
Sample records for aspergillus fumigatus antigens

  1. Aspergillus fumigatus Antigen Detection in Sera from Patients at Risk for Invasive Aspergillosis


    Chumpitazi, Bernabé F. F.; Pinel, Claudine; Lebeau, Bernadette; Ambroise-Thomas, Pierre; Grillot, Renee


    We have developed an inhibition enzyme immunoassay (inhibition-EIA) to monitor for the occurrence of invasive aspergillosis (IA) in sera from 45 immunocompromised (IC) patients. The test uses rabbit polyclonal antibodies and a mixture of components from Aspergillus fumigatus, containing three predominant antigens with molecular weights of 18,000, 33,000, and 56,000. Circulating antigens were found in five of seven proven cases of IA due to A. fumigatus. In two of the five positive cases, anti...

  2. Production and characterization of monoclonal antibodies to cell wall antigens of Aspergillus fumigatus.


    Ste-Marie, L; Sénéchal, S; Boushira, M; Garzon, S.; Strykowski, H; Pedneault, L; de Repentigny, L


    Two murine monoclonal antibodies (MAbs) against Aspergillus fumigatus were produced and characterized. Splenocytes from cell wall-immunized BALB/c mice were fused with SP2/0 myeloma cells. The hybridomas were screened with a cold alkali (CA) extract of mycelium containing protein, mannose, and galactose, and two MAbs of the immunoglobulin M class were purified from ascites fluid. MAbs 1 and 40 were characterized by double immunodiffusion against CA antigen, indirect enzyme immunoassay with ma...

  3. Metabolomics of Aspergillus fumigatus

    DEFF Research Database (Denmark)

    Frisvad, Jens Christian; Rank, Christian; Nielsen, Kristian Fog; Larsen, Thomas Ostenfeld


    Aspergillus fumigatus is the most important species in Aspergillus causing infective lung diseases. This species has been reported to produce a large number of extrolites, including secondary metabolites, acids, and proteins such as hydrophobins and extracellular enzymes. At least 226 potentially...

  4. Aspergillus fumigatus in Poultry

    Directory of Open Access Journals (Sweden)

    Pascal Arné


    Full Text Available Aspergillus fumigatus remains a major respiratory pathogen in birds. In poultry, infection by A. fumigatus may induce significant economic losses particularly in turkey production. A. fumigatus develops and sporulates easily in poor quality bedding or contaminated feedstuffs in indoor farm environments. Inadequate ventilation and dusty conditions increase the risk of bird exposure to aerosolized spores. Acute cases are seen in young animals following inhalation of spores, causing high morbidity and mortality. The chronic form affects older birds and looks more sporadic. The respiratory tract is the primary site of A. fumigatus development leading to severe respiratory distress and associated granulomatous airsacculitis and pneumonia. Treatments for infected poultry are nonexistent; therefore, prevention is the only way to protect poultry. Development of avian models of aspergillosis may improve our understanding of its pathogenesis, which remains poorly understood.

  5. A comparative study of antigens of Aspergillus fumigatus isolates from patients and soil of ornamental plants in the immunodiffusion test. (United States)

    Staib, F; Folkens, U; Tompak, B; Abel, T; Thiel, D


    The strikingly frequent and constant presence of Aspergillus fimigatus in the soil of potted ornamental plants kept in private houses and hospitals has been the reason for studying the antigens of the strains found from the diagnostic and epidemiological angles. Culture-filtrate antigens of A. fumigatus strains isolated from the soil of 4 different ornamental plants, epiphyllum (Epiphyllum truncatum), orange tree (Citrus sinensis), Alpine rose (Azalea indica) and Christmas flower (Euphorbia pulcherrima), were compared, in the immunodiffusion test, with antigens of A. fumigatus strains from aspergillosis patients prepared in an identical way. When tested against 8 different sera from different aspergillosis patients there was a good coincidence of results. Control sera from patients suffering from diseases other than aspergillosis, no false-positive reactions could be observed. The findings are discussed in respect of diagnosis and epidemiology. PMID:83753

  6. Biochemical and antigenic characterization of a new dipeptidyl-peptidase isolated from Aspergillus fumigatus. (United States)

    Beauvais, A; Monod, M; Debeaupuis, J P; Diaquin, M; Kobayashi, H; Latgé, J P


    A novel dipeptidyl-peptidase (DPP V) was purified from the culture medium of Aspergillus fumigatus. This is the first report of a secreted dipeptidyl-peptidase. The enzyme had a molecular mass of 88 kDa and contained approximately 9 kDa of N-linked carbohydrate. The expression and secretion of dipeptidyl-peptidase varied with the growth conditions; maximal intra- and extracellular levels were detected when the culture medium contained only proteins or protein hydrolysates in the absence of sugars. The gene of DPP V was cloned and showed significant sequence homology to other eukaryotic dipeptidyl-peptidase genes. Unlike the other dipeptidyl-peptidases, which are all intracellular, DPP V contained a signal peptide. Like the genes of other dipeptidyl-peptidases, that of DPP V displayed the consensus sequences of the catalytic site of the nonclassical serine proteases. The biochemical properties of native and recombinant DPP V obtained in Pichia pastoris were unique and were characterized by a substrate specificity limited to the hydrolysis of X-Ala, His-Ser, and Ser-Tyr dipeptides at a neutral pH optimum. In addition, we showed that DPP V is identical to one of the two major antigens used for the diagnosis of aspergillosis. PMID:9045640

  7. Development of monoclonal antibody-based galactomannoprotein antigen-capture ELISAs to detect Aspergillus fumigatus infection in the invasive aspergillosis rabbit models. (United States)

    Wang, Z-Y; Cai, J-P; Qiu, L-W; Hao, W; Pan, Y-X; Tung, E T K; Lau, C C Y; Woo, P C Y; Lau, S K P; Yuen, K-Y; Che, X-Y


    Aspergillus fumigatus is one of the most prominent opportunistic fungal pathogens in immunocompromised hosts. Early recognition of this infection along with prompt antifungal therapy may increase the survival rate. We expressed two potential bio-markers of A. fumigatus infection-galactomannoprotein Afmp1p and Afmp4p in Pichia pastoris. We generated 33 monoclonal antibodies (MAbs), 20 against recombinant Afmp1p (rAfmp1p) and the other 13 against recombinant Afmp4p (rAfmp4p). Subsequently, we developed two antigen-capture enzyme-linked immunosorbent assays (ELISAs) which employed MAbs as both the capture and the detection antibodies for rAfmp1p and rAfmp4p. The two antigen-capture ELISAs specifically detected Afmp1p/Afmp4p in cultures of A. fumigatus and had no cross-reaction with other tested pathogenic fungi, including Penicillium marneffei and other pathogenic Aspergillus species. The Afmp1p-captured ELISA would be positive even when the culture supernatant of A. fumigatus had been diluted to 128-fold of its original concentration. The two antigen ELISAs could capture circulating or excreted antigens during the acute phase of invasive aspergillosis (IA) in the animal model, and had no cross-reactivity to other Aspergillus-challenged animal models. We developed two antigen-capture ELISAs for the laboratory diagnosis of A. fumigatus infection. These two antigen-capture ELISAs may be useful in the clinical diagnosis of aspergillosis. PMID:22669560

  8. The Volatome of Aspergillus fumigatus


    Heddergott, C.; Calvo, A. M.; Latgé, J P


    Early detection of invasive aspergillosis is absolutely required for efficient therapy of this fungal infection. The identification of fungal volatiles in patient breath can be an alternative for the detection of Aspergillus fumigatus that still remains problematic. In this work, we investigated the production of volatile organic compounds (VOCs) by A. fumigatus in vitro, and we show that volatile production depends on the nutritional environment. A. fumigatus produces a multiplicity of VO...

  9. Putative virulence factors of Aspergillus fumigatus

    NARCIS (Netherlands)

    Tomee, JFC; Kauffman, HF


    Various putative virulence factors of Aspergillus fumigatus have been studied over the past decades. A. fumigatus gliotoxin is a potent inhibitor of the mucociliary system. Several fungal metabolites interfere with phagocytosis and opsonization including toxins, 'conidial inhibitory factor', 'A. fum

  10. Developmental regulators in Aspergillus fumigatus. (United States)

    Park, Hee-Soo; Yu, Jae-Hyuk


    The filamentous fungus Aspergillus fumigatus is the most prevalent airborne fungal pathogen causing severe and usually fatal invasive aspergillosis in immunocompromised patients. This fungus produces a large number of small hydrophobic asexual spores called conidia as the primary means of reproduction, cell survival, propagation, and infectivity. The initiation, progression, and completion of asexual development (conidiation) is controlled by various regulators that govern expression of thousands of genes associated with formation of the asexual developmental structure conidiophore, and biogenesis of conidia. In this review, we summarize key regulators that directly or indirectly govern conidiation in this important pathogenic fungus. Better understanding these developmental regulators may provide insights into the improvement in controlling both beneficial and detrimental aspects of various Aspergillus species. PMID:26920882

  11. Restriction endonuclease analysis of Aspergillus fumigatus DNA.


    Burnie, J P; Coke, A.; Matthews, R. C.


    AIMS: To develop a genome based DNA fingerprinting system for Aspergillus fumigatus mould. METHODS: DNA was extracted from 21 isolates obtained from eight patients with an aspergilloma. This was with a freeze-dried mycelial extract fragmented in liquid nitrogen. DNA was subsequently purified by phenol-chloroform extraction followed by ultracentrifugation on a caesium chloride gradient. The DNA was restricted by EcoRI and Xba I. RESULTS: All isolates were identical when cut by EcoRI; Xba I del...

  12. Degradation of melanin by Aspergillus fumigatus.


    Luther, J P; Lipke, H.


    A strain of Aspergillus fumigatus from composted coffee and garden wastes utilized natural deproteinized insect, banana, hair, octopus, and synthetic tyrosine and dopa melanins as sole sources of carbon. With a sucrose supplement, degradation was essentially complete after 50 days in Czapek medium pH 6.5 at 30 degrees C. The catabolic rate differed for each substrate pigment, as did the molecular weight distribution of products accumulating in the medium. After incubation with L-[U-14C]melani...

  13. Aspergillus fumigatus conidial melanin modulates host cytokine response

    NARCIS (Netherlands)

    L.Y.A. Chai (Louis); M.G. Netea (Mihai); J. Sugui (Janyce); A.G. Vonk (Alieke); W.W.J. van de Sande (Wendy); A. Warris (Adilia); K.J. Kwon-Chung (Kyung); B. Jan Kullberg (Bart)


    textabstractMelanin biopigments have been linked to fungal virulence. Aspergillus fumigatus conidia are melanised and are weakly immunogenic. We show that melanin pigments on the surface of resting Aspergillus fumigatus conidia may serve to mask pathogen-associated molecular patterns (PAMPs)-induced

  14. Aspergillus antigen skin test (image) (United States)

    The aspergillus antigen skin test determines whether or not a person has been exposed to the mold aspergillus. It is performed by injecting an aspergillus antigen under the skin with a needle. After 48 ...

  15. Eosinophil Deficiency Compromises Lung Defense against Aspergillus fumigatus


    Lilly, Lauren M.; Scopel, Michaella; Nelson, Michael P.; Burg, Ashley R.; Dunaway, Chad W; Steele, Chad


    Exposure to the mold Aspergillus fumigatus may result in allergic bronchopulmonary aspergillosis, chronic necrotizing pulmonary aspergillosis, or invasive aspergillosis (IA), depending on the host's immune status. Neutrophil deficiency is the predominant risk factor for the development of IA, the most life-threatening condition associated with A. fumigatus exposure. Here we demonstrate that in addition to neutrophils, eosinophils are an important contributor to the clearance of A. fumigatus f...

  16. Aspergillus fumigatus Conidial Melanin Modulates Host Cytokine Response


    Chai, Louis; Netea, Mihai; SUGUI, JANYCE; Vonk, Alieke; van de Sande, Wendy; Warris, Adilia; Kwon-Chung, Kyung; Jan Kullberg, Bart


    textabstractMelanin biopigments have been linked to fungal virulence. Aspergillus fumigatus conidia are melanised and are weakly immunogenic. We show that melanin pigments on the surface of resting Aspergillus fumigatus conidia may serve to mask pathogen-associated molecular patterns (PAMPs)-induced cytokine response. The albino conidia induced significantly more proinflammatory cytokines in human peripheral blood mononuclear cells (PBMC), as compared to melanised wild-type conidia. Blocking ...

  17. Chitin enhances serum IgE in Aspergillus fumigatus induced allergy in mice

    DEFF Research Database (Denmark)

    Dubey, Lalit Kumar; Moeller, Jesper Bonnet; Schlosser, Anders;


    Aspergillus fumigatus (A. fumigatus) is a ubiquitous fungus that activates, suppresses or modulates the immune response by changing its cell wall structure and by secreting proteases. In this study, we show that chitin acts as an adjuvant in a murine model of A. fumigatus protease induced allergy....... The mice were immunised intraperitoneally with A. fumigatus culture filtrate antigen either with or without chitin and were subsequently challenged with the culture filtrate antigen intranasally. Alum was used as an adjuvant control. Compared to alum, chitin induced a weaker inflammatory response in...... the lungs, measured as the total cell efflux in BAL, EPO and chitinase production. However, chitin enhanced the total IgE, specific IgE and specific IgG1 production as efficiently as alum. Pre-treatment with chitin but not with alum depressed the concentration of the Th2 cytokines IL-4 and IL-13 in...

  18. Calcineurin Controls Growth, Morphology, and Pathogenicity in Aspergillus fumigatus


    Steinbach, William J.; Cramer, Robert A; Perfect, B. Zachary; Asfaw, Yohannes G.; Sauer, Theodor C.; Najvar, Laura K.; Kirkpatrick, William R.; Thomas F. Patterson; Benjamin, Daniel K., Jr.; Heitman, Joseph; Perfect, John R.


    Calcineurin is implicated in a myriad of human diseases as well as homeostasis and virulence in several major human pathogenic microorganisms. The fungus Aspergillus fumigatus is a leading cause of infectious death in the rapidly expanding immunocompromised patient population. Current antifungal treatments for invasive aspergillosis are often ineffective, and novel therapeutic approaches are urgently needed. We demonstrate that a mutant of A. fumigatus lacking the calcineurin A (cnaA) catalyt...

  19. Modelling Aspergillus fumigatus infections in racing pigeons (Columba livia domestica)


    Beernaert, Lies Angèle; Pasmans, Frank; Haesebrouck, Freddy; Martel, An


    Abstract In vivo modelling of aspergillosis in birds allows the evaluation of control measures and the study of host-pathogen interactions. In this study the impact of the use of different inoculation routes and immunosuppression on the course of an infection with Aspergillus fumigatus in racing pigeons (Columba livia domestica) was examined. A. fumigatus conidia were inoculated in the thoracic air sac, lung or trachea in immunocompetent or immunosuppressed pigeon squabs. Immunosup...

  20. Aspergillus fumigatus-Related Species in Clinical Practice (United States)

    Lamoth, Frédéric


    Aspergillus fumigatus is the main etiologic agent of invasive aspergillosis (IA). Other Aspergillus species belonging to the section Fumigati (A. fumigatus complex) may occasionally be the cause of IA. These strains are often misidentified, as they cannot be distinguished from A. fumigatus by conventional morphological analysis and sequencing methods. This lack of recognition may have important consequences as these A. fumigatus-related species often display some level of intrinsic resistance to azoles and other antifungal drugs. A. lentulus, A. udagawae, A. viridinutans, and A. thermomutatus (Neosartorya pseudofischeri) have been associated with refractory cases of IA. Microbiologists should be able to suspect the presence of these cryptic species behind a putative A. fumigatus isolate on the basis of some simple characteristics, such as defect in sporulation and/or unusual antifungal susceptibility profile. However, definitive species identification requires specific sequencing analyses of the beta-tubulin or calmodulin genes, which are not available in most laboratories. Multiplex PCR assays or matrix-assisted laser desorption ionization – time-of-flight mass spectrometry (MALDI-TOF MS) gave promising results for rapid and accurate distinction between A. fumigatus and other Aspergillus spp. of the section Fumigati in clinical practice. Improved diagnostic procedures and antifungal susceptibility testing may be helpful for the early detection and management of these particular IA cases.

  1. Update on antifungal drug resistance mechanisms of Aspergillus fumigatus. (United States)

    Chamilos, G; Kontoyiannis, D P


    Although the arsenal of agents with anti-Aspergillus activity has expanded over the last decade, mortality due to invasive aspergillosis (IA) remains unacceptably high. Aspergillus fumigatus still accounts for the majority of cases of IA; however less susceptible to antifungals non-fumigatus aspergilli began to emerge. Antifungal drug resistance of Aspergillus might partially account for treatment failures. Recent advances in our understanding of mechanisms of antifungal drug action in Aspergillus, along with the standardization of in vitro susceptibility testing methods, has brought resistance testing to the forefront of clinical mycology. In addition, molecular biology has started to shed light on the mechanisms of resistance of A. fumigatus to azoles and the echinocandins, while genome-based assays show promise for high-throughput screening for genotypic antifungal resistance. Several problems remain, however, in the study of this complex area. Large multicenter clinical studies--point prevalence or longitudinal--to capture the incidence and prevalence of antifungal resistance in A. fumigatus isolates are lacking. Correlation of in vitro susceptibility with clinical outcome and susceptibility breakpoints has not been established. In addition, the issue of cross-resistance between the newer triazoles is of concern. Furthermore, in vitro resistance testing for polyenes and echinocandins is difficult, and their mechanisms of resistance are largely unknown. This review examines challenges in the diagnosis, epidemiology, and mechanisms of antifungal drug resistance in A. fumigatus. PMID:16488654

  2. Effect of serum components on biofilm formation by Aspergillus fumigatus and other Aspergillus species. (United States)

    Wuren, Tuya; Toyotome, Takahito; Yamaguchi, Masashi; Takahashi-Nakaguchi, Azusa; Muraosa, Yasunori; Yahiro, Maki; Wang, Dan-Ni; Watanabe, Akira; Taguchi, Hideaki; Kamei, Katsuhiko


    Biofilm production by microorganisms is critical for their pathogenicity. Serum promotes biofilm production by Aspergillus fumigatus; however, its effects on other Aspergillus spp. have not been reported. We analyzed biofilm formation by five Aspergillus spp., i.e., A. fumigatus, A. flavus, A. nidulans, A. niger, and A. terreus, and examined the effects of serum/serum proteins such as fetal bovine serum (FBS), fetuin A, and bovine serum albumin (BSA) on hyphal growth, hyphal branching, and extracellular matrix (ECM) formation. The antifungal susceptibility of A. fumigatus isolates that formed biofilms was also examined. All serum/serum proteins promoted the growth of all these fungal species; growth promotion was most evident with FBS, followed by fetuin A and BSA. This effect was most evident in case of A. fumigatus and least evident in case of A. terreus. Electron microscopy showed thick ECM layers surrounding fungal cell walls after culture with FBS, particularly in A. fumigatus. An increase in hyphal branching caused by fetuin A was the highest in case of A. fumigatus and A. nidulans. Biofilm-forming A. fumigatus showed resistance to most antifungal agents, although a synergism of micafungin and amphotericin B was suggested. Our results indicate that serum promotes biofilm formation, including thick ECM, by many Aspergillus spp., particularly A. fumigatus, and that this may be closely related to its virulence. PMID:24858605

  3. Regulation of Development in Aspergillus nidulans and Aspergillus fumigatus


    Yu, Jae-Hyuk


    Members of the genus Aspergillus are the most common fungi and all reproduce asexually by forming long chains of conidiospores (or conidia). The impact of various Aspergillus species on humans ranges from beneficial to harmful. For example, several species including Aspergillus oryzae and Aspergillus niger are used in industry for enzyme production and food processing. In contrast, Aspergillus flavus produce the most potent naturally present carcinogen aflatoxins, which contaminate various pl...

  4. Voriconazole for the treatment of refractory Aspergillus fumigatus keratitis


    Mehta, Hijab; Mehta, Hitendra B; Garg, Prashant; Kodial, Harish


    We report a case of Aspergillus fumigatus keratitis in a 53-year-old, well-controlled diabetic female who did not respond to standard antifungal treatment. She was started on topical natamycin eye drops, but the infiltrate continued to progress. Topical amphotericin B and systemic ketoconazole was added, however, there was no response and the infiltrate increased further. She was then switched to topical and systemic voriconazole. Steady resolution of the infiltrate was noted within 2 weeks o...

  5. Voriconazole for the treatment of refractory Aspergillus fumigatus keratitis

    Directory of Open Access Journals (Sweden)

    Mehta Hijab


    Full Text Available We report a case of Aspergillus fumigatus keratitis in a 53-year-old, well-controlled diabetic female who did not respond to standard antifungal treatment. She was started on topical natamycin eye drops, but the infiltrate continued to progress. Topical amphotericin B and systemic ketoconazole was added, however, there was no response and the infiltrate increased further. She was then switched to topical and systemic voriconazole. Steady resolution of the infiltrate was noted within 2 weeks of therapy.

  6. Diketopiperazines produced by an Aspergillus fumigatus Brazilian strain

    International Nuclear Information System (INIS)

    Seven diketopiperazines, corresponding to the cycles (L)-Pro-(L)-Phe, (L)-Pro-Gly, (L)-Pro- (L)-Pro, (L)-Pro-(L)-Val, (L)-4-OH-Pro-(L)-Leu, (L)-4-OH-Pro-(L)-Phe, and (L)-Pro-(L)-Leu, were isolated from the Aspergillus fumigatus fermentation broth. The relative and absolute stereochemistries were determined on the basis of NOESY experiments and by using a modified version of Marfey's method using HPLC, respectively. (author)

  7. Diketopiperazines produced by an Aspergillus fumigatus Brazilian strain

    Energy Technology Data Exchange (ETDEWEB)

    Furtado, Niege A.J.C; Pupo, Monica T.; Carvalho, Ivone; Campo, Vanessa L. Campo; Bastos, Jairo K. [Sao Paulo Univ., Ribeirao Preto, SP (Brazil). Faculdade de Ciencias Farmaceuticas]. E-mail:; Duarte, Marta Cristina T. [Universidade Estadual de Campinas, SP (Brazil). Centro Pluridisciplinar de Pesquisas Quimicas, Biologicas e Agricolas


    Seven diketopiperazines, corresponding to the cycles (L)-Pro-(L)-Phe, (L)-Pro-Gly, (L)-Pro- (L)-Pro, (L)-Pro-(L)-Val, (L)-4-OH-Pro-(L)-Leu, (L)-4-OH-Pro-(L)-Phe, and (L)-Pro-(L)-Leu, were isolated from the Aspergillus fumigatus fermentation broth. The relative and absolute stereochemistries were determined on the basis of NOESY experiments and by using a modified version of Marfey's method using HPLC, respectively. (author)

  8. A rare pigmented keratitis caused by Aspergillus fumigatus

    Institute of Scientific and Technical Information of China (English)

    Mauricio; Vélez; Kepa; Balparda; Ana; María; Díaz


    <正>Dear Sir,I am Mauricio Vélez,from the Department of Ophthalmology,Cornea Service Director,Universidad Pontificia Bolivariana in Medellín,Colombia.Below,I would like to share an interesting case I managed recently,which I’ve entitled"A rare pigmented keratitis caused by Aspergillus fumigatus".Fungi are a relatively uncommon cause of microbial keratitis

  9. Inhaled corticosteroids and Aspergillus fumigatus isolation in cystic fibrosis. (United States)

    Noni, Maria; Katelari, Anna; Dimopoulos, George; Kourlaba, Georgia; Spoulou, Vana; Alexandrou-Athanassoulis, Helen; Doudounakis, Stavros-Eleftherios; Tzoumaka-Bakoula, Chryssa


    Aspergillus fumigatus isolation in cultures from respiratory specimens of patients with cystic fibrosis (CF) is quite common; however, the role of A. fumigatus as a pathogen and whether its presence is associated with progression of pulmonary disease remain unclear. We investigated the association between inhaled corticosteroids and the recovery of A. fumigatus by performing a retrospective cohort study of CF patients born between 1988 and 1996. The patients' medical records from their first visit to the CF Center until December 2010 were reviewed. Outcomes were the occurrence of A. fumigatus first isolation, chronic colonization, or the last visit at the CF Center. A number of possible confounders were included in the multivariate logistic regression analysis in order to identify an independent association between inhaled corticosteroids and colonization status. A total of 121 patients were included in the study. Thirty-nine patients (32.2%) had at least one positive culture and 14 (11.6%) developed chronic colonization. Multivariate logistic regression analysis was used to determine the independent effect of inhaled corticosteroids on the odds of first isolation (odds ratio [OR], 1.165; 95% confidence interval [CI], 1.015-1.337; P = 0.029) and chronic colonization (OR, 1.180; 95% CI, 1.029-1.353; P = 0.018). In conclusion, A. fumigatus first isolation and chronic colonization are associated with the duration of inhaled corticosteroid treatment. PMID:25056962

  10. Essential gene identification and drug target prioritization in Aspergillus fumigatus. (United States)

    Hu, Wenqi; Sillaots, Susan; Lemieux, Sebastien; Davison, John; Kauffman, Sarah; Breton, Anouk; Linteau, Annie; Xin, Chunlin; Bowman, Joel; Becker, Jeff; Jiang, Bo; Roemer, Terry


    Aspergillus fumigatus is the most prevalent airborne filamentous fungal pathogen in humans, causing severe and often fatal invasive infections in immunocompromised patients. Currently available antifungal drugs to treat invasive aspergillosis have limited modes of action, and few are safe and effective. To identify and prioritize antifungal drug targets, we have developed a conditional promoter replacement (CPR) strategy using the nitrogen-regulated A. fumigatus NiiA promoter (pNiiA). The gene essentiality for 35 A. fumigatus genes was directly demonstrated by this pNiiA-CPR strategy from a set of 54 genes representing broad biological functions whose orthologs are confirmed to be essential for growth in Candida albicans and Saccharomyces cerevisiae. Extending this approach, we show that the ERG11 gene family (ERG11A and ERG11B) is essential in A. fumigatus despite neither member being essential individually. In addition, we demonstrate the pNiiA-CPR strategy is suitable for in vivo phenotypic analyses, as a number of conditional mutants, including an ERG11 double mutant (erg11BDelta, pNiiA-ERG11A), failed to establish a terminal infection in an immunocompromised mouse model of systemic aspergillosis. Collectively, the pNiiA-CPR strategy enables a rapid and reliable means to directly identify, phenotypically characterize, and facilitate target-based whole cell assays to screen A. fumigatus essential genes for cognate antifungal inhibitors. PMID:17352532

  11. Bola fúngica por Aspergillus fumigatus em cavidade pleural Aspergillus fumigatus fungus ball in the pleural cavity


    Luciana Silva Guazzelli; Cecília Bittencourt Severo; Leonardo Santos Hoff; Geison Leonardo Fernandes Pinto; José Jesus Camargo; Luiz Carlos Severo


    OBJETIVO: Relatar os casos de 6 pacientes com bola fúngica (BF) na cavidade pleural por Aspergillus fumigatus. MÉTODOS: Entre 1980 e 2009, foram diagnosticados 391 pacientes com BF aspergilar no Complexo Hospitalar Santa Casa de Porto Alegre (RS). O diagnóstico de BF na cavidade pleural foi definido com exames de imagem demonstrando derrame e espessamento pleural com nível líquido; exame micológico direto demonstrando hifas septadas, consistentes com Aspergillus sp.; e cultura positiva para A...

  12. Impact of Aspergillus fumigatus in allergic airway diseases

    Directory of Open Access Journals (Sweden)

    Chaudhary Neelkamal


    Full Text Available Abstract For decades, fungi have been recognized as associated with asthma and other reactive airway diseases. In contrast to type I-mediated allergies caused by pollen, fungi cause a large number of allergic diseases such as allergic bronchopulmonary mycoses, rhinitis, allergic sinusitis and hypersensitivity pneumonitis. Amongst the fungi, Aspergillus fumigatus is the most prevalent cause of severe pulmonary allergic disease, including allergic bronchopulmonary aspergillosis (ABPA, known to be associated with chronic lung injury and deterioration in pulmonary function in people with chronic asthma and cystic fibrosis (CF. The goal of this review is to discuss new understandings of host-pathogen interactions in the genesis of allergic airway diseases caused by A. fumigatus. Host and pathogen related factors that participate in triggering the inflammatory cycle leading to pulmonary exacerbations in ABPA are discussed.

  13. Age influence on mice lung tissue response to [i]Aspergillus fumigatus[/i] chronic exposure

    Directory of Open Access Journals (Sweden)

    Marta Kinga Lemieszek


    Full Text Available [b]Introduction and objective[/b]. Exposure to conidia of [i]Aspergillus fumigatus[/i] was described as a causative factor of a number of the respiratory system diseases, including asthma, chronic eosinophilic pneumonia, hypersensitivity pneumonitis and bronchopulmonary aspergillosis. The study investigates the effects of the repeated exposure to [i]A. fumigatus[/i] in mice pulmonary compartment. Our work tackles two, so far insufficiently addressed, important aspects of interaction between affected organism and[i] A. fumigatus[/i]: 1 recurrent character of exposure (characteristic for pathomechanism of the abovementioned disease states and 2 impact of aging, potentially important for the differentiation response to an antigen. [b]Materials and methods[/b]. In order to dissect alterations of the immune system involved with both aging and chronic exposure to [i]A. fumigatus[/i], we used 3- and 18-month-old C57BL/6J mice exposed to repeated[i] A. fumigatus[/i] inhalations for 7 and 28 days. Changes in lung tissue were monitored by histological and biochemical evaluation. Concentration of pro- and anti-inflammatory cytokines in lung homogenates was assessed by ELISA tests. [b]Results and conclusions. [/b]Our study demonstrated that chronic inflammation in pulmonary compartment, characterized by the significant increase of proinflammatory cytokines (IL1, IL6, IL10 levels, was the dominant feature of mice response to repeated [i]A. fumigatus[/i] inhalations. The pattern of cytokines’ profile in the course of exposure was similar in both age groups, however in old mice the growth of the cytokines’ levels was more pronounced (especially in case of IL1.

  14. Metabolism of p-Cresol by the Fungus Aspergillus fumigatus


    Jones, Kerina H.; Trudgill, Peter W.; Hopper, David J.


    The fungus Aspergillus fumigatus ATCC 28282 was shown to grow on p-cresol as its sole source of carbon and energy. A pathway for metabolism of this compound was proposed. This has protocatechuate as the ring-fission substrate with cleavage and metabolism by an ortho-fission pathway. The protocatechuate was formed by two alternative routes, either by initial attack on the methyl group, which is oxidized to carboxyl, followed by ring-hydroxylation, or by ring-hydroxylation as the first step wit...

  15. Identification of a putative Crf splice variant and generation of recombinant antibodies for the specific detection of Aspergillus fumigatus.

    Directory of Open Access Journals (Sweden)

    Mark Schütte

    Full Text Available BACKGROUND: Aspergillus fumigatus is a common airborne fungal pathogen for humans. It frequently causes an invasive aspergillosis (IA in immunocompromised patients with poor prognosis. Potent antifungal drugs are very expensive and cause serious adverse effects. Their correct application requires an early and specific diagnosis of IA, which is still not properly achievable. This work aims to a specific detection of A. fumigatus by immunofluorescence and the generation of recombinant antibodies for the detection of A. fumigatus by ELISA. RESULTS: The A. fumigatus antigen Crf2 was isolated from a human patient with proven IA. It is a novel variant of a group of surface proteins (Crf1, Asp f9, Asp f16 which belong to the glycosylhydrolase family. Single chain fragment variables (scFvs were obtained by phage display from a human naive antibody gene library and an immune antibody gene library generated from a macaque immunized with recombinant Crf2. Two different selection strategies were performed and shown to influence the selection of scFvs recognizing the Crf2 antigen in its native conformation. Using these antibodies, Crf2 was localized in growing hyphae of A. fumigatus but not in spores. In addition, the antibodies allowed differentiation between A. fumigatus and related Aspergillus species or Candida albicans by immunofluorescence microscopy. The scFv antibody clones were further characterized for their affinity, the nature of their epitope, their serum stability and their detection limit of Crf2 in human serum. CONCLUSION: Crf2 and the corresponding recombinant antibodies offer a novel approach for the early diagnostics of IA caused by A. fumigatus.

  16. Integrative analysis of the heat shock response in Aspergillus fumigatus

    Directory of Open Access Journals (Sweden)

    Brakhage Axel A


    Full Text Available Abstract Background Aspergillus fumigatus is a thermotolerant human-pathogenic mold and the most common cause of invasive aspergillosis (IA in immunocompromised patients. Its predominance is based on several factors most of which are still unknown. The thermotolerance of A. fumigatus is one of the traits which have been assigned to pathogenicity. It allows the fungus to grow at temperatures up to and above that of a fevered human host. To elucidate the mechanisms of heat resistance, we analyzed the change of the A. fumigatus proteome during a temperature shift from 30°C to 48°C by 2D-fluorescence difference gel electrophoresis (DIGE. To improve 2D gel image analysis results, protein spot quantitation was optimized by missing value imputation and normalization. Differentially regulated proteins were compared to previously published transcriptome data of A. fumigatus. The study was augmented by bioinformatical analysis of transcription factor binding sites (TFBSs in the promoter region of genes whose corresponding proteins were differentially regulated upon heat shock. Results 91 differentially regulated protein spots, representing 64 different proteins, were identified by mass spectrometry (MS. They showed a continuous up-, down- or an oscillating regulation. Many of the identified proteins were involved in protein folding (chaperones, oxidative stress response, signal transduction, transcription, translation, carbohydrate and nitrogen metabolism. A correlation between alteration of transcript levels and corresponding proteins was detected for half of the differentially regulated proteins. Interestingly, some previously undescribed putative targets for the heat shock regulator Hsf1 were identified. This provides evidence for Hsf1-dependent regulation of mannitol biosynthesis, translation, cytoskeletal dynamics and cell division in A. fumigatus. Furthermore, computational analysis of promoters revealed putative binding sites for an AP-2alpha

  17. Characterization of the FKBP12-Encoding Genes in Aspergillus fumigatus.

    Directory of Open Access Journals (Sweden)

    Katie Falloon

    Full Text Available Invasive aspergillosis, largely caused by Aspergillus fumigatus, is responsible for a growing number of deaths among immunosuppressed patients. Immunosuppressants such as FK506 (tacrolimus that target calcineurin have shown promise for antifungal drug development. FK506-binding proteins (FKBPs form a complex with calcineurin in the presence of FK506 (FKBP12-FK506 and inhibit calcineurin activity. Research on FKBPs in fungi is limited, and none of the FKBPs have been previously characterized in A. fumigatus. We identified four orthologous genes of FKBP12, the human FK506 binding partner, in A. fumigatus and designated them fkbp12-1, fkbp12-2, fkbp12-3, and fkbp12-4. Deletional analysis of the four genes revealed that the Δfkbp12-1 strain was resistant to FK506, indicating FKBP12-1 as the key mediator of FK506-binding to calcineurin. The endogenously expressed FKBP12-1-EGFP fusion protein localized to the cytoplasm and nuclei under normal growth conditions but also to the hyphal septa following FK506 treatment, revealing its interaction with calcineurin. The FKBP12-1-EGFP fusion protein didn't localize at the septa in the presence of FK506 in the cnaA deletion background, confirming its interaction with calcineurin. Testing of all deletion strains in the Galleria mellonella model of aspergillosis suggested that these proteins don't play an important role in virulence. While the Δfkbp12-2 and Δfkbp12-3 strains didn't show any discernable phenotype, the Δfkbp12-4 strain displayed slight growth defect under normal growth conditions and inhibition of the caspofungin-mediated "paradoxical growth effect" at higher concentrations of the antifungal caspofungin. Together, these results indicate that while only FKBP12-1 is the bona fide binding partner of FK506, leading to the inhibition of calcineurin in A. fumigatus, FKBP12-4 may play a role in basal growth and the caspofungin-mediated paradoxical growth response. Exploitation of differences between A

  18. Genetic and structural validation of Aspergillus fumigatus N-acetylphosphoglucosamine mutase as an antifungal target


    Fang, Wenxia; Du, Ting; Raimi, Olawale G.; Hurtado-Guerrero, Ramón; Mariño, Karina; Ibrahim, Adel F. M.; Albarbarawi, Osama; Ferguson, Michael A. J.; Jin, Cheng; Van Aalten, Daan M. F.


    Aspergillus fumigatus is the causative agent of IA (invasive aspergillosis) in immunocompromised patients. It possesses a cell wall composed of chitin, glucan and galactomannan, polymeric carbohydrates synthesized by processive glycosyltransferases from intracellular sugar nucleotide donors. Here we demonstrate that A. fumigatus possesses an active AfAGM1 (A. fumigatus N-acetylphosphoglucosamine mutase), a key enzyme in the biosynthesis of UDP (uridine diphosphate)–GlcNAc (N-acetylglucosamine...

  19. The Allergenicity of Aspergillus fumigatus conidia is influenced by growth temperature


    Low, Swee Yang; Dannemiller, Karen; Yao, Maosheng; Yamamoto, Naomichi; Peccia, Jordan


    Common indoor and outdoor environmental fungi such as Aspergillus fumigatus produce asexual spores containing a collection of proteins that can bind IgE antibodies and trigger allergic reactions. We characterized the impact of sporulation temperature on the IgE-binding capacity (allergenicity) of A. fumigatus and explored the links between variable allergenicity and temperature-dependant expression of genes encoding these allergenic proteins. A 12-fold increase in A. fumigatus allergenicity p...

  20. Disruption of the Phospholipase D Gene Attenuates the Virulence of Aspergillus fumigatus

    NARCIS (Netherlands)

    Li, Xianping; Gao, Meihua; Han, Xuelin; Tao, Sha; Zheng, Dongyu; Cheng, Ying; Yu, Rentao; Han, Gaige; Schmidt, Martina; Han, Li


    Aspergillus fumigatus is the most prevalent airborne fungal pathogen that induces serious infections in immunocompromised patients. Phospholipases are key enzymes in pathogenic fungi that cleave host phospholipids, resulting in membrane destabilization and host cell penetration. However, knowledge o

  1. Susceptibility testing of sequential isolates of Aspergillus fumigatus recovered from treated patients.

    NARCIS (Netherlands)

    Danaoui, E.; Meletiadis, J.; Tortorano, A.M.; Symoens, F.; Nolard, N.; Viviani, M.A.; Piens, M.A.; Lebeau, B.; Verweij, P.E.; Grillot, R.


    Two-hundred sequential Aspergillus fumigatus isolates recovered from 26 immunocompromised patients with invasive aspergillosis or bronchial colonization were tested for their in vitro susceptibility to posaconazole, itraconazole, voriconazole, terbinafine and amphotericin B. Twenty-one patients were

  2. Applicability of random primer R143 for determination of Aspergillus fumigatus DNA

    NARCIS (Netherlands)

    Erjavec, Z; Brinker, M; Apperloo-Renkema, HZ; Arends, Jan P; De Vries-Hospers, HG; Ruiters, MHJ


    The specificity of random primer R143 for Aspergillus fumigatus DNA was determined in order to test its usefulness in establishing the presence of A. fumigatus DNA in fungal cultures. When PCR reaction products of these cultures were compared with those of 21 other bacterial and fungal DNA samples,

  3. Exploring azole antifungal drug resistance in Aspergillus fumigatus with special reference to resistance mechanisms

    NARCIS (Netherlands)

    Chowdhary, A.; Sharma, C.; Hagen, F.; Meis, J.F.G.M.


    Aspergillus fumigatus, a ubiquitously distributed opportunistic pathogen, is the global leading cause of aspergillosis. Azole antifungals play an important role in the management of aspergillosis. However, over a decade, azole resistance in A. fumigatus isolates has been increasingly reported with v

  4. Biosorption of uranium (VI) by immobilized Aspergillus fumigatus beads

    International Nuclear Information System (INIS)

    Biosorption of uranium (VI) ions by immobilized Aspergillus fumigatus beads was investigated in a batch system. The influences of solution pH, biosorbent dose, U (VI) concentration, and contact time on U (VI) biosorption were studied. The results indicated that the adsorption capacity was strongly affected by the solution pH, the biosorbent dose and initial U (VI) concentration. Optimum biosorption was observed at pH 5.0, biosrobent dose (w/v) 2.5%, initial U (VI) concentration 60 mg L-1. Biosorption equilibrium was established in 120 min. The adsorption process conformed to the Freunlich and Temkin isothermal adsorption models. The dynamic adsorption model conformed to pseudo-second order model.

  5. In Vitro Biochemical Study of CYP51-Mediated Azole Resistance in Aspergillus fumigatus


    Warrilow, Andrew G. S.; Parker, Josie E.; Price, Claire L.; Nes, W. David; Kelly, Steven L.; Kelly, Diane E.


    The incidence of triazole-resistant Aspergillus infections is increasing worldwide, often mediated through mutations in the CYP51A amino acid sequence. New classes of azole-based drugs are required to combat the increasing resistance to existing triazole therapeutics. In this study, a CYP51 reconstitution assay is described consisting of eburicol, purified recombinant Aspergillus fumigatus CPR1 (AfCPR1), and Escherichia coli membrane suspensions containing recombinant A. fumigatus CYP51 prote...

  6. Thorium biosorption by Aspergillus fumigatus, a filamentous fungal biomass

    International Nuclear Information System (INIS)

    Thorium biosorption by Aspergillus fumigatus was carried out in a batch reactor to study the effect of initial pH and metal ion concentration, contact time, biomass dose and kinetics and equilibrium Th uptake. Thorium(IV) uptake by A. fumigatus was pH dependent (pH range, 2.0-6.0) and maximum sorption was observed at pH 4.0. The uptake was rapid and the biosorption process reached equilibrium within 2 h of contact times at pH 2-4 and initial Th concentration of 50 and 100 mg/L. The kinetics data fitted well to Lagergren's pseudo-second-order rate equation (r2 > 0.99). A maximum initial sorption rate of 71.94 (mg/g min) and second-order rate constant of 7.82 x 10-2 (g/mg min) were observed at pH 4.0, 50 mg Th/L. The observed maximum uptake of thorium was 370 mg Th/g at equilibrium. Biosorption process could be well described by Langmuir isotherm in comparison to Freundlich and Temkin isotherms. Sodium bicarbonate was the most efficient desorbing reagent with desorption efficiency of more than 99%. Environmental scanning electron micrograph (ESEM) showed that the surface of the biomass after desorption was intact.

  7. Thorium biosorption by Aspergillus fumigatus, a filamentous fungal biomass. (United States)

    Bhainsa, Kuber C; D'Souza, Stanislaus F


    Thorium biosorption by Aspergillus fumigatus was carried out in a batch reactor to study the effect of initial pH and metal ion concentration, contact time, biomass dose and kinetics and equilibrium Th uptake. Thorium(IV) uptake by A. fumigatus was pH dependent (pH range, 2.0-6.0) and maximum sorption was observed at pH 4.0. The uptake was rapid and the biosorption process reached equilibrium within 2h of contact times at pH 2-4 and initial Th concentration of 50 and 100mg/L. The kinetics data fitted well to Lagergren's pseudo-second-order rate equation (r(2)>0.99). A maximum initial sorption rate of 71.94 (mg/g min) and second-order rate constant of 7.82 x 10(-2) (g/mg min) were observed at pH 4.0, 50 mg Th/L. The observed maximum uptake of thorium was 370 mg Th/g at equilibrium. Biosorption process could be well described by Langmuir isotherm in comparison to Freundlich and Temkin isotherms. Sodium bicarbonate was the most efficient desorbing reagent with desorption efficiency of more than 99%. Environmental scanning electron micrograph (ESEM) showed that the surface of the biomass after desorption was intact. PMID:19036508

  8. Genetic control of asexual development in aspergillus fumigatus. (United States)

    Alkhayyat, Fahad; Chang Kim, Sun; Yu, Jae-Hyuk


    Aspergillus fumigatus is one of the most common fungi found in the environment. It is an opportunistic human pathogen causing invasive pulmonary aspergillosis with a high mortality rate in immunocompromised patients. Conidia, the asexual spores, serve as the main dispersal and infection agent allowing entrance of the fungus into the host through the respiratory tract. Therefore, understanding the asexual developmental process that gives rise to the conidia is of great interest to the scientific community and is currently the focus of an immense load of research being conducted. We have been studying the genetic basis that controls asexual development and gliotoxin biosynthesis in A. fumigatus. In this review, we discuss the genetic regulatory system that dictates conidiation in this important fungus by covering the roles of crucial genetic factors from the upstream heterotrimeric G-protein signaling components to the more specific downstream central activators of the conidiation pathway. In addition, other key asexual regulators including the velvet regulators, the Flb proteins and their associated regulatory factors are discussed. PMID:25596030

  9. Bioconversion of tea polyphenols to bioactive theabrownins by Aspergillus fumigatus. (United States)

    Wang, Qiuping; Gong, Jiashun; Chisti, Yusuf; Sirisansaneeyakul, Sarote


    Theabrownins (TB) are water-soluble phenolic compounds associated with the various health benefits of Pu-erh tea, a post-fermented Chinese dark tea. This work reports on the production of theabrownins from infusions of sun-dried green tea leaves using a pure culture of Aspergillus fumigatus isolated from a solid-state Pu-erh tea fermentation. A theabrownins yield of 158 g kg(-1) sun-dried green tea leaves was obtained in 6 days at 45 °C in an aerobic fermentation. In a 2 l fermenter, the yield of theabrownins was 151 g kg(-1) sun-dried green tea leaves in 48 h of aerobic culture (45 °C, 1 vvm aeration rate, 250 rpm agitation speed). Extracellular polyphenol oxidase and peroxidase of A. fumigatus contributed to this bioconversion. Repeated batch fermentation process was used for producing theabrownins but was less productive than the batch process. PMID:25214210

  10. Allergens/Antigens, Toxins and Polyketides of Important Aspergillus Species


    Bhetariya, Preetida J.; Madan, Taruna; Basir, Seemi Farhat; Varma, Anupam; Usha, Sarma P.


    The medical, agricultural and biotechnological importance of the primitive eukaryotic microorganisms, the Fungi was recognized way back in 1920. Among various groups of fungi, the Aspergillus species are studied in great detail using advances in genomics and proteomics to unravel biological and molecular mechanisms in these fungi. Aspergillus fumigatus, Aspergillus flavus, Aspergillus niger, Aspergillus parasiticus, Aspergillus nidulans and Aspergillus terreus are some of the important specie...

  11. Characterization of the Aspergillus fumigatus chitosanase CsnB and evaluation of its potential use in serological diagnostics. (United States)

    Beck, Julia; Broniszewska, Marzena; Schwienbacher, Monika; Ebel, Frank


    Aspergillus fumigatus is currently the major air-borne fungal pathogen as its asexual spores are distributed through the air. In severely immunocompromised patients, inhalation of these conidia can result in life-threatening infections. Invasive Aspergillosis, a major Aspergillus-associated disease, is associated with a high mortality reflecting short-comings in diagnostics and therapy. Current diagnostics largely rely on the serological detection of the galactomannan antigen. Detection of circulating antibodies is an alternative approach. In this study, we have characterized the chitosanase CsnB, a protein that was previously shown to be a major secreted A. fumigatus antigen and therefore a potential target for antibody-based diagnostics. To analyze the biological function of CsnB we have deleted the csnB gene and generated CsnB-specific antibodies. We found that A. fumigatus is able to grow on chitosan in a CsnB-dependent manner. During growth on chitosan elevated levels of CsnB are found in the supernatants indicating that chitosan triggers enhanced CsnB production. Unexpectedly we have found a similar activity for tartrate. Using recombinant proteins we analyzed antibody responses in patients at risk to develop invasive aspergillosis. We focussed this study on two antigens: CsnB and for comparison mitogillin, a secreted A. fumigatus ribotoxin. IgG responses were found to both proteins, but elevated antibody levels to CsnB and/or mitogillin showed no correlation to the results of the galactomannan antigen assay or clinical signs that are characteristic for fungal infections. PMID:24880790

  12. Critical stages of extracting DNA from Aspergillus fumigatus in whole-blood specimens.

    NARCIS (Netherlands)

    White, P.L.; Perry, M.D.; Loeffler, J.; Melchers, W.J.G.; Klingspor, L.; Bretagne, S.; McCulloch, E.; Cuenca-Estrella, M.; Finnstrom, N.; Donnelly, J.P.; Barnes, R.A.


    A standardized protocol for extracting DNA from Aspergillus fumigatus has been proposed by the European Aspergillus PCR Initiative (EAPCRI). Using meta-regression analysis, the EAPCRI showed certain stages of the process to be critical to providing a satisfactory analytical sensitivity. The study in

  13. Triazole Fungicides Can Induce Cross-Resistance to Medical Triazoles in Aspergillus fumigatus

    NARCIS (Netherlands)

    Snelders, E.; Camps, S.M.T.; Karawajczyk, A.; Schaftenaar, G.; Kema, G.H.J.; Lee, van der H.A.; Klaassen, C.H.; Melchers, W.J.G.; Verweij, P.E.


    Background Azoles play an important role in the management of Aspergillus diseases. Azole resistance is an emerging global problem in Aspergillus fumigatus, and may develop through patient therapy. In addition, an environmental route of resistance development has been suggested through exposure to 1

  14. Pulmonary Immune Responses to Aspergillus Fumigatus in Rats

    Institute of Scientific and Technical Information of China (English)



    Objective To evaluate immunologic mechanisms underlying Aspergillus fumigatus pulmonary infections in immunocompetent Dark Agouti (DA) and Albino Oxford (AO) rats recognized as being susceptible to some inflammatory diseases in different manners. Methods Lung fungal burden (quantitative colony forming units, CFU, assay), leukocyte infiltration (histology, cell composition) and their function (phagocytosis, oxidative activity, CD11b adhesion molecule expression) and cytokine interferon-γ(IFN-γ) and interleukin-17 and-4 (IL-17 and IL-4) lung content were evaluated following infection (intratracheally, 1x107 conidia). Results Slower reduction of fungal burden was observed in AO rats in comparison with that in DA rats, which was coincided with less intense histologically evident lung cell infiltration and leukocyte recovery as well as lower level of most of the their activities including intracellular myeloperoxidase activity, the capacity of nitroblue tetrazolium salt reduction and CD11b adhesion molecule expression (except for phagocytosis of conidia) in these rats. Differential patterns of changes in proinflammatory cytokine levels (unchanged levels of IFN-γand transient increase of IL-17 in AO rats vs continuous increase of both cytokines in DA rats) and unchanged levels of IL-4 were observed. Conclusion Genetically-based differences in the pattern of antifungal lung leukocyte activities and cytokine milieu, associated with differential efficiency of fungal elimination might be useful in the future use of rat models in studies of pulmonary aspergillosis.

  15. Plant-like biosynthesis of isoquinoline alkaloids in Aspergillus fumigatus. (United States)

    Baccile, Joshua A; Spraker, Joseph E; Le, Henry H; Brandenburger, Eileen; Gomez, Christian; Bok, Jin Woo; Macheleidt, Juliane; Brakhage, Axel A; Hoffmeister, Dirk; Keller, Nancy P; Schroeder, Frank C


    Natural product discovery efforts have focused primarily on microbial biosynthetic gene clusters (BGCs) containing large multimodular polyketide synthases and nonribosomal peptide synthetases; however, sequencing of fungal genomes has revealed a vast number of BGCs containing smaller NRPS-like genes of unknown biosynthetic function. Using comparative metabolomics, we show that a BGC in the human pathogen Aspergillus fumigatus named fsq, which contains an NRPS-like gene lacking a condensation domain, produces several new isoquinoline alkaloids known as the fumisoquins. These compounds derive from carbon-carbon bond formation between two amino acid-derived moieties followed by a sequence that is directly analogous to isoquinoline alkaloid biosynthesis in plants. Fumisoquin biosynthesis requires the N-methyltransferase FsqC and the FAD-dependent oxidase FsqB, which represent functional analogs of coclaurine N-methyltransferase and berberine bridge enzyme in plants. Our results show that BGCs containing incomplete NRPS modules may reveal new biosynthetic paradigms and suggest that plant-like isoquinoline biosynthesis occurs in diverse fungi. PMID:27065235

  16. Targeted Disruption of Nonribosomal Peptide Synthetase pes3 Augments the Virulence of Aspergillus fumigatus


    O'Hanlon, Karen; Cairns, Timothy; Stack, Deirdre; Schrettl, Markus; Bignell, Elaine; Kavanagh, Kevin; Miggin, Sinead; O'Keeffe, Grainne; Larsen, Thomas; Doyle, Sean


    Nonribosomal peptide synthesis (NRPS) is a documented virulence factor for the opportunistic pathogen Aspergillus fumigatus and other fungi. Secreted or intracellularly located NRP products include the toxic molecule gliotoxin and the iron-chelating siderophores triacetylfusarinine C and ferricrocin. No structural or immunologically relevant NRP products have been identified in the organism. We investigated the function of the largest gene in A. fumigatus, which encodes the NRP synthetase Pes...

  17. The Fungal Pathogen Aspergillus fumigatus Regulates Growth, Metabolism, and Stress Resistance in Response to Light


    Fuller, Kevin K.; Ringelberg, Carol S.; Loros, Jennifer J.; Dunlap, Jay C


    ABSTRACT Light is a pervasive environmental factor that regulates development, stress resistance, and even virulence in numerous fungal species. Though much research has focused on signaling pathways in Aspergillus fumigatus, an understanding of how this pathogen responds to light is lacking. In this report, we demonstrate that the fungus does indeed respond to both blue and red portions of the visible spectrum. Included in the A. fumigatus light response is a reduction in conidial germinatio...

  18. Disruption of the Phospholipase D Gene Attenuates the Virulence of Aspergillus fumigatus


    Li, Xianping; Gao, Meihua; Han, Xuelin; Tao, Sha; Zheng, Dongyu; Cheng, Ying; Yu, Rentao; Han, Gaige; Schmidt, Martina; Han, Li


    Aspergillus fumigatus is the most prevalent airborne fungal pathogen that induces serious infections in immunocompromised patients. Phospholipases are key enzymes in pathogenic fungi that cleave host phospholipids, resulting in membrane destabilization and host cell penetration. However, knowledge of the impact of phospholipases on A. fumigatus virulence is rather limited. In this study, disruption of the pld gene encoding phospholipase D (PLD), an important member of the phospholipase protei...

  19. Characterization of a 5-azacytidine-induced developmental Aspergillus fumigatus variant


    Ben-Ami, Ronen; Varga, John; Lewis, Russell E.; May, Gregory S.; William C Nierman; Kontoyiannis, Dimitrios P.


    The hypomethylating agent 5-azacytidine (5AC) is widely used in patients at risk of invasive mycoses. We sought to determine whether 5AC affects the developmental competence and virulence of Aspergillus fumigatus. Incubation of A. fumigatus strain 293 with 5AC induced high-frequency conversion to a fluffy-variant (Af293FL). The conidiation defect was bypassed by exposing Af293FL to light during the initial 18 hours of growth on solid media. Transcriptional profiling revealed differential expr...

  20. An Improved Model of the Aspergillus fumigatus CYP51A Protein▿†


    Fraczek, M. G.; Bromley, M.; P. Bowyer


    Azole resistance is an increasing clinical problem for Aspergillus fumigatus, with the majority of published resistance arising from mutations in the azole target gene CYP51A. Previous structural studies of this protein have suffered from a nonorthologous, low-homology template for homology modeling. Here we present a new model based on the human CYP51A orthologue that provides a higher-quality model for A. fumigatus CYP51A.

  1. Histidine biosynthesis plays a crucial role in metal homeostasis and virulence of Aspergillus fumigatus


    Dietl, Anna-Maria; Amich, Jorge; Leal, Sixto; Beckmann, Nicola; Binder, Ulrike; Beilhack, Andreas; Pearlman, Eric; Haas, Hubertus


    Abstract Aspergillus fumigatus is the most prevalent airborne fungal pathogen causing invasive fungal infections in immunosuppressed individuals. The histidine biosynthetic pathway is found in bacteria, archaebacteria, lower eukaryotes, and plants, but is absent in mammals. Here we demonstrate that deletion of the gene encoding imidazoleglycerol-phosphate dehydratase (HisB) in A. fumigatus causes (i) histidine auxotrophy, (ii) decreased resistance to both starvation and excess of various heav...

  2. Isolation and Identification of Aspergillus fumigatus Mycotoxins on Growth Medium and Some Building Materials


    Nieminen, Susanna M.; Kärki, Riikka; Auriola, Seppo; Toivola, Mika; Laatsch, Hartmut; Laatikainen, Reino; Hyvärinen, Anne; von Wright, Atte


    Genotoxic and cytotoxic compounds were isolated and purified from the culture medium of an indoor air mold, Aspergillus fumigatus. One of these compounds was identified as gliotoxin, a known fungal secondary metabolite. Growth of A. fumigatus and gliotoxin production on some building materials were also studied. Strong growth of the mold and the presence of gliotoxin were detected on spruce wood, gypsum board, and chipboard under saturation conditions.

  3. The Aspergillus fumigatus Transcription Factor Ace2 Governs Pigment Production, Conidiation and Virulence


    Ejzykowicz, Daniele E.; Cunha, Marcel M.; Rozental, Sonia; Solis, Norma V.; Gravelat, Fabrice N.; Sheppard, Donald C.; Filler, Scott G.


    Aspergillus fumigatus causes serious and frequently fatal infections in immunocompromised patients. To investigate the regulation of virulence of this fungus, we constructed and analyzed an A. fumigatus mutant that lacked the transcription factor Ace2, which influences virulence in other fungi. The Δace2 mutant had dysmorphic conidiophores, reduced conidia production, and abnormal conidial cell wall architecture. This mutant produced an orange pigment when grown on solid media, although its c...

  4. cyp51A-based mechanism of azole resistance in Aspergillus fumigatus: Illustration by a new 3D Structural Model of Aspergillus fumigatus CYP51A protein. (United States)

    Liu, Musang; Zheng, Nan; Li, Dongmei; Zheng, Hailin; Zhang, Lili; Ge, Hu; Liu, Weida


    Mutations of CYP51A protein (Cytochrome P450 14-α Sterol demethylase) play a central role in the azole resistance of Aspergillus fumigatus The available structural models of CYP51A protein ofA. fumigatus are built based on that of Homo sapiens and that of Mycobacterium tuberculosis, of which the amino acid homology is only 38% and 29% compared with CYP51A protein ofA. fumigatus, respectively. In the present study, we constructed a new 3D structural model ofA. fumigatus CYP51A protein based on a recently resolved crystal structure of the homologous protein in the fungus S. cerevisiae, which shares 50% amino acid homology with A. fumigatus CYP51A protein. Three azole molecules, itraconazole, voriconazole, and posaconazole, were docked to the wild-type and the mutant A. fumigatus CYP51A protein models, respectively, to illustrate the impact of cyp51A mutations to azole-resistance. We found the mutations that occurred at L98, M220, and Y431 positions would decrease the binding affinity of azoles to the CYP51A protein and therefore would reduce their inhibitory effects. Additionally, the mutations of L98 and G432 would reduce the stability of the protein, which might lead to conformational change of its binding pocket and eventually the resistance to azoles. PMID:26768370

  5. Bioactive isochromenone isolated from Aspergillus fumigatus, endophytic fungus from Bacopa monnieri

    Directory of Open Access Journals (Sweden)

    Jay Prakash Thakur


    Full Text Available Fungal endophytes are a significant reservoir of novel bioactive secondary metabolites. Present communication describes isolation and structure determination of isochromenone, from endophytic microorganism Aspergillus fumigatus hosted in Bacopa monnieri plant. Further, its biological evaluation revealed it as antioxidant and antitubercular. The methanol extract of A. fumigatus inhibits the growth of the virulent strain of Mycobacterium tuberculosis H37RV with minimum inhibitory concentration 500 μg/mL. This is the first report of isolation of isochromenone from A. fumigatus.

  6. The temporal dynamics of differential gene expression in Aspergillus fumigatus interacting with human immature dendritic cells in vitro.

    LENUS (Irish Health Repository)

    Morton, Charles O


    Dendritic cells (DC) are the most important antigen presenting cells and play a pivotal role in host immunity to infectious agents by acting as a bridge between the innate and adaptive immune systems. Monocyte-derived immature DCs (iDC) were infected with viable resting conidia of Aspergillus fumigatus (Af293) for 12 hours at an MOI of 5; cells were sampled every three hours. RNA was extracted from both organisms at each time point and hybridised to microarrays. iDC cell death increased at 6 h in the presence of A. fumigatus which coincided with fungal germ tube emergence; >80% of conidia were associated with iDC. Over the time course A. fumigatus differentially regulated 210 genes, FunCat analysis indicated significant up-regulation of genes involved in fermentation, drug transport, pathogenesis and response to oxidative stress. Genes related to cytotoxicity were differentially regulated but the gliotoxin biosynthesis genes were down regulated over the time course, while Aspf1 was up-regulated at 9 h and 12 h. There was an up-regulation of genes in the subtelomeric regions of the genome as the interaction progressed. The genes up-regulated by iDC in the presence of A. fumigatus indicated that they were producing a pro-inflammatory response which was consistent with previous transcriptome studies of iDC interacting with A. fumigatus germ tubes. This study shows that A. fumigatus adapts to phagocytosis by iDCs by utilising genes that allow it to survive the interaction rather than just up-regulation of specific virulence genes.

  7. Extrolites of Aspergillus fumigatus and Other Pathogenic Species in Aspergillus Section Fumigati (United States)

    Frisvad, Jens C.; Larsen, Thomas O.


    Aspergillus fumigatus is an important opportunistic human pathogen known for its production of a large array of extrolites. Up to 63 species have been described in Aspergillus section Fumigati, some of which have also been reliably reported to be pathogenic, including A. felis, A. fischeri, A. fumigatiaffinis, A. fumisynnematus, A. hiratsukae, A. laciniosus, A. lentulus, A. novofumigatus, A. parafelis, A. pseudofelis, A. pseudoviridinutans, A. spinosus, A. thermomutatus, and A. udagawae. These species share the production of hydrophobins, melanins, and siderophores and ability to grow well at 37°C, but they only share some small molecule extrolites, that could be important factors in pathogenicity. According to the literature gliotoxin and other exometabolites can be contributing factors to pathogenicity, but these exometabolites are apparently not produced by all pathogenic species. It is our hypothesis that species unable to produce some of these metabolites can produce proxy-exometabolites that may serve the same function. We tabulate all exometabolites reported from species in Aspergillus section Fumigati and by comparing the profile of those extrolites, suggest that those producing many different kinds of exometabolites are potential opportunistic pathogens. The exometabolite data also suggest that the profile of exometabolites are highly specific and can be used for identification of these closely related species. PMID:26779142

  8. FleA Expression in Aspergillus fumigatus Is Recognized by Fucosylated Structures on Mucins and Macrophages to Prevent Lung Infection (United States)

    Sinha, Meenal; McCabe, Orla; Palmer, Jonathan M.; Choera, Tsokyi; Yun Lim, Fang; Wimmerova, Michaela; Carrington, Stephen D.; Yuan, Shaopeng; Lowell, Clifford A.; Oscarson, Stefan; Keller, Nancy P.; Fahy, John V.


    The immune mechanisms that recognize inhaled Aspergillus fumigatus conidia to promote their elimination from the lungs are incompletely understood. FleA is a lectin expressed by Aspergillus fumigatus that has twelve binding sites for fucosylated structures that are abundant in the glycan coats of multiple plant and animal proteins. The role of FleA is unknown: it could bind fucose in decomposed plant matter to allow Aspergillus fumigatus to thrive in soil, or it may be a virulence factor that binds fucose in lung glycoproteins to cause Aspergillus fumigatus pneumonia. Our studies show that FleA protein and Aspergillus fumigatus conidia bind avidly to purified lung mucin glycoproteins in a fucose-dependent manner. In addition, FleA binds strongly to macrophage cell surface proteins, and macrophages bind and phagocytose fleA-deficient (∆fleA) conidia much less efficiently than wild type (WT) conidia. Furthermore, a potent fucopyranoside glycomimetic inhibitor of FleA inhibits binding and phagocytosis of WT conidia by macrophages, confirming the specific role of fucose binding in macrophage recognition of WT conidia. Finally, mice infected with ΔfleA conidia had more severe pneumonia and invasive aspergillosis than mice infected with WT conidia. These findings demonstrate that FleA is not a virulence factor for Aspergillus fumigatus. Instead, host recognition of FleA is a critical step in mechanisms of mucin binding, mucociliary clearance, and macrophage killing that prevent Aspergillus fumigatus pneumonia. PMID:27058347

  9. FleA Expression in Aspergillus fumigatus Is Recognized by Fucosylated Structures on Mucins and Macrophages to Prevent Lung Infection. (United States)

    Kerr, Sheena C; Fischer, Gregory J; Sinha, Meenal; McCabe, Orla; Palmer, Jonathan M; Choera, Tsokyi; Yun Lim, Fang; Wimmerova, Michaela; Carrington, Stephen D; Yuan, Shaopeng; Lowell, Clifford A; Oscarson, Stefan; Keller, Nancy P; Fahy, John V


    The immune mechanisms that recognize inhaled Aspergillus fumigatus conidia to promote their elimination from the lungs are incompletely understood. FleA is a lectin expressed by Aspergillus fumigatus that has twelve binding sites for fucosylated structures that are abundant in the glycan coats of multiple plant and animal proteins. The role of FleA is unknown: it could bind fucose in decomposed plant matter to allow Aspergillus fumigatus to thrive in soil, or it may be a virulence factor that binds fucose in lung glycoproteins to cause Aspergillus fumigatus pneumonia. Our studies show that FleA protein and Aspergillus fumigatus conidia bind avidly to purified lung mucin glycoproteins in a fucose-dependent manner. In addition, FleA binds strongly to macrophage cell surface proteins, and macrophages bind and phagocytose fleA-deficient (∆fleA) conidia much less efficiently than wild type (WT) conidia. Furthermore, a potent fucopyranoside glycomimetic inhibitor of FleA inhibits binding and phagocytosis of WT conidia by macrophages, confirming the specific role of fucose binding in macrophage recognition of WT conidia. Finally, mice infected with ΔfleA conidia had more severe pneumonia and invasive aspergillosis than mice infected with WT conidia. These findings demonstrate that FleA is not a virulence factor for Aspergillus fumigatus. Instead, host recognition of FleA is a critical step in mechanisms of mucin binding, mucociliary clearance, and macrophage killing that prevent Aspergillus fumigatus pneumonia. PMID:27058347

  10. Azole resistance in Aspergillus fumigatus: a side-eff ect of environmental fungicide use?

    NARCIS (Netherlands)

    Verweij, P.A.; Snelders, E.; Kema, G.H.J.; Mellado, E.; Melchers, W.J.G.


    Invasive aspergillosis due to multi-azole-resistant Aspergillus fumigatus has emerged in the Netherlands since 1999, with 6·0–12·8% of patients harbouring resistant isolates. The presence of a single resistance mechanism (denoted by TR/L98H), which consists of a substitution at codon 98 of cyp51A an

  11. In Vitro Interactions between Antifungals and Immunosuppressants against Aspergillus fumigatus Isolates from Transplant and Nontransplant Patients


    Steinbach, William J.; Singh, Nina; Miller, Jackie L.; Benjamin, Daniel K; Schell, Wiley A.; Heitman, Joseph; Perfect, John R.


    We performed in vitro antifungal checkerboard testing on 12 Aspergillus fumigatus clinical isolates (6 transplant recipients and 6 nontransplant patients) with three antifungal agents (amphotericin B, voriconazole, and caspofungin) and three immunosuppressants (FK506, cyclosporine, and rapamycin). We were not able to detect a difference in calcineurin inhibitor antifungal activity against isolates from transplant recipients and nontransplant patients.

  12. Aktivierungsmuster humaner neutrophiler Granulozyten nach Kontakt mit den pathogenen Pilzen Candida albicans und Aspergillus fumigatus


    Hornbach, Anke


    Humane neutrophile Granulozyten spielen eine wichtige Rolle in der Immunabwehr invasiver Infektionen durch die humanpathogenen Pilze Candida albicans und Aspergillus fumigatus. Das Ziel der hier vorliegenden Arbeit bestand in einer Charakterisierung der Interaktion beider Pilzspezies mit neutrophilen Granulozyten, mit Fokussierung auf die unterschiedlichen Effektormechanismen dieser Zellen. C. albicans exprimiert eine Reihe von Aspartatproteasen, welche mit der Virulenz des Erregers assoziier...

  13. Targeted Disruption of Nonribosomal Peptide Synthetase pes3 Augments the Virulence of Aspergillus fumigatus

    DEFF Research Database (Denmark)

    O'Hanlon, Karen A.; Cairns, Timothy; Stack, Deirdre;


    Nonribosomal peptide synthesis (NRPS) is a documented virulence factor for the opportunistic pathogen Aspergillus fumigatus and other fungi. Secreted or intracellularly located NRP products include the toxic molecule gliotoxin and the iron-chelating siderophores triacetylfusarinine C and...... contrast to other NRP synthetases, deletion of pes3 significantly increases the virulence of A. fumigatus, whereby the pes3 deletion strain (A. fumigatus Δpes3) exhibited heightened virulence (increased killing) in invertebrate (P <0.001) and increased fungal burden (P = 0.008) in a corticosteroid model of...... metabolite profiling revealed that Pes3 does not produce a secreted or intracellularly stored NRP in A. fumigatus. Macrophage infections and histological analysis of infected murine tissue indicate that Δpes3 heightened virulence appears to be mediated by aberrant innate immune recognition of the fungus...

  14. High prevalence of azole-resistant Aspergillus fumigatus in adults with cystic fibrosis exposed to itraconazole. (United States)

    Burgel, Pierre-Régis; Baixench, Marie-Thérèse; Amsellem, Michaël; Audureau, Etienne; Chapron, Jeanne; Kanaan, Reem; Honoré, Isabelle; Dupouy-Camet, Jean; Dusser, Daniel; Klaassen, Corné H; Meis, Jacques F; Hubert, Dominique; Paugam, André


    Aspergillus fumigatus is the most frequent fungus found in the sputum of cystic fibrosis (CF) subjects. Itraconazole is prescribed for allergic bronchopulmonary aspergillosis (ABPA) or Aspergillus bronchitis in CF subjects. We hypothesized that A. fumigatus isolates in the sputum of CF subjects with previous exposure to itraconazole was associated with higher prevalence of azole resistance. From June 2010 to April 2011, sputum samples from adult CF subjects at Cochin University Hospital (France) were examined systematically for the detection of A. fumigatus. MICs of A. fumigatus isolates against azoles were screened using Etest, and reduced susceptibility to azoles was confirmed using the CLSI broth microdilution method. A. fumigatus was isolated from the sputum of 131/249 (52.6%) adult CF subjects, and 47/131 (35.9%) subjects had received previous treatment with itraconazole. Reduced A. fumigatus susceptibility to itraconazole (MIC, ≥2 mg/liter) was confirmed in 6/131 (4.6%) subjects. All 6 isolates also had reduced susceptibility to posaconazole (MIC, ≥0.5 mg/liter), and 3/6 isolates had reduced susceptibility to voriconazole (MIC, ≥2 mg/liter). Mutations in the cyp51A gene were detected at positions previously implicated to cause resistance in 5 isolates. Azole-resistant A. fumigatus isolates were found in 5/25 (20%) subjects exposed to itraconazole within the previous 3 years. High rates of azole-resistant A. fumigatus isolates were present in adult CF subjects and were associated with recent itraconazole exposure. Although the clinical implications of these findings will require further studies, the cautious use of itraconazole in adult CF subjects can be recommended. PMID:22123701

  15. Laboratory epidemiology and mechanisms of azole resistance in Aspergillus fumigatus


    Bueid, Ahmed


    Although A. fumigatus strains are generally susceptible to azoles, recently, acquired resistance to a number of antifungal compounds has been reported, especially to triazoles possibly due to widespread clinical use of triazoles or through exposure to azole fungicides in the environment. The significant clinical problem of azole resistance has led to study the antifungal resistance mechanisms for developing effective therapeutic strategies. Of 230 clinical A. fumigatus isolates submitted duri...

  16. IgG antibodies to Aspergillus fumigatus in cystic fibrosis: a laboratory correlate of disease activity.


    Forsyth, K D; Hohmann, A W; Martin, A J.; Bradley, J


    Serum was collected from 50 patients with cystic fibrosis, and IgG antibodies to Aspergillus fumigatus were measured by enzyme linked immunosorbent assay (ELISA). In addition, total IgE and Aspergillus specific IgE antibodies were measured in 41 of the 50. A close association was found between pulmonary function and clinical state, and IgG antibodies to Aspergillus. There was no association between pulmonary function or clinical state and IgE antibodies. It is postulated that in patients with...

  17. Differentiation between Isolates of Aspergillus fumigatus from Breeding Turkeys and Their Environment by Genotyping with Microsatellite Markers (United States)

    Lair-Fulleringer, Sybille; Guillot, Jacques; Desterke, Christophe; Seguin, Dominique; Warin, Stephan; Bezille, Arnaud; Chermette, René; Bretagne, Stéphane


    To elucidate the epidemiology of the different forms of avian aspergillosis, 114 Aspergillus fumigatus isolates from sacrificed turkeys and 134 A. fumigatus isolates from air samples were collected and genotyped by microsatellite polymorphism marker analysis. Air sampling confirmed the huge diversity of A. fumigatus populations. Whereas older animals harbored several combinations of genotypes, 1-day-old chicks carried a unique genotype, suggesting a unique source of contamination. PMID:12682192

  18. Aspergillus oerlinghausenensis, a new mould species closely related to A. fumigatus. (United States)

    Houbraken, Jos; Weig, Michael; Groß, Uwe; Meijer, Martin; Bader, Oliver


    Two isolates belonging to Aspergillus section Fumigati were recovered from German soil on itraconazole containing agar media. Phylogenetic analysis and phenotypic characterization of both isolates show that they represent a novel species named Aspergillus oerlinghausenensis (holotype CBS H-22119(HT), ex-type CBS 139183(T) = IBT 33878 = DTO 316-A3). The species is phylogenetically related to A. fischeri and A. fumigatus. Aspergillus oerlinghausenensis can be differentiated from A. fischeri by its higher growth rate at 50°C. Furthermore, A. oerlinghausenensis is protoheterothallic as only the MAT1-1 idiomorph was detected, while A. fischeri is homothallic. The species differs from A. fumigatus by a weak sporulation on malt extract agar at 25°C, a floccose colony texture on Czapek yeast extract agar and malt extract agar and subglobose instead of subclavate vesicles. The cyp51A promoter region of A. oerlinghausenensis deviates from the previously reported cyp51A promoter regions in A. fumigatus and potentially presents a novel azole resistance conferring modification. Due to the close relationship of A. oerlinghausenensis with A. fischeri and A. fumigatus, this species is placed in a good position for comparative studies involving these species. PMID:26667219

  19. Interactions between conidia of Aspergillus fumigatus and human complement component C3.


    Sturtevant, J E; Latgé, J P


    Activation and deposition of C3 on Aspergillus fumigatus conidia have been previously demonstrated. This study investigated in further detail the interactions between complement component C3 and the conidia of A. fumigatus. Immunoblotting and 125I-C3 binding studies showed that C3 deposition was rapid (less than 15 min) and parallel to the formation of iC3b. Immunoblotting experiments identified a 54- to 58-kDa conidial protein which binds human complement component C3 and/or a C3 fragment(s)...

  20. Dectin-1-Dependent Interleukin-22 Contributes to Early Innate Lung Defense against Aspergillus fumigatus


    Gessner, Melissa A.; Werner, Jessica L.; Lilly, Lauren M.; Nelson, Michael P.; Metz, Allison E.; Dunaway, Chad W; Chan, Yvonne R.; Ouyang, Wenjun; Brown, Gordon D.; Weaver, Casey T.; Steele, Chad


    We have previously reported that mice deficient in the beta-glucan receptor Dectin-1 displayed increased susceptibility to Aspergillus fumigatus lung infection in the presence of lower interleukin 23 (IL-23) and IL-17A production in the lungs and have reported a role for IL-17A in lung defense. As IL-23 is also thought to control the production of IL-22, we examined the role of Dectin-1 in IL-22 production, as well as the role of IL-22 in innate host defense against A. fumigatus. Here, we sho...

  1. Three-dimensional models of 14?-sterol demethylase (Cyp51A) from Aspergillus lentulus and Aspergillus fumigatus: an insight into differences in voriconazole interaction



    Abstract Aspergillus lentulus, an Aspergillus fumigatus sibling species, is increasingly reported in corticosteroid-treated patients. Its clinical significance is unknown, but the fact that A. lentulus shows reduced antifungal susceptibility, mainly to voriconazole, is of serious concern. Heterologous expression of cyp51A from A. fumigatus and A. lentulus was performed in Saccharomyces cerevisiae to assess differences in the interaction of Cyp51A with the azole drugs. The absence o...

  2. Antifungal Effects of Thyme, Agastache and Satureja Essential Oils on Aspergillus fumigatus, Aspergillus flavus and Fusarium solani

    Directory of Open Access Journals (Sweden)

    Karim Mardani


    Full Text Available Growth inhibition of Aspergillus fumigatus,Aspergillus flavus and Fusarum solani exposed to the essential oils including Thyme, Agastache and Satureja were studied. Disc Diffusion Method was used to evaluate the fungal growth inhibitory effects of the essential oils. Minimal inhibitory concentration (MIC and minimal fungicidal concentration (MFC of the oils were determined and compared with each other. The results showed that all three essential oils examined, had antifungal effects against three fungi species. The MIC data revealed that Thyme oil was the most effective essential oil with the MIC of 62.5 μl ml-1.

  3. Polyphasic taxonomy of Aspergillus fumigatus and related species

    DEFF Research Database (Denmark)

    Hong, S.B.; Go, S.J.; Shin, H.D.; Frisvad, Jens Christian; Samson, R.A.


    the A. fumigatus sensu stricto species. A. lentulus including isolates from clinical origin, Korean soil and from a dolphin Clustered into an isolated group based on beta-tubulin, calmodulin and actin gene sequences, differing from A. fumigalus by morphological characters, growth temperature and...

  4. Isolate-dependent growth, virulence, and cell wall composition in the human pathogen Aspergillus fumigatus.

    Directory of Open Access Journals (Sweden)

    Nansalmaa Amarsaikhan

    Full Text Available The ubiquitous fungal pathogen Aspergillus fumigatus is a mediator of allergic sensitization and invasive disease in susceptible individuals. The significant genetic and phenotypic variability between and among clinical and environmental isolates are important considerations in host-pathogen studies of A. fumigatus-mediated disease. We observed decreased radial growth, rate of germination, and ability to establish colony growth in a single environmental isolate of A. fumigatus, Af5517, when compared to other clinical and environmental isolates. Af5517 also exhibited increased hyphal diameter and cell wall β-glucan and chitin content, with chitin most significantly increased. Morbidity, mortality, lung fungal burden, and tissue pathology were decreased in neutropenic Af5517-infected mice when compared to the clinical isolate Af293. Our results support previous findings that suggest a correlation between in vitro growth rates and in vivo virulence, and we propose that changes in cell wall composition may contribute to this phenotype.

  5. Mixed Fungal Lung Infection with Aspergillus Fumigatus and Candida Albicans in a Immunocomprimised Patient: Case Report


    S., Jaya; Vipparti, Haritha


    The frequency of invasive, opportunistic mycoses has increased significantly over the past 2 decades. In the immune-compromised host, many fungi, including species of fungi typically considered non-pathogenic, have the potential to cause serious morbidity and mortality. Here we report a rare case of mixed fungal infection of the lung with Candida albicans and Aspergillus fumigatus in a patient on prolonged steroid therapy.

  6. Bimodular Peptide Synthetase SidE Produces Fumarylalanine in the Human Pathogen Aspergillus fumigatus


    Steinchen, Wieland; Lackner, Gerald; Yasmin, Sabiha; Schrettl, Markus; Dahse, Hans-Martin; Haas, Hubertus; Hoffmeister, Dirk


    The filamentous mold Aspergillus fumigatus causes invasive aspergillosis, a potentially life-threatening infectious disease, in humans. The sidE gene encodes a bimodular peptide synthetase and was shown previously to be strongly upregulated during initiation of murine lung infection. In this study, we characterized the two adenylation domains of SidE with the ATP-[32P]pyrophosphate exchange assay in vitro, which identified fumarate and l-alanine, respectively, as the preferred substrates. Usi...

  7. Establishing In Vitro-In Vivo Correlations for Aspergillus fumigatus: the Challenge of Azoles versus Echinocandins▿


    Arendrup, Maiken Cavling; Perkhofer, Susanne; Howard, Susan J.; Garcia-Effron, Guillermo; Vishukumar, Aimanianda; Perlin, David; Lass-Flörl, Cornelia


    Two clinical isolates of Aspergillus fumigatus, designated AT and DK, were recently obtained from patients failing caspofungin and itraconazole therapy, respectively. The isolates were tested by microdilution for susceptibility to itraconazole, voriconazole, posaconazole, ravuconazole, and caspofungin and by Etest for susceptibility to amphotericin B and caspofungin. Susceptibility testing documented that the DK isolate was azole resistant (itraconazole and posaconazole MICs, >4 μg/ml; vorico...

  8. Aspergillus fumigatus Empyema, Arthritis, and Calcaneal Osteomyelitis in a Lung Transplant Patient Successfully Treated with Posaconazole


    Lodge, Barbara Alexander; Ashley, Elizabeth Dodds; Steele, Mark P.; John R Perfect


    A 64-year-old male with Aspergillus fumigatus infection that had disseminated from the lung to the ankle and adjacent bone was treated successfully with posaconazole after therapy with itraconazole and amphotericin B lipid complex failed. Marked clinical improvement occurred within 6 weeks of initiation of posaconazole therapy; after 6 months, infection had resolved at all sites. The patient has had no recurrence of infection.

  9. Characterization and identification of the xylanolytic enzymes from Aspergillus fumigatus Z5


    Miao, Youzhi; Li, Juan; Xiao, Zhizhuang; Shen, Qirong; Zhang, Ruifu


    Background Plant biomass, the most abundant natural material on earth, represents a vast source of food and energy in nature. As the main component of plant biomass, xylan is a complex polysaccharide comprising a linear β(1,4)-linked backbone of xylosyl residues substituted by acetyl, arabinosyl, glucuronysyl and 4-O-methylglucuronycyl residues. Results Aspergillus fumigatus Z5 is an efficient plant biomass depolymerization fungus. In this study, its crude xylanolytic enzymes were characteriz...

  10. An Analysis of the Response of Aspergillus fumigatus and Candida albicans to Caspofungin


    Eshwika, Ahmed


    The filamentous fungus Aspergillus fumigatus is capable of causing a range of diseases in immunocompromised patients and is responsible for up to 3% of all hospitalbased deaths in the EU. The yeast Candida albicans induces a range of diseases in immunocompromised patients. Caspofungin is a recently introduced antifungal compound that has good efficacy against these fungi with minimal side effects. The aim of the work presented here was to characterise the response of A. fumigat...

  11. Impact of Aspergillus fumigatus in allergic airway diseases


    Chaudhary Neelkamal; Marr Kieren A


    Abstract For decades, fungi have been recognized as associated with asthma and other reactive airway diseases. In contrast to type I-mediated allergies caused by pollen, fungi cause a large number of allergic diseases such as allergic bronchopulmonary mycoses, rhinitis, allergic sinusitis and hypersensitivity pneumonitis. Amongst the fungi, Aspergillus fumigatus is the most prevalent cause of severe pulmonary allergic disease, including allergic bronchopulmonary aspergillosis (ABPA), known to...

  12. Antifungal activities of Terminalia ivorensis A. Chev. bark extracts against Candida albicans and Aspergillus fumigatus.


    Ouattara Sitapha; KPOROU KOUASSI ELISEE; Djaman Allico Joseph


    Abstract The present study was undertaken to evaluate in vitro antifungal activity of aqueous and hydroacoholic extracts from bark of Terminalia ivorensis A. Chev. (Combretaceae). In vitro antifungal activity of all the extracts was done by agar slant double dilution method. Candida albicans and Aspergillus fumigatus clinically important strains were used for the study. ketoconazole was used as standards for antifungal assay. Antifungal activity was determinated by evaluating of antifung...

  13. Voriconazole for the treatment of refractory Aspergillus fumigatus keratitis


    Mehta Hijab; Mehta Hitendra; Garg Prashant; Kodial Harish


    We report a case of Aspergillus fumigatus keratitis in a 53-year-old, well-controlled diabetic female who did not respond to standard antifungal treatment. She was started on topical natamycin eye drops, but the infiltrate continued to progress. Topical amphotericin B and systemic ketoconazole was added, however, there was no response and the infiltrate increased further. She was then switched to topical and systemic voriconazole. Steady resolution of the infiltrate was noted within 2 weeks...

  14. Pulmonary immune responses to Aspergillus fumigatus in an immunocompetent mouse model of repeated exposures


    Buskirk, Amanda D.; Templeton, Steven P.; Nayak, Ajay P.; Hettick, Justin M.; Law, Brandon F.; Green, Brett J.; Donald H Beezhold


    Aspergillus fumigatus is a filamentous fungus that produces abundant pigmented conidia. Several fungal components have been identified as virulence factors, including melanin; however, the impact of these factors in a repeated exposure model resembling natural environmental exposures remains unknown. This study examined the role of fungal melanin in the stimulation of pulmonary immune responses using immunocompetent BALB/c mice in a multiple exposure model. It compared conidia from wild-type ...

  15. Diversity and origins of Indian multi-triazole resistant strains of Aspergillus fumigatus. (United States)

    Chang, Howard; Ashu, Eta; Sharma, Cheshta; Kathuria, Shallu; Chowdhary, Anuradha; Xu, Jianping


    Aspergillus fumigatus is a widespread opportunistic fungal pathogen causing an alarmingly high mortality rate in immunocompromised patients. Nosocomial infections by drug-resistant A. fumigatus strains are of particular concern, and there is a pressing need to understand the origin, dispersal and long-term evolution of drug resistance in this organism. The objective of this study was to investigate the diversity and putative origins of triazole resistance of A. fumigatus from India. Eighty-nine isolates, including 51 multiple triazole resistant (MTR) isolates and 38 azole-susceptible isolates, were genotyped using multilocus sequence typing (MLST), mating typing and PCR fingerprinting. MLST resolved the 51 MTR isolates into three genotypes, two of which have susceptible counterparts, suggesting that MTR isolates originated multiple times in India. The multiple-origin hypothesis was further supported by the diversity of sequences at the triazole target gene CYP51A among the MTR isolates, and by PCR fingerprints. Interestingly, there is abundant evidence for mating and recombination in natural population of A. fumigatus in India, suggesting that sexual spread of TR34 /L98H, the dominant MTR allele, is possible. Our results call for greater attention to MTR in A. fumigatus and for better management of antifungal drug use. PMID:26931802

  16. Hypoxia attenuates anti-Aspergillus fumigatus immune responses initiated by human dendritic cells. (United States)

    Fliesser, Mirjam; Wallstein, Marion; Kurzai, Oliver; Einsele, Hermann; Löffler, Jürgen


    Aspergillus fumigatus is an opportunistic mould that causes invasive pulmonary aspergillosis (IPA), a life-threatening infection in immunocompromised patients. During the course of IPA, localised areas of tissue hypoxia occur. Bacterial infection models revealed that hypoxic microenvironments modulate the function of host immune cells. However, the influence of hypoxia on anti-fungal immunity has been largely unknown. We evaluated the impact of hypoxia on the human anti-A. fumigatus immune response. Human monocyte-derived dendritic cells (DCs) were stimulated in vitro with germ tubes of A. fumigatus under normoxia or hypoxia (1% O2 ), followed by analysis of DC viability, maturation and cytokine release. While DC viability was unaffected, hypoxia attenuated cytokine release from DCs and maturation of DCs upon stimulation with A. fumigatus. These data suggest that hypoxia at the site of A. fumigatus infection inhibits full activation and function of human DCs. Thereby, this study identified hypoxia as a crucial immune-modulating factor in the human anti-fungal immune response that might influence the course and outcome of IPA in immunocompromised patients. PMID:27005862

  17. Dectin-1 agonist curdlan modulates innate immunity to Aspergillus fumigatus in human corneal epithelial cells

    Institute of Scientific and Technical Information of China (English)

    Cheng-Cheng; Zhu; Gui-Qiu; Zhao; Jing; Lin; Li-Ting; Hu; Qiang; Xu; Xu-Dong; Peng; Xue; Wang; Sheng; Qiu


    · AIM: To explore the immunomodulatory effects of curdlan on innate immune responses against Aspergillus fumigatus(A. fumigatus) in cultured human corneal epithelial cells(HCECs), and whether C-type lectin receptor Dectin-1 mediates the immunomodulatory effects of curdlan.·METHODS: The HCECs were stimulated by curdlan in different concentrations(50, 100, 200, 400 μg/m L) for various time. Then HCECs pretreated with or without laminarin(Dectin-1 blocker, 0.3 mg/m L) and curdlan were stimulated by A. fumigatus hyphae. The m RNA and protein production of tumor necrosis factor-α(TNF-α)and interleukin-6(IL-6) were determined by real-time quantitative polymerase chain reaction and enzyme-linked immunosorbent assay, respectively. The protein level of Dectin-1 was measured by Western blot.· RESULTS: Curdlan stimulated m RNA expression of TNF-α and IL-6 in a dose and time dependent manner in HCECs. Curdlan pretreatment before A. fumigatus hyphae stimulation significantly enhanced the expression of TNF-α and IL-6 at m RNA and protein levels compared with A. fumigatus hyphae stimulation group(P <0.05).Both curdlan and A. fumigatus hyphae up-regulated Dectin-1 protein expression in HCECs, and Dectin-1expression was elevated to 1.5- to 2-fold by curdlan pretreatment followed hyphae stimulation. The Dectin-1blocker laminarin suppressed the m RNA expression and protein production of TNF-α and IL-6 induced by curdlan and hyphae(P <0.05).· CONCLUSION: These findings demonstrated that curdlan pretreatment enhanced the inflammatory response induced by A. fumigatus hyphae in HCECs.Dectin-1 is essential for the immunomodulatory effectsof curdlan. Curdlan may have high clinical application values in fungal keratitis treatment.

  18. Preclinical evaluation of two 68Ga-siderophores as potential radiopharmaceuticals for Aspergillus fumigatus infection imaging

    International Nuclear Information System (INIS)

    Invasive pulmonary aspergillosis is mainly caused by Aspergillus fumigatus, and is one of the major causes of morbidity and mortality in immunocompromised patients. The mortality associated with invasive pulmonary aspergillosis remains high, mainly due to the difficulties and limitations in diagnosis. We have shown that siderophores can be labelled with 68Ga and can be used for PET imaging of A. fumigatus infection in rats. Here we report on the further evaluation of the most promising 68Ga-siderophore candidates, triacetylfusarinine (TAFC) and ferrioxamine E (FOXE). Siderophores were labelled with 68Ga using acetate buffer. Log P, protein binding and stability values were determined. Uptake by A. fumigatus was studied in vitro in cultures with high and low iron loads. In vivo biodistribution was determined in normal mice and an infection model was established using neutropenic rats inoculated with A. fumigatus. Static and dynamic μPET imaging was performed and correlated with CT images, and lung infection was evaluated ex vivo. 68Ga-siderophores were labelled with high radiochemical purity and specific activity. 68Ga-TAFC and 68Ga-FOXE showed high uptake by A. fumigatus in iron-deficient cultures. In normal mice, 68Ga-TAFC and 68Ga-FOXE showed rapid renal excretion with high metabolic stability. In the rat infection model focal lung uptake was detected by μPET with both compounds and increased with severity of the infection, correlating with abnormal CT images. 68Ga-TAFC and 68Ga-FOXE displayed excellent in vitro stability and high uptake by A. fumigatus. Both compounds showed excellent pharmacokinetics, highly selective accumulation in infected lung tissue and good correlation with severity of disease in a rat infection model, which makes them promising agents for A. fumigatus infection imaging. (orig.)

  19. Polyphasic taxonomy of Aspergillus fumigatus and related species

    DEFF Research Database (Denmark)

    Hong, S.B.; Go, S.J.; Shin, H.D.;


    The variability within Aspergillus fumigalus Fresenius and related species was examined using macro-, micro-morphology, growth temperature regimes and extrolite patterns. In addition, DNA analyses including partial beta-tubulin, calmodulin and actin gene sequences were used. Detailed examination ...

  20. Uranium uptake by the filamentous fungal biomass, Aspergillus fumigatus and mechanism of biosorption

    International Nuclear Information System (INIS)

    Uptake of uranium by Aspergillus fumigatus was investigated in a batch study. Previously, we had reported good uranium uptake capacity, i.e., 423 mg U/g by this fungal biomass. The objective of the present study was to investigate the uranium uptake and mechanism of biosorption by Aspergillus fumigatus. The metal uptake was rapid and 80% of metal ion could be removed within 4 minutes of contact time. Kinetic modeling indicated that the uptake of uranium followed Lagergren's pseudo-second order reaction indicating the process to be mediated through chemisorption mechanism. Further studies on isotherm modeling were carried out using D-R isotherm to confirm the same. The energy of biosorption obtained from D-R isotherm was found to be 14.4 kJ/mol. This energy corresponds to the energy of chemisorption (ion-exchange) which varies between 8-16 kJ/mol. All these results suggest that uranium uptake by Aspergillus fumigatus is mediated through chemisorptions mechanism. (author)

  1. Transcriptomic and proteomic analyses of the Aspergillus fumigatus hypoxia response using an oxygen-controlled fermenter

    Directory of Open Access Journals (Sweden)

    Barker Bridget M


    Full Text Available Abstract Background Aspergillus fumigatus is a mold responsible for the majority of cases of aspergillosis in humans. To survive in the human body, A. fumigatus must adapt to microenvironments that are often characterized by low nutrient and oxygen availability. Recent research suggests that the ability of A. fumigatus and other pathogenic fungi to adapt to hypoxia contributes to their virulence. However, molecular mechanisms of A. fumigatus hypoxia adaptation are poorly understood. Thus, to better understand how A. fumigatus adapts to hypoxic microenvironments found in vivo during human fungal pathogenesis, the dynamic changes of the fungal transcriptome and proteome in hypoxia were investigated over a period of 24 hours utilizing an oxygen-controlled fermenter system. Results Significant increases in transcripts associated with iron and sterol metabolism, the cell wall, the GABA shunt, and transcriptional regulators were observed in response to hypoxia. A concomitant reduction in transcripts was observed with ribosome and terpenoid backbone biosynthesis, TCA cycle, amino acid metabolism and RNA degradation. Analysis of changes in transcription factor mRNA abundance shows that hypoxia induces significant positive and negative changes that may be important for regulating the hypoxia response in this pathogenic mold. Growth in hypoxia resulted in changes in the protein levels of several glycolytic enzymes, but these changes were not always reflected by the corresponding transcriptional profiling data. However, a good correlation overall (R2 = 0.2, p A. fumigatus. Conclusions Taken together, our data suggest a robust cellular response that is likely regulated both at the transcriptional and post-transcriptional level in response to hypoxia by the human pathogenic mold A. fumigatus. As with other pathogenic fungi, the induction of glycolysis and transcriptional down-regulation of the TCA cycle and oxidative phosphorylation appear to major

  2. The involvement of the Mid1/Cch1/Yvc1 calcium channels in Aspergillus fumigatus virulence.

    Directory of Open Access Journals (Sweden)

    Patrícia Alves de Castro

    Full Text Available Aspergillus fumigatus is a major opportunistic pathogen and allergen of mammals. Calcium homeostasis and signaling is essential for numerous biological processes and also influences A. fumigatus pathogenicity. The presented study characterized the function of the A. fumigatus homologues of three Saccharomyces cerevisiae calcium channels, voltage-gated Cch1, stretch-activated Mid1 and vacuolar Yvc1. The A. fumigatus calcium channels cchA, midA and yvcA were regulated at transcriptional level by increased calcium levels. The YvcA::GFP fusion protein localized to the vacuoles. Both ΔcchA and ΔmidA mutant strains showed reduced radial growth rate in nutrient-poor minimal media. Interestingly, this growth defect in the ΔcchA strain was rescued by the exogenous addition of CaCl2. The ΔcchA, ΔmidA, and ΔcchA ΔmidA strains were also sensitive to the oxidative stress inducer, paraquat. Restriction of external Ca(2+ through the addition of the Ca(2+-chelator EGTA impacted upon the growth of the ΔcchA and ΔmidA strains. All the A. fumigatus ΔcchA, ΔmidA, and ΔyvcA strains demonstrated attenuated virulence in a neutropenic murine model of invasive pulmonary aspergillosis. Infection with the parental strain resulted in a 100% mortality rate at 15 days post-infection, while the mortality rate of the ΔcchA, ΔmidA, and ΔyvcA strains after 15 days post-infection was only 25%. Collectively, this investigation strongly indicates that CchA, MidA, and YvcA play a role in A. fumigatus calcium homeostasis and virulence.

  3. Effects of Iron Chelators on the Formation and Development of Aspergillus fumigatus Biofilm. (United States)

    Nazik, Hasan; Penner, John C; Ferreira, Jose A; Haagensen, Janus A J; Cohen, Kevin; Spormann, Alfred M; Martinez, Marife; Chen, Vicky; Hsu, Joe L; Clemons, Karl V; Stevens, David A


    Iron acquisition is crucial for the growth of Aspergillus fumigatus. A. fumigatus biofilm formation occurs in vitro and in vivo and is associated with physiological changes. In this study, we assessed the effects of Fe chelators on biofilm formation and development. Deferiprone (DFP), deferasirox (DFS), and deferoxamine (DFM) were tested for MIC against a reference isolate via a broth macrodilution method. The metabolic effects (assessed by XTT [2,3-bis[2-methoxy-4-nitro-5-sulfophenyl]-2H-tetrazolium-5-carboxanilide inner salt]) on biofilm formation by conidia were studied upon exposure to DFP, DFM, DFP plus FeCl3, or FeCl3 alone. A preformed biofilm was exposed to DFP with or without FeCl3. The DFP and DFS MIC50 against planktonic A. fumigatus was 1,250 μM, and XTT gave the same result. DFM showed no planktonic inhibition at concentrations of ≤2,500 μM. By XTT testing, DFM concentrations of biofilms forming in A. fumigatus or preformed biofilms (P biofilm formation (P Biofilm formation with 625 μM DFP plus any concentration of FeCl3 was lower than that in the controls (P biofilms, DFP in the range of ≥625 to 1,250 μM was inhibitory compared to the controls (P biofilm formation (P biofilm increased with 2,500 μM FeCl3 only (P biofilms of A. fumigatus clinical isolates to DFP were noted. In conclusion, iron stimulates biofilm formation and preformed biofilms. Chelators can inhibit or enhance biofilms. Chelation may be a potential therapy for A. fumigatus, but we show here that chelators must be chosen carefully. Individual isolate susceptibility assessments may be needed. PMID:26239975

  4. Arthritis and Osteomyelitis due to Aspergillus fumigatus: A 17 years old boy with chronic granulomatous disease

    Directory of Open Access Journals (Sweden)

    Tabak Yalcın


    Full Text Available Abstract Background Invasive Aspergillus infections are frequently seen in immunocompromised patients but arthritis is a rare complication of Aspergillus infections in the absence of immune suppressive therapy, trauma or surgical intervention. Case presentation A 17 years old male patient with arthritis and patellar osteomyelitis of the left knee whose further investigations revealed chronic granulomatous disease as the underlying disease is followed. Aspergillus fumigatus was isolated from the synovial fluid and the tissue samples cultures. He was treated with Amphotericin B deoxicolate 0.7 mg/kg/day. Also surgical debridement was performed our patient. Amphotericin B nephrotoxicity developed and the therapy switched to itraconazole 400 mg/day. Itraconazole therapy were discontinued at the 6th month. He can perform all the activities of daily living including. Conclusion We think that, chronic granulomatous disease should be investigated in patients who have aspergillar arthritis and osteomyelitis.

  5. Interaction of the pathogenic mold Aspergillus fumigatus with lung epithelial cells

    Directory of Open Access Journals (Sweden)



    Full Text Available Aspergillus fumigatus is an opportunistic environmental mold that can cause severe allergic responses in atopic individuals and poses a life-threatening risk for severely immunocompromised patients. Infection is caused by inhalation of fungal spores (conidia into the lungs. The initial point of contact between the fungus and the host is a monolayer of lung epithelial cells. Understanding how these cells react to fungal contact is crucial to elucidating the pathobiology of Aspergillus-related disease states. The experimental systems, both in vitro and in vivo, used to study these interactions, are described. Distinction is made between bronchial and alveolar epithelial cells. The experimental findings suggest that lung epithelial cells are more than just “innocent bystanders” or a purely physical barrier against infection. They can be better described as an active extension of our innate immune system, operating as a surveillance mechanism that can specifically identify fungal spores and activate an offensive response to block infection. This response includes the internalization of adherent conidia and the release of cytokines, antimicrobial peptides and reactive oxygen species. In the case of allergy, lung epithelial cells can dampen an over-reactive immune response by releasing anti-inflammatory compounds such as kinurenine. This review summarizes our current knowledge regarding the interaction of A. fumigatus with lung epithelial cells. A better understanding of the interactions between A. fumigatus and lung epithelial cells has therapeutic implications, as stimulation or inhibition of the epithelial response may alter disease outcome.

  6. Rapid host defense against Aspergillus fumigatus involves alveolar macrophages with a predominance of alternatively activated phenotype.

    Directory of Open Access Journals (Sweden)

    Shikha Bhatia

    Full Text Available The ubiquitous fungus Aspergillus fumigatus is associated with chronic diseases such as invasive pulmonary aspergillosis in immunosuppressed patients and allergic bronchopulmonary aspergillosis (ABPA in patients with cystic fibrosis or severe asthma. Because of constant exposure to this fungus, it is critical for the host to exercise an immediate and decisive immune response to clear fungal spores to ward off disease. In this study, we observed that rapidly after infection by A. fumigatus, alveolar macrophages predominantly express Arginase 1 (Arg1, a key marker of alternatively activated macrophages (AAMs. The macrophages were also found to express Ym1 and CD206 that are also expressed by AAMs but not NOS2, which is expressed by classically activated macrophages. The expression of Arg1 was reduced in the absence of the known signaling axis, IL-4Rα/STAT6, for AAM development. While both Dectin-1 and TLR expressed on the cell surface have been shown to sense A. fumigatus, fungus-induced Arg1 expression in CD11c(+ alveolar macrophages was not dependent on either Dectin-1 or the adaptor MyD88 that mediates intracellular signaling by most TLRs. Alveolar macrophages from WT mice efficiently phagocytosed fungal conidia, but those from mice deficient in Dectin-1 showed impaired fungal uptake. Depletion of macrophages with clodronate-filled liposomes increased fungal burden in infected mice. Collectively, our studies suggest that alveolar macrophages, which predominantly acquire an AAM phenotype following A. fumigatus infection, have a protective role in defense against this fungus.

  7. Fungistatic activity of all-trans retinoic acid against Aspergillus fumigatus and Candida albicans (United States)

    Campione, Elena; Gaziano, Roberta; Marino, Daniele; Orlandi, Augusto


    Purpose Fungal infections are a major complication in hematologic and neoplastic patients causing severe morbidity and mortality. Aspergillus fumigatus and Candida albicans are among the most invasive opportunistic pathogens in immunocompromised patients, and classic antifungal drugs are frequently unsuccessful in these patients. Recent reports hypothesize that the antifungal efficacy of all-trans retinoic acid (ATRA) is mainly related to its strong capacity to stimulate monocyte-mediated immunity, but no consideration was given to its potential direct fungistatic activity. Moreover, ATRA offers the opportunity for systemic therapy. Methods and results We investigated the efficacy of ATRA at different concentrations for its antifungal activity against opportunistic A. fumigatus and C. albicans obtained from clinical samples according to standard protocols. A fungistatic activity of ATRA on A. fumigatus and C. albicans at 0.5–1 mM concentration was documented up to 7 days. Conclusion This is the first evidence of a direct and strong fungistatic activity of ATRA against A. fumigatus and C. albicans. The potential adjuvant therapeutic application of ATRA might be useful in the treatment and/or prevention of systemic mycoses in immunocompromised patients. The discovery of a direct fungistatic activity, in association with its reported immunomodulatory properties, makes ATRA an excellent candidate for new combined antifungal strategies for systemic mycoses in immunocompromised and cancer patients. PMID:27199548

  8. Histidine biosynthesis plays a crucial role in metal homeostasis and virulence of Aspergillus fumigatus. (United States)

    Dietl, Anna-Maria; Amich, Jorge; Leal, Sixto; Beckmann, Nicola; Binder, Ulrike; Beilhack, Andreas; Pearlman, Eric; Haas, Hubertus


    Aspergillus fumigatus is the most prevalent airborne fungal pathogen causing invasive fungal infections in immunosuppressed individuals. The histidine biosynthetic pathway is found in bacteria, archaebacteria, lower eukaryotes, and plants, but is absent in mammals. Here we demonstrate that deletion of the gene encoding imidazoleglycerol-phosphate dehydratase (HisB) in A. fumigatus causes (i) histidine auxotrophy, (ii) decreased resistance to both starvation and excess of various heavy metals, including iron, copper and zinc, which play a pivotal role in antimicrobial host defense, (iii) attenuation of pathogenicity in 4 virulence models: murine pulmonary infection, murine systemic infection, murine corneal infection, and wax moth larvae. In agreement with the in vivo importance of histidine biosynthesis, the HisB inhibitor 3-amino-1,2,4-triazole reduced the virulence of the A. fumigatus wild type and histidine supplementation partially rescued virulence of the histidine-auxotrophic mutant in the wax moth model. Taken together, this study reveals limited histidine availability in diverse A. fumigatus host niches, a crucial role for histidine in metal homeostasis, and the histidine biosynthetic pathway as being an attractive target for development of novel antifungal therapy approaches. PMID:26854126

  9. A modified recombineering protocol for the genetic manipulation of gene clusters in Aspergillus fumigatus.

    Directory of Open Access Journals (Sweden)

    Laura Alcazar-Fuoli

    Full Text Available Genomic analyses of fungal genome structure have revealed the presence of physically-linked groups of genes, termed gene clusters, where collective functionality of encoded gene products serves a common biosynthetic purpose. In multiple fungal pathogens of humans and plants gene clusters have been shown to encode pathways for biosynthesis of secondary metabolites including metabolites required for pathogenicity. In the major mould pathogen of humans Aspergillus fumigatus, multiple clusters of co-ordinately upregulated genes were identified as having heightened transcript abundances, relative to laboratory cultured equivalents, during the early stages of murine infection. The aim of this study was to develop and optimise a methodology for manipulation of gene cluster architecture, thereby providing the means to assess their relevance to fungal pathogenicity. To this end we adapted a recombineering methodology which exploits lambda phage-mediated recombination of DNA in bacteria, for the generation of gene cluster deletion cassettes. By exploiting a pre-existing bacterial artificial chromosome (BAC library of A. fumigatus genomic clones we were able to implement single or multiple intra-cluster gene replacement events at both subtelomeric and telomere distal chromosomal locations, in both wild type and highly recombinogenic A. fumigatus isolates. We then applied the methodology to address the boundaries of a gene cluster producing a nematocidal secondary metabolite, pseurotin A, and to address the role of this secondary metabolite in insect and mammalian responses to A. fumigatus challenge.

  10. The allergenicity of Aspergillus fumigatus conidia is influenced by growth temperature. (United States)

    Low, Swee Yang; Dannemiller, Karen; Yao, Maosheng; Yamamoto, Naomichi; Peccia, Jordan


    Common indoor and outdoor environmental fungi such as Aspergillus fumigatus produce asexual spores containing a collection of proteins that can bind IgE antibodies and trigger allergic reactions. We characterized the impact of sporulation temperature on the IgE-binding capacity (allergenicity) of A. fumigatus and explored the links between variable allergenicity and temperature-dependant expression of genes encoding these allergenic proteins. A 12-fold increase in A. fumigatus allergenicity per spore was observed when sporulation temperatures were decreased from 32°C to 17°C. Per spore protein mass and Asp f 1 allergen mass also followed this trend. Functional gene expression analysis of A. fumigatus sporulating cultures by real-time reverse-transcription PCR and gene expression microarrays revealed that a greater number of genes encoding known, major allergens are more highly expressed at lower sporulation temperatures. The results of this study indicate that environmental conditions at growth significantly influence the allergenicity of this common mould through the differential production of allergenic proteins, and highlight the importance of in vivo or in vitro allergenicity measurements for understanding environmental exposure to airborne allergenic fungi. PMID:21724168

  11. Pulmonary immune responses to Aspergillus fumigatus in an immunocompetent mouse model of repeated exposures. (United States)

    Buskirk, Amanda D; Templeton, Steven P; Nayak, Ajay P; Hettick, Justin M; Law, Brandon F; Green, Brett J; Beezhold, Donald H


    Aspergillus fumigatus is a filamentous fungus that produces abundant pigmented conidia. Several fungal components have been identified as virulence factors, including melanin; however, the impact of these factors in a repeated exposure model resembling natural environmental exposures remains unknown. This study examined the role of fungal melanin in the stimulation of pulmonary immune responses using immunocompetent BALB/c mice in a multiple exposure model. It compared conidia from wild-type A. fumigatus to two melanin mutants of the same strain, Δarp2 (tan) or Δalb1 (white). Mass spectrometry-based analysis of conidial extracts demonstrated that there was little difference in the protein fingerprint profiles between the three strains. Field emission scanning electron microscopy demonstrated that the immunologically inert Rodlet A layer remained intact in melanin-deficient conidia. Thus, the primary difference between the strains was the extent of melanization. Histopathology indicated that each A. fumigatus strain induced lung inflammation, regardless of the extent of melanization. In mice exposed to Δalb1 conidia, an increase in airway eosinophils and a decrease in neutrophils and CD8(+) IL-17(+) (Tc17) cells were observed. Additionally, it was shown that melanin mutant conidia were more rapidly cleared from the lungs than wild-type conidia. These data suggest that the presence of fungal melanin may modulate the pulmonary immune response in a mouse model of repeated exposures to A. fumigatus conidia. PMID:23919459

  12. Acquired antifungal drug resistance in Aspergillus fumigatus: epidemiology and detection. (United States)

    Howard, Susan Julie; Arendrup, Maiken Cavling


    Voriconazole is the recommended agent for invasive aspergillosis, with lipid amphotericin B or caspofungin as second line treatment choices. Being the only agents available in oral formulation, azoles are used in chronic infections and often over longer time periods. In addition to being used in clinical medicine, azoles are employed extensively in agriculture. Azole-resistant Aspergillus has been isolated in azole naïve patients, in azole exposed patients and in the environment. The primary underlying mechanism of resistance is as a result of alterations in the cyp51A target gene, with a variety of mutations found in clinical isolates but just one identified in a environmental strain (a point mutation at codon 98 accompanied by a tandem repeat in the promoter region). Much less is currently known about echinocandin resistance in Aspergillus, in part because susceptibility testing is not routinely performed and because the methods suffer from technical difficulties and suboptimal reproducibility. Clinical breakthrough cases have been reported however, and resistance has been confirmed in vivo. In this paper we review the current knowledge on epidemiology, susceptibility testing and underlying mechanisms involved in azole and echinocandin resistance in Aspergillus. PMID:20795765

  13. Identification of Two Different 14-α Sterol Demethylase-Related Genes (cyp51A and cyp51B) in Aspergillus fumigatus and Other Aspergillus Species


    Mellado, E.; Diaz-Guerra, T. M.; Cuenca-Estrella, M.; Rodriguez-Tudela, J. L.


    Two cyp51-related genes (cyp51A and cyp51B) encoding 14-α sterol demethylase-like enzymes were identified in the opportunistic human pathogen Aspergillus fumigatus. PCR amplification using degenerate oligonucleotides based on conserved areas of cytochrome P450 demethylases of other filamentous fungi and yeasts allowed the cloning and sequencing of two different homologue genes in A. fumigatus. Southern analysis confirmed that both genes hybridized to distinct genomic loci and that both are re...

  14. Nonribosomal Peptide Synthetase Genes pesL and pes1 Are Essential for Fumigaclavine C Production in Aspergillus fumigatus


    O'Hanlon, Karen A.; Gallagher, Lorna; Schrettl, Markus; Jöchl, Christoph; Kavanagh, Kevin; Larsen, Thomas O.; Doyle, Sean


    The identity of metabolites encoded by the majority of nonribosomal peptide synthetases in the opportunistic pathogen, Aspergillus fumigatus, remains outstanding. We found that the nonribosomal peptide (NRP) synthetases PesL and Pes1 were essential for fumigaclavine C biosynthesis, the end product of the complex ergot alkaloid (EA) pathway in A. fumigatus. Deletion of either pesL (ΔpesL) or pes1 (Δpes1) resulted in complete loss of fumigaclavine C biosynthesis, relatively increased production...

  15. Molecular Epidemiology of Aspergillus fumigatus Isolates Recovered from Water, Air, and Patients Shows Two Clusters of Genetically Distinct Strains


    Warris, Adilia; Klaassen, Corné H. W.; Meis, Jacques F. G. M.; de Ruiter, Maaike T.; de Valk, Hanneke A.; Abrahamsen, Tore G.; Gaustad, Peter; Verweij, Paul E.


    There has been an increase in data suggesting that besides air, hospital water is a potential source of transmission of filamentous fungi, and in particular Aspergillus fumigatus. Molecular characterization of environmental and clinical A. fumigatus isolates, collected prospectively during an 18-month period, was performed to establish if waterborne fungi play a role in the pathogenesis of invasive aspergillosis. Isolates recovered from water (n = 54) and air (n = 21) at various locations ins...

  16. Deciphering chemokine properties by a hybrid agent-based model of Aspergillus fumigatus infection in human alveoli


    Pollmächer, Johannes; Figge, Marc Thilo


    The ubiquitous airborne fungal pathogen Aspergillus fumigatus is inhaled by humans every day. In the lung, it is able to quickly adapt to the humid environment and, if not removed within a time frame of 4–8 h, the pathogen may cause damage by germination and invasive growth. Applying a to-scale agent-based model of human alveoli to simulate early A. fumigatus infection under physiological conditions, we recently demonstrated that alveolar macrophages require chemotactic cues to accomplish the...

  17. In Vitro Biochemical Study of CYP51-Mediated Azole Resistance in Aspergillus fumigatus. (United States)

    Warrilow, Andrew G S; Parker, Josie E; Price, Claire L; Nes, W David; Kelly, Steven L; Kelly, Diane E


    The incidence of triazole-resistant Aspergillus infections is increasing worldwide, often mediated through mutations in the CYP51A amino acid sequence. New classes of azole-based drugs are required to combat the increasing resistance to existing triazole therapeutics. In this study, a CYP51 reconstitution assay is described consisting of eburicol, purified recombinant Aspergillus fumigatus CPR1 (AfCPR1), and Escherichia coli membrane suspensions containing recombinant A. fumigatus CYP51 proteins, allowing in vitro screening of azole antifungals. Azole-CYP51 studies determining the 50% inhibitory concentration (IC50) showed that A. fumigatus CYP51B (Af51B IC50, 0.50 μM) was 34-fold more susceptible to inhibition by fluconazole than A. fumigatus CYP51A (Af51A IC50, 17 μM) and that Af51A and Af51B were equally susceptible to inhibition by voriconazole, itraconazole, and posaconazole (IC50s of 0.16 to 0.38 μM). Af51A-G54W and Af51A-M220K enzymes were 11- and 15-fold less susceptible to inhibition by itraconazole and 30- and 8-fold less susceptible to inhibition by posaconazole than wild-type Af51A, confirming the azole-resistant phenotype of these two Af51A mutations. Susceptibility to voriconazole of Af51A-G54W and Af51A-M220K was only marginally lower than that of wild-type Af51A. Susceptibility of Af51A-L98H to inhibition by voriconazole, itraconazole, and posaconazole was only marginally lower (less than 2-fold) than that of wild-type Af51A. However, Af51A-L98H retained 5 to 8% residual activity in the presence of 32 μM triazole, which could confer azole resistance in A. fumigatus strains that harbor the Af51A-L98H mutation. The AfCPR1/Af51 assay system demonstrated the biochemical basis for the increased azole resistance of A. fumigatus strains harboring G54W, L98H, and M220K Af51A point mutations. PMID:26459890

  18. Early expression of mannose-binding lectin 2 during Aspergillus fumigatus infection in human corneal epithelial cells

    Institute of Scientific and Technical Information of China (English)

    Cheng-Ye; Che; Jing-Fen; Zhang; Ji-Eun; Lee; Jing; Lin; Li-Ting; Hu; Nan; Jiang; Qian; Wang; Qiang; Xu; Gui-Qiu; Zhao


    AIM: To evaluate the early expression of mannose-binding lectin 2(MBL2) in human corneal epithelial cells(HCECs) infected by Aspergillus fumigatus(AF).METHODS: HCECs cultured in vitro with AF antigens and sampled at 0, 0.5, 1, 2, 4, 6 and 8h. The expression of MBL2 m RNA was evaluated by semiquantitative reverse transcription-polymerase chain reaction(RT-PCR). The expression of MBL2 protein in supernatant fluid was shown by enzyme linked immunosorbent assay(ELISA). MBL2 protein in HCECs was detected by immunocytochemistry at 0 and 24 h.RESULTS: MBL2 m RNA and protein are expressed in normal HCECs. The expression of MBL2 m RNA and protein in supernatant fluid begin to increase after being stimulated with AF antigens. The most significantly peak of MBL2 m RNA is in 2h. The protein of MBL2 in supernatant fluid decrease gradually after 0.5h. The protein in HCECs expression increase after stimulation of24 h.· CONCLUSION: MBL2 receptor expressed in normal HCECs in vitro. The stimulation by AF antigens can increase the early expression of it.

  19. Gβ-like CpcB plays a crucial role for growth and development of Aspergillus nidulans and Aspergillus fumigatus.

    Directory of Open Access Journals (Sweden)

    Qing Kong

    Full Text Available Growth, development, virulence and secondary metabolism in fungi are governed by heterotrimeric G proteins (G proteins. A Gβ-like protein called Gib2 has been shown to function as an atypical Gβ in Gpa1-cAMP signaling in Cryptococcus neoformans. We found that the previously reported CpcB (cross pathway control B protein is the ortholog of Gib2 in Aspergillus nidulans and Aspergillus fumigatus. In this report, we further characterize the roles of CpcB in governing growth, development and toxigenesis in the two aspergilli. The deletion of cpcB results in severely impaired cellular growth, delayed spore germination, and defective asexual sporulation (conidiation in both aspergilli. Moreover, CpcB is necessary for proper expression of the key developmental activator brlA during initiation and progression of conidiation in A. nidulans and A. fumigatus. Somewhat in accordance with the previous study, the absence of cpcB results in the formation of fewer, but not micro-, cleistothecia in A. nidulans in the presence of wild type veA, an essential activator of sexual development. However, the cpcB deletion mutant cleistothecia contain no ascospores, validating that CpcB is required for progression and completion of sexual fruiting including ascosporogenesis. Furthermore, unlike the canonical GβSfaD, CpcB is not needed for the biosynthesis of the mycotoxin sterigmatocystin (ST as the cpcB null mutant produced reduced amount of ST with unaltered STC gene expression. However, in A. fumigatus, the deletion of cpcB results in the blockage of gliotoxin (GT production. Further genetic analyses in A. nidulans indicate that CpcB may play a central role in vegetative growth, which might be independent of FadA- and GanB-mediated signaling. A speculative model summarizing the roles of CpcB in conjunction with SfaD in A. nidulans is presented.



    Tri Indah; Muharni; Elfita


    The endophytic fungi Aspergillus fumigatus was isolated from the tissues of the fruits of Garcinia griffithii. The fungalstrain was identified from the colony, and it was characteristic of cell morphology. The ethyl acetate extracts derivedfrom fungus cultures showed major spots on TLC under UV light, which was continued to the isolation of thesecondary metabolites. The structure of the isolated compound was elucidated on the basis of NMR analyses (1H-NMR,13C-NMR, HMQC, HMBC and H-H COSY). Th...

  1. In vitro and ex vivo effects of cyclosporin A on phagocytic host defenses against Aspergillus fumigatus.


    Roilides, E.; Robinson, T.; T Sein; Pizzo, P A; Walsh, T J


    Because cyclosporin A (CsA) is extensively used as an immunosuppressive agent, its effects on phagocytic defenses against Aspergillus fumigatus were studied in vitro and ex vivo. After incubation with 10 to 250 ng of CsA per ml at 37 degrees C for 60 min, polymorphonuclear leukocytes (PMNs) exhibited unaltered superoxide anion (O2-) production in response to phorbol myristate acetate and N-formylmethionyl leucyl phenylalanine, whereas > or = 500 ng/ml significantly suppressed it (P < 0.01). M...

  2. Correlation between Triazole Treatment History and Susceptibility in Clinically Isolated Aspergillus fumigatus


    Tashiro, Masato; Izumikawa, Koichi; Hirano, Katsuji; Ide, Shotaro; Mihara, Tomo; Hosogaya, Naoki; Takazono, Takahiro; Morinaga, Yoshitomo; Nakamura, Shigeki; Kurihara, Shintaro; Imamura, Yoshifumi; Miyazaki, Taiga; Nishino, Tomoya; Tsukamoto, Misuzu; Kakeya, Hiroshi


    This is the first report of a detailed relationship between triazole treatment history and triazole MICs for 154 Aspergillus fumigatus clinical isolates. The duration of itraconazole dosage increased as the itraconazole MIC increased, and a positive correlation was observed (r = 0.5700, P < 0.0001). The number of itraconazole-naïve isolates dramatically decreased as the itraconazole MIC increased, particularly for MICs exceeding 2 μg/ml (0.5 μg/ml versus 2 μg/ml, P = 0.03). We also examined t...

  3. Deciphering Metabolic Traits of the Fungal Pathogen Aspergillus fumigatus: Redundancy vs. Essentiality

    Directory of Open Access Journals (Sweden)

    Jorge eAmich


    Full Text Available Incidence rates of infections caused by environmental opportunistic fungi have risen over recent decades. Aspergillus species have emerged as serious threat for the immune-compromised, and detailed knowledge about virulence-determining traits is crucial for drug target identification. As a prime saprobe, A. fumigatus has evolved to efficiently adapt to various stresses and to sustain nutritional supply by osmotrophy, which is characterized by extracellular substrate digestion followed by efficient uptake of breakdown products that are then fed into the fungal primary metabolism. These intrinsic metabolic features are believed to be related with its virulence ability. The plethora of genes that encode underlying effectors has hampered their in-depth analysis with respect to pathogenesis. Recent developments in Aspergillus molecular biology allow conditional gene expression or comprehensive targeting of gene families to cope with redundancy. Furthermore, identification of essential genes that are intrinsically connected to virulence opens accurate perspectives for novel targets in antifungal therapy.

  4. Characterization of a 5-azacytidine-induced developmental Aspergillus fumigatus variant (United States)

    Ben-Ami, Ronen; Varga, John; Lewis, Russell E; May, Gregory S; Nierman, William C


    The hypomethylating agent 5-azacytidine (5AC) is widely used in patients at risk of invasive mycoses. We sought to determine whether 5AC affects the developmental competence and virulence of Aspergillus fumigatus. Incubation of A. fumigatus strain 293 with 5AC induced high-frequency conversion to a fluffy-variant (Af293FL). The conidiation defect was bypassed by exposing Af293FL to light during the initial 18 hours of growth on solid media. Transcriptional profiling revealed differential expression of multiple genes involved in G-protein signaling, including a putative G-protein coupled photoreceptor (opsin), suggesting that impaired signaling through a light-responsive pathway upstream of brlA is responsible for this phenotype. Af293FL was fully virulent in fruit fly and murine models of invasive aspergillosis. Moreover, Af293FL overexpressed aspergillopepsin F, had increased elastase activity and was more angioinvasive than the parental wild-type strain. The 5AC-induced A. fumigatus fluffy variant illustrates the potential effects of chemotherapeutic agents on the developmental and pathobiologic characteristics of opportunistic fungi. PMID:21178435

  5. Bioaccumulation versus adsorption of reactive dye by immobilized growing Aspergillus fumigatus beads

    International Nuclear Information System (INIS)

    The removal of reactive brilliant blue KN-R using growing Aspergillus fumigatus (abbr. A. fumigatus) immobilized on carboxymethylcellulose (CMC) beads with respect to initial dye concentration was investigated. Bioaccumulation was the dominant mechanism of the dye removal. According to the UV-vis spectra and the results of three sets of experiments, it could be concluded that the bioaccumulation using immobilized growing A. fumigatus beads was achieved by metabolism-dependent accumulation and metabolism-independent adsorption (15-23% proportion of overall dye removal), which included biosorption by mycelia entrapped in them and adsorption on immobilization matrix. The transmission electron microscope (TEM) images showed the intracellular structures of mycelia and the toxicity of dye. It was found that the fungus had a considerable tolerance to reactive brilliant blue KN-R at initial dye concentrations of <114.7 mg/l. Though at high initial dye concentrations the growth of mycelia was inhibited significantly by the dye molecules in the growth medium, the bioaccumulation capacity was not markedly affected and the maximum bioaccumulation capacity was 190.5 ± 2.0 mg/g at an initial dye concentration of 374.4 mg/l. The bioaccumulation rates were not constant over the contact time

  6. Aspergillus fumigatus melanins: Interference with the host endocytosis pathway and impact on virulence

    Directory of Open Access Journals (Sweden)

    Thorsten eHeinekamp


    Full Text Available The opportunistic human pathogenic fungus Aspergillus fumigatus produces at least two types of melanin, namely pyomelanin and dihydroxynaphthalene (DHN melanin. Pyomelanin is produced during tyrosine catabolism via accumulation of homogentisic acid. Although pyomelanin protects the fungus against reactive oxygen species and acts as a defense compound in response to cell wall stress, mutants deficient for pyomelanin biosynthesis do not differ in virulence when tested in a murine infection model for invasive pulmonary aspergillosis. DHN melanin is responsible for the characteristic grey-greenish color of A. fumigatus conidia. Mutants lacking a functional polyketide synthase PksP, the enzyme responsible for the initial step in DHN-melanin formation, i.e., the synthesis of naphthopyrone, produce white spores and are attenuated in virulence. The activity of PksP was found to be essential not only for inhibition of apoptosis of phagocytes by interfering with the host PI3K/Akt signaling cascade but also for effective inhibition of acidification of conidia-containing phagolysosomes. These features allow A. fumigatus to survive in phagocytes and thereby to escape from human immune effector cells and to become a successful pathogen.

  7. [Azole resistance in Aspergillus fumigatus in the Netherlands--increase due to environmental fungicides?]. (United States)

    Verweij, Paul E; van de Sande-Bruisma, Nienke; Kema, Gert H J; Melchers, Willem J G


    The mould Aspergillus fumigatus may develop mechanisms that confer resistance to itraconazole, voriconazole and posaconazole. In the Netherlands a dominant resistance mechanism referred to as TR/L98H is found. In A. fumigatus isolates recovered from clinical samples in Dutch hospitals the prevalence of azole resistance varied between 0.8% and 9.4%. The TR/L98H resistance mechanism probably develops in our environment, as azoles are frequently used for crop protection and material preservation. It is likely that breathing in the resistant spores of these strains from the environment leads to clinical infection. More research is needed to understand the environmental route of resistance development and to enable effective measures to prevent this occurring. Azole resistance is associated with treatment failure. Of 8 patients with azole-resistant invasive aspergillosis 7 died within 12 weeks of diagnosis. Alternative treatment regimens might include lipid-formulation of amphotericin B or a combination of voriconazole and an echinocandin, but there is little data available to support these choices. Physicians who treat patients with Aspergillus diseases should be aware of the possibility of azole resistance, also in azole-naïve patients. PMID:22748367

  8. Identification of possible targets of the Aspergillus fumigatus CRZ1 homologue, CrzA

    Directory of Open Access Journals (Sweden)

    Goldman Gustavo H


    Full Text Available Abstract Background Calcineurin, a serine/threonine-specific protein phosphatase, plays an important role in the control of cell morphology and virulence in fungi. Calcineurin regulates localization and activity of a transcription factor called CRZ1. Recently, we characterize Aspergillus fumigatus CRZ1 homologue, AfCrzA. Here, we investigate which pathways are influenced by A. fumigatus AfCrzA during a short pulse of calcium by comparatively determining the transcriptional profile of A. fumigatus wild type and ΔAfcrzA mutant strains. Results We were able to observe 3,622 genes modulated in at least one timepoint in the mutant when compared to the wild type strain (3,211 and 411 at 10 and 30 minutes, respectively. Decreased mRNA abundance in the ΔcrzA was seen for genes encoding calcium transporters, transcription factors and genes that could be directly or indirectly involved in calcium metabolism. Increased mRNA accumulation was observed for some genes encoding proteins involved in stress response. AfCrzA overexpression in A. fumigatus increases the expression of several of these genes. The deleted strain of one of these genes, AfRcnA, belonging to a class of endogenous calcineurin regulators, calcipressins, had more calcineurin activity after exposure to calcium and was less sensitive to menadione 30 μM, hydrogen peroxide 2.5 mM, EGTA 25 mM, and MnCl2 25 mM. We constructed deletion, overexpression, and GFP fusion protein for the closely related A. nidulans AnRcnA. GFP::RcnA was mostly detected along the germling, did not accumulate in the nuclei and its location is not affected by the cellular response to calcium chloride. Conclusion We have performed a transcriptional profiling analysis of the A. fumigatus ΔAfcrzA mutant strain exposed to calcium stress. This provided an excellent opportunity to identify genes and pathways that are under the influence of AfCrzA. AfRcnA, one of these selected genes, encodes a modulator of calcineurin

  9. Identification of Aspergillus fumigatus multidrug transporter genes and their potential involvement in antifungal resistance. (United States)

    Meneau, Isabelle; Coste, Alix T; Sanglard, Dominique


    Aspergillus fumigatus can cause severe fatal invasive aspergillosis in immunocompromised patients but is also found in the environment. A. fumigatus infections can be treated with antifungals agents among which azole and echinocandins. Resistance to the class of azoles has been reported not only from patient samples but also from environmental samples. Azole resistance mechanisms involve for most isolates alterations at the site of the azole target (cyp51A); however, a substantial number of isolates can also exhibit non-cyp51A-mediated mechanisms.We aimed here to identify novel A. fumigatus genes involved in azole resistance. For this purpose, we designed a functional complementation system of A. fumigatus cDNAs expressed in a Saccharomyces cerevisiae isolate lacking the ATP Binding Cassette (ABC) transporter PDR5 and that was therefore more azole-susceptible than the parent wild type. Several genes were recovered including two distinct ABC transporters (atrF, atrI) and a Major Facilitator transporter (mdrA), from which atrI (Afu3g07300) and mdrA (Afu1g13800) were not yet described. atrI mediated resistance to itraconazole and voriconazole, while atrF only to voriconazole in S. cerevisiae Gene inactivation of each transporter in A. fumigatus indicated that the transporters were involved in the basal level of azole susceptibility. The expression of the transporters was addressed in clinical and environmental isolates with several azole resistance profiles. Our results show that atrI and mdrA tended to be expressed at higher levels than atrF in normal growth conditions. atrF was upregulated in 2/4 of azole-resistant environmental isolates and was the only gene with a significant association between transporter expression and azole resistance. In conclusion, this work showed the potential of complementation to identify functional transporters. The identified transporters were suggested to participate in azole resistance of A. fumigatus; however, this hypothesis will

  10. Fungistatic activity of all-trans retinoic acid against Aspergillus fumigatus and Candida albicans

    Directory of Open Access Journals (Sweden)

    Campione E


    Full Text Available Elena Campione,1 Roberta Gaziano,2 Daniele Marino,2 Augusto Orlandi3 1Department of Dermatology, 2Department of Microbiology, 3Department of Anatomic Pathology, University of Rome Tor Vergata, Rome, Italy Purpose: Fungal infections are a major complication in hematologic and neoplastic patients causing severe morbidity and mortality. Aspergillus fumigatus and Candida albicans are among the most invasive opportunistic pathogens in immunocompromised patients, and classic antifungal drugs are frequently unsuccessful in these patients. Recent reports hypothesize that the antifungal efficacy of all-trans retinoic acid (ATRA is mainly related to its strong capacity to stimulate monocyte-mediated immunity, but no consideration was given to its potential direct fungistatic activity. Moreover, ATRA offers the opportunity for systemic therapy. Methods and results: We investigated the efficacy of ATRA at different concentrations for its antifungal activity against opportunistic A. fumigatus and C. albicans obtained from clinical samples according to standard protocols. A fungistatic activity of ATRA on A. fumigatus and C. albicans at 0.5–1 mM concentration was documented up to 7 days. Conclusion: This is the first evidence of a direct and strong fungistatic activity of ATRA against A. fumigatus and C. albicans. The potential adjuvant therapeutic application of ATRA might be useful in the treatment and/or prevention of systemic mycoses in immunocompromised patients. The discovery of a direct fungistatic activity, in association with its reported immunomodulatory properties, makes ATRA an excellent candidate for new combined antifungal strategies for systemic mycoses in immunocompromised and cancer patients. Keywords: all-trans retinoic acid, fungistatic activity, fungal infections

  11. TREM-1 expression in rat corneal epithelium with Aspergillus fumigatus infection

    Institute of Scientific and Technical Information of China (English)

    Li-Ting; Hu; Zhao-Dong; Du; Gui-Qiu; Zhao; Sheng; Qiu; Nan; Jiang; Jing; Lin; Qian; Wang; Qiang; Xu


    AIM: To investigate the expression of triggering receptor expressed on myeloid cells-1(TREM-1) in the aberrant inflammation within the corneal epithelium at early period of fungal infection.METHODS: A total of 65 Wistar rats were randomly divided into control group, sham group and fungal keratitis(FK) group, in which the cornea was infected by Aspergillus fumigatus(A. fumigatus). After executed randomly at 8, 16, 24, 48 and 72 h after experimental model being established, the severity of keratomycosis in rats was scored visually with the aid of a dissecting microscope and slit lamp. Then corneas in three groups were collected to assess the expression of TREM-1through quantitative reverse transcription-polymerase chain reaction(RT-PCR), immunofluorescence technique and Western blot analysis. The correlation between FK inflammation and expression of TREM-1 was also analyzed.RESULTS: Corneal inflammation scores increased with time after fungal infection(F =49.74, P =0.000). The inflammation scores in FK group were obviously higher than those in sham group on the whole(F =137.78, P =0.000). Levels of TREM-1 in the infected rat corneal epithelium had elevated at 8h and peaked at 48h(P <0.001,compared with control group). Western blot analysis also showed an obviously elevated TREM-1 level in rat corneal epithelium at 24 h and 48 h after fungal infection.Immunofluorescence technique showed that TREM-1mainly existed in corneal epithelium and infected corneal stoma of rat. TREM-1 protein expression was enhanced after fungal infection. Moreover, severity of FK inflammation was significantly related to TREM-1expression in FK(r =0.942, P =0.000).CONCLUSION: TREM-1 may contribute to amplify theinflammation in the cornea infected with A. fumigatus and play critical roles in the battle against A. fumigatus in the innate immune responses.

  12. Transcriptional regulation of chemical diversity in Aspergillus fumigatus by LaeA.

    Directory of Open Access Journals (Sweden)

    Robyn M Perrin


    Full Text Available Secondary metabolites, including toxins and melanins, have been implicated as virulence attributes in invasive aspergillosis. Although not definitively proved, this supposition is supported by the decreased virulence of an Aspergillus fumigatus strain, DeltalaeA, that is crippled in the production of numerous secondary metabolites. However, loss of a single LaeA-regulated toxin, gliotoxin, did not recapitulate the hypovirulent DeltalaeA pathotype, thus implicating other toxins whose production is governed by LaeA. Toward this end, a whole-genome comparison of the transcriptional profile of wild-type, DeltalaeA, and complemented control strains showed that genes in 13 of 22 secondary metabolite gene clusters, including several A. fumigatus-specific mycotoxin clusters, were expressed at significantly lower levels in the DeltalaeA mutant. LaeA influences the expression of at least 9.5% of the genome (943 of 9,626 genes in A. fumigatus but positively controls expression of 20% to 40% of major classes of secondary metabolite biosynthesis genes such as nonribosomal peptide synthetases (NRPSs, polyketide synthases, and P450 monooxygenases. Tight regulation of NRPS-encoding genes was highlighted by quantitative real-time reverse-transcription PCR analysis. In addition, expression of a putative siderophore biosynthesis NRPS (NRPS2/sidE was greatly reduced in the DeltalaeA mutant in comparison to controls under inducing iron-deficient conditions. Comparative genomic analysis showed that A. fumigatus secondary metabolite gene clusters constitute evolutionarily diverse regions that may be important for niche adaptation and virulence attributes. Our findings suggest that LaeA is a novel target for comprehensive modification of chemical diversity and pathogenicity.

  13. AbaA and WetA govern distinct stages of Aspergillus fumigatus development. (United States)

    Tao, Li; Yu, Jae-Hyuk


    The opportunistic human pathogen Aspergillus fumigatus produces a massive number of asexual spores (conidia) as the primary means of dispersal, survival, genome protection and infection of hosts. In this report, we investigate the functions of two developmental regulators, AfuAbaA and AfuWetA, in A. fumigatus. The AfuabaA gene is predicted to encode an ATTS/TEA DNA-binding domain protein and is activated by AfuBrlA during the middle stage of A. fumigatus asexual development (conidiation). The deletion of AfuabaA results in the formation of aberrant conidiophores exhibiting reiterated cylinder-like terminal cells lacking spores. Furthermore, the absence of AfuabaA causes delayed autolysis and cell death, whereas the overexpression of AfuabaA accelerates these processes, indicating an additional role for AfuAbaA. The AfuwetA gene is sequentially activated by AfuAbaA in the late phase of conidiation. The deletion of AfuwetA causes the formation of defective spore walls and a lack of trehalose biogenesis, leading to a rapid loss of spore viability and reduced tolerance to various stresses. This is the first report to demonstrate that WetA is essential for trehalose biogenesis in conidia. Moreover, the absence of AfuwetA causes delayed germ-tube formation and reduced hyphal branching, suggesting a role of AfuWetA in the early phase of fungal growth. A genetic model depicting the regulation of conidiation in A. fumigatus is proposed. PMID:20966095

  14. Nonribosomal Peptide Synthetase Genes pesL and pes1 Are Essential for Fumigaclavine C Production in Aspergillus fumigatus

    DEFF Research Database (Denmark)

    O'Hanlon, Karen A.; Gallagher, Lorna; Schrettl, Markus;


    The identity of metabolites encoded by the majority of nonribosomal peptide synthetases in the opportunistic pathogen, Aspergillus fumigatus, remains outstanding. We found that the nonribosomal peptide (NRP) synthetases PesL and Pes1 were essential for fumigaclavine C biosynthesis, the end produc...

  15. Strategies for treating aspergillosis due to azole-resistant Aspergillus fumigatus : from the bench to the bedside

    NARCIS (Netherlands)

    Seyedmousavi Tasieh, S.


    In humans, Aspergillus fumigatus is the most common and life-threatening aerial fungal pathogen, especially among immunocompromised patients, with an overall mortality ranging between 30 to 88%. Azole antifungals, such as voriconazole and posaconazole, are recommended first choice drugs to manage as

  16. Absence of Respiratory Burst in X-linked Chronic Granulomatous Disease Mice Leads to Abnormalities in Both Host Defense and Inflammatory Response to Aspergillus fumigatus


    Morgenstern, David E.; Gifford, Mary A.C.; Li, Ling Lin; Doerschuk, Claire M.; Dinauer, Mary C.


    Mice with X-linked chronic granulomatous disease (CGD) generated by targeted disruption of the gp91 phox subunit of the NADPH–oxidase complex (X-CGD mice) were examined for their response to respiratory challenge with Aspergillus fumigatus. This opportunistic fungal pathogen causes infection in CGD patients due to the deficient generation of neutrophil respiratory burst oxidants important for damaging A. fumigatus hyphae. Alveolar macrophages from X-CGD mice were found to kill A. fumigatus co...

  17. Identification and Characterization of an Antifungal Protein, AfAFPR9, Produced by Marine-Derived Aspergillus fumigatus R9. (United States)

    Rao, Qi; Guo, Wenbin; Chen, Xinhua


    A fungal strain, R9, was isolated from the South Atlantic sediment sample and identified as Aspergillus fumigatus. An antifungal protein, AfAFPR9, was purified from the culture supernatant of Aspergillus fumigatus R9. AfAFPR9 was identified to be restrictocin, which is a member of the ribosome-inactivating proteins (RIPs), by MALDI-TOF-TOF-MS. AfAFPR9 displayed antifungal activity against plant pathogenic Fusarium oxysporum, Alternaria longipes, Colletotrichum gloeosporioides, Paecilomyces variotii, and Trichoderma viride at minimum inhibitory concentrations of 0.6, 0.6, 1.2, 1.2, and 2.4 μg/disc, respectively. Moreover, AfAFPR9 exhibited a certain extent of thermostability, and metal ion and denaturant tolerance. The iodoacetamide assay showed that the disulfide bridge in AfAFPR9 was indispensable for its antifungal action. The cDNA encoding for AfAFPR9 was cloned from A. fumigatus R9 by RTPCR and heterologously expressed in E. coli. The recombinant AfAFPR9 protein exhibited obvious antifungal activity against C. gloeosporioides, T. viride, and A. longipes. These results reveal the antifungal properties of a RIP member (AfAFPR9) from marine-derived Aspergillus fumigatus and indicated its potential application in controlling plant pathogenic fungi. PMID:25394604

  18. The concentration-dependent nature of in vitro amphotericin B-itraconazole interaction against Aspergillus fumigatus: isobolographic and response surface analysis of complex pharmacodynamic interactions.

    NARCIS (Netherlands)

    Meletiadis, J.; Dorsthorst, D.T.A. te; Verweij, P.E.


    The interaction between polyenes and azoles is not well understood. We therefore explored the in vitro combination of amphotericin B with itraconazole against 14 clinical Aspergillus fumigatus isolates (9 itraconazole susceptible and 5 itraconazole resistant) with a colorimetric broth microdilution

  19. Potent synergistic in vitro interaction between nonantimicrobial membrane-active compounds and itraconazole against clinical isolates of Aspergillus fumigatus resistant to itraconazole.

    NARCIS (Netherlands)

    Afeltra, J.; Vitale, R.G.; Mouton, J.W.; Verweij, P.E.


    To develop new approaches for the treatment of invasive infections caused by Aspergillus fumigatus, the in vitro interactions between itraconazole (ITZ) and seven different nonantimicrobial membrane-active compounds--amiodarone (AMD), amiloride, lidocaine, lansoprazole (LAN), nifedipine (NIF), verap

  20. Dexamethasone enhances invasiveness of Aspergillus fumigatus conidia and fibronectin expression in A549 cells

    Institute of Scientific and Technical Information of China (English)

    LI Tao; LI Jing-chao; QI Qian; LI Yu


    Background The efficacies of current treatments for invasive aspergillus (IA) are unsatisfactory and new therapeutic targets or regimens to treat IA are urgently needed.Previous studies have indicated that the ability of conidia to invade host cells is critical in IA development and fibronectin has a hand in the conidia adherence process.In the clinical setting,many patients who receive glucocorticoid for extended periods are susceptible to Aspergillus fumigatus (A.fumigatus) infection,for this reason we investigated the effect of glucocorticoid on conidia invasiveness by comparing the invasiveness of A.fumigatus conidia in the type Ⅱ human alveolar cell line (A549) cultured with different concentrations of dexamethasone.We also explored the relationships between dexamethasone and fibronectin expression.Methods Following culture with anti-fibronectin antibodies and/or dexamethasone,type Ⅱ human alveolar A549 cells were infected with conidia of A.fumigatus.After 4 hours,the extracellular free conidia were washed away and the remaining immobilized conidia were released using Triton-X 100 and quantified by counting the colony-forming units.The invasiveness of conidia was measured by calculating the invasion rate (%).The transcription of the fibronectin gene in cells cultured with different concentrations of dexamethasone for 24 hours was tested by fiuorogenic quantitative RT-PCR while the expression of fibronectinin cells cultured for 48 hours was tested by Western blotting and immunocytochemistry.Results A significant reduction in the invasiveness of conidia was seen in the cells cultured with anti-fibronectin antibody ((14.42±1.68)% vs.(19.17±2.53)%,P <0.05),but no significant difference was observed in cells cultured with a combination of anti-fibronectin antibody and dexamethasone (6.37×10-5 mol/L).There was no correlation between the dexamethasone concentration and the invasiveness of conidia after dexamethasone pretreatment of cells for 4 hours

  1. Iron – a key nexus in the virulence of Aspergillus fumigatus

    Directory of Open Access Journals (Sweden)



    Full Text Available Iron is an essential but in excess toxic nutrient. Therefore, fungi evolved fine-tuned mechanisms for uptake and storage of iron, such as the production of siderophores (low-molecular mass iron-specific chelators. In Aspergillus fumigatus, iron starvation causes extensive transcriptional remodeling involving two central transcription factors, which are interconnected in a negative transcriptional feed-back loop: the GATA-factor SreA and the bZip-factor HapX. During iron sufficiency SreA represses iron uptake, including reductive iron assimilation and siderophore-mediated iron uptake, to avoid toxic effects. During iron starvation HapX represses iron-consuming pathways, including heme biosynthesis and respiration, to spare iron and activates synthesis of ribotoxin AspF1 and siderophores, the latter partly by ensuring supply of the precursor ornithine. In agreement with the expression pattern and mode of action, detrimental effects of inactivation of SreA and HapX are confined to growth during iron sufficiency and iron starvation, respectively. Deficiency in HapX, but not SreA, attenuates virulence of A. fumigatus in a murine model of aspergillosis, which underlines the crucial role of adaptation to iron limitation in virulence. Consistently, production of both extra- and intracellular siderophores is crucial for virulence of A. fumigatus. Recently, the sterol-regulatory element-binding protein SrbA was found to be essential for adaptation to iron starvation, thereby linking regulation of iron metabolism, ergosterol biosynthesis, azole drug resistance and hypoxia adaptation.

  2. Antígenos nativos de Aspergillus fumigatus con utilidad para el inmunodiagnóstico de aspergiloma


    José Casquero; Flor Urcia; Elizabeth Sánchez


    Con el objetivo de evaluar la utilidad de los antígenos nativos de cepas autóctonas de Aspergillus fumigatus para el inmunodiagnóstico de aspergiloma, se desarrolló un estudio empleando dos cepas de ese hongo, aisladas de pacientes con diagnóstico de aspergiloma (533 y 554), los cuales fueron confrontados con sueros controles comerciales de A. fumigatus, A. flavus, A. niger, Candida, Coccidioides, Histoplasma y Paracoccidioides mediante la prueba de inmunodifusión, asimismo, se evaluaron fren...

  3. Deciphering the Counterplay of Aspergillus fumigatus Infection and Host Inflammation by Evolutionary Games on Graphs (United States)

    Pollmächer, Johannes; Timme, Sandra; Schuster, Stefan; Brakhage, Axel A.; Zipfel, Peter F.; Figge, Marc Thilo


    Microbial invaders are ubiquitously present and pose the constant risk of infections that are opposed by various defence mechanisms of the human immune system. A tight regulation of the immune response ensures clearance of microbial invaders and concomitantly limits host damage that is crucial for host viability. To investigate the counterplay of infection and inflammation, we simulated the invasion of the human-pathogenic fungus Aspergillus fumigatus in lung alveoli by evolutionary games on graphs. The layered structure of the innate immune system is represented by a sequence of games in the virtual model. We show that the inflammatory cascade of the immune response is essential for microbial clearance and that the inflammation level correlates with the infection-dose. At low infection-doses, corresponding to daily inhalation of conidia, the resident alveolar macrophages may be sufficient to clear infections, however, at higher infection-doses their primary task shifts towards recruitment of neutrophils to infection sites.


    Directory of Open Access Journals (Sweden)

    Tri Indah


    Full Text Available The endophytic fungi Aspergillus fumigatus was isolated from the tissues of the fruits of Garcinia griffithii. The fungalstrain was identified from the colony, and it was characteristic of cell morphology. The ethyl acetate extracts derivedfrom fungus cultures showed major spots on TLC under UV light, which was continued to the isolation of thesecondary metabolites. The structure of the isolated compound was elucidated on the basis of NMR analyses (1H-NMR,13C-NMR, HMQC, HMBC and H-H COSY. The compounds were identified as: 4,6-dihydroxy, 3,8a-dimethyl-1-oxo-5-(3’-oxobutan-2’-yl-1,4,4a,5,6,8a-hexahydronaphthalen-2-yl-1”,2”-dimethyl-5”-(2”’-methylprop-1”’-enylcyclopentanecarboxylate.

  5. Development of Novel PCR Assays To Detect Azole Resistance-Mediating Mutations of the Aspergillus fumigatus cyp51A Gene in Primary Clinical Samples from Neutropenic Patients


    Spiess, Birgit; Seifarth, Wolfgang; Merker, Natalia; Howard, Susan J.; Reinwald, Mark; Dietz, Anne; Hofmann, Wolf-Karsten; Buchheidt, Dieter


    The increasing incidence of azole resistance in Aspergillus fumigatus causing invasive aspergillosis (IA) in immunocompromised/hematological patients emphasizes the need to improve the detection of resistance-mediating cyp51A gene mutations from primary clinical samples, particularly as the diagnosis of invasive aspergillosis is rarely based on a positive culture yield in this group of patients. We generated primers from the unique sequence of the Aspergillus fumigatus cyp51A gene to establis...

  6. Column bioleaching of arsenic and Heavy metals from gold mine tailings by aspergillus fumigatus

    International Nuclear Information System (INIS)

    A column bioleaching experiment was carried out to compare the effectiveness of the fungus Aspergillus fumigatus to bioleach arsenic (As) and heavy metals from the tailings using two different methods. In the first method, which is named as distribution method (DM), the fungus was distributed in the column by means of vertical and horizontal layers of coarse sand. In the other method, named as surface applied method (SAM), the fungus was cultivated on the surface of the tailings, which was covered with a few centimeters of coarse sand. Results showed that in the DM, oxalic acid production was stimulated and maximum removal of As, Fe, Mn, and Zn was 53, 51, 81, and 62%, respectively. However, Pb removal was low (8%), which might be due to the precipitation of Pb as its oxalates. On the other hand, the maximum removal of As, Fe, Mn, Pb, and Zn were 22, 28, 37, 64, and 34%, respectively, for the SAM. Results of the sequential extraction study showed that the DM was effective in removing the water soluble, exchangeable, carbonate, and Fe/Mn oxide fractions of As, Fe, Mn, and Zn. Our study suggested that A. fumigatus has a potential to be used in remediation of heavy metal contaminated sites. Distributing the fungus throughout the entire tailings columns improved the bioleaching of heavy metals by the fungus. (Copyright copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  7. Column bioleaching of arsenic and Heavy metals from gold mine tailings by aspergillus fumigatus

    Energy Technology Data Exchange (ETDEWEB)

    Seh-Bardan, Bahi Jalili; Othman, Radziah; Ab Wahid, Samsuri; Husin, Aminudin; Sadegh-Zadeh, Fardin [Faculty of Agriculture, Department of Land Management, Universiti Putra Malaysia, Serdang, Selangor (Malaysia)


    A column bioleaching experiment was carried out to compare the effectiveness of the fungus Aspergillus fumigatus to bioleach arsenic (As) and heavy metals from the tailings using two different methods. In the first method, which is named as distribution method (DM), the fungus was distributed in the column by means of vertical and horizontal layers of coarse sand. In the other method, named as surface applied method (SAM), the fungus was cultivated on the surface of the tailings, which was covered with a few centimeters of coarse sand. Results showed that in the DM, oxalic acid production was stimulated and maximum removal of As, Fe, Mn, and Zn was 53, 51, 81, and 62%, respectively. However, Pb removal was low (8%), which might be due to the precipitation of Pb as its oxalates. On the other hand, the maximum removal of As, Fe, Mn, Pb, and Zn were 22, 28, 37, 64, and 34%, respectively, for the SAM. Results of the sequential extraction study showed that the DM was effective in removing the water soluble, exchangeable, carbonate, and Fe/Mn oxide fractions of As, Fe, Mn, and Zn. Our study suggested that A. fumigatus has a potential to be used in remediation of heavy metal contaminated sites. Distributing the fungus throughout the entire tailings columns improved the bioleaching of heavy metals by the fungus. (Copyright copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  8. Nanoscale biophysical properties of the cell surface galactosaminogalactan from the fungal pathogen Aspergillus fumigatus (United States)

    Beaussart, Audrey; El-Kirat-Chatel, Sofiane; Fontaine, Thierry; Latgé, Jean-Paul; Dufrêne, Yves F.


    Many fungal pathogens produce cell surface polysaccharides that play essential roles in host-pathogen interactions. In Aspergillus fumigatus, the newly discovered polysaccharide galactosaminogalactan (GAG) mediates adherence to a variety of substrates through molecular mechanisms that are poorly understood. Here we use atomic force microscopy to unravel the localization and adhesion of GAG on living fungal cells. Using single-molecule imaging with tips bearing anti-GAG antibodies, we found that GAG is massively exposed on wild-type (WT) germ tubes, consistent with the notion that this glycopolymer is secreted by the mycelium of A. fumigatus, while it is lacking on WT resting conidia and on germ tubes from a mutant (Δuge3) deficient in GAG. Imaging germ tubes with tips bearing anti-β-glucan antibodies shows that exposure of β-glucan is strongly increased in the Δuge3 mutant, indicating that this polysaccharide is masked by GAG during hyphal growth. Single-cell force measurements show that expression of GAG on germ tubes promotes specific adhesion to pneumocytes and non-specific adhesion to hydrophobic substrates. These results provide a molecular foundation for the multifunctional adhesion properties of GAG, thus suggesting it could be used as a potential target in anti-adhesion therapy and immunotherapy. Our methodology represents a powerful approach for characterizing the nanoscale organization and adhesion of cell wall polysaccharides during fungal morphogenesis, thereby contributing to increase our understanding of their role in biofilm formation and immune responses.

  9. Biological synthesis and characterization of intracellular gold nanoparticles using biomass of Aspergillus fumigatus

    Indian Academy of Sciences (India)

    Pranav Vasanthi Bathrinarayanan; Dilliganesh Thangavelu; Vasanth Kumar Muthukumarasamy; Chamundeeswari Munusamy; Baskar Gurunathan


    Nanotechnology is emerging as one of the most important and revolutionizing area in research field. Nanoparticles are produced by various methods like physical, chemical, mechanical and biological. Biological methods of reduction of metal ions using plants or microorganisms are often preferred because they are clean, nontoxic, safe, biocompatible and environmentally acceptable. In the present study, Aspergillus fumigatus was used for the intracellular synthesis of gold nanoparticles. Stable nanoparticles were produced when an aqueous solution of chloroauric acid (HAuCl4) was reduced by A. fumigatus biomass as the reducing agent. Production of nanoparticles was confirmed by the colour change from yellow to pinkish violet after ∼72 h of reaction. The produced nanoparticles were then characterized by Fourier transform infrared spectroscopy (FT–IR), scanning electron microscope (SEM), energy dispersive spectroscopy (EDS) and X-ray diffraction spectroscopy (XRD). SEM images of sample revealed that the nanoparticles were spherical, irregularly shaped with indefinite morphology. Biosynthesized gold nanoparticles were in the range of 85.1–210 nm in size. The presence of gold nanoparticle was confirmed by EDS analysis. Crystalline nature and face-centred cubic structure of synthesized gold nanoparticle was confirmed by XRD pattern.

  10. Production of xylanases and cellulases by aspergillus fumigatus ms16 using crude lignocellulosic substrates

    International Nuclear Information System (INIS)

    Xylanolytic and cellulolytic potential of a soil isolate, Aspergillus fumigatus (MS16) was studied by growing it on a variety of lignocellulosics, purified cellulose and xylan supplemented media. It was noted that carboxymethyl cellulose, salicin and xylan induce the -glucosidase and xylanase, respectively production of endoglucanase. The study revealed that Aspergillus fumigatus (MS16) co-secretes xylanase and cellulase in the presence of xylan; the ratio of the two enzymes was influenced by the initial pH of the medium. The maximum titers of xylanase and cellulase were noted at initial pH of 5.0. Relatively higher titers of both the enzymes were obtained when the fungus was cultivated at 35 degree C. Whereas, cellulase production was not detected when the fungus was cultivated at 40 degree C. The volumetric productivity (Qp) of xylanase was much higher than cellulases. The organism produced 2-3 folds higher titers of xylanase when grown on lignocellulosic materials in submerged cultivation than under solid-state cultivation, suggesting a different pattern of enzyme production in presence and in absence of free water. The partial characterization of enzymes showed that xylanase from this organism has -glucosidase. The higher melting temperature than endoglucanase and optimum temperature for activity was higher for xylanases than cellulases, whereas the optimum pH differed slightly i.e. in the range of 4.0-5.0. Enzyme preparation from this organism was loaded on some crude substrates and it showed that the enzyme preparation can be used to hydrolyze a variety of vegetable and agricultural waste materials. (author)

  11. Calcineurin Orchestrates Hyphal Growth, Septation, Drug Resistance and Pathogenesis of Aspergillus fumigatus: Where Do We Go from Here?

    Directory of Open Access Journals (Sweden)

    Praveen R Juvvadi


    Full Text Available Studies on fungal pathogens belonging to the ascomycota phylum are critical given the ubiquity and frequency with which these fungi cause infections in humans. Among these species, Aspergillus fumigatus causes invasive aspergillosis, a leading cause of death in immunocompromised patients. Fundamental to A. fumigatus pathogenesis is hyphal growth. However, the precise mechanisms underlying hyphal growth and virulence are poorly understood. Over the past 10 years, our research towards the identification of molecular targets responsible for hyphal growth, drug resistance and virulence led to the elucidation of calcineurin as a key signaling molecule governing these processes. In this review, we summarize our salient findings on the significance of calcineurin for hyphal growth and septation in A. fumigatus and propose future perspectives on exploiting this pathway for designing new fungal-specific therapeutics.

  12. Dexamethasone increases susceptibility of Aspergillus fumigatus to hydrogen peroxide via down-regulation of Afyapl gene expression in vitro

    Institute of Scientific and Technical Information of China (English)

    XU Hui; LI Li-juan; WAN Zhe; LI Ruo-yu; LIU Wei


    Background Glucocorticoid is speculated to be able to have Aspergillus fumigatus (A.fumigatus) being more susceptible to reactive oxygen species (ROS) by inhibiting Afyap1,the transcription factor activating protein-1 (AP-1)homologue in A.fumigatus,which may provide a clue to expand the clinical use of glucocorticoid in patients with fungal infections.In this study,we used dexamethasone to determine the direct effect on oxidative killing susceptibility of A.fumigatus in vitro,as well as the expression level of Afyap1 gene and its target genes (catalase and superoxide dismutase (SOD) genes).Methods A.fumigatus spores were treated with different concentrations (0,0.02,0.2 mg/ml) of glucocorticoids and assigned to four groups (A:0.5 hour,B:2 hours,C:7 hours,D:16 hours) according to the time of treatment.The H2O2 oxidative killing assay was done,using the standard method-spot test,in each group of A.fumigatus.We measured the oxidative killing susceptibility as well as the expression level of the gene Afyap1,CATA,SOD1 and SOD2in A.fumigatus at each group.The antifungal susceptibility to itraconazole and amphotericin B in each group of A.fumigatus was also measured with M38-A2 method.Results The oxidative killing susceptibility of A.fumigatus was increased,consistent with the reduction of Afyap1,CATA,SOD1 and SOD2 gene expression level after being treated with dexamethasone for 0.5 hours.However,these observations were disappeared along with being treated for longer time.The antifungal susceptibility to itraconazole and amphotericin B in the A.fumigatus strains treated with dexamethasone indicated no change,compared with those without dexamethasone treatment.Conclusion Dexamethasone can have A.fumigatus being more susceptible to ROS when treated for shorter period (0.5 to 2 hours) via the reduction of Afyap1 gene expression as well as the down-stream enzyme-coding gene expression.

  13. Azole-resistant Aspergillus fumigatus in Denmark: a laboratory-based study on resistance mechanisms and genotypes. (United States)

    Jensen, R H; Hagen, F; Astvad, K M T; Tyron, A; Meis, J F; Arendrup, M C


    Azole-resistant Aspergillus fumigatus originating from the environment as well as induced during therapy are continuously emerging in Danish clinical settings. We performed a laboratory-based retrospective study (2010-2014) of azole resistance and genetic relationship of A. fumigatus at the national mycology reference laboratory of Denmark. A total of 1162 clinical and 133 environmental A. fumigatus isolates were identified by morphology, thermotolerance and/or β-tubulin sequencing. Screening for azole resistance was carried out using azole agar, and resistant isolates were susceptibility tested by the EUCAST (European Committee on Antimicrobial Susceptibility Testing) E.Def 9.2 reference method and CYP51A sequenced. Genotyping was performed for outbreak investigation and, when appropriate, short tandem repeat Aspergillus fumigatus microsatellite assay. All 133 environmental A. fumigatus isolates were azole susceptible. However, from 2010 to 2014, there was an increasing prevalence of azole resistance (from 1.4 to 6% isolates (p 50% of the azole resistance mechanisms. Among 184 Danish A. fumigatus isolates, 120 unique genotypes were identified and compared to a collection of 1822 international genotypes. Seven (5.8%) Danish genotypes were shared between isolates within Denmark but with different origin, 19 (15.8%) were shared with foreign genotypes, and two (11.8%) of 17 genotypes of isolates carrying the TR34/L98H resistance mechanisms were identical to two Dutch TR34/L98H isolates. Our findings underlines the demand for correct identification and susceptibility testing of clinical mould isolates. Furthermore, although complex, genotyping supported the hypotheses regarding clonal expansion and the potential of a single origin for the TR34/L98H clone. PMID:27091095

  14. Amphotericin B enhances the synthesis and release of the immunosuppressive agent gliotoxin from the pulmonary pathogen Aspergillus fumigatus


    Reeves, Emer P.; Murphy, Thomas; Daly, Paul; Kavanagh, Kevin


    Exposure of the pulmonary pathogen Aspergillus fumigatus to amphotericin B alters membrane permeability as indicated by the escape of amino acids and protein from the mycelium. Amphotericin B exposure for periods of 2-4 h also leads to increased release of the immunosuppressive agent gliotoxin into the surrounding culture medium. Examination of the intracellular gliotoxin concentration following exposure to amphotericin B indicated elevated levels within the hyphae as well as in t...

  15. Association of a Myosin Immunoanalogue with Cell Envelopes of Aspergillus fumigatus Conidia and Its Participation in Swelling and Germination


    Esnault, Karine; el Moudni, Brahim; Bouchara, Jean-Philippe; Chabasse, Dominique; Tronchin, Guy


    A myosin immunoanalogue was identified in conidia of Aspergillus fumigatus by Western blotting, indirect immunofluorescence assay, and gold immunoelectron microscopy with two different antimyosin antibodies. The distribution pattern of this protein was followed during the early stages of germination. A single 180-kDa polypeptide, detected predominantly in a cell envelope extract, was found to cross-react with monoclonal and polyclonal antibodies raised against vertebrate muscle myosin. Immuno...

  16. Automated and Manual Methods of DNA Extraction for Aspergillus fumigatus and Rhizopus oryzae Analyzed by Quantitative Real-Time PCR▿


    Francesconi, Andrea; Kasai, Miki; Harrington, Susan M.; Beveridge, Mara G; Petraitiene, Ruta; Petraitis, Vidmantas; Schaufele, Robert L.; Walsh, Thomas J.


    Quantitative real-time PCR (qPCR) may improve the detection of fungal pathogens. Extraction of DNA from fungal pathogens is fundamental to optimization of qPCR; however, the loss of fungal DNA during the extraction process is a major limitation to molecular diagnostic tools for pathogenic fungi. We therefore studied representative automated and manual extraction methods for Aspergillus fumigatus and Rhizopus oryzae. Both were analyzed by qPCR for their ability to extract DNA from propagules a...

  17. Activity and Safety of Inhaled Itraconazole Nanosuspension in a Model Pulmonary Aspergillus fumigatus Infection in Inoculated Young Quails


    Wlaź, Piotr; Knaga, Sebastian; Kasperek, Kornel; Wlaź, Aleksandra; Poleszak, Ewa; Jeżewska-Witkowska, Grażyna; Winiarczyk, Stanisław; Wyska, Elżbieta; Heinekamp, Thorsten; Rundfeldt, Chris


    Pulmonary aspergillosis is frequently reported in parrots, falcons, and other birds held in captivity. Inhalation is the main route of infection for Aspergillus fumigatus, resulting in both acute and chronic disease conditions. Itraconazole (ITRA) is an antifungal commonly used in birds, but its administration requires repeated oral dosing, and the safety margin is narrow. To investigate the efficacy of inhaled ITRA, six groups of ten young quails (Coturnix japonica) were inoculated intratrac...

  18. Development stage-specific proteomic profiling uncovers small, lineage specific proteins most abundant in the Aspergillus Fumigatus conidial proteome


    Suh Moo-Jin; Fedorova Natalie D; Cagas Steven E; Hastings Susan; Fleischmann Robert D; Peterson Scott N; Perlin David S; Nierman William C; Pieper Rembert; Momany Michelle


    Abstract Background The pathogenic mold Aspergillus fumigatus is the most frequent infectious cause of death in severely immunocompromised individuals such as leukemia and bone marrow transplant patients. Germination of inhaled conidia (asexual spores) in the host is critical for the initiation of infection, but little is known about the underlying mechanisms of this process. Results To gain insights into early germination events and facilitate the identification of potential stage-specific b...

  19. Small ncRNA transcriptome analysis from Aspergillus fumigatus suggests a novel mechanism for regulation of protein synthesis


    Jöchl, Christoph; Rederstorff, Mathieu; Hertel, Jana; Stadler, Peter F.; Hofacker, Ivo L.; Schrettl, Markus; Haas, Hubertus; Hüttenhofer, Alexander


    Small non-protein-coding RNAs (ncRNAs) have systematically been studied in various model organisms from Escherichia coli to Homo sapiens. Here, we analyse the small ncRNA transcriptome from the pathogenic filamentous fungus Aspergillus fumigatus. To that aim, we experimentally screened for ncRNAs, expressed under various growth conditions or during specific developmental stages, by generating a specialized cDNA library from size-selected small RNA species. Our screen revealed 30 novel ncRNA c...

  20. Herstellung und Charakterisierung monoklonaler Antikörper gegen sezernierte Moleküle des humanpathogenen Schimmelpilzes Aspergillus fumigatus


    Heesemann, Leonie


    Aspergillus fumigatus ist der häufigste zum Tode führende opportunistische Erreger invasiver Mykosen des Menschen. Durch den zunehmenden Einsatz von Immunsuppressiva und agressiverer Chemotherapieschemata, aber auch durch Zunahme von Organ- und Stammzelltransplantationen, steigt die Zahl abwehrgeschwächter Patienten stetig an und mit ihnen die Zahl der Invasiven Aspergillosen. Bei steigender Inzidenz blieb die Letalität trotz weiterentwickelten Therapiemöglichkeiten in den letzten Jahren nahe...

  1. Surface Structure Characterization of Aspergillus fumigatus Conidia Mutated in the Melanin Synthesis Pathway and Their Human Cellular Immune Response


    Bayry, J.; Beaussart, A.; Dufrene, Y. F.; Sharma, M.; Bansal, K.; O. Kniemeyer; Aimanianda, V.; Brakhage, A. A.; Kaveri, S. V.; Kwon-Chung, K J; Latge, J.-P.; Beauvais, A.


    In Aspergillus fumigatus, the conidial surface contains dihydroxynaphthalene (DHN)-melanin. Six-clustered gene products have been identified that mediate sequential catalysis of DHN-melanin biosynthesis. Melanin thus produced is known to be a virulence factor, protecting the fungus from the host defense mechanisms. In the present study, individual deletion of the genes involved in the initial three steps of melanin biosynthesis resulted in an altered conidial surface with masked surface rodle...

  2. Ergosterol biosynthesis in Aspergillus fumigatus: its relevance as an antifungal target and role in antifungal drug resistance


    Alcazar-Fuoli, Laura; Mellado, Emilia


    Ergosterol, the major sterol of fungal membranes, is essential for developmental growth and the main target of antifungals that are currently used to treat fatal fungal infections. Emergence of resistance to existing antifungals is a current problem and several secondary resistance mechanisms have been described in Aspergillus fumigatus clinical isolates. A full understanding of ergosterol biosynthetic control therefore appears to be essential for improvement of antifungal efficacy and to pre...

  3. Aspergillus antigen testing in bone marrow transplant recipients


    Williamson, E; Oliver, D.; Johnson, E.; Foot, A.; D. Marks; Warnock, D.


    Aims—To assess the clinical usefulness of a commercial aspergillus antigen enzyme linked immunosorbent assay (ELISA) in the diagnosis of invasive aspergillosis (IA) in bone marrow transplant recipients, and to compare it with a commercial latex agglutination (LA) test.

  4. Verruculogen associated with Aspergillus fumigatus hyphae and conidia modifies the electrophysiological properties of human nasal epithelial cells

    Directory of Open Access Journals (Sweden)

    Cordonnier Catherine


    Full Text Available Abstract Background The role of Aspergillus fumigatus mycotoxins in the colonization of the respiratory tract by conidia has not been studied extensively, even though patients at risk from invasive aspergillosis frequently exhibit respiratory epithelium damage. In a previous study, we found that filtrates of A. fumigatus cultures can specifically alter the electrophysiological properties of human nasal epithelial cells (HNEC compared to those of non pathogenic moulds. Results We fractionated the organic phase of filtrate from 3-day old A. fumigatus cultures using high-performance liquid chromatography. The different fractions were tested for their ability to modify the electrophysiological properties of HNEC in an in vitro primary culture model. The fraction collected between 20 and 30 min mimicked the effects of the whole filtrate, i.e. decrease of transepithelial resistance and increase of potential differences, and contained secondary metabolites such as helvolic acid, fumagillin, and verruculogen. Only verruculogen (10-8 M had effects similar to the whole filtrate. We verified that verruculogen was produced by a collection of 67 human, animal, plant and environmental A. fumigatus isolates. Using MS-MS analysis, we found that verruculogen was associated with both mycelium and conidia extracts. Conclusion Verruculogen is a secondary metabolite that modifies the electrophysiological properties of HNEC. The role of these modifications in the colonization and invasion of the respiratory epithelium by A. fumigatus on first contact with the epithelium remains to be determined.

  5. Preclinical evaluation of two {sup 68}Ga-siderophores as potential radiopharmaceuticals for Aspergillus fumigatus infection imaging

    Energy Technology Data Exchange (ETDEWEB)

    Petrik, Milos [Innsbruck Medical University, Clinical Department of Nuclear Medicine, Innsbruck (Austria); Palacky University, Laboratory of Experimental Medicine, Institute of Molecular and Translational Medicine, Olomouc (Czech Republic); Franssen, Gerben M.; Laverman, Peter [Radboud University Nijmegen Medical Center, Department of Nuclear Medicine, Nijmegen (Netherlands); Haas, Hubertus; Schrettl, Markus [Innsbruck Medical University, Division of Molecular Biology/Biocenter, Innsbruck (Austria); Hoertnagl, Caroline; Lass-Floerl, Cornelia [Innsbruck Medical University, Department of Hygiene, Microbiology and Social Medicine, Innsbruck (Austria); Helbok, Anna; Decristoforo, Clemens [Innsbruck Medical University, Clinical Department of Nuclear Medicine, Innsbruck (Austria)


    Invasive pulmonary aspergillosis is mainly caused by Aspergillus fumigatus, and is one of the major causes of morbidity and mortality in immunocompromised patients. The mortality associated with invasive pulmonary aspergillosis remains high, mainly due to the difficulties and limitations in diagnosis. We have shown that siderophores can be labelled with {sup 68}Ga and can be used for PET imaging of A. fumigatus infection in rats. Here we report on the further evaluation of the most promising {sup 68}Ga-siderophore candidates, triacetylfusarinine (TAFC) and ferrioxamine E (FOXE). Siderophores were labelled with {sup 68}Ga using acetate buffer. Log P, protein binding and stability values were determined. Uptake by A. fumigatus was studied in vitro in cultures with high and low iron loads. In vivo biodistribution was determined in normal mice and an infection model was established using neutropenic rats inoculated with A. fumigatus. Static and dynamic {mu}PET imaging was performed and correlated with CT images, and lung infection was evaluated ex vivo. {sup 68}Ga-siderophores were labelled with high radiochemical purity and specific activity. {sup 68}Ga-TAFC and {sup 68}Ga-FOXE showed high uptake by A. fumigatus in iron-deficient cultures. In normal mice, {sup 68}Ga-TAFC and {sup 68}Ga-FOXE showed rapid renal excretion with high metabolic stability. In the rat infection model focal lung uptake was detected by {mu}PET with both compounds and increased with severity of the infection, correlating with abnormal CT images. {sup 68}Ga-TAFC and {sup 68}Ga-FOXE displayed excellent in vitro stability and high uptake by A. fumigatus. Both compounds showed excellent pharmacokinetics, highly selective accumulation in infected lung tissue and good correlation with severity of disease in a rat infection model, which makes them promising agents for A. fumigatus infection imaging. (orig.)

  6. Genes differentially expressed in conidia and hyphae of Aspergillus fumigatus upon exposure to human neutrophils.

    Directory of Open Access Journals (Sweden)

    Janyce A Sugui

    Full Text Available BACKGROUND: Aspergillus fumigatus is the most common etiologic agent of invasive aspergillosis in immunocompromised patients. Several studies have addressed the mechanism involved in host defense but only few have investigated the pathogen's response to attack by the host cells. To our knowledge, this is the first study that investigates the genes differentially expressed in conidia vs hyphae of A. fumigatus in response to neutrophils from healthy donors as well as from those with chronic granulomatous disease (CGD which are defective in the production of reactive oxygen species. METHODOLOGY/PRINCIPAL FINDINGS: Transcriptional profiles of conidia and hyphae exposed to neutrophils, either from normal donors or from CGD patients, were obtained by using the genome-wide microarray. Upon exposure to either normal or CGD neutrophils, 244 genes were up-regulated in conidia but not in hyphae. Several of these genes are involved in the degradation of fatty acids, peroxisome function and the glyoxylate cycle which suggests that conidia exposed to neutrophils reprogram their metabolism to adjust to the host environment. In addition, the mRNA levels of four genes encoding proteins putatively involved in iron/copper assimilation were found to be higher in conidia and hyphae exposed to normal neutrophils compared to those exposed to CGD neutrophils. Deletants in several of the differentially expressed genes showed phenotypes related to the proposed functions, i.e. deletants of genes involved in fatty acid catabolism showed defective growth on fatty acids and the deletants of iron/copper assimilation showed higher sensitivity to the oxidative agent menadione. None of these deletants, however, showed reduced resistance to neutrophil attack. CONCLUSION: This work reveals the complex response of the fungus to leukocytes, one of the major host factors involved in antifungal defense, and identifies fungal genes that may be involved in establishing or prolonging

  7. Multiple-locus variable-number tandem repeat analysis for molecular typing of Aspergillus fumigatus

    Directory of Open Access Journals (Sweden)

    Chermette René


    Full Text Available Abstract Background Multiple-locus variable-number tandem repeat (VNTR analysis (MLVA is a prominent subtyping method to resolve closely related microbial isolates to provide information for establishing genetic patterns among isolates and to investigate disease outbreaks. The usefulness of MLVA was recently demonstrated for the avian major pathogen Chlamydophila psittaci. In the present study, we developed a similar method for another pathogen of birds: the filamentous fungus Aspergillus fumigatus. Results We selected 10 VNTR markers located on 4 different chromosomes (1, 5, 6 and 8 of A. fumigatus. These markers were tested with 57 unrelated isolates from different hosts or their environment (53 isolates from avian species in France, China or Morocco, 3 isolates from humans collected at CHU Henri Mondor hospital in France and the reference strain CBS 144.89. The Simpson index for individual markers ranged from 0.5771 to 0.8530. A combined loci index calculated with all the markers yielded an index of 0.9994. In a second step, the panel of 10 markers was used in different epidemiological situations and tested on 277 isolates, including 62 isolates from birds in Guangxi province in China, 95 isolates collected in two duck farms in France and 120 environmental isolates from a turkey hatchery in France. A database was created with the results of the present study Three major clusters of isolates were defined by using the graphing algorithm termed Minimum Spanning Tree (MST. The first cluster comprised most of the avian isolates collected in the two duck farms in France, the second cluster comprised most of the avian isolates collected in poultry farms in China and the third one comprised most of the isolates collected in the turkey hatchery in France. Conclusions MLVA displayed excellent discriminatory power. The method showed a good reproducibility. MST analysis revealed an interesting clustering with a

  8. A murine inhalation model to characterize pulmonary exposure to dry Aspergillus fumigatus conidia.

    Directory of Open Access Journals (Sweden)

    Amanda D Buskirk

    Full Text Available Most murine models of fungal exposure are based on the delivery of uncharacterized extracts or liquid conidia suspensions using aspiration or intranasal approaches. Studies that model exposure to dry fungal aerosols using whole body inhalation have only recently been described. In this study, we aimed to characterize pulmonary immune responses following repeated inhalation of conidia utilizing an acoustical generator to deliver dry fungal aerosols to mice housed in a nose only exposure chamber. Immunocompetent female BALB/cJ mice were exposed to conidia derived from Aspergillus fumigatus wild-type (WT or a melanin-deficient (Δalb1 strain. Conidia were aerosolized and delivered to mice at an estimated deposition dose of 1×105 twice a week for 4 weeks (8 total. Histopathological and immunological endpoints were assessed 4, 24, 48, and 72 hours after the final exposure. Histopathological analysis showed that conidia derived from both strains induced lung inflammation, especially at 24 and 48 hour time points. Immunological endpoints evaluated in bronchoalveolar lavage fluid (BALF and the mediastinal lymph nodes showed that exposure to WT conidia led to elevated numbers of macrophages, granulocytes, and lymphocytes. Importantly, CD8+ IL17+ (Tc17 cells were significantly higher in BALF and positively correlated with germination of A. fumigatus WT spores. Germination was associated with specific IgG to intracellular proteins while Δalb1 spores elicited antibodies to cell wall hydrophobin. These data suggest that inhalation exposures may provide a more representative analysis of immune responses following exposures to environmentally and occupationally prevalent fungal contaminants.

  9. A murine inhalation model to characterize pulmonary exposure to dry Aspergillus fumigatus conidia. (United States)

    Buskirk, Amanda D; Green, Brett J; Lemons, Angela R; Nayak, Ajay P; Goldsmith, W Travis; Kashon, Michael L; Anderson, Stacey E; Hettick, Justin M; Templeton, Steven P; Germolec, Dori R; Beezhold, Donald H


    Most murine models of fungal exposure are based on the delivery of uncharacterized extracts or liquid conidia suspensions using aspiration or intranasal approaches. Studies that model exposure to dry fungal aerosols using whole body inhalation have only recently been described. In this study, we aimed to characterize pulmonary immune responses following repeated inhalation of conidia utilizing an acoustical generator to deliver dry fungal aerosols to mice housed in a nose only exposure chamber. Immunocompetent female BALB/cJ mice were exposed to conidia derived from Aspergillus fumigatus wild-type (WT) or a melanin-deficient (Δalb1) strain. Conidia were aerosolized and delivered to mice at an estimated deposition dose of 1×105 twice a week for 4 weeks (8 total). Histopathological and immunological endpoints were assessed 4, 24, 48, and 72 hours after the final exposure. Histopathological analysis showed that conidia derived from both strains induced lung inflammation, especially at 24 and 48 hour time points. Immunological endpoints evaluated in bronchoalveolar lavage fluid (BALF) and the mediastinal lymph nodes showed that exposure to WT conidia led to elevated numbers of macrophages, granulocytes, and lymphocytes. Importantly, CD8+ IL17+ (Tc17) cells were significantly higher in BALF and positively correlated with germination of A. fumigatus WT spores. Germination was associated with specific IgG to intracellular proteins while Δalb1 spores elicited antibodies to cell wall hydrophobin. These data suggest that inhalation exposures may provide a more representative analysis of immune responses following exposures to environmentally and occupationally prevalent fungal contaminants. PMID:25340353

  10. Detection of Aspergillus fumigatus pulmonary fungal infections in mice with 99mTc-labeled MORF oligomers targeting ribosomal RNA

    International Nuclear Information System (INIS)

    Purpose: Invasive aspergillosis is a major cause of infectious morbidity and mortality in immunocompromised patients. The fungus Aspergillus fumigatus (A. fumigatus) is the primary causative agent of invasive aspergillosis. However, A. fumigatus infections remain difficult to diagnose particularly in the early stages due to the lack of a rapid, sensitive and specific diagnostic approach. In this study, we investigated 99mTc labeled MORF oligomers targeting fungal ribosomal RNA (rRNA) for the imaging detection of fungal infections. Procedures: Three phosphorodiamidate morpholino (MORF) oligomer (a DNA analogue) probes were designed: AGEN, complementary to a sequence of the fungal 28S ribosomal RNA (rRNA) of Aspergillus, as a genus-specific probe; AFUM, complementary to the 28S rRNA sequence of A. fumigatus, as a fungus species-specific probe; and cMORF, irrelevant to all fungal species, as a control probe. The probes were conjugated with Alexa Fluor 633 carboxylic acid succinimidyl ester (AF633) for fluorescence imaging or with NHS-mercaptoacetyl triglycine (NHS-MAG3) for nuclear imaging with 99mTc and then evaluated in vitro and in vivo. Results: The specific binding of AGEN and AFUM to fungal total RNA was confirmed by dot blot hybridization while specific binding of AGEN and AFUM in fixed and live A. fumigatus was demonstrated by both fluorescent in situ hybridization (FISH) analysis and accumulation in live cells. SPECT imaging of BALB/c mice with pulmonary A. fumigatus infections and administered 99mTc labeled AGEN and AFUM showed immediate and obvious accumulation in the infected lungs, while no significant accumulation of the control 99mTc-cMORF in the infected lung was observed. Compared to non-infected mice, with sacrifice at 1 h, the accumulation of 99mTc-AGEN and 99mTc-AFUM in the lungs of mice infected with A. fumigatus was 2 and 2.7 fold higher respectively. Conclusions: In vivo targeting fungal ribosomal RNA with 99mTc labeled MORF probes AGEN and AFUM

  11. Biochemical Stability and Molecular Dynamic Characterization of Aspergillus fumigatus Cystathionine γ-Lyase in Response to Various Reaction Effectors

    KAUST Repository

    El-Sayed, Ashraf S.A.


    Cystathionine γ-lyase (CGL) is a key enzyme in the methionine-cysteine cycle in all living organisms forming cysteine, α-ketobutyrate and ammonia via homocysteine and cystathionine intermediates. Although, human and plant CGLs have been extensively studied at the molecular and mechanistic levels, there has been little work on the molecular and catalytic properties of fungal CGL. Herein, we studied in detail for the first time the molecular and catalytic stability of Aspergillus fumigatus CGL, since conformational instability, inactivation and structural antigenicity are the main limitations of the PLP-dependent enzymes on various therapeutic uses. We examined these properties in response to buffer compositions, stabilizing and destabilizing agents using Differential Scanning Fluorometery (DSF), steady state and gel-based fluorescence of the intrinsic hydrophobic core, stability of internal aldimine linkage and catalytic properties. The activity of the recombinant A. fumigatus CGL was 13.8 U/mg. The melting temperature (Tm) of CGL in potassium phosphate buffer (pH 7.0-8.0) was 73.3 °C, with ∼3 °C upshifting in MES and sodium phosphate buffers (pH 7.0). The conformational thermal stability was increased in potassium phosphate, sodium phosphate and MES buffers, in contrast to Tris-HCl, HEPES (pH 7.0) and CAPS (pH 9.0-10.0). The thermal stability and activity of CGL was slightly increased in the presence of trehalose and glycerol that might be due to hydration of the enzyme backbone, unlike the denaturing effect of GdmCl and urea. Modification of surface CGL glutamic and aspartic acids had no significant effect on the enzyme conformational and catalytic stability. Molecular modeling and dynamics simulations unveil the high conformational stability of the overall scaffold of CGL with high flexibility at the non-structural regions. CGL structure has eight buried Trp residues, which are reoriented to the enzyme surface and get exposed to the solvent under

  12. Triazole fungicides can induce cross-resistance to medical triazoles in Aspergillus fumigatus.

    Directory of Open Access Journals (Sweden)

    Eveline Snelders

    Full Text Available BACKGROUND: Azoles play an important role in the management of Aspergillus diseases. Azole resistance is an emerging global problem in Aspergillus fumigatus, and may develop through patient therapy. In addition, an environmental route of resistance development has been suggested through exposure to 14α-demethylase inhibitors (DMIs. The main resistance mechanism associated with this putative fungicide-driven route is a combination of alterations in the Cyp51A-gene (TR(34/L98H. We investigated if TR(34/L98H could have developed through exposure to DMIs. METHODS AND FINDINGS: Thirty-one compounds that have been authorized for use as fungicides, herbicides, herbicide safeners and plant growth regulators in The Netherlands between 1970 and 2005, were investigated for cross-resistance to medical triazoles. Furthermore, CYP51-protein homology modeling and molecule alignment studies were performed to identify similarity in molecule structure and docking modes. Five triazole DMIs, propiconazole, bromuconazole, tebuconazole, epoxiconazole and difenoconazole, showed very similar molecule structures to the medical triazoles and adopted similar poses while docking the protein. These DMIs also showed the greatest cross-resistance and, importantly, were authorized for use between 1990 and 1996, directly preceding the recovery of the first clinical TR(34/L98H isolate in 1998. Through microsatellite genotyping of TR(34/L98H isolates we were able to calculate that the first isolate would have arisen in 1997, confirming the results of the abovementioned experiments. Finally, we performed induction experiments to investigate if TR(34/L98H could be induced under laboratory conditions. One isolate evolved from two copies of the tandem repeat to three, indicating that fungicide pressure can indeed result in these genomic changes. CONCLUSIONS: Our findings support a fungicide-driven route of TR(34/L98H development in A. fumigatus. Similar molecule structure

  13. Cytokine and transcription factor expression by Aspergillus fumigatus-stimulated peripheral blood mononuclear cells in dogs with sino-nasal aspergillosis. (United States)

    Vanherberghen, M; Bureau, F; Peters, I R; Day, M J; Lynch, A; Fievez, L; Billen, F; Clercx, C; Peeters, D


    The causal agent of sino-nasal aspergillosis is usually Aspergillus fumigatus, which is a saprophytic and ubiquitous fungus that causes a severe rhinosinusitis in apparent healthy dogs. Affected dogs do not have systemic immuno-suppression. It has been shown previously that dogs affected by this disease have local over-expression of interleukin (IL)-10 and Th1 cytokines in nasal mucosal tissue. The aim of the present study was to assess the response of peripheral blood mononuclear cells (PBMC) from affected and unaffected dogs to antigen-specific stimulation with heat-inactivated Aspergillus spp. conidia, by quantifying gene expression for specific Th1, Th2, Th17 and Treg cytokines and their related transcription factors. Quantification of IL-4 and IFN-γ protein in culture supernatant was performed by enzyme-linked immunosorbent assay (ELISA). PBMC from dogs with SNA produced adequate mRNA encoding IFN-γ and IFN-γ protein. The expression of IL-17A mRNA was significantly greater in PBMC of affected compared with unaffected dogs. The amount of IL-10 mRNA in PBMC from affected dogs decreased after antigen-specific challenge. These results suggest that the incapacity of affected dogs to clear these fungal infections is not related to a defect in Th1 immunity or to an overwhelming regulatory reaction, but rather to an uncontrolled pro-inflammatory reaction driven by Th17 cells. PMID:23759303

  14. Aspergillus fumigatus chronic colonization and lung function decline in cystic fibrosis may have a two-way relationship. (United States)

    Noni, M; Katelari, A; Dimopoulos, G; Doudounakis, S-E; Tzoumaka-Bakoula, C; Spoulou, V


    Aspergillus fumigatus is commonly found in cystic fibrosis (CF) airways. Our aim was to assess the relationship between A. fumigatus chronic colonization and lung function in CF patients. A case-control study of CF patients born from 1989 to 2002 was performed. Medical records were reviewed from the time of initial diagnosis until December 2013. Chronic colonization was defined as two or more positive sputum cultures in a given year. Each patient chronically colonized with A. fumigatus was matched with three control patients (never colonized by A. fumigatus) for age, sex, and year of birth (±3 years). A number of parameters were recorded and analyzed prospectively. The primary outcome measure was the difference in forced expiratory volume in 1 s (FEV1) in percent predicted between groups. Linear mixed models were used for longitudinal analyses to evaluate the relationship between A. fumigatus chronic colonization and lung function during a 7-year period and study the lung function 4 years before the time of enrollment (t0). Twenty patients had chronic colonization and were matched with 60 controls. A significant difference in lung function was detected throughout the 7-year period after adjustment for confounders (est = 8.66, p = 0.020). Four years before t0, FEV1 baseline was the only factor associated with the course of lung function (est = 0.64, p < 0.001) and was significantly different between groups (p = 0.001). In conclusion, a decreased FEV1 baseline appears to be a risk factor for chronic colonization by A. fumigatus, which, in turn, may cause a faster deterioration of lung function. PMID:26319147

  15. Tolerance to silver of an Aspergillus fumigatus strain able to grow on cyanide containing wastes. (United States)

    Sabatini, L; Battistelli, M; Giorgi, L; Iacobucci, M; Gobbi, L; Andreozzi, E; Pianetti, A; Franchi, R; Bruscolini, F


    We studied the strategy of an Aspergillus fumigatus strain able to grow on metal cyanide wastes to cope with silver. The tolerance test revealed that the Minimum Inhibitory Concentration of Ag(I) was 6mM. In 1mM AgNO3 aqueous solution the fungus was able to reduce and sequestrate silver into the cell in the form of nanoparticles as evidenced by the change in color of the biomass and Electron Microscopy observations. Extracellular silver nanoparticle production also occurred in the filtrate solution after previous incubation of the fungus in sterile, double-distilled water for 72h, therefore evidencing that culture conditions may influence nanoparticle formation. The nanoparticles were characterized by UV-vis spectrometry, X-ray diffraction and Energy Dispersion X-ray analysis. Atomic absorption spectrometry revealed that the optimum culture conditions for silver absorption were at pH 8.5.The research is part of a polyphasic study concerning the behavior of the fungal strain in presence of metal cyanides; the results provide better understanding for further research targeted at a rationale use of the microorganism in bioremediation plans, also in view of possible metal recovery. Studies will be performed to verify if the fungus maintains its ability to produce nanoparticles using KAg(CN)2. PMID:26705888

  16. Aspergillus fumigatus Triggers Inflammatory Responses by Stage-Specific beta-Glucan Display.

    Directory of Open Access Journals (Sweden)


    Full Text Available Inhalation of fungal spores (conidia occurs commonly and, in specific circumstances, can result in invasive disease. We investigated the murine inflammatory response to conidia of Aspergillus fumigatus, the most common invasive mold in immunocompromised hosts. In contrast to dormant spores, germinating conidia induce neutrophil recruitment to the airways and TNF-alpha/MIP-2 secretion by alveolar macrophages. Fungal beta-glucans act as a trigger for the induction of these inflammatory responses through their time-dependent exposure on the surface of germinating conidia. Dectin-1, an innate immune receptor that recognizes fungal beta-glucans, is recruited in vivo to alveolar macrophage phagosomes that have internalized conidia with exposed beta-glucans. Antibody-mediated blockade of Dectin-1 partially inhibits TNF-alpha/MIP-2 induction by metabolically active conidia. TLR-2- and MyD88-mediated signals provide an additive contribution to macrophage activation by germinating conidia. Selective responsiveness to germinating conidia provides the innate immune system with a mechanism to restrict inflammatory responses to metabolically active, potentially invasive fungal spores.

  17. Evidence of two pathways for the metabolism of phenol by Aspergillus fumigatus. (United States)

    Jones, K H; Trudgill, P W; Hopper, D J


    Aspergillus fumigatus (ATCC 28282), a thermotolerant fungus, has been shown to be capable of growth on phenol as the sole carbon and energy source. During growth of the organism on phenol, catechol and hydroquinone accumulated transiently in the medium; cells grown on phenol oxidised these compounds without a lag period. Two different routes operating simultaneously, leading to different ring-fission substrates, are proposed for the metabolism of phenol. In one route, phenol undergoes ortho-hydroxylation to give catechol, which is then cleaved by an intradiol mechanism leading to 3-oxoadipate. In the other route, phenol is hydroxylated in the para-position to produce hydroquinone, which is then converted into 1,2,4-trihydroxybenzene for ring fission by ortho-cleavage to give maleylacetate. Cell-free extracts of phenol-grown mycelia were found to contain enzymic activities for the proposed steps. Two ring-fission dioxygenases, one active towards 1,2,4-trihydroxybenzene, but not catechol, and one active towards both ring-fission substrates, were separated by FPLC. Succinate-grown mycelia did not oxidise any of the intermediates until a clear lag period had elapsed and did not contain any of the enzymic activities for phenol metabolism. PMID:7778974

  18. New applications for known drugs: Human glycogen synthase kinase 3 inhibitors as modulators of Aspergillus fumigatus growth. (United States)

    Sebastián, Víctor; Manoli, Maria-Tsampika; Pérez, Daniel I; Gil, Carmen; Mellado, Emilia; Martínez, Ana; Espeso, Eduardo A; Campillo, Nuria E


    Invasive aspergillosis (IA) is one of the most severe forms of fungi infection. IA disease is mainly due to Aspergillus fumigatus, an air-borne opportunistic pathogen. Mortality rate caused by IA is still very high (50-95%), because of difficulty in early diagnostics and reduced antifungal treatment options, thus new and efficient drugs are necessary. The aim of this work is, using Aspergillus nidulans as non-pathogen model, to develop efficient drugs to treat IA. The recent discovered role of glycogen synthase kinase-3 homologue, GskA, in A. fumigatus human infection and our previous experience on human GSK-3 inhibitors focus our attention on this kinase as a target for the development of antifungal drugs. With the aim to identify effective inhibitors of colonial growth of A. fumigatus we use A. nidulans as an accurate model for in vivo and in silico studies. Several well-known human GSK-3β inhibitors were tested for inhibition of A. nidulans colony growth. Computational tools as docking studies and binding site prediction was used to explain the different biological profile of the tested inhibitors. Three of the five tested hGSK3β inhibitors are able to reduce completely the colonial growth by covalent bind to the enzyme. Therefore these compounds may be useful in different applications to eradicate IA. PMID:27131621

  19. Clonal expansion and emergence of environmental multiple-triazole-resistant Aspergillus fumigatus strains carrying the TR(3)(4)/L98H mutations in the cyp51A gene in India.

    NARCIS (Netherlands)

    Chowdhary, A.; Kathuria, S.; Xu, J.; Sharma, C.; Sundar, G.; Singh, P.K.; Gaur, S.N.; Hagen, F.; Klaassen, C.H.; Meis, J.F.G.M.


    Azole resistance is an emerging problem in Aspergillus which impacts the management of aspergillosis. Here in we report the emergence and clonal spread of resistance to triazoles in environmental Aspergillus fumigatus isolates in India. A total of 44 (7%) A. fumigatus isolates from 24 environmental

  20. Insights from the Molecular Dynamics Simulation of Cellobiohydrolase Cel6A Molecular Structural Model from Aspergillus fumigatus NITDGPKA3. (United States)

    Dodda, Subba Reddy; Sarkar, Nibedita; Aikat, Kaustav; Krishnaraj, Navanietha R; Bhattacharjee, Sanchari; Bagchi, Angshuman; Mukhopadhyay, Sudit S


    Global demand for bioethanol is increasing tremendously as it could help to replace the conventional fossil fuel and at the same time supporting the bioremediation of huge volume of cellulosic wastes generated from different sources. Ideal genetic engineering approaches are essential to improve the efficacy of the bioethanol production processes for real time applications. A locally isolated fungal strain Aspergillus fumigatus NITDGPKA3 was used in our laboratory for the hydrolysis of lignocellulose with good cellulolytic activity when compared with other contemporary fungal strains. An attempt is made to sequence the cellobiohydrolases (CBHs) of A. fumigatus NITDGPKA3, model its structure to predict its catalytic activity towards improving the protein by genetic engineering approaches. Herein, the structure of the sequenced Cellobiohydrolases (CBHs) of A. fumigatus NITDGPKA3, modelled by homology modelling and its validation is reported. Further the catalytic activity of the modelled CBH enzyme was assessed by molecular docking analysis. Phylogenetic analysis showed that CBH from A. fumigatus NITDGPKA3 belongs to the Glycohydro 6 (Cel6A) super family. Molecular modeling and molecular dynamics simulation suggest the structural and functional mechanism of the enzyme. The structures of both the cellulose binding (CBD) and catalytic domain (CD) have been compared with most widely studied CBH of Trichoderma reesei. The molecular docking with cellulose suggests that Gln 248, Pro 287, Val236, Asn284, and Ala288 are the main amino acids involved in the hydrolysis of the β, 1-4, glycosidic bonds of cellulose. PMID:27109185

  1. Cerebral aspergillosis due to Aspergillus fumigatus in AIDS patient: first culture - proven case reported in Brazil Aspergilosis cerebral causada por Aspergillus fumigatus en paciente con SIDA: primer reporte de caso demostrado por cultivo en Brasil

    Directory of Open Access Journals (Sweden)

    José E. Vidal


    Full Text Available Cerebral aspergillosis is a rare cause of brain expansive lesion in AIDS patients. We report the first culture-proven case of brain abscess due to Aspergillus fumigatus in a Brazilian AIDS patient. The patient, a 26 year-old male with human immunodeficiency virus (HIV infection and history of pulmonary tuberculosis and cerebral toxoplasmosis, had fever, cough, dyspnea, and two episodes of seizures. The brain computerized tomography (CT showed a bi-parietal and parasagittal hypodense lesion with peripheral enhancement, and significant mass effect. There was started anti-Toxoplasma treatment. Three weeks later, the patient presented mental confusion, and a new brain CT evidenced increase in the lesion. He underwent brain biopsy, draining 10 mL of purulent material. The direct mycological examination revealed septated and hyaline hyphae. There was started amphotericin B deoxycholate. The culture of the material demonstrated presence of the Aspergillus fumigatus. The following two months, the patient was submitted to three surgeries, with insertion of drainage catheter and administration of amphotericin B intralesional. Three months after hospital admission, his neurological condition suffered discrete changes. However, he died due to intrahospital pneumonia. Brain abscess caused by Aspergillus fumigatus must be considered in the differential diagnosis of the brain expansive lesions in AIDS patients in Brazil.La aspergilosis cerebral es una causa rara de lesión expansiva cerebral en pacientes con SIDA. Presentamos el primer reporte de un absceso cerebral causado por Aspergillus fumigatus en un paciente brasileño con SIDA. El paciente, de 26 años de edad, presentaba antecedentes de infección por el virus de la inmunodeficiencia humana (VIH, tuberculosis pulmonar y toxoplasmosis cerebral. Manifestó fiebre, tos, disnea y dos episódios de convulsiones. La tomografía computadorizada (TC demostró una lesión hipodensa parasagital y bi-parietal con

  2. Substitutions at Methionine 220 in the 14α-Sterol Demethylase (Cyp51A) of Aspergillus fumigatus Are Responsible for Resistance In Vitro to Azole Antifungal Drugs


    Mellado, E.; Garcia-Effron, G.; Alcazar-Fuoli, L.; Cuenca-Estrella, M.; Rodriguez-Tudela, J. L.


    Five clinical isolates of Aspergillus fumigatus that exhibited similar patterns of reduced susceptibility to itraconazole and other triazole drugs were analyzed. Sequence analysis of genes (cyp51A and cyp51B) encoding the 14α-sterol demethylases revealed that all five strains harbored mutations in cyp51A resulting in the replacement of methionine at residue 220 by valine, lysine, or threonine. When the mutated cyp51A genes were introduced into an A. fumigatus wild-type strain, the transforman...

  3. Breakthrough Aspergillus fumigatus and Candida albicans double infection during caspofungin treatment

    DEFF Research Database (Denmark)

    Arendrup, Maiken Cavling; Garcia-Effron, Guillermo; Buzina, Walter;


    Caspofungin is used for the treatment of acute invasive candidiasis and as salvage treatment for invasive aspergillosis. We report characteristics of isolates of Candida albicans and Aspergillus fumigatus detected in a patient with breakthrough infection complicating severe gastrointestinal surgery...... and evaluate the capability of susceptibility methods to identify candin resistance. The susceptibility of C. albicans to caspofungin and anidulafungin was investigated by Etest, microdilution (European Committee on Antibiotic Susceptibility Testing [EUCAST] and CLSI), disk diffusion, agar dilution......, and FKS1 sequencing and in a mouse model. Tissue was examined by immunohistochemistry, PCR, and sequencing for the presence of A. fumigatus and resistance mutations. The MICs for the C. albicans isolate were as follows: >32 microg/ml caspofungin and 0.5 microg/ml anidulafungin by Etest, 2 microg...

  4. Melanin is an essential component for the integrity of the cell wall of Aspergillus fumigatus conidia

    Directory of Open Access Journals (Sweden)

    Georgeault Sonia


    Full Text Available Abstract Background Aspergillus fumigatus is the most common agent of invasive aspergillosis, a feared complication in severely immunocompromised patients. Despite the recent commercialisation of new antifungal drugs, the prognosis for this infection remains uncertain. Thus, there is a real need to discover new targets for therapy. Particular attention has been paid to the biochemical composition and organisation of the fungal cell wall, because it mediates the host-fungus interplay. Conidia, which are responsible for infections, have melanin as one of the cell wall components. Melanin has been established as an important virulence factor, protecting the fungus against the host's immune defences. We suggested that it might also have an indirect role in virulence, because it is required for correct assembly of the cell wall layers of the conidia. Results We used three A. fumigatus isolates which grew as white or brown powdery colonies, to demonstrate the role of melanin. Firstly, sequencing the genes responsible for biosynthesis of melanin (ALB1, AYG1, ARP1, ARP2, ABR1 and ABR2 showed point mutations (missense mutation, deletion or insertion in the ALB1 gene for pigmentless isolates or in ARP2 for the brownish isolate. The isolates were then shown by scanning electron microscopy to produce numerous, typical conidial heads, except that the conidia were smooth-walled, as previously observed for laboratory mutants with mutations in the PKSP/ALB1 gene. Flow cytometry showed an increase in the fibronectin binding capacity of conidia from mutant isolates, together with a marked decrease in the binding of laminin to the conidial surface. A marked decrease in the electronegative charge of the conidia and cell surface hydrophobicity was also seen by microelectrophoresis and two-phase partitioning, respectively. Ultrastructural studies of mutant isolates detected considerable changes in the organisation of the conidial wall, with the loss of the outermost

  5. Influence of Ferrous sulphate on growth and alpha-a Amylase production for Aspergillus fumigatus NTCC1222

    Directory of Open Access Journals (Sweden)

    Shalini Singh


    Full Text Available Stringent government regulations and increasing public awareness is forcing chemical industries to incorporate environment friendly products and processes. Biotechnological applications, in industries, thus, hold great future. Microorganisms and their metabolites/enzymes provide a number of eminent-economic as well as environment friendly solutions for such industries. Amylases are one of the most important industrial enzymes. Commercial production of amylases requires selection of the best of production conditions. This study evaluates the influence of varying concentration of Ferrous sulphate (Fe2+ on microbial growth and amylase production for Aspergillus, Aspergillus fumigatus NTCC1222. Ferrous sulphate enhanced growth (concentration of 100mg/L by 1.83%, compared to the control. In contrast, it decreased amylase activity at all concentrations tested. As the concentration of ferrous sulphate increased, the amylase activity decreased. Amylases are metalloenzymes and the inhibition in amylase activity observed in the presence of ferrous ions may be due to competition between the exogenous cation and the protein associated cation, resulting in reduced metalloenzyme activity. Further studies will aim to evaluate the effect of different ferrous salts and different forms of iron on amylase production by Aspergillus fumigatus NTCC1222.

  6. In-depth 2-DE reference map of Aspergillus fumigatus and its proteomic profiling on exposure to itraconazole. (United States)

    Gautam, Poonam; Mushahary, Dolly; Hassan, Wazid; Upadhyay, Santosh Kumar; Madan, Taruna; Sirdeshmukh, Ravi; Sundaram, Curam Sreenivasacharlu; Sarma, Puranam Usha


    Aspergillus fumigatus (A. fumigatus) is a medically important opportunistic fungus that may lead to invasive aspergillosis in humans with weak immune system. Proteomic profiling of this fungus on exposure to itraconazole (ITC), an azole antifungal drug, may lead to identification of its molecular targets and better understanding on the development of drug resistance against ITC in A. fumigatus. Here, proteome analysis was performed using 2-DE followed by mass spectrometric analysis which resulted in identification of a total of 259 unique proteins. Further, proteome profiling of A. fumigatus was carried out on exposure to ITC, 0.154 μg/ml, the minimum inhibitory concentration (MIC50). Image analysis showed altered levels of 175 proteins (66 upregulated and 109 downregulated) of A. fumigatus treated with ITC as compared to the untreated control. Peptide mass fingerprinting led to the identification of 54 proteins (12 up-regulated and 42 down-regulated). The differentially expressed proteins include proteins related to cell stress, carbohydrate metabolism and amino acid metabolism. We also observed four proteins, including nucleotide phosphate kinase (NDK), that are reported to interact with calcineurin, a protein involved in regulation of cell morphology and fungal virulence. Comparison of differentially expressed proteins on exposure to ITC with artemisinin (ART), an antimalarial drug with antifungal activity(1), revealed a total of 26 proteins to be common among them suggesting that common proteins and pathways are targeted by these two antifungal agents. The proteins targeted by ITC may serve as important leads for development of new antifungal drugs. PMID:26868900

  7. Purification and characterization of a low molecular weight xylanase from solid-state cultures of Aspergillus fumigatus Fresenius


    Silva Claudio Henrique Cerri e; Puls Jurgen; Sousa Marcelo Valle de; Ferreira Filho Edivaldo Ximenes


    A xylan-degrading enzyme (xylanase II) was purified to apparent homogeneity from solid-state cultures of Aspergillus fumigatus Fresenius. The molecular weight of xylanase II was found to be 19 and 8.5 kDa, as estimated by SDS-PAGE and gel filtration on FPLC, respectively. The purified enzyme was most active at 55 °C and pH 5.5. It was specific to xylan. The apparent Km and Vmax values on soluble and insoluble xylans from oat spelt and birchwood showed that xylanase II was most active on solub...

  8. Development of azole resistance in Aspergillus fumigatus during azole therapy associated with change in virulence.

    Directory of Open Access Journals (Sweden)

    Maiken Cavling Arendrup

    Full Text Available Four sequential Aspergillus fumigatus isolates from a patient with chronic granulomatous disease (CGD eventually failing azole-echinocandin combination therapy were investigated. The first two isolates (1 and 2 were susceptible to antifungal azoles, but increased itraconazole, voriconazole and posaconazole MICs were found for the last two isolates (3 and 4. Microsatellite typing showed that the 4 isolates were isogenic, suggesting that resistance had been acquired during azole treatment of the patient. An immunocompromised mouse model confirmed that the in vitro resistance corresponded with treatment failure. Mice challenged with the resistant isolate 4 failed to respond to posaconazole therapy, while those infected by susceptible isolate 2 responded. Posaconazole-anidulafungin combination therapy was effective in mice challenged with isolate 4. No mutations were found in the Cyp51A gene of the four isolates. However, expression experiments of the Cyp51A showed that the expression was increased in the resistant isolates, compared to the azole-susceptible isolates. The microscopic morphology of the four isolates was similar, but a clear alteration in radial growth and a significantly reduced growth rate of the resistant isolates on solid and in broth medium was observed compared to isolates 1 and 2 and to unrelated wild-type controls. In the mouse model the virulence of isolates 3 and 4 was reduced compared to the susceptible ones and to wild-type controls. For the first time, the acquisition of azole resistance despite azole-echinocandin combination therapy is described in a CGD patient and the resistance demonstrated to be directly associated with significant change of virulence.

  9. Whole genome evaluation of horizontal transfers in the pathogenic fungus Aspergillus fumigatus

    Directory of Open Access Journals (Sweden)

    Deschavanne Patrick


    Full Text Available Abstract Background Numerous cases of horizontal transfers (HTs have been described for eukaryote genomes, but in contrast to prokaryote genomes, no whole genome evaluation of HTs has been carried out. This is mainly due to a lack of parametric methods specially designed to take the intrinsic heterogeneity of eukaryote genomes into account. We applied a simple and tested method based on local variations of genomic signatures to analyze the genome of the pathogenic fungus Aspergillus fumigatus. Results We detected 189 atypical regions containing 214 genes, accounting for about 1 Mb of DNA sequences. However, the fraction of atypical DNA detected was smaller than the average amount detected in the same conditions in prokaryote genomes (3.1% vs 5.6%. It appeared that about one third of these regions contained no annotated genes, a proportion far greater than in prokaryote genomes. When analyzing the origin of these HTs by comparing their signatures to a home made database of species signatures, 3 groups of donor species emerged: bacteria (40%, fungi (25%, and viruses (22%. It is to be noticed that though inter-domain exchanges are confirmed, we only put in evidence very few exchanges between eukaryotic kingdoms. Conclusions In conclusion, we demonstrated that HTs are not negligible in eukaryote genomes, bearing in mind that in our stringent conditions this amount is a floor value, though of a lesser extent than in prokaryote genomes. The biological mechanisms underlying those transfers remain to be elucidated as well as the biological functions of the transferred genes.

  10. Surfactant Protein-A inhibits Aspergillus fumigatus-induced allergic T-cell responses

    Directory of Open Access Journals (Sweden)

    Russo Scott J


    Full Text Available Abstract Background The pulmonary surfactant protein (SP-A has potent immunomodulatory activities but its role and regulation during allergic airway inflammation is unknown. Methods We studied changes in SP-A expression in the bronchoalveolar lavage (BAL using a murine model of single Aspergillus fumigatus (Af challenge of sensitized animals. Results SP-A protein levels in the BAL fluid showed a rapid, transient decline that reached the lowest values (25% of controls 12 h after intranasal Af provocation of sensitized mice. Decrease of SP-A was associated with influx of inflammatory cells and increase of IL-4 and IL-5 mRNA and protein levels. Since levels of SP-A showed a significant negative correlation with these BAL cytokines (but not with IFN-γ, we hypothesized that SP-A exerts an inhibitory effect on Th2-type immune responses. To study this hypothesis, we used an in vitro Af-rechallenge model. Af-induced lymphocyte proliferation of cells isolated from sensitized mice was inhibited in a dose-dependent manner by addition of purified human SP-A (0.1–10 μg/ml. Flow cytometric studies on Af-stimulated lymphocytes indicated that the numbers of CD4+ (but not CD8+ T cells were significantly increased in the parental population and decreased in the third and fourth generation in the presence of SP-A. Further, addition of SP-A to the tissue culture inhibited Af-induced IL-4 and IL-5 production suggesting that SP-A directly suppressed allergen-stimulated CD4+ T cell function. Conclusion We speculate that a transient lack of this lung collectin following allergen exposure of the airways may significantly contribute to the development of a T-cell dependent allergic immune response.

  11. Antígenos nativos de Aspergillus fumigatus con utilidad para el inmunodiagnóstico de aspergiloma

    Directory of Open Access Journals (Sweden)

    José Casquero


    Full Text Available Con el objetivo de evaluar la utilidad de los antígenos nativos de cepas autóctonas de Aspergillus fumigatus para el inmunodiagnóstico de aspergiloma, se desarrolló un estudio empleando dos cepas de ese hongo, aisladas de pacientes con diagnóstico de aspergiloma (533 y 554, los cuales fueron confrontados con sueros controles comerciales de A. fumigatus, A. flavus, A. niger, Candida, Coccidioides, Histoplasma y Paracoccidioides mediante la prueba de inmunodifusión, asimismo, se evaluaron frente a 28 sueros de pacientes con sospecha de aspergiloma. Además, se realizó la caracterización de los componentes proteicos de los antígenos nativos con la técnica de SDS-PAGE y se confrontaron con diez sueros de pacientes con aspergiloma, paracoccidioidomicosis, histoplasmosis, proteína C reactiva e hidatidosis y suero de persona sana por inmunoblot. Se encontró una buena concordancia (kappa 0,92 entre los antígenos 533 y 554, y algo menor de éstos con el antígeno comercial para A. fumigatus (kappa 0,73 y 0,81 para el 553 y 554; respectivamente. La banda de 97 kDa reaccionó sólo con sueros de pacientes con aspergiloma siendo inmunodominante.

  12. Detection of Aspergillus fumigatus in a Rat Model of Invasive Pulmonary Aspergillosis by Real-Time Nucleic Acid Sequence-Based Amplification▿


    Zhao, Yanan; Park, Steven; Warn, Peter; Shrief, Raghdaa; Harrison, Elizabeth; Perlin, David S.


    Rapid and sensitive detection of Aspergillus from clinical samples may facilitate the early diagnosis of invasive pulmonary aspergillosis (IPA). A real-time nucleic acid sequence-based amplification (NASBA) method was investigated by use of an inhalational rat model of IPA. Immunosuppressed male Sprague-Dawley rats were exposed to Aspergillus fumigatus spores for an hour in an aerosol chamber. Bronchoalveolar lavage (BAL) fluid, lung tissues, and whole blood were collected from five infected ...

  13. Aspergillus fumigatus survival in alkaline and extreme zinc-limiting environments relies on the induction of a zinc homeostasis system encoded by the zrfC and aspf2 genes. (United States)

    Amich, Jorge; Vicentefranqueira, Rocío; Leal, Fernando; Calera, José Antonio


    Aspergillus fumigatus has three zinc transporter-encoding genes whose expression is regulated by both pH and the environmental concentration of zinc. We have previously reported that the zrfA and zrfB genes of A. fumigatus are transcribed at higher levels and are required for fungal growth under acidic zinc-limiting conditions whereas they are dispensable for growth in neutral or alkaline zinc-limiting media. Here we report that the transporter of the zinc uptake system that functions in A. fumigatus growing in neutral or alkaline environments is encoded by zrfC. The transcription of zrfC occurs divergently with respect to the adjacent aspf2 gene, which encodes an immunodominant antigen secreted by A. fumigatus. The two genes-zrfC and aspf2-are required to different extents for fungal growth in alkaline and extreme zinc-limiting media. Indeed, these environmental conditions induce the simultaneous transcription of both genes mediated by the transcriptional regulators ZafA and PacC. ZafA upregulates the expression of zrfC and aspf2 under zinc-limiting conditions regardless of the ambient pH, whereas PacC represses the expression of these genes under acidic growth conditions. Interestingly, the mode of action of PacC for zrfC-aspf2 transcription contrasts with the more widely accepted model for PacC function, according to which under alkaline growth conditions PacC would activate the transcription of alkaline-expressed genes but would repress the transcription of acid-expressed genes. In sum, this report provides a good framework for investigating several important aspects of the biology of species of Aspergillus, including the repression of alkaline genes by PacC at acidic pH and the interrelationship that must exist between tissue pH, metal availability in the host tissue, and fungal virulence. PMID:20038606

  14. Impact of the lectin chaperone calnexin on the stress response, virulence and proteolytic secretome of the fungal pathogen Aspergillus fumigatus.

    Directory of Open Access Journals (Sweden)

    Margaret V Powers-Fletcher

    Full Text Available Calnexin is a membrane-bound lectin chaperone in the endoplasmic reticulum (ER that is part of a quality control system that promotes the accurate folding of glycoproteins entering the secretory pathway. We have previously shown that ER homeostasis is important for virulence of the human fungal pathogen Aspergillus fumigatus, but the contribution of calnexin has not been explored. Here, we determined the extent to which A. fumigatus relies on calnexin for growth under conditions of environmental stress and for virulence. The calnexin gene, clxA, was deleted from A. fumigatus and complemented by reconstitution with the wild type gene. Loss of clxA altered the proteolytic secretome of the fungus, but had no impact on growth rates in either minimal or complex media at 37°C. However, the ΔclxA mutant was growth impaired at temperatures above 42°C and was hypersensitive to acute ER stress caused by the reducing agent dithiothreitol. In contrast to wild type A. fumigatus, ΔclxA hyphae were unable to grow when transferred to starvation medium. In addition, depleting the medium of cations by chelation prevented ΔclxA from sustaining polarized hyphal growth, resulting in blunted hyphae with irregular morphology. Despite these abnormal stress responses, the ΔclxA mutant remained virulent in two immunologically distinct models of invasive aspergillosis. These findings demonstrate that calnexin functions are needed for growth under conditions of thermal, ER and nutrient stress, but are dispensable for surviving the stresses encountered in the host environment.

  15. Emerging aspergillosis by azole-resistant Aspergillus fumigatus at an intensive care unit in the Netherlands, 2010 to 2013. (United States)

    van Paassen, Judith; Russcher, Anne; In 't Veld-van Wingerden, Astrid Wm; Verweij, Paul E; Kuijper, Eduard J


    The prevalence of invasive aspergillosis (IA) at the intensive care unit (ICU) is unknown and difficult to assess since IA also develops in patients lacking specific host factors. In the Netherlands, increasing azole-resistance in Aspergillus fumigatus complicates treatment of patients with IA. The aim of this study was to determine the prevalence of IA by azole-resistant A. fumigatus at the ICU among patients receiving antifungal treatment and to follow their clinical outcome and prognosis. A retrospective cohort study was conducted in a university hospital ICU from January 2010 to December 2013. From all patients who received antifungal treatment for suspected IA, relevant clinical and microbiological data were collected using a standardised questionnaire. Of 9,121 admitted ICU-patients, 136 had received antifungal treatment for suspected IA, of which 38 had a positive A. fumigatus culture. Ten of the 38 patients harboured at least one azole-resistant isolate. Resistance mechanisms consisted of alterations in the cyp51A gene, more specific TR34/L98H and TR46/T289A/Y121F. Microsatellite typing did not show clonal relatedness, though isolates from two patients were genetically related. The overall 90-day mortality of patients with IA by azole-resistant A. fumigatus and patients with suspicion of IA by azole-susceptible isolates in the ICU was 100% (10/10) vs 82% (23/28) respectively. We conclude that the changing pattern of IA in ICU patients requires appropriate criteria for recognition, diagnosis and rapid resistance tests. The increase in azole resistance rates also challenges a reconsideration of empirical antifungal therapy. PMID:27541498

  16. A fast and quantitative evaluation of the Aspergillus fumigatus biofilm adhesion properties by means of digital pulsed force mode

    International Nuclear Information System (INIS)

    The opportunistic pathogenic mould Aspergillus fumigatus (A. fumigatus) is an increasing cause of morbidity and mortality in immunocompromised and in part immunocompetent patients. A. fumigatus can grow in multicellular communities by the formation of a hyphal network embedded in an extracellular matrix (ECM) meanly composed by polysaccharides, melanin, proteins. Because adhesion properties is one primary factor affecting the balance between growth, detachment and biofilm formation, its quantification is essential in understanding, predicting, and modelling biofilm development. Atomic force microscopy (AFM) imaging and force spectroscopy have recently opened a range of novel applications in microbiology including the imaging and manipulation of membrane proteins at the subnanometer level, the observation of the surface of living cells at high resolution, the mapping of local properties such as surface charges, the measurement of elastic properties of cell-surface constituents and the probing of cellular interactions using functionalized probes. Nevertheless, the principal disadvantage of this approach is the relatively slow acquisition rate that makes AFM is not able to detect fast dynamics. In this study we demonstrated that digital pulsed force mode (DPFM) atomic force microscopy can be used to obtain high-resolution topographical images and to quantify the adhesion properties of the A. fumigatus biofilm with an high acquisition rate. Here we show by means of DPFM-AFM that Alginate Lyase (AlgL), an enzyme known to reduce negatively charged alginate levels in microbial biofilm, is able to reduce the biofilm adhesion forces forming several nano-fractures in the ECM. These results suggest that the AlgL could used to enhance the antifungal drugs transit through the ECM.

  17. A fast and quantitative evaluation of the Aspergillus fumigatus biofilm adhesion properties by means of digital pulsed force mode

    Energy Technology Data Exchange (ETDEWEB)

    Maiorana, Alessandro [Istituto di Fisica, Università Cattolica del S. Cuore, L. go F. Vito 1, 00168 Roma (Italy); Papi, Massimiliano, E-mail: [Istituto di Fisica, Università Cattolica del S. Cuore, L. go F. Vito 1, 00168 Roma (Italy); Bugli, Francesca; Torelli, Riccardo [Istituto di Microbiologia, Università Cattolica del S. Cuore, L. go F. Vito 1, 00168 Roma (Italy); Maulucci, Giuseppe [Istituto di Fisica, Università Cattolica del S. Cuore, L. go F. Vito 1, 00168 Roma (Italy); Cacaci, Margherita; Posteraro, Brunella; Sanguinetti, Maurizio [Istituto di Microbiologia, Università Cattolica del S. Cuore, L. go F. Vito 1, 00168 Roma (Italy); De Spirito, Marco [Istituto di Fisica, Università Cattolica del S. Cuore, L. go F. Vito 1, 00168 Roma (Italy)


    The opportunistic pathogenic mould Aspergillus fumigatus (A. fumigatus) is an increasing cause of morbidity and mortality in immunocompromised and in part immunocompetent patients. A. fumigatus can grow in multicellular communities by the formation of a hyphal network embedded in an extracellular matrix (ECM) meanly composed by polysaccharides, melanin, proteins. Because adhesion properties is one primary factor affecting the balance between growth, detachment and biofilm formation, its quantification is essential in understanding, predicting, and modelling biofilm development. Atomic force microscopy (AFM) imaging and force spectroscopy have recently opened a range of novel applications in microbiology including the imaging and manipulation of membrane proteins at the subnanometer level, the observation of the surface of living cells at high resolution, the mapping of local properties such as surface charges, the measurement of elastic properties of cell-surface constituents and the probing of cellular interactions using functionalized probes. Nevertheless, the principal disadvantage of this approach is the relatively slow acquisition rate that makes AFM is not able to detect fast dynamics. In this study we demonstrated that digital pulsed force mode (DPFM) atomic force microscopy can be used to obtain high-resolution topographical images and to quantify the adhesion properties of the A. fumigatus biofilm with an high acquisition rate. Here we show by means of DPFM-AFM that Alginate Lyase (AlgL), an enzyme known to reduce negatively charged alginate levels in microbial biofilm, is able to reduce the biofilm adhesion forces forming several nano-fractures in the ECM. These results suggest that the AlgL could used to enhance the antifungal drugs transit through the ECM.

  18. A fast and quantitative evaluation of the Aspergillus fumigatus biofilm adhesion properties by means of digital pulsed force mode (United States)

    Maiorana, Alessandro; Papi, Massimiliano; Bugli, Francesca; Torelli, Riccardo; Maulucci, Giuseppe; Cacaci, Margherita; Posteraro, Brunella; Sanguinetti, Maurizio; De Spirito, Marco


    The opportunistic pathogenic mould Aspergillus fumigatus (A. fumigatus) is an increasing cause of morbidity and mortality in immunocompromised and in part immunocompetent patients. A. fumigatus can grow in multicellular communities by the formation of a hyphal network embedded in an extracellular matrix (ECM) meanly composed by polysaccharides, melanin, proteins. Because adhesion properties is one primary factor affecting the balance between growth, detachment and biofilm formation, its quantification is essential in understanding, predicting, and modelling biofilm development. Atomic force microscopy (AFM) imaging and force spectroscopy have recently opened a range of novel applications in microbiology including the imaging and manipulation of membrane proteins at the subnanometer level, the observation of the surface of living cells at high resolution, the mapping of local properties such as surface charges, the measurement of elastic properties of cell-surface constituents and the probing of cellular interactions using functionalized probes. Nevertheless, the principal disadvantage of this approach is the relatively slow acquisition rate that makes AFM is not able to detect fast dynamics. In this study we demonstrated that digital pulsed force mode (DPFM) atomic force microscopy can be used to obtain high-resolution topographical images and to quantify the adhesion properties of the A. fumigatus biofilm with an high acquisition rate. Here we show by means of DPFM-AFM that Alginate Lyase (AlgL), an enzyme known to reduce negatively charged alginate levels in microbial biofilm, is able to reduce the biofilm adhesion forces forming several nano-fractures in the ECM. These results suggest that the AlgL could used to enhance the antifungal drugs transit through the ECM.

  19. Environmental study of azole-resistant Aspergillus fumigatus and other aspergilli in Austria, Denmark, and Spain

    DEFF Research Database (Denmark)

    Mortensen, Klaus Leth; Mellado, Emilia; Lass-Flörl, Cornelia;


    itraconazole, voriconazole, and posaconazole. EUCAST method E.DEF 9.1 was used to confirm azole resistance. The promoter and entire coding sequence of the cyp51A gene were sequenced to identify azole-resistant A. fumigatus isolates. A. fumigatus was recovered in 144 out of 185 samples (77.8%). Four A....... fumigatus isolates from four Danish soil samples displayed elevated azole MICs (8%), and all harbored the same TR/L98H mutation of cyp51A. One A. lentulus isolate with voriconazole MIC of 4 mg/liter was detected in Spain. No azole-resistant aspergilli were detected in compost. Finally, A. terreus was...

  20. Differences in Interactions between Azole Drugs Related to Modifications in the 14-α Sterol Demethylase Gene (cyp51A) of Aspergillus fumigatus


    Garcia-Effron, G.; Mellado, E.; A. Gomez-Lopez; Alcazar-Fuoli, L.; Cuenca-Estrella, M.; Rodriguez-Tudela, Juan L.


    The combined activity of different azole drugs was investigated. Thirty-one Aspergillus fumigatus strains were tested, including two cyp51A− and one cyp51B− gene-knockout strain and azole-susceptible and -resistant strains with different resistance mechanisms. The combination of itraconazole and voriconazole was synergistic for all strains except for those with gene knockouts.

  1. Targeted Gene Disruption of the 14-α Sterol Demethylase (cyp51A) in Aspergillus fumigatus and Its Role in Azole Drug Susceptibility


    Mellado, E.; Garcia-Effron, G.; Buitrago, M. J.; Alcazar-Fuoli, L.; Cuenca-Estrella, M.; Rodriguez-Tudela, J. L.


    The role of Aspergillus fumigatus 14α-sterol demethylase (Cyp51A) in azole drug susceptibility was assessed. Targeted disruption of cyp51A in azole-susceptible and -resistant strains decreased MICs from 2- to 40-fold. The cyp51A mutants were morphologically indistinguishable from the wild-type strain, retaining the ability to cause pulmonary disease in neutropenic mice.

  2. beta-1,3-Glucan-Induced Host Phospholipase D Activation Is Involved in Aspergillus fumigatus Internalization into Type II Human Pneumocyte A549 Cells

    NARCIS (Netherlands)

    Han, Xuelin; Yu, Rentao; Zhen, Dongyu; Tao, Sha; Schmidt, Martina; Han, Li


    The internalization of Aspergillus fumigatus into lung epithelial cells is a process that depends on host cell actin dynamics. The host membrane phosphatidylcholine cleavage driven by phospholipase D (PLD) is closely related to cellular actin dynamics. However, little is known about the impact of PL

  3. Prevalence and mechanism of triazole resistance in Aspergillus fumigatus in a referral chest hospital in Delhi, India and an update of the situation in Asia

    Directory of Open Access Journals (Sweden)

    Anuradha eChowdhary


    Full Text Available Aspergillus fumigatus causes varied clinical syndromes ranging from colonization to deep infections. The mainstay of therapy of Aspergillus diseases is triazoles but several studies globally highlighted variable prevalence of triazole resistance, which hampers the management of aspergillosis. We studied the prevalence of resistance in clinical A. fumigatus isolates during 4 years in a referral Chest Hospital in Delhi, India and reviewed the scenario in Asia and the Middle East. Aspergillus species (n=2117 were screened with selective plates for azole resistance. The isolates included 45.4% A. flavus, followed by 32.4% A. fumigatus, 15.6% Aspergillus species and 6.6% A. terreus. Azole resistance was found in only 12 (1.7% A. fumigatus isolates.These triazole resistant A. fumigatus (TRAF isolates were subjected to (a calmodulin and β tubulin gene sequencing (b in vitro antifungal susceptibility testing against triazoles using CLSI M38-A2 (c sequencing of cyp51A gene and real-time PCR assay for detection of mutations and (d microsatellite typing of the resistant isolates. TRAF harbored TR34/L98H mutation in 10 (83.3% isolates with a pan-azole resistant phenotype. Among the remaining 2 TRAF isolates, one had G54E and the other had three non-synonymous point mutations. The majority of patients were diagnosed as invasive aspergillosis followed by allergic bronchopulmonary aspergillosis and chronic pulmonary aspergillosis. The Indian TR34/L98H isolates had a unique genotype and were distinct from the Chinese, Middle East and European TR34/L98H strains. This resistance mechanism has been linked to the use of fungicide azoles in agricultural practices in Europe as it has been mainly reported from azole naïve patients. Reports published from Asia demonstrate the same environmental resistance mechanism in A. fumigatus isolates from two highly populated countries in Asia i.e., China and India and also from the neighboring Middle East.

  4. Suppression of epithelial signal transducer and activator of transcription 1 activation by extracts of Aspergillus fumigatus. (United States)

    Bhushan, Bharat; Homma, Tetsuya; Norton, James E; Sha, Quan; Siebert, Jason; Gupta, Dave S; Schroeder, James W; Schleimer, Robert P


    Aspergillus fumigatus (AF) is often pathogenic in immune-deficient individuals and can cause life-threatening infections such as invasive aspergillosis. The pulmonary epithelial response to AF infection and the signaling pathways associated with it have not been completely studied. BEAS-2B cells or primary human bronchial epithelial cells were exposed to extracts of AF and challenged with IFN-β or the Toll-like receptor 3 agonist double-stranded RNA (dsRNA). Cytokine release (B-cell activating factor of the TNF family [BAFF], IFN-γ-induced protein-10 [IP-10], etc.) was assessed. AF extract was separated into low-molecular-weight (LMW) and high-molecular-weight (HMW) fractions using ultra 4 centrifugal force filters to characterize the activity. Real-time PCR was performed with a TaqMan method, and protein estimation was performed using ELISA techniques. Western blot was performed to assess phosphorylation of signal transducer and activator of transcription 1 (STAT1). IFN-β and dsRNA induced messenger RNA (mRNA) expression of BAFF (350- and 452-fold, respectively [n = 3]) and IP-10 (1,081- and 3,044-fold, respectively [n = 3]) in BEAS-2B cells. When cells were pretreated with AF extract for 1 hour and then stimulated with IFN-β or dsRNA for 6 hours, induction of BAFF and IP-10 mRNA was strongly suppressed relative to levels produced by IFN-β and dsRNA alone. When compared with control, soluble BAFF and IP-10 protein levels were maximally suppressed in dsRNA-stimulated wells treated with 1:320 wt/vol AF extract (P < 0.005). Upon molecular size fractionation, a LMW fraction of AF extract had no measurable suppressive effect on IP-10 mRNA expression. However, a HMW fraction of the AF extract significantly suppressed IP-10 expression in BEAS-2B cells that were stimulated with dsRNA or IFN-β. When BEAS-2B cells were pretreated with AF extract and then stimulated with IFN-β, reduced levels of pSTAT1 were observed, with maximum suppression at 4 and 6

  5. Aborto por Aspergillus fumigatus e A. niger em bovinos no sul do Brasil

    Directory of Open Access Journals (Sweden)

    Corbellini Luís G.


    Full Text Available As infecções micóticas apresentam distribuição mundial e podem causar placentite e aborto em diversas espécies de animais. Entre setembro 2001 e novembro 2002, foram processados no Setor de Patologia Veterinária, Universidade Federal do Rio Grande do Sul, 147 fetos bovinos abortados com o objetivo de avaliar as principais causas de aborto infeccioso bovino no sul do Brasil. Destes, 34 estavam acompanhados da placenta. Aborto micótico foi diagnosticado em cinco casos (3,4% mediante cultivo puro de quatro amostras de Aspergillus fumigatus e uma de A. niger associado a lesões histológicas características de fungo. Os exames virológico, bacteriológico e imunofluorescência direta para Leptospira sp foram negativos nestes casos. A idade dos fetos variava entre 5 e 8 meses de idade. Lesões macroscópicas foram observadas em quatro casos e eram caracterizadas por áreas circulares multifocais branco-acinzentadas na pele, principalmente na região da cabeça e dorso, em dois fetos, lesões nodulares no fígado em um caso e espessamento dos cotilédones em duas placentas enviadas juntamente com os fetos. Lesões histológicas foram observadas principalmente no fígado, pulmão e placenta, caracterizadas por hepatite necrótica multifocal, broncopneumonia supurativa e placentite necrótica. Através da coloração de Grocott hifas septadas foram observadas em duas placentas e nas bordas das lesões necróticas no fígado de um feto. Em dois casos hifas foram observadas somente na placenta e não no feto, salientando-se a importância deste tecido para o diagnóstico de aborto micótico bovino.

  6. Diagnóstico de ABPA em pacientes portadores de fibrose cística: utilidade clínica da pesquisa de IgE específica contra alérgenos recombinantes do Aspergillus fumigatus ABPA diagnosis in cystic fibrosis patients: the clinical utility of IgE specific to recombinant Aspergillus fumigatus allergens

    Directory of Open Access Journals (Sweden)

    Marina B. Almeida


    lung disease progresses. The overlap between the signs and symptoms of the two conditions makes diagnosis problematic, even if standardized criteria are used. The objective of this study was to identify, in a group of cystic fibrosis patients, cases of ABPA by assaying IgE specific to recombinant Aspergillus fumigatus antigens and to compare the method with the Cystic Fibrosis Foundation diagnostic criteria. METHODS: Fifty-four patients, aged 2 to 20 years, presenting characteristics that could occur with ABPA in isolation, were systematically assessed based on the following: clinical data, a chest CT scan, immediate hypersensitivity skin test for A. fumigatus; total serum IgE assay, RAST for A. fumigatus and serum IgE specific for the recombinant allergens Asp f1, f2, f3, f4 and f6. RESULTS: Thirty-nine patients were eligible for the study. Thirty-two of these were investigated. Sensitization to A. fumigatus was observed in 34%. Both the Cystic Fibrosis Foundation criteria and the recombinant antigen specific IgE assay defined three patients as suffering from ABPA; however, only two of these patients were diagnosed by both methods. CONCLUSIONS: The detection of A. fumigatus recombinant antigen specific IgE was a useful tool for the early detection of sensitization and diagnosis of ABPA. Nevertheless, diagnostic confirmation cannot be divorced from clinical findings, and before this method can be used for ABPA diagnosis, for detecting relapses and for defining cure criteria, longitudinal studies with larger numbers of patients are required.

  7. The potential inhibitory effect of cuminum cyminum, ziziphora clinopodioides and nigella sativa essential oils on the growth of Aspergillus fumigatus and Aspergillus flavus

    Directory of Open Access Journals (Sweden)

    A.R Khosravi


    Full Text Available The goals of this study were to evaluate the effectiveness of Cuminum cyminum, Ziziphora clinopodioides and Nigella sativa essential oils to inhibit the growth of Aspergillus fumigatus and A. flavus and to evoke ultrastructural changes. The fungi were cultured into RPMI 1640 media in the presence of oils at concentrations of 8, 6, 5, 4, 3, 2, 1.5, 1.25, 1, 0.75 and 0.5 mg/ml in broth microdilution and 2, 1.5, 1 and 0.5 mg/ml in broth macrodilution methods with shaking for 48 h at 28ºC. Conidial and mycelial samples exposed to 0.25, 0.5, 1, 1.5 and 2 mg essential oils/ml for 5 days in 2% yeast extract granulated plus 15% Saccharose media were processed for transmission electron microscopy (TEM. Based on broth dilution methods, C. cyminum and to a lesser extent Z. clinopodioides oils exhibited the strongest activity against A. fumigatus and A. flavus with MIC90 ranging from 0.25 to 1.5 mg/ml, while the oil from N. sativa exhibited relatively moderate activity against two above fungi with MIC90 ranging from 1.5 to 2 mg/ml. The main changes observed by TEM were in the cell wall, plasma membrane and membranous organelles; in particular, in the nuclei and mitochondria. These modifications in fungal structure were associated with the interference of the essential oils with the enzymes responsible for cell wall synthesis, which disturbed normal growth. Moreover, the essential oils caused high vacuolation of the cytoplasm, detachment of fibrillar layer of cell wall, plasma membrane disruption and disorganization of the nuclear and mitochondrial structures. Aspergillus fumigatus and A. flavus growth inhibition induced by these oils were found to be well-correlated with subsequent morphological changes of the fungi exposed to different fungistatic concentrations of the oils. Our results show the anti-Aspergillus activities of C. cyminum, Z. clinopodioides and N. sativa essential oils, which strengthens the potential use of these substances as anti

  8. Different Stress-Induced Calcium Signatures Are Reported by Aequorin-Mediated Calcium Measurements in Living Cells of Aspergillus fumigatus.

    Directory of Open Access Journals (Sweden)

    Alberto Muñoz

    Full Text Available Aspergillus fumigatus is an inhaled fungal pathogen of human lungs, the developmental growth of which is reliant upon Ca2+-mediated signalling. Ca2+ signalling has regulatory significance in all eukaryotic cells but how A. fumigatus uses intracellular Ca2+ signals to respond to stresses imposed by the mammalian lung is poorly understood. In this work, A. fumigatus strains derived from the clinical isolate CEA10, and a non-homologous recombination mutant ΔakuBKU80, were engineered to express the bioluminescent Ca2+-reporter aequorin. An aequorin-mediated method for routine Ca2+ measurements during the early stages of colony initiation was successfully developed and dynamic changes in cytosolic free calcium ([Ca2+]c in response to extracellular stimuli were measured. The response to extracellular challenges (hypo- and hyper-osmotic shock, mechanical perturbation, high extracellular Ca2+, oxidative stress or exposure to human serum that the fungus might be exposed to during infection, were analysed in living conidial germlings. The 'signatures' of the transient [Ca2+]c responses to extracellular stimuli were found to be dose- and age-dependent. Moreover, Ca2+-signatures associated with each physico-chemical treatment were found to be unique, suggesting the involvement of heterogeneous combinations of Ca2+-signalling components in each stress response. Concordant with the involvement of Ca2+-calmodulin complexes in these Ca2+-mediated responses, the calmodulin inhibitor trifluoperazine (TFP induced changes in the Ca2+-signatures to all the challenges. The Ca2+-chelator BAPTA potently inhibited the initial responses to most stressors in accordance with a critical role for extracellular Ca2+ in initiating the stress responses.

  9. The Aspergillus fumigatus StuA Protein Governs the Up-Regulation of a Discrete Transcriptional Program during the Acquisition of Developmental CompetenceD⃞


    Sheppard, Donald C; Doedt, Thomas; Chiang, Lisa Y.; Kim, H. Stanley; Chen, Dan; William C Nierman; Filler, Scott G


    Members of the Asm1p, Phd1p, Sok2p, Efg1p, and StuAp (APSES) family of fungal proteins regulate morphogenesis and virulence in ascomycetes. We cloned the Aspergillus fumigatus APSES gene encoding StuAp and demonstrated that stuA transcription is markedly up-regulated after the acquisition of developmental competence. A. fumigatus ΔstuA mutants were impaired in their ability to undergo asexual reproduction. Conidiophore morphology was markedly abnormal, and only small numbers of dysmorphic con...

  10. First Detection of TR34 L98H and TR46 Y121F T289A Cyp51 Mutations in Aspergillus fumigatus Isolates in the United States. (United States)

    Wiederhold, Nathan P; Gil, Veronica Garcia; Gutierrez, Felipe; Lindner, Jonathan R; Albataineh, Mohammad T; McCarthy, Dora I; Sanders, Carmita; Fan, Hongxin; Fothergill, Annette W; Sutton, Deanna A


    Azole resistance in Aspergillus fumigatus is an increasing problem. The TR34 L98H and TR46 Y121F T289A mutations that can occur in patients without previous azole exposure have been reported in Europe, Asia, the Middle East, Africa, and Australia. Here, we report the detection of both the TR34 L98H and TR46 Y121F T289A mutations in confirmed A. fumigatus isolates collected in institutions in the United States. These mutations, other mutations known to cause azole resistance, and azole MICs are reported here. PMID:26491179

  11. A Point Mutation in the 14α-Sterol Demethylase Gene cyp51A Contributes to Itraconazole Resistance in Aspergillus fumigatus


    Diaz-Guerra, T. M.; Mellado, E.; Cuenca-Estrella, M.; Rodriguez-Tudela, J. L.


    The genes encoding 14α-sterol demethylases (cyp51A and cyp51B) were analyzed in 12 itraconazole (ITC)-resistant and three ITC-susceptible clinical isolates of Aspergillus fumigatus. Six ITC-resistant strains exhibited a substitution of another amino acid for glycine at position 54, which is located at a very conserved region of the Cyp51A protein. The cyp51A gene from the A. fumigatus wild-type strain (CM-237) was replaced with the mutated cyp51A gene copy of an ITC-resistant strain (AF-72). ...

  12. Purification and characterization of a low molecular weight xylanase from solid-state cultures of Aspergillus fumigatus Fresenius

    Directory of Open Access Journals (Sweden)

    Silva Claudio Henrique Cerri e


    Full Text Available A xylan-degrading enzyme (xylanase II was purified to apparent homogeneity from solid-state cultures of Aspergillus fumigatus Fresenius. The molecular weight of xylanase II was found to be 19 and 8.5 kDa, as estimated by SDS-PAGE and gel filtration on FPLC, respectively. The purified enzyme was most active at 55 °C and pH 5.5. It was specific to xylan. The apparent Km and Vmax values on soluble and insoluble xylans from oat spelt and birchwood showed that xylanase II was most active on soluble birchwood xylan. Studies on hydrolysis products of various xylans and xylooligomers by xylanase II on HPLC showed that the enzyme released a range of products from xylobiose to xylohexaose, with a small amount of xylose from xylooligomers, and presented transferase activity.

  13. Deletion of the msdS/AfmsdC gene induces abnormal polarity and septation in Aspergillus fumigatus. (United States)

    Li, Yanjie; Zhang, Lei; Wang, Depeng; Zhou, Hui; Ouyang, Haomiao; Ming, Jia; Jin, Cheng


    alpha-Mannosidases play an important role in the processing of mannose-containing glycans in eukaryotes. A deficiency in alpha-mannosidase is lethal in humans and cattle. In contrast to mammals, Saccharomyces cerevisiae does not require the endoplasmic reticulum alpha-mannosidase gene for growth. However, little is known of the consequence of loss of function of class I alpha-mannosidases in filamentous fungi. In this study, the msdS/AfmsdC gene was identified to encode 1,2-alpha-mannosidase MsdS in Aspergillus fumigatus. Soluble MsdS expressed in Escherichia coli was characterized as a typical class I alpha-mannosidase. The msdS gene was deleted by replacement of the msdS gene with a pyrG gene. Although the mutant showed a defect in N-glycan processing, as well as a reduction of cell wall components and a reduced ability of conidiation, it appeared that the rate of hyphal growth was not affected. Morphology analysis revealed abnormal polarity and septation at the stages of germination, hyphal growth and conidiation. Although the mechanism by which the N-glycan processing affects polarity and septation is unclear, our results show that msdS is involved in polarity and septation in A. fumigatus. PMID:18599824

  14. Anethole induces apoptotic cell death accompanied by reactive oxygen species production and DNA fragmentation in Aspergillus fumigatus and Saccharomyces cerevisiae. (United States)

    Fujita, Ken-Ichi; Tatsumi, Miki; Ogita, Akira; Kubo, Isao; Tanaka, Toshio


    trans-Anethole (anethole), a major component of anise oil, has a broad antimicrobial spectrum, and antimicrobial activity that is weaker than that of other antibiotics on the market. When combined with polygodial, nagilactone E, and n-dodecanol, anethole has been shown to possess significant synergistic antifungal activity against a budding yeast, Saccharomyces cerevisiae, and a human opportunistic pathogenic yeast, Candida albicans. However, the antifungal mechanism of anethole has not been completely determined. We found that anethole stimulated cell death of a human opportunistic pathogenic fungus, Aspergillus fumigatus, in addition to S. cerevisiae. The anethole-induced cell death was accompanied by reactive oxygen species production, metacaspase activation, and DNA fragmentation. Several mutants of S. cerevisiae, in which genes related to the apoptosis-initiating execution signals from mitochondria were deleted, were resistant to anethole. These results suggest that anethole-induced cell death could be explained by oxidative stress-dependent apoptosis via typical mitochondrial death cascades in fungi, including A. fumigatus and S. cerevisiae. PMID:24393541

  15. Design, synthesis of novel antifungal triazole derivatives with high activities against Aspergillus fumigatus

    Institute of Scientific and Technical Information of China (English)

    Qiu Qin He; Chao Mei Liu; Ke Li; Yong Bing Cao


    Based on the active site of Aspergillusfumigatus lanosterol 14α-demethylase (AF-CYP51), novel triazole compounds were designed. Their chemical synthesis and the antifungal activities were reported. The results showed that all the target compounds exhibited excellent activities with broad spectrum; in which compounds 4, 12 and 15 showed comparable activities against A.fumigatus to the control drug itraconazole.

  16. Development stage-specific proteomic profiling uncovers small, lineage specific proteins most abundant in the Aspergillus Fumigatus conidial proteome

    Directory of Open Access Journals (Sweden)

    Suh Moo-Jin


    Full Text Available Abstract Background The pathogenic mold Aspergillus fumigatus is the most frequent infectious cause of death in severely immunocompromised individuals such as leukemia and bone marrow transplant patients. Germination of inhaled conidia (asexual spores in the host is critical for the initiation of infection, but little is known about the underlying mechanisms of this process. Results To gain insights into early germination events and facilitate the identification of potential stage-specific biomarkers and vaccine candidates, we have used quantitative shotgun proteomics to elucidate patterns of protein abundance changes during early fungal development. Four different stages were examined: dormant conidia, isotropically expanding conidia, hyphae in which germ tube emergence has just begun, and pre-septation hyphae. To enrich for glycan-linked cell wall proteins we used an alkaline cell extraction method. Shotgun proteomic resulted in the identification of 375 unique gene products with high confidence, with no evidence for enrichment of cell wall-immobilized and secreted proteins. The most interesting discovery was the identification of 52 proteins enriched in dormant conidia including 28 proteins that have never been detected in the A. fumigatus conidial proteome such as signaling protein Pil1, chaperones BipA and calnexin, and transcription factor HapB. Additionally we found many small, Aspergillus specific proteins of unknown function including 17 hypothetical proteins. Thus, the most abundant protein, Grg1 (AFUA_5G14210, was also one of the smallest proteins detected in this study (M.W. 7,367. Among previously characterized proteins were melanin pigment and pseurotin A biosynthesis enzymes, histones H3 and H4.1, and other proteins involved in conidiation and response to oxidative or hypoxic stress. In contrast, expanding conidia, hyphae with early germ tubes, and pre-septation hyphae samples were enriched for proteins responsible for

  17. Avirulent mutants of Macrophomina phaseolina and Aspergillus fumigatus initiate infection in Phaseolus mungo in the presence of phaseo-linone; levamisole gives protection

    Indian Academy of Sciences (India)

    Suchandra Sett; Santosh K Mishra; Kazia I Siddiqui


    To evaluate the role of phaseolinone, a phytotoxin produced by Macrophomina phaseolina, in disease initiation, three nontoxigenic avirulent mutants of the fungus were generated by UV-mutagenesis. Two of them were able to initiate infection in germinating Phaseolus mungo seeds only in the presence of phaseolinone. The minimum dose of phaseolinone required for infection in 30% seedlings was 2·5 g/ml. A human pathogen, Aspergillus fumigatus was also able to infect germinating seeds of P. mungo in the presence of 5 g/ml concentration of phaseolinone. Phaseolinone seemed to facilitate infection by A. fumigatus, which is not normally phytopathogenic, by reducing the immunity of germinating seedlings in a nonspecific way. Levamisole, a non-specific immunopotentiator gave protection against infection induced by A. fumigatus at an optimum dose of 50 g/ml. Sodium malonate prevented the effects of levamisole.

  18. Micromorphological changes on the embryonic membranes of turkey eggs infected with Aspergillus fumigatus and their importance for embryonic survival

    Directory of Open Access Journals (Sweden)

    Jezdimirović Nemanja V.


    Full Text Available Aspergillosis is a frequent fungal disease of young and adult poultry in our commercial flocks. Infection can occur after hatching by inhalation of Aspergillus conidia which can be present in contaminated hatcheries, or later, by spores from moldy litter, dust, faeces or feed. Spores from the surface of egg shell can penetrate inside of an egg. The main characteristic of aspergillosis is granulomatous inflammation of respiratory system, although generalized form is possible as well. Multiple yellow nodules can be seen as major patomorphological changes and they are usually localized in lungs, air sacs, and can also be found in spleen, brain, subcutis and eyes. Egg embryos are quite susceptible to infection by Aspergillus fumigatus during incubation. In this study, the history of a case on one local farm with mortality rate of 7.2% in the turkey flock is presented. At the same time, 28 day old 30 incubated hatching turkey eggs were sampled, that were unable to hatch. The aim of the present work was to determine the cause and to identify the agent of embryonic mortality. Total of the 30 eggs were opened, and 16 of them had thickened egg membranes in the area of air sac. Membrane thickening was visible and circumscript or diffuse presence of black-grey or grey-green fungal growth was observed. Only 3 samples air sacs were filled with developed stages of fungi. To evaluate histopathological lesions, changed egg membranes were processed by standard histological technique. Dominant microscopic finding was thickening of egg membranes as a consequence of fungal growth and many of them penetrated deep towards embryo. Most of the hyphae were growing vertically through membranes. On the outside surface of the membranes, the elements of fungi (conidial heads with phialids and spores on them, could be clearly observed. These changes were responsible for embryonic death, which on the basis of the size of dead embryos occurred between 7th and 10th day of



    Nurul Kartini Abu Bakar,; Zuraidah Zanirun; Suraini Abd-Aziz; Farinazleen Mohd Ghazali; Mohd Ali Hassan


    Utilization of oil palm empty fruit bunch (OPEFB) for bioethanol production with crude cellulase cocktails from locally isolated fungi was studied. Enzymatic saccharification of alkaline pretreated OPEFB was done using different cellulase enzyme preparations. Crude cellulase cocktails from Trichoderma asperellum UPM1 and Aspergillus fumigatus UPM2 produced 8.37 g/L reducing sugars with 0.17 g/g yield. Production of bioethanol from OPEFB hydrolysate using Baker’s yeast produced approximately 0...

  20. Purification, biochemical characterization and structural modelling of alkali-stable β-1,4-xylan xylanohydrolase from Aspergillus fumigatus R1 isolated from soil


    Deshmukh, Rehan Ahmed; Jagtap, Sharmili; Mandal, Madan Kumar; Mandal, Suraj Kumar


    Background Aspergillus fumigatus R1 produced xylanase under submerged fermentation which degrades the complex hemicelluloses contained in agricultural substrates. Xylanases have gained considerable attention because of their tremendous applications in industries. The purpose of our study was to purify xylanase and study its biochemical properties. We have predicted the secondary structure of purified xylanase and evaluated its active site residues and substrate binding sites based on the glob...

  1. Mitogen activated protein kinases SakA(HOG1) and MpkC collaborate for Aspergillus fumigatus virulence. (United States)

    Bruder Nascimento, Ariane Cristina Mendes de Oliveira; Dos Reis, Thaila Fernanda; de Castro, Patrícia Alves; Hori, Juliana I; Bom, Vinícius Leite Pedro; de Assis, Leandro José; Ramalho, Leandra Naira Zambelli; Rocha, Marina Campos; Malavazi, Iran; Brown, Neil Andrew; Valiante, Vito; Brakhage, Axel A; Hagiwara, Daisuke; Goldman, Gustavo H


    Here, we investigated which stress responses were influenced by the MpkC and SakA mitogen-activated protein kinases of the high-osmolarity glycerol (HOG) pathway in the fungal pathogen Aspergillus fumigatus. The ΔsakA and the double ΔmpkC ΔsakA mutants were more sensitive to osmotic and oxidative stresses, and to cell wall damaging agents. Both MpkC::GFP and SakA::GFP translocated to the nucleus upon osmotic stress and cell wall damage, with SakA::GFP showing a quicker response. The phosphorylation state of MpkA was determined post exposure to high concentrations of congo red and Sorbitol. In the wild-type strain, MpkA phosphorylation levels progressively increased in both treatments. In contrast, the ΔsakA mutant had reduced MpkA phosphorylation, and surprisingly, the double ΔmpkC ΔsakA had no detectable MpkA phosphorylation. A. fumigatus ΔsakA and ΔmpkC were virulent in mouse survival experiments, but they had a 40% reduction in fungal burden. In contrast, the ΔmpkC ΔsakA double mutant showed highly attenuated virulence, with approximately 50% mice surviving and a 75% reduction in fungal burden. We propose that both cell wall integrity (CWI) and HOG pathways collaborate, and that MpkC could act by modulating SakA activity upon exposure to several types of stresses and during CW biosynthesis. PMID:26878695

  2. Activity and Safety of Inhaled Itraconazole Nanosuspension in a Model Pulmonary Aspergillus fumigatus Infection in Inoculated Young Quails. (United States)

    Wlaź, Piotr; Knaga, Sebastian; Kasperek, Kornel; Wlaź, Aleksandra; Poleszak, Ewa; Jeżewska-Witkowska, Grażyna; Winiarczyk, Stanisław; Wyska, Elżbieta; Heinekamp, Thorsten; Rundfeldt, Chris


    Pulmonary aspergillosis is frequently reported in parrots, falcons, and other birds held in captivity. Inhalation is the main route of infection for Aspergillus fumigatus, resulting in both acute and chronic disease conditions. Itraconazole (ITRA) is an antifungal commonly used in birds, but its administration requires repeated oral dosing, and the safety margin is narrow. To investigate the efficacy of inhaled ITRA, six groups of ten young quails (Coturnix japonica) were inoculated intratracheally with 5 × 10(6) spores (3 groups) or 5 × 10(7) spores (3 groups). Animals were exposed to nebulized ITRA nanosuspension as 10 % suspension or 4 % suspension, once daily for 30 min, starting 2 h after inoculation for 6 days. Control groups were exposed to nebulized saline for the same period of time. Survival and clinical scores were evaluated, and animals were subjected to gross pathology. In control animals, aspergillosis resulted in systemic disease without pulmonary or air sac granulomas. Animals died from multiple organ failure. Inhalation of 10 % ITRA nanosuspension blocked lethality and prevented disease-related symptoms in the quails exposed to the low dose of spores, while the disease course in quails inoculated with the high-spore dose was retarded. Inhalation of 4 % ITRA nanosuspension was less effective. Both inhalations were well tolerated, and gross pathology did not reveal signs of local toxicity. The data indicate that inhaled administration of 10 % ITRA nanosuspension is capable of alleviating an acute A. fumigatus infection in quails. A lower ITRA concentration may be only active in chronic pulmonary aspergillosis. PMID:25790942

  3. Four ardeemin analogs from endophytic Aspergillus fumigatus SPS-02 and their reversal effects on multidrug-resistant tumor cells. (United States)

    Zhang, Hua-Wei; Ying, Chen; Tang, Yi-Fei


    Four ardeemin derivatives, 5-N-acetylardeemin (1), 5-N-acetyl-15bβ-hydroxyardeemin (2), 5-N-acetyl-15b-didehydroardeemin (3), and 5-N-acetyl-16α-hydroxyardeemin (4), were isolated from the fermentation broth of an endophytic Aspergillus fumigatus SPS-02 associated with Artemisia annua L. The structures of these metabolites were elucidated by a combination of spectroscopic data, including 1D-, 2D-NMR and MS. In vitro chemosensitization assay indicated that these ardeemins had different activities of reversing the multidrug-resistant (MDR) phenotype in three cancer cell lines, leukemia doxorubicin resistant cell K562/DOX, human lung adenocarcinoma cis-platin-resistant cell A549/DDP, and ovarian cancer cisplatin-resistant cell SK-OV-S/DDP. Compound 4 exhibited the strongest MDR reversing effect at 5 μM concentration in K562/DOX and A549/DDP cell lines 5.2±0.18-fold, 8.2±0.23-fold, respectively, while compound 2 had the highest reversal capacity in SK-OV-S/DDP cell line with 10.8±0.28 fold. Preliminary investigation of their structureactivity relationship suggested that a OH group at C(15b) or C(16) in ardeemin plays a key role in reversing the MDR effect. It is the first report on ardeemin analogs from endophytic A. fumigatus with reversal effects on MDR cancer cell lines K562/DOX, A549/DDP and SK-OV-S/DDP. PMID:24443428

  4. Secretive expression of Aspergillus fumigatus phytase in tobacco improves phosphorus nutrition in plant

    Institute of Scientific and Technical Information of China (English)

    Wang Yan; Gao Xiaorong; Su Qiao; An Lijia


    To generate transgenic plants capable of utilizing exogenous phytate,an Aspersgillus fumigatus phytase gene(fphyA) was constitutively expressed in tobacco and recombinant enzyme was secreted from plant roots into the rhizosphere using the signal sequence from tobacco calretieulin.After 40 days of plant growth in hydroponic media,phytase activities in leaves,stems,roots and growth media of transgenic plants were 8.6-fold,7.4-fold,12.6-fold and 14.3-fold higher than those of wild-type plants.Signifi-cant improvements in plant growth and phosphoms(P)utilization were observed in the transgenic plants.When phytate was supplied as the sole P source.45-day-old transgenic tobaccos accumulated 1.0-fold and 0.5-fold more shoot and root biomass than wild-type tobaccos.with a concomitant of 1.7-fold increase in total P concentration.These results indicate that secretive expression of the A.fumigatus phytase improves acquisition and use of P from phytate in plants.

  5. Aspergillus nidulans cell wall composition and function change in response to hosting several Aspergillus fumigatus UDP-galactopyranose mutase activity mutants.

    Directory of Open Access Journals (Sweden)

    Md Kausar Alam

    Full Text Available Deletion or repression of Aspergillus nidulans ugmA (AnugmA, involved in galactofuranose biosynthesis, impairs growth and increases sensitivity to Caspofungin, a β-1,3-glucan synthesis antagonist. The A. fumigatus UgmA (AfUgmA crystal structure has been determined. From that study, AfUgmA mutants with altered enzyme activity were transformed into AnugmA▵ to assess their effect on growth and wall composition in A. nidulans. The complemented (AnugmA::wild type AfugmA strain had wild type phenotype, indicating these genes had functional homology. Consistent with in vitro studies, AfUgmA residues R182 and R327 were important for its function in vivo, with even conservative amino (RK substitutions producing AnugmA? phenotype strains. Similarly, the conserved AfUgmA loop III histidine (H63 was important for Galf generation: the H63N strain had a partially rescued phenotype compared to AnugmA▵. Collectively, A. nidulans strains that hosted mutated AfUgmA constructs with low enzyme activity showed increased hyphal surface adhesion as assessed by binding fluorescent latex beads. Consistent with previous qPCR results, immunofluorescence and ELISA indicated that AnugmA▵ and AfugmA-mutated A. nidulans strains had increased α-glucan and decreased β-glucan in their cell walls compared to wild type and AfugmA-complemented strains. Like the AnugmA▵ strain, A. nidulans strains containing mutated AfugmA showed increased sensitivity to antifungal drugs, particularly Caspofungin. Reduced β-glucan content was correlated with increased Caspofungin sensitivity. Aspergillus nidulans wall Galf, α-glucan, and β-glucan content was correlated in A. nidulans hyphal walls, suggesting dynamic coordination between cell wall synthesis and cell wall integrity.

  6. Aspergillus fumigatus allergen expression is coordinately regulated in response to hydrogen peroxide and cyclic AMP

    Directory of Open Access Journals (Sweden)

    Bowyer Paul


    Full Text Available Abstract Background A. fumigatus has been associated with a wide spectrum of allergic disorders such as ABPA or SAFS. It is poorly understood what allergens in particular are being expressed during fungal invasion and which are responsible for stimulation of immune responses. Study of the dynamics of allergen production by fungi may lead to insights into how allergens are presented to the immune system. Methods Expression of 17 A. fumigatus allergen genes was examined in response to various culture conditions and stimuli as well as in the presence of macrophages in order to mimic conditions encountered in the lung. Results Expression of 14/17 allergen genes was strongly induced by oxidative stress caused by hydrogen peroxide (Asp f 1, -2, -4, -5, -6, -7, -8, -10, -13, -17 and -18, all >10-fold and Asp f 11, -12, and -22, 5-10-fold and 16/17 allergen genes were repressed in the presence of cAMP. The 4 protease allergen genes (Asp f -5, -10, -13 and -18 were expressed at very low levels compared to the comparator (β-tubulin under all other conditions examined. Mild heat shock, anoxia, lipid and presence of macrophages did not result in coordinated changes in allergen gene expression. Growth on lipid as sole carbon source contributed to the moderate induction of most of the allergen genes. Heat shock (37°C > 42°C caused moderate repression in 11/17 genes (Asp f 1, -2, -4, -5, -6, -9, -10, -13, -17, -18 and -23 (2- to 9-fold, which was mostly evident for Asp f 1 and -9 (~9-fold. Anaerobic stress led to moderate induction of 13/17 genes (1.1 to 4-fold with one, Asp f 8 induced over 10-fold when grown under mineral oil. Complex changes were seen in gene expression during co-culture of A. fumigatus with macrophages. Conclusions Remarkable coordination of allergen gene expression in response to a specific condition (oxidative stress or the presence of cAMP has been observed, implying that a single biological stimulus may play a role in allergen gene

  7. Incidence of Cyp51 A key mutations in Aspergillus fumigatus-a study on primary clinical samples of immunocompromised patients in the period of 1995-2013.

    Directory of Open Access Journals (Sweden)

    Birgit Spiess

    Full Text Available As the incidence of azole resistance in Aspergillus fumigatus is rising and the diagnosis of invasive aspergillosis (IA in immunocompromised patients is rarely based on positive culture yield, we screened our Aspergillus DNA sample collection for the occurrence of azole resistance mediating cyp51 A key mutations. Using two established, a modified and a novel polymerase chain reaction (PCR assays followed by DNA sequence analysis to detect the most frequent mutations in the A. fumigatus cyp51 A gene conferring azole resistance (TR34 (tandem repeat, L98H and M220 alterations. We analyzed two itraconazole and voriconazole and two multi-azole resistant clinical isolates and screened 181 DNA aliquots derived from clinical samples (blood, bronchoalveolar lavage (BAL, biopsies, cerebrospinal fluid (CSF of 155 immunocompromised patients of our Aspergillus DNA sample collection, previously tested positive for Aspergillus DNA and collected between 1995 and 2013. Using a novel PCR assay for the detection of the cyp51 A 46 bp tandem repeat (TR46 directly from clinical samples, we found the alteration in a TR46/Y121F/T289A positive clinical isolate. Fifty stored DNA aliquots from clinical samples were TR46 negative. DNA sequence analysis revealed a single L98H mutation in 2010, two times the L98H alteration combined with TR34 in 2011 and 2012 and a so far unknown N90K mutation in 1998. In addition, four clinical isolates were tested positive for the TR34/L98H combination in the year 2012. We consider our assay of epidemiological relevance to detect A. fumigatus azole resistance in culture-negative clinical samples of immunocompromised patients; a prospective study is ongoing.

  8. Fed-batch production of hydrophobin RodB from Aspergillus fumigatus in host Pichia pastoris

    DEFF Research Database (Denmark)

    Pedersen, Mona Højgaard; Borodina, Irina; Frisvad, Jens Christian;

    : The gene encoding hydrophobin RodB was amplified by RT-PCR from the total RNA isolated from the spores of A. fumigatus (AF296 strain). The resulting cDNA was cloned into TOPO vectors, and the inserts were sequenced. The genes were further amplified by PCR and cloned into expression vectors pPICZA and p......PICZB while adding a 6xHis-tag to the C-terminal. The plasmids were linearized, transformed into P. pastoris strain X33 and transformants were selected by zeocin resistance. The expression of the RodB gene was first studied in culture flasks in buffered complex methanol medium as protein production...

  9. Decolourization of textile dye effluent by non-viable biomass of Aspergillus fumigatus


    K. Kalaiarasi; A Lavanya; S. Amsamani; G. Bagyalakshmi


    The aim of this work was to study the decolourization of textile dye effluent by non-viable biomass of Aspergillus fumigates. The dried non-viable fungal biomass exhibited maximum dye removal at pH 7.0 with temperature of 30ºC and 3 g/l (w/v) biomass concentration, after 24 h contact time. The results showed that the non-viable biomass possessed high efficiency for dye removal from textile effluent.

  10. International expert opinion on the management of infection caused by azole-resistant Aspergillus fumigatus. (United States)

    Verweij, Paul E; Ananda-Rajah, Michelle; Andes, David; Arendrup, Maiken C; Brüggemann, Roger J; Chowdhary, Anuradha; Cornely, Oliver A; Denning, David W; Groll, Andreas H; Izumikawa, Koichi; Kullberg, Bart Jan; Lagrou, Katrien; Maertens, Johan; Meis, Jacques F; Newton, Pippa; Page, Iain; Seyedmousavi, Seyedmojtaba; Sheppard, Donald C; Viscoli, Claudio; Warris, Adilia; Donnelly, J Peter


    An international expert panel was convened to deliberate the management of azole-resistant aspergillosis. In culture-positive cases, in vitro susceptibility testing should always be performed if antifungal therapy is intended. Different patterns of resistance are seen, with multi-azole and pan-azole resistance more common than resistance to a single triazole. In confirmed invasive pulmonary aspergillosis due to an azole-resistant Aspergillus, the experts recommended a switch from voriconazole to liposomal amphotericin B (L-AmB; Ambisome(®)). In regions with environmental resistance rates of ≥10%, a voriconazole-echinocandin combination or L-AmB were favoured as initial therapy. All experts recommended L-AmB as core therapy for central nervous system aspergillosis suspected to be due to an azole-resistant Aspergillus, and considered the addition of a second agent with the majority favouring flucytosine. Intravenous therapy with either micafungin or L-AmB given as either intermittent or continuous therapy was recommended for chronic pulmonary aspergillosis due to a pan-azole-resistant Aspergillus. Local and national surveillance with identification of clinical and environmental resistance patterns, rapid diagnostics, better quality clinical outcome data, and a greater understanding of the factors driving or minimising environmental resistance are areas where research is urgently needed, as well as the development of new oral agents outside the azole drug class. PMID:26282594

  11. Exploring thermophilic cellulolytic enzyme production potential of Aspergillus fumigatus by the solid-state fermentation of wheat straw. (United States)

    Mehboob, Nazia; Asad, M Javaid; Asgher, M; Gulfraz, M; Mukhtar, Tariq; Mahmood, Raja Tahir


    Cellulases can be used for biofuel production to decrease the fuel crises in the world. Microorganisms cultured on lignocellulosic wastes can be used for the production of cellulolytic enzymes at large scale. In the current study, cellulolytic enzyme production potential of Aspergillus fumigatus was explored and optimized by employing various cultural and nutritional parameters. Maximum endoglucanase production was observed after 72 h at 55 °C, pH 5.5, and 70 % moisture level. Addition of 0.3 % of fructose, peptone, and Tween-80 further enhanced the production of endoglucanase. Maximum purification was achieved with 40 % ammonium sulfate, and it was purified 2.63-fold by gel filtration chromatography. Endoglucanase has 55 °C optimum temperature, 4.8 optimum pH, 3.97 mM K m, and 8.53 μM/mL/min V max. Maximum exoglucanase production was observed at 55 °C after 72 h, at pH 5.5, and 70 % moisture level. Further addition of 0.3 % of each of fructose, peptone, and Tween-80 enhances the secretion of endoglucanase. It was purified 3.30-fold in the presence of 40 % ammonium sulfate followed by gel filtration chromatography. Its optimum temperature was 55 °C, optimum pH was 4.8, 4.34 mM K m, and 7.29 μM/mL/min V max. In the case of β-glucosidase, maximum activity was observed after 72 h at 55 °C, pH 5.5, and 70 % moisture level. The presence of 0.3 % of fructose, peptone, and Tween-80 in media has beneficial impact on β-glucosidase production. A 4.36-fold purification was achieved by 40 % ammonium sulfate precipitation and gel filtration chromatography. Optimum temperature of β-glucosidase was 55 °C, optimum pH was 4.8, K m was 4.92 mM, and V max 6.75 μM/mL/min. It was also observed that fructose is better than glucose, and peptone is better than urea for the growth of A. fumigatus. The K m and V max values indicated that endoglucanase, exoglucanase, and β-glucosidase have good affinity for their substrates. PMID:24562980

  12. Inhibition of conidiophore development in Aspergillus fumigatus by an Escherichia coli DH5α strain, a promising antifungal candidate against aspergillosis. (United States)

    Balhara, M; Ruhil, S; Kumar, M; Dhankhar, S; Chhillar, A K


    The opportunistic human pathogen Aspergillus fumigatus produces a massive number of asexual spores (conidia) as the primary means of dispersal, survival, genome protection and infection of hosts. In this report, we investigated secretory and cytosolic proteins of non-pathogenic bacterial species (mostly belonging to human microbiome) for antifungal potential against A. fumigatus, A. flavus and A. niger. Our preliminary results revealed that cytosolic proteins of E. coli DH5α were most active and the less toxic against various pathogenic isolates of A. fumigatus (the major pathogenic species), depicting a minimum inhibitory concentration (MIC) of 62.50 μg/mL, 62.50 μg/mL and 12.50 μg/disc using microbroth dilution assay (MDA), percentage spore germination inhibition assay (PSGI) and disc diffusion assay (DDA), respectively. E. coli protein was non-toxic against human erythrocytes at doses up to 1000 μg/mL as compared to standard drug, amphotericin B which lysed 100% of erythrocytes at a concentration of 37.50 μg/mL. Time kill analysis proved it to be fungicidal in a concentration and time-dependent manner. Scanning electron microscopic studies (SEM) were carried out to prevail what kind of damage it causes to A. fumigatus. SEM results reported that conidiophore (structures forming conidia) development was halted as a major consequence, reducing the number of conidiophores to insignificant values as well as alteration in their morphological attributes. This feature may contribute to the development of new prevention strategies against Aspergillus infections. Hyphal atrophy was also observed, evidenced by shrinking and flattening of hyphal walls and reduced, abrupt hyphal branching. Such actions may effectively reduce the invasive ability of Aspergillus as well as it can sterilize the fungal burden by obstructing the conidiation pathway of A. fumigatus. Hence, E. coli DH5α, being a commensal species, can lead to the development of antifungal molecule with novel

  13. Gene expression profiles of human dendritic cells interacting with Aspergillus fumigatus in a bilayer model of the alveolar epithelium/endothelium interface.

    Directory of Open Access Journals (Sweden)

    Charles Oliver Morton

    Full Text Available The initial stages of the interaction between the host and Aspergillus fumigatus at the alveolar surface of the human lung are critical in the establishment of aspergillosis. Using an in vitro bilayer model of the alveolus, including both the epithelium (human lung adenocarcinoma epithelial cell line, A549 and endothelium (human pulmonary artery epithelial cells, HPAEC on transwell membranes, it was possible to closely replicate the in vivo conditions. Two distinct sub-groups of dendritic cells (DC, monocyte-derived DC (moDC and myeloid DC (mDC, were included in the model to examine immune responses to fungal infection at the alveolar surface. RNA in high quantity and quality was extracted from the cell layers on the transwell membrane to allow gene expression analysis using tailored custom-made microarrays, containing probes for 117 immune-relevant genes. This microarray data indicated minimal induction of immune gene expression in A549 alveolar epithelial cells in response to germ tubes of A. fumigatus. In contrast, the addition of DC to the system greatly increased the number of differentially expressed immune genes. moDC exhibited increased expression of genes including CLEC7A, CD209 and CCL18 in the absence of A. fumigatus compared to mDC. In the presence of A. fumigatus, both DC subgroups exhibited up-regulation of genes identified in previous studies as being associated with the exposure of DC to A. fumigatus and exhibiting chemotactic properties for neutrophils, including CXCL2, CXCL5, CCL20, and IL1B. This model closely approximated the human alveolus allowing for an analysis of the host pathogen interface that complements existing animal models of IA.

  14. Genetic Analysis Using an Isogenic Mating Pair of Aspergillus fumigatus Identifies Azole Resistance Genes and Lack of MAT Locus's Role in Virulence. (United States)

    Losada, Liliana; Sugui, Janyce A; Eckhaus, Michael A; Chang, Yun C; Mounaud, Stephanie; Figat, Abigail; Joardar, Vinita; Pakala, Suman B; Pakala, Suchitra; Venepally, Pratap; Fedorova, Natalie; Nierman, William C; Kwon-Chung, Kyung J


    Invasive aspergillosis (IA) due to Aspergillus fumigatus is a major cause of mortality in immunocompromised patients. The discovery of highly fertile strains of A. fumigatus opened the possibility to merge classical and contemporary genetics to address key questions about this pathogen. The merger involves sexual recombination, selection of desired traits, and genomics to identify any associated loci. We constructed a highly fertile isogenic pair of A. fumigatus strains with opposite mating types and used them to investigate whether mating type is associated with virulence and to find the genetic loci involved in azole resistance. The pair was made isogenic by 9 successive backcross cycles of the foundational strain AFB62 (MAT1-1) with a highly fertile (MAT1-2) progeny. Genome sequencing showed that the F9 MAT1-2 progeny was essentially identical to the AFB62. The survival curves of animals infected with either strain in three different animal models showed no significant difference, suggesting that virulence in A. fumigatus was not associated with mating type. We then employed a relatively inexpensive, yet highly powerful strategy to identify genomic loci associated with azole resistance. We used traditional in vitro drug selection accompanied by classical sexual crosses of azole-sensitive with resistant isogenic strains. The offspring were plated under varying drug concentrations and pools of resulting colonies were analyzed by whole genome sequencing. We found that variants in 5 genes contributed to azole resistance, including mutations in erg11A (cyp51A), as well as multi-drug transporters, erg25, and in HMG-CoA reductase. The results demonstrated that with minimal investment into the sequencing of three pools from a cross of interest, the variation(s) that contribute any phenotype can be identified with nucleotide resolution. This approach can be applied to multiple areas of interest in A. fumigatus or other heterothallic pathogens, especially for virulence

  15. A New Aspergillus fumigatus Resistance Mechanism Conferring In Vitro Cross-Resistance to Azole Antifungals Involves a Combination of cyp51A Alterations▿


    Mellado, E.; Garcia-Effron, G.; Alcázar-Fuoli, L.; Melchers, W J G; Verweij, P. E.; Cuenca-Estrella, M.; Rodríguez-Tudela, J L


    Fourteen Aspergillus fumigatus clinical isolates that exhibited a pattern of reduced susceptibility to triazole drugs were analyzed. The sequences of the cyp51A gene from all isolates showed the presence of a point mutation at t364a, which led to the substitution of leucine 98 for histidine (L98H), together with the presence of two copies of a 34-bp sequence in tandem in the promoter of the cyp51A gene. Quantitative expression analysis (real-time PCR) showed up to an eightfold increase in the...

  16. Production and partial characterization of serine and metallo peptidases secreted by Aspergillus fumigatus Fresenius in submerged and solid state fermentation. (United States)

    da Silva, Ronivaldo Rodrigues; de Freitas Cabral, Tatiana Pereira; Rodrigues, André; Cabral, Hamilton


    Enzyme production varies in different fermentation systems. Enzyme expression in different fermentation systems yields important information for improving our understanding of enzymatic production induction. Comparative studies between solid-state fermentation (SSF) using agro-industrial waste wheat bran and submerged fermentation (SmF) using synthetic media were carried out to determinate the best parameters for peptidase production by the fungus Aspergillus fumigatus Fresen. Variables tested include: the concentration of carbon and protein nitrogen sources, the size of the inoculum, the pH of the media, temperature, and the length of the fermentation process. The best peptidase production during SSF was obtained after 96 hours using wheat bran at 30 °C with an inoculum of 1 × 10(6) spores and yielded 1500 active units (U/mL). The best peptidase production using SmF was obtained after periods of 72 and 96 hours of fermentation in media containing 0.5% and 0.25% of casein, respectively, at a pH of 6.0 and at 30 °C and yielded 40 U/mL. We also found examples of catabolite repression of peptidase production under SmF conditions. Biochemical characterization of the peptidases produced by both fermentative processes showed optimum activity at pH 8.0 and 50 °C, and also showed that their proteolytic activity is modulated by surfactants. The enzymatic inhibition profile using phenylmethylsulfonyl fluoride (PMSF) in SmF and SSF indicated that both fermentative processes produced a serine peptidase. Additionally, the inhibitory effect of the ethylene-diaminetetraacetic acid (EDTA) chelating agent on the peptidase produced by SmF indicated that this fermentative process also produced a metallopeptidase. PMID:24159310

  17. Production and partial characterization of serine and metallo peptidases secreted by Aspergillus fumigatus Fresenius in submerged and solid state fermentatio

    Directory of Open Access Journals (Sweden)

    Ronivaldo Rodrigues da Silva


    Full Text Available Enzyme production varies in different fermentation systems. Enzyme expression in different fermentation systems yields important information for improving our understanding of enzymatic production induction. Comparative studies between solid-state fermentation (SSF using agro-industrial waste wheat bran and submerged fermentation (SmF using synthetic media were carried out to determinate the best parameters for peptidase production by the fungus Aspergillus fumigatus Fresen. Variables tested include: the concentration of carbon and protein nitrogen sources, the size of the inoculum, the pH of the media, temperature, and the length of the fermentation process. The best peptidase production during SSF was obtained after 96 hours using wheat bran at 30 ºC with an inoculum of 1 x 10(6 spores and yielded 1500 active units (UµmL. The best peptidase production using SmF was obtained after periods of 72 and 96 hours of fermentation in media containing 0.5% and 0.25% of casein, respectively, at a pH of 6.0 and at 30 ºC and yielded 40 UµmL. We also found examples of catabolite repression of peptidase production under SmF conditions. Biochemical characterization of the peptidases produced by both fermentative processes showed optimum activity at pH 8.0 and 50 ºC, and also showed that their proteolytic activity is modulated by surfactants. The enzymatic inhibition profile using phenylmethylsulfonyl fluoride (PMSF in SmF and SSF indicated that both fermentative processes produced a serine peptidase. Additionally, the inhibitory effect of the ethylene-diaminetetraacetic acid (EDTA chelating agent on the peptidase produced by SmF indicated that this fermentative process also produced a metallopeptidase.

  18. Metabolites from Aspergillus fumigatus, an endophytic fungus associated with Melia azedarach, and their antifungal, antifeedant, and toxic activities. (United States)

    Li, Xiao-Jun; Zhang, Qiang; Zhang, An-Ling; Gao, Jin-Ming


    Thirty-nine fungal metabolites 1-39, including two new alkaloids, 12β-hydroxy-13α-methoxyverruculogen TR-2 (6) and 3-hydroxyfumiquinazoline A (16), were isolated from the fermentation broth of Aspergillus fumigatus LN-4, an endophytic fungus isolated from the stem bark of Melia azedarach. Their structures were elucidated on the basis of detailed spectroscopic analysis (mass spectrometry and one- and two-dimensional NMR experiments) and by comparison of their NMR data with those reported in the literature. These isolated compounds were evaluated for in vitro antifungal activities against some phytopathogenic fungi, toxicity against brine shrimps, and antifeedant activities against armyworm larvae (Mythimna separata Walker). Among them, sixteen compounds showed potent antifungal activities against phytopathogenic fungi (Botrytis cinerea, Alternaria solani, Alternaria alternata, Colletotrichum gloeosporioides, Fusarium solani, Fusarium oxysporum f. sp. niveum, Fusarium oxysporum f. sp. vasinfectum, and Gibberella saubinettii), and four of them, 12β-hydroxy-13α-methoxyverruculogen TR-2 (6), fumitremorgin B (7), verruculogen (8), and helvolic acid (39), exhibited antifungal activities with MIC values of 6.25-50 μg/mL, which were comparable to the two positive controls carbendazim and hymexazol. In addition, of eighteen that exerted moderate lethality toward brine shrimps, compounds 7 and 8 both showed significant toxicities with median lethal concentration (LC(50)) values of 13.6 and 15.8 μg/mL, respectively. Furthermore, among nine metabolites that were found to possess antifeedant activity against armyworm larvae, compounds 7 and 8 gave the best activity with antifeedant indexes (AFI) of 50.0% and 55.0%, respectively. Structure-activity relationships of the metabolites were also discussed. PMID:22409377

  19. A polysaccharide virulence factor from Aspergillus fumigatus elicits anti-inflammatory effects through induction of Interleukin-1 receptor antagonist.

    Directory of Open Access Journals (Sweden)

    Mark S Gresnigt


    Full Text Available The galactosaminogalactan (GAG is a cell wall component of Aspergillus fumigatus that has potent anti-inflammatory effects in mice. However, the mechanisms responsible for the anti-inflammatory property of GAG remain to be elucidated. In the present study we used in vitro PBMC stimulation assays to demonstrate, that GAG inhibits proinflammatory T-helper (Th1 and Th17 cytokine production in human PBMCs by inducing Interleukin-1 receptor antagonist (IL-1Ra, a potent anti-inflammatory cytokine that blocks IL-1 signalling. GAG cannot suppress human T-helper cytokine production in the presence of neutralizing antibodies against IL-1Ra. In a mouse model of invasive aspergillosis, GAG induces IL-1Ra in vivo, and the increased susceptibility to invasive aspergillosis in the presence of GAG in wild type mice is not observed in mice deficient for IL-1Ra. Additionally, we demonstrate that the capacity of GAG to induce IL-1Ra could also be used for treatment of inflammatory diseases, as GAG was able to reduce severity of an experimental model of allergic aspergillosis, and in a murine DSS-induced colitis model. In the setting of invasive aspergillosis, GAG has a significant immunomodulatory function by inducing IL-1Ra and notably IL-1Ra knockout mice are completely protected to invasive pulmonary aspergillosis. This opens new treatment strategies that target IL-1Ra in the setting of acute invasive fungal infection. However, the observation that GAG can also protect mice from allergy and colitis makes GAG or a derivative structure of GAG a potential treatment compound for IL-1 driven inflammatory diseases.

  20. Essential pathway identification: from in silico analysis to potential antifungal targets in Aspergillus fumigatus

    DEFF Research Database (Denmark)

    Thykær, Jette; Andersen, Mikael Rørdam; Baker, S. E.


    Computational metabolic flux modeling has been a great aid for both understanding and manipulating microbial metabolism. A previously developed metabolic flux model for Aspergillus niger, an economically important biotechnology fungus known for protein and organic acid production, is comprised of...... 1190 biochemically unique reactions that are associated with 871 open reading frames. Through a systematic in silico deletion of single metabolic reactions using this model, several essential metabolic pathways were identified for A. niger. A total of 138 reactions were identified as being essential...... biochemical reactions during growth on a minimal glucose medium. The majority of the reactions grouped into essential biochemical pathways covering cell wall biosynthesis, amino acid biosynthesis, energy metabolism and purine and pyrimidine metabolism. Based on the A. niger open reading frames associated with...

  1. New cause for false-positive results with the Pastorex Aspergillus antigen latex agglutination test.


    Kappe, R; Schulze-Berge, A


    The Pastorex Aspergillus antigen test for detection of Aspergillus galactomannan antigen in the sera of patients with invasive aspergillosis is used in many clinical laboratories. A serum sample contaminated with Penicillium chrysogenum gave a strongly positive reaction (1:128) which was heat stable, was not eliminated by pronase treatment, and was not detected by a normal rabbit globulin control. This observation was shown to be due to cross-reactions of the monoclonal antibody EB-A2 used by...

  2. Molecular sub-typing suggests that the environment of rehabilitation centers may be a potential source of Aspergillus fumigatus infecting rehabilitating seabirds. (United States)

    Burco, Julia D; Etienne, Kizee A; Massey, J Gregory; Ziccardi, Michael H; Balajee, S Arunmozhi


    Aspergillosis remains a major cause of infection-related avian mortality in birds that are debilitated and undergoing rehabilitation for release into the wild. This study was designed to understand the source of avian aspergillosis in seabirds undergoing rehabilitation at selected northern California aquatic bird rehabilitation centers. Air, surface and water sampling was performed between August 2007 and July 2008 in three such centers and selected natural seabird loafing sites. Average air Aspergillus fumigatus counts were at least nine times higher in samples obtained from the rehabilitation sites (M = 7.34, SD = 9.78 CFU/m(3)), when compared to those found at natural sites (M = 0.76, SD = 2.24 CFU/m(3)), t (205) = -5.99, P < 0.001. A total of 37 A. fumigatus isolates from birds with confirmed aspergillosis and 42 isolates from environmental samples were identified using both morphological and molecular methods, and subsequently sub-typed using an eight-locus microsatellite panel with the neighbor joining algorithm. Results of the study demonstrated the presence of five clonal groups, 13 genotypically related clusters, and 59 distinct genotypes. Six of the 13 genotypically related clusters contained matching genotypes between clinical isolates and local environmental isolates from the rehabilitation center in which these birds were housed. We present evidence that the environment of rehabilitation centers may be a source for A. fumigatus infection in rehabilitated seabirds. PMID:21756021

  3. Optimization of pectinase enzyme production in Aspergillus fumigatus isolated from rotten fruits

    Directory of Open Access Journals (Sweden)


    Full Text Available Introduction: Pectinase is one of the most important industrial enzymes which was isolated from a wide variety of microorganisms such as bacteria and filamentous fungi. This enzyme has been usually used in the juice and textile industry. In this study, the isolation and optimization of pectinase-producing fungi on decaying rotten fruits were studied. Materials and methods: Isolation and screening of pectinase producing fungi have been done by plate culture on pectin medium and staining with Lugol's iodine solution. The best strain was identified by method of Pitt and Hocking as Aspergillus fumigates. The enzyme production was optimized by application of the factorial design which involves five factors, each at three levels. Five factors were carbon sources (whey, sugar, stevia and ammonium sulfate, manganese sulfate, temperature, and pH. Pectinase concentration was measured by the Miller method. Results: The results showed that the optimum condition for enzyme production was at 32 °C, PH = 6 , 3g / L manganese sulfate, 2.75g / L of ammonium sulfate, 10g / L of each carbon source (whey, stevia, and glucose. Optimum of enzyme production was observed in the presence of 1.328 mg / ml of glucose. Molecular weight of enzyme was obtained about 40 kDa by SDS-PAGE. Discussion and conclusion: The results demonstrated that this strain could grow in a wide range of carbon sources, PH and temperature. This study indicates that this strain is a good candidate for use in industrial application.

  4. Identification and Characterization of a Novel Aspergillus fumigatus Rhomboid Family Putative Protease, RbdA, Involved in Hypoxia Sensing and Virulence. (United States)

    Vaknin, Yakir; Hillmann, Falk; Iannitti, Rossana; Ben Baruch, Netali; Sandovsky-Losica, Hana; Shadkchan, Yona; Romani, Luigina; Brakhage, Axel; Kniemeyer, Olaf; Osherov, Nir


    Aspergillus fumigatus is the most common pathogenic mold infecting humans and a significant cause of morbidity and mortality in immunocompromised patients. In invasive pulmonary aspergillosis, A. fumigatus spores are inhaled into the lungs, undergoing germination and invasive hyphal growth. The fungus occludes and disrupts the blood vessels, leading to hypoxia and eventual tissue necrosis. The ability of this mold to adapt to hypoxia is regulated in part by the sterol regulatory element binding protein (SREBP) SrbA and the DscA to DscD Golgi E3 ligase complex critical for SREBP activation by proteolytic cleavage. Loss of the genes encoding these proteins results in avirulence. To identify novel regulators of hypoxia sensing, we screened the Neurospora crassa gene deletion library under hypoxia and identified a novel rhomboid family protease essential for hypoxic growth. Deletion of the A. fumigatus rhomboid homolog rbdA resulted in an inability to grow under hypoxia, hypersensitivity to CoCl2, nikkomycin Z, fluconazole, and ferrozine, abnormal swollen tip morphology, and transcriptional dysregulation-accurately phenocopying deletion of srbA. In vivo, rbdA deletion resulted in increased sensitivity to phagocytic killing, a reduced inflammatory Th1 and Th17 response, and strongly attenuated virulence. Phenotypic rescue of the ΔrbdA mutant was achieved by expression and nuclear localization of the N terminus of SrbA, including its HLH domain, further indicating that RbdA and SrbA act in the same signaling pathway. In summary, we have identified RbdA, a novel putative rhomboid family protease in A. fumigatus that mediates hypoxia adaptation and fungal virulence and that is likely linked to SrbA cleavage and activation. PMID:27068092

  5. Identification and deletion of Tft1, a predicted glycosyltransferase necessary for cell wall β-1,3;1,4-glucan synthesis in Aspergillus fumigatus.

    Directory of Open Access Journals (Sweden)

    Danial Samar

    Full Text Available Aspergillus fumigatus is an environmental mold that causes severe, often fatal invasive infections in immunocompromised patients. The search for new antifungal drug targets is critical, and the synthesis of the cell wall represents a potential area to find such a target. Embedded within the main β-1,3-glucan core of the A. fumigatus cell wall is a mixed linkage, β-D-(1,3;1,4-glucan. The role of this molecule or how it is synthesized is unknown, though it comprises 10% of the glucans within the wall. While this is not a well-studied molecule in fungi, it has been studied in plants. Using the sequences of two plant mixed linkage glucan synthases, a single ortholog was identified in A. fumigatus (Tft1. A strain lacking this enzyme (tft1Δ was generated along with revertant strains containing the native gene under the control of either the native or a strongly expressing promoter. Immunofluorescence staining with an antibody against β-(1,3;1,4-glucan and biochemical quantification of this polysaccharide in the tft1Δ strain demonstrated complete loss of this molecule. Reintroduction of the gene into the knockout strain yielded reappearance in amounts that correlated with expected expression of the gene. The loss of Tft1 and mixed linkage glucan yielded no in vitro growth phenotype. However, there was a modest increase in virulence for the tft1Δ strain in a wax worm model. While the precise roles for β-(1,3;1,4-glucan within A. fumigatus cell wall are still uncertain, it is clear that Tft1 plays a pivotal role in the biosynthesis of this cell wall polysaccharide.

  6. Structure-Functional Characterization of Cytochrome P450 Sterol 14α-Demethylase (CYP51B) from Aspergillus fumigatus and Molecular Basis for the Development of Antifungal Drugs. (United States)

    Hargrove, Tatiana Y; Wawrzak, Zdzislaw; Lamb, David C; Guengerich, F Peter; Lepesheva, Galina I


    Aspergillus fumigatus is the opportunistic fungal pathogen that predominantly affects the immunocompromised population and causes 600,000 deaths/year. The cytochrome P450 51 (CYP51) inhibitor voriconazole is currently the drug of choice, yet the treatment efficiency remains low, calling for rational development of more efficient agents. A. fumigatus has two CYP51 genes, CYP51A and CYP51B, which share 59% amino acid sequence identity. CYP51B is expressed constitutively, whereas gene CYP51A is reported to be inducible. We expressed, purified, and characterized A. fumigatus CYP51B, including determination of its substrate preferences, catalytic parameters, inhibition, and x-ray structure in complexes with voriconazole and the experimental inhibitor (R)-N-(1-(2,4-dichlorophenyl)-2-(1H-imidazol-1-yl)ethyl)-4-(5-phenyl-1,3,4-oxadiazol-2-yl)benzamide (VNI). The enzyme demethylated its natural substrate eburicol and the plant CYP51 substrate obtusifoliol at steady-state rates of 17 and 16 min(-1), respectively, but did not metabolize lanosterol, and the topical antifungal drug miconazole was the strongest inhibitor that we identified. The x-ray crystal structures displayed high overall similarity of A. fumigatus CYP51B to CYP51 orthologs from other biological kingdoms but revealed phylum-specific differences relevant to enzyme catalysis and inhibition. The complex with voriconazole provides an explanation for the potency of this relatively small molecule, whereas the complex with VNI outlines a direction for further enhancement of the efficiency of this new inhibitory scaffold to treat humans afflicted with filamentous fungal infections. PMID:26269599

  7. A guide to the recent literature on aspergillosis as caused by Aspergillus fumigatus, a fungus frequently found in self-heating organic matter. (United States)

    Marsh, P B; Millner, P D; Kla, J M


    Spores of Aspergillus fumigatus have been found to be abundantly present in the outdoor air at a site where large scale experimental composting of sewage sludge is in progress at Beltsville, Maryland. The health significance of this finding, for that site and for others in the future, is still only incompletely understood. Further studies are in progress to characterize absolute concentrations of the spores of the fungus in air at the site, spore dispersal by air from composting operations, and background environmental spore levels in air. The present paper contains a list of references to papers on health effects of A. fumigatus, many published in the past ten years, along with a review of the same designed to assist the reader in finding information on particular aspects of the subject in the literature. It is intended primarily as an aid to individuals interested in sludge composting and wishing to attain an insight into the A. fumigatus-composting situation, but it may also interest others concerned with other substrates which become moldy at 40--50 C. A. fumigatus has been found in great numbers in naturally and artificially heated environments such as decaying leaves, compost heaps, solar heated sloughs, cooling canals for nuclear power generators, silos, grain storage bins, boiler rooms, detritus around steam turbines and sauna baths. The evident practical merits of sludge composting have been described elsewhere; the information presented here has its main significance in respect to requirements for choice of locations for composting sites and to process and design criteria. PMID:396477

  8. Development and antimicrobial susceptibility studies of in vitro monomicrobial and polymicrobial biofilm models with Aspergillus fumigatus and Pseudomonas aeruginosa


    Manavathu, Elias K.; Vager, Dora L; Vazquez, Jose A


    Background Mixed microbial infections of the respiratory tracts with P. aeruginosa and A. fumigatus capable of producing biofilms are commonly found in cystic fibrosis patients. The primary objective of this study was to develop an in vitro model for P. aeruginosa and A. fumigatus polymicrobial biofilm to study the efficacy of various antimicrobial drugs alone and in combinations against biofilm-embedded cells. Simultaneous static cocultures of P. aeruginosa and sporelings were used for the d...

  9. Detection of Aspergillus fumigatus in a rat model of invasive pulmonary aspergillosis by real-time nucleic acid sequence-based amplification. (United States)

    Zhao, Yanan; Park, Steven; Warn, Peter; Shrief, Raghdaa; Harrison, Elizabeth; Perlin, David S


    Rapid and sensitive detection of Aspergillus from clinical samples may facilitate the early diagnosis of invasive pulmonary aspergillosis (IPA). A real-time nucleic acid sequence-based amplification (NASBA) method was investigated by use of an inhalational rat model of IPA. Immunosuppressed male Sprague-Dawley rats were exposed to Aspergillus fumigatus spores for an hour in an aerosol chamber. Bronchoalveolar lavage (BAL) fluid, lung tissues, and whole blood were collected from five infected rats at 1, 24, 48, 72, and 96 h postinfection and five uninfected rats at the end of the experiment. Total nucleic acid (TNA) was extracted on an easyMAG instrument. A primer-molecular beacon set targeting 28S rRNA was designed to detect Aspergillus spp. The results were compared to those of quantitative PCR (qPCR) (18S rDNA) and quantitative culture. The analytical sensitivity of the real-time NASBA assay was tissue burdens, while the CFU counts were stable over time. The fungal burdens in BAL fluid were more variable and not indicative of a progressive infection. The results of both real-time assays correlated well for both sample types (r = 0.869 and P tissue, r = 0.887 and P < 0.0001 for BAL fluid). For all whole-blood specimens, NASBA identified Aspergillus-positive samples in the group from which samples were collected at 72 h postinfection (three of five samples) and the group from which samples were collected at 96 h postinfection (five of five samples), but no positive results were obtained by culture or PCR. Real-time NASBA is highly sensitive and useful for the detection of Aspergillus in an experimental model of IPA. PMID:20129972

  10. Purification and characterization of a low molecular weight xylanase from solid-state cultures of Aspergillus fumigatus Fresenius Purificação e caracterização de uma xilanase de baixo peso molecular de culturas de estado sólido de Aspergillus fumigatus Fresenius


    Claudio Henrique Cerri e Silva; Jurgen Puls; Marcelo Valle de Sousa; Edivaldo Ximenes Ferreira Filho


    A xylan-degrading enzyme (xylanase II) was purified to apparent homogeneity from solid-state cultures of Aspergillus fumigatus Fresenius. The molecular weight of xylanase II was found to be 19 and 8.5 kDa, as estimated by SDS-PAGE and gel filtration on FPLC, respectively. The purified enzyme was most active at 55 °C and pH 5.5. It was specific to xylan. The apparent Km and Vmax values on soluble and insoluble xylans from oat spelt and birchwood showed that xylanase II was most active on solub...

  11. Filamentous fungal-specific septin AspE is phosphorylated in vivo and interacts with actin, tubulin and other septins in the human pathogen Aspergillus fumigatus

    Energy Technology Data Exchange (ETDEWEB)

    Juvvadi, Praveen Rao; Belina, Detti [Division of Pediatric Infectious Diseases, Department of Pediatrics, Duke University Medical Center, Durham, NC (United States); Soderblom, Erik J.; Moseley, M. Arthur [Duke Proteomics Core Facility, Institute for Genome Sciences and Policy, Duke University, Durham, NC (United States); Steinbach, William J., E-mail: [Division of Pediatric Infectious Diseases, Department of Pediatrics, Duke University Medical Center, Durham, NC (United States); Department of Molecular Genetics and Microbiology, Duke University Medical Center, Durham, NC (United States)


    Highlights: ► In vivo interactions of the novel septin AspE were identified by GFP-Trap® affinity purification. ► Septins AspA, AspB, AspC and AspD interacted with AspE in vivo. ► Actin and tubulin interacted with AspE in vivo. ► AspE is phosphorylated at six serine residues in vivo. -- Abstract: We previously analyzed the differential localization patterns of five septins (AspA–E), including a filamentous fungal-specific septin, AspE, in the human pathogen Aspergillus fumigatus. Here we utilized the A. fumigatus strain expressing an AspE–EGFP fusion protein and show that this novel septin with a tubular localization pattern in hyphae is phosphorylated in vivo and interacts with the other septins, AspA, AspB, AspC and AspD. The other major proteins interacting with AspE included the cytoskeletal proteins, actin and tubulin, which may be involved in the organization and transport of the septins. This is the first report analyzing the phosphorylation of AspE and localizing the sites of phosphorylation, and opens opportunities for further analysis on the role of post-translational modifications in the assembly and organization of A. fumigatus septins. This study also describes the previously unknown interaction of AspE with the actin-microtubule network. Furthermore, the novel GFP-Trap® affinity purification method used here complements widely-used GFP localization studies in fungal systems.

  12. Filamentous fungal-specific septin AspE is phosphorylated in vivo and interacts with actin, tubulin and other septins in the human pathogen Aspergillus fumigatus

    International Nuclear Information System (INIS)

    Highlights: ► In vivo interactions of the novel septin AspE were identified by GFP-Trap® affinity purification. ► Septins AspA, AspB, AspC and AspD interacted with AspE in vivo. ► Actin and tubulin interacted with AspE in vivo. ► AspE is phosphorylated at six serine residues in vivo. -- Abstract: We previously analyzed the differential localization patterns of five septins (AspA–E), including a filamentous fungal-specific septin, AspE, in the human pathogen Aspergillus fumigatus. Here we utilized the A. fumigatus strain expressing an AspE–EGFP fusion protein and show that this novel septin with a tubular localization pattern in hyphae is phosphorylated in vivo and interacts with the other septins, AspA, AspB, AspC and AspD. The other major proteins interacting with AspE included the cytoskeletal proteins, actin and tubulin, which may be involved in the organization and transport of the septins. This is the first report analyzing the phosphorylation of AspE and localizing the sites of phosphorylation, and opens opportunities for further analysis on the role of post-translational modifications in the assembly and organization of A. fumigatus septins. This study also describes the previously unknown interaction of AspE with the actin-microtubule network. Furthermore, the novel GFP-Trap® affinity purification method used here complements widely-used GFP localization studies in fungal systems

  13. ChIP-seq and in vivo transcriptome analyses of the Aspergillus fumigatus SREBP SrbA reveals a new regulator of the fungal hypoxia response and virulence.

    Directory of Open Access Journals (Sweden)

    Dawoon Chung


    Full Text Available The Aspergillus fumigatus sterol regulatory element binding protein (SREBP SrbA belongs to the basic Helix-Loop-Helix (bHLH family of transcription factors and is crucial for antifungal drug resistance and virulence. The latter phenotype is especially striking, as loss of SrbA results in complete loss of virulence in murine models of invasive pulmonary aspergillosis (IPA. How fungal SREBPs mediate fungal virulence is unknown, though it has been suggested that lack of growth in hypoxic conditions accounts for the attenuated virulence. To further understand the role of SrbA in fungal infection site pathobiology, chromatin immunoprecipitation followed by massively parallel DNA sequencing (ChIP-seq was used to identify genes under direct SrbA transcriptional regulation in hypoxia. These results confirmed the direct regulation of ergosterol biosynthesis and iron uptake by SrbA in hypoxia and revealed new roles for SrbA in nitrate assimilation and heme biosynthesis. Moreover, functional characterization of an SrbA target gene with sequence similarity to SrbA identified a new transcriptional regulator of the fungal hypoxia response and virulence, SrbB. SrbB co-regulates genes involved in heme biosynthesis and demethylation of C4-sterols with SrbA in hypoxic conditions. However, SrbB also has regulatory functions independent of SrbA including regulation of carbohydrate metabolism. Loss of SrbB markedly attenuates A. fumigatus virulence, and loss of both SREBPs further reduces in vivo fungal growth. These data suggest that both A. fumigatus SREBPs are critical for hypoxia adaptation and virulence and reveal new insights into SREBPs' complex role in infection site adaptation and fungal virulence.


    Directory of Open Access Journals (Sweden)

    Nurul Kartini Abu Bakar,


    Full Text Available Utilization of oil palm empty fruit bunch (OPEFB for bioethanol production with crude cellulase cocktails from locally isolated fungi was studied. Enzymatic saccharification of alkaline pretreated OPEFB was done using different cellulase enzyme preparations. Crude cellulase cocktails from Trichoderma asperellum UPM1 and Aspergillus fumigatus UPM2 produced 8.37 g/L reducing sugars with 0.17 g/g yield. Production of bioethanol from OPEFB hydrolysate using Baker’s yeast produced approximately 0.59 g/L ethanol, corresponding to 13.8% of the theoretical yield. High reducing sugars concentration in the final fermentation samples resulted from accumulation of non-fermentable sugars such as xylose and cellobiose that were not consumed by the yeast. The results obtained support the possible utilization of OPEFB biomass for bioethanol production in the future.

  15. The three-dimensional structure of the cellobiohydrolase Cel7A from Aspergillus fumigatus at 1.5 Å resolution. (United States)

    Moroz, Olga V; Maranta, Michelle; Shaghasi, Tarana; Harris, Paul V; Wilson, Keith S; Davies, Gideon J


    The enzymatic degradation of plant cell-wall cellulose is central to many industrial processes, including second-generation biofuel production. Key players in this deconstruction are the fungal cellobiohydrolases (CBHs), notably those from family GH7 of the carbohydrate-active enzymes (CAZY) database, which are generally known as CBHI enzymes. Here, three-dimensional structures are reported of the Aspergillus fumigatus CBHI Cel7A solved in uncomplexed and disaccharide-bound forms at resolutions of 1.8 and 1.5 Å, respectively. The product complex with a disaccharide in the +1 and +2 subsites adds to the growing three-dimensional insight into this family of industrially relevant biocatalysts. PMID:25615982

  16. Application of ZnO Nanoparticles for Improving the Thermal and pH Stability of Crude Cellulase Obtained from Aspergillus fumigatus AA001 (United States)

    Srivastava, Neha; Srivastava, Manish; Mishra, P. K.; Ramteke, Pramod W.


    Cellulases are the enzymes which are responsible for the hydrolysis of cellulosic biomass. In this study thermal and pH stability of crude cellulase has been investigated in the presence of zinc oxide (ZnO) nanoparticles. We synthesized ZnO nanoparticle by sol-gel method and characterized through various techniques including, X-ray Diffraction, ultraviolet-visible spectroscope, field emission scanning electron microscope and high resolution scanning electron microscope. The crude thermostable cellulase has been obtained from the Aspergillus fumigatus AA001 and treated with ZnO nanoparticle which shows thermal stability at 65°C up to 10 h whereas it showed pH stability in the alkaline pH range and retained its 53% of relative activity at pH 10.5. These findings may be promising in the area of biofuels production. PMID:27148203

  17. Transcriptome and biochemical analysis reveals that suppression of GPI-anchor synthesis leads to autophagy and possible necroptosis in Aspergillus fumigatus.

    Directory of Open Access Journals (Sweden)

    Jianghong Yan

    Full Text Available Previously, it has been shown that GPI proteins are required for cell wall synthesis and organization in Aspergillus fumigatus, a human opportunistic pathogen causing life-threatening invasive aspergillosis (IA in immunocompromised patients. Blocking GPI anchor synthesis leads to severe phenotypes such as cell wall defects, increased cell death, and attenuated virulence. However, the mechanism by which these phenotypes are induced is unclear. To gain insight into global effects of GPI anchoring in A. fumigatus, in this study a conditional expression mutant was constructed and a genome wide transcriptome analysis was carried out. Our results suggested that suppression of GPI anchor synthesis mainly led to activation of phosphatidylinositol (PtdIns signaling and ER stress. Biochemical and morphological evidence showed that autophagy was induced in response to suppression of the GPI anchor synthesis, and also an increased necroptosis was observed. Based on our results, we propose that activation of PtdIns3K and increased cytosolic Ca(2+, which was induced by both ER stress and PtdIns signaling, acted as the main effectors to induce autophagy and possible necroptosis.

  18. Krüppel-like Factor 4 modulates interleukin-6 release in human dendritic cells after in vitro stimulation with Aspergillus fumigatus and Candida albicans. (United States)

    Czakai, Kristin; Leonhardt, Ines; Dix, Andreas; Bonin, Michael; Linde, Joerg; Einsele, Hermann; Kurzai, Oliver; Loeffler, Jürgen


    Invasive fungal infections are associated with high mortality rates and are mostly caused by the opportunistic fungi Aspergillus fumigatus and Candida albicans. Immune responses against these fungi are still not fully understood. Dendritic cells (DCs) are crucial players in initiating innate and adaptive immune responses against fungal infections. The immunomodulatory effects of fungi were compared to the bacterial stimulus LPS to determine key players in the immune response to fungal infections. A genome wide study of the gene regulation of human monocyte-derived dendritic cells (DCs) confronted with A. fumigatus, C. albicans or LPS was performed and Krüppel-like factor 4 (KLF4) was identified as the only transcription factor that was down-regulated in DCs by both fungi but induced by stimulation with LPS. Downstream analysis demonstrated the influence of KLF4 on the interleukine-6 expression in human DCs. Furthermore, KLF4 regulation was shown to be dependent on pattern recognition receptor ligation. Therefore KLF4 was identified as a controlling element in the IL-6 immune response with a unique expression pattern comparing fungal and LPS stimulation. PMID:27346433

  19. GH16 and GH81 family β-(1,3)-glucanases in Aspergillus fumigatus are essential for conidial cell wall morphogenesis. (United States)

    Mouyna, Isabelle; Aimanianda, Vishukumar; Hartl, Lukas; Prevost, Marie-Christine; Sismeiro, Odile; Dillies, Marie-Agnès; Jagla, Bernd; Legendre, Rachel; Coppee, Jean-Yves; Latgé, Jean-Paul


    The fungal cell wall is a rigid structure because of fibrillar and branched β-(1,3)-glucan linked to chitin. Softening of the cell wall is an essential phenomenon during fungal morphogenesis, wherein rigid cell wall structures are cleaved by glycosylhydrolases. During the search for glycosylhydrolases acting on β-(1,3)-glucan, we identified seven genes in the Aspergillus fumigatus genome coding for potential endo-β-(1,3)-glucanase. ENG1 (previously characterized and named ENGL1, Mouyna et al., ), belongs to the Glycoside-Hydrolase 81 (GH81) family, while ENG2 to ENG7, to GH16 family. ENG1 and four GH16 genes (ENG2-5) were expressed in the resting conidia as well as during germination, suggesting an essential role during A. fumigatus morphogenesis. Here, we report the effect of sequential deletion of AfENG2-5 (GH16) followed by AfENG1 (GH81) deletion in the Δeng2,3,4,5 mutant. The Δeng1,2,3,4,5 mutant showed conidial defects, with linear chains of conidia unable to separate while the germination rate was not affected. These results show, for the first time in a filamentous fungus, that endo β-(1,3)-glucanases are essential for proper conidial cell wall assembly and thus segregation of conidia during conidiation. PMID:27306610

  20. Crystal Structures and Small-angle X-ray Scattering Analysis of UDP-galactopyranose Mutase from the Pathogenic Fungus Aspergillus fumigatus

    Energy Technology Data Exchange (ETDEWEB)

    Dhatwalia, Richa; Singh, Harkewal; Oppenheimer, Michelle; Karr, Dale B.; Nix, Jay C.; Sobrado, Pablo; Tanner, John J. (LBNL); (Missouri); (VPI)


    UDP-galactopyranose mutase (UGM) is a flavoenzyme that catalyzes the conversion of UDP-galactopyranose to UDP-galactofuranose, which is a central reaction in galactofuranose biosynthesis. Galactofuranose has never been found in humans but is an essential building block of the cell wall and extracellular matrix of many bacteria, fungi, and protozoa. The importance of UGM for the viability of many pathogens and its absence in humans make UGM a potential drug target. Here we report the first crystal structures and small-angle x-ray scattering data for UGM from the fungus Aspergillus fumigatus, the causative agent of aspergillosis. The structures reveal that Aspergillus UGM has several extra secondary and tertiary structural elements that are not found in bacterial UGMs yet are important for substrate recognition and oligomerization. Small-angle x-ray scattering data show that Aspergillus UGM forms a tetramer in solution, which is unprecedented for UGMs. The binding of UDP or the substrate induces profound conformational changes in the enzyme. Two loops on opposite sides of the active site move toward each other by over 10 {angstrom} to cover the substrate and create a closed active site. The degree of substrate-induced conformational change exceeds that of bacterial UGMs and is a direct consequence of the unique quaternary structure of Aspergillus UGM. Galactopyranose binds at the re face of the FAD isoalloxazine with the anomeric carbon atom poised for nucleophilic attack by the FAD N5 atom. The structural data provide new insight into substrate recognition and the catalytic mechanism and thus will aid inhibitor design.

  1. Proteomic analyses reveal the key roles of BrlA and AbaA in biogenesis of gliotoxin in Aspergillus fumigatus

    Energy Technology Data Exchange (ETDEWEB)

    Shin, Kwang-Soo, E-mail: [Division of Life Science, Daejeon University, Daejeon, 300-716 (Korea, Republic of); Kim, Young Hwan [Biomedical Omics Team, Korea Basic Science Institute (KBSI), Ohcang, 368-883 (Korea, Republic of); Graduate School of Analytical Science and Technology, Chungnam National University, Daejeon, 305-764 (Korea, Republic of); Department of Bio-Analytical Science, University of Science and Technology, Daejeon, 305-333 (Korea, Republic of); Yu, Jae-Hyuk, E-mail: [Departments of Bacteriology and Genetics, The University of Wisconsin–Madison, Madison, WI, 53706 (United States)


    The opportunistic human pathogenic fungus Aspergillus fumigatus primarily reproduces by forming a large number of asexual spores (conidia). Sequential activation of the central regulators BrlA, AbaA and WetA is necessary for the fungus to undergo asexual development. In this study, to address the presumed roles of these key developmental regulators during proliferation of the fungus, we analyzed and compared the proteomes of vegetative cells of wild type (WT) and individual mutant strains. Approximately 1300 protein spots were detectable from 2-D electrophoresis gels. Among these, 13 proteins exhibiting significantly altered accumulation levels were further identified by ESI-MS/MS. Markedly, we found that the GliM and GliT proteins associated with gliotoxin (GT) biosynthesis and self-protection of the fungus from GT were significantly down-regulated in the ΔabaA and ΔbrlA mutants. Moreover, mRNA levels of other GT biosynthetic genes including gliM, gliP, gliT, and gliZ were significantly reduced in both mutant strains, and no and low levels of GT were detectable in the ΔbrlA and ΔabaA mutant strains, respectively. As GliT is required for the protection of the fungus from GT, growth of the ΔbrlA mutant with reduced levels of GliT was severely impaired by exogenous GT. Our studies demonstrate that AbaA and BrlA positively regulate expression of the GT biosynthetic gene cluster in actively growing vegetative cells, and likely bridge morphological and chemical development during the life-cycle of A. fumigatus. - Highlights: • Proteome analyses of WT and mutants reveal 13 differentially expressed proteins. • The GliT and GliM proteins are significantly down-regulated by ΔabaA and ΔbrlA. • Expression of other gliotoxin biosynthetic genes is lowered by ΔabaA and ΔbrlA. • Growth of ΔbrlA strain lacking GliT is completely inhibited by exogenous gliotoxin. • BrlA and AbaA play key roles in biogenesis of gliotoxin in Aspergillus fumigatus.

  2. Proteomic analyses reveal the key roles of BrlA and AbaA in biogenesis of gliotoxin in Aspergillus fumigatus

    International Nuclear Information System (INIS)

    The opportunistic human pathogenic fungus Aspergillus fumigatus primarily reproduces by forming a large number of asexual spores (conidia). Sequential activation of the central regulators BrlA, AbaA and WetA is necessary for the fungus to undergo asexual development. In this study, to address the presumed roles of these key developmental regulators during proliferation of the fungus, we analyzed and compared the proteomes of vegetative cells of wild type (WT) and individual mutant strains. Approximately 1300 protein spots were detectable from 2-D electrophoresis gels. Among these, 13 proteins exhibiting significantly altered accumulation levels were further identified by ESI-MS/MS. Markedly, we found that the GliM and GliT proteins associated with gliotoxin (GT) biosynthesis and self-protection of the fungus from GT were significantly down-regulated in the ΔabaA and ΔbrlA mutants. Moreover, mRNA levels of other GT biosynthetic genes including gliM, gliP, gliT, and gliZ were significantly reduced in both mutant strains, and no and low levels of GT were detectable in the ΔbrlA and ΔabaA mutant strains, respectively. As GliT is required for the protection of the fungus from GT, growth of the ΔbrlA mutant with reduced levels of GliT was severely impaired by exogenous GT. Our studies demonstrate that AbaA and BrlA positively regulate expression of the GT biosynthetic gene cluster in actively growing vegetative cells, and likely bridge morphological and chemical development during the life-cycle of A. fumigatus. - Highlights: • Proteome analyses of WT and mutants reveal 13 differentially expressed proteins. • The GliT and GliM proteins are significantly down-regulated by ΔabaA and ΔbrlA. • Expression of other gliotoxin biosynthetic genes is lowered by ΔabaA and ΔbrlA. • Growth of ΔbrlA strain lacking GliT is completely inhibited by exogenous gliotoxin. • BrlA and AbaA play key roles in biogenesis of gliotoxin in Aspergillus fumigatus

  3. The pH-responsive PacC transcription factor of Aspergillus fumigatus governs epithelial entry and tissue invasion during pulmonary aspergillosis.

    Directory of Open Access Journals (Sweden)

    Margherita Bertuzzi


    Full Text Available Destruction of the pulmonary epithelium is a major feature of lung diseases caused by the mould pathogen Aspergillus fumigatus. Although it is widely postulated that tissue invasion is governed by fungal proteases, A. fumigatus mutants lacking individual or multiple enzymes remain fully invasive, suggesting a concomitant requirement for other pathogenic activities during host invasion. In this study we discovered, and exploited, a novel, tissue non-invasive, phenotype in A. fumigatus mutants lacking the pH-responsive transcription factor PacC. Our study revealed a novel mode of epithelial entry, occurring in a cell wall-dependent manner prior to protease production, and via the Dectin-1 β-glucan receptor. ΔpacC mutants are defective in both contact-mediated epithelial entry and protease expression, and significantly attenuated for pathogenicity in leukopenic mice. We combined murine infection modelling, in vivo transcriptomics, and in vitro infections of human alveolar epithelia, to delineate two major, and sequentially acting, PacC-dependent processes impacting epithelial integrity in vitro and tissue invasion in the whole animal. We demonstrate that A. fumigatus spores and germlings are internalised by epithelial cells in a contact-, actin-, cell wall- and Dectin-1 dependent manner and ΔpacC mutants, which aberrantly remodel the cell wall during germinative growth, are unable to gain entry into epithelial cells, both in vitro and in vivo. We further show that PacC acts as a global transcriptional regulator of secreted molecules during growth in the leukopenic mammalian lung, and profile the full cohort of secreted gene products expressed during invasive infection. Our study reveals a combinatorial mode of tissue entry dependent upon sequential, and mechanistically distinct, perturbations of the pulmonary epithelium and demonstrates, for the first time a protective role for Dectin-1 blockade in epithelial defences. Infecting ΔpacC mutants

  4. Clonal expansion and emergence of environmental multiple-triazole-resistant Aspergillus fumigatus strains carrying the TR₃₄/L98H mutations in the cyp51A gene in India.

    Directory of Open Access Journals (Sweden)

    Anuradha Chowdhary

    Full Text Available Azole resistance is an emerging problem in Aspergillus which impacts the management of aspergillosis. Here in we report the emergence and clonal spread of resistance to triazoles in environmental Aspergillus fumigatus isolates in India. A total of 44 (7% A. fumigatus isolates from 24 environmental samples were found to be triazole resistant. The isolation rate of resistant A. fumigatus was highest (33% from soil of tea gardens followed by soil from flower pots of the hospital garden (20%, soil beneath cotton trees (20%, rice paddy fields (12.3%, air samples of hospital wards (7.6% and from soil admixed with bird droppings (3.8%. These strains showed cross-resistance to voriconazole, posaconazole, itraconazole and to six triazole fungicides used extensively in agriculture. Our analyses identified that all triazole-resistant strains from India shared the same TR(34/L98H mutation in the cyp51 gene. In contrast to the genetic uniformity of azole-resistant strains the azole-susceptible isolates from patients and environments in India were genetically very diverse. All nine loci were highly polymorphic in populations of azole-susceptible isolates from both clinical and environmental samples. Furthermore, all Indian environmental and clinical azole resistant isolates shared the same multilocus microsatellite genotype not found in any other analyzed samples, either from within India or from the Netherlands, France, Germany or China. Our population genetic analyses suggest that the Indian azole-resistant A. fumigatus genotype was likely an extremely adaptive recombinant progeny derived from a cross between an azole-resistant strain migrated from outside of India and a native azole-susceptible strain from within India, followed by mutation and then rapid dispersal through many parts of India. Our results are consistent with the hypothesis that exposure of A. fumigatus to azole fungicides in the environment causes cross-resistance to medical triazoles. The

  5. Proteomic analyses reveal the key roles of BrlA and AbaA in biogenesis of gliotoxin in Aspergillus fumigatus. (United States)

    Shin, Kwang-Soo; Kim, Young Hwan; Yu, Jae-Hyuk


    The opportunistic human pathogenic fungus Aspergillus fumigatus primarily reproduces by forming a large number of asexual spores (conidia). Sequential activation of the central regulators BrlA, AbaA and WetA is necessary for the fungus to undergo asexual development. In this study, to address the presumed roles of these key developmental regulators during proliferation of the fungus, we analyzed and compared the proteomes of vegetative cells of wild type (WT) and individual mutant strains. Approximately 1300 protein spots were detectable from 2-D electrophoresis gels. Among these, 13 proteins exhibiting significantly altered accumulation levels were further identified by ESI-MS/MS. Markedly, we found that the GliM and GliT proteins associated with gliotoxin (GT) biosynthesis and self-protection of the fungus from GT were significantly down-regulated in the ΔabaA and ΔbrlA mutants. Moreover, mRNA levels of other GT biosynthetic genes including gliM, gliP, gliT, and gliZ were significantly reduced in both mutant strains, and no and low levels of GT were detectable in the ΔbrlA and ΔabaA mutant strains, respectively. As GliT is required for the protection of the fungus from GT, growth of the ΔbrlA mutant with reduced levels of GliT was severely impaired by exogenous GT. Our studies demonstrate that AbaA and BrlA positively regulate expression of the GT biosynthetic gene cluster in actively growing vegetative cells, and likely bridge morphological and chemical development during the life-cycle of A. fumigatus. PMID:26032501

  6. A comparative study of the timecourse of the expression of the thermo‑inducible HSP70 gene in clinical and environmental isolates of Aspergillus fumigatus. (United States)

    Sharafi, Golnaz; Khosravi, Ali Reza; Vahedi, Ghasem; Yahyaraeyat, Ramak; Abbasi, Teimur


    The internal environment within animals or humans provides different conditions to invading saprophytic fungal pathogens, requiring the differential regulation of genes in comparison to environmental conditions. Understanding the mechanisms by which pathogens regulate genes within the host may be key in determining pathogen behavior within the host and may additionally facilitate further investigation into novel therapeutic agents. The heat shock protein (HSP)70 gene and its associated proteins have been frequently reported to be among the most highly expressed and dominant proteins present within various locations at physiological temperatures. The present study examined relative gene expression levels of the HSP70 gene in Aspergillus fumigatus isolates from both clinical and environmental origins, at a range of temperature points (20, 30, 37 and 42˚C) over five days, using reverse transcription‑quantitative polymerase chain reaction, comparing with a standard A. fumigatus strain incubated at 25˚C. The results indicated a differential gene expression pattern for the environmental and clinical isolates. During the five days, the HSP70 expression levels in the clinical samples were higher than in the environmental samples. However, the difference in the expression levels between the two groups at 42˚C was reduced. The mean HSP70 expression level over the five incubation days demonstrated a gradual and continual increasing trend by temperature elevation in both groups at 30, 37 and 42˚C, however, at 20˚C both groups demonstrated reduced expression. The temperature shift from 20 to 42˚C resulted in HSP70 induction and up to a 10‑ and 8.6‑fold change in HSP70 expression levels on the fifth day of incubation in the clinical and environmental groups, respectively. In conclusion, incubation at 37 and 42˚C resulted in the highest expression levels in both experimental groups, with these temperature points important for the induction of HSP70

  7. [Farmer's lung antigens in Germany]. (United States)

    Sennekamp, J; Joest, M; Sander, I; Engelhart, S; Raulf-Heimsoth, M


    Recent studies suggest that besides the long-known farmer's lung antigen sources Saccharopolyspora rectivirgula (Micropolyspora faeni), Thermoactinomyces vulgaris, and Aspergillus fumigatus, additionally the mold Absidia (Lichtheimia) corymbifera as well as the bacteria Erwinia herbicola (Pantoea agglomerans) and Streptomyces albus may cause farmer's lung in Germany. In this study the sera of 64 farmers with a suspicion of farmer's lung were examined for the following further antigens: Wallemia sebi, Cladosporium herbarum, Aspergillus versicolor, and Eurotium amstelodami. Our results indicate that these molds are not frequent causes of farmer's lung in Germany. PMID:22477566

  8. Analysis of the growth characteristics of Aspergillus fumigatus in different temperature and nutrient media%烟曲霉在不同温度和营养条件下的生长特性初探

    Institute of Scientific and Technical Information of China (English)

    张晋卿; 刘伟; 谭静文; 万喆; 李若瑜


    Objective To determine the growth characteristics of Aspergillus fumigatus in different nutrient media and temperature. Methods Growth curves were used to determine the optimum medium, optimum and maximum growth temperatures for two strains of Aspergillus fumigatus : colony counts were used to determine the fatal temperatures for them. Results Three different nutrient media, yeast extract medium (YG) , minimal medium (MM) and yeast nitrogen base (YNB) , were tested. YG medium was the optimum medium for measuring the growth curves of Aspergillus fumigatus ; In YG medium, the optimum growth temperature for Aspergillus fumigatus was 37℃ , and the maximum growth temperature was 52℃. The slower growth rates of strains were observed with gradually elevated temperature. Unexpectedly, the responses of these two strains to high temperature were different: one strains growth became slower markedly at 48℃ than at 37℃ during log phase, while the other one grew at 48℃ as well as at 37 ℃ during log phase. The strains of Aspergillus fumigatus were dead when exposed to 65℃ lasting more than 180 min or 70℃ lasting more than 120 min. Conclusions The optimum and the maximum growth temperature for Aspergillus fumigatus were 37℃ and 52℃ , respectively. The fatal condition for Aspergillus fumigatus was 65℃ lasting more than 180 min or 70℃ lasting more than 120 min.%目的 确定烟曲霉的最适生长温度、最高生长温度及致死温度.方法 生长曲线法用来确定培养烟曲霉的最适宜培养基,并测定其最适生长温度和最高生长温度;菌落计数法用来确定其致死温度.结果 1)酵母浸膏培养基(yeast extract medium,YG)是测定烟曲霉生长曲线的最适宜培养基;2)在YG培养基中,37℃是烟曲霉的最适宜生长温度,52℃为其最高生长温度.随着温度的升高,菌株的生长速度逐渐减慢;3)65℃处理180 min或70℃处理120 min能使烟曲霉完全失活.结论 在YG培养基中,37℃

  9. Pectinase and polygalacturonase production by a thermophilic Aspergillus fumigatus isolated from decomposting orange peels Produção de pectinases e poligalacturonase por Aspergillus fumigatus termofílico isolado de cascas de laranja em decomposição

    Directory of Open Access Journals (Sweden)

    Urmila Phutela


    Full Text Available A thermophilic fungal strain producing both pectinase and polygalacturonase was isolated after primary screening of 120 different isolates. The fungus was identified as Aspergillus fumigatus Fres. MTCC 4163. Using solid-state cultivation, the optimum levels of variables for pectinase and polygalacturonase (PG production were determined. Maximal levels of enzyme activities were achieved upon growing the culture in a medium containing wheat bran, sucrose, yeast extract and (NH42SO4 after 2-3 days of incubation at a temperature of 50ºC. Highest enzyme activities of 1116 Ug-1 for pectinase and 1270 Ug-1 for polygalacturonase were obtained at pH 4.0 and 5.0, respectively.Através da tiragem de 120 cepas de fungos, isolou-se uma cepa capaz de produzir tanto pectinase quanto poligalacturonase. A cepa foi identificada como Aspergillus fumigatus Fres. MTCC 4163. Empregando cultivo em estado sólido, determinou-se os níveis ótimos das variáveis para a produção de pectinase e de poligalacturonase. Os níveis máximos de atividade enzimática foram obtidos quando a cultura era realizada em meio contendo farelo de trigo, sacarose, extrato de levedura e (NH42SO4 por 2-3 dias a uma temperatura de 50ºC. A atividade máxima de pectinase (1116 Ug-1 e de poligalacturonase (1270 Ug-1 foi obtida em pH 4,0 e 5,0, respectivamente.

  10. Research advance of pathogenic factors of Aspergillus fumigatus%烟曲霉致病相关因子的研究进展

    Institute of Scientific and Technical Information of China (English)

    邬丽红; 陈一强; 孔晋亮


    Virulence factors are produced in the process of pathogen adapting to stress in the microenvironment.It is demonstrated that the virulence of Aspergillus fumigatus is multifactorial.Some of these characteristics include the small size of its conidia which allows them to reach the human pulmonary alveoli,its thermotolerance,hydrophobicity and its high growth rate,and resistance to oxidative stress.In addition,the proteins required for adaptation to the environment and metabolism,the channel signal molecule,lipid metabolites,and toxins are seen as virulence factors.%毒力因子是在病原体适应生存环境的过程中产生.烟曲霉毒力是多因素相关的,包括微小的孢子结构使之能够吸入到达宿主的肺泡,耐热特征,疏水性,快速的繁殖速度以及抵抗氧化应激反应的能力.此外,烟曲霉适应环境及代谢相关的蛋白、通路信号分子、脂类代谢产物、毒素等均可看作毒力因子.

  11. Micromorphological changes on the embryonic membranes of turkey eggs infected with Aspergillus fumigatus and their importance for embryonic survival


    Jezdimirović Nemanja V.; Kureljušić Branislav I.; Kureljušić Jasna M.; Jakić-Dimić Dobrila P.; Ilić Živka Đ.; Miljković Biljana; Radanović Oliver Č.; Cvetojević Đorđe N.; Ivetić Vojin L.; Jezdimirović Milanka B.


    Aspergillosis is a frequent fungal disease of young and adult poultry in our commercial flocks. Infection can occur after hatching by inhalation of Aspergillus conidia which can be present in contaminated hatcheries, or later, by spores from moldy litter, dust, faeces or feed. Spores from the surface of egg shell can penetrate inside of an egg. The main characteristic of aspergillosis is granulomatous inflammation of respiratory system, although generalized form is possible as well. Mul...

  12. Characterization of a thermostable β-glucosidase from Aspergillus fumigatus Z5, and its functional expression in Pichia pastoris X33

    Directory of Open Access Journals (Sweden)

    Liu Dongyang


    Full Text Available Abstract Background Recently, the increased demand of energy has strongly stimulated the research on the conversion of lignocellulosic biomass into reducing sugars for the subsequent production, and β-glucosidases have been the focus because of their important roles in a variety fundamental biological processes and the synthesis of useful β-glucosides. Although the β-glucosidases of different sources have been investigated, the amount of β-glucosidases are insufficient for effective conversion of cellulose. The goal of this work was to search for new resources of β-glucosidases, which was thermostable and with high catalytic efficiency. Results In this study, a thermostable native β-glucosidase (nBgl3, which is secreted by the lignocellulose-decomposing fungus Aspergillus fumigatus Z5, was purified to electrophoretic homogeneity. Internal sequences of nBgl3 were obtained by LC-MS/MS, and its encoding gene, bgl3, was cloned based on the peptide sequences obtained from the LC-MS/MS results. bgl3 contains an open reading frame (ORF of 2622 bp and encodes a protein with a predicted molecular weight of 91.47 kDa; amino acid sequence analysis of the deduced protein indicated that nBgl3 is a member of the glycoside hydrolase family 3. A recombinant β-glucosidase (rBgl3 was obtained by the functional expression of bgl3 in Pichia pastoris X33. Several biochemical properties of purified nBgl3 and rBgl3 were determined - both enzymes showed optimal activity at pH 6.0 and 60°C, and they were stable for a pH range of 4-7 and a temperature range of 50 to 70°C. Of the substrates tested, nBgl3 and rBgl3 displayed the highest activity toward 4-Nitrophenyl-β-D-glucopyranoside (pNPG, with specific activities of 103.5 ± 7.1 and 101.7 ± 5.2 U mg-1, respectively. However, these enzymes were inactive toward carboxymethyl cellulose, lactose and xylan. Conclusions An native β-glucosidase nBgl3 was purified to electrophoretic homogeneity from the crude

  13. Heterologous expression of hydrophobins RodA and RodB from Aspergillus fumigatus in host Pichia pastoris

    DEFF Research Database (Denmark)

    Pedersen, Mona Højgaard; Borodina, Irina; Frisvad, Jens Christian;

    TA Cloning (Invitrogen), and the inserts were sequenced. The genes were further amplified by PCR to generate overhangs with specific restriction sites and cloned into expression vectors pPICZA and pPICZB while adding a 6xHis-tag to the C-terminal of both hydrophobins. The pPICZA vector expresses...... proteins with the signal sequence of alfa-mating factor from Saccharomyces cerevisia known to work well for protein secretion from P. pastoris and the pPICZB plasmids had proteins cloned with their native signal sequences. The plasmids were linearized, transformed into P. pastoris strain X33...... and investigation using the expression host Pichia pastoris. Methods and materials: The genes encoding hydrophobins RodA and RodB were amplified by RT-PCR with gene-specific primers from the total RNA isolated from the spores of A. fumigatus (AF296 strain). The resulting cDNA was cloned into TOPO vectors using TOPO...

  14. Three-Dimensional Models of Wild-Type and Mutated Forms of Cytochrome P450 14α-Sterol Demethylases from Aspergillus fumigatus and Candida albicans Provide Insights into Posaconazole Binding


    Xiao, Li; Madison, Vincent; Chau, Andrew S.; Loebenberg, David; Palermo, Robert E.; McNicholas, Paul M.


    The cytochrome P450 sterol 14α-demethylase enzyme (CYP51) is the target of azole antifungals. Azoles block ergosterol synthesis, and thereby fungal growth, by binding in the active-site cavity of the enzyme and ligating the iron atom of the heme cofactor through a nitrogen atom of the azole. Mutations in and around the CYP51 active site have resulted in azole resistance. In this work, homology models of the CYP51 enzymes from Aspergillus fumigatus and Candida albicans were constructed based o...

  15. Complementation of a Saccharomyces cerevisiae ERG11/CYP51 (Sterol 14α-Demethylase) Doxycycline-Regulated Mutant and Screening of the Azole Sensitivity of Aspergillus fumigatus Isoenzymes CYP51A and CYP51B▿


    Martel, Claire M.; Parker, Josie E.; Warrilow, Andrew G. S.; Rolley, Nicola J.; Kelly, Steven L.; Kelly, Diane E.


    Aspergillus fumigatus sterol 14α-demethylase isoenzymes CYP51A and CYP51B were heterologously expressed in a Saccharomyces cerevisiae mutant (YUG37-erg11), wherein native ERG11/CYP51 expression is controlled using a doxycycline-regulatable promoter. When cultured in the presence of doxycycline, recombinant YUG37-pcyp51A and YUG37-pcyp51B yeasts were able to synthesize ergosterol and grow; a control strain harboring reverse-oriented cyp51A could not. YUG37-pcyp51A and YUG37-pcyp51B constructs ...

  16. JAK/STAT regulation of Aspergillus fumigatus corneal infections and IL-6/23-stimulated neutrophil, IL-17, elastase, and MMP9 activity. (United States)

    Taylor, Patricia R; Roy, Sanhita; Meszaros, Evan C; Sun, Yan; Howell, Scott J; Malemud, Charles J; Pearlman, Eric


    IL-6 and IL-23 (IL-6/23) induce IL-17A (IL-17) production by a subpopulation of murine and human neutrophils, resulting in autocrine IL-17 activation, enhanced production of reactive oxygen species, and increased fungal killing. As IL-6 and IL-23 receptors trigger JAK1, -3/STAT3 and JAK2/STAT3 phosphorylation, respectively, we examined the role of this pathway in a murine model of fungal keratitis and also examined neutrophil elastase and gelatinase (matrix metalloproteinase 9) activity by IL-6/23-stimulated human neutrophils in vitro. We found that STAT3 phosphorylation of neutrophils in Aspergillus fumigatus-infected corne as was inhibited by the JAK/STAT inhibitor Ruxolitinib, resulting in impaired fungal killing and decreased matrix metalloproteinase 9 activity. In vitro, we showed that fungal killing by IL-6/23-stimulated human peripheral blood neutrophils was impaired by JAK/STAT inhibitors Ruxolitinib and Stattic, and by the retinoic acid receptor-related orphan receptor γt inhibitor SR1001. This was also associated with decreased reactive oxygen species, IL-17A production, and retinoic acid receptor-related orphan receptor γt translocation to the nucleus. We also demonstrate that IL-6/23-activated neutrophils exhibit increased elastase and gelatinase (matrix metalloproteinase 9) activity, which is inhibited by Ruxolitinib and Stattic but not by SR1001. Taken together, these observations indicate that the regulation of activity of IL-17-producing neutrophils by JAK/STAT inhibitors impairs reactive oxygen species production and fungal killing activity but also blocks elastase and gelatinase activity that can cause tissue damage. PMID:27034404

  17. Inhibition of Aspergillus fumigatus and Its Biofilm by Pseudomonas aeruginosa Is Dependent on the Source, Phenotype and Growth Conditions of the Bacterium.

    Directory of Open Access Journals (Sweden)

    Jose A G Ferreira

    Full Text Available Aspergillus fumigatus (Af and Pseudomonas aeruginosa (Pa are leading fungal and bacterial pathogens, respectively, in many clinical situations. Relevant to this, their interface and co-existence has been studied. In some experiments in vitro, Pa products have been defined that are inhibitory to Af. In some clinical situations, both can be biofilm producers, and biofilm could alter their physiology and affect their interaction. That may be most relevant to airways in cystic fibrosis (CF, where both are often prominent residents. We have studied clinical Pa isolates from several sources for their effects on Af, including testing involving their biofilms. We show that the described inhibition of Af is related to the source and phenotype of the Pa isolate. Pa cells inhibited the growth and formation of Af biofilm from conidia, with CF isolates more inhibitory than non-CF isolates, and non-mucoid CF isolates most inhibitory. Inhibition did not require live Pa contact, as culture filtrates were also inhibitory, and again non-mucoid>mucoid CF>non-CF. Preformed Af biofilm was more resistant to Pa, and inhibition that occurred could be reproduced with filtrates. Inhibition of Af biofilm appears also dependent on bacterial growth conditions; filtrates from Pa grown as biofilm were more inhibitory than from Pa grown planktonically. The differences in Pa shown from these different sources are consistent with the extensive evolutionary Pa changes that have been described in association with chronic residence in CF airways, and may reflect adaptive changes to life in a polymicrobial environment.

  18. Inhalation of Aspergillus fumigatus spores induces airway inflammation in mice in a similar manner as observed in Recurrent Airway Obstruction in horses Inhalación de esporas de Aspergillus fumigatus induce en ratones una inflamación de las vías aéreas similar a la observada en equinos con Obstrucción Recurrente de las Vías Aéreas

    Directory of Open Access Journals (Sweden)

    G Morán


    Full Text Available The aim of this study was to determine if mice exposed to Aspergillus (A. fumigatus spores develop airway inflammation in a similar manner to Recurrent Airway Obstruction (RAO in horses. Different groups of 2-, 5-, 6- and 8-month-old Rockefeller (RK mice were used throughout the experiment. The mice were maintained in the animal house for 16 days and kept in cages containing hay contaminated with A. fumigatus. After 16 days of mold exposure, the mice were bled and sacrificed to obtain bronchoalveolar lavage fluid (BALF or lung tissues for histological analysis. In addition, we measured the levels of A. fumigatus-specific antibodies by ELISA. The results demonstrated that inhalation of A. fumigatus spores in mice induced an inflammatory response in the lungs that was characterized by peribronchiolar and perivascular mononuclear infiltration and bronchiolar luminal exudates. Moreover, there was extensive folding of the airway epithelia, which is a sign of airway smooth muscle contraction and smooth muscle hypertrophy. In addition, we observed a high number of neutrophils and an increase in IgE, IgG1 and IgG2a antibodies in the BALF from mice that were older than 5 months and were exposed to A. fumigatus. These animals recovered from their respiratory distress when they were placed in a remission environment. We conclude that simple exposure of mice to moldy hay induces a condition that is similar to RAO in horses. Therefore, using this mouse model for the study of equine RAO offers the opportunity to approximate the immunologic response to airborne irritants and allergens as well as to evaluate pharmacological therapies.El objetivo de este estudio fue determinar si ratones expuestos a esporas de Aspergillus fumigatus desarrollan una inflamación alérgica de las vías respiratorias similar a la observada en equinos con Obstrucción Recurrente de las Vías Aéreas (ORVA. Para esto se utilizaron ratones Rockefeller (RK de 2, 5, 6 y 8 meses


    Directory of Open Access Journals (Sweden)

    C. Parra-Giraldo


    Full Text Available Use of soft contact lenses medicated as well as cosmetic is routine. In spite of its comfort, they have a highprobability of being contaminated with microorganisms and must be regularly disinfected for itspreservation. Aspergillus fumigatus is a cosmopolitan fungus, and is frequently associated with micosislike keratitis. In this study capacity of A. fumigatus to proliferate in five materials of lenses: three ofhidrogel (Alphafilcon A, Omafilcon A, Polymacon and two of hidrogel silicone (Lotrafilcon and BalafilconA, was evaluated. It was found that fungus can grow in Balafilcon A in greater proportion, and it wassmaller in Polymacon. In addition, disinfection capacity of five multipurpose solutions was evaluated,which differ from others because of antimicrobial component. Multipurpose solutions showed to have afungistatic effect, except solution with hydrogen peroxide that displayed a fungicidal effect. Solutionswith Trimetropim did not show any effect on the microorganism. Also, disinfectant capacity of materialspreviously infected with A. fumigatus was evaluated for each solution. In this case, solution with hydrogenperoxide showed to be the most effective.

  20. Role of Aspergillus fumigatus in Triggering Protease-Activated Receptor-2 in Airway Epithelial Cells and Skewing the Cells toward a T-helper 2 Bias. (United States)

    Homma, Tetsuya; Kato, Atsushi; Bhushan, Bharat; Norton, James E; Suh, Lydia A; Carter, Roderick G; Gupta, Dave S; Schleimer, Robert P


    Aspergillus fumigatus (AF) infection and sensitization are common and promote Th2 disease in individuals with asthma. Innate immune responses of bronchial epithelial cells are now known to play a key role in determination of T cell responses upon encounter with inhaled pathogens. We have recently shown that extracts of AF suppress JAK-STAT signaling in epithelial cells and thus may promote Th2 bias. To elucidate the impact of AF on human bronchial epithelial cells, we tested the hypothesis that AF can modulate the response of airway epithelial cells to favor a Th2 response and explored the molecular mechanism of the effect. Primary normal human bronchial epithelial (NHBE) cells were treated with AF extract or fractionated AF extract before stimulation with poly I:C or infection with human rhinovirus serotype 16 (HRV16). Expression of CXCL10 mRNA (real-time RT-PCR) and protein (ELISA) were measured as markers of IFN-mediated epithelial Th1-biased responses. Western blot was performed to evaluate expression of IFN regulatory factor-3 (IRF-3), NF-κB, and tyrosine-protein phosphatase nonreceptor type 11 (PTPN11), which are other markers of Th1 skewing. Knockdown experiments for protease-activated receptor-2 (PAR-2) and PTPN11 were performed to analyze the role of PAR-2 in the mechanism of suppression by AF. AF and a high-molecular-weight fraction of AF extract (HMW-AF; > 50 kD) profoundly suppressed poly I:C- and HRV16-induced expression of both CXCL10 mRNA and protein from NHBE cells via a mechanism that relied upon PAR-2 activation. Both AF extract and a specific PAR-2 activator (AC-55541) suppressed the poly I:C activation of phospho-IRF-3 without affecting activation of NF-κB. Furthermore, HMW-AF extract enhanced the expression of PTPN11, a phosphatase known to inhibit IFN signaling, and concurrently suppressed poly I:C-induced expression of both CXCL10 mRNA and protein from NHBE cells. These results show that exposure of bronchial epithelial cells to AF extract

  1. Different expression of dectin-1 and Toll-like receptor 2 in the lungs of different immune status mice infected with Aspergillus fumigatus

    Institute of Scientific and Technical Information of China (English)

    YANG Jian-xun; LIU Wan; LU Qiao-yun; WAN Zhe; WANG Xiao-hong; LI Ruo-yu


    would provide a broad range of possibilities for a specific and effective inflammatory response to kill A. fumigatus. Inhibition of dectin-1 expression may be one of the mechanisms of cyclophosphamide in the development of IPA.

  2. In vitro antifungal activity and cytotoxic effect of essential oils and extracts of medicinal and aromatic plants against Candida krusei and Aspergillus fumigatus Atividade antifúngica in vitro e os efeitos citotóxicos de óleos essenciais e extratos de plantas medicinais e aromáticas contra Candida krusei e Aspergillus fumigatus

    Directory of Open Access Journals (Sweden)

    Julieth Correa-Royero


    Full Text Available The plants are usually used in traditional medicine as antimicrobial agents and their essential oils and extracts have been known to possess antifungal activity. The aim of this study was to evaluate in vitro the activity of 32 essential oils and 29 extracts against C. krusei and A. fumigatus as well as the cytotoxic effect on Vero cells. Time-kill curve and interaction between antifungals and the most active sample against C. krusei, was also evaluated. The oils from C. ambrosioides and the extract of M. cucullata showed antifungal activity against C. krusei (GM-MIC 7.82 and 31.25 µg/mL, respectively. L. citriodora was actives against C. krusei and A. fumigates (GM-MIC = 99.21 µg/mL and 62.5 µg/mL respectively. Time-kill assays done with C. ambrosioides oil showed fungicidal activity at 4x MIC. The interaction of C. ambrosioides oil with itraconazole and amphotericin B was tested following the chequerboard technique. No interaction was detected for the combination of C. ambrosioides oil with amphotericin B and itraconazole (FICI range = 1.03-1.06 and 1.03-1.00, respectively. Cytotoxicity assays for all samples were carried out with MTT. Only the oil from Hedyosmun sp. and L. dulcis were cytotoxic.As plantas são geralmente utilizadas na medicina tradicional como agentes antimicrobianos e seus óleos essenciais e extratos foram conhecidos por possuir atividade antifúngica. O objetivo deste estudo foi avaliar in vitro a atividade de 32 óleos essenciais e 29 extratos contra Candida krusei e Aspergillus fumigatus, bem como o efeito citotóxico em células Vero. A curva do tempo-morte e a interação entre antifúngicos e Chenopodium ambrosioidese do extrato de Myrcia cucullata mostraram atividade antifúngica contra C. krusei (geometric means of the minimal inhibitory concentration [GM-MIC] 7,82 e 31,25 µg/mL, respectivamente. Lippia citriodora foi ativa contra C. krusei e A. fumigatus (GM-CIM = 99,21 µg/mL e 62,5 µg/mL, respectivamente. Os

  3. Analytical modeling and numerical optimization of the biosurfactants production in solid-state fermentation by Aspergillus fumigatus - doi: 10.4025/actascitechnol.v36i1.17818

    Directory of Open Access Journals (Sweden)

    Gabriel Castiglioni


    Full Text Available This is an experimental, analytical and numerical study to optimize the biosurfactants production in solid-state fermentation of a medium containing rice straw and minced rice bran inoculated with Aspergillus fumigatus. The goal of this work was to analytically model the biosurfactants production in solid-state fermentation into a column fixed bed bioreactor. The Least-Squares Method was used to adjust the emulsification activity experimental values to a quadratic function semi-empirical model. Control variables were nutritional conditions, the fermentation time and the aeration. The mathematical model is validated against experimental results and then used to predict the maximum emulsification activity for different nutritional conditions and aerations. Based on the semi-empirical model the maximum emulsification activity with no additional hydrocarbon sources was 8.16 UE·g-1 for 112 hours. When diesel oil was used the predicted maximum emulsification activity was 8.10 UE·g-1 for 108 hours.

  4. Effect of physical and chemical properties of oil palm empty fruit bunch, decanter cake and sago pith residue on cellulases production by Trichoderma asperellum UPM1 and Aspergillus fumigatus UPM2. (United States)

    Zanirun, Zuraidah; Bahrin, Ezyana Kamal; Lai-Yee, Phang; Hassan, Mohd Ali; Abd-Aziz, Suraini


    The effect of cultivation condition of two locally isolated ascomycetes strains namely Trichoderma asperellum UPM1 and Aspergillus fumigatus UPM2 were compared in submerged and solid state fermentation. Physical evaluation on water absorption index, solubility index and chemical properties of lignin, hemicellulose and cellulose content as well as the cellulose structure on crystallinity and amorphous region of treated oil palm empty fruit bunch (OPEFB) (resulted in partial removal of lignin), sago pith residues (SPR) and oil palm decanter cake towards cellulases production were determined. Submerged fermentation shows significant cellulases production for both strains in all types of substrates. Crystallinity of cellulose and its chemical composition mainly holocellulose components was found to significantly affect the total cellulase synthesis in submerged fermentation as the higher crystallinity index, and holocellulose composition will increase cellulase production. Treated OPEFB apparently induced the total cellulases from T. asperellum UPM1 and A. fumigatus UPM2 with 0.66 U/mg FPase, 53.79 U/mg CMCase, 0.92 U/mg β-glucosidase and 0.67 U/mg FPase, 47.56 U/mg and 0.14 U/mg β-glucosidase, respectively. Physical properties of water absorption and solubility for OPEFB and SPR also had shown significant correlation on the cellulases production. PMID:24085387

  5. Effect of phosphatidylcholine on the level expression of plc genes of Aspergillus fumigatus by real time PCR method and investigation of these genes using bioinformatics analysis.

    Directory of Open Access Journals (Sweden)

    Ali Dehghan-Noodeh


    Full Text Available Phosphlipases are a group of enzymes that breakdown phosphatidylcholine (phospholipids molecules producing second products. These produced products have a divers role in the cell like signal transduction and digestion in humans. In this research the effect of phosphatidylcholine on the expression of plc genes of A. fumigatus was studied. The plc genes of this fungus were also interrogated using bioinformatics studies.Real-time PCR was performed to study the expression of plc genes and these genes were interrogated using bioinformatics studies.There was more significant expression for all three plc genes when A. fumigatus was grown on the presence of phosphatidylcholine in the medium. The sequence of plc genes of A. fumigatus was also interrogated using bioinformatics analysis and their relationship with the other microorganisms was investigated.Real-time PCR revealed that afplc1, afplc2 and afplc3 were up-regulated in the presence of phosphatidylcholine. In this study we suggest either the plc's of A. fumigatus were present in an ancestral genome and have become lost in some lineages, or that they have been acquired from other organisms by horizontal gene transfer. We also found that plc's of this fungus appeared to be more closely related to the plant plc's than the bacterial plc's.

  6. Interrogation of Related Clinical Pan-Azole-Resistant Aspergillus fumigatus Strains: G138C, Y431C, and G434C Single Nucleotide Polymorphisms in cyp51A, Upregulation of cyp51A, and Integration and Activation of Transposon Atf1 in the cyp51A Promoter ▿ †


    Albarrag, Ahmed M.; Anderson, Michael J.; Howard, Susan J.; Robson, Geoff D.; Warn, Peter A.; Sanglard, Dominique; David W Denning


    Multiple Aspergillus fumigatus isolates from a patient with two aspergillomas complicating chronic pulmonary aspergillosis were pan-azole resistant. Microsatellite typing was identical for all isolates despite major phenotypic and some growth rate differences. Three different cyp51A mutations were found (G138C, Y431C, and G434C), of which the first two were demonstrated by heterologous expression in a hypersusceptible Saccharomyces cerevisiae strain to be at least partly responsible for eleva...

  7. Fed-batch production of the hydrophobins RodA and RodB from Aspergillus fumigatus in host Pichia pastoris

    DEFF Research Database (Denmark)

    Pedersen, Mona Højgaard; Borodina, Irina; Frisvad, Jens Christian;

    materials: The genes encoding hydrophobins RodA and RodB was amplified by RT-PCR from the total RNA isolated from A. fumigatus (AF296 strain), and cloned into expression vectors pPICZA and pPICZB while adding a C-terminal 6xHis-tag. The linearized plasmids were transformed into P. pastoris strain X33. The...

  8. Biological Safety of Aspergillus fumigatus SL-30 to Non-target Organisms%烟曲霉SL-30菌株对非靶生物的安全性观察

    Institute of Scientific and Technical Information of China (English)

    郭丹钊; 陈钧


    目的 初步研究烟曲霉(A spergillus fumigatus)SL-30菌株对非靶生物的安全性. 方法 将烟曲霉SL-30菌株分生孢子分散于200 ml长江水、湖水、雨水和自来水中,孢子浓度为6×106 cfu/ml,每2天取样检测并记录孢子数.采用半静态法测定浓度为1 04、105和106 cfu/ml烟曲霉SL-30菌株分生孢子对斑马鱼(Brachydanio rerio)、日本沼虾(Macrobrachium nippoensis)和泽蛙(Rana limnochris)蝌蚪的影响,以去氯水作为对照,观察处理后30d内上述动物的存活情况,并计算存活率.测定烟曲霉SL-30菌株分生孢子对小鼠经口急性毒性、大鼠经皮和吸入急性毒性. 结果 烟曲霉SL-30菌株分生孢子在各供试水样中可存活约12d.当烟曲霉SL-30菌株分生孢子浓度分别为104、105和106 cfu/ml时,孢子浓度与实验动物存活率之间未见显著剂量依赖关系,且斑马鱼、日本沼虾和泽蛙蝌蚪的存活率与处理相同天数的对照组间的差异,无统计学意义(P>0.05).烟曲霉SL-30菌株分生孢子对小鼠经口急性毒性、大鼠经皮和吸入急性毒性均属于低毒级,实验组动物均无明显中毒症状,大体解剖均未见明显异常,重要脏器的组织切片均未见明显病理改变. 结论 烟曲霉SL-30菌株对环境和非靶生物较安全.%Objective To evaluate biological safety of Aspergillus fumigatus SL-30,a potential molluscicide,to non-target organisms.Methods A.fumigatus SL-30 spores were scattered in the water (200 ml) from Yangtze River,lake,rain and tap water to forming 6×106 cfu/ml,the number of spores were then determined and recorded every 2 days.Effect of A.fumigatus SL-30 spores with concentration ranging from 104 cfu/ml to 106 cfu/ml on Brachydanio rerio,Macrobrachium nippoensis and tadpoles of Rana limnochris was tested by standard laboratory procedure,and survival rate of the above animals in 30 days was recorded.The tests included acute oral toxicity in mice,acute dermal toxicity and acute

  9. Biological Safety of the Molluscicidal Ingredient from Aspergillus fumigatus SL-30 Isolated from Rhizosphere of Phytolacca acinosa%商陆根际真菌Aspergillus fumigatus SL-30杀螺有效成分MI的生物安全性

    Institute of Scientific and Technical Information of China (English)

    郭丹钊; 陈钧


    目的 了解商陆(Ph ytolacca acinosa)根际真菌Aspergillus fumigatus SL-30杀螺有效成分硫代二酮哌嗪类化合物(MI)的生物安全性. 方法 将MI用去氯水配制成0.01至0.60 mg/L等一系列浓度,采用浸杀法测定MI杀灭钉螺(Oncomelania hupensis)活性,分别于24、48和72h统计各组钉螺死亡率并计算半数致死浓度(LC50);采用半静态法测定0.5~~4.0 mg/L等一系列浓度MI对斑马鱼(Brachydanio rerio)、河虾(Macrobrachium nippoensis)和泽蛙(Rana limnochris)蝌蚪的急性毒性,于24、48和72 h观察实验动物的反应并统计死亡情况;采用自然土壤法测定1 mg/kg和10 mg/kg MI对蚯蚓(Eisenia fetida)的影响,于第7和14天各观察1次,统计各处理组蚯蚓的死亡和中毒情况;采用密闭碱液直接吸收法测定10 mg/kg MI对土壤微生物的影响,分别于第2、5、7、10、12和15d测定并计算每100g干土的CO2释放量. 结果 24、48和72h MI杀灭钉螺的LC50分别为0.101、0.062和0.022mg/L;斑马鱼、河虾和泽蛙蝌蚪的死亡率均随药物浓度升高而增高,各实验动物24、48和72 h的LC50值分别为1.941、1.755和1.219 mg/L(斑马鱼),3.170、2.720和2.419 mg/L(河虾),2.109、1.751和1.288 mg/L(泽蛙蝌蚪).MI对蚯蚓的LC50>10.0 mg/kg.MI为10 mg/kg时,15d内对微生物呼吸的抑制率均低于50%. 结论 MI对斑马鱼、河虾和泽蛙蝌蚪的毒性远低于对钉螺的毒性,在有效杀螺浓度范围内,MI对供试水生非靶生物是安全的;MI对蚯蚓和土壤微生物属低毒级.%Objective To study biological safety of the molluseieidal ingredient (MI, a kind of diketopiperazines) in the exocellular broth of Aspergillus fumigatus SL-30' which was isolated from the rhizosphere of Phytolacca acinosa. Methods The MI was prepared in concentrations ranging from 0.01 to 0.60 mg/L, at the same time molluseieidal activity against Oncomelannia hupensis was tested by using immersion method, and the LC50 in the case of immersion time

  10. Study of lignin biotransformation by Aspergillus fumigatus and white-rot fungi using 14C-labeled and unlabeled kraft lignins

    International Nuclear Information System (INIS)

    The biodegradation of lignin by fungi was studied in shake flasks using 14C-labeled kraft lignin and in a deep-tank fermentor using unlabeled kraft lignin. Among the fungi screened, A. fumigatus - isolated in our laboratories - was most potent in lignin biotransformation. Dialysis-type fermentation, designed to study possible accumulation of low MW lignin-derived products, showed no such accumulation. Recalcitrant carbohydrates like microcrystalline cellulose supported higher lignolytic activity than easily metabolized carbohydrates like cellobiose. An assay developed to distinguish between CO2 evolved from lignin and carbohydrate substrates demonstrated no stoichiometric correlation between the metabolism of the two cosubstrates. The submerged fermentations with unlabeled liqnin are difficult to monitor since chemical assays do not give accurate and true results. Lignolytic efficiencies that allowed monitoring of such fermentations were defined. Degraded lignins were clearly superior to C. versicolor in all aspects of lignin degradation; A fumigatus brought about substantial demethoxylation and dehydroxylation, whereas C. versicolor degraded lignins closely resembled undegraded kraft lignin. There was a good agreement among the different indices of lignin degradation, namely, 14CO evolution, OCH3 loss, OH loss, and monomer and dimer yield after permanganate oxidation

  11. Aspergillus specific IgE estimation by radioallergosorbent technique (RAST) in obstructive airways disease at Agra

    International Nuclear Information System (INIS)

    The radioallergosorbent technique (RAST) was used to measure the levels of Aspergillus specific IgE in 25 normal controls, 25 cases of extrinsic bronchial asthma and 25 cases of allergic broncho-pulmonary aspergillosis with a view to study the clinical role and its correlation with sputum culture, skin sensitivity and severity of airways obstruction. The test was performed using Pharmacia diagnostic kits with antigen derived from Aspergillus fumigatus. Abnormal levels of Aspergillus specific IgE were observed in 84 per cent cases of bronchial asthma but none of the controls. 86.7 per cent of all cases with positive skin test had positive radioallergosorbent test and there was no false positive reaction. There was a positive correlation of Aspergillus specific IgE with skin test positivity and with FEV1/FVC per cent. (author)

  12. Production of cellulolytic enzymes by Aspergillus fumigatus ABK9 in wheat bran-rice straw mixed substrate and use of cocktail enzymes for deinking of waste office paper pulp. (United States)

    Das, Arpan; Paul, Tanmay; Halder, Suman K; Jana, Arijit; Maity, Chiranjit; Das Mohapatra, Pradeep K; Pati, Bikas R; Mondal, Keshab C


    Response surface methodology was employed to optimize mixed substrate solid state fermentation for the production of cellulases and xylanase by Aspergillus fumigatus ABK9. Among 11 different parameters, fermentation time (86-88 h), medium pH (6.1-6.2), substrate amount (10.0-10.5 g) and substrate ratio (wheat bran:rice straw) (1.1) had significantly influences on enzyme production. Under these conditions endoglucanase, β-glucosidase, FPase (filter paper degrading activity) and xylanase activities of 826.2, 255.16, 102.5 and 1130.4 U/g, respectively were obtained. The enzyme cocktail extracted (solid to water ratio of 1:10) from the ferments increased brightness of waste office paper pulp by 82.8% ISO, Ink(D) value by 82.1%, removed chromophores (2.53 OD; A(237)nm) and hydrophobic compounds (1.15 OD; A(465)nm) and also decreased the kappa number to 13.5 from 16.8. PMID:23196251

  13. Aspergillus fumigatus-induced Interleukin-8 Synthesis by Respiratory Epithelial Cells Is Controlled by the Phosphatidylinositol 3-Kinase, p38 MAPK, and ERK1/2 Pathways and Not by the Toll-like Receptor-MyD88 Pathway*


    Balloy, Viviane; Sallenave, Jean-Michel; Wu, Yongzheng; Touqui, Lhousseine; Latgé, Jean-Paul; Si-Tahar, Mustapha; Chignard, Michel


    Previous studies have established that phagocytes are key cells of the pulmonary innate immune defense against A. fumigatus, an opportunistic fungus responsible of invasive pulmonary aspergillosis. Macrophages detect A. fumigatus via Toll-like receptors 2 and 4 (TLR2 and -4) and respond by the MyD88-NF-κB-dependent synthesis of inflammatory mediators. In the present study, we demonstrate that respiratory epithelial cells also sense A. fumigatus and participate in the h...

  14. Aspergillus fumigatus-induced IL-8 synthesis by respiratory epithelial cells is controlled by the PI3 kinase, p38 MAPK and ERK1/2 pathways and not by the TLR-MYD88 pathway.


    Balloy, Viviane; Sallenave, Jean-Michel; Wu, Yongzheng; Touqui, Lhousseine; Latgé, Jean-Paul; Si-Tahar, Mustapha; Chignard, Michel


    Previous studies have established that phagocytes are key cells of the pulmonary innate immune defense against A. fumigatus, an opportunistic fungus responsible of invasive pulmonary aspergillosis. Macrophages detect A. fumigatus via Toll-like receptors (TLR) 2 and 4, and respond by the MyD88-NF-B-dependent synthesis of inflammatory mediators. In the present study, we demonstrate that respiratory epithelial cells also sense A. fumigatus and participate to the host defense. Thus, the interacti...

  15. Effects of Aspergillus fumigatus extract on human bronchial epithelial cells repair ability%烟曲霉菌提取物对人支气管上皮细胞修复功能的影响

    Institute of Scientific and Technical Information of China (English)

    龙飞; 苏莉莉; 梁斌; 金先桥


    目的:探讨烟曲霉菌对呼吸道上皮细胞修复功能的影响及其可能机制。方法实验分为正常对照组、不同浓度(10、20、40 mg/L)AFE组、热处理AFE组。分别应用不同浓度和热处理的烟曲霉菌提取物(aspergillus fumig-atus extract,AFE)作用体外培养的人支气管上皮细胞16HBE不同的时间,以细胞体外损伤修复功能、细胞迁移能力、定量细胞黏附能力、细胞伸展面积为指标,观察AFE和热处理的AFE对上皮细胞修复能力的影响。结果20、40 mg/L AFE均明显抑制16HBE细胞的体外损伤修复功能、细胞迁移能力和细胞黏附能力(P<0.05),并呈明显的时间和浓度依赖性。10 mg/L AFE与正常对照组差异无统计学意义(P>0.05)。10、20、40 mg/L AFE均明显抑制细胞的伸展能力(P<0.05),并呈明显浓度依赖性。另外,热处理AFE的蛋白酶完全灭活,对上述观察指标无明显影响(P>0.05)。结论 AFE依赖其蛋白酶活性明显抑制细胞的修复功能,并呈明显的浓度和时间依赖性。%Objective To investigate the effects of aspergillus fumigatus extract (AFE)on the human bronchial epithe-lial cells repair ability and its possible mechanism.Methods The cells were divided into medium control group,differ-ent concentrations (10,20 and 40 mg/L)of AFE groups and heat-treated AFE group.Human bronchial epithelial cells 16HBE were cultured in vitro,which were exposed to different concentrations of AFE for different time.Wound closure assay,cell migration,quantitative cell attachment assay and spreading of bronchial epithelial cells were observed.AFE and heat-treated AFE were used to investigate the effects of AFE on the human bronchial epithelial cells repair ability. Results Compared with medium control group,the repair capacity,migration ability and adhesion ability of 16HBE cells were inhibited significantly in 20 and 40 mg/L groups (P0.05).The spreading

  16. 烟曲霉菌提取物对人支气管上皮细胞修复功能的影响%Effects of Aspergillus fumigatus extract on human bronchial epithelial cells repair ability

    Institute of Scientific and Technical Information of China (English)

    龙飞; 苏莉莉; 梁斌; 金先桥


    目的:探讨烟曲霉菌对呼吸道上皮细胞修复功能的影响及其可能机制。方法实验分为正常对照组、不同浓度(10、20、40 mg/L)AFE组、热处理AFE组。分别应用不同浓度和热处理的烟曲霉菌提取物(aspergillus fumig-atus extract,AFE)作用体外培养的人支气管上皮细胞16HBE不同的时间,以细胞体外损伤修复功能、细胞迁移能力、定量细胞黏附能力、细胞伸展面积为指标,观察AFE和热处理的AFE对上皮细胞修复能力的影响。结果20、40 mg/L AFE均明显抑制16HBE细胞的体外损伤修复功能、细胞迁移能力和细胞黏附能力(P<0.05),并呈明显的时间和浓度依赖性。10 mg/L AFE与正常对照组差异无统计学意义(P>0.05)。10、20、40 mg/L AFE均明显抑制细胞的伸展能力(P<0.05),并呈明显浓度依赖性。另外,热处理AFE的蛋白酶完全灭活,对上述观察指标无明显影响(P>0.05)。结论 AFE依赖其蛋白酶活性明显抑制细胞的修复功能,并呈明显的浓度和时间依赖性。%Objective To investigate the effects of aspergillus fumigatus extract (AFE)on the human bronchial epithe-lial cells repair ability and its possible mechanism.Methods The cells were divided into medium control group,differ-ent concentrations (10,20 and 40 mg/L)of AFE groups and heat-treated AFE group.Human bronchial epithelial cells 16HBE were cultured in vitro,which were exposed to different concentrations of AFE for different time.Wound closure assay,cell migration,quantitative cell attachment assay and spreading of bronchial epithelial cells were observed.AFE and heat-treated AFE were used to investigate the effects of AFE on the human bronchial epithelial cells repair ability. Results Compared with medium control group,the repair capacity,migration ability and adhesion ability of 16HBE cells were inhibited significantly in 20 and 40 mg/L groups (P0.05).The spreading

  17. Aspergillus niger: an unusual cause of invasive pulmonary aspergillosis


    Person, A. K.; Chudgar, S. M.; Norton, B. L.; Tong, B. C.; Stout, J E


    Infections due to Aspergillus species cause significant morbidity and mortality. Most are attributed to Aspergillus fumigatus, followed by Aspergillus flavus and Aspergillus terreus. Aspergillus niger is a mould that is rarely reported as a cause of pneumonia. A 72-year-old female with chronic obstructive pulmonary disease and temporal arteritis being treated with steroids long term presented with haemoptysis and pleuritic chest pain. Chest radiography revealed areas of heterogeneous consolid...

  18. Aspergillus antigen induces robust Th2 cytokine production, inflammation, airway hyperreactivity and fibrosis in the absence of MCP-1 or CCR2

    Directory of Open Access Journals (Sweden)

    Charo Israel F


    Full Text Available Abstract Background Asthma is characterized by type 2 T-helper cell (Th2 inflammation, goblet cell hyperplasia, airway hyperreactivity, and airway fibrosis. Monocyte chemoattractant protein-1 (MCP-1 or CCL2 and its receptor, CCR2, have been shown to play important roles in the development of Th2 inflammation. CCR2-deficient mice have been found to have altered inflammatory and physiologic responses in some models of experimental allergic asthma, but the role of CCR2 in contributing to inflammation and airway hyperreactivity appears to vary considerably between models. Furthermore, MCP-1-deficient mice have not previously been studied in models of experimental allergic asthma. Methods To test whether MCP-1 and CCR2 are each required for the development of experimental allergic asthma, we applied an Aspergillus antigen-induced model of Th2 cytokine-driven allergic asthma associated with airway fibrosis to mice deficient in either MCP-1 or CCR2. Previous studies with live Aspergillus conidia instilled into the lung revealed that MCP-1 and CCR2 play a role in anti-fungal responses; in contrast, we used a non-viable Aspergillus antigen preparation known to induce a robust eosinophilic inflammatory response. Results We found that wild-type C57BL/6 mice developed eosinophilic airway inflammation, goblet cell hyperplasia, airway hyperreactivity, elevations in serum IgE, and airway fibrosis in response to airway challenge with Aspergillus antigen. Surprisingly, mice deficient in either MCP-1 or CCR2 had responses to Aspergillus antigen similar to those seen in wild-type mice, including production of Th2 cytokines. Conclusion We conclude that robust Th2-mediated lung pathology can occur even in the complete absence of MCP-1 or CCR2.

  19. Aspergillus spinal epidural abscess

    International Nuclear Information System (INIS)

    A spinal epidural abscess developed in a renal transplant recipient; results of a serum radioimmunoassay for Aspergillus antigen were positive. Laminectomy disclosed an abscess of the L4-5 interspace and L-5 vertebral body that contained hyphal forms and from which Aspergillus species was cultured. Serum Aspergillus antigen radioimmunoassay may be a valuable, specific early diagnostic test when systemic aspergillosis is a consideration in an immunosuppressed host

  20. Aspergillus fumigatus-induced Interleukin-8 Synthesis by Respiratory Epithelial Cells Is Controlled by the Phosphatidylinositol 3-Kinase, p38 MAPK, and ERK1/2 Pathways and Not by the Toll-like Receptor-MyD88 Pathway* (United States)

    Balloy, Viviane; Sallenave, Jean-Michel; Wu, Yongzheng; Touqui, Lhousseine; Latgé, Jean-Paul; Si-Tahar, Mustapha; Chignard, Michel


    Previous studies have established that phagocytes are key cells of the pulmonary innate immune defense against A. fumigatus, an opportunistic fungus responsible of invasive pulmonary aspergillosis. Macrophages detect A. fumigatus via Toll-like receptors 2 and 4 (TLR2 and -4) and respond by the MyD88-NF-κB-dependent synthesis of inflammatory mediators. In the present study, we demonstrate that respiratory epithelial cells also sense A. fumigatus and participate in the host defense. Thus, the interaction of respiratory epithelial cells with germinating but not resting conidia of A. fumigatus results in interleukin (IL)-8 synthesis that is controlled by phosphatidylinositol 3-kinase, p38 MAPK, and ERK1/2. Using MyD88-dominant negative transfected cells, we also show that IL-8 production is not dependent on the TLR-MyD88 pathway, although the MyD88 pathway is activated by A. fumigatus and leads to NF-κB activation. Thus, our results provide evidence for the existence of two independent signaling pathways activated in respiratory epithelial cells by A. fumigatus, one that is MyD88-dependent and another that is My88-independent and involved in IL-8 synthesis. PMID:18703508

  1. Aspergillus fumigatus-induced interleukin-8 synthesis by respiratory epithelial cells is controlled by the phosphatidylinositol 3-kinase, p38 MAPK, and ERK1/2 pathways and not by the toll-like receptor-MyD88 pathway. (United States)

    Balloy, Viviane; Sallenave, Jean-Michel; Wu, Yongzheng; Touqui, Lhousseine; Latgé, Jean-Paul; Si-Tahar, Mustapha; Chignard, Michel


    Previous studies have established that phagocytes are key cells of the pulmonary innate immune defense against A. fumigatus, an opportunistic fungus responsible of invasive pulmonary aspergillosis. Macrophages detect A. fumigatus via Toll-like receptors 2 and 4 (TLR2 and -4) and respond by the MyD88-NF-kappaB-dependent synthesis of inflammatory mediators. In the present study, we demonstrate that respiratory epithelial cells also sense A. fumigatus and participate in the host defense. Thus, the interaction of respiratory epithelial cells with germinating but not resting conidia of A. fumigatus results in interleukin (IL)-8 synthesis that is controlled by phosphatidylinositol 3-kinase, p38 MAPK, and ERK1/2. Using MyD88-dominant negative transfected cells, we also show that IL-8 production is not dependent on the TLR-MyD88 pathway, although the MyD88 pathway is activated by A. fumigatus and leads to NF-kappaB activation. Thus, our results provide evidence for the existence of two independent signaling pathways activated in respiratory epithelial cells by A. fumigatus, one that is MyD88-dependent and another that is My88-independent and involved in IL-8 synthesis. PMID:18703508

  2. Isolation of an Anthracene-Degrading Strain Aspergillus fumigatus A10 and Its Degradation Characteristics%蒽降解菌烟曲霉A10的分离及降解性能研究

    Institute of Scientific and Technical Information of China (English)

    强婧; 尹华; 彭辉; 叶锦韶; 秦华明; 何宝燕; 张娜


    从污染环境中筛选出1株蒽降解菌A10,经鉴定为烟曲霉(Aspergillus fumigatus),其对蒽的降解率随时间的延长逐渐升高,在12~84 h,蒽降解率增长速率较快;此后降解率的增加趋于平缓,最终(168 h)能够达到83%左右.当无机盐培养液中蒽初始浓度为10 mg/L,A10投菌量为50 g/L(以湿重计),菌龄为36 h时, 5 d内蒽降解率为79.37%.蒽浓度对菌发挥降解作用有较大影响,浓度为5 mg/L时,降解率最高,达92.17%.培养液初始pH为5.0~7.5时,降解率维持在60%左右;温度为30℃、氧气量为4.30 mg/L时蒽降解效果较好.一定量的营养盐的添加能在一定程度上促进蒽的降解.共代谢底物乳糖的添加,能使蒽的降解率提高37.15%.对蒽降解过程的初步研究表明,菌株A10对蒽的降解是一个胞外吸附/胞内降解的动态变化过程.红外光谱分析显示,在微生物作用下,蒽的结构发生改变,生成了含有1~2个苯环的芳香酸、芳香酮、芳香醛和饱和碳氢化合物等一系列降解产物.%An anthracene-degrading strain (A10) was isolated from contaminated environment and identified as Aspergillus fumigatus.The experimental results showed that the biodegradation rate of anthracene increased with the increasing time.Between 12-84 h interval, the biodegradation performed rapidly, while after this, the increase of biodegradation rate tended to become slow, and ultimately the biodegradation rate could achieve approximately 83%.The degradation rate of anthracene reached 79.37% within 5 days when the initial concentration of anthracene in mineral salts medium (MSM) was 10 mg/L, the inoculum dosage was 50 g/L (wet weight) and the cell age was 36 h.The concentration of anthracene had notable influence on degradation function of strain A10 and the highest degradation rate (92.17%) was achieved when anthracene concentration was 5 mg/L.The degradation rate could maintain about 60% with initial pH of MSM in the range of 5

  3. Diagnóstico de ABPA em pacientes portadores de fibrose cística: utilidade clínica da pesquisa de IgE específica contra alérgenos recombinantes do Aspergillus fumigatus ABPA diagnosis in cystic fibrosis patients: the clinical utility of IgE specific to recombinant Aspergillus fumigatus allergens


    Marina B. Almeida; Maria Helena C. F. Bussamra; Joaquim C. Rodrigues


    OBJETIVO: A aspergilose broncopulmonar alérgica (ABPA) é um fator complicador da fibrose cística que pode determinar uma combinação devastadora na evolução da doença pulmonar. A sobreposição de sinais e sintomas das duas enfermidades dificulta o diagnóstico, mesmo aplicando critérios padronizados. O objetivo deste trabalho foi identificar, em grupo de portadores de fibrose cística, os casos de ABPA através da detecção de IgE específica contra os alérgenos recombinantes do Aspergillus fumigatu...

  4. Antigen (United States)

    An antigen is any substance that causes your immune system to produce antibodies against it. This means your immune ... and is trying to fight it off. An antigen may be a substance from the environment, such ...

  5. Aspergillus triggers phenazine production in Pseudomonas aeruginosa

    DEFF Research Database (Denmark)

    Jensen, Britt Guillaume; Jelsbak, Lars; Søndergaard, Ib;

    Objectives: Pseudomonas aeruginosa is an opportunistic human pathogen, commonly infecting cystic fibrosis (CF) patients. Aspergilli, especially Aspergillus fumigatus, are also frequently isolated from CF patients. Our aim was to examine the possible interaction between P. aeruginosa and different...... the contact area of A. niger, A. flavus, A. oryzae, but not A. fumigatus. In addition, other metabolites with UV chromophores similar to the phenazines were only found in the contact zone between Aspergillus and Pseudomonas. No change in secondary metabolite profiles were seen for the Aspergilli, when...... comparing with or without the presence of Pseudomonas. Conclusion: All Aspergilli tested, with the exception of A. fumigatus, triggered the upregulation of phenazine-1-carboxamide and phenazine-1-carboxylic acid production by P. aeruginosa. Surprisingly no changes in secondary metabolite profiles were...

  6. Upstream and Downstream Regulation of Asexual Development in Aspergillus fumigatus†


    Mah, Jae-Hyung; Yu, Jae-Hyuk


    The opportunistic human pathogen Aspergillus fumigatus produces a large quantity of asexual spores (conidia), which are the primary agent causing invasive aspergillosis in immunocompromised patients. We investigated the mechanisms controlling asexual sporulation (conidiation) in A. fumigatus via examining functions of four key regulators, GpaA (Gα), AfFlbA (RGS), AfFluG, and AfBrlA, previously studied in Aspergillus nidulans. Expression analyses of gpaA, AfflbA, AffluG, AfbrlA, and AfwetA thr...

  7. Suppression of Aspergillus by Pseudomonas aeruginosa

    DEFF Research Database (Denmark)

    Jensen, Britt Guillaume; Jelsbak, Lars; Søndergaard, Ib;

    suppressed growth of A. fumigatus, A. niger, A. flavus, A. oryzae, A. terreus and E. nidulans. HPLC and LC-DAD-MS results showed an increase in phenazine-1-carboxylic acid and phenazine-1-carboxamide production by P. aeruginosa in the contact area of Aspergillus. Different quinolones were also identified......, here among 2-heptyl-3-hydroxy-4-quinolone (PQS). An unidentified green pseudomonas compound was also observed. Interestingly the P. aeruginosa mutant rpoN was unable to suppress A. fumigatus, but suppressed A. flavus, A. oryzae and A. niger. However several other P. aeruginosa mutants suppressed A...

  8. 302 Screening for Allergic Bronchopulmonary Aspergillosis in Patients with Aspergillus + Asthma From 2000 to 2010


    Greenberger, Paul


    Background Approximately 25% of patients with persistent asthma have immediate skin reactivity to Aspergillus species. The purpose of this study was to screen all patients with immediate hypersensitivity to Aspergillus for evidence of Allergic Bronchopulmonary Aspergillosis (ABPA). Methods All patients with asthma underwent immediate cutaneous testing including prick (epicutaneous) with a mix of Aspergillus species and if negative, intradermal at 1000 PNU/mL, Aspergillus fumigatus (Af). Sera ...

  9. Diversity and specificity of microsatellites within Aspergillus section Fumigati

    Directory of Open Access Journals (Sweden)

    Araujo Ricardo


    Full Text Available Abstract Background Microsatellites (or short tandem repeats, STRs are the genetic markers of choice for studying Aspergillus fumigatus molecular epidemiology due to its reproducibility and high discrimination power. However, the specificity of these markers must be investigated in a group of isolates from closely related species. The aim of this work was to test a microsatellite-based PCR multiplex previously designed for A. fumigatus in a set of species belonging to section Fumigati, namely Aspergillus fumigatiaffinis, Aspergillus lentulus, Aspergillus novofumigatus, Aspergillus unilateralis, Aspergillus viridinutans, Neosartorya fischeri, Neosartorya hiratsukae, Neosartorya pseudofischeri and Neosartorya udagawae. Results The reference A. fumigatus strain ATCC 46645 was easily genotyped in standard conditions showing a final electrophoretic profile of 8 expected peaks corresponding to each microsatellite locus. Inversely, no peaks were observed for all other species from section Fumigati, with an exception for marker MC6b in A. unilateralis. By screening the genome sequence of Neosartorya fischeri NRRL 181, the results showed that MC3, MC6a and MC7 might be employed for N. fischeri genotyping since these markers present several repeats of each motif. The accumulation of insertions and deletions was frequently observed in the genomic regions surrounding the microsatellites, including those where the A. fumigatus primers are located. The amplification of microsatellite markers in less stringent amplification conditions resulted in a distinct electrophoretic profile for species within section Fumigati. Conclusions Therefore, the microsatellite-based PCR multiplex allow simple identification of A. fumigatus and, with a slight modification of temperature conditions, it also allows discriminating other pathogenic species within section Fumigati, particularly A. fumigatiaffinis, N. fischeri and N. udagawae.

  10. In Vitro Interactions between Target of Rapamycin Kinase Inhibitor and Antifungal Agents against Aspergillus Species. (United States)

    Gao, Lujuan; Ding, Xiaozhen; Liu, Zhun; Wu, Qingzhi; Zeng, Tongxiang; Sun, Yi


    In vitro interactions of INK128, a target of rapamycin (TOR) kinase inhibitor, and antifungals, including itraconazole, voriconazole, posaconazole, amphotericin B, and caspofungin, against Aspergillus spp. were assessed with the broth microdilution checkerboard technique. Our results suggested synergistic effects between INK128 and all azoles tested, against multiple Aspergillus fumigatus and Aspergillus flavus isolates. However, no synergistic effects were observed when INK128 was combined with amphotericin B or caspofungin. No antagonism was observed for any combination. PMID:26976874

  11. 对唑类药物交叉耐药的烟曲霉临床分离株耐药机制的初步探讨%Molecular mechanisms of cross-resistance to azole antifungal agents in a clinical isolate of Aspergillus fumigatus: a preliminary study

    Institute of Scientific and Technical Information of China (English)

    孙毅; 刘伟; 陈伟; 万喆; 李若瑜


    Objective To investigate the molecular mechanisms of cross-resistance to azoles in a clinical isolate of Aspergillus fumigatus. Methods A. fumigatus was isolated from a patient with invasive aspergillosis.Clinical Laboratory Standard Institute M38-A2 broth microdilution method and E-test method were used to determine the minimum inhibitory concentrations (MICs) or minimum effective concentration (MEC) of itraconazole, voriconazole, amphotericin B, posaconazole and caspofungin for the A. fumigatus isolate. DNA was extracted from the isolate and subjected to the amplification of cyp51A gene encoding the target enzyme of azole antifungal agents followed by sequence analysis. Results The broth microdilution test showed that the MEC of caspofungin was 0.5 mg/L, and MICs of itraconazole, voriconazole and amphotericin B were ≥ 16 mg/L,8 mg/L and 1 mg/L, respectively, for this isolate; while E-test assay revealed that the MICs of caspofungin,itraconazole, voriconazole, amphotericin B and posaconazole were 0.047 mg/L, ≥32 mg/L,≥32 mg/L, 12 mg/L and ≥32 mg/L, respectively. Sequence analysis showed an insertion of a 34-bp tandem sequence in the promoter region of the cyp51A gene as well as a T364A point mutation causing the substitution of leucine 98 (L98H). In addition, there were some other mutations in the cyp51A gene of this isolate, such as A137T,G585A, C814A, G836C, T991C and A1350G, which could result in corresponding amino acid substitutions.Conclusions An A. fumigatus strain with cross-resistance to azole antifungal agents is isolated. There is an insertion of a 34-bp tandem sequence into the promoter region as well as a T364A point mutation in the cyp51A gene, which contribute to the cross resistance to azole antifungal agents including itraconazole, voriconazole,and posaconazole. In addition, other mutations causing amino acid substitutions have also been detected in the cyp51 A gene of this isolate.%目的 研究对唑类药物交叉耐药的烟曲霉临

  12. Cryptic Sexuality in Aspergillus parasiticus and A. flavus (United States)

    Ascomycetous fungi of the genus Aspergillus comprise a wide variety of species of biotechnological importance (e.g. A. sojae, A. oryzae, A. niger) as well as pathogens and toxin producers (e.g. A. flavus, A. parasiticus, A. fumigatus, A. nidulans). With the exception of A. nidulans, which is a homot...

  13. Cryptic Sexuality Influences Aflatoxigenicity in Aspergillus parasiticus and A. flavus (United States)

    Ascomycetous fungi of the genus Aspergillus comprise a wide variety of species of biotechnological importance as well as pathogens and toxin producers. Recent studies report A. fumigatus to be heterothallic and possibly undergoing sexual reproduction. We therefore investigated whether compatible mat...

  14. Analysis and prediction of gene splice sites in four Aspergillus genomes

    DEFF Research Database (Denmark)

    Wang, Kai; Ussery, David; Brunak, Søren


    , splice site prediction program called NetAspGene, for the genus Aspergillus. Gene sequences from Aspergillus fumigatus, the most common mould pathogen, were used to build and test our model. Compared to many animals and plants, Aspergillus contains smaller introns; thus we have applied a larger window...... better splice site prediction than other available tools. NetAspGene will be very helpful for the study in Aspergillus splice sites and especially in alternative splicing. A webpage for NetAspGene is publicly available at

  15. Antibodies generated against conserved antigens expressed by bacteria and allergen-bearing fungi suppress airway disease. (United States)

    Kin, Nicholas W; Stefanov, Emily K; Dizon, Brian L P; Kearney, John F


    There has been a sharp rise in allergic asthma and asthma-related deaths in the developed world, in contrast to many childhood illnesses that have been reduced or eliminated. The hygiene hypothesis proposes that excessively sanitary conditions early in life result in autoimmune and allergic phenomena because of a failure of the immune system to receive proper microbial stimulation during development. We demonstrate that Abs generated against conserved bacterial polysaccharides are reactive with and dampen the immune response against chitin and Aspergillus fumigatus. A reduction in Ag uptake, cell influx, cell activation, and cytokine production occurred in the presence of anti-polysaccharide Abs, resulting in a striking decrease in the severity of allergic airway disease in mice. Overall, our results suggest that Ag exposure--derived from environmental sources, self-antigens, or vaccination--during the neonatal period has dramatic effects on the adult Ab response and modifies the development of allergic airway disease. PMID:22837487

  16. In Vitro Interactions between Antifungals and Immunosuppressants against Aspergillus fumigatus


    Steinbach, William J.; Schell, Wiley A.; Blankenship, Jill R.; Onyewu, Chiatogu; Heitman, Joseph; Perfect, John R.


    The optimal treatment for invasive aspergillosis remains elusive, despite the increased efficacy of newer agents. The immunosuppressants cyclosporine (CY), tacrolimus (FK506), and sirolimus (formerly called rapamycin) exhibit in vitro and in vivo activity against Candida albicans, Cryptococcus neoformans, and Saccharomyces cerevisiae, including fungicidal synergy with azole antifungals. We report here that both FK506 and CY exhibit a clear in vitro positive interaction with caspofungin agains...

  17. Human Leukocytes Kill Aspergillus nidulans by Reactive Oxygen Species-Independent Mechanisms▿


    Henriet, Stefanie S. V.; Hermans, Peter W. M.; Verweij, Paul E.; Simonetti, Elles; Holland, Steven M.; Sugui, Janyce A.; Kwon-Chung, Kyung J.; Warris, Adilia


    Invasive aspergillosis is a major threat for patients suffering from chronic granulomatous disease (CGD). Although Aspergillus fumigatus is the most commonly encountered Aspergillus species, the presence of A. nidulans appears to be disproportionately high in CGD patients. The purpose of this study was to investigate the involvement of the NADPH oxidase and the resulting reactive oxygen species (ROS) in host defense against fungi and to clarify their relationship toward A. nidulans. Murine CG...

  18. Role of Aspergillus lentulus 14-α Sterol Demethylase (Cyp51A) in Azole Drug Susceptibility▿


    Mellado, Emilia; Alcazar-Fuoli, Laura; Cuenca-Estrella, Manuel; Rodriguez-Tudela, Juan L.


    Recent studies have demonstrated that some morphologically atypical Aspergillus fumigatus strains are different species belonging to the section Fumigati. Aspergillus lentulus, one of these sibling species, is increasingly reported in patients under corticosteroid treatment. MICs of most antifungals in clinical use are elevated against A. lentulus, and it shows primary resistance to azole drugs. Two A. lentulus cytochrome P450 14-α sterol demethylases, encoded by A. lentulus cyp51A (Alcyp51A)...

  19. Aflatoxin B1-producing Aspergillus in sun-dried medicinal plant materials


    Chinaputi, A.; Lim, S; Petcharat, V.; Chuenchit, S.; Pathanadech, A.


    Fifty sun-dried medicinal plants were obtained from fraditional drug stores in Songkhla Province, Thailand, and examined for Aspergillus and aflatoxin B1. 288 isolates of Aspergillus were obtaines by standard blotter plate and 25 species were identified. The most common species were A. niger with 99 isolates, A. Flavus 84 isolates, A. terreus 33 isolates, A. oryzae 25 isolates, A.nidulans (Emericella nidulans) 10 isolates, A fumigatus 9 isolates and A. chevalieri (Eurotium chevalieri) 8 isola...

  20. The protein phosphatase PhzA of A. fumigatus is involved in oxidative stress tolerance and fungal virulence


    Muszkieta, Laetitia; de Jesus Carrion, Steven; Robinet, Pauline; Beau, Rémi; Elbim, Carole; Pearlman, Eric; Latgé, Jean-Paul


    Protein phosphatases Z that are unique to the fungal kingdom have been associated to resistance to high salt concentration, cell wall integrity, cell cycle regulation, and oxidative stress in fungi. In Aspergillus fumigatus it was shown that PHZA is under the control of the transcription factor Skn7 and is only involved in the control of the oxidative stress. Accordingly, the ΔphzA mutant showed a defect in virulence in an experimental model of corneal infection in immuno...

  1. Septic arthritis due to tubercular and Aspergillus co-infection

    Directory of Open Access Journals (Sweden)

    Mukesh Kumar


    Full Text Available Aspergillus septic arthritis is a rare and serious medical and surgical problem. It occurs mainly in immunocompromised patients. Aspergillus fumigatus is the most common causative organism followed by Aspergillus flavus. The most common site affected is knee followed by shoulder, ankle, wrist, hip and sacroiliac joint. Debridement and voriconazole are primary treatment of articular aspergilosis. To the best of our knowledge, there are no reported cases of co-infection of tuberculosis (TB and Aspergillus infecting joints. We report a case of co-infection of TB and A. flavus of hip and knee of a 60-year-old male, with type 2 diabetes mellitus. He was treated with debridement, intravenous voriconazole, and antitubercular drugs.

  2. Evolutionary relationships in Aspergillus section Fumigati inferred from partial beta-tubulin and hydrophobin sequences

    DEFF Research Database (Denmark)

    Geiser, D.M.; Frisvad, Jens Christian; Taylor, J.W.


    Members of Aspergillus section Fumigati are important animal pathogens and food contaminants. There is considerable variation among the 16 currently recognized species in this section, particularly in their mating systems: five are known to be strictly mitosporic, nine are homothallic, and two ar....... fischeri was identified as the closest known meiotic relative to the cosmopolitan species most often implicated in human aspergillosis, A. fumigatus....

  3. Production of mycotoxins by Aspergillus lentulus and other medically important and closely related species in section Fumigati

    DEFF Research Database (Denmark)

    Larsen, Thomas Ostenfeld; Smedsgaard, Jørn; Nielsen, Kristian Fog;


    The production of mycotoxins and other secondary metabolites have been studied by LC-DAD-MS from six species in Aspergillus section Fumigati. This includes the three new species Aspergillus lentulus, A. novofumigatus and A. fumigatiaffinis as well as A. fumigatus, Neosartoria fisheri and N....... pseudofisheri. A major finding was detection of gliotoxin from N. pseudofisheri, a species not previously reported to produce this mycotoxin. Gliotoxin was also detected from A. fumigatus together with fumagillin, fumigaclavine C, fumitremorgin C, fumiquinazolines, trypacidin, methyl- sulochrin, TR-2...

  4. Therapeutic efficacy and safety of nano-silver membrane with voriconazole for Aspergillus fumigatus keratitis after topical application%伏立康唑纳米银复合膜对烟曲霉菌性角膜炎的疗效及安全性

    Institute of Scientific and Technical Information of China (English)

    钟菁; 袁进; 蒋刚彪; 陈国普; 孙弋钫; 陈玲; 邓宇晴


    of CS-ETA/Ag/GO/Vor (180 mice).CS-ETA/Ag/GO and CS-ETA/Ag/GO/Vor were attached on the normal corneas of mice and compared with the normal mice to assess the histopathological changes.Aspergillus fumigatus-infected mouse models were established in the left eyes of 180 mice by intrastromally injection of 2.0 μl Aspergillus fumigatus suspension with the density of 5 × 107 CFU/ml,then the mice were randomized into the model control group,CS-ETA/Ag/GO group and CS-ETA/Ag/GO/Vor group,and the corresponding membrane were attached the central corneas in different groups.In 1 day,3,5,7 days after modeling,the corneas were examined under the slit lamp microscope and scored,and corneal sections were prepared for the histopathological examination.Fungal activity was confirmed by plate counts,and real-time PCR was employed to assay the relative expressions of interleukin-1β (IL-1β) mRNA and tumor necrosis factor-α (TNF-α) mRNA in the corneas.Results No morphological abnormality was seen in the corneas in the normal control group,CS-ETA/Ag/GO group and CSETA/Ag/GO/Vor group.Corneal inflammatory score was significantly lower in the CS-ETA/Ag/GO/Vor group in various time points,with a significant differences among the groups and time points (Fgroup =237.29,P=0.00;Ftime =260.33,P=0.00).The edema,necrosis or perforation of cornea were seen in the model control group,and slighter inflammatory response in the CS-ETA/Ag/GO group,and corneal edema was gradually disappear in the CS-ETA/Ag/GO/Vor group.The corneal fungal loads were highest in the model control group and lowest in the CS-ETA/Ag/GO/V or group,with significant differences among the three groups and various time points (Fgroup =113.15,P =0.00;Ftime =126.52,P=0.00).The relative expressions of IL-1β mRNA and TNF-α mRNA in the corneas peaked in the fifth day after modeling in all of the three groups,and the expression levels of IL-1β mRNA and TNF-α mRNA in the corneas were lowest in the CS-ETA/Ag/GO/Vor group

  5. Prospective Evaluation of a New Aspergillus IgG Enzyme Immunoassay Kit for Diagnosis of Chronic and Allergic Pulmonary Aspergillosis. (United States)

    Dumollard, C; Bailly, S; Perriot, S; Brenier-Pinchart, M P; Saint-Raymond, C; Camara, B; Gangneux, J P; Persat, F; Valot, S; Grenouillet, F; Pelloux, H; Pinel, C; Cornet, M


    Anti-Aspergillus IgG antibodies are important biomarkers for the diagnosis of chronic pulmonary aspergillosis (CPA) and allergic bronchopulmonary aspergillosis (ABPA). We compared the performance of a new commercial enzyme immunoassay (EIA) (Bordier Affinity Products) with that of the Bio-Rad and Virion\\Serion EIAs. This assay is novel in its association of two recombinant antigens with somatic and metabolic antigens of Aspergillus fumigatus In a prospective multicenter study, 436 serum samples from 147 patients diagnosed with CPA (136 samples/104 patients) or ABPA (94 samples/43 patients) and from 205 controls (206 samples) were tested. We obtained sensitivities of 97%, 91.7%, and 86.1%, and specificities of 90.3%, 91.3%, and 81.5% for the Bordier, Bio-Rad, and Virion\\Serion tests, respectively. The Bordier kit was more sensitive than the Bio-Rad kit (P < 0.01), which was itself more sensitive than the Virion\\Serion kit (P = 0.04). The Bordier and Bio-Rad kits had similar specificity (P = 0.8), both higher than that of the Virion\\Serion kit (P = 0.02). The area under the receiver operating characteristic (ROC) curves confirmed the superiority of the Bordier kit over the Bio-Rad and the Virion\\Serion kits (0.977, 0.951, and 0.897, respectively; P < 0.01 for each comparison). In a subset analysis of 279 serum samples tested with the Bordier and Bio-Rad kits and an in-house immunoprecipitin assay (IPD), the Bordier kit had the highest sensitivity (97.7%), but the IPD tended to be more specific (71.2 and 84.7%, respectively; P = 0.10). The use of recombinant, somatic, and metabolic antigens in a single EIA improved the balance of sensitivity and specificity, resulting in an assay highly suitable for use in the diagnosis of chronic and allergic aspergillosis. PMID:26888904

  6. The Putative Guanine Nucleotide Exchange Factor RicA Mediates Upstream Signaling for Growth and Development in Aspergillus


    Kwon, Nak-Jung; Park, Hee-Soo; Jung, Seunho; Kim, Sun Chang; Yu, Jae-Hyuk


    Heterotrimeric G proteins (G proteins) govern growth, development, and secondary metabolism in various fungi. Here, we characterized ricA, which encodes a putative GDP/GTP exchange factor for G proteins in the model fungus Aspergillus nidulans and the opportunistic human pathogen Aspergillus fumigatus. In both species, ricA mRNA accumulates during vegetative growth and early developmental phases, but it is not present in spores. The deletion of ricA results in severely impaired colony growth ...

  7. Negative regulation and developmental competence in Aspergillus. (United States)

    Lee, Mi-Kyung; Kwon, Nak-Jung; Lee, Im-Soon; Jung, Seunho; Kim, Sun-Chang; Yu, Jae-Hyuk


    Asexual development (conidiation) in the filamentous fungus Aspergillus nidulans is governed by orchestrated gene expression. The three key negative regulators of conidiation SfgA, VosA, and NsdD act at different control point in the developmental genetic cascade. Here, we have revealed that NsdD is a key repressor affecting the quantity of asexual spores in Aspergillus. Moreover, nullifying both nsdD and vosA results in abundant formation of the development specific structure conidiophores even at 12 h of liquid culture, and near constitutive activation of conidiation, indicating that acquisition of developmental competence involves the removal of negative regulation exerted by both NsdD and VosA. NsdD's role in repressing conidiation is conserved in other aspergilli, as deleting nsdD causes enhanced and precocious activation of conidiation in Aspergillus fumigatus or Aspergillus flavus. In vivo NsdD-DNA interaction analyses identify three NsdD binding regions in the promoter of the essential activator of conidiation brlA, indicating a direct repressive role of NsdD in conidiation. Importantly, loss of flbC or flbD encoding upstream activators of brlA in the absence of nsdD results in delayed activation of brlA, suggesting distinct positive roles of FlbC and FlbD in conidiation. A genetic model depicting regulation of conidiation in A. nidulans is presented. PMID:27364479

  8. Case report of a new pathogenic variant of Aspergillus fumigates isolated from Hipposideros cervinus (Chiroptera: Hipposideridae in Sarawak, Malaysia

    Directory of Open Access Journals (Sweden)

    S.S.J. Seelan


    Full Text Available First record of new Aspergillus fumigatus variant (UNIMAS F009 was reported from the ears of bats at Kubah National Park, Borneo, Malaysia. Morphological characterization of this isolate showed some differences in terms of their growth rate, colony color, size of conidia and pigmentation on different media.

  9. Metabolomics Analysis Reveals Specific Novel Tetrapeptide and Potential Anti-Inflammatory Metabolites in Pathogenic Aspergillus species

    Directory of Open Access Journals (Sweden)

    Kim-Chung Lee


    Full Text Available Infections related to Aspergillus species have emerged to become an important focus in infectious diseases, as a result of the increasing use of immunosuppressive agents and high fatality associated with invasive aspergillosis. However, laboratory diagnosis of Aspergillus infections remains difficult. In this study, by comparing the metabolomic profiles of the culture supernatants of 30 strains of six pathogenic Aspergillus species (A. fumigatus, A. flavus, A. niger, A. terreus, A. nomius and A. tamarii and 31 strains of 10 non-Aspergillus fungi, eight compounds present in all strains of the six Aspergillus species but not in any strain of the non-Aspergillus fungi were observed. One of the eight compounds, Leu–Glu–Leu–Glu, is a novel tetrapeptide and represents the first linear tetrapeptide observed in Aspergillus species, which we propose to be named aspergitide. Two other closely related Aspergillus-specific compounds, hydroxy-(sulfooxybenzoic acid and (sulfooxybenzoic acid, may possess anti-inflammatory properties, as 2-(sulfooxybenzoic acid possesses a structure similar to those of aspirin [2-(acetoxybenzoic acid] and salicylic acid (2-hydroxybenzoic acid. Further studies to examine the potentials of these Aspergillus-specific compounds for laboratory diagnosis of aspergillosis are warranted and further experiments will reveal whether Leu–Glu–Leu–Glu, hydroxy-(sulfooxybenzoic acid and (sulfooxybenzoic acid are virulent factors of the pathogenic Aspergillus species.


    Directory of Open Access Journals (Sweden)

    Vanice Rodrigues Poester


    Full Text Available Aspergillosis is the main cause of mortality in captivity penguins. The infection occurs mainly by conidia inhalation of the Aspergillus genus, however, the fungus can also be dispersed by water. Therefore, this study aimed to evaluate water quality of the pool where the rehabilitated penguins remain at Centro de Recuperação de Animais Marinhos in Rio Grande city, Brazil, searching for the presence of the fungus Aspergillus spp. Water samples were collected weekly during a ten-month period and processed within six hours, applying the technique of filtrating membrane, with incubation at 25 ºC and 37 ºC during seven days. Of the forty samples analyzed, thirty-two were positive for the presence of Aspergillus genus, from these 60% correspond to A. fumigatus. Some variables significantly interfered on the isolation of Aspergillus genus and/or Aspergillus fumigatus specie, such as incubation temperature, seasonality and population density. This study showed Aspergillus spp. is present in the water, being one of the possible sources of infections for penguins in rehabilitation.

  11. Opportunistic infection of Aspergillus and bacteria in captive Cape vultures (Gyps coprotheres)

    Institute of Scientific and Technical Information of China (English)

    Stephen Chege; Judith Howlett; Majid Al Qassimi; Arshad Toosy; Joerg Kinne; Vincent Obanda


    Objective: To describe clinical signs, pathology, diagnosis and treatment of Cape vultures in which Aspergillus fumigatus (A. fumigatus) and mixed species of bacteria were isolated. Methods: Six Cape vultures sourced from South Africa for exhibition at Al Ain Zoo developed illness manifesting as anorexia, dyspnea, polyuria and lethargy. Three vultures died manifesting‘‘pneumonia-like syndrome’’. These three vultures were necropsied and gross lesions recorded, while organ tissues were collected for histopathology. Internal organs were swabbed for bacteriology and mycology. From live vultures, blood was collected for hematology and biochemistry, oropharyngeal and cloacal swabs were collected for mycology and bacteriology. Results: A. fumigatus was isolated from the three dead vultures and two live ones that eventually survived. One of the dead vulture and two live vultures were co-infected with A. fumigatus and mixed species of bacteria that included Clostridium perfringens, Pseudomonas, Staphylococcus, Escherichia, Proteus, Enterococcus and Enterbacter. One of the Cape vulture and a Lappet-faced vulture, however, were free of Aspergillus or bacterial infections. At necropsy, intestinal hemorrhages were observed and the lungs were overtly congested with granulomas present on caudal air sac. Histopathological examinations demonstrated granulomatous lesions that were infiltrated by mononuclear cells and giant cells. Conclusions: Aspergillosis is a persistent threat to captive birds and we recommend routine health assessments so that early diagnosis may prompt early treatment. It is likely that prompt prophylaxis by broad spectrum antibiotics and antifungals medication contributed to the survival of some of the vultures.

  12. Iatrogenic aspergillus infection of the central nervous system in a pregnant woman

    Directory of Open Access Journals (Sweden)

    Lokuhetty Menaka


    Full Text Available A healthy postnatal woman succumbed to fulminant iatrogenic Aspergillus infection of the central nervous system, following accidental inoculation into the subarachnoid space at spinal anesthesia, during an outbreak of Aspergillus meningitis in Sri Lanka. Autopsy revealed extensive Aspergillus meningitis and culture confirmed Aspergillus fumigatus. The thalamic parenchyma in the brain was invaded by fungal hyphae producing necrotizing angitis with thrombosis, thalamic infarcts and fungal abscesses. The directional growth of fungal hyphae from the extra-luminal side of blood vessels towards the lumen favored extension from the brain parenchyma over hematogenous spread. The spinal parenchyma was resistant to fungal invasion in spite of the heavy growth within the spinal meninges and initial inoculation at spinal level. Modulation of the immune response in pregnancy with depression of selective aspects of cell-mediated immunity probably contributed to rapid spread within the subarachnoid space, to involve the brain parenchyma leading to clinical deterioration and death.

  13. In Vitro Activities at pH 5.0 and pH 7.0 and In Vivo Efficacy of Flucytosine against Aspergillus fumigatus▿


    Verweij, P. E.; Dorsthorst, D.T.A. te; Janssen, W.H.P.; Meis, J. F. G. M.; Mouton, J. W.


    The antifungal agent flucytosine was found to be active in vitro against Aspergillus fumigatus isolates when the MIC was determined at pH 5.0 instead of pH 7.0. The in vitro MIC at pH 5.0 corresponded to the in vivo efficacy of flucytosine monotherapy in a murine model of invasive aspergillosis.

  14. Aspergillus: a primer for the novice. (United States)

    Bennett, J W


    Aspergillus is a genus of molds named after the morphological structure that bears asexual spores, the aspergillum, which resembles a liturgical device. This genus contains several species of positive or negative economic importance in industry, agriculture and medicine. The majority of aspergilli, including most species of economic importance, are known to reproduce only by asexual spores. Genome projects have been completed for A. fumigatus, A. nidulans, A. niger and A. oryzae; several other species are also being sequenced. The data from these genome projects have been useful in elucidating aspects of phylogeny, the evolution of sexuality and the extent of secondary metabolite diversity. To date, however, the impact on drug discovery, diagnosis of aspergillosis, and our understanding of fungal pathogenesis has been less pronounced. PMID:19253144

  15. Antifungal activity of ibuprofen against aspergillus species and its interaction with common antifungal drugs

    Institute of Scientific and Technical Information of China (English)

    LI Li-juan; CHEN Wei; XU Hui; WAN Zhe; LI Ruo-yu; LIU Wei


    Background The incidence of invasive aspergillosis (IA) has increased in frequency in immunocompromised patients with a variety of diseases. The poor prognosis might be due to limited treatment option. This study aimed to evaluate antifungal activity of ibuprofen against clinical isolates of aspergillus species, as well as its interaction with azoles or with amphotericin B or with micafungin.Methods Antifungal activity of ibuprofen against 10 strains of Aspergillus fumigatus, Aspergillus flavus, and Aspergillus terreus were tested with both disk diffusion assay and standard broth microdilution method. To determine whether ibuprofen combined with itraconazole, voriconazole, amphotericin B, or micafungin had interactive effects on aspergillus spp., we used both disk diffusion assay and Chequerboard method.Results As for disk diffusion method, ibuprofen produced a zone of growth inhibition with diameters of (20.1±3.9) mm at 48 hours of incubation. As for broth microdilution method, the minimal inhibitory concentration (MIC) ranges of ibuprofen against aspergillus spp. were 1000-2000 μg/ml, and the minimal fungicidal concentration (MFC) ranges of that was 2000-8000 μg/ml. For 2 of 5 isolates, when ibuprofen combined with itraconazole or voriconazole, the zones of growth inhibition were larger than those of the individual drug. The results of Chequerboard method showed that fractional inhibitory concentration index (FICI) ranges were 1.125-2.500.Conclusions Ibuprofen is active against aspergillus spp.. And ibuprofen does not affect the in vitro activity of itraconazole, voriconazole, amphotericin B or micafungin against aspergillus spp..

  16. Efficacy of corn and rice seed-borne mycoflora in controlling aflatoxigenic Aspergillus flavus

    Directory of Open Access Journals (Sweden)

    Adel K. Madbouly


    Full Text Available Food commodities such as cereals are subjected to spoilage and bio-deterioration during storage by mycotoxigenic fungi such as Aspergillus flavus. Efforts are done to biologically control toxigenic A. flavus and subsequently prevent or at least minimize its aflatoxin production ability, without the need of using synthetic fungicides. Antifungal activity of corn and rice seed-borne mycoflora was tested against aflatoxigenic A. flavus in vitro, using bioassays such as dual culture technique; ability to produce volatile and non-volatile metabolites; ability to inhibit germination and reduce germ tube length of A. flavus conidia; in vivo reduction of aflatoxins level in corn seeds co-inoculated with the pathogen and antagonists. Penicillum crustosum, Aspergillus giganteus, Fusarium verticillioides and Aspergillus fumigatus isolates showed promising antifungal activities and varying efficiencies of reducing aflatoxins level; however, only A. fumigatus isolate was non-aflatoxigenic. It could be concluded that A. fumigatus could be used effectively as a biopreservative to increase shelf life of cereals during storage, but after testing its tendency to produce other mycotoxins or causing human Aspergillosis.

  17. What can comparative genomics tell us about species concepts in the genus Aspergillus?

    Energy Technology Data Exchange (ETDEWEB)

    Rokas, Antonis; payne, gary; Federova, Natalie D.; Baker, Scott E.; Machida, Masa; yu, Jiujiang; georgianna, D. R.; Dean, Ralph A.; Bhatnagar, Deepak; Cleveland, T. E.; Wortman, Jennifer R.; Maiti, R.; Joardar, V.; Amedeo, Paolo; Denning, David W.; Nierman, William C.


    Understanding the nature of species" boundaries is a fundamental question in evolutionary biology. The availability of genomes from several species of the genus Aspergillus allows us for the first time to examine the demarcation of fungal species at the whole-genome level. Here, we examine four case studies, two of which involve intraspecific comparisons, whereas the other two deal with interspecific genomic comparisons between closely related species. These four comparisons reveal significant variation in the nature of species boundaries across Aspergillus. For example, comparisons between A. fumigatus and Neosartorya fischeri (the teleomorph of A. fischerianus) and between A. oryzae and A. flavus suggest that measures of sequence similarity and species-specific genes are significantly higher for the A. fumigatus - N. fischeri pair. Importantly, the values obtained from the comparison between A. oryzae and A. flavus are remarkably similar to those obtained from an intra-specific comparison of A. fumigatus strains, giving support to the proposal that A. oryzae represents a distinct ecotype of A. flavus and not a distinct species. We argue that genomic data can aid Aspergillus taxonomy by serving as a source of novel and unprecedented amounts of comparative data, as a resource for the development of additional diagnostic tools, and finally as a knowledge database about the biological differences between strains and species.

  18. Isolation of Aspergillus species from Nasal Cavity and Bedroom of Healthy Volunteers and Patients with Allergic Rhinitis in Mashhad, Iran

    Directory of Open Access Journals (Sweden)

    Samaneh Eidi


    Full Text Available Background: The purpose of this study was to investigate the presence, frequency and comparison of Aspergillus spp. in nasal cavity and bedroom of healthy volunteers and patients with allergic rhinitis. Materials and Methods: In this cross-sectional study, a group of patients with allergic rhinitis (N=50 were selected based on positive skin prick test. Healthy volunteers were chosen to be in the comparison group by matching in age, gender, and no history of respiratory system disease. Samples from nasal cavity and different parts of bedroom were collected and cultured. Cultured Aspergillus spp. was identified by standard mycological techniques. Results: The most common species isolated from all samples of healthy volunteers was A. flavus (88%, followed by A. niger (76% and A. fumigatus (74%. A. flavus (56% was the predominant species isolated from all samples of patients, followed by A. niger (34% and A. fumigatus (6%. Conclusion: A. flavus was the most prevalent species of Aspergillus both healthy volunteers and patients. The presence of Aspergillus in homes does not necessarily imply a cause and effect relationship with illness, but we speculate that A. flavus may be a major source of aeroallergens along with A. niger and A. fumigatus; and should alert physicians and healthcare professionals to do more vigorous environmental testing.

  19. Detection of Aspergillus-specific antibodies by agar gel double immunodiffusion and IgG ELISA in feline upper respiratory tract aspergillosis. (United States)

    Barrs, V R; Ujvari, B; Dhand, N K; Peters, I R; Talbot, J; Johnson, L R; Billen, F; Martin, P; Beatty, J A; Belov, K


    Feline upper respiratory tract aspergillosis (URTA) is an emerging infectious disease. The aims of this study were: (1) to assess the diagnostic value of detection of Aspergillus-specific antibodies using an agar gel double immunodiffusion (AGID) assay and an indirect immunoglobulin G (IgG) ELISA; and (2) to determine if an aspergillin derived from mycelia of Aspergillus fumigatus, Aspergillus niger and Aspergillus flavus can be used to detect serum antibodies against cryptic Aspergillus spp. in Aspergillus section Fumigati. Sera from cats with URTA (group 1: n = 21) and two control groups (group 2: cats with other upper respiratory tract diseases, n = 25; group 3: healthy cats and cats with non-respiratory, non-fungal illness, n = 84) were tested. Isolates from cats with URTA comprised A. fumigatus (n = 5), A. flavus (n = 1) and four cryptic species: Aspergillus felis (n = 12), Aspergillus thermomutatus (Neosartorya pseudofischeri, n = 1), Aspergillus lentulus (n = 1) and Aspergillus udagawae (n = 1). Brachycephalic purebred cats were significantly more likely to develop URTA than other breeds (P = 0.013). The sensitivity (Se) of the AGID was 43% and the specificity (Sp) was 100%. At a cut-off value of 6 ELISA units/mL, the Se of the IgG ELISA was 95.2% and the Sp was 92% and 92.9% for groups 2 and 3 cats, respectively. Aspergillus-specific antibodies against all four cryptic species were detected in one or both assays. Assay Se was not associated with species identity. Detection of Aspergillus-specific antibodies by IgG ELISA has high Se and Sp for diagnosis of feline URTA. PMID:25634077

  20. Primary cutaneous aspergillosis due to Aspergillus flavus: a case report

    Institute of Scientific and Technical Information of China (English)

    ZHANG Qiang-qiang; LI Li; ZHU Min; ZHANG Chao-ying; WANG Jia-jun


    @@ Infections caused by opportunistic organisms which have been known as etiologic agents of disease become more and more frequent.Aspergillus spp. is one of the agents. Fungi of aspergillus genus are widely distributed in nature, particularly in the soil and in the decomposed vegetation. They are frequent opportunist pathogens in immunocompromised patients. The most frequent causative organisms that cause cutaneous aspergillosis are A.fumigatus and A.flavus.1-3 In this report, we present a case of primary cutaneous aspergillosis manifested by ulceration of the shank due to A. flavus. The patient had no deficiency of immunological status and severe disease associated with fungal infection. Excellent response was shown to anti-fungal therapy.

  1. Environmental contamination by Aspergillus spp. in laying hen farms and associated health risks for farm workers. (United States)

    Cafarchia, Claudia; Camarda, Antonio; Iatta, Roberta; Danesi, Patrizia; Favuzzi, Vincenza; Di Paola, Giancarlo; Pugliese, Nicola; Caroli, Anna; Montagna, Maria Teresa; Otranto, Domenico


    Data on the occurrence and epidemiology of Aspergillus spp. in laying hens farms are scant. With the aims of determining levels of airborne contamination in laying hen farms and evaluating the potential risk of infection for workers and animals, 57 air samples from 19 sheds (Group I), 69 from faeces (Group II), 19 from poultry feedstuffs (Group III) and 60 from three anatomical sites (i.e. nostrils, pharynx, ears) of 20 farm workers (Group IV) were cultured. The Aspergillus spp. prevalence in samples ranged from 31.6% (Group III) to 55.5% (Group IV), whereas the highest conidia concentration was retrieved in Group II (1.2 × 10(4) c.f.u. g(-1)) and in Group III (1.9 × 10(3) c.f.u. g(-1)). The mean concentration of airborne Aspergillus spp. conidia was 70 c.f.u. m(-3) with Aspergillus fumigatus (27.3%) being the most frequently detected species, followed by Aspergillus flavus (6.3%). These Aspergillus spp. were also isolated from human nostrils (40%) and ears (35%) (Pdisease in hens, it causes human colonization. Correct management of hen farms is necessary to control environmental contamination by Aspergillus spp., and could lead to a significant reduction of animal and human colonization. PMID:24430250

  2. Study of the metabolism of flucytosine in Aspergillus species by 19F nuclear magnetic resonance spectroscopy

    International Nuclear Information System (INIS)

    The metabolism of flucytosine (5FC) in two Aspergillus species (Aspergillus fumigatus and A. niger) was investigated by 19F nuclear magnetic resonance spectroscopy. In intact mycelia, 5FC was found to be deaminated to 5-fluorouracil and then transformed into fluoronucleotides; the catabolite alpha-fluoro-beta-alanine was also detected in A. fumigatus. Neither 5-fluoroorotic acid nor 5-fluoro-2'-deoxyuridine-5'-monophosphate was detected in perchloric acid extracts after any incubation with 5FC. 5FC, 5-fluorouracil, and the classical fluoronucleotides 5-fluorouridine-5'-mono-, di-, and triphosphates were identified in the acid-soluble pool. Two hydrolysis products of 5-fluorouracil incorporated into RNA, 5-fluorouridine-2'-monophosphate and 5-fluorouridine-3'-monophosphate, were found in the acid-insoluble pool. No significant differences in the metabolic transformation of 5FC were noted in the two species of Aspergillus. The main pathway of 5FC metabolism in the two species of Aspergillus studied is thus the biotransformation into ribofluoronucleotides and the subsequent incorporation of 5-fluorouridine-5'-triphosphate into RNA

  3. Prevalence of Aspergillus species in clinical samples isolated in an Indian tertiary care hospital

    Directory of Open Access Journals (Sweden)

    Xess Immaculata


    Full Text Available CONTEXT (BACKGROUND: In recent times, it has become important to determine the prevalence of different Aspergillus species in clinical samples in view of difference in antifungal susceptibility noted in some species. AIMS: To determine the species prevalence of Aspergillus isolates in various clinical samples received in the Mycology Laboratory at our institute. METHOD: Over a period of 4-years, a total of 18,731 samples were processed, and species identification carried out by standard microbiological methods. RESULTS: Four hundred and fifty six samples (2.43% were culture positive for Aspergillus species. A.flavus (46.93% was the most common isolate, followed by A.fumigatus (37.72% and A.niger (15.35%. It was observed that A.fumigatus was the predominant species isolated from blood and respiratory specimens, A.flavus was predominantly isolated from nasal polyps whereas A.niger predominated in nail specimens. Culture positivity was highest in the age group 12-65 years and in males. Sixty-nine patients (15.13% were admitted to the intensive care unit. CONCLUSIONS: The study highlights the diverse manifestations caused by Aspergillus species in human beings and also throws light on the different species prevalent locally. The knowledge would prove useful in selecting empirical antifungal therapy and formulating prophylactic and pre-emptive strategies.

  4. The T788G Mutation in the cyp51C Gene Confers Voriconazole Resistance in Aspergillus flavus Causing Aspergillosis


    Liu, Wei; Sun, Yi; Chen, Wei; Liu, Weixia; Wan, Zhe; Bu, Dingfang; Li, Ruoyu


    With voriconazole (VRC) being approved as the first choice in treating invasive aspergillosis (IA) and its increasing use in treatment, a VRC-resistant strain of Aspergillus flavus, the second leading cause of IA after Aspergillus fumigatus, has emerged. The VRC-resistant strain of A. flavus was isolated for the first time from the surgical lung specimen of an IA patient with no response to VRC therapy. In order to ascertain the mechanism of VRC resistance, the azole target enzyme genes in th...

  5. A case of aspergillus endophthalmitis in an immuncompetent woman: intra-ocular penetration of oral voriconazole: a case report


    Logan, SA; Rajan, MS; Graham, E; Johnson, EM; Klein, JL


    Background There are very few reports of Aspergillus fumigatus causing endogenous endophthalmitis (EAE) in immunocompetent individuals although it is well recognised in the immunocompromised. Treatment can be with intravitreal, intravenous and oral antifungal agents. The benefit of an oral agent is clear however the concentration of voriconazole in the inflamed eye after oral administration has not previously been documented. Case presentation We present a case of EAE in an immunocompetent 78...

  6. Distribution of Aspergillus species among apparently healthy birds in poultry farms in Kaduna state, Nigeria

    Directory of Open Access Journals (Sweden)

    Clara N Kwanashie


    Full Text Available The study wasconducted to determine the prevalence and distribution of Aspergilllus species among apparently healthy birds in poultryfarms. Trachea swabs from 1500 birds in 52 commercial (10% of birds in eachpoultry farm visited poultry farms were collected for this study. Six speciesof Aspergillus were isolated wasisolated from 718 (47.87% of the birds viz: A. fumigatus made up 52.37% (376 of the Aspergillus isolates followed by A. flavus 21.87% (157, A.niger 11.42% (82, A. terreus8.64% (62, A. restrictus 2.79% (20and A. ochraceous 2.92% (21. Aspergillus species was found to occurthroughout the year in the farms though with a higher incidence during therainy season compared to the dry season.

  7. Comparison of Etest with Modified Broth Microdilution Method for Testing Susceptibility of Aspergillus spp. to Voriconazole (United States)

    Serrano, M. C.; Morilla, D.; Valverde, A.; Chávez, M.; Espinel-Ingroff, A.; Claro, R.; Ramírez, M.; Mazuelos, E. Martín


    We compared the Etest with a broth microdilution method, performed according to a modified National Committee for Clinical Laboratory Standards guideline (M38-A), for determining the in vitro susceptibility of 77 isolates of Aspergillus spp. (26 A. fumigatus, 21 A. flavus, 10 A. terreus, 9 A. niger, 5 A. nidulellus, 4 A. glaucus, and 2 A. flavipes isolates). Overall, there was 92.2% agreement between both methods when Etest MICs were read at 24 h and 83.1% agreement when both methods were read at 48 h. When Etest MICs were read at 24 h, the agreement was >90% for all species tested except for A. fumigatus (84.6%). When Etest MICs were read at 48 h, the agreement ranged from 50 to 100%. The poorest agreement was seen with A. glaucus (50%) and A. fumigatus (65%). Where a discrepancy was observed between Etest and the reference method, the Etest MIC was generally higher. The Etest appears to be a suitable alternative procedure for testing the susceptibility of Aspergillus spp. to voriconazole. PMID:14605181

  8. Characterization of filamentous fungi isolated from Moroccan olive and olive cake: toxinogenic potential of Aspergillus strains. (United States)

    Roussos, Sevastianos; Zaouia, Nabila; Salih, Ghislane; Tantaoui-Elaraki, Abdelrhafour; Lamrani, Khadija; Cheheb, Mostafa; Hassouni, Hicham; Verhé, Fréderic; Perraud-Gaime, Isabelle; Augur, Christopher; Ismaili-Alaoui, Mustapha


    During the 2003 and 2004 olive oil production campaigns in Morocco, 136 samples from spoiled olive and olive cake were analyzed and 285 strains were isolated in pure culture. Strains included 167 mesophilic strains belonging to ten genera: Penicillium, Aspergillus, Geotrichum, Mucor, Rhizopus, Trichoderma, Alternaria, Acremonium, Humicola, Ulocladium as well as 118 thermophilic strains isolated in 2003 and 2004, mainly belonging to six species: Aspergillus fumigatus, Paecilomyces variotii, Mucor pusillus, Thermomyces lanuginosus, Humicola grisea, and Thermoascus aurantiacus. Penicillium and Aspergillus, respectively, 32.3 and 26.9% of total isolates represented the majority of mesophilic fungi isolated. When considering total strains (including thermotolerant strains) Aspergillus were the predominant strains isolated; follow-up studies on mycotoxins therefore focused primarily on aflatoxins (AFs) and ochratoxin A (OTA) from the latter strains. All isolated Aspergillus flavus strains (9) and Aspergillus niger strains (36) were studied in order to evaluate their capacity to produce AFs and OTA, respectively, when grown on starch-based culture media. Seven of the nine tested A. flavus strains isolated from olive and olive cake produced AF B1 at concentrations between 48 and 95 microg/kg of dry rice weight. As for the A. niger strains, 27 of the 36 strains produced OTA. PMID:16715545

  9. In Vitro Activity of ASP2397 against Aspergillus Isolates with or without Acquired Azole Resistance Mechanisms. (United States)

    Arendrup, Maiken Cavling; Jensen, Rasmus Hare; Cuenca-Estrella, Manuel


    ASP2397 is a new compound with a novel and as-yet-unknown target different from that of licensed antifungal agents. It has activity against Aspergillus and Candida glabrata. We compared its in vitro activity against wild-type and azole-resistant A. fumigatus and A. terreus isolates with that of amphotericin B, itraconazole, posaconazole, and voriconazole. Thirty-four isolates, including 4 wild-type A. fumigatus isolates, 24 A. fumigatus isolates with alterations in CYP51A TR/L98H (5 isolates), M220 (9 isolates), G54 (9 isolates), and HapE (1 isolate), and A. terreus isolates (2 wild-type isolates and 1 isolate with an M217I CYP51A alteration), were analyzed. EUCAST E.Def 9.2 and CLSI M38-A2 MIC susceptibility testing was performed. ASP2397 MIC50 values (in milligrams per liter, with MIC ranges in parentheses) determined by EUCAST and CLSI were 0.5 (0.25 to 1) and 0.25 (0.06 to 0.25) against A. fumigatus CYP51A wild-type isolates and were similarly 0.5 (0.125 to >4) and 0.125 (0.06 to >4) against azole-resistant A. fumigatus isolates, respectively. These values were comparable to those for amphotericin B, which were 0.25 (0.125 to 0.5) and 0.25 (0.125 to 0.25) against wild-type isolates and 0.25 (0.125 to 1) and 0.25 (0.125 to 1) against isolates with azole resistance mechanisms, respectively. In contrast, MICs for the azole compounds were elevated and highest for itraconazole: >4 (1 to >4) and 4 (0.5 to >4) against isolates with azole resistance mechanisms compared to 0.125 (0.125 to 0.25) and 0.125 (0.06 to 0.25) against wild-type isolates, respectively. ASP2397 was active against A. terreus CYP51A wild-type isolates (MIC 0.5 to 1), whereas MICs of both azole and ASP2397 were elevated for the mutant isolate. ASP2397 displayed in vitro activity against A. fumigatus and A. terreus isolates which was independent of the presence or absence of azole target gene resistance mutations in A. fumigatus. The findings are promising at a time when azole-resistant A. fumigatus

  10. Recurrent Aspergillus contamination in a biomedical research facility: a case study. (United States)

    Cornelison, Christopher T; Stubblefield, Bryan; Gilbert, Eric; Crow, Sidney A


    Fungal contamination of biomedical processes and facilities can result in major revenue loss and product delay. A biomedical research facility (BRF) culturing human cell lines experienced recurring fungal contamination of clean room incubators over a 3-year period. In 2010, as part of the plan to mitigate contamination, 20 fungal specimens were isolated by air and swab samples at various locations within the BRF. Aspergillus niger and Aspergillus fumigatus were isolated from several clean-room incubators. A. niger and A. fumigatus were identified using sequence comparison of the 18S rRNA gene. To determine whether the contaminant strains isolated in 2010 were the same as or different from strains isolated between 2007 and 2009, a novel forensic approach to random amplified polymorphic DNA (RAPD) PCR was used. The phylogenetic relationship among isolates showed two main genotypic clusters, and indicated the continual presence of the same A. fumigatus strain in the clean room since 2007. Biofilms can serve as chronic sources of contamination; visual inspection of plugs within the incubators revealed fungal biofilms. Moreover, confocal microscopy imaging of flow cell-grown biofilms demonstrated that the strains isolated from the incubators formed dense biofilms relative to other environmental isolates from the BRF. Lastly, the efficacies of various disinfectants employed at the BRF were examined for their ability to prevent spore germination. Overall, the investigation found that the use of rubber plugs around thermometers in the tissue culture incubators provided a microenvironment where A. fumigatus could survive regular surface disinfection. A general lesson from this case study is that the presence of microenvironments harboring contaminants can undermine decontamination procedures and serve as a source of recurrent contamination. PMID:22143434

  11. Activity of voriconazole (UK-109,496) against clinical isolates of Aspergillus species and its effectiveness in an experimental model of invasive pulmonary aspergillosis.


    Murphy, M.; Bernard, E M; Ishimaru, T.; Armstrong, D.


    Voriconazole, a new azole antifungal agent, showed potent activity against clinical isolates of Aspergillus spp. in vitro. For A. fumigatus, the MIC range was < 0.03 to 0.5 microgram/ml and the MIC at which 90% of isolates are inhibited was 0.25 microgram/ml. In an experimental model of invasive pulmonary aspergillosis which mimics infection in humans, oral voriconazole at dosages of 30 mg/kg of body weight per day significantly delayed or prevented mortality.

  12. A genomics based discovery of secondary metabolite biosynthetic gene clusters in Aspergillus ustus.

    Directory of Open Access Journals (Sweden)

    Borui Pi

    Full Text Available Secondary metabolites (SMs produced by Aspergillus have been extensively studied for their crucial roles in human health, medicine and industrial production. However, the resulting information is almost exclusively derived from a few model organisms, including A. nidulans and A. fumigatus, but little is known about rare pathogens. In this study, we performed a genomics based discovery of SM biosynthetic gene clusters in Aspergillus ustus, a rare human pathogen. A total of 52 gene clusters were identified in the draft genome of A. ustus 3.3904, such as the sterigmatocystin biosynthesis pathway that was commonly found in Aspergillus species. In addition, several SM biosynthetic gene clusters were firstly identified in Aspergillus that were possibly acquired by horizontal gene transfer, including the vrt cluster that is responsible for viridicatumtoxin production. Comparative genomics revealed that A. ustus shared the largest number of SM biosynthetic gene clusters with A. nidulans, but much fewer with other Aspergilli like A. niger and A. oryzae. These findings would help to understand the diversity and evolution of SM biosynthesis pathways in genus Aspergillus, and we hope they will also promote the development of fungal identification methodology in clinic.

  13. [A case of invasive pulmonary aspergillosis accompanied with Aspergillus meningitis]. (United States)

    Akutsu, K; Goto, H; Sakurada, S; Ota, T; Yuasa, K; Iguchi, M; Okamura, T; Ieki, R; Kawamura, T


    A 53-year-old female was admitted to our hospital complaining of chest pain and gait disturbance. Examinations on admission showed that she was immunocompetent except the negative tuberculin test. The chest X-ray showed infiltrative shadows with old tuberculous lesions in the bilateral upper lung fields. In CT, a mass lesion was revealed in the lesion, which destructed the fifth thoracic vertebra and invaded into the epidural space. She died of meningitis on the 18th day after admission. On autopsy, it was made clear that the mass lesion was caused by Aspergillus fumigatus, and that the meningitis was the result of the invasion of the fungus into the epidural space. PMID:8741716

  14. A trispecies Aspergillus microarray: Comparative transcriptomics of three Aspergillus species

    DEFF Research Database (Denmark)

    Andersen, Mikael Rørdam; Vongsangnak, Wanwipa; Panagiotou, Gianni; Salazar, Margarita Pena; Lehmann, Linda Olkjær; Nielsen, Jens


    The full-genome sequencing of the filamentous fungi Aspergillus nidulans, Aspergillus niger, and Aspergillus oryzae has opened possibilities for studying the cellular physiology of these fungi on a systemic level. As a tool to explore this, we are making available an Affymetrix GeneChip developed...

  15. Binding mode of dihydroquinazolinones with lysozyme and its antifungal activity against Aspergillus species. (United States)

    Hemalatha, K; Madhumitha, G; Ravi, Lokesh; Khanna, V Gopiesh; Al-Dhabi, Naif Abdullah; Arasu, Mariadhas Valan


    Aspergillosis is one of the infectious fungal diseases affecting mainly the immunocompromised patients. The scarcity of the antifungal targets has identified the importance of N-myristoyl transferase (NMT) in the regulation of fungal pathway. The dihydroquinazolinone molecules were designed on the basis of fragments responsible for binding with the target enzyme. The aryl halide, 1(a-g), aryl boronic acid and potassium carbonate were heated together in water and dioxane mixture to yield new CC bond formation in dihydroquinazolinone. The bis(triphenylphosphine)palladium(II) dichloride was used as catalyst for the CC bond formation. The synthesized series were screened for their in vitro antifungal activity against Aspergillus niger and Aspergillus fumigatus. The binding interactions of the active compound with lysozyme were explored using multiple spectroscopic studies. Molecular docking study of dihydroquinazolinones with the enzyme revealed the information regarding various binding forces involved in the interaction. PMID:27214045

  16. Antifungal activity of Oleoresins used in meat industry on some toxigenic Aspergillus spp.

    Directory of Open Access Journals (Sweden)

    Šošo Vladislava M.


    Full Text Available Different spice oleoresins are widely used in meat industry. They contribute to the specific aroma and flavor of the end products, but they have also been reported to have strong antimicrobial activity. These properties open a plenty of possibilities to be used for defining the specific sensory profile of the product but also as natural food preservatives. This paper focuses on the antifungal activity of four oleoresins against different foodborne toxigenic Aspergillus species. Oleoresins used in the experiments were cayenne pepper, black pepper, garlic and rosemary oleoresins, and they were tested against following Aspergillus species: A. clavatus, A. flavus, A. fumigatus, A. niger, A. ochraceus and A. versicolor. Antifungal activity was tested using microtitre-plate-based assay incorporating resazurin as an indicator of cell growth and broth microdilution-method. [Projekat Ministarstva nauke Republike Srbije, br. III46009

  17. Light Sensing in Aspergillus fumigatus Highlights the Case for Establishing New Models for Fungal Photobiology


    Idnurm, Alexander


    ABSTRACT Microbes inhabit diverse environmental locations, and many species need to shift their physiology between different niches. To do this effectively requires the accurate sensing of and response to the environment. For pathogens, exposure to light is one major change between a free-living saprophyte lifestyle and causation of disease within the host. However, how light may act as a signal to influence pathogenesis, on the side of either the host or the pathogen, is poorly understood. R...

  18. Optimization of pectinase enzyme production in Aspergillus fumigatus isolated from rotten fruits



    Introduction: Pectinase is one of the most important industrial enzymes which was isolated from a wide variety of microorganisms such as bacteria and filamentous fungi. This enzyme has been usually used in the juice and textile industry. In this study, the isolation and optimization of pectinase-producing fungi on decaying rotten fruits were studied. Materials and methods: Isolation and screening of pectinase producing fungi have been done by plate culture on pectin medium and staining wi...

  19. GliZ, a transcriptional regulator of gliotoxin in Aspergillus fumigatus

    DEFF Research Database (Denmark)

    Bok, J.W.; Chung, D.W.; Balajee, A.;


    involved in gliotoxin production, including gliZ, encoding a putative Zn2Cys6 binuclear transcription factor. Replacement of gliZ with a marker gene (gliZ) resulted in no detectable gliotoxin production and loss of gene expression of other gli cluster genes.Placement of multiple copies of gliZ in the...... genome increased gliotoxin production. Using endpoint survival data, the gliZ and a multiple-copy gliZ strain were not statistically different from the wild type in a murine pulmonary model; however, both the wild-type and the multiple-copy gliZ strain were more virulent than laeA (a mutant reduced in...... production of gliotoxin and other toxins). A flow-cytometric analysis of polymorphonuclear leukocytes (PMNs) exposed to supernatants from wild-type, gliZ, complemented gliZ, and laeA strains supported a role for gliotoxin in apoptotic but not necrotic PMN cell eath. This may indicate that several secondary...

  20. Diversity, molecular phylogeny and fingerprint profiles of airborne Aspergillus species using random amplified polymorphic DNA. (United States)

    Kermani, Firoozeh; Shams-Ghahfarokhi, Masoomeh; Gholami-Shabani, Mohammadhassan; Razzaghi-Abyaneh, Mehdi


    In the present study, diversity and phylogenetic relationship of Aspergillus species isolated from Tehran air was studied using random amplified polymorphic DNA (RAPD)-polymerase chain reaction (RAPD-PCR). Thirty-eight Aspergillus isolates belonging to 12 species i.e. A. niger (28.94 %, 11 isolates), A. flavus (18.42 %, 7 isolates), A. tubingensis (13.15 %, 5 isolates), A. japonicus (10.52 %, 4 isolates), A. ochraceus (10.52 %, 4 isolates), and 2.63 %, 1 isolate from each A. nidulans, A. amstelodami, A. oryzae, A. terreus, A. versicolor, A. flavipes and A. fumigatus were obtained by settle plate method which they were distributed in 18 out of 22 sampling sites examined. Fungal DNA was extracted from cultured mycelia of all Aspergillus isolates on Sabouraud Dextrose Agar and used for amplification of gene fragments in RAPD-PCR using 11 primers. RAPD-PCR data was analyzed using UPGMA software. Resulting dendrogram of combined selected primers including PM1, OPW-04, OPW-05, P160, P54, P10 and OPA14 indicated the distribution of 12 Aspergillus species in 8 major clusters. The similarity coefficient of all 38 Aspergillus isolates ranged from 0.02 to 0.40 indicating a wide degree of similarities and differences within and between species. Taken together, our results showed that various Aspergillus species including some important human pathogenic ones exist in the outdoor air of Tehran by different extents in distribution and diversity and suggested inter- and intra-species genetic diversity among Aspergillus species by RAPD-PCR as a rapid, sensitive and reproducible method. PMID:27116962

  1. In vitro susceptibility testing of Aspergillus spp. against voriconazole, itraconazole, posaconazole, amphotericin B and caspofungin

    Institute of Scientific and Technical Information of China (English)

    SHI Jun-yan; WANG He; GUO Li-na; XU Ying-chun; SHI Yi; L(U) Huo-xiang; LIU Yong; ZHAO Wang-sheng; CHEN Dong-mei; XI Li-yan; ZHOU Xin


    Background During recent years, the incidence of serious infections caused by opportunistic fungi has increased dramatically due to alterations of the immune status of patients with hematological diseases, malignant tumors,transplantations and so forth. Unfortunately, the wide use of triazole antifungal agents to treat these infections has lead to the emergence of Aspergillus spp. resistant to triazoles. The present study was to assess the in vitro activities of five antifungal agents (voriconazole, itraconazole, posaconazole, amphotericin B and caspofungin) against different kinds of Aspergillus spp. that are commonly encountered in the clinical setting.Methods The agar-based Etest MIC method was employed. One hundred and seven strains of Aspergillus spp. (5 species) were collected and prepared according to Etest Technique Manuel. Etest MICs were determined with RPMI agar containing 2% glucose and were read after incubation for 48 hours at 35℃. MIC50, MIC90 and MIC range were acquired by Whonet 5.4 software.Results The MIC90 of caspofungin against A. fumigatus, A. flavus and A. nidulans was 0.094 μg/ml whereas the MIC90 against A. niger was 0.19 μg/ml. For these four species, the MlC90 of caspofungin was the lowest among the five antifungal agents. For A. terrus, the MIC90 of posaconazole was the lowest. For A. fumigatus and A. flavus, the MlC90in order of increasing was caspofungin, posaconazole, voriconazole, itraconazole, and amphotericin B. The MIC of amphotericin B against A. terrus was higher than 32 μg/ml in all 7 strains tested.Conclusions The in vitro antifungal susceptibility test shows the new drug caspofungin, which is a kind of echinocandins, has good activity against the five species of Aspergillus spp. and all the triazoles tested have better in vitro activity than traditional amphotericin B.

  2. Mycoflora and ochratoxin A producing strains of Aspergillus in Algerian wheat. (United States)

    Riba, A; Mokrane, S; Mathieu, F; Lebrihi, A; Sabaou, N


    Wheat is a basic staple food for very large segments of the population of Algeria. The aim of this study is to analyse ochratoxin A (OTA)-producing mould and OTA-contaminated wheat. To evaluate the mycoflora and the potential for OTA production by Aspergillus strains, a total of 85 samples of wheat destined for human consumption were collected from two regions in Algeria (Tizi Ouzou and Setif) during the following phases: preharvest, storage in silos, and after processing. The mean value counts of fungi ranged from 275 to 1277 CFU g(-1). The dominant genus was Aspergillus, predominantly A. flavus, A. niger and A. versicolor. The other isolated species were A. ochraceus, A. alliaceus, A. carbonarius, A. terreus, A. fumigatus, A. candidus and Aspergillus spp. The occurrence and the levels of the genus Penicillium, Fusarium, Alternaria and Mucor were substantially lower than those of Aspergillus. The storage in silos shows high levels of Aspergillus (66 to 84%), especially A. flavus, but A. niger and other fungi were isolated at relatively low percentages. Equal distribution of the fungal contamination into the bran, flour and semolina fractions was observed from Flour Mill and Semolina Mill. The genus Aspergillus remained present at high levels at several phases of the production process. In addition, the ability to produce OTA by 135 isolates belonging to eleven species of Aspergillus and 23 isolates of Penicillium spp. was analyzed using fluorescent detection-based HPLC. Thus, it was found that 51 isolates (32.3%) were ochratoxigenic. All isolated strains of A. ochraceus (12) and A. alliaceus (6) produced OTA at concentrations ranging from 0.23 to 11.50 microg g(-1). Most of the A. carbonarius strains (80%) were OTA producers (0.01 to 9.35 microg g(-1)), whereas A. terreus (50%), A. niger (28%), A. fumigatus (40%), A. versicolor (18%) and Penicillium spp. (21.7%) were low level producers (0.01 to 0.07 microg g(-1)). The concentration of OTA was determined in 30

  3. Chemical composition and antifungal activity of Hyptis suaveolens (L. poit leaves essential oil against Aspergillus species

    Directory of Open Access Journals (Sweden)

    Ana Carolina Pessoa Moreira


    Full Text Available This study aimed to identify the constituents of the essential oil from Hyptis suaveolens (L. leaves using a Gas Chromatograph -Mass Spectrometer and assess its inhibitory effect on some potentially pathogenic Aspergilli (A. flavus, A. parasiticus, A. ochraceus, A. fumigatus and A. niger. Eucaliptol (47.64 % was the most abundant component in the oil, followed for gama-ellemene (8.15 %, beta-pynene (6.55 %, (+3-carene (5.16 %, trans-beta-cariophyllene (4.69 % and germacrene (4.86 %. The essential oil revealed an interesting anti-Aspergillus property characterized by a Minimum Inhibitory Concentration and Minimum Fungicidal Concentration of 40 and 80 µL/mL, respectively. The oil at 80 and 40 µL/mL strongly inhibited the mycelial growth of A. fumigatus and A. parasiticus along 14 days. In addition, at 10 and 20 µL/mL the oil was able to cause morphological changes in A. flavus as decreased conidiation, leakage of cytoplasm, loss of pigmentation and disrupted cell structure suggesting fungal wall degeneration. These findings showed the interesting anti-Aspergillus property of H. suaveolens leaves essential oil supporting its possible rational use as alternative source of new antifungal compounds to be applied in the aspergillosis treatment.

  4. A novel inhibition ELISA for the detection and monitoring of Penicillium marneffei antigen in human serum. (United States)

    Prakit, K; Nosanchuk, J D; Pruksaphon, K; Vanittanakom, N; Youngchim, S


    The thermally dimorphic fungus Penicillium marneffei is a causative agent of penicilliosis marneffei, a disease considered to be an acquired immune deficiency syndrome (AIDS)-defining illness in Southeast Asia and southern China. We have developed an inhibition enzyme-linked immunosorbent assay (inh-ELISA) incorporating the yeast phase specific mannoprotein-binding monoclonal antibody 4D1 for the detection of P. marneffei infection. In our sample set, the test detected antigenemia in all 45 (100 %) patients with P. marneffei, with a mean antigen concentration of 4.32 μg/ml. No cross-reactivity in this assay was found using serum from 44 additional patients with other fungal infections, such as Aspergillus fumigatus, Cryptococcus neoformans, and Candida albicans, as well as 44 patients with bacterial infections, such as Mycobacterium tuberculosis and Streptococcus suis. Additionally, no reactivity occurred using serum from 31 human immunodeficiency virus (HIV)-infected patients without a history of fungal infections and 113 healthy controls residing in endemic areas. To investigate the potential of the inh-ELISA for disease monitoring, we followed the reduction in antigenemia in six patients who clinically responded to itraconazole and P. marneffei was no longer isolated from their blood or tissues. In contrast, we correlated increased concentrations of antigenemia in patients with relapsed P. marneffei infection with the progression of their clinical symptoms and the isolation of P. marneffei from their clinical specimens. In summary, the P. marneffei inh-ELISA is a promising new assay for the rapid diagnosis of P. marneffei, as well as a tool for evaluating clinical response and clearance of the fungus during treatment. PMID:26838686

  5. (+)-Geodin from Aspergillus terreus

    DEFF Research Database (Denmark)

    Rønnest, Mads Holger; Nielsen, Morten Thrane; Leber, Blanka; Mortensen, Uffe Hasbro; Krämer, Alwin; Clausen, Mads Hartvig; Larsen, Thomas Ostenfeld; Harris, Pernille

    The fungal metabolite (+)-geodin [systematic name: (2R)-methyl 5,7-dichloro-4-hydroxy-6'-methoxy-6-methyl-3,4'-dioxospiro[benzofuran-2,1'-cyclohexa-2',5'-diene]-2'-carboxylate], C(17)H(12)Cl(2)O(7), was isolated from Aspergillus terreus. The crystal structure contains two independent molecules in...

  6. Environmental and clinical epidemiology of Aspergillus terreus: data from a prospective surveillance study. (United States)

    Rüping, M J G T; Gerlach, S; Fischer, G; Lass-Flörl, C; Hellmich, M; Vehreschild, J J; Cornely, O A


    Aspergillus terreus may be resistant to amphotericin B and is associated with significant morbidity and mortality in immunocompromised patients. Local incidence is influenced by the density of airborne Aspergillus spp. spores which may in turn depend on meteorological factors. Once-weekly environmental samples were collected prospectively inside and outside the University Hospital of Cologne, Germany (UHC) and haematological patients were screened for nasal Aspergillus spp. colonisation and monitored for invasive fungal disease (IFD). RAPD (rapid amplification of polymorphic DNA)-polymerase chain reaction (PCR) and amphotericin B susceptibility testing were performed on all A. terreus isolates. A total of 4919 colony-forming units (cfu) were isolated (2212 indoors, 2707 outdoors). Further identification revealed A. fumigatus (73.5%), A. niger (4.3%), A. flavus (1.7%), A. terreus (0.2%) and non-Aspergillus fungi (20.3%). RAPD-PCR did not reveal clonal relationships between the A. terreus isolates. All A. terreus isolates displayed complete resistance to amphotericin. The B. Aspergillus spp. conidia exposure was lowest in June and highest in November inside and outside UHC. Conidia load correlated with the season and the relative humidity, with increasing spore counts during dry periods. One out of 855 nasal swabs was positive for A. niger. The patient did not develop IFD. A. terreus is unlikely to be a relevant pathogen at the UHC. Results from RAPD-PCR suggested a wide epidemiological variety of strains rather than a common source of contamination. Nasal swab surveillance cultures for early detection of Aspergillus spp. colonisation were not useful in identifying patients who may develop IFD. The risk of IFD at the UHC may increase in autumn and during dry periods. PMID:21440331

  7. Actividad in vitro anti-candida y anti-aspergillus de aceites esenciales de plantas de la familia piperaceae


    Ana Cecilia Mesa; Jehidys Montiel; Catalina Martínez; Bibiana Zapata; Nayive Pino; Juan Gabriel Bueno; Elena Stashenko


    Plantas de la familia Piperaceae se han utilizado con fines curativos en diferentes regiones del mundo. El objetivo del presente fue evaluar la actividad antifúngica in vitro de 10 aceites esenciales provenientes de especies del genero Piper, mediante la determinación de la concentración mínima inhibitoria (CMI), con las cepas Aspergillus flavus ATCC 204304 y A. fumigatus ATCC 20430, siguiendo el protocolo CLSI M38-A. Además, se evaluaron las cepas Candida krusei ATCC 6258 y...

  8. New taxa in Aspergillus section Usti

    DEFF Research Database (Denmark)

    Samson, R. A.; Varga, J.; Meijer, M.;


    Based on phylogenetic analysis of sequence data, Aspergillus section Usti includes 21 species, inducing two teleomorphic species Aspergillus heterothallicus (=Emericella heterothallica) and Fennellia monodii. Aspergillus germanicus sp. nov. was isolated from indoor air in Germany. This species ha...

  9. Antifungal susceptibility testing of Aspergillus species complex in the Clinical Laboratory: how to do it, when to do it, and how to interpret it

    Directory of Open Access Journals (Sweden)

    Esther Manso


    Full Text Available The emergence of drug resistance in fungal pathogens has a profound impact on human health given limited number of antifungal drugs. Antifungal resistance in Aspergillus spp. infection can be encountered in the antifungal drug-exposed patient due to selection of intrinsically resistant species or isolates with acquired resistance belonging to species that are normally susceptible. Resistance to triazoles is not common in Aspergillus spp., however, triazole resistance in A. fumigatus appears to be increasing in several European countries in recent years and can be clinically relevant. The Clinical and Laboratory Standards Institute and European Committee on Antimicrobial Susceptibility Testing have developed breakpoints and epidemiological cutoff values that are now established for Aspergillus spp. Clinical microbiology laboratories will be employed commercial susceptibility assays, rather than reference broth microdilution methods and comparative studies are particularly important.

  10. Studies on Aspergillus flavus

    International Nuclear Information System (INIS)

    In vitro studies were conducted on conidia of Aspergillus flavus Link (aflatoxin producing) and Aspergillus flavus oryzae (non-toxigenic) strains isolated and identified in this laboratory. These strains differed in resistance to heat and gamma radiation, the toxigenic strain being more resistant to both treatments. Results of tests on dose-modifying factors indicated that composition, temperature and pH of suspending media affected radiation resistance. On the other hand, the size of the initial population and the age of the conidia did not influence the radiation resistance of either strain. Studies on thermal inactivation of the conidia suggested that the temperature employed was more important than the time of heat treatment. Conidia of both strains showed a synergistic effect of combined heat and radiation treatments, although a heat-radiation sequence was more effective than a radiation-heat sequence. (author)

  11. Three extracellular dipeptidyl peptidases found in Aspergillus oryzae show varying substrate specificities. (United States)

    Maeda, Hiroshi; Sakai, Daisuke; Kobayashi, Takuji; Morita, Hiroto; Okamoto, Ayako; Takeuchi, Michio; Kusumoto, Ken-Ichi; Amano, Hitoshi; Ishida, Hiroki; Yamagata, Youhei


    Three extracellular dipeptidyl peptidase genes, dppB, dppE, and dppF, were unveiled by sequence analysis of the Aspergillus oryzae genome. We investigated their differential enzymatic profiles, in order to gain an understanding of the diversity of these genes. The three dipeptidyl peptidases were expressed using Aspergillus nidulans as the host. Each recombinant enzyme was purified and subsequently characterized. The enzymes displayed similar optimum pH values, but optimum temperatures, pH stabilities, and substrate specificities varied. DppB was identified as a Xaa-Prolyl dipeptidyl peptidase, while DppE scissile substrates were similar to the substrates for Aspergillus fumigatus DPPV (AfDPPV). DppF was found to be a novel enzyme that could digest both substrates for A. fumigatus DPPIV and AfDPPV. Semi-quantitative PCR revealed that the transcription of dppB in A. oryzae was induced by protein substrates and repressed by the addition of an inorganic nitrogen source, despite the presence of protein substrates. The transcription of dppE depended on its growth time, while the transcription of dppF was not affected by the type of the nitrogen source in the medium, and it started during the early stage of the fungal growth. Based on these results, we conclude that these enzymes may represent the nutrition acquisition enzymes. Additionally, DppF may be one of the sensor peptidases responsible for the detection of the protein substrates in A. oryzae environment. DppB may be involved in nitrogen assimilation control, since the transcription of dppB was repressed by NaNO3, despite the presence of protein substrates. PMID:26846741

  12. Pituitary aspergillus infection. (United States)

    Moore, Lauren A; Erstine, Emily M; Prayson, Richard A


    Fungal infection should be considered in the differential diagnosis of a pituitary or sellar mass, albeit fungal infections involving the pituitary gland and sella are a rare occurrence. We report a case of Aspergillus infection involving the pituitary gland and sellar region discovered in a 74-year-old man. The patient had a history of hypertension, chronic renal disease, autoimmune hemolytic anemia and presented with right eye pain, headaches and worsening hemiparesis. Imaging studies revealed a right internal carotid artery occlusion and an acute right pontine stroke along with smaller infarcts in the right middle cerebral artery distribution. Clinically, the patient was thought to have vasculitis. An infectious etiology was not identified. He developed respiratory distress and died. At autopsy, necrotizing meningitis was discovered. A predominantly chronic inflammatory cell infiltrate consisting of benign-appearing lymphocytes, plasma cells and macrophages was accompanied by acute angle branching, angioinvasive hyphae which were highlighted on Gomori methenamine silver staining and were morphologically consistent with Aspergillus species. In previously reported cases of Aspergillus infection involving the pituitary or sella, most presented with headaches or impaired vision and were not immunocompromised. A transsphenoidal surgical approach is recommended in suspected cases in order to minimize the risk of dissemination of the infection. Some patients have responded well to antifungal medications once diagnosed. PMID:26896907

  13. Enumeration and identification of Aspergillus group and Penicillium species in poultry feeds from Argentina. (United States)

    Magnoli, C; Dalcero, A M; Chiacchiera, S M; Miazzo, R; Saenz, M A


    A total of 180 samples of poultry feeds were collected during 1996 and 1997 from different factories in the south of the province of Córdoba-Argentina. They were examined for the occurrence of Penicillium spp. and Aspergillus group species. Likewise, the capacity to produce aflatoxins by the Aspergillus section flavi group was determined. The predominant species of Aspergillus were A. flavus and A. parasiticus. For Penicillium spp., P. brevicompactum, P. purpurogenum and P. oxalicum were identified. Less frequently isolated were A. candidus, A. fumigatus, A. niger, A. orizae, A. parvulus, A. tamarii, A. terreus, and P. expansum, P. funiculosum, P. minioluteum, P. pinophylum, P. restrictum, P. variable and others. The mean value counts ranged from 1 x 10(3) to 9.5 x 10(4) CFU/g for the Aspergillus spp. and from 1.2 x 10(3) to 2.5 x 10(5) CFU/g for the Penicillium spp. When cultured on autoclaved rice kernels for 1 week in the dark at 25 degrees C, mycotoxin production by strains of A. flavus was as follows: 21 of the 45 assayed strains (47%) produced aflatoxins. From them, 24% of the isolates produced AFB1 and AFB2 with levels from 181 to 14545 and 6 to 3640 micrograms/kg respectively. Only 10 strains produced AFB1 with levels from 10 to 920 micrograms/kg. Fifty percent of the A. parasiticus strain was toxicogenic; six aflatoxicogenic profiles were identified. Only 10% of the strains produced all of the aflatoxins. These results showed that a potential exists for the production of mycotoxins by the Aspergillus section flavi and the Penicillium spp. They also suggested an association of mycotoxicosis with poultry feeds in Argentina. PMID:9850595

  14. New resources for functional analysis of omics data for the genus Aspergillus

    Directory of Open Access Journals (Sweden)

    Meyer Vera


    Full Text Available Abstract Background Detailed and comprehensive genome annotation can be considered a prerequisite for effective analysis and interpretation of omics data. As such, Gene Ontology (GO annotation has become a well accepted framework for functional annotation. The genus Aspergillus comprises fungal species that are important model organisms, plant and human pathogens as well as industrial workhorses. However, GO annotation based on both computational predictions and extended manual curation has so far only been available for one of its species, namely A. nidulans. Results Based on protein homology, we mapped 97% of the 3,498 GO annotated A. nidulans genes to at least one of seven other Aspergillus species: A. niger, A. fumigatus, A. flavus, A. clavatus, A. terreus, A. oryzae and Neosartorya fischeri. GO annotation files compatible with diverse publicly available tools have been generated and deposited online. To further improve their accessibility, we developed a web application for GO enrichment analysis named FetGOat and integrated GO annotations for all Aspergillus species with public genome sequences. Both the annotation files and the web application FetGOat are accessible via the Broad Institute's website ( To demonstrate the value of those new resources for functional analysis of omics data for the genus Aspergillus, we performed two case studies analyzing microarray data recently published for A. nidulans, A. niger and A. oryzae. Conclusions We mapped A. nidulans GO annotation to seven other Aspergilli. By depositing the newly mapped GO annotation online as well as integrating it into the web tool FetGOat, we provide new, valuable and easily accessible resources for omics data analysis and interpretation for the genus Aspergillus. Furthermore, we have given a general example of how a well annotated genome can help improving GO annotation of related species to subsequently facilitate the

  15. Fever and Peripheral Emboli in an Immunocompetent Host. A Case of Aspergillus Endocarditis

    Directory of Open Access Journals (Sweden)

    Derek Yung


    Full Text Available Despite diagnostic and therapeutic advances in medical, surgical, and critical care, the mortality rate for Aspergillus endocarditis remains dismal (approaching 100%. We report a case of a 49 year old immunocompetent woman with recent aortic valve prosthesis who presents with fever, chills, sweats, left facial droop, left arm weakness, petechial rash and cyanotic toes. Initial trans-esophageal echo was normal but a repeat study revealed a 9 × 5 mm vegetation abutting the aortic pros- thesis. Microbiological correlation could not be documented despite the presence of persistent fever through serial blood cultures, and the diagnosis of Aspergillus fumigatus endocarditis was ultimately made on embolectomy specimen when she developed an ischemic right leg. Aggressive medical treatment was initiated with intravenous voraconazole, liposomal amphotericin-B and heparin. The timing of surgical intervention was contemplated, but was precluded by multiple comorbidities. She succumbed to her illness after developing cerebral herniation following intraparenchymal hemorrhage.The effectiveness of combined medical intervention and surgical valve replacement for Aspergillus endocarditis is therefore contingent on high diagnostic suspicion and early echocardiographic detection in a high risk individual with features of culture-negative endocarditis.

  16. Aspergillus Tracheobronchitis Causing Subtotal Tracheal Stenosis in a Liver Transplant Recipient

    Directory of Open Access Journals (Sweden)

    Sonia Radunz


    Full Text Available Invasive aspergillosis is recognized as one of the most significant opportunistic infections after liver transplantation. Diagnosis of invasive aspergillosis in transplant recipients has been proven to be challenging, and optimal approach to the treatment of invasive aspergillosis is still controversial. We here present an unusual case of Aspergillus tracheobronchitis in the setting of liver transplantation. A 47-year-old female patient with persistent dry cough after liver transplantation developed respiratory insufficiency and was readmitted to the intensive care unit 55 days after liver transplantation. A CT scan revealed subtotal tracheal stenosis; bronchoscopy was performed, and extended white mucus coverings causative of the tracheal stenosis were removed. Microbiological assessment isolated Aspergillus fumigatus. The diagnosis was obstructive Aspergillus tracheobronchitis. The patient was started on a treatment of voriconazole 200 mg orally twice daily, adjusted to a trough level of 1–4 mg/L. For further airway management, a tracheal stent had to be implanted. The patient is alive and well 28 months after liver transplantation. Invasive aspergillosis should be considered a possible etiology in liver transplant patients presenting with unspecific symptoms such as persistent dry cough. Optimal strategies for improved and early diagnosis as well as prophylaxis need to be defined.

  17. Aspergillus saccharolyticus sp. nov., a new black Aspergillus species isolated in Denmark

    DEFF Research Database (Denmark)

    Sørensen, Annette; Lübeck, Peter S.; Lübeck, Mette; Nielsen, Kristian Fog; Ahring, Birgitte K.; Teller, Philip J.; Frisvad, Jens Christian


    A novel species, Aspergillus saccharolyticus sp. nov., belonging to the Aspergillus section Nigri group is described. This species was isolated in Denmark from treated hardwood. Its taxonomic status was determined using a polyphasic taxonomic approach including phenotypic (morphology and extrolite...... Aspergillus species that is morphologically similar to Aspergillus japonicus and Aspergillus aculeatus, but has a totally different extrolite profile compared to any known Aspergillus species. The type strain of A. saccharolyticus sp. nov. is CBS 127449T ( = IBT 28509T)....

  18. Aspergillus-Related Lung Disease

    Directory of Open Access Journals (Sweden)

    Alia Al-Alawi


    Full Text Available Aspergillus is a ubiquitous dimorphic fungus that causes a variety of human diseases ranging in severity from trivial to life-threatening, depending on the host response. An intact host defence is important to prevent disease, but individuals with pre-existing structural lung disease, atopy, occupational exposure or impaired immunity are susceptible. Three distinctive patterns of aspergillus-related lung disease are recognized: saprophytic infestation of airways, cavities and necrotic tissue; allergic disease including extrinsic allergic alveolitis, asthma, allergic bronchopulmonary aspergillosis, bronchocentric granulomatosis and chronic eosinophilic pneumonia; and airway and tissue invasive disease -- pseudomembranous tracheobronchitis, acute bronchopneumonia, angioinvasive aspergillosis, chronic necrotizing aspergillosis and invasive pleural disease. A broad knowledge of these clinical presentations and a high index of suspicion are required to ensure timely diagnosis and treatment of the potentially lethal manifestations of aspergillus-related pulmonary disease. In the present report, the clinical, radiographic and pathological aspects of the various aspergillus-related lung diseases are briefly reviewed.

  19. New species in .i.Aspergillus./i. section .i.Fumigati./i. from reclamation sites in Wyoming (USA) and revision of .i.A. viridinutans./i. complex

    Czech Academy of Sciences Publication Activity Database

    Nováková, Alena; Hubka, Vít; Dudová, Zuzana; Matsuzawa, T.; Kubátová, A.; Yaguchi, T.; Kolařík, Miroslav


    Roč. 64, č. 1 (2014), s. 253-274. ISSN 1560-2745 R&D Projects: GA MŠk ME08085; GA MŠk(CZ) EE2.3.20.0055; GA MŠk(CZ) EE2.3.30.0003 Grant ostatní: GA MŠk(CZ) GAUK 607812 Institutional support: RVO:60077344 ; RVO:61388971 Keywords : Aspergillus fumigatus * heterothallic species * MAT locus * Neosartorya udagawae * PCR fingerprinting * soil fungi Subject RIV: EF - Botanics Impact factor: 6.221, year: 2014

  20. The use of a-methyl-D-glucoside, a synthetic analogue of maltose, as inducer of amylase by Aspergillus sp in solid-state and submerged fermentations


    Moreira Fabiana G.; Lenartovicz Veridiana; Souza Cristina G. M.; Ramos Edivan P.; Peralta Rosane M.


    The use of a methyl-D-glucoside (alphaMG), a synthetic analogue of maltose, as carbon source and inducer of amylase synthesis to several species of Aspergillus was studied in submerged and solid-state fermentations. Among a group of ten species, A. tamarii, A. fumigatus and A. flavus were able to produce biomass and high specific amylolytic activity in submerged cultures containing alphaMG as the only carbon source. In solid state fermentation, the enrichment of basal wheat bran or corn cob m...

  1. 血清半乳甘露聚糖试验在血液病合并侵袭性曲霉菌感染诊疗中的意义%Clinical value of galactomannan antigen assay in diagnosis and treatment of invasive aspergillus infection combined with hematologic diseases

    Institute of Scientific and Technical Information of China (English)

    王珏; 杨艺; 王瑾; 李春蕊; 黄丽芳; 孙汉英; 刘文励; 周剑峰; 孟凡凯


    目的 探讨酶联免疫法测定血清半乳甘露聚糖抗原(GM)在血液病合并侵袭性曲霉菌感染中的应用价值.方法 收集武汉同济医院血液科222例住院患者的355份血清GM试验结果及相关临床资料,并进行回顾性分析.结果 以I>0.5为阳性界值GM试验的敏感性为(75.00±15.30)%,特异性为(95.6±1.53)%;222例患者中,确诊侵袭性真菌感染(IFI)4例,拟诊20例,排除诊断181例,结合GM试验结果使临床诊断组由4例提高至17例;以GM试验阳性结合胸部影像学渗出表现为起点的抢先性抗真菌治疗的有效率为81.25%;抢先治疗后早期即出现血清GM值的明显下降.结论 GM试验在IFI分层诊断中可帮助提高诊断级别;结合影像学资料,以较低的GM试验界值(1>0.5)作为治疗起点可获得较高的抢先治疗有效率;观察血清GM值的动态变化对侵袭性曲霉菌病的疗效评价与监测复发有重要意义.%OBJECTIVE To investigate the value of enzyme linked immunosorbent assay for determination of galactomannan (GM) antigen in diagnosis and treatment of hematologic disease patients with invasive Aspergillus infection. METHODS The clinical data and the result of GM test for 355 blood samples of 222 patients from hematology department of Wuhan Tongji Hospital were retrospectively analyzed. RESULTS The sensitivity was (75. 00 ± 15. 30)% as the positive threshold value was Ⅰ>0. 5, the specificity was(95. 6 ± 1. 53)%; of totally 222 patients, 4 cases had been proven invasive fungal infections, 20 cases were diagnosed, and 181 cases were diagnosed without any invasive fungal infections; the probable cases increased from 4 to 17 cases when GM assay results were taken into consideration. Preemptive antifungal therapy at start point of one positive result of GM-EIA or radiology imaging achieved an effective rate of 81. 25%. The GM antigen level declined significantly in early stage when the preemptive amtifungal therapy was

  2. Tet-on, or Tet-off, that is the question: Advanced conditional gene expression in Aspergillus. (United States)

    Wanka, Franziska; Cairns, Timothy; Boecker, Simon; Berens, Christian; Happel, Anna; Zheng, Xiaomei; Sun, Jibin; Krappmann, Sven; Meyer, Vera


    In Aspergillus, controlled gene expression is often achieved using the reverse tetracycline-controlled transactivator (rtTA) dependent Tet-on system, whereby transcription is activated in a titratable manner by addition of the tetracycline derivative doxycycline. The complementary Tet-off system utilises the tetracycline-controlled transactivator (tTA) component to quantitatively reduce gene expression. In this study, we utilised a synthetic biological approach to engineer highly optimised Tet-off conditional expression systems in Aspergillus niger and Aspergillus fumigatus. Steps for delivery of these tools include utilising codon optimised cassette components, testing several promoters for improved genetic stability and validating two modified luciferase reporters for highly accurate measurements of gene expression. The Tet-off cassettes developed in this study enable facile and quantitative functional analysis, as validated by Tet-off analysis of genes involved in chitin synthesis and cell wall polarity in A. niger, and para-aminobenzoic acid synthesis in A. fumigatus. We also used a racA(G18V) dominant allele to demonstrate that Tet-off in A. niger enables gene over-expression and downregulation in a single isolate. Additionally, we used the improved luciferase reporters to show that the Tet-off cassette in A. niger enables quantification of gene oscillations. In order to demonstrate that synthetic biological approaches developed here are broadly applicable to engineering transcriptional circuits in filamentous fungi, we used our strategy for improving cassette stability by promoter replacement in the A. niger Tet-on system, which resulted in a modified Tet-on cassette with higher stability in recipient genomes. PMID:26555930

  3. A controlled study to determine the efficacy of Loxostylis alata (Anacardiaceae in the treatment of aspergillus in a chicken (Gallus domesticus model in comparison to ketoconazole

    Directory of Open Access Journals (Sweden)

    Suleiman Mohammed M


    Full Text Available Abstract Background The poultry industry due to intensive methods of farming is burdened with losses from numerous infectious agents, of which one is the fungus Aspergillus fumigatus. In a preliminary study, the extracts of Loxostylis alata A. Spreng, ex Rchb. showed good activity in vitro against A. fumigatus with a minimum inhibitory concentration of 0.07 mg/ml. For this study crude, a crude acetone extract of L. alata leaves was evaluated for its acute toxicity in a healthy chicken model and for efficacy in an infectious model of aspergillosis (A. fumigatus. Results At a dose of 300 mg/kg, the extract induced some toxicity characterised by decreased feed intake and weight loss. Consequently, 100 and 200 mg/kg were used to ascertain efficacy in the infectious model. The plant extract significantly reduced clinical disease in comparison to the control in a dose dependant manner. The extract was as effective as the positive control ketoconazole dosed at 60 mg/kg. Conclusions The results indicate that a crude extract of L. alata leaves has potential as an antifungal agent to protect poultry against avian aspergillosis.

  4. Invertase production by Aspergillus and Penicillium and sequencing of an inv gene fragment

    Directory of Open Access Journals (Sweden)

    A. C. Flores-Gallegos


    Full Text Available Invertase (B-fructofuranosidase is an enzyme used in the food industry, where sugar mixtures are preferred to glucose because they are sweeter and do not crystallize easily. In this study, a biochemical characterization of five fungal strains isolated from a Mexican semi-desert (Aspergillus niger GH1, A. fumigatus GS, Penicillium purpurogenum GH2, P. citrinum ESS, P. pinophilum EH2 was carried out. Evaluation of maximal growth of the strains on potato dextrose agar at several temperatures and pH values, as well as the assessment of invertase production using polyurethane foam as a non-biodegradable support, were performed. The highest growth rates corresponded to A. niger GH1 (0.2831 mm/h, and P. citrinum ESS (0.1931 mm/h. The maximum invertase yield was 81,270 U/L per min, determined for A. niger GH1 at 72 h. Oligonucleotide primers were designed for amplification of sequences from the invertase gene, InvF 5 ACGTCTGGCTGTCCGGTGAC and InvR 5 ACCGAACCCAAGTACTCAACGCA 3, showing an optimum annealing temperature of 61.6 C. DNA fragments of about 560 bp were obtained and sequenced, corresponding to the putative invertase gene of Aspergillus.

  5. A Non-canonical Melanin Biosynthesis Pathway Protects Aspergillus terreus Conidia from Environmental Stress. (United States)

    Geib, Elena; Gressler, Markus; Viediernikova, Iuliia; Hillmann, Falk; Jacobsen, Ilse D; Nietzsche, Sandor; Hertweck, Christian; Brock, Matthias


    Melanins are ubiquitous pigments found in all kingdoms of life. Most organisms use them for protection from environmental stress, although some fungi employ melanins as virulence determinants. The human pathogenic fungus Aspergillus fumigatus and related Ascomycetes produce dihydroxynaphthalene- (DHN) melanin in their spores, the conidia, and use it to inhibit phagolysosome acidification. However, biosynthetic origin of melanin in a related fungus, Aspergillus terreus, has remained a mystery because A. terreus lacks genes for synthesis of DHN-melanin. Here we identify genes coding for an unusual NRPS-like enzyme (MelA) and a tyrosinase (TyrP) that A. terreus expressed under conidiation conditions. We demonstrate that MelA produces aspulvinone E, which is activated for polymerization by TyrP. Functional studies reveal that this new pigment, Asp-melanin, confers resistance against UV light and hampers phagocytosis by soil amoeba. Unexpectedly, Asp-melanin does not inhibit acidification of phagolysosomes, thus likely contributing specifically to survival of A. terreus conidia in acidic environments. PMID:27133313

  6. Extrolites of Aspergillus fumigatus and Other Pathogenic Species in Aspergillus Section Fumigati

    DEFF Research Database (Denmark)

    Frisvad, Jens Christian; Larsen, Thomas Ostenfeld


    . fumigatiaffinis, A. fumisynnematus, A. hiratsukae, A. laciniosus, A. lentulus, A. noyofumigatus, A. parafelis, A. pseudofelis, A. pseudoyiridinutans, A. spinosus, A. therrnornutatus, and A. udagawae. These species share the production of hydrophobins, melanins, and siderophores and ability to grow well at 37 °C...

  7. A putative mitochondrial calcium uniporter in A. fumigatus contributes to mitochondrial Ca(2+) homeostasis and stress responses. (United States)

    Song, Jinxing; Liu, Xiao; Zhai, Pengfei; Huang, Jingjing; Lu, Ling


    Ca(2+) uptake into mitochondria plays a central role in cell physiology by stimulating ATP production, shaping cytosolic Ca(2+) transients and regulating cell survival or death. Although this system has been studied extensively in mammalian cells, the physiological implications of Ca(2+) uptake into mitochondria in fungal cells are still unknown. In this study, a bi-directional best-hit BLASTP search revealed that the genome of Aspergillus fumigatus encodes a homolog of a putative mitochondrial Ca(2+) uniporter (MCU) and a mitochondrial carrier protein AGC1/MICU1 homolog. Both putative homologs are mitochondrially localized and required for the response to azole and oxidative stress such that the loss of either McuA or AgcA results in reduced susceptibility to azole and oxidative stress, suggesting a role in environmental stress adaptation. Overexpressing mcuA restores the azole-resistance phenotype of the ΔagcA strain to wild-type levels, but not vice versa, indicating McuA plays a dominant role during these stress responses. Using a mitochondrially targeted version of the calcium-sensitive photoprotein aequorin, we found that only mcuA deletion leads to dysfunctional [Ca(2+)]mt and [Ca(2+)]c homeostasis, suggesting that McuA, but not AgcA, contributes to Ca(2+) uptake into mitochondria. Further point-mutation experiments combined with extracellular Ca(2+) chelator treatment verified that two predicted Ca(2+)-binding sites in McuA are required for Ca(2+) uptake into mitochondria and stress responses through the regulation of [Ca(2+)]c homeostasis. PMID:27378202

  8. 76 FR 16297 - Aspergillus flavus (United States)


    ... exemptions for experimental use of Aspergillus flavus AF36 on pistachio (72 FR 28871, May 23, 2007) (FRL-8129... Findings In the Federal Register of March 3, 2010 (75 FR 9596) (FRL-8811-2), EPA issued a notice pursuant..., 2003 (68 FR 41541) (FRL-7311-6). Those health effects data were the basis for establishing...

  9. Aspergillus infections in cystic fibrosis. (United States)

    King, Jill; Brunel, Shan F; Warris, Adilia


    Patients with cystic fibrosis (CF) suffer from chronic lung infection and airway inflammation. Respiratory failure secondary to chronic or recurrent infection remains the commonest cause of death and accounts for over 90% of mortality. Bacteria as Staphylococcus aureus, Pseudomonas aeruginosa and Burkholderia cepacia complex have been regarded the main CF pathogens and their role in progressive lung decline has been studied extensively. Little attention has been paid to the role of Aspergillus spp. and other filamentous fungi in the pathogenesis of non-ABPA (allergic bronchopulmonary aspergillosis) respiratory disease in CF, despite their frequent recovery in respiratory samples. It has become more apparent however, that Aspergillus spp. may play an important role in chronic lung disease in CF. Research delineating the underlying mechanisms of Aspergillus persistence and infection in the CF lung and its link to lung deterioration is lacking. This review summarizes the Aspergillus disease phenotypes observed in CF, discusses the role of CFTR (cystic fibrosis transmembrane conductance regulator)-protein in innate immune responses and new treatment modalities. PMID:27177733

  10. Aspergillus mediastinitis after cardiac surgery

    Directory of Open Access Journals (Sweden)

    Marie-Josée Caballero


    Conclusion: The clinical features of postoperative Aspergillus mediastinitis may be paucisymptomatic, emphasizing the need for a low index of suspicion in cases of culture-negative mediastinitis or in indolent wound infections. In addition to surgical debridement, the central component of antifungal therapy should include amphotericin B or voriconazole.

  11. Transcriptional profiling of Aspergillus niger

    NARCIS (Netherlands)

    Veen, van der D.


    The industrially important fungus Aspergillus niger feeds naturally on decomposing plant material, of which a significant proportion is lipid. Examination of the A. niger genome sequence suggested that all proteins required for metabolic conversion of lipids are present, including 63 predicted lipas

  12. Influence of Ferrous sulphate on growth and alpha-a Amylase production for Aspergillus fumigatus NTCC1222


    Shalini Singh; Sahibjot Kaur Cheema; Bineypreet Kaur,; Navreet Kaur Mann


    Stringent government regulations and increasing public awareness is forcing chemical industries to incorporate environment friendly products and processes. Biotechnological applications, in industries, thus, hold great future. Microorganisms and their metabolites/enzymes provide a number of eminent-economic as well as environment friendly solutions for such industries. Amylases are one of the most important industrial enzymes. Commercial production of amylases requires selection of the best o...

  13. New Untargeted Metabolic Profiling Combining Mass Spectrometry and Isotopic Labeling: Application on Aspergillus fumigatus Grown on Wheat



    Characterization of fungal secondary metabolomes has become a challenge due to the industrial applications of many of these molecules, and also due to the emergence of fungal threats to public health and natural ecosystems. Given that, the aim of the present study was to develop an untargeted method to analyze fungal secondary metabolomes by combining high-accuracy mass spectrometry and double isotopic labeling of fungal metabolomes. The strain NRRL 35693 of Aspergillu...

  14. Technetium-99m labelled fluconazole and antimicrobial peptides for imaging of Candida albicans and Aspergillus fumigatus infections

    International Nuclear Information System (INIS)

    The aim of this study was to investigate whether technetium-99m labelled fluconazole can distinguish fungal from bacterial infections. Fluconazole was labelled with 99mTc and radiochemical analysis showed less than 5% impurities. The labelling solution was injected into animals with experimental infections. For comparison, we used two peptides for infection detection, i.e. UBI 29-41 and hLF 1-11, and human IgG, all labelled with 99mTc. Mice were infected with Candida albicans or injected with heat-killed C. albicans or lipopolysaccharides to induce sterile inflammation. Also, mice were infected with Staphylococcus aureus or Klebsiella pneumoniae. Next, accumulation of 99mTc-fluconazole and 99mTc-labelled peptides/IgG at affected sites was determined scintigraphically. 99mTc-fluconazole detected C. albicans infections (T/NT ratio=3.6±0.47) without visualising bacterial infections (T/NT ratio=1.3±0.04) or sterile inflammatory processes (heat-killed C. albicans: T/NT ratio=1.3±0.2; lipopolysaccharide: T/NT ratio=1.4±0.1). C. albicans infections were already seen within the first hour after injection of 99mTc-fluconazole (T/NT ratio=3.1±0.2). A good correlation (R2=0.864; P99mTc-UBI 29-41 and 99mTc-hLF 1-11 were able to distinguish C. albicans infections from sterile inflammatory processes in mice, these 99mTc-labelled peptides did not distinguish these fungal infections from bacterial infections. It is concluded that 99mTc-fluconazole distinguishes infections with C. albicans from bacterial infections and sterile inflammations. (orig.)

  15. Technetium-99m labelled fluconazole and antimicrobial peptides for imaging of Candida albicans and Aspergillus fumigatus infections

    Energy Technology Data Exchange (ETDEWEB)

    Lupetti, Antonella [Department of Infectious Diseases, Leiden University Medical Center (LUMC), Leiden (Netherlands); Dipartimento di Patologia Sperimentale, Biotecnologie Mediche, Univ. di Pisa (Italy); Welling, Mick M. [Department of Radiology, Division of Nuclear Medicine, LUMC, Leiden (Netherlands); Mazzi, Ulderico [Dipartimento di Scienze Farmaceutiche, Universita degli Studi di Padova (Italy); Nibbering, Peter H. [Department of Infectious Diseases, Leiden University Medical Center (LUMC), Leiden (Netherlands); Pauwels, Ernest K.J. [Department of Radiology, Division of Nuclear Medicine, LUMC, Leiden (Netherlands); Department of Radiology, Leiden University Medical Center (LUMC) (Netherlands)


    The aim of this study was to investigate whether technetium-99m labelled fluconazole can distinguish fungal from bacterial infections. Fluconazole was labelled with {sup 99m}Tc and radiochemical analysis showed less than 5% impurities. The labelling solution was injected into animals with experimental infections. For comparison, we used two peptides for infection detection, i.e. UBI 29-41 and hLF 1-11, and human IgG, all labelled with {sup 99m}Tc. Mice were infected with Candida albicans or injected with heat-killed C. albicans or lipopolysaccharides to induce sterile inflammation. Also, mice were infected with Staphylococcus aureus or Klebsiella pneumoniae. Next, accumulation of {sup 99m}Tc-fluconazole and {sup 99m}Tc-labelled peptides/IgG at affected sites was determined scintigraphically. {sup 99m}Tc-fluconazole detected C. albicans infections (T/NT ratio=3.6{+-}0.47) without visualising bacterial infections (T/NT ratio=1.3{+-}0.04) or sterile inflammatory processes (heat-killed C. albicans: T/NT ratio=1.3{+-}0.2; lipopolysaccharide: T/NT ratio=1.4{+-}0.1). C. albicans infections were already seen within the first hour after injection of {sup 99m}Tc-fluconazole (T/NT ratio=3.1{+-}0.2). A good correlation (R{sup 2}=0.864; P<0.05) between T/NT ratios for this tracer and the number of viable C. albicans was found. Although {sup 99m}Tc-UBI 29-41 and {sup 99m}Tc-hLF 1-11 were able to distinguish C. albicans infections from sterile inflammatory processes in mice, these {sup 99m}Tc-labelled peptides did not distinguish these fungal infections from bacterial infections. It is concluded that {sup 99m}Tc-fluconazole distinguishes infections with C. albicans from bacterial infections and sterile inflammations. (orig.)

  16. Invasive Aspergillus fumigatus infection after Plasmodium falciparum malaria in an immuno-competent host: Case report and review of literature

    Directory of Open Access Journals (Sweden)

    Stremmel Wolfgang


    Full Text Available Abstract Invasive fungal infection is rarely reported in association with malaria, even though malaria-associated inhibition of phagocyte function is a well-known condition. Invasive aspergillosis is frequently found in severely immuno-compromised patients but not in healthy individuals. Here, a case of pulmonary invasive aspergillosis in a previously healthy patient with severe P. falciparum malaria is presented, who was successfully treated with voriconazol and caspofungin. This is the first survival of malaria-associated invasive aspergillosis.

  17. High-yield production of hydrophobins RodA and RodB from Aspergillus fumigatus in Pichia pastoris

    DEFF Research Database (Denmark)

    Pedersen, Mona Højgaard; Borodina, Irina; Moresco, Jacob Lange;


    -PAGE. Recombinant RodA as well as rRodB were able to convert a glass surface from hydrophilic to hydrophobic similar to native RodA, but only rRodB was able to decrease the hydrophobicity of a Teflon-like surface to the same extent as native RodA, while rRodA showed this ability to a lesser extent. Recombinant Rod...

  18. Identification of thermostable beta-xylosidase activities produced by Aspergillus brasiliensis and Aspergillus niger

    DEFF Research Database (Denmark)

    Pedersen, Mads; Lauritzen, H.K.; Frisvad, Jens Christian; Meyer, Anne S.


    Twenty Aspergillus strains were evaluated for production of extracellular cellulolytic and xylanolytic activities. Aspergillus brasiliensis, A. niger and A. japonicus produced the highest xylanase activities with the A. brasiliensis and A. niger strains producing thermostable beta-xylosidases. The...

  19. Identification of thermostable β-xylosidase activities produced by Aspergillus brasiliensis and Aspergillus niger

    DEFF Research Database (Denmark)

    Pedersen, Mads; Lauritzen, Henrik Klitgaard; Frisvad, Jens Christian; Meyer, Anne Boye Strunge


    Twenty Aspergillus strains were evaluated for production of extracellular cellulolytic and xylanolytic activities. Aspergillus brasiliensis, A. niger and A. japonicus produced the highest xylanase activities with the A. brasiliensis and A. niger strains producing thermostable beta-xylosidases. The...

  20. Identificação e características culturais de espécies do gênero Aspergillus isoladas de sementes de feijão no Estado da Paraíba Identification and cultural characteristics of Aspergillus species isolated in common bean seeds from Paraíba State, Brazil

    Directory of Open Access Journals (Sweden)

    Vanilde Benicio


    Full Text Available A partir de sementes de feijão (Phaseulus vulgaris armazenadas no estado da Paraíba, foram isolados os fungos Aspergillus flavus, A. fumigatus, A. lucknowensis, A.niger, A.ochraceus e A. parasiticus. Os fungos foram identificados com base nas características culturais exibidas em meio de Czapek-Agar e morfológicas através de microscópio ótico composto. No oitavo dia de crescimento em meio de BDA, cada espécie apresentou diferenças quanto à curva de crescimento, taxa de crescimento durante o período de incubação e diâmetro das colônias no oitavo dia de acordo com a procedência das amostras de sementes.The fungi Aspergillus flavus, A. fumigatus, A. lucknowensis, A.niger, A.ochraceus and A. parasiticus were isolated from common bean (Phaseolus vulgaris seeds produced and stored by growers in the State of Paraíba, Brazil. These fungi were identified according to cultural characteristics on Czapek-agar medium and the structures viewed under compound microscope. The development of each fungal species on Potato-Dextrose-Agar (PDA medium presented differences for colony diameter, curve and rate of growth according to the seed samples from which were obtained.

  1. Ochratoxin A-Produktion durch Aspergillus ochraceus


    Mühlencoert, Ellen


    Ochratoxin A, one of the 5 most important mycotoxins in food safety, is produced by several Aspergillus and Penicillium strains growing on grain, grapes and coffee. OTA biosynthesis in Aspergillus spp. depends more on the complex interaction of diverse environmental conditions than on a single growth factor or even the genetic ability to produce OTA. No apparent connection between biomass and OTA production was observed. OTA production by Aspergillus ochraceus could be controlled by the pH of...

  2. Regulatory processes in Aspergillus niger

    DEFF Research Database (Denmark)

    Poulsen, Lars

    Filamentous fungi are extensively used in the fermentation industry for synthesis of numerous products. One of the most important, is the fungus Aspergillus niger, used industrially for production of organic acids, and homologous as well as heterologous enzymes. This fungus has numerous of advant...... fumonisin production, identified. These formed the basis for the subsequent examinations, which resulted in the identification of azelaic acid, a plant hormone and a very potent fumonisin inducer....

  3. Germination of Aspergillus niger conidia


    Hayer, Kimran


    Aspergillus niger is a black-spored filamentous fungus that forms asexual spores called conidospores (‘conidia’). Germination of conidia, leading to the formation of hyphae, is initiated by conidial swelling and mobilisation of endogenous carbon and energy stores, followed by polarisation and emergence of a hyphal germ tube. These morphological and biochemical changes which define the model of germination have been studied with the aim of understanding how conidia sense and utilise different...

  4. Transcriptional profiling of Aspergillus niger


    Veen, van der, J.T.


    The industrially important fungus Aspergillus niger feeds naturally on decomposing plant material, of which a significant proportion is lipid. Examination of the A. niger genome sequence suggested that all proteins required for metabolic conversion of lipids are present, including 63 predicted lipases. In contrast to polysaccharide-degrading enzyme networks, not much is known about the signaling and regulatory processes that control lipase expression and activity in fungi. This project was ai...

  5. Asexual Sporulation in Aspergillus nidulans


    Adams, Thomas H; Wieser, Jenny K.; Yu, Jae-Hyuk


    The formation of mitotically derived spores, called conidia, is a common reproductive mode in filamentous fungi, particularly among the large fungal class Ascomycetes. Asexual sporulation strategies are nearly as varied as fungal species; however, the formation of conidiophores, specialized multicellular reproductive structures, by the filamentous fungus Aspergillus nidulans has emerged as the leading model for understanding the mechanisms that control fungal sporulation. Initiation of A. nid...

  6. Aspergillus DNA contamination in blood collection tubes


    Harrison, Elizabeth; Stahlberger, Thomas; Whelan, Ruth; Sugrue, Michele; Wingard, John R.; Alexander, Barbara D.; Follett, Sarah A; Bowyer, Paul; Denning, David W


    Fungal PCR-based diagnostic methods are at risk of contamination. Sample collection containers were investigated for fungal DNA contamination using real-time PCR assays. Up to 18% of blood collection tubes were contaminated with fungal DNA, probably A. fumigatus. Lower proportions of contamination in other vessels were observed.

  7. Liver injury in invasive aspergillus. Echographic findings

    International Nuclear Information System (INIS)

    Aspergillus is the second most common mycoses in immuno compromised patients. The invasive form is associated with a mortality of approximately 100%. We present a case of invasive aspergillus in a heart transplant recipient in whom ultrasound disclosed the presence of liver injury which was later confirmed by necropsy. We review the available literature. (Author) 15 refs

  8. Carcinoma-associated antigens

    International Nuclear Information System (INIS)

    This invention relates to novel antigens associated with breast carcinoma, anti-sera specific to said antigens, 125I-labeled forms of said antigens and methods of detecting said antigens in serum or plasma. The invention also relates to a diagnostic kit containing standardised antigens or antisera or marked forms thereof for the detection of said antigens in human blood, serum or plasma. (author)

  9. In-silico analysis of Aspergillus niger beta-glucosidases (United States)

    Yeo S., L.; Shazilah, K.; Suhaila, S.; Abu Bakar F., D.; Murad A. M., A.


    Genomic data mining was carried out and revealed a total of seventeen β-glucosidases in filamentous fungi Aspergillus niger. Two of them belonged to glycoside hydrolase family 1 (GH1) while the rest belonged to genes in family 3 (GH3). These proteins were then named according to the nomenclature as proposed by the International Union of Biochemistry (IUB), starting from the lowest pI and glycoside hydrolase family. Their properties were predicted using various bionformatic tools showing the presence of domains for signal peptide and active sites. Interestingly, one particular domain, PA14 (protective antigen) was present in four of the enzymes, predicted to be involved in carbohydrate binding. A phylogenetic tree grouped the two glycoside hydrolase families with GH1 and GH3 related organisms. This study showed that the various domains present in these β-glucosidases are postulated to be crucial for the survival of this fungus, as supported by other analysis.

  10. Two novel species of Aspergillus section Nigri from indoor air (United States)

    Aspergillus collinsii, Aspergillus floridensis, and Aspergillus trinidadensis are described as novel uniseriate species of Aspergillus section Nigri isolated from air samples. To describe the species we used phenotypes from 7-d Czapek yeast extract agar culture (CYA) and malt extract agar culture (M...

  11. Aspergillus Osteomyelitis of the Skull. (United States)

    Nicholson, Simon; King, Richard; Chumas, Paul; Russell, John; Liddington, Mark


    Osteomyelitis of the craniofacial skeleton is rare, with fungal pathogens least commonly implicated. The authors present 2 patients of osteomyelitis of the skull caused by Aspergillus spp. and discuss the diagnosis, clinicopathological course, and management strategies.Late recurrence seen in this type of infection warrants long-term follow-up and a high index of suspicion for the clinical signs associated with recurrence.Such patients would benefit from their surgical debridement being planned and managed via a specialist craniofacial unit, so as to utilize the most aesthetically sensitive approach and the experience of specialists from several surgical disciplines. PMID:27391523

  12. Ribonuclease Production by Aspergillus species


    Eleni Gomes; Roberto da Silva; Alcides Serzedello


    Ribonuclease production by Aspergillus flavipes, A. sulphureus and A. fischeri in semi-synthetic medium, after 24-144 hours at 30ºC under shaking, was studied. After cultivation, the medium was separated from micelia by filtration and the resultant solution was used as enzymatic extract. The highest amount of biomass and RNase was obtained after 96 hours of cultivation. The enzymes produced by three species presented similar characteristics, with optimum temperature at 55ºC and two peaks of a...

  13. In vitro susceptibility testing of Candida and Aspergillus spp. to voriconazole and other antifungal agents using Etest: results of a French multicentre study. (United States)

    Mallié, M; Bastide, J M; Blancard, A; Bonnin, A; Bretagne, S; Cambon, M; Chandenier, J; Chauveau, V; Couprie, B; Datry, A; Feuilhade, M; Grillot, R; Guiguen, C; Lavarde, V; Letscher, V; Linas, M D; Michel, A; Morin, O; Paugam, A; Piens, M A; Raberin, H; Tissot, E; Toubas, D; Wade, A


    Minimum inhibitory concentrations (MICs) of the antifungal agent voriconazole were determined using the Etest and compared with those of amphotericin B, itraconazole and fluconazole using 1986 clinical isolates of Candida spp. Voriconazole MICs were also compared with those of amphotericin B and itraconazole using 391 clinical isolates of Aspergillus spp. Voriconazole was found to have more potent activity and lower MIC values than amphotericin B, itraconazole and fluconazole against C. albicans, C. tropicalis, C. parapsilosis and C. kefyr. Against C. glabrata and C. krusei, voriconazole was more active than either of the other two azole antifungals but had similar activity to amphotericin B. For species of Aspergillus, MIC values of voriconazole were lower than those of amphotericin B and itraconazole against A. fumigatus and A. flavus, and were similar to those of amphotericin B against A. niger. Against A. terreus, MIC values for voriconazole and itraconazole were similar. A. terreus is known to be resistant to amphotericin B, and this was reflected in higher MIC values compared with those of voriconazole and itraconazole. Voriconazole therefore compares very favourably with other antifungal agents against a large number of clinical isolates of Candida and Aspergillus spp. PMID:15784312

  14. FRET-Based Quantum Dot Immunoassay for Rapid and Sensitive Detection of Aspergillus amstelodami

    Directory of Open Access Journals (Sweden)

    Michele D. Kattke


    Full Text Available In this study, a fluorescence resonance energy transfer (FRET-based quantum dot (QD immunoassay for detection and identification of Aspergillus amstelodami was developed. Biosensors were formed by conjugating QDs to IgG antibodies and incubating with quencher-labeled analytes; QD energy was transferred to the quencher species through FRET, resulting in diminished fluorescence from the QD donor. During a detection event, quencher-labeled analytes are displaced by higher affinity target analytes, creating a detectable fluorescence signal increase from the QD donor. Conjugation and the resulting antibody:QD ratios were characterized with UV-Vis spectroscopy and QuantiT protein assay. The sensitivity of initial fluorescence experiments was compromised by inherent autofluorescence of mold spores, which produced low signal-to-noise and inconsistent readings. Therefore, excitation wavelength, QD, and quencher were adjusted to provide optimal signal-to-noise over spore background. Affinities of anti-Aspergillus antibody for different mold species were estimated with sandwich immunoassays, which identified A. fumigatus and A. amstelodami for use as quencher-labeled- and target-analytes, respectively. The optimized displacement immunoassay detected A. amstelodami concentrations as low as 103 spores/mL in five minutes or less. Additionally, baseline fluorescence was produced in the presence of 105 CFU/mL heat-killed E. coli O157:H7, demonstrating high specificity. This sensing modality may be useful for identification and detection of other biological threat agents, pending identification of suitable antibodies. Overall, these FRET-based QD-antibody biosensors represent a significant advancement in detection capabilities, offering sensitive and reliable detection of targets with applications in areas from biological terrorism defense to clinical analysis.

  15. Genetic diversity of Aspergillus species isolated from onychomycosis and Aspergillus hongkongensis sp. nov., with implications to antifungal susceptibility testing. (United States)

    Tsang, Chi-Ching; Hui, Teresa W S; Lee, Kim-Chung; Chen, Jonathan H K; Ngan, Antonio H Y; Tam, Emily W T; Chan, Jasper F W; Wu, Andrea L; Cheung, Mei; Tse, Brian P H; Wu, Alan K L; Lai, Christopher K C; Tsang, Dominic N C; Que, Tak-Lun; Lam, Ching-Wan; Yuen, Kwok-Yung; Lau, Susanna K P; Woo, Patrick C Y


    Thirteen Aspergillus isolates recovered from nails of 13 patients (fingernails, n=2; toenails, n=11) with onychomycosis were characterized. Twelve strains were identified by multilocus sequencing as Aspergillus spp. (Aspergillus sydowii [n=4], Aspergillus welwitschiae [n=3], Aspergillus terreus [n=2], Aspergillus flavus [n=1], Aspergillus tubingensis [n=1], and Aspergillus unguis [n=1]). Isolates of A. terreus, A. flavus, and A. unguis were also identifiable by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. The 13th isolate (HKU49(T)) possessed unique morphological characteristics different from other Aspergillus spp. Molecular characterization also unambiguously showed that HKU49(T) was distinct from other Aspergillus spp. We propose the novel species Aspergillus hongkongensis to describe this previously unknown fungus. Antifungal susceptibility testing showed most Aspergillus isolates had low MICs against itraconazole and voriconazole, but all Aspergillus isolates had high MICs against fluconazole. A diverse spectrum of Aspergillus species is associated with onychomycosis. Itraconazole and voriconazole are probably better drug options for Aspergillus onychomycosis. PMID:26658315

  16. Aspergillus uvarum sp. nov., an uniseriate black Aspergillus species isolated from grapes in Europe

    DEFF Research Database (Denmark)

    Perrone, Giancarlo; Varga, János; Susca, Antonia;


    A novel species, Aspergillus uvarum sp. nov., is described within Aspergillus section Nigri. This species can be distinguished from other black aspergilli based on internal transcribed spacers (ITS), beta-tubulin and calmodulin gene sequences, by AFLP analysis and by extrolite profiles. Aspergill...... atypical strains of Aspergillus aculeatus, CBS 114.80 and CBS 620.78, and was isolated from grape berries in Portugal, Italy, France, Israel, Greece and Spain. The type strain of Aspergillus uvarum sp. nov. is IMI 388523(T)=CBS 127591(T)= ITEM 4834(T)= IBT26606(T)....

  17. Partial purification and characterization of mold antigens commonly found in foods.


    Tsai, G J; Cousin, M. A.


    Rapid methods are needed for detection of molds in foods; therefore, an enzyme-linked immunosorbent assay was developed. The extracellular and mycelial antigens for Mucor, Aspergillus, Cladosporium, and Geotrichum species were partially purified and characterized. The molecular masses of the mycelial and extracellular antigens, as determined by size exclusion chromatography, ranged from 4.5 x 10(5) to 6.7 x 10(5) Da. There was only one main antigenic peak separated by Sepharose CL-4B and conc...

  18. Comparison of the activities of amphotericin B, itraconazole, and voriconazole against clinical and environmental isolates of Aspergillus species

    Directory of Open Access Journals (Sweden)

    Richa Misra


    Full Text Available Background: Invasive fungal infections are a significant cause of morbidity and mortality in immunocompromised populations. Aims: To evaluate the susceptibility pattern of our isolates against amphotericin B, itraconazole, and voriconazole and to compare the antifungal activities of these agents with each other against the Aspergillus species tested. Settings and Design: A prospective study was designed to include clinical and environmental isolates of Aspergillus species. Materials and Methods: 420 sputum samples, 70 bronchoalveolar lavage fluids, 160 oral washings, and 47 environmental samples were collected. Direct microscopy by potassium hydroxide and lactophenol cotton blue mounts followed by culture on Sabourad`s dextrose agar (SDA was done. Susceptibility testing was performed by the broth microdilution technique as per Clinical Laboratory Standards Institute standards (M-38A. Additionally, all the isolates were also tested by the colorimetric microdilution technique using Alamar Blue dye. Statistical Analysis: It was done by the Chi-square test and Z-test using SPSS statistical software version 12.0. Results and Conclusion: Twenty-seven isolates (47.3% were recovered from patients with chronic bronchial asthma followed by fibrocavitary pulmonary tuberculosis in 9 (15.7%, allergic bronchopulmonary aspergillosis (ABPA in 6 cases (10.5%, bronchiectasis in 3 (5.2%, bronchogenic carcinoma in 5 (8.7% and those receiving radiotherapy for head and neck cancer 7 (12.2%. Thirteen environmental isolates were also included in the study. The most common isolate was A. fumigatus 28 (40%, followed by A. niger 22 (31%, A. flavus 13 (19%, and A. terreus 7(10%. All isolates were susceptible to amphotericin B, itraconazole, and voriconazole. Among the three agents tested, voriconazole exhibited lowest MICs (≤1 μg/ml against all Aspergillus species.

  19. Phylogeny and subgeneric taxonomy of Aspergillus

    DEFF Research Database (Denmark)

    Peterson, S.W.; Varga, Janos; Frisvad, Jens Christian; Samson, Robert A.

    The phylogeny of the genus Aspergillus and its teleomorphs is discussed based on multilocus sequence data. DNA sequence analysis was used to formulate a nucleotide sequence framework of the genus and to analyze character changes in relationship to the phylogeny hypothesized from the DNA sequence...... analysis. The sequence data used to delimitate subgeneric taxa included partial calmodulin, rDNA and RNA polymerase gene sequences. In our phylogenic structure of Aspergillus extrolite data of the various Aspergillus taxa collected from ex-type cultures and numerous other isolates are also discussed. A new...... subgeneric classification is proposed which includes 8 subgenera and 22 sections within the Aspergillus genus. Characteristics of these taxa are shortly discussed in this chapter....

  20. "A PCR-RFLP Method to Identification of the Important Opportunistic Fungi: Candida Species, Cryptococcus neoformans, Aspergillus famigatus and Fusarium solani"

    Directory of Open Access Journals (Sweden)

    SH Mirhendi


    Full Text Available Deep-seated fungal infection present with non specific symptoms and involove a large number of different organisms. DNA-based technology offers for eariler detection of fungal pathogens and then earlier initiation of antifungal therapy. In this study universal primers common to almost all fungi were used to amplification of internal transcribe spacer 1 and 2 region. Subsequent restriction enzyme analysis of PCR products, using HpaII allows us to identify the most medically opportunistic important fungi: Candida albicans, C. glabrata, C. tropicalis, C. kruzei, C. guilliermondi, Cryptococcus neoformans, Aspergillus fumigatus and Fusarium solani, according to sizely different bands in polyacrilamid gel electrophoresis. It seems that this panel of PCR-RFLP could be a rapid and useful molecular approach in diagnostic studies of invasive opportunistic fungal infections.

  1. The use of a-methyl-D-glucoside, a synthetic analogue of maltose, as inducer of amylase by Aspergillus sp in solid-state and submerged fermentations

    Directory of Open Access Journals (Sweden)

    Moreira Fabiana G.


    Full Text Available The use of a methyl-D-glucoside (alphaMG, a synthetic analogue of maltose, as carbon source and inducer of amylase synthesis to several species of Aspergillus was studied in submerged and solid-state fermentations. Among a group of ten species, A. tamarii, A. fumigatus and A. flavus were able to produce biomass and high specific amylolytic activity in submerged cultures containing alphaMG as the only carbon source. In solid state fermentation, the enrichment of basal wheat bran or corn cob medium with alphaMG increased up to 3 times the production of amylases. In both submerged and solid state fermentations, alphaMG was more effective inducer of amylases than maltose and starch.

  2. Simple and highly discriminatory VNTR-based multiplex PCR for tracing sources of Aspergillus flavus isolates.

    Directory of Open Access Journals (Sweden)

    Dong Ying Wang

    Full Text Available Aspergillus flavus is second only to A. fumigatus in causing invasive aspergillosis and it is the major agent responsible for fungal sinusitis, keratitis and endophthalmitis in many countries in the Middle East, Africa and Southeast Asia. Despite the growing challenge due to A. flavus, data on the molecular epidemiology of this fungus remain scarce. The objective of the present study was to develop a new typing method based on the detection of VNTR (Variable number tandem repeat markers. Eight VNTR markers located on 6 different chromosomes (1, 2, 3, 5, 7 and 8 of A. flavus were selected, combined by pairs for multiplex amplifications and tested on 30 unrelated isolates and six reference strains. The Simpson index for individual markers ranged from 0.398 to 0.818. A combined loci index calculated with all the markers yielded an index of 0.998. The MLVA (Multiple Locus VNTR Analysis technique proved to be specific and reproducible. In a second time, a total of 55 isolates from Chinese avian farms and from a Tunisian hospital have been evaluated. One major cluster of genotypes could be defined by using the graphing algorithm termed Minimum Spanning Tree. This cluster comprised most of the isolates collected in an avian farm in southern China. The MLVA technique should be considered as an excellent and cost-effective typing method that could be used in many laboratories without the need for sophisticated equipment.

  3. Post-genomic insights into the plant polysaccharide degradation potential of Aspergillus nidulans and comparison to Aspergillus niger and Aspergillus oryzae

    DEFF Research Database (Denmark)

    Coutinho, Pedro M.; Andersen, Mikael Rørdam; Kolenova, Katarina; vanKuyk, Patricia A.; Benoit, Isabelle; Gruben, Birgit S.; Trejo-Aguilar, Blanca; Visser, Hans; van Solingen, Piet; Pakula, Tiina; Seiboth, Bernard; Battaglia, Evy; Aguilar-Osorio, Guillermo; de Jong, Jan F.; Ohm, Robin A.; Aguilar, Mariana; Henrissat, Bernard; Nielsen, Jens; Stålbrand, Henrik; de Vries, Ronald P.

    The plant polysaccharide degradative potential of Aspergillus nidulans was analysed in detail and compared to that of Aspergillus niger and Aspergillus oryzae using a combination of bioinformatics, physiology and transcriptomics. Manual verification indicated that 28.4% of the A. nidulans ORFs...

  4. Histocompatibility antigen test (United States)

    ... more common in certain autoimmune diseases . For example, HLA-B27 antigen is found in many people (but not ... More Ankylosing spondylitis Autoimmune disorders Bone marrow transplant HLA-B27 antigen Kidney transplant Reactive arthritis Update Date 2/ ...

  5. Ribonuclease Production by Aspergillus species

    Directory of Open Access Journals (Sweden)

    Eleni Gomes


    Full Text Available Ribonuclease production by Aspergillus flavipes, A. sulphureus and A. fischeri in semi-synthetic medium, after 24-144 hours at 30ºC under shaking, was studied. After cultivation, the medium was separated from micelia by filtration and the resultant solution was used as enzymatic extract. The highest amount of biomass and RNase was obtained after 96 hours of cultivation. The enzymes produced by three species presented similar characteristics, with optimum temperature at 55ºC and two peaks of activity at pH 4.5 and 7.0. A. flavipes RNases were more sensitive to temperature: 50% of the initial activity was lost after 1 hour at 70ºC. After this heat treatment, RNase of A. sulphureus lost 30% of this activity and that of A. fischeri only 16%. The nucleotides released by enzimatic hydrolysis of RNA were separated by ion exchange chromatography in a AG-1X8-formiate column and identified by paper chromatography. This procedure indicated that the raw enzymatic extract of Aspergillus flavipes is able to hydrolyze RNA, releasing 3'-nucleotides monophosphate at pH 4.5 and 3' and 5'-nucleotides monophosphate at pH 7.0 and 8.5. This result suggests that this strain produces two different types of RNase, one acidic and other alcaline, with different specificities.A produção de ribonucleases extracelulares pelos fungos Aspergillus flavipes, A. sulphureus e A. fischeri foi estudada em meio semi-sintético por períodos de 24 a 144 horas, em "shaker" a 30ºC. Após o cultivo, o meio foi separado da massa micelial por filtração, sendo o filtrado utilizado como solução enzimática bruta. As três espécies produziram maior quantidade de biomassa e ribonuclease após 96 horas de cultivo. O estudo das RNases como extrato enzimático bruto demonstrou que existe grande similaridade entre as enzimas das três espécies, com temperaturas ótimas de 55ºC e dois picos de atividade a pH 4,5 e a pH 7,0. A RNAse produzida pelo fungo A. flavipes demonstrou ser mais

  6. Neuroimaging features of cerebral aspergillus abscess: Case report

    Directory of Open Access Journals (Sweden)

    Jie Bai


    Conclusion: Cerebral aspergillus abscesses possess some degree neuroimaging features on traditional CT/MR imaging. Combined with patient's clinical history, CT/MRI examination could facilitate early diagnosis of aspergillus abscesses in central nervous system.

  7. Chemodiversity in the genus Aspergillus

    DEFF Research Database (Denmark)

    Frisvad, Jens Christian; Larsen, Thomas Ostenfeld


    characterized. The genus Aspergillus is cladistically holophyletic but phenotypically polythetic and very diverse and is associated to quite different sexual states. Following the one fungus one name system, the genus Aspergillus is restricted to a holophyletic clade that include the morphologically different...... biosynthetic family isoextrolites. However, it appears that secondary metabolites from one Aspergillus section have analogous metabolites in other sections (here also called heteroisoextrolites). In this review, we give a genus-wide overview of secondary metabolite production in Aspergillus species. Extrolites...

  8. Aspergillus species: An emerging pathogen in onychomycosis among diabetics


    Wijesuriya, T. M.; Kottahachchi, J.; T. D. C. P. Gunasekara; Bulugahapitiya, U.; K. N. P. Ranasinghe; Neluka Fernando, S. S.; M M Weerasekara


    Introduction: Approximately, 33% patients with diabetes are afflicted with onychomycosis. In the past, nondermatophyte molds have been regarded as opportunistic pathogens; recently, Aspergillus species are considered as emerging pathogens of toenail infections. In Sri Lanka, the prevalence of Aspergillus species in onychomycosis among diabetics is not well documented. Objective: To determine the proportion of Aspergillus onychomycosis, risk factors and knowledge among diabetics. Materials and...

  9. 21 CFR 866.3040 - Aspergillus spp. serological reagents. (United States)


    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Aspergillus spp. serological reagents. 866.3040... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3040 Aspergillus spp. serological reagents. (a) Identification. Aspergillus spp. serological reagents are devices...

  10. Combined molecular and biochemical approach identifies Aspergillus japonicus and Aspergillus aculeatus as two species

    DEFF Research Database (Denmark)

    Parenicova, L.; Skouboe, P.; Frisvad, Jens Christian; Samson, R.A.; Rossen, L.; Hoor-Suykerbuyk, M.; Visser, J.


    We examined nine Aspergillus japonicus isolates and 10 Aspergillus aculeatus isolates by using molecular and biochemical markers, including DNA sequences of the ITS1-5.8S rRNA gene-ITS2 region, restriction fragment length polymorphisms (RFLP), and secondary-metabolite profiles. The DNA sequence of...... the internal transcribed spacers (ITS1 and ITS2) and the 5.8S rRNA gene could not be used to distinguish between A. japonicus and A. aculeatus but did show that these two taxa are more closely related to each other than to other species of black aspergilli. Aspergillus niger pyruvate kinase (pkiA) and...

  11. A rare case of bilateral aspergillus endophthalmitis (United States)

    Gupta, Saurabh; Loudill, Cameron; Tammara, Anita; Chow, Robert T.


    Aspergillus endophthalmitis is a devastating inflammatory condition of the intraocular cavities that may result in irreparable loss of vision and rapid destruction of the eye. Almost all cases in the literature have shown an identified source causing aspergillus endophthalmitis as a result of direct extension of disease. We present a rare case of bilateral aspergillus endophthalmitis. A 72-year-old woman with a history of diabetes mellitus, congenital Hirschsprung disease, and recent culture-positive candida pyelonephritis with hydronephrosis status post-surgical stent placement presented with difficulty opening her eyes. She complained of decreased vision (20/200) with pain and redness in both eyes – right worse then left. Examination demonstrated multiple white fungal balls in both retinas consistent with bilateral fungal endophthalmitis. Bilateral vitreous taps for cultures and staining were performed. Patient was given intravitreal injections of amphotericin B, vancomycin, ceftazidime, and started on oral fluconazole. Patient was scheduled for vitrectomy to decrease organism burden and to remove loculated areas of infection that would not respond to systemic antifungal agents. Four weeks after initial presentation, the fungal cultures revealed mold growth consistent with aspergillus. Patient was subsequently started on voriconazole and fluconazole was discontinued due to poor efficacy against aspergillus. Further workup was conducted to evaluate for the source of infection and seeding. Transthoracic cardiogram was unremarkable for any vegetation or valvular abnormalities. MRI of the orbits and sinuses did not reveal any mass lesions or bony destruction. CT of the chest was unremarkable for infection. Aspergillus endophthalmitis may occur because of one of these several mechanisms: hematogenous dissemination, direct inoculation by trauma, and contamination during surgery. Our patient's cause of bilateral endophthalmitis was through an unknown iatrogenic seed

  12. A rare case of bilateral aspergillus endophthalmitis. (United States)

    Gupta, Saurabh; Loudill, Cameron; Tammara, Anita; Chow, Robert T


    Aspergillus endophthalmitis is a devastating inflammatory condition of the intraocular cavities that may result in irreparable loss of vision and rapid destruction of the eye. Almost all cases in the literature have shown an identified source causing aspergillus endophthalmitis as a result of direct extension of disease. We present a rare case of bilateral aspergillus endophthalmitis. A 72-year-old woman with a history of diabetes mellitus, congenital Hirschsprung disease, and recent culture-positive candida pyelonephritis with hydronephrosis status post-surgical stent placement presented with difficulty opening her eyes. She complained of decreased vision (20/200) with pain and redness in both eyes - right worse then left. Examination demonstrated multiple white fungal balls in both retinas consistent with bilateral fungal endophthalmitis. Bilateral vitreous taps for cultures and staining were performed. Patient was given intravitreal injections of amphotericin B, vancomycin, ceftazidime, and started on oral fluconazole. Patient was scheduled for vitrectomy to decrease organism burden and to remove loculated areas of infection that would not respond to systemic antifungal agents. Four weeks after initial presentation, the fungal cultures revealed mold growth consistent with aspergillus. Patient was subsequently started on voriconazole and fluconazole was discontinued due to poor efficacy against aspergillus. Further workup was conducted to evaluate for the source of infection and seeding. Transthoracic cardiogram was unremarkable for any vegetation or valvular abnormalities. MRI of the orbits and sinuses did not reveal any mass lesions or bony destruction. CT of the chest was unremarkable for infection. Aspergillus endophthalmitis may occur because of one of these several mechanisms: hematogenous dissemination, direct inoculation by trauma, and contamination during surgery. Our patient's cause of bilateral endophthalmitis was through an unknown iatrogenic seed

  13. A rare case of bilateral aspergillus endophthalmitis

    Directory of Open Access Journals (Sweden)

    Saurabh Gupta


    Full Text Available Aspergillus endophthalmitis is a devastating inflammatory condition of the intraocular cavities that may result in irreparable loss of vision and rapid destruction of the eye. Almost all cases in the literature have shown an identified source causing aspergillus endophthalmitis as a result of direct extension of disease. We present a rare case of bilateral aspergillus endophthalmitis. A 72-year-old woman with a history of diabetes mellitus, congenital Hirschsprung disease, and recent culture-positive candida pyelonephritis with hydronephrosis status post-surgical stent placement presented with difficulty opening her eyes. She complained of decreased vision (20/200 with pain and redness in both eyes – right worse then left. Examination demonstrated multiple white fungal balls in both retinas consistent with bilateral fungal endophthalmitis. Bilateral vitreous taps for cultures and staining were performed. Patient was given intravitreal injections of amphotericin B, vancomycin, ceftazidime, and started on oral fluconazole. Patient was scheduled for vitrectomy to decrease organism burden and to remove loculated areas of infection that would not respond to systemic antifungal agents. Four weeks after initial presentation, the fungal cultures revealed mold growth consistent with aspergillus. Patient was subsequently started on voriconazole and fluconazole was discontinued due to poor efficacy against aspergillus. Further workup was conducted to evaluate for the source of infection and seeding. Transthoracic cardiogram was unremarkable for any vegetation or valvular abnormalities. MRI of the orbits and sinuses did not reveal any mass lesions or bony destruction. CT of the chest was unremarkable for infection. Aspergillus endophthalmitis may occur because of one of these several mechanisms: hematogenous dissemination, direct inoculation by trauma, and contamination during surgery. Our patient's cause of bilateral endophthalmitis was through an

  14. Aspergillus species: An emerging pathogen in onychomycosis among diabetics (United States)

    Wijesuriya, T. M.; Kottahachchi, J.; Gunasekara, T. D. C. P.; Bulugahapitiya, U.; Ranasinghe, K. N. P.; Neluka Fernando, S. S.; Weerasekara, M. M.


    Introduction: Approximately, 33% patients with diabetes are afflicted with onychomycosis. In the past, nondermatophyte molds have been regarded as opportunistic pathogens; recently, Aspergillus species are considered as emerging pathogens of toenail infections. In Sri Lanka, the prevalence of Aspergillus species in onychomycosis among diabetics is not well documented. Objective: To determine the proportion of Aspergillus onychomycosis, risk factors and knowledge among diabetics. Materials and Methods: This was descriptive cross-sectional study. Three hundred diabetic patients were included. Clinical examinations of patients’ toenails were performed by a clinical microbiologist. Laboratory identification was done, and pathogens were identified to the species level by morpho-physiological methods. All inferential statistics were tested at P onychomycosis. Aspergillus species were most commonly isolated n = 180 (71%) followed by dermatophytes, yeasts, and other molds n = 75 (29%). Of the patients having Aspergillus onychomycosis, 149 (83%) were in the > age group. In men, Aspergillus onycomycosis was seen in 82%. Among patients who had Aspergillus nail infection, 114 (63%) had diabetes for a period of > years. Among patients who were engaged in agricultural activities, 77% were confirmed to have infected nails due to Aspergillus species. Conclusion: Aspergillus niger was the most common pathogen isolated from toenail infection. Aspergillus species should be considered as an important pathogen in toenail onychomycosis in diabetic patients. Risk factors associated with Aspergillus onychomycosis were age, gender, duration of diabetes, length of exposure to fungi, and occupation. PMID:26693433

  15. Identification and toxigenic potential of the industrially important fungi, Aspergillus oryzae and Aspergillus sojae

    DEFF Research Database (Denmark)

    Jørgensen, Thomas R


    Mold strains belonging to the species Aspergillus oryzae and Aspergillus sojae are highly valued as koji molds in the traditional preparation of fermented foods, such as miso, sake, and shoyu, and as protein production hosts in modern industrial processes. A. oryzae and A. sojae are relatives of...... the wild molds Aspergillus flavus and Aspergillus parasiticus. All four species are classified to the A. flavus group. Strains of the A. flavus group are characterized by a high degree of morphological similarity. Koji mold species are generally perceived of as being nontoxigenic, whereas wild molds...... are associated with the carcinogenic aflatoxins. Thus, reliable identification of individual strains is very important for application purposes. This review considers the pheno- and genotypic markers used in the classification of A. flavus group strains and specifically in the identification of A...

  16. Characterization of a polyketide synthase in Aspergillus niger whose product is a precursor for both dihydroxynaphthalene (DHN) melanin and naphtho-γ-pyrone.

    Energy Technology Data Exchange (ETDEWEB)

    Chiang, Yi Ming; Meyer, Kristen M; Praseuth, Michael; Baker, Scott E; Bruno, Kenneth S; Wang, Clay C


    The genome sequencing of the fungus Aspergillus niger, an industrial workhorse, uncovered a large cache of genes encoding enzymes thought to be involved in the production of secondary metabolites yet to be identified. Identification and structural characterization of many of these predicted secondary metabolites are hampered by their low concentration relative to the known A. niger metabolites such as the naphtho-γ-pyrone family of polyketides. We deleted a nonreducing PKS gene in A. niger strain ATCC 11414, a daughter strain of A. niger ATCC strain 1015 whose genome was sequenced by the DOE Joint Genome Institute. This PKS encoding gene is a predicted ortholog of alb1 from Aspergillus fumigatus which is responsible for production of YWA1, a precursor of fungal DHN melanin. Our results show that the A. niger alb1 PKS is responsible for the production of the polyketide precursor for DHN melanin biosynthesis. Deletion of alb1 elimnates the production of major metabolites, naphtho-γ-pyrones. The generation of an A. niger strain devoid of naphtho-γ-pyrones will greatly facilitate the elucidation of cryptic biosynthetic pathways in this organism.

  17. Aspergillus pragensis sp nov discovered during molecular reidentification of clinical isolates belonging to Aspergillus section Candidi

    Czech Academy of Sciences Publication Activity Database

    Hubka, Vít; Lysková, P.; Frisvad, J.C.; Peterson, S.W.; Skořepová, M.; Kolařík, Miroslav


    Roč. 52, č. 6 (2014), s. 565-576. ISSN 1369-3786 R&D Projects: GA MŠk(CZ) EE2.3.20.0055; GA MŠk(CZ) EE2.3.30.0003 Institutional support: RVO:61388971 Keywords : Aspergillus candidus * Aspergillus tritici * antifungal susceptibility testing Subject RIV: EE - Microbiology, Virology Impact factor: 2.335, year: 2014

  18. The Production of Itaconic Acid from Sweet Potato Peel Using Aspergillus niger and Aspergillus terreus




    Accumulation of large quantities of agricultural residues results in deterioration of the environment and biomass loss which could be processed to yield value-added products like fuels and a variety of acids. The quest for a solution led to the fermentation of Ipomoea batatas using fungi. Aspergillus niger (ATCC 16404) and Aspergillus terreus (ATCC 20542) were used to ferment sweet potato peel (SPP), an agro-based waste. The physico-chemical analysis of the SPP was carried out. SPP was dried...

  19. Study of effect ultraviolet radiation on Aspergillus Flavus and Aspergillus Parasiticus

    International Nuclear Information System (INIS)

    In this article the results of ultraviolet radiation effects on Aspergillus Flavus and Aspergillus parasiticus to reach the quality control standards are presented. The purpose was to test the effect of ultraviolet radiation in 254 nanometer wavelength for fungi decontamination with respect to the exposure time of radiation and the distance between samples and radiation source. The ultraviolet radiation effects on plates containing Aspergillus Flavus and Aspergillus Parasiticus fungi were studied in the exposure time duration of 30, to 360 seconds of a fixed distance, and also for variable distances from 10 to 40 cm at a given exposure time. It is shown that in the exposure time of more than 360 second the ultraviolet radiation exposure highly decreases the number of Aspergillus Flavus and Aspergillus Parasiticus fungi colonies. By reducing the distance, the number of colonies decreases and it is minimized at a 10 cm distance in the time exposure of 360 second. The above results show that the ultraviolet radiation is an effective method for food decontamination and can be used in industry

  20. Taxonomic Characterization and Secondary Metabolite Profiling of Aspergillus Section Aspergillus Contaminating Feeds and Feedstuffs (United States)

    Greco, Mariana; Kemppainen, Minna; Pose, Graciela; Pardo, Alejandro


    Xerophilic fungal species of the genus Aspergillus are economically highly relevant due to their ability to grow on low water activity substrates causing spoilage of stored goods and animal feeds. These fungi can synthesize a variety of secondary metabolites, many of which show animal toxicity, creating a health risk for food production animals and to humans as final consumers, respectively. Animal feeds used for rabbit, chinchilla and rainbow trout production in Argentina were analysed for the presence of xerophilic Aspergillus section Aspergillus species. High isolation frequencies (>60%) were detected in all the studied rabbit and chinchilla feeds, while the rainbow trout feeds showed lower fungal charge (25%). These section Aspergillus contaminations comprised predominantly five taxa. Twenty isolates were subjected to taxonomic characterization using both ascospore SEM micromorphology and two independent DNA loci sequencing. The secondary metabolite profiles of the isolates were determined qualitatively by HPLC-MS. All the isolates produced neoechinulin A, 17 isolates were positive for cladosporin and echinulin, and 18 were positive for neoechinulin B. Physcion and preechinulin were detected in a minor proportion of the isolates. This is the first report describing the detailed species composition and the secondary metabolite profiles of Aspergillus section Aspergillus contaminating animal feeds. PMID:26364643

  1. New species in Aspergillus section Terrei

    DEFF Research Database (Denmark)

    Samson, R. A.; Peterson, S. W.; Frisvad, Jens Christian;


    Section Terrei of Aspergillus was studied using a polyphasic approach including sequence analysis of parts of the beta-tubulin and calmodulin genes and the ITS region, macro- and micromorphological analyses and examination of extrolite profiles to describe three new species in this section. Based...

  2. Organic acid production by Aspergillus niger

    DEFF Research Database (Denmark)

    Jongh, Wian de


    . Specielt Aspergillus niger er interessant i forbindelse med produktion af organiske syrer, idet denne organisme tolerer lavt pH, kan give høje produktudbytter, og kan give høje produktiviteter som allerede illustreret i anvendelsen af denne organisme i produktionen af citronsyre. Disse faktorer gør A...

  3. Phylogeny and subgeneric taxonomy of Aspergillus

    DEFF Research Database (Denmark)

    Peterson, S.W.; Varga, Janos; Frisvad, Jens Christian;


    The phylogeny of the genus Aspergillus and its teleomorphs is discussed based on multilocus sequence data. DNA sequence analysis was used to formulate a nucleotide sequence framework of the genus and to analyze character changes in relationship to the phylogeny hypothesized from the DNA sequence...


    Eighteen isolates of Aspergillus bombycis from samples of dust, insect frass, and soil collected from 8 silkworm rearing facilities in Japan, as well as single silkworm rearing facilities in Indonesia and Malaysia, were subjected to DNA fingerprinting. PstI digests of total genomic DNA from each is...

  5. Isolation and optimization of pectinase enzyme production one of useful industrial enzyme in Aspergillus niger, Rhizopus oryzae, Penicilium chrysogenum

    Directory of Open Access Journals (Sweden)

    akram songol


    Full Text Available Introduction: Pectinase enzyme is one of the most important industrial enzymes which isolated from a wide variety of microorganisms such as bacteria and filamentous fungi. This enzyme has been usually used in the fruit and textile industry. In this study, the isolation and optimization of pectinase-producing fungi on decaying rotten fruits were studied. Materials and methods: Isolation and screening of pectinase producing fungi performed through plate culture on pectin medium and staining with Lugol's iodine solution. The best strains were identified by ITS1, 4 sequencing as Aspergillus fumigatus, Rhizopus oryzae, Penicilium chrysogenum. The enzyme production was optimized by application of the five factorial design, each at three levels. These factors are carbon sources (whey, glucose and stevia, ammonium sulfate, manganese sulfate, temperature, and pH. Pectinase concentration was measured by the Miller method. Results: The results indicate that optimum condition for enzyme production for three fungi strains was obtained at 32 °C, pH = 6, 3g / L manganese sulfate, 2.75g / L of ammonium sulfate and 10g / L of each carbon source. The best experiment in obtaining the optimum enzyme contained 1.328 mg / ml of glucose for Aspergillus niger 1.284 and 1.039 mg / ml of whey for Rhizopus oryzae and Penicilium chrysogenum. Molecular weight of enzyme was about 40 and 37 kDa which was obtained by SDS- PAGE. Discussion and conclusion: The results indicate that three strains could grow in a wide range of carbon source, pH and temperature, which could be a good candidate for industrial application.

  6. Production and characterization of two major Aspergillus oryzae secreted prolyl endopeptidases able to efficiently digest proline-rich peptides of gliadin. (United States)

    Eugster, Philippe J; Salamin, Karine; Grouzmann, Eric; Monod, Michel


    Prolyl endopeptidases are key enzymes in the digestion of proline-rich proteins. Fungal extracts rich in prolyl endopeptidases produced by a species such as Aspergillus oryzae used in food fermentation would be of particular interest for the development of an oral enzyme therapy product in patients affected by intolerance to gluten. Two major A. oryzae secreted prolyl endopeptidases of the MEROPS S28 peptidase family, AoS28A and AoS28B, were identified when this fungus was grown at acidic pH in a medium containing soy meal protein or wheat gliadin as the sole source of nitrogen. AoS28B was produced by 12 reference A. oryzae strains used in food fermentation. AoS28A was secreted by six of these 12 strains. This protease is the orthologue of the previously characterized Aspergillus fumigatus (AfuS28) and Aspergillus niger (AN-PEP) prolyl endopeptidases which are encoded by genes with a similar intron-exon structure. Large amounts of secreted AoS28A and AoS28B were obtained by gene overexpression in A. oryzae. AoS28A and AoS28B are endoproteases able to cleave N-terminally blocked proline substrates. Both enzymes very efficiently digested the proline-rich 33-mer of gliadin, the most representative immunotoxic peptide deriving from gliadin, with some differences in terms of specificity and optimal pH. Digestion of the gliadin peptide in short peptides with both enzymes was found to occur from its N terminus. PMID:26464108

  7. Two novel species of Aspergillus section Nigri from Thai coffee beans

    DEFF Research Database (Denmark)

    Noonim, Paramee; Mahakarnchanakul, Warapa; Varga, Janos; Frisvad, Jens Christian; Samson, Robert A.


    Two novel species of Aspergillus section Nigri from Thai coffee beans are described as Aspergillus aculeatinus sp. nov. and Aspergillus sclerotiicarbonarius sp. nov. Their taxonomic status was determined using a polyphasic taxonomic approach with phenotypic (morphology and extrolite profiles) and...

  8. Two novel species of Aspergillus section Nigri from Thai coffee beans

    DEFF Research Database (Denmark)

    Noonim, Paramee; Mahakarnchanakul, Warapa; Varga, Janos;


    Two novel species of Aspergillus section Nigri from Thai coffee beans are described as Aspergillus aculeatinus sp. nov. and Aspergillus sclerotiicarbonarius sp. nov. Their taxonomic status was determined using a polyphasic taxonomic approach with phenotypic (morphology and extrolite profiles...

  9. Phylogeny, identification and nomenclature of the genus Aspergillus

    DEFF Research Database (Denmark)

    Samson, R.A.; Visagie, C.M.; Houbraken, J.;


    Aspergillus comprises a diverse group of species based on morphological, physiological and phylogenetic characters, which significantly impact biotechnology, food production, indoor environments and human health. Aspergillus was traditionally associated with nine teleomorph genera, but phylogenetic...... data suggest that together with genera such as Polypaecilum, Phialosimplex, Dichotomomyces and Cristaspora, Aspergillus forms a monophyletic clade closely related to Penicillium. Changes in the International Code of Nomenclature for algae, fungi and plants resulted in the move to one name per species......, meaning that a decision had to be made whether to keep Aspergillus as one big genus or to split it into several smaller genera. The International Commission of Penicillium and Aspergillus decided to keep Aspergillus instead of using smaller genera. In this paper, we present the arguments for this decision...

  10. Aspergillus species: An emerging pathogen in onychomycosis among diabetics

    Directory of Open Access Journals (Sweden)

    T M Wijesuriya


    Full Text Available Introduction: Approximately, 33% patients with diabetes are afflicted with onychomycosis. In the past, nondermatophyte molds have been regarded as opportunistic pathogens; recently, Aspergillus species are considered as emerging pathogens of toenail infections. In Sri Lanka, the prevalence of Aspergillus species in onychomycosis among diabetics is not well documented. Objective: To determine the proportion of Aspergillus onychomycosis, risk factors and knowledge among diabetics. Materials and Methods: This was descriptive cross-sectional study. Three hundred diabetic patients were included. Clinical examinations of patients' toenails were performed by a clinical microbiologist. Laboratory identification was done, and pathogens were identified to the species level by morpho-physiological methods. All inferential statistics were tested at P age group. In men, Aspergillus onycomycosis was seen in 82%. Among patients who had Aspergillus nail infection, 114 (63% had diabetes for a period of > years. Among patients who were engaged in agricultural activities, 77% were confirmed to have infected nails due to Aspergillus species. Conclusion: Aspergillus niger was the most common pathogen isolated from toenail infection. Aspergillus species should be considered as an important pathogen in toenail onychomycosis in diabetic patients. Risk factors associated with Aspergillus onychomycosis were age, gender, duration of diabetes, length of exposure to fungi, and occupation.



    Kantabathini Venkata Pavani; Nandigam Srujana; Guntur Preethi; Tandale Swati


    Recent developments in the biosynthesis of nanomaterials have demonstrated the important role of microorganisms in nanotechnology. The organisms show a unique potential in environmentally friendly production and accumulation of nanoparticles with different shapes and sizes. The present study proposed a green process for synthesis of copper nanoparticles using Aspergillus species. Syntheses of copper nanoparticles were characterized by UV-visible spectroscopy. The extracellular synthesis of co...


    Directory of Open Access Journals (Sweden)

    Kantabathini Venkata Pavani


    Full Text Available Recent developments in the biosynthesis of nanomaterials have demonstrated the important role of microorganisms in nanotechnology. The organisms show a unique potential in environmentally friendly production and accumulation of nanoparticles with different shapes and sizes. The present study proposed a green process for synthesis of copper nanoparticles using Aspergillus species. Syntheses of copper nanoparticles were characterized by UV-visible spectroscopy. The extracellular synthesis of copper nanoparticles was characterized by scanning electron microscopy and Transmission electron microscopy.

  13. L-histidine utilization in Aspergillus nidulans.


    Polkinghorne, M A; Hynes, M J


    Histidase activity rather than uptake of L-histidine is the limiting factor for the utilization of histidine as the sole nitrogen source for Aspergillus nidulans. Histidine cannot act as the sole carbon source, and evidence is presented indicating that this is attributable to an inability to convert histidine to L-glutamate in vivo. It has been shown that this fungus lacks an active urocanase enzyme and that histidine is quantitatively converted to urocanate, which accumulates in the extracel...

  14. Aspergillus bertholletius sp. nov. from Brazil Nuts


    Taniwaki, Marta H.; Pitt, John I.; Iamanaka, Beatriz T.; Sartori, Daniele; Copetti, Marina V.; Balajee, Arun; Fungaro, Maria Helena P.; Frisvad, Jens Christian


    During a study on the mycobiota of brazil nuts (Bertholletia excelsa) in Brazil, a new Aspergillus species, A. bertholletius, was found, and is described here. A polyphasic approach was applied using morphological characters, extrolite data as well as partial beta-tubulin, calmodulin and ITS sequences to characterize this taxon. A. bertholletius is represented by nineteen isolates from samples of brazil nuts at various stages of production and soil close to Bertholletia excelsa trees. The fol...

  15. Pectinolytic activity of Aspergillus section Nigri strains


    Maciel, M. H. C.; Ottoni, C. A.; Santos, C.; Moreira, K.; Lima, Nelson; Motta, Cristina Souza


    Pectinases are a heterogeneous group of related enzymes that hydrolyze pectic substances present mostly in plants. Pectinases are produced by plants, fungi, yeasts and bacteria. Filamentous fungi are good producers of pectinolytic enzymes (e.g., exopolygalacturonase (exo-PG) and endopolygalacturonase (endo-PG) and Aspergillus niger is the most commonly used fungal species for industrial production of pectinolytic enzymes. The application of pectinolytic enzymes plays an importa...

  16. Comparative Reannotation of 21 Aspergillus Genomes

    Energy Technology Data Exchange (ETDEWEB)

    Salamov, Asaf; Riley, Robert; Kuo, Alan; Grigoriev, Igor


    We used comparative gene modeling to reannotate 21 Aspergillus genomes. Initial automatic annotation of individual genomes may contain some errors of different nature, e.g. missing genes, incorrect exon-intron structures, 'chimeras', which fuse 2 or more real genes or alternatively splitting some real genes into 2 or more models. The main premise behind the comparative modeling approach is that for closely related genomes most orthologous families have the same conserved gene structure. The algorithm maps all gene models predicted in each individual Aspergillus genome to the other genomes and, for each locus, selects from potentially many competing models, the one which most closely resembles the orthologous genes from other genomes. This procedure is iterated until no further change in gene models is observed. For Aspergillus genomes we predicted in total 4503 new gene models ( ~;;2percent per genome), supported by comparative analysis, additionally correcting ~;;18percent of old gene models. This resulted in a total of 4065 more genes with annotated PFAM domains (~;;3percent increase per genome). Analysis of a few genomes with EST/transcriptomics data shows that the new annotation sets also have a higher number of EST-supported splice sites at exon-intron boundaries.

  17. A comparison between intratracheal and inhalation delivery of Aspergillus fumigatus conidia in the development of fungal allergic asthma in C57BL/6 mice


    Samarasinghe, Amali E.; Hoselton, Scott A; Schuh, Jane M


    Allergic asthma is a debilitating disease of the airways characterized by airway hyperresponsiveness, eosinophilic inflammation, goblet cell metaplasia with associated mucus hypersecretion, and airway wall remodelling events, particularly subepithelial fibrosis and smooth muscle cell hyperplasia. Animal models that accurately mimic these hallmarks of allergic airways disease are critical for studying mechanisms associated with the cellular and structural changes that lead to disease pathogene...

  18. Quantification by SIFT-MS of volatile compounds emitted by Aspergillus fumigatus cultures and in co-culture with Pseudomonas aeruginosa, Staphylococcus aureus and Streptococcus pneumoniae

    Czech Academy of Sciences Publication Activity Database

    Chippendale, T. W. E.; Gilchrist, F. J.; Španěl, Patrik; Alcock, A.; Lenney, W.; Smith, D.


    Roč. 6, č. 20 (2014), s. 8154-8164. ISSN 1759-9660 Institutional support: RVO:61388955 Keywords : ion-flow tube * ionization-mass spectrometry * nose-enhaled breath Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.821, year: 2014

  19. Comparison of Fractional Inhibitory Concentration Index with Response Surface Modeling for Characterization of In Vitro Interaction of Antifungals against Itraconazole-Susceptible and -Resistant Aspergillus fumigatus Isolates


    te Dorsthorst, D. T. A.; Verweij, P E; Meis, J.F.G.M.; Punt, N. C.; Mouton, J. W.


    Although the fractional inhibitory concentration (FIC) index is most frequently used to define or to describe drug interactions, it has some important disadvantages when used for drugs against filamentous fungi. This includes observer bias in the determination of the MIC and no agreement on the endpoints (MIC-0, MIC-1, or MIC-2 [≥95, ≥75, and ≥50% growth inhibition, respectively]) when studying drug combinations. Furthermore, statistical analysis and comparisons are troublesome. The use of a ...

  20. Clonality and sex impact aflatoxigenicity in Aspergillus populations (United States)

    Species in Aspergillus section Flavi commonly infect agricultural staples such as corn, peanuts, cottonseed, and tree nuts and produce an array of mycotoxins, the most potent of which are aflatoxins. Aspergillus flavus is the dominant aflatoxin-producing species in the majority of crops. Populatio...

  1. The current status of species recognition and identification in Aspergillus (United States)

    The genus Aspergillus is a large economically important genus of fungi. In agriculture, some of the 250 species in this genus cause disease in plants and animals and some also produce poisons (mycotoxins) in foods and feeds. Aspergillus is a major killer of immunosuppressed people, such as diabeti...

  2. Phylogeny, identification and nomenclature of the genus Aspergillus. (United States)

    Samson, R A; Visagie, C M; Houbraken, J; Hong, S-B; Hubka, V; Klaassen, C H W; Perrone, G; Seifert, K A; Susca, A; Tanney, J B; Varga, J; Kocsubé, S; Szigeti, G; Yaguchi, T; Frisvad, J C


    Aspergillus comprises a diverse group of species based on morphological, physiological and phylogenetic characters, which significantly impact biotechnology, food production, indoor environments and human health. Aspergillus was traditionally associated with nine teleomorph genera, but phylogenetic data suggest that together with genera such as Polypaecilum, Phialosimplex, Dichotomomyces and Cristaspora, Aspergillus forms a monophyletic clade closely related to Penicillium. Changes in the International Code of Nomenclature for algae, fungi and plants resulted in the move to one name per species, meaning that a decision had to be made whether to keep Aspergillus as one big genus or to split it into several smaller genera. The International Commission of Penicillium and Aspergillus decided to keep Aspergillus instead of using smaller genera. In this paper, we present the arguments for this decision. We introduce new combinations for accepted species presently lacking an Aspergillus name and provide an updated accepted species list for the genus, now containing 339 species. To add to the scientific value of the list, we include information about living ex-type culture collection numbers and GenBank accession numbers for available representative ITS, calmodulin, β-tubulin and RPB2 sequences. In addition, we recommend a standard working technique for Aspergillus and propose calmodulin as a secondary identification marker. PMID:25492982

  3. Aspergillus brasiliensis sp. nov., a biseriate black Aspergillus species with world-wide distribution

    DEFF Research Database (Denmark)

    Varga, János; Kocsubé, Sándor; Tóth, Beáta;


    to produce ochratoxin A, kotanins, funalenone or pyranonigrins. The novel species was most closely related to A. niger, and was isolated from soil from Brazil, Australia, USA and The Netherlands, and from grape berries from Portugal. The type strain of Aspergillus brasiliensis sp. nov. is CBS 101740...

  4. The population genomics of mycotoxin diversity in Aspergillus flavus and Aspergillus parasiticus (United States)

    Mycotoxins, and especially the aflatoxins, are an enormous problem in agriculture, with aflatoxin B1 being the most carcinogenic known natural compound. The worldwide costs associated with aflatoxin monitoring and crop losses are in the hundreds of millions of dollars. Aspergillus flavus and A. par...

  5. Two novel aflatoxin-producing Aspergillus species from Argentinean peanuts

    DEFF Research Database (Denmark)

    Pildain, M.B.; Frisvad, Jens Christian; Vaamonde, G.; Cabral, D.; Varga, J.; Samson, R.A.


    (morphology and extrolite profiles) and molecular (beta-tubulin and calmodulin gene sequences) characters. A. minisclerotigenes resembles Aspergillus flavus and Aspergillus parvisclerotigenus in producing aflatoxins B-1 and B-2, cyclopiazonic acid, kojic acid and aspergillic acid, but in addition it produces......Two novel species from Aspergillus section Flavi from different species of Arachis (peanuts) in Argentina are described as Aspergillus arachidicola sp. nov. and Aspergillus minisclerotigenes sp. nov. Their novel taxonomic status was determined using a polyphasic taxonomic approach with phenotypic...... aflatoxins G(1) and G(2), aflavarins, aflatrem, aflavinines, parasiticolides and paspaline. This species also includes several isolates previously assigned to A. flavus group II and three Australian soil isolates. A. arachidicola produces aflatoxins B-1, B-2, G(1) and G(2), kojic acid, chrysogine and...

  6. Strain Dependent Variation of Immune Responses to A-fumigatus: Definition of Pathogenic Species


    Lisa Rizzetto; Gloria Giovannini; Michael Bromley; Paul Bowyer; Luigina Romani; Duccio Cavalieri


    For over a century microbiologists and immunologist have categorized microorganisms as pathogenic or non-pathogenic species or genera. This definition, clearly relevant at the strain and species level for most bacteria, where differences in virulence between strains of a particular species are well known, has never been probed at the strain level in fungal species. Here, we tested the immune reactivity and the pathogenic potential of a collection of strains from Aspergillus spp, a fungus that...

  7. Cloning and Characterization of the Aspergillus ochraceoroseus Aflatoxin Biosynthetic Gene Cluster (United States)

    Production of the carcinogenic mycotoxin aflatoxin B1 has been reported from members of Aspergillus section Flavi, Aspergillus section Nidulantes, and a newly proposed section, Aspergillus section Ochraceorosei that consists of Aspergillus ochraceoroseus and the closely related A. rambellii. A. och...

  8. Aspergillus bertholletius sp. nov. from Brazil Nuts

    DEFF Research Database (Denmark)

    Taniwaki, Marta H.; Pitt, John I.; Iamanaka, Beatriz T.;


    During a study on the mycobiota of brazil nuts (Bertholletia excelsa) in Brazil, a new Aspergillus species, A. bertholletius, was found, and is described here. A polyphasic approach was applied using morphological characters, extrolite data as well as partial beta-tubulin, calmodulin and ITS...... sequences to characterize this taxon. A. bertholletius is represented by nineteen isolates from samples of brazil nuts at various stages of production and soil close to Bertholletia excelsa trees. The following extrolites were produced by this species: aflavinin, cyclopiazonic acid, kojic acid, tenuazonic...

  9. Production of amylases by Aspergillus tamarii


    Moreira Fabiana Guillen; Lima Francieli Arrias de; Pedrinho Sophia Renata Fazzano; Lenartovicz Veridiana; Souza Cristina Giatti Marques de; Peralta Rosane Marina


    A strain of Aspergillus tamarii, a filamentous fungus isolated from soil, was able to produce both a-amylase and glucoamylase activities in mineral media supplemented with 1% (w/v) starch or maltose as the carbon source. Static cultivation led to significantly higher yields than those obtained using shaking culture. The production of amylases was tolerant to a wide range of initial culture pH values (from 4 to 10) and temperature (from 25 to 42oC). Two amylases, one a-amylase and one glucoamy...

  10. Aspergillus endophthalmitis in orthotopic liver transplantation

    Directory of Open Access Journals (Sweden)

    Hosseini Hamid


    Full Text Available In this report, we describe a patient with drug-induced liver failure who developed endogenous endophthalmitis after liver transplantation. Our patient′s clinical course was so fulminant that the eye was lost in less than 1 month, without any response to therapy. Recognition of this infection is important because many patients die of disseminated Aspergillus infection, which may be detected early with bedside funduscopic examination by an ophthalmologist. Probably if the patient had referred to us earlier, it may have been possible to save the eye.

  11. Cancer vaccine--Antigenics. (United States)


    Antigenics is developing a therapeutic cancer vaccine based on heat-shock proteins (HSPs). The vaccine [HSPPC-96, Oncophage] is in a pivotal phase III clinical trial for renal cancer at 80 clinical sites worldwide. The trial is enrolling at least 500 patients who are randomised to receive surgical removal of the primary tumour followed by out-patient treatment with Oncophage((R)) or surgery only. This study was initiated on the basis of results from a pilot phase I/II study and preliminary results from a phase II study in patients with renal cell cancer. In October 2001, Oncophage was designated as a fast-track product by the Food and Drug Administration in the US for the treatment of renal cell carcinoma. Oncophage is in phase I/II trials in Italy for colorectal cancer (30 patients) and melanoma. The trials in Italy are being conducted at the Istituto dei Tumouri, Milan (in association with Sigma-Tau). Preliminary data from the phase II trial for melanoma was presented at the AACR-NCI-EORTC International Conference in Florida, USA, in October 2001. Oncophage is also in a phase I/II (42 patients) and a phase II trial (84 patients) in the US for renal cell cancer, a phase II trial in the US for non-Hodgkin's lymphoma (35 patients), a phase II trial in the US for sarcoma (20-35 patients), a phase I/II trial in the US for melanoma (36 patients), and phase I/II trials in Germany for gastric (30 patients) and pancreatic cancers. A pilot phase I trial in patients with pancreatic cancer began in the US in 1997 with 5 patients enrolled. In November 2000, Antigenics announced that this trial had been expanded to a phase I/II study which would now include survival as an endpoint and would enroll 5 additional patients. The US trials are being performed at Memorial Sloan-Kettering Cancer Center and the M.D. Anderson Cancer Center. The trials in Germany are being carried out at Johannes Gutenberg-University Hospital, Mainz. Oncophage is an autologous vaccine consisting of

  12. Effect of cinnamomum zeylanicum blume essential oil on the rowth and morphogenesis of some potentially pathogenic Aspergillus species Efeito do óleo essencial de Cinnamomum zeylanicum Blume sobre o crescimento e morfogênese de algumas espécies de Aspergillus potencialmente patogênicas

    Directory of Open Access Journals (Sweden)

    Egberto Santos Carmo


    Full Text Available Cinnamomum zeylanicum Blume is known for a wide range of medicinal properties. This study aimed to assess the interference of C. zeylanicum essential oil on the growth and morphogenesis of some potentially pathogenic Aspergillus species. The essential oil presented strong antifungal effect causing the growth inhibition of the assayed strains and development of large growth inhibition zones. MIC50 and MIC90 values were 40 and 80 µL/mL, respectively. 80, 40 and 20 µL/mL of the oil strongly inhibited the radial mycelial growth of A. niger, A. flavus and A. fumigatus along 14 days. 80 and 40 µL/mL of the oil caused a 100% inhibition of the fungal spore germination. Main morphological changes observed under light microscopy provided by the essential oil in the fungal strains were decreased conidiation, leakage of cytoplasm, loss of pigmentation and disrupted cell structure indicating fungal wall degeneration. It is concluded that C. zeylanicum essential oil could be known as potential antifungal compound, particularly, to protect against the growth of Aspergillus species.Cinnamomum zeylanicum Blume é uma planta conhecida por apresentar ampla variedade de propriedades medicinais. Portanto, este estudo teve por objetivo avaliar a interferência do óleo essencial C. zeylanicum sobre o crescimento e morfogênese de algumas espécies de Aspergillus potencialmente patogênicas. O óleo essencial testado apresentou potente efeito antifúngico demonstrado pela visualização de grandes zonas de inibição de crescimento de todas as linhagens testadas. Os valores de CIM50 e de CIM90 foram 40 e 80 µL/mL, respectivamente. Nas concentrações de 80, 40 e 20 µL/mL o óleo demonstrou um potente efeito fumigante, inibindo o crescimento micelial radial de A. niger, A. flavus e A. fumigatus ao longo de 14 dias de exposição. A 80 e 40 µL/mL o óleo essencial promoveu inibição de 100% da germinação de esporos, das três espécies de Aspergillus citadas

  13. Antigen smuggling in tuberculosis. (United States)

    Hudrisier, Denis; Neyrolles, Olivier


    The importance of CD4 T lymphocytes in immunity to M. tuberculosis is well established; however, how dendritic cells activate T cells in vivo remains obscure. In this issue of Cell Host & Microbe, Srivastava and Ernst (2014) report a mechanism of antigen transfer for efficient activation of antimycobacterial T cells. PMID:24922567

  14. Antigen detection systems (United States)

    Infectious agents or their constituent parts (antigens or nucleic acids) can be detected in fresh, frozen, or fixed tissues or other specimens, using a variety of direct or indirect assays. The assays can be modified to yield the greatest sensitivity and specificity but in most cases a particular m...

  15. Scleral buckle infection with aspergillus flavus

    Directory of Open Access Journals (Sweden)

    Bouhaimed Manal


    Full Text Available Purpose: To present a case of scleral buckle infection with Aspergillus flavus in a tertiary eye center in Saudi Arabia. Methods: A retrospective case report of a 28-year-old Saudi male who presented with a six-month history of conjunctival injection and discharge from the left eye which had undergone uncomplicated conventional retinal detachment surgery, at the King Khaled Eye Specialist Hospital in Riyadh, Saudi Arabia, in the form of cryopexy, subretinal fluid drainage and scleral buckle (grooved segmental sponge and circumferential band with sleeve for a macula on retinal detachment four years earlier. A diagnosis of infected extruded scleral buckle was made and the buckle was removed. Results: The infected scleral buckle was removed under local anesthesia with administration of sub-conjunctival irrigation of 50 mg solution of Vancomycin, and sub-conjunctival injection of 25mg of Vancomycin. Post operative microbiological studies revealed infection with silver staining of moderate Aspergillus flavus hyphae. Visual acuity of the left eye improved from 20/200 before surgery to 20/60 in the two years follow-up visit. Conclusion: This case report indicates the importance of considering infection with multiple organisms - including fungal ones - in cases of scleral buckle infections in our population.

  16. Aspergillus pneumonia in renal transplant recipients

    Institute of Scientific and Technical Information of China (English)

    ZHANG Xiao-dong; HU Xiao-peng; YIN Hang; WANG Wei; ZHANG Xin; MA Lin-lin; WANG Yong


    Background Filamentous fungal infections are associated with a high morbidity and mortality in solid organ transplants.The present study aimed to investigate the aspergillus pneumonia in renal transplant recipients, and its diagnosis as well as treatment.Methods Approximately 2000 cases of renal transplants were retrospectively studied and we focused on cases hospitalized during August 1, 2005 and February 1, 2007, as the study period. The clinical database and electronic records were analyzed. Recently published literature was reviewed.Results There was more diabetes and hypertension in the infected group than in the non-infected group (86% vs 62% and 57% vs 39%, respectively). Eighty-six percent of recipients from the infected group had delayed graft function. Seven cases with aspergillus pneumonia were identified based on either fungal culture or radiology. Of the 7 cases, 4 died in a few days after diagnosis. Liposomal amphotericin B was used as a first-line therapy.Conclusions Incidences of fungal infection are increasing among renal transplant recipients. Early diagnosis and treatment are critical steps in curing aspergillosis.

  17. Aspergillus in the lung: diverse and coincident forms

    International Nuclear Information System (INIS)

    Pulmonary disease caused by the fungus Aspergillus has traditionally been regarded as belonging to one of the following, apparently distinct, entities: saprophytic aspergilloma; allergic bronchopulmonary aspergillosis (ABPA); and invasive aspergillosis (IPA); which may be further categorised as angioinvasive, acute or chronic airway invasive [1]. It is not always obvious that there is overlap between these entities, and that in any given patient more than one Aspergillus-related pathological process can co-exist [2]. The aim of this article is to review the clinical and imaging features of the main categories of Aspergillus-related pulmonary disease and, in particular, to highlight the overlap between them. (orig.)

  18. Pulmonary hypersensitivity to Alternaria and Aspergillus in baker's asthma. (United States)

    Klaustermeyer, W B; Bardana, E J; Hale, F C


    In two cases of baker's asthma pulmonary hypersensitivity was found to the fungi Alternaria and Aspergillus. Provocative bronchial challenge revealed a dual response; an immediate and an Arthus type hypersensitivity to Aspergillus in the first case. A primary binding assay revealed high titres of anti-Aspergillus antibody in the serum. In the second case intradermal and bronchial challenge suggested an immediate type I hypersensitivity response to Alternaria. The suspected organisms were present in the room air of the bakeries. It is suggested that an immunological response to these airborne fungi may have contributed to the pathogenesis of baker's asthma. PMID:561668

  19. Stool Test: H. Pylori Antigen (United States)

    ... All About Food Allergies Stool Test: H. Pylori Antigen KidsHealth > For Parents > Stool Test: H. Pylori Antigen Print A A A Text Size What's in ... sample is used to determine if H. pylori antigens are present in your child's gastrointestinal (GI) system. ...

  20. Effect of gamma radiation on Aspergillus flavus and Aspergillus ochraceus ultrastructure and mycotoxin production

    International Nuclear Information System (INIS)

    The aim of this work was to study the effect of gamma radiation (2 kGy) on Aspergillus flavus and Aspergillus ochraceus ultrastructure. Moreover, the influence on aflatoxin B1 and ochratoxin A production was also observed. Irradiated A. flavus strain showed a dull orangish colony while control strain showed the typical green color. Minor differences were observed on stipes, metulae and conidia size between control and irradiated A. flavus and A. ochraceus strains. Irradiated fungi showed ultrastructural changes on cell wall, plasmalema and cytoplasm levels. The levels of mycotoxins produced by irradiated strains were two times greater than those produced by control strains. Successive transferences of irradiated strains on malt extract agar allowed the fungus to recuperate morphological characteristics. Although minor changes in the fungal morphology were observed, ultrastructural changes at cell wall level and the increase of mycotoxin production ability were observed. Inappropriate storage of irradiated food and feed would allow the development of potentially more toxicogenic fungal propagules.

  1. Effect of gamma radiation on Aspergillus flavus and Aspergillus ochraceus ultrastructure and mycotoxin production (United States)

    Ribeiro, J.; Cavaglieri, L.; Vital, H.; Cristofolini, A.; Merkis, C.; Astoreca, A.; Orlando, J.; Carú, M.; Dalcero, A.; Rosa, C. A. R.


    The aim of this work was to study the effect of gamma radiation (2 kGy) on Aspergillus flavus and Aspergillus ochraceus ultrastructure. Moreover, the influence on aflatoxin B 1 and ochratoxin A production was also observed. Irradiated A. flavus strain showed a dull orangish colony while control strain showed the typical green color. Minor differences were observed on stipes, metulae and conidia size between control and irradiated A. flavus and A. ochraceus strains. Irradiated fungi showed ultrastructural changes on cell wall, plasmalema and cytoplasm levels. The levels of mycotoxins produced by irradiated strains were two times greater than those produced by control strains. Successive transferences of irradiated strains on malt extract agar allowed the fungus to recuperate morphological characteristics. Although minor changes in the fungal morphology were observed, ultrastructural changes at cell wall level and the increase of mycotoxin production ability were observed. Inappropriate storage of irradiated food and feed would allow the development of potentially more toxicogenic fungal propagules.

  2. Aspergillus pragensis sp nov discovered during molecular reidentification of clinical isolates belonging to Aspergillus section Candidi

    DEFF Research Database (Denmark)

    Lyskova, Pavlina; Hubka, Vit; Kolarik, Miroslav;


    The identity of nine clinical isolates recovered from Czech patients and presumptively identified as Aspergillus sp. section Candidi based on colony morphology was revised using sequences of beta-tubulin, calmodulin gene sequence, and internal transcribed spacer rDNA. Six isolates were from...... secondary metabolite analysis was also provided with comparison of metabolite spectrum to other species. Section Candidi now encompasses five species for which a dichotomous key based on colony characteristics is provided. All clinical isolates were tested for susceptibilities to selected antifungal agents...... suspected and proven onychomycosis, one from otitis externa, and two associated with probable invasive aspergillosis. The results showed that one Aspergillus candidus isolate was the cause of otitis externa, and both isolates obtained from sputa of patients with probable invasive aspergillosis were...

  3. A novel fungal fruiting structure formed by Aspergillus niger and Aspergillus carbonarius in grape berries. (United States)

    Pisani, Cristina; Nguyen, Trang Thoaivan; Gubler, Walter Douglas


    Sour rot, is a pre-harvest disease that affects many grape varieties. Sour rot symptoms include initial berry cracking and breakdown of berry tissue. This is a disease complex with many filamentous fungi and bacteria involved, but is usually initiated by Aspergillus niger or Aspergillus carbonarius. Usually, by the time one sees the rot there are many other organisms involved and it is difficult to attribute the disease to one species. In this study two species of Aspergillus were shown to produce a previously unknown fruiting structure in infected berries. The nodulous morphology, bearing conidia, suggests them to be an 'everted polymorphic stroma'. This structure forms freely inside the berry pulp and assumes multiple shapes and sizes, sometimes sclerotium-like in form. It is composed of a mass of vegetative hyphae with or without tissue of the host containing spores or fruiting bodies bearing spores. Artificially inoculated berries placed in soil in winter showed the possible overwintering function of the fruiting body. Inoculated berry clusters on standing vines produced fruiting structures within 21 d post inoculation when wounds were made at veraison or after (July-September). Histological studies confirmed that the fruiting structure was indeed fungal tissue. PMID:26321727

  4. Nonfunctionality of Aspergillus sojae aflR in a Strain of Aspergillus parasiticus with a Disrupted aflR Gene


    Takahashi, Tadashi; Chang, Perng-Kuang; Matsushima, Kenichiro; Yu, Jiujiang; Abe, Keietsu; Bhatnagar, Deepak; Cleveland, Thomas E.; Koyama, Yasuji


    Aspergillus sojae belongs to the Aspergillus section Flavi but does not produce aflatoxins. The functionality of the A. sojae aflR gene (aflRs) was examined by transforming it into an ΔaflR strain of A. parasiticus, derived from a nitrate-nonutilizing, versicolorin A (VERA)-accumulating strain. The A. parasiticus aflR gene (aflRp) transformants produced VERA, but the aflRs transformants did not. Even when aflRs was placed under the control of the amylase gene (amyB) promoter of Aspergillus or...

  5. Immunoassay of antigens

    International Nuclear Information System (INIS)

    A method is described of immunoassay of an antigen in a liquid sample wherein a complex is formed between antigen contained in the said sample and two or more antibody reagents, and the said complex is bound to a solid support by non-covalent bonding as defined herein: and the amount of complex becoming bound to the support is determined; the process employing at least one monoclonal antibody reagent. Labelling methods including radioactive, fluorimetric and enzyme labelling may be used to effect determination of the binding ofthe complex to the solid support. The solid support may take the form of particles, beads, wall-coatings on the reaction vessel or an insert of large surface area. The method is particularly applicable to the assay of TSH, CEA, HCG, alphafeto protein, immunoglobulins, viruses, allergens, bacteria, toxins, drugs and vitamins. Use of monoclonal reagents improves the specificity of the process, and also decreases non-specific binding

  6. Nutrient environment influences competition among Aspergillus flavus genotypes (United States)

    Structures of Aspergillus flavus populations, shaped by intraspecific competition, influence the incidences and severities of crop aflatoxin contamination. Competition for nutrients may be one factor modulating intraspecific interactions, but influences of specific types and concentrations of nutrie...

  7. Aspergillus niger contains the cryptic phylogenetic species A. awamori

    DEFF Research Database (Denmark)

    Perrone, Giancarlo; Stea, Gaetano; Epifani, Filomena;


    . Phylogenetic analyses of sequences generated from portions of three genes coding for the proteins β-tubulin (benA), calmodulin (CaM), and the translation elongation factor-1 alpha (TEF-1α) of a population of A. niger strains isolated from grapes in Europe revealed the presence of a cryptic phylogenetic species......Aspergillus section Nigri is an important group of species for food and medical mycology, and biotechnology. The Aspergillus niger ‘aggregate’ represents its most complicated taxonomic subgroup containing eight morphologically indistinguishable taxa: A. niger, Aspergillus tubingensis, Aspergillus...... mycotoxins ochratoxin A and fumonisin B2, and they also share the production of pyranonigrin A, tensidol B, funalenone, malformins, and naphtho-γ-pyrones. In addition, sequence analysis of four putative A. awamori strains from Japan, used in the koji industrial fermentation, revealed that none of these...

  8. Genetics of Polyketide Metabolism in Aspergillus nidulans

    DEFF Research Database (Denmark)

    Klejnstrup, Marie L.; Frandsen, Rasmus John Normand; Holm, Dorte Koefoed;


    including polyketides. The majority of genes required for production of these metabolites are mostly organized in gene clusters, which often are silent or barely expressed under laboratory conditions, making discovery and analysis difficult. Fortunately, the genome sequences of several filamentous fungi are...... publicly available, greatly facilitating the establishment of links between genes and metabolites. This review covers the attempts being made to trigger the activation of polyketide metabolism in the fungal model organism Aspergillus nidulans. Moreover, it will provide an overview of the pathways where ten...... polyketide synthase genes have been coupled to polyketide products. Therefore, the proposed biosynthesis of the following metabolites will be presented; naphthopyrone, sterigmatocystin, aspyridones, emericellamides, asperthecin, asperfuranone, monodictyphenone/emodin, orsellinic acid, and the austinols....

  9. Microbial transformation of curcumol by Aspergillus niger. (United States)

    Chen, Li-Xia; Zhang, Hui; Zhao, Qian; Yin, Shi-Yu; Zhang, Zhong; Li, Tian-Xian; Qiu, Feng


    Curcumol is a representative index component for the quality control of the essential oil of Curcuma wenyujin Y.H. Chen et C. Ling, an antivirus and anticancer drug in China. Microbial transformation of curcumol (1) by Aspergillus niger AS 3.739 yielded two products. Their structures were elucidated as 3alpha-hydroxycurcumol (2) and 3alpha-(4'-methoxy-succinyloxy)-curcumol (3) by extensive spectroscopic methods including 2D-NMR and HRESI-MS. Among them, 3 is a new compound. Esterification of the substrate with succinic acid is a novel reaction in the field of microbial transformation of natural products. Compound 2, the major transformation product of 1, was a high regio- and stereo-specific hydroxylation product and showed significant antiviral effects. PMID:23513713

  10. Synthesis of lead nanoparticles by Aspergillus species. (United States)

    Pavani, K V; Kumar, N Sunil; Sangameswaran, B B


    In the context of the current demand to develop green technologies in material synthesis, a natural process in the synthesis of lead particles by Aspergillus species to suit such technology is reported. The fungal strain was grown in medium containing different concentrations of lead (0.2-1.5 mM) to determine its resistance to heavy metals. The organism was found to utilize some mechanism and accumulate lead particles outside and inside the cell. The extracellular presence of lead particles in the range of 1.77-5.8 microm was characterized by scanning electron microscopy. The presence of particles of lead in the 5-20 nm size range was found on the cell surface, in the periplasmic space and in the cytoplasm and was analyzed by transmission electron microscopy. PMID:22708348

  11. Production of amylases by Aspergillus tamarii

    Directory of Open Access Journals (Sweden)

    Moreira Fabiana Guillen


    Full Text Available A strain of Aspergillus tamarii, a filamentous fungus isolated from soil, was able to produce both a-amylase and glucoamylase activities in mineral media supplemented with 1% (w/v starch or maltose as the carbon source. Static cultivation led to significantly higher yields than those obtained using shaking culture. The production of amylases was tolerant to a wide range of initial culture pH values (from 4 to 10 and temperature (from 25 to 42oC. Two amylases, one a-amylase and one glucoamylase, were separated by ion exchange chromatography. Both partially purified enzymes had optimal activities at pH values between 4.5 and 6.0 and were stable under acid conditions (pH 4.0-7.0. The enzymes exhibited optimal activities at temperatures between 50o and 60o C and were stable for more than ten hours at 55oC.

  12. Mesenchymal stromal cells mediate Aspergillus hyphal extract-induced allergic airway inflammation by inhibition of the Th17 signaling pathway. (United States)

    Lathrop, Melissa J; Brooks, Elice M; Bonenfant, Nick R; Sokocevic, Dino; Borg, Zachary D; Goodwin, Meagan; Loi, Roberto; Cruz, Fernanda; Dunaway, Chad W; Steele, Chad; Weiss, Daniel J


    Systemic administration of mesenchymal stromal cells (MSCs) suppresses airway inflammation and methacholine-induced airway hyper-responsiveness (AHR) in mouse models of T helper cell (Th) type 2-mediated eosinophilic allergic airway inflammation (AAI); however, the efficacy of MSCs in mouse models of severe Th17-mediated neutrophilic AAI has not yet been demonstrated. We assessed MSC effects in a mouse model of mixed Th2/Th17 AAI produced by mucosal exposure to Aspergillus fumigatus hyphal extract (AHE). Following sensitization produced by oropharyngeal AHE administration, systemic (tail vein) administration of syngeneic MSCs on the first day of challenge significantly reduced acute AHR predominantly through reduction of Th17-mediated airway inflammation. In parallel experiments, MSCs also mitigated AHR when administered during recurrent challenge 10 weeks after initial sensitization and challenge through reduction in systemic Th17-mediated inflammation. Investigation into potential mechanistic actions of MSCs in this model demonstrated that although T regulatory cells were increased in all AHE-treated mice, MSC administration did not alter T regulatory cell numbers in either the acute or recurrent model. Differential induction of interleukin-17a secretion was observed in ex vivo restimulation of mediastinal lymph node mixed-cell cytokine analyses. Although the mechanisms by which MSCs act to decrease inflammation and AHR in this model are not yet fully elucidated, decrease in Th17-mediated airway inflammation appears to play a significant role. These results provide a basis for further investigations of MSC administration as a potential therapeutic approach for severe refractory neutrophilic asthma. PMID:24436442

  13. Studies on Aspergillus Flavus Link. Isolated From Maize in Iran


    Houshyar-Fard Mahmoud; Rouhani Hamid; Falahati-Rastegar Mahrokh; Mahdikhani-Moghaddam Esmat; Malekzadeh-Shafaroudi Saeed; Probst Claudia


    The Aspergillus flavus population structure from maize kernels was examined. During 2011, samples were collected from two main grain maize production areas in Iran (Fars and Ardebil provinces), shortly before harvest. One-hundred nine A. flavus isolates were recovered on Dichloran Rose Bengal Chloramphenicole (DRBC) agar and Aspergillus flavus/parasiticus medium (AFPA) and grouped into morphotypes and Vegetative Compatibility Groups (VCGs) based on morphological (e.g. sclerotia production), p...

  14. New ochratoxin A producing species of Aspergillus section Circumdati

    DEFF Research Database (Denmark)

    Frisvad, Jens Christian; Frank, J.M.; Houbraken, J.A.M.P.; Kuijpers, A.F.A.; Samson, R.A.

    Aspergillus section Circumdati contains species with yellow to ochre conidia and non-black sclerotia that produce at least one of the following extrolites: ochratoxins, penicillic acids, xanthomegnins or melleins. The exception to this is A. robustus, which produces black sclerotia, phototropic...... A: Aspergillus cretensis, A. flocculosus, A. pseudoelegans, A. roseoglobulosus, A. westerdijkiae, A. sulphurous, and Neopetromyces muricatus. Two species produce large or small amounts of ochratoxin A, but less consistently: A. ochraceus and A. sclerotiorum. Ochratoxin production in these species...

  15. Significance and occurrence of fumonisins from Aspergillus niger


    Mogensen, Jesper Mølgaard; Nielsen, Kristian Fog; Larsen, Thomas Ostenfeld; Frisvad, Jens Christian


    Fumonisins is a well-studied group of mycotoxins, mainly produced in maize by Fusarium species. However with the recent discovery of a fumonisin production by Aspergillus niger, other food commodities are at risk, since A. niger is a ubiquitous contaminant of many food and feed products. The objective of this thesis was to determine the significance and occurrence of fumonisins from Aspergillus niger in food, the frequency of fumonisin production in A. niger isolates, as well as studies of th...

  16. Aspergillus Mycoviruses Are Targets and Suppressors of RNA Silencing▿ †


    Hammond, T. M.; Andrewski, M. D.; Roossinck, M J; Keller, N P


    RNA silencing can function as a virus defense mechanism in a diverse range of eukaryotes, and many viruses are capable of suppressing the silencing machinery targeting them. However, the extent to which this occurs between fungal RNA silencing and mycoviruses is unclear. Here, three Aspergillus dsRNA mycoviruses were partially characterized, and their relationship to RNA silencing was investigated. Aspergillus virus 1816 is related to Agaricus bisporus white button mushroom virus 1 and suppre...

  17. Immobilization of Isolated Lipase From Moldy Copra (Aspergillus Oryzae)




    Enzyme immobilization is a recovery technique that has been studied in several years, using support as a media to help enzyme dissolutions to the reaction substrate. Immobilization method used in this study was adsorption method, using specific lipase from Aspergillus oryzae. Lipase was partially purified from the culture supernatant of Aspergillus oryzae. Enzyme was immobilized by adsorbed on silica gel. Studies on free and immobilized lipase systems for determination of op...

  18. Immobilization of Isolated Lipase From Moldy Copra (Aspergillus Oryzae)


    Seniwati Dali; A. B. D. Rauf Patong; M.Noor Jalaluddin; Pirman; Baharuddin Hamzah


    Enzyme immobilization is a recovery technique that has been studied in several years, using support as a media to help enzyme dissolutions to the reaction substrate. Immobilization method used in this study was adsorption method, using specific lipase from Aspergillus oryzae. Lipase was partially purified from the culture supernatant of Aspergillus oryzae. Enzyme was immobilized by adsorbed on silica gel. Studies on free and immobilized lipase systems for determination of optimum pH, optimum ...

  19. Accessory enzymes from Aspergillus involved in xylan and pectin degradation


    Vries, de, G.


    The xylanolytic and pectinolytic enzyme systems from Aspergillus have been the subject of study for many years. Although the main chain cleaving enzymes and their encoding genes have been studied in detail, little information is available about most of the accessory enzymes and their corresponding genes. This thesis describes the purification and characterisation of two accessory enzymes from Aspergillus , feruloyl esterase A (FaeA) andα-glucuronidase A (AguA), and the activities of these enz...

  20. Utilization of Low-Cost Ellagitannins for Ellagic Acid Production and Antimicrobial Phenolics Enhancing By Aspergillus awamorii and Aspergillus oryzae

    International Nuclear Information System (INIS)

    Three fungal strains, Aspergillus awamorii A9, Aspergillus awamorii A23 and Aspergillus oryzae O2, were selected out of ten fungal strains for their activeness in converting pomegranate peel ellagitannins into ellagic acid. When pomegranate peel was fermented by Aspergillus awamorii A9, the highest yields of ellagic acid (7.93±0.23 mg/g solid substrate) and total soluble phenolics (14.61±0.36 mg/g solid substrate) were produced at 5 and 10 days of incubation, respectively. Also, blue berry pomace, red grape pomace, strawberry pomace were evaluated as low cost ellagitannin sources for ellagic acid and soluble phenolics production. The antimicrobial activity of soluble phenolics extracted from fermented pomegranate peel and strawberry pomace was tested against two food-borne pathogens (Escherichia coli and Salmonella typhimurium). This study also revealed that 3 kGy enhanced the activity of antimicrobial phenolics