emphasize the procedure and difficulties met during this approach in order to give a guide for this kind of chemical reactions using QM/MM methods.
Berraud-Pache, Romain; Garcia-Iriepa, Cristina; Navizet, Isabelle
2018-04-01
In less than half a century, the hybrid QM/MM method has become one of the most used technique to model molecules embedded in a complex environment. A well-known application of the QM/MM method is for biological systems. Nowadays, one can understand how enzymatic reactions work or compute spectroscopic properties, like the wavelength of emission. Here, we have tackled the issue of modelling chemical reactions inside proteins. We have studied a bioluminescent system, fireflies, and deciphered if a keto-enol tautomerization is possible inside the protein. The two tautomers are candidates to be the emissive molecule of the bioluminescence but no outcome has been reached. One hypothesis is to consider a possible keto-enol tautomerization to treat this issue, as it has been already observed in water. A joint approach combining extensive MD simulations as well as computation of key intermediates like TS using QM/MM calculations is presented in this publication. We also emphasize the procedure and difficulties met during this approach in order to give a guide for this kind of chemical reactions using QM/MM methods.
Investigation into the Use of the Concept Laser QM System as an In-Situ Research and Evaluation Tool
Bagg, Stacey
2014-01-01
The NASA Marshall Space Flight Center (MSFC) is using a Concept Laser Fusing (Cusing) M2 powder bed additive manufacturing system for the build of space flight prototypes and hardware. NASA MSFC is collecting and analyzing data from the M2 QM Meltpool and QM Coating systems for builds. This data is intended to aide in understanding of the powder-bed additive manufacturing process, and in the development of a thermal model for the process. The QM systems are marketed by Concept Laser GmbH as in-situ quality management modules. The QM Meltpool system uses both a high-speed near-IR camera and a photodiode to monitor the melt pool generated by the laser. The software determines from the camera images the size of the melt pool. The camera also measures the integrated intensity of the IR radiation, and the photodiode gives an intensity value based on the brightness of the melt pool. The QM coating system uses a high resolution optical camera to image the surface after each layer has been formed. The objective of this investigation was to determine the adequacy of the QM Meltpool system as a research instrument for in-situ measurement of melt pool size and temperature and its applicability to NASA's objectives in (1) Developing a process thermal model and (2) Quantifying feedback measurements with the intent of meeting quality requirements or specifications. Note that Concept Laser markets the system only as capable of giving an indication of changes between builds, not as an in-situ research and evaluation tool. A secondary objective of the investigation is to determine the adequacy of the QM Coating system as an in-situ layer-wise geometry and layer quality evaluation tool.
Aspergillus asper sp. nov. and Aspergillus collinsii sp. nov., from Aspergillus section Usti.
Jurjevic, Zeljko; Peterson, Stephen W
2016-07-01
In sampling fungi from the built environment, two isolates that could not confidently be placed in described species were encountered. Phenotypic analysis suggested that they belonged in Aspergillus sect. Usti. In order to verify the sectional placement and to assure that they were undescribed rather than phenotypically aberrant isolates, DNA was isolated and sequenced at the beta-tubulin, calmodulin, internal transcribed spacer and RNA polymerase II loci and sequences compared with those from other species in the genus Aspergillus. At each locus, each new isolate was distant from existing species. Phylogenetic trees calculated from these data and GenBank data for species of the section Usti excluded the placement of these isolates in existing species, with statistical support. Because they were excluded from existing taxa, the distinct species Aspergillus asper (type strain NRRL 35910 T ) and Aspergillus collinsii (type strain NRRL 66196 T ) in sect. Usti are proposed to accommodate these strains.
9 CFR 329.1 - Article or livestock subject to administrative detention.
2010-01-01
... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Article or livestock subject to administrative detention. 329.1 Section 329.1 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE... of the provisions of Title I of the Act, any other Federal law, or the laws of any State or Territory...
Chen, X; Su, Y Q; Wang, J; Liu, M; Niu, S F; Zhong, S P; Qiu, F
2012-10-15
In order to investigate the immune role of ribosomal protein L10 (RPL10/QM-like gene) in marine fish, we challenged the large yellow croaker Pseudosciaena (= Larimichthys) crocea, the most important marine fish culture species in China, by injection with a mixture of the bacteria Vibrio harveyi and V. parahaemolyticus (3:1 in volume). Microarray analysis and real-time PCR were performed 24 and 48 h post-challenge to isolate and identify the QM-like gene from the gill P. crocea (designated PcQM). The expression level of the PcQM gene did not changed significantly at 24 h post-challenge, but was significantly downregulated at 48 h post-challenge, suggesting that the gene had an immune-modulatory effect in P. crocea. Full-length PcQM cDNA and genomic sequences were obtained by rapid amplification of cDNA ends (RACE)-PCR. The sequence of the PcQM gene clustered together with those of other QM-like genes from other aquatic organisms, indicating that the QM-like gene is highly conserved in teleosts.
47 CFR 51.329 - Notice of network changes: Methods for providing notice.
2010-10-01
... 47 Telecommunication 3 2010-10-01 2010-10-01 false Notice of network changes: Methods for providing notice. 51.329 Section 51.329 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED...) Filing a public notice with the Commission; or (2) Providing public notice through industry fora...
A trispecies Aspergillus microarray: Comparative transcriptomics of three Aspergillus species
DEFF Research Database (Denmark)
Andersen, Mikael Rørdam; Vongsangnak, Wanwipa; Panagiotou, Gianni
2008-01-01
The full-genome sequencing of the filamentous fungi Aspergillus nidulans, Aspergillus niger, and Aspergillus oryzae has opened possibilities for studying the cellular physiology of these fungi on a systemic level. As a tool to explore this, we are making available an Affymetrix GeneChip developed...... data identified 23 genes to be a conserved response across Aspergillus sp., including the xylose transcriptional activator XlnR. A promoter analysis of the up-regulated genes in all three species indicates the conserved XInR-binding site to be 5'-GGNTAAA-3'. The composition of the conserved gene......-set suggests that xylose acts as a molecule, indicating the presence of complex carbohydrates such as hemicellulose, and triggers an array of degrading enzymes. With this case example, we present a validated tool for transcriptome analysis of three Aspergillus species and a methodology for conducting cross...
Coutinho, Pedro M; Andersen, Mikael R; Kolenova, Katarina; vanKuyk, Patricia A; Benoit, Isabelle; Gruben, Birgit S; Trejo-Aguilar, Blanca; Visser, Hans; van Solingen, Piet; Pakula, Tiina; Seiboth, Bernard; Battaglia, Evy; Aguilar-Osorio, Guillermo; de Jong, Jan F; Ohm, Robin A; Aguilar, Mariana; Henrissat, Bernard; Nielsen, Jens; Stålbrand, Henrik; de Vries, Ronald P
The plant polysaccharide degradative potential of Aspergillus nidulans was analysed in detail and compared to that of Aspergillus niger and Aspergillus oryzae using a combination of bioinformatics, physiology and transcriptomics. Manual verification indicated that 28.4% of the A. nidulans ORFs
Directory of Open Access Journals (Sweden)
Daniel Júnior de Andrade
2010-12-01
Full Text Available A adição de óleos à calda de pulverização, muitas vezes, é utilizada a campo sem o adequado conhecimento sobre a absorção do produto fitossanitário pelo alvo, retenção de calda e até mesmo sobre a praga e a cultura. O objetivo do trabalho foi avaliar o efeito da adição de óleos ao acaricida cyhexatin sobre o ácaro Brevipalpus phoenicis e na retenção de calda por folhas de citros. Avaliou-se a mortalidade de ácaros, utilizando-se de frutos de laranja com uma arena circundada com cola entomológica para confinar os ácaros. Adotou-se o delineamento inteiramente casualizado, em esquema fatorial, constituído pelos fatores: duas formulações de cyhexatin (WG e SC, dois tipos de óleo (mineral e vegetal e duas concentrações dos óleos (0,5 e 1,0%, e mais dois tratamentos adicionais (acaricidas não adicionados de óleo e uma testemunha sem aplicação. A aplicação dos produtos foi realizada sobre frutos de laranja até além do ponto de escorrimento. Logo após a aplicação, transferiram-se 10 ácaros B. phoenicis para cada fruto.A contagem dos ácaros vivos, mortos e retidos na barreira adesiva foi realizada um dia após a aplicação. Para a determinação da quantidade de calda retida, utilizaram-se folhas de laranjeira, que foram pulverizadas até além do ponto de escorrimento, adotando-se os mesmos tratamentos e o delineamento estatístico mencionados para a avaliação da mortalidade de ácaros, com exceção da testemunha sem aplicação. Determinou-se a massa de líquido retido após a aplicação dos produtos por folha, com auxílio de balança de precisão. Verificou-se que um dia após a aplicação dos produtos, todos os tratamentos apresentaram mortalidade de B. phoenicis acima de 99%. Dessa forma, a adição de óleo, seja mineral, seja vegetal, ao acaricida cyhexatin não afetou a eficácia biológica deste acaricida nas formulações SC e WG. A maior fuga de B. phoenicis para a barreira de cola foi
Study of effect ultraviolet radiation on Aspergillus Flavus and Aspergillus Parasiticus
International Nuclear Information System (INIS)
Ghafourian, H.; Kafaei, F.; Raouf, J.B.
2000-01-01
In this article the results of ultraviolet radiation effects on Aspergillus Flavus and Aspergillus parasiticus to reach the quality control standards are presented. The purpose was to test the effect of ultraviolet radiation in 254 nanometer wavelength for fungi decontamination with respect to the exposure time of radiation and the distance between samples and radiation source. The ultraviolet radiation effects on plates containing Aspergillus Flavus and Aspergillus Parasiticus fungi were studied in the exposure time duration of 30, to 360 seconds of a fixed distance, and also for variable distances from 10 to 40 cm at a given exposure time. It is shown that in the exposure time of more than 360 second the ultraviolet radiation exposure highly decreases the number of Aspergillus Flavus and Aspergillus Parasiticus fungi colonies. By reducing the distance, the number of colonies decreases and it is minimized at a 10 cm distance in the time exposure of 360 second. The above results show that the ultraviolet radiation is an effective method for food decontamination and can be used in industry
What Does Genetic Diversity of Aspergillus flavus Tell Us About Aspergillus oryzae?
Aspergillus flavus and Aspergillus oryzae belong to Aspergillus section Flavi. They are closely related and are of significant economic importance. The former species has the ability to produce harmful aflatoxins while the latter is widely used in food fermentation and industrial enzyme production. ...
14 CFR 135.329 - Crewmember training requirements.
2010-01-01
... of the crewmember: (1) Basic indoctrination ground training for newly hired crewmembers including... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Crewmember training requirements. 135.329... REQUIREMENTS: COMMUTER AND ON DEMAND OPERATIONS AND RULES GOVERNING PERSONS ON BOARD SUCH AIRCRAFT Training...
Extracting dimer structures from simulations of organic-based materials using QM/MM methods
Energy Technology Data Exchange (ETDEWEB)
Pérez-Jiménez, A.J., E-mail: aj.perez@ua.es; Sancho-García, J.C., E-mail: jc.sancho@ua.es
2015-09-28
Highlights: • DFT geometries of isolated dimers in organic crystals differ from experimental ones. • This can be corrected using QM/MM geometry optimizations. • The QM = B3LYP–D3(ZD)/cc-pVDZ and MM = GAFF combination works reasonably well. - Abstract: The functionality of weakly bound organic materials, either in Nanoelectronics or in Materials Science, is known to be strongly affected by their morphology. Theoretical predictions of the underlying structure–property relationships are frequently based on calculations performed on isolated dimers, but the optimized structure of the latter may significantly differ from experimental data even when dispersion-corrected methods are used for it. Here, we address this problem on two organic crystals, namely coronene and 5,6,11,12-tetrachlorotetracene, concluding that it is caused by the absence of the surrounding monomers present in the crystal, and that it can be efficiently cured when the dimer is embedded into a general Quantum Mechanics/Molecular Mechanics (QM/MM) geometry optimization scheme. We also investigate how the size of the MM region affects the results. These findings may be helpful for the simulation of the morphology of active materials in crystalline or glassy samples.
A QM/MM refinement of an experimental DNA structure with metal-mediated base pairs.
Kumbhar, Sadhana; Johannsen, Silke; Sigel, Roland K O; Waller, Mark P; Müller, Jens
2013-10-01
A series of hybrid quantum mechanical/molecular mechanical (QM/MM) calculations was performed on models of a DNA duplex with artificial silver(I)-mediated imidazole base pairs. The optimized structures were compared to the original experimental NMR structure (Nat. Chem. 2 (2010) 229-234). The metal⋯metal distances are significantly shorter (~0.5Å) in the QM/MM model than in the original NMR structure. As a result, argentophilic interactions are feasible between the silver(I) ions of neighboring metal-mediated base pairs. Using the computationally determined metal⋯metal distances, a re-refined NMR solution structure of the DNA duplex was obtained. In this new NMR structure, all experimental constraints remain fulfilled. The new NMR structure shows less deviation from the regular B-type conformation than the original one. This investigation shows that the application of QM/MM models to generate additional constraints to be used during NMR structural refinements represents an elegant approach to obtaining high-resolution NMR structures. Copyright © 2013 Elsevier Inc. All rights reserved.
Mirhendi, H; Zarei, F; Motamedi, M; Nouripour-Sisakht, S
2016-03-01
This work aimed to identify the species distribution of common clinical and environmental isolates of black Aspergilli based on simple restriction fragment length polymorphism (RFLP) analysis of the β-tubulin gene. A total of 149 clinical and environmental strains of black Aspergilli were collected and subjected to preliminary morphological examination. Total genomic DNAs were extracted, and PCR was performed to amplify part of the β-tubulin gene. At first, 52 randomly selected samples were species-delineated by sequence analysis. In order to distinguish the most common species, PCR amplicons of 117 black Aspergillus strains were identified by simple PCR-RFLP analysis using the enzyme TasI. Among 52 sequenced isolates, 28 were Aspergillus tubingensis, 21 Aspergillus niger, and the three remaining isolates included Aspergillus uvarum, Aspergillus awamori, and Aspergillus acidus. All 100 environmental and 17 BAL samples subjected to TasI-RFLP analysis of the β-tubulin gene, fell into two groups, consisting of about 59% (n=69) A. tubingensis and 41% (n=48) A. niger. Therefore, the method successfully and rapidly distinguished A. tubingensis and A. niger as the most common species among the clinical and environmental isolates. Although tardy, the Ehrlich test was also able to differentiate A. tubingensis and A. niger according to the yellow color reaction specific to A. niger. A. tubingensis and A. niger are the most common black Aspergillus in both clinical and environmental isolates in Iran. PCR-RFLP using TasI digestion of β-tubulin DNA enables rapid screening for these common species. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Aspergillus fumigatus and Related Species
Sugui, Janyce A.; Kwon-Chung, Kyung J.; Juvvadi, Praveen R.; Latgé, Jean-Paul; Steinbach, William J.
2015-01-01
The genus Aspergillus contains etiologic agents of aspergillosis. The clinical manifestations of the disease range from allergic reaction to invasive pulmonary infection. Among the pathogenic aspergilli, Aspergillus fumigatus is most ubiquitous in the environment and is the major cause of the disease, followed by Aspergillus flavus, Aspergillus niger, Aspergillus terreus, Aspergillus nidulans, and several species in the section Fumigati that morphologically resemble A. fumigatus. Patients that are at risk for acquiring aspergillosis are those with an altered immune system. Early diagnosis, species identification, and adequate antifungal therapy are key elements for treatment of the disease, especially in cases of pulmonary invasive aspergillosis that often advance very rapidly. Incorporating knowledge of the basic biology of Aspergillus species to that of the diseases that they cause is fundamental for further progress in the field. PMID:25377144
Energy Technology Data Exchange (ETDEWEB)
Sudiarta, I. Wayan; Angraini, Lily Maysari, E-mail: lilyangraini@unram.ac.id [Physics Study Program, University of Mataram, Jln. Majapahit 62 Mataram, NTB (Indonesia)
2016-04-19
We have applied the finite difference time domain (FDTD) method with the supersymmetric quantum mechanics (SUSY-QM) procedure to determine excited energies of one dimensional quantum systems. The theoretical basis of FDTD, SUSY-QM, a numerical algorithm and an illustrative example for a particle in a one dimensional square-well potential were given in this paper. It was shown that the numerical results were in excellent agreement with theoretical results. Numerical errors produced by the SUSY-QM procedure was due to errors in estimations of superpotentials and supersymmetric partner potentials.
2010-10-01
... other service agents release to employees? 40.329 Section 40.329 Transportation Office of the Secretary... Confidentiality and Release of Information § 40.329 What information must laboratories, MROs, and other service agents release to employees? (a) As an MRO or service agent you must provide, within 10 business days of...
Tsang, Chi-Ching; Hui, Teresa W S; Lee, Kim-Chung; Chen, Jonathan H K; Ngan, Antonio H Y; Tam, Emily W T; Chan, Jasper F W; Wu, Andrea L; Cheung, Mei; Tse, Brian P H; Wu, Alan K L; Lai, Christopher K C; Tsang, Dominic N C; Que, Tak-Lun; Lam, Ching-Wan; Yuen, Kwok-Yung; Lau, Susanna K P; Woo, Patrick C Y
2016-02-01
Thirteen Aspergillus isolates recovered from nails of 13 patients (fingernails, n=2; toenails, n=11) with onychomycosis were characterized. Twelve strains were identified by multilocus sequencing as Aspergillus spp. (Aspergillus sydowii [n=4], Aspergillus welwitschiae [n=3], Aspergillus terreus [n=2], Aspergillus flavus [n=1], Aspergillus tubingensis [n=1], and Aspergillus unguis [n=1]). Isolates of A. terreus, A. flavus, and A. unguis were also identifiable by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. The 13th isolate (HKU49(T)) possessed unique morphological characteristics different from other Aspergillus spp. Molecular characterization also unambiguously showed that HKU49(T) was distinct from other Aspergillus spp. We propose the novel species Aspergillus hongkongensis to describe this previously unknown fungus. Antifungal susceptibility testing showed most Aspergillus isolates had low MICs against itraconazole and voriconazole, but all Aspergillus isolates had high MICs against fluconazole. A diverse spectrum of Aspergillus species is associated with onychomycosis. Itraconazole and voriconazole are probably better drug options for Aspergillus onychomycosis. Copyright © 2016 Elsevier Inc. All rights reserved.
33 CFR 329.12 - Geographic and jurisdictional limits of oceanic and tidal waters.
2010-07-01
... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Geographic and jurisdictional limits of oceanic and tidal waters. 329.12 Section 329.12 Navigation and Navigable Waters CORPS OF ENGINEERS, DEPARTMENT OF THE ARMY, DEPARTMENT OF DEFENSE DEFINITION OF NAVIGABLE WATERS OF THE UNITED STATES...
QM/MM Molecular Dynamics Studies of Metal Binding Proteins
Directory of Open Access Journals (Sweden)
Pietro Vidossich
2014-07-01
Full Text Available Mixed quantum-classical (quantum mechanical/molecular mechanical (QM/MM simulations have strongly contributed to providing insights into the understanding of several structural and mechanistic aspects of biological molecules. They played a particularly important role in metal binding proteins, where the electronic effects of transition metals have to be explicitly taken into account for the correct representation of the underlying biochemical process. In this review, after a brief description of the basic concepts of the QM/MM method, we provide an overview of its capabilities using selected examples taken from our work. Specifically, we will focus on heme peroxidases, metallo-β-lactamases, α-synuclein and ligase ribozymes to show how this approach is capable of describing the catalytic and/or structural role played by transition (Fe, Zn or Cu and main group (Mg metals. Applications will reveal how metal ions influence the formation and reduction of high redox intermediates in catalytic cycles and enhance drug metabolism, amyloidogenic aggregate formation and nucleic acid synthesis. In turn, it will become manifest that the protein frame directs and modulates the properties and reactivity of the metal ions.
Current status of the Citrus leprosis virus (CiLV -C and its vector Brevipalpus phoenicis (Geijskes
Directory of Open Access Journals (Sweden)
Guillermo León M
2012-08-01
Full Text Available The Citrus leprosis virus CiLV-C is a quarantine disease of economic importance. Over the past 15 years, this disease has spread to several countries of Central and South America. Colombia has about 45,000 hectares of citrus planted with an annual production of 750,000 tonnes. The CiLV-C has only been detected in the departments of Meta, Casanare and recently Tolima. Meta has 4,300 hectares representing 10% of the national cultivated area, and Casanare, where CiLV-C appeared in 2004, has no more than 500 ha planted with citrus. The presence of the Citrus leprosis virus in Colombia could affect the international market for citrus, other crops and ornamental plants with the United States and other countries without the disease. The false spider mite Brevipalpus phoenicis (Geijskes (Acari: Tenuipalpidae is the main vector of the CiLV-C. Disease management is based on control programs of the vector and diminishing host plants. Chemical mite control is expensive, wasteful and generates resistance to different acaricides. This paper provides basic information on CiLV-C and its vector, advances in diagnosis and methods to control the disease and prevention of its spread
Directory of Open Access Journals (Sweden)
Fernando Juari Celoto
2010-12-01
Full Text Available O objetivo deste trabalho foi avaliar a atividade do acaricida etoxazol, no controle e reprodução do ácaro B. phoenicis. Para tanto, foram demarcadas com cola adesiva arenas de cinco centímetros de diâmetro em frutos de citros com alta infestação do ácaro. O ensaio foi delineado em parcelas inteiramente casualizadas, com oito tratamentos e quatro repetições. Em cada arena foram contados o número de ácaros adultos, jovens e ovos. Os tratamentos constaram dos seguintes acaricidas e doses em g i.a./100 L de água: etoxazol 110 SC (1,1; 1,65; 2,75 e 5,5; hexitiazoxi 500 PM (0,75; flufenoxuron 100 CE (3; cihexatina 500 PM (25, aplicados diretamente sobre as arenas. Os frutos foram mantidos em câmara de germinação tipo BOD. com temperatura de 25 ± 2 ºC e fotofase de 12 horas. Diariamente, foram contados o número de ácaros adultos, jovens e ovos, com auxílio de microscópio esteroscópio. Os parâmetros avaliados foram a atividade ovicida, esterilização de fêmeas e efeito sobre formas jovens. Constatou-se que o etoxazol provocou mortalidade de formas jovens do ácaro-da-leprose superior a 95%, nas doses a partir de 1,1 g i.a. /100 L de água. Ovos tratados com etoxazol, nas doses a partir de 1,65 g i.a. /100 L de água, apresentaram inviabilidade média de 60%. O etoxazol apresentou efeito esterilizante sobre fêmeas nas doses a partir de 2,75 g i.a./100 L de água, inviabilizando 95% dos ovos.The objective of this work was to evaluate the activity of the etoxazole acaricide, on the mortality and reproduction of the citrus leprosies mite, B. phoenicis. A five centimeter diameter arena were demarcated with adhesive glue, in citrus fruits with high infestation of the mite. The design was entirely randomized plots with eight treatments and four replications. In each arena were counted the number of adults, young and eggs of B. phoenicis. The treatments consisted the following acaricides and doses in g a.i./100 L of water: etoxazole
QM/MM studies of cisplatin complexes with DNA dimer and octamer
Gkionis, Konstantinos
2012-08-01
Hybrid QM/MM calculations on adducts of cisplatin with DNA dimer and octamer are reported. Starting from the crystal structure of a cisplatin-DNA dimer complex and an NMR structure of a cisplatin-DNA octamer complex, several variants of the ONIOM approach are tested, all employing BHandH for the QM part and AMBER for MM. We demonstrate that a generic set of molecular mechanics parameters for description of Pt-coordination can be used within the subtractive ONIOM scheme without loss of accuracy, such that dedicated parameters for new platinum complexes may not be required. Comparison of optimised structures obtained with different strategies indicates that electrostatic embedding is vital for proper description of the complex, while inclusion of water molecules as explicit solvent further improves performance. The resulting DNA structural parameters are in good general agreement with the experimental structure obtained, particularly when the inherent variability in NMR-derived parameters is taken into account. © 2012 Elsevier B.V.
Strayer, R. F.; Brannon, M. A.; Garland, J. L.
1990-01-01
Cellulose and xylan (a hemicellulose) comprise 50 percent of inedible wheat residue (which is 60 percent of total wheat biomass) produced in the Kennedy Space Center Closed Ecological Life Support System (CELSS) Breadboard Biomass Production Chamber (BPC). These polysaccharides can be converted by enzymatic hydrolysis into useful monosaccharides, thus maximizing the use of BPC volume and energy, and minimizing waste material to be treated. The evaluation of CELSS-derived wheat residues for production for cellulase enzyme complex by Trichoderma reesei and supplemental beta-glucosidase by Aspergillus phoenicis is in progress. Results to date are given.
Aspergillus uvarum sp. nov., an uniseriate black Aspergillus species isolated from grapes in Europe
DEFF Research Database (Denmark)
Perrone, Giancarlo; Varga, János; Susca, Antonia
2008-01-01
uvarum sp. nov. isolates produced secalonic acid, common to other Aspergillus japonicus-related taxa, and geodin, erdin and dihydrogeodin, which are not produced by any other black aspergilli. None of the isolates were found to produce ochratoxin A. The novel species is most closely related to two......A novel species, Aspergillus uvarum sp. nov., is described within Aspergillus section Nigri. This species can be distinguished from other black aspergilli based on internal transcribed spacers (ITS), beta-tubulin and calmodulin gene sequences, by AFLP analysis and by extrolite profiles. Aspergillus...
BUILDING A RELATIONSHIP WITH THE CUSTOMER: A CRM VERSUS A QM PERSPECTIVE
Directory of Open Access Journals (Sweden)
Sandru Ioana Maria Diana
2009-05-01
Full Text Available Customer relationship management (CRM and quality management (QM both define the customer as being the focus of all business activities. The question arises on how these two concepts work together. In the change defined environment, where getting ahead
Aspergillus--classification and antifungal susceptibilities.
Buzina, Walter
2013-01-01
Aspergillus is one of the most important fungal genera for the man, for its industrial use, its ability to spoil food and not least its medical impact as cause of a variety of diseases. Currently hundreds of species of Aspergillus are known; nearly fifty of them are able to cause infections in humans and animals. Recently, the genus Aspergillus is subdivided into 8 subgenera and 22 sections. The spectrum of diseases caused by Aspergillus species varies from superficial cutaneous to invasive and systemic infections. All species of Aspergillus investigated so far are resistant against the antifungals fluconazole and 5-fluorocytosine, the range of susceptibilities to currently available antifungals is discussed in this paper.
76 FR 16297 - Aspergillus flavus
2011-03-23
... ENVIRONMENTAL PROTECTION AGENCY 40 CFR Part 180 [EPA-HQ-OPP-2010-0101; FRL-8868-7] Aspergillus... for residues of the microbial pesticide, Aspergillus flavus AF36, in or on corn food and feed... to the existing exemption from the requirement of a tolerance for Aspergillus flavus AF36. This...
Chemodiversity in the genus Aspergillus
DEFF Research Database (Denmark)
Frisvad, Jens Christian; Larsen, Thomas Ostenfeld
2015-01-01
to be characterized. The genus Aspergillus is cladistically holophyletic but phenotypically polythetic and very diverse and is associated to quite different sexual states. Following the one fungus one name system, the genus Aspergillus is restricted to a holophyletic clade that include the morphologically different...... biosynthetic family isoextrolites. However, it appears that secondary metabolites from one Aspergillus section have analogous metabolites in other sections (here also called heteroisoextrolites). In this review, we give a genus-wide overview of secondary metabolite production in Aspergillus species. Extrolites...
Aflatoxigenic Aspergillus flavus and Aspergillus parasiticus strains in Hungarian maize fields.
Sebők, Flóra; Dobolyi, Csaba; Zágoni, Dóra; Risa, Anita; Krifaton, Csilla; Hartman, Mátyás; Cserháti, Mátyás; Szoboszlay, Sándor; Kriszt, Balázs
2016-12-01
Due to the climate change, aflatoxigenic Aspergillus species and strains have appeared in several European countries, contaminating different agricultural commodities with aflatoxin. Our aim was to screen the presence of aflatoxigenic fungi in maize fields throughout the seven geographic regions of Hungary. Fungi belonging to Aspergillus section Flavi were isolated in the ratio of 26.9% and 42.3% from soil and maize samples in 2013, and these ratios decreased to 16.1% and 34.7% in 2014. Based on morphological characteristics and the sequence analysis of the partial calmodulin gene, all isolates proved to be Aspergillus flavus, except four strains, which were identified as Aspergillus parasiticus. About half of the A. flavus strains and all the A. parasiticus strains were able to synthesize aflatoxins. Aflatoxigenic Aspergillus strains were isolated from all the seven regions of Hungary. A. parasiticus strains were found in the soil of the regions Southern Great Plain and Southern Transdanubia and in a maize sample of the region Western Transdanubia. In spite of the fact that aflatoxins have rarely been detected in feeds and foods in Hungary, aflatoxigenic A. flavus and A. parasiticus strains are present in the maize culture throughout Hungary posing a potential threat to food safety.
DEFF Research Database (Denmark)
Coutinho, Pedro M.; Andersen, Mikael Rørdam; Kolenova, Katarina
2009-01-01
The plant polysaccharide degradative potential of Aspergillus nidulans was analysed in detail and compared to that of Aspergillus niger and Aspergillus oryzae using a combination of bioinformatics, physiology and transcriptomics. Manual verification indicated that 28.4% of the A. nidulans ORFs...... between the Aspergilli in the presence Of putative regulatory sequences in the promoters of the ORFs Of this Study and correlation of the presence Of putative XlnR binding sites to induction by xylose was detected for A. niger. These data demonstrate differences at genome content, Substrate specificity...
Aflatoxins are the most toxic and carcinogenic secondary metabolites produced primarily by the filamentous fungi Aspergillus flavus and Aspergillus parasiticus. The toxins cause devastating economic losses because of strict regulations on distribution of contaminated products. Aspergillus sojae are...
Previously unknown species of Aspergillus.
Gautier, M; Normand, A-C; Ranque, S
2016-08-01
The use of multi-locus DNA sequence analysis has led to the description of previously unknown 'cryptic' Aspergillus species, whereas classical morphology-based identification of Aspergillus remains limited to the section or species-complex level. The current literature highlights two main features concerning these 'cryptic' Aspergillus species. First, the prevalence of such species in clinical samples is relatively high compared with emergent filamentous fungal taxa such as Mucorales, Scedosporium or Fusarium. Second, it is clearly important to identify these species in the clinical laboratory because of the high frequency of antifungal drug-resistant isolates of such Aspergillus species. Matrix-assisted laser desorption/ionization-time of flight mass spectrometry (MALDI-TOF MS) has recently been shown to enable the identification of filamentous fungi with an accuracy similar to that of DNA sequence-based methods. As MALDI-TOF MS is well suited to the routine clinical laboratory workflow, it facilitates the identification of these 'cryptic' Aspergillus species at the routine mycology bench. The rapid establishment of enhanced filamentous fungi identification facilities will lead to a better understanding of the epidemiology and clinical importance of these emerging Aspergillus species. Based on routine MALDI-TOF MS-based identification results, we provide original insights into the key interpretation issues of a positive Aspergillus culture from a clinical sample. Which ubiquitous species that are frequently isolated from air samples are rarely involved in human invasive disease? Can both the species and the type of biological sample indicate Aspergillus carriage, colonization or infection in a patient? Highly accurate routine filamentous fungi identification is central to enhance the understanding of these previously unknown Aspergillus species, with a vital impact on further improved patient care. Copyright © 2016 European Society of Clinical Microbiology and
Adsorption of amyloglucosidase from Aspergillus niger NRRL 3122 using ion exchange resin
Directory of Open Access Journals (Sweden)
Ana Paula Manera
2008-10-01
Full Text Available Amyloglucosidase enzyme was produced by Aspergillus niger NRRL 3122 from solid-state fermentation, using deffated rice bran as substrate. The effects of process parameters (pH, temperature in the equilibrium partition coefficient for the system amyloglucosidase - resin DEAE-cellulose were investigated, aiming at obtaining the optimum conditions for a subsequent purification process. The highest partition coefficients were obtained using 0.025M Tris-HCl buffer, pH 8.0 and 25ºC. The conditions that supplied the highest partition coefficient were specified, the isotherm that better described the amyloglucosidase process of adsorption obtained. It was observed that the adsorption could be well described by Langmuir equation and the values of Qm and Kd estimated at 133.0 U mL-1 and 15.4 U mL-1, respectively. From the adjustment of the kinetic curves using the fourth-order Runge-Kutta algorithm, the adsorption (k1 and desorption (k2 constants were obtained through optimization by the least square procedure, and the values calculated were 2.4x10-3 mL U-1 min-1 for k1 and 0.037 min-1 for k2 .A enzima amiloglicosidase foi produzida por Aspergillus niger NRRL 3122 através de fermentação em estado sólido, tendo como substrato farelo de arroz desengordurado. Os efeitos dos parâmetros de processo (pH e temperatura no coeficiente de partição no equilíbrio, para o sistema amiloglicosidase - resina DEAE-celulose foram investigados, com o objetivo de se obter as melhores condições para um posterior processo de purificação. Os maiores coeficientes de partição foram obtidos usando tampão Tris-HCl 0,025M pH 8,0 e 25°C. Determinadas as condições que forneceram o maior coeficiente de partição obteve-se a isoterma que melhor descrevia o processo de adsorção de amiloglicosidase. Foi verificado que adsorção pode ser bem descrita pela equação de Langmuir e os valores de Qm e Kd foram estimados em 133,0 U mL-1 e 15,4 U mL-1 respectivamente. A
Fedorov, Dmitri G; Sugita, Yuji; Choi, Cheol Ho
2013-07-03
An efficient parallel implementation of QM/MM-based replica-exchange molecular dynamics (REMD) as well as umbrella samplings techniques was proposed by adopting the generalized distributed data interface (GDDI). Parallelization speed-up of 40.5 on 48 cores was achieved, making our QM/MM-MD engine a robust tool for studying complex chemical dynamics in solution. They were comparatively used to study the torsional isomerization of hydrogen peroxide in aqueous solution. All results by QM/MM-REMD and QM/MM umbrella sampling techniques yielded nearly identical potentials of mean force (PMFs) regardless of the particular QM theories for solute, showing that the overall dynamics are mainly determined by solvation. Although the entropic penalty of solvent rearrangements exists in cisoid conformers, it was found that both strong intermolecular hydrogen bonding and dipole-dipole interactions preferentially stabilize them in solution, reducing the torsional free-energy barrier at 0° by about 3 kcal/mol as compared to that in gas phase.
Le, Quang Anh Tuan; Kim, Seonghoon; Chang, Rakwoo; Kim, Yong Hwan
2015-07-30
Serum paraoxonase 1 (PON1) is a versatile enzyme for the hydrolysis of various substrates (e.g., lactones, phosphotriesters) and for the formation of a promising chemical platform γ-valerolactone. Elucidation of the PON1-catalyzed lactonase reaction mechanism is very important for understanding the enzyme function and for engineering this enzyme for specific applications. Kinetic study and hybrid quantum mechanics/molecular mechanics (QM/MM) method were used to investigate the PON1-catalyzed lactonase reaction of γ-butyrolactone (GBL) and (R)-γ-valerolactone (GVL). The activation energies obtained from the QM/MM calculations were in good agreement with the experiments. Interestingly, the QM/MM energy barriers at MP2/3-21G(d,p) level for the lactonase of GVL and GBL were respectively 14.3-16.2 and 11.5-13.1 kcal/mol, consistent with the experimental values (15.57 and 14.73 kcal/mol derived from respective kcat values of 36.62 and 147.21 s(-1)). The QM/MM energy barriers at MP2/6-31G(d) and MP2/6-31G(d,p) levels were also in relatively good agreements with the experiments. Importantly, the difference in the QM/MM energy barriers at MP2 level with all investigated basis sets for the lactonase of GVL and GBL were in excellent agreement with the experiments (0.9-3.1 and 0.8 kcal/mol, respectively). A detailed mechanism for the PON1-catalyzed lactonase reaction was also proposed in this study.
Greco, Mariana; Kemppainen, Minna; Pose, Graciela; Pardo, Alejandro
2015-01-01
Xerophilic fungal species of the genus Aspergillus are economically highly relevant due to their ability to grow on low water activity substrates causing spoilage of stored goods and animal feeds. These fungi can synthesize a variety of secondary metabolites, many of which show animal toxicity, creating a health risk for food production animals and to humans as final consumers, respectively. Animal feeds used for rabbit, chinchilla and rainbow trout production in Argentina were analysed for the presence of xerophilic Aspergillus section Aspergillus species. High isolation frequencies (>60%) were detected in all the studied rabbit and chinchilla feeds, while the rainbow trout feeds showed lower fungal charge (25%). These section Aspergillus contaminations comprised predominantly five taxa. Twenty isolates were subjected to taxonomic characterization using both ascospore SEM micromorphology and two independent DNA loci sequencing. The secondary metabolite profiles of the isolates were determined qualitatively by HPLC-MS. All the isolates produced neoechinulin A, 17 isolates were positive for cladosporin and echinulin, and 18 were positive for neoechinulin B. Physcion and preechinulin were detected in a minor proportion of the isolates. This is the first report describing the detailed species composition and the secondary metabolite profiles of Aspergillus section Aspergillus contaminating animal feeds. PMID:26364643
Directory of Open Access Journals (Sweden)
Mariana Greco
2015-09-01
Full Text Available Xerophilic fungal species of the genus Aspergillus are economically highly relevant due to their ability to grow on low water activity substrates causing spoilage of stored goods and animal feeds. These fungi can synthesize a variety of secondary metabolites, many of which show animal toxicity, creating a health risk for food production animals and to humans as final consumers, respectively. Animal feeds used for rabbit, chinchilla and rainbow trout production in Argentina were analysed for the presence of xerophilic Aspergillus section Aspergillus species. High isolation frequencies (>60% were detected in all the studied rabbit and chinchilla feeds, while the rainbow trout feeds showed lower fungal charge (25%. These section Aspergillus contaminations comprised predominantly five taxa. Twenty isolates were subjected to taxonomic characterization using both ascospore SEM micromorphology and two independent DNA loci sequencing. The secondary metabolite profiles of the isolates were determined qualitatively by HPLC-MS. All the isolates produced neoechinulin A, 17 isolates were positive for cladosporin and echinulin, and 18 were positive for neoechinulin B. Physcion and preechinulin were detected in a minor proportion of the isolates. This is the first report describing the detailed species composition and the secondary metabolite profiles of Aspergillus section Aspergillus contaminating animal feeds.
Greco, Mariana; Kemppainen, Minna; Pose, Graciela; Pardo, Alejandro
2015-09-02
Xerophilic fungal species of the genus Aspergillus are economically highly relevant due to their ability to grow on low water activity substrates causing spoilage of stored goods and animal feeds. These fungi can synthesize a variety of secondary metabolites, many of which show animal toxicity, creating a health risk for food production animals and to humans as final consumers, respectively. Animal feeds used for rabbit, chinchilla and rainbow trout production in Argentina were analysed for the presence of xerophilic Aspergillus section Aspergillus species. High isolation frequencies (>60%) were detected in all the studied rabbit and chinchilla feeds, while the rainbow trout feeds showed lower fungal charge (25%). These section Aspergillus contaminations comprised predominantly five taxa. Twenty isolates were subjected to taxonomic characterization using both ascospore SEM micromorphology and two independent DNA loci sequencing. The secondary metabolite profiles of the isolates were determined qualitatively by HPLC-MS. All the isolates produced neoechinulin A, 17 isolates were positive for cladosporin and echinulin, and 18 were positive for neoechinulin B. Physcion and preechinulin were detected in a minor proportion of the isolates. This is the first report describing the detailed species composition and the secondary metabolite profiles of Aspergillus section Aspergillus contaminating animal feeds.
Direct hydride shift mechanism and stereoselectivity of P450nor confirmed by QM/MM calculations.
Krámos, Balázs; Menyhárd, Dóra K; Oláh, Julianna
2012-01-19
Nitric oxide reductase (P450(nor)) found in Fusarium oxysporum catalyzes the reduction of nitric oxide to N(2)O in a multistep process. The reducing agent, NADH, is bound in the distal pocket of the enzyme, and direct hydride transfer occurs from NADH to the nitric oxide bound heme enzyme, forming intermediate I. Here we studied the possibility of hydride transfer from NADH to both the nitrogen and oxygen of the heme-bound nitric oxide, using quantum chemical and combined quantum mechanics/molecular mechanics (QM/MM) calculations, on two different protein models, representing both possible stereochemistries, a syn- and an anti-NADH arrangement. All calculations clearly favor hydride transfer to the nitrogen of nitric oxide, and the QM-only barrier and kinetic isotope effects are good agreement with the experimental values of intermediate I formation. We obtained higher barriers in the QM/MM calculations for both pathways, but hydride transfer to the nitrogen of nitric oxide is still clearly favored. The barriers obtained for the syn, Pro-R conformation of NADH are lower and show significantly less variation than the barriers obtained in the case of anti conformation. The effect of basis set and wide range of functionals on the obtained results are also discussed.
A molecular analysis of L-arabinan degradation in Aspergillus niger and Aspergillus nidulans
Flipphi, M.J.A.
1995-01-01
This thesis describes a molecular study of the genetics ofL-arabinan degradation in Aspergillus niger and Aspergillus nidulans. These saprophytic hyphal fungi produce an extracellular hydrolytic enzyme system to
Allergens/Antigens, Toxins and Polyketides of Important Aspergillus Species
Bhetariya, Preetida J.; Madan, Taruna; Basir, Seemi Farhat; Varma, Anupam; Usha, Sarma P.
2011-01-01
The medical, agricultural and biotechnological importance of the primitive eukaryotic microorganisms, the Fungi was recognized way back in 1920. Among various groups of fungi, the Aspergillus species are studied in great detail using advances in genomics and proteomics to unravel biological and molecular mechanisms in these fungi. Aspergillus fumigatus, Aspergillus flavus, Aspergillus niger, Aspergillus parasiticus, Aspergillus nidulans and Aspergillus terreus are some of the important specie...
Aflatoxins are toxic and carcinogenic secondary metabolites produced primarily by the filamentous fungi Aspergillus favus and Aspergillus parasitic and cause toxin contamination in food chain worldwide. Aspergillus oryzae and Aspergillus sojae are highly valued as koji molds in the traditional prep...
Directory of Open Access Journals (Sweden)
M Iyan Sofyan
2004-12-01
Full Text Available The objectives of this research were: 1 to determine aeration rate and substrate concentration of pure cellulose to produce maximum glucose by Trichoderma reesei QM 9414 at 30 oC, and agitation 150 rpm; 2 to study the kinetics of pure cellulose fermentation by Trichoderma reesei QM 9414 to glucose and its implication upon fermentation of the lignin free rice straw. The experiment was arranged in factorial randomized complete design in three times replication. Treatments consisted of three levels of aeration (1,00 vvm; 1,5 vvm; 2,0 vvm and three levels of substrate concentration (0,75 ; 1,00 ; 1,25 % w/v. The results showed that at the exponential phase the average specific growth of Trichoderma reesei QM 9414 was 0,05374 hour-1, the maximum glucose product concentration of pure cellulose was 0.1644 gL-1,and the oxygen transfer was 0,0328 mg L-1 hour-1. According to t-test, the kinetics of pure cellulose fermentation model just the same as the lignin free rice straw fermentation.The enzymes produced by Trichoderma reesei QM 9414 in pure cellulose fermentation media followed the Michaelis-Menten model. The enzyme kinetic parameters were the maximum growth rate was 37x10-3 hour-1 and Michaelis-Menten constant was ½ maximum μ =17,5x10-3 hour-1. The volumetric oxygen transfer (KLa using rice straw was 0,0337 mg.hour-1. The value of KLa could be used for conversion from bioreactor at laboratory scale to commercial scale design.
Glucosidase: microbial production and effect on enzymatic hydrolysis of cellulose
Energy Technology Data Exchange (ETDEWEB)
Sternberg, D
1977-01-01
The enzymic conversion of cellulose is catalyzed by a multiple enzyme system. The Trichoderma enzyme system has insufficient ..beta..-glucosidase (EC 3.2.1.21) activity for the practical saccharification of cellulose. Aspergillus niger and A. phoenicis were superior producers of ..beta.. glucosidase and a method for production of this enzyme in liquid culture is presented. When Trichoderma cellulase preparations are supplemented with ..beta.. glucosidase from Aspergullus during practical saccharifications glucose is the predominant product and the rate of saccharification is significantly increased. The stimulatory effect of ..beta.. glucosidase appears to be due to the removal of inhibitory levels of cellobiose.
Aspergillus species as emerging causative agents of onychomycosis.
Nouripour-Sisakht, S; Mirhendi, H; Shidfar, M R; Ahmadi, B; Rezaei-Matehkolaei, A; Geramishoar, M; Zarei, F; Jalalizand, N
2015-06-01
Onychomycosis is a common nail infection caused by dermatophytes, non-dermatophyte molds (NDM), and yeasts. Aspergillus species are emerging as increasing causes of toenail onychomycosis. The purpose of this study was species delineation of Aspergillus spp. isolated from patients with onychomycosis. During a period of one year (2012-2013), nail samples were collected from patients clinically suspected of onychomycosis and subjected to microscopic examination and culture. Species identification was performed based on macro- and micro-morphology of colonies. For precise species identification, PCR-amplification and sequencing of the beta-tubulin gene followed by BLAST queries were performed where required. A total of 463/2,292 (20.2%) tested nails were diagnosed with onychomycosis. Among the positive specimens, 154 cases (33.2%) were identified as saprophytic NDM onychomycosis, 135 (29.2%) of which were attributable to Aspergillus. Aspergillus species isolated from the infected nails included Aspergillus flavus (77.3%, n=119), Aspergillus niger (n=4), Aspergillus tubingensis (n=4), Aspergillus terreus (n=3), Aspergillus sydowii (n=2), Aspergillus spp. (n=2), and Aspergillus candidus (n=1). Among the patients diagnosed with onychomycosis due to Aspergillus (average patient age, 47.4 years), 40 had fingernail and 95 toenail involvement. The large toenails were most commonly affected. This study identified a markedly high occurrence of A. flavus, and this fungus appears to be an emerging cause of saprophytic onychomycosis in Iran. The study moreover highlights the necessity of differentiating between dermatophytic and non-dermatophytic nail infections for informed decisions on appropriate therapy. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
DEFF Research Database (Denmark)
Jørgensen, Thomas R
2007-01-01
Mold strains belonging to the species Aspergillus oryzae and Aspergillus sojae are highly valued as koji molds in the traditional preparation of fermented foods, such as miso, sake, and shoyu, and as protein production hosts in modern industrial processes. A. oryzae and A. sojae are relatives...... of the wild molds Aspergillus flavus and Aspergillus parasiticus. All four species are classified to the A. flavus group. Strains of the A. flavus group are characterized by a high degree of morphological similarity. Koji mold species are generally perceived of as being nontoxigenic, whereas wild molds...... are associated with the carcinogenic aflatoxins. Thus, reliable identification of individual strains is very important for application purposes. This review considers the pheno- and genotypic markers used in the classification of A. flavus group strains and specifically in the identification of A. oryzae and A...
9 CFR 329.7 - Procedure for seizure, condemnation, and disposition.
2010-01-01
... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Procedure for seizure, condemnation... AND VOLUNTARY INSPECTION AND CERTIFICATION DETENTION; SEIZURE AND CONDEMNATION; CRIMINAL OFFENSES § 329.7 Procedure for seizure, condemnation, and disposition. Any article or livestock subject to...
Boulanger, Eliot; Thiel, Walter
2012-11-13
Accurate quantum mechanical/molecular mechanical (QM/MM) treatments should account for MM polarization and properly include long-range electrostatic interactions. We report on a development that covers both these aspects. Our approach combines the classical Drude oscillator (DO) model for the electronic polarizability of the MM atoms with the generalized solvent boundary Potential (GSBP) and the solvated macromolecule boundary potential (SMBP). These boundary potentials (BP) are designed to capture the long-range effects of the outer region of a large system on its interior. They employ a finite difference approximation to the Poisson-Boltzmann equation for computing electrostatic interactions and take into account outer-region bulk solvent through a polarizable dielectric continuum (PDC). This approach thus leads to fully polarizable three-layer QM/MM-DO/BP methods. As the mutual responses of each of the subsystems have to be taken into account, we propose efficient schemes to converge the polarization of each layer simultaneously. For molecular dynamics (MD) simulations using GSBP, this is achieved by considering the MM polarizable model as a dynamical degree of freedom, and hence contributions from the boundary potential can be evaluated for a frozen state of polarization at every time step. For geometry optimizations using SMBP, we propose a dual self-consistent field approach for relaxing the Drude oscillators to their ideal positions and converging the QM wave function with the proper boundary potential. The chosen coupling schemes are evaluated with a test system consisting of a glycine molecule in a water ball. Both boundary potentials are capable of properly reproducing the gradients at the inner-region atoms and the Drude oscillators. We show that the effect of the Drude oscillators must be included in all terms of the boundary potentials to obtain accurate results and that the use of a high dielectric constant for the PDC does not lead to a polarization
Directory of Open Access Journals (Sweden)
Melissa Orzechowski Xavier
2013-06-01
Full Text Available Here we investigate the extent to which different Aspergillus species release galactomannan (GM in vitro. Marked variability was observed in GM reactivity between and within Aspergillus species, with A. terreus strains showing the highest GM indexes. The in vivo significance of these findings remains to be determined.
8 CFR 329.5 - Natives of the Philippines with active duty service during World War II.
2010-01-01
... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Natives of the Philippines with active duty service during World War II. 329.5 Section 329.5 Aliens and Nationality DEPARTMENT OF HOMELAND SECURITY... of the Philippines with active duty service during World War II. (a) A person desiring to naturalize...
Biosolubilization of poorly soluble rock phosphates by Aspergillus tubingensis and Aspergillus niger
Energy Technology Data Exchange (ETDEWEB)
Reddy, M.S.; Kumar, S.; Babita, K. [Thapar Institute of Engineering and Technology, Patiala (India). School of Biotechnology; Reddy, M.S. [Auburn University, AL (United States). Department of Entomology and Plant Pathology
2002-09-01
Three isolates of Aspergillus tubingensis and two isolates of Aspergillus niger isolated from rhizospheric soils were tested on solubilization of different rock phosphates. All the isolates of Aspergillus were capable of solubilizing all the natural rock phosphates. A. tubingensis (AT1) showed maximum percent solubilization in all the rock phosphates tested in this study when compared to other isolates. This isolate also showed highest phosphorus (P) solubilization when grown in the presence of 2% of rock phosphate. A. tubingensis (AT1) seems to be more efficient in solubilization of rock phosphates compared to other isolates reported elsewhere. This is the first report of rock phosphate solubilization by A. tubingensis and might provide an efficient large scale biosolubilization of rock phosphates intended for P fertilizer. (author)
Czech Academy of Sciences Publication Activity Database
Banáš, P.; Walter, N.G.; Šponer, Jiří; Otyepka, Michal
2009-01-01
Roč. 26, č. 6 (2009), s. 816 ISSN 0739-1102. [The 17th Conversation . 16.06.2009-20.06.2009, Albany] Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : QM/MM * RNA Subject RIV: BO - Biophysics
International Nuclear Information System (INIS)
Chang, Hyun Young; Park, Heung Bae; Kim, Young Sik; Ahn, Sang Kon; Jang, Yoon Young
2011-01-01
Lean duplex stainless steels have been developed in Korea for the purpose of being used in the seawater systems of industry. There are also many important seawater systems in nuclear power plants. These systems supply seawater to cooling water condenser tubes, heat exchanger tubes, related pipes and chlorine injection systems. The flow velocity of some part of seawater systems in nuclear power plants is high and damages of components from corrosion are severe. The considered lean duplex stainless steels are STS329LD (20.3Cr-2.2Ni-1.4Mo) and STS329J3L (22.4Cr-5.7Ni-3Mo) and PRENs of them are 29.4 and 37.3 respectively. Physical, mechanical and micro-structural properties of them are evaluated, and electrochemical corrosion resistance is measured quantitatively in NaCl solution. Critical Pitting Temperatures (CPT)s are measured on these alloys and pit depths are evaluated using laser microscope. Long period field tests on these alloys are now being performed, and some results are going to be presented in the following study
Dohn, A O; Jónsson, E Ö; Levi, G; Mortensen, J J; Lopez-Acevedo, O; Thygesen, K S; Jacobsen, K W; Ulstrup, J; Henriksen, N E; Møller, K B; Jónsson, H
2017-12-12
A multiscale density functional theory-quantum mechanics/molecular mechanics (DFT-QM/MM) scheme is presented, based on an efficient electrostatic coupling between the electronic density obtained from a grid-based projector augmented wave (GPAW) implementation of density functional theory and a classical potential energy function. The scheme is implemented in a general fashion and can be used with various choices for the descriptions of the QM or MM regions. Tests on H 2 O clusters, ranging from dimer to decamer show that no systematic energy errors are introduced by the coupling that exceeds the differences in the QM and MM descriptions. Over 1 ns of liquid water, Born-Oppenheimer QM/MM molecular dynamics (MD) are sampled combining 10 parallel simulations, showing consistent liquid water structure over the QM/MM border. The method is applied in extensive parallel MD simulations of an aqueous solution of the diplatinum [Pt 2 (P 2 O 5 H 2 ) 4 ] 4- complex (PtPOP), spanning a total time period of roughly half a nanosecond. An average Pt-Pt distance deviating only 0.01 Å from experimental results, and a ground-state Pt-Pt oscillation frequency deviating by <2% from experimental results were obtained. The simulations highlight a remarkable harmonicity of the Pt-Pt oscillation, while also showing clear signs of Pt-H hydrogen bonding and directional coordination of water molecules along the Pt-Pt axis of the complex.
Variability of Germinative Potential among Pathogenic Species of Aspergillus
Araujo, Ricardo; Rodrigues, Acacio Gonçalves
2004-01-01
The objective of our study was to evaluate parameters influencing the germination of Aspergillus conidia. Inoculum concentration and age significantly influenced germination. Different incubation temperatures revealed significant differences among Aspergillus species. The internal human milieu provides the ideal conditions for the development of invasive disease by Aspergillus fumigatus but restricts invasion by Aspergillus flavus and Aspergillus niger.
DEFF Research Database (Denmark)
Curutchet, Carles; Cupellini, Lorenzo; Kongsted, Jacob
2018-01-01
embedding approaches, respectively, nonelectrostatic dispersion and repulsion interactions are instead commonly described through classical potentials despite their quantum mechanical origin. Here we present an extension of the Tkatchenko-Scheffler semiempirical van der Waals (vdWTS) scheme aimed......Mixed multiscale quantum/molecular mechanics (QM/MM) models are widely used to explore the structure, reactivity, and electronic properties of complex chemical systems. Whereas such models typically include electrostatics and potentially polarization in so-called electrostatic and polarizable...... at describing dispersion and repulsion interactions between quantum and classical regions within a QM/MM polarizable embedding framework. Starting from the vdWTSexpression, we define a dispersion and a repulsion term, both of them density-dependent and consistently based on a Lennard-Jones-like potential. We...
Adav, Sunil S; Ravindran, Anita; Sze, Siu Kwan
2015-04-24
Aspergillus sp. plays an essential role in lignocellulosic biomass recycling and is also exploited as cell factories for the production of industrial enzymes. This study profiled the secretome of Aspergillus fumigatus when grown with cellulose, xylan and starch by high throughput quantitative proteomics using isobaric tags for relative and absolute quantification (iTRAQ). Post translational modifications (PTMs) of proteins play a critical role in protein functions. However, our understanding of the PTMs in secretory proteins is limited. Here, we present the identification of PTMs such as deamidation of secreted proteins of A. fumigatus. This study quantified diverse groups of extracellular secreted enzymes and their functional classification revealed cellulases and glycoside hydrolases (32.9%), amylases (0.9%), hemicellulases (16.2%), lignin degrading enzymes (8.1%), peptidases and proteases (11.7%), chitinases, lipases and phosphatases (7.6%), and proteins with unknown function (22.5%). The comparison of quantitative iTRAQ results revealed that cellulose and xylan stimulates expression of specific cellulases and hemicellulases, and their abundance level as a function of substrate. In-depth data analysis revealed deamidation as a major PTM of key cellulose hydrolyzing enzymes like endoglucanases, cellobiohydrolases and glucosidases. Hemicellulose degrading endo-1,4-beta-xylanase, monosidases, xylosidases, lignin degrading laccase, isoamyl alcohol oxidase and oxidoreductases were also found to be deamidated. The filamentous fungi play an essential role in lignocellulosic biomass recycling and fungal strains belonging to Aspergillus were also exploited as cell factories for the production of organic acids, pharmaceuticals, and industrially important enzymes. In this study, extracellular proteins secreted by thermophilic A. fumigatus when grown with cellulose, xylan and starch were profiled using isobaric tags for relative and absolute quantification (iTRAQ) by
Nováková, Alena; Hubka, Vit; Saiz-Jimenez, Cesareo; Kolarik, Miroslav
2012-11-01
Two novel species of Aspergillus that are clearly distinct from all known species in section Usti were revealed during a study of microfungal communities in Spanish caves. The novel species identified in this study and additional species of Aspergillus section Usti are associated with places and substrates related to human activities in caves. Novel species are described using data from four loci (ITS, benA, caM and rpb2), morphology and basic chemical and physiological analyses. Members of the species Aspergillus thesauricus sp. nov. were isolated from various substrates, including decaying organic matter, cave air and cave sediment of the Cueva del Tesoro Cave (the Treasure cave); the species is represented by twelve isolates and is most closely related to the recently described Aspergillus germanicus. Members of the species Aspergillus baeticus sp. nov. were isolated from cave sediment in the Gruta de las Maravillas Cave (the Grotto of the Marvels); the species is represented by two isolates. An additional isolate was found in the Cueva del Tesoro Cave and in the Demänovská Peace Cave (Slovakia), suggesting a potentially wide distribution of this micro-organism. The species is related to Aspergillus ustus and Aspergillus pseudoustus. Both species were unable to grow at 37 °C, and a weakly positive, light greenish yellow Ehrlich reaction was observed in A. thesauricus. Unique morphological features alone are sufficient to distinguish both species from related taxa.
Curutchet, Carles; Cupellini, Lorenzo; Kongsted, Jacob; Corni, Stefano; Frediani, Luca; Steindal, Arnfinn Hykkerud; Guido, Ciro A; Scalmani, Giovanni; Mennucci, Benedetta
2018-03-13
Mixed multiscale quantum/molecular mechanics (QM/MM) models are widely used to explore the structure, reactivity, and electronic properties of complex chemical systems. Whereas such models typically include electrostatics and potentially polarization in so-called electrostatic and polarizable embedding approaches, respectively, nonelectrostatic dispersion and repulsion interactions are instead commonly described through classical potentials despite their quantum mechanical origin. Here we present an extension of the Tkatchenko-Scheffler semiempirical van der Waals (vdW TS ) scheme aimed at describing dispersion and repulsion interactions between quantum and classical regions within a QM/MM polarizable embedding framework. Starting from the vdW TS expression, we define a dispersion and a repulsion term, both of them density-dependent and consistently based on a Lennard-Jones-like potential. We explore transferable atom type-based parametrization strategies for the MM parameters, based on either vdW TS calculations performed on isolated fragments or on a direct estimation of the parameters from atomic polarizabilities taken from a polarizable force field. We investigate the performance of the implementation by computing self-consistent interaction energies for the S22 benchmark set, designed to represent typical noncovalent interactions in biological systems, in both equilibrium and out-of-equilibrium geometries. Overall, our results suggest that the present implementation is a promising strategy to include dispersion and repulsion in multiscale QM/MM models incorporating their explicit dependence on the electronic density.
Pre-discovery detections and progenitor candidate for SPIRITS17qm in NGC 1365
Jencson, J. E.; Bond, H. E.; Adams, S. M.; Kasliwal, M. M.
2018-04-01
We report the detection of a pre-discovery outburst of SPIRITS17qm, discovered as part of the ongoing Spitzer InfraRed Intensive Transients Survey (SPIRITS) using the 3.6 and 4.5 micron imaging channels ([3.6] and [4.5]) of the Infrared Array Camera (IRAC) on the Spitzer Space Telescope (ATel #11575).
Preface [EmQM15: 3. international symposium on emergent quantum mechanics
International Nuclear Information System (INIS)
2016-01-01
These proceedings comprise the invited lectures of the third international symposium on Emergent Quantum Mechanics (EmQM15), which was held at the Vienna University of Technology in Vienna, Austria, 23-25 October 2015. The symposium convened at the Festsaal and the adjacent Boeckl-Saal of the Technical University, and was devoted to the open exploration of the quantum state as a reality. The resurgence of interest in ontological quantum theory, including both deterministic and indeterministic approaches, challenges long held assumptions and focuses on the following questions: Is the world local or nonlocal? What is the nature of quantum nonlocality? If nonlocal, i.e., superluminal, influences exist then why can't they be used for superluminal signaling and communication? How is the role of the scientific observer/agent to be accounted for in realistic approaches to quantum theory? How could recent developments in the field of space-time as an emergent phenomenon advance new insight at this research frontier? What new experiments might contribute to new understanding? These and related questions were addressed in the context also of a possible deeper level theory for quantum mechanics that interconnects three fields of knowledge: emergence, the quantum, and information. Could there appear a revised image of physical reality from recognizing new links between emergence, the quantum, and information? The symposium provided a forum for considering (i) current theoretical and conceptual obstacles which need to be overcome as well as (ii) promising developments and research opportunities on the way towards realistic quantum mechanics. Contributions were invited that present current advances in both standard as well as unconventional approaches. The EmQM15 symposium was co-organized by Gerhard Grössing (Austrian Institute for Nonlinear Studies (AINS), Vienna), and by Jan Walleczek (Fetzer Franklin Fund, USA, and Phenoscience Laboratories, Berlin). After two
FT-Raman and QM/MM study of the interaction between histamine and DNA
International Nuclear Information System (INIS)
Ruiz-Chica, A.J.; Soriano, A.; Tunon, I.; Sanchez-Jimenez, F.M.; Silla, E.; Ramirez, F.J.
2006-01-01
The interaction between histamine and highly polymerized calf-thymus DNA has been investigated using FT-Raman spectroscopy and the hybrid QM/MM (quantum mechanics/molecular mechanics) methodology. Raman spectra of solutions containing histamine and calf-thymus DNA, at different molar ratios, were recorded. Solutions were prepared at physiological settings of pH and ionic strength, using both natural and heavy water as the solvent. The analysis of the spectral changes on the DNA Raman spectra when adding different concentrations of histamine allowed us to identify the reactive sites of DNA and histamine, which were used to built two minor groove and one intercalated binding models. They were further used as starting points of the QM/MM theoretical study. However, minimal energy points were only reached for the two minor groove models. For each optimized structure, we calculated analytical force constants of histamine molecule in order to perform the vibrational dynamics. Normal mode descriptions allowed us to compare calculated wavenumbers for DNA-interacting histamine to those measured in the Raman spectra of DNA-histamine solutions
Heterologous expression of Gaeumannomyces graminis lipoxygenase in Aspergillus nidulans
Heshof, R.; Schayck, van J.P.; Tamayo Ramos, J.A.; Graaff, de L.H.
2014-01-01
Aspergillus sp. contain ppo genes coding for Ppo enzymes that produce oxylipins from polyunsaturated fatty acids. These oxylipins function as signal molecules in sporulation and influence the asexual to sexual ratio of Aspergillus sp. Fungi like Aspergillus nidulans and Aspergillus niger contain
[Survival Strategies of Aspergillus in the Human Body].
Tashiro, Masato; Izumikawa, Koichi
2017-01-01
The human body is a hostile environment for Aspergillus species, which originally live outside the human body. There are lots of elimination mechanisms against Aspergillus inhaled into the human body, such as high body temperature, soluble lung components, mucociliary clearance mechanism, or responses of phagocytes. Aspergillus fumigatus, which is the primary causative agent of human infections among the human pathogenic species of Aspergillus, defend itself from the hostile human body environment by various mechanisms, such as thermotolerance, mycotoxin production, and characteristic morphological features. Here we review mechanisms of defense in Aspergillus against elimination from the human body.
Intra and extracellular nuclease production by Aspergillus niger and Aspergillus nidulans
Directory of Open Access Journals (Sweden)
Ferreira Adlane V. B.
1998-01-01
Full Text Available Intra and extracellular nuclease production by strains of Aspergillus niger and Aspergillus nidulans was estimated using a modified DNAse test agar and cell-free extract assays. Differences in the production of nucleases by A. niger and A. nidulans were observed. These observations suggest that the DNAse test agar can be helpful for a quick screening for some types of nucleases in filamentous fungi. The assays using cell-free extracts can also be useful for initial characterization of other types of nucleases.
Phylogeny, identification and nomenclature of the genus Aspergillus
Samson, R.A.; Visagie, C.M.; Houbraken, J.; Hong, S.-B.; Hubka, V.; Klaassen, C.H.W.; Perrone, G.; Seifert, K.A.; Susca, A.; Tanney, J.B.; Varga, J.; Kocsubé, S.; Szigeti, G.; Yaguchi, T.; Frisvad, J.C.
2014-01-01
Aspergillus comprises a diverse group of species based on morphological, physiological and phylogenetic characters, which significantly impact biotechnology, food production, indoor environments and human health. Aspergillus was traditionally associated with nine teleomorph genera, but phylogenetic data suggest that together with genera such as Polypaecilum, Phialosimplex, Dichotomomyces and Cristaspora, Aspergillus forms a monophyletic clade closely related to Penicillium. Changes in the International Code of Nomenclature for algae, fungi and plants resulted in the move to one name per species, meaning that a decision had to be made whether to keep Aspergillus as one big genus or to split it into several smaller genera. The International Commission of Penicillium and Aspergillus decided to keep Aspergillus instead of using smaller genera. In this paper, we present the arguments for this decision. We introduce new combinations for accepted species presently lacking an Aspergillus name and provide an updated accepted species list for the genus, now containing 339 species. To add to the scientific value of the list, we include information about living ex-type culture collection numbers and GenBank accession numbers for available representative ITS, calmodulin, β-tubulin and RPB2 sequences. In addition, we recommend a standard working technique for Aspergillus and propose calmodulin as a secondary identification marker. PMID:25492982
Directory of Open Access Journals (Sweden)
Jitrayut Jitonnom
2018-04-01
Full Text Available The data presented in this paper are related to the research article entitled “QM/MM modeling of the hydrolysis and transfructosylation reactions of fructosyltransferase from Aspergillus japonicas, an enzyme that produces prebiotic fructooligosaccharide” (Jitonnom et al., 2018 [1]. This paper presents the procedure and data for characterizing the whole relative energy profiles of hydrolysis and transglycosylation reactions whose elementary steps differ in chemical composition. The data also reflects the choices of the QM cluster model, the functional/basis set method and the equations in determining the reaction energetics.
10 CFR 205.329 - Environmental requirements for Presidential Permits-Alternative 2.
2010-01-01
... Facilities for Transmission of Electric Energy at International Boundaries § 205.329 Environmental... 10 Energy 3 2010-01-01 2010-01-01 false Environmental requirements for Presidential Permits... such Presidential Permits: (1) ERA will determine whether an Environmental Impact Statement (EIS) or an...
Aspergillus saccharolyticus sp. nov., a new black Aspergillus species isolated in Denmark
DEFF Research Database (Denmark)
Sørensen, Annette; Lübeck, Peter S.; Lübeck, Mette
2011-01-01
A novel species, Aspergillus saccharolyticus sp. nov., belonging to the Aspergillus section Nigri group is described. This species was isolated in Denmark from treated hardwood. Its taxonomic status was determined using a polyphasic taxonomic approach including phenotypic (morphology and extrolite...... profiles) and molecular (β-tubulin, internal transcribed spacer and calmodulin gene sequences, and universally primed PCR fingerprinting) analysis. Phenotypic and molecular data enabled this novel species to be clearly distinguished from other black aspergilli. A. saccharolyticus is a uniseriate...
New species in Aspergillus section Terrei
DEFF Research Database (Denmark)
Samson, R. A.; Peterson, S. W.; Frisvad, Jens Christian
2011-01-01
. clade including the type isolate of A. niveus (CBS 115.27) constitutes a lineage closely related to A. carneus. Fennellia nivea, the hypothesized teleomorph is not related to this clade. Aspergillus allahabadii, A. niveus var. indicus, and two species originally placed in section Versicolores, A......Section Terrei of Aspergillus was studied using a polyphasic approach including sequence analysis of parts of the beta-tubulin and calmodulin genes and the ITS region, macro- and micromorphological analyses and examination of extrolite profiles to describe three new species in this section. Based....... floccosus, A. terreus var. africanus, A. terreus var. aureus, while Aspergillus hortai is recognised at species level. Aspergillus terreus NRRL 4017 is described as the new species A. pseudoterreus. Also included in section Terrei are some species formerly placed in sections Flavipedes and Versicolores. A...
García-Cela, E; Crespo-Sempere, A; Ramos, A J; Sanchis, V; Marin, S
2014-03-03
The aim of this study was to evaluate the diversity of black aspergilli isolated from berries from different agroclimatic regions of Spain. Growth characterization (in terms of temperature and water activity requirements) of Aspergillus carbonarius, Aspergillus tubingensis and Aspergillus niger was carried out on synthetic grape medium. A. tubingensis and A. niger showed higher maximum temperatures for growth (>45 °C versus 40-42 °C), and lower minimum aw requirements (0.83 aw versus 0.87 aw) than A. carbonarius. No differences in growth boundaries due to their geographical origin were found within A. niger aggregate isolates. Conversely, A. carbonarius isolates from the hotter and drier region grew and produced OTA at lower aw than other isolates. However, little genetic diversity in A. carbonarius was observed for the microsatellites tested and the same sequence of β-tubulin gene was observed; therefore intraspecific variability did not correlate with the geographical origin of the isolates or with their ability to produce OTA. Climatic change prediction points to drier and hotter climatic scenarios where A. tubingensis and A. niger could be even more prevalent over A. carbonarius, since they are better adapted to extreme high temperature and drier conditions. Copyright © 2013 Elsevier B.V. All rights reserved.
QM/MM study of dislocation—hydrogen/helium interactions in α-Fe
International Nuclear Information System (INIS)
Zhao, Yi; Lu, Gang
2011-01-01
Impurities such as hydrogen (H) and helium (He) interact strongly with dislocations in metals. Using a multiscale quantum-mechanics/molecular-mechanics (QM/MM) approach, we have examined the interactions between the impurities (H and He) with dislocations (edge and screw) in α-Fe. The impurity trapping at the dislocation core is examined by calculating the impurity-dislocation binding energy and the impurity solution energy. We find that in general both H and He prefer the tetrahedral sites at the dislocation core, as well as in the bulk; the exceptions are due to deformed structures at the dislocation cores. Both H and He have a greater solution energy and binding energy to the edge dislocation than to the screw dislocation. The impurity pipe diffusion along the dislocation core is investigated using the QM/MM nudged-elastic-band method. We find that the diffusion barrier along the screw dislocation is lower than the bulk value for both H and He impurities. For the edge dislocation, although H has similar diffusion barriers as in the bulk, He has much higher diffusion energy barriers compared with the bulk. Finally we have examined the impurity effect on the dislocation mobility. We find that both H and He can lower the Peierls energy barrier for the screw dislocation significantly. The H enhanced dislocation mobility is consistent with experimental observations
Aspergillus niger contains the cryptic phylogenetic species A. awamori.
Perrone, Giancarlo; Stea, Gaetano; Epifani, Filomena; Varga, János; Frisvad, Jens C; Samson, Robert A
2011-11-01
Aspergillus section Nigri is an important group of species for food and medical mycology, and biotechnology. The Aspergillus niger 'aggregate' represents its most complicated taxonomic subgroup containing eight morphologically indistinguishable taxa: A. niger, Aspergillus tubingensis, Aspergillus acidus, Aspergillus brasiliensis, Aspergillus costaricaensis, Aspergillus lacticoffeatus, Aspergillus piperis, and Aspergillus vadensis. Aspergillus awamori, first described by Nakazawa, has been compared taxonomically with other black aspergilli and recently it has been treated as a synonym of A. niger. Phylogenetic analyses of sequences generated from portions of three genes coding for the proteins β-tubulin (benA), calmodulin (CaM), and the translation elongation factor-1 alpha (TEF-1α) of a population of A. niger strains isolated from grapes in Europe revealed the presence of a cryptic phylogenetic species within this population, A. awamori. Morphological, physiological, ecological and chemical data overlap occurred between A. niger and the cryptic A. awamori, however the splitting of these two species was also supported by AFLP analysis of the full genome. Isolates in both phylospecies can produce the mycotoxins ochratoxin A and fumonisin B₂, and they also share the production of pyranonigrin A, tensidol B, funalenone, malformins, and naphtho-γ-pyrones. In addition, sequence analysis of four putative A. awamori strains from Japan, used in the koji industrial fermentation, revealed that none of these strains belong to the A. awamori phylospecies. Copyright © 2011 British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Neglijenţa în serviciu (art.329 CP RM: delimitarea de unele fapte penale similare (II
Directory of Open Access Journals (Sweden)
Popenco Adrian
2017-10-01
Full Text Available In the present study are highlighted lines between negligent performance of duties and violation by negligence of medical assistance rule and methods. In determining whether perpetrated by a doctor or another health worker falls under art. 213 or 329 PC RM, must identified the type of obligations ignored by the offender while implementing its activity: professional or service. It concludes that the rules of art. 213 and 329 PC RM isn’t in conflict, because the subject of an offense under 213 PC RM ignores the rules of medical assistance in the execution of his professional obligations while the subject of offenses provided in art. 329 PC RM commits offence in the performance of his duties, not those professional.
DEFF Research Database (Denmark)
Visagie, Cobus M.; Yilmaz, Neriman; Renaud, Justin B.
2017-01-01
of 1039 strains; 296 strains belong to Aspergillus and represented 37 species. Reference sequences were generated for all species and deposited in GenBank. Aspergillus sect. Aspergillus (formerly called Eurotium) was one of the most predominant groups from house dust with nine species identified...
Jolink, H.
2017-01-01
The T-cell mediated immune response to Aspergillus fumigatus was studied in healthy individuals and in several patient groups. In peripheral blood of healthy individuals low frequencies of Aspergillus-specific CD4+ T-cells with a Thelper 1 profile were present. In patients with invasive
Ivanova, Christa; Ramoni, Jonas; Aouam, Thiziri; Frischmann, Alexa; Seiboth, Bernhard; Baker, Scott E; Le Crom, Stéphane; Lemoine, Sophie; Margeot, Antoine; Bidard, Frédérique
2017-01-01
The hydrolysis of biomass to simple sugars used for the production of biofuels in biorefineries requires the action of cellulolytic enzyme mixtures. During the last 50 years, the ascomycete Trichoderma reesei , the main source of industrial cellulase and hemicellulase cocktails, has been subjected to several rounds of classical mutagenesis with the aim to obtain higher production levels. During these random genetic events, strains unable to produce cellulases were generated. Here, whole genome sequencing and transcriptomic analyses of the cellulase-negative strain QM9978 were used for the identification of mutations underlying this cellulase-negative phenotype. Sequence comparison of the cellulase-negative strain QM9978 to the reference strain QM6a identified a total of 43 mutations, of which 33 were located either close to or in coding regions. From those, we identified 23 single-nucleotide variants, nine InDels, and one translocation. The translocation occurred between chromosomes V and VII, is located upstream of the putative transcription factor vib1 , and abolishes its expression in QM9978 as detected during the transcriptomic analyses. Ectopic expression of vib1 under the control of its native promoter as well as overexpression of vib1 under the control of a strong constitutive promoter restored cellulase expression in QM9978, thus confirming that the translocation event is the reason for the cellulase-negative phenotype. Gene deletion of vib1 in the moderate producer strain QM9414 and in the high producer strain Rut-C30 reduced cellulase expression in both cases. Overexpression of vib1 in QM9414 and Rut-C30 had no effect on cellulase production, most likely because vib1 is already expressed at an optimal level under normal conditions. We were able to establish a link between a chromosomal translocation in QM9978 and the cellulase-negative phenotype of the strain. We identified the transcription factor vib1 as a key regulator of cellulases in T. reesei whose
Aspergillus tracheobronchitis in a mild immunocompromised host.
Cho, Byung Ha; Oh, Youngmin; Kang, Eun Seok; Hong, Yong Joo; Jeong, Hye Won; Lee, Ok-Jun; Chang, You-Jin; Choe, Kang Hyeon; Lee, Ki Man; An, Jin-Young
2014-11-01
Aspergillus tracheobronchitis is a form of invasive pulmonary aspergillosis in which the Aspergillus infection is limited predominantly to the tracheobronchial tree. It occurs primarily in severely immunocompromised patients such as lung transplant recipients. Here, we report a case of Aspergillus tracheobronchitis in a 42-year-old man with diabetes mellitus, who presented with intractable cough, lack of expectoration of sputum, and chest discomfort. The patient did not respond to conventional treatment with antibiotics and antitussive agents, and he underwent bronchoscopy that showed multiple, discrete, gelatinous whitish plaques mainly involving the trachea and the left bronchus. On the basis of the bronchoscopic and microbiologic findings, we made the diagnosis of Aspergillus tracheobronchitis and initiated antifungal therapy. He showed gradual improvement in his symptoms and continued taking oral itraconazole for 6 months. Physicians should consider Aspergillus tracheobronchitis as a probable diagnosis in immunocompromised patients presenting with atypical respiratory symptoms and should try to establish a prompt diagnosis.
Verwer, P E B; van Leeuwen, W B; Girard, V; Monnin, V; van Belkum, A; Staab, J F; Verbrugh, H A; Bakker-Woudenberg, I A J M; van de Sande, W W J
2014-02-01
In 2005, a new sibling species of Aspergillus fumigatus was discovered: Aspergillus lentulus. Both species can cause invasive fungal disease in immune-compromised patients. The species are morphologically very similar. Current techniques for identification are PCR-based or morphology-based. These techniques are labour-intense and not sufficiently discriminatory. Since A. lentulus is less susceptible to several antifungal agents, it is important to correctly identify the causative infectious agent in order to optimize antifungal therapy. In this study we determined whether Raman spectroscopy and/or MALDI-TOF MS were able to differentiate between A. lentulus and A. fumigatus. For 16 isolates of A. lentulus and 16 isolates of A. fumigatus, Raman spectra and peptide profiles were obtained using the Spectracell and MALDI-TOF MS (VITEK MS RUO, bioMérieux) respectively. In order to obtain reliable Raman spectra for A. fumigatus and A. lentulus, the culture medium needed to be adjusted to obtain colourless conidia. Only Raman spectra obtained from colourless conidia were reproducible and correctly identified 25 out of 32 (78 %) of the Aspergillus strains. For VITEK MS RUO, no medium adjustments were necessary. Pigmented conidia resulted in reproducible peptide profiles as well in this case. VITEK MS RUO correctly identified 100 % of the Aspergillus isolates, within a timeframe of approximately 54 h including culture. Of the two techniques studied here, VITEK MS RUO was superior to Raman spectroscopy in the discrimination of A. lentulus from A. fumigatus. VITEK MS RUO seems to be a successful technique in the daily identification of Aspergillus spp. within a limited timeframe.
Directory of Open Access Journals (Sweden)
Melissa Orzechowski Xavier
2013-06-01
Full Text Available Here we investigate the extent to which different Aspergillus species release galactomannan (GM in vitro. Marked variability was observed in GM reactivity between and within Aspergillus species, with A. terreus strains showing the highest GM indexes. The in vivo significance of these findings remains to be determined.O estudo objetivou investigar a liberação in vitro de galactomanana (GM em distintas espécies patogênicas de fungos do gênero Aspergillus. Grande variabilidade foi detectada tanto intra quanto inter espécies, sendo as cepas da espécie A. terreus relacionadas aos maiores índices de GM detectados. O significado in vivo destes achados permanece em aberto, porém merece investigação.
Hemdan, R. Elmitwalli; Fatma, Helmi M.; Rizk, Mohammed A.; Hagrassy, Abeer F.
Biodeterioration of mural paintings by Aspergillus niger and Aspergillus flavus Fungi has been proved in different mural paintings in Egypt nowadays. Several researches have studied the effect of fungi on mural paintings, the mechanism of interaction and methods of control. But none of these researches gives us the solution without causing a side effect. In this paper, for the first time, a recent treatment by antibiotic "6 penthyl α pyrone phenol" was applied as a successful technique for elimination of Aspergillus niger and Aspergillus flavus. On the other hand, it is favorable for cleaning Surfaces of Murals executed by tembera technique from the fungi metabolism which caused a black pigments on surfaces.
International Nuclear Information System (INIS)
2015-01-01
This document provides a set of common positions for harmonizing inspection criteria called 'Common QA/QM Criteria' which will be used in Multinational Vendor Inspections. This document was prepared by the Vendor Inspection Co-operation Working Group (VICWG) of the Multinational Design Evaluation Program (MDEP). The 'Common QA/QM Criteria' provides the basic areas for consideration when performing Vendor Inspections. The criteria have been developed in conformity with International Codes and Standards such as IAEA, ISO, etc. that MDEP member countries have adopted
Causative Agents of Aspergillosis Including Cryptic Aspergillus Species and A. fumigatus.
Toyotome, Takahito
2016-01-01
Aspergillosis is an important deep mycosis. The causative agents are Aspergillus fumigatus, Aspergillus flavus, Aspergillus niger, and Aspergillus terreus, of which A. fumigatus is the most prevalent. Cryptic Aspergillus spp., which morphologically resemble representative species of each Aspergillus section, also cause aspergillosis. Most of the cryptic species reveal different susceptibility patterns and/or different secondary metabolite profiles, also called exometabolome in this manuscript, from those representative species. On the other hand, azole-resistant A. fumigatus strains in clinical specimens and in the environment have been reported. Therefore, it is imperative to precisely identify the species, including cryptic Aspergillus spp., and evaluate the susceptibility of isolates.In this manuscript, some of the causative cryptic Aspergillus spp. are briefly reviewed. In addition, the exometabolome of Aspergillus section Fumigati is described. Finally, azole resistance of A. fumigatus is also discussed, in reference to several studies from Japan.
Allergens/Antigens, toxins and polyketides of important Aspergillus species.
Bhetariya, Preetida J; Madan, Taruna; Basir, Seemi Farhat; Varma, Anupam; Usha, Sarma P
2011-04-01
The medical, agricultural and biotechnological importance of the primitive eukaryotic microorganisms, the Fungi was recognized way back in 1920. Among various groups of fungi, the Aspergillus species are studied in great detail using advances in genomics and proteomics to unravel biological and molecular mechanisms in these fungi. Aspergillus fumigatus, Aspergillus flavus, Aspergillus niger, Aspergillus parasiticus, Aspergillus nidulans and Aspergillus terreus are some of the important species relevant to human, agricultural and biotechnological applications. The potential of Aspergillus species to produce highly diversified complex biomolecules such as multifunctional proteins (allergens, antigens, enzymes) and polyketides is fascinating and demands greater insight into the understanding of these fungal species for application to human health. Recently a regulator gene for secondary metabolites, LaeA has been identified. Gene mining based on LaeA has facilitated new metabolites with antimicrobial activity such as emericellamides and antitumor activity such as terrequinone A from A. nidulans. Immunoproteomic approach was reported for identification of few novel allergens for A. fumigatus. In this context, the review is focused on recent developments in allergens, antigens, structural and functional diversity of the polyketide synthases that produce polyketides of pharmaceutical and biological importance. Possible antifungal drug targets for development of effective antifungal drugs and new strategies for development of molecular diagnostics are considered.
Biomarkers of Aspergillus spores
Sulc, Miroslav; Peslova, Katerina; Zabka, Martin; Hajduch, Marian; Havlicek, Vladimir
2009-02-01
We applied both matrix-assisted laser desorption/ionization time of flight (MALDI-TOF) mass spectrometric and 1D sodium dodecylsulfate polyacrylamide gel electrophoretic (1D-PAGE) approaches for direct analysis of intact fungal spores of twenty four Aspergillus species. In parallel, we optimized various protocols for protein extraction from Aspergillus spores using acidic conditions, step organic gradient and variable sonication treatment. The MALDI-TOF mass spectra obtained from optimally prepared samples provided a reproducible fingerprint demonstrating the capability of the MALDI-TOF approach to type and characterize different fungal strains within the Aspergillus genus. Mass spectra of intact fungal spores provided signals mostly below 20 kDa. The minimum material amount represented 0.3 [mu]g (10,000 spores). Proteins with higher molecular weight were detected by 1D-PAGEE Eleven proteins were identified from three selected strains in the range 5-25 kDa by the proteomic approach. Hemolysin and hydrophobin have the highest relevance in host-pathogen interactions.
Tisch, Doris; Pomraning, Kyle R; Collett, James R; Freitag, Michael; Baker, Scott E; Chen, Chia-Ling; Hsu, Paul Wei-Che; Chuang, Yu Chien; Schuster, Andre; Dattenböck, Christoph; Stappler, Eva; Sulyok, Michael; Böhmdorfer, Stefan; Oberlerchner, Josua; Wang, Ting-Fang; Schmoll, Monika
2017-11-15
The filamentous fungus Trichoderma reesei is found predominantly in the tropics but also in more temperate regions, such as Europe, and is widely known as a producer of large amounts of plant cell wall-degrading enzymes. We sequenced the genome of the sexually competent isolate CBS999.97, which is phenotypically different from the female sterile strain QM6a but can cross sexually with QM6a. Transcriptome data for growth on cellulose showed that entire carbohydrate-active enzyme (CAZyme) families are consistently differentially regulated between these strains. We evaluated backcrossed strains of both mating types, which acquired female fertility from CBS999.97 but maintained a mostly QM6a genetic background, and we could thereby distinguish between the effects of strain background and female fertility or mating type. We found clear regulatory differences associated with female fertility and female sterility, including regulation of CAZyme and transporter genes. Analysis of carbon source utilization, transcriptomes, and secondary metabolites in these strains revealed that only a few changes in gene regulation are consistently correlated with different mating types. Different strain backgrounds (QM6a versus CBS999.97) resulted in the most significant alterations in the transcriptomes and in carbon source utilization, with decreased growth of CBS999.97 on several amino acids (for example proline or alanine), which further correlated with the downregulation of genes involved in the respective pathways. In combination, our findings support a role of fertility-associated processes in physiology and gene regulation and are of high relevance for the use of sexual crossing in combining the characteristics of two compatible strains or quantitative trait locus (QTL) analysis. IMPORTANCE Trichoderma reesei is a filamentous fungus with a high potential for secretion of plant cell wall-degrading enzymes. We sequenced the genome of the fully fertile field isolate CBS999.97 and
Two novel aflatoxin-producing Aspergillus species from Argentinean peanuts
DEFF Research Database (Denmark)
Pildain, M.B.; Frisvad, Jens Christian; Vaamonde, G.
2008-01-01
Two novel species from Aspergillus section Flavi from different species of Arachis (peanuts) in Argentina are described as Aspergillus arachidicola sp. nov. and Aspergillus minisclerotigenes sp. nov. Their novel taxonomic status was determined using a polyphasic taxonomic approach with phenotypic...
Phylogeny, identification and nomenclature of the genus Aspergillus
DEFF Research Database (Denmark)
Samson, R.A.; Visagie, C.M.; Houbraken, J.
2014-01-01
, meaning that a decision had to be made whether to keep Aspergillus as one big genus or to split it into several smaller genera. The International Commission of Penicillium and Aspergillus decided to keep Aspergillus instead of using smaller genera. In this paper, we present the arguments for this decision...... data suggest that together with genera such as Polypaecilum, Phialosimplex, Dichotomomyces and Cristaspora, Aspergillus forms a monophyletic clade closely related to Penicillium. Changes in the International Code of Nomenclature for algae, fungi and plants resulted in the move to one name per species....... We introduce new combinations for accepted species presently lacking an Aspergillus name and provide an updated accepted species list for the genus, now containing 339 species. To add to the scientific value of the list, we include information about living ex-type culture collection numbers and Gen...
49 CFR 214.329 - Train approach warning provided by watchmen/lookouts.
2010-10-01
... Protection § 214.329 Train approach warning provided by watchmen/lookouts. Roadway workers in a roadway work group who foul any track outside of working limits shall be given warning of approaching trains by one... shall clearly signify to all recipients of the warning that a train or other on-track equipment is...
Characterization of Aspergillus species associated with ...
African Journals Online (AJOL)
About 82 triphala powder samples were analyzed for the association of different fungi. Results reveal the predominance of Aspergillus as the major genera with six predominant species namely, A. niger, A. flavus, A. fumigatus, A. terreus, A. nidulans and A. amstelodami. Therefore, these six isolated Aspergillus species were ...
A QM/MM–Based Computational Investigation on the Catalytic Mechanism of Saccharopine Reductase
Almasi, Joel N.; Bushnell, Eric A.C.; Gauld, James W.
2011-01-01
Saccharopine reductase from Magnaporthe grisea, an NADPH-containing enzyme in the α-aminoadipate pathway, catalyses the formation of saccharopine, a precursor to L-lysine, from the substrates glutamate and α-aminoadipate-δ-semialdehyde. Its catalytic mechanism has been investigated using quantum mechanics/molecular mechanics (QM/MM) ONIOM-based approaches. In particular, the overall catalytic pathway has been elucidated and the effects of electron correlation and the anisotropic polar protein...
Czech Academy of Sciences Publication Activity Database
Hubka, Vít; Lysková, P.; Frisvad, J.C.; Peterson, S.W.; Skořepová, M.; Kolařík, Miroslav
2014-01-01
Roč. 52, č. 6 (2014), s. 565-576 ISSN 1369-3786 R&D Projects: GA MŠk(CZ) EE2.3.20.0055; GA MŠk(CZ) EE2.3.30.0003 Institutional support: RVO:61388971 Keywords : Aspergillus candidus * Aspergillus tritici * antifungal susceptibility testing Subject RIV: EE - Microbiology, Virology Impact factor: 2.335, year: 2014
Molecular epidemiology of Aspergillus collected from cystic fibrosis patients.
Sabino, Raquel; Ferreira, Jose A G; Moss, Richard B; Valente, Joana; Veríssimo, Cristina; Carolino, Elisabete; Clemons, Karl V; Everson, Cassie; Banaei, Niaz; Penner, John; Stevens, David A
2015-07-01
Aspergillus respiratory infection is a common complication in cystic fibrosis (CF) and is associated with loss of pulmonary function and allergic disease. Fifty-three Aspergillus isolates recovered from CF patients were identified to species by Internal Transcribed Spacer Region (ITS), β-tubulin, and calmodulin sequencing. Three species complexes (Terrei, Nigri, and Fumigati) were found. Identification to species level gave a single Aspergillus terreus sensu stricto, one Aspergillus niger sensu stricto and 51 Aspergillus fumigatus sensu stricto isolates. No cryptic species were found. To our knowledge, this is the first prospective study of Aspergillus species in CF using molecular methods. The paucity of non-A. fumigatus and of cryptic species of A. fumigatus suggests a special association of A. fumigatus sensu stricto with CF airways, indicating it likely displays unique characteristics making it suitable for chronic residence in that milieu. These findings could refine an epidemiologic and therapeutic approach geared to this pathogen. Copyright © 2014 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.
Ghasemi, Saba; Habibi, Zohreh; Mohajeri, Maryam; Yousefi, Maryam
2018-02-22
The microbial transformations of peucedanin and oreoselon by the fungi Aspergillus niger and Aspergillus sp. were investigated for the first time. Incubation of peucedanin with A. niger yielded a new hydroxylated metabolite with high yield (56%), which was characterized as 2-(1-hydroxypropan-2-yl)-3-methoxy-7H-furo[3,2-g]chromen-7-one. Oreoselon was converted to a new reduced metabolite methyl 3-(2,3-dihydro-6-hydroxy-2-isopropyl-3-oxobenzofuran-5-yl)propanoate in biotransformation by Aspergillus sp. The structures of the metabolites were determined by spectroscopic methods including IR, EI-MS, 1 H NMR, 13 C NMR, and elemental analysis.
[Aspergillus species in hospital environments with pediatric patients in critical condition].
Fernández, Mariana; Cattana, María; Rojas, Florencia; Sosa, María de Los Ángeles; Aguirre, Clarisa; Vergara, Marta; Giusiano, Gustavo
2014-01-01
Aspergillus is a group of opportunistic fungi that cause infections, with high morbimortality in immunosuppressed patients. Aspergillus fumigatus is the most frequent species in these infections, although the incidence of other species has increased in the last few years. To evaluate the air fungal load and the diversity of Aspergillus species in hospitals with pediatric patients in critical condition. The Intensive Care Unit and Burns Unit of a pediatric hospital were sampled every 15 days during the autumn and spring seasons. The air samples were collected with SAS Super 100(®) and the surface samples were collected by swab method. The UFC/m(3) counts found exceeded the acceptable levels. The UFC/m(3) and the diversity of Aspergillus species found in the Intensive Care Unit were higher than those found in the Burns Unit. The fungal load and the diversity of species within the units were higher than those in control environments. The use of both methods -SAS and swab- allowed the detection of a higher diversity of species, with 96 strains of Aspergillus being isolated and 12 species identified. The outstanding findings were Aspergillus sydowii, Aspergillus niger, Aspergillus flavus, Aspergillus terreus and Aspergillus parasiticus, due to their high frequency. Aspergillus fumigatus, considered unacceptable in indoor environments, was isolated in both units. Aspergillus was present with high frequency in these units. Several species are of interest in public health for being potential pathogenic agents. Air control and monitoring are essential in the prevention of these infections. Copyright © 2013 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.
DEFF Research Database (Denmark)
Pedersen, Mads; Lauritzen, Henrik Klitgaard; Frisvad, Jens Christian
2007-01-01
Twenty Aspergillus strains were evaluated for production of extracellular cellulolytic and xylanolytic activities. Aspergillus brasiliensis, A. niger and A. japonicus produced the highest xylanase activities with the A. brasiliensis and A. niger strains producing thermostable beta......-xylosidases. The beta-xylosidase activities of the A. brasiliensis and A. niger strains had similar temperature and pH optima at 75 degrees C and pH 5 and retained 62% and 99%, respectively, of these activities over 1 h at 60 degrees C. At 75 degrees C, these values were 38 and 44%, respectively. Whereas A. niger...
Genomic Diversity in the Genus of Aspergillus
DEFF Research Database (Denmark)
Rasmussen, Jane Lind Nybo
, sections and genus of Aspergillus. The work uncovers a large genomic diversity across all studied groups of species. The genomic diversity was especially evident on the section level, where the proteins shared by all species only represents ⇠55% of the proteome. This number decreases even further, to 38......, sections Nigri, Usti and Cavericolus, clade Tubingensis, and species A. niger. It lastly uses these results to predict genetic traits that take part in fungal speciation. Within a few years the Aspergillus whole-genus sequencing project will have published all currently-accepted Aspergillus genomes......Aspergillus is a highly important genus of saprotrophic filamentous fungi. It is a very diverse genus that is inextricably intertwined with human a↵airs on a daily basis, holding species relevant to plant and human pathology, enzyme and bulk chemistry production, food and beverage biotechnology...
Tvaroška, Igor
2015-02-11
Glycosyltransferases catalyze the formation of glycosidic bonds by assisting the transfer of a sugar residue from donors to specific acceptor molecules. Although structural and kinetic data have provided insight into mechanistic strategies employed by these enzymes, molecular modeling studies are essential for the understanding of glycosyltransferase catalyzed reactions at the atomistic level. For such modeling, combined quantum mechanics/molecular mechanics (QM/MM) methods have emerged as crucial. These methods allow the modeling of enzymatic reactions by using quantum mechanical methods for the calculation of the electronic structure of the active site models and treating the remaining enzyme environment by faster molecular mechanics methods. Herein, the application of QM/MM methods to glycosyltransferase catalyzed reactions is reviewed, and the insight from modeling of glycosyl transfer into the mechanisms and transition states structures of both inverting and retaining glycosyltransferases are discussed. Copyright © 2014 Elsevier Ltd. All rights reserved.
PREFACE: EmQM13: Emergent Quantum Mechanics 2013
2014-04-01
These proceedings comprise the invited lectures of the second international symposium on Emergent Quantum Mechanics (EmQM13), which was held at the premises of the Austrian Academy of Sciences in Vienna, Austria, 3-6 October 2013. The symposium was held at the ''Theatersaal'' of the Academy of Sciences, and was devoted to the open exploration of emergent quantum mechanics, a possible ''deeper level theory'' that interconnects three fields of knowledge: emergence, the quantum, and information. Could there appear a revised image of physical reality from recognizing new links between emergence, the quantum, and information? Could a novel synthesis pave the way towards a 21st century, ''superclassical'' physics? The symposium provided a forum for discussing (i) important obstacles which need to be overcome as well as (ii) promising developments and research opportunities on the way towards emergent quantum mechanics. Contributions were invited that presented current advances in both standard as well as unconventional approaches to quantum mechanics. The EmQM13 symposium was co-organized by Gerhard Grössing (Austrian Institute for Nonlinear Studies (AINS), Vienna), and by Jan Walleczek (Fetzer Franklin Fund, USA, and Phenoscience Laboratories, Berlin). After a very successful first conference on the same topic in 2011, the new partnership between AINS and the Fetzer Franklin Fund in producing the EmQM13 symposium was able to further expand interest in the promise of emergent quantum mechanics. The symposium consisted of two parts, an opening evening addressing the general public, and the scientific program of the conference proper. The opening evening took place at the Great Ceremonial Hall (Grosser Festsaal) of the Austrian Academy of Sciences, and it presented talks and a panel discussion on ''The Future of Quantum Mechanics'' with three distinguished speakers: Stephen Adler (Princeton), Gerard 't Hooft (Utrecht) and Masanao Ozawa (Nagoya). The articles contained in
DEFF Research Database (Denmark)
Dohn, A. O.; Jónsson, E. Ö.; Levi, Gianluca
2017-01-01
A multiscale density functional theory-quantum mechanics/molecular mechanics (DFT-QM/MM) scheme is presented, based on an efficient electrostatic coupling between the electronic density obtained from a grid-based projector augmented wave (GPAW) implementation of density functional theory...... and a classical potential energy function. The scheme is implemented in a general fashion and can be used with various choices for the descriptions of the QM or MM regions. Tests on H2O clusters, ranging from dimer to decamer show that no systematic energy errors are introduced by the coupling that exceeds...
Kniemeyer, Olaf
2011-08-01
Fungal species of the genus Aspergillus play significant roles as model organisms in basic research, as "cell factories" for the production of organic acids, pharmaceuticals or industrially important enzymes and as pathogens causing superficial and invasive infections in animals and humans. The release of the genome sequences of several Aspergillus sp. has paved the way for global analyses of protein expression in Aspergilli including the characterisation of proteins, which have not designated any function. With the application of proteomic methods, particularly 2-D gel and LC-MS/MS-based methods, first insights into the composition of the proteome of Aspergilli under different growth and stress conditions could be gained. Putative targets of global regulators led to the improvement of industrially relevant Aspergillus strains and so far not described Aspergillus antigens have already been discovered. Here, I review the recent proteome data generated for the species Aspergillus nidulans, Aspergillus fumigatus, Aspergillus niger, Aspergillus terreus, Aspergillus flavus and Aspergillus oryzae. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Final report on AFRIMETS.QM-K27: Determination of ethanol in aqueous matrix
Archer, Marcellé; Fernandes-Whaley, Maria; Visser, Ria; de Vos, Jayne; Prins, Sara; Rosso, Adriana; Ruiz de Arechavaleta, Mariana; Tahoun, Ibrahim; Kakoulides, Elias; Luvonga, Caleb; Muriira, Geoffrey; Naujalis, Evaldas; Zakaria, Osman Bin; Buzoianu, Mirella; Bebic, Jelena; Achour Mounir, Ben; Thanh, Ngo Huy
2013-01-01
From within AFRIMETS, the Regional Metrology Organization (RMO) for Africa, the RMO Key Comparison AFRIMETS.QM-K27 was coordinated by the National Metrology Institute of South Africa (NMISA) in 2011. Ten Metrology Institutes participated, comprising three AFRIMETS, two APMP, four EURAMET and one SIM participant. Participants were required to determine the forensic level concentration of two aqueous ethanol solutions that were gravimetrically prepared by the NMISA. Concentrations were expected to lie in the range of 0.1 mg/g to 5.0 mg/g. The accurate determination of ethanol content in aqueous medium is critical for regulatory forensic and trade purposes. The CCQM Organic Analysis Working Group has carried out several key comparisons (CCQM-K27 series) on the determination of ethanol in wine and aqueous matrices. Developing NMIs now had the opportunity to link to the earlier CCQM-K27 studies through the AFRIMETS.QM-K27 study. Gas chromatography coupled to flame ionisation or mass spectrometric detection was applied by eight of the participants, while three participants (including NMISA) applied titrimetry for the ethanol assay. The assigned reference value of the aqueous ethanol solutions was used to link AFRIMETS.QM-K27 to the CCQM-K27 key comparison reference value. The assigned reference values for AFRIMETS.QM-K27 Level 1 and Level 2 were (0.3249 ± 0.0021) mg/g (k = 2) and (4.6649 ± 0.0152) mg/g (k = 2), respectively. The reference values were determined using the purity-corrected gravimetric preparation values, while the standard uncertainty incorporated the gravimetric preparation and titrimetric homogeneity uncertainties. From previous CCQM-K27 studies, the expected spread (%CV) of higher order measurements of ethanol in aqueous medium is about 0.85% relative. In this study the CV for Level 1 is about 12% (10% with two outliers removed) and for Level 2 about 4%. Three of the ten laboratories submitted results within 1.5% of the gravimetric reference value for
21 CFR 866.3040 - Aspergillus spp. serological reagents.
2010-04-01
... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3040 Aspergillus... consist of antigens and antisera used in various serological tests to identify antibodies to Aspergillus...
International Nuclear Information System (INIS)
Rossi-Zalaf, Luciana S.; Alves, Sergio B.; Vieira, Solange A.
2008-01-01
The virulence of Hirsutella thompsonii (Fischer) to Brevipalpus phoenicis (Geijskes) was evaluated in laboratory, grown on complete and solid culture media (MC-S); complete and liquid culture media (MC-L); rice (APC) and powdered rice (APC-SM). Adults were confined to arenas prepared with citrus leaves in acrylic dishes containing water-agar. Conidial suspensions were prepared at different concentration (3.2 x 10 5 to 1 x 10 7 spores/ml) and applied on mites to establish the table curve-response on fourth day. For field evaluation, adults were maintained in arenas prepared with fruits which were placed in plants. In this test, four treatments were tried: H. thompsonii cultured on rice (APC) at two concentrations (20 kg/ha and 10 kg/ha), H. thompsonii produced by liquid fermentation (MC-L) (5 L/ha) and control (sterile water). Adult survival, number of eggs and nymphs per fruit were observed 10 and 20 days after the fungus application. The lowest LC 25 value calculated was from pathogen produced in MC-S (1.9 x 10 5 conidia/ml).The LC 25 values calculated to APC and APC-SM did not differ statistically. The LC 25 values to MC-L and MC-S were 1.9 x 10 6 infective cells/ml and 2.2 x 10 5 conidia/ml. In the fi eld, concentration and time to death differed between treatments and control. The applications resulted in reduction of adult survival and number of eggs. (author)
Heterologous expression of Gaeumannomyces graminis lipoxygenase in Aspergillus nidulans.
Heshof, Ruud; van Schayck, J Paul; Tamayo-Ramos, Juan Antonio; de Graaff, Leo H
2014-01-01
Aspergillus sp. contain ppo genes coding for Ppo enzymes that produce oxylipins from polyunsaturated fatty acids. These oxylipins function as signal molecules in sporulation and influence the asexual to sexual ratio of Aspergillus sp. Fungi like Aspergillus nidulans and Aspergillus niger contain just ppo genes where the human pathogenic Aspergillus flavus and Aspergillus fumigatus contain ppo genes as well as lipoxygenases. Lipoxygenases catalyze the synthesis of oxylipins and are hypothesized to be involved in quorum-sensing abilities and invading plant tissue. In this study we used A. nidulans WG505 as an expression host to heterologously express Gaeumannomyces graminis lipoxygenase. The presence of the recombinant LOX induced phenotypic changes in A. nidulans transformants. Also, a proteomic analysis of an A. nidulans LOX producing strain indicated that the heterologous protein was degraded before its glycosylation in the secretory pathway. We observed that the presence of LOX induced the specific production of aminopeptidase Y that possibly degrades the G. graminis lipoxygenase intercellularly. Also the presence of the protein thioredoxin reductase suggests that the G. graminis lipoxygenase is actively repressed in A. nidulans.
Aspergillus is monophyletic: Evidence from multiple gene phylogenies and extrolites profiles
Directory of Open Access Journals (Sweden)
S. Kocsubé
2016-09-01
Full Text Available Aspergillus is one of the economically most important fungal genera. Recently, the ICN adopted the single name nomenclature which has forced mycologists to choose one name for fungi (e.g. Aspergillus, Fusarium, Penicillium, etc.. Previously two proposals for the single name nomenclature in Aspergillus were presented: one attributes the name “Aspergillus” to clades comprising seven different teleomorphic names, by supporting the monophyly of this genus; the other proposes that Aspergillus is a non-monophyletic genus, by preserving the Aspergillus name only to species belonging to subgenus Circumdati and maintaining the sexual names in the other clades. The aim of our study was to test the monophyly of Aspergilli by two independent phylogenetic analyses using a multilocus phylogenetic approach. One test was run on the publicly available coding regions of six genes (RPB1, RPB2, Tsr1, Cct8, BenA, CaM, using 96 species of Penicillium, Aspergillus and related taxa. Bayesian (MrBayes and Ultrafast Maximum Likelihood (IQ-Tree and Rapid Maximum Likelihood (RaxML analyses gave the same conclusion highly supporting the monophyly of Aspergillus. The other analyses were also performed by using publicly available data of the coding sequences of nine loci (18S rRNA, 5,8S rRNA, 28S rRNA (D1-D2, RPB1, RPB2, CaM, BenA, Tsr1, Cct8 of 204 different species. Both Bayesian (MrBayes and Maximum Likelihood (RAxML trees obtained by this second round of independent analyses strongly supported the monophyly of the genus Aspergillus. The stability test also confirmed the robustness of the results obtained. In conclusion, statistical analyses have rejected the hypothesis that the Aspergilli are non-monophyletic, and provided robust arguments that the genus is monophyletic and clearly separated from the monophyletic genus Penicillium. There is no phylogenetic evidence to split Aspergillus into several genera and the name Aspergillus can be used for all the species
Directory of Open Access Journals (Sweden)
Ozana Maria de Andrade Maia
2005-01-01
Full Text Available O ácaro Brevipalpus phoenicis (Geijskes é transmissor do vírus da leprose dos citros, doença responsável por significativa redução da produtividade. Objetivou-se avaliar neste trabalho a possibilidade de algumas plantas utilizadas como cercas-vivas e quebra-ventos, além de plantas daninhas de pomares cítricos serem hospedeiras do vírus da leprose. O experimento foi realizado em laboratório e casa-de-vegetação na FCAV/UNESP, Jaboticabal-SP-Brasil. De uma criação-estoque de ácaros, criados sobre frutos de citros (Citrus sinensis contendo lesões de leprose, foram transferidos 100 ácaros para uma unidade experimental das seguintes espécies: Hibiscus sp., Malvaviscus mollis, Grevillea robusta, Mimosa caesalpiniaefolia, Bixa orellana, Commelina benghalensis, Sida cordifolia, Ageratum conyzoides e Citrus sinensis, e mantidas em casa de vegetação por um período de 90 dias. Depois desse período, 160 ácaros foram recuperados dessas espécies vegetais e transferidos para quatro mudas das variedades cítricas 'Natal' e 'Valência' (20 ácaros/planta, e foram mantidas por 60 dias em casa de vegetação. Decorrido esse período, quantificou-se o número de lesões de leprose presentes nas folhas, ramos e caules das mudas cítricas. Em mudas cítricas da variedade 'Natal', foram observados sintomas da leprose decorrentes da transferência de ácaros provenientes de C. sinensis, A. conyzoides, C. benghalensis e B. orellana. Na variedade 'Valência', sintomas de leprose ocorreram em mudas infestadas com ácaros criados sobre C. sinensis, S. cordifolia benghalensis, B. orellana e A. conyzoides. Mudas cítricas das variedades 'Natal' e 'Valência' não manifestaram sintomas de leprose com ácaros procedentes de M. mollis, Hibiscus sp., G. robusta e M. caesalpiniaefolia.The mite Brevipalpus phoenicis (Geijskes is a vector of the citrus leprosies virus, a disease that significantly reduces orange production. We examined whether some plant
Aspergillus contaminans is described as a new species from the fingernail of a patient with an infected nail. Phylogenetic analysis of four loci (ITS, calmodulin, beta tubulin and RNA polymerase beta, second largest subunit) showed that this species is most closely related to A. carlsbadensis from A...
Radiological abnormalities associated with Aspergillus colonization in a cystic fibrosis population
International Nuclear Information System (INIS)
McMahon, Michelle A.; Chotirmall, Sanjay Haresh; McCullagh, Brian; Branagan, Peter; McElvaney, N.G.; Logan, P.M.
2012-01-01
Objective: To determine if sputum colonization with Aspergillus species in patients with cystic fibrosis (PWCF) correlates with radiological abnormalities and/or a reduction in pulmonary function (FEV1). Methods: We prospectively evaluated 32 PWCF utilizing high resolution computed tomography (HRCT) of the thorax and pulmonary function testing (PFT). The cohort was assessed as two groups: Aspergillus positive (n = 16) and Aspergillus negative (n = 16) based on sputum culture for Aspergillus species. A modified Bhalla scoring system was applied to each HRCT scan by two blinded radiologists. Results: Aspergillus positive patients had more severe and significant bronchiectasis compared to those Aspergillus negative (p < 0.05). This was most marked in the right upper and lower lobes (RUL, RLL). Total Bhalla score was clinically significant in both groups and approached statistical significance between groups (p = 0.063). No difference in pulmonary function between the groups was detected. Conclusion: PWCF colonized by Aspergillus species have greater radiological abnormalities undetectable by PFTs. Early radiological evaluation of Aspergillus colonized PWCF is therefore warranted.
International Nuclear Information System (INIS)
El-Bialy, H.A.; Abd EL-Aziz, A.B.
2009-01-01
Three fungal strains, Aspergillus awamorii A 9 , Aspergillus awamorii A 2 3 and Aspergillus oryzae O 2 , were selected out of ten fungal strains for their activeness in converting pomegranate peel ellagitannins into ellagic acid. When pomegranate peel was fermented by Aspergillus awamorii A 9 , the highest yields of ellagic acid (7.93±0.23 mg/g solid substrate) and total soluble phenolics (14.61±0.36 mg/g solid substrate) were produced at 5 and 10 days of incubation, respectively. Also, blue berry pomace, red grape pomace, strawberry pomace were evaluated as low cost ellagitannin sources for ellagic acid and soluble phenolics production. The antimicrobial activity of soluble phenolics extracted from fermented pomegranate peel and strawberry pomace was tested against two food-borne pathogens (Escherichia coli and Salmonella typhimurium). This study also revealed that 3 kGy enhanced the activity of antimicrobial phenolics
Aspergillus otitis in small animals--a retrospective study of 17 cases.
Goodale, Elizabeth C; Outerbridge, Catherine A; White, Stephen D
2016-02-01
Aspergillus spp. are saprophytic opportunistic fungal organisms and are a common cause of otomycosis in humans. Although there have been case reports of Aspergillus otitis externa in dogs, to the best of the authors' knowledge, this is the first retrospective case series describing Aspergillus otitis in dogs and cats. To characterize signalment, putative risk factors, treatments and outcomes of a case series of dogs and cats with Aspergillus otitis. Eight dogs and nine cats diagnosed with Aspergillus otitis. A retrospective review of medical records from 1989 to 2014 identified animals diagnosed with Aspergillus otitis based on culture. All dogs weighed greater than 23 kg. The most common putative risk factors identified in this study were concurrent diseases, therapy causing immunosuppression or a history of an otic foreign body. Aspergillus otitis was unilateral in all study dogs and most cats. Concurrent otitis media was confirmed in three dogs and one cat, and suspected in two additional cats. Aspergillus fumigatus was the most common isolate overall and was the dominant isolate in cats. Aspergillus niger and A. terreus were more commonly isolated from dogs. Animals received various topical and systemic antifungal medications; however, otic lavage under anaesthesia and/or surgical intervention increased the likelihood of resolution of the fungal infection. Aspergillus otitis is uncommon, typically seen as unilateral otitis externa in cats and larger breed dogs with possible risk factors that include immunosuppression and otic foreign bodies; previous antibiotic usage was common. © 2015 ESVD and ACVD.
Aspergillus niger and A. carbonarius are two species in the Aspergillus section Nigri (black-spored aspergilli) frequently associated with peanut (Arachis hypogea), maize (Zea mays), and other plants as pathogens. These infections are symptomless and as such are major concerns since some black aspe...
Biesebeke, te R.; Boussier, A.; Biezen van, N.; Braaksma, M.; Hondel, van den C.A.M.J.J.; Vos, de W.M.; Punt, P.J.
2006-01-01
DNA fragments coding for hemoglobin domains (HBD) were isolated from Aspergillus oryzae and Aspergillus niger. The HBD activities were expressed in A. oryzae by introduction of HBD gene fragments under the control of the promoter of the constitutively expressed gpdA gene. In the transformants,
Chronological aging in conidia of pathogenic Aspergillus: Comparison between species.
Oliveira, Manuela; Pereira, Clara; Bessa, Cláudia; Araujo, Ricardo; Saraiva, Lucília
2015-11-01
Aspergillus fumigatus, Aspergillus flavus, Aspergillus terreus and Aspergillus niger are common airborne fungi, and the most frequent causative agents of human fungal infections. However, the resistance and lifetime persistence of these fungi in the atmosphere, and the mechanism of aging of Aspergillus conidia are unknown.With this work, we intended to study the processes underlying conidial aging of these four relevant and pathogenic Aspergillus species. Chronological aging was therefore evaluated in A. fumigatus, A. flavus, A. terreus and A. niger conidia exposed to environmental and human body temperatures. The results showed that the aging process in Aspergillus conidia involves apoptosis,with metacaspase activation, DNA fragmentation, and reactive oxygen species production, associated with secondary necrosis. Distinct results were observed for the selected pathogenic species. At environmental conditions, A. niger was the species with the highest resistance to aging, indicating a higher adaption to environmental conditions, whereas A. flavus followed by A. terreus were the most sensitive species. At higher temperatures (37 °C), A. fumigatus presented the longest lifespan, in accordance with its good adaptation to the human body temperature. Altogether,with this work new insights regarding conidia aging are provided, which may be useful when designing treatments for aspergillosis.
АЛЛЕРГЕНЫ ASPERGILLUS NIGER И ASPERGILLUS FUMIGATUS
БАЯЗИТОВА А.А.; ГЛУШКО Н.И.; ЛИСОВСКАЯ С.А.; ХАЛДЕЕВА Е.В.; ПАРШАКОВ В.Р.; ИЛЬИНСКАЯ О.И.
2016-01-01
Риск развития микогенной аллергии, наряду со способностью вызывать микозы и оказывать токсическое действие, является одним из медицински значимых свойств грибов. В обзоре рассмотрены грибы рода Aspergillus, в частности, Aspergillus niger и Aspergillus fumigatus, как одни из важных источников ингаляционных аллергенов. Предоставлена оценка аллергенности Aspergillus niger и Aspergillus fumigatus, также приведена более подробная характеристика наиболее значимых аллергенов....
Assessment of Aspergillus niger biofilm growth kinetics in ...
African Journals Online (AJOL)
Jane
2011-10-12
Oct 12, 2011 ... other hand, A. niger biofilm growth followed a logistic model having higher maximal specific growth rate than ...... Growth estimation of Aspergillus oryzae cultured on ... Initial intracellular proteome profile of Aspergillus niger.
Directory of Open Access Journals (Sweden)
Solano Diego Armando
2008-12-01
Full Text Available
Los cítricos son un renglón importante en la agricultura colombiana ya que generan cerca de cincuenta mil empleos. Brevipalpus phoenicis es catalogado como el principal vector de la leprosis de los cítricos, enfermedad de carácter viral que causa pérdidas de sesenta millones de dólares al año en Brasil. En Colombia la enfermedad se reportó por el ICA para los departamentos de Meta y Casanare. Con el objetivo de determinar la distribución espacial del vector de la leprosis se realizó un muestreo de B. phoenicis semanal durante los meses de febrero a abril del año 2006 (12 muestreos en el tiempo en un cultivo de naranja Valencia en dos estratos del árbol (de 0 a 1,5 m y de 1,5 a 2,5 m de altura. Los datos se analizaron mediante una metodología geoestadística con el software Surfer 8 (Golden Software, 1997-2007 para determinar la distribución espacial del ácaro. Como resultado se obtuvieron 36 variogramas experimentales y 36 mapas de distribución espacial, para el periodo de duración del estudio. El ácaro tuvo un comportamiento inversamente proporcional a la precipitación ya que cuando comenzaron las lluvias su población disminuyó; así mismo el ácaro presentó un desplazamiento desde el estrato más húmedo del árbol hacia el más seco, lo que implica que el comportamiento del ácaro es dependiente tanto de la humedad relativa como de la precipitación. El patrón de distribución del ácaro se ajustó a un modelo lineal y se determinó la tendencia del vector hacia el costado más seco del lote.
Induction of mutation in Trichoderma viride for conversion of natural cellulose into glucose
Energy Technology Data Exchange (ETDEWEB)
Tahoun, M.K.; Khalil, A.I.; Helmi, S.; Khairy, A.H. [Univ. of Alexandria Research Centre, Alexandria (Egypt)
1991-12-31
The production of cellulolytic enzymes from fungi has been extensively studied. Several mutants of Trichoderma reesei were selected. Most of the studies were carried out on T. reesei, T. viride, T. harzianum, Penicillium funiculosum, Altemaria alternata. Aspergillus phoenicis, A. ustus, A. tamarii, A. japonicus, and A. niger. T. koningii is one of the most active producers of the so-called C, factor, which is indispensable for the rapid and extensive attack on crystal-line cellulose. However, Trichodenna is known to excrete only small amounts of {beta}-glucosidase. Therefore, Trichoderma is supplemented with {beta}-glucosidase from Aspergillus to increase the saccharification rate of cellulose to glucose as the main sugar. Induction of mutations in Trichodenna spp. rather than T. viride as a tool for the enhancement of {beta}-glucosidase activity was reported. Unfortunately, T. reesei is a poor producer of {beta}-glucosidase. On the other hand, T. harzianum M{sub 5}, a mutant that was induced by gamma radiation, produced high yields, not only of Avicelase and carboxy methyl cellulose, but also of {beta}-glucosidase, than its respective wild type.
Cyclopiazonic Acid Biosynthesis of Aspergillus flavus and Aspergillus oryzae
Cyclopiazonic acid (CPA) is an indole-tetramic acid neurotoxin produced by some of the same strains of A. flavus that produce aflatoxins and by some Aspergillus oryzae strains. Despite its discovery 40 years ago, few reviews of its toxicity and biosynthesis have been reported. This review examines w...
Extrolites of Aspergillus fumigatus and Other Pathogenic Species in Aspergillus Section Fumigati
Frisvad, Jens C.; Larsen, Thomas O.
2016-01-01
Aspergillus fumigatus is an important opportunistic human pathogen known for its production of a large array of extrolites. Up to 63 species have been described in Aspergillus section Fumigati, some of which have also been reliably reported to be pathogenic, including A. felis, A. fischeri, A. fumigatiaffinis, A. fumisynnematus, A. hiratsukae, A. laciniosus, A. lentulus, A. novofumigatus, A. parafelis, A. pseudofelis, A. pseudoviridinutans, A. spinosus, A. thermomutatus, and A. udagawae. These species share the production of hydrophobins, melanins, and siderophores and ability to grow well at 37°C, but they only share some small molecule extrolites, that could be important factors in pathogenicity. According to the literature gliotoxin and other exometabolites can be contributing factors to pathogenicity, but these exometabolites are apparently not produced by all pathogenic species. It is our hypothesis that species unable to produce some of these metabolites can produce proxy-exometabolites that may serve the same function. We tabulate all exometabolites reported from species in Aspergillus section Fumigati and by comparing the profile of those extrolites, suggest that those producing many different kinds of exometabolites are potential opportunistic pathogens. The exometabolite data also suggest that the profile of exometabolites are highly specific and can be used for identification of these closely related species. PMID:26779142
[Aspergillus fumigatus endocarditis in a patient with a biventricular pacemaker].
Cuesta, José M; Fariñas, María C; Rodilla, Irene G; Salesa, Ricardo; de Berrazueta, José R
2005-05-01
Aspergillus fumigatus endocarditis is one of the rarest and severest complications in cardiological patients. We describe a patient with an intracardial pacemaker who was diagnosed as having Aspergillus fumigatus endocarditis. Postmortem examination showed a large, Aspergillus-infected thrombus encased in the right ventricle, pulmonary trunk and main pulmonary branches.
Plotnikov, Nikolay V; Prasad, B Ram; Chakrabarty, Suman; Chu, Zhen T; Warshel, Arieh
2013-10-24
Understanding the nature of the free-energy surfaces for phosphate hydrolysis is a prerequisite for understanding the corresponding key chemical reactions in biology. Here, the challenge has been to move to careful ab initio QM/MM (QM(ai)/MM) free-energy calculations, where obtaining converging results is very demanding and computationally expensive. This work describes such calculations, focusing on the free-energy surface for the hydrolysis of phosphate monoesters, paying special attention to the comparison between the one water (1W) and two water (2W) paths for the proton-transfer (PT) step. This issue has been explored before by energy minimization with implicit solvent models and by nonsystematic QM/MM energy minimization, as well as by nonsystematic free-energy mapping. However, no study has provided the needed reliable 2D (3D) surfaces that are necessary for reaching concrete conclusions. Here we report a systematic evaluation of the 2D (3D) free-energy maps for several relevant systems, comparing the results of QM(ai)/MM and QM(ai)/implicit solvent surfaces, and provide an advanced description of the relevant energetics. It is found that the 1W path for the hydrolysis of the methyl diphosphate (MDP) trianion is 6-9 kcal/mol higher than that the 2W path. This difference becomes slightly larger in the presence of the Mg(2+) ion because this ion reduces the pKa of the conjugated acid form of the phosphate oxygen that accepts the proton. Interestingly, the BLYP approach (which has been used extensively in some studies) gives a much smaller difference between the 1W and 2W activation barriers. At any rate, it is worth pointing out that the 2W transition state for the PT is not much higher that the common plateau that serves as the starting point of both the 1W and 2W PT paths. Thus, the calculated catalytic effects of proteins based on the 2W PT mechanistic model are not expected to be different from the catalytic effects predicted using the 1W PT mechanistic
Aspergillus Osteomyelitis: Epidemiology, Clinical Manifestations, Management, and Outcome
Gamaletsou, Maria N.; Rammaert, Blandine; Bueno, Marimelle A.; Moriyama, Brad; Sipsas, Nikolaos V.; Kontoyiannis, Dimitrios P.; Roilides, Emmanuel; Zeller, Valerie; Prinapori, Roberta; Tajaldeen, Saad Jaber; Brause, Barry; Lortholary, Olivier; Walsh, Thomas J.
2014-01-01
Background The epidemiology, pathogenesis, diagnosis, and management of Aspergillus osteomyelitis are not well understood. Methods Protocol-defined cases of Aspergillus osteomyelitis published in the English literature were reviewed for comorbidities, microbiology, mechanisms of infection, clinical manifestations, radiological findings, inflammatory biomarkers, antifungal therapy, and outcome. Results Among 180 evaluable patients, 127 (71%) were males. Possible predisposing medical conditions in 103 (57%) included pharmacological immunosuppression, primary immunodeficiency, and neutropenia. Seventy-three others (41%) had prior open fracture, trauma or surgery. Eighty (44%) followed a hematogenous mechanism, 58 (32%) contiguous infections, and 42 (23%) direct inoculation. Aspergillus osteomyelitis was the first manifestation of aspergillosis in 77%. Pain and tenderness were present in 80%. The most frequently infected sites were vertebrae (46%), cranium (23%), ribs (16%), and long bones (13%). Patients with vertebral Aspergillus osteomyelitis had more previous orthopedic surgery (19% vs 0%; P=0.02), while those with cranial osteomyelitis had more diabetes mellitus (32% vs 8%; P=0.002) and prior head/neck surgery (12% vs 0%; P=0.02). Radiologic findings included osteolysis, soft-tissue extension, and uptake on T2-weighted images. Vertebral body Aspergillus osteomyelitis was complicated by spinal-cord compression in 47% and neurological deficits in 41%. Forty-four patients (24%) received only antifungal therapy, while 121(67%) were managed with surgery and antifungal therapy. Overall mortality was 25%. Median duration of therapy was 90 days (range, 10–772 days). There were fewer relapses in patients managed with surgery plus antifungal therapy in comparison to those managed with antifungal therapy alone (8% vs 30%; P=0.006). Conclusions Aspergillus osteomyelitis is a debilitating infection affecting both immunocompromised and immunocompetent patients. The most
Jørgensen, Thomas R
2007-12-01
Mold strains belonging to the species Aspergillus oryzae and Aspergillus sojae are highly valued as koji molds in the traditional preparation of fermented foods, such as miso, sake, and shoyu, and as protein production hosts in modern industrial processes. A. oryzae and A. sojae are relatives of the wild molds Aspergillus flavus and Aspergillus parasiticus. All four species are classified to the A. flavus group. Strains of the A. flavus group are characterized by a high degree of morphological similarity. Koji mold species are generally perceived of as being nontoxigenic, whereas wild molds are associated with the carcinogenic aflatoxins. Thus, reliable identification of individual strains is very important for application purposes. This review considers the pheno- and genotypic markers used in the classification of A. flavus group strains and specifically in the identification of A. oryzae and A. sojae strains. Separation of A. oryzae and A. sojae from A. flavus and A. parasiticus, respectively, is inconsistent, and both morphologic and molecular evidence support conspecificity. The high degree of identity is reflected by the divergent identification of reference cultures maintained in culture collections. As close relatives of aflatoxin-producing wild molds, koji molds possess an aflatoxin gene homolog cluster. Some strains identified as A. oryzae and A. sojae have been implicated in aflatoxin production. Identification of a strain as A. oryzae or A. sojae is no guarantee of its inability to produce aflatoxins or other toxic metabolites. Toxigenic potential must be determined specifically for individual strains. The species taxa, A. oryzae and A. sojae, are currently conserved by societal issues.
Septic arthritis due to tubercular and Aspergillus co-infection
Directory of Open Access Journals (Sweden)
Mukesh Kumar
2016-01-01
Full Text Available Aspergillus septic arthritis is a rare and serious medical and surgical problem. It occurs mainly in immunocompromised patients. Aspergillus fumigatus is the most common causative organism followed by Aspergillus flavus. The most common site affected is knee followed by shoulder, ankle, wrist, hip and sacroiliac joint. Debridement and voriconazole are primary treatment of articular aspergilosis. To the best of our knowledge, there are no reported cases of co-infection of tuberculosis (TB and Aspergillus infecting joints. We report a case of co-infection of TB and A. flavus of hip and knee of a 60-year-old male, with type 2 diabetes mellitus. He was treated with debridement, intravenous voriconazole, and antitubercular drugs.
Septic arthritis due to tubercular and Aspergillus co-infection.
Kumar, Mukesh; Thilak, Jai; Zahoor, Adnan; Jyothi, Arun
2016-01-01
Aspergillus septic arthritis is a rare and serious medical and surgical problem. It occurs mainly in immunocompromised patients. Aspergillus fumigatus is the most common causative organism followed by Aspergillus flavus. The most common site affected is knee followed by shoulder, ankle, wrist, hip and sacroiliac joint. Debridement and voriconazole are primary treatment of articular aspergilosis. To the best of our knowledge, there are no reported cases of co-infection of tuberculosis (TB) and Aspergillus infecting joints. We report a case of co-infection of TB and A. flavus of hip and knee of a 60-year-old male, with type 2 diabetes mellitus. He was treated with debridement, intravenous voriconazole, and antitubercular drugs.
DEFF Research Database (Denmark)
Hubka, Vit; Peterson, Stephen W.; Frisvad, Jens Christian
2013-01-01
Two new and phylogenetically closely related species in Aspergillus section Fumigati are described and illustrated. Homothallic Aspergillus waksmanii sp. nov. was isolated from New Jersey soil (USA) and is represented by the ex-type isolate NRRL 179T (=CCF 4266T=Thom 4138.HS2T=IBT 31900T......). Aspergillus marvanovae sp. nov. was isolated from water with high boracic acid anions content in Dukovany nuclear power station (Czech Republic). The sexual stage of this species is unknown, but the MAT1-1 locus was successfully amplified suggesting that the species is probably heterothallic and teleomorphic...... but is represented by only the ex-type isolate CCM 8003T (=CCF 4037T=NRRL 62486T=IBT 31279T=IFM 60873T). Both species can be distinguished from all previously described species in section Fumigati based on morphology, maximum growth temperature, sequence data from five unlinked loci and unique secondary metabolites...
A rare case of bilateral aspergillus endophthalmitis
Directory of Open Access Journals (Sweden)
Saurabh Gupta
2015-12-01
Full Text Available Aspergillus endophthalmitis is a devastating inflammatory condition of the intraocular cavities that may result in irreparable loss of vision and rapid destruction of the eye. Almost all cases in the literature have shown an identified source causing aspergillus endophthalmitis as a result of direct extension of disease. We present a rare case of bilateral aspergillus endophthalmitis. A 72-year-old woman with a history of diabetes mellitus, congenital Hirschsprung disease, and recent culture-positive candida pyelonephritis with hydronephrosis status post-surgical stent placement presented with difficulty opening her eyes. She complained of decreased vision (20/200 with pain and redness in both eyes – right worse then left. Examination demonstrated multiple white fungal balls in both retinas consistent with bilateral fungal endophthalmitis. Bilateral vitreous taps for cultures and staining were performed. Patient was given intravitreal injections of amphotericin B, vancomycin, ceftazidime, and started on oral fluconazole. Patient was scheduled for vitrectomy to decrease organism burden and to remove loculated areas of infection that would not respond to systemic antifungal agents. Four weeks after initial presentation, the fungal cultures revealed mold growth consistent with aspergillus. Patient was subsequently started on voriconazole and fluconazole was discontinued due to poor efficacy against aspergillus. Further workup was conducted to evaluate for the source of infection and seeding. Transthoracic cardiogram was unremarkable for any vegetation or valvular abnormalities. MRI of the orbits and sinuses did not reveal any mass lesions or bony destruction. CT of the chest was unremarkable for infection. Aspergillus endophthalmitis may occur because of one of these several mechanisms: hematogenous dissemination, direct inoculation by trauma, and contamination during surgery. Our patient's cause of bilateral endophthalmitis was through an
International Nuclear Information System (INIS)
Suparmi, A.; Cari, C.; Deta, U. A.; Handhika, J.
2016-01-01
The non-relativistic energies and wave functions of extended hyperbolic Scarf I plus separable non-central shape invariant potential in four dimensions are investigated using Supersymmetric Quantum Mechanics (SUSY QM) Approach. The three dimensional separable non-central shape invariant angular potential consists of trigonometric Scarf II, Manning Rosen and Poschl-Teller potentials. The four dimensional Schrodinger equation with separable shape invariant non-central potential is reduced into four one dimensional Schrodinger equations through variable separation method. By using SUSY QM, the non-relativistic energies and radial wave functions are obtained from radial Schrodinger equation, the orbital quantum numbers and angular wave functions are obtained from angular Schrodinger equations. The extended potential means there is perturbation terms in potential and cause the decrease in energy spectra of Scarf I potential. (paper)
Aspergillus fumigatus conidial melanin modulates host cytokine response
L.Y.A. Chai (Louis); M.G. Netea (Mihai); J. Sugui (Janyce); A.G. Vonk (Alieke); W.W.J. van de Sande (Wendy); A. Warris (Adilia); K.J. Kwon-Chung (Kyung); B. Jan Kullberg (Bart)
2010-01-01
textabstractMelanin biopigments have been linked to fungal virulence. Aspergillus fumigatus conidia are melanised and are weakly immunogenic. We show that melanin pigments on the surface of resting Aspergillus fumigatus conidia may serve to mask pathogen-associated molecular patterns (PAMPs)-induced
Aspergillus fumigatus conidial melanin modulates host cytokine response.
Chai, L.; Netea, M.G.; Sugui, J.; Vonk, A.G.; Sande, W.W. van de; Warris, A.; Kwon-Chung, K.J.; Kullberg, B.J.
2010-01-01
Melanin biopigments have been linked to fungal virulence. Aspergillus fumigatus conidia are melanised and are weakly immunogenic. We show that melanin pigments on the surface of resting Aspergillus fumigatus conidia may serve to mask pathogen-associated molecular patterns (PAMPs)-induced cytokine
Two novel species of Aspergillus section Nigri from Thai coffee beans
DEFF Research Database (Denmark)
Noonim, Paramee; Mahakarnchanakul, Warapa; Varga, Janos
2008-01-01
Two novel species of Aspergillus section Nigri from Thai coffee beans are described as Aspergillus aculeatinus sp. nov. and Aspergillus sclerotiicarbonarius sp. nov. Their taxonomic status was determined using a polyphasic taxonomic approach with phenotypic (morphology and extrolite profiles...
21 CFR 173.120 - Carbohydrase and cellulase derived from Aspergillus niger.
2010-04-01
... cellulase derived from Aspergillus niger. Carbohydrase and cellulase enzyme preparation derived from Aspergillus niger may be safely used in food in accordance with the following prescribed conditions: (a) Aspergillus niger is classified as follows: Class, Deuteromycetes; order, Moniliales; family, Moniliaceae...
Two novel species of Aspergillus section Nigri from Thai coffee beans.
Noonim, P.; Mahakarnchanakul, W.; Varga, J.; Frisvad, J.C.; Samson, R.A.
2008-01-01
Two novel species of Aspergillus section Nigri from Thai coffee beans are described as Aspergillus aculeatinus sp. nov. and Aspergillus sclerotiicarbonarius sp. nov. Their taxonomic status was determined using a polyphasic taxonomic approach with phenotypic (morphology and extrolite profiles) and
Liver injury in invasive aspergillus. Echographic findings
International Nuclear Information System (INIS)
Otero Fernandez, R.; Garcia Revillo, J.; Paez Moreno, J.; Zurera Tendero, L.J.
1994-01-01
Aspergillus is the second most common mycoses in immuno compromised patients. The invasive form is associated with a mortality of approximately 100%. We present a case of invasive aspergillus in a heart transplant recipient in whom ultrasound disclosed the presence of liver injury which was later confirmed by necropsy. We review the available literature. (Author) 15 refs
New and revisited species in Aspergillus section Nigri
DEFF Research Database (Denmark)
Varga, J.; Frisvad, Jens Christian; Kocsube, S.
2011-01-01
based on either beta-tubulin or calmodulin sequence data. Aspergillus eucalypticola produced pyranonigrin A, funalenone, aurasperone B and other naphtho-gamma-pyrones. Aspergillus neoniger is also a biseriate species isolated from desert sand in Namibia, and mangrove water in Venezuela, which produces...
Characteristic clinical features of Aspergillus appendicitis: Case report and literature review.
Gjeorgjievski, Mihajlo; Amin, Mitual B; Cappell, Mitchell S
2015-11-28
This work aims to facilitate diagnosing Aspergillus appendicitis, which can be missed clinically due to its rarity, by proposing a clinical pentad for Aspergillus appendicitis based on literature review and one new case. The currently reported case of pathologically-proven Aspergillus appendicitis was identified by computerized search of pathology database at William Beaumont Hospital, 1999-2014. Prior cases were identified by computerized literature search. Among 10980 pathology reports of pathologically-proven appendicitis, one case of Aspergillus appendicitis was identified (rate = 0.01%). A young boy with profound neutropenia, recent chemotherapy, and acute myelogenous leukemia presented with right lower quadrant pain, pyrexia, and generalized malaise. Abdominal computed tomography scan showed a thickened appendiceal wall and periappendiceal inflammation, suggesting appendicitis. Emergent laparotomy showed an inflamed, thickened appendix, which was resected. The patient did poorly postoperatively with low-grade-fevers while receiving antibacterial therapy, but rapidly improved after initiating amphotericin therapy. Microscopic examination of a silver stain of the appendectomy specimen revealed fungi with characteristic Aspergillus morphology, findings confirmed by immunohistochemistry. Primary Aspergillus appendicitis is exceptionally rare, with only 3 previously reported cases. All three cases presented with (1)-neutropenia, (2)-recent chemotherapy, (3)-acute leukemia, and (4)-suspected appendicitis; (5)-the two prior cases initially treated with antibacterial therapy, fared poorly before instituting anti-Aspergillus therapy. The current patient satisfied all these five criteria. Based on these four cases, a clinical pentad is proposed for Aspergillus appendicitis: clinically-suspected appendicitis, neutropenia, recent chemotherapy, acute leukemia, and poor clinical response if treated solely by antibacterial/anti-candidial therapy. Patients presenting with
Characterization of Aspergillus species based on fatty acid profiles.
Fraga, Marcelo E; Santana, Djalva Maria N; Gatti, Mario Jorge; Direito, Gloria Maria; Cavaglieri, Lilia R; Rosa, Carlos Alberto R
2008-09-01
Cellular fatty acid (FA) composition was utilized as a taxonomic tool to discriminate between different Aspergillus species. Several of the tested species had the same FA composition and different relative FA concentrations. The most important FAs were palmitic acid (C16:0), estearic acid (C18:0), oleic acid (C18:1) and linoleic acid (C18:2), which represented 95% of Aspergillus FAs. Multivariate data analysis demonstrated that FA analysis is a useful tool for differentiating species belonging to genus Aspergillus. All the species analyzed showed significantly FA acid profiles (p < 0.001). Furthermore, it will be possible to distinguish among Aspergillus spp. in the Flavi Section. FA composition can serve as a useful tool for the identification of filamentous fungi.
Aspergillus Monitoring Project in a Large Educational Hospital ...
African Journals Online (AJOL)
Also molecular method, PCR-RFLP using single restriction enzyme as a rapid and available method was performed to investigate environmental sources of Aspergillus infections. Results: Total of 110 clinical fungal isolates included Candida and Aspergillus species and some other opportunistic fungi. Among the clinical
Cho, Sung-Yeon; Lee, Dong-Gun; Choi, Jae-Ki; Lee, Hyo-Jin; Kim, Si-Hyun; Park, Sun Hee; Choi, Su-Mi; Choi, Jung-Hyun; Yoo, Jin-Hong; Park, Yeon-Joon; Lee, Jong-Wook
2017-12-01
While the epidemiology and clinical differences of various Candida spp. has been relatively well-identified, data regarding invasive aspergillosis (IA) caused by different Aspergillus spp. are insufficient.We aimed to determine the epidemiology of culture-positive invasive pulmonary aspergillosis (IPA) and to compare the characteristics and outcomes of Aspergillus fumigatus IPA with those of non-fumigatus IPA in patients with hematologic diseases. All consecutive cases of IPA from 2011 to 2015 were reviewed retrospectively.There were 430 proven/probable IPA and 76 culture-positive proven/probable IPA. Excluding cases of multiple species of fungi or cases having difficulties in species-level identification, 41 A fumigatus and 22 non-fumigatus IPA (Aspergillus flavus [n = 11], Aspergillus niger [n = 6], and Aspergillus terreus [n = 5]) were compared. There were no significant differences in baseline characteristics between the 2 groups. However, disseminated IA was more common in non-fumigatus IPA (2.4% vs 18.2%; P = .046). Paranasal sinus (PNS) involvement was more common in non-fumigatus IPA. There was a trend towards higher peak serum galactomannan values in non-fumigatus IPA than in A fumigatus IPA group (median 1.33 [interquartile 0.98-3.29] vs 0.97 [0.66-1.97]; P = .084). Clinical response and mortality did not differ between groups.The culture-positive rate of proven/probable IPA was 17.7%, of which non-fumigatus Aspergillus accounted for about one-third. Disseminated IA, especially involving the PNS, was more frequent in non-fumigatus IPA than in A fumigatus IPA.
The Platelia Aspergillus ELISA in diagnosis of invasive pulmonary aspergilosis (IPA).
Siemann, M; Koch-Dörfler, M
2001-01-01
The sensitivity of a sandwich enzyme-linked immunosorbent assay (ELISA) for detecting Aspergillus galactomannan was evaluated with 66 serum samples and 113 specimens of the respiratory tract obtained from 52 patients with pulmonary diseases. The patients were divided into five groups: proven invasive pulmonary aspergillosis (IPA) (five patients), probable IPA (seven patients), Aspergillus colonization (eight patients) or unlikely Aspergillus infection (27 patients). Another five patients with doubtful diagnostic test results are discussed in detail. The results of the Platelia Aspergillus ELISA (Sanofi Pasteur, Freiburg, Germany) in testing specimens of the respiratory tract were 90% sensitivity in proven (serum 38%), 60% in probable (serum 37%) and 71% in Aspergillus colonization (serum 0%). Furthermore, 85% of the Aspergillus spp. from positive cultures of specimens of the respiratory tract were also detected in the ELISA. A total of 57% of the culture negative specimens of patients with a least one positive culture or proven aspergillosis in a series of specimens were positive in the ELISA.
Lifescience Database Archive (English)
Full Text Available ulation VWP2 x VWP4 and pseudo-F2 population ... Chr12 ... 10.1007/s00438-005-1149-2 16021467 ... QM109927 Solanum lycopersicum Solanaceae L16L Others ATAGTGTCTACTTCAGGG CCATCAAACAGTTCTCT S. peruvianum pop
Lifescience Database Archive (English)
Full Text Available GATGGCGTT S. peruvianum population VWP2 x VWP4 and pseudo-F2 population ... Chr12 ... 10.1007/s00438-005-1149-2 16021467 ... QM109928 Solanum lycopersicum Solanaceae DH8R Others TAGAGAGACTATCCTTTA CACATTCAGT
Aspergillus thyroiditis in a renal transplant recipient mimicking subacute thyroiditis.
Solak, Y; Atalay, H; Nar, A; Ozbek, O; Turkmen, K; Erekul, S; Turk, S
2011-04-01
Fungal pathogens are increasingly encountered after renal transplantation. Aspergillus causes significant morbidity and mortality in transplant patients. Fungal thyroiditis is a rare occurrence owing to unique features of the thyroid gland. Most cases are caused by Aspergillus species and have been described in immunocompromised patients. Presentation may be identical with that of subacute thyroiditis, in which hyperthyroidism features and painful thyroid are the prominent findings. Diagnosis can be ascertained by fine-needle aspiration of thyroid showing branching hyphae of Aspergillus. We describe a renal transplant patient who developed Aspergillus thyroiditis as part of a disseminated infection successfully treated with voriconazole. © 2010 John Wiley & Sons A/S.
Aspergillus Species and Their Associated Mycotoxins.
Perrone, Giancarlo; Gallo, Antonia
2017-01-01
The genus Aspergillus is among the most abundant and widely distributed organism on earth, and at the moment comprises 339 known species. It is one of the most important economically fungal genus and the biotechnological use of Aspergillus species is related to production of soy sauce, of different hydrolytic enzymes (amylases, lipases) and organic acid (citric acid, gluconic acid), as well as biologically active metabolites such as lovastatin. Although they are not considered to be major cause of plant diseases, Aspergillus species are responsible for several disorders in various plants and plant products, especially as opportunistic storage moulds. The notable consequence of their presence is contamination of foods and feeds by mycotoxins, among which the most important are aflatoxins, ochratoxin A, and, at a less extent, fumonisins. Aflatoxins B 1 , B 2 , G 1 , G 2 are the most toxic and carcinogenic mycotoxins, due to their extreme hepatocarcinogenicity; ochratoxin A is a potent nephrotoxin, it is also carcinogenic, teratogenic, and immunotoxic in rats and possibly in humans; fumonisins are hepatotoxic and nephrotoxic with potential carcinogenic effects on rat and mice. In this chapter we summarize the main aspects of morphology, ecology, epidemiology, and toxigenicity of Aspergillus foodborne pathogens which belong to sections Flavi, Circumdati, and Nigri, occurring in several agricultural products and responsible of aflatoxin, ochratoxin A, and fumonisins contamination of food and feed.
Biodiversity of Aspergillus species in some important agricultural products
DEFF Research Database (Denmark)
Perrone, Giancarlo; Susca, A.,; Cozzi, G.
2007-01-01
The genus Aspergillus is one of the most important filamentous fungal genera. Aspergillus species are used in the fermentation industry, but they are also responsible of various plant and food secondary rot, with the consequence of possible accumulation of mycotoxins. The aflatoxin producing A....... flavus and A. parasiticus, and ochratoxinogenic A. niger, A. ochraceus and A. carbonarius species are frequently encountered in agricultural products. Studies on the biodiversity of toxigenic Aspergillus species is useful to clarify molecular, ecological and biochemical characteristics of the different...... occurring in agricultural fields. Altogether nine different black Aspergillus species can be found on grapes which are often difficult to identify with classical methods. The polyphasic approach used in our studies led to the identification of three new species occurring on grapes: A. brasiliensis, A...
Lifescience Database Archive (English)
Full Text Available QM357356 Solanum tuberosum Solanaceae toPt-437059 Others ... CIP703825 ... Chr10 ratio of tuber length to tuber... width trait and eye depth of tuber trait 1 10.1186/s12863-015-0213-0 26024857
9 CFR 329.8 - Authority for condemnation or seizure under other provisions of law.
2010-01-01
... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Authority for condemnation or seizure... PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION DETENTION; SEIZURE AND CONDEMNATION; CRIMINAL OFFENSES § 329.8 Authority for condemnation or seizure under other provisions of law. The...
Honda, Atsushi; Nakamura, Yuji; Ohara, Hiroshi; Cao, Xin; Nomura, Hiroaki; Katagi, Jun; Wada, Takeshi; Izumi-Nakaseko, Hiroko; Ando, Kentaro; Sugiyama, Atsushi
2016-03-15
Cardiac effects of a prostagrandin EP4-receptor agonist ONO-AE1-329 were assessed in the halothane-anesthetized dogs under the monitoring of left ventricular pressure-volume relationship, which were compared with those of clinically recommended doses of dopamine, dobutamine and milrinone (n=4-5 for each treatment). ONO-AE1-329 was intravenously administered in doses of 0.3, 1 and 3 ng/kg/min for 10 min with a pause of 20 min. Dopamine in a dose of 3 µg/kg/min for 10 min, dobutamine in a dose of 1 µg/kg/min for 10 min and milrinone in a dose of 5 µg/kg/min for 10 min followed by 0.5 µg/kg/min for 10 min were intravenously administered. Low dose of ONO-AE1-329 increased the stroke volume. Middle dose of ONO-AE1-329 increased the cardiac output, left ventricular end-diastolic volume, ejection fraction, maximum upstroke/downstroke velocities of the left ventricular pressure and external work, but decreased the end-systolic pressure and internal work besides the change by the low dose. High dose of ONO-AE1-329 increased the heart rate and maximum elastance, but decreased the end-systolic volume besides the changes by the middle dose. Dopamine, dobutamine and milrinone exerted essentially similar cardiac effects to ONO-AE1-329, but they did not significantly change the end-diastolic volume, end-systolic volume, stroke volume, ejection fraction, end-systolic pressure, maximum elastance, external work or internal work. Thus, EP4-receptor stimulation by ONO-AE1-329 may have potential to better promote the passive ventricular filling than the conventional cardiotonic drugs, which could become a candidate of novel therapeutic strategy for the treatment of heart failure with preserved ejection fraction. Copyright © 2016 Elsevier B.V. All rights reserved.
Liu, Jin-Na; Xie, Xiao-Liang; Yang, Tai-Xin; Zhang, Cun-Li; Jia, Dong-Sheng; Liu, Ming; Wen, Chun-Xiu
2014-04-01
To study the different mature stages and the best processing methods on the quality of Trichosanthes kirilowii seeds. The content of 3,29-dibenzoyl rarounitriol in Trichosanthes kirilowii seeds was determined by HPLC. The sample of different mature stages such as immature, near mature and fully mature and processed by different methods were studied. Fully mature Trichosanthes kirilowii seeds were better than the immatured, and the best processing method was dried under 60degrees C, the content of 3,29-dibenzoyl rarounitriol reached up to 131.63microlg/mL. Different processing methods and different mature stages had a significant influence on the quality of Trichosanthes kirilowii seeds.
[Utility of Aspergillus-LFD: first experience in Chile].
Alvarez, Eduardo
2015-02-01
The diagnosis of invasive aspergillosis remains a challenge. Detection of galactomannan in serum and bronchoalveolar lavage is a useful tool; however due to methodological and economic reasons, the test frequencies of galactomannan assays vary from daily to weekly, which constitute a risk to the patient. In this study, we aimed to evaluate and correlate the performance of the new kit Aspergillus-LFD with the GM-EIA. Aspergillus-LFD kit represents a fast, economical and simple test; showed a good performance and excellent correlation with GM-EIA kit. Given the above, the Aspergillus-LFD is emerging as an alternative to consider in the early diagnosis of invasive aspergillosis.
Aspergillus in the lung: diverse and coincident forms
International Nuclear Information System (INIS)
Buckingham, Susan J.; Hansell, David M.
2003-01-01
Pulmonary disease caused by the fungus Aspergillus has traditionally been regarded as belonging to one of the following, apparently distinct, entities: saprophytic aspergilloma; allergic bronchopulmonary aspergillosis (ABPA); and invasive aspergillosis (IPA); which may be further categorised as angioinvasive, acute or chronic airway invasive [1]. It is not always obvious that there is overlap between these entities, and that in any given patient more than one Aspergillus-related pathological process can co-exist [2]. The aim of this article is to review the clinical and imaging features of the main categories of Aspergillus-related pulmonary disease and, in particular, to highlight the overlap between them. (orig.)
International Nuclear Information System (INIS)
Cari, C; Suparmi, A; Yunianto, M; Pratiwi, B N
2016-01-01
The Dirac equation of q-deformed hyperbolic Manning Rosen potential in D dimension was solved by using Supersymmetric Quantum Mechanics (SUSY QM). The D dimensional relativistic energy spectra were obtained by using SUSY QM and shape invariant properties and D dimensional wave functions of q-deformed hyperbolic Manning Rosen potential were obtained by using the SUSY raising and lowering operators. In the nonrelativistic limit, the relativistic energy spectra for exact spin symmetry case reduced into nonrelativistic energy spectra and so for the wave functions. In the classical regime, the partition function, the vibrational specific heat, and the vibrational mean energy of some diatomic molecules were calculated from the non-relativistic energy spectra with the help of error function and imaginary error function. (paper)
Aspergillus section Restricti together with sister sect. Aspergillus (formerly Eurotium) comprises osmophilic species, that are able to grow on substrates with low water activity and in extreme environments. We addressed the monophyly of both sections within subgenus Aspergillus and applied multidis...
PENGARUH RHIZOPUS ORYZAE DAN ASPERGILLUS ORYZAE TERHADAP KUALITAS KECAP
Directory of Open Access Journals (Sweden)
Dewi Sabita Slamet
2012-11-01
Full Text Available Telah diteliti pengganti fermentasi mikroorganisme Aspergillus oryzae Rhyzopus oryzae dan campuran Aspergillus dan Rhyzopus oryzae, dengan perendaman dalam larutan garam 20% dalam waktu yang berbeda terhadap kualitas kecap.Lamanya perendaman dalam larutan garam 20% yang berbeda menghasilkan kadar protein kecap yang berbeda. Aspergillus oryzae lebih baik dalam menghasilkan enzima protease dari pada Rhyzopus oryzae.Uji organoleptik menunjukkan perbedaan tidak bermakna dalam hal rasa maupun aroma antar kecap yang dibuat dengan strain jamur yang berlainan serta waktu perendaman yang berbeda. Untuk membuat kecap, sebaiknya dilakukan perendaman dalam larutan garam 20% selama 14 hari.
Yamashita, Nobuo; Komori, Yumiko; Okumura, Yoshiyuki; Uchiya, Kei-Ichi; Matsui, Takeshi; Nishimura, Akira; Ogawa, Kenji; Nikai, Toshiaki
2011-08-01
AFUEI, an elastase inhibitor produced by Aspergillus fumigatus strongly inhibits the elastolytic activity of A. fumigatus etc. To purify AFUEI, we constructed a strain that overproduces AFUEI by introducing the gene encoding AFUEI (Genbank accession no. AB546725) under control of the amyB promoter into the heterologous host Aspergillus oryzae. A. oryzae TF-4 displayed strong elastase inhibitory activity and produced considerably more AFUEI than that of A. fumigatus. Furthermore, AFUEI could be purified using culture broth and single ultrafiltration (UF) treatment, allowing for the effective production of AFUEI for use in clinical trials. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Analysis and prediction of gene splice sites in four Aspergillus genomes
DEFF Research Database (Denmark)
Wang, Kai; Ussery, David; Brunak, Søren
2009-01-01
Several Aspergillus fungal genomic sequences have been published, with many more in progress. Obviously, it is essential to have high-quality, consistently annotated sets of proteins from each of the genomes, in order to make meaningful comparisons. We have developed a dedicated, publicly available......, splice site prediction program called NetAspGene, for the genus Aspergillus. Gene sequences from Aspergillus fumigatus, the most common mould pathogen, were used to build and test our model. Compared to many animals and plants, Aspergillus contains smaller introns; thus we have applied a larger window...... better splice site prediction than other available tools. NetAspGene will be very helpful for the study in Aspergillus splice sites and especially in alternative splicing. A webpage for NetAspGene is publicly available at http://www.cbs.dtu.dk/services/NetAspGene....
Deletion of creB in Aspergillus oryzae increases secreted hydrolytic enzyme activity.
Hunter, A J; Morris, T A; Jin, B; Saint, C P; Kelly, J M
2013-09-01
Aspergillus oryzae has been used in the food and beverage industry for centuries, and industrial strains have been produced by multiple rounds of selection. Targeted gene deletion technology is particularly useful for strain improvement in such strains, particularly when they do not have a well-characterized meiotic cycle. Phenotypes of an Aspergillus nidulans strain null for the CreB deubiquitinating enzyme include effects on growth and repression, including increased activity levels of various enzymes. We show that Aspergillus oryzae contains a functional homologue of the CreB deubiquitinating enzyme and that a null strain shows increased activity levels of industrially important secreted enzymes, including cellulases, xylanases, amylases, and proteases, as well as alleviated inhibition of spore germination on glucose medium. Reverse transcription-quantitative PCR (RT-qPCR) analysis showed that the increased levels of enzyme activity in both Aspergillus nidulans and Aspergillus oryzae are mirrored at the transcript level, indicating transcriptional regulation. We report that Aspergillus oryzae DAR3699, originally isolated from soy fermentation, has a similar phenotype to that of a creB deletion mutant of the RIB40 strain, and it contains a mutation in the creB gene. Collectively, the results for Aspergillus oryzae, Aspergillus nidulans, Trichoderma reesei, and Penicillium decumbens show that deletion of creB may be broadly useful in diverse fungi for increasing production of a variety of enzymes.
Dutta, Debodyuti; Mishra, Sabyashachi
2017-07-27
The mechanism of the catalytic hydrolysis of N-succinyl diaminopimelic acid (SDAP) by the microbial enzyme DapE in its wild-type (wt) form as well as three of its mutants (E134D, H67A, and H349A) is investigated employing a hybrid quantum mechanics/molecular mechanics (QM/MM) method coupled with molecular dynamics (MD) simulations, wherein the time evolution of the atoms of the QM and MM regions are obtained from the forces acting on the individual atoms. The free-energy profiles along the reaction coordinates of this multistep hydrolysis reaction process are explored using a combination of equilibrium and nonequilibrium (umbrella sampling) QM/MM-MD simulation techniques. In the enzyme-substrate complexes of wt-DapE and the E134D mutant, nucleophilic attack is found to be the rate-determining step involving a barrier of 15.3 and 21.5 kcal/mol, respectively, which satisfactorily explains the free energy of activation obtained from kinetic experiments in wt-DapE-SDAP (15.2 kcal/mol) and the 3 orders of magnitude decrease in the catalytic activity due to E134D mutation. The catalysis is found to be quenched in the H67A and H349A mutants of DapE due to conformational rearrangement in the active site induced by the absence of the active site His residues that prohibits activation of the catalytic water molecule.
Exact Molecular Typing of Aspergillus fumigatus. Methods and Applications.
Valk-van Haren, J.A. de
2008-01-01
Aspergillus species are widely distributed fungi that release large amounts of airborne conidia that are dispersed in the environment. Aspergillus fumigatus is the species most frequently isolated from human infections. In this thesis a novel assay for fingerprinting A. fumigatus is described and
Aspergillus triggers phenazine production in Pseudomonas aeruginosa
DEFF Research Database (Denmark)
Jensen, Britt Guillaume; Jelsbak, Lars; Søndergaard, Ib
in the contact area of A. niger, A. flavus, A. oryzae, but not A. fumigatus. In addition, other metabolites with UV chromophores similar to the phenazines were only found in the contact zone between Aspergillus and Pseudomonas. No change in secondary metabolite profiles were seen for the Aspergilli, when......Objectives: Pseudomonas aeruginosa is an opportunistic human pathogen, commonly infecting cystic fibrosis (CF) patients. Aspergilli, especially Aspergillus fumigatus, are also frequently isolated from CF patients. Our aim was to examine the possible interaction between P. aeruginosa and different...... Aspergillus species. Methods: A suspension of fungal spores was streaked onto WATM agar plates. After 24 hours incubation at 37 °C, a P. aeruginosa overnight culture was streaked out perpendicular to the fungal streak. The plates were incubated at 37 °C for five days, examined and plugs were extracted...
The Inhibition of aflatoxin production from Aspergillus parasiticus ...
African Journals Online (AJOL)
The inhibition of Aflatoxin production from Aspergillus parasiticus strain NRRL 2999 was investigated using ethanol extracts of Aframommon danielli flower at concentrations of 250ìg/g, 500ìg/g, 750ìg/g and 1000ìg/g with whole wheat bread as a substrate. Aspergillus parasiticus grew abundantly on whole wheat bread; ...
Expression of the Aspergillus terreus itaconic acid biosynthesis cluster in Aspergillus niger.
van der Straat, Laura; Vernooij, Marloes; Lammers, Marieke; van den Berg, Willy; Schonewille, Tom; Cordewener, Jan; van der Meer, Ingrid; Koops, Andries; de Graaff, Leo H
2014-01-17
Aspergillus terreus is a natural producer of itaconic acid and is currently used to produce itaconic acid on an industrial scale. The metabolic process for itaconic acid biosynthesis is very similar to the production of citric acid in Aspergillus niger. However, a key enzyme in A. niger, cis-aconitate decarboxylase, is missing. The introduction of the A. terreus cadA gene in A. niger exploits the high level of citric acid production (over 200 g per liter) and theoretically can lead to production levels of over 135 g per liter of itaconic acid in A. niger. Given the potential for higher production levels in A. niger, production of itaconic acid in this host was investigated. Expression of Aspergillus terreus cis-aconitate decarboxylase in Aspergillus niger resulted in the production of a low concentration (0.05 g/L) of itaconic acid. Overexpression of codon-optimized genes for cis-aconitate decarboxylase, a mitochondrial transporter and a plasma membrane transporter in an oxaloacetate hydrolase and glucose oxidase deficient A. niger strain led to highly increased yields and itaconic acid production titers. At these higher production titers, the effect of the mitochondrial and plasma membrane transporters was much more pronounced, with levels being 5-8 times higher than previously described. Itaconic acid can be produced in A. niger by the introduction of the A. terreus cis-aconitate decarboxylase encoding cadA gene. This results in a low itaconic acid production level, which can be increased by codon-optimization of the cadA gene for A. niger. A second crucial requirement for efficient production of itaconic acid is the expression of the A. terreus mttA gene, encoding a putative mitochondrial transporter. Expression of this transporter results in a twenty-fold increase in the secretion of itaconic acid. Expression of the A. terreus itaconic acid cluster consisting of the cadA gene, the mttA gene and the mfsA gene results in A. niger strains that produce over
Lifescience Database Archive (English)
Full Text Available CG GCTCCAACTTCAATGCCTGT Gold Ball Livingston x Yellow Pear|San Marzano x Gold Ball Livingston|T1693 x Yellow Pear ... chr11 fruit shape 1 10.1038/hdy.2013.45 23673388 ... QM183663 Solanum lycopersicum Solanaceae 11EP186 CAPS/dCAPS TGGAAGCTTTAAACTTGTCGTT
International Nuclear Information System (INIS)
Sinicropi, A; Basosi, R; Olivucci, M
2008-01-01
The excited-state properties of chemically different chromophores embedded in diverse protein environments or in solution can be nowadays correctly evaluated by means of a hybrid quantum mechanics/molecular mechanics (QM/MM) computational strategy based on multiconfigurational perturbation theory and complete-active-space-self-consistent-field geometry optimization. In particular, in this article we show how a QM/MM strategy has been recently developed in our laboratory and has been successfully applied to the investigation of the fluorescence of the green fluorescent protein (GFP) and how the same strategy (embedding the chromophores in methanol solution) has been combined with retrosynthetic analysis to design a prototype light-driven Z/E molecular switch featuring a single reactive double bond and the same electronic structure and photoisomerization mechanism of the chromophore of the visual pigment Rhodopsin
9 CFR 329.5 - Movement of article or livestock detained; removal of official marks.
2010-01-01
... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Movement of article or livestock...; CRIMINAL OFFENSES § 329.5 Movement of article or livestock detained; removal of official marks. (a) No... it is located when so detained, for refrigeration, freezing, or storage purposes if such movement has...
International Nuclear Information System (INIS)
Padwal-Desai, S.R.; Ghanekar, A.S.; Sreenivasan, A.
1976-01-01
In vitro studies were conducted on conidia of Aspergillus flavus Link (aflatoxin producing) and Aspergillus flavus oryzae (non-toxigenic) strains isolated and identified in this laboratory. These strains differed in resistance to heat and gamma radiation, the toxigenic strain being more resistant to both treatments. Results of tests on dose-modifying factors indicated that composition, temperature and pH of suspending media affected radiation resistance. On the other hand, the size of the initial population and the age of the conidia did not influence the radiation resistance of either strain. Studies on thermal inactivation of the conidia suggested that the temperature employed was more important than the time of heat treatment. Conidia of both strains showed a synergistic effect of combined heat and radiation treatments, although a heat-radiation sequence was more effective than a radiation-heat sequence. (author)
Production of aspartic peptidases by Aspergillus spp. using tuna ...
African Journals Online (AJOL)
The production of extracellular aspartic peptidase by the fungi Aspergillus niger and Aspergillus awamori was carried out in a shake flask and in stirred tank submerged fermentations using tuna cooked wastewater, an industrial effluent, as nitrogen source for culture medium. In stirred tank fermentation, biomass production ...
Directory of Open Access Journals (Sweden)
Niken Indriyanti
2015-06-01
Full Text Available Aspergillus niger is a mold that can infect respiratory tract in certain condition. Azoles are used to solve this infection. Drug development on antifungal drugs still continued, one of the resorce is from plant. A plant that widely studied as antifungi is singawalang (Petiveria alliacea L.. Activity of ethanol extract and fraction of singawalang roots on Aspergillus niger tested by microdilution broth method appropriate to Clinical and Laboratory Standard Institute (CLSI standard. Microdilution test results showed that Singawalang roots extract has antifungal activity against Aspergillus niger with Minimum Inhibition Concentration (MIC 32 μg/mL and Minimum Fungicidal Concentration (MFC 1048 μg/mL. Fraction that has high activity against Aspergillus niger was ethylacetate fraction of Singawalang roots with MIC 128 µg/ml dan MFC 512 μg/mL. The higher activity of the extract than the fraction was predicted as the impact of multiple compounds that have synergic activity. The growth profile of Aspergillus niger showed unconstant result and tends to descend. However, further research needed to ensure this effect. Keywords: antifungal, microdilution, singawalang (Petiveria alliacea L., Aspergillus niger ABSTRAK Aspergillus niger merupakan kapang penginfeksi saluran pernafasan pada kondisi tertentu. Obat-obat golongan azol biasa digunakan untuk mengatasi infeksi ini. Pengembangan obat antifungi saat ini terus dilakukan, termasuk dari tanaman. Salah satu tanaman yang telah banyak diteliti memiliki efek antifungi adalah tanaman singawalang (Petiveria alliacea L.. Pengujian dilakukan dengan Broth Microdilution sesuai standar Clinical and Laboratory Standard Institute (CLSI. Ekstrak akar singawalang menghambat pertumbuhan Aspergillus niger dan memiliki KHM 32 ppm dan KFM 1048 ppm. Hasil dan Fraksi Ekstrak Akar Singawalang Terhadap Aspergillus niger pada fraksi etilasetat ekstrak etanol akar singawalang adalah Konsentrasi Hambat
Directory of Open Access Journals (Sweden)
Marciane Magnani
2005-01-01
Full Text Available Some species belonging to the genus Aspergillus are potential producers of ochratoxin A (OA, a mycotoxin with nephrotoxic, immunosuppressive, teratogenic and carcinogenic effects. The aim of the present study was to identify the species of Aspergillus that contaminate the inside of coffee beans collected in the stage of maturation and drying, from 16 producing areas located in the northern region of the State of Paraná, in the South of Brazil. A total of 108 isolates of Aspergillus spp. was identified at the species level, by sequencing the internal transcribed spacer (ITS1-5.8S-ITS2 of ribosomal DNA (rDNA. The results revealed the presence of potentially ochratoxigenic species in 82% of the geographic regions studied, among which Aspergillus niger was the species most frequently detected, followed by A. ochraceus and A. carbonarius. The presence of A. carbonarius in immature coffee fruits harvested from trees is reported for the first time.Algumas espécies pertencentes ao gênero Aspergillus possuem potencial para produção de Ocratoxina A (OA, uma micotoxina de efeitos nefrotóxicos, imunossupressivos, teratogênicos e carcinogênicos. Com o objetivo de identificar as espécies de Aspergillus que contaminam o interior de grãos de café, foram coletadas amostras em diferentes estádios de maturação do produto, em 16 propriedades produtoras do norte do estado do Paraná. Um total de 108 isolados de Aspergillus spp. foram identificados ao nível de espécie, pelo sequenciamento dos espaços internos transcritos (ITS1-5,8S-ITS2 do DNA ribossomal (rDNA. Os resultados revelaram a presença de espécies potencialmente ocratoxigênicas em 82% das regiões analisadas, sendo dentre estas, Aspergillus niger a espécie mais freqüentemente detectada,seguida por A. ochraceus, e A. carbonarius. É relatada pela primeira vez a presença de A. carbonarius em frutos de café coletados na árvore.
Aspergillus sensitisation in bidi smokers with and without chronic obstructive lung disease.
Agarwal, Ritesh; Bhogal, Sumita; Choudhary, Hansraj; Aggarwal, Ashutosh N; Sehgal, Inderpaul S; Dhooria, Sahajal; Behera, Digambar; Chakrabarti, Arunaloke
2017-06-01
Recent studies have described fungal sensitisation in patients with chronic obstructive pulmonary disease (COPD). However, no study has evaluated fungal sensitisation specifically in bidi smokers. Herein, we evaluate the prevalence of Aspergillus sensitisation in bidi smokers. Bidi smokers with and without COPD underwent chest radiography, spirometry, Aspergillus skin test, A. fumigatus precipitins, A. fumigatus-specific IgE and total IgE. Aspergillus sensitisation was defined as the presence of either immediate cutaneous hyperreactivity to Aspergillus antigen or raised A. fumigatus-specific IgE level >0.35 kUA/L. Bidis were obtained from a subset of cases and controls and cultured for the growth of any fungus. Two hundred subjects with COPD and 72 chronic bidi smokers without COPD were included in the study (258 men; mean age, 56.8 years). Aspergillus sensitisation was found to be significantly higher in bidi smokers without COPD (27.8%) compared to the COPD cases (16%). Age, COPD, lung function, severity of smoking and current smoking were not associated with Aspergillus sensitisation, on a multivariate logistic regression analysis. We found a high prevalence of Aspergillus sensitisation in bidi-smoking subjects. More studies are required to confirm the findings of our study. © 2017 Blackwell Verlag GmbH.
2010-01-01
... authorities having jurisdiction over article or livestock detained; form of written notification. 329.4... governmental authorities having jurisdiction over article or livestock detained; form of written notification. Within 48 hours after the detention of any livestock or article pursuant to this part, an authorized...
Takenaka, Norio; Kitamura, Yukichi; Nagaoka, Masataka
2016-03-03
In solution chemical reaction, we often need to consider a multidimensional free energy (FE) surface (FES) which is analogous to a Born-Oppenheimer potential energy surface. To survey the FES, an efficient computational research protocol is proposed within the QM/MM framework; (i) we first obtain some stable states (or transition states) involved by optimizing their structures on the FES, in a stepwise fashion, finally using the free energy gradient (FEG) method, and then (ii) we directly obtain the FE differences among any arbitrary states on the FES, efficiently by employing the QM/MM method with energy representation (ER), i.e., the QM/MM-ER method. To validate the calculation accuracy and efficiency, we applied the above FEG-ER methodology to a typical isomerization reaction of glycine in aqueous solution, and reproduced quite satisfactorily the experimental value of the reaction FE. Further, it was found that the structural relaxation of the solute in the QM/MM force field is not negligible to estimate correctly the FES. We believe that the present research protocol should become prevailing as one computational strategy and will play promising and important roles in solution chemistry toward solution reaction ergodography.
Nasri, Tuba; Hedayati, Mohammad Taghi; Abastabar, Mahdi; Pasqualotto, Alessandro C; Armaki, Mojtaba Taghizadeh; Hoseinnejad, Akbar; Nabili, Mojtaba
2015-10-01
Aspergillus species are important agents of life-threatening infections in immunosuppressed patients. Proper speciation in the Aspergilli has been justified based on varied fungal virulence, clinical presentations, and antifungal resistance. Accurate identification of Aspergillus species usually relies on fungal DNA sequencing but this requires expensive equipment that is not available in most clinical laboratories. We developed and validated a discriminative low-cost PCR-based test to discriminate Aspergillus isolates at the species level. The Beta tubulin gene of various reference strains of Aspergillus species was amplified using the universal fungal primers Bt2a and Bt2b. The PCR products were subjected to digestion with a single restriction enzyme AlwI. All Aspergillus isolates were subjected to DNA sequencing for final species characterization. The PCR-RFLP test generated unique patterns for six clinically important Aspergillus species, including Aspergillus flavus, Aspergillus fumigatus, Aspergillus nidulans, Aspergillus terreus, Aspergillus clavatus and Aspergillus nidulans. The one-enzyme PCR-RFLP on Beta tubulin gene designed in this study is a low-cost tool for the reliable and rapid differentiation of the clinically important Aspergillus species. Copyright © 2015 Elsevier B.V. All rights reserved.
Pisani, Cristina; Nguyen, Trang Thoaivan; Gubler, Walter Douglas
2015-09-01
Sour rot, is a pre-harvest disease that affects many grape varieties. Sour rot symptoms include initial berry cracking and breakdown of berry tissue. This is a disease complex with many filamentous fungi and bacteria involved, but is usually initiated by Aspergillus niger or Aspergillus carbonarius. Usually, by the time one sees the rot there are many other organisms involved and it is difficult to attribute the disease to one species. In this study two species of Aspergillus were shown to produce a previously unknown fruiting structure in infected berries. The nodulous morphology, bearing conidia, suggests them to be an 'everted polymorphic stroma'. This structure forms freely inside the berry pulp and assumes multiple shapes and sizes, sometimes sclerotium-like in form. It is composed of a mass of vegetative hyphae with or without tissue of the host containing spores or fruiting bodies bearing spores. Artificially inoculated berries placed in soil in winter showed the possible overwintering function of the fruiting body. Inoculated berry clusters on standing vines produced fruiting structures within 21 d post inoculation when wounds were made at veraison or after (July-September). Histological studies confirmed that the fruiting structure was indeed fungal tissue. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Arabinase induction and carbon catabolite repression in Aspergillus niger and Aspergillus nidulans
Veen, van der P.
1995-01-01
The first aim of this thesis was to get a better understanding of the properties and the induction features of arabinan degrading enzymes and enzymes involved in the intracellular L-arabinose catabolic pathway in Aspergillus niger. The second aim was to understand the
Aspergillus flavus: human pathogen, allergen and mycotoxin producer.
Hedayati, M T; Pasqualotto, A C; Warn, P A; Bowyer, P; Denning, D W
2007-06-01
Aspergillus infections have grown in importance in the last years. However, most of the studies have focused on Aspergillus fumigatus, the most prevalent species in the genus. In certain locales and hospitals, Aspergillus flavus is more common in air than A. fumigatus, for unclear reasons. After A. fumigatus, A. flavus is the second leading cause of invasive aspergillosis and it is the most common cause of superficial infection. Experimental invasive infections in mice show A. flavus to be 100-fold more virulent than A. fumigatus in terms of inoculum required. Particularly common clinical syndromes associated with A. flavus include chronic granulomatous sinusitis, keratitis, cutaneous aspergillosis, wound infections and osteomyelitis following trauma and inoculation. Outbreaks associated with A. flavus appear to be associated with single or closely related strains, in contrast to those associated with A. fumigatus. In addition, A. flavus produces aflatoxins, the most toxic and potent hepatocarcinogenic natural compounds ever characterized. Accurate species identification within Aspergillus flavus complex remains difficult due to overlapping morphological and biochemical characteristics, and much taxonomic and population genetics work is necessary to better understand the species and related species. The flavus complex currently includes 23 species or varieties, including two sexual species, Petromyces alliaceus and P. albertensis. The genome of the highly related Aspergillus oryzae is completed and available; that of A. flavus in the final stages of annotation. Our understanding of A. flavus lags far behind that of A. fumigatus. Studies of the genomics, taxonomy, population genetics, pathogenicity, allergenicity and antifungal susceptibility of A. flavus are all required.
screening and improvement of local isolates of aspergillus niger
African Journals Online (AJOL)
DR. AMINU
ABSTRACT. The study involved the screening of fourteen isolates of Aspergillus niger for citric acid production from glucose. The study was aimed at screening and improving local strains of Aspergillus niger with potential for citric acid production. All the isolates screened produced varying amounts of citric acid, the highest ...
Wang, Bo; Truhlar, Donald G
2013-02-12
Tuned and balanced redistributed charge schemes have been developed for modeling the electrostatic fields of bonds that are cut by a quantum mechanical-molecular mechanical boundary in combined quantum mechanical and molecular mechanical (QM/MM) methods. First, the charge is balanced by adjusting the charge on the MM boundary atom to conserve the total charge of the entire QM/MM system. In the balanced smeared redistributed charge (BSRC) scheme, the adjusted MM boundary charge is smeared with a smearing width of 1.0 Å and is distributed in equal portions to the midpoints of the bonds between the MM boundary atom and the MM atoms bonded to it; in the balanced redistributed charge-2 (BRC2) scheme, the adjusted MM boundary charge is distributed as point charges in equal portions to the MM atoms that are bonded to the MM boundary atom. The QM subsystem is capped by a fluorine atom that is tuned to reproduce the sum of partial atomic charges of the uncapped portion of the QM subsystem. The new aspect of the present study is a new way to carry out the tuning process; in particular, the CM5 charge model, rather than the Mulliken population analysis applied in previous studies, is used for tuning the capping atom that terminates the dangling bond of the QM region. The mean unsigned error (MUE) of the QM/MM deprotonation energy for a 15-system test suite of deprotonation reactions is 2.3 kcal/mol for the tuned BSRC scheme (TBSRC) and 2.4 kcal/mol for the tuned BRC2 scheme (TBRC2). As was the case for the original tuning method based on Mulliken charges, the new tuning method performs much better than using conventional hydrogen link atoms, which have an MUE on this test set of about 7 kcal/mol. However, the new scheme eliminates the need to use small basis sets, which can be problematic, and it allows one to be more consistent by tuning the parameters with whatever basis set is appropriate for applications. (Alternatively, since the tuning parameters and partial charges
Mechanical Deformation Behavior of Lean Duplex 329LA Steel
Energy Technology Data Exchange (ETDEWEB)
Yoon, Byung-Jun [Research Institute of Industrial Science and Technology, Pohang (Korea, Republic of); Choi, Jeom-Yong [POSCO Technical Research Lab., Pohang (Korea, Republic of); Park, Kyung-Tae [Hanvat National University, Daejeon (Korea, Republic of); Lee, Ho Seong [Kyungpook National University, Daegu (Korea, Republic of)
2015-09-15
The tensile response of Lean Duplex 329LA stainless steel was investigated over various strain rates. It was observed that the mechanical response, including in particular the total elongation of the tested alloy, was strongly affected by the strain rate. As the strain rate decreased from 10-1 s-1 to 10-4 s-1, the elongation increased. As the strain rate increased, the deformation mode in an austenite phase was dominated by dislocation glide, resulting in deterioration of the elongation. The substructure of the ferritic phase showed a dislocation cell structure, independent of the applied strain rate. The optimum mechanical properties of lean duplex stainless steel thus can be obtained by controlling the deformation mode in the austenitic phase.
Mechanical Deformation Behavior of Lean Duplex 329LA Steel
International Nuclear Information System (INIS)
Yoon, Byung-Jun; Choi, Jeom-Yong; Park, Kyung-Tae; Lee, Ho Seong
2015-01-01
The tensile response of Lean Duplex 329LA stainless steel was investigated over various strain rates. It was observed that the mechanical response, including in particular the total elongation of the tested alloy, was strongly affected by the strain rate. As the strain rate decreased from 10-1 s-1 to 10-4 s-1, the elongation increased. As the strain rate increased, the deformation mode in an austenite phase was dominated by dislocation glide, resulting in deterioration of the elongation. The substructure of the ferritic phase showed a dislocation cell structure, independent of the applied strain rate. The optimum mechanical properties of lean duplex stainless steel thus can be obtained by controlling the deformation mode in the austenitic phase.
Directory of Open Access Journals (Sweden)
Karim Mardani
2010-09-01
Full Text Available Growth inhibition of Aspergillus fumigatus,Aspergillus flavus and Fusarum solani exposed to the essential oils including Thyme, Agastache and Satureja were studied. Disc Diffusion Method was used to evaluate the fungal growth inhibitory effects of the essential oils. Minimal inhibitory concentration (MIC and minimal fungicidal concentration (MFC of the oils were determined and compared with each other. The results showed that all three essential oils examined, had antifungal effects against three fungi species. The MIC data revealed that Thyme oil was the most effective essential oil with the MIC of 62.5 μl ml-1.
Partial Purification and Characterization of a Thermostable β-Mannanase from Aspergillus foetidus
Directory of Open Access Journals (Sweden)
Juliana da Conceição Infante de Marco
2015-10-01
Full Text Available An extracellular β-mannanase was isolated from samples of crude extract of the mesophilic fungus Aspergillus foetidus grown on soybean husk as a carbon source. The induction profile showed that β-mannanase reached a maximum activity level (2.0 IU/mL on the 15th day of cultivation. The enzyme was partially purified by ultrafiltration and gel filtration chromatography procedures and was named Man 58. Sodium dodecyl sulfate-polyacrilamide electrophoresis and zymogram analysis of Man 58 showed two bands of approximately 43 and 45 kDa with β-mannanase activity. Ultrafiltration showed that β-mannanase activity was only detected in the concentrated sample. Man 58 was most active at 60 °C and at pH 4.0. It was thermostable in the temperature range of 40–60 °C for eleven days, and the half-life at 70 °C was ten days. Man 58 showed Km and Vmax values of 3.29 mg/mL and 1.76 IU/mL respectively, with locust bean gum as a substrate. It was mostly activated by FeSO4 and CoCl2 and inhibited by MgSO4, FeCl3, CuSO4, MgCl2, ZnCl2, ZnSO4, CaCl2, CuCl2, KCl and ethylenediaminetetraacetic acid (EDTA. Phenolic compounds did not inhibit the enzyme. On the other hand, auto-hydrolysis liquor showed an inhibitory effect on Man 58 activity.
Czech Academy of Sciences Publication Activity Database
Nováková, Alena; Hubka, Vít; Saiz-Jimenez, C.; Kolařík, Miroslav
2012-01-01
Roč. 62, November (2012), s. 2778-2785 ISSN 1466-5026 Grant - others:GAUK(CZ) 607812 Institutional research plan: CEZ:AV0Z60660521; CEZ:AV0Z50200510 Keywords : Aspergillus baeticus sp. nov. * Aspergillus thesauricus sp.nov. * Spanish caves Subject RIV: EH - Ecology, Behaviour Impact factor: 2.112, year: 2012
Extrolites of Aspergillus fumigatus and Other Pathogenic Species in Aspergillus Section Fumigati
DEFF Research Database (Denmark)
Frisvad, Jens Christian; Larsen, Thomas Ostenfeld
2016-01-01
Aspergillus fumigatus is an important opportunistic human pathogen known for its production of a large array of extrolites. Up to 63 species have been described in Aspergillus section Fumigati, some of which have also been reliably reported to be pathogenic, including A. felis, A. fischeri, A....... fumigatiaffinis, A. fumisynnematus, A. hiratsukae, A. laciniosus, A. lentulus, A. noyofumigatus, A. parafelis, A. pseudofelis, A. pseudoyiridinutans, A. spinosus, A. therrnornutatus, and A. udagawae. These species share the production of hydrophobins, melanins, and siderophores and ability to grow well at 37 °C...
Biocatalytic potential of laccase-like multicopper oxidases from Aspergillus niger
Tamayo Ramos, J.A.; Berkel, van W.J.H.; Graaff, de L.H.
2012-01-01
BACKGROUND: Laccase-like multicopper oxidases have been reported in several Aspergillus species but they remain uncharacterized. The biocatalytic potential of the Aspergillus niger fungal pigment multicopper oxidases McoA and McoB and ascomycete laccase McoG was investigated. RESULTS: The
Challa, Sundaram; Uppin, Shantveer G; Uppin, Megha S; Pamidimukkala, Umabala; Vemu, Lakshmi
2015-06-01
Identification based on histology alone has limitations as Aspergillus species share morphology with other filamentous fungi. Differentiation of Aspergillus species from hyalohyphomycetes and dematiaceous fungi is important as the antifungal susceptibility varies among different species and genera. Given these problems, ancillary techniques are needed to increase specificity. Our aim was to study the utility of immunohistochemistry (IHC) with anti-Aspergillus antibody in the identification of Aspergillus species and to differentiate them from other filamentous fungi. Fifty formalin fixed, paraffin embedded tissue sections including 47 from cases of culture proven filamentous fungi, 3 from colonies of cultures of hyalohyphomycetes, and 11 smears from cultures were subjected to IHC studies using polyclonal rabbit anti-Aspergillus antibody (Abcam, UK) after antigen retrieval. The IHC on tissue sections was positive in 88% cases involving culture proven Aspergillus species. There was no cross reactivity with Mucorales species, Candida species, dematiaceous fungi and hyalohyphomycetes. Hence immunohistochemistry can be used as an ancillary technique for the diagnosis of Aspergillus species. © The Author 2015. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Phylogeny of xerophilic aspergilli (subgenus Aspergillus and taxonomic revision of section Restricti
Directory of Open Access Journals (Sweden)
F. Sklenář
2017-09-01
The vast majority of species in sect. Restricti produce asperglaucide, asperphenamate or both in contrast to species in sect. Aspergillus. Mycophenolic acid was detected for the first time in at least six members of the section. The ascomata of A. halophilicus do not contain auroglaucin, epiheveadride or flavoglaucin which are common in sect. Aspergillus, but shares the echinulins with sect. Aspergillus.
Health effects of Aspergillus in food and air.
Klich, Maren A
2009-01-01
This review summarizes the health aspects of the medically important fungal genus Aspergillus. The morphology and systematics of the genus are explained as well as its biogeography. Major mycotoxins, the aspergilli that produce them, affected crops, and symptoms of the toxicoses are summarized, as are the major mycoses caused by aspergilli. The current status of the relationship between Aspergillus in the indoor environment and health issues are discussed.
Lee, Kim-Chung; Tam, Emily W T; Lo, Ka-Ching; Tsang, Alan K L; Lau, Candy C Y; To, Kelvin K W; Chan, Jasper F W; Lam, Ching-Wan; Yuen, Kwok-Yung; Lau, Susanna K P; Woo, Patrick C Y
2015-06-17
Infections related to Aspergillus species have emerged to become an important focus in infectious diseases, as a result of the increasing use of immunosuppressive agents and high fatality associated with invasive aspergillosis. However, laboratory diagnosis of Aspergillus infections remains difficult. In this study, by comparing the metabolomic profiles of the culture supernatants of 30 strains of six pathogenic Aspergillus species (A. fumigatus, A. flavus, A. niger, A. terreus, A. nomius and A. tamarii) and 31 strains of 10 non-Aspergillus fungi, eight compounds present in all strains of the six Aspergillus species but not in any strain of the non-Aspergillus fungi were observed. One of the eight compounds, Leu-Glu-Leu-Glu, is a novel tetrapeptide and represents the first linear tetrapeptide observed in Aspergillus species, which we propose to be named aspergitide. Two other closely related Aspergillus-specific compounds, hydroxy-(sulfooxy)benzoic acid and (sulfooxy)benzoic acid, may possess anti-inflammatory properties, as 2-(sulfooxy)benzoic acid possesses a structure similar to those of aspirin [2-(acetoxy)benzoic acid] and salicylic acid (2-hydroxybenzoic acid). Further studies to examine the potentials of these Aspergillus-specific compounds for laboratory diagnosis of aspergillosis are warranted and further experiments will reveal whether Leu-Glu-Leu-Glu, hydroxy-(sulfooxy)benzoic acid and (sulfooxy)benzoic acid are virulent factors of the pathogenic Aspergillus species.
Pricope, D; Deneuville, E; Frain, S; Chevrier, S; Belaz, S; Roussey, M; Gangneux, J-P
2015-06-01
The sources of exposure during diseases due to Aspergillus fungi in cystic fibrosis patients are still poorly explored. We assessed home fungal exposure in patients suffering from cystic fibrosis and analysed its impact on the presence of Aspergillus biological markers, the colonisation of airways, as well as the sensitization and Aspergillus serology. Between March 2012 and August 2012, 34 patients benefited from a visit performed by a home environment medical adviser including sampling for mycological analysis. The number of colonies of Aspergillus was not significantly different in the various sampling sites (P=0.251), but the number of non-Aspergillus colonies was much higher in the kitchen (P=0.0045). Subsequently, home fungal exposure was compared between the groups "absence of Aspergillus-related markers" and "presence of Aspergillus-related markers". Home exposure to Aspergillus (P=0.453) and non-Aspergillus (P=0.972) flora was not significant between the 2 groups. Within this series of 34 patients that should be expanded, we note an absence of clear relationship between home exposure and the Aspergillus-linked markers in patients suffering from cystic fibrosis. This result should be taken into account regarding too restrictive hygiene advices provided to families, given the fact that fungal exposure can also results from activities performed away from home. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Triazole resistance surveillance in Aspergillus fumigatus.
Resendiz Sharpe, Agustin; Lagrou, Katrien; Meis, Jacques F; Chowdhary, Anuradha; Lockhart, Shawn R; Verweij, Paul E
2018-04-01
Triazole resistance is an increasing concern in the opportunistic mold Aspergillus fumigatus. Resistance can develop through exposure to azole compounds during azole therapy or in the environment. Resistance mutations are commonly found in the Cyp51A-gene, although other known and unknown resistance mechanisms may be present. Surveillance studies show triazole resistance in six continents, although the presence of resistance remains unknown in many countries. In most countries, resistance mutations associated with the environment dominate, but it remains unclear if these resistance traits predominately migrate or arise locally. Patients with triazole-resistant aspergillus disease may fail to antifungal therapy, but only a limited number of cohort studies have been performed that show conflicting results. Treatment failure might be due to diagnostic delay or due to the limited number of alternative treatment options. The ISHAM/ECMM Aspergillus Resistance Surveillance working group was set up to facilitate surveillance studies and stimulate international collaborations. Important aims are to determine the resistance epidemiology in countries where this information is currently lacking, to gain more insight in the clinical implications of triazole resistance through a registry and to unify nomenclature through consensus definitions.
Phosphate solubilizing ability of two Arctic Aspergillus niger strains
Directory of Open Access Journals (Sweden)
Shiv Mohan Singh,
2011-06-01
Full Text Available Many filamentous fungi were isolated from the soils of Ny-Ålesund, Spitsbergen, Svalbard, and were screened in vitro for their phosphate solubilizing ability. Two strains of Aspergillus niger showed good tricalcium phosphate (TCP solubilizing ability in Pikovskaya's medium. The TCP solubilization index was calculated at varying levels of pH and temperatures. The ability of Aspergillus niger strain-1 to solubilize and release inorganic-P was 285 µg ml–1, while Aspergillus niger strain-2 solubilized 262 µg ml–1 from 0.5% TCP after seven days. This is the first report of TCP solubilization by Arctic strains that may serve as very good phosphate solubilizers in the form of biofertilizer.
Specific detection of Aspergillus fumigatus in sputum sample of ...
African Journals Online (AJOL)
We developed a two-step PCR assay that specifically amplifies a region of the 18S rRNA gene that is highly conserved in Aspergillus fumigatus. This assay allows direct and rapid detection of down to 10 fg of Aspergillus fumigatus DNA corresponding to 1 to 5 colony forming unit (CFU) per ml of sputum sample of pulmonary ...
Genome sequence of Aspergillus luchuensis NBRC 4314
Yamada, Osamu; Machida, Masayuki; Hosoyama, Akira; Goto, Masatoshi; Takahashi, Toru; Futagami, Taiki; Yamagata, Youhei; Takeuchi, Michio; Kobayashi, Tetsuo; Koike, Hideaki; Abe, Keietsu; Asai, Kiyoshi; Arita, Masanori; Fujita, Nobuyuki; Fukuda, Kazuro; Higa, Ken-ichi; Horikawa, Hiroshi; Ishikawa, Takeaki; Jinno, Koji; Kato, Yumiko; Kirimura, Kohtaro; Mizutani, Osamu; Nakasone, Kaoru; Sano, Motoaki; Shiraishi, Yohei; Tsukahara, Masatoshi; Gomi, Katsuya
2016-01-01
Awamori is a traditional distilled beverage made from steamed Thai-Indica rice in Okinawa, Japan. For brewing the liquor, two microbes, local kuro (black) koji mold Aspergillus luchuensis and awamori yeast Saccharomyces cerevisiae are involved. In contrast, that yeasts are used for ethanol fermentation throughout the world, a characteristic of Japanese fermentation industries is the use of Aspergillus molds as a source of enzymes for the maceration and saccharification of raw materials. Here we report the draft genome of a kuro (black) koji mold, A. luchuensis NBRC 4314 (RIB 2604). The total length of nonredundant sequences was nearly 34.7 Mb, comprising approximately 2,300 contigs with 16 telomere-like sequences. In total, 11,691 genes were predicted to encode proteins. Most of the housekeeping genes, such as transcription factors and N-and O-glycosylation system, were conserved with respect to Aspergillus niger and Aspergillus oryzae. An alternative oxidase and acid-stable α-amylase regarding citric acid production and fermentation at a low pH as well as a unique glutamic peptidase were also found in the genome. Furthermore, key biosynthetic gene clusters of ochratoxin A and fumonisin B were absent when compared with A. niger genome, showing the safety of A. luchuensis for food and beverage production. This genome information will facilitate not only comparative genomics with industrial kuro-koji molds, but also molecular breeding of the molds in improvements of awamori fermentation. PMID:27651094
Fractal supersymmetric QM, Geometric Probability and the Riemann Hypothesis
Castro, C
2004-01-01
The Riemann's hypothesis (RH) states that the nontrivial zeros of the Riemann zeta-function are of the form $ s_n =1/2+i\\lambda_n $. Earlier work on the RH based on supersymmetric QM, whose potential was related to the Gauss-Jacobi theta series, allows to provide the proper framework to construct the well defined algorithm to compute the probability to find a zero (an infinity of zeros) in the critical line. Geometric probability theory furnishes the answer to the very difficult question whether the probability that the RH is true is indeed equal to unity or not. To test the validity of this geometric probabilistic framework to compute the probability if the RH is true, we apply it directly to the the hyperbolic sine function $ \\sinh (s) $ case which obeys a trivial analog of the RH (the HSRH). Its zeros are equally spaced in the imaginary axis $ s_n = 0 + i n \\pi $. The geometric probability to find a zero (and an infinity of zeros) in the imaginary axis is exactly unity. We proceed with a fractal supersymme...
SACCHAROMYCES CEREVISIAE AND ASPERGILLUS NIGER
African Journals Online (AJOL)
DR. AMINU
increase in ethanol production and cell growth increased with time of fermentation. ... fuel for automobiles. ... growth was determined by measuring the cell density .... Direct fermentation of potato starch to ethanol by co-cultures of Aspergillus.
Immunoproteomics of Aspergillus for the development of biomarkers and immunotherapies.
Kniemeyer, Olaf; Ebel, Frank; Krüger, Thomas; Bacher, Petra; Scheffold, Alexander; Luo, Ting; Strassburger, Maria; Brakhage, Axel A
2016-10-01
Filamentous fungi of the genus Aspergillus play significant roles as pathogens causing superficial and invasive infections as well as allergic reactions in humans. Particularly invasive mycoses caused by Aspergillus species are characterized by high mortality rates due to difficult diagnosis and insufficient antifungal therapy. The application of immunoproteomic approaches has a great potential to identify new targets for the diagnosis, therapy, and vaccine development of diseases caused by Aspergillus species. Serological proteome analyses (SERPA) that combine 2D electrophoresis with Western blotting are still one of the most popular techniques for the identification of antigenic proteins. However, recently a growing number of approaches have been developed to identify proteins, which either provoke an antibody response or which represent targets of T-cell immunity in patients with allergy or fungal infections. Here, we review advances in the studies of immune responses against pathogenic Aspergilli as well as the current status of diagnosis and immunotherapy of Aspergillus infections. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Aspergillus oerlinghausenensis, a new mould species closely related to A. fumigatus
Houbraken, Jos; Weig, Michael; Groß, Uwe; Meijer, Martin; Bader, Oliver
2015-01-01
Two isolates belonging to Aspergillus section Fumigati were recovered from German soil on itraconazole containing agar media. Phylogenetic analysis and phenotypic characterization of both isolates show that they represent a novel species named Aspergillus oerlinghausenensis (holotype CBS
DEFF Research Database (Denmark)
Varga, János; Kocsubé, Sándor; Tóth, Beáta
2007-01-01
to produce ochratoxin A, kotanins, funalenone or pyranonigrins. The novel species was most closely related to A. niger, and was isolated from soil from Brazil, Australia, USA and The Netherlands, and from grape berries from Portugal. The type strain of Aspergillus brasiliensis sp. nov. is CBS 101740(T) (=IM...
(+)-Geodin from Aspergillus terreus
DEFF Research Database (Denmark)
Rønnest, Mads Holger; Nielsen, Morten Thrane; Leber, Blanka
2011-01-01
The fungal metabolite (+)-geodin [systematic name: (2R)-methyl 5,7-dichloro-4-hydroxy-6'-methoxy-6-methyl-3,4'-dioxospiro[benzofuran-2,1'-cyclohexa-2',5'-diene]-2'-carboxylate], C(17)H(12)Cl(2)O(7), was isolated from Aspergillus terreus. The crystal structure contains two independent molecules...
Comparative Reannotation of 21 Aspergillus Genomes
Energy Technology Data Exchange (ETDEWEB)
Salamov, Asaf; Riley, Robert; Kuo, Alan; Grigoriev, Igor
2013-03-08
We used comparative gene modeling to reannotate 21 Aspergillus genomes. Initial automatic annotation of individual genomes may contain some errors of different nature, e.g. missing genes, incorrect exon-intron structures, 'chimeras', which fuse 2 or more real genes or alternatively splitting some real genes into 2 or more models. The main premise behind the comparative modeling approach is that for closely related genomes most orthologous families have the same conserved gene structure. The algorithm maps all gene models predicted in each individual Aspergillus genome to the other genomes and, for each locus, selects from potentially many competing models, the one which most closely resembles the orthologous genes from other genomes. This procedure is iterated until no further change in gene models is observed. For Aspergillus genomes we predicted in total 4503 new gene models ( ~;;2percent per genome), supported by comparative analysis, additionally correcting ~;;18percent of old gene models. This resulted in a total of 4065 more genes with annotated PFAM domains (~;;3percent increase per genome). Analysis of a few genomes with EST/transcriptomics data shows that the new annotation sets also have a higher number of EST-supported splice sites at exon-intron boundaries.
Aspergillus serology: Have we arrived yet?
Richardson, Malcolm D; Page, Iain D
2017-01-01
Aspergillosis presents in various clinical forms, among them chronic pulmonary aspergillosis, which is a spectrum of disease entities including aspergilloma, chronic cavitary pulmonary aspergillosis, and chronic fibrosing pulmonary aspergillosis. Aspergillus also contributes to fungal allergy and sensitization. Analysis of the immune response to Aspergillus and its antigens is an integral part of the diagnosis of these diseases. Over the past half century, the techniques used to determine antibody titers have evolved from testing for precipitating and agglutinating antibodies by agar gel double diffusion and immunolectrophoresis to enzyme-linked immunosorbent assays using recombinant proteins as capture antigens. A resurgence of interest in the detection of immunoglobulins, primarily Aspergillus-specific IgG, has hinted at the possibility of distinguishing between colonization and invasion in immunocompromised patients with invasive aspergillosis. Even though there appears to be a greater degree of discrimination between the clinical forms of aspergillosis there is still a long way to travel. This review presents illustrative examples of where new diagnostic platforms and technologies have been applied to this intriguing spectrum of diseases. © The Authors 2016. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Ioannou, Petros; Andrianaki, Aggeliki; Akoumianaki, Tonia; Kyrmizi, Irene; Albert, Nathaniel; Perlin, David; Samonis, George
2015-01-01
The modest in vitro activity of echinocandins against Aspergillus implies that host-related factors augment the action of these antifungal agents in vivo. We found that, in contrast to the other antifungal agents (voriconazole, amphotericin B) tested, caspofungin exhibited a profound increase in activity against various Aspergillus species under conditions of cell culture growth, as evidenced by a ≥4-fold decrease in minimum effective concentrations (MECs) (P = 0. 0005). Importantly, the enhanced activity of caspofungin against Aspergillus spp. under cell culture conditions was strictly dependent on serum albumin and was not observed with the other two echinocandins, micafungin and anidulafungin. Of interest, fluorescently labeled albumin bound preferentially on the surface of germinating Aspergillus hyphae, and this interaction was further enhanced upon treatment with caspofungin. In addition, supplementation of cell culture medium with albumin resulted in a significant, 5-fold increase in association of fluorescently labeled caspofungin with Aspergillus hyphae (P Aspergillus hyphae. PMID:26643329
Viegas, Carla; Moreira, Ricardo; Faria, Tiago; Caetano, Liliana Aranha; Carolino, Elisabete; Gomes, Anita Quintal; Viegas, Susana
2018-05-04
The frequency and importance of Aspergillus infections is increasing worldwide. This study aimed to assess the occupational exposure of forklifts and taxi drivers to Aspergillus spp. Nineteen filters from air conditioning system of taxis, 17 from forklifts and 37 from personal vehicles were assessed. Filters extract were streaked onto MEA, DG18 and in azole-supplemented media. Real-time quantitative PCR amplification of selected Aspergillus species-complex was also performed. Forklifts filter samples presented higher median values. Aspergillus section Nigri was the most observed in forklifts filters in MEA (28.2%) and in azole-supplemented media. DNA from Aspergillus sections Fumigati and Versicolores was successfully amplified by qPCR. This study enlightens the added value of using filters from the air conditioning system to assess Aspergillus spp. occupational exposure. Aspergillus azole resistance screening should be included in future occupational exposure assessments.
Biodiversity of Aspergillus species in some important agricultural products.
Perrone, G; Susca, A; Cozzi, G; Ehrlich, K; Varga, J; Frisvad, J C; Meijer, M; Noonim, P; Mahakarnchanakul, W; Samson, R A
2007-01-01
The genus Aspergillus is one of the most important filamentous fungal genera. Aspergillus species are used in the fermentation industry, but they are also responsible of various plant and food secondary rot, with the consequence of possible accumulation of mycotoxins. The aflatoxin producing A. flavus and A. parasiticus, and ochratoxinogenic A. niger, A. ochraceus and A. carbonarius species are frequently encountered in agricultural products. Studies on the biodiversity of toxigenic Aspergillus species is useful to clarify molecular, ecological and biochemical characteristics of the different species in relation to their different adaptation to environmental and geographical conditions, and to their potential toxigenicity. Here we analyzed the biodiversity of ochratoxin producing species occurring on two important crops: grapes and coffee, and the genetic diversity of A. flavus populations occurring in agricultural fields. Altogether nine different black Aspergillus species can be found on grapes which are often difficult to identify with classical methods. The polyphasic approach used in our studies led to the identification of three new species occurring on grapes: A. brasiliensis, A. ibericus, and A. uvarum. Similar studies on the Aspergillus species occurring on coffee beans have evidenced in the last five years that A. carbonarius is an important source of ochratoxin A in coffee. Four new species within the black aspergilli were also identified in coffee beans: A. sclerotioniger, A. lacticoffeatus, A. sclerotiicarbonarius, and A. aculeatinus. The genetic diversity within A. flavus populations has been widely studied in relation to their potential aflatoxigenicity and morphological variants L- and S-strains. Within A. flavus and other Aspergillus species capable of aflatoxin production, considerable diversity is found. We summarise the main recent achievements in the diversity of the aflatoxin gene cluster in A. flavus populations, A. parasiticus and the non
29 CFR 779.329 - Effect of type of customer and type of goods or services.
2010-07-01
... 29 Labor 3 2010-07-01 2010-07-01 false Effect of type of customer and type of goods or services... FAIR LABOR STANDARDS ACT AS APPLIED TO RETAILERS OF GOODS OR SERVICES Exemptions for Certain Retail or Service Establishments ârecognizedâ As Retail âin the Particular Industryâ § 779.329 Effect of type of...
A.C.A.P. Leenders (Alexander); A.F. van Belkum (Alex); M.D. Behrendt (Myra); A. Luijendijk (Ad); H.A. Verbrugh (Henri)
1999-01-01
textabstractAfter five patients were diagnosed with nosocomial invasive aspergillosis caused by Aspergillus fumigatus and A. flavus, a 14-month surveillance program for pathogenic and nonpathogenic fungal conidia in the air within and outside the University Hospital in
Hayashi, Shigehiko; Uchida, Yoshihiro; Hasegawa, Taisuke; Higashi, Masahiro; Kosugi, Takahiro; Kamiya, Motoshi
2017-05-05
Many remarkable molecular functions of proteins use their characteristic global and slow conformational dynamics through coupling of local chemical states in reaction centers with global conformational changes of proteins. To theoretically examine the functional processes of proteins in atomic detail, a methodology of quantum mechanical/molecular mechanical (QM/MM) free-energy geometry optimization is introduced. In the methodology, a geometry optimization of a local reaction center is performed with a quantum mechanical calculation on a free-energy surface constructed with conformational samples of the surrounding protein environment obtained by a molecular dynamics simulation with a molecular mechanics force field. Geometry optimizations on extensive free-energy surfaces by a QM/MM reweighting free-energy self-consistent field method designed to be variationally consistent and computationally efficient have enabled examinations of the multiscale molecular coupling of local chemical states with global protein conformational changes in functional processes and analysis and design of protein mutants with novel functional properties.
Directory of Open Access Journals (Sweden)
Paulo de Tarso Oliveira Ferreira
2007-09-01
Full Text Available Solano-violeta (Solanum violaefolium é uma planta ornamental rasteira usada para cobrir solos de áreas sombreadas. Um vírus que induz manchas anelares nas folhas desta planta, tentativamente designado Solanum violaefolium ringspot virus - SvRSV, transmitido pelo ácaro Brevipalpus phoenicis (Acari: Tenuipalpidae foi encontrado em Piracicaba, SP. Trata-se de um vírus baciliforme que se assemelha a outros vírus do tipo citoplasmático transmitidos por Brevipalpus sp. Este trabalho teve como objetivo relatar propriedades biológicas e estabelecer uma caracterização molecular parcial do SvRSV. O vírus pode ser transmitido mecanicamente a várias outras espécies botânicas, causando lesões localizadas. Entre as espécies avaliadas, Datura stramonium mostrou-se a melhor hospedeira experimental. Observou-se também a manifestação de sintomas nestas plantas após infestação das mesmas por B. obovatus previamente alimentado em lesões de SvRSV, confirmando esta outra espécie de ácaro como vetor do vírus. Suas propriedades físicas in vitro foram: temperatura de inativação 40-45 ºC; ponto final de diluição 10-3-10-4; longevidade in vitro 12 dias. Em secções ultrafinas, as partículas do SvRSV mostraram-se levemente mais delgadas e mais longas que as de outros vírus do mesmo grupo. A partir do dsRNA do SvRSV foi construída uma biblioteca de cDNA e foram identificadas duas possíveis regiões codificadoras das proteínas de movimento e replicase viral. Baseado nestas regiões foram desenhados "primers" para amplificação do RNA do SvRSV por RT-PCR. Sondas baseadas nas seqüências obtidas hibridizaram com ss- e dsRNA de D. stramonium infectadas pelo vírus. Ensaios preliminares de RT-PCR e hibridização não resultaram em reação com o vírus da leprose dos citros, tipo citoplasmático (CiLV-C.Solanum violaefolium is an ornamental plant, with prostrate, trailing growth habit and is cultivated in shaded areas. A virus that causes
Selection arena in Aspergillus nidulans
Bruggeman, J.; Debets, A.J.M.; Hoekstra, R.F.
2004-01-01
The selection arena hypothesis states that overproduction of zygotes-a widespread phenomenon in animals and plants-can be explained as a mechanism of progeny choice. As a similar mechanism, the ascomycetous fungus Aspergillus nidulans may overproduce dikaryotic fruit initials, hereafter called
Takahashi, Tadashi; Masuda, Tsutomu; Koyama, Yasuji
2006-01-01
Ku genes play a key role in the non-homologous end-joining pathway. We have identified Ku70 and Ku80 homologs in the koji molds Aspergillus sojae and Aspergillus oryzae, and have constructed the disruption mutants of Ku70, Ku80, and Ku70-80 to characterize the phenotypic change in these mutants. Neither Ku70- nor Ku80-disrupted strains show hypersensitivity to the DNA damaging agents methylmethane sulfonate (MMS) and phleomycin. Moreover, undesirable phenotypes, such as poor growth or repressed conidiospore formation, were not observed in the Ku-disrupted A. sojae and A. oryzae.
Directory of Open Access Journals (Sweden)
Hélène Guegan
2018-03-01
Full Text Available Aspergillus fumigatus triazole resistance is an emerging concern for treating chronically infected/colonized patients. This study sought to evaluate the performance of PCR assays to detect Aspergillus fungi together with azole resistance in sputum samples from cystic fibrosis (CF patients. In total, 119 sputum samples from 87 CF patients were prospectively processed for Aspergillus detection by means of mycological culture and four qPCR assays, 2 in-house methods and two commercial multiplex real-time PCR assays simultaneously detecting Aspergillus and the most relevant cyp51A gene mutations (MycoGENIE® and AsperGenius®. Azole susceptibility of A. fumigatus isolates was assessed using Etest® method and cyp51A gene mutation were characterized by sequencing. The overall rate of Aspergillus detection with the four qPCR assays ranged from 47.9 to 57.1%, contrasting with 42/119 (35.3% positive cultures with A. fumigatus. The high sensitivity of PCR on sputum could then contribute to more effective grading of Aspergillus disease in CF patients. Five out of 41 isolated strains (12.2% exhibited azole-resistant MIC patterns, three of which harbored cyp51A mutations and only 1/3 with the sequence TR34/L98H. Combined with culture, PCR assay achieved high sensitivity Aspergillus screening in CF samples. However, cyp51A targeting was only moderately effective for azole resistance monitoring, while Aspergillus resistance remains of great concern.
Aspergillus in chronic lung disease: Modeling what goes on in the airways.
Takazono, Takahiro; Sheppard, Donald C
2017-01-01
Aspergillus species cause a range of respiratory diseases in humans. While immunocompromised patients are at risk for the development of invasive infection with these opportunistic molds, patients with underlying pulmonary disease can develop chronic airway infection with Aspergillus species. These conditions span a range of inflammatory and allergic diseases including Aspergillus bronchitis, allergic bronchopulmonary aspergillosis, and severe asthma with fungal sensitization. Animal models are invaluable tools for the study of the molecular mechanism underlying the colonization of airways by Aspergillus and the host response to these non-invasive infections. In this review we summarize the state-of-the-art with respect to the available animal models of noninvasive and allergic Aspergillus airway disease; the key findings of host-pathogen interaction studies using these models; and the limitations and future directions that should guide the development and use of models for the study of these important pulmonary conditions. © The Author 2016. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
ALPHA-AMYLASE PRODUCTION FROM Aspergillus oryzae M BY SUBMERGED FERMENTATION
Directory of Open Access Journals (Sweden)
Suleimenova
2016-08-01
Full Text Available The main goal of present study was implementation of the Aspergillus oryzae M strain improved technology using earlier developed method of microorganism selection. 8 pure strains of Aspergillus fungi were screened for the production of extra cellular alpha-amylase using agar medium with starch as a substrate and incubated for 72h at 30 ºС. Zone of clearance was observed for screening of the amylolytic fungi (in mm. Aspergillus oryzae M has demonstrated the highest zone of clearance. Aspergillus oryzae M was cultivated for 42 days in submerged conditions of growth using new method of fungal cultivation. This method based on immobilizing enzymes producers on solid career in submerged conditions of growth gives the way to improve quality of filtrates, which remain clear, does not require additional filtering and easily separated from the mycelium. Moreover, it allows to prolong the process of fungal cultivation and to maintain high enzymatic activity for a long period of time. Presented method allowed increasing alpha-amylase production from 321 U/ml (before immobilization to 502 U/ml (after immobilization.
Energy Technology Data Exchange (ETDEWEB)
Chofor, Ndimofor; Harder, Dietrich; Selbach, Hans-Joachim; Poppe, Bjoern [University of Oldenburg and Pius-Hospital Oldenburg (Germany). Medical Radiation Physics Group
2016-11-01
The application of various radiation detectors for brachytherapy dosimetry has motivated this study of the energy dependence of radiation quality correction factor k{sub Q,M}, the quotient of the detector responses under calibration conditions at a {sup 60}Co unit and under the given non-reference conditions at the point of measurement, M, occurring in photon brachytherapy. The investigated detectors comprise TLD, radiochromic film, ESR, Si diode, plastic scintillator and diamond crystal detectors as well as ionization chambers of various sizes, whose measured response-energy relationships, taken from the literature, served as input data. Brachytherapy photon fields were Monte-Carlo simulated for an ideal isotropic {sup 192}Ir point source, a model spherical {sup 192}Ir source with steel encapsulation and a commercial HDR GammaMed Plus source. The radial source distance was varied within cylindrical water phantoms with outer radii ranging from 10 to 30 cm and heights from 20 to 60 cm. By application of this semiempirical method - originally developed for teletherapy dosimetry - it has been shown that factor k{sub Q,M} is closely correlated with a single variable, the fluence-weighted mean photon energy anti E{sub F} at the point of measurement. The radial profiles of anti E{sub F} obtained with either the commercial {sup 192}Ir source or the two simplified source variants show little variation. The observed correlations between parameters k{sub Q,M} and anti E{sub F} are represented by fitting formulae for all investigated detectors, and further variation of the detector type is foreseen. The herewith established close correlation of radiation quality correction factor k{sub Q,M} with local mean photon energy anti E{sub F} can be regarded as a simple regularity, facilitating the practical application of correction factor k{sub Q,M} for in-phantom dosimetry around {sup 192}Ir brachytherapy sources. anti E{sub F} values can be assessed by Monte Carlo simulation or
Rahim, Muhamad Hafiz Abd; Hasan, Hanan; Harith, Hanis H; Abbas, Ali
2017-12-01
This study investigates the effects of viscosity, friction, and sonication on the morphology and the production of lovastatin, (+)-geodin, and sulochrin by Aspergillus terreus ATCC 20542. Sodium alginate and gelatine were used to protect the fungal pellet from mechanical force by increasing the media viscosity. Sodium alginate stimulated the production of lovastatin by up to 329.0% and sulochrin by 128.7%, with inhibitory effect on (+)-geodin production at all concentrations used. However, the use of gelatine to increase viscosity significantly suppressed lovastatin, (+)-geodin, and sulochrin's production (maximum reduction at day 9 of 42.7, 60.8, and 68.3%, respectively), which indicated that the types of chemical play a major role in metabolite production. Higher viscosity increased both pellet biomass and size in all conditions. Friction significantly increased (+)-geodin's titre by 1527.5%, lovastatin by 511.1%, and sulochrin by 784.4% while reducing pellet biomass and size. Conversely, sonication produced disperse filamentous morphology with significantly lower metabolites. Sodium alginate-induced lovastatin and sulochrin production suggest that these metabolites are not affected by viscosity; rather, their production is affected by the specific action of certain chemicals. In contrast, low viscosity adversely affected (+)-geodin's production, while pellet disintegration can cause a significant production of (+)-geodin.
Energy Technology Data Exchange (ETDEWEB)
Blanco, M.J.
1991-12-31
Native or pretreated biomass from Onopordum nervosum boiss, has been examined as candidate feedstock for cellulase production by two mutant strain of trichoderma longibrachiatum QM9414 and Rut C30. Batch cultivation methods were evaluated and compared with previous experiments using ball-milled, crystalline cellulose (Solka floc). Batch cultivation of T. longibrachiatum Rut C30 on 55% (W/V) acid pretreated O. nervosum biomass yielded enzyme productivities and activities comparable to those obtained on Solka floc. However, the overall enzyme production performance was lower than on Solka floc at comparable cellulose concentrations. This fact may be due to the accumulation of pretreated by products and lignin in the fermentor.(author)
Energy Technology Data Exchange (ETDEWEB)
Blanco, M.J.
1991-01-01
Native or pretreated biomass from Onopordum nervosum boiss, has been examined as candidate feedstock for cellulase production by two mutant strain of trichoderma longibrachiatum QM9414 and Rut C30. Batch cultivation methods were evaluated and compared with previous experiments using ball-milled, crystalline cellulose (Solka floc). Batch cultivation of T. longibrachiatum Rut C30 on 55% (W/V) acid pretreated O. nervosum biomass yielded enzyme productivities and activities comparable to those obtained on Solka floc. However, the overall enzyme production performance was lower than on Solka floc at comparable cellulose concentrations. This fact may be due to the accumulation of pretreated by products and lignin in the fermentor.(author)
Energy Technology Data Exchange (ETDEWEB)
Ribeiro, J. [Departamento de Microbiologia e Inmunologia Veterinaria, Universidad Federal Rural de Rio de Janeiro (UFRRJ) (Brazil); Cavaglieri, L., E-mail: lcavaglieri@arnet.com.a [Departamento de Microbiologia e Inmunologia, Universidad Nacional de Rio Cuarto (UNRC), Rio Cuarto, Cordoba (Argentina); Member of Consejo Nacional de Investigaciones Cientificas y Tecnologicas (CIC-CONICET) (Argentina); Vital, H. [Centro Tecnologico do Exercito (CTEx), Secao de Defesa Nuclear, Rio de Janeiro (Brazil); Cristofolini, A.; Merkis, C. [Departamento de Microscopia Electronica, Universidad Nacional de Rio Cuarto. Ruta 36 km 601 (5800) Rio Cuarto (Argentina); Astoreca, A. [Departamento de Microbiologia e Inmunologia, Universidad Nacional de Rio Cuarto (UNRC), Rio Cuarto, Cordoba (Argentina); Member of Consejo Nacional de Investigaciones Cientificas y Tecnologicas (CIC-CONICET) (Argentina); Orlando, J.; Caru, M. [Departamento de Ciencias Ecologicas, Facultad de Ciencias, Universidad de Chile, Santiago (Chile); Dalcero, A. [Departamento de Microbiologia e Inmunologia, Universidad Nacional de Rio Cuarto (UNRC), Rio Cuarto, Cordoba (Argentina); Member of Consejo Nacional de Investigaciones Cientificas y Tecnologicas (CIC-CONICET) (Argentina); Rosa, C.A.R. [Departamento de Microbiologia e Inmunologia Veterinaria, Universidad Federal Rural de Rio de Janeiro (UFRRJ) (Brazil); Member of Consejo Nacional de Pesquisas (CNPq) (Brazil)
2011-05-15
The aim of this work was to study the effect of gamma radiation (2 kGy) on Aspergillus flavus and Aspergillus ochraceus ultrastructure. Moreover, the influence on aflatoxin B{sub 1} and ochratoxin A production was also observed. Irradiated A. flavus strain showed a dull orangish colony while control strain showed the typical green color. Minor differences were observed on stipes, metulae and conidia size between control and irradiated A. flavus and A. ochraceus strains. Irradiated fungi showed ultrastructural changes on cell wall, plasmalema and cytoplasm levels. The levels of mycotoxins produced by irradiated strains were two times greater than those produced by control strains. Successive transferences of irradiated strains on malt extract agar allowed the fungus to recuperate morphological characteristics. Although minor changes in the fungal morphology were observed, ultrastructural changes at cell wall level and the increase of mycotoxin production ability were observed. Inappropriate storage of irradiated food and feed would allow the development of potentially more toxicogenic fungal propagules.
International Nuclear Information System (INIS)
Ribeiro, J.; Cavaglieri, L.; Vital, H.; Cristofolini, A.; Merkis, C.; Astoreca, A.; Orlando, J.; Caru, M.; Dalcero, A.; Rosa, C.A.R.
2011-01-01
The aim of this work was to study the effect of gamma radiation (2 kGy) on Aspergillus flavus and Aspergillus ochraceus ultrastructure. Moreover, the influence on aflatoxin B 1 and ochratoxin A production was also observed. Irradiated A. flavus strain showed a dull orangish colony while control strain showed the typical green color. Minor differences were observed on stipes, metulae and conidia size between control and irradiated A. flavus and A. ochraceus strains. Irradiated fungi showed ultrastructural changes on cell wall, plasmalema and cytoplasm levels. The levels of mycotoxins produced by irradiated strains were two times greater than those produced by control strains. Successive transferences of irradiated strains on malt extract agar allowed the fungus to recuperate morphological characteristics. Although minor changes in the fungal morphology were observed, ultrastructural changes at cell wall level and the increase of mycotoxin production ability were observed. Inappropriate storage of irradiated food and feed would allow the development of potentially more toxicogenic fungal propagules.
Directory of Open Access Journals (Sweden)
Kenzheakhmet N.
2017-12-01
Full Text Available Objective: Little is known about diplomatic relations between the Jūchīd Ulūs and Ming China (1368–1644, even though some evidence of early tributary trade relations exists. The first extant Chinese account about the country of Salai (Saray dates to around 1394, when accounts of diplomatic exchange between the Ming court and the Jūchīd Ulūs began to appear in the Ming shilu (The Veritable Records of the Ming. Research materials: This article analyzes the Ming shilu in order to understand the character of Chinese knowledge about the Jūchīd Ulūs during their years of contact between 1394 and 1456. Additional sources like geographic accounts and maps help define the extent of Chinese knowledge about the khanate, clarify the kinds of information that the Chinese sought and the reasons why, and measure the influence of cross-cultural contact on Ming Chinese understanding of the Jūchīd Ulūs. Results and novelty of the research: The Ming shilu suggests that at least by the end of the fourteenth and the early years of the fifteenth century, Salai (Saray became an integral, and possibly the most important, element in the name that the Ming court used for the country of the Jūchīd Ulūs. The Persian and Mongol historians used the term Tūqmāq and Togmog to refer to the Jūchīd Ulūs, while Ming Chinese historians used the term Tuohema to refer to the Jūchīd Ulūs or the whole Dasht-i Qipchāq, in post-Mongol Central Eurasia. The diplomatic contact between Ming China and the Tuohuma occurred through the Chinese system of tribute trade during the mid-fifteenth century. Under the reign of Yongle (1402–1424, Zhengtong (1435–1449, and Jingtai (1449–1457, the foundations for a flourishing relationship between Ming China and the Jūchīd Ulūs were established. At that time, the Chinese knew the Jūchīd Ulūs by the name Salai (Saray and Tuohuma (Tūqmāq. Despite the political turmoil that erupted after the fall of the Jūchīd Ul
Marcolongo, Juan P.; Zeida, Ari; Semelak, Jonathan A.; Foglia, Nicolás O.; Morzan, Uriel N.; Estrin, Dario A.; González Lebrero, Mariano C.; Scherlis, Damián A.
2018-03-01
In this work we present the current advances in the development and the applications of LIO, a lab-made code designed for density functional theory calculations in graphical processing units (GPU), that can be coupled with different classical molecular dynamics engines. This code has been thoroughly optimized to perform efficient molecular dynamics simulations at the QM/MM DFT level, allowing for an exhaustive sampling of the configurational space. Selected examples are presented for the description of chemical reactivity in terms of free energy profiles, and also for the computation of optical properties, such as vibrational and electronic spectra in solvent and protein environments.
Occurrence and biodiversity of Aspergillus section Nigri on 'Tannat' grapes in Uruguay.
Garmendia, Gabriela; Vero, Silvana
2016-01-04
Ochratoxin A (OTA) is a nephrotoxic mycotoxin which has been found worldwide as a contaminant in wines. It is produced on grapes mainly by molds from Aspergillus section Nigri. This study has demonstrated for the first time the occurrence of black aspergilli on Tannat grapes from Uruguay, in a two year survey. Aspergillus uvarum (uniseriate) and Aspergillus welwitschiae (from Aspergillusniger aggregate) were the prevalent species whereas Aspergillus carbonarius which is considered the main OTA producing species was not detected. OTA production in culture medium was evaluated for native isolates from A. niger aggregate and compared to levels produced by a type strain of A. carbonarius. This work also includes the development of quick and easy molecular methods to identify black aspergilli to species level, avoiding sequencing. Copyright © 2015 Elsevier B.V. All rights reserved.
Aspergillus section Fumigati typing by PCR-restriction fragment polymorphism.
Staab, Janet F; Balajee, S Arunmozhi; Marr, Kieren A
2009-07-01
Recent studies have shown that there are multiple clinically important members of the Aspergillus section Fumigati that are difficult to distinguish on the basis of morphological features (e.g., Aspergillus fumigatus, A. lentulus, and Neosartorya udagawae). Identification of these organisms may be clinically important, as some species vary in their susceptibilities to antifungal agents. In a prior study, we utilized multilocus sequence typing to describe A. lentulus as a species distinct from A. fumigatus. The sequence data show that the gene encoding beta-tubulin, benA, has high interspecies variability at intronic regions but is conserved among isolates of the same species. These data were used to develop a PCR-restriction fragment length polymorphism (PCR-RFLP) method that rapidly and accurately distinguishes A. fumigatus, A. lentulus, and N. udagawae, three major species within the section Fumigati that have previously been implicated in disease. Digestion of the benA amplicon with BccI generated unique banding patterns; the results were validated by screening a collection of clinical strains and by in silico analysis of the benA sequences of Aspergillus spp. deposited in the GenBank database. PCR-RFLP of benA is a simple method for the identification of clinically important, similar morphotypes of Aspergillus spp. within the section Fumigati.
Aspergillus Section Fumigati Typing by PCR-Restriction Fragment Polymorphism▿
Staab, Janet F.; Balajee, S. Arunmozhi; Marr, Kieren A.
2009-01-01
Recent studies have shown that there are multiple clinically important members of the Aspergillus section Fumigati that are difficult to distinguish on the basis of morphological features (e.g., Aspergillus fumigatus, A. lentulus, and Neosartorya udagawae). Identification of these organisms may be clinically important, as some species vary in their susceptibilities to antifungal agents. In a prior study, we utilized multilocus sequence typing to describe A. lentulus as a species distinct from A. fumigatus. The sequence data show that the gene encoding β-tubulin, benA, has high interspecies variability at intronic regions but is conserved among isolates of the same species. These data were used to develop a PCR-restriction fragment length polymorphism (PCR-RFLP) method that rapidly and accurately distinguishes A. fumigatus, A. lentulus, and N. udagawae, three major species within the section Fumigati that have previously been implicated in disease. Digestion of the benA amplicon with BccI generated unique banding patterns; the results were validated by screening a collection of clinical strains and by in silico analysis of the benA sequences of Aspergillus spp. deposited in the GenBank database. PCR-RFLP of benA is a simple method for the identification of clinically important, similar morphotypes of Aspergillus spp. within the section Fumigati. PMID:19403766
Senba, Masachika; Toda, Takayoshi; Toda, Yumiko; Hokama, Seitetsu
1989-01-01
In tissue, hyphae of mucor are characteristically broad and infrequently septate. However, it may be difficult to distinguish mucor from aspergillus in tissue sections occasionally, because sometimes aspergillus septa are not detected with hematoxylin-eosin (HE), periodic acid Schiff (PAS ), and Grocott's methenamine silver (GMS). In a case, aspergillus septa can be seen under ultraviolet light. Specifically, structures of these septum were clear cut differences in the histological finding be...
In vivo confocal microscopy appearance of Fusarium and Aspergillus species in fungal keratitis.
Chidambaram, Jaya Devi; Prajna, Namperumalsamy Venkatesh; Larke, Natasha; Macleod, David; Srikanthi, Palepu; Lanjewar, Shruti; Shah, Manisha; Lalitha, Prajna; Elakkiya, Shanmugam; Burton, Matthew J
2017-08-01
Clinical outcomes in fungal keratitis vary between Fusarium and Aspergillus spp, therefore distinguishing between species using morphological features such as filament branching angles, sporulation along filaments (adventitious sporulation) or dichotomous branching may be useful. In this study, we assessed these three features within Heidelberg Retina Tomograph 3 in vivo confocal microscopy (IVCM) images from culture-positive Fusarium and Aspergillus spp keratitis participants. Prospective observational cohort study in Aravind Eye Hospital (February 2011-February 2012). Eligibility criteria: age ≥18 years, stromal infiltrate ≥3 mm diameter, Fusarium or Aspergillus spp culture-positive. previous/current herpetic keratitis, visual acuity 80% corneal thinning. IVCM was performed and images analysed for branch angle, presence/absence of adventitious sporulation or dichotomous branching by a grader masked to the microbiological diagnosis. 98 participants were included (106 eligible, 8 excluded as no measurable branch angles); 68 were positive for Fusarium spp, 30 for Aspergillus spp. Mean branch angle for Fusarium spp was 59.7° (95% CI 57.7° to 61.8°), and for Aspergillus spp was 63.3° (95% CI 60.8° to 65.8°), p=0.07. No adventitious sporulation was detected in Fusarium spp ulcers. Dichotomous branching was detected in 11 ulcers (7 Aspergillus spp, 4 Fusarium spp). There was very little difference in the branching angle of Fusarium and Aspergillus spp. Adventitious sporulation was not detected and dichotomous branching was infrequently seen. Although IVCM remains a valuable tool to detect fungal filaments in fungal keratitis, it cannot be used to distinguish Fusarium from Aspergillus spp and culture remains essential to determine fungal species. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.
Electrochemical monitoring of citric acid production by Aspergillus niger
International Nuclear Information System (INIS)
Kutyła-Olesiuk, Anna; Wawrzyniak, Urszula E.; Ciosek, Patrycja; Wróblewski, Wojciech
2014-01-01
Highlights: • Citric acid fermentation process (production) by Aspergillus niger. • Qualitative/quantitative monitoring of standard culture and culture infected with yeast. • Electronic tongue based on potentiometric and voltammetric sensors. • Evaluation of the progress and the correctness of the fermentation process. • The highest classification abilities of the hybrid electronic tongue. - Abstract: Hybrid electronic tongue was developed for the monitoring of citric acid production by Aspergillus niger. The system based on various potentiometric/voltammetric sensors and appropriate chemometric techniques provided correct qualitative and quantitative classification of the samples collected during standard Aspergillus niger culture and culture infected with yeast. The performance of the proposed approach was compared with the monitoring of the fermentation process carried out using classical methods. The results obtained proved, that the designed hybrid electronic tongue was able to evaluate the progress and correctness of the fermentation process
Electrochemical monitoring of citric acid production by Aspergillus niger
Energy Technology Data Exchange (ETDEWEB)
Kutyła-Olesiuk, Anna; Wawrzyniak, Urszula E.; Ciosek, Patrycja; Wróblewski, Wojciech, E-mail: wuwu@ch.pw.edu.pl
2014-05-01
Highlights: • Citric acid fermentation process (production) by Aspergillus niger. • Qualitative/quantitative monitoring of standard culture and culture infected with yeast. • Electronic tongue based on potentiometric and voltammetric sensors. • Evaluation of the progress and the correctness of the fermentation process. • The highest classification abilities of the hybrid electronic tongue. - Abstract: Hybrid electronic tongue was developed for the monitoring of citric acid production by Aspergillus niger. The system based on various potentiometric/voltammetric sensors and appropriate chemometric techniques provided correct qualitative and quantitative classification of the samples collected during standard Aspergillus niger culture and culture infected with yeast. The performance of the proposed approach was compared with the monitoring of the fermentation process carried out using classical methods. The results obtained proved, that the designed hybrid electronic tongue was able to evaluate the progress and correctness of the fermentation process.
D-Galactose uptake is nonfunctional in the conidiospores of Aspergillus niger
Fekete, E.; de Vries, R.P.; Seiboth, B.; vanKuyk, P.A.; Sandor, E.; Metz, B.; Kubicek, C.P.; Karaffa, L.
2012-01-01
The majority of black Aspergilli (Aspergillus section Nigri), including Aspergillus niger, as well as many other Ascomycetes fail to germinate on d-galactose as a sole carbon source. Here, we provide evidence that the ability of A. niger to transport d-galactose is growth stage dependent, being
New ochratoxin A or sclerotium producing species in Aspergillus section Nigri
DEFF Research Database (Denmark)
Samson, R.A.; Frisvad, Jens Christian
2004-01-01
in Costa Rica and produces large pink to greyish brown sclerotia. Aspergillus lacticoffeatus was found on coffee beans in Venezuela and Indonesia, and is an effective producer of ochratoxin A. Aspergillus piperis was isolated from black ground pepper and produces large yellow to pink brown sclerotia...
Anti-Aspergillus Activities of the Respiratory Epithelium in Health and Disease
Directory of Open Access Journals (Sweden)
Margherita Bertuzzi
2018-01-01
Full Text Available Respiratory epithelia fulfil multiple roles beyond that of gaseous exchange, also acting as primary custodians of lung sterility and inflammatory homeostasis. Inhaled fungal spores pose a continual antigenic, and potentially pathogenic, challenge to lung integrity against which the human respiratory mucosa has developed various tolerance and defence strategies. However, respiratory disease and immune dysfunction frequently render the human lung susceptible to fungal diseases, the most common of which are the aspergilloses, a group of syndromes caused by inhaled spores of Aspergillus fumigatus. Inhaled Aspergillus spores enter into a multiplicity of interactions with respiratory epithelia, the mechanistic bases of which are only just becoming recognized as important drivers of disease, as well as possible therapeutic targets. In this mini-review we examine current understanding of Aspergillus-epithelial interactions and, based upon the very latest developments in the field, we explore two apparently opposing schools of thought which view epithelial uptake of Aspergillus spores as either a curative or disease-exacerbating event.
Martinelli, Livia; Zalar, Polona; Gunde-Cimerman, Nina; Azua-Bustos, Armando; Sterflinger, Katja; Piñar, Guadalupe
2017-07-01
Halophilic fungal strains isolated from historical wooden staircase in a salt mine in Austria, and from wall biofilm and soil of a cave in the Coastal Range of the hyperarid Atacama Desert in Chile were characterised and described newly as Aspergillus salisburgensis and Aspergillus atacamensis. Morphological characters including solitary phialides producing solitary conidia and conidia in chains and/or heads suggested affinity to Aspergillus subgenus Polypaecilum. Strains required salt for growth, grew optimally on media with 10-25% NaCl and at 15-28 °C. These values are similar to those observed for Aspergillus salinarus comb. nov. (Phialosimplex salinarum), while the ex-type strains of Aspergillus sclerotialis, Aspergillus chlamydosporus and Aspergillus caninus (all belonging to Aspergillus subgen. Polypaecilum) grew optimally at 0-5% NaCl and showed fastest growth at 28-37 °C. Phylogenetic analyses on the basis of rDNA sequences, RAPD-PCR fingerprint patterns, and cellobiohydrolase gene (cbh-I) polymorphism clustered the strains into three groups and supported their taxonomic recognition as A. salinarus, A. atacamensis and A. salisburgensis. On the basis of phylogenetic inferences, also Sagenomella keratitidis is newly combined as Aspergillus keratitidis and inferred as a species of Aspergillus subgenus Polypaecilum.
Aspergillus Section Fumigati Typing by PCR-Restriction Fragment Polymorphism▿
Staab, Janet F.; Balajee, S. Arunmozhi; Marr, Kieren A.
2009-01-01
Recent studies have shown that there are multiple clinically important members of the Aspergillus section Fumigati that are difficult to distinguish on the basis of morphological features (e.g., Aspergillus fumigatus, A. lentulus, and Neosartorya udagawae). Identification of these organisms may be clinically important, as some species vary in their susceptibilities to antifungal agents. In a prior study, we utilized multilocus sequence typing to describe A. lentulus as a species distinct from...
Immobilization of Isolated Lipase From Moldy Copra (Aspergillus Oryzae)
Dali, Seniwati; Patong, A. B. D. Rauf; Jalaluddin, M. Noor; Pirman; Hamzah, Baharuddin
2011-01-01
Enzyme immobilization is a recovery technique that has been studied in several years, using support as a media to help enzyme dissolutions to the reaction substrate. Immobilization method used in this study was adsorption method, using specific lipase from Aspergillus oryzae. Lipase was partially purified from the culture supernatant of Aspergillus oryzae. Enzyme was immobilized by adsorbed on silica gel. Studies on free and immobilized lipase systems for determination of optimum pH, optimum ...
Palencia, Edwin Rene; Glenn, Anthony Elbie; Hinton, Dorothy Mae; Bacon, Charles Wilson
2013-09-01
Aspergillus niger and Aspergillus carbonarius are two species in the Aspergillus section Nigri (black-spored aspergilli) frequently associated with peanut (Arachis hypogea), maize (Zea mays), and other plants as pathogens. These infections are symptomless and as such are major concerns since some black aspergilli produce important mycotoxins, ochratoxins A, and the fumonisins. To facilitate the study of the black aspergilli-maize interactions with maize during the early stages of infections, we developed a method that used the enhanced yellow fluorescent protein (eYFP) and the monomeric red fluorescent protein (mRFP1) to transform A. niger and A. carbonarius, respectively. The results were constitutive expressions of the fluorescent genes that were stable in the cytoplasms of hyphae and conidia under natural environmental conditions. The hyphal in planta distribution in 21-day-old seedlings of maize were similar wild type and transformants of A. niger and A. carbonarius. The in planta studies indicated that both wild type and transformants internally colonized leaf, stem and root tissues of maize seedlings, without any visible disease symptoms. Yellow and red fluorescent strains were capable of invading epidermal cells of maize roots intercellularly within the first 3 days after inoculation, but intracellular hyphal growth was more evident after 7 days of inoculation. We also tested the capacity of fluorescent transformants to produce ochratoxin A and the results with A. carbonarius showed that this transgenic strain produced similar concentrations of this secondary metabolite. This is the first report on the in planta expression of fluorescent proteins that should be useful to study the internal plant colonization patterns of two ochratoxigenic species in the Aspergillus section Nigri. © 2013.
Fatal coinfection with Legionella pneumophila serogroup 8 and Aspergillus fumigatus.
Guillouzouic, Aurélie; Bemer, Pascale; Gay-Andrieu, Françoise; Bretonnière, Cédric; Lepelletier, Didier; Mahé, Pierre-Joachim; Villers, Daniel; Jarraud, Sophie; Reynaud, Alain; Corvec, Stéphane
2008-02-01
Legionella pneumophila is an important cause of community-acquired and nosocomial pneumonia. We report on a patient who simultaneously developed L. pneumophila serogroup 8 pneumonia and Aspergillus fumigatus lung abscesses. Despite appropriate treatments, Aspergillus disease progressed with metastasis. Coinfections caused by L. pneumophila and A. fumigatus remain exceptional. In apparently immunocompetent patients, corticosteroid therapy is a key risk factor for aspergillosis.
Unique antimicrobial spectrum of ophiobolin K produced by Aspergillus ustus.
Sohsomboon, Natthapat; Kanzaki, Hiroshi; Nitoda, Teruhiko
2018-03-01
A co-cultivation study of two fungal strains showed that Aspergillus ustus could inhibit Aspergillus repens growth. The bioactive compound responsible for the observed activity was purified and identified as a sesterterpene, ophiobolin K. Ophiobolin K exhibited marked inhibition against both fungi and bacteria, especially A. repens, A. glaucus and gram-positive bacteria including Bacillus subtilis, Staphylococcus aureus, and Micrococcus luteus.
Takahashi, Tadashi; Chang, Perng-Kuang; Matsushima, Kenichiro; Yu, Jiujiang; Abe, Keietsu; Bhatnagar, Deepak; Cleveland, Thomas E; Koyama, Yasuji
2002-08-01
Aspergillus sojae belongs to the Aspergillus section Flavi but does not produce aflatoxins. The functionality of the A. sojae aflR gene (aflRs) was examined by transforming it into an DeltaaflR strain of A. parasiticus, derived from a nitrate-nonutilizing, versicolorin A (VERA)-accumulating strain. The A. parasiticus aflR gene (aflRp) transformants produced VERA, but the aflRs transformants did not. Even when aflRs was placed under the control of the amylase gene (amyB) promoter of Aspergillus oryzae, the amy(p)::aflRs transformants did not produce VERA. A chimeric construct containing the aflRs promoter plus the aflRs N- and aflRp C-terminal coding regions could restore VERA production, but a construct containing the aflRp promoter plus the aflRp N- and aflRs C-terminal coding regions could not. These results show that the A. sojae aflR promoter is functional in A. parasiticus and that the HAHA motif does not affect the function of the resulting hybrid AflR. We conclude that the lack of aflatoxin production by A. sojae can be attributed, at least partially, to the premature termination defect in aflRs, which deletes the C-terminal transcription activation domain that is critical for the expression of aflatoxin biosynthetic genes.
Shivanna, Gunashree B.; Venkateswaran, Govindarajulu
2014-01-01
Fermentation is one of the industrially important processes for the development of microbial metabolites that has immense applications in various fields. This has prompted to employ fermentation as a major technique in the production of phytase from microbial source. In this study, a comparison was made between submerged (SmF) and solid-state fermentations (SSF) for the production of phytase from Aspergillus niger CFR 335 and Aspergillus ficuum SGA 01. It was found that both the fungi were capable of producing maximum phytase on 5th day of incubation in both submerged and solid-state fermentation media. Aspergillus niger CFR 335 and A. ficuum produced a maximum of 60.6 U/gds and 38 U/gds of the enzyme, respectively, in wheat bran solid substrate medium. Enhancement in the enzyme level (76 and 50.7 U/gds) was found when grown in a combined solid substrate medium comprising wheat bran, rice bran, and groundnut cake in the ratio of 2 : 1 : 1. A maximum of 9.6 and 8.2 U/mL of enzyme activity was observed in SmF by A. niger CFR 335 and A.ficuum, respectively, when grown in potato dextrose broth. PMID:24688383
The infrared spectral transmittance of Aspergillus niger spore aggregated particle swarm
Zhao, Xinying; Hu, Yihua; Gu, Youlin; Li, Le
2015-10-01
Microorganism aggregated particle swarm, which is quite an important composition of complex media environment, can be developed as a new kind of infrared functional materials. Current researches mainly focus on the optical properties of single microorganism particle. As for the swarm, especially the microorganism aggregated particle swarm, a more accurate simulation model should be proposed to calculate its extinction effect. At the same time, certain parameters deserve to be discussed, which helps to better develop the microorganism aggregated particle swarm as a new kind of infrared functional materials. In this paper, take Aspergillus Niger spore as an example. On the one hand, a new calculation model is established. Firstly, the cluster-cluster aggregation (CCA) model is used to simulate the structure of Aspergillus Niger spore aggregated particle. Secondly, the single scattering extinction parameters for Aspergillus Niger spore aggregated particle are calculated by using the discrete dipole approximation (DDA) method. Thirdly, the transmittance of Aspergillus Niger spore aggregated particle swarm is simulated by using Monte Carlo method. On the other hand, based on the model proposed above, what influences can wavelength causes has been studied, including the spectral distribution of scattering intensity of Aspergillus Niger spore aggregated particle and the infrared spectral transmittance of the aggregated particle swarm within the range of 8-14μm incident infrared wavelengths. Numerical results indicate that the scattering intensity of Aspergillus Niger spore aggregated particle reduces with the increase of incident wavelengths at each scattering angle. Scattering energy mainly concentrates on the scattering angle between 0-40°, forward scattering has an obvious effect. In addition, the infrared transmittance of Aspergillus Niger spore aggregated particle swarm goes up with the increase of incident wavelengths. However, some turning points of the trend are
Energy Technology Data Exchange (ETDEWEB)
Kang, Byeong Seong; Yang, Myeon Jun; Kim, Young Min; Youm, Yoon Seok; Choi, Seong Hoon; Park, Sung Bin; Jeong, Ae Kyung [University of Ulsan College of Medicine, Ulsan University Hospital, Ulsan (Korea, Republic of)
2008-04-15
Aspergillus bursitis is an uncommon condition demonstrated as a nonspecific soft tissue mass. To our knowledge, the ultrasonographic findings of aspergillus bursitis in immunocompromised patients have not been previously reported. Here, we report a case of aspergillus bursitis in a renal transplant recipient, accompanied by the associated ultrasonographic findings.
International Nuclear Information System (INIS)
Kang, Byeong Seong; Yang, Myeon Jun; Kim, Young Min; Youm, Yoon Seok; Choi, Seong Hoon; Park, Sung Bin; Jeong, Ae Kyung
2008-01-01
Aspergillus bursitis is an uncommon condition demonstrated as a nonspecific soft tissue mass. To our knowledge, the ultrasonographic findings of aspergillus bursitis in immunocompromised patients have not been previously reported. Here, we report a case of aspergillus bursitis in a renal transplant recipient, accompanied by the associated ultrasonographic findings
40 CFR 180.1254 - Aspergillus flavus NRRL 21882; exemption from the requirement of a tolerance.
2010-07-01
... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Aspergillus flavus NRRL 21882... RESIDUES IN FOOD Exemptions From Tolerances § 180.1254 Aspergillus flavus NRRL 21882; exemption from the... of Aspergillus flavus NRRL 21882 on peanut; peanut, hay; peanut, meal; and peanut, refined oil. (b...
International Nuclear Information System (INIS)
Hill, D.R.; Shaw, T.M.; Graham, W.; Woodruff, G.N.
1990-01-01
In vitro autoradiography was performed in order to visualize cholecystokinin-A (CCK-A) receptors in sections of Cynomolgus monkey brain. CCK-A receptors were defined as those which displayed high affinity for the selective non-peptide antagonist MK-329 (L-364,718) and were detected in several regions by selective inhibition of 125I-Bolton Hunter CCK using MK-329 or direct labeling with 3H-MK-329. In the caudal medulla, high densities of CCK-A sites were present in the nucleus tractus solitarius, especially the caudal and medial aspects, and also the dorsal motor nucleus of the vagus. CCK-A sites were localized to a number of hypothalamic nuclei such as the supraoptic and paraventricular nuclei, the dorsomedial and infundibular nuclei as well as the neurohypophysis. The mammillary bodies and supramammillary nuclei also contained CCK-A receptor sites. High concentrations of CCK-A receptors were present in the substantia nigra zona compacta and also the ventral tegmental area and may be associated with dopamine cell bodies. Binding of 3H-MK-329 was also detected in parts of the caudate nucleus and ventral putamen. The detection, by autoradiographical means, of CCK-A receptors throughout the Cynomolgus monkey brain contrasts with similar studies performed using rodents and suggests differences in the density and, perhaps, the importance of CCK-A receptors in the primate as opposed to the rodent. The data suggest the possibility that CCK-A receptors may be involved in a number of important brain functions as diverse as the processing of sensory information from the gut, the regulation of hormone secretion, and the activity of dopamine cell activity
Antifungal activity of some essential oils against toxigenic Aspergillus species.
Alizadeh, Alireza; Zamani, Elham; Sharaifi, Rohollah; Javan-Nikkhah, Mohammad; Nazari, Somayeh
2010-01-01
Increasing attentions have been paid on the application of essential oils and plant extracts for control of postharvest pathogens due to their natural origin and less appearance of resistance in fungi pathogens. Some Aspergillus species are toxigenic and responsible for many cases of food and feed contamination. Some Toxins that produce with some Aspergillus species are known to be potent hepatocarcinogens in animals and humans. The present work evaluated the parameters of antifungal activity of the essential oils of Zataria multiflora, Thymus migricus, Satureja hortensis, Foeniculum vulgare, Carum capticum and thiabendazol fungicide on survival and growth of different species of Aspergillus. Aerial part and seeds of plant species were collected then dried and its essential oils isolated by means of hydrodistillation. Antifungal activity was evaluated in vitro by poisonous medium technique with PDA medium at six concentrations. Results showed that all essential oils could inhibit the growth of Aspergillus species. The essential oil with the best effect and lowest EC50 and MIC (Minimum Inhibitory Concentration) was Z. multiflora (223 microl/l and 650 microl/l, respectively). The chemical composition of the Z. multiflora essential oil was analyzed by GC-MS.
Aspergillus-Associated Airway Disease, Inflammation, and the Innate Immune Response
Chotirmall, Sanjay H.; Al-Alawi, Mazen; Logan, P. Mark; Greene, Catherine M.; McElvaney, Noel G.
2013-01-01
Aspergillus moulds exist ubiquitously as spores that are inhaled in large numbers daily. Whilst most are removed by anatomical barriers, disease may occur in certain circumstances. Depending on the underlying state of the human immune system, clinical consequences can ensue ranging from an excessive immune response during allergic bronchopulmonary aspergillosis to the formation of an aspergilloma in the immunocompetent state. The severest infections occur in those who are immunocompromised where invasive pulmonary aspergillosis results in high mortality rates. The diagnosis of Aspergillus-associated pulmonary disease is based on clinical, radiological, and immunological testing. An understanding of the innate and inflammatory consequences of exposure to Aspergillus species is critical in accounting for disease manifestations and preventing sequelae. The major components of the innate immune system involved in recognition and removal of the fungus include phagocytosis, antimicrobial peptide production, and recognition by pattern recognition receptors. The cytokine response is also critical facilitating cell-to-cell communication and promoting the initiation, maintenance, and resolution of the host response. In the following review, we discuss the above areas with a focus on the innate and inflammatory response to airway Aspergillus exposure and how these responses may be modulated for therapeutic benefit. PMID:23971044
Aspergillus niger: an unusual cause of invasive pulmonary aspergillosis
Person, A. K.; Chudgar, S. M.; Norton, B. L.; Tong, B. C.; Stout, J. E.
2010-01-01
Infections due to Aspergillus species cause significant morbidity and mortality. Most are attributed to Aspergillus fumigatus, followed by Aspergillus flavus and Aspergillus terreus. Aspergillus niger is a mould that is rarely reported as a cause of pneumonia. A 72-year-old female with chronic obstructive pulmonary disease and temporal arteritis being treated with steroids long term presented with haemoptysis and pleuritic chest pain. Chest radiography revealed areas of heterogeneous consolidation with cavitation in the right upper lobe of the lung. Induced bacterial sputum cultures, and acid-fast smears and cultures were negative. Fungal sputum cultures grew A. niger. The patient clinically improved on a combination therapy of empiric antibacterials and voriconazole, followed by voriconazole monotherapy. After 4 weeks of voriconazole therapy, however, repeat chest computed tomography scanning showed a significant progression of the infection and near-complete necrosis of the right upper lobe of the lung. Serum voriconazole levels were low–normal (1.0 μg ml−1, normal range for the assay 0.5–6.0 μg ml−1). A. niger was again recovered from bronchoalveolar lavage specimens. A right upper lobectomy was performed, and lung tissue cultures grew A. niger. Furthermore, the lung histopathology showed acute and organizing pneumonia, fungal hyphae and oxalate crystallosis, confirming the diagnosis of invasive A. niger infection. A. niger, unlike A. fumigatus and A. flavus, is less commonly considered a cause of invasive aspergillosis (IA). The finding of calcium oxalate crystals in histopathology specimens is classic for A. niger infection and can be helpful in making a diagnosis even in the absence of conidia. Therapeutic drug monitoring may be useful in optimizing the treatment of IA given the wide variations in the oral bioavailability of voriconazole. PMID:20299503
40 CFR 180.1206 - Aspergillus flavus AF36; exemption from the requirement of a tolerance.
2010-07-01
... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Aspergillus flavus AF36; exemption... FOOD Exemptions From Tolerances § 180.1206 Aspergillus flavus AF36; exemption from the requirement of a... pesticide Aspergillus flavus AF36 in or on cotton, gin byproducts; cotton, hulls; cotton, meal; cotton...
Aspergillus luchuensis, an industrially important black Aspergillus in East Asia
DEFF Research Database (Denmark)
Hong, Seung-Beom; Lee, Mina; Kim, Dae-Ho
2013-01-01
of A. awamori which are stored in National Research Institute of Brewing in Japan, represent A. niger (n = 14) and A. luchuensis (n = 6). The neotype of A. awamori (CBS 557.65 = NRRL 4948) does not originate from awamori fermentation and it is shown to be identical with the unknown taxon Aspergillus...
Invasive aspergillosis in the aortic arch with infectious Aspergillus lesions in pulmonary bullae
Directory of Open Access Journals (Sweden)
Isao Watanabe
2015-03-01
Full Text Available A patient with pulmonary bullae died of massive hemoptysis. At autopsy a hole was observed in the aortic wall. A microscopic examination indicated small Aspergillus lesions in pulmonary bullae and extensive necrotic lesions with Aspergillus hyphae in the media of the thoracic aorta. These findings led to a diagnosis of invasive aspergillosis in the aortic arch. This is a rare case in which Aspergillus invaded the aorta in a patient without hematologic neoplasms or neutropenia.
Comparison of Aspergillus species-complexes detected in different environmental settings
Sabino, Raquel; Viegas, Carla; Veríssimo, Carla; Clemons, K. V.; Stevens, D. A.
2014-01-01
Purpose: Samples from different environmental sources were screened for the presence of Aspergillus, and the distribution of the different species-complexes was determined in order to understand differences among that distribution in the several environmental sources and which of these species complexes are present in specific environmental settings. Methods: Four distinct environments (beaches, poultries, swineries and hospital) were studied and analyzed for which Aspergillus complexes were ...
Gómez-Miranda, Begoña; Prieto, Alicia; Leal, Juan Antonio; Ahrazem, Oussama; Jiménez-Barbero, Jesús; Bernabé, Manuel
2004-01-01
The alkali extractable and water-soluble cell wall polysaccharides F1SS from Aspergillus wentii and Chaetosartorya chrysella have been studied by methylation analysis, 1D- and 2D-NMR, and MALDI-TOF analysis. Their structures are almost identical, corresponding to the following repeating unit: [--> 3)-beta-D-Gal f -(1 --> 5)-beta-D-Gal f-(1 -->]n --> mannan core. The structure of this galactofuranose side chain differs from that found in the pathogenic fungus Aspergillus fumigatus, in other Aspergillii and members of Trichocomaceae: [--> 5)-beta-D-Gal f-(1 -->]n --> mannan core. The mannan cores have also been investigated, and are constituted by a (1 --> 6)-alpha-mannan backbone, substituted at positions 2 by chains from 1 to 7 residues of (1 --> 2) linked alpha-mannopyranoses. Copyright 2004 Kluwer Academic Publishers
Metabolites from marine fungus Aspergillus sp.
Digital Repository Service at National Institute of Oceanography (India)
Wahidullah, S.; Rajmanickam, R.; DeSouza, L.
Chemical examination of a methanolic extract of the marine fungus, Aspergillus sp., isolated from marine grass environment, yielded a steroid, ergosterol peroxide (1), and a mixture of known glyceride esters (2,3) of unsaturated fatty acids...
[Primary Aspergillus endocarditis. Apropos of a case and review of the international literature].
Roux, J P; Koussa, A; Cajot, M A; Marquette, F; Goullard, L; Gosselin, B; Pol, A; Warembourg, H; Soots, G
1992-01-01
The authors report a case of primary aspergillus endocarditis with endophthalmitis and vertebral osteomyelitis. No underlying disease and no predisposing factors were found. Valve replacement plus combined antifungal chemotherapy proved to be effective as the patient is asymptomatic 18 months after the first symptoms. 48 cases of aspergillus endocarditis, without prior cardiac surgery have been reported in the literature. Aspergillus endocarditis was valvular or mural. Extracardiac dissemination was common but endophthalmitis and osteomyelitis were infrequent. In 11 cases, the diagnosis was made by histologic examination of embolectomy or ocular, skin biopsy tissue. All patients were febrile. Blood cultures showed no Aspergillus species. Clinical manifestations of endocarditis were described in less than fifty per cent of cases. Echocardiographic visualization of vegetations was obtained in 5 cases. Many patients experienced embolic phenomena. Mortality from Aspergillus endocarditis is extremely high (96%). Surgery is the main treatment, consisting of valve replacement. Antifungal chemotherapy should be combined. The proper duration and dosage and the combination of antifungal drugs have not been clearly defined.
Aspergillus mediastinitis after cardiac surgery
Directory of Open Access Journals (Sweden)
Marie-Josée Caballero
2016-03-01
Conclusion: The clinical features of postoperative Aspergillus mediastinitis may be paucisymptomatic, emphasizing the need for a low index of suspicion in cases of culture-negative mediastinitis or in indolent wound infections. In addition to surgical debridement, the central component of antifungal therapy should include amphotericin B or voriconazole.
Microbiological quality of raw and roasted African palm weevil ...
African Journals Online (AJOL)
Microbiological quality of raw and roasted African palm weevil ( Rhynchophorus phoenicis ) consumed in the south eastern Nigeria. ... Rhynchophorus phoenicis though reported to be highly nutritious in terms of amino acid profile and presence of unsaturated fatty acid can be a source of food poison if not properly handled ...
Directory of Open Access Journals (Sweden)
Juan P. Marcolongo
2018-03-01
Full Text Available In this work we present the current advances in the development and the applications of LIO, a lab-made code designed for density functional theory calculations in graphical processing units (GPU, that can be coupled with different classical molecular dynamics engines. This code has been thoroughly optimized to perform efficient molecular dynamics simulations at the QM/MM DFT level, allowing for an exhaustive sampling of the configurational space. Selected examples are presented for the description of chemical reactivity in terms of free energy profiles, and also for the computation of optical properties, such as vibrational and electronic spectra in solvent and protein environments.
Cellulase production by two mutant strain of Trichoderma longibrachiatum Qm9414 and Rut C30
International Nuclear Information System (INIS)
Blanco, M.J.
1991-01-01
Native or pretreated biomass from Onopordum nervosum boiss, has been examined as candidate feedstock for cellulase production by two mutant strain of trichoderma longibrachiatum QM9414 and Rut C30. Batch cultivation methods were evaluated and compared with previous experiments using ball-milled, crystalline cellulose (Solka floc). Batch cultivation of T. longibrachiatum Rut C30 on 55% (W/V) acid pretreated O. nervosum biomass yielded enzyme productivities and activities comparable to those obtained on Solka floc. However, the overall enzyme production performance was lower than on Solka floc at comparable cellulose concentrations. This fact may be due to the accumulation of pretreated by products and lignin in the fermentor.(author)
Aspergillus fumigatus-Related Species in Clinical Practice.
Lamoth, Frédéric
2016-01-01
Aspergillus fumigatus is the main etiologic agent of invasive aspergillosis (IA). Other Aspergillus species belonging to the section Fumigati (A. fumigatus complex) may occasionally be the cause of IA. These strains are often misidentified, as they cannot be distinguished from A. fumigatus by conventional morphological analysis and sequencing methods. This lack of recognition may have important consequences as these A. fumigatus-related species often display some level of intrinsic resistance to azoles and other antifungal drugs. A. lentulus, A. udagawae, A. viridinutans, and A. thermomutatus (Neosartorya pseudofischeri) have been associated with refractory cases of IA. Microbiologists should be able to suspect the presence of these cryptic species behind a putative A. fumigatus isolate on the basis of some simple characteristics, such as defect in sporulation and/or unusual antifungal susceptibility profile. However, definitive species identification requires specific sequencing analyses of the beta-tubulin or calmodulin genes, which are not available in most laboratories. Multiplex PCR assays or matrix-assisted laser desorption ionization - time-of-flight mass spectrometry (MALDI-TOF MS) gave promising results for rapid and accurate distinction between A. fumigatus and other Aspergillus spp. of the section Fumigati in clinical practice. Improved diagnostic procedures and antifungal susceptibility testing may be helpful for the early detection and management of these particular IA cases.
DEFF Research Database (Denmark)
Lyskova, Pavlina; Hubka, Vit; Kolarik, Miroslav
2014-01-01
The identity of nine clinical isolates recovered from Czech patients and presumptively identified as Aspergillus sp. section Candidi based on colony morphology was revised using sequences of beta-tubulin, calmodulin gene sequence, and internal transcribed spacer rDNA. Six isolates were from suspe...
The effects of types of media on uranium leaching using metabolite of Aspergillus niger
International Nuclear Information System (INIS)
Li Guangyue; Ding Dexin; Wang Yongdong; Hu Nan
2012-01-01
To investigate the influences of different media to uranium leaching applying with metabolite of Aspergillus niger, PSA and glucose-steepwater medium were used for the culture of Aspergillus niger, and the metabolite of Aspergillus niger with different pH value produced in the diverse culture temperature were obtained which was applied on the tests of uranium leaching as leaching agent. The test results show that the maximum leaching rate is 83.05% when the leaching agent is the metabolite of Aspergillus niger produced by PSA, as for the glucose- steepwater medium, the maximum leaching rate is 68.20%. The pH value of the metabolite of Aspergillus niger of the two kinds of media has a significant effect on the leaching rate. When PSA is adopted, the best leaching rate appears at the pH value of metabolite ranging from 2.0 to 2.5, and as for the glucose-steepwater medium, the pH value is below 2.1. (authors)
Ioannou, Petros; Andrianaki, Aggeliki; Akoumianaki, Tonia; Kyrmizi, Irene; Albert, Nathaniel; Perlin, David; Samonis, George; Kontoyiannis, Dimitrios P; Chamilos, Georgios
2015-12-07
The modest in vitro activity of echinocandins against Aspergillus implies that host-related factors augment the action of these antifungal agents in vivo. We found that, in contrast to the other antifungal agents (voriconazole, amphotericin B) tested, caspofungin exhibited a profound increase in activity against various Aspergillus species under conditions of cell culture growth, as evidenced by a ≥4-fold decrease in minimum effective concentrations (MECs) (P = 0. 0005). Importantly, the enhanced activity of caspofungin against Aspergillus spp. under cell culture conditions was strictly dependent on serum albumin and was not observed with the other two echinocandins, micafungin and anidulafungin. Of interest, fluorescently labeled albumin bound preferentially on the surface of germinating Aspergillus hyphae, and this interaction was further enhanced upon treatment with caspofungin. In addition, supplementation of cell culture medium with albumin resulted in a significant, 5-fold increase in association of fluorescently labeled caspofungin with Aspergillus hyphae (P hyphae. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Aspergillus terreus endogenous endophthalmitis: Report of a case and review of literature
Directory of Open Access Journals (Sweden)
Pradeep Kumar Panigrahi
2014-01-01
Full Text Available We report a rare case of Aspergillus terreus endogenous endophthalmitis in an immunocompetent patient with subretinal abscess and also review the reported cases. A 50-year-old healthy male presented with sudden painful loss of vision in right eye. He was diagnosed with endogenous endophthalmitis and underwent urgent vitrectomy. Aspergillus terreus growth was obtained in culture. At final follow-up, there was complete resolution of the infection but visual acuity was poor due to macular scar. Aspergillus terreus is a rare cause of endophthalmitis with usually poor outcomes. Newer antifungals like Voriconazole can be sometimes associated with better prognosis.
Occurrence of toxigenic Aspergillus flavus in commercial Bulgur wheat
Directory of Open Access Journals (Sweden)
Carla Bertechini FARIA
Full Text Available Abstract Aflatoxins are mutagenic, carcinogenic, and teratogenic mycotoxins. The objective of this work was to study the presence of aflatoxigenic Aspergillus in commercial Bulgur wheat in the city of Maringá, Paraná, Brazil. Thirty samples of commercial Bulgur wheat, acquired in the period of August 2011 to January 2012, were evaluated. The enumeration analysis showed that samples had up to 273.3 CFU of molds and 133.3 CFU of aflatoxigenic Aspergillus per gram of wheat. Forty-two monosporic isolates were obtained and identified as Aspergillus flavus. The isolates were analyzed regarding their aflatoxigenic potential by culture in coconut milk agar; hydroxide vapor exposure; chromatography; and polymerase chain reaction (PCR targeting genes that code enzymes of the aflatoxins synthesis pathway. Some of the isolates were confirmed to be aflatoxin producers and several of them presented a genetic profile of aflatoxin synthesis. The obtained results demonstrated that Bulgur wheat A. flavus contamination is concerning.
Tam, Emily W T; Chen, Jonathan H K; Lau, Eunice C L; Ngan, Antonio H Y; Fung, Kitty S C; Lee, Kim-Chung; Lam, Ching-Wan; Yuen, Kwok-Yung; Lau, Susanna K P; Woo, Patrick C Y
2014-04-01
Aspergillus nomius and Aspergillus tamarii are Aspergillus species that phenotypically resemble Aspergillus flavus. In the last decade, a number of case reports have identified A. nomius and A. tamarii as causes of human infections. In this study, using an internal transcribed spacer, β-tubulin, and calmodulin gene sequencing, only 8 of 11 clinical isolates reported as A. flavus in our clinical microbiology laboratory by phenotypic methods were identified as A. flavus. The other three isolates were A. nomius (n = 2) or A. tamarii (n = 1). The results corresponded with those of metabolic fingerprinting, in which the A. flavus, A. nomius, and A. tamarii strains were separated into three clusters based on ultra-high-performance liquid chromatography-tandem mass spectrometry (UHPLC MS) analysis. The first two patients with A. nomius infections had invasive aspergillosis and chronic cavitary and fibrosing pulmonary and pleural aspergillosis, respectively, whereas the third patient had A. tamarii colonization of the airway. Identification of the 11 clinical isolates and three reference strains by matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) showed that only six of the nine strains of A. flavus were identified correctly. None of the strains of A. nomius and A. tamarii was correctly identified. β-Tubulin or the calmodulin gene should be the gene target of choice for identifying A. flavus, A. nomius, and A. tamarii. To improve the usefulness of MALDI-TOF MS, the number of strains for each species in MALDI-TOF MS databases should be expanded to cover intraspecies variability.
Tam, Emily W. T.; Chen, Jonathan H. K.; Lau, Eunice C. L.; Ngan, Antonio H. Y.; Fung, Kitty S. C.; Lee, Kim-Chung; Lam, Ching-Wan; Yuen, Kwok-Yung
2014-01-01
Aspergillus nomius and Aspergillus tamarii are Aspergillus species that phenotypically resemble Aspergillus flavus. In the last decade, a number of case reports have identified A. nomius and A. tamarii as causes of human infections. In this study, using an internal transcribed spacer, β-tubulin, and calmodulin gene sequencing, only 8 of 11 clinical isolates reported as A. flavus in our clinical microbiology laboratory by phenotypic methods were identified as A. flavus. The other three isolates were A. nomius (n = 2) or A. tamarii (n = 1). The results corresponded with those of metabolic fingerprinting, in which the A. flavus, A. nomius, and A. tamarii strains were separated into three clusters based on ultra-high-performance liquid chromatography-tandem mass spectrometry (UHPLC MS) analysis. The first two patients with A. nomius infections had invasive aspergillosis and chronic cavitary and fibrosing pulmonary and pleural aspergillosis, respectively, whereas the third patient had A. tamarii colonization of the airway. Identification of the 11 clinical isolates and three reference strains by matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS) showed that only six of the nine strains of A. flavus were identified correctly. None of the strains of A. nomius and A. tamarii was correctly identified. β-Tubulin or the calmodulin gene should be the gene target of choice for identifying A. flavus, A. nomius, and A. tamarii. To improve the usefulness of MALDI-TOF MS, the number of strains for each species in MALDI-TOF MS databases should be expanded to cover intraspecies variability. PMID:24452174
Rhizomucor miehei triglyceride lipase is processed and secreted from transformed Aspergillus oryzae.
Huge-Jensen, B; Andreasen, F; Christensen, T; Christensen, M; Thim, L; Boel, E
1989-09-01
The cDNA encoding the precursor of the Rhizomucor miehei triglyceride lipase was inserted in an Aspergillus oryzae expression vector. In this vector the expression of the lipase cDNA is under control of the Aspergillus oryzae alpha-amylase gene promoter and the Aspergillus niger glucoamylase gene terminator. The recombinant plasmid was introduced into Aspergillus oryzae, and transformed colonies were selected and screened for lipase expression. Lipase-positive transformants were grown in a small fermentor, and recombinant triglyceride lipase was purified from the culture broth. The purified enzymatically active recombinant lipase (rRML) secreted from A. oryzae was shown to have the same characteristics with respect to mobility on reducing SDS-gels and amino acid composition as the native enzyme. N-terminal amino acid sequencing indicated that approximately 70% of the secreted rRML had the same N-terminal sequence as the native Rhizomucor miehei enzyme, whereas 30% of the secreted rRML was one amino acid residue shorter in the N-terminal. The recombinant lipase precursor, which has a 70 amino acid propeptide, is thus processed in and secreted from Aspergillus oryzae. We have hereby demonstrated the utility of this organism as a host for the production of recombinant triglyceride lipases.
Zhang, Wei; Xue, Beibei; Li, Mengmeng; Mu, Yang; Chen, Zhihui; Li, Jianping; Shan, Anshan
2014-11-13
Aflatoxin B₁, a type of highly toxic mycotoxin produced by some species belonging to the Aspergillus genus, such as Aspergillus flavus and Aspergillus parasiticus, is widely distributed in feed matrices. Here, coumarin was used as the sole carbon source to screen microorganism strains that were isolated from types of feed ingredients. Only one isolate (ND-1) was able to degrade aflatoxin B₁ after screening. ND-1 isolate, identified as a strain of Aspergillus niger using phylogenetic analysis on the basis of 18S rDNA, could remove 26.3% of aflatoxin B₁ after 48 h of fermentation in nutrient broth (NB). Optimization of fermentation conditions for aflatoxin B₁ degradation by selected Aspergillus niger was also performed. These results showed that 58.2% of aflatoxin B₁ was degraded after 24 h of culture under the optimal fermentation conditions. The aflatoxin B₁ degradation activity of Aspergillus niger supernatant was significantly stronger than cells and cell extracts. Furthermore, effects of temperature, heat treatment, pH, and metal ions on aflatoxin B₁ degradation by the supernatant were examined. Results indicated that aflatoxin B₁ degradation of Aspergillus niger is enzymatic and this process occurs in the extracellular environment.
Tani, Yasushi; Amaishi, Yasunori; Funatsu, Tori; Ito, Masahiro; Itonori, Saki; Hata, Yoji; Ashida, Hisashi; Yamamoto, Kenji
2014-12-01
Glucosylceramide and galactosylceramide were detected in three Aspergillus species: Aspergillus oryzae, Aspergillus sojae and Aspergillus. awamori, using borate-coated TLC. The cerebrosides from A. oryzae were further purified by ion exchange and iatrobeads column chromatographies with or without borate, and determined the composition of sugar, fatty acid and sphingoid base by GC/MS, MALDI-TOF/MS and (1)H-NMR. We identified them as β-glucosylceramide and β-galactosylceramide. The ceramide moiety of both cerebrosides consisted mainly of 2-hydroxystearic acid and either 9-methyl-octadeca-4, 8-sphingadienine or octadeca-4, 8-sphingadienine. To our knowledge, this is the first study to provide evidence for the presence of β-galactosylceramide in A. oryzae.
Diversity of Aspergillus section Nigri on the surface of Vitis labrusca and its hybrid grapes
DEFF Research Database (Denmark)
Ferranti, Larissa de Souza; Fungaro, Maria Helena P; Massi, Fernanda Pelisson
2018-01-01
This study investigated the presence of Aspergillus species belonging to Aspergillus section Nigri on Vitis labrusca and its hybrid grapes grown in Brazil. The ability of the fungi isolates to produce ochratoxin A (OTA) and fumonisin B2 (FB2) as well as the presence of these mycotoxins in the gra......This study investigated the presence of Aspergillus species belonging to Aspergillus section Nigri on Vitis labrusca and its hybrid grapes grown in Brazil. The ability of the fungi isolates to produce ochratoxin A (OTA) and fumonisin B2 (FB2) as well as the presence of these mycotoxins...
Zwane, Eunice N; Rose, Shaunita H; van Zyl, Willem H; Rumbold, Karl; Viljoen-Bloom, Marinda
2014-06-01
The production of ferulic acid esterase involved in the release of ferulic acid side groups from xylan was investigated in strains of Aspergillus tubingensis, Aspergillus carneus, Aspergillus niger and Rhizopus oryzae. The highest activity on triticale bran as sole carbon source was observed with the A. tubingensis T8.4 strain, which produced a type A ferulic acid esterase active against methyl p-coumarate, methyl ferulate and methyl sinapate. The activity of the A. tubingensis ferulic acid esterase (AtFAEA) was inhibited twofold by glucose and induced twofold in the presence of maize bran. An initial accumulation of endoglucanase was followed by the production of endoxylanase, suggesting a combined action with ferulic acid esterase on maize bran. A genomic copy of the A. tubingensis faeA gene was cloned and expressed in A. niger D15#26 under the control of the A. niger gpd promoter. The recombinant strain has reduced protease activity and does not acidify the media, therefore promoting high-level expression of recombinant enzymes. It produced 13.5 U/ml FAEA after 5 days on autoclaved maize bran as sole carbon source, which was threefold higher than for the A. tubingensis donor strain. The recombinant AtFAEA was able to extract 50 % of the available ferulic acid from non-pretreated maize bran, making this enzyme suitable for the biological production of ferulic acid from lignocellulosic plant material.
Iatrogenic aspergillus infection of the central nervous system in a pregnant woman
Directory of Open Access Journals (Sweden)
Lokuhetty Menaka
2009-07-01
Full Text Available A healthy postnatal woman succumbed to fulminant iatrogenic Aspergillus infection of the central nervous system, following accidental inoculation into the subarachnoid space at spinal anesthesia, during an outbreak of Aspergillus meningitis in Sri Lanka. Autopsy revealed extensive Aspergillus meningitis and culture confirmed Aspergillus fumigatus. The thalamic parenchyma in the brain was invaded by fungal hyphae producing necrotizing angitis with thrombosis, thalamic infarcts and fungal abscesses. The directional growth of fungal hyphae from the extra-luminal side of blood vessels towards the lumen favored extension from the brain parenchyma over hematogenous spread. The spinal parenchyma was resistant to fungal invasion in spite of the heavy growth within the spinal meninges and initial inoculation at spinal level. Modulation of the immune response in pregnancy with depression of selective aspects of cell-mediated immunity probably contributed to rapid spread within the subarachnoid space, to involve the brain parenchyma leading to clinical deterioration and death.
Aspergillus-Associated Airway Disease, Inflammation, and the Innate Immune Response
Directory of Open Access Journals (Sweden)
Sanjay H. Chotirmall
2013-01-01
Full Text Available Aspergillus moulds exist ubiquitously as spores that are inhaled in large numbers daily. Whilst most are removed by anatomical barriers, disease may occur in certain circumstances. Depending on the underlying state of the human immune system, clinical consequences can ensue ranging from an excessive immune response during allergic bronchopulmonary aspergillosis to the formation of an aspergilloma in the immunocompetent state. The severest infections occur in those who are immunocompromised where invasive pulmonary aspergillosis results in high mortality rates. The diagnosis of Aspergillus-associated pulmonary disease is based on clinical, radiological, and immunological testing. An understanding of the innate and inflammatory consequences of exposure to Aspergillus species is critical in accounting for disease manifestations and preventing sequelae. The major components of the innate immune system involved in recognition and removal of the fungus include phagocytosis, antimicrobial peptide production, and recognition by pattern recognition receptors. The cytokine response is also critical facilitating cell-to-cell communication and promoting the initiation, maintenance, and resolution of the host response. In the following review, we discuss the above areas with a focus on the innate and inflammatory response to airway Aspergillus exposure and how these responses may be modulated for therapeutic benefit.
Nitrile biotransformation by Aspergillus niger
Czech Academy of Sciences Publication Activity Database
Šnajdrová, Radka; Kristová, Veronika; Crestia, D.; Nikolaou, K.; Kuzma, Marek; Lemaire, M.; Gallienne, E.; Bolte, J.; Bezouška, K.; Křen, Vladimír; Martínková, Ludmila
2004-01-01
Roč. 29, - (2004), s. 227-232 ISSN 1381-1177 R&D Projects: GA MŠk OC D25.002; GA AV ČR IAA4020213 Institutional research plan: CEZ:AV0Z5020903 Keywords : aspergillus niger * nitrile-converting enzymes * nitrile hydratase Subject RIV: EE - Microbiology, Virology Impact factor: 1.547, year: 2004
Hélène Guegan; Sylviane Chevrier; Chantal Belleguic; Eric Deneuville; Florence Robert-Gangneux; Florence Robert-Gangneux; Jean-Pierre Gangneux; Jean-Pierre Gangneux
2018-01-01
Aspergillus fumigatus triazole resistance is an emerging concern for treating chronically infected/colonized patients. This study sought to evaluate the performance of PCR assays to detect Aspergillus fungi together with azole resistance in sputum samples from cystic fibrosis (CF) patients. In total, 119 sputum samples from 87 CF patients were prospectively processed for Aspergillus detection by means of mycological culture and four qPCR assays, 2 in-house methods and two commercial multiplex...
Rania Aydi-Ben Abdallah; Marwa Hassine; Hayfa Jabnoun-Khiareddine; Rabiaa Haouala; Mejda Daami-Remadi
2014-01-01
Culture filtrates, chloroform and ethyl acetate extracts of nine isolates of Aspergillus spp. (A. niger, A. terreus, A. flavus and Aspergillus sp.), isolated from soil and compost, were tested for antifungal activity against Pythium ultimum the causal agent of the potato Pythium leak. Culture filtrates showed a significant antifungal activity at the different tested concentrations. Total inhibition of the pathogen was induced by the filtrate of CH8 of Aspergillus sp., used at 10% ...
Kachapulula, Paul W; Akello, Juliet; Bandyopadhyay, Ranajit; Cotty, Peter J
2017-11-16
Aflatoxins are cancer-causing, immuno-suppressive mycotoxins that frequently contaminate important staples in Zambia including maize and groundnut. Several species within Aspergillus section Flavi have been implicated as causal agents of aflatoxin contamination in Africa. However, Aspergillus populations associated with aflatoxin contamination in Zambia have not been adequately detailed. Most of Zambia's arable land is non-cultivated and Aspergillus communities in crops may originate in non-cultivated soil. However, relationships between Aspergillus populations on crops and those resident in non-cultivated soils have not been explored. Because characterization of similar fungal populations outside of Zambia have resulted in strategies to prevent aflatoxins, the current study sought to improve understanding of fungal communities in cultivated and non-cultivated soils and in crops. Crops (n=412) and soils from cultivated (n=160) and non-cultivated land (n=60) were assayed for Aspergillus section Flavi from 2012 to 2016. The L-strain morphotype of Aspergillus flavus and A. parasiticus were dominant on maize and groundnut (60% and 42% of Aspergillus section Flavi, respectively). Incidences of A. flavus L-morphotype were negatively correlated with aflatoxin in groundnut (log y=2.4990935-0.09966x, R 2 =0.79, P=0.001) but not in maize. Incidences of A. parasiticus partially explained groundnut aflatoxin concentrations in all agroecologies and maize aflatoxin in agroecology III (log y=0.1956034+0.510379x, R 2 =0.57, Pagroecologies across Zambia gives support for modifying fungal community structure to reduce the aflatoxin-producing potential. Published by Elsevier B.V.
Comparison of the aflR gene sequences of strains in Aspergillus section Flavi.
Lee, Chao-Zong; Liou, Guey-Yuh; Yuan, Gwo-Fang
2006-01-01
Aflatoxins are polyketide-derived secondary metabolites produced by Aspergillus parasiticus, Aspergillus flavus, Aspergillus nomius and a few other species. The toxic effects of aflatoxins have adverse consequences for human health and agricultural economics. The aflR gene, a regulatory gene for aflatoxin biosynthesis, encodes a protein containing a zinc-finger DNA-binding motif. Although Aspergillus oryzae and Aspergillus sojae, which are used in fermented foods and in ingredient manufacture, have no record of producing aflatoxin, they have been shown to possess an aflR gene. This study examined 34 strains of Aspergillus section Flavi. The aflR gene of 23 of these strains was successfully amplified and sequenced. No aflR PCR products were found in five A. sojae strains or six strains of A. oryzae. These PCR results suggested that the aflR gene is absent or significantly different in some A. sojae and A. oryzae strains. The sequenced aflR genes from the 23 positive strains had greater than 96.6 % similarity, which was particularly conserved in the zinc-finger DNA-binding domain. The aflR gene of A. sojae has two obvious characteristics: an extra CTCATG sequence fragment and a C to T transition that causes premature termination of AFLR protein synthesis. Differences between A. parasiticus/A. sojae and A. flavus/A. oryzae aflR genes were also identified. Some strains of A. flavus as well as A. flavus var. viridis, A. oryzae var. viridis and A. oryzae var. effuses have an A. oryzae-type aflR gene. For all strains with the A. oryzae-type aflR gene, there was no evidence of aflatoxin production. It is suggested that for safety reasons, the aflR gene could be examined to assess possible aflatoxin production by Aspergillus section Flavi strains.
Chiotta, María L; Ponsone, María L; Sosa, Débora M; Combina, Mariana; Chulze, Sofía N
2013-12-01
Aspergillus section Nigri are described as the main source of ochratoxin A (OTA) contamination in grapes and wine worldwide. The knowledge of the factors affecting grape contamination by species included in this section and OTA production is essential to be able to reduce their presence, not only to improve wine quality, but also to maintain their safety. Therefore, the aims of this study were to determine the incidence of Aspergillus section Nigri species harvested in different grape-growing regions from Argentina, their ability to produce OTA, to correlate with meteorological conditions and geographical coordinates with their prevalence and to evaluate the OTA natural occurrence in grapes and wines. The morphological identification showed that Aspergillus niger aggregate species were the most prevalent ones, followed by Aspergillus carbonarius and Aspergillus uniseriate. These populations were confirmed through using AFLP markers and sequencing and, Aspergillus tubingensis was separated from A. niger aggregate. Climatic factors, altitude, longitude and latitude have influenced on the distribution of species included in the section. A. carbonarius and A. niger were OTA producers but differed in their OTA producing ability. Temperature was the factor which influenced the most over the highest incidence of A. carbonarius in La Rioja and San Juan regions. The trellis system in vineyards and drip irrigation also influenced the species isolation. The OTA levels detected in grapes and wines were low, but grape variety was more important in susceptibility to fungal infection and OTA levels. Copyright © 2013 Elsevier Ltd. All rights reserved.
Czech Academy of Sciences Publication Activity Database
Sklenář, František; Jurjević, Ž.; Zalar, P.; Frisvad, J.C.; Visagie, C.M.; Kolařík, Miroslav; Houbraken, J.; Chen, A.J.; Yilmaz, N.; Seifert, K. A.; Coton, M.; Deniel, F.; Gunde-Cimerman, N.; Samson, R.A.; Peterson, S.W.; Hubka, Vít
2017-01-01
Roč. 88, SEP 2017 (2017), s. 161-236 ISSN 0166-0616 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:61388971 Keywords : Aspergillus restrictus * Aspergillus penicillioides * Eurotium Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 14.000, year: 2016
DEFF Research Database (Denmark)
Welten, S. M. J.; Bastiaansen, Ajnm; de Jong, R. C. M.
2014-01-01
in mice after single femoral artery ligation. Methods and Results: Gene silencing oligonucleotides (GSOs) were used to inhibit 4 14q32 microRNAs, miR-329, miR-487b, miR-494, and miR-495, 1 day before double femoral artery ligation. Blood flow recovery was followed by laser Doppler perfusion imaging. All 4...... GSOs clearly improved blood flow recovery after ischemia. Mice treated with GSO-495 or GSO-329 showed increased perfusion already after 3 days (30% perfusion versus 15% in control), and those treated with GSO-329 showed a full recovery of perfusion after 7 days (versus 60% in control). Increased...
Energy Technology Data Exchange (ETDEWEB)
Desai, M. I.; Dayeh, M. A.; Ebert, R. W.; Schwadron, N. A. [Southwest Research Institute, 6220 Culebra Road, San Antonio, TX 78238 (United States); Mason, G. M. [Johns Hopkins University/Applied Physics Laboratory, Laurel, MD 20723 (United States); McComas, D. J. [Department of Astrophysical Sciences, Princeton University, NJ 08544 (United States); Li, G. [The Center for Space Plasma and Aeronomic Research (CSPAR), University of Alabama in Huntsville, Huntsville, AL 35756 (United States); Cohen, C. M. S.; Mewaldt, R. A. [California Institute of Technology, Pasadena, CA 91125 (United States); Smith, C. W., E-mail: mdesai@swri.edu [University of New Hampshire, 8 College Road, Durham NH 03824 (United States)
2016-09-10
We fit ∼0.1–500 MeV nucleon{sup −1} H–Fe spectra in 46 large solar energetic particle (SEP) events with the double power-law Band function to obtain a normalization constant, low- and high-energy parameters γ {sub a} and γ {sub b}, and break energy E {sub B}, and derive the low-energy spectral slope γ {sub 1}. We find that: (1) γ {sub a}, γ {sub 1}, and γ {sub b} are species-independent and the spectra steepen with increasing energy; (2) E {sub B} decreases systematically with decreasing Q/M scaling as (Q/M){sup α}; (3) α varies between ∼0.2–3 and is well correlated with the ∼0.16–0.23 MeV nucleon{sup −1} Fe/O; (4) in most events, α < 1.4, γ {sub b}– γ {sub a} > 3, and O E {sub B} increases with γ {sub b}– γ {sub a}; and (5) in many extreme events (associated with faster coronal mass ejections (CMEs) and GLEs), Fe/O and {sup 3}He/{sup 4}He ratios are enriched, α ≥ 1.4, γ {sub b}– γ {sub a} < 3, and E {sub B} decreases with γ {sub b}– γ {sub a}. The species-independence of γ {sub a}, γ {sub 1}, and γ {sub b} and the Q/M dependence of E {sub B} within an event and the α values suggest that double power-law SEP spectra occur due to diffusive acceleration by near-Sun CME shocks rather than scattering in interplanetary turbulence. Using γ {sub 1}, we infer that the average compression ratio for 33 near-Sun CME shocks is 2.49 ± 0.08. In most events, the Q/M dependence of E {sub B} is consistent with the equal diffusion coefficient condition and the variability in α is driven by differences in the near-shock wave intensity spectra, which are flatter than the Kolmogorov turbulence spectrum but weaker than the spectra for extreme events. In contrast, in extreme events, enhanced wave power enables faster CME shocks to accelerate impulsive suprathermal ions more efficiently than ambient coronal ions.
A genomics based discovery of secondary metabolite biosynthetic gene clusters in Aspergillus ustus.
Directory of Open Access Journals (Sweden)
Borui Pi
Full Text Available Secondary metabolites (SMs produced by Aspergillus have been extensively studied for their crucial roles in human health, medicine and industrial production. However, the resulting information is almost exclusively derived from a few model organisms, including A. nidulans and A. fumigatus, but little is known about rare pathogens. In this study, we performed a genomics based discovery of SM biosynthetic gene clusters in Aspergillus ustus, a rare human pathogen. A total of 52 gene clusters were identified in the draft genome of A. ustus 3.3904, such as the sterigmatocystin biosynthesis pathway that was commonly found in Aspergillus species. In addition, several SM biosynthetic gene clusters were firstly identified in Aspergillus that were possibly acquired by horizontal gene transfer, including the vrt cluster that is responsible for viridicatumtoxin production. Comparative genomics revealed that A. ustus shared the largest number of SM biosynthetic gene clusters with A. nidulans, but much fewer with other Aspergilli like A. niger and A. oryzae. These findings would help to understand the diversity and evolution of SM biosynthesis pathways in genus Aspergillus, and we hope they will also promote the development of fungal identification methodology in clinic.
A Genomics Based Discovery of Secondary Metabolite Biosynthetic Gene Clusters in Aspergillus ustus
Pi, Borui; Yu, Dongliang; Dai, Fangwei; Song, Xiaoming; Zhu, Congyi; Li, Hongye; Yu, Yunsong
2015-01-01
Secondary metabolites (SMs) produced by Aspergillus have been extensively studied for their crucial roles in human health, medicine and industrial production. However, the resulting information is almost exclusively derived from a few model organisms, including A. nidulans and A. fumigatus, but little is known about rare pathogens. In this study, we performed a genomics based discovery of SM biosynthetic gene clusters in Aspergillus ustus, a rare human pathogen. A total of 52 gene clusters were identified in the draft genome of A. ustus 3.3904, such as the sterigmatocystin biosynthesis pathway that was commonly found in Aspergillus species. In addition, several SM biosynthetic gene clusters were firstly identified in Aspergillus that were possibly acquired by horizontal gene transfer, including the vrt cluster that is responsible for viridicatumtoxin production. Comparative genomics revealed that A. ustus shared the largest number of SM biosynthetic gene clusters with A. nidulans, but much fewer with other Aspergilli like A. niger and A. oryzae. These findings would help to understand the diversity and evolution of SM biosynthesis pathways in genus Aspergillus, and we hope they will also promote the development of fungal identification methodology in clinic. PMID:25706180
Lee, Seung-Hun; Park, Shin Young; Byun, Kye-Hwan; Chun, Hyang Sook; Ha, Sang-Do
2017-07-01
Aspergillus flavus and Aspergillus parasiticus are primary pathogen moulds on brown rice and barley. This study investigated the effects of microwave irradiation (MWI) (2450 MHz, 700 W, 10-50 s) on inactivation of A. flavus and A. parasiticus on brown rice and barley and the quality of these samples. The counts of both strains were significantly (p 90% reduction of mould without causing deleterious changes to the colour, moisture content and sensory qualities of these cereals.
Aspergillus niger endocarditis in an immunocompetent patient: an unusual course
Kreiss, Y.; Vered, Z.; Keller, N.; Kochva, I.; Sidi, Y.; Gur, H.
2000-01-01
Aspergillus is an opportunistic nosocomial fungus generally associated with a high mortality rate. A niger has been rarely associated with infection, and most cases have occurred in patients who have recently undergone heart surgery or in immunocompromised patients. We present a case of an immunocompetent patient with A niger endocarditis which illustrates the difficulties in diagnosis and the possible insidious course of fungal endocarditis. Keywords: endocarditis; Aspergillus niger; transoesophageal echocardiography PMID:10644391
Yazdani, D; Zainal Abidin, M A; Tan, Y H; Kamaruzaman, S
2011-01-01
Thirty milled rice samples were collected from retailers in 4 provinces of Malaysia. These samples were evaluated for Aspergillus spp. infection by direct plating on malt extract salt agar (MESA). All Aspergillus holomorphs were isolated and identified using nucleotide sequences of ITS 1 and ITS 2 of rDNA. Five anamorphs (Aspergillus flavus, A. oryzae, A. tamarii, A. fumigatus and A. niger) and 5 teleomorphs (Eurotium rubrum, E. amstelodami, E. chevalieri, E. cristatum and E. tonophilum) were identified. The PCR-sequencing based technique for sequences of ITS 1 and ITS 2 is a fast technique for identification of Aspergillus and Eurotium species, although it doesn't work flawlessly for differentiation of Eurotium species. All Aspergillus and Eurotium isolates were screened for their ability to produce aflatoxin and ochratoxin A (OTA) by HPLC and TLC techniques. Only A. flavus isolate UPM 89 was able to produce aflatoxins B1 and B2.
Polyphasic taxonomy of Aspergillus section Cervini
DEFF Research Database (Denmark)
Chen, A.J.; Varga, J.; Frisvad, Jens Christian
2016-01-01
Species belonging to Aspergillus section Cervini are characterised by radiate or short columnar, fawn coloured, uniseriate conidial heads. The morphology of the taxa in this section is very similar and isolates assigned to these species are frequently misidentified. In this study, a polyphasic...
GalX regulates the d-galactose oxido-reductive pathway in Aspergillus niger
Gruben, B.S.; Zhou, M.; de Vries, R.P.
2012-01-01
Galactose catabolism in Aspergillus nidulans is regulated by at least two regulators, GalR and GalX. In Aspergillus niger only GalX is present, and its role in d-galactose catabolism in this fungus was investigated. Phenotypic and gene expression analysis of a wild type and a galX disruptant
Directory of Open Access Journals (Sweden)
Kambiz Diba
2014-09-01
Conclusion: The hospital sources for the Aspergillus clinical isolates included air condition and walls. RAPD-PCR analysis can play a trivial role to find the hospital sources of Aspergillus clinical isolates.
Wood, Geoffrey P F; Sreedhara, Alavattam; Moore, Jamie M; Wang, John; Trout, Bernhardt L
2016-05-12
An assessment of the mechanisms of (•)OH and (•)OOH radical-mediated oxidation of tryptophan was performed using density functional theory calculations and ab initio plane-wave Quantum Mechanics/Molecular Mechanics (QM/MM) molecular dynamics simulations. For the (•)OH reactions, addition to the pyrrole ring at position 2 is the most favored site with a barrierless reaction in the gas phase. The subsequent degradation of this adduct through a H atom transfer to water was intermittently observed in aqueous-phase molecular dynamics simulations. For the (•)OOH reactions, addition to the pyrrole ring at position 2 is the most favored pathway, in contrast to the situation in the model system ethylene, where concerted addition to the double bond is preferred. From the (•)OOH position 2 adduct QM/MM simulations show that formation of oxy-3-indolanaline occurs readily in an aqueous environment. The observed transformation starts from an initial rupture of the O-O bond followed by a H atom transfer with the accompanying loss of an (•)OH radical to solution. Finally, classical molecular dynamics simulations were performed to equate observed differential oxidation rates of various tryptophan residues in monoclonal antibody fragments. It was found that simple parameters derived from simulation correlate well with the experimental data.
Directory of Open Access Journals (Sweden)
Aylin Canbolat Ayhan
2013-06-01
Full Text Available Aspergillus can causes invasive disease of various organs especially in patients with weakened immune systems. Aspergillus synovitis and arthritis are uncommon types of involvement due to this infection. Approches to fungal osteoarticular infections are based on only case reports. This paper presents a rare case of chronic granulomatous Aspergillus synovitis in an immunocompromised 5-year old girl who was treated for acute lymphoblastic leukemia.
Internal Carotid Artery Blister-Like Aneurysm Caused by Aspergillus – Case Report
International Nuclear Information System (INIS)
Ogawa, Masaki; Sakurai, Keita; Kawaguchi, Takatsune; Naiki-Ito, Aya; Nakagawa, Motoo; Okita, Kenji; Matsukawa, Noriyuki; Shibamoto, Yuta
2015-01-01
Blister-like aneurysm of the supraclinoid internal carotid artery (ICA) is a well-documented cause of subarachnoid hemorrhage. Generally, this type of aneurysm is associated with various conditions such as hypertension, arteriosclerosis, and ICA dissection. Although Aspergillus is the most common organism causing intracranial fungal aneurysmal formation, there is no report of a blister-like aneurysm caused by Aspergillus infection. An 83-year-old man received corticosteroid pulse therapy followed by oral steroid therapy for an inflammatory pseudotumor of the clivus. Two months later, the patient was transported to an emergency department due to the diffuse subarachnoid hemorrhage, classified as Fisher group 4. Subsequent 3D computed tomography angiogram revealed a blister-like aneurysm at the superior wall of the left ICA. Six days later, the patient died of subarachnoid hemorrhage caused by the left ICA aneurysm rerupture. Autopsy revealed proliferation of Aspergillus hyphae in the wall of the aneurysm. Notably, that change was present more densely in the inner membrane than in the outer one. Thus, it was considered that Aspergillus hyphae caused infectious aneurysm formation in the left ICA via hematogenous seeding rather than direct invasion. The blister-like aneurysm is a rare but important cause of subarachnoid hemorrhage. This case report documents another cause of blister-like aneurysms, that is an infectious aneurysm associated with Aspergillus infection
Aspergillus fumigatus-Related Species in Clinical Practice
Directory of Open Access Journals (Sweden)
Frederic eLamoth
2016-05-01
Full Text Available Aspergillus fumigatus is the main etiologic agent of invasive aspergillosis (IA. Other Aspergillus species belonging to the section Fumigati (A. fumigatus complex may occasionally be the cause of IA. These strains are often misidentified, as they cannot be distinguished from A. fumigatus by conventional morphological analysis and sequencing methods. This lack of recognition may have important consequences as these A. fumigatus-related species often display some level of intrinsic resistance to azoles and other antifungal drugs. A. lentulus, A. udagawae, A. viridinutans and A. thermomutatus (Neosartorya pseudofischeri have been associated with refractory cases of IA. Microbiologists should be able to suspect the presence of these cryptic species behind a putative A. fumigatus isolate on the basis of some simple characteristics, such as defect in sporulation and/or unusual antifungal susceptibility profile. However, definitive species identification requires specific sequencing analyses of the beta-tubulin or calmodulin genes, which are not available in most laboratories. Multiplex PCR assays or matrix-assisted laser desorption ionization – time-of-flight mass spectrometry (MALDI-TOF MS gave promising results for rapid and accurate distinction between A. fumigatus and other Aspergillus spp. of the section Fumigati in clinical practice. Improved diagnostic procedures and antifungal susceptibility testing may be helpful for the early detection and management of these particular IA cases.
In a previous study, inedible almond pick-out samples were assayed for aflatoxin and aflatoxigenic Aspergillus species. These samples were observed to contain high populations of black-spored Aspergillus section Nigri species. To investigate whether these species may contribute to the total potent...
Blood Aspergillus RNA is a promising alternative biomarker for invasive aspergillosis.
Zhao, Yanan; Paderu, Padmaja; Railkar, Radha; Douglas, Cameron; Iannone, Robert; Shire, Norah; Perlin, David S
2016-11-01
A critical challenge for the successful application of antifungal therapies for invasive aspergillosis (IA) is a lack of reliable biomarkers to assess early treatment response. Patients with proven or probable IA were prospectively enrolled, and serial blood samples were collected at 8 specified time points during 12-week antifungal therapy. Total nucleic acid was extracted from 2.5 ml blood and tested for Aspergillus-specific RNA by a pan-Aspergillus real-time nucleic acid sequence-based amplification (NASBA) assay. Serum 1, 3-β-D-glucan (BG) and galactomannan (GM) were measured in parallel. Clinical outcome was evaluated at 6 and 12 weeks. Overall, 48/328 (14.6%) blood samples from 29/46 (63%) patients had positive NASBA detection at baseline and/or some point during the study. Positive NASBA results during the first 4 and 6 weeks of treatment are significantly associated with the 12-week outcome. Blood RNA load change during weeks 4-6 may be informative to predict outcome at 12 weeks. While independent of serum GM, the kinetic change of circulating Aspergillus RNA appears to be well correlated with that of BG on some patient individuals. Monitoring blood Aspergillus RNA during the first 4-6 weeks of antifungal treatment may help assess therapeutic response. Combination of circulating Aspergillus RNA and BG may be a useful adjunct to assess response. © The Author 2016. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Cellulase production by two mutant strain of Trichoderma longibranchiatum QM 9414 and Rut C30
International Nuclear Information System (INIS)
Blanco, M. J.
1991-01-01
Native or pretreated biomass from Onopordum nervosum Boiss, has been examined as candidate feedstock for cellulase production by two mutant strain of Trichoderma Ionqibrachiatum QM9414 and Rut C30. Batch cultivation methods were evaluated and compared with previous experiments using ball-milled, crystalline cellulose (Solka floc). Batch cultivation of T. Ionqibrachiatum Rut C30 on 5% (w/v) acid pretreated O. nervosum biomass yielded enzyme productivities and activities comparable to those obtained on Solka floc. However, the overall enzyme production performance was lower than on Solka floc at comparable cellulose concentrations. This fact may be due to the accumulation of pretreated by products and lignin in the ferment. (Author) 40 refs
Sobolev, Victor; Arias, Renee; Goodman, Kerestin; Walk, Travis; Orner, Valerie; Faustinelli, Paola; Massa, Alicia
2018-01-10
Aspergillus flavus is a soil fungus that commonly invades peanut seeds and often produces carcinogenic aflatoxins. Under favorable conditions, the fungus-challenged peanut plant produces and accumulates resveratrol and its prenylated derivatives in response to such an invasion. These prenylated stilbenoids are considered peanut antifungal phytoalexins. However, the mechanism of peanut-fungus interaction has not been sufficiently studied. We used pure peanut stilbenoids arachidin-1, arachidin-3, and chiricanine A to study their effects on the viability of and metabolite production by several important toxigenic Aspergillus species. Significant reduction or virtually complete suppression of aflatoxin production was revealed in feeding experiments in A. flavus, Aspergillus parasiticus, and Aspergillus nomius. Changes in morphology, spore germination, and growth rate were observed in A. flavus exposed to the selected peanut stilbenoids. Elucidation of the mechanism of aflatoxin suppression by peanut stilbenoids could provide strategies for preventing plant invasion by the fungi that produce aflatoxins.
Phylogeny and subgeneric taxonomy of Aspergillus
DEFF Research Database (Denmark)
Peterson, S.W.; Varga, Janos; Frisvad, Jens Christian
2008-01-01
The phylogeny of the genus Aspergillus and its teleomorphs is discussed based on multilocus sequence data. DNA sequence analysis was used to formulate a nucleotide sequence framework of the genus and to analyze character changes in relationship to the phylogeny hypothesized from the DNA sequence...
Simulating chemical reactions in ionic liquids using QM/MM methodology.
Acevedo, Orlando
2014-12-18
The use of ionic liquids as a reaction medium for chemical reactions has dramatically increased in recent years due in large part to the numerous reported advances in catalysis and organic synthesis. In some extreme cases, ionic liquids have been shown to induce mechanistic changes relative to conventional solvents. Despite the large interest in the solvents, a clear understanding of the molecular factors behind their chemical impact is largely unknown. This feature article reviews our efforts developing and applying mixed quantum and molecular mechanical (QM/MM) methodology to elucidate the microscopic details of how these solvents operate to enhance rates and alter mechanisms for industrially and academically important reactions, e.g., Diels-Alder, Kemp eliminations, nucleophilic aromatic substitutions, and β-eliminations. Explicit solvent representation provided the medium dependence of the activation barriers and atomic-level characterization of the solute-solvent interactions responsible for the experimentally observed "ionic liquid effects". Technical advances are also discussed, including a linear-scaling pairwise electrostatic interaction alternative to Ewald sums, an efficient polynomial fitting method for modeling proton transfers, and the development of a custom ionic liquid OPLS-AA force field.
Performance of Aspergillus PCR in cerebrospinal fluid for the diagnosis of cerebral aspergillosis.
Imbert, S; Brossas, J-Y; Palous, M; Joly, I; Meyer, I; Fekkar, A
2017-11-01
Cerebral aspergillosis is a rare but often fatal form of invasive aspergillosis that remains difficult to diagnose. The literature has shown the value of Aspergillus PCR in blood-derived samples for the diagnosis of invasive aspergillosis but provides far less information for cerebrospinal fluid (CSF) in cerebral aspergillosis. Here, we evaluated the usefulness of an Aspergillus PCR assay performed on CSF for the diagnosis of cerebral aspergillosis. This retrospective study involved 72 patients with suspected cerebral aspergillosis for a total of 88 CSF samples in whom CSF Aspergillus PCR was performed. Seventeen patients had proven/probable invasive aspergillosis according to the European Organization for Research and Treatment of Cancer/Mycoses Study Group criteria, including 12 cases of proven/probable cerebral aspergillosis. Aspergillus PCR in CSF was positive in nine of the twelve patients with cerebral aspergillosis, i.e. 75% sensitivity. In contrast, CSF culture was positive for Aspergillus in only two patients. In the non-cerebral aspergillosis group (60 patients), PCR was positive in one patient, i.e. 98.3% specificity. In this particular population of high-risk patients with suspicion of cerebral aspergillosis, the disease incidence was 16.7%. Therefore, the positive and negative predictive values of PCR were 90% and 95.2%, respectively. The results of this study indicate that Aspergillus PCR in CSF is an interesting tool that may eliminate the need for cerebral biopsy in patients with suspected cerebral aspergillosis. Copyright © 2017 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.
Aspergillus Pericarditis with Tamponade in a Renal Transplant Patient
Directory of Open Access Journals (Sweden)
Sylvia Biso
2017-01-01
Full Text Available Aspergillus pericarditis is a rare and life-threatening infection in immunosuppressed patients. It has nonspecific clinical manifestations that often mimic other disease entities especially in patients who have extensive comorbidities. Diagnosis is oftentimes delayed and rarely done antemortem. A high degree of suspicion in immunocompromised patients is necessary for evaluation and timely diagnosis. This is a case of Aspergillus pericarditis with cardiac tamponade in a renal transplant patient with liver cirrhosis. Two months after transplant, he developed decompensation of his cirrhosis from hepatitis C, acute cellular rejection, and Kluyvera bacteremia, followed by vancomycin-resistant Enterococcus faecium (VRE bacteremia. Four months after transplant, the patient presented with lethargy and fluid overload. He subsequently developed shock and ventilator-dependent respiratory failure. An echocardiogram showed pericardial effusion with cardiac tamponade. He had emergent pericardiocentesis that showed purulent drainage. He was started on broad-spectrum antibiotics. Amphotericin B was initiated when the pericardial fluid grew mold that was later identified as Aspergillus fumigatus. The patient quickly decompensated and expired.
Energy Technology Data Exchange (ETDEWEB)
Blanco, M J
1991-07-01
Native or pretreated biomass from Onopordum nervosum Boiss, has been examined as candidate feedstock for cellulase production by two mutant strain of Trichoderma Ionqibrachiatum QM9414 and Rut C30. Batch cultivation methods were evaluated and compared with previous experiments using ball-milled, crystalline cellulose (Solka floc). Batch cultivation of T. Ionqibrachiatum Rut C30 on 5% (w/v) acid pretreated O. nervosum biomass yielded enzyme productivities and activities comparable to those obtained on Solka floc. However, the overall enzyme production performance was lower than on Solka floc at comparable cellulose concentrations. This fact may be due to the accumulation of pretreated by products and lignin in the ferment. (Author) 40 refs.
CSIR Research Space (South Africa)
Zwane, EN
2017-03-01
Full Text Available acid, in particular for the enrichment of food substrates. A recombinant Aspergillus tubingensis ferulic acid esterase Type A (FAEA) was expressed in Aspergillus niger D15#26 and purified with anion-exchange chromatography (3487 U/mg, Km = 0.43 mM, Kcat...
Aspergillus bertholletius sp. nov. from Brazil nuts.
Directory of Open Access Journals (Sweden)
Marta H Taniwaki
Full Text Available During a study on the mycobiota of brazil nuts (Bertholletia excelsa in Brazil, a new Aspergillus species, A. bertholletius, was found, and is described here. A polyphasic approach was applied using morphological characters, extrolite data as well as partial β-tubulin, calmodulin and ITS sequences to characterize this taxon. A. bertholletius is represented by nineteen isolates from samples of brazil nuts at various stages of production and soil close to Bertholletia excelsa trees. The following extrolites were produced by this species: aflavinin, cyclopiazonic acid, kojic acid, tenuazonic acid and ustilaginoidin C. Phylogenetic analysis using partial β-tubulin and camodulin gene sequences showed that A. bertholletius represents a new phylogenetic clade in Aspergillus section Flavi. The type strain of A. bertholletius is CCT 7615 ( = ITAL 270/06 = IBT 29228.
Aspergillus bertholletius sp. nov. from Brazil Nuts
Taniwaki, Marta H.; Pitt, John I.; Iamanaka, Beatriz T.; Sartori, Daniele; Copetti, Marina V.; Balajee, Arun; Fungaro, Maria Helena P.; Frisvad, Jens C.
2012-01-01
During a study on the mycobiota of brazil nuts (Bertholletia excelsa) in Brazil, a new Aspergillus species, A. bertholletius, was found, and is described here. A polyphasic approach was applied using morphological characters, extrolite data as well as partial β-tubulin, calmodulin and ITS sequences to characterize this taxon. A. bertholletius is represented by nineteen isolates from samples of brazil nuts at various stages of production and soil close to Bertholletia excelsa trees. The following extrolites were produced by this species: aflavinin, cyclopiazonic acid, kojic acid, tenuazonic acid and ustilaginoidin C. Phylogenetic analysis using partial β-tubulin and camodulin gene sequences showed that A. bertholletius represents a new phylogenetic clade in Aspergillus section Flavi. The type strain of A. bertholletius is CCT 7615 ( = ITAL 270/06 = IBT 29228). PMID:22952594
Zheng, Ajuan; Zhang, Lihui; Wang, Shaojin
2017-05-16
Radio frequency (RF) heating has been proposed and tested to achieve a required anti-fungal efficacy on various food samples due to its advantage of deeper penetration depth and better heating uniformity. The purpose of this study was to validate applications of RF treatments for controlling Aspergillus parasiticus in corn while maintaining product quality. A pilot-scale, 27.12MHz, 6kW RF heating system together with hot air heating was used to rapidly pasteurize 3.0kg corn samples. Results showed that the pasteurizing effect of RF heating on Aspergillus parasiticus increased with increasing heating temperature and holding time, and RF heating at 70°C holding in hot air for at least 12min resulted in 5-6 log reduction of Aspergillus parasiticus in corn samples with the moisture content of 15.0% w.b. Furthermore, thermal resistance of Aspergillus parasiticus decreased with increasing moisture content (MC) of corn samples. Quality (MC, water activity - a w , protein, starch, ash, fat, fatty acid, color, electrical conductivity and germination rate) of RF treated corn met the required quality standard used in cereal industry. Therefore, RF treatments can provide an effective and rapid heating method to control Aspergillus parasiticus and maintain acceptable corn quality. Copyright © 2017 Elsevier B.V. All rights reserved.
Fatal fungal endocarditis by Aspergillus udagawae: an emerging cause of invasive aspergillosis.
Seki, Atsuko; Yoshida, Atsushi; Matsuda, Yoko; Kawata, Mitsuhiro; Nishimura, Takashi; Tanaka, Jun; Misawa, Yoshiki; Nakano, Yuta; Asami, Ryoko; Chida, Koji; Kikuchi, Ken; Arai, Tomio
Aspergillus udagawae has morphological similarities to Aspergillusfumigatus; however, it shows a low susceptibility to common antifungal drugs and poor in vitro sporulation. We present the first reported case of infectious endocarditis caused by A. udagawae. An awareness of this newly described Aspergillus species is vital for further clarification. Copyright © 2017 Elsevier Inc. All rights reserved.
New taxa in Aspergillus section Usti
DEFF Research Database (Denmark)
Samson, R. A.; Varga, J.; Meijer, M.
2011-01-01
identical ITS sequences with A. insuetus CBS 119.27, but is clearly distinct from that species based on beta-tubulin and calmodulin sequence data. This species is unable to grow at 37 degrees C, similarly to A. keveii and A. insuetus. Aspergillus carlsbadensis sp. nov. was isolated from the Carlsbad Caverns...... National Park in New Mexico. This taxon is related to, but distinct from a dade including A. calidoustus, A. pseudodeflectus, A. insuetus and A. keveii on all trees. This species is also unable to grow at 37 degrees C, and acid production was not observed on CREA. Aspergillus californicus sp. nov....... Isolates from stored maize, South Africa, as a culture contaminant of Bipolaris sorokiniana from indoor air in Finland proved to be related to, but different from A. ustus and A. puniceus. The taxon is proposed as the new species A. pseudoustus. Although supported only by low bootstrap values, F monodii...
Description of a cellulose-binding domain and a linker sequence from Aspergillus fungi
Quentin, M; Ebbelaar, M; Derksen, J; Mariani, C; van der Valk, H
A family I cellulose-binding domain (CBD) and a serine- and threonine-rich linker peptide were cloned from the fungi Aspergillus japonicus and Aspergillus aculeatus. A glutathione S-transferase (GST) fusion protein comprising GST and a peptide linker with the CBD fused to its C-terminus, was
nitrosoguanidine-induced cadmium resistant mutants of Aspergillus
Indian Academy of Sciences (India)
Unknown
nitrosoguanidine-induced cadmium resistant mutants of. Aspergillus niger. SAMAR ... gens and UV irradiation to study transportation of cad- mium ion through cell ..... Rowley W S 1993 Yeast bZib proteins mediate pleiotropic drug and metal ...
Measurement and analysis on optical characteristics of Aspergillus oryzae spores in infrared band
Li, Le; Hu, Yihua; Gu, Youlin; Chen, Wei; Xu, Shilong; Zhao, Xinying
2015-10-01
Spore is an important part of bioaerosols. The optical characteristics of spore is a crucial parameter for study on bioaerosols. The reflection within the waveband of 2.5 to15μm were measured by squash method. Based on the measured data, Complex refractive index of Aspergillus oryzae spores within the waveband of 3 to 5μm and 8 to 14 μm were calculated by using Krames-Kronig (K-K) relationship. Then,the mass extinction coefficient of Aspergillus oryzae spores within the waveband of 3 to 5μm and 8 to 14μm were obtained by utilizing Mie scattering theory, and the results were analyzed and discussed. The average mass extinction coefficient of Aspergillus oryzae spores is 0.51 m2/g in the range of 3 to 5μm and 0.48m2/g in the range of 8 to 14μm. Compared with common inorganic compounds, Aspergillus oryzae spores possesses a good extinction performance in infrared band.
Experimental study of Aspergillus flavus fungus from uranium mines
Energy Technology Data Exchange (ETDEWEB)
Kusak, V. (Ceskoslovenska Akademie Ved, Prague. Ustav Experimentalni Mediciny)
1982-06-01
Cultivation is discussed of fungus strain Aspergillus flavus obtained from materials from uranium mines. It was found that an addition of 0.6 g of uranium in form of uranyl acetate or of 0.6 g of thorium in form on thorium nitrate in 1000 ml of the standard medium had stimulating effects on the growth and sporulation of Aspergillus flavus. Irradiating the cultivated fungus through a polyethylene foil did not show a stimulating effect. It is stated that uranium and its daughters must be directly present in the culture medium for their stimulating effect on growth and sporulation to manifest itself.
Isolation, Optimization, and Investigation of Production of Linoleic Acid in Aspergillus niger
Directory of Open Access Journals (Sweden)
Noushin Shafiei
2016-08-01
Full Text Available Background and Objectives: Microorganisms that are capable of accumulating lipid up to 20% of their biomass are called oleaginous microorganisms. In this study, optimization in lipid and linolenic acid production was investigated in Aspergillus niger as an oleaginous filamentous fungi. Methods: In this study, at first different strains of filamentous fungi were isolated, and after staining of the isolates with Sudan Black, their oil was extracted using chloroform/methanol. Then, the isolates with oil/dry biomass ratio of more than 20% were considered as oleaginous filamentous fungi. After microscopic examination, the identified isolate was optimized in terms of oil production. Finally, the amount of linolenic acid was evaluated using gas chromatography. Results: At first, 20 filamentous fungi isolates were isolated. According to the results of Sudan Black staining, lipid inclusions were observed in all the fungal isolates. The amount of oil produced in all isolates, showed that the percentage of oil production in isolates 4, 5, and 16, was more than 20%. In microscopic examination, the isolate 5 was Aspergillus niger. The best pH, temperature, time, and carbon source for oil production by Aspergillus niger was 4.5, 30°C, 96 hours, and fructose, respectively. The amount of linolenic acid in Aspergillus niger was reported 22.4% using gas chromatography. Conclusion: The results of this study revealed that Aspergillus niger is an appropriate filamentous fungi for linolenic acid production.
Complement Attack against Aspergillus and Corresponding Evasion Mechanisms
Directory of Open Access Journals (Sweden)
Cornelia Speth
2012-01-01
Full Text Available Invasive aspergillosis shows a high mortality rate particularly in immunocompromised patients. Perpetually increasing numbers of affected patients highlight the importance of a clearer understanding of interactions between innate immunity and fungi. Innate immunity is considered to be the most significant host defence against invasive fungal infections. Complement represents a crucial part of this first line defence and comprises direct effects against invading pathogens as well as bridging functions to other parts of the immune network. However, despite the potency of complement to attack foreign pathogens, the prevalence of invasive fungal infections is increasing. Two possible reasons may explain that phenomenon: First, complement activation might be insufficient for an effective antifungal defence in risk patients (due to, e.g., low complement levels, poor recognition of fungal surface, or missing interplay with other immune elements in immunocompromised patients. On the other hand, fungi may have developed evasion strategies to avoid recognition and/or eradication by complement. In this review, we summarize the most important interactions between Aspergillus and the complement system. We describe the various ways of complement activation by Aspergillus and the antifungal effects of the system, and also show proven and probable mechanisms of Aspergillus for complement evasion.
Production and Purification of Peroxidase from Aspergillus niger.
Directory of Open Access Journals (Sweden)
Mohammed A. Jebor
2017-02-01
Full Text Available This study was conducted in the laboratories of Biology Department, College of Science, which deals with isolation and purification of peroxidase and optimization of process parameters to achieve maximum yield of peroxidase by Aspergillus niger. Solid-state fermentation of Aspergillus niger was carried out for enhanced production of peroxidase using hydrogen peroxide as the substrate of enzyme maximum activity of the enzyme was achieved under optimum growth conditions. The optimum conditions were the isolated of Aspergillus niger from soil and growth in synthetic medium, it gave high titer of peroxidase activity, the fructose as carbon source, peptone as nitrogen source, after 12 days of incubation, incubation temperature 25 °C and pH = 6.5. Peroxidase purified in four purification steps; precipitation with 70% saturation of ammonium sulfate, step of dialysis, the third by ion exchange chromatography using DEAE-Cellulose and fourth by gel filtration throughout Sephadex G-100. The specific activity of the purified enzyme was 150U/mg with 7.75 folds. The peroxidase was shown to have molecular weight of 40kDa in SDS-PAGA and about 40kDa in gel filtration.The optimum pH and temperature for peroxidase activity 7 and 35 C0 respectively.
Trnka, Tomáš; Kozmon, Stanislav; Tvaroška, Igor; Koča, Jaroslav
2015-04-01
The glycosylation of cell surface proteins plays a crucial role in a multitude of biological processes, such as cell adhesion and recognition. To understand the process of protein glycosylation, the reaction mechanisms of the participating enzymes need to be known. However, the reaction mechanism of retaining glycosyltransferases has not yet been sufficiently explained. Here we investigated the catalytic mechanism of human isoform 2 of the retaining glycosyltransferase polypeptide UDP-GalNAc transferase by coupling two different QM/MM-based approaches, namely a potential energy surface scan in two distance difference dimensions and a minimum energy reaction path optimisation using the Nudged Elastic Band method. Potential energy scan studies often suffer from inadequate sampling of reactive processes due to a predefined scan coordinate system. At the same time, path optimisation methods enable the sampling of a virtually unlimited number of dimensions, but their results cannot be unambiguously interpreted without knowledge of the potential energy surface. By combining these methods, we have been able to eliminate the most significant sources of potential errors inherent to each of these approaches. The structural model is based on the crystal structure of human isoform 2. In the QM/MM method, the QM region consists of 275 atoms, the remaining 5776 atoms were in the MM region. We found that ppGalNAcT2 catalyzes a same-face nucleophilic substitution with internal return (SNi). The optimized transition state for the reaction is 13.8 kcal/mol higher in energy than the reactant while the energy of the product complex is 6.7 kcal/mol lower. During the process of nucleophilic attack, a proton is synchronously transferred to the leaving phosphate. The presence of a short-lived metastable oxocarbenium intermediate is likely, as indicated by the reaction energy profiles obtained using high-level density functionals.
Directory of Open Access Journals (Sweden)
Tomáš Trnka
2015-04-01
Full Text Available The glycosylation of cell surface proteins plays a crucial role in a multitude of biological processes, such as cell adhesion and recognition. To understand the process of protein glycosylation, the reaction mechanisms of the participating enzymes need to be known. However, the reaction mechanism of retaining glycosyltransferases has not yet been sufficiently explained. Here we investigated the catalytic mechanism of human isoform 2 of the retaining glycosyltransferase polypeptide UDP-GalNAc transferase by coupling two different QM/MM-based approaches, namely a potential energy surface scan in two distance difference dimensions and a minimum energy reaction path optimisation using the Nudged Elastic Band method. Potential energy scan studies often suffer from inadequate sampling of reactive processes due to a predefined scan coordinate system. At the same time, path optimisation methods enable the sampling of a virtually unlimited number of dimensions, but their results cannot be unambiguously interpreted without knowledge of the potential energy surface. By combining these methods, we have been able to eliminate the most significant sources of potential errors inherent to each of these approaches. The structural model is based on the crystal structure of human isoform 2. In the QM/MM method, the QM region consists of 275 atoms, the remaining 5776 atoms were in the MM region. We found that ppGalNAcT2 catalyzes a same-face nucleophilic substitution with internal return (SNi. The optimized transition state for the reaction is 13.8 kcal/mol higher in energy than the reactant while the energy of the product complex is 6.7 kcal/mol lower. During the process of nucleophilic attack, a proton is synchronously transferred to the leaving phosphate. The presence of a short-lived metastable oxocarbenium intermediate is likely, as indicated by the reaction energy profiles obtained using high-level density functionals.
Böckmann, Marcus; Doltsinis, Nikos L; Marx, Dominik
2015-06-09
An extended Lagrangian formalism that allows for a smooth transition between two different descriptions of interactions during a molecular dynamics simulation is presented. This time-adaptive method is particularly useful in the context of multiscale simulation as it provides a sound recipe to switch on demand between different hierarchical levels of theory, for instance between ab initio ("QM") and force field ("MM") descriptions of a given (sub)system in the course of a molecular dynamics simulation. The equations of motion can be integrated straightforwardly using the usual propagators, such as the Verlet algorithm. First test cases include a bath of harmonic oscillators, of which a subset is switched to a different force constant and/or equilibrium position, as well as an all-MM to QM/MM transition in a hydrogen-bonded water dimer. The method is then applied to a smectic 8AB8 liquid crystal and is shown to be able to switch dynamically a preselected 8AB8 molecule from an all-MM to a QM/MM description which involves partition boundaries through covalent bonds. These examples show that the extended Lagrangian approach is not only easy to implement into existing code but that it is also efficient and robust. The technique moreover provides easy access to a conserved energy quantity, also in cases when Nosé-Hoover chain thermostatting is used throughout dynamical switching. A simple quadratic driving potential proves to be sufficient to guarantee a smooth transition whose time scale can be easily tuned by varying the fictitious mass parameter associated with the auxiliary variable used to extend the Lagrangian. The method is general and can be applied to time-adaptive switching on demand between two different levels of theory within the framework of hybrid scale-bridging simulations.
Characterisation of Aspergillus niger prolyl aminopeptidase
Basten, E.J.W.; Moers, A.P.H.A.; Ooyen, van A.J.J.; Schaap, P.J.
2005-01-01
We have cloned a gene (papA) that encodes a prolyl aminopeptidase from Aspergillus niger. Homologous genes are present in the genomes of the Eurotiales A. nidulans, A. fumigatus and Talaromyces emersonii, but the gene is not present in the genome of the yeast Saccharomyces cerevisiae. Cell extracts
VeA of Aspergillus niger increases spore dispersing capacity by impacting conidiophore architecture
Wang, Fengfeng; Dijksterhuis, Jan; Wyatt, Timon; Wösten, Han A B; Bleichrodt, Robert-Jan
Aspergillus species are highly abundant fungi worldwide. Their conidia are among the most dominant fungal spores in the air. Conidia are formed in chains on the vesicle of the asexual reproductive structure called the conidiophore. Here, it is shown that the velvet protein VeA of Aspergillus niger
Kim, Beom-Su; Blaghen, Mohamed; Lee, Kang-Min
2017-07-01
Intensive research studies have revealed that fungal decolorization of dye wastewater is a promising replacement for the current process of dye wastewater decolorization. The authors isolated an Aspergillus sp. from the effluent of a textile industry area in Korea and assessed the effects of a variety of operational parameters on the decolorization of methyl red (MR) by this strain of Aspergillus sp. This Aspergillus sp. was then immobilized by entrapment in several polymeric matrices and the effects of operational conditions on MR decolorization were investigated again. The optimal decolorization activity of this Aspergillus sp. was observed in 1% glucose at a temperature of 37 °C and pH of 6.0. Furthermore, stable decolorization efficiency was observed when fungal biomass was immobilized into alginate gel during repeated batch experiment. These results suggest that the Aspergillus sp. isolated in Korea could be used to treat industrial wastewaters containing MR dye.
Das, P; Pandey, P; Harishankar, A; Chandy, M; Bhattacharya, S; Chakrabarti, A
2017-01-01
Standardization of Aspergillus polymerase chain reaction (PCR) poses two technical challenges (a) standardization of DNA extraction, (b) optimization of PCR against various medically important Aspergillus species. Many cases of aspergillosis go undiagnosed because of relative insensitivity of conventional diagnostic methods such as microscopy, culture or antigen detection. The present study is an attempt to standardize real-time PCR assay for rapid sensitive and specific detection of Aspergillus DNA in EDTA whole blood. Three nucleic acid extraction protocols were compared and a two-step real-time PCR assay was developed and validated following the recommendations of the European Aspergillus PCR Initiative in our setup. In the first PCR step (pan-Aspergillus PCR), the target was 28S rDNA gene, whereas in the second step, species specific PCR the targets were beta-tubulin (for Aspergillus fumigatus, Aspergillus flavus, Aspergillus terreus), gene and calmodulin gene (for Aspergillus niger). Species specific identification of four medically important Aspergillus species, namely, A. fumigatus, A. flavus, A. niger and A. terreus were achieved by this PCR. Specificity of the PCR was tested against 34 different DNA source including bacteria, virus, yeast, other Aspergillus sp., other fungal species and for human DNA and had no false-positive reactions. The analytical sensitivity of the PCR was found to be 102 CFU/ml. The present protocol of two-step real-time PCR assays for genus- and species-specific identification for commonly isolated species in whole blood for diagnosis of invasive Aspergillus infections offers a rapid, sensitive and specific assay option and requires clinical validation at multiple centers.
Directory of Open Access Journals (Sweden)
Elliot Watanabe Kitajima
2008-02-01
Full Text Available Chlorotic spots have been observed in plants of Clerodendrum x speciosum growing in residential gardens and parks in Piracicaba, SP, Brazil. Thin sections of diseased tissues revealed characteristic cytopathic effects of the nuclear type of the Brevipalpus (Acari: Tenuipalpidae mite-transmitted viruses (BTrV. Brevipalpus mites, identified as B. phoenicis, infesting symptomatic C. x speciosum plants transmitted the pathogen to healthy C. x speciosum and to C. thomsonae, Gomphrena globosa, Hibiscus cannabinus, H. coccineus, H. schizopetalus, Salvia leucantha, Spathiphyllum wallasi and Tetragonia expansa causing chlorotic spots on their leaves. Mechanical inoculation using leaf extracts from infected C. x speciosum resulted in chlorotic spots on inoculated C. x speciosum, Chenopodium quinoa, C. amaranticolor, G. globosa, H. cannabinus, H. coccineus and T. expansa leaves. C. amaranticolor and C. quinoa kept at 28 - 30°C became systemically infected. The same cytopathic effects caused by the nuclear type of BTrV were seen in tissues from all infected test plants by electron microscopy. The virus was purified from systemically infected leaves of C. amaranticolor and C. quinoa. A polyclonal antiserum obtained from an immunized rabbit presented a strong reaction with the homologous antigen in ELISA tests. The results suggest that this chlorotic spot disease of C. x speciosum is caused by a new species of the nuclear type of BTrV, tentatively named Clerodendrum chlorotic spot virus (ClCSV.Manchas cloróticas e necróticas foram observadas em folhas de várias plantas de coração-sangrento (Clerodendrum x speciosum cultivadas em parques e jardins em Piracicaba, SP, associadas à infestação pelo ácaro tenuipalpídeo Brevipalpus phoenicis. Exames preliminares de secções de tecido das manchas cloróticas ao microscópio eletrônico revelaram a ocorrência de efeitos citopáticos característicos dos induzidos pelos vírus do tipo nuclear, transmitido
DEFF Research Database (Denmark)
Kjærbølling, Inge; Vesth, Tammi C.; Frisvad, Jens C.
2018-01-01
The fungal genus of Aspergillus is highly interesting, containing everything from industrial cell factories, model organisms, and human pathogens. In particular, this group has a prolific production of bioactive secondary metabolites (SMs). In this work, four diverse Aspergillus species (A...
DEFF Research Database (Denmark)
Atanda, O. O.; Adetunji, M. C.; Ezekiel, C. N.
2014-01-01
In order to facilitate easy and rapid identification of aflatoxin-producing Aspergillus species, the phenotypic traits of Aspergillus section Flavi isolates were examined on neutral red desiccated coconut agar (NRDCA). Phenotype variations in colony morphology and the relationship between colour...
Gamaletsou, Maria N; Rammaert, Blandine; Bueno, Marimelle A; Sipsas, Nikolaos V; Moriyama, Brad; Kontoyiannis, Dimitrios P; Roilides, Emmanuel; Zeller, Valerie; Taj-Aldeen, Saad J; Henry, Michael; Petraitis, Vidmantas; Denning, David W; Lortholary, Olivier; Walsh, Thomas J
2017-04-01
Aspergillus arthritis is a debilitating form of invasive aspergillosis. Little is known about its epidemiology, clinical manifestations, laboratory features, treatment, and prognosis. Cases of Aspergillus arthritis were reviewed in the English literature from 1967 through 2015 for variables of arthritis with Aspergillus spp. recovered from joint and/or adjacent bone, underlying conditions, symptoms, signs, inflammatory biomarkers, diagnostic imaging, management, and outcome. Among 31 evaluable cases, 87% were males and 13% pediatric. Median age was 50 y (range 1-83 y). Seventeen (55%) patients were immunosuppressed with such conditions as hematological malignancies (26%), corticosteroids (39%), and/or transplantation (26%). Approximately one-half (52%) of patients had hematogenous seeding of the joint, and more than 80% had de novo infection with no prior antifungal therapy. Oligoarticular infection (2-3 joints) occurred in 45% and contiguous osteomyelitis was present in 61%. Clinical manifestations included pain (87%), edema (26%), and limited function (23%), with knees (35%), intervertebral discs (26%), and hips (16%) being most commonly infected. Aspergillus fumigatus constituted 77% of cases followed by Aspergillus flavus in 13%, Aspergillus niger in 3%, and not specified in 7%. Median ESR was 90 mm/hr and median CRP was 3.6 mg/dl. Median synovial fluid WBC was 17,200/μL (7,300-128,000) with 72% PMNs (range 61-92). Osteolysis occurred in 35%, and soft-tissue extension 47%. Nineteen patients (61%) were managed with combined medical and surgical therapy, 10 (32%) with medical therapy only, and 2 (6%) surgery only. Amphotericin B and itraconazole were the most frequently used agents with median duration of therapy of 219 days (range 30-545). Surgical interventions included debridement in 61%, drainage 19%, and amputation 6%. Complete or partial response was achieved in 71% and relapse occurred in 16%. Medical therapy was reinstituted with successful outcome in
Directory of Open Access Journals (Sweden)
A.J. Chen
2017-09-01
Full Text Available Aspergillus section Aspergillus (formerly the genus Eurotium includes xerophilic species with uniseriate conidiophores, globose to subglobose vesicles, green conidia and yellow, thin walled eurotium-like ascomata with hyaline, lenticular ascospores. In the present study, a polyphasic approach using morphological characters, extrolites, physiological characters and phylogeny was applied to investigate the taxonomy of this section. Over 500 strains from various culture collections and new isolates obtained from indoor environments and a wide range of substrates all over the world were identified using calmodulin gene sequencing. Of these, 163 isolates were subjected to molecular phylogenetic analyses using sequences of ITS rDNA, partial β-tubulin (BenA, calmodulin (CaM and RNA polymerase II second largest subunit (RPB2 genes. Colony characteristics were documented on eight cultivation media, growth parameters at three incubation temperatures were recorded and micromorphology was examined using light microscopy as well as scanning electron microscopy to illustrate and characterize each species. Many specific extrolites were extracted and identified from cultures, including echinulins, epiheveadrides, auroglaucins and anthraquinone bisanthrons, and to be consistent in strains of nearly all species. Other extrolites are species-specific, and thus valuable for identification. Several extrolites show antioxidant effects, which may be nutritionally beneficial in food and beverages. Important mycotoxins in the strict sense, such as sterigmatocystin, aflatoxins, ochratoxins, citrinin were not detected despite previous reports on their production in this section. Adopting a polyphasic approach, 31 species are recognized, including nine new species. ITS is highly conserved in this section and does not distinguish species. All species can be differentiated using CaM or RPB2 sequences. For BenA, Aspergillus brunneus and A. niveoglaucus share identical
Prasongsuk, Sehanat; Ployngam, Saowaluck; Wacharasindhu, Sumrit; Lotrakul, Pongtharin; Punnapayak, Hunsa
2013-09-01
Cultured cell extracts from ten tropical strains of Aureobasidium pullulans were screened for antifungal activity against four pathogenic Aspergillus species (Aspergillus flavus, Aspergillus niger, Aspergillus fumigatus, and Aspergillus terreus) using the well diffusion and conidial germination inhibition assays. The crude cell extract from A. pullulans NRRL 58536 resulted in the greatest fungicidal activity against all four Aspergillus species and so was selected for further investigation into enhancing the production of antifungal activity through optimization of the culture medium, carbon source (sucrose and glucose) and amino acid (phenylalanine, proline, and leucine) supplementation. Sucrose did not support the production of any detectable antifungal activity, while glucose did with the greatest antifungal activity against all four Aspergillus species being produced in cells grown in medium containing 2.5 % (w/v) glucose. With respect to the amino acid supplements, variable trends between the different Aspergillus species and amino acid combinations were observed, with the greatest antifungal activities being obtained when grown with phenylalanine plus leucine supplementation for activity against A. flavus, proline plus leucine for A. terreus, and phenylalanine plus proline and leucine for A. niger and A. fumigatus. Thin layer chromatography, spectrophotometry, high-performance liquid chromatography, (1)H-nuclear magnetic resonance, and MALDI-TOF mass spectrometry analyses were all consistent with the main component of the A. pullulans NRRL 58536 extracts being aureobasidins.
International Nuclear Information System (INIS)
Son, Jeong-Min; Jee, Won-Hee; Jung, Chan-Kwon; Kim, Sang-Il; Ha, Kee-Yong
2007-01-01
Aspergillosis is a rare cause of spondylitis. Moreover, early diagnosis by MR imaging and adequate treatment can prevent the serious complications of fungal infection. To our knowledge, the MR findings of multilevel aspergillus spondylitis in the cervico-thoraco-lumbar spine have not been previously described. Here, we report the MR findings of aspergillus spondylitis involving the cervical, thoracic, and lumbar spine in a liver transplant recipient. spergillosis is a rare cause of spondylitis, and early diagnosis by MR imaging and adequate treatment are essential for a good outcome. Although the MR findings of bacterial spondylitis have been fully described, the findings of aspergillus spondylitis have been rarely described, and to the best of our knowledge multilevel involvement of cervico-thoraco-lumbar spine has not been previously reported. Here, we report the MR imaging findings of aspergillus spondylitis involving the cervico-thoraco-lumbar spine in a liver transplant recipient. In conclusion, aspergillus spondylitis should be considered in the differential diagnosis of immunocompromised patients with MR findings resembling those of tuberculous spondylitis
Joosten, V.; Gouka, R.J.; Hondel, C.A.M.J.J. van den; Verrips, C.T.; Lokman, B.C.
2005-01-01
We report the expression and production of llama variable heavy-chain antibody fragments (VHHs) by Aspergillus awamori. Fragments encoding VHHs were cloned in a suitable Aspergillus expression vector and transformants secreting VHH fragments were analysed for integrated gene copy-numbers, mRNA
Lackner, M.; Coassin, S.; Haun, M.; Binder, U.; Kronenberg, F.; Haas, H. de; Jank, M.; Maurer, E.; Meis, J.F.; Hagen, F.; Lass-Florl, C.
2016-01-01
Aspergillus terreus species complex is recognized as a frequent agent of invasive aspergillosis in Tyrol. The reason for this specific epidemiological situation is unclear. Aspergillus terreus strains isolated from environmental and clinical sources were genotyped using a novel panel of short tandem
Volatile compounds of Aspergillus strains with different abilities to produce ochratoxin A.
Jeleń, Henryk H; Grabarkiewicz-Szczesna, Jadwiga
2005-03-09
Volatile compounds emitted by Aspergillus strains having different abilities to produce ochratoxin A were investigated. Thirteen strains of Aspergillus ochraceus, three belonging to the A. ochraceus group, and eight other species of Aspergillus were examined for their abilities to produce volatile compounds and ochratoxin A on a wheat grain medium. The profiles of volatile compounds, analyzed using SPME, in all A. ochraceus strains, regardless of their toxeginicity, were similar and comprised mainly of 1-octen-3-ol, 3-octanone, 3-octanol, 3-methyl-1-butanol, 1-octene, and limonene. The prevailing compound was always 1-octen-3-ol. Mellein, which forms part of the ochratoxin A molecule, was found in both toxigenic and nontoxigenic strains. Volatile compounds produced by other Aspergillus strains were similar to those of A. ochraceus. Incubation temperatures (20, 24, and 27 degrees C) and water content in the medium (20, 30, and 40%) influenced both volatile compounds formation and ochratoxin A biosynthesis efficiency, although conditions providing the maximum amount of volatiles were different from those providing the maximum amount of ochratoxin A. The pattern of volatiles produced by toxigenic A. ochraceus strains does not facilitate their differentiation from nontoxigenic strains.
Directory of Open Access Journals (Sweden)
Gustavo A.S. Pinto
2001-03-01
Full Text Available The aim of this work was to select strains of Aspergillus niger for tannase production. Growth of colonies in plates with tannic acid-containing medium indicated their ability to synthesize tannase. Tannase activity was also measured in solid-state fermentation. A. niger 11T25A5 was the best tannase producer (67.5 U.g-1/72 hours of fermentation.O objetivo deste trabalho foi selecionar linhagens de Aspergillus niger para síntese de tanase. O crescimento das colônias em meio contendo ácido tânico indicou capacidade de produção de tanase. A atividade enzimática foi determinada em fermentação semi-sólida. A. niger 11T25A5 foi o melhor produtor (67.5 U.g-1/72 horas de fermentação.
Triazole Resistance in Aspergillus spp.: A Worldwide Problem?
Rivero-Menendez, Olga; Alastruey-Izquierdo, Ana; Mellado, Emilia; Cuenca-Estrella, Manuel
2016-01-01
Since the first description of an azole-resistant A. fumigatus strain in 1997, there has been an increasing number of papers describing the emergence of azole resistance. Firstly reported in the USA and soon after in Europe, it has now been described worldwide, challenging the management of human aspergillosis. The main mechanism of resistance is the modification of the azole target enzyme: 14-α sterol demethylase, encoded by the cyp51A gene; although recently, other resistance mechanisms have also been implicated. In addition, a shift in the epidemiology has been noted with other Aspergillus species (mostly azole resistant) increasingly being reported as causative agents of human disease. This paper reviews the current situation of Aspergillus azole resistance and its implications in the clinical setting. PMID:29376938
Directory of Open Access Journals (Sweden)
Melissa Orzechowski Xavier
2008-04-01
Full Text Available A case of invasive aspergillosis caused by Aspergillus niger in a lung transplant recipient is described. The patient presented hyperglycemia starting postoperatively, with other complications such as cytomegalovirus infection. The associated predisposing factors and other implications are discussed. Aspergillus niger seems to be a fungal species of low virulence that requires the presence of a severely immunosuppressed host to cause invasive disease.Descreve-se um caso de aspergilose invasiva causada por Aspergillus niger em um paciente transplantado de pulmão com quadros hiperglicêmicos desde o pós-operatório e outras complicações como infecção por citomegalovírus. Os fatores predisponentes associados e outras implicações são discutidos. Aspergillus niger parece ser uma espécie fúngica de baixa virulência, necessitando a presença de um hospedeiro gravemente imunodeprimido para causar doença invasiva.
International Nuclear Information System (INIS)
Sharma, S.K.; Singh, R.; Mehrotra, M.P.; Patney, N.L.; Sachan, A.S.; Shiromany, A.
1986-01-01
The radioallergosorbent technique (RAST) was used to measure the levels of Aspergillus specific IgE in 25 normal controls, 25 cases of extrinsic bronchial asthma and 25 cases of allergic broncho-pulmonary aspergillosis with a view to study the clinical role and its correlation with sputum culture, skin sensitivity and severity of airways obstruction. The test was performed using Pharmacia diagnostic kits with antigen derived from Aspergillus fumigatus. Abnormal levels of Aspergillus specific IgE were observed in 84 per cent cases of bronchial asthma but none of the controls. 86.7 per cent of all cases with positive skin test had positive radioallergosorbent test and there was no false positive reaction. There was a positive correlation of Aspergillus specific IgE with skin test positivity and with FEV 1 /FVC per cent. (author)
Aspergillus candidus: a respiratory hazard associated with grain dust.
Krysinska-Traczyk, E; Dutkiewicz, J
2000-01-01
The concentration of Aspergillus candidus in samples of grain dust and of air polluted with grain dust was found to be large (respectively 3.0 x 10(5) - 3.0 x 10(9) cfu/g and 5.0 x 10(3) - 6.47 x 10(5) cfu/m(3)) and proved to be significantly greater compared to samples of other organic dusts (pgrain workers reacted significantly more frequently to extract of A. candidus in the leukocyte migration inhibition test (pdusts. It was concluded that Aspergillus candidus, because of its common occurrence and strong immunomodulating properties, poses an important occupational hazard for grain handling workers
Malic acid production from thin stillage by Aspergillus species.
West, Thomas P
2011-12-01
The ability of Aspergillus strains to utilize thin stillage to produce malic acid was compared. The highest malic acid was produced by Aspergillus niger ATCC 9142 at 17 g l(-1). Biomass production from thin stillage was similar with all strains but ATCC 10577 was the highest at 19 g l(-1). The highest malic acid yield (0.8 g g(-1)) was with A. niger ATCC 9142 and ATCC 10577 on the stillage. Thus, thin stillage has the potential to act as a substrate for the commercial production of food-grade malic acid by the A. niger strains. © Springer Science+Business Media B.V. 2011
Experimental study of Aspergillus flavus fungus from uranium mines
International Nuclear Information System (INIS)
Kusak, V.
1982-01-01
Cultivation is discussed of fungus strain Aspergillus flavus obtained from materials from uranium mines. It was found that an addition of 0.6 g of uranium in form of uranyl acetate or of 0.6 g of thorium in form on thorium nitrate in 1000 ml of the standard medium had stimulating effects on the growth and sporulation of Aspergillus flavus. Irradiating the cultivated fungus through a polyethylene foil did not show a stimulating effect. It is stated that uranium and its daughters must be directly present in the culture medium for their stimulating effect on growth and sporulation to manifest itself. (H.S.)
International Nuclear Information System (INIS)
MATTAR, Z.A.
2008-01-01
Amylases are one of the most important and oldest industrial enzymes. The optimization of production of α -amylase from Aspergillus niger and Aspergillus oryzae fungi, using different agro-wastes as sole carbon sources, was performed. The highest productivity of α -amylase by the two organisms was recorded at pH 6 and incubation temperature at 30 0C when the two organisms were grown on potato peels (PPs) and/or wheat straw (Ws) after days of cultivation. Pre-treated PPs and Ws with 20 kGy gave the best enzyme productivity by the two organisms compared with untreated ones. Also, exposing the inoculums of A. niger and A.oryzae to 0.5 and 0.75 kGy, respectively, led to enhancement of α-amylase to 48 and 46 μ/ml, respectively
Thermostable crude endoglucanase produced by Aspergillus ...
African Journals Online (AJOL)
Cellulases are used in many industries worldwide and there is an ever increasing need to isolate, produce or develop thermostable cellulases. Manipulation of fermentation techniques in order to obtain desirable product(s) can be one line of action. In this study Aspergillus fumigatus was grown on chopped wheat straw in a ...
Ryde, Ulf
2017-11-14
Combined quantum mechanical and molecular mechanical (QM/MM) calculations is a popular approach to study enzymatic reactions. They are often based on a set of minimized structures obtained on snapshots from a molecular dynamics simulation to include some dynamics of the enzyme. It has been much discussed how the individual energies should be combined to obtain a final estimate of the energy, but the current consensus seems to be to use an exponential average. Then, the question is how many snapshots are needed to reach a reliable estimate of the energy. In this paper, I show that the question can be easily be answered if it is assumed that the energies follow a Gaussian distribution. Then, the outcome can be simulated based on a single parameter, σ, the standard deviation of the QM/MM energies from the various snapshots, and the number of required snapshots can be estimated once the desired accuracy and confidence of the result has been specified. Results for various parameters are presented, and it is shown that many more snapshots are required than is normally assumed. The number can be reduced by employing a cumulant approximation to second order. It is shown that most convergence criteria work poorly, owing to the very bad conditioning of the exponential average when σ is large (more than ∼7 kJ/mol), because the energies that contribute most to the exponential average have a very low probability. On the other hand, σ serves as an excellent convergence criterion.
Reeves, Emer P; Reiber, Kathrin; Neville, Claire; Scheibner, Olaf; Kavanagh, Kevin; Doyle, Sean
2006-07-01
Aspergillus fumigatus is an important human fungal pathogen. The Aspergillus fumigatus genome contains 14 nonribosomal peptide synthetase genes, potentially responsible for generating metabolites that contribute to organismal virulence. Differential expression of the nonribosomal peptide synthetase gene, pes1, in four strains of Aspergillus fumigatus was observed. The pattern of pes1 expression differed from that of a putative siderophore synthetase gene, sidD, and so is unlikely to be involved in iron acquisition. The Pes1 protein (expected molecular mass 698 kDa) was partially purified and identified by immunoreactivity, peptide mass fingerprinting (36% sequence coverage) and MALDI LIFT-TOF/TOF MS (four internal peptides sequenced). A pes1 disruption mutant (delta pes1) of Aspergillus fumigatus strain 293.1 was generated and confirmed by Southern and western analysis, in addition to RT-PCR. The delta pes1 mutant also showed significantly reduced virulence in the Galleria mellonella model system (P < 0.001) and increased sensitivity to oxidative stress (P = 0.002) in culture and during neutrophil-mediated phagocytosis. In addition, the mutant exhibited altered conidial surface morphology and hydrophilicity, compared to Aspergillus fumigatus 293.1. It is concluded that pes1 contributes to improved fungal tolerance against oxidative stress, mediated by the conidial phenotype, during the infection process.
Subungual onychomycosis due to Aspergillus niger mimicking a glomus tumor: A case report.
Matsuyama, Yumi; Nakamura, Tomoki; Hagi, Tomohito; Asanuma, Kunihiro; Sudo, Akihiro
2017-12-01
Onychomycosis is a common nail infection caused by dermatophytes, while non-dermatophytes including Aspergillus spp. are causes of nail onychomycosis. Aspergillus niger is not common as a cause of nail onychomycosis. In the current study we present a 60-year-old woman with subungual onychomycosis due to Aspergillus niger mimicking a glomus tumor. Physical examination revealed right thumb had a black color of nail bed. Localized tenderness and severe pain were observed. However, the cold sensitivity test, Loves pin test and Hildreths test were negative. On radiograph, bone erosion was found in a part of distal phalanx at the right thumb. Magnetic resonance imaging identified a mass at the subungual space, which exhibited low signal intensity on T1-weighted images and high signal intensity on T2-weighted images. The differential diagnosis included glomus tumor and infection. The histological findings demonstrated dichotomous septate hyphae. The culture was positive for Aspergillus niger . The results suggested that when physical examination is not typical for a glomus tumor, other diseases may be considered. Additionally, frozen section diagnosis may be useful.
Keratitis caused by the recently described new species Aspergillus brasiliensis: two case reports
Directory of Open Access Journals (Sweden)
Vágvölgyi Csaba
2010-02-01
Full Text Available Abstract Introduction Human infections caused by Aspergillus brasiliensis have not yet been reported. We describe the first two known cases of fungal keratitis caused by Aspergillus brasiliensis. Case presentations A 49-year-old Indian Tamil woman agricultural worker came with pain and defective vision in the right eye for one month. Meanwhile, a 35-year-old Indian Tamil woman presented with a history of a corneal ulcer involving the left eye for 15 days. The fungal strains isolated from these two cases were originally suspected to belong to Aspergillus section Nigri based on macro- and micromorphological characteristics. Molecular identification revealed that both isolates represent A. brasiliensis. Conclusion The two A. brasiliensis strains examined in this study were part of six keratitis isolates from Aspergillus section Nigri, suggesting that this recently described species may be responsible for a significant proportion of corneal infections caused by black Aspergilli. The presented cases also indicate that significant differences may occur between the severities of keratitis caused by individual isolates of A. brasiliensis.
Directory of Open Access Journals (Sweden)
Melissa Orzechowski Xavier
2009-02-01
Full Text Available Here we report a case of invasive pansinusitis with proptosis of the right eye caused by Aspergillus flavus in an immunocompromised patient with acute biphenotypic leukemia without aggressive therapy response.Descreve-se um caso de pansinusite invasiva com proptose do globo ocular direito causado por Aspergillus flavus em um paciente imunossuprimido com leucemia aguda bifenotípica sem resposta a terapia agressiva.
Extracellular β-D-fructofuranosidase from Aspergillus parasiticus ...
African Journals Online (AJOL)
The β-D-fructofuranosidases are enzymes with biotechnological potential that can be used in different industrial sectors as food and beverage. In this context, microorganisms are important producers of these biomolecules, especially filamentous fungi. The production of extracellular β-Dfructofuranosidase from Aspergillus ...
Biosynthesis of silver nanoparticles synthesized by Aspergillus
Indian Academy of Sciences (India)
In the present study, biosynthesis of silver nanoparticles and its antioxidant, antimicrobial and cytotoxic activities were investigated. Silver nanoparticles were extracellularly synthesized using Aspergillus flavus and the formation of nanoparticles was observed after 72 h of incubation. The results recorded from colour ...
Meyer, Vera; Fiedler, Markus; Nitsche, Benjamin; King, Rudibert
2015-01-01
Living with limits. Getting more from less. Producing commodities and high-value products from renewable resources including waste. What is the driving force and quintessence of bioeconomy outlines the lifestyle and product portfolio of Aspergillus, a saprophytic genus, to which some of the top-performing microbial cell factories belong: Aspergillus niger, Aspergillus oryzae and Aspergillus terreus. What makes them so interesting for exploitation in biotechnology and how can they help us to address key challenges of the twenty-first century? How can these strains become trimmed for better growth on second-generation feedstocks and how can we enlarge their product portfolio by genetic and metabolic engineering to get more from less? On the other hand, what makes it so challenging to deduce biological meaning from the wealth of Aspergillus -omics data? And which hurdles hinder us to model and engineer industrial strains for higher productivity and better rheological performance under industrial cultivation conditions? In this review, we will address these issues by highlighting most recent findings from the Aspergillus research with a focus on fungal growth, physiology, morphology and product formation. Indeed, the last years brought us many surprising insights into model and industrial strains. They clearly told us that similar is not the same: there are different ways to make a hypha, there are more protein secretion routes than anticipated and there are different molecular and physical mechanisms which control polar growth and the development of hyphal networks. We will discuss new conceptual frameworks derived from these insights and the future scientific advances necessary to create value from Aspergillus Big Data.
Trichocomaceae: biodiversity of Aspergillus spp and Penicillium spp residing in libraries.
Leite, Diniz Pereira; Yamamoto, Ana Caroline Akeme; Amadio, Janaína Vasconcellos Ribeiro de Souza; Martins, Evelin Rodrigues; do Santos, Fábio Alexandre Leal; Simões, Sara de Almeida Alves; Hahn, Rosane Christine
2012-10-19
Atmospheric air is the most common vehicle for the dispersion of fungi. Fungi belonging to the genera Aspergillus and Penicillium are cosmopolitan and are classified in the family Trichocomaceae. Species of the genera are commonly found in soil, decaying organic materials, animal feed, stored grains, and other materials. This study aimed to determine the taxonomic diversity of airborne fungi of the genera Aspergillus and Penicillium residing in the dust of library environments to contribute to current knowledge of these characteristic genera. Three libraries in the city of Cuiaba, State of Mato Grosso, Brazil, were selected as the study areas. A total of 168 samples were collected at randomized sites within each library in areas containing journals, archives, in study rooms, and in collection storage areas in two different periods, the dry season (n = 42) and the rainy season (n = 42). Samples were collected by exposing Petri dishes containing Sabouraud agar with chloramphenicol to the environmental air. Additional samples were collected with sterile swabs which were rubbed over the surface of randomly chosen books on the shelves; the swabs were subsequently incubated in the laboratory. The genus Aspergillus was highlighted as one of the principal airborne fungi present in indoor environments. Aspergillus spp was identified in 1,277 (89.6%) samples and Penicillium spp in 148 (10.4%). The dry period exhibited a greater number of isolates of the two taxons.
Aspergillus in endodontic infection near the maxillary sinus
Directory of Open Access Journals (Sweden)
Cinthya Cristina Gomes
2015-10-01
Full Text Available ABSTRACT INTRODUCTION: Diseases of the maxillary sinus have been associated with dental roots near the maxillary sinus that have undergone endodontic treatment. OBJECTIVE: To investigate the presence of filamentous fungi in patients with dental roots near the maxillary sinus who had apical periodontitis treated endodontically, and to alert practitioners that this could be a possible avenue of contamination of the sinus in patients who develop maxillary sinus infection. METHODS: Cross-sectional study in 60 palatal roots of the first maxillary molars near the maxillary sinus, that underwent endodontic treatment for apical periodontitis. After removal of the filling material, dentin shavings were collected and placed in test tubes containing Sabouraud dextrose agar and chloramphenicol. The phenotype was determined by macroscopic and microscopic examination of the colonies. For polymerase chain reaction, the primers ITS-5 and ITS-4 were used. The sequences obtained were compared with those deposited at GenBank using the Basic Local Alignment Search Tool program. RESULTS: Filamentous fungi were isolated from 6 of 60 canals (10%:Aspergillus niger (6.7%, Aspergillus versicolor (1.6%, and Aspergillus fumigatus(1.6%. CONCLUSION: Root canals near the maxillary sinus with endodontic treatment and apical periodontitis may exhibit positive cultures for filamentous fungi. Interested professionals should be alert, because these microorganisms have pathogenic characteristics that can cause disease of odontogenic origin in the maxillary sinus.
Devipriya, Duraipandi; Roopan, Selvaraj Mohana
2017-11-01
Recently, non-toxic source mediated synthesis of metal and a metal oxide nanoparticle attains more attention due to key applicational responsibilities. This present report stated that the eco-friendly synthesis of copper oxide nanoparticles (CuO NPs) using Cissus quadrangularis (C. quadrangularis) plant extract. Further the eco-friendly synthesized CuO NPs were characterized using a number of analytical techniques. The observed results stated that the synthesized CuO NPs were spherical in shape with 30±2nm. Then the eco-friendly synthesized CuO NPs were subjected for anti-fungal against two strains namely Aspergillus niger (A. niger) resulted in 83% at 500ppm, 86% of inhibition at 1000ppm and Aspergillus flavus (A. flavus) resulted in 81% at 500ppm, 85% of inhibition at 1000ppm respectively. Despite the fact that compared to standard Carbendazim, eco-friendly synthesized CuO NPs exhibits better results were discussed in this manuscript. Copyright © 2017 Elsevier B.V. All rights reserved.
Heo, Min Seok; Shin, Jong Hee; Choi, Min Ji; Park, Yeon Joon; Lee, Hye Soo; Koo, Sun Hoe; Lee, Won Gil; Kim, Soo Hyun; Shin, Myung Geun; Suh, Soon Pal; Ryang, Dong Wook
2015-11-01
We investigated the species distribution and amphotericin B (AMB) susceptibility of Korean clinical Aspergillus isolates by using two Etests and the CLSI broth microdilution method. A total of 136 Aspergillus isolates obtained from 11 university hospitals were identified by sequencing the internal transcribed spacer (ITS) and β-tubulin genomic regions. Minimal inhibitory concentrations (MICs) of AMB were determined in Etests using Mueller-Hinton agar (Etest-MH) and RPMI agar (Etest-RPG), and categorical agreement with the CLSI method was assessed by using epidemiological cutoff values. ITS sequencing identified the following six Aspergillus species complexes: Aspergillus fumigatus (42.6% of the isolates), A. niger (23.5%), A. flavus (17.6%), A. terreus (11.0%), A. versicolor (4.4%), and A. ustus (0.7%). Cryptic species identifiable by β-tubulin sequencing accounted for 25.7% (35/136) of the isolates. Of all 136 isolates, 36 (26.5%) had AMB MICs of ≥2 μg/mL by the CLSI method. The categorical agreement of Etest-RPG with the CLSI method was 98% for the A. fumigatus, A. niger, and A. versicolor complexes, 87% for the A. terreus complex, and 37.5% for the A. flavus complex. That of Etest-MH was ≤75% for the A. niger, A. flavus, A. terreus, and A. versicolor complexes but was higher for the A. fumigatus complex (98.3%). Aspergillus species other than A. fumigatus constitute about 60% of clinical Aspergillus isolates, and reduced AMB susceptibility is common among clinical isolates of Aspergillus in Korea. Molecular identification and AMB susceptibility testing by Etest-RPG may be useful for characterizing Aspergillus isolates of clinical relevance.
Hong, Seung-Beom; Kim, Dae-Ho; Samson, Robert A
2015-09-01
Aspergillus is an important fungal genus used for the fermentation of Asian foods; this genus is referred to as koji mold in Japan and China. A. oryzae, A. sojae, and A. tamari are used in the production of miso and shoyu in Japan, but a comprehensive taxonomic study of Aspergillus isolated from Meju, a fermented soybean starting material for traditional soy sauce and soybean paste in Korea, has not been conducted. In this study, various Aspergillus species were isolated during a study of the mycobiota of Meju, and the aspergilli were identified based on phenotypic characteristics and sequencing of the β-tubulin gene. Most strains of Aspergillus were found to belong to the following sections: Aspergillus (n = 220), Flavi (n = 213), and Nigri (n = 54). The most commonly identified species were A. oryzae (n = 183), A. pseudoglaucus (Eurotium repens) (n = 81), A. chevalieri (E. chevalieri) (n = 62), A. montevidensis (E. amstelodami) (n = 34), A. niger (n = 21), A. tamari (n = 15), A. ruber (E. rubrum) (n = 15), A. proliferans (n = 14), and A. luchuensis (n = 14); 25 species were identified from 533 Aspergillus strains. Aspergillus strains were mainly found during the high temperature fermentation period in the later steps of Meju fermentation.
Jung, Nina; Mronga, Silke; Schroth, Susanne; Vassiliou, Timon; Sommer, Frank; Walthers, Eduard; Aepinus, Christian; Jerrentrup, Andreas; Vogelmeier, Claus; Holland, Angelique; Koczulla, Rembert
2014-11-26
Acute Aspergillus fumigatus infection in immunocompetent patients is rare. This is the first known case of a patient who survived Aspergillus sepsis after being treated early with veno-venous extracorporeal membrane (ECMO) and antifungal therapy. An immunocompetent 54-year-old woman was exposed to plant mulch during gardening and subsequently developed pulmonary failure that progressed to sepsis with multiorgan failure. Owing to her severe clinical condition, she was treated for acute respiratory distress syndrome (ARDS) with veno-venous ECMO. Empiric antifungal therapy comprising voriconazole was also initiated owing to her history and a previous case report of aspergillosis after plant mulch exposure, though there was no microbiological proof at the time. A. fumigatus was later cultured and detected on antibody testing. The patient recovered, and ECMO was discontinued 1 week later. After 7 days of antifungal treatment, Aspergillus antibodies were undetectable. In cases of sepsis that occur after gardening, clinicians should consider Aspergillus inhalation as an aetiology, and early antimycotic therapy is recommended.
Elucidation of the biosynthesis of meroterpenoid yanuthone D in Aspergillus Niger
DEFF Research Database (Denmark)
Holm, Dorte Koefoed; Petersen, Lene Maj; Klitgaard, Andreas
2012-01-01
We have elucidated the mode of biosynthesis of the meroterpenoid compound Yanuthone D in Aspergillus niger. We have successfully deleted all cluster genes, and identified a number of intermediates. Structures of the intermediates were solved using a combined approach comprising classical 1D- and 2D......-NMR and tandem mass spectrometry (MS/MS). In this study we have confirmed that Yanuthone D is of meroterpenoid origin, and we have identified an unexpected precursor, which has not before been reported for Aspergillus niger....
Transcriptional profiling of Aspergillus niger
Veen, van der, D.
2009-01-01
The industrially important fungus Aspergillus niger feeds naturally on decomposing plant material, of which a significant proportion is lipid. Examination of the A. niger genome sequence suggested that all proteins required for metabolic conversion of lipids are present, including 63 predicted lipases. In contrast to polysaccharide-degrading enzyme networks, not much is known about the signaling and regulatory processes that control lipase expression and activity in fungi. This project was ai...
Sardjono; Zhu, Y.; Knol, W.
1998-01-01
To explore the possibilities of using lupine as a soybean replacement in fermented foods, fermentation profiles of lupine and soybean by Aspergillus oryzae and A. sojae, respectively, in a solid-state culture were compared. Biomass, spore concentration, oxygen consumption rate, carbon dioxide
Central nervous system aspergillus infection complicating renal transplantation
International Nuclear Information System (INIS)
Coates, M.; Wilson, J.
2001-01-01
A case of catastrophic intracerebral haemorrhage secondary to aspergillus infection in an immunocompromised renal transplant patient is presented. The pathological features and related images are described and the radiology of CNS aspergillus infection is reviewed. A 37-year-old woman was admitted with abdominal pain. She had recently received a cadaveric renal transplant following failure of the previous live donor kidney. Gastroscopy showed changes suspicious of cytomegalovirus (CMV) gastroduodenitis and she was treated with gancyclovir, with resolution of her symptoms. While in hospital her creatinine began to rise. The renal biopsy was suggestive of cyclosporin toxicity and the cyclosporin level was raised 537 mg/mL (normal 160-360 mg/mL). Several days later, she developed slurred speech and weakness in her right arm. Non-contrast CT showed multifocal regions of low attenuation over the right temporal convexity, within the basal ganglia, inferior frontal lobe and corona radiata on the left side. Magnetic resonance imaging on the same day showed multiple areas of high signal on the FLAIR images, some of which contained central areas of low signal. There was no significant enhancement post gadolinium but several of the lesions showed increased signal on the diffusion-weighted images, reflecting cytotoxic oedema. Repeat CT showed an increase in the size of the cerebral lesions with haemorrhagic transformation of the right basal ganglia mass. A further lesion with a peripheral dense rim on the non-contrast images was identified in the right cerebellar hemisphere. The possibility of a vasculitis secondary to a fungal infection was raised. Two days later the patient became comatose with CT showing a large intracerebral haematoma in the left basal ganglia, intraventricular blood and hydrocephalus. The patient died soon afterwards. Post-mortem examination showed multifocal cerebral haemorrhage associated with necrotizing vasculitis and aspergillus infection
DEFF Research Database (Denmark)
Rasmussen, Jane Lind Nybo; Vesth, Tammi Camilla; Theobald, Sebastian
In the era of high-throughput sequencing, comparative genomics can be applied for evaluating species diversity. In this project we aim to compare the genomes of 300 species of filamentous fungi from the Aspergillus genus, a complex task. To be able to define species, clade, and core features......, this project uses BLAST on the amino acid level to discover orthologs. With a potential of 300 Aspergillus species each having ~12,000 annotated genes, traditional clustering will demand supercomputing. Instead, our approach reduces the search space by identifying isoenzymes within each genome creating...... intragenomic protein families (iPFs), and then connecting iPFs across all genomes. The initial findings in a set of 31 species show that ~48% of the annotated genes are core genes (genes shared between all species) and 2-24% of the genes are defining the individual species. The methods presented here...
Aspergillus bertholletius sp. nov. from Brazil Nuts
DEFF Research Database (Denmark)
Taniwaki, Marta H.; Pitt, John I.; Iamanaka, Beatriz T.
2012-01-01
During a study on the mycobiota of brazil nuts (Bertholletia excelsa) in Brazil, a new Aspergillus species, A. bertholletius, was found, and is described here. A polyphasic approach was applied using morphological characters, extrolite data as well as partial beta-tubulin, calmodulin and ITS sequ...
Overexpression, purification and characterization of the Aspergillus ...
African Journals Online (AJOL)
Cellulases are industrially important hydrolytic enzymes applicable in the bioconversion of cellulosic biomass to simple sugars. In this work, an endoglucanase from Aspergillus niger ATCC 10574, EglA, was expressed in the methylotrophic yeast Pichia pastoris and the properties of the recombinant protein were ...
A polarizable QM/MM approach to the molecular dynamics of amide groups solvated in water
Energy Technology Data Exchange (ETDEWEB)
Schwörer, Magnus; Wichmann, Christoph; Tavan, Paul, E-mail: tavan@physik.uni-muenchen.de [Lehrstuhl für BioMolekulare Optik, Ludwig-Maximilians Universität München, Oettingenstr. 67, 80538 München (Germany)
2016-03-21
The infrared (IR) spectra of polypeptides are dominated by the so-called amide bands. Because they originate from the strongly polar and polarizable amide groups (AGs) making up the backbone, their spectral positions sensitively depend on the local electric fields. Aiming at accurate computations of these IR spectra by molecular dynamics (MD) simulations, which derive atomic forces from a hybrid quantum and molecular mechanics (QM/MM) Hamiltonian, here we consider the effects of solvation in bulk liquid water on the amide bands of the AG model compound N-methyl-acetamide (NMA). As QM approach to NMA we choose grid-based density functional theory (DFT). For the surrounding MM water, we develop, largely based on computations, a polarizable molecular mechanics (PMM) model potential called GP6P, which features six Gaussian electrostatic sources (one induced dipole, five static partial charge distributions) and, therefore, avoids spurious distortions of the DFT electron density in hybrid DFT/PMM simulations. Bulk liquid GP6P is shown to have favorable properties at the thermodynamic conditions of the parameterization and beyond. Lennard-Jones (LJ) parameters of the DFT fragment NMA are optimized by comparing radial distribution functions in the surrounding GP6P liquid with reference data obtained from a “first-principles” DFT-MD simulation. Finally, IR spectra of NMA in GP6P water are calculated from extended DFT/PMM-MD trajectories, in which the NMA is treated by three different DFT functionals (BP, BLYP, B3LYP). Method-specific frequency scaling factors are derived from DFT-MD simulations of isolated NMA. The DFT/PMM-MD simulations with GP6P and with the optimized LJ parameters then excellently predict the effects of aqueous solvation and deuteration observed in the IR spectra of NMA. As a result, the methods required to accurately compute such spectra by DFT/PMM-MD also for larger peptides in aqueous solution are now at hand.
The normal mycoflora of commodities from Thailand. 1. Nuts and oilseeds.
Pitt, J I; Hocking, A D; Bhudhasamai, K; Miscamble, B F; Wheeler, K A; Tanboon-Ek, P
1993-12-01
A comprehensive study was carried out of the fungi occurring in commodities normally traded in Thailand. Samples of major commodities were obtained from farmers' stocks and middlemen in major producing areas throughout the country. Retail samples were obtained from outlets in and around Bankok. Samples were divided into two portions, one being examined in Bangkok, and the second in Sydney. After surface disinfection, fungi were enumerated by direct plating on dichloran rose bengal chloramphenicol agar, dichloran 18% glycerol agar, Aspergillus flavus and parasiticus agar and dichloran chloramphenicol peptone agar. Figures for percentage infection were calculated, and fungi were isolated and identified to species level. In all 602 samples were examined, and at North Ryde about 18,000 fungal isolates identified. Data obtained from 329 samples are reported here, comprising maize (154), peanuts (109), cashews (45) and copra (21). Major fungi in maize included Fusarium moniliforme (present in 97% of samples), Aspergillus flavus (85%), Penicillium citrinum (67%), Aspergillus niger (64%), Lasiodiplodia theobromae (58%) and Fusarium semitectum (45%). In peanuts, the major fungi were Aspergillus flavus (95% of samples), Aspergillus niger (86%), Rhizopus oryzae (60%), Eurotium rubrum (51%), Macromina phaseolina (49%), Penicillium citrinum (46%) and Eurotium chevalieri (46%). Invasion in cashews was lower, major fungi being Aspergillus flavus (60%), Nigrospora oryzae (58%), Aspergillus niger (53%), Chaetomium globosum (47%) and Eurotium chevalieri (40%). Aspergillus flavus (86% of samples) was again dominant in copra, with Rhizopus oryzae (52%), Aspergillus niger (43%), Eurotium chevalieri (43%) the only other species exceeding 40% infection. Aspergillus parasiticus was rarely seen, and Aspergillus nomius was reported from foods for the first time.
Induction of mutation in Aspergillus niger for conversion of cellulose into glucose
Energy Technology Data Exchange (ETDEWEB)
Helmi, S.; Khalil, A.E.; Tahoun, M.K.; Khairy, A.H. [Univ. of Alexandria Research Centre, Alexandria (Egypt)
1991-12-31
Plant wastes are very important part of biomass used and investigated for energy, chemical, and fuel production. Cellulose is the major renewable form of carbohydrate in the world, about 10{sup 11} tons of which is synthesized annually. For general use, it must be hydrolyzed first, either chemically or by cellulases derived from a few specialized microorganisms. Enzymes are acceptable environmentally but expensive to produce. Certainly, induction of mutations and selection of high cellulose microbial strains with significant adaptability to degrade cellulose to glucose is promising solutions. Induction of mutations in other fungi and Aspergillus sp. rather than Aspergillus niger was reported. Aspergillus ustus and Trichoderma harzianum were induced by gamma irradiation indicating mutants that excrete higher cellulose yields, particularly exocellobiohydrolase (Avicelase) than their respective wild types. Mutants from the celluiolytic fungus Penicillium pinophilum were induced by chemical and UV-irradiation. Enhancing the production of endo-1,4-{Beta}-D-glucanase (CMCase) and particularly {Beta}-glucosidase was obtained by gamma irradiation of Altemaria alternate. To overcome the lower activity of {beta}-glucosidase in certain fungi species rather than A. niger, mixed cultures of different species were tried. Thus, Aspergillus phonicis with Trichoderma reesei Rut 30, produced a cellulose complex that improved activity twofold over cellulose from Trichoderma alone.
Gazendam, Roel P; van Hamme, John L; Tool, Anton T J; Hoogenboezem, Mark; van den Berg, J Merlijn; Prins, Jan M; Vitkov, Ljubomir; van de Veerdonk, Frank L; van den Berg, Timo K; Roos, Dirk; Kuijpers, Taco W
2016-02-01
Neutrophils are known to play a pivotal role in the host defense against Aspergillus infections. This is illustrated by the prevalence of Aspergillus infections in patients with neutropenia or phagocyte functional defects, such as chronic granulomatous disease. However, the mechanisms by which human neutrophils recognize and kill Aspergillus are poorly understood. In this work, we have studied in detail which neutrophil functions, including neutrophil extracellular trap (NET) formation, are involved in the killing of Aspergillus fumigatus conidia and hyphae, using neutrophils from patients with well-defined genetic immunodeficiencies. Recognition of conidia involves integrin CD11b/CD18 (and not dectin-1), which triggers a PI3K-dependent nonoxidative intracellular mechanism of killing. When the conidia escape from early killing and germinate, the extracellular destruction of the Aspergillus hyphae needs opsonization by Abs and involves predominantly recognition via Fcγ receptors, signaling via Syk, PI3K, and protein kinase C to trigger the production of toxic reactive oxygen metabolites by the NADPH oxidase and myeloperoxidase. A. fumigatus induces NET formation; however, NETs did not contribute to A. fumigatus killing. Thus, our findings reveal distinct killing mechanisms of Aspergillus conidia and hyphae by human neutrophils, leading to a comprehensive insight in the innate antifungal response. Copyright © 2016 by The American Association of Immunologists, Inc.
Greco, Mariana; Kemppainen, Minna; Pose, Graciela; Pardo, Alejandro
2015-01-01
Xerophilic fungal species of the genus Aspergillus are economically highly relevant due to their ability to grow on low water activity substrates causing spoilage of stored goods and animal feeds. These fungi can synthesize a variety of secondary metabolites, many of which show animal toxicity, creating a health risk for food production animals and to humans as final consumers, respectively. Animal feeds used for rabbit, chinchilla and rainbow trout production in Argentina were analysed for t...
Genome-scale analysis of the high-efficient protein secretion system of Aspergillus oryzae
DEFF Research Database (Denmark)
Liu, Lifang; Feizi, Amir; Osterlund, Tobias
2014-01-01
related fungal species such as Aspergillus nidulans and Aspergillus niger. To evaluate the defined component list, we performed transcriptome analysis on three a-amylase over-producing strains with varying levels of secretion capacities. Specifically, secretory components involved in the ER......Background: The koji mold, Aspergillus oryzae is widely used for the production of industrial enzymes due to its particularly high protein secretion capacity and ability to perform post-translational modifications. However, systemic analysis of its secretion system is lacking, generally due...... to the poorly annotated proteome. Results: Here we defined a functional protein secretory component list of A. oryzae using a previously reported secretory model of S. cerevisiae as scaffold. Additional secretory components were obtained by blast search with the functional components reported in other closely...
DEFF Research Database (Denmark)
Anyaogu, Diana Chinyere
in industrial applications for the productionof these bioactive compounds and other chemicals as well as for enzyme production. Especially Aspergillusniger and Aspergillus oryzae are used as industrial workhorses for the production of various enzymes. Manyof the secreted proteins are glycosylated, indicating...... aspharmaceuticals. Access to this unexploited reservoir is hampered as many of the clusters are silent orbarely expressed under laboratory conditions. Methods for activating these pathways are thereforeessential for pathway discovery and elucidation. Filamentous fungi and Aspergillus species in particular are used...... that glycosylation plays an important role in thesecretory pathway. Thus, understanding the role and process of glycosylation will enable directedglycoengineering in Aspergilli to improve protein production and expand the repertoire of proteins, whichcan be produced by these fungi. Aspergillus nidulans has been used...
Umemura, Myco; Koike, Hideaki; Yamane, Noriko; Koyama, Yoshinori; Satou, Yuki; Kikuzato, Ikuya; Teruya, Morimi; Tsukahara, Masatoshi; Imada, Yumi; Wachi, Youji; Miwa, Yukino; Yano, Shuichi; Tamano, Koichi; Kawarabayasi, Yutaka; Fujimori, Kazuhiro E.; Machida, Masayuki; Hirano, Takashi
2012-01-01
Aspergillus oryzae has been utilized for over 1000 years in Japan for the production of various traditional foods, and a large number of A. oryzae strains have been isolated and/or selected for the effective fermentation of food ingredients. Characteristics of genetic alterations among the strains used are of particular interest in studies of A. oryzae. Here, we have sequenced the whole genome of an industrial fungal isolate, A. oryzae RIB326, by using a next-generation sequencing system and compared the data with those of A. oryzae RIB40, a wild-type strain sequenced in 2005. The aim of this study was to evaluate the mutation pressure on the non-syntenic blocks (NSBs) of the genome, which were previously identified through comparative genomic analysis of A. oryzae, Aspergillus fumigatus, and Aspergillus nidulans. We found that genes within the NSBs of RIB326 accumulate mutations more frequently than those within the SBs, regardless of their distance from the telomeres or of their expression level. Our findings suggest that the high mutation frequency of NSBs might contribute to maintaining the diversity of the A. oryzae genome. PMID:22912434
Umemura, Myco; Koike, Hideaki; Yamane, Noriko; Koyama, Yoshinori; Satou, Yuki; Kikuzato, Ikuya; Teruya, Morimi; Tsukahara, Masatoshi; Imada, Yumi; Wachi, Youji; Miwa, Yukino; Yano, Shuichi; Tamano, Koichi; Kawarabayasi, Yutaka; Fujimori, Kazuhiro E; Machida, Masayuki; Hirano, Takashi
2012-10-01
Aspergillus oryzae has been utilized for over 1000 years in Japan for the production of various traditional foods, and a large number of A. oryzae strains have been isolated and/or selected for the effective fermentation of food ingredients. Characteristics of genetic alterations among the strains used are of particular interest in studies of A. oryzae. Here, we have sequenced the whole genome of an industrial fungal isolate, A. oryzae RIB326, by using a next-generation sequencing system and compared the data with those of A. oryzae RIB40, a wild-type strain sequenced in 2005. The aim of this study was to evaluate the mutation pressure on the non-syntenic blocks (NSBs) of the genome, which were previously identified through comparative genomic analysis of A. oryzae, Aspergillus fumigatus, and Aspergillus nidulans. We found that genes within the NSBs of RIB326 accumulate mutations more frequently than those within the SBs, regardless of their distance from the telomeres or of their expression level. Our findings suggest that the high mutation frequency of NSBs might contribute to maintaining the diversity of the A. oryzae genome.
Biosynthesis and Characterization of Silver Nanoparticles by Aspergillus Species
Pourshahid, Seyedmohammad; Mehryar, Pouyan; Pakshir, Keyvan; Rahimi, Mohammad Javad; Arabi Monfared, Ali
2016-01-01
Currently, researchers turn to natural processes such as using biological microorganisms in order to develop reliable and ecofriendly methods for the synthesis of metallic nanoparticles. In this study, we have investigated extracellular biosynthesis of silver nanoparticles using four Aspergillus species including A. fumigatus, A. clavatus, A. niger, and A. flavus. We have also analyzed nitrate reductase activity in the studied species in order to determine the probable role of this enzyme in the biosynthesis of silver nanoparticles. The formation of silver nanoparticles in the cell filtrates was confirmed by the passage of laser light, change in the color of cell filtrates, absorption peak at 430 nm in UV-Vis spectra, and atomic force microscopy (AFM). There was a logical relationship between the efficiencies of studied Aspergillus species in the production of silver nanoparticles and their nitrate reductase activity. A. fumigatus as the most efficient species showed the highest nitrate reductase activity among the studied species while A. flavus exhibited the lowest capacity in the biosynthesis of silver nanoparticles which was in accord with its low nitrate reductase activity. The present study showed that Aspergillus species had potential for the biosynthesis of silver nanoparticles depending on their nitrate reductase activity. PMID:27652264
Pectinolytic complex production by Aspergillus niger URM 4645 ...
African Journals Online (AJOL)
-PG), pectin lyase (PL), and pectin methylesterase (PE), produced by Aspergillus niger URM 4645, were studied in solid state fermentation (SSF) using yellow passion fruit peels as substrate. The effect of substrate amount, initial moisture ...
Self-affine fractal growth front of Aspergillus oryzae
Matsuura, Shu; Miyazima, Sasuke
1992-12-01
Aspergillus oryzae have been grown in various environmental conditions and analyzed from the viewpoint of self-affinity. The growth behavior can be described by the Eden model in favorable conditions, and by DLA in unfavorable conditions.
Gerritsen, M G; Brinkman, P; Escobar Salazar, Natalia; Bos, L D; de Heer, K; Meijer, M; Janssen, H-G; de Cock, H; Wösten, H A B; Visser, C.E.; van Oers, M H J; Sterk, P J
Volatile organic compounds (VOCs) in exhaled breath may identify the presence of invasive pulmonary aspergillosis. We aimed to detect VOC profiles emitted by in vitro cultured, clinical Aspergillus isolates using gas chromatography-mass spectrometry (GC-MS). Three clinical Aspergillus isolates and a
Gerritsen, M. G.; Brinkman, P.; Escobar, N.; Bos, L. D.; de Heer, K.; Meijer, M.; Janssen, H.-G.; de Cock, H.; Wösten, H. A. B.; Visser, C. E.; van Oers, M. H. J.; Sterk, P. J.
2018-01-01
Volatile organic compounds (VOCs) in exhaled breath may identify the presence of invasive pulmonary aspergillosis. We aimed to detect VOC profiles emitted by in vitro cultured, clinical Aspergillus isolates using gas chromatography-mass spectrometry (GC-MS). Three clinical Aspergillus isolates and a
Biodegradación de compuestos fenólicos del alpechín con Aspergillus terreus
Directory of Open Access Journals (Sweden)
García Paeja, María P.
1992-04-01
Full Text Available Olive mill wastewater degradation by Aspergillus terreus and under aerobic conditions at 28°C, was measured by the parameter of phenol content. We have explored the effect of different concentrations of olive mill wastewater upon the activity of Aspergillus terreus. Through HPLC, 10 phenol compounds (90% of the total phenolic content of the olive mill wastewater were identified.Se estudia la degradación de alpechines con Aspergillus terreus en condiciones de aerobiosis y temperatura de 28°C, utilizando como parámetro el contenido fenólico. Se analiza el efecto de la concentración de alpechín con Aspergillus terreus utilizando el mismo parámetro. Se han identificado por cromatografía líquida de alta eficacia (CLAE 10 compuestos fenólicos que suponen el 90% del total del alpechín.
Germination of Aspergillus niger conidia
Hayer, Kimran
2014-01-01
Aspergillus niger is a black-spored filamentous fungus that forms asexual spores called conidospores (‘conidia’). Germination of conidia, leading to the formation of hyphae, is initiated by conidial swelling and mobilisation of endogenous carbon and energy stores, followed by polarisation and emergence of a hyphal germ tube. These morphological and biochemical changes which define the model of germination have been studied with the aim of understanding how conidia sense and utilise different...
Regulatory processes in Aspergillus niger
Poulsen, Lars; Thykær, Jette; Eliasson Lantz, Anna
2012-01-01
Filamentous fungi are extensively used in the fermentation industry for synthesis of numerous products. One of the most important, is the fungus Aspergillus niger, used industrially for production of organic acids, and homologous as well as heterologous enzymes. This fungus has numerous of advantages, including tolerance for low pH, which is important for acid production. Furthermore, it has the capability of metabolizing a wide variety of carbon sources, possesses an exceptional efficient pr...
Aspergillus species isolated from mangrove forests in Borneo Island, Sarawak, Malaysia
Directory of Open Access Journals (Sweden)
J.S.S. Seelan
2009-06-01
Full Text Available A study on the occurrence of Aspergillus spp. on selected mangrove forests in Sarawak was conducted to find out their diversity and distribution. Samples were obtained from mangrove soils and leaf litters at different locations, i.e. Sematan, Lundu, Kampung Bako, Bako in Sarawak. Soil and leaf litter samples were taken randomly at different locations with five replicates from each area. A total of 138 isolates of Aspergillus species were obtained from the soil and leaf litter samples by using direct plating and Warcup method. Based on both macroscopic and microscopic observations, using an identification key, individual isolates were classified within the genus Aspergillus, belonging to three subgenera, four sections and five species. The fungi isolates were identified as A. terreus, A. flavipes, A. carneus, A. fumigatus and A. clavatus. The most frequent isolated species was A. flavipes (63.04%, followed by A. fumigatus (16.7%, A. terreus (13.04%, A. carneus (5.8% and A. clavatus (1.44%. All of the isolated Aspergillus species grew well on MEA and CYA at 25°C. A. carneus produced reddish sclerotia on MEA after seven days and this could be used as an important characteristic in this species identification. A. clavatus from mangrove soil in Kampung Bako has shown long conidiophores (ranging from 3-5 cm with swollen hyphal structures, while A. clavatus from Sematan area has shorter conidiophores (ranging from 2.5-3.5 cm on MEA.
Jantapan, Kittika; Poapolathep, Amnart; Imsilp, Kanjana; Poapolathep, Saranya; Tanhan, Phanwimol; Kumagai, Susumu; Jermnak, Usuma
2017-01-01
The antiaflatoxigenic and antifungal activities of essential oils (EOs) of finger root (Boesenbergia rotunda (L.) Mansf.), pine (Pinus pinaster), rosewood (Aniba rosaedora), Siam benzoin (Styrax tonkinensis), Thai moringa (Moringa oleifera), and ylang ylang (Cananga odorata) were tested for Aspergillus parasiticus and Aspergillus flavus in potato dextrose broth. Aflatoxin B 1 (AFB 1 ) was extracted from culture using a QuEChERS-based extraction procedure and analyzed with high performance liquid chromatography (HPLC) coupled to a fluorescence detector. EO of pine showed the greatest inhibition of growth and AFB 1 production of A. parasiticus, followed by EOs of rosewood, finger root, Siam benzoin, and ylang ylang. EO of finger root gave the best inhibitory effects on A. flavus, followed by EOs of rosewood, pine, ylang ylang, and Siam benzoin. EO of Thai moringa did not show any significant inhibition of aflatoxigenic fungi. The antiaflatoxigenic activities of EOs correlated with their antifungal activities in the dosedependent manner. Comparison of the application of the five selected EOs in peanut pods by direct and vapor exposure indicated that the AFB 1 production inhibitory effects of the five EOs by direct exposure were faster and more effective than by vapor exposure. EO of finger root showed the best inhibition of AFB 1 production of A. flavus in peanut pods by direct exposure, followed by EOs of pine, rosewood, ylang ylang, and Siam benzoin.
Li, Zhipeng; Ahn, Hyung Jin; Kim, Nam Yeon; Lee, Yu Na; Ji, Geun Eog
2016-01-01
To transform ginsenosides, Korean ginseng berry (KGB) was fermented by mycotoxin non-producing Aspergillus niger and Aspergillus oryzae. Changes of ginsenoside profile and anti-proliferative activities were observed. Results showed that A. niger tended to efficiently transform protopanaxadiol (PPD) type ginsenosides such as Rb1, Rb2, Rd to compound K while A. oryzae tended to efficiently transform protopanaxatriol (PPT) type ginsenoside Re to Rh1 via Rg1. Butanol extracts of fermented KGB showed high cytotoxicity on human adenocarcinoma HT-29 cell line and hepatocellular carcinoma HepG2 cell line while that of unfermented KGB showed little. The minimum effective concentration of niger-fermented KGB was less than 2.5 µg/mL while that of oryzae-fermented KGB was about 5 µg/mL. As A. niger is more inclined to transform PPD type ginsenosides, niger-fermented KGB showed stronger anti-proliferative activity than oryzae-fermented KGB.
Directory of Open Access Journals (Sweden)
Baozhu Guo
2011-06-01
Full Text Available Aspergillus flavus and A. parasiticus infect peanut seeds and produce aflatoxins, which are associated with various diseases in domestic animals and humans throughout the world. The most cost-effective strategy to minimize aflatoxin contamination involves the development of peanut cultivars that are resistant to fungal infection and/or aflatoxin production. To identify peanut Aspergillus-interactive and peanut Aspergillus-resistance genes, we carried out a large scale peanut Expressed Sequence Tag (EST project which we used to construct a peanut glass slide oligonucleotide microarray. The fabricated microarray represents over 40% of the protein coding genes in the peanut genome. For expression profiling, resistant and susceptible peanut cultivars were infected with a mixture of Aspergillus flavus and parasiticus spores. The subsequent microarray analysis identified 62 genes in resistant cultivars that were up-expressed in response to Aspergillus infection. In addition, we identified 22 putative Aspergillus-resistance genes that were constitutively up-expressed in the resistant cultivar in comparison to the susceptible cultivar. Some of these genes were homologous to peanut, corn, and soybean genes that were previously shown to confer resistance to fungal infection. This study is a first step towards a comprehensive genome-scale platform for developing Aspergillus-resistant peanut cultivars through targeted marker-assisted breeding and genetic engineering.
Avirulent mutants of Macrophomina phaseolina and Aspergillus ...
Indian Academy of Sciences (India)
A human pathogen, Aspergillus fumigatus was also able to infect germinating seeds of P. mungo in the presence of 5 g/ml concentration of phaseolinone. Phaseolinone seemed to facilitate infection by A. fumigatus, which is not normally phytopathogenic, by reducing the immunity of germinating seedlings in a nonspecific ...
Comparative Studies on Pectinases obtained from Aspergillus ...
African Journals Online (AJOL)
Prof. Ogunji
Abstract. Pectinase was produced from Aspergillus species (A. fumigatus, and A. niger) in a submerged fermentation system after 4 and 5 days of fermentation, respectively using pectin extracted from different agro-wastes (mango, orange and pineapple peels) as the carbon sources. The pectin was extracted from mango, ...
Aspergillus in endodontic infection near the maxillary sinus.
Gomes, Cinthya Cristina; Pinto, Larissa Christina Costa; Victor, Fernanda Loretti; Silva, Erlange Andrade Borges da; Ribeiro, Apoena de Aguiar; Sarquis, Maria Inês de Moura; Camões, Isabel Coelho Gomes
2015-01-01
Diseases of the maxillary sinus have been associated with dental roots near the maxillary sinus that have undergone endodontic treatment. To investigate the presence of filamentous fungi in patients with dental roots near the maxillary sinus who had apical periodontitis treated endodontically, and to alert practitioners that this could be a possible avenue of contamination of the sinus in patients who develop maxillary sinus infection. Cross-sectional study in 60 palatal roots of the first maxillary molars near the maxillary sinus, that underwent endodontic treatment for apical periodontitis. After removal of the filling material, dentin shavings were collected and placed in test tubes containing Sabouraud dextrose agar and chloramphenicol. The phenotype was determined by macroscopic and microscopic examination of the colonies. For polymerase chain reaction, the primers ITS-5 and ITS-4 were used. The sequences obtained were compared with those deposited at GenBank using the Basic Local Alignment Search Tool program. Filamentous fungi were isolated from 6 of 60 canals (10%): Aspergillus niger (6.7%), Aspergillus versicolor (1.6%), and Aspergillus fumigatus (1.6%). Root canals near the maxillary sinus with endodontic treatment and apical periodontitis may exhibit positive cultures for filamentous fungi. Interested professionals should be alert, because these microorganisms have pathogenic characteristics that can cause disease of odontogenic origin in the maxillary sinus. Copyright © 2015 Associação Brasileira de Otorrinolaringologia e Cirurgia Cérvico-Facial. Published by Elsevier Editora Ltda. All rights reserved.
Nutrient enrichment of pineapple waste using Aspergillus niger and ...
African Journals Online (AJOL)
Nutrient enrichment of pineapple waste using Aspergillus niger and Trichoderma viride by solid state fermentation. Evans Otieno Omwango, Eliud Nyaga Mwaniki Njagi, George Owino Orinda, Ruth Nduta Wanjau ...
International Nuclear Information System (INIS)
Morzan, Uriel N.; Ramírez, Francisco F.; Scherlis, Damián A.; Oviedo, M. Belén; Sánchez, Cristián G.; Lebrero, Mariano C. González
2014-01-01
This article presents a time dependent density functional theory (TDDFT) implementation to propagate the Kohn-Sham equations in real time, including the effects of a molecular environment through a Quantum-Mechanics Molecular-Mechanics (QM-MM) hamiltonian. The code delivers an all-electron description employing Gaussian basis functions, and incorporates the Amber force-field in the QM-MM treatment. The most expensive parts of the computation, comprising the commutators between the hamiltonian and the density matrix—required to propagate the electron dynamics—, and the evaluation of the exchange-correlation energy, were migrated to the CUDA platform to run on graphics processing units, which remarkably accelerates the performance of the code. The method was validated by reproducing linear-response TDDFT results for the absorption spectra of several molecular species. Two different schemes were tested to propagate the quantum dynamics: (i) a leap-frog Verlet algorithm, and (ii) the Magnus expansion to first-order. These two approaches were confronted, to find that the Magnus scheme is more efficient by a factor of six in small molecules. Interestingly, the presence of iron was found to seriously limitate the length of the integration time step, due to the high frequencies associated with the core-electrons. This highlights the importance of pseudopotentials to alleviate the cost of the propagation of the inner states when heavy nuclei are present. Finally, the methodology was applied to investigate the shifts induced by the chemical environment on the most intense UV absorption bands of two model systems of general relevance: the formamide molecule in water solution, and the carboxy-heme group in Flavohemoglobin. In both cases, shifts of several nanometers are observed, consistently with the available experimental data
Prevalence of potential toxigenic Aspergillus species isolated from ...
African Journals Online (AJOL)
ADEYEYE
2015-12-17
Dec 17, 2015 ... Aspergillus species) in feeds used in poultry farms in Sokoto metropolis. During a ... potential exists for the production of mycotoxins that may be of both veterinary public health significance and ..... The effect of antioxidant and.
Aspergillus and Penicillium in the Post-genomic Era
DEFF Research Database (Denmark)
and a whole genus genome sequencing project in progress for Aspergillus. This book highlights some of the changes in the studies into these fungi, since the availability of genome sequences. The contributions vary from insights in the taxonomy of these genera, use of genomics for forward genetics and genomic......Genome sequencing has affected studies into the biology of all classes of organisms and this is certainly true for filamentous fungi. The level with which biological systems can be studied since the availability of genomes and post-genomic technologies is beyond what most people could have imagined...... previously. The fungal genera Aspergillus and Penicillium contain some species that are amongst the most widely used industrial microorganisms and others that are serious pathogens of plants, animals and humans. These genera are also at the forefront of fungal genomics with many genome sequences available...
Significance and occurrence of fumonisins from Aspergillus niger
DEFF Research Database (Denmark)
Mogensen, Jesper Mølgaard
Fumonisins is a well-studied group of mycotoxins, mainly produced in maize by Fusarium species. However with the recent discovery of a fumonisin production by Aspergillus niger, other food commodities are at risk, since A. niger is a ubiquitous contaminant of many food and feed products....... The objective of this thesis was to determine the significance and occurrence of fumonisins from Aspergillus niger in food, the frequency of fumonisin production in A. niger isolates, as well as studies of the effect of physiological factors affecting fumonisin production. Major findings in this context have...... been the ocumentation of the production of fumonisins in raisins and peanuts, and occurrence of A. niger derived fumonisins in retail wine and raisins. Physiological investigations have demonstrated that fumonisin production in A. niger occurs at temperatures between 20-37 °C. Three water activity...
Discovery of novel secondary metabolites in Aspergillus aculeatus
DEFF Research Database (Denmark)
Petersen, Lene Maj; Holm, Dorte Koefoed; Gotfredsen, Charlotte Held
2012-01-01
, whereby several novel secondary metabolites have been discovered. A. aculeatus has recently been genome-sequenced; however no genetic approaches have so far been described to facilitate genetic engineering. We here present a system for non-integrated (AMA1-based) gene expression in A. aculeatus based...... on the USERTM cloning technique. The AMA-1 based gene expression has successfully been applied to express genes in A. aculeatus and by this approach the function of a PKS gene has been established. Furthermore the technique was used to activate a silent cluster by expression of a transcription factor, leading...... of the industrially important black Aspergillus Aspergillus aculeatus by UHPLC-DAD-HRMS has identified several SMs already known from this organism. However, several compounds could not be unambiguously dereplicated wherefore some have been selected, purified and structure elucidated by 1D and 2D NMR spectroscopy...
Buil, J B; Rijs, A J M M; Meis, J F; Birch, M; Law, D; Melchers, W J G; Verweij, P E
2017-09-01
F901318 is a new antifungal agent with a novel mechanism of action with activity against Aspergillus species. We investigated the in vitro activity of F901318 against a collection of Aspergillus isolates. A total of 213 Aspergillus isolates were used in this study. A total of 143 Aspergillus fumigatus sensu stricto isolates were used, of which 133 were azole resistant [25 TR34/L98H; 25 TR46/Y121F/T289A; 33 A. fumigatus with cyp51A-associated point mutations (25 G54, 1 G432 and 7 M220); and 50 azole-resistant A. fumigatus without known resistance mechanisms]. Ten azole-susceptible A. fumigatus isolates were used as WT controls. The in vitro activity was also determined against Aspergillus calidoustus (25 isolates), Aspergillus flavus (10), Aspergillus nidulans (10) and Aspergillus tubingensis (25). F901318 activity was compared with that of itraconazole, voriconazole, posaconazole, isavuconazole, amphotericin B and anidulafungin. Minimum effective concentrations and MICs were determined using the EUCAST broth microdilution method. F901318 was active against all tested isolates: A. fumigatus WT, MIC90 0.125 mg/L (range 0.031-0.125); TR34/L98H,TR46/Y121F/T289A and azole resistant without known resistance mechanisms, MIC90 0.125 mg/L (range 0.031-0.25); A. fumigatus with cyp51A-associated point mutations, MIC90 0.062 mg/L (range 0.015-0.125); and other species, A. calidoustus MIC90 0.5 mg/L (range 0.125-0.5), A. flavus MIC90 0.062 mg/L (range 0.015-0.62), A. nidulans MIC90 0.125 mg/L (range 0.062-0.25) and A. tubingensis MIC90 0.062 mg/L (range 0.015-0.25). F901318 showed potent and consistent in vitro activity against difficult-to-treat Aspergillus spp. with intrinsic and acquired antifungal resistance due to known and unknown resistance mechanisms, suggesting no significant implications of azole resistance mechanisms for the mode of action of F901318. © The Author 2017. Published by Oxford University Press on behalf of the British Society for
Morton, C Oliver; White, P Lewis; Barnes, Rosemary A; Klingspor, Lena; Cuenca-Estrella, Manuel; Lagrou, Katrien; Bretagne, Stéphane; Melchers, Willem; Mengoli, Carlo; Caliendo, Angela M; Cogliati, Massimo; Debets-Ossenkopp, Yvette; Gorton, Rebecca; Hagen, Ferry; Halliday, Catriona; Hamal, Petr; Harvey-Wood, Kathleen; Jaton, Katia; Johnson, Gemma; Kidd, Sarah; Lengerova, Martina; Lass-Florl, Cornelia; Linton, Chris; Millon, Laurence; Morrissey, C Orla; Paholcsek, Melinda; Talento, Alida Fe; Ruhnke, Markus; Willinger, Birgit; Donnelly, J Peter; Loeffler, Juergen
2017-06-01
A wide array of PCR tests has been developed to aid the diagnosis of invasive aspergillosis (IA), providing technical diversity but limiting standardisation and acceptance. Methodological recommendations for testing blood samples using PCR exist, based on achieving optimal assay sensitivity to help exclude IA. Conversely, when testing more invasive samples (BAL, biopsy, CSF) emphasis is placed on confirming disease, so analytical specificity is paramount. This multicenter study examined the analytical specificity of PCR methods for detecting IA by blind testing a panel of DNA extracted from a various fungal species to explore the range of Aspergillus species that could be detected, but also potential cross reactivity with other fungal species. Positivity rates were calculated and regression analysis was performed to determine any associations between technical specifications and performance. The accuracy of Aspergillus genus specific assays was 71.8%, significantly greater (P Aspergillus species (47.2%). For genus specific assays the most often missed species were A. lentulus (25.0%), A. versicolor (24.1%), A. terreus (16.1%), A. flavus (15.2%), A. niger (13.4%), and A. fumigatus (6.2%). There was a significant positive association between accuracy and using an Aspergillus genus PCR assay targeting the rRNA genes (P = .0011). Conversely, there was a significant association between rRNA PCR targets and false positivity (P = .0032). To conclude current Aspergillus PCR assays are better suited for detecting A. fumigatus, with inferior detection of most other Aspergillus species. The use of an Aspergillus genus specific PCR assay targeting the rRNA genes is preferential. © The Author 2016. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Effect of different substrates on the production of amino acids by aspergillus niger
International Nuclear Information System (INIS)
Almani, F.; Memon, M. A.; Dahot, M. U.
2006-01-01
In the present work, attempts were made to utilize sugarcane waste as carbon source for amino acid production by Aspergillus nigher. Different concentration (0.3N and 0.6N) of H/sub 2/SO/sub 4/ and NH/sub 4/OH were used to hydrolyze lignocellulosic material of the sugar cane bagasse to release the fermentable sugar, which were incorporated with mineral medium for the growth of Aspergillus niger and amino acid production. Whereas, molasses was diluted in 2.5% and 5% and was mixed with mineral medium for amino acid production by Aspergillus niger. The results were compaired with sugar cane bagasse for amino acid production. Molasses 5% was found better substrate for higher production of amino acids in comparison to hydrolysates of sugar can bagasse. (author)
Biosynthesis of silver nanoparticles by Aspergillus niger , Fusarium ...
African Journals Online (AJOL)
... scanning electron microscope (SEM). Results indicate the synthesis of silver nanoparticles in the reaction mixture. The synthesis of nanoparticles would be suitable for developing a microbial nanotechnology biosynthesis process for mass scale production. Keywords: Silver nanoparticles, biosynthesis, fungi, Aspergillus.
Beauvais, Anne; Beau, Remi; Candoni, Anna; Maertens, Johan; Rossi, Giulio; Morselli, Monica; Zanetti, Eleonora; Quadrelli, Chiara; Codeluppi, Mauro; Guaraldi, Giovanni; Pagano, Livio; Caira, Morena; Giovane, Cinzia Del; Maccaferri, Monica; Stefani, Alessandro; Morandi, Uliano; Tazzioli, Giovanni; Girardis, Massimo; Delia, Mario; Specchia, Giorgina; Longo, Giuseppe; Marasca, Roberto; Narni, Franco; Merli, Francesco; Imovilli, Annalisa; Apolone, Giovanni; Carvalho, Agostinho; Comoli, Patrizia; Romani, Luigina; Latgè, Jean Paul; Luppi, Mario
2013-01-01
Several studies in mouse model of invasive aspergillosis (IA) and in healthy donors have shown that different Aspergillus antigens may stimulate different adaptive immune responses. However, the occurrence of Aspergillus-specific T cells have not yet been reported in patients with the disease. In patients with IA, we have investigated during the infection: a) whether and how specific T-cell responses to different Aspergillus antigens occur and develop; b) which antigens elicit the highest frequencies of protective immune responses and, c) whether such protective T cells could be expanded ex-vivo. Forty hematologic patients have been studied, including 22 patients with IA and 18 controls. Specific T cells producing IL-10, IFN-γ, IL-4 and IL-17A have been characterized through enzyme linked immunospot and cytokine secretion assays on 88 peripheral blood (PB) samples, by using the following recombinant antigens: GEL1p, CRF1p, PEP1p, SOD1p, α1–3glucan, β1–3glucan, galactomannan. Specific T cells were expanded through short term culture. Aspergillus-specific T cells producing non-protective interleukin-10 (IL-10) and protective interferon-gamma (IFN-γ) have been detected to all the antigens only in IA patients. Lower numbers of specific T cells producing IL-4 and IL-17A have also been shown. Protective T cells targeted predominantly Aspergillus cell wall antigens, tended to increase during the IA course and to be associated with a better clinical outcome. Aspergillus-specific T cells could be successfully generated from the PB of 8 out of 8 patients with IA and included cytotoxic subsets able to lyse Aspergillus hyphae. Aspergillus specific T-cell responses contribute to the clearance of the pathogen in immunosuppressed patients with IA and Aspergillus cell wall antigens are those mainly targeted by protective immune responses. Cytotoxic specific T cells can be expanded from immunosuppressed patients even during the infection by using the above mentioned
The transmission of cytoplasmic genes in Aspergillus nidulans
Coenen, A.
1997-01-01
Introduction
This manuscript concerns the spread of selfish cytoplasmic genes in the fungus Aspergillus nidulans. A.nidulans is a common soil fungus that grows vegetatively by forming a network (mycelium) of hyphae and reproduces
Novofumigatonin, a New Orthoester Meroterpenoid from Aspergillus novofumigatus
DEFF Research Database (Denmark)
Rank, Christian; Phipps, Richard Kerry; Harris, Pernille
2008-01-01
Novofumigatonin (1), a new metabolite, has been isolated from Aspergillus novofumigatus. The structure and relative stereochemistry were determined from HR ESI MS, one- and two-dimensional NMR, and single-crystal X-ray analysis. The absolute configuration was assigned using vibrational circular...
Baxter, C G; Denning, D W; Jones, A M; Todd, A; Moore, C B; Richardson, M D
2013-04-01
Detection of Aspergillus IgG antibodies is important in the diagnosis of chronic pulmonary aspergillosis and allergic bronchopulmonary aspergillosis. Immunoprecipitation techniques to detect these antibodies appear to lack sensitivity and accurate quantitation compared with enzyme immunoassays (EIA). This study assessed the performance of two commercial EIAs compared with counterimmunoelectrophoresis (CIE). This was a prospective cohort study of 175 adult patients with chronic or allergic pulmonary aspergillosis. Aspergillus IgG antibodies were detected using CIE, Phadia ImmunoCap Aspergillus IgG and Bio-Rad Platelia Aspergillus IgG. Inter-assay reproducibility was determined for each method and 25 patients had two serum samples analysed within a 6-month interval. When compared with CIE, both ImmunoCap and Platelia Aspergillus IgG had good sensitivity (97 and 93%, respectively) for detection of Aspergillus IgG antibodies. The level of agreement between the two EIAs for positive results was good, but the concentration of antibodies was not correlated between the tests or with CIE titre. ImmunoCap IgG inter-assay coefficient of variation was 5%, whereas Platelia IgG was 33%. Median ImmunoCap IgG values for CPA and allergic aspergillosis were 95 and 32 mg/L, respectively, whereas Platelia IgG values were >80 and 6 AU/mL. The direction of CIE titre change over 6 months was mirrored by ImmunoCap IgG levels in 92% of patients, and by Platelia IgG in 72% of patients. Both ImmunoCap and Platelia Aspergillus IgG EIAs are sensitive measures of Aspergillus IgG antibodies compared with CIE. However, ImmunoCap appears to have better reproducibility and may be more suitable for monitoring patient disease. © 2012 The Authors Clinical Microbiology and Infection © 2012 European Society of Clinical Microbiology and Infectious Diseases.
Giaj Merlera, G; Muñoz, S; Coelho, I; Cavaglieri, L R; Torres, A M; Reynoso, M M
2015-10-01
Aspergillus section Nigri is a heterogeneous fungal group including some ochratoxin A producer species that usually contaminate raisins. The section contains the Series Carbonaria which includes the toxigenic species Aspergillus carbonarius and nontoxigenic Aspergillus ibericus that are phenotypically undistinguishable. The aim of this study was to examine the diversity of black aspergilli isolated from raisins and to develop a specific genetic marker to distinguish A. ibericus from A. carbonarius. The species most frequently found in raisins in this study were Aspergillus tubingensis (35.4%) and A. carbonarius (32.3%), followed by Aspergillus luchuensis (10.7%), Aspergillus japonicus (7.7%), Aspergillus niger (6.2%), Aspergillus welwitschiae (4.6%) and A. ibericus (3.1%). Based on inter-simple sequence repeat (ISSR) fingerprinting profiles of major Aspergillus section Nigri members, a sequence-characterized amplified region (SCAR) marker was identified. Primers were designed based on the conserved regions of the SCAR marker and were utilized in a PCR for simultaneous identification of A. carbonarius and A. ibericus. The detection level of the SCAR-PCR was found to be 0.01 ng of purified DNA. The present SCAR-PCR is rapid and less cumbersome than conventional identification techniques and could be a supplementary strategy and a reliable tool for high-throughput sample analysis. Copyright © 2015 Elsevier B.V. All rights reserved.
Effect of Aspergillus versicolor strain JASS1 on low density polyethylene degradation
Gajendiran, A.; Subramani, S.; Abraham, J.
2017-11-01
Low density polyethylene (LDPE) waste disposal remains one of the major environmental concerns faced by the world today. In past decades, major focus has been given to enhance the biodegradation of LDPE by microbial species. In this present study, Aspergillus versicolor with the ability to degrade LDPE was isolated from municipal landfill area using enrichment technique. Based on 18S rRNA gene sequencing confirmed its identity as Aspergillus versicolor. The biodegradation study was carried out for 90 d in M1 medium. The degradation behaviour of LDPE films by Aspergillus versicolor strain JASS1 were confirmed by weight loss, CO2 evolution, Scanning electron microscopy (SEM) analysis, Atomic force microscopy (AFM), Fourier transform infrared spectroscopy (FTIR) technique. From current investigation, it can be concluded that our isolated strain JASS1 had the potential to degrade LDPE films and it can be useful in solving the problem caused by polyethylene in the environment.
Ma, Xiao; Bibby, Kyle
2017-09-01
Fungi are near-ubiquitous in potable water distribution systems, but the disinfection kinetics of commonly identified fungi are poorly studied. In the present study, laboratory scale experiments were conducted to evaluate the inactivation kinetics of Aspergillus fumigatus, Aspergillus versicolor, and Penicillium purpurogenum by free chlorine and monochloramine. The observed inactivation data were then fit to a delayed Chick-Watson model. Based on the model parameter estimation, the Ct values (integrated product of disinfectant concentration C and contact time t over defined time intervals) for 99.9% inactivation of the tested fungal strains ranged from 48.99 mg min/L to 194.7 mg min/L for free chlorine and from 90.33 mg min/L to 531.3 mg min/L for monochloramine. Fungal isolates from a drinking water system (Aspergillus versicolor and Penicillium purpurogenum) were more disinfection resistant than Aspergillus fumigatus type and clinical isolates. The required 99.9% inactivation Ct values for the tested fungal strains are higher than E. coli, a commonly monitored indicator bacteria, and within a similar range for bacteria commonly identified within water distribution systems, such as Mycobacterium spp. and Legionella spp. Copyright © 2017 Elsevier Ltd. All rights reserved.
Potential aflatoxin and ochratoxin a production by Aspergillus species in poultry feed processing.
Fraga, M E; Curvello, F; Gatti, M J; Cavaglieri, L R; Dalcero, A M; da Rocha Rosa, C A
2007-04-01
Poultry feeds are prone to fungal growth and mycotoxin production during processing. The identification of biota with the ability to produce mycotoxins is essential. The aims of this study were (1) to monitor the mycobiota counts at different stages of poultry feed processing; (2) to determine the occurrence of Aspergillus species; (3) to evaluate the natural incidence of aflatoxins and ochratoxin A. The ability of Aspergillus spp. and its teleomorphs isolated here to produce these toxins was also investigated. Samples (144) were collected at random from a factory in Brazil. The occurrence of Aspergillus and Eurotium species was demonstrated on DRBC and DG18 media and the production of aflatoxins and ochratoxin A and their natural incidence were determined by TLC and HPLC methods. A. flavus and E. chevalieri were the most prevalent species isolated. Fungal contamination was not found after the pelleting process, though Aspergillus and Eurotium species were recovered from trough samples. High levels of aflatoxin and ochratoxin A producers were found at all stages of poultry feed processing. Also, high natural contamination with aflatoxins and ochratoxin A was found in the samples. Contact of feed with remainder poultry feed could lead to fungal contamination, so the risk of aflatoxin and/or ochratoxin A contamination of feed must be taken into account.
Directory of Open Access Journals (Sweden)
I Mangisah
2010-05-01
Full Text Available Two steps of experiment were conducted to evaluate the proximate composition and nutritive value of fermented water hyacinth leaf (WHL with Aspergillus niger in Tegal duck. Twenty two heads of eight-week Tegal ducks with an average body weight of 1202.55 + 111.14 g were used in this experiment. There were two treatments namely: non-fermented (NFWH and fermented with Aspergillus niger (FWHAN. Each treatment was replicated 10 times. Data gathered were analyzed using t-student test. The proximate composition between NFWH and FWHAN showed an increase in crude protein/CP (11.44 vs 16.09% and ash (12.76 vs 22.37% but a decrease in crude fiber/CF (21.51 vs 16.62% and nitrogen free extract/NFE (53.20 vs 43.59%. The nutritive value of diet for eight-week Tegal ducks showed that fermentation of WHL with Aspergillus niger significantly increased CP digestibility, true metabolizable energy (TME and nitrogen retention (NR, but not for CF digestibility. It could be concluded that fermentation of WHL with Aspergillus niger increases the nutrient quality and the nutritive value of diet for eight-week Tegal ducks in term of CP digestibility, TME and NR. (Animal Production 12(2: 100-104 (2010Key Words: water hyacinth leaf, fermentation, Aspergillus niger, biological value, Tegal ducks
On the safety of Aspergillus niger - a review
DEFF Research Database (Denmark)
Schuster, E.; Dunn-Coleman, N.; Frisvad, Jens Christian
2002-01-01
Aspergillus niger is one of the most important microorganisms used in biotechnology. It has been in use already for many decades to produce extracellular (food) enzymes and citric acid. In fact, citric acid and many A. niger enzymes are considered GRAS by the United States Food and Drug...... retrieval reasons and there is a taxonomical consensus based on molecular data that the only other common species closely related to A. niger in the Aspergillus series Nigri is A. tubingensis. A. niger, like other filamentous fungi, should be treated carefully to avoid the formation of spore dust. However...... Administration. In addition, A. niger is used for biotransformations and waste treatment. In the last two decades, A. niger has been developed as an important transformation host to over-express food enzymes. Being pre-dated by older names, the name A. niger has been conserved for economical and information...
Fumonisins in Aspergillus niger: Industrial and food aspects
DEFF Research Database (Denmark)
Frisvad, Jens Christian; Nielsen, Kristian Fog; Mogensen, Jesper
Introduction: Fumonisins are toxic seconday metabolites from Fusarium verticillioides and other Fusaria, from Tolypocladium and Aspergillus niger 1,2. Being a generalist Aspergillus niger is the workhorse in a very large number of industrial applications, and is also a common contaminant in foods....... Fumonisin production by A. niger is depending on temperature and water activity, but is produced mostly on substrates with high maounts of sugar or salt 1,3,4. We wanted to find out whether industrial strains could produce fumonisins in worst case scenarios and if fumonisin production was only a feature...... ever used in biotechnology could produce fuminisins B2, B4 & B6. The strains could be subdivided into two clades (representing A. niger and the “phylospecies” A. awamori), and there were fumonisin producers in both clades. Ochratoxin A was also produced by strains in both clades, but only...
Nomura, Hiroaki; Nakamura, Yuji; Cao, Xin; Honda, Atsushi; Katagi, Jun; Ohara, Hiroshi; Izumi-Nakaseko, Hiroko; Satoh, Yoshioki; Ando, Kentaro; Sugiyama, Atsushi
2015-08-15
Cardiovascular effects of a highly selective prostaglandin E2 type 4 (EP4) receptor agonist ONO-AE1-329 were assessed with the halothane-anesthetized dogs (n=6). ONO-AE1-329 was intravenously infused in three escalating doses of 0.3, 1 and 3ng/kg/min for 10min with a pause of 20min between the doses. The low dose of 0.3ng/kg/min significantly increased maximum upstroke velocity of left ventricular pressure by 18% at 20min, indicating increase of ventricular contractility. The middle dose of 1ng/kg/min significantly decreased total peripheral resistance by 24% and left ventricular end-diastolic pressure by 32% at 10min, indicating dilation of arteriolar resistance vessels and venous capacitance ones, respectively; and increased cardiac output by 25% at 10min in addition to the change induced by the low dose. The high dose of 3ng/kg/min increased heart rate by 34% at 10min; decreased mean blood pressure by 14% at 10min and atrioventricular nodal conduction time by 13% at 5min; and shortened left ventricular systolic period by 8% at 10min and electromechanical coupling defined as an interval from completion of repolarization to the start of ventricular diastole by 39% at 10min in addition to the changes induced by the middle dose. No significant change was detected in a ventricular repolarization period. These results indicate that ONO-AE1-329 may possess a similar cardiovascular profile to typical phosphodiesterase 3 inhibitors as an inodilator, and suggest that EP4 receptor stimulation can become an alternative strategy for the treatment of congestive heart failure. Copyright © 2015 Elsevier B.V. All rights reserved.
Hyphal heterogeneity in Aspergillus niger
de Bekker, A.M.
2011-01-01
Mycelial fungi use hyphae to colonize substrates. These hyphae secrete enzymes that convert complex polymers into breakdown products that can be taken up to serve as nutrients. Using GFP as a reporter it has been shown that exploring hyphae of Aspergillus niger are heterogenic with respect to expression of the glucoamylase gene glaA; some hyphae strongly express the glucoamylase gene glaA, while others express it lowly. This was a surprising finding considering the fact that all hyphae were e...
Lysine aminopeptidase of Aspergillus niger
Basten, D.E.J.W.; Visser, J.; Schaap, P.J.
2001-01-01
Conserved regions within the M1 family of metallo-aminopeptidases have been used to clone a zinc aminopeptidase from the industrially used fungus Aspergillus niger. The derived amino acid sequence of ApsA is highly similar to two yeast zinc aminopeptidases, LAPI and AAPI (53.3 and 50.9␘verall similarity, respectively), two members of the M1 family of metallo-aminopeptidases. The encoding gene was successfully overexpressed in A. niger and the overexpressed product was purified and characteriz...
Aflatoxin B1-producing Aspergillus in sun-dried medicinal plant materials
Directory of Open Access Journals (Sweden)
Chinaputi, A.
2001-10-01
Full Text Available Fifty sun-dried medicinal plants were obtained from fraditional drug stores in Songkhla Province, Thailand, and examined for Aspergillus and aflatoxin B1. 288 isolates of Aspergillus were obtaines by standard blotter plate and 25 species were identified. The most common species were A. niger with 99 isolates, A. Flavus 84 isolates, A. terreus 33 isolates, A. oryzae 25 isolates, A.nidulans (Emericella nidulans 10 isolates, A fumigatus 9 isolates and A. chevalieri (Eurotium chevalieri 8 isolates. The other species[A. alliaceus, A.auricomus, A. carbonarius, A. carneus, A. clavatus, A. fisheri(Sartorya fumigata, A. janus, A. melleus,A. ochraceus, A. phoencis, A. sparsus, A. terricola, A. thomii, A. versicolor, A. wentii and Aspergillus sp.1-3] each had 1-2 siolates. Ofthe 50 different plants examined,9 had no trace of Aspergillus, namely Cinnamomum zeylanicum, Illicium verum, Andrographis paniculate, Carthamus tinctorius, Eugenia caryophyllus, Elettaria cardomomum, Coriandrum sativum, Curcuma longa and Cassia garrettiana. The highest number of species(9 of Aspergillus was found on Rauvolfia serpentina.The ability of Aspergillus to form aflatoxin was determined in coconut milk agar by observing the intensity of blue fluorescence in agar surrounding the colonies under ultraviolet light and the yellow pigment under the colonies. The results showed the production of aflatoxin was limited to the one species, A. flavus, from which 84 isolates produced aflatoxin in 57 isolates(67.8%.Aflatoxin B1. production was confirmed by culturing fluorescencing isolates of A. flavus in coconut nilk broth and detecting by ELISA technique. Aflatoxin B1. showed increasing production after 2 days, stabilizing at 3-4 days, and the decreasing after 5-6 days. Aflatoxin B1. could not be detected from nonfluorescencing isolates.The morphological characteristics of the aflatoxin B1. -producing and non-producing strains of A. flavus were similar under light microscope and
Czech Academy of Sciences Publication Activity Database
Banáš, Pavel; Rulíšek, Lubomír; Hánošová, V.; Svozil, Daniel; Walter, N.G.; Šponer, Jiří; Otyepka, Michal
2008-01-01
Roč. 112, č. 35 (2008), s. 11177-11187 ISSN 1520-6106 R&D Projects: GA MŠk LC512; GA MŠk(CZ) LC06030; GA AV ČR(CZ) IAA400040802; GA AV ČR 1QS500040581 Grant - others:NIH(US) GM62357 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : HDV ribozyme * catalysis * QM/MM calculations Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.189, year: 2008
Energy Technology Data Exchange (ETDEWEB)
Takada, Toshikazu [Research Program for Computational Science, RIKEN 2-1, Hirosawa, Wako, Saitama 351-0198 (Japan)
2007-07-15
The goal of this project is to understand the charge separation mechanisms in biological systems using the molecular orbital theories. Specially, the charge separation in the photosynthetic reaction center is focused on, since the efficiency in use of the solar energy is extraordinary and the reason for it is still kept unknown. Here, a QM/MM theoretical scheme is employed to take the effects of the surrounding proteins onto the pigments into account. To describe such excited electronic structures, a unified theory by MRSCI and DFT is newly invented. For atoms in the MM space, a new sampling method has also been created, based on the statistical physics. By using these theoretical framework, the excited and positively charged states of the special pair, that is, chlorophyll dimmer are planning to be calculated this year.
International Nuclear Information System (INIS)
Takada, Toshikazu
2007-01-01
The goal of this project is to understand the charge separation mechanisms in biological systems using the molecular orbital theories. Specially, the charge separation in the photosynthetic reaction center is focused on, since the efficiency in use of the solar energy is extraordinary and the reason for it is still kept unknown. Here, a QM/MM theoretical scheme is employed to take the effects of the surrounding proteins onto the pigments into account. To describe such excited electronic structures, a unified theory by MRSCI and DFT is newly invented. For atoms in the MM space, a new sampling method has also been created, based on the statistical physics. By using these theoretical framework, the excited and positively charged states of the special pair, that is, chlorophyll dimmer are planning to be calculated this year
DEFF Research Database (Denmark)
Frisvad, Jens Christian; Petersen, Lene Maj; Lyhne, Ellen Kirstine
2014-01-01
Several species in Aspergillus section Nigri have been reported to produce sclerotia on well-known growth media, such as Czapek yeast autolysate (CYA) agar, with sclerotia considered to be an important prerequisite for sexual development. However Aspergillus niger sensu stricto has not been repor...
Ortholog prediction of the Aspergillus genus applicable for synthetic biology
DEFF Research Database (Denmark)
Rasmussen, Jane Lind Nybo; Vesth, Tammi Camilla; Theobald, Sebastian
of genotype-to-phenotype. To achieve this, we have developed orthologous protein prediction software that utilizes genus-wide genetic diversity. The approach is optimized for large data sets, based on BLASTp considering protein identity and alignment coverage, and clustering using single linkage of bi......The Aspergillus genus contains leading industrial microorganisms, excelling in producing bioactive compounds and enzymes. Using synthetic biology and bioinformatics, we aim to re-engineer these organisms for applications within human health, pharmaceuticals, environmental engineering, and food......-directional hits. The result is orthologous protein families describing the genomic and functional features of individual species, clades and the core/pan genome of Aspergillus; and applicable to genotype-to-phenotype analyses in other microbial genera....
Metabolic control analysis of xylose catabolism in Aspergillus
Prathumpai, W.; Gabelgaard, J.B.; Wanchanthuek, P.; Vondervoort, van de P.J.I.; Groot, de M.J.L.; McIntyre, M.; Nielsen, J.
2003-01-01
A kinetic model for xylose catabolism in Aspergillus is proposed. From a thermodynamic analysis it was found that the intermediate xylitol will accumulate during xylose catabolism. Use of the kinetic model allowed metabolic control analysis (MCA) of the xylose catabolic pathway to be carried out,
Aspergillus flavus infection on preserved Eel (Thysoidea macrurus)
Digital Repository Service at National Institute of Oceanography (India)
Gupta, R.; Samuel, C.T.
The fungus Aspergillus flavus was observed growing on a 2.1 m long specimen of eel (Thyrsoidea macrurus). Half of the eel was submerged in 5% formalin in a loosely covered specimen jar. The fungus grew on the eel skin as yellowish-green, heavily...
cellulase and pectinase production potentials of aspergillus niger
African Journals Online (AJOL)
Prof Oyeleke
Production of pectinase and cellulase by Aspergillus niger from corn cob was examined. ... organism was screened for enzymatic activity using Carboxyl Methyl ... preparation of denim fabrics in textile industries, ... exploitation of cellulase is its high cost of production ... catabolite repression influence economics of cellulase.
Protective role of Aspergillus fumigatus melanin against ultraviolet ...
African Journals Online (AJOL)
Melanin protects pigmented cells from physical and biological stresses which are associated with virulence in several important human pathogens, but little is known about the immune response to this ubiquitous biologic compound. Melanin content increased in Aspergillus fumigatus mycelium exposed to ultraviolet for 10 ...
Aspergillus flavus secondary metabolites: more than just aflatoxins
Aspergillus flavus is best known for producing the family of potent carcinogenic secondary metabolites known as aflatoxins. However, this opportunistic plant and animal pathogen also produces numerous other secondary metabolites, many of which have also been shown to be toxic. While about forty of t...
Biomodification of palm shell activated carbon using Aspergillus ...
African Journals Online (AJOL)
Adsorption of lead ions from aqueous solutions using commercial untreated granular palm shell activated carbon (PSAC) and PSAC biomodified with Bacillus subtilis and Aspergillus niger biomass, respectively, was studied. The adsorption capacity of the three biosorbents was evaluated in batch adsorption experiments at ...
Directory of Open Access Journals (Sweden)
Fernando Juari Celoto
2010-12-01
Full Text Available O objetivo deste trabalho foi avaliar a atividade do acaricida etoxazol, no controle e reprodução do ácaro B. phoenicis. Para tanto, foram demarcadas com cola adesiva arenas de cinco centímetros de diâmetro em frutos de citros com alta infestação do ácaro. O ensaio foi delineado em parcelas inteiramente casualizadas, com oito tratamentos e quatro repetições. Em cada arena foram contados o número de ácaros adultos, jovens e ovos. Os tratamentos constaram dos seguintes acaricidas e doses em g i.a./100 L de água: etoxazol 110 SC (1,1; 1,65; 2,75 e 5,5; hexitiazoxi 500 PM (0,75; flufenoxuron 100 CE (3; cihexatina 500 PM (25, aplicados diretamente sobre as arenas. Os frutos foram mantidos em câmara de germinação tipo BOD. com temperatura de 25 ± 2 ºC e fotofase de 12 horas. Diariamente, foram contados o número de ácaros adultos, jovens e ovos, com auxílio de microscópio esteroscópio. Os parâmetros avaliados foram a atividade ovicida, esterilização de fêmeas e efeito sobre formas jovens. Constatou-se que o etoxazol provocou mortalidade de formas jovens do ácaro-da-leprose superior a 95%, nas doses a partir de 1,1 g i.a. /100 L de água. Ovos tratados com etoxazol, nas doses a partir de 1,65 g i.a. /100 L de água, apresentaram inviabilidade média de 60%. O etoxazol apresentou efeito esterilizante sobre fêmeas nas doses a partir de 2,75 g i.a./100 L de água, inviabilizando 95% dos ovos.
Growth pattern of the surface of fungus Aspergillus colony
Matsuura, Shu; Miyazima, Sasuke
1992-05-01
Aspergillus oryzae colonies were grown under various glucose concentrations, temperatures, and agar concentrations, and the effects on the pattern were investigated. Patterns of colony were found to vary from uniform to diffusion-limited aggregation type.
Directory of Open Access Journals (Sweden)
Fernanda Pelisson Massi
2016-06-01
Full Text Available We present the multiplex PCR data for the presence/absence of genes involved in OTA and FB2 biosynthesis in Aspergillus niger/Aspergillus welwitschiae strains isolated from different food substrates in Brazil. Among the 175 strains analyzed, four mPCR profiles were found: Profile 1 (17% highlights strains harboring in their genome the pks, radH and the fum8 genes. Profile 2 (3.5% highlights strains harboring genes involved in OTA biosynthesis i.e. radH and pks. Profile 3 (51.5% highlights strains harboring the fum8 gene. Profile 4 (28% highlights strains not carrying the genes studied herein. This research content is supplemental to our original research article, “Prospecting for the incidence of genes involved in ochratoxin and fumonisin biosynthesis in Brazilian strains of A. niger and A. welwitschiae” [1].
2010-10-01
... New Entrant Safety Assurance Program § 385.329 May a new entrant that has had its USDOT new entrant... new entrant registration was revoked because of a failed safety audit, the new entrant must do all of... because FMCSA found that the new entrant had failed to submit to a safety audit, it must do all of the...
Wang, Ting; Li, Peiwu; Zhang, Qi; Zhang, Wen; Zhang, Zhaowei; Wang, Tong; He, Ting
2017-06-28
Aspergillus and its poisonous mycotoxins are distributed worldwide throughout the environment and are of particular interest in agriculture and food safety. In order to develop a specific method for rapid detection of Aspergillus flavus to forecast diseases and control aflatoxins, a nanobody, PO8-VHH, highly reactive to A. flavus was isolated from an immunized alpaca nanobody library by phage display. The nanobody was verified to bind to the components of extracellular and intracellular antigen from both A. flavus and A. parasiticus. To construct a sandwich format immunoassay, polyclonal antibodies against Aspergillus were raised with rabbits. Finally, a highly selective nanobody-polyclonal antibody sandwich enzyme-linked immunosorbent assay was optimized and developed. The results revealed that the detection limits of the two fungi were as low as 1 μg mL -1 , and that it is able to detect fungal concentrations below to 2 μg mg -1 of peanut and maize grains in both artificially and naturally contaminated samples. Therefore, we here provided a rapid and simple method for monitoring Aspergillus spp. contamination in agricultural products.
International Nuclear Information System (INIS)
Ducreux, D.; Chevallier, P.; Raffaelli, C.; Padovani, B.; Perrin, C.; Jourdan, J.; Hofman, P.
2000-01-01
Pseudomembranous aspergillus bronchitis is considered as an early form of invasive pulmonary aspergillosis, a well-known airway infection in immunocompromised patients. Radiologic features concerning invasive aspergillosis of the airways have been reported. However, we describe here an unusual feature of invasive aspergillus bronchitis, never reported to date, observed in a double-lung transplanted patient. Chest radiograph and CT revealed significant peribronchial thickening without any parenchymal involvement. (orig.)
Chronic necrotising pneumonia caused by Aspergillus niger.
Wiggins, J; Clark, T J; Corrin, B
1989-01-01
A woman with asthma developed chronic necrotising semi-invasive pneumonia due to mixed Aspergillus niger and Candida albicans infection; though not severely immunosuppressed, she may have been predisposed by long term oral corticosteroid and recurrent oral antibiotic treatment. The diagnosis should be considered in patients with chronic airflow limitation who develop cavitating pneumonia. Images PMID:2763249
Biotransformation of Stypotriol triacetate by Aspergillus niger
Areche, Carlos; Vaca, Inmaculada; Labbe, Pamela; Soto-Delgado, Jorge; Astudillo, Luis; Silva, Mario; Rovirosa, Juana; San-Martin, Aurelio
2011-07-01
Biological transformation of the meroditerpenoid, stypotriol triacetate ( 1) by the fungi Aspergillus niger, Cunninghamella elegans, Gibberella fujikuroi and Mucor plumbeus was studied. The incubation of 1 with A. niger yielded the new compound 6',14-diacetoxy-stypol-4,5-dione ( 2) whose structure was established by 1H, 13C and 2D NMR and supported by DFT/GIAO.
Safety analysis report for the Neutron Multiplier Facility, 329 Building
International Nuclear Information System (INIS)
Rieck, H.G.
1978-09-01
Neutron multiplication is a process wherein the flux of a neutron source such as 252 Cf is enhanced by fission reactions that occur in a subcritical assemblage of fissile material. The multiplication factor of the device depends upon the consequences of neutron reactions with matter and is independent of the initial number of neutrons present. Safe utilization of such a device demands that the fissile material assemblage be maintained in a subcritical state throughout all normal and credibly abnormal conditions. Examples of things that can alter the multiplication factor (and degree of subcriticality) are temperature fluctuations, changes in moderator material such as voiding or composition, addition of fissile materials, and change in assembly configuration. The Neutron Multiplier Facility (NMF) utilizes a multiplier- 252 Cf assembly to produce neutrons for activation analysis of organic and inorganic environmental samples and for on-line mass spectrometry analysis of fission products which diffuse from a stationary fissile target (less than or equal to 4 g fissile material) located in the Neutron Multiplier. The NMF annex to the 329 Building provides close proximity to related counting equipment, and delay between sample irradiation and counting is minimized