WorldWideScience

Sample records for asa cssa sssa

  1. The international annual meetings of the American Society of Agronomy (ASA), Crop Science Society of America (CSSA) and Soil Science Society of America (SSSA)

    International Nuclear Information System (INIS)

    Full text: Lee Heng attended and presented two oral papers at the A-3 Symposium on 'Yield Response to Water: Examination of the Role of Crop Models in Predicting Water Use Efficiency'. Both of Lee Heng's oral papers are related to FAO's AquaCrop model, one paper was entitled 'Calibration and testing of FAO AquaCrop model for rainfed and irrigated maize' and the second paper was entitled 'Productivity of soybean-based systems in semi-arid tropics - Testing with AquaCrop'. (author)

  2. ASA branding

    OpenAIRE

    Kirkeby, Kennie; Jakobsen, Christian Yttergren; Birch, Frederik; Dalman, Newsha

    2014-01-01

    This thesis examines the company ASA Trading and how ASA, through branding, have used CSR and social entrepreneurship as a part of their branding. In order to illuminate these subjects, the thesis is based upon theory about branding, CSR, Story Telling and social entrepreneurship. In addition, the thesis uses a qualitative empirical data from interview with CEO of ASA Trading Julian Amery, and a rapport from CSE Roskilde University, 2008. This thesis discusses and analyses ASA’s us...

  3. Soil Science Education: Philosophy and Perspectives. SSSA Special Publication Number 37.

    Science.gov (United States)

    Baveye, Philippe, Ed.; And Others

    Soil science provides the educational framework to integrate components of earth science systems, to understand the causes and consequences of spatial variability, and view dynamic processes impacting ecosystems in a holistic perspective. This book, a special publication of the Soil Science Society of America (SSSA), identifies and analyzes…

  4. Verdsettelse av DOF ASA

    OpenAIRE

    Aalvik, Alexander

    2012-01-01

    Formålet med masteroppgaven er å verdsette selskapet DOF ASA den 31.desember 2010. Estimatet vil bli vurdert i forhold til aksjeprisen på Oslo Børs og tilnærmingen er basert på bruk av relevant informasjon og modeller innenfor temaet verdsettelse. I første del av oppgaven presenteres DOF ASA, og det gis en kort introduksjon av offshore supply industrien i Norge som virksomheten driver innenfor. Selskapene Solstad Offshore ASA og Farstad Shipping ASA danner grunnlaget for bransjen og bruke...

  5. ASA education outreach

    Science.gov (United States)

    Hansen, Uwe J.; Everbach, E. Carr

    2003-04-01

    A number of very successful Hands-on demo sessions for high school students have been a part of regular ASA meetings for some time. In addition, the Education Committee has organized a series of teacher workshops. These workshops are designed to give high school teachers relatively sophisticated tools to enhance their laboratory content. Workshops for teachers in the elementary grades prepare teachers to use music as a vehicle to introduce additional science concepts. Content and methods associated with both workshops will be discussed. Cyberspace outreach by the ASA was accelerated by the establishment of a Home Page Committee, and more recently by the On-Line Education committee, which is creating an educational website. The website provides a fun way for users to access information including acoustics information, history, demos, and links to the Technical Committee's webpages. The ASA has joined other AIP member societies in developing additional mechanisms, including road shows and nightly news spots.

  6. Verdsettelse av Statoil ASA

    OpenAIRE

    Drangsholt, Bjørn Harald

    2011-01-01

    I løpet av denne oppgaven vil jeg utføre en fundamental verdsettelse av Statoil ASA basert på offentlig tilgjengelig informasjon. Med utgangspunkt i en strategisk analyse og en regnskapsanalyse ønsker jeg å finne verdien av Statoil-aksjen. Oppgaven innledes med en kort presentasjon av Statoil ASA, der det gis et innblikk i historie, foretningsområde og organisasjonsstruktur. Deretter følger en metodedel hvor jeg gir en rask innføring i verdsettelsesteori, samt gir en begrunnelse for mitt ...

  7. Verdsetting av Norsk Hydro ASA

    OpenAIRE

    Holmgren, Truls Ekhorn

    2014-01-01

    I denne oppgaven vil jeg finne ut om Norsk Hydro ASAs egenkapitalverdi gjenspeiles i aksjekursen som vi finner på Oslo Børs. Problemstillingen blir da som følger: "Hva er egenkapitalverdien til Norsk Hydro ASA?" Oppgaven begynner med en presentasjon av Norsk Hydro ASA og dets virke. Etterfulgt av en framlegging av aktuell teori innenfor verdsetting. Videre følger en vurdering av selskapets strategiske posisjon. Til den strategiske analysen benyttes rammeverkene Porters Five Forces og PE...

  8. ASA24-Kids-2014 and ASA24-Kids-2012

    Science.gov (United States)

    >ASA24-Kids-2014 was released in February 2014 and researchers can still register new studies in this version of the ASA24® system. A mobile accessible version is in development and is expected to be open to new studies later in 2016.

  9. Photosynthesis of maize and alfalfa during daytime sprinkler irrigation

    OpenAIRE

    Cavero Campo, José; Urrego Pereira, Yenny Fernanda; Fernández, Victoria; Merino, Carlos; Martínez-Cob, Antonio

    2010-01-01

    1 copia .pdf de la presentación original (14 Pags., con Figs. y Fots.). This Presentation was included in 2010 ASA, CSSA, and SSSA International Annual Meeting, Division A03 Agroclimatology & Agronomic Modeling, Session Agroclimatology & Agronomic Modeling: I/Div. A03 Business Meeting (number 263-4). In Wednesday, November 3, 2010: 9:00 AM, Long Beach Convention Center, Room 103A, First Floor.

  10. Adaptive simulated annealing (ASA): Lessons learned

    OpenAIRE

    Ingber, L.

    2000-01-01

    Adaptive simulated annealing (ASA) is a global optimization algorithm based on an associated proof that the parameter space can be sampled much more efficiently than by using other previous simulated annealing algorithms. The author's ASA code has been publicly available for over two years. During this time the author has volunteered to help people via e-mail, and the feedback obtained has been used to further develop the code. Some lessons learned, in particular some which are relevant to ot...

  11. A Brief History of the Soil Science Society of America

    Science.gov (United States)

    Brevik, Eric C.

    2013-04-01

    Career Professional Award. SSSA has also hosted the World Congress of Soil Science in 1960 and 2006. In 2010 SSSA membership was at 6,367, the third highest membership total in SSSA history. SSSAJ published 259 items totaling 2,201 pages. But unlike 1937, SSSAJ is no longer SSSA's only journal. In 2009 Journal of Environmental Quality published 272 items on 2,480 pages, Soil Survey Horizons (renamed Soil Horizons in 2012) published 26 items on 133 pages, Vadose Zone Journal published 116 items on 1,088 pages, and Journal of Natural Resources and Life Sciences Education published 48 items on 250 pages, giving Society journals a total of 721 items published on 6,132 pages. At the end of 2010 SSSA was worth 3,130,163. All of these numbers show significant achievement in the years since the Society's founding, but not all of those years have been rosy. For example, SSSA's membership dropped from an all-time high of 6,402 in 1985 to 5,319 in 2002 and the Society's net worth declined from 2,132,750 in 1999 to 984,866 in 2002. This period from the mid-1980s through the early 2000s has probably been the most challenging so far in SSSA's history. Many changes are also in store going into the future. Over the past few years SSSA has become increasingly independent from ASA. While the two societies (along with the Crop Science Society of America (CSSA)) still maintain close ties, the members of SSSA have expressed a desire to emphasize that soils are more than agronomic. One indication of this increasing independence can be seen in the annual meetings. SSSA met jointly with the Geological Society of America in 2008 and will meet with the Entomological Society of America in 2015. There are also plans for SSSA to meet independently of ASA and CSSA for the first time in 2018. Another indication is the recent rearrangement of the governing structures of ASA, CSSA, and SSSA.

  12. Verdsettelse av Renewable Energy Corporation ASA

    OpenAIRE

    Dahlberg, Jonas; Fredriksen, Marius Sletbakk

    2011-01-01

    I denne bacheloroppgaven har vi hatt verdsettelse som tema, der vi har sett nærmere på Renewable Energy Corporation ASA(REC). Problemstillingen vår har vært: “Hva er verdien av Renewable Energy Corporation ASA 1.1.2011?” REC er en vertikalt integrert bedrift som produserer solenergi. De er et konsern som driver i alle deler av verdikjeden, fra produksjon av silisium – wafere – solceller – solcellepanel – solcellemoduler. Selskapet ble notert på Oslo Børs i 2006 til en aksjekurs på 107,5...

  13. Asa Grant Hilliard III: Scholar Supreme

    Science.gov (United States)

    Watkins, William H.

    2008-01-01

    This integrative review uses two of Asa Grant Hilliard's books, "SBA: The Reawakening of the African Mind" and "The Maroon Within Us: Selected Essays on African American Community Socialization", to discuss aspects of his scholarly legacy in teaching, history, and psychology. His scholarship is provocative. Hilliard rejected the supremacy of the…

  14. ASAS = NASA's Advanced Solid-state Array Spectroradiometer: 1988 -2000

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — The Advanced Solid-State Array Spectroradiometer (ASAS) data collection contains data collected by the ASAS sensor flown aboard NASA aircraft. A fundamental use of...

  15. Asa Gray and Charles Darwin: Corresponding Naturalists

    OpenAIRE

    Browne, Janet E

    2010-01-01

    Recent work on the rise of science in the nineteenth century has encouraged historians to look again at the role of correspondence. Naturalists relied extensively on this form of contact and correspondence was a major element in generating a community of experts who agreed on what comprised valid knowledge. As a leading figure in the development of North American botany, Asa Gray found that letters with botanists and collectors all over the world greatly expanded his areas of influence. La...

  16. Predictive validity of the ASAS classification criteria for axial and peripheral spondyloarthritis after follow-up in the ASAS cohort

    DEFF Research Database (Denmark)

    Sepriano, Alexandre; Landewé, Robert; van der Heijde, Désirée;

    2016-01-01

    OBJECTIVE: To establish the predictive validity of the Assessment of SpondyloArthritis international Society (ASAS) spondyloarthritis (SpA) classification criteria. METHODS: 22 centres (N=909 patients) from the initial 29 ASAS centres (N=975) participated in the ASAS-cohort follow-up study. Patie...

  17. DOF ASA : an offshore service company organized for expansion

    OpenAIRE

    Vad, Jan Tore; Engås, Aleksander

    2010-01-01

    The purpose of this thesis is a valuation of DOF ASA with a thorough analysis of the offshore service market. The valuation is based on public available information up until November 2010, and discussions with CFO Hilde Drønnen at DOF ASA. The market analysis is based on reports and presentations obtained from various Norwegian investment houses that cover the offshore service and subsea market. We will compile and use them as input in a market model. The market analysis conclu...

  18. Italian: AS/A2 Digital Reading Practice Tests 2009

    OpenAIRE

    Bertoni, Silvia; Nocchi, Susanna

    2009-01-01

    AS/A2 Digital Reading Practice Tests 2009 consists of authentic reading material and practice test questions. This resource is ideal for practising, improving and building up students’ reading skills in preparation for the AS/A2 Level exams in the UK.The tests are also suitable practice materials for students preparing for other advanced level exams, such as Irish Leaving Certificate, International Baccalaureate or Advance Placement.

  19. Italian: AS/A2 Digital Listening Practice Tests 2009

    OpenAIRE

    Bertoni, Silvia; Nocchi, Susanna

    2009-01-01

    AS/A2 Digital Listening Comprehension Practice Tests 2009 consists of a book and audio files with authentic listening material and test questions. This book is ideal for practising, improving and building up students’ confidence in listening skills in preparation for the AS Level,A2 Level, the Irish Leaving Certificate and other advanced level exams.

  20. Eitzen Chemical ASA : strategisk regnskapsanalyse og verdsettelse basert syntetisk restrukturering

    OpenAIRE

    Berger, Atle

    2014-01-01

    Denne masterutredningen utfører strategisk regnskapsanalyse og verdsettelse basert på syntetisk restrukturering av Eitzen Chemical ASA (Eitzen Chemical, ECHEM eller selskapet). Utredningen er basert på offentlig tilgjengelig informasjon. Det benyttes fundamental verdsettelsesteknikk som suppleres med substansverdier for å justere verdiestimatet for selskapets konkurssannsynlighet. Utredningen begynner med å presentere Eitzen Chemical og kjemikalietankbransjen, samt hvordan selskapet avvike...

  1. ASAS classification criteria for axial spondyloarthritis: time to modify.

    Science.gov (United States)

    Akkoc, Nurullah; Khan, Muhammad A

    2016-06-01

    The relationship between ankylosing spondylitis and the recently proposed entity called axial spondyloarthritis with its radiographic and non-radiographic forms that have been defined by the Assessment of Spondyloarthritis International Society (ASAS) criteria for axial spondyloarthritis (axSpA), is currently being debated. The Food and Drug Agency (FDA) had criticized the ASAS criteria and the studies which used these criteria to enroll patients in a clinical trial of certolizumab and adalimumab for the treatment of non-radiographic axial spondyloarthritis. The primary aim of classification criteria is to create homogenous patient populations for basic and clinical research. But the multi-arm construct of the ASAS criteria is a potential source of heterogeneity reducing their utility. Criteria sets should be regarded as dynamic concepts open to modifications or updates as our knowledge advances. We provide evidence to conclude that it is time to modify the ASAS Criteria for axSpA, and we propose some of the steps that can be taken to start moving forward in improving the validity of these criteria. PMID:27094940

  2. Nanometer aerosol size analyzer (nASA) and data inversion

    Science.gov (United States)

    Han, Hee Siew

    A fast-response Nanometer Aerosol Size Analyzer (nASA) that is capable of scanning 30 size channels between 3 and 100 nm in a total time of 3 seconds was developed. The analyzer includes a bipolar charger (Po 210), an extended-length Nano DMA, and an electrometer. This combination of components provides particle size spectra at a scan rate of 0.1 second per channel free of uncertainties caused by response-time induced smearing. In addition, because of its thermodynamically stable means of particle detection, the nASA is useful for applications requiring measurements over a broad range of sample pressures and temperatures. Indeed, experimental transfer functions determined for the extended-length Nano-DMA using the Tandem Differential Mobility Analyzer technique indicate the nASA provides good size resolution at pressures as low as 200 Torr, corresponding to measurement at an altitude of 10 km. The second part of this study is devoted to the selection of an accurate data inversion algorithm. From the simulation results, it is found that MICRON provides the most stable solutions with good accuracy and reasonable convergent speed especially when aerosol distribution functions are bi-modal. All subsequent nASA measurement results are inverted using the MICRON algorithm. A second generation nASA was developed for the later series of engine exhaust measurements. Several improvements are implemented to the nASA to enhance its performance and ease of use. First, its physical size is reduced and the capability for controlling the DMA flow rates via computer software is added. The former improves the portability of the instrument and the latter allows the nASA to have an wider aerosol size ranges. Finally, the system was used in the EXperiment to Characterize Aircraft Volatile Aerosol and Trace species Emissions (EXCAVATE) workshop to investigate aerosol size distribution from a Boeing 757 engine. The results show that the aerosol size distributions from the engine are

  3. Effects of acetylsalicylic acid (ASA), ASA plus L-glutamine and L-glutamine on healing of chronic gastric ulcer in the rat.

    Science.gov (United States)

    Okabe, S; Takeuchi, K; Honda, K; Takagi, K

    1976-01-01

    A chronic gastric ulcer model was produced in rats by the subserosal injection of 20% acetic acid solution (0.015 ml) in order to examine whether (1) acetylsalicylic acid (ASA) irritates the chronic gastric ulcer in active or healed or diminished stage, (2) L-glutamine, given together with ASA, inhibits the adverse effect of ASA. Oral ASA 200 mg/kg/day, given in two divided doses for 10 consecutive days, apparently delayed the healing of the gastric ulcer and irritated the healed ulcer to reulcerate. L-Glutamine, 1,500 mg/kg/day, which was given together with ASA in two divided doses, markedly protected the gastric ulcer both in active and healed stages from the deleterious activity of ASA. PMID:955326

  4. 78 FR 32477 - ASA Gold and Precious Metals Limited; Notice of Application

    Science.gov (United States)

    2013-05-30

    .... ASA also seeks relief to exercise in South Africa, Hong Kong, the United Kingdom, Canada, or Australia... COMMISSION ASA Gold and Precious Metals Limited; Notice of Application May 22, 2013. AGENCY: Securities and... Metals Limited (``ASA''), a Bermuda closed-end management investment company registered under section...

  5. Multiples among detached eclipsing binaries from the ASAS catalog

    CERN Document Server

    Hełminiak, K G; Ratajczak, M; Jordán, A; Espinoza, N; Brahm, R; Kambe, E; Ukita, N

    2015-01-01

    For more than three years now we have been conducting a spectroscopic survey of detached eclipsing binaries (DEBs) from the All-Sky Automated Survey (ASAS) database. Thousands of high-resolution spectra of over 300 systems were secured, and used for radial velocity measurements and spectral analysis. In our sample we found a zoo of multiple systems, such as spectroscopic triples and quadruples, visual binaries with eclipsing components, and circumbinary low-mass companions, including sub-stellar-mass candidates

  6. Strategisk analyse og verdsettelse av Farstad Shipping ASA

    OpenAIRE

    Fladset, Marit; Gjendem, Mikael

    2013-01-01

    Hensikten med denne masteroppgaven var å verdsette egenkapitalen til Farstad Shipping ASA pr. 1.1.2013. Verdien ble beregnet ved anvendelse av fundamental verdsettelse hvor strategiske og regnskapsbaserte analyser utgjorde fundamentet. Komparativ- og opsjonsbasert verdsettelse ble benyttet som et supplement. Farstad Shipping er en betydelig aktør i offshore supply bransjen, og er i dag den 6. største aktøren i det internasjonale markedet for store og mellomstore supplyskip. Offshore supply...

  7. Impact of an increasing supply of bioenergy sources on the sustainability of agricul-tural enterprises, evaluated with the Criteria System for Sustainable Agriculture (CSSA); Folgenabschaetzung einer zunehmenden Bereitstellung von Bioenergietraegern auf die Nachhaltigkeit landwirtschaftlicher Unternehmen, bewertet mit dem Kriteriensystem Nachhaltige Landwirtschaft (KSNL)

    Energy Technology Data Exchange (ETDEWEB)

    Breitschuh, Thorsten; Eckert, Hans; Maier, Uta; Gernand, Ulrich; Mueller, Anja [Thueringer Landesanstalt fuer Landwirtschaft (TLL), Jena (Germany); Verband fuer Agrarforschung und Bildung Thueringen e.V., Jena (Germany)

    2009-07-15

    The report investigates how an increasing supply of bioenergy sources affects the sustainability situation of farms at different sites and with different structures. The ''Criteria System for Sustainable Agriculture'' (CSSA) was used as analysis and assessment criteria system. The CSSA is based on 34 selected criteria in the field of economy, environment and social conditions. Each criterion indicates a defined pres-sure or state and evaluates the results on the basis of defined tolerance ranges. In the study short-term scenarios of an increasing provision of bioenergy based on real data from agricultural farms were evaluated with the CSSA system. Altogether, 30 scenarios were analysed. As a result the most sustainable scenario for the supply of bioenergy was identified for each farm considered. Using this approach, the most important adaptation reactions of agricultural enterprises were determined and evaluated. Potential applications of the explained procedure are the ex-ante simulation and ex- ante evaluation of agricultural processes and the creation and evaluation of sup-port programmes. (orig.)

  8. Geriatric Hip Fractures and Inpatient Services: Predicting Hospital Charges Using the ASA Score

    Directory of Open Access Journals (Sweden)

    Rachel V. Thakore

    2014-01-01

    Full Text Available Purpose. To determine if the American Society of Anesthesiologist (ASA score can be used to predict hospital charges for inpatient services. Materials and Methods. A retrospective chart review was conducted at a level I trauma center on 547 patients over the age of 60 who presented with a hip fracture and required operative fixation. Hospital charges associated with inpatient and postoperative services were organized within six categories of care. Analysis of variance and a linear regression model were performed to compare preoperative ASA scores with charges and inpatient services. Results. Inpatient and postoperative charges and services were significantly associated with patients’ ASA scores. Patients with an ASA score of 4 had the highest average inpatient charges of services of $15,555, compared to $10,923 for patients with an ASA score of 2. Patients with an ASA score of 4 had an average of 45.3 hospital services compared to 24.1 for patients with a score of 2. Conclusions. A patient’s ASA score is associated with total and specific hospital charges related to inpatient services. The findings of this study will allow payers to identify the major cost drivers for inpatient services based on a hip fracture patient’s preoperative physical status.

  9. Geriatric Hip Fractures and Inpatient Services: Predicting Hospital Charges Using the ASA Score.

    Science.gov (United States)

    Thakore, Rachel V; Lee, Young M; Sathiyakumar, Vasanth; Obremskey, William T; Sethi, Manish K

    2014-01-01

    Purpose. To determine if the American Society of Anesthesiologist (ASA) score can be used to predict hospital charges for inpatient services. Materials and Methods. A retrospective chart review was conducted at a level I trauma center on 547 patients over the age of 60 who presented with a hip fracture and required operative fixation. Hospital charges associated with inpatient and postoperative services were organized within six categories of care. Analysis of variance and a linear regression model were performed to compare preoperative ASA scores with charges and inpatient services. Results. Inpatient and postoperative charges and services were significantly associated with patients' ASA scores. Patients with an ASA score of 4 had the highest average inpatient charges of services of $15,555, compared to $10,923 for patients with an ASA score of 2. Patients with an ASA score of 4 had an average of 45.3 hospital services compared to 24.1 for patients with a score of 2. Conclusions. A patient's ASA score is associated with total and specific hospital charges related to inpatient services. The findings of this study will allow payers to identify the major cost drivers for inpatient services based on a hip fracture patient's preoperative physical status. PMID:24876836

  10. The Best and the Brightest: Tidal Disruption Events Discovered by ASAS-SN

    Science.gov (United States)

    Warren-Son Holoien, Thomas; ASAS-SN

    2016-01-01

    Even today only human eyes scan the entire optical sky for the violent, variable, and transient events that shape our universe. The All-Sky Automated Survey for SuperNovae (ASAS-SN or "Assassin") is changing this by monitoring the visible sky to 17th magnitude every 2-3 days using multiple telescopes in the northern and southern hemispheres. Having been in operation for two years, ASAS-SN is discovering new transient objects daily, and while the primary goal of ASAS-SN is a complete survey of bright, nearby supernovae, ASAS-SN also discovers many other interesting nearby transients. Notably, ASAS-SN has discovered three bright tidal disruption events (TDEs), the three closest such events ever discovered at optical wavelengths, providing the opportunity to obtain detailed follow-up data at many wavelengths. ASAS-SN is discovering roughly 1 TDE for every 60 Type Ia supernovae, a rate that is significantly higher than other surveys. By virtue of their brightness, TDEs discovered by ASAS-SN can also be studied in unprecedented detail for many months, allowing deeper insight into their physics.

  11. Crystallization and preliminary X-ray diffraction studies of AsaP1_E294A and AsaP1_E294Q, two inactive mutants of the toxic zinc metallopeptidase AsaP1 from Aeromonas salmonicida subsp. achromogenes

    OpenAIRE

    Bogdanović, Xenia; Singh, Rajesh Kumar; Hentschke, Johanna; Gudmundsdóttir, Bjarnheidur K.; Hinrichs, Winfried

    2009-01-01

    Crystallization and preliminary X-ray diffraction studies of AsaP1_E294A and AsaP1_E294Q, two inactive mutants of the toxic zinc metallopeptidase AsaP1 from A. salmonicida subsp. achromogenes, are reported.

  12. ASA conference on radiation and health, Coolfont VI: Final report

    International Nuclear Information System (INIS)

    The 1986 ASA Conference on Radiation and Health (Coolfont VI) continued the procedure established in 1981 of holding forenoon and evening sessions, leaving afternoons free for discussion and relaxation. One exception was made this year in that Michael and Marie Stoline were invited to discuss the Chernobyl Disaster on Monday afternoon. The program consisted of the following topics: a general overview of radiation and health problems; cytogenetics and radiation (human and animal studies and statistical analysis of dose-response curves); uranium and health effects, including continuing emphasis on radon, which has attracted considerable national interest lately; epidemiologic studies of workers at nuclear power plants and an uranium processing plant; the latest assessment of atomic bomb dosimetry. These Coolfont Conferences provide an excellent environment for an interchange of ideas and information in an assemblage of scientists from a variety of disciplines. Unfortunately there is one important factor which limits this interchange: language. In order to overcome the difficulty of statisticians understanding nuclear scientists and nuclear scientists understanding statisticians, I suggested one of two procedures: each group prepare a set of commonly used terms with definitions which would be understood by the other group(s); have an introductory session in which each group attempts to explain its language to the other group(s). This problem of communication is even more serious when scientists attempt to explain their research efforts to the general public. The Coolfont Conferences on Radiation and Health should be ideal forums for development of a language which could be understood by the general public as well as different scientific groups. This document contains the abstracts of 12 presented papers

  13. ASA conference on radiation and health: Coolfont 7: Final report

    International Nuclear Information System (INIS)

    These proceedings provide a summary of papers presented at the seventh annual ASA Conference on Radiation and Health, held at the Coolfont Conference Center in Berkeley Springs, West Virginia. More than forty scientists, including statisticians, epidemiologists, biologists, and physicists, participated in the conference. The 1987 conference focused on lung cancer risks, especially lung cancer risks due to radon. The BEIR IV report, which addresses health risks of radon and other internally deposited alpha-emitters, was summarized early in the conference. Results of analyses of data on miners in Colorado and in New Mexico were presented, as well as analyses of combined data from several studies, which were used as the basis of estimates in the BEIR IV report. Statistical issues related to appropriate analysis of chronic exposure and of smoking data received considerable attention and discussion. Papers describing models for lung cancer risks based on exposure to cigarette smoke, radiation, and other substances provided insights into general understanding of lung cancer mechanisms. Carcinogenic models were also the subject of a presentation on radiation-induced skin cancer in humans and animals. In addition, relevant data on animal experiments involving radon exposure were summarized. Understanding risks requires relating them to dose, and thus the presentation on dosimetry, both for miner populations and for residents of US homes, made an important contribution to the conference. Presentations on current efforts at the state and national level to assess radon levels in US homes were also of considerable interest to the participants. Individual papers were processed separately for the data base

  14. ASA Kindlustus loodab lepingud kahe nädalaga Tšiili firmale anda / Margus Simson

    Index Scriptorium Estoniae

    Simson, Margus

    1999-01-01

    ASA Kindlustus ja AB Elukindlustus loodavad, et seltside tegevuslitsentside tühistamine lükatakse edasi veel kahe nädala võrra, kindlustusportfellide üleandmine Tšiili firmale Pacific Overseas Group

  15. BOREAS RSS-2 Level-1B ASAS Image Data: At-Sensor Radiance in BSQ Format

    Science.gov (United States)

    Russell, C.; Hall, Forrest G. (Editor); Nickeson, Jaime (Editor); Dabney, P. W.; Kovalick, W.; Graham, D.; Bur, Michael; Irons, James R.; Tierney, M.

    2000-01-01

    The BOREAS RSS-2 team used the ASAS instrument, mounted on the NASA C-130 aircraft, to create at-sensor radiance images of various sites as a function of spectral wavelength, view geometry (combinations of view zenith angle, view azimuth angle, solar zenith angle, and solar azimuth angle), and altitude. The level-1b ASAS images of the BOREAS study areas were collected from April to September 1994 and March to July 1996.

  16. Anaesthesia related mortality in ASA-1 and 2 patients as a quality improvement indicator

    International Nuclear Information System (INIS)

    Quality and safety in anesthesia is usually monitored by analysis of perioperative mortality-morbidity and incidents. Clinical quality indicator, death within 48 hours of anaesthesia exposure is considered to be a flag that can alert to possible problems in individual patient care. The measurement of perioperative mortality as a quality indicator is a continuous peer reviewed quality improvement activity. Medical records and morbidity and mortality files were reviewed to see the trends and finding the benchmark of mortality in ASA-1 and 2 patient who died between 1992-2006 within 48 hours of anaesthesia exposure. Mortality in class 1 was nil. Anaesthetic mortality in ASA-1 and 2 patients were 0.35 per 10,000 and 0.74 per 10,000 of ASA-2 patient's volume. Anaesthesia-related mortality was 0.17 per 10,000 and 0.37 per 10,000 of ASA-2 patient's volume which is almost double of the overall calculated incidence. We suggest continuing monitoring of anaesthesia related mortality as a continuous quality indicator in developing countries. The reporting and analyzing of data according to the ASA status volume should be taken as a denominator. The available benchmark will help in evaluating the confounding factors and perioperative care of a particular group of patients. (author)

  17. The ASAS-SN Bright Supernova Catalog I: 2013-2014

    CERN Document Server

    Holoien, T W -S; Kochanek, C S; Shappee, B J; Prieto, J L; Brimacombe, J; Bersier, D; Bishop, D W; Dong, Subo; Brown, J S; Danilet, A B; Simonian, G V; Basu, U; Beacom, J F; Falco, E; Pojmanski, G; Skowron, D M; Wozniak, P R; Avila, C G; Conseil, E; Contreras, C; Cruz, I; Fernandez, J M; Koff, R A; Guo, Zhen; Herczeg, G J; Hissong, J; Hsiao, E Y; Jose, J; Kiyota, S; Long, Feng; Monard, L A G; Nicholls, B; Nicolas, J; Wiethoff, W S

    2016-01-01

    We present basic statistics for all supernovae discovered by the All-Sky Automated Survey for SuperNovae (ASAS-SN) during its first year-and-a-half of operations, spanning 2013 and 2014. We also present the same information for all other bright ($m_V\\leq17$), spectroscopically confirmed supernovae discovered from 2014 May 1 through the end of 2014, providing a comparison to the ASAS-SN sample starting from the point where ASAS-SN became operational in both hemispheres. In addition, we present collected redshifts and near-UV through IR magnitudes, where available, for all host galaxies of the bright supernovae in both samples. This work represents a comprehensive catalog of bright supernovae and their hosts from multiple professional and amateur sources, allowing for population studies that were not previously possible because the all-sky emphasis of ASAS-SN redresses most previously existing biases. In particular, ASAS-SN systematically finds supernovae closer to the centers of host galaxies than either other...

  18. Pharmacokinetics and tissue distribution of 14C-5-aminosalicylic acid (14C-5-ASA) in rats

    International Nuclear Information System (INIS)

    5-Aminosalicylic acid (5-ASA) is effective in the treatment of ulcerative colitis and Crohn's disease. As part of a preclinical metabolism profile with 5-ASA, we evaluated the tissue level and distribution of 14C-5-ASA in rats. Biodistribution of 14C-radioactivity was determined in the major organs of rats after a single oral dose (34 mg/kg; 15 uci/rat). Data from tissue area under the curve (AUC 0-72) indicated that the highest amounts of radioactivity were retained in cecum (481.1 hr.ug.equ/gm), colon-rectum (178.5 hr.ug.equ/gm), ileum (166.7 hr.ug.equ/gm), jejunum (65.5 hr.ug.equ/gm), followed by kidneys (58.0 hr.ug.equ/gm) and liver (14.8 hr.ug.equ/gm). The radioactivity retained in tissues at 72 hours postdose was wither nondetectable or less than 0.1 ppm. The radioactivity concentration in blood was highest at 0.5 hr (tmax) postdose and the terminal half-life (t1/2) of 14C-radioactivity (5-ASA + metabolite) was 2.7 hours. 14C-5-ASA is absorbed and distributed in the body. The greatest amount of 14C-radioactivity was found in the stomach and GI tract. 14C-5-ASA was eliminated completely (44.9% in the urine, 51.7% in the feces) 72 hours after administration without significant tissue retention

  19. All Source Analysis System (ASAS): Migration from VAX to Alpha AXP computer systems

    Science.gov (United States)

    Sjoholm-Sierchio, Michael J.; Friedman, Steven Z. (Editor)

    1994-01-01

    The Jet Propulsion Laboratory's (JPL's) experience migrating existing VAX applications to Digital Equipment Corporation's new Alpha AXP processor is covered. The rapid development approach used during the 10-month period required to migrate the All Source Analysis System (ASAS), 1.5 million lines of FORTRAN, C, and Ada code, is also covered. ASAS, an automated tactical intelligence system, was developed by the Jet Propulsion Laboratory for the U. S. Army. Other benefits achieved as a result of the significant performance improvements provided by Alpha AXP platform are also described.

  20. VODENJE EVIDENCE DELOVNEGA ČASA S POMOČJO PAMETNE URE SAMSUNG GEAR S

    OpenAIRE

    Štravs, Rok

    2015-01-01

    Diplomsko delo obsega raziskavo na področju vodenja evidence delovnega časa delavcev ter izdelavo aplikacije. Vodenje delovnega časa temelji na dveh skupinah, in sicer skupini delavcev in delodajalcev. Vsak delavec se lahko prijavi in odjavi z dela ter ima možnost vpogleda v svoje opravljeno delo. Delodajalci imajo omogočen nadzor in pregled nad opravljenim delov vseh svojih delavcev. Pregled dela omogoča spletna aplikacija izdelana v tehnologiji ASP.NET MVC. Prijava in odjava na delo pa se o...

  1. Crystallization and preliminary X-ray diffraction studies of AsaP1-E294A and AsaP1-E294Q, two inactive mutants of the toxic zinc metallopeptidase AsaP1 from Aeromonas salmonicida subsp. achromogenes

    International Nuclear Information System (INIS)

    Crystallization and preliminary X-ray diffraction studies of AsaP1-E294A and AsaP1-E294Q, two inactive mutants of the toxic zinc metallopeptidase AsaP1 from A. salmonicida subsp. achromogenes, are reported. Two mutants of the toxic extracellular zinc endopeptidase AsaP1 (AsaP1-E294Q and AsaP1-E294A) of Aeromonas salmonicida subsp. achromogenes were expressed in Escherichia coli and crystallized by the vapour-diffusion method. Crystals were obtained using several precipitants and different protein concentrations. Protein crystals were found in a monoclinic (C2) as well as an orthorhombic (P212121) space group. The crystals belonging to the monoclinic space group C2 had unit-cell parameters a = 103.4, b = 70.9, c = 54.9 Å, β = 109.3° for AsaP1-E294A, and a = 98.5, b = 74.5, c = 54.7 Å, β = 112.4° for AsaP1-E294Q. The unit-cell parameters of the orthorhombic crystal obtained for AsaP1-E294A were a = 57.9, b = 60.2, c = 183.6 Å. The crystals of the two different mutants diffracted X-rays beyond 2.0 Å resolution

  2. Making a Theist out of Darwin: Asa Gray's Post-Darwinian Natural Theology

    Science.gov (United States)

    Hunter, T. Russell

    2012-01-01

    In March of 1860 the eminent Harvard Botanist and orthodox Christian Asa Gray began promoting the Origin of Species in hopes of securing a fair examination of Darwin's evolutionary theory among theistic naturalists. To this end, Gray sought to demonstrate that Darwin had not written atheistically and that his theory of evolution by natural…

  3. The Scholarship of Dr. Asa G. Hilliard, III: Implications for Black Principal Leadership

    Science.gov (United States)

    Tillman, Linda C.

    2008-01-01

    For over 40 years the scholarship of Dr. Asa G. Hilliard has impacted the fields of educational psychology, testing and measurement, teacher education, and African and African American history. Dr. Hilliard was also concerned about school leadership, and much of his work is closely aligned with current discussions about school reform and…

  4. Modest phenotypic improvements in ASA-deficient mice with only one UDP-galactose:ceramide-galactosyltransferase gene

    Directory of Open Access Journals (Sweden)

    De Deyn PP

    2006-08-01

    Full Text Available Summary Background Arylsulfatase A (ASA-deficient mice are a model for the lysosomal storage disorder metachromatic leukodystrophy. This lipidosis is characterised by the lysosomal accumulation of the sphingolipid sulfatide. Storage of this lipid is associated with progressive demyelination. We have mated ASA-deficient mice with mice heterozygous for a non-functional allele of UDP-galactose:ceramide-galactosyltransferase (CGT. This deficiency is known to lead to a decreased synthesis of galactosylceramide and sulfatide, which should reduce sulfatide storage and improve pathology in ASA-deficient mice. Results ASA-/- CGT+/- mice, however, showed no detectable decrease in sulfatide storage. Neuronal degeneration of cells in the spiral ganglion of the inner ear, however, was decreased. Behavioural tests showed small but clear improvements of the phenotype in ASA-/- CGT+/- mice. Conclusion Thus the reduction of galactosylceramide and sulfatide biosynthesis by genetic means overall causes modest improvements of pathology.

  5. Quorum sensing in Aeromonas salmonicida subsp. achromogenes and the effect of the autoinducer synthase AsaI on bacterial virulence

    DEFF Research Database (Denmark)

    Schwenteit, Johanna; Gram, Lone; Nielsen, Kristian Fog;

    2011-01-01

    Ideficient mutant was 20-fold higher than that of the isogenic wt strain and the mean day to death of the mutant was significantly prolonged. Furthermore, the expression of two virulence factors (a toxic protease, AsaP1, and a cytotoxic factor) and a brown pigment were reduced in the mutant. AsaP1 productionwas...... an important virulence factor, AsaP1, without affecting bacterial growth, makes A. salmonicida subsp. achromogenes an interesting target organism to study the effects of QS in disease development and QSI in disease control.......The Gram-negative fish pathogenic bacterium Aeromonas salmonicida possesses the LuxIRtype quorum sensing (QS) system, termed AsaIR. In this study the role of QS in A. salmonicida subsp. achromogenes virulence and pigment production was investigated. Five wild-type Asa strains induced the N...

  6. The influence of the combined treatment with Vadimezan (ASA404 and taxol on the growth of U251 glioblastoma xenografts

    Directory of Open Access Journals (Sweden)

    Milanović Dušan

    2012-06-01

    Full Text Available Abstract Background One of the most important biological characteristics of Glioblastoma multiforme (GBM is high vascular density. Vadimezan (ASA404, DMXAA belongs to the class of small molecule vascular disrupting agents (VDA that cause disruption of established tumor vessels and subsequent tumor hemorrhagic necrosis. Its selective antivascular effect is mediated by intratumoral induction of several cytokines including tumor necrosis factor-α (TNF-α, granulocyte-colony-stimulating factor (G-CSF, interleukin 6 (IL-6 and macrophage inflammatory protein 1α (MIP-1α. Preclinical studies have demonstrated that ASA404 acts synergistically with taxanes. In this study, we investigated if treatment of mice bearing U251 human glioblastoma xenografts with ASA404 and taxol may be synergistic. Therapy response was evaluated by measuring changes in tumor size and metabolic activity using 18F-FDG PET (Fluorodeoxyglucose - positron emision tomography imaging. Methods U251 cells were inoculated s.c. in the right hind limb of NMRI-Foxn1nu athymic female nude mice. Animals were randomly assigned into 4 groups (7–9 animals/group for treatment: control, taxol, ASA404, and ASA404 plus taxol. The animals received either a single dose of taxol (10 mg/kg, ASA404 (27.5 mg/kg, or taxol (10 mg/kg plus ASA404 (27.5 mg/kg administered i.p.; ASA404 was administred 24 h after the treatment with taxol. 4 and 24 h after treatment with ASA404 (28 and 48 h hours after treatment with taxol 18 F-FDG PET scans were performed. Results The treatment with taxol did not affect the tumor growth in comparison to untreated controls. The treatment of animals with single dose ASA404 alone or in combination with taxol caused a significant delay in tumor growth. The combined treatment did not decrease the growth of the xenografts significantly more than ASA404 alone, but early changes in tumor 18 F-FDG uptake preceded subsequent growth inhibition. The tumor weights

  7. The influence of the combined treatment with Vadimezan (ASA404) and taxol on the growth of U251 glioblastoma xenografts

    International Nuclear Information System (INIS)

    One of the most important biological characteristics of Glioblastoma multiforme (GBM) is high vascular density. Vadimezan (ASA404, DMXAA) belongs to the class of small molecule vascular disrupting agents (VDA) that cause disruption of established tumor vessels and subsequent tumor hemorrhagic necrosis. Its selective antivascular effect is mediated by intratumoral induction of several cytokines including tumor necrosis factor-α (TNF-α), granulocyte-colony-stimulating factor (G-CSF), interleukin 6 (IL-6) and macrophage inflammatory protein 1α (MIP-1α). Preclinical studies have demonstrated that ASA404 acts synergistically with taxanes. In this study, we investigated if treatment of mice bearing U251 human glioblastoma xenografts with ASA404 and taxol may be synergistic. Therapy response was evaluated by measuring changes in tumor size and metabolic activity using 18F-FDG PET (Fluorodeoxyglucose - positron emision tomography) imaging. U251 cells were inoculated s.c. in the right hind limb of NMRI-Foxn1nu athymic female nude mice. Animals were randomly assigned into 4 groups (7–9 animals/group) for treatment: control, taxol, ASA404, and ASA404 plus taxol. The animals received either a single dose of taxol (10 mg/kg), ASA404 (27.5 mg/kg), or taxol (10 mg/kg) plus ASA404 (27.5 mg/kg) administered i.p.; ASA404 was administred 24 h after the treatment with taxol. 4 and 24 h after treatment with ASA404 (28 and 48 h hours after treatment with taxol) 18 F-FDG PET scans were performed. The treatment with taxol did not affect the tumor growth in comparison to untreated controls. The treatment of animals with single dose ASA404 alone or in combination with taxol caused a significant delay in tumor growth. The combined treatment did not decrease the growth of the xenografts significantly more than ASA404 alone, but early changes in tumor 18 F-FDG uptake preceded subsequent growth inhibition. The tumor weights, which were determined at the end of treatment, were lower in

  8. Dose-Related Effects of Acetylsalicylic acid (ASA) on Gamma Radiation-Induced Teratogenicity in Pregnant Albino Rats

    International Nuclear Information System (INIS)

    Reviews of acetylsalicylic acid (ASA), a widely used nonsteroidal anti- inflammatory drug, has consistently suggested a possible association between prenatal ASA ingestion and adverse effects in the pregnant mothers and their developing fetuses. The objective of the current study was to comprehensively define the effect of relatively low and high doses of ASA (25 mg/kg body wt. and 200 mg/kg body wt. respectively) on gestating rats and their possible impact on the irradiated ones. Therefore 36 pregnant rats were randomly divided into 6 equal groups. Three rat groups were daily orally gavaged from the 7th to the 18th gestational days with: distilled water (Group 1), 25 mg/kg body wt. ASA (Group 2) and 200 mg/kg body wt. ASA (Group 3). The other three groups similarly received the same previous treatments besides 2 Gy whole body gamma irradiation of each, to serve as: Group 4 (distilled water + irradiation), Group 5 (25 mg/kg body wt. ASA + irradiation) and Group 6 (200 mg/kg body wt. ASA + irradiation). All rat groups were sacrificed on the 20th day of pregnancy and the uterine contents were examined. The lower ASA dose (25 mg/kg body wt.) treated group (Group 2) displayed healthy mothers and fetuses whereas that of the higher dose (200 mg/kg body wt.) (Group 3) despite not showing significant maternal or fetal mortalities, yet the intrauterine contents presented fetal developmental disorders including stunted growth and resorption together with some head and limb anomalies including plagiocephaly, marked acampsia and acrocontracture. Meanwhile, results have unexpectedly shown a radioprotective role of the lower ASA dose (25 mg/kg. body wt.) (Group 5) to pregnant rats and their fetuses as inspected by its efficacy in retrieving the radiation induced maternal weight loss together with its noticeable ameliorating effects on the intrauterine lethality of the affected fetuses and their externally detected abnormalities in addition toits effectiveness in retaining some

  9. Entry and operation modes of international oil companies : focus on Statoil ASA

    OpenAIRE

    Skogekker, Marius Haug

    2009-01-01

    This paper examines entry and operation modes of international oil companies on the Norwegian Continental Shelf, in the Gulf of Mexico, in Brazil and in Russia. The theoretical basis is the Integrated Transaction Cost Economics Model, and the focus is on implementation of company resources and capabilities in order to achieve optimal performance. The analysis is based on information of the Norwegian company Statoil ASA. The discussion concern; which organizational form is optimal ...

  10. Geriatric Hip Fractures and Inpatient Services: Predicting Hospital Charges Using the ASA Score

    OpenAIRE

    Thakore, Rachel V.; Young M. Lee; Vasanth Sathiyakumar; Obremskey, William T.; Sethi, Manish K.

    2014-01-01

    Purpose. To determine if the American Society of Anesthesiologist (ASA) score can be used to predict hospital charges for inpatient services. Materials and Methods. A retrospective chart review was conducted at a level I trauma center on 547 patients over the age of 60 who presented with a hip fracture and required operative fixation. Hospital charges associated with inpatient and postoperative services were organized within six categories of care. Analysis of variance and a linear regression...

  11. Human brucellosis mimicking axial spondyloarthritis: a challenge for rheumatologists when applying the 2009 ASAS criteria.

    Science.gov (United States)

    Ye, Cong; Shen, Gui-Fen; Li, Shou-Xin; Dong, Ling-Li; Yu, Yi-Kai; Tu, Wei; Zhu, Ying-Zi; Hu, Shao-Xian

    2016-06-01

    Although the development of the 2009 SpA classification criteria by Assessment of SpondyloArthritis international Society (ASAS) represents an important step towards a better definition of the early disease stage particularly in axial spondyloarthritis (axSpA), the specificity of the criteria has been criticized these days. As the commonest zoonotic infection worldwide, human brucellosis can mimic a large number of diseases, including SpA. This study was performed to determine the frequency of rheumatologic manifestations in patients with brucellosis and the chance of misdiagnosing them as having axSpA in central China. The results showed that clinical manifestations of axSpA could be observed in brucellosis. Over half of patients had back pain, and one fifth of the patients with back pain were less than 45 years old at onset and had the symptom for more than 3 months. Two young males were falsely classified as suffering from axSpA according to the ASAS criteria, and one with MRI proved sacroiliitis was once given Etanercept for treatment. Therefore, differential diagnosis including human brucellosis should always be kept in mind when applying the ASAS criteria, even in traditionally non-endemic areas. PMID:27376805

  12. CONFRONTING THE VULNERABILITY AND SOCIAL defencelessness: THE EXPERIENCE OF THE JOINT Brazilian semiarid region (ASA

    Directory of Open Access Journals (Sweden)

    Uende Aparecida Figueiredo Gomes

    2012-08-01

    Full Text Available  Este trabalho tem por objetivo apresentar e discutir as ações do Programa de Formação e Mobilização Social para Convivência com o Semiárido – Um milhão de Cisternas Rurais (P1MC e o trabalho realizado pela Articulação no Semiárido Brasileiro (ASA. Para avaliar as ações do programa foram realizadas entrevistas abertas com gestor do Ministério do Desenvolvimento Social e Combate à Fome, com membro da coordenação da ASA e com um beneficiário integrante do Movimento dos Trabalhadores Rurais Sem Terra. A análise dos dados indica que as ações da ASA têm sido efetivas ao instituírem práticas de convivência com o semiárido por meio de tecnologias de coleta e armazenamento de água de chuva, no entanto, o fortalecimento político das populações beneficiadas pelas ações ainda permanece como desafio.

  13. The Curious Case of ASAS J174600-2321.3: an Eclipsing Symbiotic Nova in Outburst?

    CERN Document Server

    Huemmerich, Stefan; Tisserand, Patrick; Bernhard, Klaus

    2015-01-01

    The star ASAS J174600-2321.3 was found to exhibit peculiar photometric variability (conspicuous brightening of about 4 magnitudes (V), fast luminosity declines, intrinsic pulsations). It was rejected as an RCB candidate in recent investigations on spectroscopic grounds. We have collected and present all available data from public sky surveys, photometric catalogues, and the literature. From an analysis of these data, we have identified ASAS J174600-2321.3 as a long-period eclipsing binary (Porb = 1011.5 days). The primary star, which is probably a white dwarf, is currently in outburst and exhibits the spectral characteristics of a reddened, early F-type supergiant; the secondary star is a giant of spectral type late M. We discuss the possible origin of the observed brightening, which is related to the primary component. ASAS J174600-2321.3 is most certainly an eclipsing symbiotic binary - probably a symbiotic nova of GCVS type NC - that is currently in outburst. However, further photometric and spectroscopic ...

  14. The Pre-Main-Sequence Eclipsing Binary ASAS J052821+0338.5

    CERN Document Server

    Stempels, H C; Stassun, K G; Holtzman, J; Dunstone, N; Glowienka, L; Frandsen, S

    2008-01-01

    In this paper we present the first results of a detailed spectroscopic and photometric analysis of the V = 11.7m eclipsing binary ASAS J052821+0338.5. With the FIES spectrograph at the Nordic Optical Telescope we have obtained a series of high-resolution spectra (R=47000) covering the entire orbit of the system. In addition we obtained simultaneous broadband photometry from three small aperture telescopes. From these spectroscopic and photometric data we have derived the system's orbital parameters and determined the fundamental stellar parameters of the two components. Our results indicate that ASAS J052821+0338.5 is a K1/K3 pre-main-sequence eclipsing binary, with component masses of 1.38 M_sun and 1.33 M_sun and a period of 3.87 days, located at a distance of 280 +/- 30 pc. The kinematics, physical location and the evolutionary status of the two stars suggest that ASAS J052821+0338.5 is a member of the approximately 11 Myr old Orion OB1a subassociation. The systems also exhibits smooth 0.15m out-of-eclipse...

  15. First Light Curve Analyses of Binary Systems AO Aqr, CW Aqr and ASAS 012206-4924.7

    CERN Document Server

    Ulas, Burak

    2015-01-01

    Using the data from the public database of the All Sky Automated Survey ({\\tt ASAS}) we performed the very first light curve analyses of the three eclipsing binary systems \\astrobj{AO~Aqr}, \\astrobj{CW~Aqr} and \\astrobj{ASAS~012206-4924.7}. The physical parameters of the systems were determined by the {\\tt PHOEBE} software. From an analysis of the ASAS data it was concluded that AO~Aqr was found to be a contact binary system while CW~Aqr and ASAS~012206-4924.7 were found to be near--contact and detached binaries, respectively. Finally, the locations of the components, corresponding to the estimated physical parameters, in the HR diagram were also discussed.

  16. Influence of pre-anaesthetic thoracic radiographs on ASA physical status classification and anaesthetic protocols in traumatized dogs and cats

    International Nuclear Information System (INIS)

    The purpose of this study was to evaluate if pre-anaesthetic thoracic radiographs contribute to the anaesthetic management of trauma patients by comparing American Society of Anesthesiologists Physical Status Classification (ASA grade) with and without information from thoracic radiography findings. Case records of 157 dogs and cats being anaesthetized with or without post-traumatic, pre-anaesthetic chest radiographs were retrospectively evaluated for clinical parameters, radiographic abnormalities and anaesthetic protocol. Animals were retrospectively assigned an ASA grade. ASA grades, clinical signs of respiratory abnormalities and anaesthesia protocols were compared between animals with and without chest radiographs. The group of animals without pre-anaesthetic radiographs was anaesthetized earlier after trauma and showed less respiratory abnormalities at presentation. The retrospectively evaluated ASA grade significantly increased with the information from thoracic radiography. Animals with a higher ASA grade were less frequently mechanically ventilated. Pre-anaesthetic radiographs may provide important information to assess the ASA grade in traumatized patients and may therefore influence the anesthesia protocol

  17. A Nanometer Aerosol Size Analyzer (nASA) for Rapid Measurement of High-concentration Size Distributions

    International Nuclear Information System (INIS)

    We have developed a fast-response nanometer aerosol size analyzer (nASA) that is capable of scanning 30 size channels between 3 and 100 nm in a total time of 3 s. The analyzer includes a bipolar charger (Po210), an extended-length nanometer differential mobility analyzer (Nano-DMA), and an electrometer (TSI 3068). This combination of components provides particle size spectra at a scan rate of 0.1 s per channel free of uncertainties caused by response-time-induced smearing. The nASA thus offers a fast response for aerosol size distribution measurements in high-concentration conditions and also eliminates the need for applying a de-smearing algorithm to resulting data. In addition, because of its thermodynamically stable means of particle detection, the nASA is useful for applications requiring measurements over a broad range of sample pressures and temperatures. Indeed, experimental transfer functions determined for the extended-length Nano-DMA using the tandem differential mobility analyzer (TDMA) technique indicate the nASA provides good size resolution at pressures as low as 200 Torr. Also, as was demonstrated in tests to characterize the soot emissions from the J85-GE engine of a T-38 aircraft, the broad dynamic concentration range of the nASA makes it particularly suitable for studies of combustion or particle formation processes. Further details of the nASA performance as well as results from calibrations, laboratory tests and field applications are presented below

  18. In Vivo Evaluation of 5-ASA Colon-Specific Tablets Using Experimental-Induced Colitis Rat Animal Model.

    Science.gov (United States)

    Sawarkar, Sujata P; Deshpande, S G; Bajaj, A N; Nikam, V S

    2015-12-01

    Colonic drug delivery is intended not only for local treatment in inflammatory bowel disease (IBD) but also for systemic delivery of therapeutics. Intestinal myeloperoxidase (MPO) determination could be used to estimate the average level of inflammation in colon as well as to determine the efficacy of drugs to be used in the treatment of inflammatory bowel diseases or study the specificity of dosage forms to be used for colonic targeting of anti-inflammatory drugs. Colonic prodrug sulfasalazine (SASP) gets metabolized to give 5-aminosalicylic acid (5-ASA), which is the active portion of SASP. However, when given orally, 5-ASA is absorbed in upper part of gastrointestinal tract (GIT) and not made available in colon. In the present study, colon-targeted delivery of 5-ASA was achieved by formulating tablets with two natural polymers namely guar gum and pectin using compression coating method. Colonic specificity of 5-ASA tablets (prepared using guar gum and pectin as polymers) was evaluated in vitro using simulated fluids mimicking in vivo environment as well as in vivo method using chemically (2,4,6-trinitrobenzenesulfonic acid and acetic acid)-induced colitis rat model. Both colon-specific formulations of 5-ASA (guar gum and pectin) were observed to be more effective in reducing inflammation in chemically induced colitis rat models when compared to colon-specific prodrug sulfasalazine as well as conventional 5-ASA administered orally. PMID:26017284

  19. Deriving albedo maps for HAPEX-Sahel from ASAS data using kernel-driven BRDF models

    Directory of Open Access Journals (Sweden)

    P. Lewis

    1999-01-01

    Full Text Available This paper describes the application and testing of a method for deriving spatial estimates of albedo from multi-angle remote sensing data. Linear kernel-driven models of surface bi-directional reflectance have been inverted against high spatial resolution multi-angular, multi- spectral airborne data of the principal cover types within the HAPEX-Sahel study site in Niger, West Africa. The airborne data are obtained from the NASA Airborne Solid-state Imaging Spectrometer (ASAS instrument, flown in Niger in September and October 1992. The maps of model parameters produced are used to estimate integrated reflectance properties related to spectral albedo. Broadband albedo has been estimated from this by weighting the spectral albedo for each pixel within the map as a function of the appropriate spectral solar irradiance and proportion of direct and diffuse illumination. Partial validation of the results was performed by comparing ASAS reflectance and derived directional-hemispherical reflectance with simulations of a millet canopy made with a complex geometric canopy reflectance model, the Botanical Plant Modelling System (BPMS. Both were found to agree well in magnitude. Broadband albedo values derived from the ASAS data were compared with ground-based (point sample albedo measurements and found to agree extremely well. These results indicate that the linear kernel-driven modelling approach, which is to be used operationally to produce global 16 day, 1 km albedo maps from forthcoming NASA Earth Observing System spaceborne data, is both sound and practical for the estimation of angle-integrated spectral reflectance quantities related to albedo. Results for broadband albedo are dependent on spectral sampling and on obtaining the correct spectral weigthings.

  20. Fragment o dimenzijah emocije, "mathesisa" in časa v čisto glasbenem

    OpenAIRE

    Popović Mlađenović, Tijana

    2015-01-01

    V dialogu iz Kaj je glasba? Carla Dahlhausa in Hansa Heinricha Eggebrecht je glasba opredeljena kot "matematizirana emocija" ali "emocionalizirani 'mathesis'". Kot poudarja Marija Bergamo, gre za način izpostavljanja enakosti, neizogibnosti konstituiranja glasbe kot emotivno in racionalne organizacije v dimenziji časa. Marija Bergamo nenehno išče tista določila glasbenega dela kot "avtonomnega estetskega dejstva", ki temeljijo in katerih resnično bistvo leži "znotraj narave in bistva glasbe s...

  1. Discovery of Bright Galactic R Coronae Borealis and DY Persei Variables: Rare Gems Mined from ASAS

    CERN Document Server

    Miller, A A; Bloom, J S; Cenko, S B; Silverman, J M; Starr, D L; Stassun, K G

    2012-01-01

    We present the results of a machine-learning (ML) based search for new R Coronae Borealis (RCB) stars and DY Persei-like stars (DYPers) in the Galaxy using cataloged light curves obtained by the All-Sky Automated Survey (ASAS). RCB stars - a rare class of hydrogen-deficient carbon-rich supergiants - are of great interest owing to the insights they can provide on the late stages of stellar evolution. DYPers are possibly the low-temperature, low-luminosity analogs to the RCB phenomenon, though additional examples are needed to fully establish this connection. While RCB stars and DYPers are traditionally identified by epochs of extreme dimming that occur without regularity, the ML search framework more fully captures the richness and diversity of their photometric behavior. We demonstrate that our ML method recovers ASAS candidates that would have been missed by traditional search methods employing hard cuts on amplitude and periodicity. Our search yields 13 candidates that we consider likely RCB stars/DYPers: n...

  2. A new bright eclipsing hot subdwarf binary from the ASAS and SuperWASP surveys

    CERN Document Server

    Schaffenroth, V; Drechsel, H; Heber, U; Wils, P; Oestensen, R H; Maxted, P F L; di Scala, G

    2013-01-01

    We report the discovery of a bright (V=11.6 mag) eclipsing hot subdwarf binary of spectral type B with a late main sequence companion from the All Sky Automated Survey (ASAS 102322-3737.0). Such systems are called HW Vir stars after the prototype. The lightcurve shows a grazing eclipse and a strong reflection effect. An orbital period of P=0.13927 d, an inclination of i=65.86{\\deg}, a mass ratio q=0.34, a radial velocity semiamplitude K_1=81.0 kms^-1, and other parameters are derived from a combined spectroscopic and photometric analysis. The short period can only be explained by a common envelope origin of the system. The atmospheric parameters (T_eff=28400 K, log g=5.60) are consistent with a core helium-burning star located on the extreme horizontal branch. In agreement with that we derived the most likely sdB mass to be M_sdB=0.46M_sun, close to the canonical mass of such objects. The companion is a late M-dwarf with a mass of M_comp=0.16 M_sun. ASAS 102322-3737.0 is the third brightest of only 12 known H...

  3. Comparison between 3-Nitrooxyphenyl acetylsalicylate (NO-ASA) and O2-(acetylsalicyloxymethyl)-1-(pyrrolidin-1-yl)diazen-1-ium-1,2-diolate (NONO-ASA) as Safe Anti-Inflammatory, Analgesic, Antipyretic, Antioxidant Prodrugs

    Science.gov (United States)

    Chattopadhyay, Mitali; Velazquez, Carlos A.; Pruski, April; Nia, Kamran V.; Abdellatif, Khaled R.; Keefer, Larry K.

    2010-01-01

    Chronic inflammation is an underlying etiological factor in carcinogenesis; nonsteroidal anti-inflammatory drugs (NSAIDs) and their chemically modified NO-releasing prodrugs (NO-NSAIDs) are promising chemopreventive agents. The aim of this study was to conduct a head-to-head comparison between two NO-ASAs possessing different NO donor groups, an organic nitrate [3-nitrooxyphenyl acetylsalicylate (NO-ASA; NCX-4016)] and an N-diazeniumdiolate [NONO-ASA, O2- (acetylsalicyloxymethyl)-1-(pyrrolidin-1-yl)diazen-1-ium-1,2-diolate (NONO-ASA; CVM-01)], as antiulcerogenic, analgesic, anti-inflammatory, and antipyretic agents. All drugs were administered orally at equimolar doses. For antiulcerogenic study, 6 h after administration, the number and size of hemorrhagic lesions in stomachs from euthanized animals were counted. Tissue samples were frozen for prostaglandin E2 (PGE2), superoxide dismutase (SOD), and malondialdehyde determination. For anti-inflammatory study, 1 h after drug administration, the volume of carrageenan-induced rat paw edemas was measured for 6 h. For antipyretic study, 1 h after dosing, fever was induced by intraperitoneal LPS, and body core temperatures measured for 5 h. For analgesic study, time-dependent analgesic effect of prodrugs was evaluated by carrageenan-induced hyperalgesia. Drugs were administered 30 min after carrageenan. NO-ASA and NONO-ASA were equipotent as analgesic and anti-inflammatory agents but were better than aspirin. Despite a drastic reduction of PGE2 in stomach tissue, both prodrugs were devoid of gastric side effects. Lipid peroxidation induced by aspirin was higher than that observed by prodrugs. SOD activity induced by both prodrugs was similar, but approximately 2-fold higher than that induced by aspirin. CVM-01 is as effective as NCX-4016 in anti-inflammatory, analgesic, and antipyretic assays in vivo, and it showed an equivalent safety profile in the stomach. These results underscore the use of N-diazeniumdiolate moieties

  4. Challenges in converting an interviewer-administered food probe database to self-administration in the National Cancer Institute Automated Self-administered 24-Hour Recall (ASA24)

    OpenAIRE

    Zimmerman, Thea Palmer; Hull, Stephen G.; McNutt, Suzanne; Mittl, Beth; Islam, Noemi; Guenther, Patricia M.; Thompson, Frances E; Potischman, Nancy A.; Subar, Amy F.

    2009-01-01

    The National Cancer Institute (NCI) is developing an automated, self-administered 24-hour dietary recall (ASA24) application to collect and code dietary intake data. The goal of the ASA24 development is to create a web-based dietary interview based on the US Department of Agriculture (USDA) Automated Multiple Pass Method (AMPM) instrument currently used in the National Health and Nutrition Examination Survey (NHANES). The ASA24 food list, detail probes, and portion probes were drawn from the ...

  5. Pharmaceuticals and other organic chemicals in selected north-central and northwestern Arkansas streams

    Science.gov (United States)

    Haggard, B.E.; Galloway, J.M.; Green, W.R.; Meyer, M.T.

    2006-01-01

    Recently, our attention has focused on the low level detection of many antibiotics, pharmaceuticals, and other organic chemicals in water resources. The limited studies available suggest that urban or rural streams receiving wastewater effluent are more susceptible to contamination. The purpose of this study was to evaluate the occurrence of antibiotics, pharmaceuticals, and other organic chemicals at 18 sites on seven selected streams in Arkansas, USA, during March, April, and August 2004. Water samples were collected upstream and downstream from the influence of effluent discharges in northwestern Arkansas and at one site on a relatively undeveloped stream in north-central Arkansas. At least one antibiotic, pharmaceutical, or other organic chemical was detected at all sites, except at Spavinaw Creek near Mayesville, Arkansas. The greatest number of detections was observed at Mud Creek downstream from an effluent discharge, including 31 pharmaceuticals and other organic chemicals. The detection of these chemicals occurred in higher frequency at sites downstream from effluent discharges compared to those sites upstream from effluent discharges; total chemical concentration was also greater downstream. Wastewater effluent discharge increased the concentrations of detergent metabolites, fire retardants, fragrances and flavors, and steroids in these streams. Antibiotics and associated degradation products were only found at two streams downstream from effluent discharges. Overall, 42 of the 108 chemicals targeted in this study were found in water samples from at least one site, and the most frequently detected organic chemicals included caffeine, phenol, para-cresol, and acetyl hexamethyl tetrahydro naphthalene (AHTN). ?? ASA, CSSA, SSSA.

  6. Effects of paracetamol and propacetamol on gastric mucosal damage and gastric lipid peroxidation caused by acetylsalicylic acid (ASA) in rats.

    Science.gov (United States)

    Galunska, B; Marazova, K; Tankova, T; Popov, A; Frangov, P; Krushkov, I; Di Massa, A

    2002-08-01

    We have studied the effect of paracetamol and its pro-drug propacetamol on gastric mucosal damage induced by acetylsalicylic acid (ASA) and its possible relation to changes in gastric lipid peroxidation status in rats. Paracetamol or propacetamol were administered intragastrically 1h before ASA (300 mg kg(-1)) in the following equivalent doses: 62.5, 125.0 and 250.0 mg kg(-1) or 125.0, 250.0 and 500.0 mg kg(-1), respectively. The effects of the tested agents were compared to that of prostaglandin E2 (PGE2) 15, 30 and 60 mg kg(-1). Gastric ulcer formation was estimated morphometrically 4h after ASA administration. Malondialdehyde (MDA), glutathione (reduced, GSH, and oxidized, GSSG) and uric acid (UA) were determined in gastric mucosa and blood plasma and used as biochemical markers of the oxidative status. The results showed that paracetamol (250, 125, 62.5 mg kg(-1)) and propacetamol (500, 250, 125 mg kg(-1)) diminished the area of ASA-induced gastric lesions. The effect of propacetamol was more pronounced than that of paracetamol and similar to that of PGE2. Gastric MDA increased 3-fold in the ASA-group. The tested agents reduced it by a range of 30-70%. In all pretreated groups gastric glutathione and UA levels were found higher than that of control group and lower than that of ASA-group. Paracetamol and propacetamol, as well as PGE2, diminished the lipid peroxidation in plasma to a lesser extent than in gastric mucosa, but maintained elevated levels of the selective plasma antioxidant UA. These results show that the ASA-induced gastric mucosal damage is accompanied by the development of oxidative stress, evidenced by the accumulation of MDA, and concomitant initial activation of cell antioxidant defences. As paracetamol and propacetamol tend to decrease gastric lesions caused by ASA and alter gastric mucosal MDA, glutathione and UA values in a favorable manner, it could be suggested that their effects on the gastric mucosa could be related to interference with

  7. ASAS-SN 13cl : A Newly-Discovered Cataclysmic Binary with an Anomalously Warm Secondary

    CERN Document Server

    Thorstensen, John R

    2015-01-01

    The spectrum of the recently discovered cataclysmic variable star (CV) ASAS-SN 13cl shows that a secondary star with spectral type K4 (+- 2 subclasses) contributes roughly half the optical light. The radial velocities of the secondary are modulated on an orbital period P_orb = 4.86 hr with a velocity semiamplitude K = 246 +- 9 km/s, and the light curve shows ellipsoidal variations and an apparent grazing eclipse. At this orbital period, the secondary stars in most CVs are substantially cooler, with spectral types near M3. ASN-13cl therefore joins the small group of CVs with anomalously warm secondary stars, which apparently form when the onset of mass transfer occurs after the secondary has undergone significant nuclear evolution.

  8. ASA conference on radiation and health: Health effects of electric and magnetic fields: Statistical support for research strategies. Final report

    Energy Technology Data Exchange (ETDEWEB)

    1990-05-01

    This report is a collection of papers documenting presentations made at the VIII ASA (American Statistical Association) Conference on Radiation and Health entitled Health Effects of Electric and Magnetic Fields: Statistical Support for Research Strategies. Individual papers are abstracted and indexed for the database.

  9. Making a Theist out of Darwin: Asa Gray's Post-Darwinian Natural Theology

    Science.gov (United States)

    Russell Hunter, T.

    2012-07-01

    In March of 1860 the eminent Harvard Botanist and orthodox Christian Asa Gray began promoting the Origin of Species in hopes of securing a fair examination of Darwin's evolutionary theory among theistic naturalists. To this end, Gray sought to demonstrate that Darwin had not written atheistically and that his theory of evolution by natural selection had not presented any new scientific or theological difficulties for traditional Christian belief. From his personal correspondence with the author of the Origin, Gray well knew that Darwin did not affirm God's "particular" design of nature but conceded to the possibility that evolution proceeded according to "designed laws." From this concession, Gray attempted to develop a post-Darwinian natural theology which encouraged theistic naturalists to view God's design of nature through the evolutionary process in a manner similar to the way in which they viewed God's Providential interaction with human history. Indeed, securing a fair reading of the Origin was not Gray's sole aim as a promoter of Darwinian ideas. In Darwin's theory of natural selection, Gray believed he had discovered the means by which a more robust natural theological conception of the living and evolving natural world could be developed. In this paper I outline Gray's efforts to produce and popularize a theistic interpretation of Darwinian theory in order to correct various misconceptions concerning Gray's natural theological views and their role in the Darwinian Revolution.

  10. VARIABILITY OF LUMINOUS STARS IN THE LARGE MAGELLANIC CLOUD USING 10 YEARS OF ASAS DATA

    International Nuclear Information System (INIS)

    Motivated by the detection of a recent outburst of the massive luminous blue variable LMC-R71, which reached an absolute magnitude MV = -9.3 mag, we undertook a systematic study of the optical variability of 1268 massive stars in the Large Magellanic Cloud, using a recent catalog by Bonanos et al. as the input. The ASAS All Star Catalog provided well-sampled light curves of these bright stars spanning 10 years. Combining the two catalogs resulted in 599 matches, on which we performed a variability search. We identified 117 variable stars, 38 of which were not known before, despite their brightness and large amplitude of variation. We found 13 periodic stars that we classify as eclipsing binary (EB) stars, 8 of which are newly discovered bright massive EBs composed of OB-type stars. The remaining 104 variables are either semi- or non-periodic, the majority (85) being red supergiants (RSGs). Most (26) of the newly discovered variables in this category are also RSGs with only three B and four O stars.

  11. A search for photometric variability in magnetic chemically peculiar stars using ASAS-3 data

    CERN Document Server

    Bernhard, K; Otero, S; Paunzen, E

    2015-01-01

    The (magnetic) chemically peculiar (CP) stars of the upper main sequence are well-suited laboratories for investigating the influence of magnetic fields on the stellar surface because they produce abundance inhomogeneities (spots), which results in photometric variability that is explained in terms of the oblique rotator model. CP stars exhibiting this phenomenon are normally classified as alpha2 Canum Venaticorum (ACV) variables. It is important to increase the sample of known rotational periods among CP stars by discovering new ACV variables. The ASAS-3 data were cross-correlated with the Catalogue of Ap, HgMn, and Am stars in order to analyse the light curves of bona fide CP and related stars. The light curves were downloaded and cleaned of outliers and data points with a flag indicating bad quality. Promising candidates showing a larger scatter than observed for constant stars in the corresponding magnitude range were searched for periodic signals using a standard Fourier technique. In total, we found 323...

  12. PENERAPAN ASAS UMUM PEMERINTAHAN YANG BAIK DALAM SISTEM PELAYANAN PERIZINAN SATU PINTU

    Directory of Open Access Journals (Sweden)

    Dwi Haryati

    2012-10-01

    Full Text Available This study will discuss the implementation of General Principles of Good Governance (AUPB in the One Stop Licensing System in the city of Yogyakarta. Some things that would be an important consideration in this study were changes to Local Government Law No. 22 of 1999 as Law No. 32 of 2004 and its consequence, the issuance of Government Regulation No. 84 of 2000 governing the organization’s guidelines in the area of technical authority in issuing permits and Ministerial Decree No. PAN 63/KEP/M.PAN/7/2003 On Implementation Guidelines for Public Service and Administrative Reform Decree No. 26/KEP/M.PAN/2/2004 About Help Technical Transparency and Accountability. Penelitian ini akan membahas penerapan Asas Umum Pemerintahan yang Baik (AUPB dalam Sistem Perijinan Satu Pintu di Kota Yogyakarta. Beberapa hal yang akan menjadi pertimbangan penting dalam penelitian ini adalah Perubahan UU Otonomi Daerah Nomor 22 Tahun 1999 menjadi UU Nomor 32 Tahun 2004 beserta konsekuensinya. Penerbitan Peraturan Pemerintah Nomor 84 Tahun 2000 yang mengatur tentang pedoman organisasi perangkat daerah dalam kewenangan teknisnya mengeluarkan ijin di daerah serta Kepmen PAN Nomor 63/KEP/M.PAN/7/2003 tentang Pedoman Penyelenggaraan Pelayanan Publik dan Keputusan Menteri Pendayagunaan Aparatur Negara Nomor 26/KEP/M. PAN/2/2004 tentang Petunjuk Teknis Transparansi dan Akuntabilitas.

  13. VizieR Online Data Catalog: ASAS 101538-5933.1 BV light curves (Berdnikov, 2013)

    Science.gov (United States)

    Berdnikov, L. N.

    2013-04-01

    In the plate collection of the Harvard College Observatory, we have obtained 528 photographic magnitude estimates for the recently discovered long-period classical Cepheid ASAS 101538-5933.1 (P=51.4-days). Together with the published photoelectric and CCD observations, our data have allowed us to construct an O-C diagram spanning a time interval of 120 years. The O-C diagram has the shape of a parabola, which has made it possible to determine for the first time the quadratic light elements and to calculate the rate of evolutionary increase in the period, dP/dt=51.8(+/-4.8)s/yr or (dP/dt)/P=7.3(+/-0.7)s, in agreement with the results of theoretical calculations for the third crossing of the instability strip. The available data reduced by the method of Eddington and Plakidis reveal small random period fluctuations that do not distort the evolutionary trend in the O-C residuals. (1 data file).

  14. Synthesis and hydrocracking performance of Y/ASA composite%Y/ASA复合材料的制备及加氢裂化性能

    Institute of Scientific and Technical Information of China (English)

    孟庆磊; 刘百军; 盖有东; 何琳琳

    2012-01-01

    采用原位包覆技术制备了无定形硅铝(ASA)包覆Y型分子筛的Y/ASA复合材料.分别以Y/ASA复合材料和工业Y分子筛与ASA的机械混合材料Y-ASA为载体,Ni-W为活性组分,制备了两种负载型催化剂,并考察了两种催化剂的加氢裂化性能,通过XRD、SEM、吸附吡啶的原位红外光谱和N2吸附-脱附对载体和催化剂进行了表征.结果表明,Y/ASA载体和Ni-W/Y/ASA的总酸量较低,但强酸量和强弱酸比例均高于Y-ASA和Ni-W/Y-ASA,Y/ASA载体和Ni-W/Y/ASA催化剂拥有更大的介孔比表面积、孔容及平均孔径.正癸烷的加氢裂化反应结果表明,Ni-W/Y/ASA催化剂上正癸烷的转化率和中间组分(C5-9)收率比Ni-W/Y-ASA催化剂分别高7.6%和12.4%.%In-situ covering technology was used to prepare the Y/ASA composite material in which Y zeolite was covered around with amorphous silica-alumina ( ASA). Two kinds of supported Ni-W catalysts for hydrocracking of decane were prepared using Y/ASA and Y-ASA as supports, respectively. Y-ASA was a kind of mechanical mixture of industrial Y zeolite and ASA. The supports and catalysts were characterized by X-ray powder diffraction, scanning electron microscopy, infrared spectroscopy of pyridine adsorption and N2 adsorption-desorption. The results showed that, while there were less total acid sites on Y/ASA and Ni-W/Y/ ASA, there were more strong acid sites. The ratios of strong acid sites to weak acid sites of Y/ASA and Ni-W/ Y/ASA were higher than those of Y-ASA and Ni-W/Y-ASA. The average pore diameter, mesopore surface area and pore volume of Y/ASA and Ni-W/Y/ASA were larger than those of the comparative samples, respectively. The hydrocracking of decane over the Ni-W/Y/ASA catalyst revealed that the conversion and yield of middle-component (C5 -9) were improved by 7.6 % and 12.4 % , respectively, compared with that over Ni-W/Y-ASA catalyst.

  15. Orbital and physical parameters of eclipsing binaries from the ASAS catalogue -- IX. Spotted pairs with red giants

    CERN Document Server

    Ratajczak, M; Konacki, M; Smith, A M S; Kozłowski, S K; Espinoza, N; Jordán, A; Brahm, R; Hempel, M; Anderson, D R; Hellier, C

    2016-01-01

    We present spectroscopic and photometric solutions for three spotted systems with red giant components. Absolute physical and orbital parameters for these double-lined detached eclipsing binary stars are presented for the first time. These were derived from the V-, and I-band ASAS and WASP photometry, and new radial velocities calculated from high quality optical spectra we obtained with a wide range of spectrographs and using the two-dimensional cross-correlation technique (TODCOR). All of the investigated systems (ASAS J184949-1518.7, BQ Aqr, and V1207 Cen) show the differential evolutionary phase of their components consisting of a main sequence star or a subgiant and a red giant, and thus constitute very informative objects in terms of testing stellar evolution models. Additionally, the systems show significant chromospheric activity of both components. They can be also classified as classical RS CVn-type stars. Besides the standard analysis of radial velocities and photometry, we applied spectral disenta...

  16. Advanced Steganography Algorithm Using Randomized Intermediate QR Host Embedded With Any Encrypted Secret Message: ASA_QR Algorithm

    OpenAIRE

    Somdip Dey; Kalyan Mondal; Joyshree Nath; Asoke Nath

    2012-01-01

    Due to tremendous growth in communication technology, now it is a real problem / challenge to send some confidential data / information through communication network. For this reason, Nath et al. developed several information security systems, combining cryptography and steganography together, and the present method, ASA_QR, is also one of them. In the present paper, the authors present a new steganography algorithm to hide any small encrypted secret message inside QR CodeTM , which is then ...

  17. Orbital and physical parameters of eclipsing binaries from the ASAS catalogue -- IX. Spotted pairs with red giants

    OpenAIRE

    Ratajczak, M.; Hełminiak, K. G.; Konacki, M.; Smith, A.M.S.; Kozłowski, S. K.; Espinoza, N.; Jordán, A.; Brahm, R.; Hempel, M; Anderson, D R; Hellier, C.

    2016-01-01

    We present spectroscopic and photometric solutions for three spotted systems with red giant components. Absolute physical and orbital parameters for these double-lined detached eclipsing binary stars are presented for the first time. These were derived from the V-, and I-band ASAS and WASP photometry, and new radial velocities calculated from high quality optical spectra we obtained with a wide range of spectrographs and using the two-dimensional cross-correlation technique (TODCOR). All of t...

  18. Risk of upper gastrointestinal bleeding in a cohort of new users of low-dose ASA for secondary prevention of cardiovascular outcomes

    Directory of Open Access Journals (Sweden)

    LucíaCea Soriano

    2010-10-01

    Full Text Available The Health Improvement Network UK primary care database was used to identify a cohort of 38 077 individuals aged 50–84 years with a first prescription of low-dose acetylsalicylic acid (ASA; 75–300 mg/day for secondary prevention of cardiovascular or cerebrovascular events during 2000–2007. From this cohort, 169 incident cases of upper gastrointestinal bleeding (UGIB were identified. Controls with no UGIB (n = 2000 were frequency-matched to the cases by age, sex and follow-up time. A nested case–control analysis was performed to determine risk factors associated with UGIB. The incidence of UGIB was 1.1 per 1000 person-years (95% CI, 1.0–1.3. Low-dose ASA users with a history of peptic ulcer disease had an increased risk of UGIB compared with those without (rate ratio [RR], 4.59; 95% CI, 2.87–7.33. Concomitant use of ASA and clopidogrel (RR, 1.61; 95% CI, 0.85–3.05 or non-steroidal anti-inflammatory drugs (NSAIDs; RR, 2.92; 95% CI, 1.77–4.82 conferred an increased risk of UGIB compared with ASA monotherapy. Discontinuation of ASA therapy (RR: 0.71, 95% CI, 0.42–1.20 and PPI co-treatment given since the start of ASA therapy (RR, 0.56; 95% CI, 0.33–0.96 were associated with a reduced risk of UGIB. In conclusion, in a cohort of individuals receiving low-dose ASA for secondary prevention of cardiovascular or cerebrovascular events, patients with a history of peptic ulcer disease, or who were receiving clopidogrel or NSAIDs had an increased risk of UGIB. The prescription of PPI therapy at the initiation of low-dose ASA reduced the risk of UGIB by almost half.

  19. [German patient version of the ASAS/EULAR recommendations for the management of ankylosing spondylitis].

    Science.gov (United States)

    Kiltz, U; Feldtkeller, E; Braun, J

    2010-03-01

    The evidence-based recommendations on the management of ankylosing spondylitis (AS) have enjoyed a high level of acceptance and circulation in Germany, as well as in other European countries. To make patient participation in the decision-making process regarding their disease easier, as well as to strengthen the physician-patient relationship, the ASAS and EULAR have set up an initiative to formulate a patient-friendly version of the recommendations, initially in English. In order that this lay version can also be used in German-speaking countries, a group predominantly comprising patients was formed to ensure that the German translation of this version has the broadest possible basis. In cooperation with the German (DVMB), Austrian (OVMB) and Swiss Morbus Bechterew Associations (SVMB), as well as the German Rheumatology League, patients from Germany, Austria and Switzerland with appropriate English skills were invited to a meeting in 2008. The aim of the translation was to leave the content unchanged while finding a level of speech easily understandable to the lay person. The translated text was considered as accepted when a minimum of 12 patients (>80%) gave their approval on the wording of the translation of individual recommendations in an open vote. The rheumatologist given the function of moderator was not entitled to vote. The level of approval for each recommendation was determined (0: no approval to 10: full approval). The 14 patients were able to translate the English patient version into German. Choice of words and style of speech were discussed intensively. Acceptance of the translation of the 10 recommendations was generally high. The content was clearly accepted with an approval rate of 8.4+/-1.6. This was the first time that patients, in cooperation with rheumatologists, have translated an international patient version on AS management into German under controlled conditions. The translation text was approved by the majority in terms of both form and

  20. Photometric study and preliminary elements of the low-mass ratio W UMa system ASAS 021209+2708.3

    Institute of Scientific and Technical Information of China (English)

    Francesco Acerbi; Carlo Barani; Massimiliano Martignoni

    2011-01-01

    We present CCD B and V light curves, obtained in the year 2006, and a photometric solution of the Iow-mass ratio contact binary ASAS 021209+2708.3.With our data we were able to determine six new times of minimum light and refine the orbital period of the system to 0.3181963 days. The light curves are analyzed using the 2003 version of the Wilson-Devinney program and the analysis was performed with and without adding a spot on the surface of one star because the light curves appear to exhibit a typical O'Connell effect, with Maximum I brighter than Maximum 11. The results show that ASAS 021209+2708.3 may be classified as an A-subtype W Ursae Majoris system with a small mass ratio q = 0.1889, a large over-contact degree of f=0.587, a very small difference between the component temperatures of △T = 53 K and an orbital inclination of i= 81°. It is known that deep (f > 50%), low-mass ratio (q < 0.25) overcontact binary stars are a very important resource for understanding the phenomena of Blue Straggler/FK Com-type stars. The formations of Blue Straggler stars and FK Com-type stars are unsolved problems in stellar astrophysics. One of the possible explanations for their formation is from the coalescence of W UMa-type overcontact binary systems. The absolute dimensions of ASAS 021209+2708.3 are estimated and its dynamical evolution is inferred.

  1. [Patient evaluation of the German version of the ASAS/EULAR recommendations for the management of ankylosing spondylitis].

    Science.gov (United States)

    Kiltz, U; Feldtkeller, E; Braun, J

    2008-12-01

    On the initiative of the ASAS (Assessment of SpondyloArthritis International Society) and EULAR (European League against Rheumatism), evidence-based recommendations for the management of ankylosing spondylitis (AS) were drawn up, with healthcare professionals as the target group for these recommendations. To facilitate patient participation in the decision-making process with regard to their disease, and to further improve the doctor-patient relationship, the ASAS and EULAR are working on a patient-friendly version of the recommendations.In order to establish to what extent the ASAS/EULAR recommendations, as translated by German experts, can be understood by patients, the recommendations for health care professionals, together with an evaluation form, was distributed to 105 delegates of the German society for ankylosing spondylitis (Deutschen Vereinigung Morbus Bechterew, DVMB). Responders were questioned on text comprehension and their level of agreement (0: not agree at all to 10: fully agree). Space was also provided for additional comments.In total, 59 delegates filled out the questionnaire (rate of return: 56.2%). For recommendation Nos. 1, 2, 5, 6 and 7, text comprehension was moderate. On average, the recommendations were positively assessed with 8.38+/-1.9. Recommendation No. 4 (non-pharmacological therapy) was given the highest agreement (9.54+/-1.02), while recommendation No. 7 (corticosteroids, 6.54+/-2.55) received the lowest agreement. The acceptance of the recommendation was high with 87.9% questions answered.For the first time, the German expert translation of recommendations for the management of AS patients was evaluated by patients. The present translation met with broad approval. To minimize text comprehension problems, patients should be involved in compiling a future patient version. PMID:19011877

  2. RACIONALIZACIJA ČASA MENJAVE ORODIJ ZA BRIZGANJE PLASTIČNIH MAS V PODJETJU ISKRA MEHANIZMI D.D. LIPNICA

    OpenAIRE

    Oblak, Tomaž

    2010-01-01

    Spremembe, ki so stalnica današnjega časa, nastajajo zelo hitro. S tem se tudi okolje, v katerem živimo, nenehno in zelo intenzivno spreminja. Takšemu okolju se morajo hitro in nenehno prilagajati tudi podjetja, če si želijo zagotoviti svoj dolgoročni obstoj. V diplomski nalogi je predstavljeno nekaj osnov o brizganju plastičnih mas in preoblikovanje sistema menjav orodij na strojih za brizganje plastičnih mas s pomočjo uporabe metode SMED. V nalogi so predstavljene prednosti, ki jih met...

  3. Estimation of the sensitivity and specificity of ASAS criteria for peripheral spondyloarthritis in patients with early psoriatic arthritis

    Directory of Open Access Journals (Sweden)

    E. Yu. Loginova

    2015-01-01

    Full Text Available Objective: to estimate the sensitivity and specificity of ASAS (Assessment of Spondyloarthritis International Society criteria for peripheral spondyloarthritis (SpA in patients with early psoriatic arthritis (ePsA.Subjects and methods. Examinations was made in 45 patients (17 men and 28 women with ePsA meeting the CASPAR (ClASsification criteria for Psoriatic ARthritis criteria (mean age, 37 years; disease duration, 1 year and in 20 patients (9 men and 11 women with signs of peripheral SpA meeting the ESSG (European Spondyloarthropathy Study Group criteria (mean age, 23 years; disease duration, 2.25 years; control group. The investigators estimated 78/76 tender/swollen joints and enthuses using MASES (Maastricht Ankylosing Spondylitis Enthesitis Score and assessed the presence of inflammatory spinal pain according to the ASAS criteria, psoriasis, uveitis, inflammatory bowel diseases, genitourinary and/or enteric infections, and a family history of SpA. They also performed X-ray studies of the hand and distal portions of the foot and pelvis and graded sacroilitis using the Kellgren scores. HLA-B27, C-reactive protein, and erythrocyte sedimentation rate were determined. The sensitivity/specificity, likelihood ratios, and clinical value of criteria were calculated.Results. 41/4 and 31/14 patents with ePsA met/unmet Criteria Sets I and II. The sensitivity/specificity of Sets I and II was 91.1/10% and 68.8/95%, respectively. One patient with ePsA and two patients in the control group did not meet one of the sing sets. The total sensitivity/specificity was 97.8/10%. In the control group, the sensitivity/specificity of Sets I and II was 91.1/100% and 68.8/100%, respectively. For ePsA, the positive likelihood ratio proved to be high for Set II (13.78% and low for Set I (1.01.Conclusion. ASAS Criteria Set I for peripheral SpA is of low value in identifying ePsA and Sign Set II shows a high value in diagnosing ePsA as it includes the major clinical

  4. Double-blind, placebo-controlled evaluation of 5-ASA suppositories in active distal proctitis and measurement of extent of spread using /sup 99m/Tc-labeled 5-ASA suppositories

    International Nuclear Information System (INIS)

    Patients with active distal proctitis received either 5-aminosalicylic (5-ASA) acid or identical placebo suppositories, 500 mg t.i.d. for 6 weeks. Activity at 3 and 6 wks was assessed using a Disease Activity Index (DAI), derived from four categories: number of daily evacuations more than usual, evacuations containing blood, sigmoidoscopy appearance, and physician's overall assessment. Each category was graded 0-3. There was thus 0-12 points scored ranging from complete remission to severe disease. A minimum score of 3 from two categories was necessary for study entry. Of 27 patients randomized, 14 received active medication and 13 placebo. Of the 14 patients, with initial mean DAI 7.1 +/- 1.8, 11 were in complete remission at 6 wks (78.6%). Whereas, there was no significant change in the placebo group, with initial mean DAI 7.1 +/- 1.8. An additional 6 patients with inflammatory bowel disease and 6 healthy volunteers were given /sup 99m/Tc-labelled 5-aminosalicylic acid suppositories. The extent of spread was limited to the rectum, and the suppositories were retained for 3 hours. There was no absorbed radioactivity. 5-ASA suppositories are safe, well-tolerated, and effective treatment for active distal proctitis

  5. Orbital and physical parameters of eclipsing binaries from the ASAS catalogue - IX. Spotted pairs with red giants

    Science.gov (United States)

    Ratajczak, M.; Hełminiak, K. G.; Konacki, M.; Smith, A. M. S.; Kozłowski, S. K.; Espinoza, N.; Jordán, A.; Brahm, R.; Hempel, M.; Anderson, D. R.; Hellier, C.

    2016-09-01

    We present spectroscopic and photometric solutions for three spotted systems with red giant components. Absolute physical and orbital parameters for these double-lined detached eclipsing binary stars are presented for the first time. These were derived from the V-, and I-band ASAS and WASP photometry, and new radial velocities calculated from high quality optical spectra we obtained with a wide range of spectrographs and using the two-dimensional cross-correlation technique (TODCOR). All of the investigated systems (ASAS J184949-1518.7, BQ Aqr, and V1207 Cen) show the differential evolutionary phase of their components consisting of a main-sequence star or a subgiant and a red giant, and thus constitute very informative objects in terms of testing stellar evolution models. Additionally, the systems show significant chromospheric activity of both components. They can be also classified as classical RS CVn-type stars. Besides the standard analysis of radial velocities and photometry, we applied spectral disentangling to obtain separate spectra for both components of each analysed system which allowed for a more detailed spectroscopic study. We also compared the properties of red giant stars in binaries that show spots, with those that do not, and found that the activity phenomenon is substantially suppressed for stars with Rossby number higher than ˜1 and radii larger than ˜20 R⊙.

  6. Defining active sacroiliitis on magnetic resonance imaging (MRI) for classification of axial spondyloarthritis: a consensual approach by the ASAS/OMERACT MRI group

    DEFF Research Database (Denmark)

    Rudwaleit, M; Jurik, A G; Hermann, K-G A;

    2009-01-01

    to reach consensus on which MRI findings are essential for the definition of sacroiliitis. METHODS: Ten doctors (two radiologists and eight rheumatologists) from the ASAS/OMERACT MRI working group reviewed and discussed in three workshops MR images depicting sacroiliitis associated with SpA and other...... relevant for sacroiliitis have been defined by consensus by a group of rheumatologists and radiologists. These definitions should help in applying correctly the imaging feature "active sacroiliitis by MRI" in the new ASAS classification criteria for axial SpA....

  7. Advanced Steganography Algorithm Using Randomized Intermediate QR Host Embedded With Any Encrypted Secret Message: ASA_QR Algorithm

    Directory of Open Access Journals (Sweden)

    Somdip Dey

    2012-06-01

    Full Text Available Due to tremendous growth in communication technology, now it is a real problem / challenge to send some confidential data / information through communication network. For this reason, Nath et al. developed several information security systems, combining cryptography and steganography together, and the present method, ASA_QR, is also one of them. In the present paper, the authors present a new steganography algorithm to hide any small encrypted secret message inside QR CodeTM , which is then randomized and then, finally embed that randomized QR Code inside some common image. Quick Response Codes (or QR Codes are a type of two-dimensional matrix barcodes used for encoding information. It has become very popular recently for its high storage capacity. The present method is ASA_QR is a combination of strong encryption algorithm and data hiding in two stages to make the entire process extremely hard to break. Here, the secret message is encrypted first and hide it in a QR CodeTM and then again that QR CodeTM is embed in a cover file (picture file in random manner, using the standard method of steganography. In this way the data, which is secured, is almost impossible to be retrieved without knowing the cryptography key, steganography password and the exact unhide method. For encrypting data The authors used a method developed by Nath et al i.e. TTJSA, which is based on generalized modified Vernam Cipher, MSA and NJJSA method; and from the cryptanalysis it is seen that TTJSA is free from any standard cryptographic attacks, like differential attack, plain-text attack or any brute force attack. After encrypting the data using TTJSA,the authors have used standard steganographic method To hide data inside some host file. The present method may be used for sharing secret key, password, digital signature etc.

  8. Modeling bidirectional radiance measurements collected by the advanced solid-state array spectroradiometer (ASAS) over Oregon transect conifer forests

    International Nuclear Information System (INIS)

    A geometric-optical model of the bidirectional reflectance of a forest canopy, developed by Li and Strahler, fits observed directional radiance measurements with good accuracy. This model treats the forest cover as a scene of discrete, three-dimensional objects (trees) that are illuminated and viewed from different positions in the hemisphere. The shapes of the objects, their count densities and patterns of placement, are the driving variables, and they condition the mixture of sunlit and shaded objects and background that are observed from a particular viewing direction, given a direction of illumination. This mixture, in turn, controls the brightness apparent to an observer or a radiometric instrument. The Advanced Solid-State Array Spectroradiometer (ASAS) was used to validate this model. This aircraft sensor presently acquires images in 29 spectral bands in the range (465–871 nm) and is pointable fore-and-aft, allowing directional measurements of radiance as a target is approached and imaged at view angles ranging ± 45° from nadir. Through atmospheric correction, ASAS radiances were reduced to bidirectional reflectance factors (BRFs). These were compared to corresponding BRF values computed from the Li-Strahler model using, wherever possible, ground measured component BRFs for calibration. The comparisons showed a good match between the modeled and measured reflectance factors for four of the five Oregon Transect Sites. Thus, the geometric-optical approach provides a realistic model for the bidirectional reflectance distribution function of such natural vegetation canopies. Further modifications are suggested to improve the predicted BRFs and yield still better results. (author)

  9. Denitrification in the shallow ground water of a tile-drained, agricultural watershed

    Science.gov (United States)

    Mehnert, E.; Hwang, H.-H.; Johnson, T.M.; Sanford, R.A.; Beaumont, W.C.; Holm, T.R.

    2007-01-01

    Nonpoint-source pollution of surface water by N is considered a major cause of hypoxia. Because Corn Belt watersheds have been identified as major sources of N in the Mississippi River basin, the fate and transport of N from midwestern agricultural watersheds have received considerable interest. The fate and transport of N in the shallow ground water of these watersheds still needs additional research. Our purpose was to estimate denitrification in the shallow ground water of a tile-drained, Corn Belt watershed with fine-grained soils. Over a 3-yr period, N was monitored in the surface and ground water of an agricultural watershed in central Illinois. A significant amount of N was transported past the tile drains and into shallow ground water. The ground water nitrate was isotopically heavier than tile drain nitrate, which can be explained by denitrification in the subsurface. Denitrifying bacteria were found at depths to 10 m throughout the watershed. Laboratory and push-pull tests showed that a significant fraction of nitrate could be denitrified rapidly. We estimated that the N denitrified in shallow ground water was equivalent to 0.3 to 6.4% of the applied N or 9 to 27% of N exported via surface water. These estimates varied by water year and peaked in a year of normal precipitation after 2 yr of below average precipitation. Three years of monitoring data indicate that shallow ground water in watersheds with fine-grained soils may be a significant N sink compared with N exported via surface water. ?? ASA, CSSA, SSSA.

  10. Orbital and physical parameters of eclipsing binaries from the ASAS catalogue - IV. A 0.61 + 0.45 M_sun binary in a multiple system

    CERN Document Server

    Hełminiak, K G; Rozyczka, M; Kaluzny, J; Ratajczak, M; Borkowski, J; Sybilski, P; Muterspaugh, M W; Reichart, D E; Ivarsen, K M; Haislip, J B; Crain, J A; Foster, A C; Nysewander, M C; LaCluyze, A P

    2012-01-01

    We present the orbital and physical parameters of a newly discovered low-mass detached eclipsing binary from the All-Sky Automated Survey (ASAS) database: ASAS J011328-3821.1 A - a member of a visual binary system with the secondary component separated by about 1.4 seconds of arc. The radial velocities were calculated from the high-resolution spectra obtained with the 1.9-m Radcliffe/GIRAFFE, 3.9-m AAT/UCLES and 3.0-m Shane/HamSpec telescopes/spectrographs on the basis of the TODCOR technique and positions of H_alpha emission lines. For the analysis we used V and I band photometry obtained with the 1.0-m Elizabeth and robotic 0.41-m PROMPT telescopes, supplemented with the publicly available ASAS light curve of the system. We found that ASAS J011328-3821.1 A is composed of two late-type dwarfs having masses of M_1 = 0.612 +/- 0.030 M_sun, M_2 = 0.445 +/- 0.019 M_sun and radii of R_1 = 0.596 +/- 0.020 R_sun, R_2 = 0.445 +/- 0.024 R_sun, both show a substantial level of activity, which manifests in strong H_alp...

  11. Orbital and physical parameters of eclipsing binaries from the ASAS catalogue - VIII. The totally-eclipsing double-giant system HD 187669

    CERN Document Server

    Hełminiak, K G; Konacki, M; Pilecki, B; Ratajczak, M; Pietrzyński, G; Sybilski, P; Villanova, S; Gieren, W; Pojmański, G; Konorski, P; Suchomska, K; Reichart, D E; Ivarsen, K M; B., J; Haislip,; LaCluyze, A P

    2014-01-01

    We present the first full orbital and physical analysis of HD 187669, recognized by the All-Sky Automated Survey (ASAS) as the eclipsing binary ASAS J195222-3233.7. We combined multi-band photometry from the ASAS and SuperWASP public archives and 0.41-m PROMPT robotic telescopes with our high-precision radial velocities from the HARPS spectrograph. Two different approaches were used for the analysis: 1) fitting to all data simultaneously with the WD code, and 2) analysing each light curve (with JKTEBOP) and RVs separately and combining the partial results at the end. This system also shows a total primary (deeper) eclipse, lasting for about 6 days. A spectrum obtained during this eclipse was used to perform atmospheric analysis with the MOOG and SME codes in order to constrain physical parameters of the secondary. We found that ASAS J195222-3233.7 is a double-lined spectroscopic binary composed of two evolved, late-type giants, with masses of $M_1 = 1.504\\pm0.004$ and $M_2=1.505\\pm0.004$ M$_\\odot$, and radii ...

  12. Comparison of Risk Scoring Systems to Predict the Outcome in ASA-PS V Patients Undergoing Surgery: A Retrospective Cohort Study.

    Science.gov (United States)

    Yurtlu, Derya Arslan; Aksun, Murat; Ayvat, Pnar; Karahan, Nagihan; Koroglu, Lale; Aran, Gülcin Önder

    2016-03-01

    Operative decision in American Society of Anesthesiology Physical Status (ASA-PS) V patient is difficult as this group of patients expected to have high mortality rate. Another risk scoring system in this ASA-PS V subset of patients can aid to ease this decision.Data of ASA-PS V classified patients between 2011 and 2013 years in a single hospital were analyzed in this study. Predicted mortality of these patients was determined with acute physiology and chronic health evaluations (APACHE) II, simplified acute physiology score (SAPS II), Charlson comorbidity index (CCI), Porthsmouth physiological and operative severity score for enumeration of mortality and morbidity (P-POSSUM), Surgical apgar score (SAS), and Goldman cardiac risk index (GCRI) scores. Observed and predicted mortality rates according to the risk indexes in these patients were compared at survivor and nonsurvivor group of patients. Risk stratification was made with receiver operator characteristic (ROC) curve analysis.Data of 89 patients were included in the analyses. Predicted mortality rates generated by APACHE II and SAPS II scoring systems were significantly different between survivor and nonsurvivor group of patients. Risk stratification with ROC analysis revealed that area under curve was 0.784 and 0.681 for SAPS II and APACHE II scoring systems, respectively. Highest sensitivity (77.3) is reached with SAPS II score.APACHE II and SAPS II are better predictive tools of mortality in ASA-PS V classified subset of patients. Discrimination power of SAPS II score is the best among the compared risk stratification scores. SAPS II can be suggested as an additional risk scoring system for ASA-PS V patients. PMID:27043696

  13. New Photometric Observations and the 2015 Eclipse of the Symbiotic Nova Candidate ASAS J174600-2321.3

    CERN Document Server

    Hambsch, Franz-Josef; Bernhard, Klaus; Otero, Sebastián

    2015-01-01

    The eclipsing binary system ASAS J174600-2321.3, which has shown a conspicuous brightening of ~4 magnitudes (V) in the past, was recently identified as a symbiotic nova candidate. A long-term photometric monitoring program was initiated in July 2014. In its present active stage, the system shows deep eclipses with an amplitude of ~3.5 magnitudes (V) that occur about every 33 months. In order to monitor the eclipse of 2015, AAVSO Alert Notice 510 was issued. During the ensuing campaign, AAVSO observers obtained 338 measurements in Johnson B, 393 measurements in Johnson V, and 369 measurements in Cousins I, as well as 27 visual observations. The present paper presents and analyzes these data from the AAVSO International Database, along with observations from the aforementioned photometric monitoring program. From these data, we were able to refine the orbital period to Porb = 1012.4 days. Furthermore, the data are suggestive of a slight decrease in mean brightness, which -if proven real- might indicate a declin...

  14. Search for evolutionary changes in Cepheid periods using the Harvard plate collection: ASAS 101538-5933.1

    Science.gov (United States)

    Berdnikov, L. N.

    2010-08-01

    In the plate collection of the Harvard College Observatory, we have obtained 528 photographic magnitude estimates for the recently discovered long-period classical Cepheid ASAS 101538-5933.1 ( P = 51.4 days). Together with the published photoelectric and CCD observations, our data have allowed us to construct an O-C diagram spanning a time interval of 120 years. The O-C diagram has the shape of a parabola, which has made it possible to determine for the first time the quadratic light elements and to calculate the rate of evolutionary increase in the period, dP/dt = 51.8 (±4.8) s yr-1 or dot P / P = 7.3 (±0.7) s, in agreement with the results of theoretical calculations for the third crossing of the instability strip. The available data reduced by the method of Eddington and Plakidis reveal small random period fluctuations that do not distort the evolutionary trend in the O-C residuals.

  15. Increased glutamine in leaves of poplar transgenic with pine GS1a caused greater anthranilate synthetase α-subunit (ASA1) transcript and protein abundances: an auxin-related mechanism for enhanced growth in GS transgenics?

    OpenAIRE

    Man, Huimin; Pollmann, Stephan; Weiler, Elmar W.; Kirby, Edward G.

    2011-01-01

    The initial reaction in the pathway leading to the production of indole-3-acetic acid (IAA) in plants is the reaction between chorismate and glutamine to produce anthranilate, catalysed by the enzyme anthranilate synthase (ASA; EC 4.1.3.27). Compared with non-transgenic controls, leaves of transgenic poplar with ectopic expression of the pine cytosolic glutamine synthetase (GS1a; EC 6.3.1.2) produced significantly greater glutamine and significantly enhanced ASA α-subunit (ASA1) transcript an...

  16. The Efficacy of Probiotic (Lactobacillus rhamnosus GG) and 5-ASA (Aminosalicylic Acid) in the Treatment of Experimental Radiation Proctitis in Rats.

    Science.gov (United States)

    Dandin, Özgür; Akin, Mehmet Levhi; Balta, Ahmet Ziya; Yücel, Ergün; Karakaş, Dursun Özgür; Demirbaş, Sezai; Özdemir, Sevim; Haholu, Apdullah

    2015-12-01

    The aims of the study are to demonstrate the effect of probiotic use on the healing of radiation proctitis (RP) and evaluate the efficiency of fecal biomarkers at follow-up of the treatment. Thirty-two male/female rats were randomly separated into four groups of eight rats. The first group (control) was not radiated. RP was created by 17.5 Gy single dose rectal irradiation. The second group (RP) was subjected to RP, but not treated. The third group (RP+ASA) was treated with 5-aminosalicylic acid (5-ASA) 250 mg/kg daily by gastric lavage for 14 days after the irradiation, and the forth group (RP+LGG) was treated with Lactobacillus GG (LGG) 25 × 100 million CFU daily. Feces samples were taken at the 7th and 14th day of the treatment for fecal biomarkers. Rectums of the rats were resected at the 14th day by laparotomy. Samples were evaluated both macroscopically and microscopically. RP was achieved both macroscopically and microscopically. Weight loss of RP group is statistically significant (p < 0.005) than other groups. The healing ratio of RP+ASA and RP+LGG groups was significantly better than the RP group (p < 0.005) both macroscopically and microscopically. But there was no significant difference between ASA and LGG groups. Biochemically, fecal calprotectin was found to be more effective than fecal myeloperoxidase and fecal lactoferrin to show the efficacy of treatment of radiation proctitis. The results of our study demonstrate that probiotic is as effective as 5-aminosalicylic in the treatment of radiation proctitis, and fecal calprotectin is a useful biomarker in determining the response to the treatment. PMID:26730065

  17. Arabidopsis ERF1 Mediates Cross-Talk between Ethylene and Auxin Biosynthesis during Primary Root Elongation by Regulating ASA1 Expression.

    Directory of Open Access Journals (Sweden)

    Jie-Li Mao

    2016-01-01

    Full Text Available The gaseous phytohormone ethylene participates in the regulation of root growth and development in Arabidopsis. It is known that root growth inhibition by ethylene involves auxin, which is partially mediated by the action of the WEAK ETHYLENE INSENSITIVE2/ANTHRANILATE SYNTHASE α1 (WEI2/ASA1, encoding a rate-limiting enzyme in tryptophan (Trp biosynthesis, from which auxin is derived. However, the molecular mechanism by which ethylene decreases root growth via ASA1 is not understood. Here we report that the ethylene-responsive AP2 transcription factor, ETHYLENE RESPONSE FACTOR1 (ERF1, plays an important role in primary root elongation of Arabidopsis. Using loss- and gain-of-function transgenic lines as well as biochemical analysis, we demonstrate that ERF1 can directly up-regulate ASA1 by binding to its promoter, leading to auxin accumulation and ethylene-induced inhibition of root growth. This discloses one mechanism linking ethylene signaling and auxin biosynthesis in Arabidopsis roots.

  18. Arabidopsis ERF1 Mediates Cross-Talk between Ethylene and Auxin Biosynthesis during Primary Root Elongation by Regulating ASA1 Expression

    Science.gov (United States)

    Wang, Zhen; Yu, Lin-Hui; Cai, Xiao-Teng; Xiang, Cheng-Bin

    2016-01-01

    The gaseous phytohormone ethylene participates in the regulation of root growth and development in Arabidopsis. It is known that root growth inhibition by ethylene involves auxin, which is partially mediated by the action of the WEAK ETHYLENE INSENSITIVE2/ANTHRANILATE SYNTHASE α1 (WEI2/ASA1), encoding a rate-limiting enzyme in tryptophan (Trp) biosynthesis, from which auxin is derived. However, the molecular mechanism by which ethylene decreases root growth via ASA1 is not understood. Here we report that the ethylene-responsive AP2 transcription factor, ETHYLENE RESPONSE FACTOR1 (ERF1), plays an important role in primary root elongation of Arabidopsis. Using loss- and gain-of-function transgenic lines as well as biochemical analysis, we demonstrate that ERF1 can directly up-regulate ASA1 by binding to its promoter, leading to auxin accumulation and ethylene-induced inhibition of root growth. This discloses one mechanism linking ethylene signaling and auxin biosynthesis in Arabidopsis roots. PMID:26745809

  19. The Araucaria Project. Accurate stellar parameters and distance to evolved eclipsing binary ASAS J180057-2333.8 in Sagittarius Arm

    CERN Document Server

    Suchomska, K; Smolec, R; Pietrzyński, G; Gieren, W; Stȩpień, K; Konorski, P; Pilecki, B; Villanova, S; Thompson, I B; Górski, M; Karczmarek, P; Wielgórski, P

    2015-01-01

    We have analyzed the double-lined eclipsing binary system ASAS J180057-2333.8 from the All Sky Automated Survey (ASAS) catalogue . We measure absolute physical and orbital parameters for this system based on archival $V$-band and $I$-band ASAS photometry, as well as on high-resolution spectroscopic data obtained with ESO 3.6m/HARPS and CORALIE spectrographs. The physical and orbital parameters of the system were derived with an accuracy of about 0.5 - 3%. The system is a very rare configuration of two bright well-detached giants of spectral types K1 and K4 and luminosity class II. The radii of the stars are $R_1$ = 52.12 $\\pm$ 1.38 and $R_2$ = 67.63 $\\pm$ 1.40 R$_\\odot$ and their masses are $M_1$ = 4.914 $\\pm$ 0.021 and $M_2$ = 4.875$\\pm$ 0.021 M$_\\odot$ . The exquisite accuracy of 0.5% obtained for the masses of the components is one of the best mass determinations for giants. We derived a precise distance to the system of 2.14 $\\pm$ 0.06 kpc (stat.) $\\pm$ 0.05 (syst.) which places the star in the Sagittariu...

  20. Transactions of the Asae

    OpenAIRE

    Matak, K. E.; Wilson, J. H.; Duncan, S. E.; E. J. Wilson; Hackney, C. R.; Sumner, S S

    2003-01-01

    Lactose hydrolysis was investigated as a method of producing a more extrudable ice cream product. Ice cream mixes were treated with lactase from the microbial sources Kluyveromyces lactis and Aspergillus oryzae to produce 0% to 100% lactose hydrolysis. Compression measurements and yield stress tests of frozen ice cream were both affected by the temperature of the samples. As the temperature decreased, the work required to compress the ice cream 10 mm (firmness) and the torsional shear stress ...

  1. Verdsettelse av Ekornes ASA

    OpenAIRE

    Brakestad, Anniken Stokvik; Pedersen, Erika

    2011-01-01

    Denne oppgaven er en verdsettelse av Ekornes-konsernet. Verdsettelsen er i hovedsak basert på offentlig tilgjengelig informasjon, samt intervju med konsernsjefen i Ekornes Øyvind Tørlen og møbelhistoriker Eldar Høidal. Verdsettelsesmetoden vi har benyttet er kontantstrømsbasert modell. Verdien av konsernet er beregnet med utgangspunkt i en strategisk analyse, en regnskapsanalyse, beregnet avkastningskrav og estimerte fremtidige kontantoverskudd. Problemstillingen for oppgave...

  2. Study of ASA Algorithms

    OpenAIRE

    Ardam, Nagaraju

    2010-01-01

    Hearing aid devices are used to help people with hearing impairment. The number of people that requires hearingaid devices are possibly constant over the years, however the number of people that now have access to hearing aiddevices increasing rapidly. The hearing aid devices must be small, consume very little power, and be fairly accurate.Even though it is normally more important for the user that hearing impairment look good (are discrete). Once thehearing aid device prescribed to the user,...

  3. International 7{sup th} ASA waste days. Mechanical-biological waste treatment - performance of MBT. Proceedings; Internationale 7. ASA-Abfalltage. Mechanisch-Biologische Restabfallbehandlung - Leistungsfaehigkeit der MBA. Tagungsunterlagen

    Energy Technology Data Exchange (ETDEWEB)

    Barth, Josef; Rohring, Daniel (comps.)

    2008-07-01

    Within the International 7th ASA Waste Days at 13th to 15th February, 2008, at the Congress Center Hanover (Federal Republic of Germany), the following lectures were held: (1) Climate change and resource protection (M. Stock); (2) Legal requirements for immission protection of thermal and biological waste treatment (U. Lahl); (3) MBT and requirements in Europe incl. the Integrated Pollution prevention and Control IPPC Guideline (B. Zambrzycki); (4) MBT in Italy - A case study for a successful introduction (A. Confalonieri); (5) MBT with dry digestion - Example of Pohlsche Heide aus Bassum (B. Schulte); (6) MBT with dry digestion - Example of MBT Hanover (B. Vielhaber, C. Nuelle); (7) MBT with percolation - Example of Kahlenberg (G. Person, M. Schreiber, G. Gibis); (8) MBT with tunnel and table windrows decomposition process - Example Havelland; (9) MBT with tunnel and table windrows decomposition process - Example Linkenbach (S. Kraus, T. Sterk); (10) MBS Mechanical Biological Stabilisation Process - Example Osnabrueck (C. Niehaves); (11) Complete Eco-efficient Material and Energetic Recovery of Dried Municipal Solid Wastes (M. Monzel); (12) MPS Mechanical Physical Stabilisation Process - Example Berlin (D. Michalski, A. Wendt, U. Buell); (13) Secondary Fuels - Pretreatment, Specialities, Requirements, Current Sales and Markets (S. Flamme); (14) Corrosion in Biological Waste Treatment Plants (K. Fricke, T. Thiel, T. Bahr, R. Wallmann); (15) Problems at the Operation of Plants with the RTO Exhaust Gas Treatment in the Frame of MBT Processes (O. Carlowitz, O. Neese); (16) Problems and Solutions with the Analysis and Emission Measuring According to AbfABIV and 30. BImSchV (K. Ketelsen); (17) Securing of a High Plant Availability by Self-Supporting Cleansing, Maintenance and Care Programmes - Example of MBT Plant Croebern (J. Burchert); (18) Fire Control - Conceptions, Safety Measures, Cause of Fires - Example of MBT Ennigerloh and MBT Vorketzin (M. Pahlenkemper, B

  4. Six months of multiwavelength follow-up of the tidal disruption candidate ASASSN-14li and implied TDE rates from ASAS-SN

    Science.gov (United States)

    Holoien, T. W.-S.; Kochanek, C. S.; Prieto, J. L.; Stanek, K. Z.; Dong, Subo; Shappee, B. J.; Grupe, D.; Brown, J. S.; Basu, U.; Beacom, J. F.; Bersier, D.; Brimacombe, J.; Danilet, A. B.; Falco, E.; Guo, Z.; Jose, J.; Herczeg, G. J.; Long, F.; Pojmanski, G.; Simonian, G. V.; Szczygieł, D. M.; Thompson, T. A.; Thorstensen, J. R.; Wagner, R. M.; Woźniak, P. R.

    2016-01-01

    We present ground-based and Swift photometric and spectroscopic observations of the candidate tidal disruption event (TDE) ASASSN-14li, found at the centre of PGC 043234 (d ≃ 90 Mpc) by the All-Sky Automated Survey for SuperNovae (ASAS-SN). The source had a peak bolometric luminosity of L ≃ 1044 erg s-1 and a total integrated energy of E ≃ 7 × 1050 erg radiated over the ˜6 months of observations presented. The UV/optical emission of the source is well fitted by a blackbody with roughly constant temperature of T ˜ 35 000 K, while the luminosity declines by roughly a factor of 16 over this time. The optical/UV luminosity decline is broadly consistent with an exponential decline, L∝ e^{-t/t_0}, with t0 ≃ 60 d. ASASSN-14li also exhibits soft X-ray emission comparable in luminosity to the optical and UV emission but declining at a slower rate, and the X-ray emission now dominates. Spectra of the source show broad Balmer and helium lines in emission as well as strong blue continuum emission at all epochs. We use the discoveries of ASASSN-14li and ASASSN-14ae to estimate the TDE rate implied by ASAS-SN, finding an average rate of r ≃ 4.1 × 10-5 yr-1 per galaxy with a 90 per cent confidence interval of (2.2-17.0) × 10-5 yr-1 per galaxy. ASAS-SN found roughly 1 TDE for every 70 Type Ia supernovae in 2014, a rate that is much higher than that of other surveys.

  5. 810-nm InGaA1As/A1GaAs double quantum well semiconductor lasers with asymmetric waveguide structures

    Institute of Scientific and Technical Information of China (English)

    Lin Li; Guojun Liu; Zhanguo Li; Mei Li; Xiaohua Wang; Hui Li; Chunming Wan

    2008-01-01

    @@ The 810-nm InGaA1As/A1GaAs double quantum well (QW) semiconductor lasers with asymmetric waveguide structures, grown by molecular beam epitaxy, show high quantum efficiency and high-power conversion efficiency at continuous-wave (CW) power output. The threshold current density and slope efficiency of the device are 180 A/cm2 and 1.3 W/A, respectively. The internal loss and the internal quantum efficiency are 1.7 cm-1 and 93%, respectively. The 70% maximum power conversion efficiency is achieved with narrow far-field patterns.

  6. Tidal Effects on Groundwater in a Very Small Tropical Island: A Study on the Groundwater Resources of Pag-asa Island, Kalayaan Island Group

    Directory of Open Access Journals (Sweden)

    John Ong

    2000-12-01

    Full Text Available The Pag-asa Island, with its very small land area and low relief, has a very limited fresh water supply occurring as a thin freshwater lens. Climate, topography, vegetation, lithology, human abstractions, and tides affect the volume of the freshwater lens. Topographic and hydrogeologic surveys, coupled with a 72-hour groundwater-monitoring program were done to assess the effects of tides on the freshwater lens.Groundwater parameters measured in wells during the monitoring program include variations in water table depths, specific electrical conductivity (SEC, and temperature. Changes in these parameters were then correlated with the observed variations of the tides.The groundwater levels oscillate with the tides at varying amplitudes. The hydraulic properties of the lithologies making up the island's aquifer influence the amplitude of the oscillations. Groundwater level oscillations are least in the reef materials and greatest in the sandy materials where it is nearly simultaneous with the tidal variations. High electrical conductivity values are marked in wells built near the coasts and in sandy materials.The average annual precipitation is approximately 2,020 mm. Based on empirical studies, the estimated sustainable yield for small tropical islands is 6% of the lowest annual rainfall or about 20,300 m3/yr for Pag-asa Island.

  7. TDPAC measurements of the EFG in Hf2Fe compound and the interpretation of the results by the FP-LMTO-ASA Method

    International Nuclear Information System (INIS)

    The time differential perturbed angular correlation (TDPAC) technique has been used to investigate the temperature dependence of the electric field gradient (EFG) at 181Ta ion probe in the intermetallic compound Hf2Fe. The results of the measurements at 78 K are compared with the theoretical calculations performed by the first-principle full potential (FP) linear muffin tin orbital (LMTO) method in the atomic sphere approximation (ASA). The experimental results for two inequivalent Hf sites in Hf2Fe reveal very large differences concerning the EFG values and their temperature dependencies. These facts are confirmed by the theoretical calculations and could be explained by the existence of different mechanisms of formation of the EFG's at these sites. (authors)

  8. Discovery of a Promissing Candidate of WZ Sge-Type Dwarf Novae, ASAS 160048-4846.2: Evidence for Double-Peaked Humps

    CERN Document Server

    Imada, A; Imada, Akira

    2005-01-01

    We report on time-resolved CCD photometry during the 2005 June outburst of a dwarf nova, ASAS160048-4846.2. The observed light curves unambiguously showed embryonic humps with a period of 0.063381(41) days, after which genuine superhumps emerged with a period of 0.064927(3) days. Based on evidence for double-peaked humps in the earlier stage of the outburst, this object might be qualified as the seventh member of WZ Sge-type dwarf novae after Var Her 04. If the former period is the same as, or very close to the orbital period of the system, as in other WZ Sge systems, the fractional superhump excess is about 2.4${%}$. This value is unexpectedly larger than that of other WZ Sge-type dwarf novae. The early phase of our observing run provided evidence for the transition from chaotic humps to genuine superhumps, together with increasing the amplitude.

  9. The consciousness state space (CSS)-a unifying model for consciousness and self.

    Science.gov (United States)

    Berkovich-Ohana, Aviva; Glicksohn, Joseph

    2014-01-01

    Every experience, those we are aware of and those we are not, is embedded in a subjective timeline, is tinged with emotion, and inevitably evokes a certain sense of self. Here, we present a phenomenological model for consciousness and selfhood which relates time, awareness, and emotion within one framework. The consciousness state space (CSS) model is a theoretical one. It relies on a broad range of literature, hence has high explanatory and integrative strength, and helps in visualizing the relationship between different aspects of experience. Briefly, it is suggested that all phenomenological states fall into two categories of consciousness, core and extended (CC and EC, respectively). CC supports minimal selfhood that is short of temporal extension, its scope being the here and now. EC supports narrative selfhood, which involves personal identity and continuity across time, as well as memory, imagination and conceptual thought. The CSS is a phenomenological space, created by three dimensions: time, awareness and emotion. Each of the three dimensions is shown to have a dual phenomenological composition, falling within CC and EC. The neural spaces supporting each of these dimensions, as well as CC and EC, are laid out based on the neuroscientific literature. The CSS dynamics include two simultaneous trajectories, one in CC and one in EC, typically antagonistic in normal experiences. However, this characteristic behavior is altered in states in which a person experiences an altered sense of self. Two examples are laid out, flow and meditation. The CSS model creates a broad theoretical framework with explanatory and unificatory power. It constructs a detailed map of the consciousness and selfhood phenomenology, which offers constraints for the science of consciousness. We conclude by outlining several testable predictions raised by the CSS model. PMID:24808870

  10. Orbital and physical parameters of eclipsing binaries from the ASAS catalogue -- I. A sample of systems with components' masses between 1 and 2 M$_\\odot$

    CERN Document Server

    Hełminiak, K G; Ratajczak, M; Muterspaugh, M

    2009-01-01

    We derive the absolute physical and orbital parameters for a sample of 18 detached eclipsing binaries from the \\emph{All Sky Automated Survey} (ASAS) database based on the available photometry and our own radial velocity measurements. The radial velocities (RVs) are computed using spectra we collected with the 3.9-m Anglo-Australian Telescope and its \\emph{University College London Echelle Spectrograph} and the 1.9-m SAAO Radcliffe telescope and its \\emph{Grating Instrument for Radiation Analysis with a Fibre Fed Echelle}. In order to obtain as precise RVs as possible, most of the systems were observed with an iodine cell available at the AAT/UCLES and/or analyzed using the two-dimensional cross-correlation technique (TODCOR). The RVs were measured with TODCOR using synthetic template spectra as references. However, for two objects we used our own approach to the tomographic disentangling of the binary spectra to provide observed template spectra for the RV measurements and to improve the RV precision even mo...

  11. Six Months of Multi-Wavelength Follow-up of the Tidal Disruption Candidate ASASSN-14li and Implied TDE Rates from ASAS-SN

    CERN Document Server

    Holoien, T W -S; Prieto, J L; Stanek, K Z; Dong, Subo; Shappee, B J; Grupe, D; Brown, J S; Basu, U; Beacom, J F; Bersier, D; Brimacombe, J; Danilet, A B; Falco, E; Guo, Z; Jose, J; Herczeg, G J; Long, F; Pojmanski, G; Simonian, G V; Szczygiel, D M; Thompson, T A; Thorstensen, J R; Wozniak, P R

    2016-01-01

    We present ground-based and Swift photometric and spectroscopic observations of the candidate tidal disruption event (TDE) ASASSN-14li, found at the center of PGC 043234 ($d\\simeq90$~Mpc) by the All-Sky Automated Survey for SuperNovae (ASAS-SN). The source had a peak bolometric luminosity of $L\\simeq10^{44}$ ergs s$^{-1}$ and a total integrated energy of $E\\simeq7\\times10^{50}$ ergs radiated over the $\\sim6$ months of observations presented. The UV/optical emission of the source is well-fit by a blackbody with roughly constant temperature of $T\\sim35,000$ K, while the luminosity declines by roughly a factor of 16 over this time. The optical/UV luminosity decline is broadly consistent with an exponential decline, $L\\propto e^{-t/t_0}$, with $t_0\\simeq60$ days. ASASSN-14li also exhibits soft X-ray emission comparable in luminosity to the optical and UV emission but declining at a slower rate, and the X-ray emission now dominates. Spectra of the source show broad Balmer and helium lines in emission as well as st...

  12. In search of quality assurance in basic education : an investigation on the role of Kwara state universal basic education board in Asa local government Area of Kwara State, Nigeria

    OpenAIRE

    2009-01-01

    Abstract This inquiry deals with the subject of quality of education at the basic level. It specifically seeks to examine the efforts Kwara State Universal Basic Education Board (KWSUBEB) is making to improve the quality of basic education in Asa Local Government Area (ALGA), Kwara State, Nigeria. The methodological paradigm applied to investigate the study is qualitative. Case study is utilised as the choice of research design. Interviews and documents are the instruments of data col...

  13. Static platelet adhesion, flow cytometry and serum TXB2 levels for monitoring platelet inhibiting treatment with ASA and clopidogrel in coronary artery disease: a randomised cross-over study

    OpenAIRE

    Hedbäck Bo; Lindahl Tomas L; Jonasson Lena; Eriksson Andreas C; Whiss Per A

    2009-01-01

    Background: Despite the use of anti-platelet agents such as acetylsalicylic acid (ASA) and clopidogrel in coronary heart disease, some patients continue to suffer from atherothrombosis. This has stimulated development of platelet function assays to monitor treatment effects. However, it is still not recommended to change treatment based on results from platelet function assays. This study aimed to evaluate the capacity of a static platelet adhesion assay to detect platelet inhibiting effects ...

  14. Windows Messenger i Statoil ASA

    OpenAIRE

    Kollsgård, Mari

    2007-01-01

    Denne oppgaven er en kvalitativ undersøkelse av kommunikasjon i tverrfaglige prosjektarbeid med utgangspunkt i bruk av kommunikasjonskanalen Windows Messenger. De empiriske funnene i oppgaven er basert på en intervju- og observasjonsundersøkelse som ble gjort i Statoil ved årsskiftet 2006/2007.

  15. Validación de apariencia, contenido y consistencia interna de la Escala de Apreciación de Agencia de Autocuidado (ASA) para Costa Rica, segunda versión en español

    OpenAIRE

    Viriam Leiva Díaz; Kenneth Cubillo Vargas; Tatiana Ramírez Villegas; Yuliany Porras Gutiérrez; Isabel Sirias Wong

    2015-01-01

    Introducción: Este artículo presenta los resultados obtenidos del proceso de validación de apariencia, contenido y consistencia interna al que fue sometida la segunda versión en español de la escala ASA aplicada a población  costarricense.Método: Este estudio es descriptivo, transversal, con un enfoque cuantitativo, con un diseño no experimental y psicométrico, realizado con una muestra de 211 personas en la etapa de la adultez temprana, intermedia y tardía, según su condición de salud conoci...

  16. Soil development in the Nordic countries - Identification and quantification of factors and processes, and prerequisites for biological primary production. Extended abstracts from a Nordic Workshop 6-9 September 1994, Asa, Sweden

    Energy Technology Data Exchange (ETDEWEB)

    Olsson, Mats [ed.

    1996-12-31

    This report is a compilation of abstracts from research presentations during a Nordic workshop at Asa in Sweden, September 6-9th 1994. The main goal with the workshop was to give insight in ongoing pedological research in Denmark, Finland, Norway and Sweden. Further aims were to form a basis for co-ordinated research that takes advantage of the amplitude in soils and climate, and scientific competence in the Nordic countries. The intention was also to initiate a Nordic soil data-bank to be used in research and teaching. Focus was placed on podzolised soils. Separate inputs have been made for all the 14 abstracts

  17. Genetic screening and analysis of suppressors of asa1-1 (soa) defective in jasmonate-mediated lateral root formation in Arabidopsis%茉莉酸诱导侧根形成缺陷突变体asa1-1抑制子(soa)的鉴定与遗传分析

    Institute of Scientific and Technical Information of China (English)

    李延安; 祁林林; 孙加强; 刘宏宇; 李传友

    2011-01-01

    外源茉莉酸处理野生型拟南芥能够促进侧根的形成,而在asa1-1突变体中茉莉酸抑制侧根的形成,这与在该突变体背景下茉莉酸显著降低PIN2蛋白水平密切相关.为了进一步研究茉莉酸诱导PIN2蛋白水平下调的分子机制,文章采用正向遗传学的方法筛选asa1-1抑制子soa,期望获得茉莉酸处理后侧根发育恢复的突变体.通过筛选鉴定获得2个突变体:soa563和soa856.这2个突变体在10 μmol/L茉莉酸甲酯处理条件下都能够恢复侧根发育,而且茉莉酸处理后PIN2蛋白水平降低的现象在soa563中被完全抑制,在soa856中被部分抑制.这些结果表明这两个突变基因可能影响了茉莉酸调控的PIN2蛋白水平下调途径,并且参于了茉莉酸对侧根发生的调控.对这两个基因的分离和功能研究将为阐明茉莉酸与生长素互作调控侧根发生的分子机制提供新的知识积累.%It has been shown that jasmonate modulates the lateral root development through crosstalk with auxin in Arabidopsis thaliana. Exogenous application of jasmonate stimulates lateral root formation in wild type but inhibits lateral root formation in asal-1. Our previous work has demonstrated that the lateral root formation defect of asal-1 is co-related with jasmonte effect on PIN2 protein levels. To further elucidate the molecular mechanisms underlying jasmonate-mediated reduction of plasma membrane (PM)-resident PIN2 abundance, we have conducted a genetic screen to identify suppressors of asal-1 (soa), which showed lateral root formation in the presence of jasmonate. Here, we described the basic characteri-zation of soa563 and soa856. We showed that both soa563 and soa856 displayed restored lateral root formation in response to exogenous jasmonate. In addition, jasmonate-induced PIN2:GFP reduction was blocked in these two mutants. Our on-going effort to identify genes defined by these mutants promise to shed new light on the understanding of

  18. Confiabilidad de la escala "Apreciación de la agencia de autocuidado" (ASA, segunda versión en español, adaptada para población colombiana Confiabilidade da escala "Apreciação da Agência de Autocuidado" (ASA, segunda versão em espanhol, adaptada ao povo colombiano Scale reliability "Self-care Agency Appreciation" (SAA, second version in Spanish, adapted for the Colombian population

    Directory of Open Access Journals (Sweden)

    ANITA VELANDIA ARIAS

    2009-07-01

    Full Text Available Objetivo: establecer la confiabilidad de la escala "Apreciación de la agencia de autocuidado" (ASA deEvers eIsenberg, segunda versión en español, y describir la capacidad de agencia de autocuidado en personas con factor de riesgo cardiovascular que asisten al programa de crónicos del servicio de consulta externa de un hospital de Bogotá, Colombia. Metodología: diseño descriptivo con abordaje cuantitativo que permitió evaluar la capacidad de agencia de autocuidado en una muestra de 201 personas con factores de riesgo cardiovascular que asistieron al programa de crónicos en un hospital de Bogotá, mediante el empleo de la escala ASA, segunda versión en español. A esta escala se le realizó la medición de la confiabilidad a través del cálculo del valor del coeficiente de alfa-Cronbach. Resultados: se encontró que el 35,8% de los participantes tuvo buena capacidad de agencia de autocuidado y el 62,6%, regular. Se aplicó el coeficiente de confiabilidad alfa-Cronbach a la escala ASA y se obtuvo un valor de 0,744. Conclusiones: se observa una diferencia de 0,026 por debajo del valor reportado en la medición de confiabilidad de la escala ASA, realizada por la doctora Gallegos, primera versión en español, para un contexto mexicano; estos resultados significan que los 24 ítems analizados de la escala miden un mismo concepto y por lo tanto se concluye que el instrumento posee consistencia interna.Objectivo: estabelecer a confiabilidade da escala "Apreciação da agência de autocuidado" (ASA de Evers e Isenberg, segunda versão em espanhol, e descreve a capacidade de agência de autocuidado em pessoas com fatores de risco cardiovascular que utilizam o programa de crônicos do serviço de consulta externa de um hospital de Bogotá, Colômbia. Metodologia: delineamento descritivo com abordagem quantitativa que permitiu avaliar a capacidade de agência de autocuidado dentro de uma amostra de 201 pessoas com fatores de risco cardiovascular

  19. Confiabilidad de la escala "Apreciación de la agencia de autocuidado" (ASA, segunda versión en español, adaptada para población colombiana1 Scale reliability "Self-care Agency Appreciation" (SAA, second version in Spanish, adapted for the Colombian population Confiabilidade da escala "Apreciação da Agência de Autocuidado" (ASA, segunda versão em espanhol, adaptada ao povo colombiano

    Directory of Open Access Journals (Sweden)

    RIVERA ÁLVAREZ LUZ NELLY

    2009-07-01

    Full Text Available Objetivo: establecer la confiabilidad de la escala "Apreciación de la agencia de autocuidado" (ASA deEvers eIsenberg, segunda versión en español, y describir la capacidad de agencia de autocuidado en personas con factor de riesgo cardiovascular que asisten al programa de crónicos del servicio de consulta externa de un hospital de Bogotá, Colombia. Metodología: diseño descriptivo con abordaje cuantitativo que permitió evaluar la capacidad de agencia de autocuidado en una muestra de 201 personas con factores de riesgo cardiovascular que asistieron al programa de crónicos en un hospital de Bogotá, mediante el empleo de la escala ASA, segunda versión en español. A esta escala se le realizó la medición de la confiabilidad a través del cálculo del valor del coeficiente de alfa-Cronbach. Resultados: se encontró que el 35,8% de los participantes tuvo buena capacidad de agencia de autocuidado y el 62,6%, regular. Se aplicó el coeficiente de confiabilidad alfa-Cronbach a la escala ASA y se obtuvo un valor de 0,744. Conclusiones: se observa una diferencia de 0,026 por debajo del valor reportado en la medición de confiabilidad de la escala ASA, realizada por la doctora Gallegos, primera versión en español, para un contexto mexicano; estos resultados significan que los 24 ítems analizados de la escala miden un mismo concepto y por lo tanto se concluye que el instrumento posee consistencia interna.Purpose: To establish the scale reliability "Self-care Agency Appreciation" (SAA of Evers and Isenberg, second version in Spanish, and to describe the capacity of self-care agency among people with cardiovascular factor risks who attend the out-patient chronic patients program service of a hospital in Bogotá, Colombia. Method: descriptive design with a quantitative approach that enabled us to evaluate the self-care agency capacity in a sample of 201 patients with cardiovascular risk factors who attended the chronic patients

  20. “Conviver com a seca”: contribuição da Articulação do Semi-Árido/ASA para o desenvolvimento sustentável

    Directory of Open Access Journals (Sweden)

    Ghislaine Duque

    2008-01-01

    Full Text Available The Brazilian semi-arid region poses huge challenges to sustainable development: the edapho-climatic characteristics, undoubtedly, but also, and much more so, the prevalence of a policy based on greenrevolution principles and incentives to agribusiness, on one hand, and on assistentialism for the poor in the countryside, on the other. Against the “fighting draught” paradigm – carried on by the construction of large water reservoirs and water distribution through tank trucks, leading to dependence, and its use for irrigation, harming the environment – family farmers and their institutions, organized by the Semi-Arid Articulation/ASA, complain about the “living with draught” principle. They restore and promote experiences born from popular knowledge and improved through contact with scientific knowledge, and change them into references to propose a different public policy model to the public authorities. This is how the P1MC – Programa de Formação e Mobilização para Convivência no Semi-Árido: um Milhão de Cisternas Rurais (Education and Mobilization Program for Semi-Arid Living: One Million Rural Cisterns was born, followed by P1+2 – Programa Uma Terra e Duas Águas (One Earth/Land and Two Waters Program. The strategy used by the farmers to diversify activities and create water reserves, forage, and seeds, and agro-ecological principles, are at the basis of the development model proposed by ASA. The methodology developed fosters farmer protagonism and its organization, safeguarding the sustainability of the process.

  1. Pharmacokinetics in Wistar Rats of 5-[(4-Carboxybutanoyl)Amino]-2-Hydroxybenzoic Acid: A Novel Synthetic Derivative of 5-Aminosalicylic Acid (5-ASA) with Possible Anti-Inflammatory Activity

    Science.gov (United States)

    Correa-Basurto, José; Rosales Hernández, Martha Cecilia; Padilla Martínez, Itzia Irene; Mendieta-Wejebe, Jessica Elena

    2016-01-01

    5-[(4-carboxybutanoyl)amino]-2-hydroxybenzoic acid (C2) is a novel synthetic derivative of 5-aminosalicylic acid (5-ASA), which is currently being evaluated ex vivo as an anti-inflammatory agent and has shown satisfactory results. This study aimed to obtain the pharmacokinetic profiles, tissue distribution and plasma protein binding of C2 in Wistar Rats. Additionally, an HPLC method was developed and validated to quantify C2 in rat plasma. The pharmacokinetic profiles of intragastric, intravenous and intraperitoneal administration routes at singles doses of 100, 50, and 100 mg/kg, respectively, were studied in Wistar rats. The elimination half-life of intravenously administered C2 was approximately 33 min. The maximum plasma level of C2 was reached approximately 24 min after intragastric administration, with a Cmax value of 2.5 g/mL and an AUCtot value of 157 μg min-1/mL; the oral bioavailability was approximately 13%. Following a single intragastric or oral dose (100 mg/kg), C2 was distributed and detected in all examined tissues (including the brain and colon). The results showed that C2 accumulates over time. The plasma protein binding results indicated that the unbound fraction of C2 at concentrations of 1 to 20 μg/mL ranged from 89.8% to 92.5%, meaning that this fraction of C2 is available to cross tissues. Finally, the blood-plasma partitioning (BP ratio) of C2 in rat plasma was 0.71 and 0.6 at concentrations of 5 and 10 μg/mL, respectively, which indicates that C2 is free in the plasmatic phase and not inside blood cells. The results of this study suggest that a fraction of the administered C2 dose is absorbed in the stomach, and the fraction that is not absorbed reaches the small intestine and colon. This distribution constitutes the main advantage of C2 compared with 5-ASA for the treatment of ulcerative colitis (UC) and Crohn's disease (CD). PMID:27454774

  2. Bioaccumulation and associated dietary risks of Pb, Cd, and Zn in amaranth (Amaranthus cruentus) and jute mallow (Corchorus olitorius) grown on soil irrigated using polluted water from Asa River, Nigeria.

    Science.gov (United States)

    Ogunkunle, Clement Oluseye; Ziyath, Abdul M; Adewumi, Faderera Esther; Fatoba, Paul Ojo

    2015-05-01

    Dietary uptake of heavy metals through the consumption of vegetables grown on polluted soil can have serious human health implications. Thus, the study presented in this paper investigated the bioaccumulation and associated dietary risks of Pb, Zn, and Cd present in vegetables widely consumed in Nigeria, namely amaranth and jute mallow, grown on soil irrigated with polluted water from Asa River. The study found that the soil was polluted with Zn, Pb, and Cd with Pb and Cd being contributed by polluted river, while Zn was from geogenic sources. The metal concentration in amaranth and jute mallow varied in the order of Zn > Pb > Cd and Zn > Pb ≈ Cd, respectively. Jute mallow acts as an excluder plant for Pb, Cd, and Zn. Consequently, the metal concentrations in jute mallow were below the toxic threshold levels. Furthermore, non-cancer human health risk of consuming jute mallow from the study site was not significant. In contrast, the concentrations of Pb and Cd in amaranth were found to be above the recommended safe levels and to be posing human health risks. Therefore, further investigation was undertaken to identify the pathways of heavy metals to amaranth. The study found that the primary uptake pathway of Pb and Cd by amaranth is foliar route, while root uptake is the predominant pathway of Zn in amaranth. PMID:25899541

  3. Vertical Electrical Sounding Investigation for Delineation of Geoelectric Layers and Evaluation of Groundwater Potential in Ajagba, Asa and Ikonifin Localities of Ola Oluwa Local Government Area of Osun State, South Western Nigeria

    Directory of Open Access Journals (Sweden)

    M. Onimisi

    2013-10-01

    Full Text Available Vertical Electrical Sounding (VES surveys were carried out at Ajagba, Asa and Ikonifin communities in the north of Ola Oluwa local government area of Osun state, Nigeria in order to delineate the geoelectric layers in the area as well as evaluate the groundwater potential. The area is in the basement complex terrain of Nigeria where the occurrence of groundwater is highly unpredictable and hence requires the use of hydrologic, geophysical and geologic surveys to achieve success in groundwater development programs. The survey delineated a maximum of four geoelectric layers which may be interpreted to correspond to four geologic layers viz the topsoil, weathered basement, partly weathered/fractured basement and the fresh basement. The weathered basement and the partly weathered/fractured basement layers constitute the aquifer units. The partly weathered/fractured layer is significant in enhancing the ground water potential in this area because of its relatively low resistivity resulting from its high fracture frequency. The ground water potential in the area varies from medium to high. Groundwater development is therefore feasible in these communities.

  4. Validación de apariencia, contenido y consistencia interna de la Escala de Apreciación de Agencia de Autocuidado (ASA para Costa Rica, segunda versión en español

    Directory of Open Access Journals (Sweden)

    Viriam Leiva Díaz

    2015-07-01

    Full Text Available Introducción: Este artículo presenta los resultados obtenidos del proceso de validación de apariencia, contenido y consistencia interna al que fue sometida la segunda versión en español de la escala ASA aplicada a población  costarricense.Método: Este estudio es descriptivo, transversal, con un enfoque cuantitativo, con un diseño no experimental y psicométrico, realizado con una muestra de 211 personas en la etapa de la adultez temprana, intermedia y tardía, según su condición de salud conocidas como sanas o con diagnóstico de enfermedad crónica.Resultados: La investigación determinó que el análisis factorial con la aplicación de métodos estadísticos, la prueba de Kaiser-Meyer-Olkin (KMO con resultado de 0,79, evidenció la viabilidad de la escala, en la que las variables miden factores comunes con una varianza total del 64,14%.Conclusión: El análisis factorial arrojó siete ejes factoriales y obtuvo valores adecuados que demuestran su validez.

  5. Asas Indemnitas dan Kafalah dalam Asuransi Syariah

    Directory of Open Access Journals (Sweden)

    Desmadi Saharuddin

    2015-10-01

    Full Text Available The main objectives of a person to invest are to become wealthier and to gain tranquility in his life. It becomes absurd when the right customers for indemnity (kafalah towards customers who received a risk become unguaranteed. The customer is often difficult to understand the terms contained in the insurance policy that written in a very small font. The ambiguities of these terms become significant obstacles in the settlement of claims. Cases of claim are mostly the result of the customer's difficulty in understanding these terms and the lack of a good explanation of the company concerning the content of the policy.DOI: 10.15408/aiq.v5i1.2114

  6. Edexcel Physics ASA2 student unit guide

    CERN Document Server

    Bridgeman, Keith

    2013-01-01

    Perfect for revision, these guides explain the unit requirements, summarise the content and include specimen questions with graded answers. Each full-colour New Edition Student Unit Guide provides ideal preparation for your unit exam:.; Feel confident you understand the unit: each guide comprehensively covers the unit content and includes topic summaries, knowledge check questions and a reference index.; Get to grips with the exam requirements: the specific skills on which you will be tested are explored and explained.; Analyse exam-style questions: graded student responses will help you focus

  7. Pemahaman Konsep Tauhid Asas Keharmonian Kepelbagaian Agama

    Directory of Open Access Journals (Sweden)

    Nur Farhana Abdul Rahman

    2012-06-01

    Full Text Available Efforts in forming harmonious existence among religious believers have produced two important responses and approaches as reaction to religious diversity. The first type views religious diversity as a need for implementing active tolerance attitude among religious believers although this does not proceed to relativism and the second type of view acknowledges the unity of religious truths. Essentially, Islam has many models and systems in dealing with religious diversity. In evidence, the essence of Islamic teachings is the obligation of Muslims to act in justice and peaceful to all human beings regardless of their religious beliefs. This has also been described in Al-Faruqi’s discourse on meta-religion. However, the Islamic teachings that emphasize on respect to other religious believers should not exceed the basic tenets of Islamic creed and faith. This study found that the concept of tawhid in Islam can be a strong argument in cultivating tolerance and harmony among people of different religions.

  8. 烯基琥珀酸酐疏水化淀粉的性能及其表面施胶应用研究%Study on the performance and of hydrophobic starch modified by ASA and its application as surface sizing agent

    Institute of Scientific and Technical Information of China (English)

    杨晓武; 沈一丁; 李培枝; 黄芳

    2013-01-01

    为制备一种环境友好型表面施胶剂,采用烯基琥珀酸酐(ASA)对淀粉进行疏水改性,使用红外光谱(FT-IR)、X射线衍射(XRD)、扫描电镜(SEM)和表面张力仪等测试手段对其性能进行了表征,并将烯基琥珀酸酐疏水化改性淀粉作为纸张表面施胶剂进行应用研究.结果表明,在淀粉分子上成功引入疏水性长链,淀粉颗粒形貌发生了变化,烯基琥珀酸酐疏水化淀粉施胶浓度为5%时,其施胶度可达206s,动态接触角达120°以上.%In order to prepare a kind of environment-friendly surface sizing agent, the starch was modified by alkenyl succinic anhydride (ASA) , and the performances were characterized by the infrared spectrum (FT-IR) , X-ray diffraction (XRD) , scanning electron microscopy (SEM), surface tension meter and so on, and the sur-face sizing effect of hydrophobic starch modified by ASA was studied. The results showed that, the hydropho-bic long chain was introduced onto the guar gum successfully, the morphology of starch granules changed. As the dosage of modified guar gum was 5%, the sizing degree was up to 206s, and the dynamic contact angle (DCA) was more than 120°.

  9. Variations of Three Antioxidant Enzymes Activities and AsA Content in Leaves of Solanum nigrum L. under Cadmium Stress%镉胁迫下龙葵叶中三种抗氧化酶的活性和抗坏血酸含量的变化

    Institute of Scientific and Technical Information of China (English)

    唐秀梅; 龚春风; 刘鹏; 徐根娣; 蔡妙珍; 吴琼鸯

    2008-01-01

    水培龙葵,设置0、10、25、50、100 mg·L-15个镉浓度,处理17和34 d后测定叶片中3个保护酶活性和抗坏血酸含量.结果表明,经镉处理后的过氧化物酶(POD)、超氧化物歧化酶(SOD)、过氧化氢酶(CAT)活性和抗坏血酸(ASA)含量都增加,25、100mg·L-1镉处理的差异显著;处理34d后,3个酶的活性呈现随着镉浓度升高而变化的规律,三者都表现出先升高后降低再升高的趋势.

  10. Validación de apariencia, contenido y consistencia interna de la Escala de Apreciación de Agencia de Autocuidado (ASA para Costa Rica, segunda versión en español para población conocida sana

    Directory of Open Access Journals (Sweden)

    Viriam Leiva Díaz

    2015-12-01

    Full Text Available Introducción. Este artículo presenta los resultados obtenidos del proceso de validación de apariencia, contenido y consistencia interna al que fue sometida la segunda versión en español de la escala ASA con población costarricense conocida sana. Metodología. Se trata de un estudio descriptivo, transversal, de enfoque cuantitativo, diseño no experimental y psicométrico, realizado con una muestra de 105 personas en etapa de adultez temprana, intermedia y tardía. Resultado. La investigación determinó que el estudio factorial (método ACP con rotación Varimax sugirió el análisis con cinco ejes factoriales que explican el 60,03% de la varianza total en Costa Rica. Del resultado de los dominios anteriores, se destaca que en la mayoría de ellos predomina la categoría relacionada al requisito universal de prevención de peligros contra la vida, el funcionamiento y bienestar humano. Conclusión. En Costa Rica, la enfermería puede contar con un instrumento válido y confiable para medir la capacidad de agencia de autocuidado en las personas conocidas sanas que se encuentran en la etapa de la adultez.

  11. ASA24® Instructions for Study Staff & Respondents

    Science.gov (United States)

    The following documents have been created by the National Cancer Institute (NCI) as resources for study staff and Respondents. Each resource is available as a ready-to-use PDF as well as in Word format to allow users to adapt the content as desired.

  12. ASA conference on radiation and health: Coolfont IV. Final report

    International Nuclear Information System (INIS)

    The conference included presentations on (1) DOE follow-up studies of exposed workers; (2) probability of causation; (3) radon; (4) occupational mortality studies; (5) life-table construction; (6) morbidity versus mortality studies; (7) old and new risks in radium dial painters; and (8) mental retardation in A-bomb survivors

  13. ASAS INDEMNITAS DAN KAFÂLAH DALAM ASURANSI SYARIAH

    Directory of Open Access Journals (Sweden)

    Desmadi Saharuddin

    2015-10-01

    Full Text Available The main objectives of a person to invest are to become wealthier and to gain tranquility in his life. It becomes absurd when the right customers for indemnity (kafâlah towards customers who received a risk become unguaranteed. The customer is often difficult to understand the terms contained in the insurance policy that written in a very small font. The ambiguities of these terms become significant obstacles in the settlement of claims. Cases of claim are mostly the result of the customer’s difficulty in understanding these terms and the lack of a good explanation of the company concerning the content of the policy.DOI: 10.15408/aiq.v5i1.2560

  14. ASA theory: an empirical study of the attraction proposition

    OpenAIRE

    Billsberry, Jon

    2004-01-01

    This paper reports an empirical test of Schneider's (1987) attraction proposition that organizations attract people who share the organization's values. The values of 621 applicants to nine utility companies in the United Kingdom were compared to (1) the values of people contiguously seeking similar work, (2) the values of employees they might be working alongside, and (3) the values of the organizations' senior managers. The results show an effect for person–vocation fit, but once this is co...

  15. Specifications Used for ASA24® Digital Images

    Science.gov (United States)

    The Children's Nutrition Research Center's (CNRC) at the Baylor College of Medicine developed a food photography system to photograph precise portion sizes of a large number of food items to create quality standardized images used for dietary recall protocols.

  16. PEMBERLAKUAN ASAS RETROAKTIF DALAM PEMBERANTASAN TINDAK PIDANA KORUPSI

    Directory of Open Access Journals (Sweden)

    I MADE ADI SERAYA

    2013-01-01

    Full Text Available The study entitled, "The implementation of the retroactive principle in fighting against corruption". The background of this research was derive from the fact that corruption is an extraordinary crime that needs an extra way against it. The formation of Corruption Eradication Commission (KPK as an independent agency in the form of eradicating corruption in Indonesia has gradually demonstrated its role. But, Problems then occur when the citizen force KPK to handle the corruption cases before this constitution constructed, especially BLBI case which made this state inflict a financial loss about  Rp 138,4 trillions happen during  the 1997-1998. From the background it raised an issue, whether the retroactive principle can be applied by the Commission in the investigation, and prosecution of the perpetrators of corruption that occurred before the enactment of Law No. 30 Year 2002 was made on the Corruption Eradication Commission? In this discussion the retroactive principle can be applied by the Commission in making "a series of actions" which make it able to conduct an investigation and prosecution of the perpetrators of corruption despite they occurred before Law. 30 of 2002 on the Corruption Eradication Commission enacted. Besides confirming that the application of this principle is that corruption is a crime classified as an extraordinary crime which has wide negative effects to the country.

  17. PEMBERLAKUAN ASAS RETROAKTIF DALAM PEMBERANTASAN TINDAK PIDANA KORUPSI

    OpenAIRE

    I MADE ADI SERAYA

    2013-01-01

    The study entitled, "The implementation of the retroactive principle in fighting against corruption". The background of this research was derive from the fact that corruption is an extraordinary crime that needs an extra way against it. The formation of Corruption Eradication Commission (KPK) as an independent agency in the form of eradicating corruption in Indonesia has gradually demonstrated its role. But, Problems then occur when the citizen force KPK to handle the corruption cases before ...

  18. Strategisk regnskapsanalyse og verdsettelse av Renewable Energy Corporation ASA

    OpenAIRE

    Søvik, Lene; Sømme, Tore

    2011-01-01

    Hva er vi villige til å betale for en aksje? ”Price is what you pay, but value is what you get” av Professor Stephen H. Penman i boken ”Financial Statement Analysis and Security Valuation” 2010, poengterer at en aktiv investor ser på prisen for en aksje som kostnaden ved en investering, og ikke verdien av en aksje. I denne utredningen ønsker vi å utfordre markedsverdien til REC, og undersøke om aksjen er over eller underpriset i forhold til børsverdi. Dette har vi gjort ved å foreta en f...

  19. Strategic analysis & fundamental valuation of Solstad Offshore ASA

    OpenAIRE

    Døsen, Liv Karina; Hovden, Anders Hodder

    2014-01-01

    This master thesis, in the field of financial economics, is written with the purpose of valuing Solstad Offshore ASA’s equity at 31.12.2012. Solstad’s price per share at 31.12.2012 was NOK 100. The reason why we estimate from this date is due to the late annual report for 2013. Two valuing methods are applied – fundamental valuation and comparable valuation. The comprehensive thesis can be divided into five sections: - Strategic Analysis - Financial Statements Analysis - Future E...

  20. Fish farm ecology : a conceptual framework and empirical investigation of the CSR performance of Marine Harvest ASA and Cermaq ASA

    OpenAIRE

    Bundli, Vidar Andersen; Liltvedt, Kristian Korvald

    2012-01-01

    The purpose of this master thesis is to give business participants, regulatory authorities, researchers and the broader community awareness of priority areas within the fish farming industry. In this sense, we have developed a conceptual framework; Fish Farm Ecology (FFE). The FFE model equates three spheres; economy, ecology, and ichthyology. It has flexibility and can be used both as an analytical tool for a broader interest group and as a management tool for companies within the industry. ...

  1. STUDIES ON THE USE OF AMPICILLIN-DEXTRIN AGAR ASAS AEROMONAS RECOVERY MEDIUM

    Science.gov (United States)

    The Contaminant Candidate List (CCL) includes the unregulated chemical and microbiological contaminants the EPA has identified as possibly posing a significant public risk to consumers if present in drinking water (1). There are three bacterial species listed in the CCL (Aeromon...

  2. A sombra das vossas asas: o corpo como rascunho e projeto de si

    Directory of Open Access Journals (Sweden)

    Érica Schlude Wels

    2015-12-01

    Full Text Available Arquiteturas corporais, consumo, alta e baixa cultura e processos de hibridização na hipermodernidade são os temas centrais do recorte teórico do presente artigo, a partir da crítica empreendida por autores como Baudrillard (2004, 2003, 1991, Lipovetsky (2004, Canclini (2003, 1999. Como obra-síntese dessas questões, escolhemos o romance “A sombra das vossas asas” (1997, de Fernanda Young, no qual o corpo da escritora ganha voz no plano narrativo; o enredo se constitui a partir de uma reconstrução corporal da protagonista, com vistas à aparência da modelo Lee Miller. Participam igualmente dessa leitura aspectos midiáticos, presentes também na figura da romancista, além da sedução, proporcionada por uma espécie de projeto pessoal de si mesmo, guiado pela moda e pelo consumo.

  3. Pemurnian kreativiti dalam pendidikan prasekolah sebagai asas pembinaan bangsa malaysia yang kreatif: Suatu kupasan awal

    Directory of Open Access Journals (Sweden)

    Othman b. A. Kassim

    2004-06-01

    Full Text Available Kreativiti merupakan mauduk dan agenda penting dalam mana-mana orientasi pendidikan di dunia. Institusi pendidikan merupakan tempat terpenting untk menyuburkan bakat dan kebolehan kreatif pelajar. Banyak negara di dunia seperti Amerika Syarikat, Jerman, Swedan, Jepun, Singapura dan Korea Selatan memberi penekanan dalam sistem pendidikan prasekolah hingga peringkat pendidikan tinggi. Justeru, negara-negara yang disebutkan tadi, khususnya Amerika Syarikat berusaha melahirkan sumber manusia kreatif yang mampu mengangkat martabat dan dignity bangsa itu. Hal ini di akui oleh pakar-pakar sains pemikiran kreatif seperti Amabile (1992, Swartz (1989, Buzan (2002, De Bono (1971, Leong (1998, dan ramai lagi. Amabile (1992, misalnya menyifatkan institusi pendidikan. Khususnya pendidikan prasekolah merupakan tempat paling penting untuk memupuk alam kreativiti di kalangan kanak-kanak. Selanjunya, Cropley (2001, menegaskan bahawa pendidikan awal kanak-kanak sangat memerlukan persekitaran dan motivasi yang amat signifikan bagi meralisasikan bakat dan kemahirankreativiti kanak-kanak. Namun begitu, menurut de Bono (1970, tanpa prime mover (dibaca sebagai pendidikyang menggerakkan persekitaran yang kondusif untuk berkreativiti, maka sukar untuk para pelajar untuk berkreasi dengan selasa dan selamat. sungguhpun begitu, Prime mover yang dimaksudkan oleh de Bono itu ialah pendidik yang dibekali dengan pengetahuan dan kemahiran kreativiti. Pendidik yang tidak memiliki kemahiran dan pengetahuan kreativiti sukar untuk merealisasikan suasana, ruang, dan pengalaman kreatif dalam pengajaran dan pembelajarannya. Oleh yang demikian, kertas kerja konseptual ini akan mengupas agenda pemurnian kretiviti dalam pendidikan prasekolah serta kesannya terhadap pembinaan bangsa Malaysia yang kreatif. Justeru, kami akan memulakan dengan kupasan terma-terma penting kertas kerja ini seperti pemurnian kreativiti, bangsa Malaysia yang kreatif serta komponen- proses kreativiti kanak-kanak prasekolah. Selain itu, kertas kerja ini akan memberi tumpuan terhadap motivasi bagi mengharmonikan kreativiti dalam aktiviti pengajaran dan pembelajaran pada peringkat prasekolah. Selanjutnya, kertas kerja ini akan menggagaskan persekitaran yang kondusif serta teknk-teknik yang spesifik dalam pemurnian kreativiti dalam aktiviti pendidikan prasekolah. Akhirnya, kertas kerja ini akan melakarkan model pemurnian kreativiti yang sesuai dalam konteks pendidikan prasekolah.

  4. ASA conference on radiation and health. Coolfont V. Final report. Summaries

    International Nuclear Information System (INIS)

    The conference included presentations on four major topics related to radiation and health: dose assessment, measurement error, dose-response, and dosimetry. Separate abstracts have been prepared for the individual presentations

  5. Vicia faba Hypersensitivity and ASA Intolerance in a Farmer: A Case Report

    Directory of Open Access Journals (Sweden)

    Elisabetta Damiani

    2011-01-01

    Full Text Available The IgE-mediated allergic reactions to food are caused, generally, by ingestion. However, they can be rarely induced by exposure to airborne food particles through the handling or the cooking. Vicia faba is a vegetable which belongs to Legumes or Fabaceae family, Fabales order. Allergic reactions after ingestion of legumes and cases of asthma after exposure to the cooking vapors have been reported in the literature. A paper assessed the volatile substances (insect repellents released by V. faba. The authors demonstrated that this plant produces several chemical substances, such as small quantities of methyl salicylate. We describe a case of occupational allergy, induced by handling during picking up of fresh broad beans, in a farmer with history of adverse reaction after eating the cooked and raw vegetable.

  6. Computerized Assessment System for Academic Satisfaction (ASAS) for First-Year University Student

    Science.gov (United States)

    Medrano, Leonardo Adrian; Liporace, Mercedes Fernandez; Perez, Edgardo

    2014-01-01

    Introduction: Computerized tests have become one of the most widely used and efficient educational assessment methods. Increasing efforts to generate computerized assessment systems to identify students at risk for drop out have been recently noted. An important variable influencing student retention is academic satisfaction. Accordingly, the…

  7. ASAS Centennial Paper: Developments and future outlook for preharvest food safety

    Science.gov (United States)

    While the United States food supply is one of the safest in the world, CDC estimates that 76 million people get sick, more than 300,000 are hospitalized, and 5,000 die each year from foodborne illness. Consequently, preventing foodborne illness and death remains a major public health concern. Chal...

  8. Pengecualian terhadap Penerapan Asas Ultra Petitum Partium dalam Beracara di Pengadilan Agama

    Directory of Open Access Journals (Sweden)

    Mrs. Hartini

    2012-02-01

    Full Text Available A judge must examine and adjudicate all charges thoroughly on the lawsuit brought to the court. The judge should not only examine and adjudicate part of the charge and disregard the rest. On the other hand, judge in his/her adjudication is prohibited to accede above the suit brought by the parties. This prohibition is called ultra petitum partium. A judge who accedes in excess of the suit partium is considered to be exceeding his/her authority. In Religious Court proceedings, the implementation of ultra petitum partium principle is an exception in several types of cases. In the procedure of divorce (cerai talak, a judge may grant something not demanded by wife either in the petition of divorce or in the reconvention by charging certain obligations upon the husband, which is the wife’s right as the consequence of the separation. In the procedure of divorce, judge may order a preliminary injunction even if such injunction is not demanded. The argument that justifies the judge’s action is the Marriage Act and the procedural law in the Act on Religious Court is a lex specialis stipulation, judge as judge made law must dig into the values of life, and the judge may execute contra legem action if the stipulation in an article considered to be in contradiction with justice and benefit.

  9. Photo Essay: An East Asian Circulation: Asa Mattice on the USS Juniata, 1883–1885

    Directory of Open Access Journals (Sweden)

    Robert Bickers

    2013-06-01

    Full Text Available On Tuesday, May 12, 1885, 210 men from the U.S. navy warships Juniata and Monocacy marched up Shanghai’s Nanjing Road, from the riverside Bund to the Shanghai racecourse, led by a sixteen-man band. There, on the recreation ground inside the track, they exercised and paraded for two hours, putting their field gun teams through their maneuvers, and in the afternoon the band played for the spectators. The weather was fine that day. Toward the end of the proceedings, before the men were paraded back through the streets of the foreign-run International Settlement to embark for the ships moored in the Huangpu River, the North China Herald (May 15, 1885, p. 552 recorded that “past Assistant Engineer Mattice of the Juniata took a photographic view of the battalion by the dry plate process.”

  10. Role of ASA in the primary and secondary prevention of cardiovascular events.

    NARCIS (Netherlands)

    Casado-Arroyo, R.; Bayrak, F.; Sarkozy, A.; Chierchia, G.B.; Asmundis, C. de; Brugada, P.

    2012-01-01

    Cardiovascular disease, which includes coronary heart disease, cerebrovascular disease and peripheral artery disease, is the leading cause of death in developed countries. Evidence from basic research, clinical investigations, observational epidemiologic studies and randomized clinical trials has pr

  11. PROBLEMATIKA PENERAPAN ASAS RECKLESSNESS DALAM PERSPEKTIF PEMBAHARUAN HUKUM LALU LINTAS DI INDONESIA

    Directory of Open Access Journals (Sweden)

    Edi As'adi

    2014-09-01

    Full Text Available Recklessness is one of the causes of traffic accidents. However, Law No. 22 of 2009 has not implicitly set the application of the principle of recklessness. So in field settings is still referring to the 359 of the Criminal Code, Article 360 of the Criminal Code and Article 492 of the Criminal Code, and even for difficult cases and found no law in the traffic law, judges apply article 338 of the Criminal Code with the principle of dolus eventualis consideration to fill the legal vacuum which are not in traffic law. Based in the future it is necessary reformulation of the principle of Recklessness in traffic law reform based on social justice values of Pancasila.

  12. Vicia faba Hypersensitivity and ASA Intolerance in a Farmer: A Case Report

    OpenAIRE

    Elisabetta Damiani; Anna Maria Aloia; Maria Giovanna Priore; Angela Pastore; Stefania Nardulli; Cristina Lippolis; Luigi Macchia; Antonio Ferrannini

    2011-01-01

    The IgE-mediated allergic reactions to food are caused, generally, by ingestion. However, they can be rarely induced by exposure to airborne food particles through the handling or the cooking. Vicia faba is a vegetable which belongs to Legumes or Fabaceae family, Fabales order. Allergic reactions after ingestion of legumes and cases of asthma after exposure to the cooking vapors have been reported in the literature. A paper assessed the volatile substances (insect repellents) released by V. f...

  13. Discovery and outburst characteristics of the dwarf nova ASAS J224349+0809.5

    CERN Document Server

    Shears, Jeremy; Bolt, Greg; Hambsch, Franz-Josef; Krajci, Tom; Miller, Ian; Sabo, Richard; Staels, Bart

    2010-01-01

    We report the discovery of a new dwarf nova and our observations of its first confirmed superoutburst during 2009 October. The outburst amplitude was 6 magnitudes. The main outburst lasted 17 days and was followed 4 days later by a remarkable rebrightening. Superhumps were present during the main outburst, which confirms that it belongs to the SU UMa family. Initially the mean superhump period was Psh = 0.06965(17) d, but analysis of the O-C residuals showed a dramatic evolution in Psh during the outburst. During the first two-thirds of the plateau phase the period increased with dPsh/dt = +1.24(5) x 10-3. There was then an abrupt change following which the period decreased with dPsh/dt = -1.01(9) x 10-3. The amplitude of the superhumps also varied, with a maximum amplitude near the beginning of the outburst and a second maximum corresponding to the discontinuity in Psh. Analysis of archival data showed outbursts also occurred in October 2005, June 2006 and June 2007. Assuming that the superoutbursts are peri...

  14. A new dipole index of the salinity anomalies of the tropical Indian Ocean

    Science.gov (United States)

    Li, Junde; Liang, Chujin; Tang, Youmin; Dong, Changming; Chen, Dake; Liu, Xiaohui; Jin, Weifang

    2016-04-01

    With the increased interest in studying the sea surface salinity anomaly (SSSA) of the tropical Indian Ocean during the Indian Ocean Dipole (IOD), an index describing the dipole variability of the SSSA has been pursued recently. In this study, we first use a regional ocean model with a high spatial resolution to produce a high-quality salinity simulation during the period from 1982 to 2014, from which the SSSA dipole structure is identified for boreal autumn. On this basis, by further analysing the observed data, we define a dipole index of the SSSA between the central equatorial Indian Ocean (CEIO: 70°E-90°E, 5°S-5°N) and the region off the Sumatra-Java coast (SJC: 100°E-110°E, 13°S-3°S). Compared with previous SSSA dipole indices, this index has advantages in detecting the dipole signals and in characterizing their relationship to the sea surface temperature anomaly (SSTA) dipole variability. Finally, the mechanism of the SSSA dipole is investigated by dynamical diagnosis. It is found that anomalous zonal advection dominates the SSSA in the CEIO region, whereas the SSSA in the SJC region are mainly influenced by the anomalous surface freshwater flux. This SSSA dipole provides a positive feedback to the formation of the IOD events.

  15. The role of multi-parametric MR imaging in the detection of early inflammatory sacroiliitis according to ASAS criteria

    International Nuclear Information System (INIS)

    Purpose: To retrospectively evaluate the accuracy of multi-parametric magnetic resonance (MR) imaging including fat saturated (FS) T2-weighted, short-tau inversion recovery (STIR), diffusion-weighted (DW-MR), and dynamic-contrast-enhanced MR (DCE-MR) imaging techniques in the diagnosis of early inflammatory sacroiliitis and determine the additional value of DW-MR and DCE-MR images according to recently defined ‘Assessment in SpondyloArthritis international Society’ criteria. Materials and methods: The study included 45 patients with back pain. Two radiologists estimated the likelihood of osteitis in 4 independent viewing sessions including FS T2-weighted, STIR, DW-MR and DCE-MR images. Sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV), and area under the receiver operating characteristic (ROC) curve (AUC) were calculated. Results: Of the 45 patients, 31 had inflammatory back pain. Of 31, 28 (90.3%) patients had inflammatory sacroiliitis diagnosed by clinical and laboratory analysis. FS T2-weighted MR images had the highest sensitivity (42.8% for both radiologists) for detecting osteitis in patients with inflammaory sacroiliitis when compared to other imaging sequences. For specificity, PPV, NPV, accuracy, and AUC levels there were no statistically significant difference between image viewing settings. However, adding STIR, DW-MR and DCE-MR images to the FS T2-weighted MR images did not improve the above stated indices. Conclusion: FS T2-weighted MR imaging had the highest sensitivity when compared to other imaging sequences. The addition of DW-MR and DCE-MR images did not significantly improve the diagnostic value of MR imaging in the diagnosis of osteitis for both experienced and less experienced radiologists

  16. The STRESA (storage of reactor safety) database (Web page: http://asa2.jrc.it/stresa)

    International Nuclear Information System (INIS)

    A considerable amount of resources has been devoted at the international level during the last few decades, to the generation of experimental databases in order to provide reference information for the understanding of reactor safety relevant phenomenologies and for the development and/or assessment of related computational methodologies. The extent to which these databases are preserved and can be accessed and retrieved is an issue of major concern. This paper provides an outline of the JRC databases preservation initiative and a description of the supporting web-based computer platform STRESA. (author)

  17. PENGANUTAN ASAS SISTEM DUA JALUR (DOUBLE TRACK SYSTEM) DALAM MELINDUNGI ANAK YANG BERKONFLIK DENGAN HUKUM: TINJAUAN FORMULASI DAN APLIKASINYA

    OpenAIRE

    Nasriana Nasriana

    2015-01-01

    Abstract: Overview of the sanctions measures, especially in thecontext of a criminal measure as a reflection of the adoption of adouble track system in Act No. 11 of 2012 turned out to be verysimple and consequently weakening back the adoption of thisprinciple. This shows that there are doubts the legislators informulating sanctions act as an alternative to criminalsanctions for children in conflict with the law and ultimatelythe adoption of a double track system becomes less meaningful.ملخص:...

  18. Penerapan Asas Kepentingan Terbaik Bagi Anak (The Best Interest Of The Child) Dalam Upaya Menjauhkan Anak Dari Pidana Penjara

    OpenAIRE

    Azhar, Saiful

    2013-01-01

    Two main reasons of why children must be protected are that, first, children are our next generations and the future of our nation; and second, naturally, children belong to the weak community group. Thus, the nation, as the holder of authority to guard and protect its citizens including children, is required to pay attention to and provide protection for the children. Convention of the Rights of the Child approved by the UN General Assembly on November 20, 1989 and has been ratified by Indon...

  19. PENGANUTAN ASAS SISTEM DUA JALUR (DOUBLE TRACK SYSTEM DALAM MELINDUNGI ANAK YANG BERKONFLIK DENGAN HUKUM: TINJAUAN FORMULASI DAN APLIKASINYA

    Directory of Open Access Journals (Sweden)

    Nasriana Nasriana

    2015-08-01

    Full Text Available Abstract: Overview of the sanctions measures, especially in thecontext of a criminal measure as a reflection of the adoption of adouble track system in Act No. 11 of 2012 turned out to be verysimple and consequently weakening back the adoption of thisprinciple. This shows that there are doubts the legislators informulating sanctions act as an alternative to criminalsanctions for children in conflict with the law and ultimatelythe adoption of a double track system becomes less meaningful.ملخص: نظرة عامة على صیاغة تدابیر الجزاءات ، وخاصة في سیاق إجراء جنائيبوصفھا انعكاسا لاعتماد نظام المسار المزدوج في القانون رقم أحد عشر من 2012تبین أن تكون بسیطة جدا و بالتالي یضعف مرة أخرى اعتماد من ھذا المبدأ. ھذا یدلعلى أن ھناك شكوك المشرعین في صیاغة عقوبات یكون بمثابة بدیل ل عقوباتجنائیة على الأطفال في نزاع مع القانون ، وفي نھایة المطاف اعتماد نظام المسارالمزدوج یصبح أقل وضوحا.Kata Kunci: anak bermasalah dengan hukum

  20. The role of multi-parametric MR imaging in the detection of early inflammatory sacroiliitis according to ASAS criteria

    Energy Technology Data Exchange (ETDEWEB)

    Boy, Fatma Nur, E-mail: nursoylu@yahoo.com [Department of Radiology, Fatih Sultan Mehmet Training and Research Hospital, E-5 Karayolu Uzeri, 34752 Atasehir, Istanbul (Turkey); Kayhan, Arda, E-mail: arda_kayhan@yahoo.com [Health Services Vocational School, Esenyurt University, Dogan Arasli Bulvari No 120, Esenyurt, Istanbul (Turkey); Karakas, Hakki Muammer, E-mail: hakki.karakas@gmail.com [Department of Radiology, Fatih Sultan Mehmet Training and Research Hospital, E-5 Karayolu Uzeri, 34752 Atasehir, Istanbul (Turkey); Unlu-Ozkan, Feyza, E-mail: feyzamd@yahoo.com [Department of Physical Therapy and Rehabilitation, Fatih Sultan Mehmet Training and Research Hospital, E-5 Karayolu Uzeri, 34752 Atasehir, Istanbul (Turkey); Silte, Duygu, E-mail: drduygusilte@hotmail.com [Department of Physical Therapy and Rehabilitation, Fatih Sultan Mehmet Training and Research Hospital, E-5 Karayolu Uzeri, 34752 Atasehir, Istanbul (Turkey); Aktas, İlknur, E-mail: iaktas@hotmail.com [Department of Physical Therapy and Rehabilitation, Fatih Sultan Mehmet Training and Research Hospital, E-5 Karayolu Uzeri, 34752 Atasehir, Istanbul (Turkey)

    2014-06-15

    Purpose: To retrospectively evaluate the accuracy of multi-parametric magnetic resonance (MR) imaging including fat saturated (FS) T2-weighted, short-tau inversion recovery (STIR), diffusion-weighted (DW-MR), and dynamic-contrast-enhanced MR (DCE-MR) imaging techniques in the diagnosis of early inflammatory sacroiliitis and determine the additional value of DW-MR and DCE-MR images according to recently defined ‘Assessment in SpondyloArthritis international Society’ criteria. Materials and methods: The study included 45 patients with back pain. Two radiologists estimated the likelihood of osteitis in 4 independent viewing sessions including FS T2-weighted, STIR, DW-MR and DCE-MR images. Sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV), and area under the receiver operating characteristic (ROC) curve (AUC) were calculated. Results: Of the 45 patients, 31 had inflammatory back pain. Of 31, 28 (90.3%) patients had inflammatory sacroiliitis diagnosed by clinical and laboratory analysis. FS T2-weighted MR images had the highest sensitivity (42.8% for both radiologists) for detecting osteitis in patients with inflammaory sacroiliitis when compared to other imaging sequences. For specificity, PPV, NPV, accuracy, and AUC levels there were no statistically significant difference between image viewing settings. However, adding STIR, DW-MR and DCE-MR images to the FS T2-weighted MR images did not improve the above stated indices. Conclusion: FS T2-weighted MR imaging had the highest sensitivity when compared to other imaging sequences. The addition of DW-MR and DCE-MR images did not significantly improve the diagnostic value of MR imaging in the diagnosis of osteitis for both experienced and less experienced radiologists.

  1. Vpliv časa fiksacije zaščitnih pripravkov na osnovi bakra in etanolamina na izpiranje

    OpenAIRE

    Golež, Branko

    2014-01-01

    Bakrove spojine so učinkoviti in zelo razširjeni fungicidi. Njihova poglavitna slabost je neustrezna vezava v les. Ta lastnost omejuje uporabo zaščitenega lesa na mestih, kjer prihaja do izpiranja aktivnih komponent. Fiksacijo bakrovih učinkovin lahko močno izboljšamo z dodajanjem aminov in karboksilnih kislin. Ugotavljali smo kako čas vezave vpliva na fiksacijo baker-etanolaminskih pripravkov v les. Smrekove vzorce smo, v skladu s postopkom polnih celic, impregnirali s 3 različnimi kombinaci...

  2. Properties of eclipsing binaries from all-sky surveys - I. Detached eclipsing binaries in ASAS, NSVS, and LINEAR

    Science.gov (United States)

    Lee ( ), Chien-Hsiu

    2015-11-01

    Eclipsing binaries provide a unique opportunity to measure fundamental properties of stars. With the advent of all-sky surveys, thousands of eclipsing binaries have been reported, yet their light curves are not fully exploited. The goal of this work is to make use of the eclipsing binary light curves delivered by all-sky surveys. We attempt to extract physical parameters of the binary systems from their light curves and colour. Inspired by the work of Devor et al., we use the Detached Eclipsing Binary Light curve fitter (DEBIL) and the Method for Eclipsing Component Identification (MECI) to derive basic properties of the binary systems reported by the All Sky Automated Survey, the Northern Sky Variability Survey, and the Lincoln Near Earth Asteroids Research. We derive the mass, fractional radius, and age for 783 binary systems. We report a subsample of eccentric systems and compare their properties to the tidal circularization theory. With MECI, we are able to estimate the distance of the eclipsing binary systems and use them to probe the structure of the Milky Way. Following the approach of Devor et al., we demonstrate that DEBIL and MECI are instrumental to investigate eclipsing binary light curves in the era of all-sky surveys, and provide estimates of stellar parameters of both binary components without spectroscopic information.

  3. PERLINDUNGAN HUKUM BAGI PEMOHON KREDIT DENGAN MENGACU PADA ASAS KESEIMBANGAN ANTARA PELAKU USAHA (BANK DAN KONSUMENNYA (PEMOHON KREDIT

    Directory of Open Access Journals (Sweden)

    Ni Luh Putu Sri Suryaningsih

    2012-10-01

    Full Text Available Banking institutions as one of the financial institutions have a strategic rolein supporting the economic life of a country. Banking institutions meant hereas an intermediary of the parties who have surplus funds to the lack of funds.Banking activities that provide services on the economic sector that do not inspite of the risks that could harm the banks themselves and the customer.Relationship between the bank and the customer is bound to a creditagreement unnoticed by the debtor of his rights is often overlooked by thebank. Guaranteeing the law protection and law certainty for the debtorslosing for such unilateral, the regulations of consumer protection, therefore,have important functions. The type of research used in this paper is thenormative legal research. This research moved from the inclusion of thestandard clause that would open up opportunities for businesses, especiallybanks to position the client, in this case the credit applicant, to be weakerthan the bank.

  4. The expansion of low cost carriers into the long-haul market: a strategic analysis of Norwegian Air Shuttle ASA

    OpenAIRE

    Chen, Long; Pawlikowski, Hubert

    2015-01-01

    The low-cost carrier (“LCC”) business model has been in existence for several decades and their market share has been growing steadily. However, the most successful LCCs such as Southwest, Ryanair and EasyJet have focused upon implementing the low-cost strategy on short-haul routes. The main strategic objective of this thesis is to identify the underlying reasons for this phenomenon and whether there is a potential for the exploitation of the low-cost business model on long-haul ...

  5. The STRESA (storage of reactor safety) database (Web page: http://asa2.jrc.it/stresa)

    Energy Technology Data Exchange (ETDEWEB)

    Annunziato, A.; Addabbo, C.; Brewka, W. [Joint Research Centre, Commission of the European Communities, Ispra (Italy)

    2001-07-01

    A considerable amount of resources has been devoted at the international level during the last few decades, to the generation of experimental databases in order to provide reference information for the understanding of reactor safety relevant phenomenologies and for the development and/or assessment of related computational methodologies. The extent to which these databases are preserved and can be accessed and retrieved is an issue of major concern. This paper provides an outline of the JRC databases preservation initiative and a description of the supporting web-based computer platform STRESA. (author)

  6. Deram-me as asas para eu voar : investigação participativa com jovens em acolhimento

    OpenAIRE

    Castro, Patrícia Filipa Mendes

    2014-01-01

    O presente trabalho é um projeto de Investigação Participativa, realizado em parceria com quatro jovens que frequentam o ensino superior e que apresentam percursos de vida enquadrados por respostas sociais de acolhimento (Lar de Infância e Juventude e Apartamento de Autonomia). Tendo em conta os contextos de vulnerabilidade e risco social que determinam a institucionalização de crianças, assim como os constrangimentos, dificuldades e limitações que acompanham a experiência d...

  7. Historical Highlights From 75 Years of the Soil Science Society of America

    Science.gov (United States)

    Brevik, E. C.

    2012-04-01

    From its official founding on November 18, 1936 to the present day, the Soil Science Society of America (SSSA) has developed a rich and diverse history. SSSA began with 190 members grouped into six sections: 1) physics, 2) chemistry, 3) microbiology, 4) fertility, 5) morphology, and 6) technology. Today SSSA has over 6,000 members who can choose from any of 11 divisions, S1 Soil Physics, S2 Soil Chemistry, S3 Soil Biology and Biochemistry, S4 Soil Fertility and Plant Nutrition, S5 Pedology, S6 Soil and Water Management and Conservation, S7 Forest, Range, and Wildland Soils, S8 Nutrient Management and Soil and Plant Analysis, S9 Soil Mineralogy, S10 Wetland Soils, and S11 Soils and Environmental Quality to represent their primary area(s) of interest. The Society has also gone from being largely agriculturally focused to an eclectic mix of individuals with interests in agriculture, the environment, earth sciences, human interactions, and other diverse areas. At its founding, SSSA sponsored one publication, the Soil Science Society of America Proceedings. Today, SSSA sponsors its descendent, the Soil Science Society of America Journal, as well as Vadose Zone Journal, the Journal of Environmental Quality, Soil Survey Horizons, and the Journal of Natural Resources and Life Science Education. In short, SSSA's history has been one of continued growth over the last 75 years. The future holds many challenges for SSSA and the field of soil science. There are increasing calls to meet with groups other than or in addition to the American Society of Agronomy and the Crop Science Society of America, groups like the Geological Society of America and the Ecological Society of America. Members in SSSA now work in university departments, government agencies, and businesses representing the fields of biology, geology, geography, and archeology, among others, in addition to the traditional agricultural sector. How SSSA handles this diversification of the field and its membership will

  8. Feasibility of Distributed Carbon Capture and Storage (DCCS)

    International Nuclear Information System (INIS)

    Research highlights: → The concept of Distributed Carbon Capture and Storage (DCCS) is proposed. → Carbon Storage in a Shallow Aquifer (CSSA) is studied as a technique for the DCCS. → The CSSA is estimated to allow less than Yen 3000/t-CO2 of the storage cost. → The CSSA is estimated to allow more than 20-years of the injection period. → The required energy for the CSSA is less than 10 % of the energy generated by the CO2 sources. -- Abstract: The concept of Distributed Carbon Capture and Storage (DCCS) for small scale CO2 sources, such as Distributed Energy Systems (DES), is proposed, and Carbon Storage in a Shallow Aquifer (CSSA), in which CO2 is stored in shallow aquifers as aqueous solution, is also studied as a technique for the DCCS. A conceptual design for the CSSA have been performed and the fundamental calculations in this study show that the dissolution capacity, that is, the amount of CO2 which can be dissolved into unit volume of water in a shallow aquifer is 10-35 kg-CO2/m3 in the range of the storage depth of 100-500 m. The dissolution capacity of the CSSA is less than 10% of the possible amount of CO2 stored by the ordinary CCS technique in which CO2 is stored in the supercritical condition. However, the CSSA is estimated to allow the CO2 storage at less than Yen 3000/t-CO2 of the storage cost and more than 20-years of the injection period for CO2 sources of 1800-39,000 t-CO2/year, which correspond to the CO2 emissions from 0.1 to 10 MW DES. The required energy for the CSSA is estimated to be less than 10% of the energy generated by the CO2 sources.

  9. What can be done to increase the value of Statoil ASA? Analysis of the discrepancy between theoretical value and stock price

    OpenAIRE

    Guevara, Susana

    2014-01-01

    The trend of Statoil’s stock price has remained flat over the course of the last few years, gaining the attention of investors and managers and creating doubts among them as to whether Statoil’s shares are correctly priced on the market. The intention of this thesis is to find a theoretical value of Statoil’s share and compare it with its market price in order to find any discrepancy. For this purpose, three different valuation methods were utilized; Market Comparables method, ...

  10. Asas da Norma: o míto de Ícaro e o positivismo jurídico de Hans Kelsen

    Directory of Open Access Journals (Sweden)

    Rafael Henrique Pereira

    2013-12-01

    Full Text Available Estabelece uma paridade entre o positivismo jurídico de Hans Kelsen, com foco na obra filosófica “Teoria Pura do Direito”, e o mito de Ícaro, consagrado na mitologia grega, cujos erros e acertos verificados no instituto positivista, especificamente, durante o período compreendido na Segunda Guerra Mundial, legitimou, ainda que indiretamente, a ascensão do pensamento e poder ditatorial hitleriano.

  11. O ENSINO COM GÊNEROS TEXTUAIS NO PROGRAMA DE ACELERAÇÃO DA APRENDIZAGEM ASAS DA FLORESTANIA – ACRE

    Directory of Open Access Journals (Sweden)

    José Júlio César do Nascimento Araújo

    2011-12-01

    Full Text Available This article shows how you performed the teaching of writing in the classroom in the Wings Program Florestania acceleration in rural public schools of the Southern Cross-Acre. The central focus is directed at the relationship between cognition, building concepts and strategies of representation of information through genres. It is understood by speech genres, in this proposal, the superstructures. The work was developed based on qualitative methodology and its theoretical framework, especially the postulates VanDijk, (2004, Lopes-Rossi (2002 and Fairclough (2001. They want to expand the question: is that when teachers set out the names of discourse genres or genre or text types, are meaning the same theoretical object? Thus, it is necessary first of all, understand what you are addressing in Portuguese classes in the program Wings of Florestania, and what peculiarities in each different comprehensive approach. The texts were collected from classroom activities by teachers Florestania Wings of the Program on Southern Cross / AC. In analyzing the texts and the results have worked to see that the way the teachers guide the discursive practices of their students in relation to multimodal texts and this work contributes to building a critical discourse of the student, and also what are the guidelines regarding the many functions and meanings of Literacy, underlying the discursive practices used by teachers. Wanted, finally, to understand how the genres are worked in the classroom in an Amazonian community.

  12. Pertanggungjawaban Pelaku Usaha Melalui Kontrak Baku Dan Asas Kepatutan Dalam Perlindungan Konsumen : Studi Hubungan Hukum antara Pelaku Usaha dengan Konsumen Perumahan

    OpenAIRE

    Hakim, Abdul

    2014-01-01

    Principle of contract is very important. Merit principle one of the principle of contract. The use of stndard contracts in agreements between enterpreneurs to residential consumers is leaving many legal issue. Ranging from neglect of duty of the entrepreneurs in terms of product liability which they are marketed, to the violation of merit law requirements that must be respected and used as the basis of moral bonds of the contract or agreement. As a result, the rights of consumers being neglec...

  13. CHARACTERIZING A DRAMATIC ΔV ∼ –9 FLARE ON AN ULTRACOOL DWARF FOUND BY THE ASAS-SN SURVEY

    International Nuclear Information System (INIS)

    We analyze a ΔV ∼ –9 magnitude flare on the newly identified M8 dwarf SDSS J022116.84+194020.4 (hereafter SDSSJ0221) detected as part of the All-Sky Automated Survey for Supernovae. Using infrared and optical spectra, we confirm that SDSSJ0221 is a relatively nearby (d ∼ 76 pc) M8 dwarf with strong quiescent Hα emission. Based on kinematics and the absence of features consistent with low-gravity (young) ultracool dwarfs, we place a lower limit of 200 Myr on the age of SDSSJ0221. When modeled with a simple, classical flare light curve, this flare is consistent with a total U-band flare energy EU ∼ 1034 erg, confirming that the most dramatic flares are not limited to warmer, more massive stars. Scaled to include a rough estimate of the emission line contribution to the V band, we estimate a blackbody filling factor of ∼10%-30% during the flare peak and ∼0.5%-1.6% during the flare decay phase. These filling factors correspond to flare areas that are an order of magnitude larger than those measured for most mid-M dwarf flares

  14. Evaluación preliminar de actividad insecticida de lectina ASA II a partir de ajo (Allium sativum), sobre Tecia solanivora

    OpenAIRE

    Carreño Rondón, Nury Lysseth

    2013-01-01

    La polilla guatemalteca de la papa Tecia solanivora es considerada como uno de los principales insectos que ataca el cultivo de papa, causando daños a los tubérculos tanto en campo como en almacenamiento, existen reportes en Colombia que mencionan pérdidas cercanas al 25% en cultivo y hasta el 100% en almacenamiento. El uso de plaguicidas químicos es generalmente la única forma de control del insecto, sin embargo el uso de plaguicidas puede ocasionar efectos tóxicos sobre el cultivo y sobre e...

  15. Risk management and internal control systems in the financial sector of the Norwegian economy : a case study of DnB NOR ASA

    OpenAIRE

    Siayor, Anne Deladem

    2010-01-01

    Businesses today are faced with greater challenges and complications than ever before, as economical, technological and legal interdependence become more common and pronounced. Due to these developments, risks may go unidentified too long and early warning indicators ignored. It is therefore assumed that every business organization has put in place risk management and internal control systems in order for the organization to continue running. In light of this, this research is undertaken to f...

  16. Dicty_cDB: SSA649 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SS (Link to library) SSA649 (Link to dictyBase) - - - Contig-U14313-1 SSA649Z (Link... to Original site) - - SSA649Z 355 - - - - Show SSA649 Library SS (Link to library) Clone ID SSA649 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SS/SSA6-C/SSA649Q.Seq.d/ Representative seq. ID SSA64...9Z (Link to Original site) Representative DNA sequence >SSA649 (SSA649Q) /CSM/SS/SSA6-C/SSA649Q.Seq.d/ XXXXX...SM-cDNA Score E Sequences producing significant alignments: (bits) Value SSA649 (SSA649Q) /CSM/SS/SSA6-C/SSA

  17. Dicty_cDB: SSA265 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SS (Link to library) SSA265 (Link to dictyBase) - - - Contig-U15010-1 SSA265F (Link to Original site) SSA...265F 355 - - - - - - Show SSA265 Library SS (Link to library) Clone ID SSA265 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SS/SSA2-C/SSA265Q.Seq.d/ Representative seq. ID SSA26...5F (Link to Original site) Representative DNA sequence >SSA265 (SSA265Q) /CSM/SS/SSA2-C/SSA265Q.Seq.d/ CAAAG...SM-cDNA Score E Sequences producing significant alignments: (bits) Value SSA265 (SSA265Q) /CSM/SS/SSA2-C/SSA

  18. Dicty_cDB: SSA871 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SS (Link to library) SSA871 (Link to dictyBase) - - - Contig-U15063-1 SSA871P (Link to Original site) SSA...871F 197 SSA871Z 507 SSA871P 704 - - Show SSA871 Library SS (Link to library) Clone ID SSA... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SS/SSA8-C/SSA871Q.Seq.d/ Representative seq. ID SSA...871P (Link to Original site) Representative DNA sequence >SSA871 (SSA871Q) /CSM/SS/SSA8-C/SSA8...ng significant alignments: (bits) Value SSA871 (SSA871Q) /CSM/SS/SSA8-C/SSA871Q.Seq.d/ 1176 0.0 CHD325 (CHD3

  19. Dicty_cDB: SSA153 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SS (Link to library) SSA153 (Link to dictyBase) - - - Contig-U10248-1 SSA153F (Link to Original site) SSA...153F 463 - - - - - - Show SSA153 Library SS (Link to library) Clone ID SSA153 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SS/SSA1-C/SSA153Q.Seq.d/ Representative seq. ID SSA15...3F (Link to Original site) Representative DNA sequence >SSA153 (SSA153Q) /CSM/SS/SSA1-C/SSA153Q.Seq.d/ ATTTG...ficant alignments: (bits) Value SSA153 (SSA153Q) /CSM/SS/SSA1-C/SSA153Q.Seq.d/ 918 0.0 SSH468 (SSH468Q) /CSM

  20. Dicty_cDB: SSA863 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SS (Link to library) SSA863 (Link to dictyBase) - - - Contig-U14496-1 - (Link to Original site) - - SSA...863Z 436 - - - - Show SSA863 Library SS (Link to library) Clone ID SSA863 (Link to dicty...iol.tsukuba.ac.jp/CSM/SS/SSA8-C/SSA863Q.Seq.d/ Representative seq. ID - (Link to ...Original site) Representative DNA sequence >SSA863 (SSA863Q) /CSM/SS/SSA8-C/SSA863Q.Seq.d/ XXXXXXXXXXAGATTCA...ore E Sequences producing significant alignments: (bits) Value SSA863 (SSA863Q) /CSM/SS/SSA8-C/SSA863Q.Seq.d

  1. Dicty_cDB: SSA452 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SS (Link to library) SSA452 (Link to dictyBase) - G20763 DDB0185811 Contig-U04397-1... - (Link to Original site) SSA452F 433 - - - - - - Show SSA452 Library SS (Link to library) Clone ID SSA452 ...l site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SS/SSA4-C/SSA452Q.Seq.d/ Repres...entative seq. ID - (Link to Original site) Representative DNA sequence >SSA452 (SSA452Q) /CSM/SS/SSA4-C/SSA4...ng significant alignments: (bits) Value SSA452 (SSA452Q) /CSM/SS/SSA4-C/SSA452Q.Seq.d/ 383 e-105 SLD553 (SLD

  2. Dicty_cDB: SSA362 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SS (Link to library) SSA362 (Link to dictyBase) - - - Contig-U16560-1 SSA362Z (Link... to Original site) - - SSA362Z 549 - - - - Show SSA362 Library SS (Link to library) Clone ID SSA362 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SS/SSA3-C/SSA362Q.Seq.d/ Representative seq. ID SSA36...2Z (Link to Original site) Representative DNA sequence >SSA362 (SSA362Q) /CSM/SS/SSA3-C/SSA362Q.Seq.d/ XXXXX...es producing significant alignments: (bits) Value SSA362 (SSA362Q) /CSM/SS/SSA3-C/SSA362Q.Seq.d/ 1027 0.0 SS

  3. Dicty_cDB: SSA472 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SS (Link to library) SSA472 (Link to dictyBase) - - - Contig-U01956-1 SSA472F (Link to Original site) SSA...472F 540 - - - - - - Show SSA472 Library SS (Link to library) Clone ID SSA472 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SS/SSA4-C/SSA472Q.Seq.d/ Representative seq. ID SSA47...2F (Link to Original site) Representative DNA sequence >SSA472 (SSA472Q) /CSM/SS/SSA4-C/SSA472Q.Seq.d/ TAAAA... 854 0.0 SSC507 (SSC507Q) /CSM/SS/SSC5-A/SSC507Q.Seq.d/ 854 0.0 SSA650 (SSA650Q) /CSM/SS/SSA6-C/SSA650Q.Seq.d/ 854 0.0 SSA472 (SSA

  4. Dicty_cDB: SSA449 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SS (Link to library) SSA449 (Link to dictyBase) - - - Contig-U12270-1 SSA449E (Link... to Original site) - - - - - - SSA449E 372 Show SSA449 Library SS (Link to library) Clone ID SSA449 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SS/SSA4-C/SSA449Q.Seq.d/ Representative seq. ID SSA44...9E (Link to Original site) Representative DNA sequence >SSA449 (SSA449Q) /CSM/SS/SSA4-C/SSA449Q.Seq.d/ TAAAC...*ilkk kkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SSA449 (SSA449Q) /CSM/SS/SSA4-C/SSA

  5. Dicty_cDB: SSA563 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SS (Link to library) SSA563 (Link to dictyBase) - - - - SSA563E (Link to Original site) - - - - - - SSA...563E 383 Show SSA563 Library SS (Link to library) Clone ID SSA563 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SS/SSA5-C/SSA...563Q.Seq.d/ Representative seq. ID SSA563E (Link to Original site) R...epresentative DNA sequence >SSA563 (SSA563Q) /CSM/SS/SSA5-C/SSA563Q.Seq.d/ GATTCAGAAAAAATTAAAAAAGCCAGAGATTTT

  6. Dicty_cDB: SSA249 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available utative transporter protein SSA662 (ssa662) mRNA, complete cds. 40 9e-04 2 AC1155...SS (Link to library) SSA249 (Link to dictyBase) - - - Contig-U07966-1 - (Link to Original site) SSA...249F 236 - - - - - - Show SSA249 Library SS (Link to library) Clone ID SSA249 (Link to dicty...iol.tsukuba.ac.jp/CSM/SS/SSA2-C/SSA249Q.Seq.d/ Representative seq. ID - (Link to ...Original site) Representative DNA sequence >SSA249 (SSA249Q) /CSM/SS/SSA2-C/SSA249Q.Seq.d/ ACTTATCGTCACAATTC

  7. Dicty_cDB: SSA770 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SS (Link to library) SSA770 (Link to dictyBase) - - - - SSA770F (Link to Original site) SSA...770F 172 - - - - - - Show SSA770 Library SS (Link to library) Clone ID SSA770 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SS/SSA7-C/SSA...770Q.Seq.d/ Representative seq. ID SSA770F (Link to Original site) R...epresentative DNA sequence >SSA770 (SSA770Q) /CSM/SS/SSA7-C/SSA770Q.Seq.d/ ATTTATTCTTTATCGAATATCATAATTAAAAGA

  8. Brain-targeting study of stearic acid–grafted chitosan micelle drug-delivery system

    Directory of Open Access Journals (Sweden)

    Xie YT

    2012-06-01

    Full Text Available Yi-Ting Xie, Yong-Zhong Du, Hong Yuan, Fu-Qiang HuCollege of Pharmaceutical Sciences, Zhejiang University, Hangzhou, ChinaPurpose: Therapy for central nervous system disease is mainly restricted by the blood–brain barrier. A drug-delivery system is an effective approach to overcome this barrier. In this research, the potential of polymeric micelles for brain-targeting drug delivery was studied.Methods: Stearic acid–grafted chitosan (CS-SA was synthesized by hydrophobic modification of chitosan with stearic acid. The physicochemical characteristics of CS-SA micelles were investigated. bEnd.3 cells were chosen as model cells to evaluate the internalization ability and cytotoxicity of CS-SA micelles in vitro. Doxorubicin (DOX, as a model drug, was physically encapsulated in CS-SA micelles. The in vivo brain-targeting ability of CS-SA micelles was qualitatively and quantitatively studied by in vivo imaging and high-performance liquid chromatography analysis, respectively. The therapeutic effect of DOX-loaded micelles in vitro was performed on glioma C6 cells.Results: The critical micelle concentration of CS-SA micelles with 26.9% ± 1.08% amino substitute degree was 65 µg/mL. The diameter and surface potential of synthesized CS-SA micelles in aqueous solution was 22 ± 0.98 nm and 36.4 ± 0.71 mV, respectively. CS-SA micelles presented excellent cellular uptake ability on bEnd.3 cells, the IC50 of which was 237.6 ± 6.61 µg/mL. DOX-loaded micelles exhibited slow drug-release behavior, with a cumulative release up to 72% within 48 hours in vitro. The cytotoxicity of DOX-loaded CS-SA micelles against C6 was 2.664 ± 0.036 µg/mL, compared with 0.181 ± 0.066 µg/mL of DOX • HCl. In vivo imaging results indicated that CS-SA was able to transport rapidly across the blood–brain barrier and into the brain. A maximum DOX distribution in brain of 1.01%/g was observed 15 minutes after administration and maintained above 0.45%/g within 1 hour

  9. ON THE 125TH ANNIVERSARY OF ACETYLSALICYLIC ACID

    Directory of Open Access Journals (Sweden)

    I. N. Bokarev

    2016-01-01

    Full Text Available An experience of acetylsalicylic acid (ASA clinical use since its synthesis in 1887 is highlighted. ASA modes of action and its position among the modern antiplatelet agents are considered. The evidence based clinical data on ASA treatment and the problem of antiplatelet therapy resistance are discussed. ASA interaction with other drugs and ASA pleiotropic effects are reviewed 

  10. NPP Krsko fire protection action plan

    International Nuclear Information System (INIS)

    This paper describes the Fire Protection Action Plan which prioritized proposed fire protection modifications from recommendations reported in the NPP Krsko Fire Hazards Analysis - Safe-Shutdown Separation Analysis (SSSA), the ICISA Analysis of Core Damage Frequency Due to Fire at the Krsko Nuclear Power Plant, and the Operational Safety Review Team (OSART) reports using a risk-based cost/benefit methodology. (author)

  11. American Society of Anesthesiologists

    Science.gov (United States)

    ... ASA Newsroom Our Mission Governance and Committees Component Societies Related Organizations Office of General Counsel Employment at ... About ASA Our Mission Governance and Committees Component Societies Related Organizations Employment at ASA Contact Us Support ...

  12. American Sleep Association

    Science.gov (United States)

    ... Public Health Professionals Join ASA Press Room American Sleep Association Share What is Sleep ? Insight into the ... Forums Contact Us Login Join ASA – for FREE Sleep Blog ASA Charitable Work – Sleeping Children Around the ...

  13. Comparison on the Developmental Trends between Chinese Students Studying Abroad and Foreign Students Studying in China

    Science.gov (United States)

    Liu, Xuezhi

    2014-01-01

    China has been undergoing a new period of political stability, cultural prosperity, and social harmony since its reform and opening-up in the late 1970s. At the same time, the number of Chinese students studying abroad (CSSA) and foreign students studying in China (FSSC) has grown rapidly and steadily in the past three decades. With China's…

  14. NEW METABOLITES OF THE DRUG 5-AMINOSALICYLIC ACID .2. N-FORMYL-5-AMINOSALICYLIC ACID

    DEFF Research Database (Denmark)

    Tjornelund, J.; Hansen, S. H.; Cornett, Claus

    1991-01-01

    rat liver homogenate when 5-ASA and N-formyl-L-kynurenine were added. Thus N-formyl-5-ASA might be formed by the actions of formamidase in vivo. 5. N-Formyl-5-ASA has been found in human plasma from healthy volunteers dosed i.v. with 5-ASA (250 mg). N-beta-D-glucopyranosyl-5-ASA, N-acetyl-5-ASA and N...

  15. [Nutrient contents and heavy metal pollutions in composted sewage sludge from different municipal wastewater treatment plants in Beijing region].

    Science.gov (United States)

    Bai, Li-Ping; Qi, Hong-Tao; Fu, Ya-Ping; Li, Ping

    2014-12-01

    Changes of nutrient contents and heavy metal pollutions in composted sewage sludge from different municipal wastewater treatment plants (as represented by CSS-A and CSS-B, respectively) in Beijing region were investigated. The results showed that the pH values, nutrient contents, trace elements and heavy metals in CSS-A and CSS-B depended on the sludge resources and particular years. The average of organic matter content in different years (203 338.0 mg x kg(-1)) from CSS-A met both the requirement of sludge quality standard for agricultural use (CJ/T 309-2009) and land improvement (GB/T 24600-2009) in China except the permitted limit of sludge quality standards for garden or park use (GB/T 23486-2009) in China. Moreover, the average of organic matter in different years (298531.5 mg x kg(-1)) from CSS-B and the averages of pH values (7.1 and 7.2, respectively) and NPK concentrations (41 111.7 mg x kg(-1) and 65 901.5 mg x kg(-1), respectively) in different years from CSS-A and CSS-B all met the requirements of sludge quality standards for the above-mentioned disposal types of sewage sludge from municipal wastewater treatment plants. The contents of heavy metals in CSS-A and CSS-B except Hg and Ni were below the permitted limits of the A-class sludge quality standard for agricultural use (CJ/T 309-2009) , being the most stringent standards in China. It was suggested that composted sewage sludge from different municipal wastewater treatment plants in Beijing region use as a fertilizer in agriculture, land improvement, and garden or park, but the top concern about potential environmental pollution of Hg and Ni should be considered. PMID:25826937

  16. Energy- and time-saving low-temperature thermomechanical treatment of low-carbon plain steel: Prihranki energije in časa pri nizkotemperaturni termomehanski obdelavi maloogljičnega ploščatega jekla:

    OpenAIRE

    Hauserova, Daniela; Jirkova, Hana; Kucerova, Ludmila; Masek, Bohuslav

    2013-01-01

    Reduction of energy is one way of cutting the cost of finished steel products. In this context heat treatment is a costly stage of the production. This paper presents a method of reducing soft-annealing times. The method termed as ASR (accelerated spheroidization and refinement) was employed for improving the cold formability of the ferrite-pearlite steel. In this study, plain low-carbon RSt-32 steel was used as the experimental material. The influence of deformation below the Asub{c1} temper...

  17. Skrajšanje nastavitvenega časa na štiristranskem skobeljnem stroju z metodo SMED: Setup time reduction on four-side planing machine with the SMED method:

    OpenAIRE

    Kropivšek, Jože; Lipušček, Igor; Oblak, Leon

    2003-01-01

    Due to the rapidly increasing diversity of products and smaller batch sizes, the setup time reduction is of crucial importance for the profitability of a company. The article deals with the problem of long setup times in a wood company and possibilities for the solution with the SMED method. On a practical case, the setup time reduction on four-side planing machine was analysed. Zaradi čedalje hitrejšega naraščanja raznolikosti proizvodov in manjšanja velikosti izdelavnih serij je skrajšan...

  18. Parallel phase 1 clinical trials inthe US andin China:accelerating the test ofavitinib inlung cancer asa novel inhibitor selectively targeting mutated EGFR andovercoming T790M-induced resistance

    Institute of Scientific and Technical Information of China (English)

    Xiao Xu

    2015-01-01

    Avitinib, a new generation inhibitor of epidermal growth factor receptor (EGFR), was approved for clinical trial in both China and the United States, and the phase 1 trials were initiated in both countries in parallel. In the preclinical stud-ies, avitinib showed three novel features including (1) irreversibly bindingEGFR by forming a covalent bound with Cys 797 in the ATP-binding pocket, (2) sparing wild-typeEGFR, and (3) overcoming T790M-induced resistance. Avitinib is the ifrst China-developed novel EGFR inhibitor that has entered in global clinical trials, and will provide a precision targeted therapy for non-small cell lung cancer patients.

  19. The impact of higher capital requirements on cost of capital for DNB Bank ASA : will increased capital requirements for Norway’s largest bank increase interest rates charged to consumers?

    OpenAIRE

    Rasch, Sondre L.

    2013-01-01

    The financial crisis of 2007-2008 affected the financial sector worldwide. After the crisis, regulatory bodies and governments implemented stricter capital requirements for banks and financial institutions in order to cushion the impact of similar shocks in the future. In Norway the government aims to impose even stricter regulations than the Basel III-accord require. In opposition to the new rules DNB, Norway’s largest bank, claims the new rules will increase their capital cost and therefore...

  20. Identification of oxidation products of 5-aminosalicylic acid in faeces and the study of their formation in vitro

    DEFF Research Database (Denmark)

    Jensen, J.; Cornett, Claus; Olsen, C. E.;

    1993-01-01

    products of 5-ASA using H-1-NMR spectroscopy and mass spectrometry. Reactions carried out in vitro between 5-ASA and oxidants suggested to be present in the inflamed bowel verified that the hypochlorite-mediated oxidation of 5-ASA as well as the haemoglobin-catalysed H2O2-dependent oxidation of 5-ASA...

  1. Positional Isomers of Aspirin Are Equally Potent in Inhibiting Colon Cancer Cell Growth: Differences in Mode of Cyclooxygenase Inhibition

    OpenAIRE

    Kodela, Ravinder; Chattopadhyay, Mitali; Goswami, Satindra; Gan, Zong Yuan; Rao, Praveen P.N.; Nia, Kamran V.; Velázquez-Martínez, Carlos A.; Kashfi, Khosrow

    2013-01-01

    We compared the differential effects of positional isomers of acetylsalicylic acid (o-ASA, m-ASA, and p-ASA) on cyclooxygenase (COX) inhibition, gastric prostaglandin E2 (PGE2), malondialdehyde, tumor necrosis factor-alpha (TNF-α) levels, superoxide dismutase (SOD) activity, human adenocarcinoma colon cancer cell growth inhibition, cell proliferation, apoptosis, and cell-cycle progression. We also evaluated the gastric toxicity exerted by ASA isomers. All ASA isomers inhibit COX enzymes, but ...

  2. Efficacy and Safety of Etanercept in Patients with Ankylosing Spondylitis

    OpenAIRE

    Kalı, Gökhan; ERSOY, Yüksel; DURMUŞ, Bekir; Altay, Zuhal; Baysal, Özlem; ERSOY, Yasemin

    2010-01-01

    Objective: The aim of this study was to evaluate efficacy and safety of etanercept in patients with ankylosing spondylitis (AS). Material and Methods: 21 patients with AS were evaluated before and after 6 months of etanercept treatment based on the clinical and laboratory parameters. Clinical efficacy was determined using criteria defined by the asessment in AS (ASAS) International Working Group (ASAS-20 ASAS-40, ASAS-5/6, and ASAS partial remission) and BASDAI-50 responses. Results: ...

  3. Therapeutic Efficacy of pH-Dependent Release Formulation of Mesalazine on Active Ulcerative Colitis Resistant to Time-Dependent Release Formulation: Analysis of Fecal Calprotectin Concentration

    Science.gov (United States)

    Kawashima, Kousaku; Ishihara, Shunji; Yuki, Takafumi; Onishi, Koji; Kushiyama, Yoshinori; Miyaoka, Youichi; Yuki, Mika; Komazawa, Yoshinori; Tanimura, Takashi; Sonoyama, Hiroki; Tada, Yasumasa; Kusunoki, Ryusaku; Fukuba, Nobuhiko; Oshima, Naoki; Moriyama, Ichiro; Kinoshita, Yoshikazu

    2014-01-01

    Purpose. Few reports have compared the clinical efficacy of a pH-dependent release formulation of mesalazine (pH-5-ASA) with a time-dependent release formulation (time-5-ASA). We examined whether pH-5-ASA is effective for active ulcerative colitis (UC) in patients resistant to time-5-ASA. Methods. We retrospectively and prospectively analyzed the efficacy of pH-5-ASA in mildly to moderately active UC patients in whom time-5-ASA did not successfully induce or maintain remission. The clinical efficacy of pH-5-ASA was assessed by clinical activity index (CAI) before and after switching from time-5-ASA. In addition, the efficacy of pH-5-ASA on mucosal healing (MH) was evaluated in a prospective manner by measuring fecal calprotectin concentration. Results. Thirty patients were analyzed in a retrospective manner. CAI was significantly reduced at both 4 and 8 weeks after switching to pH-5-ASA. In the prospective study (n = 14), administration of pH-5-ASA also significantly reduced CAI scores at 4 and 8 weeks in these patients who were resistant to time-5-ASA. In addition, fecal calprotectin concentration was significantly decreased along with improvement in CAI after switching to pH-5-ASA. Conclusions. Our results suggest that pH-5-ASA has clinical efficacy for mildly to moderately active patients with UC in whom time-5-ASA did not successfully induce or maintain remission. PMID:25478568

  4. Therapeutic Efficacy of pH-Dependent Release Formulation of Mesalazine on Active Ulcerative Colitis Resistant to Time-Dependent Release Formulation: Analysis of Fecal Calprotectin Concentration

    Directory of Open Access Journals (Sweden)

    Kousaku Kawashima

    2014-01-01

    Full Text Available Purpose. Few reports have compared the clinical efficacy of a pH-dependent release formulation of mesalazine (pH-5-ASA with a time-dependent release formulation (time-5-ASA. We examined whether pH-5-ASA is effective for active ulcerative colitis (UC in patients resistant to time-5-ASA. Methods. We retrospectively and prospectively analyzed the efficacy of pH-5-ASA in mildly to moderately active UC patients in whom time-5-ASA did not successfully induce or maintain remission. The clinical efficacy of pH-5-ASA was assessed by clinical activity index (CAI before and after switching from time-5-ASA. In addition, the efficacy of pH-5-ASA on mucosal healing (MH was evaluated in a prospective manner by measuring fecal calprotectin concentration. Results. Thirty patients were analyzed in a retrospective manner. CAI was significantly reduced at both 4 and 8 weeks after switching to pH-5-ASA. In the prospective study (n=14, administration of pH-5-ASA also significantly reduced CAI scores at 4 and 8 weeks in these patients who were resistant to time-5-ASA. In addition, fecal calprotectin concentration was significantly decreased along with improvement in CAI after switching to pH-5-ASA. Conclusions. Our results suggest that pH-5-ASA has clinical efficacy for mildly to moderately active patients with UC in whom time-5-ASA did not successfully induce or maintain remission.

  5. Barium titanate core – gold shell nanoparticles for hyperthermia treatments

    OpenAIRE

    FarrokhTakin E; Ciofani G; Puleo GL; de Vito G; Filippeschi C; Mazzolai B; Piazza V; Mattoli V

    2013-01-01

    Elmira FarrokhTakin,1,2 Gianni Ciofani,1 Gian Luigi Puleo,1 Giuseppe de Vito,3,4 Carlo Filippeschi,1 Barbara Mazzolai,1 Vincenzo Piazza,3 Virgilio Mattoli1 1Center for Micro-BioRobotics @SSSA, Fondazione Istituto Italiano di Tecnologia, Pontedera, Pisa, Italy; 2The Biorobotics Institute, Scuola Superiore Sant'Anna, Pontedera, Pisa, Italy; 3Center for Nanotechnology Innovation @NEST, Fondazione Istituto Italiano di Tecnologia, Pisa, Italy; 4NEST, Scuola Normale Superiore, Pisa, Italy ...

  6. A new iterative approach to the corrective security-constrained optimal power flow problem

    OpenAIRE

    Capitanescu, Florin; Wehenkel, Louis

    2008-01-01

    This paper deals with techniques to solve the corrective security-constrained optimal power flow (CSCOPF) problem. To this end, we propose a new iterative approach that comprises four modules: a CSCOPF which considers only a subset of potentially binding contingencies among the postulated ones, a (steady-state) security analysis (SSSA), a contingency filtering (CF) technique, and an OPF variant to check post-contingency state feasibility when taking into account po...

  7. Dicty_cDB: SSA365 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SS (Link to library) SSA365 (Link to dictyBase) - G20758 DDB0185325 Contig-U04375-1 SSA...365E (Link to Original site) - - - - - - SSA365E 349 Show SSA365 Library SS (Link to library) Clone ID SSA...riginal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SS/SSA3-C/SSA365Q.Seq.d/ ...Representative seq. ID SSA365E (Link to Original site) Representative DNA sequence >SSA365 (SSA365Q) /CSM/SS/SSA3-C/SSA...core E Sequences producing significant alignments: (bits) Value SSA365 (SSA365Q) /CSM/SS/SSA3-C/SSA365Q.Seq.

  8. Dicty_cDB: SSA672 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SS (Link to library) SSA672 (Link to dictyBase) - - - Contig-U12249-1 SSA672E (Link... to Original site) - - - - - - SSA672E 573 Show SSA672 Library SS (Link to library) Clone ID SSA672 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SS/SSA6-C/SSA672Q.Seq.d/ Representative seq. ID SSA67...2E (Link to Original site) Representative DNA sequence >SSA672 (SSA672Q) /CSM/SS/SSA6-C/SSA672Q.Seq.d/ ATTAT....Seq.d/ 1104 0.0 SSF809 (SSF809Q) /CSM/SS/SSF8-A/SSF809Q.Seq.d/ 1104 0.0 SSF627 (SSF627Q) /CSM/SS/SSF6-B/SSF627Q.Seq.d/ 1104 0.0 SSA

  9. Dicty_cDB: SSA166 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SS (Link to library) SSA166 (Link to dictyBase) - - - Contig-U14969-1 SSA166F (Link to Original site) SSA...166F 455 - - - - - - Show SSA166 Library SS (Link to library) Clone ID SSA166 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SS/SSA1-C/SSA166Q.Seq.d/ Representative seq. ID SSA16...6F (Link to Original site) Representative DNA sequence >SSA166 (SSA166Q) /CSM/SS/SSA1-C/SSA166Q.Seq.d/ GCAAG... (bits) Value VSK402 (VSK402Q) /CSM/VS/VSK4-A/VSK402Q.Seq.d/ 137 2e-31 SSL708 (SSL708Q) /CSM/SS/SSL7-A/SSL708Q.Seq.d/ 137 2e-31 SSA

  10. Dicty_cDB: SSA269 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SS (Link to library) SSA269 (Link to dictyBase) - - - Contig-U16244-1 SSA269Z (Link... to Original site) - - SSA269Z 504 - - - - Show SSA269 Library SS (Link to library) Clone ID SSA269 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SS/SSA2-C/SSA269Q.Seq.d/ Representative seq. ID SSA26...9Z (Link to Original site) Representative DNA sequence >SSA269 (SSA269Q) /CSM/SS/SSA2-C/SSA269Q.Seq.d/ XXXXX...letal 4.0 %: vacuolar 4.0 %: plasma membrane >> prediction for SSA269 is cyt 5' end seq. ID - 5' end seq. -

  11. Dicty_cDB: SSA765 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SS (Link to library) SSA765 (Link to dictyBase) - - - Contig-U16394-1 SSA765Z (Link... to Original site) - - SSA765Z 154 - - - - Show SSA765 Library SS (Link to library) Clone ID SSA765 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SS/SSA7-C/SSA765Q.Seq.d/ Representative seq. ID SSA76...5Z (Link to Original site) Representative DNA sequence >SSA765 (SSA765Q) /CSM/SS/SSA7-C/SSA765Q.Seq.d/ XXXXX...htriyay*k*k*kkknnv*n*k Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SSA765 (SSA

  12. Dicty_cDB: SSA854 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SS (Link to library) SSA854 (Link to dictyBase) ssa854 - - Contig-U16352-1 SSA854F ...(Link to Original site) SSA854F 249 - - - - - - Show SSA854 Library SS (Link to library) Clone ID SSA854 (Li...nk to dictyBase) Atlas ID ssa854 NBRP ID - dictyBase ID - Link to Contig Contig-U16352-1 Original site URL h...ttp://dictycdb.biol.tsukuba.ac.jp/CSM/SS/SSA8-C/SSA854Q.Seq.d/ Representative seq. ID SSA...854F (Link to Original site) Representative DNA sequence >SSA854 (SSA854Q) /CSM/SS/SSA8-C/SSA854Q.Se

  13. Dicty_cDB: SSA572 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SS (Link to library) SSA572 (Link to dictyBase) - - - Contig-U11935-1 SSA572F (Link to Original site) SSA...572F 580 - - - - - - Show SSA572 Library SS (Link to library) Clone ID SSA572 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SS/SSA5-C/SSA572Q.Seq.d/ Representative seq. ID SSA57...2F (Link to Original site) Representative DNA sequence >SSA572 (SSA572Q) /CSM/SS/SSA5-C/SSA572Q.Seq.d/ ATGAA...ASSVIDTFLAPGSPLLNVV IHGHYLETAFNS--- Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SSA572 (SSA

  14. Dicty_cDB: SSA568 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SS (Link to library) SSA568 (Link to dictyBase) - - - Contig-U04420-1 SSA568E (Link to Original site) SSA...568F 423 SSA568Z 348 SSA568P 771 SSA568E 423 Show SSA568 Library SS (Link to library) Clone ID SSA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SS/SSA5-C/SSA568Q.Seq.d/ Representative seq. ID SSA...568E (Link to Original site) Representative DNA sequence >SSA568 (SSA568Q) /CSM/SS/SSA5-C/SSA...ces producing significant alignments: (bits) Value SSA568 (SSA568Q) /CSM/SS/SSA5-C/SSA568Q.Seq.d/ 529 e-149

  15. Dicty_cDB: SSA154 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SS (Link to library) SSA154 (Link to dictyBase) - - - Contig-U16544-1 SSA154E (Link... to Original site) - - - - - - SSA154E 255 Show SSA154 Library SS (Link to library) Clone ID SSA154 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SS/SSA1-C/SSA154Q.Seq.d/ Representative seq. ID SSA15...4E (Link to Original site) Representative DNA sequence >SSA154 (SSA154Q) /CSM/SS/SSA1-C/SSA154Q.Seq.d/ ATTTT...( C46264 ) thioredoxin 3 - slime mold (Dictyostelium discoid... 55 6e-07 BT057388_1( BT057388 |pid:none) Salmo salar clone ssa

  16. Dicty_cDB: SSA261 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SS (Link to library) SSA261 (Link to dictyBase) - G02045 DDB0235194 Contig-U04344-1 SSA...261F (Link to Original site) SSA261F 301 - - - - - - Show SSA261 Library SS (Link to library) Clone ID SSA...riginal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SS/SSA2-C/SSA261Q.Seq.d/ ...Representative seq. ID SSA261F (Link to Original site) Representative DNA sequence >SSA261 (SSA261Q) /CSM/SS/SSA2-C/SSA...I4-B/SSI429Q.Seq.d/ 436 e-122 SSA261 (SSA261Q) /CSM/SS/SSA2-C/SSA261Q.Seq.d/ 436 e-122 VSH479 (VSH479Q) /CSM

  17. A constrained approach to multiscale stochastic simulation of chemically reacting systems

    KAUST Repository

    Cotter, Simon L.

    2011-01-01

    Stochastic simulation of coupled chemical reactions is often computationally intensive, especially if a chemical system contains reactions occurring on different time scales. In this paper, we introduce a multiscale methodology suitable to address this problem, assuming that the evolution of the slow species in the system is well approximated by a Langevin process. It is based on the conditional stochastic simulation algorithm (CSSA) which samples from the conditional distribution of the suitably defined fast variables, given values for the slow variables. In the constrained multiscale algorithm (CMA) a single realization of the CSSA is then used for each value of the slow variable to approximate the effective drift and diffusion terms, in a similar manner to the constrained mean-force computations in other applications such as molecular dynamics. We then show how using the ensuing Fokker-Planck equation approximation, we can in turn approximate average switching times in stochastic chemical systems. © 2011 American Institute of Physics.

  18. Interní audit a řízení rizik v organizační složce státu

    OpenAIRE

    Hamšík, Petr

    2014-01-01

    Bachelor thesis „Internal auditing and Risk Management in a State Organisational Unit“ deals with the assessment of the role and status of internal audit in the organizational folder State. Literature search contains basic information related to the issue. In the next section is rated the implementation of internal audits and risk management in an organizational folder State. The organizational component of the State in this case is the Czech administration of social security (CSSA).

  19. Decentralized Cooperation Strategies in Two-Dimensional Traffic of Cellular Automata

    International Nuclear Information System (INIS)

    We study the two-dimensional traffic of cellular automata using computer simulation. We propose two type of decentralized cooperation strategies, which are called stepping aside (CS-SA) and choosing alternative routes (CS-CAR) respectively. We introduce them into an existing two-dimensional cellular automata (CA) model. CS-SA is designed to prohibit a kind of ping-pong jump when two objects standing together try to move in opposite directions. CS-CAR is designed to change the solution of conflict in parallel update. CS-CAR encourages the objects involved in parallel conflicts choose their alternative routes instead of waiting. We also combine the two cooperation strategies (CS-SA-CAR) to test their combined effects. It is found that the system keeps on a partial jam phase with nonzero velocity and flow until the density reaches one. The ratios of the ping-pong jump and the waiting objects involved in conflict are decreased obviously, especially at the free phase. And the average flow is improved by the three cooperation strategies. Although the average travel time is lengthened a bit by CS-CAR, it is shorten by CS-SA and CS-SA-CAR. In addition, we discuss the advantage and applicability of decentralized cooperation modeling.

  20. 5-Aminosalicylic Acid Azo-Linked to Procainamide Acts as an Anticolitic Mutual Prodrug via Additive Inhibition of Nuclear Factor kappaB.

    Science.gov (United States)

    Kim, Wooseong; Nam, Joon; Lee, Sunyoung; Jeong, Seongkeun; Jung, Yunjin

    2016-06-01

    To improve the anticolitic efficacy of 5-aminosalicylic acid (5-ASA), a colon-specific mutual prodrug of 5-ASA was designed. 5-ASA was coupled to procainamide (PA), a local anesthetic, via an azo bond to prepare 5-(4-{[2-(diethylamino)ethyl]carbamoyl}phenylazo)salicylic acid (5-ASA-azo-PA). 5-ASA-azo-PA was cleaved to 5-ASA and PA up to about 76% at 10 h in the cecal contents while remaining stable in the small intestinal contents. Oral gavage of 5-ASA-azo-PA and sulfasalazine, a colon-specific prodrug currently used in clinic, to rats showed similar efficiency in delivery of 5-ASA to the large intestine, and PA was not detectable in the blood after 5-ASA-azo-PA administration. Oral gavage of 5-ASA-azo-PA alleviated 2,4,6-trinitrobenzenesulfonic acid-induced rat colitis. Moreover, combined intracolonic treatment with 5-ASA and PA elicited an additive ameliorative effect. Furthermore, combined treatment with 5-ASA and PA additively inhibited nuclear factor-kappaB (NFκB) activity in human colon carcinoma cells and inflamed colonic tissues. Finally, 5-ASA-azo-PA administered orally was able to reduce inflammatory mediators, NFκB target gene products, in the inflamed colon. 5-ASA-azo-PA may be a colon-specific mutual prodrug acting against colitis, and the mutual anticolitic effects occurred at least partly through the cooperative inhibition of NFκB activity. PMID:27112518

  1. Reduced mucosal side-effects of acetylsalicylic acid after conjugation with tris-hydroxymethyl-aminomethane. Synthesis and biological evaluation of a new anti-inflammatory compound.

    Science.gov (United States)

    Varga, Gabriella; Lajkó, Norbert; Ugocsai, Melinda; Érces, Dániel; Horváth, Gyöngyi; Tóth, Gábor; Boros, Mihály; Ghyczy, Miklós

    2016-06-15

    Acetylsalicylic acid (ASA) causes adverse haemorrhagic reactions in the upper gastrointestinal (GI) tract, and previous results have suggested that combination therapy with 2-amino-2-(hydroxymethyl)-1,3-propanediol (Tris) could provide protection in this scenario. Based on this hypothesis, our aim was to develop a new compound from ASA and Tris precursors and to characterize the biological effects of ASA-Tris and the derivatives ASA-bis- and mono-hydroxymethyl-aminomethane (ASA-Bis, ASA-Mono, respectively) using in vivo and in vitro test systems. ASA or ASA conjugates (0.55mmol/kg, each) were administered intragastrically to Sprague-Dawley rats. Changes in the mucosal structure and in the serosal microcirculation were detected by in vivo imaging techniques, the plasma TNF-alpha, tissue xanthine oxidoreductase and myeloperoxidase activities, and liver cytochrome c changes were also determined. In two separate series, platelet aggregation and carrageenan arthritis-induced inflammatory pain were measured in control, ASA and ASA-Tris-treated groups. Severe mucosal injury and a significant decrease in serosal red blood cell velocity developed in the ASA-treated group and an ~2-fold elevation in proinflammatory mediator levels evolved. ASA-Tris did not cause bleeding, microcirculatory dysfunction, mucosal injury or an elevation in proinflammatory markers. The ASA-Mono and ASA-Bis conjugates did not cause macroscopic bleeding, but the inflammatory activation was apparent. ASA-Tris did not influence the cyclooxygenase-induced platelet aggregation significantly, but the inflammatory pain was reduced as effectively as in the case of equimolar ASA doses. ASA-Tris conjugation is an effective approach through which the GI side-effects of ASA are controlled by decreasing the cytokine-mediated progression of pro-inflammatory events. PMID:27079640

  2. Enteric coating can lead to reduced antiplatelet effect of low-dose acetylsalicylic acid

    DEFF Research Database (Denmark)

    Fentz Haastrup, Peter; Grønlykke, Thor; Jarbøl, Dorte Ejg

    2015-01-01

    Low-dose acetylsalicylic acid (ASA) is widely used as antithrombotic prophylaxis. Enteric coated ASA has been developed in order to decrease the risk of gastrointestinal side effects. The consequences of enteric coating on pharmacokinetics and antiplatelet effect of ASA have not systematically been...... assessed. This MiniReview demonstrates that data from clinical trials indicate that enteric coating can reduce the antiplatelet effect of ASA compared to plain ASA. This is possibly due to decreased bioavailability of ASA caused by prolonged solvation and absorption of the enteric coated formulations...

  3. Therapeutic Efficacy of pH-Dependent Release Formulation of Mesalazine on Active Ulcerative Colitis Resistant to Time-Dependent Release Formulation: Analysis of Fecal Calprotectin Concentration

    OpenAIRE

    Kousaku Kawashima; Shunji Ishihara; Takafumi Yuki; Koji Onishi; Yoshinori Kushiyama; Hirofumi Fujishiro; Youichi Miyaoka; Mika Yuki; Yoshinori Komazawa; Takashi Tanimura; Hiroki Sonoyama; Yasumasa Tada; Ryusaku Kusunoki; Akihiko Oka; Nobuhiko Fukuba

    2014-01-01

    Purpose. Few reports have compared the clinical efficacy of a pH-dependent release formulation of mesalazine (pH-5-ASA) with a time-dependent release formulation (time-5-ASA). We examined whether pH-5-ASA is effective for active ulcerative colitis (UC) in patients resistant to time-5-ASA. Methods. We retrospectively and prospectively analyzed the efficacy of pH-5-ASA in mildly to moderately active UC patients in whom time-5-ASA did not successfully induce or maintain remission. The clinical e...

  4. Anesthesiology: About the Anesthesiology Profession

    Science.gov (United States)

    ... significantly longer and more extensive training than other classifications of anesthesia practitioners, physician anesthesiologists are the most ... at ASA Contact Us Support ASA Advertise Exhibit Corporate Support Resources Standards & Guidelines Practice Management Quality Improvement ...

  5. High-pressure polymorphism of acetylsalicylic acid (aspirin): Raman spectroscopy

    Science.gov (United States)

    Crowell, Ethan L.; Dreger, Zbigniew A.; Gupta, Yogendra M.

    2015-02-01

    Micro-Raman spectroscopy was used to elucidate the high-pressure polymorphic behavior of acetylsalicylic acid (ASA), an important pharmaceutical compound known as aspirin. Using a diamond anvil cell (DAC), single crystals of the two polymorphic phases of aspirin existing at ambient conditions (ASA-I and ASA-II) were compressed to 10 GPa. We found that ASA-I does not transform to ASA-II, but instead transforms to a new phase (ASA-III) above ∼2 GPa. It is demonstrated that this transformation primarily introduces structural changes in the bonding and arrangement of the acetyl groups and is reversible upon the release of pressure. In contrast, a less dense ASA-II shows no transition in the pressure range studied, though it appears to exhibit a disordered structure above 7 GPa. Our results suggest that ASA-III is the most stable polymorph of aspirin at high pressures.

  6. Induction of tolerance to human arylsulfatase A in a mouse model of metachromatic leukodystrophy.

    Science.gov (United States)

    Matzner, Ulrich; Matthes, Frank; Herbst, Eva; Lüllmann-Rauch, Renate; Callaerts-Vegh, Zsuzsanna; D'Hooge, Rudi; Weigelt, Cecilia; Eistrup, Carl; Fogh, Jens; Gieselmann, Volkmar

    2007-01-01

    A deficiency of arylsulfatase A (ASA) causes metachromatic leukodystrophy (MLD), a lysosomal storage disorder characterized by accumulation of sulfatide, a severe neurological phenotype and early death. The efficacy of enzyme replacement therapy (ERT) has previously been determined in ASA knockout (ASA-/-) mice representing the only available animal model for MLD. Repeated intravenous injection of human ASA (hASA) improved the nervous system pathology and function, but also elicited a progressive humoral immune response leading to treatment resistance, anaphylactic reactions, and high mortality. In contrast to ASA-/- mice, most MLD patients express mutant hASA which may entail immunological tolerance to substituted wildtype hASA and thus protect from immunological complications. To test this notion, a cysteine-to-serine substitution was introduced into the active site of the hASA and the resulting inactive hASA-C69S variant was constitutively expressed in ASA-/- mice. Mice with sub-to supranormal levels of mutant hASA expression were analyzed. All mice, including those showing transgene expression below the limit of detection, were immunologically unresponsive to injected hASA. More than 100-fold overexpression did not induce an overt new phenotype except occasional intralysosomal deposition of minor amounts of glycogen in hepatocytes. Furthermore, long-term, low-dose ERT reduced sulfatide storage in peripheral tissues and the central nervous system indicating that high levels of extracellular mutant hASA do not prevent cellular uptake and lysosomal targeting of substituted wildtype hASA. Due to the tolerance to hASA and maintenance of the MLD-like phenotype, the novel transgenic strain may be particularly advantageous to assess the benefit and risk of long-term ERT. PMID:17660863

  7. Patient characteristics among users of analgesic over-the-counter aspirin in a Danish pharmacy setting

    DEFF Research Database (Denmark)

    Pottegård, Anton; Kviesgaard, Ann-Katrine; Hesse, Ulrik;

    2014-01-01

    BACKGROUND: Use of over-the-counter (OTC) high-dose acetylsalicylic acid (ASA) is a risk factor for experiencing gastric bleeding. However, more detailed knowledge on the characteristics of users of OTC ASA is needed. OBJECTIVE: To characterise users of OTC high-dose ASA in a Danish pharmacy...

  8. The prevalence of intolerance for low-dose acetylsalicylacid in the secondary prevention of atherothrombosis.

    Science.gov (United States)

    Tournoij, E; Peters, R J G; Langenberg, M; Kanhai, K J K; Moll, F L

    2009-05-01

    Daily low-dose acetylsalicylacid (ASA) is prescribed to patients with atherothrombosis frequently to prevent vascular complications. In reports on complications and side effects of low-dose ASA use in the literature there is a range of definitions. We explored the incidence, characteristics and consequences of symptoms suggestive of ASA intolerance in patients on low-dose ASA. General practitioners and specialists in 105 centres were asked to review their patient files for the last 10 consecutive patients who were prescribed ASA. Participating patients completed a questionnaire about their current ASA use (doctors completed the questionnaire together with the patients), use of co-medication and symptoms suggestive of ASA intolerance. A total of 947 patients were included in this study. Sixty patients (6.6%) had ceased ASA treatment, predominantly because of the occurrence of side effects suspected to be caused by ASA use. A quarter of the patients concomitantly used an anti-acid agent. Of the 947 patients, 271 (30.6%) indicated symptoms during ASA intake. The most common symptoms were related to the gastrointestinal tract (25.1%). In patients prescribed a low-dose of ASA monotherapy, side effects suggestive of intolerance are common. More awareness should be created to detect and treat these symptoms, because the occurrence of side effects is the most important reason for patients to discontinue ASA treatment. PMID:19297216

  9. Illuminating tomato fruit enhances fruit Vitamin C content

    NARCIS (Netherlands)

    Ntagkas, N.; Min, Q.; Woltering, E.J.; Labrie, C.; Nicole, C.C.S.; Marcelis, L.F.M.

    2016-01-01

    L-ascorbate (AsA; Vitamin C) is an anti-and pro-oxidant phytochemical essential for the proper functioning of the human body. Field grown tomato fruit (Solanum lycopersicum) contain substantial amounts of AsA. When grown in the greenhouse, tomato fruit typically have low levels of AsA. Light is t

  10. 5-Aminosalicylic acid dependency in Crohn's disease: A Danish Crohn Colitis Database study

    DEFF Research Database (Denmark)

    Duricova, D.; Pedersen, N.; Elkjaer, M.;

    2010-01-01

    Background and aims The role of 5 aminosalicylic acid (5 ASA) in Crohns disease is unclear The outcome of the first course of 5 ASA monotherapy with emphasis on 5 ASA dependency was retrospectively assessed in consecutive cohort of 537 Crohn s disease patients diagnosed 1953-2007 Methods Following...

  11. A novel dissolution method relevant to intestinal release behaviour and its application in the evaluation of modified release mesalazine products

    NARCIS (Netherlands)

    Schellekens, R.C.A.; Stuurman, F.E.; van der Weert, F.H.J.; Kosterink, J.G.W.; Frijlink, H.W.

    2007-01-01

    Mesalazine (5-ASA) is a compound being used in the therapy of inflammatory bowel disease (IBD). Considering the fact that 5-ASA is locally active and that the location of inflammation in IBD may vary, it is recognized that the release profile of 5-ASA drugs is the dominant factor for adequate local

  12. Platelet content of nitric oxide synthase 3 phosphorylated at Serine 1177 is associated with the functional response of platelets to aspirin.

    Directory of Open Access Journals (Sweden)

    Javier Modrego

    Full Text Available OBJECTIVE: To analyse if platelet responsiveness to aspirin (ASA may be associated with a different ability of platelets to generate nitric oxide (NO. PATIENTS/METHODS: Platelets were obtained from 50 patients with stable coronary ischemia and were divided into ASA-sensitive (n = 26 and ASA-resistant (n = 24 using a platelet functionality test (PFA-100. RESULTS: ASA-sensitive platelets tended to release more NO (determined as nitrite + nitrate than ASA-resistant platelets but it did not reach statistical significance. Protein expression of nitric oxide synthase 3 (NOS3 was higher in ASA-sensitive than in ASA-resistant platelets but there were no differences in the platelet expression of nitric oxide synthase 2 (NOS2 isoform. The highest NOS3 expression in ASA-sensitive platelets was independent of the presence of T-to-C mutation at nucleotide position -786 (T(-786 → C in the NOS3-coding gene. However, platelet content of phosphorylated NOS3 at Serine (Ser(1177, an active form of NOS3, was higher in ASA-sensitive than in ASA-resistant platelets. The level of platelet NOS3 Ser(1177 phosphorylation was positively associated with the closure time in the PFA-100 test. In vitro, collagen failed to stimulate the aggregation of ASA-sensitive platelets, determined by lumiaggregometry, and it was associated with a significant increase (p = 0.018 of NOS3 phosphorylation at Ser(1177. On the contrary, collagen stimulated the aggregation of ASA-resistant platelets but did not significantly modify the platelet content of phosphorylated NOS3 Ser(1177. During collagen stimulation the release of NO from ASA-sensitive platelets was significantly enhanced but it was not modified in ASA-resistant platelets. CONCLUSIONS: Functional platelet responsiveness to ASA was associated with the platelet content of phosphorylated NOS3 at Ser(1177.

  13. Fragment o dimenzijah emocije, "mathesisa" in časa v čisto glasbenem: A fragment on the emotion, "mathesis" and the time dimension of the purely musical: marginalia with Prelude to the afternoon of a faun by Claude Debussy: pripombe ob Preludiju k faunovemu popoldnevu Claudea Debussyja:

    OpenAIRE

    Popović Mlađenović, Tijana

    2007-01-01

    In the dialogue What Is Music? between Carl Dahlhaus and Hans Heinrich Eggebrecht, music is defined as a "mathematized emotion" or an "emotionalized 'mathesis'". As emphasized by Marija Bergamo, this is the way of underlining its equal and unavoidable constitution, based on emotion and rational organization in the time dimension. So, Marija Bergamo is continuously searching for those music determinants in a musical work as an "autonomous aesthetic fact", whose base and real essence lie "withi...

  14. Research on the Mode of ASP-based Services Alliance for SME

    Institute of Scientific and Technical Information of China (English)

    MEI Yi; LIU Dan; YANG Wenjie

    2006-01-01

    More and more small and medium enterprises(SMEs) carry professional information systems into effect by Application Service Provider(ASP). However, lots of ASP has just single function so that they can't meet needs for collaborative commerce among SMEs. Therefore, the ASP-based Services Alliance (ASA) is proposed to raise level of information application for SMEs. The formation process of ASA is introduced, some key methods supporting ASA formation are presented and the practice of ASA in Guizhou province which was developed with the key methods discussed. SMEs can get high quality, low cost online services and the ability of capturing market with allied member collaboratively through ASA.

  15. La seguridad alimentaria en Venezuela. 2. Una evaluación de políticas públicas en relación a la autosuficiencia o autonomía alimentaria. Período 1999-2012

    Directory of Open Access Journals (Sweden)

    Daniel Castro Aniyar

    2013-06-01

    Full Text Available Luego de evaluar en la primera parte otros objetivos de la seguridad alimentaria venezolana, esta segunda parte enfocó la evaluación de la autosuficiencia o autonomía alimentaria según criterios de la FAO. Tal evaluación se realizó mediante la comparación, por un lado, de 22 emprendimientos productivos y de provisión alimentarios y no alimentarios convocados por el Sistema Socialista de Soberanía Alimentaria (SSSA y, por el otro, de indicadores macroeconómicos y socio-productivos extraídos de diferentes fuentes oficiales de manera directa e indirecta. Se concluye que, a diferencia de los anteriores objetivos evaluados, el SSSA logró levantar someramente la producción nacional pero el resultado fue contrario al deseado: los emprendimientos productivos iniciados en la sociedad civil han descendido, al menos, desde el 2007 y, además, muchos de los que comenzaron han fenecido tempranamente. El derrumbe de los nuevos emprendimientos es particularmente más pronunciado que el de otros países latinoamericanos como Perú, Guatemala, Colombia o Brasil. En este sentido, la dependencia del sector externo ha sido mucho mayor en el 2012 que antes del SSSA y sus indicadores se encuentran más de 40 puntos por debajo de los niveles críticos establecidos por la FAO, situación que se agravó al menos desde el 2007.

  16. [Pharmacokinetics after oral and intravenous administration of d,l-monolysine acetylsalicylate and an oral dose of acetylsalicylic acid in healthy volunteers].

    Science.gov (United States)

    Raschka, C; Koch, H J

    2001-01-01

    We studied the ASA pharmacokinetics of single doses of 500 mg and 1000 mg of D,L-lysine-monoacetylsalicylate (Lys-ASA) administered both orally (Delgesic) and 500 mg parenterally (Aspisol) as well as 500 mg acetylsalicylate (ASA, Aspirin) in 13 healthy volunteers. Blood samples were taken before and at defined times up to 48 h after application of Lys-ASA and ASA. Analysis for ASA and its metabolite salicylic acid were performed by HPLC. All concentration versus time data were presented descriptively. As far as ASA was concerned, differences were assessed by means of ANOVA according to Friedman including post hoc Wilcoxon tests for each time point. Pharmacokinetic parameters were calculated based on a one-compartment model. The concentration vs. time curves after oral intake of 500 mg of ASA and Lys-ASA differed significantly (p salicylic acid concentration after injection of Lys-ASS. We conclude that concerning time dimension oral administration of Lys-ASA is almost equivalent to i.v. Lys-ASA and may be an alternative for i.v. administration in cases of acute heart attacks. PMID:11878089

  17. La seguridad alimentaria en Venezuela. 1. Una evaluación de los sub-objetivos suficiencia, acceso, disponibilidad y estabilidad. Período 1999-2012

    OpenAIRE

    Daniel Castro Aniyar

    2013-01-01

    Este trabajo evaluó los alcances en seguridad alimentaria del Sistema Socialista de Soberanía Alimentaria en Venezuela (SSSA) desde el año 1999 hasta el 2012, a partir de los sub-objetivos suficiencia, acceso, disponibilidad y estabilidad. Para tal fin, se comparó información extraída de los discursos oficiales, de políticas públicas, de diarios de campo entre 22 emprendimientos del poder popular (sociedad civil convocada), a lo largo de ese período y de los indicadores socioeconómicos desde ...

  18. 青少年主观社会经济地位量表的初步编制%Development of Subjective Socioeconomic Status Scale for Chinese Adolescents

    Institute of Scientific and Technical Information of China (English)

    胡牡丽; 王孟成; 蔡琳; 朱熊兆; 姚树桥

    2012-01-01

    Objective: To develop a Subjective Socioeconomic Status Scale for Chinese Adolescents. Methods: A total of 6687 middle school students, from grade 7 to grade 12, finished SSS-A and other scales from four cities of China, 495 of them finished the SSS-A the second time after 3 weeks. Results: The intraclass correlation coefficient of SSS-A was 0.78, 0.76 for the family place and 0.71 for the school place; criterion validity analyses showed SSS-A had significant negative correlation with CES-D and MASC(r=-0.14—0.38, P<0.01), and positive correlation with the RSES and objective SES(r=0.12~0.44,P<0.01). Conclusion: The Subjective Socioeconomic Status Scale for Chinese Adolescents in the present study attains acceptable psychometric properties.%目的:编制适合于中国青少年的主观社会经济地位量表.方法:长沙、成都、苏州和银川四市6687名初一至高三学生完成青少年主观社会经济地位(SSS-A)等量表,其中495人间隔3周进行了重测.结果:SSS-A的重测信度为0.78,家庭地位和学校地位两条目的重测信度分别是0.76、0.71;SSS-A总分和两条目与流调中心用抑郁量表(CES-D)、儿童多维焦虑自评量表(MASC-C)得分呈负相关(r=-0.14~-0.38,P<0.01),与Rosemberg自尊量表(RSES)总分和客观SES指标显著正相关(r=0.12~0.44,P<0.01).结论:本研究编制的SSS-A具有良好的信效度,适用于我国青少年的主观社会经济地位评估.

  19. La seguridad alimentaria en Venezuela. 2. Una evaluación de políticas públicas en relación a la autosuficiencia o autonomía alimentaria. Período 1999-2012

    OpenAIRE

    Daniel Castro Aniyar

    2013-01-01

    Luego de evaluar en la primera parte otros objetivos de la seguridad alimentaria venezolana, esta segunda parte enfocó la evaluación de la autosuficiencia o autonomía alimentaria según criterios de la FAO. Tal evaluación se realizó mediante la comparación, por un lado, de 22 emprendimientos productivos y de provisión alimentarios y no alimentarios convocados por el Sistema Socialista de Soberanía Alimentaria (SSSA) y, por el otro, de indicadores macroeconómicos y socio-productivos extraídos d...

  20. L-Ascorbic acid metabolism during fruit development in an ascorbate-rich fruit crop chestnut rose (Rosa roxburghii Tratt).

    Science.gov (United States)

    Huang, Ming; Xu, Qiang; Deng, Xiu-Xin

    2014-09-01

    Chestnut rose (Rosa roxburghii Tratt) is a fruit crop that contains unusually high levels of l-ascorbic acid (AsA; ∼1300 mg 100g(-1) FW). To explore the mechanisms underlying AsA metabolism, we investigated the distribution and abundance of AsA during fruit development. We also analyzed gene expression patterns, enzyme activities, and content of metabolites related to AsA biosynthesis and recycling. AsA first accumulated during late fruit development and continued to accumulate during ripening, with the highest accumulation rate near fruit maturity. The redox state of AsA in fruit was also enhanced during late fruit development, while leaf and other tissues had much lower levels of AsA and the redox state of AsA was lower. In mature fruit, AsA was mainly distributed in the cytoplasm of the mesocarp. Correlation analysis suggested that the gene expression patterns, enzyme activities, and related metabolite concentrations involved in the l-galactose pathway showed relatively high correlations with the accumulation rate of AsA. The gene expression pattern and activity of dehydroascorbate reductase (DHAR, EC 1.8.5.1) correlated strongly with AsA concentration, possibly indicating the crucial role of DHAR in the accumulation of high levels of AsA in chestnut rose fruit. Over expression of DHAR in Arabidopsis significantly increased the reduced AsA content and redox state. This was more effective than over expression of the l-galactose pathway gene GDP-d-mannose-3,5-epimerase (EC 5.1.3.18). These findings will enhance understanding of the molecular mechanisms regulating accumulation of AsA in chestnut rose. PMID:25019249

  1. A new method for the characterization of strain-specific conformational stability of protease-sensitive and protease-resistant PrPSc.

    Directory of Open Access Journals (Sweden)

    Laura Pirisinu

    Full Text Available Although proteinacious in nature, prions exist as strains with specific self-perpetuating biological properties. Prion strains are thought to be associated with different conformers of PrP(Sc, a disease-associated isoform of the host-encoded cellular protein (PrP(C. Molecular strain typing approaches have been developed which rely on the characterization of protease-resistant PrP(Sc. However, PrP(Sc is composed not only of protease-resistant but also of protease-sensitive isoforms. The aim of this work was to develop a protocol for the molecular characterization of both, protease-resistant and protease-sensitive PrP(Sc aggregates. We first set up experimental conditions which allowed the most advantageous separation of PrP(C and PrP(Sc by means of differential centrifugation. The conformational solubility and stability assay (CSSA was then developed by measuring PrP(Sc solubility as a function of increased exposure to GdnHCl. Brain homogenates from voles infected with human and sheep prion isolates were analysed by CSSA and showed strain-specific conformational stabilities, with mean [GdnHCl](1/2 values ranging from 1.6 M for MM2 sCJD to 2.1 for scrapie and to 2.8 M for MM1/MV1 sCJD and E200K gCJD. Interestingly, the rank order of [GdnHCl](1/2 values observed in the human and sheep isolates used as inocula closely matched those found following transmission in voles, being MM1 sCJD the most resistant (3.3 M, followed by sheep scrapie (2.2 M and by MM2 sCJD (1.6 M. In order to test the ability of CSSA to characterise protease-sensitive PrP(Sc, we analysed sheep isolates of Nor98 and compared them to classical scrapie isolates. In Nor98, insoluble PrP(Sc aggregates were mainly protease-sensitive and showed a conformational stability much lower than in classical scrapie. Our results show that CSSA is able to reveal strain-specified PrP(Sc conformational stabilities of protease-resistant and protease-sensitive PrP(Sc and that it is a valuable tool

  2. Adaptación cultural e implantación del programa matrix de tratamiento de las adicciones en la Región de Murcia

    OpenAIRE

    Galindo Piñana, Pilar

    2012-01-01

    El modelo multicomponente Matrix, es efectivo en el tratamiento de las conductas adictivas con un alto nivel de evidencia científica. Objetivos: Adaptar, aplicar y evaluar la eficacia del Programa en la Región de Murcia. Hipótesis: el Programa, disminuye la sintomatología, el craving y favorece la abstinencia. Metodología: A 49 pacientes drogodependientes se aplicaron: MCMI-II, 16 PF-5, CTI, SCL 90-R. CGI, BIS-11, Y-BOCS, CSSA. Resultados: Perfil: varón, 35 años, soltero, estudios primarios, ...

  3. Effects of L-glutamine on acetylsalycylic acid induced gastric lesions and acid back diffusion in dogs.

    Science.gov (United States)

    Hung, C R; Takeuchi, K; Okabe, S; Murata, T; Takagi, K

    1976-12-01

    Effects of L-glutamine on acetylsalicylic acid (ASA)-induced gastric mucosal lesions were studied in mongrel dogs. It was confirmed that when oral ASA at 1.0 or 2.0 g per dog is given in two divided doses, there is severe and consistent dose-dependent mucosal damage in the glandular portion of the stomach in fasted dogs. However, when L-glutamine 2.0 or 4.0 g per dog in two divided doses is given concomitantly with ASA 2.0 g per dog orally, the gastric irritation is significantly inhibited. Instillation of 20 mM of ASA in 100 mM HCl solution into the Heidenhain pouch of Beagle dogs produced a significant loss of H+ from the pouch and a gain of Na+ in the lumen compared with ASA-free controls. When L-glutamine (100 mM) was given concomitantly with ASA (20 mM) into the pouch, changes of electrolyte fluxes in response to ASA alone were significantly suppressed. However, 50 mM of L-glutamine had no appreciable effect on acid back diffusion caused by ASA 20 mM. The amino acid itself had little effect on the ionic movement in the pouch. Gross bleeding from the pouch treated with ASA was never observed with the concomitant dosing of ASA and L-glutamine 50 or 100 mM. PMID:15154

  4. Variability in the pharmacokinetics and pharmacodynamics of low dose aspirin in healthy male volunteers.

    Science.gov (United States)

    Benedek, I H; Joshi, A S; Pieniaszek, H J; King, S Y; Kornhauser, D M

    1995-12-01

    Data describing the pharmacokinetics and pharmacodynamics of low dose aspirin (acetylsalicylic acid; ASA) are limited. This single-center study was designed to determine the rate and extent of oral absorption of 80-mg ASA tablets in healthy, young male subjects and to assess the intra- and inter-subject variability of ASA pharmacokinetics and platelet aggregation effects. Ten subjects each received a single, open-label, oral 80-mg ASA dose on three separate days. Each dose was separated by a 2-week washout interval. Blood samples for pharmacokinetic determinations of ASA and its metabolite, salicylic acid (SA) and platelet aggregation studies were obtained at scheduled timepoints before and up to 24 hours after each dose. Peak plasma ASA levels of 1 microgram/mL were achieved within 30 minutes. Peak plasma SA levels of approximately 4 micrograms/mL were attained in 1 hour. The terminal half-lives (t1/2) of ASA and SA were 0.4 and 2.1 hours, respectively. Both ASA and SA pharmacokinetics and the platelet aggregation response to ASA exhibited considerable intra- and inter-subject variability. Inhibition of platelet aggregation was found to relate with ASA area under the plasma concentration versus time curve (AUC). PMID:8750369

  5. Prevalence of Non-Left Anterior Descending Septal Perforator Culprit in Patients With Hypertrophic Cardiomyopathy Undergoing Alcohol Septal Ablation.

    Science.gov (United States)

    Alkhouli, Mohamad; Sajjad, Waseem; Lee, Junsoo; Fernandez, Genaro; Waits, Bryan; Schwarz, Karl Q; Cove, Christopher J

    2016-05-15

    Identifying the coronary branch that supplies the basal septum is the cornerstone for successful alcohol septal ablation (ASA). The basal septum is often supplied by septal perforator artery/arteries (SPA/SPAs) not originating from the left anterior descending (LAD) coronary artery. We aim to investigate the prevalence and significance of non-LAD septal "culprit" in patients undergoing ASA. A retrospective review of patients who underwent ASA from 2006 to 2014 was conducted. Procedural and midterm outcomes of patients who had ASA of LAD and non-LAD culprit SPA were reported. A total 89 patients were included in the analysis; 13 patients (15%) had ASA of non-LAD SPA. These patients were more likely to have a history of failed ASA, more than one SPA treated, more ethanol dose injected, longer procedures, and higher contrast use compared with those who had ASA of LAD-SPA. In-hospital outcomes, residual gradient, symptom improvement, and midterm mortality were similar in the 2 groups. In conclusion, in a cohort of patients undergoing ASA, 15% had ablation of SPA culprit that did not originate from the LAD. Half of these patients had previous unsuccessful ASA. Systematic screening for the ideal culprit SPA with nonselective coronary injection of echo contrast should be used to avoid incomplete or failed ASA. PMID:27006152

  6. Accessible surface area from NMR chemical shifts

    Energy Technology Data Exchange (ETDEWEB)

    Hafsa, Noor E.; Arndt, David; Wishart, David S., E-mail: david.wishart@ualberta.ca [University of Alberta, Department of Computing Science (Canada)

    2015-07-15

    Accessible surface area (ASA) is the surface area of an atom, amino acid or biomolecule that is exposed to solvent. The calculation of a molecule’s ASA requires three-dimensional coordinate data and the use of a “rolling ball” algorithm to both define and calculate the ASA. For polymers such as proteins, the ASA for individual amino acids is closely related to the hydrophobicity of the amino acid as well as its local secondary and tertiary structure. For proteins, ASA is a structural descriptor that can often be as informative as secondary structure. Consequently there has been considerable effort over the past two decades to try to predict ASA from protein sequence data and to use ASA information (derived from chemical modification studies) as a structure constraint. Recently it has become evident that protein chemical shifts are also sensitive to ASA. Given the potential utility of ASA estimates as structural constraints for NMR we decided to explore this relationship further. Using machine learning techniques (specifically a boosted tree regression model) we developed an algorithm called “ShiftASA” that combines chemical-shift and sequence derived features to accurately estimate per-residue fractional ASA values of water-soluble proteins. This method showed a correlation coefficient between predicted and experimental values of 0.79 when evaluated on a set of 65 independent test proteins, which was an 8.2 % improvement over the next best performing (sequence-only) method. On a separate test set of 92 proteins, ShiftASA reported a mean correlation coefficient of 0.82, which was 12.3 % better than the next best performing method. ShiftASA is available as a web server ( http://shiftasa.wishartlab.com http://shiftasa.wishartlab.com ) for submitting input queries for fractional ASA calculation.

  7. Accessible surface area from NMR chemical shifts

    International Nuclear Information System (INIS)

    Accessible surface area (ASA) is the surface area of an atom, amino acid or biomolecule that is exposed to solvent. The calculation of a molecule’s ASA requires three-dimensional coordinate data and the use of a “rolling ball” algorithm to both define and calculate the ASA. For polymers such as proteins, the ASA for individual amino acids is closely related to the hydrophobicity of the amino acid as well as its local secondary and tertiary structure. For proteins, ASA is a structural descriptor that can often be as informative as secondary structure. Consequently there has been considerable effort over the past two decades to try to predict ASA from protein sequence data and to use ASA information (derived from chemical modification studies) as a structure constraint. Recently it has become evident that protein chemical shifts are also sensitive to ASA. Given the potential utility of ASA estimates as structural constraints for NMR we decided to explore this relationship further. Using machine learning techniques (specifically a boosted tree regression model) we developed an algorithm called “ShiftASA” that combines chemical-shift and sequence derived features to accurately estimate per-residue fractional ASA values of water-soluble proteins. This method showed a correlation coefficient between predicted and experimental values of 0.79 when evaluated on a set of 65 independent test proteins, which was an 8.2 % improvement over the next best performing (sequence-only) method. On a separate test set of 92 proteins, ShiftASA reported a mean correlation coefficient of 0.82, which was 12.3 % better than the next best performing method. ShiftASA is available as a web server ( http://shiftasa.wishartlab.com http://shiftasa.wishartlab.com ) for submitting input queries for fractional ASA calculation

  8. Gene expression studies in kiwifruit and gene over-expression in Arabidopsis indicates that GDP-L-galactose guanyltransferase is a major control point of vitamin C biosynthesis

    Science.gov (United States)

    Bulley, Sean M.; Rassam, Maysoon; Hoser, Dana; Otto, Wolfgang; Schünemann, Nicole; Wright, Michele; MacRae, Elspeth; Gleave, Andrew; Laing, William

    2009-01-01

    Vitamin C (L-ascorbic acid, AsA) is an essential metabolite for plants and animals. Kiwifruit (Actinidia spp.) are a rich dietary source of AsA for humans. To understand AsA biosynthesis in kiwifruit, AsA levels and the relative expression of genes putatively involved in AsA biosynthesis, regeneration, and transport were correlated by quantitative polymerase chain reaction in leaves and during fruit development in four kiwifruit genotypes (three species; A. eriantha, A. chinensis, and A. deliciosa). During fruit development, fruit AsA concentration peaked between 4 and 6 weeks after anthesis with A. eriantha having 3–16-fold higher AsA than other genotypes. The rise in AsA concentration typically occurred close to the peak in expression of the L-galactose pathway biosynthetic genes, particularly the GDP-L-galactose guanyltransferase gene. The high concentration of AsA found in the fruit of A. eriantha is probably due to higher expression of the GDP-mannose-3′,5′-epimerase and GDP-L-galactose guanyltransferase genes. Over-expression of the kiwifruit GDP-L-galactose guanyltransferase gene in Arabidopsis resulted in up to a 4-fold increase in AsA, while up to a 7-fold increase in AsA was observed in transient expression studies where both GDP-L-galactose guanyltransferase and GDP-mannose-3′,5′-epimerase genes were co-expressed. These studies show the importance of GDP-L-galactose guanyltransferase as a rate-limiting step to AsA, and demonstrate how AsA can be significantly increased in plants. PMID:19129165

  9. Comparison of five peptide vectors for improved brain delivery of the lysosomal enzyme arylsulfatase A.

    Science.gov (United States)

    Böckenhoff, Annika; Cramer, Sandra; Wölte, Philipp; Knieling, Simeon; Wohlenberg, Claudia; Gieselmann, Volkmar; Galla, Hans-Joachim; Matzner, Ulrich

    2014-02-26

    Enzyme replacement therapy (ERT) is a treatment option for lysosomal storage disorders (LSDs) caused by deficiencies of soluble lysosomal enzymes. ERT depends on receptor-mediated transport of intravenously injected recombinant enzyme to lysosomes of patient cells. The blood-brain barrier (BBB) prevents efficient transfer of therapeutic polypeptides from the blood to the brain parenchyma and thus hinders effective treatment of LSDs with CNS involvement. We compared the potential of five brain-targeting peptides to promote brain delivery of the lysosomal enzyme arylsulfatase A (ASA). Fusion proteins between ASA and the protein transduction domain of the human immunodeficiency virus TAT protein (Tat), an Angiopep peptide (Ang-2), and the receptor-binding domains of human apolipoprotein B (ApoB) and ApoE (two versions, ApoE-I and ApoE-II) were generated. All ASA fusion proteins were enzymatically active and targeted to lysosomes when added to cultured cells. In contrast to wild-type ASA, which is taken up by mannose-6-phosphate receptors, all chimeric proteins were additionally endocytosed via mannose-6-phosphate-independent routes. For ASA-Ang-2, ASA-ApoE-I, and ASA-ApoE-II, uptake was partially due to the low-density lipoprotein receptor-related protein 1. Transendothelial transfer in a BBB cell culture model was elevated for ASA-ApoB, ASA-ApoE-I, and ASA-ApoE-II. Brain delivery was, however, increased only for ASA-ApoE-II. ApoE-II was also superior to wild-type ASA in reducing lysosomal storage in the CNS of ASA-knock-out mice treated by ERT. Therefore, the ApoE-derived peptide appears useful to treat metachromatic leukodystrophy and possibly other neurological disorders more efficiently. PMID:24573272

  10. La seguridad alimentaria en Venezuela. 1. Una evaluación de los sub-objetivos suficiencia, acceso, disponibilidad y estabilidad. Período 1999-2012

    Directory of Open Access Journals (Sweden)

    Daniel Castro Aniyar

    2013-01-01

    Full Text Available Este trabajo evaluó los alcances en seguridad alimentaria del Sistema Socialista de Soberanía Alimentaria en Venezuela (SSSA desde el año 1999 hasta el 2012, a partir de los sub-objetivos suficiencia, acceso, disponibilidad y estabilidad. Para tal fin, se comparó información extraída de los discursos oficiales, de políticas públicas, de diarios de campo entre 22 emprendimientos del poder popular (sociedad civil convocada, a lo largo de ese período y de los indicadores socioeconómicos desde diferentes fuentes a nivel nacional y regional. Se concluye que, para estos sub-objetivos, mejoraron los indicadores de suficiencia, disponibilidad real, acceso de manera relativamente estable para ese período y pobreza asociada, en relación con los niveles anteriores al SSSA. De mantenerse estas condiciones, el país lograría la meta de reducir la pobreza a la mitad para el 2015 según los Objetivos de Desarrollo del Milenio de la ONU y asociados. Estos indicadores fueron desarrollados principalmente mediante estrategias de provisión, comercialización, distribución y regulación de precios. Sin embargo, tal mejoría no se acompaña de aumentos suficientes de producción y de tierras cultivadas.

  11. La seguridad alimentaria en Venezuela. 1. Una evaluación de los sub-objetivos suficiencia, acceso, disponibilidad y estabilidad. Período 1999-2012

    Directory of Open Access Journals (Sweden)

    Daniel Castro Aniyar

    2013-06-01

    Full Text Available Este trabajo evaluó los alcances en seguridad alimentaria del Sistema Socialista de Soberanía Alimentaria en Venezuela (SSSA desde el año 1999 hasta el 2012, a partir de los sub-objetivos suficiencia, acceso, disponibilidad y estabilidad. Para tal fin, se comparó información extraída de los discursos oficiales, de políticas públicas, de diarios de campo entre 22 emprendimientos del poder popular (sociedad civil convocada, a lo largo de ese período y de los indicadores socioeconómicos desde diferentes fuentes a nivel nacional y regional. Se concluye que, para estos sub-objetivos, mejoraron los indicadores de suficiencia, disponibilidad real, acceso de manera relativamente estable para ese período y pobreza asociada, en relación con los niveles anteriores al SSSA. De mantenerse estas condiciones, el país lograría la meta de reducir la pobreza a la mitad para el 2015 según los Objetivos de Desarrollo del Milenio de la ONU y asociados. Estos indicadores fueron desarrollados principalmente mediante estrategias de provisión, comercialización, distribución y regulación de precios. Sin embargo, tal mejoría no se acompaña de aumentos suficientes de producción y de tierras cultivadas.

  12. Aspirin Increases the Solubility of Cholesterol in Lipid Membranes

    Science.gov (United States)

    Alsop, Richard; Barrett, Matthew; Zheng, Sonbo; Dies, Hannah; Rheinstadter, Maikel

    2014-03-01

    Aspirin (ASA) is often prescribed for patients with high levels of cholesterol for the secondary prevention of myocardial events, a regimen known as the Low-Dose Aspirin Therapy. We have recently shown that Aspirin partitions in lipid bilayers. However, a direct interplay between ASA and cholesterol has not been investigated. Cholesterol is known to insert itself into the membrane in a dispersed state at moderate concentrations (under ~37.5%) and decrease fluidity of membranes. We prepared model lipid membranes containing varying amounts of both ASA and cholesterol molecules. The structure of the bilayers as a function of ASA and cholesterol concentration was determined using high-resolution X-ray diffraction. At cholesterol levels of more than 40mol%, immiscible cholesterol plaques formed. Adding ASA to the membranes was found to dissolve the cholesterol plaques, leading to a fluid lipid bilayer structure. We present first direct evidence for an interaction between ASA and cholesterol on the level of the cell membrane.

  13. Effect of formulation variables on in vitro release of a water-soluble drug from chitosan–sodium alginate matrix tablets

    Directory of Open Access Journals (Sweden)

    Liang Li

    2015-07-01

    Full Text Available The objective of this study is to investigate the feasibility of using chitosan–sodium alginate (CS–SA based matrix tablets for extended-release of highly water-soluble drugs by changing formulation variables. Using trimetazidine hydrochloride (TH as a water-soluble model drug, influence of dissolution medium, the amount of CS–SA, the CS:SA ratio, the type of SA, the type and amount of diluents, on in vitro drug release from CS–SA based matrix tablets were studied. Drug release kinetics and release mechanisms were elucidated. In vitro release experiments were conducted in simulated gastric fluid (SGF followed by simulated intestinal fluid (SIF. Drug release rate decreased with the increase of CS–SA amount. CS:SA ratio had only slight effect on drug release and no influence of SA type on drug release was found. On the other hand, a large amount of water-soluble diluents could modify drug release profiles. It was found that drug release kinetics showed the best fit to Higuchi equation with Fickian diffusion as the main release mechanism. In conclusion, this study demonstrated that it is possible to design extended-release tablets of water-soluble drugs using CS–SA as the matrix by optimizing formulation components, and provide better understanding about drug release from CS–SA matrix tablets.

  14. Aspirin attenuates the anti-inflammatory effects of theophylline via inhibition of cAMP production in mice with non-eosinophilic asthma

    OpenAIRE

    Moon, Hyung-Geun; Kim, You-sun; Choi, Jun-Pyo; Choi, Dong-Sic; Yoon, Chang Min; Jeon, Seong Gyu; Gho, Yong Song; Kim, Yoon-Keun

    2009-01-01

    Theophylline is commonly used to treat severe asthma and chronic obstructive pulmonary disease (COPD) characterized by non-eosinophilic inflammation. Acetyl salicylic acid (ASA) is one of the most widely used medications worldwide, but up to 20% of patients with asthma experience aggravated respiratory symptoms after taking ASA. Here we evaluated the adverse effect of ASA on the therapeutic effect of theophylline in mice with non-eosinophilic asthma. A non-eosinophilic asthma mouse model was ...

  15. Systemic hypertension in two patients with ASL deficiency: A result of nitric oxide deficiency?

    OpenAIRE

    Brunetti-Pierri, Nicola; Erez, Ayelet; Shchelochkov, Oleg; Craigen, William; Lee, Brendan

    2009-01-01

    Argininosuccinic aciduria (ASA) is an inborn error of ureagenesis which if untreated leads to hyperammonemia, accumulation of argininosuccinic acid and arginine depletion. The presence of high blood pressure in patients with ASA has been reported so far as transient in one newborn. We describe the first two patients, one child and one young adult, with ASA and persistent systemic hypertension. Extensive evaluation of both patients excluded secondary causes of systemic hypertension. The intrig...

  16. Mesalamine modulates intercellular adhesion through inhibition of p-21 activated kinase-1

    OpenAIRE

    Khare, Vineeta; Lyakhovich, Alex; Dammann, Kyle; Lang, Michaela; Borgmann, Melanie; Tichy, Boris; Pospisilova, Sarka; Luciani, Gloria; Campregher, Christoph; Evstatiev, Rayko; Pflueger, Maren; Hundsberger, Harald; Gasche, Christoph

    2013-01-01

    Mesalamine (5-ASA) is widely used for the treatment of ulcerative colitis, a remitting condition characterized by chronic inflammation of the colon. Knowledge about the molecular and cellular targets of 5-ASA is limited and a clear understanding of its activity in intestinal homeostasis and interference with neoplastic progression is lacking. We sought to identify molecular pathways interfered by 5-ASA, using CRC cell lines with different genetic background. Microarray was performed for gene ...

  17. Inhibition of Murine Systemic Leishmaniasis by Acetyl Salicylic Acid Via Nitric Oxide Immunomodulation

    OpenAIRE

    Assmar, M; Farahmand, M; M Jalalian; Nahrevanian, H; AR Esmaeili Rastaghi; Sayyah, M.

    2012-01-01

    Background: The purpose of this study was to evaluate antileishmanial effects of ASA via NO pathway in Leishmania major infected Balb/c mice. Moreover, toxicity and pathological consequences of ASA administration were investigated.Methods: Balb/c mice were infected with L. major and ASA was inoculated orally after lesion appearance for its ability to modulate NO and to modify Leishmania infection in host, in order to evaluate the effects of NO production on size and lesion macroscopy, delay o...

  18. A Novel Preparation Method for 5-Aminosalicylic Acid Loaded Eudragit S100 Nanoparticles

    OpenAIRE

    Sining Li; Yaping Zhao; Daode Hu; Wenjuan Chen; Liang Liu

    2012-01-01

    In this study, solution enhanced dispersion by supercritical fluids (SEDS) technique was applied for the preparation of 5-aminosalicylic acid (5-ASA) loaded Eudragit S100 (EU S100) nanoparticles. The effects of various process variables including pressure, temperature, 5-ASA concentration and solution flow rate on morphology, particle size, 5-ASA loading and entrapment efficiency of nanoparticles were investigated. Under the appropriate conditions, drug-loaded nanoparticles exhibited a spheri...

  19. A spectroscopic study of phenylbutazone and aspirin bound to serum albumin in rheumatoid diseases

    Science.gov (United States)

    Maciążek-Jurczyk, M.; Sułkowska, A.; Bojko, B.; Równicka-Zubik, J.; Sułkowski, W. W.

    2011-11-01

    Interaction of phenylbutazone (PBZ) and aspirin (ASA), two drugs recommended in rheumatoid diseases (RDs), when binding to human (HSA) and bovine (BSA) serum albumins, has been studied by quenching of fluorescence and proton nuclear magnetic resonance ( 1HNMR) techniques. On the basis of spectrofluorescence measurements high affinity binding sites of PBZ and ASA on albumin as well as their interaction within the binding sites were described. A low affinity binding site has been studied by proton nuclear magnetic resonance spectroscopy. Using fluorescence spectroscopy the location of binding site in serum albumin (SA) for PBZ and ASA was found. Association constants Ka were determined for binary (i.e. PBZ-SA and ASA-SA) and ternary complexes (i.e. PBZ-[ASA]-SA and ASA-[PBZ]-SA). PBZ and ASA change the affinity of each other to the binding site in serum albumin (SA). The presence of ASA causes the increase of association constants KaI of PBZ-SA complex. Similarly, PBZ influences KaI of ASA-SA complex. This phenomenon shows that the strength of binding and the stability of the complexes increase in the presence of the second drug. The decrease of KaII values suggests that the competition between PBZ and ASA in binding to serum albumin in the second class of binding sites occurs. The analysis of 1HNMR spectral parameters i.e. changes of chemical shifts and relaxation times of the drug indicate that the presence of ASA weakens the interaction of PBZ with albumin. Similarly PBZ weakens the interaction of ASA with albumin. This conclusion points to the necessity of using a monitoring therapy owning to the possible increase of uncontrolled toxic effects.

  20. A Performance Assessment of a Tactical Airborne Separation Assistance System using Realistic, Complex Traffic Flows

    Science.gov (United States)

    Smith, Jeremy C.; Neitzke, Kurt W.; Bussink, Frank J. L.

    2008-01-01

    This paper presents the results from a study that investigates the performance of aspects of an Airborne Separation Assistance System (ASAS) under varying demand levels using realistic traffic patterns. This study only addresses the tactical aspects of an ASAS using aircraft state data (latitude, longitude, altitude, heading and speed) to detect and resolve projected conflicts. The main focus of this paper is to determine the extent to which sole reliance on the proposed tactical ASAS can maintain aircraft separation at demand levels up to three times current traffic. The effect of mixing ASAS equipped aircraft with non-equipped aircraft that do not have the capability to self-separate is also investigated.

  1. Inhibition of Radiation-Induced Oxidative Damage in the Lung Tissue: May Acetylsalicylic Acid Have a Positive Role?

    Science.gov (United States)

    Demirel, Can; Kilciksiz, Sevil Cagiran; Gurgul, Serkan; Erdal, Nurten; Yigit, Seyran; Tamer, Lulufer; Ayaz, Lokman

    2016-02-01

    The lung is relatively sensitive to irradiation. It is shown that acetylsalicylic acid (ASA) might reduce oxidative injury and that it has a place in protection from cancer. The aim of this study is to evaluate the potential radioprotective effects of ASA. Whole-body irradiation (6 Gy, single dose) was applied to the rats. Glutathione (GSH), malondialdehyde (MDA), myeloperoxidase (MPO), and nitric oxide (NO) levels in the lung tissue were measured. Control (C), Radiation (R), Radiation + ASA (R + ASA; received irradiation and 25 mg/kg of ASA intraperitoneally (i.p.)), and Radiation + Amifostine (R + WR-2721; received irradiation and 200 mg/kg of WR-2721 i.p.) groups were used. The MPO levels decreased statistically significantly in the group administered ASA. Histopathologically, a radioprotective effect of ASA was more evident in the R + ASA group. ASA is an agent which has not been used as a radioprotector in the clinic yet, and it is worth supporting with more advanced studies. PMID:26276129

  2. Transcriptomic analysis reveals the metabolic mechanism of L-ascorbic acid in Ziziphus jujuba Mill.

    Directory of Open Access Journals (Sweden)

    Chunmei eZhang

    2016-02-01

    Full Text Available Chinese jujube (Ziziphus jujuba Mill. is the most economically important member of the Rhamnaceae family and contains a high concentration of ascorbic acid (AsA. To explore the metabolic mechanism of AsA accumulation, we investigated the abundance of AsA in the fruit development stages, the leaf and flower of Z. jujuba cv Junzao, and the mature fruit of one type of wild jujube (Z. jujuba var. spinosa Hu, Yanchuan sour jujube. And the expression patterns of genes involved in AsA biosynthesis, degradation and recycling were analyzed. The result showed that AsA biosynthesis during early fruit development (the enlargement stage is the main reason for jujube high accumulation. The L-galactose pathway plays a predominant role in the biosynthesis of AsA during jujube fruit development, and the genes GMP1, GME1, GGP, and GaLDH involved in the determination of AsA concentration during fruit development and in different genotypes; the myo-inositol pathway along with the genes GME2 and GMP2 in the L-galactose pathway play a compensatory role in maintaining AsA accumulation during the ripening stage. These findings enhance our understanding of the molecular mechanism in regulating AsA accumulation for jujube.

  3. Dual effects of acetylsalicylic acid on ERK signaling and Mitf transcription lead to inhibition of melanogenesis.

    Science.gov (United States)

    Nishio, Takashi; Usami, Mai; Awaji, Mizuki; Shinohara, Sumire; Sato, Kazuomi

    2016-01-01

    Acetylsalicylic acid (ASA) is widely used as an analgesic/antipyretic drug. It exhibits a wide range of biological effects, including preventative effects against heart attack and stroke, and the induction of apoptosis in various cancer cells. We previously found that ASA inhibits melanogenesis in B16 melanoma cells. However, the mechanisms of how ASA down-regulates melanin synthesis remain unclear. Here, we investigated the effect of ASA on melanogenic pathways, such as extracellular signal-regulated kinase (ERK) and microphthalmia-associated transcription factor (Mitf) transcription. ASA significantly inhibited melanin synthesis in a dose-dependent manner without oxidative stress and cell death. Semi-quantitative reverse transcription-polymerase chain reaction analysis showed that the inhibitory effect of ASA might be due to the inhibition of Mitf gene transcription. Interestingly, ASA also induced ERK phosphorylation. Additionally, treatment with PD98059, a specific ERK phosphorylation inhibitor, abolished the anti-melanogenic effect of ASA. These results suggest that the depigmenting effect of ASA results from down-regulation of Mitf, which is induced by both the induction of ERK phosphorylation and the inhibition of Mitf transcription. PMID:26699907

  4. Gene therapy of metachromatic leukodystrophy.

    Science.gov (United States)

    Matzner, Ulrich; Gieselmann, Volkmar

    2005-01-01

    Metachromatic leukodystrophy (MLD) is a lysosomal storage disease that is caused by a deficiency of arylsulfatase A (ASA). The deficiency results in the intralysosomal accumulation of the acidic sphingolipid 3-O-sulfogalactosyl-ceramide (sulfatide). Patients suffer from progressive demyelination and die from multiple neurological deficits. Curative treatment is not available. ASA bears mannose 6-phosphate residues which function as recognition markers in endosome/lysosome-specific targeting pathways. The endocytic targeting route can be exploited to deliver exogenous ASA to the lysosomes of ASA-deficient cells. ASA knockout mice, which develop a disorder related to MLD, have therefore been treated by ex vivo and in vivo gene therapy. Following transplantation of bone marrow cells overexpressing ASA from a retroviral vector, donor-type cells secrete ASA, which is endocytosed by recipient cells. The enzyme transfer results in the metabolic cross-correction of recipient cells and the improvement of biochemical, histological and clinical parameters. For the transfer of the ASA cDNA to non-dividing cells, adenovirus, adeno-associated virus and lentivirus vectors have been constructed. Such vectors might be particularly advantageous for direct ASA gene delivery to the brain, which is the main site of disease in MLD. PMID:15709909

  5. Inhibition of Murine Systemic Leishmaniasis by Acetyl Salicylic Acid Via Nitric Oxide Immunomodulation

    Directory of Open Access Journals (Sweden)

    M Assmar

    2012-06-01

    Full Text Available Background: The purpose of this study was to evaluate antileishmanial effects of ASA via NO pathway in Leishmania major infected Balb/c mice. Moreover, toxicity and pathological consequences of ASA administration were investigated.Methods: Balb/c mice were infected with L. major and ASA was inoculated orally after lesion appearance for its ability to modulate NO and to modify Leishmania infection in host, in order to evaluate the effects of NO production on size and lesion macroscopy, delay of lesion formation and proliferation of amasti­gotes inside macrophages. Liver, spleen, and lymph nodes were also studied as target organs to detect amastigotes. In addition, plasma was investigated for NO induction using Griess microassay.Results: ASA increased NO production in plasma of both naïve and Leishmania test groups at the ultimate of the experimental period. A decline was observed in proliferation of amastigotes inside macrophages of test group when compared with control one. ASA reduced lesion size, inhibited Leishma­nia visceralisation in spleen, lymph node, and decreased hepato/splenomegaly in ASA treated animals.Conclusions: Some antileishmanial effects of ASA by NO-modulation were indicated during systemic leishmaniasis in mice. Despite slight effects on lesion size, ASA decreased parasite visceralization in target organs and declined their proliferation inside macrophages. Therefore, ASA may be indicated to inhibit systemic leishmaniasis via NO pathway in mice model.

  6. Sexual revictimization in a clinical sample of women reporting childhood sexual abuse

    DEFF Research Database (Denmark)

    Lau, Marianne; Kristensen, Ellids

    2010-01-01

    BACKGROUND: Child and adolescent sexual abuse (CSA) increases the risk for adult sexual assault (ASA), and psychological vulnerability as well as aspects of CSA and upbringing might influence the risk. AIMS: The aims of this study were to investigate whether women who reported both CSA and ASA: 1......: The results showed an increased psychological vulnerability among women with ASA, but whether the results are cause or effect of sexual revictimization or can be generalized to other clinical samples are not clear. Interventions targeting the increased risk of ASA should be developed, implemented and tested...

  7. Effects of very low versus standard dose acetyl salicylic acid, dipyridamole and sulfinpyrazone on platelet function and thromboxane formation in man.

    Science.gov (United States)

    Lorenz, R; Siess, W; Weber, P C

    1981-04-01

    The effects of three conventional antiplatelet regimes, dipyridamole 3 X 75 mg/day (D), sulfinpyrazone 4 X 200 mg/day (S), acetylsalicylic acid 3 X 330 mg/day combined with dipyridamole 3 X 75 mg/day (ASA + D), and very low dose acetylsalicylic acid 100 mg/day (ASA) on platelet function were studied in man following 4 days of treatment. D and S slightly increased mean minimal ADP concentration for irreversible aggregation (n.s.), S reduced aggregation and thromboxane (TXB2) formation on low dose collagen (2P less than or equal to 0.05), ASA and ASA + D increased platelet count (2P less than or equal to 0.05), increased bleeding time (n.s. for ASA, 2P less than or equal to 0.05 for ASA + D), abolished irreversible aggregation on ADP, suppressed TXB2 formation on all (2P less than or equal to 0.001) and aggregation on lower concentrations of collagen (2P less than or equal to 0.01) and abolished aggregation and TXB2 formation on arachidonic acid (2P less than or equal to 0.001). Very low dose ASA suppresses platelet aggregation and TXB2 formation on several stimuli of possible physiologic significance. In the light of a recently proposed critical balance of vascular antiaggregatory prostacyclin and platelet proaggregatory TXA2 very low dose ASA might offer advantages over conventional dosage of ASA and should be evaluated in thromboembolic disorders. PMID:7238575

  8. Nitric Oxide-Releasing Aspirin Suppresses NF-κB Signaling in Estrogen Receptor Negative Breast Cancer Cells in Vitro and in Vivo

    Directory of Open Access Journals (Sweden)

    Niharika Nath

    2015-07-01

    Full Text Available Estrogen receptor negative (ER(− breast cancer is aggressive, responds poorly to current treatments and has a poor prognosis. The NF-κB signaling pathway is implicated in ER(− tumorigenesis. Aspirin (ASA is chemopreventive against ER(+ but not for ER(− breast cancers. Nitric oxide-releasing aspirin (NO-ASA is a safer ASA where ASA is linked to an NO-releasing moiety through a spacer. In vitro, we investigated anti-proliferation effects of NO-ASA (para- and meta-isomers against ER(− breast cancer cells MDA-MB-231 and SK-BR-23, effects on NF-κB signaling, and reactive oxygen species by standard techniques. In vivo, effects of NO-ASA were evaluated in a mouse xenograft model using MDA-MB-231 cells. p-NO-ASA inhibited the growth of MDA-MB-231 and SK-BR-3 cells at 24 h, the respective IC50s were 13 ± 2 and 17 ± 2 μM; ASA had an IC50 of >3000 μM in both cell lines. The IC50s for m-NO-ASA in MDA-MB-231 and SK-BR-3 were 173 ± 15 and 185 ± 12 μM, respectively, therefore, implying p-NO-ASA as a stronger inhibitor of growth p-NO-ASA reduced cell growth by inhibiting proliferation, inducing apoptosis and causing G0/G1 cell cycle block. Activation of NF-κB was inhibited by both isomers as demonstrated by decreases in NF-κB-DNA binding and luciferase activity at 24 h, However, m-NO-ASA produced transient effects at 3 h such as increased NF-κB-DNA-binding, increased levels of nuclear p50, even though both isomers inhibited IκB degradation. Increase in nuclear p50 by m-NO-ASA was associated with translocation of p50 in to the nucleus as observed by immunoflouresence at 3 h. NO-ASA induced reactive oxygen species (ROS as evidenced by overall increases in both H2DCFDA (2′,7′-dichlorodihydrofluorescein and DHE (dihydroethidium-derived fluorescence. Inhibition of ROS by N-acetyl-cysteine reversed the m-NO-ASA-mediated translocation of p50 in to the nucleus. In xenografts, p-NO-ASA inhibited tumor growth by inhibiting proliferation (PCNA and

  9. Colon-specific drug delivery systems based on cyclodextrin prodrugs: In vivo evaluation of 5-aminosalicylic acid from its cyclodextrin conjugates

    Institute of Scientific and Technical Information of China (English)

    Mei-Juan Zou; Gang Cheng; Hirokazu Okamoto; Xiu-Hua Hao; Feng An; Fu-De Cui; Kazumi Danjo

    2005-01-01

    AIM: To investigate the release of cyclodextrin-5-amino salicylic acid (CyD-5-ASA) in cecum and colon.METHODS: An anti-inflammatory drug 5-ASA was conjugated onto the hydroxyl groups of α-, β- and γ-cyclodextrins (CyDs) through an ester linkage, and the in vivo drug release behavior of these prodrugs in rat' s gastrointestinal tract after the oral administration was investigated.RESULTS: The 5-ASA concentration in the rat's stomach and small intestine after the oral administration of CyD5-ASA conjugate was much lower than that after the oral administration of 5-ASA alone. The lower concentration was attributable to the passage of the conjugate throughthe stomach and small intestine without significant degradation or absorption, followed by the degradation of the conjugate site-specific in the cecum and colon. The oral administration of CyD-5-ASA resulted in lower plasma and urine concentration of 5-ASA than that of 5-ASA alone.CONCLUSION: CyD-5-ASA conjugates may be used as prodrugs for colon-specific drug delivery system.

  10. The monitoring of antiaggregation effect of acetylsalicylic acid therapy by measuring serum thromboxane B2 in patients with coronary artery bypass grafting.

    Science.gov (United States)

    Klasic, Anita; Lakusic, Nenad; Gaspar, Ludovit; Kruzliak, Peter

    2016-06-01

    Cardiovascular patients take acetylsalicylic acid (ASA) for preventing myocardial infarction and other thromboembolic complications. It is already known that in some patients this therapy is not effective. The aim of this study was to assess the percentage of ASA resistance on the sample of patients with coronary artery bypass grafting. Our study included 105 patients with coronary artery bypass grafting treated with ASA 150 mg/day or lesser. Platelet aggregation was measured by serum thromboxane B2 level as well as impedance aggregometry from whole blood to determine ASA antiaggregation effect. The percentage of ASA resistance was 41.9% with impedance aggregometry, and after determining the serum thromboxane B2 level this percentage was only 8.6%. The correlation between these two methods was weak (r = 0.443; P < 0.0001). Thromboembolic complications still occur in ASA-treated patients because some patients are resistant to ASA therapy. It would be useful to monitor the effectiveness of ASA therapy and give another antiaggregation drug to these patients to reduce adverse events. The problem is which test is ideal because different tests show different percentages of ASA resistance. PMID:26575493

  11. Kinetics, intermediates and acute toxicity of arsanilic acid photolysis.

    Science.gov (United States)

    Zhu, Xiang-Dong; Wang, Yu-Jun; Liu, Cun; Qin, Wen-Xiu; Zhou, Dong-Mei

    2014-07-01

    Arsanilic acid (4-amino phenyl arsenic acid, ASA) is widely used in poultry production as feed additives, while most of ASA in the feed is excreted in the animal manure and released into the environment. However, the environmental behaviors of ASA were not well understood. In the present study, the photolysis behaviors of ASA and the toxicity of its metabolites to luminescent bacterium were studied. The results showed that ASA could be photodegraded and this process was strongly affected by solution pH, humic acid and dissolved oxygen. Upon UV irradiation for 360 min, ASA could be completely eliminated, but the reduction of total organic carbon (TOC) was not significant. In addition, NH4(+) ions and inorganic arsenic including arsenite and arsenate were identified as the predominant end-products. The conversion of ASA included both direct and indirect photolysis involving radicals, and its possible photolysis pathways were proposed on the basis of the identified intermediates. Unfortunately, higher adverse effects of the conversion products of ASA on bacteria were observed during the photolysis reaction. The results of present study might be helpful for assessing the environmental persistence and risks of ASA. PMID:24405966

  12. Implications of Altered Glutathione Metabolism in Aspirin-Induced Oxidative Stress and Mitochondrial Dysfunction in HepG2 Cells

    OpenAIRE

    Raza, Haider; John, Annie

    2012-01-01

    We have previously reported that acetylsalicylic acid (aspirin, ASA) induces cell cycle arrest, oxidative stress and mitochondrial dysfunction in HepG2 cells. In the present study, we have further elucidated that altered glutathione (GSH)-redox metabolism in HepG2 cells play a critical role in ASA-induced cytotoxicity. Using selected doses and time point for ASA toxicity, we have demonstrated that when GSH synthesis is inhibited in HepG2 cells by buthionine sulfoximine (BSO), prior to ASA tre...

  13. Inhibitory Effect of Flavonoids on the Efflux of -Acetyl 5-Aminosalicylic Acid Intracellularly Formed in Caco-2 Cells

    Directory of Open Access Journals (Sweden)

    Shin Yoshimura

    2009-01-01

    Full Text Available -acetyl 5-aminosalicylic acid (5-AcASA that was intracellularly formed from 5-aminosalicylic acid (5-ASA at 200 M was discharged 5.3, 7.1, and 8.1-fold higher into the apical site than into the basolateral site during 1, 2, and 4-hour incubations, respectively, in Caco-2 cells grown in Transwells. The addition of flavonols (100 M such as fisetin and quercetin with 5-ASA remarkably decreased the apically directed efflux of 5-AcASA. When 5-ASA (200 M was added to Caco-2 cells grown in tissue culture dishes, the formation of 5-AcASA decreased, and, in addition, the formed 5-AcASA was found to be accumulated within the cells in the presence of such flavonols. Thus, the decrease in 5-AcASA efflux by such flavonols was attributed not only to the inhibition of -acetyl-conjugation of 5-ASA but to the predominant cellular accumulation of 5-AcASA. Various flavonoids also had both of the effects with potencies that depend on their specific structures. The essential structure of flavonoids was an absence of a hydroxyl substitution at the C5 position on the A-ring of flavone structure for the inhibitory effect on the -acetyl-conjugation of 5-ASA, and a presence of hydroxyl substitutions at the C3 or C4 position on the B-ring of flavone structure for the promoting effect on the cellular accumulation of 5-AcASA. Both the decrease in 5-AcASA apical efflux and the increase in 5-AcASA cellular accumulation were also caused by MK571 and indomethacin, inhibitors of MRPs, but not by quinidine, cyclosporin A, P-glycoprotein inhibitors, and mitoxantrone, a BCRP substrate. These results suggest that certain flavonoids suppress the apical efflux of 5-AcASA possibly by inhibiting MRPs pumps located on apical membranes in Caco-2 cells.

  14. Ascorbic acid is a key participant during the interactions between chloroplasts and mitochondria to optimize photosynthesis and protect against photoinhibition

    Indian Academy of Sciences (India)

    Saikrishna Talla; Khateef Riazunnisa; Lolla Padmavathi; Pidakala Rajsheel; Agepati S Raghavendra

    2011-03-01

    The possible role of L-ascorbate (AsA) as a biochemical signal during the interactions between photosynthesis and respiration was examined in leaf discs of Arabidopsis thaliana. AsA content was either decreased as in AsA-deficient vtc1 mutants or increased by treatment with L-galactono-1, 4-lactone (L-GalL, a precursor of AsA; EC 1.3.2.3). In mutants, photosynthesis was extremely sensitive to both antimycin A (inhibitor of the cytochrome oxidase pathway [COX pathway]) and salicylhydroxamic acid (SHAM, inhibitor of the alternative pathway [AOX pathway]), particularly at high light conditions. Mitochondrial inhibitors lowered the ratio of reduced AsA to total AsA, at high light, indicating oxidative stress in leaf discs. Elevation of AsA by L-GalL decreased the sensitivity of photosynthesis at high light to antimycin A or SHAM, sustained photosynthesis at supraoptimal light and relieved the extent of photoinhibition. High ratios of reduced AsA to total AsA in L-GalL-treated leaf discs suggests that L-GalL lowers oxidative stress. The protection by L-GalL of photosynthesis against the mitochondrial inhibitors and photoinhibition was quite pronounced in vtc1 mutants. Our results suggest that the levels and redox state of AsA modify the pattern of modulation of photosynthesis by mitochondrial metabolism. The extent of the AOX pathway as a percentage of the total respiration in Arabidopsis mesophyll protoplasts was much higher in vtc1 than in wild type. We suggest that the role of AsA becomes pronounced at high light and/or when the AOX pathway is inhibited. While acknowledging the importance of the COX pathway, we hypothesize that AsA and the AOX pathway may complement each other to protect photosynthesis against photoinhibition.

  15. Synthesis of L-ascorbic acid in the phloem

    Directory of Open Access Journals (Sweden)

    Haupt Sophie

    2003-11-01

    Full Text Available Abstract Background Although plants are the main source of vitamin C in the human diet, we still have a limited understanding of how plants synthesise L-ascorbic acid (AsA and what regulates its concentration in different plant tissues. In particular, the enormous variability in the vitamin C content of storage organs from different plants remains unexplained. Possible sources of AsA in plant storage organs include in situ synthesis and long-distance transport of AsA synthesised in other tissues via the phloem. In this paper we examine a third possibility, that of synthesis within the phloem. Results We provide evidence for the presence of AsA in the phloem sap of a wide range of crop species using aphid stylectomy and histochemical approaches. The activity of almost all the enzymes of the primary AsA biosynthetic pathway were detected in phloem-rich vascular exudates from Cucurbita pepo fruits and AsA biosynthesis was demonstrated in isolated phloem strands from Apium graveolens petioles incubated with a range of precursors (D-glucose, D-mannose, L-galactose and L-galactono-1,4-lactone. Phloem uptake of D-[U-14C]mannose and L-[1-14C]galactose (intermediates of the AsA biosynthetic pathway as well as L-[1-14C]AsA and L-[1-14C]DHA, was observed in Nicotiana benthamiana leaf discs. Conclusions We present the novel finding that active AsA biosynthesis occurs in the phloem. This process must now be considered in the context of mechanisms implicated in whole plant AsA distribution. This work should provoke studies aimed at elucidation of the in vivo substrates for phloem AsA biosynthesis and its contribution to AsA accumulation in plant storage organs.

  16. Secretion of phosphomannosyl-deficient arylsulphatase A and cathepsin D from isolated human macrophages.

    Science.gov (United States)

    Muschol, Nicole; Matzner, Ulrich; Tiede, Stephan; Gieselmann, Volkmar; Ullrich, Kurt; Braulke, Thomas

    2002-12-15

    The transfer of macrophage-secreted arylsulphatase A (ASA) to enzyme-deficient brain cells is part of the therapeutic concept of bone marrow transplantation in lysosomal storage diseases. Here we have investigated this transfer in vitro. The uptake of (125)I-labelled recombinant human ASA purified from ASA-overexpressing mouse embryonic fibroblasts deficient for mannose 6-phosphate (M6P) receptors in a mouse ASA-deficient astroglial cell line was completely inhibited by M6P. In contrast, when ASA-deficient astroglial cells were incubated with secretions of [(35)S]methionine-labelled human macrophages or mouse microglia, containing various lysosomal enzymes, neither ASA nor cathepsin D (CTSD) were detected in acceptor cells. Co-culturing of metabolically labelled macrophages with ASA-deficient glial cells did not result in an M6P-dependent transfer of ASA or CTSD between these two cell types. In secretions of [(33)P]phosphate-labelled macrophages no or weakly phosphorylated ASA and CTSD precursor polypeptides were found, whereas both intracellular and secreted ASA from ASA-overexpressing baby hamster kidney cells displayed (33)P-labelled M6P residues. Finally, the uptake of CTSD from secretions of [(35)S]methionine-labelled macrophages in rat hepatocytes was M6P-independent. These data indicated that lysosomal enzymes secreted by human macrophages or a mouse microglial cell line cannot be endocytosed by brain cells due to the failure to equip newly synthesized lysosomal enzymes with the M6P recognition marker efficiently. The data suggest that other mechanisms than the proposed M6P-dependent secretion/recapture of lysosomal enzymes might be responsible for therapeutic effects of bone marrow transplantation in the brain. PMID:12296771

  17. Simultaneous extraction of acetylsalicylic acid and salicylic acid from human plasma and simultaneous estimation by liquid chromatography and atmospheric pressure chemical ionization/tandem mass spectrometry detection. Application to a pharmacokinetic study.

    Science.gov (United States)

    Nirogi, Ramakrishna; Kandikere, Vishwottam; Mudigonda, Koteshwara; Ajjala, Devender; Suraneni, Ramakrishna; Thoddi, Parthasarathi

    2011-01-01

    A simple analytical method using liquid chromatography-tandem mass spectrometry (LC-MS/MS) in atmospheric chemical ionization mode (APCI) for the simultaneous estimation of acetylsalicylic acid (ASA, CAS 50-78-2) and its active metabolite salicylic acid (SA, CAS 69-72-7) in human plasma has been developed and validated. ASA and SA were analyzed simultaneously despite differences in plasma concentration ranges of ASA and SA after oral administration of ASA. In spite of having different chemical, ionization and chromatographic properties, ASA and SA were extracted simultaneously from the plasma sample using acetonitrile protein precipitation followed by liquid-liquid extraction. The analytes were separated on a reversed phase column with rapid gradient program using mobile phase consisting of ammonium acetate buffer and methanol. The structural analogue diclofenac was used as an internal standard. The multiple reaction monitoring (MRM) transitions m/z 179 --> 137 for ASA, m/z 137 --> 65 for SA and m/z 294 --> 250 for IS were used. The assay exhibited a linear dynamic range of 0.02-10 microg/mL for ASA and 0.1-50 microg/mL for SA. The between-batch precision (%CV) ranged from 2.1 to 7.9% for ASA and from 0.2 to 5.2% for SA. The between-batch accuracy ranged from 95.4 to 96.7% for ASA and from 94.6 to 111.3% for SA. The validated method was successfully applied for the evaluation of pharmacokinetics of ASA after single oral administration of 650 mg test formulation versus two 325 mg reference formulations of ASA in human subjects. PMID:21755814

  18. Effect of Erythropoietin Carried by Stearic Acid-Grafted Chitosan Micelle on Epilepsy Seizure in Mice%促红细胞生成素胶束给药系统对小鼠癫痫的影响

    Institute of Scientific and Technical Information of China (English)

    曹高扬; 胡薇薇; 俞栋栋; 于亚赛; 谢贻珽; 袁弘; 陆源; 厉旭云; 戴海斌; 陈忠

    2013-01-01

    探讨载促红细胞生成素的壳聚糖-硬脂酸(CS-SA)胶束给药系统对戊四唑诱导的小鼠癫痫的影响.小鼠给予载人重组促红细胞生成素的壳聚糖-硬脂酸(r-HuEPO-CS-SA)胶束制剂和r-HuEPO普通制剂24 h后,观察对戊四唑(PTZ)诱导的急性癫痫模型中发作潜伏时间、发作级别、大发作持续时间以及次数的影响.此外,小鼠隔天注射r-HuEPO-CS-SA胶束制剂和普通制剂,观察对PTZ诱导的癫痫形成过程的影响.结果:在PTZ急性模型中,给予r-HuEPO普通制剂仅4 000 IU/kg剂量组在降低发作级别、减少大发作持续时间和减少发作次数方面有显著差异(P<0.05).而给予r-HuEPO-CSCS-SA胶束制剂2 000 IU/kg就可显著增加潜伏时间,降低大发作持续时间(P<0.05).并且给予r-HuEPO-CS-SA胶束制剂4 000 IU/kg、8 000 IU/kg,在延长潜伏时间、降低发作级别、减少大发作持续时间和减少发作次数方面均有显著差异(P<0.05).但在慢性癫痫点燃过程中,给予r-HuEPO-CS-SA胶束制剂和普通制剂均不能缓解癫痫形成的进程.本研究表明r-HuEPO-CS-SA胶束制剂可以显著缓解PTZ诱导的急性癫痫发作,作用较r-HuEPO普通制剂更明显,但对于PTZ诱导的癫痫形成过程无明显作用,提示载促红细胞生成素的CS-SA胶束给药系统有望更好的用于防治癫痫发作.%To study the effect of erythropoietin carried by stearic acid-grafted chitosan ( CS-SA) micelle on pentylenetetrazol (PTZ)-induced seizure in mice, in PTZ induced acute seizure model, the seizure latency, stage, seizure duration, and number of convulsive episodes were recorded at 24 h after administration of r-HuEPO ( recombinant human erythropoietin) carried by CS-SA micelle or r-HuEPO common formulation. The development of PTZ-induced kindling was examined after administration of r-HuEPO carried by CS-SA micelle or r-HuEPO common formulation every other day. The results showed that the administration of r

  19. Low risk of pelvic sepsis after intersphincteric proctectomy in patients with low rectal cancer

    DEFF Research Database (Denmark)

    Eriksen, Marianne H.; Maina, Pierre; Jensen, Kenneth Højsgaard

    2014-01-01

    (28%), ASA 2 (60%), and ASA 3 (12%); their tumour-node-metastasis (TNM) staging was TNM: ≤ T2 (30%), T3 (50%), and T4 (20%); and 26% had received neoadjuvant radiotherapy, whereas 40% had received chemotherapy. A total of three patients (6%) developed a post-operative pelvic sepsis. The median length...

  20. 32 CFR Appendix F to Part 651 - Glossary

    Science.gov (United States)

    2010-07-01

    .... ASA(AL&T) Assistant Secretary of the Army (Acquisition, Logistics, and Technology). ASA(FM) Assistant... Environmental Response Compensation and Liability Act. CDNL C-Weighted Day-Night Levels. CFR Code of Federal.../Cost Analysis. EICS Environmental Impact Computer System. EIFS Economic Impact Forecast System....

  1. Ascorbic acid prevents acetaminophen-induced hepatotoxicity in mice by ameliorating glutathione recovery and autophagy.

    Science.gov (United States)

    Kurahashi, Toshihiro; Lee, Jaeyong; Nabeshima, Atsunori; Homma, Takujiro; Kang, Eun Sil; Saito, Yuka; Yamada, Sohsuke; Nakayama, Toshiyuki; Yamada, Ken-Ichi; Miyata, Satoshi; Fujii, Junichi

    2016-08-15

    Aldehyde reductase (AKR1A) plays a role in the biosynthesis of ascorbic acid (AsA), and AKR1A-deficient mice produce about 10-15% of the AsA that is produced by wild-type mice. We found that acetaminophen (AAP) hepatotoxicity was aggravated in AKR1A-deficient mice. The pre-administration of AsA in the drinking water markedly ameliorated the AAP hepatotoxicity in the AKR1A-deficient mice. Treatment of the mice with AAP decreased both glutathione and AsA levels in the liver in the early phase after AAP administration, and an AsA deficiency delayed the recovery of the glutathione content in the healing phase. While in cysteine supply systems; a neutral amino acid transporter ASCT1, a cystine transporter xCT, enzymes for the transsulfuration pathway, and autophagy markers, were all elevated in the liver as the result of the AAP treatment, the AsA deficiency suppressed their induction. Thus, AsA appeared to exert a protective effect against AAP hepatotoxicity by ameliorating the supply of cysteine that is available for glutathione synthesis as a whole. Because some drugs produce reactive oxygen species, resulting in the consumption of glutathione during the metabolic process, the intake of sufficient amounts of AsA would be beneficial for protecting against the hepatic damage caused by such drugs. PMID:27288086

  2. 29 CFR 1910.6 - Incorporation by reference.

    Science.gov (United States)

    2010-07-01

    ...(a) and 1 CFR part 51. (4) Copies of standards listed in this section and issued by private standards... (ASAE), 2950 Niles Road, Post Office Box 229, St. Joseph, MI 49085: (1) ASAE Emblem for Identifying Slow... Plastic Sheeting and Cellular Plastics, IBR approved for § 1910.103(c)(1)(v)(d). (19) ASTM D...

  3. Regulation of ascorbic acid biosynthesis and recycling during root development in carrot (Daucus carota L.).

    Science.gov (United States)

    Wang, Guang-Long; Xu, Zhi-Sheng; Wang, Feng; Li, Meng-Yao; Tan, Guo-Fei; Xiong, Ai-Sheng

    2015-09-01

    Ascorbic acid (AsA), also known as vitamin C, is an essential nutrient in fruits and vegetables. The fleshy root of carrot (Daucus carota L.) is a good source of AsA for humans. However, the metabolic pathways and molecular mechanisms involved in the control of AsA content during root development in carrot have not been elucidated. To gain insights into the regulation of AsA accumulation and to identify the key genes involved in the AsA metabolism, we cloned and analyzed the expression of 21 related genes during carrot root development. The results indicate that AsA accumulation in the carrot root is regulated by intricate pathways, of which the l-galactose pathway may be the major pathway for AsA biosynthesis. Transcript levels of the genes encoding l-galactose-1-phosphate phosphatase and l-galactono-1,4-lactone dehydrogenase were strongly correlated with AsA levels during root development. Data from this research may be used to assist breeding for improved nutrition, quality, and stress tolerance in carrots. PMID:25956452

  4. Regulation of ascorbic acid metabolism by blue LED light irradiation in citrus juice sacs.

    Science.gov (United States)

    Zhang, Lancui; Ma, Gang; Yamawaki, Kazuki; Ikoma, Yoshinori; Matsumoto, Hikaru; Yoshioka, Terutaka; Ohta, Satoshi; Kato, Masaya

    2015-04-01

    In the present study, the effects of red and blue LED lights on the accumulation of ascorbic acid (AsA) were investigated in the juice sacs of three citrus varieties, Satsuma mandarin, Valencia orange, and Lisbon lemon. The results showed that the blue LED light treatment effectively increased the AsA content in the juice sacs of the three citrus varieties, whereas the red LED light treatment did not. By increasing the blue LED light intensity, the juice sacs of the three citrus varieties accumulated more AsA. Moreover, continuous irradiation with blue LED light was more effective than pulsed irradiation for increasing the AsA content in the juice sacs of the three citrus varieties. Gene expression results showed that the modulation of AsA accumulation by blue LED light was highly regulated at the transcription level. The up-regulation of AsA biosynthetic genes (CitVTC1, CitVTC2, CitVTC4, and CitGLDH), AsA regeneration genes (CitMDAR1, CitMDAR2, and CitDHAR) and two GSH-producing genes (CitGR and CitchGR) contributed to these increases in the AsA content in the three citrus varieties. PMID:25711821

  5. ANTISPERM ANTIBODY IS A POSSIBLE CAUSE OF SPONTANEOUS ABORTION

    Institute of Scientific and Technical Information of China (English)

    XUChong; CHENFu; LIULi; ZHAOFei-Sha

    1989-01-01

    To clarify the possible correlation between antisperm antibodies (ASA) and spontaneous abortion, 68 women, aged 23-37, experienced 2-9 times of spontaneous abortion were tested for ASA by ELISA. 38 fertile women, aged 24-40, without history of abortion were employed as control.

  6. Non-inhibitory antibodies impede lysosomal storage reduction during enzyme replacement therapy of a lysosomal storage disease.

    Science.gov (United States)

    Matzner, Ulrich; Matthes, Frank; Weigelt, Cecilia; Andersson, Claes; Eistrup, Carl; Fogh, Jens; Gieselmann, Volkmar

    2008-04-01

    Enzyme replacement therapy is a treatment option for several lysosomal storage disorders. We reported previously that treatment of a knockout mouse model of the sphingolipid storage disease metachromatic leukodystrophy (MLD) by intravenous injection of recombinant human arylsulfatase A (rhASA) reduces sulfatide storage and improves nervous system pathology and function. Here, we show that treated mice can develop anti-rhASA antibodies, which impede sulfatide clearance without inhibiting enzyme activity. The neutralizing effect of antibodies was reproduced in cell culture models of MLD by demonstrating that mouse immune serum reduces the ability of rhASA to clear sulfatide from cultured ASA-deficient Schwann and kidney cells. We show that reduced clearance is due to an antibody-mediated blockade of mannose 6-phosphate receptor-dependent enzyme uptake, retargeting of rhASA from sulfatide-storing cells to macrophages, intracellular misrouting of rhASA, and reduction of enzyme stability. Induction of immunotolerance to rhASA by transgenic expression of an active site mutant of human ASA restores sulfatide clearance in mice. The data indicate that the influence of non-inhibitory antibodies must be more intensively considered in evaluating the therapeutic efficacy of enzyme replacement in lysosomal storage disorders in general and in patients without cross-reacting material specifically. PMID:18360747

  7. Academic help seeking, social academic self-efficacy and class-related emotions in university students

    OpenAIRE

    Sánchez Rosas, Javier

    2013-01-01

    A cross-sectional study examined whether (a) are there relations between academic help-seeking (BAA), social academic self-efficacy (ASA) and achievement emotions in a sample of university students (N = 433) and (b) are there gender differences across the studied variables (N=180). Partial correlations between ASA with enjoyment, hope, anxiety and shame were found (r=.19, .12, -.13, -.38; p

  8. Laparoscopic partial nephrectomy for endophytic hilar tumors

    DEFF Research Database (Denmark)

    Di Pierro, G B; Tartaglia, N; Aresu, L; Polara, A; Cielo, A; Cristini, C; Grande, P; Gentile, V; Grosso, G

    2014-01-01

    To analyze feasibility and outcomes of laparoscopic partial nephrectomy (LPN) for endophytic hilar tumors in low-intermediate (ASA I-II) risk patients.......To analyze feasibility and outcomes of laparoscopic partial nephrectomy (LPN) for endophytic hilar tumors in low-intermediate (ASA I-II) risk patients....

  9. Long-term clinical outcome after alcohol septal ablation for obstructive hypertrophic cardiomyopathy

    DEFF Research Database (Denmark)

    Veselka, Josef; Jensen, Morten Kvistholm; Liebregts, Max;

    2016-01-01

    AIMS: The first cases of alcohol septal ablation (ASA) for obstructive hypertrophic cardiomyopathy (HCM) were published two decades ago. Although the outcomes of single-centre and national ASA registries have been published, the long-term survival and clinical outcome of the procedure are still...

  10. Low-dose aspirin and rupture of abdominal aortic aneurysm

    DEFF Research Database (Denmark)

    Wemmelund, Holger; Jørgensen, Trine M M; Høgh, Annette;

    2016-01-01

    OBJECTIVE: The use of low-dose aspirin (acetylsalicylic acid [ASA]) has been suggested to attenuate growth of abdominal aortic aneurysms (AAAs), yet solid clinical evidence of this hypothesis is still missing. This study aimed to investigate whether preadmission ASA use influenced the risk of...

  11. Atrioventricular conduction after alcohol septal ablation for obstructive hypertrophic cardiomyopathy

    DEFF Research Database (Denmark)

    Axelsson, Anna; Weibring, Kristina; Havndrup, Ole;

    2014-01-01

    AIMS: Lesion of the atrioventricular conduction system is a well known adverse effect of alcohol septal ablation (ASA) in patients with obstructive hypertrophic cardiomyopathy (HCM). We assessed the atrioventricular conduction at long-term follow-up after ASA. METHODS: In patients with a pacemaker...

  12. SUBSTITUTION OF HIGH-YIELD-PULP FOR HARDWOOD BLEACHED KRAFT PULP IN PAPER PRODUCTION AND ITS EFFECT ON ALKENYL SUCCINIC ANHYDRIDE SIZING

    Directory of Open Access Journals (Sweden)

    Qijie Chen,

    2012-02-01

    Full Text Available In recent years there has been an increasing interest in using high-yield pulp (HYP as a partial replacement for hardwood bleached kraft pulp (HWBKP in the production of high-quality fine papers as a cost-effective way of improving the product performance. This study investigated the substitution of HYP for HWBKP and its effect on the Alkenyl Succinic Anhydride (ASA sizing performance. The results showed that the substitution of an aspen HYP for HWBKP can increase the ASA sizing performance at a HYP substitution as high as 15 to 20%. The ASA addition sequence has an influence on the ASA sizing performance and first adding ASA to the HYP followed by mixing with kraft pulps was the preferred method. Using precipitated calcium carbonate (PCC as a paper filler at a dosage of less than 20% can increase the ASA sizing performance due to the contribution of the calcium soap of the hydrolysed ASA. A PCC dosage greater than 20% resulted in a negative impact on the sizing performance. It was also found that different PCC loading sequences can also affect the ASA sizing performance.

  13. Direct toxicity of nonsteroidal antiinflammatory drugs for renal medullary cells

    OpenAIRE

    Rocha, Gerson M.; Michea, Luis F.; Peters, Eugenia M.; Kirby, Martha; Xu, Yuhui; Ferguson, Douglas R.; Burg, Maurice B.

    2001-01-01

    Antipyretic analgesics, taken in large doses over a prolonged period, cause a specific form of kidney disease, characterized by papillary necrosis and interstitial scarring. Epidemiological evidence incriminated mixtures of drugs including aspirin (ASA), phenacetin, and caffeine. The mechanism of toxicity is unclear. We tested the effects of ASA, acetaminophen (APAF, the active metabolite of phenacetin), caffeine, and other related drugs individually and in combination...

  14. PREVENTION OF THROMBOSES IN ANTIPHOSPHOLIPID SYNDROME

    Directory of Open Access Journals (Sweden)

    Lyubov Valeryevna Kondratyeva

    2009-09-01

    Patients with antiphospholipid (aPL antibodies and venous thromboses need long-term moderate-intensity warfarin therapy. Patients with ischemic strokes without other indications for the use of anticoagulants may be given either warfarin or ASA. In the latter case, there is no need for laboratory control or an individual dose adjustment. The primary prevention of thromboses in the presence of aPL is also performed with ASA. When pregnancy occurs, women with obstetric manifestations of APS may be given small-dose ASA in combination with heparins. To reduce the risk of hemorrhages, warfarin dosage adjustment is initiated with the minimum doses (<5 mg/day. Novel ASA formulations, such as ASA with the unabsorbed antacid magnesium hydroxide, have been developed to prevent gastrointestinal tract complications.

  15. Synthesis and structural elucidation of glutathione and N-aceyl-cysteine conjugates of 5-aminosalicylic acid

    DEFF Research Database (Denmark)

    Jensen, J.; Cornett, Claus; Olsen, C. E.;

    1993-01-01

    The ability of 5-aminosalicylic acid (5-ASA) to be oxidized to a quinone monoimine compound capable of conjugating with nucleophilic compounds such as N-acetyl-cysteine (NAC) and glutathione (GSH) has been investigated in vitro. Three isomeric conjugates of 5-ASA and NAC as well as three isomeric...... conjugates of 5-ASA and GSH were found to be formed. 5-ASA was initially oxidized by PbO2 in a solution of TRIS-HCl buffer pH 9.3 followed by the in situ addition of N-acetyl-cysteine or glutathione to the oxidized 5-ASA at pH 7.5. The resulting conjugates were N-acetylated at the aromatic amino group in...

  16. A Novel Preparation Method for 5-Aminosalicylic Acid Loaded Eudragit S100 Nanoparticles

    Directory of Open Access Journals (Sweden)

    Sining Li

    2012-05-01

    Full Text Available In this study, solution enhanced dispersion by supercritical fluids (SEDS technique was applied for the preparation of 5-aminosalicylic acid (5-ASA loaded Eudragit S100 (EU S100 nanoparticles. The effects of various process variables including pressure, temperature, 5-ASA concentration and solution flow rate on morphology, particle size, 5-ASA loading and entrapment efficiency of nanoparticles were investigated. Under the appropriate conditions, drug-loaded nanoparticles exhibited a spherical shape and small particle size with narrow particle size distribution. In addition, the nanoparticles prepared were characterized by X-ray diffraction, Differential scanning calorimetry and Fourier transform infrared spectroscopy analyses. The results showed that 5-ASA was imbedded into EU S100 in an amorphous state after SEDS processing and the SEDS process did not induce degradation of 5-ASA.

  17. Effects of acetylsalicylic acid on fresh weight pigment and protein content of bean leaf discs (Phaseolus vulgaris L.).

    Science.gov (United States)

    Canakçi, S

    2003-01-01

    The effects of 100, 250, and 500 ppm acetylsalicylic acid solutions treatments on weight alteration, pigment and protein amounts in discs from the primary leaves of one month old bean (Phaseolus vulgaris L.) seedlings produced tinder greenhouse conditions are presented. The experiments show that: 100 ppm ASA had no significant influence (P > 0.05) but 250 and 500 ppm ASA caused an increase on weight loss (P 0.05), none of the ASA treatments caused a statistically significant influence on carotenoid amount (P > 0.05); 100 and 250 ppm ASA treatments did not cause a significant influence on protein amount (P > 0.05). however 500 ppm ASA treatment caused an increase on protein injury (P < 0.05). Consequently, it is supposed that wet weight loss, pigment and protein injury have somewhat increased on leaf discs. depending on the toxic effect of high acetylsalicylic acid concentrations. PMID:14711042

  18. Aspirin for cancer is no mere antiplatelet prototype. There is potential in its ancient roots.

    Science.gov (United States)

    Lawrence, James R; Baxter, Gwendoline J; Paterson, John R

    2016-09-01

    Aspirin (ASA), increasingly accepted as predominantly a cyclooxygenase (COX)-1 inhibitor, is a prodrug for salicylic acid (SA) which has no such activity. SA is widespread in nature, vital in plants, and present in drug free serum from animals and man. Evolutionary conserved SA receptors are found in human tissues. Very low doses of ASA will, on repeat dosing, produce near maximal platelet COX-1 inhibition. Evidence for cancer prophylaxis is based on ASA doses of at least 75mg/day. Pleiotropic mechanisms underlie low dose ASA's undoubted efficacy in preventive medicine but the key barrier to its more widespread use is gastrointestinal toxicity. ASA/SA combination formulations may improve the current risk/benefit ratio of chemo-prophylactic preparations. There is well established methodology for, and should be few regulatory barriers to, their evaluation. PMID:27515206

  19. Pharmacokinetics and Brain Uptake in the Rhesus Monkey of a Fusion Protein of Arylsulfatase A and a Monoclonal Antibody Against the Human Insulin Receptor

    Science.gov (United States)

    Boado, Ruben J.; Lu, Jeff Zhiqiang; Hui, Eric K.-W.; Sumbria, Rachita K.; Pardridge, William M.

    2014-01-01

    Metachromatic leukodystrophy (MLD) is a lysosomal storage disorder of the brain caused by mutations in the gene encoding the lysosomal sulfatase, arylsulfatase A (ASA). It is not possible to treat the brain in MLD with recombinant ASA, because the enzyme does not cross the blood-brain barrier (BBB). In the present investigation, a BBB-penetrating IgG-ASA fusion protein is engineered and expressed, where the ASA monomer is fused to the carboxyl terminus of each heavy chain of an engineered monoclonal antibody (MAb) against the human insulin receptor (HIR). The HIRMAb crosses the BBB via receptor-mediated transport on the endogenous BBB insulin receptor, and acts as a molecular Trojan horse to ferry the ASA into brain from blood. The HIRMAb-ASA is expressed in stably transfected Chinese hamster ovary cells grown in serum free medium, and purified by protein A affinity chromatography. The fusion protein retains high affinity binding to the HIR, EC50 = 0.34 ± 0.11 nM, and retains high ASA enzyme activity, 20 ± 1 units/mg. The HIRMAb-ASA fusion protein is endocytosed and triaged to the lysosomal compartment in MLD fibroblasts. The fusion protein was radio-labeled with the Bolton-Hunter reagent, and the [125I]-HIRMAb-ASA rapidly penetrates the brain in the Rhesus monkey following intravenous administration. Film and emulsion autoradiography of primate brain shows global distribution of the fusion protein throughout the monkey brain. These studies describe a new biological entity that is designed to treat the brain of humans with MLD following non-invasive, intravenous infusion of an IgG-ASA fusion protein. PMID:23192358

  20. Melatonin combined with ascorbic acid provides salt adaptation in Citrus aurantium L. seedlings.

    Science.gov (United States)

    Kostopoulou, Zacharoula; Therios, Ioannis; Roumeliotis, Efstathios; Kanellis, Angelos K; Molassiotis, Athanassios

    2015-01-01

    Ascorbic acid (AsA) and melatonin (Mel) are known molecules participating in stress resistance, however, their combined role in counteracting the impact of salinity in plants is still unknown. In this work the effect of exogenous application of 0.50 mΜ AsA, 1 μΜ Mel and their combination (AsA + Mel) on various stress responses in leaves and roots of Citrus aurantium L. seedlings grown under 100 mΜ NaCl for 30 days was investigated. Application of AsA, Mel or AsA + Mel to saline solution decreased NaCl-induced electrolyte leakage and lipid peroxidation and prevented NaCl-associated toxicity symptoms and pigments degradation. Also, leaves exposed to combined AsA + Mel treatment displayed lower Cl(-) accumulation. Treatments with AsA and/or Mel modulated differently carbohydrates, proline, phenols, glutathione and the total antioxidant power of tissues as well as the activities of SOD, APX, POD, GR and PPO compared to NaCl alone treatment. Exposure of leaves and roots to chemical treatments and especially to combined AsA and Mel application was able to regulate CaMIPS, CaSLAH1 and CaMYB73 expression, indicating that sugar metabolism, ion homeostasis and transcription regulation were triggered by AsA and Mel. These results provide evidence that the activation of the metabolic pathways associated with combined AsA and Mel application are linked with salt adaptation in citrus plants. PMID:25500452

  1. Interaction of 4-aminosalieylic Acid and Surfactants in Aqueous Solutions Using UV-Vis Spectra and Steady-state Fluorescence Spectroscopy

    Institute of Scientific and Technical Information of China (English)

    XU Dongying; REN Jiaoyan; LIAO Zhengfu; WANG Hui; ZHAO Mouming; LI Guangji

    2011-01-01

    The interactions of 4-aminosalicylic acid (4-ASA) and surfactants in aqueous solutions were investigated by using UV-Vis spectra and steady-state fluorescence spectroscopy.The results showed that the strongest peak at UV-vis spectra of 4-ASA aqueous solution in the presence of cationic surfactant and cetyltrimethyl ammonium bromide (CTAB) appeared at 206 nm and took.a red shift from 206 nm to 221 nm with the increase of 4-ASA concentrations from 0.8× 10-5 to 4.4× 10-4 mol/L.Similarly,the strongest peak at UV-vis spectra of 4-ASA aqueous solution in the presence of nonionic surfactant and polyvinylpyrrolidone (PVP)appeared at 206 nm and took a red shift from 206 nm to 219 nm with the increase of 4-ASA concentrations from 0.8× 10-5 to 4.4x 10-4 mol/L.However,the similar phenomena did not appeared in the presence of anion surfactant,sodium dodecyl sulfate (SDS),the UV-vis spectra of 4-ASA aqueous solution remained the same peak position and the peak value increased with the 4-ASA concentration increase.The results could be attributed to the electrostatic attraction between 4-ASA and CTAB or PVP,as well as the electrostatic repulsion between 4-ASA and SDS.Furthermore,the value of critical micelle concentration (CMC) of surfactants in the presence of 4-ASA was determined with Fluorescence method.The first and second CMC of CTAB was 1.2×10-4 M and 2.4x10-4 M,respectively.The first and second CMC of PVP was 1.2×10 4 M and 2.8x 10 4 M.SDS realized the multiple micellizations to form multiple CMC.

  2. Spectroscopic studies of the interaction of aspirin and its important metabolite, salicylate ion, with DNA, A·T and G·C rich sequences

    Science.gov (United States)

    Bathaie, S. Z.; Nikfarjam, L.; Rahmanpour, R.; Moosavi-Movahedi, A. A.

    2010-12-01

    Among different biological effects of acetylsalicylic acid (ASA), its anticancer property is controversial. Since ASA hydrolyzes rapidly to salicylic acid (SA), especially in the blood, interaction of both ASA and SA (as the small molecules) with ctDNA, oligo(dA·dT) 15 and oligo(dG·dC) 15, as a possible mechanism of their action, is investigated here. The results show that the rate of ASA hydrolysis in the absence and presence of ctDNA is similar. The spectrophotometric results indicate that both ASA and SA cooperatively bind to ctDNA. The binding constants ( K) are (1.7 ± 0.7) × 10 3 M -1 and (6.7 ± 0.2) × 10 3 M -1 for ASA and SA, respectively. Both ligands quench the fluorescence emission of ethidium bromide (Et)-ctDNA complex. The Scatchard plots indicate the non-displacement based quenching (non-intercalative binding). The circular dichroism (CD) spectra of ASA- or SA-ctDsNA complexes show the minor distortion of ctDNA structure, with no characteristic peaks for intercalation of ligands. Tm of ctDNA is decreased up to 3 °C upon ASA binding. The CD results also indicate more distortions on oligo(dG·dC) 15 structure due to the binding of both ASA and SA in comparison with oligo(dA·dT) 15. All data indicate the more affinity for SA binding with DNA minor groove in comparison with ASA which has more hydrophobic character.

  3. Ascorbic acid enhances radiation-induced apoptosis in an HL60 human leukemia cell line

    International Nuclear Information System (INIS)

    This study was conducted to examine the utility of the combined use of ascorbic acid (AsA) and radiation in clinical applications. We investigated cell survival, DNA fragmentation, and caspase activation after X-ray irradiation and AsA treatment of human leukemia HL60 cells. The number of living cells decreased after combined X-ray irradiation and AsA treatment (2 Gy+5 mM) in comparison with that after X-ray irradiation (2 Gy) or AsA treatment (5 mM) alone. DNA fragmentation was more in the cells subjected to combined X-ray irradiation and AsA treatment than in those subjected to X-ray irradiation alone. Caspase-3, caspase-8, and caspase-9 were highly activated following combined X-ray irradiation and AsA treatment, but caspase-8 activity was not markedly increased after X-ray irradiation alone. Bax levels in the mitochondrial membrane fractions were increased after AsA treatment alone and after combined X-ray irradiation and AsA treatment. However, there was no apparent increase in the Bax levels after X-ray irradiation treatment alone. Thus, this study confirmed that supplementing X-ray irradiation with AsA treatment results in increased apoptosis in HL60 cells. With regard to the apoptosis-inducing factors, we hypothesized that Bax and caspase-8 were activated after combined X-ray irradiation and AsA treatment compared with either treatment alone. (author)

  4. Randomized clinical trial: pharmacokinetics and safety of multimatrix mesalamine for treatment of pediatric ulcerative colitis

    Directory of Open Access Journals (Sweden)

    Cuffari C

    2016-02-01

    Full Text Available Carmen Cuffari,1 David Pierce,2 Bartosz Korczowski,3 Krzysztof Fyderek,4 Heather Van Heusen,5 Stuart Hossack,6 Hong Wan,5 Alena YZ Edwards,7 Patrick Martin5 1Department of Pediatrics, Division of Pediatric Gastroenterology and Nutrition, The Johns Hopkins University School of Medicine, Baltimore, MD, USA; 2Shire, Basingstoke, UK; 3Medical College, University of Rzeszów, Rzeszów, Poland; 4University Children’s Hospital of Cracow, Cracow, Poland; 5Shire, Wayne, PA, USA; 6Covance Clinical Research Unit Limited, Leeds, UK; 7ICON Early Phase Services, Marlow, Buckinghamshire, UK Background: Limited data are available on mesalamine (5-aminosalicylic acid; 5-ASA use in pediatric ulcerative colitis (UC.Aim: To evaluate pharmacokinetic and safety profiles of 5-ASA and metabolite acetyl-5-ASA (Ac-5-ASA after once-daily, oral administration of multimatrix mesalamine to children and adolescents with UC.Methods: Participants (5–17 years of age; 18–82 kg, stratified by weight with UC received multimatrix mesalamine 30, 60, or 100 mg/kg/day once daily (to 4,800 mg/day for 7 days. Blood samples were collected pre-dose on days 5 and 6. On days 7 and 8, blood and urine samples were collected and safety was evaluated. 5-ASA and Ac-5-ASA plasma and urine concentrations were analyzed by non-compartmental methods and used to develop a population pharmacokinetic model.Results: Fifty-two subjects (21 [30 mg/kg]; 22 [60 mg/kg]; 9 [100 mg/kg] were randomized. On day 7, systemic exposures of 5-ASA and Ac-5-ASA exhibited a dose-proportional increase between 30 and 60 mg/kg/day cohorts. For 30, 60, and 100 mg/kg/day doses, mean percentages of 5-ASA absorbed were 29.4%, 27.0%, and 22.1%, respectively. Simulated steady-state exposures and variabilities for 5-ASA and Ac-5-ASA (coefficient of variation approximately 50% and 40%–45%, respectively were similar to those observed previously in adults at comparable doses. Treatment-emergent adverse events were

  5. Dicty_cDB: SSA662 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available putative transporter protein SSA662 (ssa662) mRNA, complete cds. 1267 0.0 4 AC115576 |AC115576.1 Dictyostel...SS (Link to library) SSA662 (Link to dictyBase) - G03081 DDB0185065 Contig-U07966-1 SSA...662P (Link to Original site) SSA662F 470 SSA662Z 664 SSA662P 1134 - - Show SSA662 Library SS (Link to library) Clone ID SSA...Contig-U07966-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SS/SSA6-C/SSA...662Q.Seq.d/ Representative seq. ID SSA662P (Link to Original site) Representative DNA sequence >SSA662 (SSA662Q) /CSM/SS/SSA

  6. PUNJABI TEXT CLUSTERING BY SENTENCE STRUCTURE ANALYSIS

    Directory of Open Access Journals (Sweden)

    Saurabh Sharma

    2012-10-01

    Full Text Available Punjabi Text Document Clustering is done by analyzing the sentence structure of similar documents sharing same topics and grouping them into clusters. The prevalent algorithms in this field utilize the vector space model which treats the documents as a bag of words. The meaning in natural language inherently depends on the word sequences which are overlooked and ignored while clustering. The current paper deals with a new Punjabi text clustering algorithm named Clustering by Sentence Structure Analysis(CSSA which has been carried out on 221 Punjabi news articles available on news sites. The phrases are extracted for processing by a meticulous analysis of the structure of a sentence by applying the basic grammatical rules of Karaka. Sequences formed from phrases, are used to find the topic and for finding similarities among all documents which results in the formation of meaningful clusters.

  7. The effect of probiotic Escherichia coli strain Nissle 1917 lipopolysaccharide on the 5-aminosalicylic acid transepithelial transport across Caco-2 cell monolayers.

    Science.gov (United States)

    Stětinová, Věra; Smetanová, Libuše; Kholová, Dagmar; Květina, Jaroslav; Svoboda, Zbyněk; Zídek, Zdeněk; Tlaskalová-Hogenová, Helena

    2013-09-01

    The object of this study was to investigate the effect of probiotic Escherichia coli strain Nissle 1917 (EcN) (i) EcN lipopolysaccharide (EcN LPS) and (ii) bacteria-free supernatant of EcN suspension (EcN supernatant) on in vitro transepithelial transport of mesalazine (5-aminosalicylic acid, 5-ASA), the most commonly prescribed anti-inflammatory drug in inflammatory bowel disease (IBD). Effect of co-administered EcN LPS (100 µg/ml) or EcN supernatant (50 µg/ml) on the 5-ASA transport (300 µmol/l) was studied using the Caco-2 monolayer (a human colon carcinoma cell line) as a model of human intestinal absorption. Permeability characteristics for absorptive and secretory transport of parent drug and its intracellularly-formed metabolite were determined. The quantification of 5-ASA and its main metabolite N-acetyl-5-amino-salicylic acid (N-Ac-5-ASA) was performed by high performance liquid chromatography. Obtained results suggest that neither EcN LPS nor EcN supernatant had effect on the total 5-ASA transport (secretory flux greater than absorptive flux) and on the transport of intracellularly formed N-Ac-5-ASA (preferentially transported in the secretory direction). The percent cumulative transport of the total 5-ASA alone or in combination with EcN LPS or EcN supernatant did not exceed 1%. PMID:23846256

  8. Mechanism of degradation and discoloration reaction of L-ascorbic acid

    International Nuclear Information System (INIS)

    The mechanisms of decomposition and coloration reaction of L-ascorbic acid are reviewed. At the initial stage of the decomposition, it can be classified roughly into oxidative and non-oxidative processes of decomposition. ASA forms furfural by being heated and decomposed in strong acid. The mechanism of the production of furfural at varying pH in acidic region was discussed. Furfural was produced through the enol form of 3-deoxy-L-pentosulose(3DP). 3DP seemed to be produced by two different routes: the one route consists of successive reactions from ASA through lactone ring-opening, dehydration, decarboxylation, to 3DP, and the other consists of reactions from the 3-keto form of ASA, through lactone ring-opening, decarboxylation, and dehydration, to the enol form of 3DP. ASA is easily reduced and decomposed through dehydro-ASA(DHA) by the presence of an oxidizing agent. The decomposition of DHA is discussed in cases of the systems of DHA alone, DHA and α-aminoacid, and DHA and amine. DHA was decomposed by the same reaction scheme as the decomposition of ASA and yielded 2-furoic acid. In the presence of an amino acid, DHA was decomposed by the Strecker decomposition, and yielded a red compound and a radical. In the presence of an amine, the discoloration reaction seemed to take place through radical reaction mechanism. The coloration reaction of ASA occurs in an acidic medium, and is accelerated by the oxidative process of decomposition. (Nishino, S.)

  9. Dry Priming of Maize Seeds Reduces Aluminum Stress.

    Directory of Open Access Journals (Sweden)

    Berenice Kussumoto Alcântara

    Full Text Available Aluminum (Al toxicity is directly related to acidic soils and substantially limits maize yield. Earlier studies using hormones and other substances to treat the seeds of various crops have been carried out with the aim of inducing tolerance to abiotic stress, especially chilling, drought and salinity. However, more studies regarding the effects of seed treatments on the induction of Al tolerance are necessary. In this study, two independent experiments were performed to determine the effect of ascorbic acid (AsA seed treatment on the tolerance response of maize to acidic soil and Al stress. In the first experiment (greenhouse, the AsA seed treatment was tested in B73 (Al-sensitive genotype. This study demonstrates the potential of AsA for use as a pre-sowing seed treatment (seed priming because this metabolite increased root and shoot growth under acidic and Al stress conditions. In the second test, the evidence from field experiments using an Al-sensitive genotype (Mo17 and an Al-tolerant genotype (DA suggested that prior AsA seed treatment increased the growth of both genotypes. Enhanced productivity was observed for DA under Al stress after priming the seeds. Furthermore, the AsA treatment decreased the activity of oxidative stress-related enzymes in the DA genotype. In this study, remarkable effects using AsA seed treatment in maize were observed, demonstrating the potential future use of AsA in seed priming.

  10. Deciphering Ascorbic Acid Regulatory Pathways in Ripening Tomato Fruit Using a Weighted Gene Correlation Network Analysis Approach

    Institute of Scientific and Technical Information of China (English)

    Chao Gao; Zheng Ju; Shan Li; Jinhua Zuo; Daqi Fu; Huiqin Tian; Yunbo Luo; Benzhong Zhu

    2013-01-01

    Genotype is generally determined by the co-expression of diverse genes and multiple regulatory pathways in plants. Gene co-expression analysis combining with physiological trait data provides very important information about the gene function and regulatory mechanism. L-Ascorbic acid (AsA), which is an essential nutrient component for human health and plant metabolism, plays key roles in diverse biological processes such as cell cycle, cell expansion, stress resistance, hormone synthesis, and signaling. Here, we applied a weighted gene correlation network analysis approach based on gene expression values and AsA content data in ripening tomato (Solanum lycopersicum L.) fruit with different AsA content levels, which leads to identification of AsA relevant modules and vital genes in AsA regulatory pathways. Twenty-four modules were compartmentalized according to gene expression profiling. Among these modules, one negatively related module containing genes involved in redox processes and one positively related module enriched with genes involved in AsA biosynthetic and recycling pathways were further analyzed. The present work herein indicates that redox pathways as well as hormone-signal pathways are closely correlated with AsA accumulation in ripening tomato fruit, and allowed us to prioritize candidate genes for follow-up studies to dissect this interplay at the biochemical and molecular level.

  11. Intracerebroventricular enzyme infusion corrects central nervous system pathology and dysfunction in a mouse model of metachromatic leukodystrophy.

    Science.gov (United States)

    Stroobants, Stijn; Gerlach, Debora; Matthes, Frank; Hartmann, Dieter; Fogh, Jens; Gieselmann, Volkmar; D'Hooge, Rudi; Matzner, Ulrich

    2011-07-15

    Arylsulfatase A (ASA) catalyzes the desulfation of sulfatide, a major lipid component of myelin. Inherited functional deficiencies of ASA cause the lysosomal storage disease (LSD) metachromatic leukodystrophy (MLD), which is characterized by intralysosomal accumulation of sulfatide, progressive neurological symptoms and early death. Enzyme replacement therapy (ERT) using intravenous injection of active enzyme is a treatment option for many LSDs as exogenous lysosomal enzymes are delivered to lysosomes of patient's cells via receptor-mediated endocytosis. Efficient treatment of MLD and other LSDs with central nervous system (CNS) involvement is, however, hampered by the blood-brain barrier (BBB), which limits transfer of therapeutic enzymes from the circulation to the brain parenchyma. To bypass the BBB, we infused recombinant human ASA (rhASA) by implanted miniature pumps into the cerebrospinal fluid (CSF) of a conventional and a novel, genetically aggravated ASA knockout mouse model of MLD. rhASA continuously delivered to the lateral ventricle for 4 weeks penetrated the brain parenchyma and was targeted to the lysosomes of brain cells. Histological analysis revealed complete reversal of lysosomal storage in the infused hemisphere. rhASA concentrations and sulfatide clearance declined with increasing distance from the infusion site. Correction of the ataxic gait indicated reversal of central nervous system dysfunctions. The profound histopathological and functional improvements, the requirement of low enzyme doses and the absence of immunological side effects suggest intracerebroventricular ERT to be a promising treatment option for MLD and other LSDs with prevailing CNS disease. PMID:21515587

  12. Effect of low dose acetylsalicylic acid on the frequency and hematologic activity of left ventricular thrombus in anterior wall acute myocardial infarction

    Energy Technology Data Exchange (ETDEWEB)

    Kuepper, A.J.V.; Verheugt, F.W.; Peels, C.H.; Galema, T.W.; den Hollander, W.; Roos, J.P.

    1989-04-15

    In this prospective, randomized, placebo-controlled trial the effect of 100 mg acetylsalicylic acid (ASA) once daily on the incidence, hematologic activity and embolic potential of left ventricular (LV) thrombosis was studied in 100 consecutive patients with a first anterior wall acute myocardial infarction (AMI). Patients were randomized to ASA or placebo less than 12 hours after onset of symptoms. Heparin, 5,000 IU subcutaneously twice daily, was given to all patients during immobilization. Echocardiography was performed less than 24 hours, 48 to 72 hours and 1, 2, and 12 weeks after AMI. LV thrombosis was detected by echocardiography in 30 (33%) of the 92 evaluable patients (15 patients given ASA and 15 given placebo). Indium-111 platelet scintigraphy was done in 17 of the 22 patients with an LV thrombus at the second week echocardiogram. Among 7 ASA-treated patients, 4 had positive images; among 10 placebo patients, 5 had positive images. LV thrombus resolution was noted in 3 of 9 patients with a positive scan and in 5 of 8 patients with a negative platelet scan. In 7 of 10 ASA-treated patients and 5 of 12 placebo-treated patients thrombus resolution was observed (difference not significant). Systemic embolism occurred in 2 patients, both given ASA, during the first week after AMI. Thus, low dose ASA has no effect on the incidence, hematologic activity and embolic potential of LV thrombosis in anterior wall AMI.

  13. Effects of X‑ray irradiation in combination with ascorbic acid on tumor control.

    Science.gov (United States)

    Hosokawa, Yoichiro; Monzen, Satoru; Yoshino, Hironori; Terashima, Shingo; Nakano, Manabu; Toshima, Keisuke; Saga, Ryo; Kashiwakura, Ikuo

    2015-10-01

    Our previous studies demonstrated that the combination of treatment with ascorbic acid (AsA) and X‑ray irradiation results in increased apoptosis in HL60 cells. The present study was performed to investigate the effects of the combined use of AsA and X‑ray irradiation on epithelial cancer and sarcoma cells, and its potential use in future clinical treatment. X‑ray irradiation combined with AsA treatment resulted in increased suppression of cell growth of HT1080, SAS and A549 cells in vitro compared with X‑ray irradiation alone. The combined treatment also suppressed tumor growth in implanted HT‑1080 cells in vivo. Using annexin V/propidium iodide staining and the detection of activated caspase 3, it was found that X‑ray irradiation increased the apoptotic rate of HT1080 cells and resulted in G2/M arrest. However, apoptosis in the HT1080 cells treated with 5 mM AsA remained unchanged, and no changes were observed in the G2/M fraction. By contrast, AsA treatment caused increased suppression of proliferation compared with X‑ray irradiation. These results suggested that 5 mM AsA slowed the cell cycle and reduced tumor growth. Therefore, X‑ray irradiation combined with AsA treatment may be effective against epithelial cancer and sarcoma cells. PMID:26238154

  14. IDENTIFICATION OF ACROSOME AS THE MAIN ANTIGEN OF THE SPERM CELLS PROVOKING AUTOANTIBODIES IN VASECTOMIZED IRANIAN MEN

    Directory of Open Access Journals (Sweden)

    M R Nowroozi

    2008-12-01

    Full Text Available "nVasectomy is one of the extensively used methods of contraception in family planning programs. Antisperm antibodies (ASA develop after vasectomy which can result in auto-immune male infertility. The precise sperm antigens involved in the autoimmune response are still poorly defined, therefore we determined the circulating ASA and identified relevant sperm antigens based on localization of binding sites of ASA to sperm cell antigens, using a rapid, inexpensive and clinically relevant assay in vasectomized men. Results showed that 2.5% of men had ASA at the time of vasectomy, whereas 53.5% of the study population subsequently developed ASA. The numbers of men with circulating ASA increased significantly for the first three months after vasectomy. These antibodies were distinguishable into three groups based on their bindings to different sites of sperm cell antigens including against acrosome and tail in 67.56% and 10.8%, respectively; 21.6% of subjects had antibody to the other parts of the sperm cell antigens. The results of this study are discussed in terms of an autoimmune response against sperm antigens and development of ASA.

  15. Influence of cellulose powder structure on moisture-induced degradation of acetylsalicylic acid.

    Science.gov (United States)

    Mihranyan, A; Strømme, M; Ek, R

    2006-02-01

    The stability of crystalline acetylsalicylic acid (ASA) powder in binary mixtures with cellulose powders was investigated to reveal information about the influence of the cellulose structural properties on the moisture-induced ASA degradation. Different cellulose powder samples were manufactured and characterized by X-ray diffraction and N2 BET gas adsorption. The degradation patterns in ASA/cellulose mixtures were monitored as a function of salicylic acid increase versus time under various relative humidity conditions at 50 degrees C. The crystallinity index of cellulose samples varied between approximately 49 and 95%. The results indicated that cellulose powder with the lowest crystallinity index exhibited lower degradation rates than the samples with the higher crystallinity index. It should be noted that higher ASA degradation rates were observed in the samples with comparably lower moisture contents. This effect was most pronounced in the 1:3 (w/w), ASA/cellulose mixtures, whereas in 3:1 (w/w), ASA/cellulose mixtures the effect was less obvious. The findings emphasise the importance of cellulose structural organisation when governing the moisture's partition between cellulose and ASA during the hydrolytic degradation. PMID:16311024

  16. A comparative study between conventional pan coater and quasi-continuous small batch coater on the stability of tablets containing acetylsalicylic acid.

    Science.gov (United States)

    Cahyadi, Christine; Chan, Lai Wah; Heng, Paul Wan Sia

    2015-02-01

    The Supercell coater was developed as an in-line small batch tablet coater which uses air-fluidization for tablet coating. Coating time is very much reduced, with improved heat and mass transfer. It was hypothesized that the quasi-continuous Supercell coating process was more suitable for the aqueous coating of tablets containing moisture-sensitive drugs. Acetylsalicylic acid (ASA) was used as the model drug in this study. The extent of ASA degradation in Supercell coating was compared against that of tablets coated using the conventional pan coater. Less than 0.3% of ASA was degraded at the end of the coating process using either coater. The extent of ASA degradation was found to be more pronounced during storage. The Supercell coated tablets exhibited comparable or smaller percentage of ASA degradation than the pan coated tablets at the end of a storage period of 6 months under accelerated stability conditions (40°C/75% RH) and 3 years under ambient conditions (25°C/50% RH). The extent and rate of ASA degradation during storage were dependent on the processing conditions employed during Supercell coating. Increase in temperature generally led to a reduction in ASA degradation, while increase in spray rate and coating level caused more degradation. Greater extent of ASA degradation was observed on the surface of pan coated tablets compared with Supercell coated tablets due to greater moisture contact and the slower and wetter coating process. Changes to the processing conditions also influenced the residual moisture content (0.55-2.86%) of the tablets. However, no direct correlation between the residual moisture content of the tablets after coating and the extent of ASA degradation during storage was found. PMID:25448074

  17. Transport of Arylsulfatase A across the Blood-Brain Barrier in Vitro*

    Science.gov (United States)

    Matthes, Frank; Wölte, Philipp; Böckenhoff, Annika; Hüwel, Sabine; Schulz, Mareike; Hyden, Pia; Fogh, Jens; Gieselmann, Volkmar; Galla, Hans-Joachim; Matzner, Ulrich

    2011-01-01

    Enzyme replacement therapy is an option to treat lysosomal storage diseases caused by functional deficiencies of lysosomal hydrolases as intravenous injection of therapeutic enzymes can correct the catabolic defect within many organ systems. However, beneficial effects on central nervous system manifestations are very limited because the blood-brain barrier (BBB) prevents the transfer of enzyme from the circulation to the brain parenchyma. Preclinical studies in mouse models of metachromatic leukodystrophy, however, showed that arylsulfatase A (ASA) is able to cross the BBB to some extent, thus reducing lysosomal storage in brain microglial cells. The present study aims to investigate the routing of ASA across the BBB and to improve the transfer in vitro using a well established cell culture model consisting of primary porcine brain capillary endothelial cells cultured on Transwell filter inserts. Passive apical-to-basolateral ASA transfer was observed, which was not saturable up to high ASA concentrations. No active transport could be determined. The passive transendothelial transfer was, however, charge-dependent as reduced concentrations of negatively charged monosaccharides in the N-glycans of ASA or the addition of polycations increased basolateral ASA levels. Adsorptive transcytosis is therefore considered to be the major transport pathway. Partial inhibition of the transcellular ASA transfer by mannose 6-phosphate indicated a second route depending on the insulin-like growth factor II/mannose 6-phosphate receptor, MPR300. We conclude that cationization of ASA and an increase of the mannose 6-phosphate content of the enzyme may promote blood-to-brain transfer of ASA, thus leading to an improved therapeutic efficacy of enzyme replacement therapy behind the BBB. PMID:21454621

  18. Transport of arylsulfatase A across the blood-brain barrier in vitro.

    Science.gov (United States)

    Matthes, Frank; Wölte, Philipp; Böckenhoff, Annika; Hüwel, Sabine; Schulz, Mareike; Hyden, Pia; Fogh, Jens; Gieselmann, Volkmar; Galla, Hans-Joachim; Matzner, Ulrich

    2011-05-20

    Enzyme replacement therapy is an option to treat lysosomal storage diseases caused by functional deficiencies of lysosomal hydrolases as intravenous injection of therapeutic enzymes can correct the catabolic defect within many organ systems. However, beneficial effects on central nervous system manifestations are very limited because the blood-brain barrier (BBB) prevents the transfer of enzyme from the circulation to the brain parenchyma. Preclinical studies in mouse models of metachromatic leukodystrophy, however, showed that arylsulfatase A (ASA) is able to cross the BBB to some extent, thus reducing lysosomal storage in brain microglial cells. The present study aims to investigate the routing of ASA across the BBB and to improve the transfer in vitro using a well established cell culture model consisting of primary porcine brain capillary endothelial cells cultured on Transwell filter inserts. Passive apical-to-basolateral ASA transfer was observed, which was not saturable up to high ASA concentrations. No active transport could be determined. The passive transendothelial transfer was, however, charge-dependent as reduced concentrations of negatively charged monosaccharides in the N-glycans of ASA or the addition of polycations increased basolateral ASA levels. Adsorptive transcytosis is therefore considered to be the major transport pathway. Partial inhibition of the transcellular ASA transfer by mannose 6-phosphate indicated a second route depending on the insulin-like growth factor II/mannose 6-phosphate receptor, MPR300. We conclude that cationization of ASA and an increase of the mannose 6-phosphate content of the enzyme may promote blood-to-brain transfer of ASA, thus leading to an improved therapeutic efficacy of enzyme replacement therapy behind the BBB. PMID:21454621

  19. Protein nitration and nitrosylation by NO-donating aspirin in colon cancer cells: Relevance to its mechanism of action

    OpenAIRE

    Williams, Jennie L.; Ji, Ping; Ouyang, Nengtai; Kopelovich, Levy; Rigas, Basil

    2011-01-01

    Nitric oxide-donating aspirin (NO-ASA) is a promising agent for cancer prevention. Although studied extensively, its molecular targets and mechanism of action are still unclear. S-nitrosylation of signaling proteins is emerging as an important regulatory mechanism by NO. Here, we examined whether S-nitrosylation of the NF-κB, p53, and Wnt signaling proteins by NO-ASA might explain, in part, its mechanism of action in colon cancer. NO-ASA releases significant amounts of NO detected intracellul...

  20. Assay of ascorbic acid in plants tissues, I: 1H and 13C NMR study of the complex between Cu(I) and 2,2'-biquinoline

    International Nuclear Information System (INIS)

    The Shieh's method, originally devised for the analysis of ascorbic acid (AsA) in pharmaceutical preparations and based on the reaction of this acid with Cu(I) and 2,2'-biquinoline, was adapted to determine AsA in biological samples and particularly in plant tissues. The proposed assay is compared with some current methods for AsA determination. Moreover the system Cu(I)-biquinoline is studied by 1H and 13C NMR spectroscopy, and a coordination model for the complex is proposed. (author). 12 refs., 4 figs., 2 tabs

  1. A New Application of an ANFIS for the Shape Optimal Design of Electromagnetic Devices

    Directory of Open Access Journals (Sweden)

    N. Mohdeb

    2014-09-01

    Full Text Available This paper presents a new model based on simulated annealing algorithm (ASA and adaptive neuro-fuzzy inference system (ANFIS for shape optimization and its applications to electromagnetic devices. The proposed model uses ANFIS system to evaluate the electromagnetic performance of the device. Both the ANFIS and ASA method are applied to the design/optimization of the electromagnetic actuator. The results of the proposed approach are compared with other techniques such as: method of moving asymptotes, penalty method, augmented lagrangian genetic algorithm and simulated annealing method (SA. Among the algorithms, the proposed ANFIS-ASA approach significantly outperforms the other methods.

  2. Lack of Pharmacokinetic Interaction between Aspirin and Warfarin.

    Science.gov (United States)

    Fiske, William D.; Connell, Jill M.; Benedek, Irma H.

    1995-06-01

    An open-label, randomized, two-phase crossover study was conducted on 36 healthy male volunteers to identify the effects of coadministration of aspirin (acetylsalicylic acid; ASA) and crystalline warfarin sodium (Coumadin((R))) on the elimination and disposition kinetics of ASA, salicylic acid (SA) and R- and S-warfarin enantiomers. Twenty-four subjects were administered single doses of 325 mg of ASA alone and in combination with 10 mg of crystalline warfarin sodium with a 1-week washout between ASA doses. ASA and SA pharmacokinetic parameters were determined after each dose. Twelve subjects were administered single doses of 10 mg of crystalline warfarin sodium alone and in combination with 325 mg of ASA with a 4-week washout between warfarin doses. R- and S-warfarin enantiomer pharmacokinetic parameters were determined after each dose. Pharmacokinetic parameters were compared using analysis of variance and 90% confidence intervals. ASA and SA AUCs (the area under the plasma concentration versus time curve from time zero to time infinity) respectively were 3.28 plus minus 0.80 and 66.99 plus minus 11.73 &mgr;g h ml(minus sign1) (ASA alone), and 3.22 plus minus 0.61 and 69.48 plus minus 15.79 &mgr;g h ml(minus sign1) (ASA with warfarin). R-warfarin and S-warfarin AUCs respectively were 33.9 plus minus 9.3 and 23.9 plus minus 16.0 &mgr;g h ml(minus sign1) (warfarin alone) and 33.6 plus minus 10.2 and 22.6 plus minus 14.7 &mgr;g h ml(minus sign1) (warfarin with ASA). The only pharmacokinetic parameter which was statistically significantly different when the combination was administered was the S-warfarin elimination rate constant (p < 0.05), but the difference (9.2% increase in the presence of ASA) was small and no significant difference was found in S-warfarin clearance. It is concluded that there is no pharmacokinetic interaction when a single dose of ASA 325 mg is coadministered with a single dose of crystalline warfarin sodium 10 mg. PMID:11850685

  3. Angular spectrum approach for fast simulation of pulsed non-linear ultrasound fields

    DEFF Research Database (Denmark)

    Du, Yigang; Jensen, Henrik; Jensen, Jørgen Arendt

    The paper presents an Angular Spectrum Approach (ASA) for simulating pulsed non-linear ultrasound fields. The source of the ASA is generated by Field II, which can simulate array transducers of any arbitrary geometry and focusing. The non-linear ultrasound simulation program - Abersim, is used as...... the fundamental and keep the second harmonic field, since Abersim simulates non-linear fields with all harmonic components. ASA and Abersim are compared for the pulsed fundamental and second harmonic fields in the time domain at depths of 30 mm, 40 mm (focal depth) and 60 mm. Full widths at -6 d...

  4. Metal-rich or misclassified? The case of four RR Lyrae stars

    CERN Document Server

    Molnár, L; Plachy, E; Szabó, R

    2016-01-01

    We analysed the light curve of four, apparently extremely metal-rich fundamental-mode RR Lyrae stars. We identified two stars, MT Tel and ASAS J091803-3022.6 as RRc (first-overtone) pulsators that were misclassified as RRab ones in the ASAS survey. In the case of the other two stars, V397 Gem and ASAS J075127-4136.3, we could not decide conclusively, as they are outliers in the period-Fourier-coefficient space from the loci of both classes, but their photometric metallicities also favour the RRc classification.

  5. Risk of haemorrhage from transurethral prostatectomy in acetylsalicylic acid and NSAID-treated patients

    DEFF Research Database (Denmark)

    Wierød, F S; Frandsen, N J; Jacobsen, J D; Hartvigsen, A; Olsen, P R

    1998-01-01

    unselected clinical records of all patients undergoing TUR-P in the Department of Urology at Hvidovre Hospital (during 1992-1994) with special focus on the use of ASA and non-steroidal anti-inflammatory drugs (NSAIDs). In total, 457 records were examined: 99 patients on ASA/NSAID received 42 units of blood......, while 358 patients free from such medication received 68 units of blood, a significantly smaller amount (p = 0.0390). We conclude that ASA and NSAIDs increase the risk of bleeding during and after TUR-P, and we recommend the withdrawal of these drugs for one week before TUR-P....

  6. Aquagenic Syringeal Acrokeratoderma

    Directory of Open Access Journals (Sweden)

    Müzeyyen Gönül

    2015-09-01

    Full Text Available Aquagenic syringeal acrokeratoderma (ASA; which is a rare acquired condition with unknown etiology appears to predominantly affect adolescent and young adult women. ASA is characterized by symmetrical, translucent, whitish papules with burning sensation which are localized mainly on palms and sometimes plantar regions and developing after few minutes of exposure to warm water. The condition spontaneously resolves after drying. Diagnosis of the disease is established by clinical and histopathologic examinations. Histopathologically, dilatation is observed on hyperkeratosis and dilated ecrine ducts. It has been reported that dermatoscopy is useful in diagnosing ASA with the increasing use of in recent years. Herein, we report, a twenty-one year old woman presented with a seven-month-history of burning sensation, whitening and thickening of the skin on both palms after sweating or immersion in water for a few minutes. In this case the diagnosis of ASA was based on clinical, histopathological and dermatoscopic features.

  7. Intra-cardiac echocardiography in alcohol septal ablation

    DEFF Research Database (Denmark)

    Cooper, Robert M; Shahzad, Adeel; Newton, James;

    2015-01-01

    Alcohol septal ablation (ASA) in hypertrophic obstructive cardiomyopathy reduces left ventricular outflow tract gradients. A third of patients do not respond; inaccurate localisation of the iatrogenic infarct can be responsible. Transthoracic echocardiography (TTE) using myocardial contrast can be...

  8. ASTRONOMY IN THE SYSTEM OF UNIVERSITY EDUCATION

    OpenAIRE

    Александров, Ю В; Харківський національний університет ім. В.Н.Каразіна; Захожай, В А; Харківський національний університет ім. В.Н.Каразіна

    2014-01-01

    Three aspects ofastronomical university education are considered: such as preparation of astronomists-professionals, teaching astronomy asa part of scientific and professional specialists preparation, teaching astronomy as an element of cultural universityeducation.

  9. Associations between spondyloarthritis features and MRI findings

    DEFF Research Database (Denmark)

    Arnbak, Bodil; Jurik, Anne Grethe; Hørslev-Petersen, Kim;

    2015-01-01

    ASAS definition, was present in 217(21%) patients. Of those, 91(42%) had bone marrow oedema (BMO) at the minimum requirement according to ASAS (low BMO score). HLA-B27, peripheral arthritis, good response to NSAID, and preceding infection associated independently with SIJ MRI findings (OR range 1...... clinical features and MRI findings included in ASAS criteria, and 2) explore the associations between clinical features and MRI findings. METHODS: Patients aged 18-40 years with persistent LBP referred to an outpatient spine clinic were included. Information on clinical features (incl. HLA-B27 and CRP) and......OBJECTIVES: The Assessment of SpondyloArthritis international Society (ASAS) has previously published criteria for spondyloarthritis (SpA). The objectives in the current study were in a low back pain (LBP) cohort, including an unknown proportion of SpA patients, to: 1) estimate the prevalence of...

  10. Täna kell 20 esitletakse EKA galerii...

    Index Scriptorium Estoniae

    2004-01-01

    Esitletakse norra kunstnike (loetletud) videosid "Darling, don't leave me all by myself". Korraldaja Bergeni kuraatoriduo Rakett (Asa Lövgren, Karolin Tampere). 4. IV näeb Tallinna projekti Von Krahli teatris

  11. African Studies Abstracts Online: number 28, 2009

    OpenAIRE

    African Studies Centre

    2009-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 28 (2009). African Studies Centre, Leiden.

  12. African Studies Abstracts Online: number 25, 2009

    OpenAIRE

    African Studies Centre

    2009-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 25 (2009). African Studies Centre, Leiden.

  13. African Studies Abstracts Online: number 10, 2005

    OpenAIRE

    African Studies Centre

    2005-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 10 (2005). African Studies Centre, Leiden.

  14. African Studies Abstracts Online: number 36, 2011

    OpenAIRE

    African Studies Centre

    2011-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 36 (2011). African Studies Centre, Leiden.

  15. African Studies Abstracts Online: number 23, 2008

    OpenAIRE

    African Studies Centre

    2008-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 23 (2008). African Studies Centre, Leiden.

  16. African Studies Abstracts Online: number 30, 2010

    OpenAIRE

    African Studies Centre

    2010-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 30 (2010). African Studies Centre, Leiden.

  17. African Studies Abstracts Online: number 20, 2007

    OpenAIRE

    African Studies Centre

    2007-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 20 (2007). African Studies Centre, Leiden.

  18. African Studies Abstracts Online: number 50, 2015

    OpenAIRE

    African Studies Centre

    2015-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 50 (2015). African Studies Centre, Leiden.

  19. African Studies Abstracts Online: number 34, 2011

    OpenAIRE

    African Studies Centre

    2011-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 34 (2011). African Studies Centre, Leiden.

  20. African Studies Abstracts Online: number 11, 2005

    OpenAIRE

    African Studies Centre

    2005-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 11 (2005). African Studies Centre, Leiden.

  1. African Studies Abstracts Online: number 52, 2015

    OpenAIRE

    African Studies Centre

    2015-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 52 (2015). African Studies Centre, Leiden.

  2. African Studies Abstracts Online: number 15, 2006

    OpenAIRE

    African Studies Centre

    2006-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 15 (2006). African Studies Centre, Leiden.

  3. African Studies Abstracts Online: number 48, 2014

    OpenAIRE

    African Studies Centre

    2014-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 48 (2014). African Studies Centre, Leiden.

  4. African Studies Abstracts Online: number 22, 2008

    OpenAIRE

    African Studies Centre

    2008-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 22 (2008). African Studies Centre, Leiden.

  5. African Studies Abstracts Online: number 43, 2013

    OpenAIRE

    African Studies Centre

    2013-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 43 (2013). African Studies Centre, Leiden.

  6. African Studies Abstracts Online: number 17, 2007

    OpenAIRE

    African Studies Centre

    2007-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 17 (2007). African Studies Centre, Leiden.

  7. African Studies Abstracts Online: number 18, 2007

    OpenAIRE

    African Studies Centre

    2007-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 18 (2007). African Studies Centre, Leiden.

  8. African Studies Abstracts Online: number 38, 2012

    OpenAIRE

    African Studies Centre

    2012-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 38 (2012). African Studies Centre, Leiden.

  9. African Studies Abstracts Online: number 9, 2005

    OpenAIRE

    African Studies Centre

    2005-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 9 (2005). African Studies Centre, Leiden.

  10. African Studies Abstracts Online: number 31, 2010

    OpenAIRE

    African Studies Centre

    2010-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 31 (2010). African Studies Centre, Leiden.

  11. African Studies Abstracts Online: number 40, 2012

    OpenAIRE

    African Studies Centre

    2012-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 40 (2012). African Studies Centre, Leiden.

  12. African Studies Abstracts Online: number 27, 2009

    OpenAIRE

    African Studies Centre

    2009-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 27 (2009). African Studies Centre, Leiden.

  13. African Studies Abstracts Online: number 37, 2012

    OpenAIRE

    African Studies Centre

    2012-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 37 (2012). African Studies Centre, Leiden.

  14. African Studies Abstracts Online: number 26, 2009

    OpenAIRE

    African Studies Centre

    2009-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 26 (2009). African Studies Centre, Leiden.

  15. African Studies Abstracts Online: number 29, 2010

    OpenAIRE

    African Studies Centre

    2010-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 29 (2010). African Studies Centre, Leiden.

  16. African Studies Abstracts Online: number 33, 2011

    OpenAIRE

    African Studies Centre

    2011-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 33 (2011). African Studies Centre, Leiden.

  17. African Studies Abstracts Online: number 42, 2013

    OpenAIRE

    African Studies Centre

    2013-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 42 (2013). African Studies Centre, Leiden.

  18. African Studies Abstracts Online: number 45, 2014

    OpenAIRE

    African Studies Centre

    2014-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 45 (2014). African Studies Centre, Leiden.

  19. African Studies Abstracts Online: number 19, 2007

    OpenAIRE

    African Studies Centre

    2007-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 19 (2007). African Studies Centre, Leiden.

  20. African Studies Abstracts Online: number 46, 2014

    OpenAIRE

    African Studies Centre

    2014-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 46 (2014). African Studies Centre, Leiden.

  1. Supporting the Pathway to the Professoriate: A Descriptive Overview of a Faculty Development Program

    Science.gov (United States)

    Jackson, Jerlando F. L.; Flowers, Lamont A.

    2014-01-01

    This article describes the Asa G. Hilliard III and Barbara A. Sizemore Research Institute on African Americans and Education, a future faculty program designed to encourage doctoral students to enter the professoriate and study the African American experience in education.

  2. African Studies Abstracts Online: number 32, 2010

    OpenAIRE

    African Studies Centre

    2010-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 32 (2010). African Studies Centre, Leiden.

  3. African Studies Abstracts Online: number 51, 2015

    OpenAIRE

    African Studies Centre

    2015-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 51 (2015). African Studies Centre, Leiden.

  4. African Studies Abstracts Online: number 16, 2006

    OpenAIRE

    African Studies Centre

    2006-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 16 (2006). African Studies Centre, Leiden.

  5. African Studies Abstracts Online: number 24, 2008

    OpenAIRE

    African Studies Centre

    2008-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 24 (2008). African Studies Centre, Leiden.

  6. African Studies Abstracts Online: number 39, 2012

    OpenAIRE

    African Studies Centre

    2012-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 39 (2012). African Studies Centre, Leiden.

  7. African Studies Abstracts Online: number 54, 2016

    OpenAIRE

    African Studies Centre Leiden

    2016-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 54 (2016). African Studies Centre, Leiden.

  8. African Studies Abstracts Online: number 47, 2014

    OpenAIRE

    African Studies Centre

    2014-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 47 (2014). African Studies Centre, Leiden.

  9. African Studies Abstracts Online: number 21, 2008

    OpenAIRE

    African Studies Centre

    2008-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 21 (2008). African Studies Centre, Leiden.

  10. African Studies Abstracts Online: number 35, 2011

    OpenAIRE

    African Studies Centre

    2011-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 35 (2011). African Studies Centre, Leiden.

  11. African Studies Abstracts Online: number 44, 2013

    OpenAIRE

    African Studies Centre

    2013-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 44 (2013). African Studies Centre, Leiden.

  12. African Studies Abstracts Online: number 53, 2016

    OpenAIRE

    African Studies Centre

    2016-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 53 (2016). African Studies Centre, Leiden.

  13. African Studies Abstracts Online: number 49, 2015

    OpenAIRE

    African Studies Centre

    2015-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 49 (2015). African Studies Centre, Leiden.

  14. African Studies Abstracts Online: number 41, 2013

    OpenAIRE

    African Studies Centre

    2013-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 41 (2013). African Studies Centre, Leiden.

  15. Non-linear Ultrasound Imaging

    DEFF Research Database (Denmark)

    Du, Yigang

    The theory for modeling non-linear acoustic propagation is addressed in the dissertation. The solutions to both the linear and non-linear wave equations have been found by an angular spectrum approach (ASA), in which an analytical expression can be derived. This makes the calculation complete...... without iteration steps. The ASA is implemented in combination with Field II and extended to simulate the pulsed ultrasound fields. The simulated results from a linear array transducer are made by the ASA based on Field II, and by a released non-linear simulation program- Abersim, respectively. The...... calculation speed of the ASA is increased approximately by a factor of 140. For the second harmonic point spread function the error of the full width is 1.5% at -6 dB and 6.4% at -12 dB compared to Abersim. To further investigate the linear and non-linear ultrasound fields, hydrophone measurements are...

  16. Predicting Aggression among Male Adolescents: an Application of the Theory of Planned Behavior

    OpenAIRE

    ZinatMotlagh, Fazel; Ataee, Mari; Jalilian, Farzad; MirzaeiAlavijeh, Mehdi; Aghaei, Abbas; Karimzadeh Shirazi, Kambiz

    2013-01-01

    Background: Aggressive behaviorin adolescencecan be expressed asa predictorfor crime, substanceabuse, depression and academic failure. The purpose of this study was to determine the prediction of aggression among Iranian adolescent based on theory of planned behavior (TPB) as a theoretical framework.

  17. Bleeding complications after pacemaker or cardioverter-defibrillator implantation in patients receiving dual antiplatelet therapy: Results of a prospective, two-centre registry

    OpenAIRE

    Przybylski, A; Derejko, P.; Kwaśniewski, W.; Urbańczyk-Świć, D.; Zakrzewska, J.; Orszulak, W.; Orczykowski, M.; Filipecki, A.; Szumowski, Ł; Walczak, F.; Trusz-Gluza, M.

    2010-01-01

    Introduction. The aim of the study was to define the prevalence of bleeding events in patients treated with dual antiplatelet therapy (DAT) in comparison with patients receiving only acetylsalicylic acid (ASA).

  18. [In Process Citation].

    Science.gov (United States)

    Lotz, Gösta

    2016-04-01

    Due to its relevance to patient outcome, management of the difficult airway is a major topic in the training of anesthesiologists. Algorithms may serve as a plan for a difficult situation. Since 1993, many professional organizations have published guidelines for airway management. ASA and DGAI share common strategies in their guidelines, but also have significant differences. The DGAI provides different algorithms for both the anticipated and unanticipated difficult airway, while the ASA uses one universal algorithm. Extraglottic airway devices and video laryngoscopes are integral part of all these algorithms. In the DGAI guideline, spontaneous breathing is essential, in contrast to the ASA algorithm. Furthermore, the DGAI guideline is much more specific than the ASA guideline in regard to the anticipated difficult airway, extubation strategy and continuing training of anesthesiologists. PMID:27070518

  19. Graphene/Nafion composite film modified glassy carbon electrode for simultaneous determination of paracetamol, aspirin and caffeine in pharmaceutical formulations.

    Science.gov (United States)

    Yiğit, Aydın; Yardım, Yavuz; Çelebi, Metin; Levent, Abdulkadir; Şentürk, Zühre

    2016-09-01

    A graphene-Nafion composite film was fabricated on the glassy carbon electrode (GR-NF/GCE), and used for simultaneous determination of paracetamol (PAR), aspirin (ASA) and caffeine (CAF). The electrochemical behaviors of PAR, ASA and CAF were investigated by cyclic voltammetry and square-wave adsorptive anodic stripping voltammetry. By using stripping one for simultaneous determination of PAR, ASA and CAF, their electrochemical oxidation peaks appeared at +0.64, 1.04 and 1.44V, and good linear current responses were obtained with the detection limits of 18ngmL(-1) (1.2×10(-9)M), 11.7ngmL(-1) (6.5×10(-8)M) and 7.3ngmL(-1) (3.8×10(-8)M), respectively. Finally, the proposed electrochemical sensor was successfully applied for quantifying PAR, ASA and CAF in commercial tablet formulations. PMID:27343573

  20. The prophylactic effect of 5-aminosalicylic acid and salazosulphapyridine on degraded-carrageenan-induced colitis in guinea pigs

    DEFF Research Database (Denmark)

    Poulsen, Steen Seier

    1984-01-01

    placebo group, all guinea pigs developed many small punctiform ulcerations in the cecum (median, 30/cm2). In the 5-ASA group no protective effect was demonstrated, since the number of ulcerations was 37/cm2. The difference is not statistically significant. However, the SASP group presented significantly......Experimental colitis was induced in guinea pigs by administration of 5% degraded carrageenan for 5 days. The prophylactic effect of a slow-release preparation of 5-aminosalicylic acid (5-ASA; 13 mg/100 g/day) was compared with approximately equimolar amounts of salazosulphapyridine (SASP; 26 mg/100...... fewer ulcerations (4/cm2). The concentrations of 5-ASA and/or its acetylated metabolite were several times higher in the cecum content and twice as high in plasma in the SASP group, indicating a difference in the absorption patterns of 5-ASA and the two drugs. These results and the etiological...

  1. The effect of low-dose acetylsalicylic acid on bleeding after transurethral prostatectomy--a prospective, randomized, double-blind, placebo-controlled study

    DEFF Research Database (Denmark)

    Nielsen, Jesper Dan; Holm-Nielsen, A; Jespersen, J;

    2000-01-01

    OBJECTIVE: An increase in the loss of blood after ingestion of acetylsalicylic acid (ASA) has been reported after several types of surgery, but randomized placebo-controlled studies have exclusively been performed after coronary artery bypass surgery. The reported effects of ASA on bleeding after...... transurethral prostatectomy (TURP) have been conflicting. We have studied the effect of low doses of ASA (150 mg) on bleeding after TURP in a prospective, randomized, double-blind, placebo-controlled trial. PATIENTS AND METHODS: Patients were randomized to receive either 150 mg ASA (n = 26) or placebo (n = 27...... group (median 284; quartiles 196-660 ml) was significantly higher than in the placebo group (median 144; quartiles 75-379 ml), (p = 0.011). No significant difference was observed between the groups regarding the amount of resected tissue (p = 0.209) or the operating time (p = 0.297). In both groups the...

  2. Abandoned Shipwreck Act

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Abandoned Shipwreck Act of 1987 (ASA) affirms the authority of state governments to claim ownership to, protect, and manage abandoned shipwrecks on state...

  3. Fast simulation of non-linear pulsed ultrasound fields using an angular spectrum approach

    DEFF Research Database (Denmark)

    Du, Yigang; Jensen, Jørgen Arendt

    2013-01-01

    accuracy of the nonlinear ASA is compared to the non-linear simulation program – Abersim, which is a numerical solution to the Burgers equation based on the OSM. Simulations are performed for a linear array transducer with 64 active elements, focus at 40 mm, and excitation by a 2-cycle sine wave with a......A fast non-linear pulsed ultrasound field simulation is presented. It is implemented based on an angular spectrum approach (ASA), which analytically solves the non-linear wave equation. The ASA solution to the Westervelt equation is derived in detail. The calculation speed is significantly...... increased compared to a numerical solution using an operator splitting method (OSM). The ASA has been modified and extended to pulsed non-linear ultrasound fields in combination with Field II, where any array transducer with arbitrary geometry, excitation, focusing and apodization can be simulated. The...

  4. Ship Traffic 2011 West Coast Region - All Ship Types

    Data.gov (United States)

    Bureau of Ocean Energy Management, Department of the Interior — The data was derived from US Coast Guard raw vessel point returns and preprocessed by ASA (Applied Science Associates), to one minute point interCAls. The data...

  5. Consistent Blood Pressure Control May Cut Rate of Second Stroke in Half

    Science.gov (United States)

    ... AHA/ASA Embargoed Media Materials Media Contacts Boilerplate Branding Guidelines Copyright Permissions Embargo/Recording Policies Linking Policy ... associate chief medical officer at Rancho Los Amigos National Rehabilitation Center in Downey, Calif. Reducing salt intake, ...

  6. Pharmacokinetics and pharmacodynamics of acetylsalicylic acid after intravenous and oral administration to healthy volunteers

    Directory of Open Access Journals (Sweden)

    Nagelschmitz J

    2014-03-01

    Full Text Available J Nagelschmitz,1 M Blunck,1 J Kraetzschmar,1 M Ludwig,1 G Wensing,1 T Hohlfeld2 1Bayer HealthCare AG, Clinical Pharmacology, Wuppertal, Germany; 2Institut für Pharmakologie und Klinische Pharmakologie, Heinrich-Heine Universität Düsseldorf, Düsseldorf, Germany Background: The pharmacology of single doses of acetylsalicylic acid (ASA administered intravenously (250 or 500 mg or orally (100, 300, or 500 mg was evaluated in a randomized, placebo-controlled, crossover study. Methods: Blood and urine samples were collected before and up to 24 hours after administration of ASA in 22 healthy volunteers. Pharmacokinetic parameters and measurements of platelet aggregation were determined using validated techniques. Results: A comparison between administration routes showed that the geometric mean dose-corrected peak concentrations (Cmax/D and the geometric mean dose-corrected area under the curve (AUC0–∞/D were higher following intravenous administration of ASA 500 mg compared with oral administration (estimated ratios were 11.23 and 2.03, respectively. Complete inhibition of platelet aggregation was achieved within 5 minutes with both intravenous ASA doses, reflecting a rapid onset of inhibition that was not observed with oral dosing. At 5 minutes after administration, the mean reduction in arachidonic acid-induced thromboxane B2 synthesis ex vivo was 99.3% with ASA 250 mg intravenously and 99.7% with ASA 500 mg intravenously. In exploratory analyses, thromboxane B2 synthesis was significantly lower after intravenous versus oral ASA 500 mg (P<0.0001 at each observed time point up to the first hour after administration. Concentrations of 6-keto-prostaglandin1α at 5 and 20 minutes after dosing were also significantly lower with ASA 500 mg intravenously than with ASA 500 mg orally. Conclusion: This study demonstrates that intravenous ASA provides more rapid and consistent platelet inhibition than oral ASA within the first hour after dosing

  7. Aspirin suppresses cardiac fibroblast proliferation and collagen formation through downregulation of angiotensin type 1 receptor transcription

    International Nuclear Information System (INIS)

    Aspirin (acetyl salicylic acid, ASA) is a common drug used for its analgesic and antipyretic effects. Recent studies show that ASA not only blocks cyclooxygenase, but also inhibits NADPH oxidase and resultant reactive oxygen species (ROS) generation, a pathway that underlies pathogenesis of several ailments, including hypertension and tissue remodeling after injury. In these disease states, angiotensin II (Ang II) activates NADPH oxidase via its type 1 receptor (AT1R) and leads to fibroblast growth and collagen synthesis. In this study, we examined if ASA would inhibit NADPH oxidase activation, upregulation of AT1R transcription, and subsequent collagen generation in mouse cardiac fibroblasts challenged with Ang II. Mouse heart fibroblasts were isolated and treated with Ang II with or without ASA. As expected, Ang II induced AT1R expression, and stimulated cardiac fibroblast growth and collagen synthesis. The AT1R blocker losartan attenuated these effects of Ang II. Similarly to losartan, ASA, and its SA moiety suppressed Ang II-mediated AT1R transcription and fibroblast proliferation as well as expression of collagens and MMPs. ASA also suppressed the expression of NADPH oxidase subunits (p22phox, p47phox, p67phox, NOX2 and NOX4) and ROS generation. ASA did not affect total NF-κB p65, but inhibited its phosphorylation and activation. These observations suggest that ASA inhibits Ang II-induced NADPH oxidase expression, NF-κB activation and AT1R transcription in cardiac fibroblasts, and fibroblast proliferation and collagen expression. The critical role of NADPH oxidase activity in stimulation of AT1R transcription became apparent in experiments where ASA also inhibited AT1R transcription in cardiac fibroblasts challenged with H2O2. Since SA had similar effect as ASA on AT1R expression, we suggest that ASA's effect is mediated by its SA moiety. -- Highlights: ► Aspirin in therapeutic concentrations decreases mouse cardiac fibroblast growth and collagen formation

  8. A Performance Assessment of an Airborne Separation Assistance System Using Realistic Complex Traffic Flows

    Science.gov (United States)

    Smith, Jeremy C.; Bussink, Frank J. L.

    2008-01-01

    This paper presents the results from a study that investigates the performance of a tactical Airborne Separation Assistance System (ASAS) in en route airspace, under varying demand levels, with realistic traffic flows. The ASAS concept studied here allows flight crews of equipped aircraft to perform separation from other air traffic autonomously. This study addresses the tactical aspects of an ASAS using aircraft state data (i.e. position and velocity) to detect and resolve projected conflicts. In addition, use of a conflict prevention system helps ASAS-equipped aircraft avoid maneuvers that may cause new conflicts. ASAS-capable aircraft are equipped with satellite-based navigation and Automatic Dependent Surveillance Broadcast (ADS-B) for transmission and receipt of aircraft state data. In addition to tactical conflict detection and resolution (CD&R), a complete, integrated ASAS is likely to incorporate a strategic CD&R component with a longer look-ahead time, using trajectory intent information. A system-wide traffic flow management (TFM) component, located at the FAA command center helps aircraft to avoid regions of excessive traffic density and complexity. A Traffic Alert and Collision Avoidance System (TCAS), as used today is the system of last resort. This integrated approach avoids sole reliance on the use of the tactical CD&R studied here, but the tactical component remains a critical element of the complete ASAS. The focus of this paper is to determine to what extent the proposed tactical component of ASAS alone can maintain aircraft separation at demand levels up to three times that of current traffic. The study also investigates the effect of mixing ASAS-equipped aircraft with unequipped aircraft (i.e. current day) that do not have the capability to self-separate. Position and velocity data for unequipped aircraft needs to be available to ASASequipped. Most likely, for this future concept, state data would be available from instrument flight rules (IFR

  9. Aspirin suppresses cardiac fibroblast proliferation and collagen formation through downregulation of angiotensin type 1 receptor transcription

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Xianwei, E-mail: XWang2@UAMS.edu; Lu, Jingjun; Khaidakov, Magomed; Mitra, Sona; Ding, Zufeng; Raina, Sameer; Goyal, Tanu; Mehta, Jawahar L., E-mail: MehtaJL@UAMS.edu

    2012-03-15

    Aspirin (acetyl salicylic acid, ASA) is a common drug used for its analgesic and antipyretic effects. Recent studies show that ASA not only blocks cyclooxygenase, but also inhibits NADPH oxidase and resultant reactive oxygen species (ROS) generation, a pathway that underlies pathogenesis of several ailments, including hypertension and tissue remodeling after injury. In these disease states, angiotensin II (Ang II) activates NADPH oxidase via its type 1 receptor (AT1R) and leads to fibroblast growth and collagen synthesis. In this study, we examined if ASA would inhibit NADPH oxidase activation, upregulation of AT1R transcription, and subsequent collagen generation in mouse cardiac fibroblasts challenged with Ang II. Mouse heart fibroblasts were isolated and treated with Ang II with or without ASA. As expected, Ang II induced AT1R expression, and stimulated cardiac fibroblast growth and collagen synthesis. The AT1R blocker losartan attenuated these effects of Ang II. Similarly to losartan, ASA, and its SA moiety suppressed Ang II-mediated AT1R transcription and fibroblast proliferation as well as expression of collagens and MMPs. ASA also suppressed the expression of NADPH oxidase subunits (p22{sup phox}, p47{sup phox}, p67{sup phox}, NOX2 and NOX4) and ROS generation. ASA did not affect total NF-κB p65, but inhibited its phosphorylation and activation. These observations suggest that ASA inhibits Ang II-induced NADPH oxidase expression, NF-κB activation and AT1R transcription in cardiac fibroblasts, and fibroblast proliferation and collagen expression. The critical role of NADPH oxidase activity in stimulation of AT1R transcription became apparent in experiments where ASA also inhibited AT1R transcription in cardiac fibroblasts challenged with H{sub 2}O{sub 2}. Since SA had similar effect as ASA on AT1R expression, we suggest that ASA's effect is mediated by its SA moiety. -- Highlights: ► Aspirin in therapeutic concentrations decreases mouse cardiac

  10. Genetic and genome-wide transcriptomic analyses identify co-regulation of oxidative response and hormone transcript abundance with vitamin C content in tomato fruit

    Directory of Open Access Journals (Sweden)

    Lima-Silva Viviana

    2012-05-01

    Full Text Available Abstract Background L-ascorbic acid (AsA; vitamin C is essential for all living plants where it functions as the main hydrosoluble antioxidant. It has diverse roles in the regulation of plant cell growth and expansion, photosynthesis, and hormone-regulated processes. AsA is also an essential component of the human diet, being tomato fruit one of the main sources of this vitamin. To identify genes responsible for AsA content in tomato fruit, transcriptomic studies followed by clustering analysis were applied to two groups of fruits with contrasting AsA content. These fruits were identified after AsA profiling of an F8 Recombinant Inbred Line (RIL population generated from a cross between the domesticated species Solanum lycopersicum and the wild relative Solanum pimpinellifollium. Results We found large variability in AsA content within the RIL population with individual RILs with up to 4-fold difference in AsA content. Transcriptomic analysis identified genes whose expression correlated either positively (PVC genes or negatively (NVC genes with the AsA content of the fruits. Cluster analysis using SOTA allowed the identification of subsets of co-regulated genes mainly involved in hormones signaling, such as ethylene, ABA, gibberellin and auxin, rather than any of the known AsA biosynthetic genes. Data mining of the corresponding PVC and NVC orthologs in Arabidopis databases identified flagellin and other ROS-producing processes as cues resulting in differential regulation of a high percentage of the genes from both groups of co-regulated genes; more specifically, 26.6% of the orthologous PVC genes, and 15.5% of the orthologous NVC genes were induced and repressed, respectively, under flagellin22 treatment in Arabidopsis thaliana. Conclusion Results here reported indicate that the content of AsA in red tomato fruit from our selected RILs are not correlated with the expression of genes involved in its biosynthesis. On the contrary, the data

  11. Ascorbate biosynthesis during early fruit development is the main reason for its accumulation in kiwi.

    Directory of Open Access Journals (Sweden)

    Mingjun Li

    Full Text Available BACKGROUND: Ascorbic acid (AsA is a unique antioxidant as well as an enzyme cofactor. Although it has multiple roles in plants, it is unclear how its accumulation is controlled at the expression level, especially in sink tissues. Kiwifruit (Actinidia is well-known for its high ascorbate content. Our objective was to determine whether AsA accumulates in the fruits primarily through biosynthesis or because it is imported from the foliage. METHODOLOGY/PRINCIPAL FINDINGS: We systematically investigated AsA levels, biosynthetic capacity, and mRNA expression of genes involved in AsA biosynthesis in kiwi (A. deliciosa cv. Qinmei. Recycling and AsA localization were also monitored during fruit development and among different tissue types. Over time, the amount of AsA, with its capacity for higher biosynthesis and lower recycling, peaked at 30 days after anthesis (DAA, and then decreased markedly up to 60 DAA before declining more slowly. Expression of key genes showed similar patterns of change, except for L-galactono-1,4-lactone dehydrogenase and L-galactose-1-phosphate phosphatase (GPP. However, GPP had good correlation with the rate of AsA accumulation. The expression of these genes could be detected in phloem of stem as well as petiole of leaf and fruit. Additionally, fruit petioles had greater ascorbate amounts, although that was the site of lowest expression by most genes. Fruit microtubule tissues also had higher AsA. However, exogenous applications of AsA to those petioles did not lead to its transport into fruits, and distribution of ascorbate was cell-specific in the fruits, with more accumulation occurring in larger cells. CONCLUSIONS: These results suggest that AsA biosynthesis in kiwi during early fruit development is the main reason for its accumulation in the fruits. We also postulate here that GPP is a good candidate for regulating AsA biosynthesis whereas GDP-L-galactose-1-phosphate phosphorylase is not.

  12. Radiation protection with mesalamine (5-amino salicylic acid)

    International Nuclear Information System (INIS)

    Purpose: Radiation proctitis induced during the therapy of rectal and prostate cancers, and radiation injuries in general, are often the principal dose limiting factor limiting dose escalation for radiation therapy. Thus, there has been a continuous search for radioprotective agents, especially those that could selectively protect normal tissues, as opposed to the target cancer. 5-amino salicylic acid (5ASA) is in clinical use as Mesalamine for the local treatment of ulcerative proctitis. Inasmuch as other investigators have identified 5ASA as a free radical scavenger, we determined whether pretreatment with 5ASA could confer radiation protection. Materials and Methods: Adult male C57BL/6J mice obtained from Jackson Laboratories were employed for these studies. We determined LD50 for acute gastrointestinal death for young (≤ 10 weeks old, ≤ 25 gms body weight) and aged (≥ 1 year old, ≥ 35 gms body weight) animals exposed to single fractions (1 - 20 Gy) from three different radiation sources, Cs137, 270 KeV x-rays, and a 4 MeV linear accelerator. Experimental mice were pre- or post-treated with 5ASA in an acidified isotonic saline solution by oral, rectal, or intraperitoneal administration. Animals were housed, maintained by AAALAC standards and treated with antibiotics or acidified water post radiation exposure to control opportunistic infections. Animals were scored for death when moribund. Results: 5ASA was found to be radioprotective by oral, rectal or intraperitoneal administration when given 15 to 90 minutes prior to radiation exposure. Administration of drug following radiation exposure failed to confer radioprotection. We determined a dose effect for 5ASA with maximum tolerated dose of 200 mg/kg administered ip 30 minutes prior to 11 Gy whole body exposure. Dose modification and radioprotection by 5ASA were determined by LD50(6), LD50(30), or LD50(365). More recently, we determined that 5ASA conferred significant radioprotection to mice exposed to

  13. Species Diversity of Hypogeous Ascomycetes in Israel

    OpenAIRE

    Barseghyan, Gayane S.; Wasser, Solomon P

    2010-01-01

    We conducted a species diversity study of the hypogeous Ascomycetes of Israel. The hypogeous Ascomycetes in Israel include members of the families Pyronemataceae, Pezizaceae, and Tuberaceae, which are represented by seven species: Hydnocystis piligera, Terfezia arenaria, T. claveryi, T. oligosperma, Tirmania africana, Tuber asa, and T. nitidum; only T. asa is new to Israeli mycobiota. Synonymy, locations, collection data, general distribution, distribution in Israel, descriptions, a key to id...

  14. Protein nitration and nitrosylation by NO-donating aspirin in colon cancer cells: Relevance to its mechanism of action

    International Nuclear Information System (INIS)

    Nitric oxide-donating aspirin (NO-ASA) is a promising agent for cancer prevention. Although studied extensively, its molecular targets and mechanism of action are still unclear. S-nitrosylation of signaling proteins is emerging as an important regulatory mechanism by NO. Here, we examined whether S-nitrosylation of the NF-κB, p53, and Wnt signaling proteins by NO-ASA might explain, in part, its mechanism of action in colon cancer. NO-ASA releases significant amounts of NO detected intracellularly in HCT116 and HT-29 colon cells. Using a modified biotin switch assay we demonstrated that NO-ASA S-nitrosylates the signaling proteins p53, β-catenin, and NF-κB, in colon cancer cells in a time- and concentration-dependent manner. NO-ASA suppresses NF-κB binding to its cognate DNA oligonucleotide, which occurs without changes in the nuclear levels of the NF-κB subunits p65 and p50 and is reversed by dithiothreitol that reduces -S-NO to -SH. In addition to S-nitrosylation, we documented both in vitro and in vivo widespread nitration of tyrosine residues of cellular proteins in response to NO-ASA. Our results suggest that the increased intracellular NO levels following treatment with NO-ASA modulate cell signaling by chemically modifying key protein members of signaling cascades. We speculate that S-nitrosylation and tyrosine nitration are responsible, at least in part, for the inhibitory growth effect of NO-ASA on cancer cell growth and that this may represent a general mechanism of action of NO-releasing agents.

  15. Aspirin and tension-type headache

    OpenAIRE

    Farinelli, I.; Martelletti, P.

    2007-01-01

    Acetylsalicylic acid (ASA, Aspirin) is among the most used drugs worldwide. At present, Aspirin represents a quite versatile drug employed in the control of pain symptomatologies and in situations such as prevention of both ischaemic stroke and cardiovascular events. Aspirin causes inhibition of prostaglandin (PG) synthesis by inactivation of the cyclooxygenase (COX) enzyme. ASA constitutes the focus of new researches explaining more widely Aspirin’s control of inflammation. The induction of ...

  16. Tanggung Jawab Direksi Perseroan Terbuka Dalam Kerangka Good Corporate Governance Di Pasar Modal

    OpenAIRE

    Hasibuan, Tivani Ruslan

    2010-01-01

    Tanggung jawab Direksi adalah bertanggung jawab penuh atas pengurusan perseroan untuk kepentingan dan tujuan penuh atas pengurusan perseroan untuk kepentingan dan tujuan perseroan, serta mewakili perseroan baik di dalam maupun di luar pengadilan sesuai dengan ketentuan anggaran dasar, yang terdapat dalam UU No 40 Tahun 2007. Mengingat sampai saat ini merupakan kerangka yang paling baik sesuai dengan asas- asas pemerintahan yang berlaku yaitu good corporate governance atau tata kelola perusaha...

  17. Control of cucumber (Cucumis sativus L. tolerance to chilling stress – evaluating the role of ascorbic acid and glutathione

    Directory of Open Access Journals (Sweden)

    Alexander S. Lukatkin

    2014-12-01

    Full Text Available Chilling temperatures (1-10 ºC are known to disturb cellular physiology, cause oxidative stress via creating imbalance between generation and metabolism of reactive oxygen species (ROS leading finally to cell and/or plant death. Owing to known significance of low molecular antioxidants - ascorbic acid (AsA and glutathione (GSH in plant stress-tolerance, this work analyzes the role of exogenously applied AsA and GSH in the alleviation of chilling stress (3°C-impact in cucumber (Cucumis sativus L. cv. Vjaznikowskij 37 plants. Results revealed AsA and GSH concentration dependent metabolism of ROS such as superoxide (O2•‾ and the mitigation of ROS-effects such as lipid peroxidation (LPO as well as membrane permeability (measured as electrolyte leakage in C. sativus leaf discs. AsA concentration (750 µM and GSH (100 µM exhibited maximum reduction in O2•‾ generation, LPO intensity as well as electrolyte leakage, all of these were increased in cold water (3°C and 25°C-treated leaf discs. However, AsA, in particular, had a pronounced antioxidative effect, more expressed in case of leaf discs during chilling (3°C; whereas, at temperature 25°C, some AsA concentrations (such as 50 and 100 mM AsA exhibited a prooxidative effect that requires molecular-genetic studies. Overall, it is inferred that AsA and GSH have high potential for sustainably increasing chilling-resistance in plants.

  18. Effect of the ulcerogenic agents ethanol, acetylsalicylic acid and taurocholate on actin cytoskeleton and cell motility in cultured rat gastric mucosal cells

    Institute of Scientific and Technical Information of China (English)

    Siamak Bidel; Harri Mustonen; Giti Khalighi-Sikaroudi; Eero Lehtonen; Pauli Puolakkainen; Tuula Kiviluoto; Eero Kivilaakso

    2005-01-01

    AIM: To assess the effects of ulcerogenic agents on actin cytoskeleton and cell motility and the contribution of oxidative stress.METHODS: Rat gastric mucosal cell monolayers were cultured on coverslips. The cells were exposed, with or without allopurinol (2 mmol/L), for 15 min to ethanol (10-150 mL/L), ASA (1-20 mmol/L) or taurocholate (1-20 mmol/L), then the cells were processed for actin and vinculin staining. Cell migration after wounding was also measured.RESULTS: Exposure to 10 mL/L ethanol caused divergence of zonula adherens-associated actin bundles of adjacent cells and decreased rate of migration. These actions were opposed by xanthine oxidase inhibitor allopurinol. Exposure to 50 mL/L ethanol induced degradation and divergence of zonula adherens-associated vinculin from adjacent cells,which was, again, partially reverted by allopurinol. With 1 mmol/L ASA actin filaments became shorter and thicker.However, higher concentrations (10, 20 mmol/L) of ASA returned microfilaments thinner and longer, and decreased rate of migration. Zonula adherens-associated actin bundles were moderately distorted with 10 mmol/L ASA and with 10 mmol/L taurocholate. Exposure to taurocholate provoked changes resembling those of ASA. Taurocholate 5-20 mmol/L decreased the rate of migration dose dependently. The effects of ASA and taurocholate were not prevented by allopurinol.CONCLUSION: All ulcerogenic agents decreased the rate of migration dose dependently and induced divergence of zonula adherens-associated actin bundles of adjacent cells.In addition, ethanol and ASA caused degradation of actin cytoskeleton. Oxidative stress seems to underlie ethanol,but not ASA or taurocholate, induced cytoskeletal damage.

  19. Allopurinol and 5-aminosalicylic acid influence thiopurine-induced hepatotoxicity in vitro

    OpenAIRE

    Broekman, Mark M. T. J.; Roelofs, Hennie M. J.; Wong, Dennis R.; Kerstholt, Mariska; Leijten, Alex; Hoentjen, Frank; Peters, Wilbert H. M.; Geert J A Wanten; de Jong, Dirk J.

    2015-01-01

    Introduction The use of thiopurines is frequently accompanied by hepatotoxicity. Studies on hepatocyte cultures showed a time- and dose-dependent increase of thiopurine toxicity. 5-Aminosalicylic acid (5-ASA) and allopurinol can influence thiopurine metabolism; however, it is unknown whether this affects in vitro cytotoxicity. Methods Human hepatoma cells (Huh7, HepG2 and HepaRG) were incubated with increasing concentrations of thiopurines, 5-ASA or allopurinol. Water-soluble tetrazolium salt...

  20. Multiple giant succular and fusiform right and left coronary artery aneurysms after early and adequate treatment of atypical kawasaki disease with unusual presentation.

    Directory of Open Access Journals (Sweden)

    Mostafa Behjati-Ardakani

    2014-06-01

    Full Text Available The major complication of Kawasaki disease is coronary artery dilatation and aneurysm. It occurs in approximately 15-25% of untreated children with Kawasaki Disease. Early diagnosis and treatment with Intravenous immune globulin (IVIG and aspirin (ASA can reduce the incidence of coronary artery abnormality to 2%-5%. We report one case of Atypical Kawasaki Disease with Multiple giant coronary artery aneurysms despite early adequate treatment with IVIG and ASA.

  1. Co-existence of hepatitis A and adult Reye's syndrome.

    OpenAIRE

    Duerksen, D R; Jewell, L.D.; Mason, A L; Bain, V. G.

    1997-01-01

    Reye's syndrome is most frequently seen in children but has also been described in adults. This syndrome is usually associated with ingestion of 5-aminosalicylates (ASA) or infection with influenza A, influenza B, or varicella virus. A case of Reye's syndrome in a 47 year old, previously healthy woman precipitated by ingestion of ASA and acute hepatitis A virus infection is described. Reye's syndrome was diagnosed on the basis of her clinical course, and the presence of hepatic microvesicular...

  2. Molecular and functional analysis of phosphomannomutase (PMM) from higher plants and genetic evidence for the involvement of PMM in ascorbic acid biosynthesis in Arabidopsis and Nicotiana benthamiana

    DEFF Research Database (Denmark)

    Qian, W; Yu, C; Qin, H;

    2007-01-01

    constitutively expressed in both vegetative and reproductive organs. Reducing the PMM expression level through virus-induced gene silencing caused a substantial decrease in ascorbic acid (AsA) content in N. benthamiana leaves. Conversely, raising the PMM expression level in N. benthamiana using viral...... and provides genetic evidence on the involvement of PMM in the biosynthesis of AsA in Arabidopsis and N. benthamiana plants....

  3. Bipolar Saline TURP for Large Prostate Glands

    OpenAIRE

    Finley, David S.; Shawn Beck; Szabo, Richard J.

    2007-01-01

    The objective of this study was to evaluate the feasibility of bipolar transurethral resection of the prostate ( TURP) in patients with very large prostate glands and significant comorbidities. Four patients with prostate glands > 160 cc on preoperative volume measurement and ASA class three or higher underwent bipolar TURP with the Gyrus PlasmaKinetic system. Preoperative, operative, and postoperative parameters were studied. The results showed an average ASA class 3.25 (range: 3-4). The ave...

  4. Saposin B-dependent reconstitution of arylsulfatase A activity in vitro and in cell culture models of metachromatic leukodystrophy.

    Science.gov (United States)

    Matzner, Ulrich; Breiden, Bernadette; Schwarzmann, Günter; Yaghootfam, Afshin; Fluharty, Arvan L; Hasilik, Andrej; Sandhoff, Konrad; Gieselmann, Volkmar

    2009-04-01

    Arylsulfatase A (ASA) catalyzes the intralysosomal desulfation of 3-O-sulfogalactosylceramide (sulfatide) to galactosylceramide. The reaction requires saposin B (Sap B), a non-enzymatic proteinaceous cofactor which presents sulfatide to the catalytic site of ASA. The lack of either ASA or Sap B results in a block of sulfatide degradation, progressive intralysosomal accumulation of sulfatide, and the fatal lysosomal storage disease metachromatic leukodystrophy. We studied the coupled Sap B-ASA reaction in vitro using detergent-free micellar and liposomal assay systems and in vivo using cell culture models of metachromatic leukodystrophy. Under in vitro conditions, the reaction had a narrow pH optimum around pH 4.3 and was inhibited by mono- and divalent cations, phosphate and sulfite. Bis(monoacylglycero) phosphate and phosphatidic acid were activators of the reaction, underscoring a significant role of acidic phosphoglycerolipids in sphingolipid degradation. Desulfation was negligible when Sap B was substituted by Sap A, C, or D. Up to a molar ratio between Sap B and sulfatide of 1:5, an elevation of Sap B concentrations caused a sharp increase of sulfatide hydrolysis, indicating the requirement of unexpected high Sap B levels for maximum turnover. Feeding of ASA-deficient, sulfatide-storing primary mouse kidney cells with ASA caused partial clearance of sulfatide. Co-feeding of Sap B or its precursor prosaposin resulted in the lysosomal uptake of the cofactor but did not promote ASA-catalyzed sulfatide hydrolysis. This suggests that Sap B is not a limiting factor of the coupled Sap B-ASA reaction in mouse kidney cells even if sulfatide has accumulated to unphysiologically high levels. PMID:19224915

  5. Saposin B-dependent Reconstitution of Arylsulfatase A Activity in Vitro and in Cell Culture Models of Metachromatic Leukodystrophy*

    Science.gov (United States)

    Matzner, Ulrich; Breiden, Bernadette; Schwarzmann, Günter; Yaghootfam, Afshin; Fluharty, Arvan L.; Hasilik, Andrej; Sandhoff, Konrad; Gieselmann, Volkmar

    2009-01-01

    Arylsulfatase A (ASA) catalyzes the intralysosomal desulfation of 3-O-sulfogalactosylceramide (sulfatide) to galactosylceramide. The reaction requires saposin B (Sap B), a non-enzymatic proteinaceous cofactor which presents sulfatide to the catalytic site of ASA. The lack of either ASA or Sap B results in a block of sulfatide degradation, progressive intralysosomal accumulation of sulfatide, and the fatal lysosomal storage disease metachromatic leukodystrophy. We studied the coupled Sap B-ASA reaction in vitro using detergent-free micellar and liposomal assay systems and in vivo using cell culture models of metachromatic leukodystrophy. Under in vitro conditions, the reaction had a narrow pH optimum around pH 4.3 and was inhibited by mono- and divalent cations, phosphate and sulfite. Bis(monoacylglycero) phosphate and phosphatidic acid were activators of the reaction, underscoring a significant role of acidic phosphoglycerolipids in sphingolipid degradation. Desulfation was negligible when Sap B was substituted by Sap A, C, or D. Up to a molar ratio between Sap B and sulfatide of 1:5, an elevation of Sap B concentrations caused a sharp increase of sulfatide hydrolysis, indicating the requirement of unexpected high Sap B levels for maximum turnover. Feeding of ASA-deficient, sulfatide-storing primary mouse kidney cells with ASA caused partial clearance of sulfatide. Co-feeding of Sap B or its precursor prosaposin resulted in the lysosomal uptake of the cofactor but did not promote ASA-catalyzed sulfatide hydrolysis. This suggests that Sap B is not a limiting factor of the coupled Sap B-ASA reaction in mouse kidney cells even if sulfatide has accumulated to unphysiologically high levels. PMID:19224915

  6. Acetyl salicylic acid inhibits Th17 airway inflammation via blockade of IL-6 and IL-17 positive feedback

    OpenAIRE

    Moon, Hyung-Geun; Kang, Chil Sung; Choi, Jun-Pyo; Choi, Dong Sic; Choi, Hyun Il; Choi, Yong Wook; Jeon, Seong Gyu; Yoo, Joo-Yeon; Jang, Myoung Ho; Gho, Yong Song; Kim, Yoon-Keun

    2013-01-01

    T-helper (Th)17 cell responses are important for the development of neutrophilic inflammatory disease. Recently, we found that acetyl salicylic acid (ASA) inhibited Th17 airway inflammation in an asthma mouse model induced by sensitization with lipopolysaccharide (LPS)-containing allergens. To investigate the mechanism(s) of the inhibitory effect of ASA on the development of Th17 airway inflammation, a neutrophilic asthma mouse model was generated by intranasal sensitization with LPS plus ova...

  7. Identification of major degradation products of 5-aminosalicylic acid formed in aqueous solutions and in pharmaceuticals

    DEFF Research Database (Denmark)

    Jensen, J.; Cornett, Claus; Olsen, C. E.;

    1992-01-01

    The formation of four major degradation products of 5-aminosalicylic acid (5-ASA) in buffered solutions at pH 7.0 was demonstrated by gradient HPLC analysis. The isolation and structural elucidation of the resulting degradation products showed that the degradation of 5-ASA led to the formation of......-containing pharmaceuticals, which had not been stored as prescribed, but in diffuse daylight for up to 2 years....

  8. Hemodynamic stability in total intravenous propofol anesthesia with midazolam coinduction versus general balanced anaesthesia in laparoscopic cholecystectomy

    OpenAIRE

    Šurbatović Maja; Vesić Zoran; Đorđević Dragan; Radaković Sonja; Zeba Snježana; Jovanović Duško; Novaković Marijan

    2012-01-01

    Background/Aim. Laparoscopic cholecystectomy can be a greater challenge for anesthesiologist than for surgeon if the patient is ASA III with concomitant cardiovascular diseases. The aim of our study was to compare the effect of total intravenous anesthesia (TIVA - propofol with midazolam) and general balanced anesthesia (GBA - midazolam, thiopenton, nitrous oxide and O2) on hemodynamic stability in the ASA III patients who underwent laparoscopic cholecystectomy. Methods. In our study, 6...

  9. Sociology and Classical Liberalism

    OpenAIRE

    KLEIN, Daniel; Stern, Lotta

    2005-01-01

    We advocate the development of a classical-liberal character within professional sociology. The American Sociological Association (ASA) is taken as representative of professional sociology in the United States. We review the ASA’s activities and organizational statements, to show the association’s leftist character. Internal criticism is often very uneasy about leftist domination of the field. We present survey results establishing that, in voting and in policy views, the ASA membership is mo...

  10. Protein nitration and nitrosylation by NO-donating aspirin in colon cancer cells: Relevance to its mechanism of action

    Energy Technology Data Exchange (ETDEWEB)

    Williams, Jennie L.; Ji, Ping; Ouyang, Nengtai [Division of Cancer Prevention, Stony Brook University, HSC, T17-080, Stony Brook, NY 11794-8173 (United States); Kopelovich, Levy [Division of Cancer Prevention NCI, NIH, Bethesda, MD (United States); Rigas, Basil, E-mail: basil.rigas@stonybrook.edu [Division of Cancer Prevention, Stony Brook University, HSC, T17-080, Stony Brook, NY 11794-8173 (United States)

    2011-06-10

    Nitric oxide-donating aspirin (NO-ASA) is a promising agent for cancer prevention. Although studied extensively, its molecular targets and mechanism of action are still unclear. S-nitrosylation of signaling proteins is emerging as an important regulatory mechanism by NO. Here, we examined whether S-nitrosylation of the NF-{kappa}B, p53, and Wnt signaling proteins by NO-ASA might explain, in part, its mechanism of action in colon cancer. NO-ASA releases significant amounts of NO detected intracellularly in HCT116 and HT-29 colon cells. Using a modified biotin switch assay we demonstrated that NO-ASA S-nitrosylates the signaling proteins p53, {beta}-catenin, and NF-{kappa}B, in colon cancer cells in a time- and concentration-dependent manner. NO-ASA suppresses NF-{kappa}B binding to its cognate DNA oligonucleotide, which occurs without changes in the nuclear levels of the NF-{kappa}B subunits p65 and p50 and is reversed by dithiothreitol that reduces -S-NO to -SH. In addition to S-nitrosylation, we documented both in vitro and in vivo widespread nitration of tyrosine residues of cellular proteins in response to NO-ASA. Our results suggest that the increased intracellular NO levels following treatment with NO-ASA modulate cell signaling by chemically modifying key protein members of signaling cascades. We speculate that S-nitrosylation and tyrosine nitration are responsible, at least in part, for the inhibitory growth effect of NO-ASA on cancer cell growth and that this may represent a general mechanism of action of NO-releasing agents.

  11. Ascorbic acid mitigation of water stress-inhibition of root growth in association with oxidative defense in tall fescue (Festuca arundinacea Schreb.)

    OpenAIRE

    Xu, Yi; Xu, Qian; Huang, Bingru

    2015-01-01

    Root growth inhibition by water stress may be related to oxidative damages. The objectives of this study were to determine whether exogenous application of ascorbic acid (ASA) could mitigate root growth decline due to water stress and whether ASA effects on root growth could be regulated through activating non-enzymatic or enzymatic antioxidant systems in perennial grass species. Tall fescue (Festuca arundinacea Schreb. cv. “K-31”) plants were grown in nutrient solution, and polyethylene glyc...

  12. A comparative study of efficacy of esmolol and fentanyl for pressure attenuation during laryngoscopy and endotracheal intubation

    OpenAIRE

    Gupta, Shobhana; Tank, Purvi

    2011-01-01

    Objective: To compare the effectiveness of single bolus dose of esmolol or fentanyl in attenuating the hemodynamic responses during laryngoscopy and endotracheal intubation. Methods: Ninety adult ASA I and ASA II patients were included in the study who underwent elective surgical procedures. Patients were divided into three groups. Group C (control) receiving 10 ml normal saline, group E (esmolol) receiving bolus dose of esmolol 2 mg/kg and group F (fentanyl) receiving bolus dose of fentanyl ...

  13. Abscisic acid enhances tolerance of wheat seedlings to drought and regulates transcript levels of genes encoding ascorbate-glutathione biosynthesis.

    Science.gov (United States)

    Wei, Liting; Wang, Lina; Yang, Yang; Wang, Pengfei; Guo, Tiancai; Kang, Guozhang

    2015-01-01

    Glutathione (GSH) and ascorbate (ASA) are associated with the abscisic acid (ABA)-induced abiotic tolerance in higher plant, however, its molecular mechanism remains obscure. In this study, exogenous application (10 μM) of ABA significantly increased the tolerance of seedlings of common wheat (Triticum aestivum L.) suffering from 5 days of 15% polyethylene glycol (PEG)-stimulated drought stress, as demonstrated by increased shoot lengths and shoot and root dry weights, while showing decreased content of hydrogen peroxide (H2O2) and malondialdehyde (MDA). Under drought stress conditions, ABA markedly increased content of GSH and ASA in both leaves and roots of ABA-treated plants. Temporal and spatial expression patterns of eight genes encoding ASA and GSH synthesis-related enzymes were measured using quantitative real-time reverse transcription polymerase chain reaction (qPCR). The results showed that ABA temporally regulated the transcript levels of genes encoding ASA-GSH cycle enzymes. Moreover, these genes exhibited differential expression patterns between the root and leaf organs of ABA-treated wheat seedlings during drought stress. These results implied that exogenous ABA increased the levels of GSH and ASA in drought-stressed wheat seedlings in time- and organ-specific manners. Moreover, the transcriptional profiles of ASA-GSH synthesis-related enzyme genes in the leaf tissue were compared between ABA- and salicylic acid (SA)-treated wheat seedlings under PEG-stimulated drought stress, suggesting that they increased the content of ASA and GSH by differentially regulating expression levels of ASA-GSH synthesis enzyme genes. Our results increase our understanding of the molecular mechanism of ABA-induced drought tolerance in higher plants. PMID:26175737

  14. Use of Aspirin Associates with Longer Primary Patency of Hemodialysis Grafts

    OpenAIRE

    Dixon, Bradley S.; Beck, Gerald J.; Dember, Laura M; Vazquez, Miguel A.; Greenberg,Arthur; Delmez, James A.; Allon, Michael; Himmelfarb, Jonathan; Hu, Bo; Greene, Tom; Radeva, Milena K.; Davidson, Ingemar J.; Ikizler, T. Alp; Braden, Gregory L.; Lawson, Jeffrey H.

    2011-01-01

    Extended-release dipyridamole plus low-dose aspirin (ERDP/ASA) prolongs primary unassisted graft patency of newly created hemodialysis arteriovenous grafts, but the individual contributions of each component are unknown. Here, we analyzed whether use of aspirin at baseline associated with primary unassisted graft patency among participants in a randomized trial that compared ERDP/ASA and placebo in newly created grafts. We used Cox proportional hazards regression, adjusting for prespecified b...

  15. Masking of Pressure Overload in a Patient with Pulmonary Thromboembolism Accompanied by Atrial Septal Aneurysm

    OpenAIRE

    Yu, Tae Kyung; Kim, Woo Shik; Kim, Weon

    2011-01-01

    A pulmonary thromboembolism (PTE) causes a dramatic pressure overload to the right heart. Previous case reports have shown that elevated right atrial pressure secondary to a PTE can cause right-to-left shunting in the presence of an atrial septal aneurysm (ASA). A 57-year-old female with diabetes, hypertension, and an old cerebral infarction was admitted to our hospital with acute PTE. Initial transthoracic echocardiography (TTE) showed an ASA swing from the right side to the left side, and r...

  16. A metabolomics strategy to explore urinary biomarkers and metabolic pathways for assessment of interaction between Danhong injection and low-dose aspirin during their synergistic treatment.

    Science.gov (United States)

    Li, Jianping; Guo, Jianming; Shang, Erxin; Zhu, Zhenhua; Zhu, Kevin Yue; Li, Shujiao; Zhao, Buchang; Jia, Lifu; Zhao, Jing; Tang, Zhishu; Duan, Jinao

    2016-07-15

    The drug combination of Danhong injection (DHI) and low-dose aspirin (ASA) was frequently applied for the treatment of cardiovascular and cerebrovascular diseases. Due to the drug interactions, a lot of potential benefits and risks might exist side by side in the course of combination therapy. However, there had been no studies of interaction between DHI and ASA. Metabolomics was a powerful tool to explore endogenous biomarkers and metabolic pathways. In present study, metabolic profiling with ultra-high-performance liquid chromatography coupled to quadrupole time of flight mass spectrometry (UHPLC-QTOF/MS) coupled with multivariate statistical analysis was performed to provide insight into understanding the interaction between DHI and low-dose ASA. Eleven potential biomarkers of three types were identified and seven metabolic pathways were constructed. The results showed that the interaction between DHI and low-dose ASA during synergistic treatment indeed affected some key endogenous biomarkers and metabolic pathways, which could not happen when DHI or low-dose ASA was used alone. The quality and quantity of endogenous metabolite were both influenced by interaction between DHI and low-dose ASA. In details, the amount of flavin mononucleotide, L-2, 4-diaminobutyric acid (DABA) and 4-aminohippuric acid were significantly increased. On the contrary, the amount of 3-methyluridine, 4, 6-dihydroxyquinoline, cortolone-3-glucuronide, and serotonin were significantly decreased. Furthermore, O-phosphotyrosine, 3-methyl-2-butenal, indoxyl sulfate and dolichyl diphosphate were disappeared in urine. As to metabolic pathways, riboflavin metabolism, pentose and glucuronate interconversions, and tryptophan metabolism were all significantly influenced. The emerging alterations of biomarkers and metabolic pathways were associated with a lot of drugs and diseases based on literature researches, which might influence the co-administration of other drugs or the treatments of relevant

  17. Elevated ratio of urinary metabolites of thromboxane and prostacyclin is associated with adverse cardiovascular events in ADAPT.

    Directory of Open Access Journals (Sweden)

    Thomas J Montine

    Full Text Available Results from prevention trials, including the Alzheimer's Disease Anti-inflammatory Prevention Trial (ADAPT, have fueled discussion about the cardiovascular (CV risks associated with non-steroidal anti-inflammatory drugs (NSAIDs. We tested the hypotheses that (i adverse CV events reported among ADAPT participants (aged 70 years and older are associated with increased ratio of urine 11-dehydrothromboxane B(2 (Tx-M to 2'3-donor-6-keto-PGF1 (PGI-M attributable to NSAID treatments; (ii coincident use of aspirin (ASA would attenuate NSAID-induced changes in Tx-M/PGI-M ratio; and (iii use of NSAIDs and/or ASA would not alter urine or plasma concentrations of F(2-isoprostanes (IsoPs, in vivo biomarkers of free radical damage. We quantified urine Tx-M and PGI-M, and urine and plasma F(2-IsoPs from 315 ADAPT participants using stable isotope dilution assays with gas chromatography/mass spectrometry, and analyzed these data by randomized drug assignment and self-report compliance as well as ASA use. Adverse CV events were significantly associated with higher urine Tx-M/PGI-M ratio, which seemed to derive mainly from lowered PGI-M. Participants taking ASA alone had reduced urine Tx-M/PGI-M compared to no ASA or NSAID; however, participants taking NSAIDs plus ASA did not have reduced urine Tx-M/PGI-M ratio compared to NSAIDs alone. Neither NSAID nor ASA use altered plasma or urine F(2-IsoPs. These data suggest a possible mechanism for the increased risk of CV events reported in ADAPT participants assigned to NSAIDs, and suggest that the changes in the Tx-M/PGI-M ratio was not substantively mitigated by coincident use of ASA in individuals 70 years or older.

  18. Validation of HPLC, DPPH• and nitrosation methods for mesalamine determination in pharmaceutical dosage forms Validação dos métodos de CLAE, DPPH• e nitrosação para determinação de mesalazina em formas farmacêuticas

    OpenAIRE

    Janice Aparecida Rafael; José Roberto Jabor; Rúbia Casagrande; Sandra Regina Georgetti; Maria de Fátima Borin; Maria José Vieira Fonseca

    2007-01-01

    Mesalamine (5-aminosalicylic acid, 5-ASA) is used because of its local effects in the treatment of inflammatory bowel disease. Therefore, the aims of this work were to compare and validate three analytical methods for the quality control of commercial coated tablets containing 5-ASA: high performance liquid chromatography (HPLC), 1,1-diphenyl-2-picrylhydrazyl radicals (DPPH•) and nitrosation. The parameters linearity, precision and accuracy were studied in this work. HPLC with ultraviole...

  19. A novel aspirin prodrug inhibits NFκB activity and breast cancer stem cell properties

    OpenAIRE

    Kastrati, Irida; Litosh, Vladislav A.; Zhao, Shuangping; Alvarez, Manuel; Thatcher, Gregory R.J.; Frasor, Jonna

    2015-01-01

    Introduction Activation of cyclooxygenase (COX)/prostaglandin and nuclear factor κB (NFκB) pathways can promote breast tumor initiation, growth, and progression to drug resistance and metastasis. Thus, anti-inflammatory drugs have been widely explored as chemopreventive and antineoplastic agents. Aspirin (ASA), in particular, is associated with reduced breast cancer incidence but gastrointestinal toxicity has limited its usefulness. To improve potency and minimize toxicity, ASA ester prodrugs...

  20. NAC attenuates LPS-induced toxicity in aspirin-sensitized mouse macrophages via suppression of oxidative stress and mitochondrial dysfunction.

    Directory of Open Access Journals (Sweden)

    Haider Raza

    Full Text Available Bacterial endotoxin lipopolysaccharide (LPS induces the production of inflammatory cytokines and reactive oxygen species (ROS under in vivo and in vitro conditions. Acetylsalicylic acid (ASA, aspirin is a commonly used anti-inflammatory drug. Our aim was to study the effects of N-acetyl cysteine (NAC, an antioxidant precursor of GSH synthesis, on aspirin-sensitized macrophages treated with LPS. We investigated the effects of LPS alone and in conjunction with a sub-toxic concentration of ASA, on metabolic and oxidative stress, apoptosis, and mitochondrial function using J774.2 mouse macrophage cell line. Protection from LPS-induced toxicity by NAC was also studied. LPS alone markedly induced ROS production and oxidative stress in macrophage cells. When ASA was added to LPS-treated macrophages, the increase in oxidative stress was significantly higher than that with LPS alone. Similarly, alteration in glutathione-dependent redox metabolism was also observed in macrophages after treatment with LPS and ASA. The combination of LPS and ASA selectively altered the CYP 3A4, CYP 2E1 and CYP 1A1 catalytic activities. Mitochondrial respiratory complexes and ATP production were also inhibited by LPS-ASA treatment. Furthermore a higher apoptotic cell death was also observed in LPS-ASA treated macrophages. NAC pre-treatment showed protection against oxidative stress induced apoptosis and mitochondrial dysfunction. These effects are presumed, at least in part, to be associated with alterations in NF-κB/Nrf-2 mediated cell signaling. These results suggest that macrophages are more sensitive to LPS when challenged with ASA and that NAC pre-treatment protects the macrophages from these deleterious effects.

  1. The epigenetic effects of aspirin: the modification of histone H3 lysine 27 acetylation in the prevention of colon carcinogenesis in azoxymethane- and dextran sulfate sodium-treated CF-1 mice.

    Science.gov (United States)

    Guo, Yue; Liu, Yue; Zhang, Chengyue; Su, Zheng-Yuan; Li, Wenji; Huang, Mou-Tuan; Kong, Ah-Ng

    2016-06-01

    Colorectal cancer (CRC) is the third most common cancer worldwide. Chronic inflammation appears to enhance the risk of CRC. Emerging evidence has suggested that epigenetic mechanisms play an important role in CRC. Aspirin [acetylsalicylic acid (ASA)] has been shown to prevent CRC; however, the epigenetic mechanisms of its action remain unknown. This study investigated the protective role of ASA in azoxymethane (AOM)-initiated and dextran sulfate sodium (DSS)-promoted colitis-associated colon cancer (CAC) and examined the epigenetic effects, particularly on histone 3 lysine 27 acetylation (H3K27ac), underlying the preventive effect of ASA. CF-1 mice were fed with AIN-93M diet with or without 0.02% ASA from 1 week prior to AOM initiation until the mice were killed 20 weeks after AOM injection. Our results showed that AOM/DSS + ASA significantly suppressed inflammatory colitis symptoms and tumor multiplicity. AOM/DSS + ASA reduced AOM/DSS-induced protein expression and the activity of histone deacetylases (HDACs) and globally restored H3K27ac. Furthermore, AOM/DSS + ASA inhibited AOM/DSS-induced enrichment of H3K27ac in the promoters of inducible nitric oxide synthase (iNOS), tumor necrosis factor alpha (TNF-α) and interleukin 6 (IL-6) that corresponded to the dramatic suppression of the messenger RNA (mRNA) and protein levels. Surprisingly, no significant changes in the H3K27ac abundance in the prostaglandin-endoperoxide synthase 2 (Cox-2) promoters or in the Cox-2 mRNA and protein expression were observed. Collectively, our results suggest that a potential novel epigenetic mechanism underlies the chemopreventive effects of ASA, and this mechanism attenuates CAC in AOM/DSS-induced CF-1 mice via the inhibition of HDACs and the modification of H3K27ac marks that suppress iNOS, TNF-α and IL-6. PMID:27207670

  2. Identification of the segmental artery feeding the anterior spinal artery. Correlation between helical CT and angiography

    International Nuclear Information System (INIS)

    We investigated whether identification of the segmental artery feeding the anterior spinal artery (ASA) is possible by single-slice helical CT. Enhanced CT and angiography were performed in 14 patients with retroperitoneal, liver, or bone tumor. A single-slice helical CT scanner with 7 mm collimation and a 1.0 helical pitch was used. Scanning was started 25 to 30 sec after an intravenous injection of 100 ml of contrast medium at a rate of 3.0 ml/sec. We predicted the segmental artery feeding the ASA in all 14 patients using enhanced CT images. In 12 of the 14 patients, the segmental artery feeding the ASA was angiographically identified. In 7 of these 12 patients, the level of the segmental artery feeding the ASA identified on segmental arteriogram was the same level as that predicted by enhanced CT. In the remaining 5 patients, the level of the segmental artery feeding the ASA identified on segmental arteriogram was one level higher or lower than the predicted spinal level. We could identify the segmental artery feeding the ASA by detailed examination and interpretation of single-slice helical CT images. (author)

  3. Increased antioxidant capacity in tomato by ectopic expression of the strawberry D-galacturonate reductase gene.

    Science.gov (United States)

    Amaya, Iraida; Osorio, Sonia; Martinez-Ferri, Elsa; Lima-Silva, Viviana; Doblas, Veronica G; Fernández-Muñoz, Rafael; Fernie, Alisdair R; Botella, Miguel A; Valpuesta, Victoriano

    2015-03-01

    Increasing L-ascorbic acid (AsA, vitamin C) content in fruits is a common goal in current breeding programs due to its beneficial effect on human health. Attempts to increase AsA content by genetic engineering have resulted in variable success likely due to AsA's complex regulation. Here, we report the effect of ectopically expressing in tomato the D-galacturonate reductase (FaGalUR) gene from strawberry, involved in AsA biosynthesis, either under the control of the constitutive 35S or the tomato fruit-specific polygalucturonase (PG) promoters. Although transgenic lines showed a moderate increase on AsA content, complex changes in metabolites were found in transgenic fruits. Metabolomic analyses of ripe fruits identified a decrease in citrate, glutamate, asparagine, glucose, and fructose, accompanied by an increase of sucrose, galactinol, and chlorogenic acid. Significant metabolic changes also occurred in leaves of 35S-FaGalUR lines, which showed higher non-photochemical fluorescence quenching (NPQ), indicative of a higher constitutive photo-protective capacity. Overall, overexpression of FaGalUR increased total antioxidant capacity in fruits and the results suggest a tight control of AsA content, probably linked to a complex regulation of cellular redox state and metabolic adjustment. PMID:25143316

  4. Acetylsalicylic Acid Reduces the Severity of Dextran Sodium Sulfate-Induced Colitis and Increases the Formation of Anti-Inflammatory Lipid Mediators

    Directory of Open Access Journals (Sweden)

    Thomas Köhnke

    2013-01-01

    Full Text Available The role of non-steroidal anti-inflammatory drugs in inflammatory bowel disease is controversial, as they have been implicated in disease aggravation. Different from other cyclooxygenase inhibitors, acetylsalicylic acid (ASA enhances the formation of anti-inflammatory and proresolution lipoxins derived from arachidonic acid as well as resolvins from omega-3 polyunsaturated fatty acids such as docosahexaenoic acid (DHA. In this study, we examined the effect of ASA on murine dextran sodium sulfate colitis. A mouse magnetic resonance imaging (MRI protocol and post mortem assessment were used to assess disease severity, and lipid metabolites were measured using liquid chromatography-coupled tandem mass spectrometry. Decreased colitis activity was demonstrated by phenotype and MRI assessment in mice treated with ASA, and confirmed in postmortem analysis. Analysis of lipid mediators showed sustained formation of lipoxin A4 and an increase of DHA-derived 17-hydroxydocosahexaenoic acid (17-HDHA after treatment with ASA. Furthermore, in vitro experiments in RAW264.7 murine macrophages demonstrated significantly increased phagocytosis activity after incubation with 17-HDHA, supporting its proresolution effect. These results show a protective effect of ASA in a murine colitis model and could give a rationale for a careful reassessment of ASA therapy in patients with inflammatory bowel disease and particularly ulcerative colitis, possibly combined with DHA supplementation.

  5. Cryopreserved Amniotic Suspension for the Treatment of Knee Osteoarthritis.

    Science.gov (United States)

    Vines, Jeremy B; Aliprantis, Antonios O; Gomoll, Andreas H; Farr, Jack

    2016-08-01

    There are few treatment options for symptomatic knee osteoarthritis (OA). Human amniotic suspension allografts (ASA) have anti-inflammatory and chondroregenerative potential and thus represent a promising treatment strategy. In anticipation of a large, placebo-controlled trial of intra-articular ASA for symptomatic knee OA, an open-label prospective feasibility study was performed. Six patients with Kellgren-Lawrence grades 3 and 4 tibiofemoral knee OA were administered a single intra-articular ASA injection containing cryopreserved particulated human amnion and amniotic fluid cells. Patients were followed for 12 months after treatment. No significant injection reactions were noted. Compared with baseline there were (1) no significant effect of the ASA injection on blood cell counts, lymphocyte subsets, or inflammatory markers and (2) a small, but statistically significant increase in serum IgG and IgE levels. Patient-reported outcomes including International Knee Documentation Committee, Knee Injury and Osteoarthritis Outcome, and Single Assessment Numeric Evaluation scores were collected throughout the study and evaluated for up to 12 months. Overall, this study demonstrates the feasibility of a single intra-articular injection of ASA for the treatment of knee OA and provides the foundation for a large placebo-controlled trial of intra-articular ASA for symptomatic knee OA. PMID:26683979

  6. Neutrophils influx and proinflammatory cytokines inhibition by sodium salicylate, unlike aspirin, in Candida albicans-induced peritonitis model.

    Science.gov (United States)

    Pereira, Priscilla Aparecida Tártari; Bini, Daniel; Bovo, Fernanda; Faccioli, Lucia Helena; Monteiro, Marta Chagas

    2016-07-01

    Sodium salicylate (NaS) and aspirin (ASA) are known to have a variety of effects on microorganisms, such as fungus (C. albicans and C. neoformans), moreover, it have effects in leukocyte adhesion and migration in vitro. In this report, we investigated the effect of ASA and NaS in neutrophil migration and cytokine production in C. albicans-induced peritonitis murine model. For this, mice were treated intraperitoneally (i.p) or orally (po) with NaS or ASA; after they were stimulated i.p. with C. albicans, the cellular migration was evaluated 24 h after stimulation. NaS, in mice treated i.p., unlike ASA, was able to inhibit the neutrophil migration and proinflammatory cytokine production induced by C. albicans, such as TNF-α, IL-1, IFN-γ, IL-12, and IL-10, but did not alter the IL-4 levels in these animals. However, the po treatment with same the dose of NaS or ASA did not affect the influx of this cell for inflammatory site. These results suggest that the NaS inhibits cellular migration and proinflammatory cytokine by different anti-inflammatory mechanism compared to ASA. PMID:26762336

  7. Influence of antisperm antibodies in the semen on intracytoplasmic sperm injection outcome

    Directory of Open Access Journals (Sweden)

    Sandro C. Esteves

    2007-12-01

    Full Text Available OBJECTIVE: The aim of this study was to analyze the influence of autoantibodies against spermatozoa present in the semen on the outcome of in vitro fertilization with intracytoplasmic sperm injection (ICSI. MATERIALS AND METHODS: We performed a retrospective analysis of clinical and laboratorial data from a six year-period ICSI cycles. Screening for the presence of ASA in the semen, by using the direct immunobeads test (IBT, was available for 351 cycles. According to the percentage of antibody-bound spermatozoa in the semen, we divided the cycles in four groups: I (n = 194: 0%-10% ASA; II (n = 107: 11%-20%; III (n = 33: 21%-50% and IV (n = 17: 51%-100% ASA. Additionally, a group of 349 ICSI cycles performed with ejaculated spermatozoa from oligo/asthenozoospermic men who had insufficient number of motile sperm available for ASA screening was included for comparison. ICSI outcomes were compared among groups and included fertilization rate (2 PN, cleavage rate, cleavage velocity, embryo quality, clinical pregnancy and miscarriage rates. Data were examined statistically, with an alpha level of 5% considered significant. RESULTS: Fertilization, cleavage rate and velocity, percentage of good quality embryos, as well as clinical pregnancy and miscarriage rates did not differ among different ASA levels groups. ICSI outcomes in men exhibiting different levels of autoimmunity against spermatozoa did not differ from those with severely abnormal seminal parameters. CONCLUSIONS: Our data indicate that intracytoplasmic sperm injection (ICSI outcomes are not influenced by ASA levels on sperm.

  8. Systemic thrombolysis in anterior spinal artery syndrome: what has to be considered?

    Science.gov (United States)

    Koch, Mia; Sepp, Dominik; Prothmann, Sascha; Poppert, Holger; Seifert, Christian L

    2016-04-01

    Anterior spinal artery syndrome (ASAS) often leads to complete motor paralysis with poor clinical outcome. There is a lack of controlled clinical trials on acute treatment strategies in ASAS. However, systemic thrombolysis with recombinant tissue-plasminogen activator (rt-PA) might be a useful therapeutic option in ASAS. We report the management of a patient with ASAS below thoracic level 10, who was treated with intravenous thrombolysis. An 81 year old patient presented with flaccid paraplegia. After exclusion of aortal dissection, spinal tumour or haemorrhage, the patient was treated with intravenous rt-PA 3 h 40 min after symptom onset. The follow up magnetic resonance imaging (MRI) showed spinal infarction below thoracic segment 10. In the clinical course, the patient partially recovered lower limb muscle strength and was able to walk with assistance. To the best of our knowledge, this is the first case in the literature of ASAS with MRI-proven spinal ischemia and the application of rt-PA. Systemic thrombolysis seems to be justifiable in patients with ASAS after the rule-out of aortal dissection and spinal bleeding. PMID:26386968

  9. Semi-physiologic model validation and bioequivalence trials simulation to select the best analyte for acetylsalicylic acid.

    Science.gov (United States)

    Cuesta-Gragera, Ana; Navarro-Fontestad, Carmen; Mangas-Sanjuan, Victor; González-Álvarez, Isabel; García-Arieta, Alfredo; Trocóniz, Iñaki F; Casabó, Vicente G; Bermejo, Marival

    2015-07-10

    The objective of this paper is to apply a previously developed semi-physiologic pharmacokinetic model implemented in NONMEM to simulate bioequivalence trials (BE) of acetyl salicylic acid (ASA) in order to validate the model performance against ASA human experimental data. ASA is a drug with first-pass hepatic and intestinal metabolism following Michaelis-Menten kinetics that leads to the formation of two main metabolites in two generations (first and second generation metabolites). The first aim was to adapt the semi-physiological model for ASA in NOMMEN using ASA pharmacokinetic parameters from literature, showing its sequential metabolism. The second aim was to validate this model by comparing the results obtained in NONMEM simulations with published experimental data at a dose of 1000 mg. The validated model was used to simulate bioequivalence trials at 3 dose schemes (100, 1000 and 3000 mg) and with 6 test formulations with decreasing in vivo dissolution rate constants versus the reference formulation (kD 8-0.25 h (-1)). Finally, the third aim was to determine which analyte (parent drug, first generation or second generation metabolite) was more sensitive to changes in formulation performance. The validation results showed that the concentration-time curves obtained with the simulations reproduced closely the published experimental data, confirming model performance. The parent drug (ASA) was the analyte that showed to be more sensitive to the decrease in pharmaceutical quality, with the highest decrease in Cmax and AUC ratio between test and reference formulations. PMID:25869458

  10. Radiolytical oxidation of ascorbic acid in aqueous solutions

    International Nuclear Information System (INIS)

    Complete text of publication follows. Ascorbic acid, AsA (vitamin c), has been widely studied as an antioxidant or as an initiator of some technological processes, for example polymerization or nanoparticles formation. AsA can be easily oxidized to ascorbyl radical, in the first stage, and to dehydroascorbic acid, DHA, in the second stage. It has been found that several different ascorbyl radicals are formed during AsA oxidation but the main radical exists as the anion with the unpaired electron delocalized on a highly conjugated tricarbonyl system. Absorption spectrum of ascorbyl radical shows two bands with maxima at 300 and 360 nm, however only that at 360 nm is proportional to the dose and thus this wavelength was chosen for observations. We studied the oxidation of AsA by the following oxidizing radicals generated by the pulse radiolysis method ·OH, (SCN)2-·, Cl2-·, N3· and NO2·. The observed dependence of the yield and the formation rate of the AsA radical on the reduction potential of the oxidizing radical is discussed. The results obtained in water are compared with those obtained with AsA enclosed in the water pools of reverse micelles formed by AOT in n-heptane or by Igepal CO-520 in c-hexane. Somewhat surprising observation of different ascorbyl radical in pulse irradiated reverse micelles containing DHA is also commented.

  11. Mortality in perforated duodenal ulcer depends upon pre-operative risk: a retrospective 10-year study.

    LENUS (Irish Health Repository)

    Larkin, J O

    2012-01-31

    INTRODUCTION: Most patients presenting with acutely perforated duodenal ulcer undergo operation, but conservative treatment may be indicated when an ulcer has spontaneously sealed with minimal\\/localised peritoneal irritation or when the patient\\'s premorbid performance status is poor. We retrospectively reviewed our experience with operative and conservative management of perforated duodenal ulcers over a 10-year period and analysed outcome according to American Society of Anesthesiologists (ASA) score. METHODS: The records of all patients presenting with perforated duodenal ulcer to the Department of Surgery, Mayo General Hospital, between January 1998 and December 2007 were reviewed. Age, gender, co-morbidity, ASA-score, clinical presentation, mode of management, operative procedures, morbidity and mortality were considered. RESULTS: Of 76 patients included, 48 (44 operative, 4 conservative) were ASA I-III, with no mortality irrespective of treatment. Amongst 28 patients with ASA-score IV\\/V, mortality was 54.5% (6\\/11) following operative management and 52.9% (9\\/17) with conservative management. CONCLUSION: In patients with a perforated duodenal ulcer and ASA-score I-III, postoperative outcome is uniformly favourable. We recommend these patients have repair with peritoneal lavage performed, routinely followed postoperatively by empirical triple therapy. Given that mortality is equivalent between ASA IV\\/V patients whether managed operatively or conservatively, we suggest that both management options are equally justifiable.

  12. In vitro evaluation of aspirin-induced HspB1 against heat stress damage in chicken myocardial cells.

    Science.gov (United States)

    Wu, Di; Zhang, Miao; Xu, Jiao; Song, Erbao; Lv, Yinjun; Tang, Shu; Zhang, Xiaohui; Kemper, N; Hartung, J; Bao, Endong

    2016-05-01

    To understand the potential association of heat stress resistance with HspB1 induction by aspirin (ASA) in chicken myocardial cells, variations of HspB1 expression and heat stressed-induced damage of myocardial cells after ASA administration were studied in primary cultured myocardial cells. Cytopathological lesions as well as damage-related enzymes, such as creatine kinase-MB (CK-MB) and lactate dehydrogenase (LDH), indicated the considerable protective ability of ASA pre-treatment against acute heat stress. Immunostaining assays showed that heat stress caused HspB1 to relocate into the nucleus, while ASA did not. ELISA analysis, revealed that HspB1 expression induced by ASA averaged 45.62-fold higher than that of the control. These results indicated that the acute heat-stressed injuries were accompanied by comparatively lower HspB1 expression caused by heat stress in vitro. ASA pre-treatment induced a level of HspB1 presumed to be sufficient to protect myocardial cells from acute heat stress in the extracorporal model, although more detailed mechanisms will require further investigation. PMID:26910344

  13. Pharmacokinetics and plasma concentrations of acetylsalicylic acid after intravenous, rectal, and intragastric administration to horses.

    Science.gov (United States)

    Broome, Ted A; Brown, Murray P; Gronwall, Ronald R; Casey, Matthew F; Meritt, Kelly A

    2003-10-01

    Six healthy adult horses (5 mares and 1 stallion) were given a single dose of acetylsalicylic acid (ASA), 20 mg/kg of body weight, by intravenous (IV), rectal, and intragastric (IG) routes. Serial blood samples were collected via jugular venipuncture over a 36-h period, and plasma ASA and salicylic acid (SA) concentrations were determined by high-performance liquid chromatography. After IV administration, the mean elimination rate constant of ASA (+/- the standard error of the mean) was 1.32 +/- 0.09 h(-1), the mean elimination half-life was 0.53 +/- 0.04 h, the area under the plasma concentration-versus-time curve (AUC) was 2555 +/- 98 microg x min/mL, the plasma clearance was 472 +/- 18.9 mL/h/kg, and the volume of distribution at steady state was 0.22 +/- 0.01 L/kg. After rectal administration, the plasma concentration of ASA peaked at 5.05 +/- 0.80 microg/mL at 0.33 h, then decreased to undetectable levels by 4 h; the plasma concentration of SA peaked at 17.39 +/- 5.46 microg/mL at 2 h, then decreased to 1.92 +/- 0.25 microg/mL by 36 h. After rectal administration, the AUC for ASA was 439.4 +/- 94.55 microg x min/mL and the bioavailability was 0.17 +/- 0.037. After IG administration, the plasma concentration of ASA peaked at 1.26 +/- 0.10 microg/mL at 0.67 h, then declined to 0.37 +/- 0.37 microg/mL by 36 h; the plasma concentration of SA peaked at 23.90 +/- 4.94 microg/mL at 4 h and decreased to 0.85 +/- 0.31 microg/mL by 36 h. After IG administration, the AUC for ASA was 146.70 +/- 24.90 microg x min/mL and the bioavailability was 0.059 +/- 0.013. Administration of a single rectal dose of ASA of 20 mg/kg to horses results in higher peak plasma ASA concentrations and greater bioavailability than the same dose given IG. Plasma ASA concentrations after rectal administration should be sufficient to inhibit platelet thromboxane production, and doses lower than those suggested for IG administration may be adequate. PMID:14620867

  14. Soil Science Society of America - K-12 Outreach

    Science.gov (United States)

    Lindbo, David L.; Loynachan, Tom; Mblia, Monday; Robinson, Clay; Chapman, Susan

    2013-04-01

    The Soil Science Society of America created its K12 Committee in 2006 in part to compliment the Dig It! The Secrets of Soil exhibit that opened in July 2008 at the Smithsonian's Institution's Nation Museum of Natural History (of which SSS was a founding sponsor). The committee's work began quickly with a website designed to provide resources for K12 teachers. The first accomplishments included reviewing and posting links to web based information already available to teachers. These links were sorted by subject and grade level to make it easier for teachers to navigate the web and find what they needed quickly. Several presentations and lessons designed for K12 teachers were also posted at this time. Concurrent with this effort a subcommittee review and organized the national teaching standards to show where soils could fit into the overall K12 curriculum. As the website was being developed another subcommittee developed a soils book (Soil! Get the Inside Scoop, 2008) to further compliment the Dig It! exhibit. This was a new endeavor for SSSA having never worked with the non-academic audience in developing a book. Peer-reviews of this book included not only scientist but also students in order to make sure the book was attractive to them. Once the book was published and the website developed it became clear more outreach was needed. SSSA K12 Committee has attended both the National Science Teachers Association (since 2008) the USA Science and Engineering Festival (since 2010) with exhibits and workshops. It has cooperated and contributed to the American Geologic Institutes' Earth Science Week materials with brochures and lesson plans and with National Association of Conservation Districts by providing peer-review and distribution of materials. The most recent developments from the committee include a web redesign that is more student and teacher friendly, the development of a peer-review system to publish K12 Lesson Plans, and finally the publication of a new soils

  15. Aspirin or Nonsteroidal Anti-inflammatory Drug-Exacerbated Chronic Rhinosinusitis.

    Science.gov (United States)

    Ledford, Dennis K; Lockey, Richard F

    2016-01-01

    Aspirin (ASA)-exacerbated respiratory disease (AERD) is characterized by upper airway congestion due to eosinophilic inflammation of the nasal and sinus membranes and nasal polyposis, associated with increased leukotriene production that is further accentuated by ASA or other nonsteroidal anti-inflammatory drug (NSAID) ingestion. It occurs in 5% to 10% of subjects with chronic rhinosinusitis (CRS) and in 15% to 40% of those with nasal polyposis. Although AERD with CRS is usually associated with asthma, this is not always the case. The eosinophilic airway inflammation and symptoms precede clinical reactions to ASA or other NSAIDs, but ultimately affected subjects experience worsening of symptoms with ingestion of ASA/NSAIDs. The endotypic mechanism for this worsening is related to a chronic increase in leukotriene and a decrease in prostaglandin production, particularly prostaglandin E2, that is further aggravated by the inhibition of cycloxgenase I. IgE does not likely play a role in the pathogenesis of the disease although nasal and sinus staphylococcal infection increases local IgE level and may increase total IgE and specific IgE levels. Genetic studies suggest that multiple genes may be involved, but the genetic abnormalities may differ in affected subjects from different ethnicities and candidate genes have not been confirmed in multiple studies. Genome-wide association studies have not been revealing. The phenotype is recognized by the mucosal inflammation and worsening of symptoms acutely with ASA/NSAID. There is clinical improvement with ASA desensitization followed by regular ingestion of ASA or other NSAIDs. Further understanding of this unique phenotype and endotype of CRS will likely improve the understanding of other eosinophilic airway diseases. PMID:27393773

  16. Synthesis of Chromium (Ⅲ) 5-aminosalicylate

    Institute of Scientific and Technical Information of China (English)

    LI Wei; HAO Er-jun; JIANG Yu-qin

    2004-01-01

    As we all known that diabetes is a chronic disease with major health consequences.Research has revealed that the occurrence of diabetes have great thing to do with the chromium deficient. Almost 40 years after the first report of glucose tolerance factor(GTF) [1], no conclusive evidence for an isolable ,biologically active form of chromium exited. Three materials have been proposed to be the biologically active form of chromium: "glucose tolerance factor", chromium Picolinate and low-molecular-weight chromium-binding substance (LWMCr) [2] . So there is potential for the design of new chromium drugs .5-Aminosalicylic acid (5-ASA) is identified as an active component in the therapy of inflammatory bowel disease (IBD) such as Crohn's disease and ulcerative colitis . The therapeutic action of 5-ASA is believed to be coupled to its ability to act as a free radical scavenger [3-4],acting locally on the inflamed colonic mucosa [5-7]. However, the clinical use of 5-ASA is limited, since orally administered 5-ASA is rapidly and completely absorbed from the upper gastrointestinal tract and therefore the local therapeutic effects of 5-ASA in the colon is hardly expected.In this paper, we report the synthesis of chromium(Ⅲ)5-aminosalicylate from 5-ASA and CrCl3. 6H2O.The synthesis route is as follow:The complex has been characterized by elemental analysis, IR spectra, X-ray powder diffractionand TG-DTA . They indicate that the structure is tris(5-ASA) Chromium . Experiments show that thecomplex has a good activity for supplement tiny dietary chromium, lowering blood glucose levels,lowering serum lipid levels and in creasing lean body mass .

  17. Diagnosis of asymptomatic atrial septal aneurysms using two-dimensional color Doppler and contrast transthoracic echocardiography

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    Objective To evaluate the dimensions of atrial septal aneurysm (ASA), the presence and characteristics of interatrial shunt, the movement of the wall of the aneurysm, and correlation between these findings and sign and/or symptoms suggesting embolism in Manisa, a district of a western Anatolian city of Turkey. Methods Two thousand five hundred cases were examined by routine transthoracic echocardiography (TTE) in both pediatric and adult cardiology outpatient clinics. ASA was detected in 20 cases and evaluated by two-dimensional color Doppler echocardiography (CDE). The length of the base, the maximum radius and the maximum displacement of ASA were measured. The shunt between the atria was examined by CDE. In cases where a shunt could not be found, galactose and palmitic acid was injected. Standard 12-lead electrocardiogram (ECG) and exercise stress test were also performed. Results No clinical signs or symptoms were found, suggesting a systemic or cerebral embolism. The maximum displacement of ASA was between 2 and 5 mm. All of the aneurysms were localized in the right atrium, and the walls of the aneurysm did not move beyond the base of the left atrium during the maximum displacement. Interatrial shunt was detected in 14 of 20 patients (70%) by CDE and in the remaining six cases by contrast TTE. Frequent ventricular ectopic beats were observed in one patient. Conclusions During routine TTE we observed 0.8% asymptomatic ASA in our population. The use of a contrast agent was found to be a valuable additional method in patients with ASA when the shunt could not be detected by CDE. The risk for embolism is not high when the maximum displacement of the wall of ASA was 5 mm or less and no bulge into the left atrium was observed. Based on our experience with this method, TTE is easy to perform, well-tolerated and acceptable.

  18. Platelet thromboxane (11-dehydro-Thromboxane B2) and aspirin response in patients with diabetes and coronary artery disease.

    Science.gov (United States)

    Lopez, Luis R; Guyer, Kirk E; Torre, Ignacio Garcia De La; Pitts, Kelly R; Matsuura, Eiji; Ames, Paul Rj

    2014-04-15

    Aspirin (ASA) irreversibly inhibits platelet cyclooxygenase-1 (COX-1) leading to decreased thromboxane-mediated platelet activation. The effect of ASA ingestion on thromboxane generation was evaluated in patients with diabetes (DM) and cardiovascular disease. Thromboxane inhibition was assessed by measuring the urinary excretion of 11-dehydro-thromboxane B2 (11dhTxB2), a stable metabolite of thromboxane A2. The mean baseline urinary 11dhTxB2 of DM was 69.6% higher than healthy controls (P = 0.024): female subjects (DM and controls) had 50.9% higher baseline 11dhTxB2 than males (P = 0.0004), while age or disease duration had no influence. Daily ASA ingestion inhibited urinary 11dhTxB2 in both DM (71.7%) and controls (75.1%, P < 0.0001). Using a pre-established cut-off of 1500 pg/mg of urinary 11dhTxB2, there were twice as many ASA poor responders (ASA "resistant") in DM than in controls (14.8% and 8.4%, respectively). The rate of ASA poor responders in two populations of acute coronary syndrome (ACS) patients was 28.6 and 28.7%, in spite of a significant (81.6%) inhibition of urinary 11dhTxB2 (P < 0.0001). Both baseline 11dhTxB2 levels and rate of poor ASA responders were significantly higher in DM and ACS compared to controls. Underlying systemic oxidative inflammation may maintain platelet function in atherosclerotic cardiovascular disease irrespective of COX-1 pathway inhibition and/or increase systemic generation of thromboxane from non-platelet sources. PMID:24748925

  19. The role of antioxidant system in freezing acclimation-induced freezing resistance of Populus suaveolens cuttings

    Institute of Scientific and Technical Information of China (English)

    Luo Lei; Lin Shan-zhi; Zheng Hui-quan; Lei Yang; Zhang Qian; Zhang Zhi-yi

    2007-01-01

    We investigated the changes in the contents of H2O2, malonaldehyde (MDA) and endogenous antioxidants, the activities of protective enzymes and some critical enzymes involved in the ascorbate-glutathione (ASA-GSH) cycle as well as freezing resistance(expressed as LT50) and correlations mentioned above, in detail using Populus suaveolens cuttings. The purpose was to explore the physiological mechanism of the enhancement of freezing resistance induced by freezing acclimation at -20℃, and to elucidate the physiological mechanisms by which trees adapt to freezing. The results showed that freezing acclimation enhanced the activities of superoxide dismutase (SOD), peroxidase (POD), catalase (CAT), monodehydroascorbate reductase (MDAR), ascorbate peroxidase(APX), dehydroascorbate reductase (DHAR) and glutathione reductase (GR). And it increased the contents of reduced ascorbate(ASA), reduced glutathione (GSH), dehydroascorbate (DHA) and oxidized glutathione (GSSG). However, H2O2 and MDA contents and LT50 of cuttings were decreased. LT50 in cuttings was found to be closely correlated to the levels of SOD, POD, CAT, APX,DHAR, MDAR, GR, H2O2, MDA, ASA, GSH, DHA and GSSG during freezing acclimation. This suggested that the enhancement of freezing resistance of cuttings induced by freezing acclimation may relate to the distinct increase for the levels of SOD, POD, CAT,APX, DHAR, MDAR,GR,ASA, GSH, DHA, and GSSG. In addition, the observed levels of APX, DHAR, MDAR, GR, ASA, DHA,GSH and GSSG were higher than those of SOD, POD and CAT during freezing acclimation. It indicated that a higher capacity of the ASA-GSH cycle is required for H2O2 detoxification, and growth and development of cuttings. Based on the obtained results, it can be concluded that the ASA-GSH cycle plays an important role in enhancement of freezing resistance of P. suaveolens cuttings during freezing acclimation.

  20. Can endometrial arylsulfatase A activity predict the onset of endometrial polyps over the years? A atividade da arilsulfatase endometrial A pode prever a aparição de pólipos endometriais ao longo dos anos?

    Directory of Open Access Journals (Sweden)

    Ugo Indraccolo

    2013-01-01

    Full Text Available PURPOSE: To assess if arylsulfatase A activity (ASA and sulfatide (SL concentration in the human endometrium can be predictive of the development of endometrial polyps over the years, since ASA activity reflects the endometrial sensitivity to hormones. METHODS: ASA activity and SL concentration were determined by biochemical procedures on endometrial samples collected between 1990 and 1994 in non-menopausal women. These women underwent a new endometrial sampling following the clinical indication some years after the first endometrial sampling. The histological assessment of the second endometrial specimens found four patients with normal endometrial pattern and 10 patients with one or more endometrial polyps. ASA activity/years elapsed and SL concentration/years elapsed were compared using two tailed Mann-Whitney test for unpaired data between patients with normal pattern and patients with endometrial polyps. RESULTS: Median ASA activities were 2.62 (normal pattern versus 1.85 (endometrial polyps nmol hydrolized substrate/min. Median activity/years elapsed is higher in patients with second endometrial sample presenting normal pattern (p=0.006 and median SL concentration/years elapsed does not differ significantly among groups, even if median SL concentration seems to be higher in patients who subsequently developed polyps (1031 µg/g of fresh tissue versus 341,5 µg/g of fresh tissue. CONCLUSIONS: ASA activity can predict the onset of endometrial polyps over the years.OBJETIVO: Avaliar se a atividade da arilsulfatase A (ASA e a concentração de sulfatida (SL no endométrio humano pode ser preditivo em relação ao desenvolvimento de pólipos endometriais ao longo dos anos, posto que atividade da ASA reflete a sensibilidade do endométrio aos hormônios. MÉTODOS: A atividade da ASA, assim como a concentração de SL, foi determinada por meio de procedimentos bioquímicos em amostras de endométrio coletadas entre 1990 e 1994, em mulheres que n

  1. Rapid degradation of p-arsanilic acid with simultaneous arsenic removal from aqueous solution using Fenton process.

    Science.gov (United States)

    Xie, Xiande; Hu, Yuanan; Cheng, Hefa

    2016-02-01

    Although banned in some developed countries, p-arsanilic acid (p-ASA) is still used widely as a feed additive for swine production in many countries. With little uptake and transformation in animal bodies, nearly all the p-ASA administered to animals is excreted chemically unchanged in animal wastes, which can subsequently release the more toxic inorganic arsenic species upon degradation in the environment. For safe disposal of the animal wastes laden with p-ASA, we proposed a method of leaching the highly water-soluble p-ASA out of the manure first, followed by treatment of the leachate using the Fenton process to achieve fast oxidation of p-ASA and removal of the inorganic arsenic species released (predominantly arsenate) from solution simultaneously. The effects of solution pH, dosages of H2O2 and Fe(2+), and the presence of dissolved organic matter (DOM) on the treatment efficiency were systematically investigated. Under the optimum treatment conditions (0.53 mmol L(-1) Fe(2+), 2.12 mmol L(-1) H2O2, and initial pH of 3.0), p-ASA (10 mg-As L(-1)) could be completely oxidized to As(V) within 30 min in pure water and 4 natural water samples, and at the final pH of 4.0, the residual arsenic levels in solution phase were as low as 1.1 and 20.1-43.4 μg L(-1) in the two types of water matrixes, respectively. The presence of humic acid significantly retarded the oxidation of p-ASA by scavenging HO, and inhibited the As(V) removal through competitive adsorption on ferric hydroxide. Due to the high contents of DOM in the swine manure leachate samples (TOC at ∼500 mg L(-1)), much higher dosages of Fe(2+) (10.0 mmol L(-1)) and H2O2 (40.0 mmol L(-1)) and a longer treatment time (120 min) were required to achieve near complete oxidation of p-ASA (98.0%), while maintaining the levels of residual arsenic in the solution at products detected. Together, the results demonstrate that the Fenton process is promising as an efficient, robust, and low-cost treatment

  2. Ondansetron reduces naturalistic drinking in non-treatment seeking alcohol dependent individuals with the LL 5′-HTTLPR genotype: a laboratory study

    Science.gov (United States)

    Kenna, George A.; Zywiak, William H.; Swift, Robert M.; McGeary, John E.; Clifford, James S.; Shoaff, Jessica R.; Vuittonet, Cynthia; Fricchione, Samuel; Brickley, Michael; Beaucage, Kayla; Haass-Koffler, Carolina L.; Leggio, Lorenzo

    2014-01-01

    Background One hypothesis suggests that the differential response to ondansetron and serotonin specific re-uptake inhibitors (SSRIs) may be due to a functional polymorphism of the 5′-HTTLPR promoter region in SLC6A4, the gene that codes for the serotonin transporter (5-HTT). The LL 5′-HTTLPR genotype is postulated to be specifically sensitive to the effects of ondansetron with SS/SL 5′-HTTLPR genotypes sensitive to SSRIs. This study tests this hypothesis by matching non-treatment seeking alcohol dependent (AD) individuals with LL genotype to ondansetron and SS/SL genotypes to the SSRI sertraline, and mis-matching them assessing naturalistic and bar-laboratory alcohol drinking. Methods Seventy-seven AD individuals were randomized to one of two counterbalanced arms to receive sertraline 200mg/day or ondansetron 0.5 mg/day for three weeks followed by an alcohol self-administration experiment (ASAE), then received placebo for three weeks followed by a second ASAE. Individuals then received the alternate drug for three weeks followed by a third ASAE. Drinks per drinking day (DDD with drinks in SDUs) for 7 days prior to each ASAE and milliliters consumed during each ASAE were the primary outcomes. Results Fifty-five participants completed the study. The genotype x order interaction was significant [F(1,47) = 8.42, p = .006] for DDD. Three ANCOVAs were conducted for DDD during the week before each ASAE. Ondansetron compared to sertraline resulted in a significant reduction in DDD during the week before the first [F(1,47) = 7.64, p = .008] but not the third ASAE. There was no difference in milliliters consumed during each ASAE. Conclusion This study modestly supports the hypothesis that ondansetron may reduce DDD in AD individuals with the LL genotype as measured naturalistically. By contrast there was no support that ondansetron reduces drinking during the ASAEs or that sertraline reduces alcohol use in individuals who have SS/SL genotypes. We provide limited

  3. Recycling ground granulated blast furnace slag as cold bonded artificial aggregate partially used in self-compacting concrete.

    Science.gov (United States)

    Gesoğlu, Mehmet; Güneyisi, Erhan; Mahmood, Swara Fuad; Öz, Hatice Öznur; Mermerdaş, Kasım

    2012-10-15

    Ground granulated blast furnace slag (GGBFS), a by-product from iron industry, was recycled as artificial coarse aggregate through cold bonding pelletization process. The artificial slag aggregates (ASA) replaced partially the natural coarse aggregates in production of self-compacting concrete (SCC). Moreover, as being one of the most widely used mineral admixtures in concrete industry, fly ash (FA) was incorporated as a part of total binder content to impart desired fluidity to SCCs. A total of six concrete mixtures having various ASA replacement levels (0%, 20%, 40%, 60%, and 100%) were designed with a water-to-binder (w/b) ratio of 0.32. Fresh properties of self-compacting concretes (SCC) were observed through slump flow time, flow diameter, V-funnel flow time, and L-box filling height ratio. Compressive strength of hardened SCCs was also determined at 28 days of curing. It was observed that increasing the replacement level of ASA resulted in decrease in the amount of superplasticizer to achieve a constant slump flow diameter. Moreover, passing ability and viscosity of SCC's enhanced with increasing the amount of ASA in the concrete. The maximum compressive strength was achieved for the SCC having 60% ASA replacement. PMID:22951223

  4. Novel pH-sensitive hydrogels for 5-aminosalicylic acid colon targeting delivery: in vivo study with ulcerative colitis targeting therapy in mice.

    Science.gov (United States)

    Bai, Xia Yan; Yan, Yan; Wang, Lin; Zhao, Lan Gui; Wang, Ke

    2016-07-01

    Current guidelines recommend patients with active and mild-to-moderate ulcerative colitis (UC), who have received initial therapy with 5-aminosalicylic acid (5-ASA). In this study, a novel drug delivery vehicle achieved by pH-sensitive hydrogels was applied to 5-ASA. In our previous work, a novel P(CE-MAA-MEG) pH-sensitive hydrogel was successfully synthesized by the heat-initiated free radical polymerization method. The aim of this study is to investigate its site-specific delivering of drugs to the colon and evaluate its colon-targeting characteristic in vivo. 5-ASA was chosen as a model drug and successfully loaded in the hydrogel. In vitro investigations were carried out to evaluate its release process. Above all, animal treatment results reveal an obvious effect on the UC healing. Therefore, all results suggested that the developed 5-ASA-P(CE-MAA-MEG) hydrogel (5-ASA-GEL) as a colon-targeting vector might have a great potential application in the UC therapy. PMID:25693641

  5. Kwas acetylosalicylowy i jego zastosowanie w profilaktyce chorób u kobiet po menopauzie

    Directory of Open Access Journals (Sweden)

    Ireneusz Połać

    2011-02-01

    Full Text Available Acetylsalicylic acid (ASA is a simple chemical compound belonging to a group of nonsteroidal antiinflammatorydrugs (NSAIDs. The mechanism of acetylsalicylic acid is based on the inhibition of cyclooxygenase(COX. That enzyme is responsible for the biosynthesis of cyclic prostanoids, i.e. prostaglandins (D2, E2, F2, I2,thromboxane A2 (TXA2 and prostacyclin. For this reason ASA is one of the most popular anti-inflammatorydrugs present on the pharmaceutical market. Due to its ability to inhibit the synthesis of TXA2 (moleculescapable of platelet activation ASA is effective in the prevention of cardiovascular diseases such as ischemicheart disease. Clinical trials confirm the efficacy of aspirin in the prevention of cardiovascular diseases inpostmenopausal women. In some cases ASA is unable to inhibit platelet activation. This phenomenon iscalled aspirin resistance. Acetylsalicylic acid can also inhibit aromatase activity, therefore it may be used inthe prevention of breast cancer. Many clinical trials confirm that acetylsalicylic acid reduces the risk of breastcancer in postmenopausal women. Use of ASA may also increase bone mineral density (BMD. This articledescribes the mechanism of action and pharmacokinetics of the acetylsalicylic acid as well as clinical trialsconducted on postmenopausal women.

  6. Gradient Elution Method for Successive Separation of Common Cations and Hydrophobic Amines using Suppressed Ion Chromatography

    International Nuclear Information System (INIS)

    In mixed waste the separation and sequential determination of alkali, alkaline earth metals mixed with hydrophobic amines represent a challenge analytical problem. The effect of a new mobile phase (amido-sulfonic acid, ASA) on the suppressed ion chromatographic separation of alkali, alkaline earth metals and hydrophobic amines on Dionex Ion Pac CS12A analytical column was investigated. The addition of surface modifier to the eluent appears to provide better interfacial compatibility between the mobile and stationary phase and facilitates the rapid equilibration of analytes. Incorporation of a very low concentration of the additive may also alters the stationary phase surface by creating a fine-tuning and improves the partition characteristics of the analytes. A dramatic and sufficient elution capability of ASA for sequential separation of the analytes was found and rational mechanisms for the separated analytes are proposed. ASA can act as ion-pairing agent resulting in the separation of a wide variety of amines. The new mobile phase (ASA) is proved to have more successful separation over methanesulfonic acid (MSA) even with eluent free solvent. The proposed method shows that a profound particular effect on the separation of aliphatic diamine (ethylenediamine) and organic amine (cyclohexylamine) was achieved in addition to all common cations and amines using isocratic elution of 18 mM of ASA without organic eluent modifier

  7. The Correlation between Sexual Practices and the Development of Antisperm Antibodies

    Directory of Open Access Journals (Sweden)

    Reza Salman Yazdi

    2009-01-01

    Full Text Available Background: Infertility is one of the most common and important subjects in today’s obstetricsand gynecology. Immunological factors such as the presence of antisperm antibodies (ASA arechallenging etiologies for infertility. This study was performed to determine the correlation betweenthe type of sexual practices (oral‚ anal and vaginal during menstruation and the ASA levels insemen and in the sexual partners’ serum.Materials and Methods: In this analytic cross sectional study which was performed in RoyanInstitute between 2005-2007‚ the type of sexual behaviours was determined in 51 couples withprimary or secondary infertility. The ASA level was determined in both sexual partners’ bloodserum and in the semen‚ using the Sperm Mar Test kit.Results: Using statistical analyses‚ there was no significant difference between the types of sexualpractices (anal‚ oral‚ vaginal during menstruation and the prevalence and level of ASA.Conclusion: Based on the results of this study, the prevalence and level of ASA has no significantcorrelation with the types of sexual behaviours (anal‚ oral‚ vaginal during menstruation.

  8. The effect of salicylic acid and acetylsalicylic acid on red pigment formation in mechanically wounded scales of Hippeastrum x hybr. hort. and on the growth and development of Phoma narcissi

    Directory of Open Access Journals (Sweden)

    Alicja Saniewska

    2012-12-01

    Full Text Available Various organs of Hippeastrum infected by Phoma narcissi, infested with mite, Steneotarsonemus laticeps or mechanically wounded, produce red pigment on the surface of injured tissues. The aim of the present work was to study the effect of salicylic (SA and acetylsalicylic acids (ASA (inhibitors of biosynthesis of jasmonates and ethylene on red pigment formation in wounded scales of bulbs of Hippeastrum and on the mycelium growth of P. narcissi in vivo and in vitro. SA and ASA at a concentration of 1 and 2 mM partially inhibited the formation of red pigment in wounded scales, first of all in first 2 days after treatment. The growth and development of P. narcissi on basal plate and scales of longitudinally cut Hippeastrum bulb treated with SA and ASA (1 and 2 mM was similar as in control. SA (50 µg·cm-3 and ASA (250 µg·cm-3 inhibited the mycelium growth of P. narcissi on PDA medium, and concentration of 1000 µg·cm-3 of both almost totally inhibited the mycelium growth of the pathogen. Inhibitory effect of SA and ASA on the formation of red pigment in wounded scales of Hippeastrum may be caused by lowered biosynthesis and accumulation of jasmonates.

  9. Light and abiotic stresses regulate the expression of GDP-L-galactose phosphorylase and levels of ascorbic acid in two kiwifruit genotypes via light-responsive and stress-inducible cis-elements in their promoters.

    Science.gov (United States)

    Li, Juan; Liang, Dong; Li, Mingjun; Ma, Fengwang

    2013-09-01

    Ascorbic acid (AsA) plays an essential role in plants by protecting cells against oxidative damage. GDP-L-galactose phosphorylase (GGP) is the first committed gene for AsA synthesis. Our research examined AsA levels, regulation of GGP gene expression, and how these are related to abiotic stresses in two species of Actinidia (kiwifruit). When leaves were subjected to continuous darkness or light, ABA or MeJA, heat, or a hypoxic environment, we found some correlation between the relative levels of GGP mRNA and AsA concentrations. In transformed tobacco plants, activity of the GGP promoter was induced by all of these treatments. However, the degree of inducibility in the two kiwifruit species differed among the GGP promoter deletions. We deduced that the G-box motif, a light-responsive element, may have an important function in regulating GGP transcripts under various light conditions in both A. deliciosa and A. eriantha. Other elements such as ABRE, the CGTCA motif, and HSE might also control the promoter activities of GGP in kiwifruit. Altogether, these data suggest that GGP expression in the two kiwifruit species is regulated by light or abiotic stress via the relative cis-elements in their promoters. Furthermore, GGP has a critical role in modulating AsA concentrations in kiwifruit species under abiotic stresses. PMID:23775440

  10. Improved aortocoronary bypass patency by low-dose aspirin (100 mg daily). Effects on platelet aggregation and thromboxane formation.

    Science.gov (United States)

    Lorenz, R L; Schacky, C V; Weber, M; Meister, W; Kotzur, J; Reichardt, B; Theisen, K; Weber, P C

    1984-06-01

    Prevention of aortocoronary bypass occlusion by aspirin (ASA, 1 X 100 mg per day) was studied in a prospective double-blind trial of 83 patients. 60 (72%) were randomly allocated to ASA or placebo starting 24 h after operation. 90% of grafts in the ASA group and 68% in the placebo group were patent at four months. At least one anastomosis was occluded in 62% of the patients on placebo and in 27% of those on aspirin. Ventricular arrhythmias increased after surgery in more patients on placebo (12/18) than in patients on ASA (5/17). Platelet thromboxane formation on collagen tested before operation was significantly higher in patients in whom bypass occlusion developed (occlusion: 40 +/- 19, no occlusion: 25 +/- 13 ng/ml). A 100 mg dose of ASA per day effectively blocked platelet thromboxane formation and thromboxane-supported aggregation on collagen and was safe in the postoperative phase. No side effects were reported throughout the trial. The reduced toxicity with full efficacy favours a low and infrequent dosage of aspirin. PMID:6144975

  11. RESIDUAL PLATELET REACTIVITY DURING THERAPY WITH INHIBITORS OF CYCLOOXIGENASE OR ADENOSINE DIPHOSPHATE RECEPTORS

    Directory of Open Access Journals (Sweden)

    A. A. Lomonosova

    2012-01-01

    Full Text Available Aim. To compare effects of acetylsalicylic acid (ASA and two clopidogrel drugs on residual platelet aggregative reactivity (RPAR. Material and methods. Patients (n=40 with ischemic heart disease aged under 70 years were involved into the crossover study. Clinical examination included questionnaire survey , blood pressure (BP measurement, ECG registration, 24-hour ECG and BP monitoring, determination of blood levels of total cholesterol, high density lipoproteins, triglycerides, transaminases, and creatinine, complete blood cell count, including platelets number and hemoglobin level. Besides evaluation of the platelet aggregation by optical aggregometry was performed initially , after one week ASA treatment and after every next 3 week clopidogrel treatment period.  Results. RPAR during ASA monotherapy was 56.4±0.3%. There were no significant differences in effects of original and generic clopidogrel on RPAR. Сlopidogrel therapy reduced RPAR more significantly (42.2±0.2% than ASA monotherapy did (p=0.0003. Authors proposed definition for high level of RPAR during therapy - it is platelet aggregation more than 46%. Data analysis taking into account this criterion showed that a number of patients with high RPAR was 70 and 30% among patients treated with enterosoluble ASA and clopidogrel, respectively. Conclusion. Study results show that a significant number of patients receiving antiplatelet monotherapy does not achieve the target level of RPAR(<46%. These results may be a rationale for combined therapy in patients of this type.

  12. [Acute ischemic spinal cord disease. Spinal cord infarction. A clinical study and MRI in 8 cases].

    Science.gov (United States)

    Pau Serradell, A

    1994-01-01

    Acute spinal cord infarction (ASCI) occurs infrequently and may have diverse causes. The diagnosis of ASCI, and particularly of an anterior spinal artery syndrome (ASAS) can be confirmed nowadays by MRI, whereas in the past only necropsy confirmation was possible. Pathophysiology and long-term prognosis may be better known at present and treatments more consistent. We present the longitudinal study and clinical features of 8 patients suffering from ASCI. All of them were personally studied and had MRI examinations, often with sequential studies. three groups must be considered: one included 4 cases of ASAS at cervical level, the second 2 cases of ASAS at thoracic level and the third group with infarction of the conus medullaris (ICM), one of them developed during surgical repair of an infrarenal aortic aneurysm. Motor and sensory sequelae were assessed in each case together with possible etiological factors. In conclusion, recovery after ASAS tends to be dependent on the severity of the initial deficit. At cervical level, clinical and morphological findings argue in favour of an extrinsic selective compression of the C7 right radiculo-medullary artery as responsible for the ASA. At thoracic level, the artery preferentially occluded seems to be the sulco-commisural artery as a consequence of disc compression. Finally, an underlying peculiarity of the pattern of arterial supply is a probable predisposing factor for ICM. Generally, the long-term prognosis of ASCI is not necessarily bad. PMID:7801036

  13. Efficacy of enzyme replacement therapy in an aggravated mouse model of metachromatic leukodystrophy declines with age.

    Science.gov (United States)

    Matthes, Frank; Stroobants, Stijn; Gerlach, Debora; Wohlenberg, Claudia; Wessig, Carsten; Fogh, Jens; Gieselmann, Volkmar; Eckhardt, Matthias; D'Hooge, Rudi; Matzner, Ulrich

    2012-06-01

    Metachromatic leukodystrophy (MLD) is a lysosomal storage disease caused by a functional deficiency of arylsulfatase A (ASA). Previous studies in ASA-knockout mice suggested enzyme replacement therapy (ERT) to be a promising treatment option. The mild phenotype of ASA-knockout mice did, however, not allow to examine therapeutic responses of the severe neurological symptoms that dominate MLD. We, therefore, generated an aggravated MLD mouse model displaying progressive demyelination and reduced nerve conduction velocity (NCV) and treated it by weekly intravenous injections of 20 mg/kg recombinant human ASA for 16 weeks. To analyze the stage-dependent therapeutic effects, ERT was initiated in a presymptomatic, early and progressed disease stage, at age 4, 8 and 12 months, respectively. Brain sulfatide storage, NCV and behavioral alterations were improved only in early, but not in late, treated mice showing a clear age-dependent efficacy of treatment. Hematopoietic stem cell transplantation (HSCT) for late-onset variants is the only therapeutic option for MLD to date. ERT resembles a part of the HSCT rationale, which is based on ASA supply by donor cells. Beyond ERT, our results, therefore, corroborate the clinical observation that HSCT is only effective when performed in early stages of disease. PMID:22388935

  14. Ascorbic Acid and/or 24-Epibrassinolide Trigger Physiological and Biochemical Responses for the Salt Stress Mitigation in Potato (Solanum tuberosum L.

    Directory of Open Access Journals (Sweden)

    Chandrama Prakash Upadhyaya

    2015-12-01

    Full Text Available In the present study, we examined the role of ascorbic acid (AsA, vitamin C and/or 24-epibrassinolide (EBL, an active BR in mitigation of salt-induced stress in potato (Solanum tuberousum L. The 10-d-old plants were exposed to 150 mM NaCl and they were subsequently treated by ASA and/or EBL. The salt stress reduced significantly the plant growth, tuber yield, total chlorophyll and increased proline content and electrolyte leakage in the leaves. Toxic effects induced by salt stress were completely overcome by the combined exogenous application of AsA and EBL. The AsA and/or EBL treatments improved the growth parameters of the salt treated plants, such as shoot length, tuber number and size, fresh and dry mass and other physiological parameters. Our data also indicated that applications of AsA and EBL up-regulated the stress regulating plant hormone such as IAA, IBA and activities of the antioxidant enzymes, such as catalase (CAT, peroxidase (POX, superoxide dismutase (SOD, ascorbate peroxidase (APX and under salt stress.

  15. Ethanol increase PGE and thromboxane production in mouse pregnant uterine tissue

    Energy Technology Data Exchange (ETDEWEB)

    Anton, R.F.; Becker, H.C.; Randall, C.L. (Veterans Administration Medical Center, Charleston, SC (USA))

    1990-01-01

    The teratogenic effect of ethanol in the C57BL/6J mouse can be attenuated by pretreatment with aspirin (ASA). One prominent effect of ASA is to inhibit prostaglandin (PGE) and thromboxane (TXB{sub 2}) production. We examined the effect in vivo ethanol exposure on PGE and TXB{sub 2} production in a uterine-embryo tissue sample of C57BL/6J mice either before or after in vivo ASA pretreatment on day 10 of gestation. Ethanol increase both PGE and TXB{sub 2} production by approximately 20%. ASA caused a marked reduction of PGE and TXB{sub 2} in both control and ethanol groups by approximately 80-90%. The mouse strain, gestation time, and study parameters used in this study were the same as in the previously reported ASA attenuation of the teratogenic effect of ethanol. Therefore, the present data add additional support to the hypothesis that prostaglandin and/or thromboxane production may be involved in at least some aspects of fetal alcohol syndrome.

  16. The transcription factor SlDof22 involved in ascorbate accumulation and salinity stress in tomato.

    Science.gov (United States)

    Cai, Xiaofeng; Zhang, Chanjuan; Shu, Wenbo; Ye, Zhibiao; Li, Hanxia; Zhang, Yuyang

    2016-06-10

    Ascorbic acid (AsA) is an important antioxidant and its biosynthesis in plants has extensively been investigated. However, the key regulatory factors controlling the accumulation of AsA remain elusive. Here we report that tomato SlDof22, a member of the Dof family, negatively regulated AsA accumulation in tomato. RNA interference (RNAi) of SlDof22 in transgenic lines induced AsA levels, and affected the expression of genes in the D-mannose/L-galactose pathway and AsA recycling. In addition, SlSOS1 was significantly down-regulated in SlDof22 RNAi plants which resulted in reduced tolerance to salt stress. We further found that SlDof22 could bind to the promoter sequence of SlSOS1 gene by yeast one-hybrid analysis. Taken together, our data suggested that the Dof transcription factor SIDof22 involved in ascorbate accumulation and salt stress response in tomato. PMID:27157141

  17. Colon-specific prodrugs of 4-aminosalicylic acid for inflammatory bowel disease.

    Science.gov (United States)

    Dhaneshwar, Suneela S

    2014-04-01

    Despite the advent of biological products, such as anti-tumor necrosis factor-α monoclonal antibodies (infliximab and adalimumab), for treatment of moderate to severe cases of inflammatory bowel disease (IBD), most patients depend upon aminosalicylates as the conventional treatment option. In recent years, the increased knowledge of complex pathophysiological processes underlying IBD has resulted in development of a number of newer pharmaceutical agents like low-molecular-weight heparin, omega-3 fatty acids, probiotics and innovative formulations such as high-dose, once-daily multi-matrix mesalamine, which are designed to minimize the inflammatory process through inhibition of different targets. Optimization of delivery of existing drugs to the colon using the prodrug approach is another attractive alternative that has been utilized and commercialized for 5-aminosalicylic acid (ASA) in the form of sulfasalazine, balsalazide, olsalazine and ipsalazine, but rarely for its positional isomer 4-ASA - a well-established antitubercular drug that is twice as potent as 5-ASA against IBD, and more specifically, ulcerative colitis. The present review focuses on the complete profile of 4-ASA and its advantages over 5-ASA and colon-targeting prodrugs reported so far for the management of IBD. The review also emphasizes the need for reappraisal of this promising but unexplored entity as a potential treatment option for IBD. PMID:24707139

  18. Acacia-gelatin microencapsulated liposomes: preparation, stability, and release of acetylsalicylic acid.

    Science.gov (United States)

    Dong, C; Rogers, J A

    1993-01-01

    Liposomes of dipalmitoylphosphatidylcholine (DPPC) containing acetylsalicylic acid (ASA) have been microencapsulated by acacia-gelatin using the complex coacervation technique as a potential oral drug delivery system. The encapsulation efficiency of ASA was unaltered by the microencapsulation process. The stability of the microencapsulated liposomes in sodium cholate solutions at pH 5.6 was much greater than the corresponding liposomes. The optimum composition and conditions for stability and ASA release were 3.0% acacia-gelatin and a 1- to 2-hr formaldehyde hardening time. Approximately 25% ASA was released in the first 6 hr from microencapsulated liposomes at 23 degrees C and the kinetics followed matrix-controlled release (Q varies; is directly proportional to t1/2). At 37 degrees C, this increased to 75% released in 30 min followed by a slow constant release, likely due to lowering of the phase transition temperature of DPPC by the acacia-gelatin to near 37 degrees C. At both temperatures, the release from control liposomes was even more rapid. Hardening times of 4 hr and an acacia-gelatin concentration of 5% resulted in a lower stability of liposomes and a faster release of ASA. It is concluded that under appropriate conditions the microencapsulation of liposomes by acacia-gelatin may increase their potential as an oral drug delivery system. PMID:8430052

  19. Soil! Get the Scoop - The Soil Science Society of America's International Year of Soils Campaign

    Science.gov (United States)

    Lindbo, David L.; Hopmans, Jan; Olson, Carolyn; Fisk, Susan; Chapman, Susan; van Es, Harold

    2015-04-01

    Soils are a finite natural resource and are nonrenewable on a human time scale. Soils are the foundation for food, animal feed, fuel and natural fiber production, the supply of clean water, nutrient cycling and a range of ecosystem functions. The area of fertile soils covering the world's surface is limited and increasingly subject to degradation, poor management and loss to urbanization. Increased awareness of the life-supporting functions of soil is called for if this trend is to be reversed and so enable the levels of food production necessary to meet the demands of population levels predicted for 2050. The Soil Science Society of America is coordinating with the Global Soil Partnership and other organizations around the world to celebrate the 2015 International Year of Soils and raise awareness and promote the sustainability of our limited soil resources. We all have a valuable role in communicating vital information on soils, a life sustaining natural resource. Therefore, we will provide resources to learn about soils and help us tell the story of soils. We will promote IYS on social media by sharing our posts from Facebook and Twitter. Additionally SSSA developed 12 monthly themes that reflect the diverse value of soils to our natural environment and society. Each month has information on the theme, a lesson plan, and other outreach activities. All information is available on a dedicated website www.soil.org/IYS. The site will be updated constantly throughout the year.

  20. Spin–spin correlation length in a two-dimensional frustrated magnet and its relation to doping

    International Nuclear Information System (INIS)

    In a spherically symmetric self-consistent approach (SSSA), the spin-1/2 J1–J2 Heisenberg model on a two-dimensional square lattice is considered for two-time retarded spin–spin Green’s functions. The spin excitation spectrum, ω(q), and spin gaps at symmetric points are obtained for the entire J1–J2 diagram, i.e., for any ϕ, J1 = cosϕ, and J2 = sinϕ. The structure factor cq and the correlation length ξ at finite temperature are calculated in the entire range of parameters. A radical difference in the behavior of the system in the upper, frustrated (0 ⩽ ϕ ⩽ π), and the lower, nonfrustrated (π ⩽ ϕ ⩽ 2π), regions of the diagram is demonstrated. In the latter region, there is a first-order phase transition that is unique on the phase diagram. For a weakly frustrated antiferromagnet (J1 > J2 > 0), the results obtained are compared with the experimental dependence of ξ on temperature and doping level. A correspondence rule is proposed between frustration in a spin model and the doping of an antiferromagnet with holes

  1. Using soil health to assess ecotoxicological impacts of pollutants on soil microflora.

    Science.gov (United States)

    Bécaert, Valérie; Deschênes, Louise

    2006-01-01

    Microorganisms are essential for a properly functioning soil ecosystem. However, few methods allow an ecotoxicological evaluation of pollutant impact on the soil microbial community. This review proposes the use of the concept of soil health as an ecotoxicological evaluation tool for soil microflora. Initially limited to sustainable agriculture, the concept of soil health is now being applied to novel situations including contaminated and remediated soils. A large amount of work has been published in the last few decades on soil health indicators, and a review of the most relevant studies is presented here. The most cited work is that of the S-5518 committee set up in 1997 by the Soil Science Society of America (SSSA), which proposed to define soil quality as being "the capacity of a soil to function within the limits of an ecosystem, to support biological production, to maintain environmental quality and to support fauna and flora health." The soil health indicators reviewed here are the ones based on this definition because it relates well to sustainability and durability of the soil functions. Several indicators proposed in these studies could be employed in the evaluation of the ecotoxicological impact of pollutants on the soil microbial community, including microbial diversity, microbial activity, and functional stability. However, research is still required to unify the concept, to set threshold values, and to standardize methodologies. PMID:17016918

  2. Possible interactions between dietary fibres and 5-aminosalicylic acid [corrected

    DEFF Research Database (Denmark)

    Henriksen, Camilla; Hansen, Steen Honoré; Nordgaard-Lassen, Inge;

    2010-01-01

    fibres is related to disease activity in patients with ulcerative colitis (UC) treated with 5-ASA. METHODS: In vitro: 15 g of Ispaghula Husk, wheat bran, citrus-pectin, or wheat flour were incubated in a 37°C buffered solutions of 5-ASA (1 g/l) for 3 hours at pH 6 and 7. The concentrations of 5-ASA were...... Ispaghula Husk (5.3-10.0 mg/g) and wheat bran (4.6-5.5 mg/g), and to a minor degree to citrus-pectin. No differences were found in relation to pH. In vivo: 29 patients completed the scheduled interviews. No significant changes in fibre consumption were observed over time; however, patients consuming a diet...

  3. Angular Spectrum Simulation of Pulsed Ultrasound Fields

    DEFF Research Database (Denmark)

    Du, Yigang; Jensen, Henrik; Jensen, Jørgen Arendt

    The optimization of non-linear ultrasound imaging should in a first step be based on simulation, as this makes parameter studies considerably easier than making transducer prototypes. Such a simulation program should be capable of simulating non-linear pulsed fields for arbitrary transducer...... geometries for any kind of focusing and apodization. The Angular Spectrum Approach (ASA) is capable of simulating monochromatic non-linear acoustic wave propagation. However, for ultrasound imaging the time response of each specific point in space is required, and a pulsed ASA simulation with multi temporal...... frequencies must be performed. Combining it with Field II, the generation of non-linear simulation for any geometry with any excitation array transducer becomes feasible. The purpose of this paper is to make a general pulsed simulation software using the modified ASA. Linear and phased array transducers are...

  4. Final hazard classification and auditable safety analysis for the N basin segment

    International Nuclear Information System (INIS)

    The purpose of this report is to provide the following: To serve as the auditable safety analysis (ASA) for the N Basin Segment, including both the quiescent state and planned intrusive activities. The ASA is developed through the realistic evaluation of potential hazards that envelope the threat to personnel. The ASA also includes the specification of the programmatic, baseline, and activity- specific controls that are necessary for the protection of workers. To determine and document the final hazard classification (FHC) for the N Basin Segment. The FHC is developed through the use of bounding accident analyses that envelope the potential exposures to personnel. The FHC also includes the specification of the special controls that are necessary to remain within the envelope of those accident analyses

  5. Full charge-density scheme with a kinetic-energy correction: Application to ground-state properties of the 4d metals

    DEFF Research Database (Denmark)

    Vitos, Levente; Kollár, J.; Skriver, Hans Lomholt

    1997-01-01

    We present a full charge-density technique to evaluate total energies from the output of self-consistent linear muffin-tin orbitals (LMTO) calculations in the atomic-sphere approximation (ASA). The Coulomb energy is calculated exactly from the complete, nonspherically symmetric charge density...... defined within nonoverlapping, space-filling Wigner-Seitz cells; the exchange-correlation energy is evaluated by means of the local-density approximation or the generalized gradient approximation applied to the complete charge-density; and the ASA kinetic energy is corrected for the nonspherically...... symmetric charge density by a gradient expansion. The technique retains most of the simplicity and the computational efficiency of the LMTO-ASA method, and calculations of atomic volumes and elastic constants of the 4d elements show that it has the accuracy of full-potential methods....

  6. Decontamination of laryngoscopes in The Netherlands.

    Science.gov (United States)

    Bucx, M J; Dankert, J; Beenhakker, M M; Harrison, T E

    2001-01-01

    In this study the decontamination procedures of laryngoscopes in Dutch hospitals are described, based on a structured telephone questionnaire. There were substantial differences between decontamination procedures in Dutch hospitals and the standards of the APIC (Association of Professionals in Infection Control and Epidemiology), CDC (Centers of Disease Control) and ASA (American Society of Anesthesiology) were met in full in 19.4% of the hospitals. The standards of manual decontamination, used in 78% of the 139 hospitals, were particularly disappointing; manual cleaning was considered inadequate in 22.9% of these hospitals and manual disinfection did not meet the standards of the APIC, CDC or ASA in any of these hospitals. Decontamination by instrument cleaning machines as a standard procedure was used in 30 (22%) hospitals. In three of these hospitals the blades were subsequently sterilized. We suggest adherence to the infection control guidelines of the CDC, APIC and ASA, until the safety of less conservative infection control practices are demonstrated. PMID:11575419

  7. Medicinal therapy for interventional surgery of the peripheral vascular system

    International Nuclear Information System (INIS)

    The aim of medicinal treatment, during and after femoral and crural interventions is to prevent early or late onset arterial thrombosis of the treated vascular segments. Therefore, unfractionated heparin is administered during the intervention by an intra-arterial or intravenous approach. To avoid late onset thrombosis, administration of platelet function inhibitors is recommended. However, valid data are only available for acetylsalicylic acid (ASA). Therefore, ASA is recommended for long term medication. In several cardiological studies on stent implantation in coronary vessels the combination of ASA and clopidogrel for dual platelet inhibition has been proven to be effective. These results have been transferred to antithrombotic therapy of the lower extremities despite the lack of dedicated studies. There is no evidence for the use of vitamin K antagonists after peripheral interventions. (orig.)

  8. Comparative gastrointestinal blood loss associated with placebo, aspirin, and nabumetone as assessed by radiochromium (/sup 51/Cr)

    Energy Technology Data Exchange (ETDEWEB)

    Lussier, A.; Davis, A.; Lussier, Y.; Lebel, E.

    1989-03-01

    Nabumetone differs from most other nonsteroidal anti-inflammatory drugs. It is presented to the gut as a nonacidic prodrug, and is metabolized to its active form after absorption. Studies in animals and humans suggest it is less irritating to the gastrointestinal mucosa. This study compared the gastrointestinal microbleeding induced by nabumetone to aspirin (acetylsalicylic acid, ASA), and placebo in a double blind parallel study using chromium /sup 51/Cr labelled red cells to quantitate fecal blood loss (FBL) in healthy volunteers. Thirty subjects were randomized to treatment with nabumetone (2000 mg), ASA (3.6 g) or placebo for 21 days following a 7 day placebo period. Six subjects served as untreated controls. FBL in nabumetone treated subjects was not significantly different to placebo or untreated subjects. In contrast, ASA-treated subjects exhibited significantly increased FBL than the other 3 groups (P less than .0001).

  9. Palomuurien IPv6-migraatio

    OpenAIRE

    Leinonen, Riku

    2011-01-01

    Tämän työn tarkoituksena on ollut tutkia Cisco ASA -palomuurien IPv6-ominaisuuksia ja sitä, mitä pitää ottaa huomioon IPv6-osoitteisiin siirtyessä, erityisesti Cisco ASA 5510 -palomuureissa. Työssä selvitettiin, miten saatiin käytössä olevaan IPv4-palomuuriin lisättyä IPv6-liikenne ja mitä eri IPv6-tunneleita voitiin toteuttaa eri Cisco ASA –käyttöjärjestelmäversioilla. Työssä selvitettiin myös miten natiivi IPv6-palomuuri liitettiin verkkoon. Työ on tehty Optimiratkaisut Oy:n toimeksiantona ...

  10. ACOUSTICAL STANDARDS NEWS.

    Science.gov (United States)

    Blaeser, Susan B; Struck, Christopher J

    2016-03-01

    American National Standards (ANSI Standards) developed by Accredited Standards Committees S1, S2, S3, S3/SC 1, and S12 in the areas of acoustics, mechanical vibration and shock, bioacoustics, animal bioacoustics, and noise, respectively, are published by the Acoustical Society of America (ASA). In addition to these standards, ASA publishes a catalog of Acoustical American National Standards. To receive a copy of the latest Standards catalog, please contact Susan B. Blaeser.Comments are welcomed on all material in Acoustical Standards News.This Acoustical Standards News section in JASA, as well as the National Catalog of Acoustical Standards and other information on the Standards Program of the Acoustical Society of America, are available via the ASA home page: http://acousticalsociety.org. PMID:27036268

  11. Classroom Materials from the Acoustical Society of America

    Science.gov (United States)

    Adams, W. K.; Clark, A.; Schneider, K.

    2013-09-01

    As part of the new education initiatives of the Acoustical Society of America (ASA), an activity kit for teachers that includes a variety of lessons addressing acoustics for a range of students (K-12) has been created. The "Sound and Music Activity Kit" is free to K-12 teachers. It includes materials sufficient to teach a class of 30 students plus a USB thumb drive containing 47 research-based, interactive, student-tested lessons, laboratory exercises, several assessments, and video clips of a class using the materials. ASA has also partnered with both the Optical Society of America (OSA) and the American Association of Physics Teachers. AAPT Physics Teaching Resource Agents (PTRA) have reviewed the lessons along with members of the ASA Teacher Activity Kit Committee. Topics include basic learning goals for teaching the physics of sound with examples and applications relating to medical imaging, animal bioacoustics, physical and psychological acoustics, speech, audiology, and architectural acoustics.

  12. Comparison of single-dose ibuprofen lysine, acetylsalicylic acid, and placebo for moderate-to-severe postoperative dental pain.

    Science.gov (United States)

    Nelson, S L; Brahim, J S; Korn, S H; Greene, S S; Suchower, L J

    1994-01-01

    In a single-dose, double-blind, parallel-group, single-site study, ibuprofen lysine 200 mg (IBL 200) was compared with acetylsalicylic acid 500 mg (ASA 500) and placebo in 183 patients with moderate-to-severe postoperative dental pain. The relative onset of analgesic response, duration and degree of analgesia, and safety were assessed over a 6-hour postdose period. Analgesic efficacy was assessed by patient self-rating of pain intensity, pain relief, time to meaningful pain relief, global evaluation, and requirement for additional analgesic medication; both IBL 200 and ASA 500 were significantly more effective than placebo. IBL 200 also had a significantly faster onset of action, greater peak and overall analgesic effect, and longer duration of analgesia than ASA 500. All treatments were generally well tolerated. PMID:7923312

  13. Synthesis of azo derivatives of 4-aminosalicylic acid

    Institute of Scientific and Technical Information of China (English)

    Zheng Bao Zhao; Hui Xia Zheng; Yuan Gui Wei; Jiang Liu

    2007-01-01

    For searching a better 4-aminosalicylic acid derivative with higher activity and less side effects against the inflammatory bowel disease, 4-aminosalicylic acid (4-ASA) was protected by benzyloxycarbonyl and acetyl, respectively.The resultant was hydrogenized to remove protective group of amino group, then the product was reacted with NaNO2 to give diazonium salt, which was conjugated with salicylic acid, hydroxybenzene, N-salicyloyl glycine acid to get azo derivatives of 4-ASA.The azo derivatives were hydrolyzed under the alkaline condition to get the target products.All compounds were characterized by FT-IR, 1H NMR, 13C NMR spectra in details.New derivatives of 4-ASA were characterized.The synthetic route was reasonable and feasible.

  14. Effective cluster interactions using the generalized perturbation method in the atomic-sphere approximation

    International Nuclear Information System (INIS)

    We describe the generalized perturbation method in the atomic-sphere approximation (ASA) for calculating the effective cluster interactions. Based on our development of Korringa-Kohn-Rostoker coherent-potential approximation in the ASA [Singh et al., Phys. Rev. B 44, 8578 (1991)], the present approach is the next step towards developing a first-principles method that can be easily applied to describe substitutionally disordered alloys based on simple lattice structures as well as complex lattice structures with low symmetry. To test the accuracy of the ASA results, we have calculated the effective pair interactions (EPI) up to fourth-nearest neighbors for the substitutionally disordered Pd0.5V0.5 and Pd0.75Rh0.25 alloys. Our calculated EPI's are in good agreement with the respective muffin-tin results

  15. Fabrication of fluorescent chitosan-containing microcapsules

    Directory of Open Access Journals (Sweden)

    Zhang R.

    2013-08-01

    Full Text Available Intense emission peaks of Eu(DBM3Phen (DBM and Phen are dibenzoylmethane and 1,10-phenanthroline, respectively in the microcapsules containing molecules of quaternary ammonium chitosan (QACS and sodium alginate are observed. The microcapsules are assembled by using CaCO3 particles as template cores by the layer-by-layer (LbL technique. Observation of microcapsules by the fluorescence mode and the transmission mode in the confocal laser scanning microscopy shows that the microcapsules are intact after core decomposition. Fluorescence under ultraviolet irradiation comes directly from the Eu(DBM3Phen. Homogeneous assembly of Eu(DBM3Phen can be deduced due to the homogeneous fluorescence of the microcapsules in the fluorescence micrographs. The microcapsules show adherence to solid substrates due to large quantities of hydroxyl groups of QACS. AFM measurements of dried hollow microcapsules with only 4 bilayers of (CS/SA fabricated with Eu(DBM3Phen show the intact shell with a thickness of 3.0 nm. Regarding the biocompatible natural polysaccharides and the intense fluorescence emission, the microcapsules in this work might be of great importance in potential application in drug delivery and bioassay.

  16. Asthma and Rhinitis Induced by Selective Immediate Reactions to Paracetamol and Non-steroidal Anti-inflammatory Drugs in Aspirin Tolerant Subjects

    Science.gov (United States)

    Pérez-Alzate, Diana; Blanca-López, Natalia; Doña, Inmaculada; Agúndez, José A.; García-Martín, Elena; Cornejo-García, José A.; Perkins, James R.; Blanca, Miguel; Canto, Gabriela

    2016-01-01

    In subjects with non-steroidal anti-inflammatory drugs (NSAIDs)- exacerbated respiratory disease (NERD) symptoms are triggered by acetyl salicylic acid (ASA) and other strong COX-1 inhibitors, and in some cases by weak COX-1 or by selective COX-2 inhibitors. The mechanism involved is related to prostaglandin pathway inhibition and leukotriene release. Subjects who react to a single NSAID and tolerate others are considered selective responders, and often present urticaria and/or angioedema and anaphylaxis (SNIUAA). An immunological mechanism is implicated in these reactions. However, anecdotal evidence suggests that selective responders who present respiratory airway symptoms may also exist. Our objective was to determine if subjects might develop selective responses to NSAIDs/paracetamol that manifest as upper/lower airways respiratory symptoms. For this purpose, we studied patients reporting asthma and/or rhinitis induced by paracetamol or a single NSAID that tolerated ASA. An allergological evaluation plus controlled challenge with ASA was carried out. If ASA tolerance was found, we proceeded with an oral challenge with the culprit drug. The appearance of symptoms was monitored by a clinical questionnaire and by measuring FEV1 and/or nasal airways volume changes pre and post challenge. From a total of 21 initial cases, we confirmed the appearance of nasal and/or bronchial manifestations in ten, characterized by a significant decrease in FEV1% and/or a decrease in nasal volume cavity after drug administration. All cases tolerated ASA. This shows that ASA tolerant subjects with asthma and/or rhinitis induced by paracetamol or a single NSAID without skin/systemic manifestations exist. Whether these patients represent a new clinical phenotype to be included within the current classification of hypersensitivity reactions to NSAIDs requires further investigation. PMID:27489545

  17. CONSTRUCTION OF A CALIBRATED PROBABILISTIC CLASSIFICATION CATALOG: APPLICATION TO 50k VARIABLE SOURCES IN THE ALL-SKY AUTOMATED SURVEY

    International Nuclear Information System (INIS)

    With growing data volumes from synoptic surveys, astronomers necessarily must become more abstracted from the discovery and introspection processes. Given the scarcity of follow-up resources, there is a particularly sharp onus on the frameworks that replace these human roles to provide accurate and well-calibrated probabilistic classification catalogs. Such catalogs inform the subsequent follow-up, allowing consumers to optimize the selection of specific sources for further study and permitting rigorous treatment of classification purities and efficiencies for population studies. Here, we describe a process to produce a probabilistic classification catalog of variability with machine learning from a multi-epoch photometric survey. In addition to producing accurate classifications, we show how to estimate calibrated class probabilities and motivate the importance of probability calibration. We also introduce a methodology for feature-based anomaly detection, which allows discovery of objects in the survey that do not fit within the predefined class taxonomy. Finally, we apply these methods to sources observed by the All-Sky Automated Survey (ASAS), and release the Machine-learned ASAS Classification Catalog (MACC), a 28 class probabilistic classification catalog of 50,124 ASAS sources in the ASAS Catalog of Variable Stars. We estimate that MACC achieves a sub-20% classification error rate and demonstrate that the class posterior probabilities are reasonably calibrated. MACC classifications compare favorably to the classifications of several previous domain-specific ASAS papers and to the ASAS Catalog of Variable Stars, which had classified only 24% of those sources into one of 12 science classes.

  18. CONSTRUCTION OF A CALIBRATED PROBABILISTIC CLASSIFICATION CATALOG: APPLICATION TO 50k VARIABLE SOURCES IN THE ALL-SKY AUTOMATED SURVEY

    Energy Technology Data Exchange (ETDEWEB)

    Richards, Joseph W.; Starr, Dan L.; Miller, Adam A.; Bloom, Joshua S.; Brink, Henrik; Crellin-Quick, Arien [Astronomy Department, University of California, Berkeley, CA 94720-3411 (United States); Butler, Nathaniel R., E-mail: jwrichar@stat.berkeley.edu [School of Earth and Space Exploration, Arizona State University, Tempe, AZ 85287 (United States)

    2012-12-15

    With growing data volumes from synoptic surveys, astronomers necessarily must become more abstracted from the discovery and introspection processes. Given the scarcity of follow-up resources, there is a particularly sharp onus on the frameworks that replace these human roles to provide accurate and well-calibrated probabilistic classification catalogs. Such catalogs inform the subsequent follow-up, allowing consumers to optimize the selection of specific sources for further study and permitting rigorous treatment of classification purities and efficiencies for population studies. Here, we describe a process to produce a probabilistic classification catalog of variability with machine learning from a multi-epoch photometric survey. In addition to producing accurate classifications, we show how to estimate calibrated class probabilities and motivate the importance of probability calibration. We also introduce a methodology for feature-based anomaly detection, which allows discovery of objects in the survey that do not fit within the predefined class taxonomy. Finally, we apply these methods to sources observed by the All-Sky Automated Survey (ASAS), and release the Machine-learned ASAS Classification Catalog (MACC), a 28 class probabilistic classification catalog of 50,124 ASAS sources in the ASAS Catalog of Variable Stars. We estimate that MACC achieves a sub-20% classification error rate and demonstrate that the class posterior probabilities are reasonably calibrated. MACC classifications compare favorably to the classifications of several previous domain-specific ASAS papers and to the ASAS Catalog of Variable Stars, which had classified only 24% of those sources into one of 12 science classes.

  19. Construction of a Calibrated Probabilistic Classification Catalog: Application to 50k Variable Sources in the All-Sky Automated Survey

    Science.gov (United States)

    Richards, Joseph W.; Starr, Dan L.; Miller, Adam A.; Bloom, Joshua S.; Butler, Nathaniel R.; Brink, Henrik; Crellin-Quick, Arien

    2012-12-01

    With growing data volumes from synoptic surveys, astronomers necessarily must become more abstracted from the discovery and introspection processes. Given the scarcity of follow-up resources, there is a particularly sharp onus on the frameworks that replace these human roles to provide accurate and well-calibrated probabilistic classification catalogs. Such catalogs inform the subsequent follow-up, allowing consumers to optimize the selection of specific sources for further study and permitting rigorous treatment of classification purities and efficiencies for population studies. Here, we describe a process to produce a probabilistic classification catalog of variability with machine learning from a multi-epoch photometric survey. In addition to producing accurate classifications, we show how to estimate calibrated class probabilities and motivate the importance of probability calibration. We also introduce a methodology for feature-based anomaly detection, which allows discovery of objects in the survey that do not fit within the predefined class taxonomy. Finally, we apply these methods to sources observed by the All-Sky Automated Survey (ASAS), and release the Machine-learned ASAS Classification Catalog (MACC), a 28 class probabilistic classification catalog of 50,124 ASAS sources in the ASAS Catalog of Variable Stars. We estimate that MACC achieves a sub-20% classification error rate and demonstrate that the class posterior probabilities are reasonably calibrated. MACC classifications compare favorably to the classifications of several previous domain-specific ASAS papers and to the ASAS Catalog of Variable Stars, which had classified only 24% of those sources into one of 12 science classes.

  20. Onyx injection by direct puncture for the treatment of hypervascular spinal metastases close to the anterior spinal artery: initial experience.

    Science.gov (United States)

    Clarençon, Frédéric; Di Maria, Federico; Cormier, Evelyne; Sourour, Nader-Antoine; Enkaoua, Eric; Sailhan, Frédéric; Iosif, Christina; Le Jean, Lise; Chiras, Jacques

    2013-06-01

    Presurgical devascularization of hypervascular spinal metastases has been shown to be effective in preventing major blood loss during open surgery. Most often, embolization can be performed using polyvinyl alcohol (PVA) microparticles. However, in some cases, the close relationship between the feeders of the metastases and the feeders of the anterior spinal artery (ASA) poses a risk of spinal cord ischemia when PVA microparticle embolization is performed. The authors present their early experience in the treatment of spinal metastases close to the ASA; in 2 cases they injected Onyx-18, by direct puncture, into hypervascular posterior arch spinal metastases situated close to the ASA. Two women, one 36 and the other 55 years of age, who presented with spinal lesions (at the posterior arch of C-4 and T-6, respectively) from thyroid and a kidney tumors, were sent to the authors' department to undergo presurgical embolization. After having performed a complete spinal digital subtraction angiography study, a regular angiography catheter was positioned at the ostium of the artery that mainly supplied the lesion. Then, with the patient in the left lateral decubitus position, direct puncture with 18-gauge needles of the lesion was performed using roadmap guidance. Onyx-18 was injected through the needles under biplanar fluoroscopy. Satisfactory devascularization of the lesions was obtained; the ASA remained patent in both cases. The metastases were surgically removed in both cases within the 48 hours after the embolization and major blood loss did not occur. Presurgical devascularization of hypervascular spinal metastases close the ASA by direct puncture with Onyx-18 seems to be an effective technique and appears to be safe in terms of the preserving the ASA's patency. PMID:23600580

  1. Addition of aspirin to a fish oil-rich diet decreases inflammation and atherosclerosis in ApoE-null mice.

    Science.gov (United States)

    Sorokin, Alexander V; Yang, Zhi-Hong; Vaisman, Boris L; Thacker, Seth; Yu, Zu-Xi; Sampson, Maureen; Serhan, Charles N; Remaley, Alan T

    2016-09-01

    Aspirin (ASA) is known to alter the production of potent inflammatory lipid mediators, but whether it interacts with omega-3 fatty acids (FAs) from fish oil to affect atherosclerosis has not been determined. The goal was to investigate the impact of a fish oil-enriched diet alone and in combination with ASA on the production of lipid mediators and atherosclerosis. ApoE(-/-) female mice were fed for 13weeks one of the four following diets: omega-3 FA deficient (OD), omega-3 FA rich (OR) (1.8g omega-3 FAs/kg·diet per day), omega-3 FA rich plus ASA (ORA) (0.1g ASA/kg·diet per day) or an omega-3 FA deficient plus ASA (ODA) with supplement levels equivalent to human doses. Plasma lipids, atherosclerosis, markers of inflammation, hepatic gene expression and aortic lipid mediators were determined. Hepatic omega-3 FAs were markedly higher in OR (9.9-fold) and ORA (7-fold) groups. Mice in both OR and ORA groups had 40% less plasma cholesterol in very low-density lipoprotein-cholesterol and low-density lipoprotein fractions, but aortic plaque area formation was only significantly lower in the ORA group (5.5%) compared to the OD group (2.5%). Plasma PCSK9 protein levels were approximately 70% lower in the OR and ORA groups. Proinflammatory aortic lipid mediators were 50%-70% lower in the ODA group than in the OD group and more than 50% lower in the ORA group. In summary, less aortic plaque lesions and aortic proinflammatory lipid mediators were observed in mice on the fish oil diet plus ASA vs. just the fish oil diet. PMID:27394692

  2. An Energy Aware Adaptive Sampling Algorithm for Energy Harvesting WSN with Energy Hungry Sensors.

    Science.gov (United States)

    Srbinovski, Bruno; Magno, Michele; Edwards-Murphy, Fiona; Pakrashi, Vikram; Popovici, Emanuel

    2016-01-01

    Wireless sensor nodes have a limited power budget, though they are often expected to be functional in the field once deployed for extended periods of time. Therefore, minimization of energy consumption and energy harvesting technology in Wireless Sensor Networks (WSN) are key tools for maximizing network lifetime, and achieving self-sustainability. This paper proposes an energy aware Adaptive Sampling Algorithm (ASA) for WSN with power hungry sensors and harvesting capabilities, an energy management technique that can be implemented on any WSN platform with enough processing power to execute the proposed algorithm. An existing state-of-the-art ASA developed for wireless sensor networks with power hungry sensors is optimized and enhanced to adapt the sampling frequency according to the available energy of the node. The proposed algorithm is evaluated using two in-field testbeds that are supplied by two different energy harvesting sources (solar and wind). Simulation and comparison between the state-of-the-art ASA and the proposed energy aware ASA (EASA) in terms of energy durability are carried out using in-field measured harvested energy (using both wind and solar sources) and power hungry sensors (ultrasonic wind sensor and gas sensors). The simulation results demonstrate that using ASA in combination with an energy aware function on the nodes can drastically increase the lifetime of a WSN node and enable self-sustainability. In fact, the proposed EASA in conjunction with energy harvesting capability can lead towards perpetual WSN operation and significantly outperform the state-of-the-art ASA. PMID:27043559

  3. Lipoic acid and redox status in barley plants subjected to salinity and elevated CO{sub 2}

    Energy Technology Data Exchange (ETDEWEB)

    Perez-Lopez, U.; Robredo, A.; Mena-Petite, A.; Munoz-Rueda, A. (Univ. del Pais Vasco/EHU, Dept. de Biologia Vegetal y Ecologia, Bilbao (Spain)); Lacuesta, M. (Univ. del Pais Vasco/EHU, Dept. de Biologia Vegetal y Ecologia, Vitoria-Gasteiz (Spain)); Sgherri, C.; Navari-Izzo, F. (Univ. di Pisa, Dipartimento di Chimica e Biotecnologie Agrarie, Pisa (Italy))

    2010-02-15

    Future environmental conditions will include elevated concentrations of salt in the soil and an elevated concentration of CO{sub 2}in the atmosphere. Because these environmental changes will likely affect reactive oxygen species (ROS) formation and cellular antioxidant metabolism in opposite ways, we analyzed changes in cellular H{sub 2}O{sub 2} and non-enzymatic antioxidant metabolite [lipoic acid (LA), ascorbate (ASA), glutathione (GSH)] content induced by salt stress (0, 80, 160 or 240 mM NaCl) under ambient (350 mumol mol-1) or elevated (700 mumol mol-1) CO{sub 2}concentrations in two barley cultivars (Hordeum vulgare L.) that differ in sensitivity to salinity (cv. Alpha is more sensitive than cv. Iranis). Under non-salinized conditions, elevated CO{sub 2}increased LA content, while ASA and GSH content decreased. Under salinized conditions and ambient CO{sub 2}, ASA increased, while GSH and LA decreased. At 240 mM NaCl, H{sub 2}O{sub 2} increased in Alpha and decreased in Iranis. When salt stress was imposed at elevated CO{sub 2}, less oxidative stress and lower increases in ASA were detected, while LA was constitutively higher. The decrease in oxidative stress could have been because of less ROS formation or to a higher constitutive LA level, which might have improved regulation of ASA and GSH reductions. Iranis had a greater capacity to synthesize ASA de novo and had higher constitutive LA content than did Alpha. Therefore, we conclude that elevated CO{sub 2}protects barley cultivars against oxidative damage. However, the magnitude of the positive effect is cultivar specific. (author)

  4. Adherence with regulatory resolutions on prevention of NSAIDS-related gastrointestinal injury in Italy.

    Science.gov (United States)

    Montagnani, Sabrina; Tuccori, Marco; Testi, Arianna; Cristofano, Michele; Corona, Tiberio; Salvadori, Stefano; Scarpignato, Carmelo; Blandizzi, Corrado

    2016-08-01

    Background The rate of gastrointestinal (GI) complications with non-steroidal antiinflammatory drugs (NSAIDs) or low-dose aspirin (LD-ASA) varies according to risk factors. For at risk patients, the Italian regulatory resolution enforce prophylaxis with proton pump inhibitors (PPIs) or misoprostol. Objective This study evaluated the consistency with such resolution in patients receiving NSAIDs or LD-ASA and assessed whether patients continued to receive GI protection with PPIs for an adequate time following NSAID discontinuation. Setting An observational retrospective study was conducted using data from Health District of Pisa. Methods The analysis was performed on patients receiving prescription of NSAIDs or LD-ASA, with or without concomitant PPIs or misoprostol, accordingly with the presence of risk factors (2008-2010). Prescription data were retrieved from the database of reimbursement claims for dispensed drugs, while history of past GI diseases was obtained from primary or secondary discharge diagnosis. Main outcome measure The consistency rates of PPI and misoprostol prescriptions with Italian regulatory rules in patients receiving chronic NSAIDs or LD-ASA. Results 6869 patients, receiving NSAIDs or LD-ASA during the observation period, were eligible for the analysis. For NSAIDs or LD-ASA, gastroprotection rates in patients without risk factors were: 8 and 6 % in 2008; 10 and 8 % in 2009; 9 and 6 % in 2010; while the proportions of patients with one or more risk factors not receiving gastroprotection were: 12 and 17 % in 2008; 25 and 22 % in 2009; 15 and 17 % in 2010. In patients discontinuing chronic NSAIDs, 62 % were maintained on protection with PPIs, but only 28 % continued the PPI treatment for an adequate time (60 ± 7 days). Conclusions The present analysis, although restricted to prescription patterns in a single health district, suggests scarce levels of consistency with Italian regulatory resolution on the prophylaxis of GI adverse

  5. Synergistic and individual effect of glomus etunicatum root colonization and acetyl salicylic acid on root activity and architecture of tomato plants under moderate nacl stress

    International Nuclear Information System (INIS)

    A pot based experiment in plastic tunnel was conducted to investigate the changes in root morphology and root activity of the tomato plants grown under moderate NaCl stress (100 mM), pretreated with arbuscular mycorrhizal fungus AMF (Glomus etunicatum) root colonization and acetyl salicylic acid (ASA) as salinity ameliorative agents. The results revealed that both AMF and ASA treatments significantly enhanced the fresh root weight and root morphological parameters; net length, surface area, volume, mean diameter, nodal count and number of tips to different extents as compared to those of sole salinity treatment at 90 days after transplantation. Both treatments; AMF alone and in combination with ASA significantly enhanced the root activity level in terms of triphenyl tetrazolium chloride (TTC) reduction (2.37 and 2.40 mg g /sup -1/ h /sup -1/ respectively) as compared to the sole salinity treatment (0.40 mg g /sup -1/ h /sup -1/ ) as well as the salt free control (1.69 mg g /sup -1/ h /sup -1/) On the other hand, ASA treatment alone also uplifted root activity (1.53 mg g /sup -1/ h /sup -1/ ) which was significantly higher than that of sole salt treatment. It was inferred that under moderate saline conditions (100 mM NaCl), AMF (Glomus etunicatum) and ASA (individually or in combination) confer protective effect on plant growth by enhanced root activity and improved root architecture. Therefore, synergistic use of AMF (G. etunicatum) and ASA can be eco-friendly and economically feasible option for tomato production in marginally salt affected lands and suggests further investigations. (author)

  6. An Energy Aware Adaptive Sampling Algorithm for Energy Harvesting WSN with Energy Hungry Sensors

    Science.gov (United States)

    Srbinovski, Bruno; Magno, Michele; Edwards-Murphy, Fiona; Pakrashi, Vikram; Popovici, Emanuel

    2016-01-01

    Wireless sensor nodes have a limited power budget, though they are often expected to be functional in the field once deployed for extended periods of time. Therefore, minimization of energy consumption and energy harvesting technology in Wireless Sensor Networks (WSN) are key tools for maximizing network lifetime, and achieving self-sustainability. This paper proposes an energy aware Adaptive Sampling Algorithm (ASA) for WSN with power hungry sensors and harvesting capabilities, an energy management technique that can be implemented on any WSN platform with enough processing power to execute the proposed algorithm. An existing state-of-the-art ASA developed for wireless sensor networks with power hungry sensors is optimized and enhanced to adapt the sampling frequency according to the available energy of the node. The proposed algorithm is evaluated using two in-field testbeds that are supplied by two different energy harvesting sources (solar and wind). Simulation and comparison between the state-of-the-art ASA and the proposed energy aware ASA (EASA) in terms of energy durability are carried out using in-field measured harvested energy (using both wind and solar sources) and power hungry sensors (ultrasonic wind sensor and gas sensors). The simulation results demonstrate that using ASA in combination with an energy aware function on the nodes can drastically increase the lifetime of a WSN node and enable self-sustainability. In fact, the proposed EASA in conjunction with energy harvesting capability can lead towards perpetual WSN operation and significantly outperform the state-of-the-art ASA. PMID:27043559

  7. Aspirin delays mesothelioma growth by inhibiting HMGB1-mediated tumor progression.

    Science.gov (United States)

    Yang, H; Pellegrini, L; Napolitano, A; Giorgi, C; Jube, S; Preti, A; Jennings, C J; De Marchis, F; Flores, E G; Larson, D; Pagano, I; Tanji, M; Powers, A; Kanodia, S; Gaudino, G; Pastorino, S; Pass, H I; Pinton, P; Bianchi, M E; Carbone, M

    2015-01-01

    High-mobility group box 1 (HMGB1) is an inflammatory molecule that has a critical role in the initiation and progression of malignant mesothelioma (MM). Aspirin (acetylsalicylic acid, ASA) is the most widely used nonsteroidal anti-inflammatory drug that reduces the incidence, metastatic potential and mortality of many inflammation-induced cancers. We hypothesized that ASA may exert anticancer properties in MM by abrogating the carcinogenic effects of HMGB1. Using HMGB1-secreting and -non-secreting human MM cell lines, we determined whether aspirin inhibited the hallmarks of HMGB1-induced MM cell growth in vitro and in vivo. Our data demonstrated that ASA and its metabolite, salicylic acid (SA), inhibit motility, migration, invasion and anchorage-independent colony formation of MM cells via a novel HMGB1-mediated mechanism. ASA/SA, at serum concentrations comparable to those achieved in humans taking therapeutic doses of aspirin, and BoxA, a specific inhibitor of HMGB1, markedly reduced MM growth in xenograft mice and significantly improved survival of treated animals. The effects of ASA and BoxA were cyclooxygenase-2 independent and were not additive, consistent with both acting via inhibition of HMGB1 activity. Our findings provide a rationale for the well documented, yet poorly understood antitumorigenic activity of aspirin, which we show proceeds via HMGB1 inhibition. Moreover, the use of BoxA appears to allow a more efficient HMGB1 targeting while eluding the known gastrointestinal side effects of ASA. Our findings are directly relevant to MM. Given the emerging importance of HMGB1 and its tumor-promoting functions in many cancer types, and of aspirin in cancer prevention and therapy, our investigation is poised to provide broadly applicable information. PMID:26068794

  8. Implications of altered glutathione metabolism in aspirin-induced oxidative stress and mitochondrial dysfunction in HepG2 cells.

    Directory of Open Access Journals (Sweden)

    Haider Raza

    Full Text Available We have previously reported that acetylsalicylic acid (aspirin, ASA induces cell cycle arrest, oxidative stress and mitochondrial dysfunction in HepG2 cells. In the present study, we have further elucidated that altered glutathione (GSH-redox metabolism in HepG2 cells play a critical role in ASA-induced cytotoxicity. Using selected doses and time point for ASA toxicity, we have demonstrated that when GSH synthesis is inhibited in HepG2 cells by buthionine sulfoximine (BSO, prior to ASA treatment, cytotoxicity of the drug is augmented. On the other hand, when GSH-depleted cells were treated with N-acetyl cysteine (NAC, cytotoxicity/apoptosis caused by ASA was attenuated with a significant recovery in oxidative stress, GSH homeostasis, DNA fragmentation and some of the mitochondrial functions. NAC treatment, however, had no significant effects on the drug-induced inhibition of mitochondrial aconitase activity and ATP synthesis in GSH-depleted cells. Our results have confirmed that aspirin increases apoptosis by increased reactive oxygen species production, loss of mitochondrial membrane potential and inhibition of mitochondrial respiratory functions. These effects were further amplified when GSH-depleted cells were treated with ASA. We have also shown that some of the effects of aspirin might be associated with reduced GSH homeostasis, as treatment of cells with NAC attenuated the effects of BSO and aspirin. Our results strongly suggest that GSH dependent redox homeostasis in HepG2 cells is critical in preserving mitochondrial functions and preventing oxidative stress associated complications caused by aspirin treatment.

  9. Final Hazard Classification and Auditable Safety Analysis for the N Basin Segment

    International Nuclear Information System (INIS)

    The purposes of this report are to serve as the auditable safety analysis (ASA) for the N Basin Segment, during surveillance and maintenance preceding decontamination and decommissioning; to determine and document the final hazard classification (FHC) for the N Basin Segment. The result of the ASA evaluation are: based on hazard analyses and the evaluation of accidents, no activity could credibly result in an unacceptable exposure to an individual; controls are identified that serve to protect worker health and safety. The results of the FHC evaluation are: potential exposure is much below 10 rem (0.46 rem), and the FHC for the N Basin Segment is Radiological

  10. Multivariate density estimation theory, practice, and visualization

    CERN Document Server

    Scott, David W

    2015-01-01

    David W. Scott, PhD, is Noah Harding Professor in the Department of Statistics at Rice University. The author of over 100 published articles, papers, and book chapters, Dr. Scott is also Fellow of the American Statistical Association (ASA) and the Institute of Mathematical Statistics. He is recipient of the ASA Founder's Award and the Army Wilks Award. His research interests include computational statistics, data visualization, and density estimation. Dr. Scott is also Coeditor of Wiley Interdisciplinary Reviews: Computational Statistics and previous Editor of the Journal of Computational and

  11. Control of cucumber (Cucumis sativus L.) tolerance to chilling stress—evaluating the role of ascorbic acid and glutathione

    OpenAIRE

    Lukatkin, Alexander S.; Anjum, Naser A.

    2014-01-01

    Chilling temperatures (1–10°C) are known to disturb cellular physiology, cause oxidative stress via creating imbalance between generation and metabolism of reactive oxygen species (ROS) leading finally to cell and/or plant death. Owing to known significance of low molecular antioxidants—ascorbic acid (AsA) and glutathione (GSH) in plant stress-tolerance, this work analyzes the role of exogenously applied AsA and GSH in the alleviation of chilling stress (3°C)-impact in cucumber (Cucumis sativ...

  12. The Influence of Prolonged Acetylsalicylic Acid Supplementation-Induced Gastritis on the Neurochemistry of the Sympathetic Neurons Supplying Prepyloric Region of the Porcine Stomach.

    Directory of Open Access Journals (Sweden)

    Katarzyna Palus

    Full Text Available This experiment was designed to establish the localization and neurochemical phenotyping of sympathetic neurons supplying prepyloric area of the porcine stomach in a physiological state and during acetylsalicylic acid (ASA induced gastritis. In order to localize the sympathetic perikarya the stomachs of both control and acetylsalicylic acid treated (ASA group animals were injected with neuronal retrograde tracer Fast Blue (FB. Seven days post FB injection, animals were divided into a control and ASA supplementation group. The ASA group was given 100 mg/kg of b.w. ASA orally for 21 days. On the 28th day all pigs were euthanized with gradual overdose of anesthetic. Then fourteen-micrometer-thick cryostat sections were processed for routine double-labeling immunofluorescence, using primary antisera directed towards tyrosine hydroxylase (TH, dopamine β-hydroxylase (DβH, neuropeptide Y (NPY, galanin (GAL, neuronal nitric oxide synthase (nNOS, leu 5-enkephalin (LENK, cocaine- and amphetamine- regulated transcript peptide (CART, calcitonin gene-related peptide (CGRP, substance P (SP and vasoactive intestinal peptide (VIP. The data obtained in this study indicate that postganglionic sympathetic nerve fibers supplying prepyloric area of the porcine stomach originate from the coeliac-cranial mesenteric ganglion complex (CCMG. In control animals, the FB-labelled neurons expressed TH (94.85 ± 1.01%, DβH (97.10 ± 0.97%, NPY (46.88 ± 2.53% and GAL (8.40 ± 0.53%. In ASA group, TH- and DβH- positive nerve cells were reduced (85.78 ± 2.65% and 88.82 ± 1.63% respectively. Moreover, ASA- induced gastritis resulted in increased expression of NPY (76.59 ± 3.02% and GAL (26.45 ± 2.75% as well as the novo-synthesis of nNOS (6.13 ± 1.11% and LENK (4.77 ± 0.42% in traced CCMG neurons. Additionally, a network of CART-, CGRP-, SP-, VIP-, LENK-, nNOS- immunoreactive (IR nerve fibers encircling the FB-positive perikarya were observed in both intact and ASA

  13. 各種カンキツにおける果汁中アスコルビン酸含量および抗酸化能

    OpenAIRE

    山本, 雅史; 古賀, 孝徳; 福田, 麻由子; 久保, 達也; 冨永, 茂人; ヤマモト, マサシ; コガ, タカノリ; フクダ, マユコ; クボ, タツヤ; トミナガ, シゲト; Yamamoto, Masashi; KOGA, Takanori; Fukuda, Mayuko; KUBO, Tatsuya; TOMINAGA, Shigeto

    2009-01-01

    Specific and varietal differences of ascorbic acid (AsA) concentration and DPPH radical scavenging activity of citrus juice citrus were investigated. In 2006–2007, 41 species and/or cultivars (accessions) were used as materials. Their AsA concentrations ranged from 8.2 mg・100 mL^{−1} (Shiikuu) to 50.0 mg・100 mL^{−1} (‘Amakusa’); the average was 26.6 mg・100 mL^{−1}. Their DPPH radical scavenging activity ranged from 0.64 nmol-Trolox equivalent・μL^{−1} (Shiikuu) to 3.49 nmol (‘Amakusa’); the av...

  14. Spectroscopic identification of ASASSN-15qi as an FU Ori-like object

    Science.gov (United States)

    Maehara, Hiroyuki; Ayani, Kazuya; Itoh, Ryosuke; Takata, Koji; Kawabata, Koji S.

    2015-10-01

    We report spectroscopic observations of the optical transient ASASSN-15qi. This object was discovered by the All-Sky Automated Survey for Supernovae (ASAS-SN or "Assassin") at V=13.64 mag on 2015-10-03.27 and was classified as a possible YSO based on its association with an HII region (ASAS-SN Transients list; Shappee et al. 2014, ApJ, 788, 48). The object is identical to IPHAS J225608.82+583104.1 (r=16.66, i=15.59) and 2MASS J22560882+5831040 (J=13.704, H=12.923, K=12.647).

  15. Five-Aminosalicylic Acid: An Update for the Reappraisal of an Old Drug

    Directory of Open Access Journals (Sweden)

    Cristiana Perrotta

    2015-01-01

    Full Text Available Inflammatory bowel disease (IBD comprises several conditions with chronic or recurring immune response and inflammation of the gastrointestinal apparatus, of which ulcerative colitis and Crohn’s disease are the commonest forms. This disease has a significant prevalence and it is of an unknown aethiology. Five-aminosalicylic acid (5-ASA and its derivatives are among the oldest drugs approved for the treatment of the IBD. In this review we reapprise aspects of 5-ASA mechanism of action, safety, and efficacy that in our opinion make it a valuable drug that can be fruitfully tailored in personalised treatments as a therapeutic option alongside other immune-modifying agents.

  16. Diversity and homogeneity among small plasmids of Aeromonas salmonicida subsp. salmonicida linked with geographical origin

    Directory of Open Access Journals (Sweden)

    Sabrina A Attéré

    2015-11-01

    Full Text Available Furunculosis, which is caused by Aeromonas salmonicida subsp. salmonicida, is a major salmonid disease in fish farms worldwide. Several plasmids found in this bacterium confer phenotypes such drug resistance and virulence. Small plasmids (pAsa1, pAsa2, pAsa3, and pAsal1 related to ColE1- and ColE2-type replicons are usually present in its normal plasmidome. In the present study, with the objective to investigate if these plasmids display particularities related to the origin of the isolates bearing them, a total of 153 isolates, including 78 new and 75 previously described, were analyzed for the presence of small plasmids by PCR and DNA restriction fragment profiling. A geographical dichotomy between Canadian and European isolates for their propensity to do not have pAsa3 or pAsal1 was found. In addition, the genotyping analysis led to the identification of two European isolates harboring an unusual pAsal1. An investigation by next-generation sequencing (NGS of these two isolates shed light on two pAsal1 variants (pAsal1C and pAsal1D. As with pAsal1B, another pAsal1 variant previously described, these two new variants bore a second insertion sequence (ISAS5 in addition to the usual ISAS11. The characterization of these variants suggested that they could predominate over the wild-type pAsal1 in stressful conditions such as growth at temperatures of 25°C and above. To obtain a comprehensive portrait of the mutational pressure on small plasmids, 26 isolates whose DNA had been sequenced by NGS were investigated. pAsa3 and pAsal1 were more prone to mutations than pAsa1 and pAsa2, especially in the mobA gene, which encodes a relaxase and a primase. Lastly, the average copy number of each plasmid per cell was assessed using raw sequencing data. A clear trend with respect to the relative proportion per cell of each plasmid was identified. Our large-scale study revealed a geographical dichotomy in small plasmid repertoire in addition to a clear trend

  17. Problematika Putusan Hakim dalam Perkara Pembatalan Perjanjian

    Directory of Open Access Journals (Sweden)

    Nindyo Pramono

    2012-02-01

    Full Text Available The rapid development of international business law requires judges to re-scrutinise principles of contract law in the Civil Code. Therefore, principles of good faith, protection of third-party, retroaction, and restoration to pre-contract position will be analysed to provide objectively constructive feedback for judges when hearing over request for contract annulment.  Pesatnya perkembangan hukum bisnis internasional mengharuskan hakim untuk mempelajari kembali asas-asas hukum perjanjian dalam KUHPerdata. Prinsipprinsip itikad baik, perlindungan bagi pihak ketiga, retroaktif, dan kembali ke keadaan semula akan dianalisis dalam tulisan ini sehingga memberikan konstruksi obyektif kepada hakim dalam memutus permohonan pembatalan perjanjian agar jangan sampai menimbulkan perkara baru.

  18. Auditable safety analysis and final hazard classification for Buildings 1310-N and 1314-N

    International Nuclear Information System (INIS)

    This document is a graded auditable safety analysis (ASA) of the deactivation activities planned for the 100-N facility segment comprised of the Building 1310-N pump silo (part of the Liquid Radioactive Waste Treatment Facility) and 1314-N Building (Liquid Waste Disposal Building).The ASA describes the hazards within the facility and evaluates the adequacy of the measures taken to reduce, control, or mitigate the identified hazards. This document also serves as the Final Hazard Classification (FHC) for the 1310-N pump silo and 1314-N Building segment. The FHC is radiological based on the Preliminary Hazard Classification and the total inventory of radioactive and hazardous materials in the segment

  19. Diversity and Homogeneity among Small Plasmids of Aeromonas salmonicida subsp. salmonicida Linked with Geographical Origin

    Science.gov (United States)

    Attéré, Sabrina A.; Vincent, Antony T.; Trudel, Mélanie V.; Chanut, Romain; Charette, Steve J.

    2015-01-01

    Furunculosis, which is caused by Aeromonas salmonicida subsp. salmonicida, is a major salmonid disease in fish farms worldwide. Several plasmids found in this bacterium confer phenotypes such drug resistance and virulence. Small plasmids (pAsa1, pAsa2, pAsa3, and pAsal1) related to ColE1- and ColE2-type replicons are usually present in its normal plasmidome. In the present study, with the objective to investigate if these plasmids display particularities related to the origin of the isolates bearing them, a total of 153 isolates, including 78 new and 75 previously described, were analyzed for the presence of small plasmids by PCR and DNA restriction fragment profiling. A geographical dichotomy between Canadian and European isolates for their propensity to do not have pAsa3 or pAsal1 was found. In addition, the genotyping analysis led to the identification of two European isolates harboring an unusual pAsal1. An investigation by next-generation sequencing (NGS) of these two isolates shed light on two pAsal1 variants (pAsal1C and pAsal1D). As with pAsal1B, another pAsal1 variant previously described, these two new variants bore a second insertion sequence (ISAS5) in addition to the usual ISAS11. The characterization of these variants suggested that they could predominate over the wild-type pAsal1 in stressful conditions such as growth at temperatures of 25°C and above. To obtain a comprehensive portrait of the mutational pressure on small plasmids, 26 isolates whose DNA had been sequenced by NGS were investigated. pAsa3 and pAsal1 were more prone to mutations than pAsa1 and pAsa2, especially in the mobA gene, which encodes a relaxase and a primase. Lastly, the average copy number of each plasmid per cell was assessed using raw sequencing data. A clear trend with respect to the relative proportion per cell of each plasmid was identified. Our large-scale study revealed a geographical dichotomy in small plasmid repertoire in addition to a clear trend for pAsa3 and p

  20. A dynamic model of once-daily 5-aminosalicylic acid predicts clinical efficacy

    Institute of Scientific and Technical Information of China (English)

    Deepak; Parakkal; Eli; D; Ehrenpreis; Matthew; P; Thorpe; Karson; S; Putt; Bruce; Hannon

    2010-01-01

    New once daily mesalamine formulations may improve adherence to medication usage.Response to Asacol and other forms of 5-aminosalicyclic acid(5-ASA)is better correlated with tissue concentrations and best predicted by concentrations of the drug within the lumen of the colon.Our group used computer simulation to predict colonic 5-ASA levels after Asacol administration.In our study,the model simulated Asacol distribution in the healthy colon,and during quiescent and active ulcerative colitis.An Asacol dosage ...